summaryrefslogtreecommitdiff
path: root/test/drb/ut_array.rb
blob: d13dda3d8e500abf81a4f28cc9af7a3e7a9e098b (plain)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
# frozen_string_literal: false
require 'drb/drb'
require 'drb/extserv'

if __FILE__ == $0
  def ARGV.shift
    it = super()
    raise "usage: #{$0} <uri> <name>" unless it
    it
  end

  DRb.start_service('druby://localhost:0', [1, 2, 'III', 4, "five", 6])
  es = DRb::ExtServ.new(ARGV.shift, ARGV.shift)
  DRb.thread.join
  es.stop_service if es.alive?
end

mary='diffstat' class='diffstat'>-rw-r--r--.appveyor.yml134
-rw-r--r--.dir-locals.el39
-rw-r--r--.document34
-rw-r--r--.editorconfig26
-rw-r--r--.gdbinit370
-rw-r--r--.git-blame-ignore-revs23
-rw-r--r--.gitattributes3
-rw-r--r--.github/SECURITY.md9
-rw-r--r--.github/codeql/codeql-config.yml3
-rw-r--r--.github/dependabot.yml6
-rw-r--r--.github/workflows/baseruby.yml80
-rw-r--r--.github/workflows/bundled_gems.yml166
-rw-r--r--.github/workflows/check_dependencies.yml78
-rw-r--r--.github/workflows/codeql-analysis.yml75
-rw-r--r--.github/workflows/compilers.yml281
-rw-r--r--.github/workflows/macos.yml113
-rw-r--r--.github/workflows/mingw.yml179
-rw-r--r--.github/workflows/mjit-bindgen.yml104
-rw-r--r--.github/workflows/mjit.yml113
-rw-r--r--.github/workflows/publish.yml18
-rw-r--r--.github/workflows/scorecards.yml72
-rw-r--r--.github/workflows/spec_guards.yml71
-rw-r--r--.github/workflows/ubuntu.yml146
-rw-r--r--.github/workflows/wasm.yml146
-rw-r--r--.github/workflows/windows.yml149
-rw-r--r--.github/workflows/yjit-ubuntu.yml170
-rw-r--r--.gitignore95
-rw-r--r--.indent.pro17
-rw-r--r--.rdoc_options4
-rw-r--r--.rspec_parallel2
-rw-r--r--.travis.yml102
-rw-r--r--BSDL6
-rw-r--r--CONTRIBUTING.md5
-rw-r--r--COPYING76
-rw-r--r--COPYING.ja66
-rw-r--r--ChangeLog8046
-rw-r--r--LEGAL1221
-rw-r--r--Makefile.in549
-rw-r--r--NEWS211
-rw-r--r--NEWS.md820
-rw-r--r--README.ja.md83
-rw-r--r--README.md174
-rw-r--r--acinclude.m446
-rw-r--r--aclocal.m415
-rw-r--r--addr2line.c2374
-rw-r--r--addr2line.h7
-rw-r--r--appveyor.yml37
-rw-r--r--array.c8086
-rw-r--r--array.rb69
-rw-r--r--ast.c773
-rw-r--r--ast.rb276
-rwxr-xr-xautogen.sh17
-rwxr-xr-xbasictest/runner.rb4
-rwxr-xr-xbasictest/test.rb36
-rw-r--r--benchmark/README.md74
-rw-r--r--benchmark/app_answer.rb (renamed from benchmark/bm_app_answer.rb)0
-rw-r--r--benchmark/app_aobench.rb297
-rw-r--r--benchmark/app_erb.yml23
-rw-r--r--benchmark/app_factorial.rb (renamed from benchmark/bm_app_factorial.rb)0
-rw-r--r--benchmark/app_fib.rb (renamed from benchmark/bm_app_fib.rb)0
-rw-r--r--benchmark/app_lc_fizzbuzz.rb (renamed from benchmark/bm_app_lc_fizzbuzz.rb)0
-rw-r--r--benchmark/app_mandelbrot.rb (renamed from benchmark/bm_app_mandelbrot.rb)0
-rw-r--r--benchmark/app_pentomino.rb130
-rw-r--r--benchmark/app_raise.rb (renamed from benchmark/bm_app_raise.rb)0
-rw-r--r--benchmark/app_strconcat.rb (renamed from benchmark/bm_app_strconcat.rb)0
-rw-r--r--benchmark/app_tak.rb (renamed from benchmark/bm_app_tak.rb)0
-rw-r--r--benchmark/app_tarai.rb (renamed from benchmark/bm_app_tarai.rb)0
-rw-r--r--benchmark/app_uri.rb (renamed from benchmark/bm_app_uri.rb)0
-rw-r--r--benchmark/array_flatten.yml19
-rw-r--r--benchmark/array_intersection.yml14
-rw-r--r--benchmark/array_max_float.yml30
-rw-r--r--benchmark/array_max_int.yml31
-rw-r--r--benchmark/array_max_str.yml30
-rw-r--r--benchmark/array_min.yml31
-rw-r--r--benchmark/array_sample.yml4
-rw-r--r--benchmark/array_sample_100k_10.rb2
-rw-r--r--benchmark/array_sample_100k_11.rb2
-rw-r--r--benchmark/array_sample_100k__100.rb2
-rw-r--r--benchmark/array_sample_100k__1k.rb2
-rw-r--r--benchmark/array_sample_100k__6k.rb2
-rw-r--r--benchmark/array_sample_100k___10k.rb2
-rw-r--r--benchmark/array_sample_100k___50k.rb2
-rw-r--r--benchmark/array_shift.rb (renamed from benchmark/bm_array_shift.rb)0
-rw-r--r--benchmark/array_small_and.rb17
-rw-r--r--benchmark/array_small_diff.rb17
-rw-r--r--benchmark/array_small_or.rb17
-rw-r--r--benchmark/array_sort_block.rb2
-rw-r--r--benchmark/array_sort_float.rb2
-rw-r--r--benchmark/array_sort_int.yml15
-rw-r--r--benchmark/array_values_at_int.rb2
-rw-r--r--benchmark/array_values_at_range.rb2
-rw-r--r--benchmark/attr_accessor.yml29
-rw-r--r--benchmark/bighash.rb1
-rw-r--r--benchmark/bm_app_aobench.rb291
-rw-r--r--benchmark/bm_app_erb.rb26
-rw-r--r--benchmark/bm_app_pentomino.rb259
-rw-r--r--benchmark/bm_require.rb7
-rw-r--r--benchmark/bm_require_thread.rb15
-rw-r--r--benchmark/bm_so_ackermann.rb19
-rw-r--r--benchmark/bm_so_array.rb23
-rw-r--r--benchmark/bm_so_concatenate.rb18
-rw-r--r--benchmark/bm_so_count_words.rb19
-rw-r--r--benchmark/bm_so_exception.rb61
-rw-r--r--benchmark/bm_so_fasta.rb81
-rw-r--r--benchmark/bm_so_k_nucleotide.rb48
-rw-r--r--benchmark/bm_so_matrix.rb48
-rw-r--r--benchmark/bm_so_meteor_contest.rb563
-rw-r--r--benchmark/bm_so_nbody.rb148
-rw-r--r--benchmark/bm_so_nested_loop.rb24
-rw-r--r--benchmark/bm_so_object.rb56
-rw-r--r--benchmark/bm_so_pidigits.rb92
-rw-r--r--benchmark/bm_so_reverse_complement.rb30
-rw-r--r--benchmark/bm_vm1_attr_ivar.rb14
-rw-r--r--benchmark/bm_vm1_attr_ivar_set.rb14
-rw-r--r--benchmark/bm_vm1_block.rb10
-rw-r--r--benchmark/bm_vm1_const.rb8
-rw-r--r--benchmark/bm_vm1_ensure.rb11
-rw-r--r--benchmark/bm_vm1_float_simple.rb7
-rw-r--r--benchmark/bm_vm1_gc_short_lived.rb10
-rw-r--r--benchmark/bm_vm1_gc_short_with_complex_long.rb27
-rw-r--r--benchmark/bm_vm1_gc_short_with_long.rb13
-rw-r--r--benchmark/bm_vm1_gc_short_with_symbol.rb15
-rw-r--r--benchmark/bm_vm1_gc_wb_ary.rb12
-rw-r--r--benchmark/bm_vm1_gc_wb_ary_promoted.rb14
-rw-r--r--benchmark/bm_vm1_gc_wb_obj.rb15
-rw-r--r--benchmark/bm_vm1_gc_wb_obj_promoted.rb17
-rw-r--r--benchmark/bm_vm1_ivar.rb8
-rw-r--r--benchmark/bm_vm1_ivar_set.rb6
-rw-r--r--benchmark/bm_vm1_length.rb9
-rw-r--r--benchmark/bm_vm1_lvar_init.rb18
-rw-r--r--benchmark/bm_vm1_lvar_set.rb5
-rw-r--r--benchmark/bm_vm1_neq.rb8
-rw-r--r--benchmark/bm_vm1_not.rb7
-rw-r--r--benchmark/bm_vm1_rescue.rb7
-rw-r--r--benchmark/bm_vm1_simplereturn.rb9
-rw-r--r--benchmark/bm_vm1_swap.rb8
-rw-r--r--benchmark/bm_vm1_yield.rb10
-rw-r--r--benchmark/bm_vm2_array.rb5
-rw-r--r--benchmark/bm_vm2_bigarray.rb106
-rw-r--r--benchmark/bm_vm2_bighash.rb5
-rw-r--r--benchmark/bm_vm2_case.rb14
-rw-r--r--benchmark/bm_vm2_case_lit.rb19
-rw-r--r--benchmark/bm_vm2_defined_method.rb9
-rw-r--r--benchmark/bm_vm2_dstr.rb6
-rw-r--r--benchmark/bm_vm2_eval.rb6
-rw-r--r--benchmark/bm_vm2_method.rb9
-rw-r--r--benchmark/bm_vm2_method_missing.rb12
-rw-r--r--benchmark/bm_vm2_method_with_block.rb9
-rw-r--r--benchmark/bm_vm2_mutex.rb9
-rw-r--r--benchmark/bm_vm2_newlambda.rb5
-rw-r--r--benchmark/bm_vm2_poly_method.rb20
-rw-r--r--benchmark/bm_vm2_poly_method_ov.rb20
-rw-r--r--benchmark/bm_vm2_proc.rb14
-rw-r--r--benchmark/bm_vm2_raise1.rb18
-rw-r--r--benchmark/bm_vm2_raise2.rb18
-rw-r--r--benchmark/bm_vm2_regexp.rb6
-rw-r--r--benchmark/bm_vm2_send.rb12
-rw-r--r--benchmark/bm_vm2_string_literal.rb5
-rw-r--r--benchmark/bm_vm2_struct_big_aref_hi.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aref_lo.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_aset.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_href_hi.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_href_lo.rb7
-rw-r--r--benchmark/bm_vm2_struct_big_hset.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aref.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_aset.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_href.rb7
-rw-r--r--benchmark/bm_vm2_struct_small_hset.rb7
-rw-r--r--benchmark/bm_vm2_super.rb20
-rw-r--r--benchmark/bm_vm2_unif1.rb8
-rw-r--r--benchmark/bm_vm2_zsuper.rb20
-rw-r--r--benchmark/bm_vm_thread_alive_check1.rb6
-rw-r--r--benchmark/bm_vm_thread_pass.rb15
-rw-r--r--benchmark/bm_vm_thread_pass_flood.rb8
-rw-r--r--benchmark/bm_vm_thread_queue.rb18
-rw-r--r--benchmark/buffer_each.yml27
-rw-r--r--benchmark/buffer_get.yml25
-rw-r--r--benchmark/cgi_escape_html.yml31
-rw-r--r--benchmark/complex_float_add.yml7
-rw-r--r--benchmark/complex_float_div.yml7
-rw-r--r--benchmark/complex_float_mul.yml7
-rw-r--r--benchmark/complex_float_new.yml7
-rw-r--r--benchmark/complex_float_power.yml7
-rw-r--r--benchmark/complex_float_sub.yml7
-rw-r--r--benchmark/constant_invalidation.rb22
-rw-r--r--benchmark/dir_empty_p.rb5
-rw-r--r--benchmark/driver.rb427
-rw-r--r--benchmark/enum_lazy_flat_map.yml16
-rw-r--r--benchmark/enum_lazy_grep_v_100.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_20.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_50.rb4
-rw-r--r--benchmark/enum_lazy_uniq_100.rb4
-rw-r--r--benchmark/enum_lazy_uniq_20.rb4
-rw-r--r--benchmark/enum_lazy_uniq_50.rb4
-rw-r--r--benchmark/enum_lazy_zip.yml22
-rw-r--r--benchmark/enum_minmax.yml25
-rw-r--r--benchmark/enum_sort.yml15
-rw-r--r--benchmark/enum_tally.yml4
-rw-r--r--benchmark/erb_escape_html.yml31
-rw-r--r--benchmark/erb_render.yml24
-rw-r--r--benchmark/fiber_chain.yml36
-rw-r--r--benchmark/fiber_locals.yml8
-rw-r--r--benchmark/file_chmod.rb9
-rw-r--r--benchmark/file_rename.rb11
-rw-r--r--benchmark/float_methods.yml14
-rw-r--r--benchmark/float_neg_posi.yml8
-rw-r--r--benchmark/float_to_s.yml7
-rw-r--r--benchmark/gc/aobench.rb2
-rw-r--r--benchmark/gc/binary_trees.rb2
-rw-r--r--benchmark/gc/gcbench.rb3
-rw-r--r--benchmark/gc/pentomino.rb2
-rw-r--r--benchmark/hash_aref_array.rb5
-rw-r--r--benchmark/hash_aref_dsym.rb (renamed from benchmark/bm_hash_aref_dsym.rb)0
-rw-r--r--benchmark/hash_aref_dsym_long.rb (renamed from benchmark/bm_hash_aref_dsym_long.rb)0
-rw-r--r--benchmark/hash_aref_fix.rb (renamed from benchmark/bm_hash_aref_fix.rb)0
-rw-r--r--benchmark/hash_aref_flo.rb (renamed from benchmark/bm_hash_aref_flo.rb)0
-rw-r--r--benchmark/hash_aref_miss.rb (renamed from benchmark/bm_hash_aref_miss.rb)0
-rw-r--r--benchmark/hash_aref_str.rb (renamed from benchmark/bm_hash_aref_str.rb)0
-rw-r--r--benchmark/hash_aref_sym.rb (renamed from benchmark/bm_hash_aref_sym.rb)0
-rw-r--r--benchmark/hash_aref_sym_long.rb (renamed from benchmark/bm_hash_aref_sym_long.rb)0
-rw-r--r--benchmark/hash_defaults.yml6
-rw-r--r--benchmark/hash_dup.yml8
-rw-r--r--benchmark/hash_first.yml11
-rw-r--r--benchmark/hash_flatten.rb (renamed from benchmark/bm_hash_flatten.rb)0
-rw-r--r--benchmark/hash_ident_flo.rb (renamed from benchmark/bm_hash_ident_flo.rb)0
-rw-r--r--benchmark/hash_ident_num.rb (renamed from benchmark/bm_hash_ident_num.rb)0
-rw-r--r--benchmark/hash_ident_obj.rb (renamed from benchmark/bm_hash_ident_obj.rb)0
-rw-r--r--benchmark/hash_ident_str.rb (renamed from benchmark/bm_hash_ident_str.rb)0
-rw-r--r--benchmark/hash_ident_sym.rb (renamed from benchmark/bm_hash_ident_sym.rb)0
-rw-r--r--benchmark/hash_keys.rb (renamed from benchmark/bm_hash_keys.rb)0
-rw-r--r--benchmark/hash_literal_small2.rb3
-rw-r--r--benchmark/hash_literal_small4.rb3
-rw-r--r--benchmark/hash_literal_small8.rb3
-rw-r--r--benchmark/hash_long.rb4
-rw-r--r--benchmark/hash_shift.rb (renamed from benchmark/bm_hash_shift.rb)0
-rw-r--r--benchmark/hash_shift_u16.rb (renamed from benchmark/bm_hash_shift_u16.rb)0
-rw-r--r--benchmark/hash_shift_u24.rb (renamed from benchmark/bm_hash_shift_u24.rb)0
-rw-r--r--benchmark/hash_shift_u32.rb (renamed from benchmark/bm_hash_shift_u32.rb)0
-rw-r--r--benchmark/hash_small2.rb1
-rw-r--r--benchmark/hash_small4.rb1
-rw-r--r--benchmark/hash_small8.rb1
-rw-r--r--benchmark/hash_to_proc.rb (renamed from benchmark/bm_hash_to_proc.rb)0
-rw-r--r--benchmark/hash_values.rb (renamed from benchmark/bm_hash_values.rb)0
-rw-r--r--benchmark/int_quo.rb1
-rw-r--r--benchmark/io_copy_stream_write.rb24
-rw-r--r--benchmark/io_copy_stream_write_socket.rb35
-rw-r--r--benchmark/io_file_create.rb (renamed from benchmark/bm_io_file_create.rb)0
-rw-r--r--benchmark/io_file_read.rb (renamed from benchmark/bm_io_file_read.rb)0
-rw-r--r--benchmark/io_file_write.rb (renamed from benchmark/bm_io_file_write.rb)0
-rw-r--r--benchmark/io_nonblock_noex.rb (renamed from benchmark/bm_io_nonblock_noex.rb)0
-rw-r--r--benchmark/io_nonblock_noex2.rb (renamed from benchmark/bm_io_nonblock_noex2.rb)0
-rw-r--r--benchmark/io_pipe_rw.rb13
-rw-r--r--benchmark/io_select.rb (renamed from benchmark/bm_io_select.rb)0
-rw-r--r--benchmark/io_select2.rb (renamed from benchmark/bm_io_select2.rb)0
-rw-r--r--benchmark/io_select3.rb (renamed from benchmark/bm_io_select3.rb)0
-rw-r--r--benchmark/io_write.rb22
-rw-r--r--benchmark/irb_color.yml13
-rw-r--r--benchmark/irb_exec.yml10
-rw-r--r--benchmark/iseq_load_from_binary.yml25
-rw-r--r--benchmark/ivar_extend.yml23
-rw-r--r--benchmark/kernel_clone.yml6
-rw-r--r--benchmark/kernel_float.yml5
-rw-r--r--benchmark/kernel_tap.yml6
-rw-r--r--benchmark/kernel_then.yml6
-rw-r--r--benchmark/keyword_arguments.yml13
-rw-r--r--benchmark/lib/benchmark_driver/output/driver.rb36
-rw-r--r--benchmark/lib/benchmark_driver/runner/cstime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/cutime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit.rb34
-rw-r--r--benchmark/lib/benchmark_driver/runner/peak.rb151
-rw-r--r--benchmark/lib/benchmark_driver/runner/ractor.rb122
-rw-r--r--benchmark/lib/benchmark_driver/runner/size.rb25
-rw-r--r--benchmark/lib/benchmark_driver/runner/stime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/total.rb137
-rw-r--r--benchmark/lib/benchmark_driver/runner/utime.rb22
-rw-r--r--benchmark/lib/load.rb18
-rw-r--r--benchmark/loop_for.rb (renamed from benchmark/bm_loop_for.rb)0
-rw-r--r--benchmark/loop_generator.rb (renamed from benchmark/bm_loop_generator.rb)0
-rw-r--r--benchmark/loop_times.rb (renamed from benchmark/bm_loop_times.rb)0
-rw-r--r--benchmark/loop_whileloop.rb (renamed from benchmark/bm_loop_whileloop.rb)0
-rw-r--r--benchmark/loop_whileloop2.rb (renamed from benchmark/bm_loop_whileloop2.rb)0
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/marshal_dump_flo.rb (renamed from benchmark/bm_marshal_dump_flo.rb)0
-rw-r--r--benchmark/marshal_dump_load_geniv.rb (renamed from benchmark/bm_marshal_dump_load_geniv.rb)0
-rw-r--r--benchmark/marshal_dump_load_integer.yml22
-rw-r--r--benchmark/marshal_dump_load_time.rb (renamed from benchmark/bm_marshal_dump_load_time.rb)0
-rw-r--r--benchmark/masgn.yml53
-rw-r--r--benchmark/match_gt4.rb1
-rw-r--r--benchmark/match_small.rb1
-rw-r--r--benchmark/memory_wrapper.rb16
-rw-r--r--benchmark/method_bind_call.yml16
-rw-r--r--benchmark/mjit_exivar.yml18
-rw-r--r--benchmark/mjit_integer.yml32
-rw-r--r--benchmark/mjit_kernel.yml20
-rw-r--r--benchmark/mjit_leave.yml8
-rw-r--r--benchmark/mjit_opt_cc_insns.yml27
-rw-r--r--benchmark/mjit_struct_aref.yml10
-rw-r--r--benchmark/module_eqq.yml27
-rw-r--r--benchmark/nil_p.yml9
-rw-r--r--benchmark/nilclass.yml6
-rw-r--r--benchmark/num_zero_p.yml8
-rw-r--r--benchmark/numeric_methods.yml29
-rw-r--r--benchmark/object_allocate.yml21
-rw-r--r--benchmark/objspace_dump_all.yml13
-rw-r--r--benchmark/other-lang/fact.py2
-rw-r--r--benchmark/pm_array.yml19
-rw-r--r--benchmark/prepare_require.rb25
-rw-r--r--benchmark/prepare_require_thread.rb2
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/ractor_const.yml4
-rw-r--r--benchmark/ractor_float_to_s.yml8
-rw-r--r--benchmark/range_last.yml4
-rw-r--r--benchmark/range_min.yml2
-rw-r--r--benchmark/realpath.yml30
-rw-r--r--benchmark/report.rb79
-rw-r--r--benchmark/require.yml32
-rw-r--r--benchmark/require_thread.yml40
-rw-r--r--benchmark/run.rb127
-rw-r--r--benchmark/runc.rb27
-rw-r--r--benchmark/securerandom.rb (renamed from benchmark/bm_securerandom.rb)0
-rw-r--r--benchmark/so_ackermann.rb19
-rw-r--r--benchmark/so_array.rb23
-rw-r--r--benchmark/so_binary_trees.rb (renamed from benchmark/bm_so_binary_trees.rb)0
-rw-r--r--benchmark/so_concatenate.rb18
-rw-r--r--benchmark/so_count_words.yml65
-rw-r--r--benchmark/so_exception.rb61
-rw-r--r--benchmark/so_fannkuch.rb (renamed from benchmark/bm_so_fannkuch.rb)0
-rw-r--r--benchmark/so_fasta.rb81
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_lists.rb (renamed from benchmark/bm_so_lists.rb)0
-rw-r--r--benchmark/so_mandelbrot.rb (renamed from benchmark/bm_so_mandelbrot.rb)0
-rw-r--r--benchmark/so_matrix.rb48
-rw-r--r--benchmark/so_meteor_contest.rb563
-rw-r--r--benchmark/so_nbody.rb148
-rw-r--r--benchmark/so_nested_loop.rb24
-rw-r--r--benchmark/so_nsieve.rb (renamed from benchmark/bm_so_nsieve.rb)0
-rw-r--r--benchmark/so_nsieve_bits.rb (renamed from benchmark/bm_so_nsieve_bits.rb)0
-rw-r--r--benchmark/so_object.rb56
-rw-r--r--benchmark/so_partial_sums.rb (renamed from benchmark/bm_so_partial_sums.rb)0
-rw-r--r--benchmark/so_pidigits.rb92
-rw-r--r--benchmark/so_random.rb (renamed from benchmark/bm_so_random.rb)0
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--benchmark/so_sieve.rb (renamed from benchmark/bm_so_sieve.rb)0
-rw-r--r--benchmark/so_spectralnorm.rb (renamed from benchmark/bm_so_spectralnorm.rb)0
-rw-r--r--benchmark/string_capitalize.yml10
-rw-r--r--benchmark/string_casecmp.yml26
-rw-r--r--benchmark/string_casecmp_p.yml26
-rw-r--r--benchmark/string_concat.yml45
-rw-r--r--benchmark/string_downcase.yml18
-rw-r--r--benchmark/string_index.rb3
-rw-r--r--benchmark/string_scan_re.rb2
-rw-r--r--benchmark/string_scan_str.rb2
-rw-r--r--benchmark/string_slice.yml11
-rw-r--r--benchmark/string_split.yml22
-rw-r--r--benchmark/string_swapcase.yml18
-rw-r--r--benchmark/string_upcase.yml18
-rw-r--r--benchmark/time_at.yml7
-rw-r--r--benchmark/time_new.yml4
-rw-r--r--benchmark/time_now.yml3
-rw-r--r--benchmark/time_parse.yml10
-rw-r--r--benchmark/time_strptime.yml13
-rw-r--r--benchmark/time_subsec.rb2
-rw-r--r--benchmark/vm_array.yml4
-rw-r--r--benchmark/vm_attr_ivar.yml14
-rw-r--r--benchmark/vm_attr_ivar_set.yml14
-rw-r--r--benchmark/vm_backtrace.rb (renamed from benchmark/bm_vm3_backtrace.rb)0
-rw-r--r--benchmark/vm_bigarray.yml105
-rw-r--r--benchmark/vm_bighash.yml4
-rw-r--r--benchmark/vm_block.yml9
-rw-r--r--benchmark/vm_block_handler.yml27
-rw-r--r--benchmark/vm_blockparam.yml7
-rw-r--r--benchmark/vm_blockparam_call.yml8
-rw-r--r--benchmark/vm_blockparam_pass.yml12
-rw-r--r--benchmark/vm_blockparam_yield.yml8
-rw-r--r--benchmark/vm_case.yml13
-rw-r--r--benchmark/vm_case_classes.yml9
-rw-r--r--benchmark/vm_case_lit.yml23
-rw-r--r--benchmark/vm_clearmethodcache.rb (renamed from benchmark/bm_vm3_clearmethodcache.rb)0
-rw-r--r--benchmark/vm_const.yml13
-rw-r--r--benchmark/vm_cvar.yml20
-rw-r--r--benchmark/vm_defined_method.yml8
-rw-r--r--benchmark/vm_dstr.yml6
-rw-r--r--benchmark/vm_dstr_ary.rb6
-rw-r--r--benchmark/vm_dstr_bool.rb7
-rw-r--r--benchmark/vm_dstr_class_module.rb10
-rw-r--r--benchmark/vm_dstr_digit.rb7
-rw-r--r--benchmark/vm_dstr_int.rb5
-rw-r--r--benchmark/vm_dstr_nil.rb6
-rw-r--r--benchmark/vm_dstr_obj.rb6
-rw-r--r--benchmark/vm_dstr_obj_def.rb8
-rw-r--r--benchmark/vm_dstr_str.rb6
-rw-r--r--benchmark/vm_dstr_sym.rb6
-rw-r--r--benchmark/vm_ensure.yml14
-rw-r--r--benchmark/vm_eval.yml4
-rw-r--r--benchmark/vm_fiber_allocate.yml8
-rw-r--r--benchmark/vm_fiber_count.yml10
-rw-r--r--benchmark/vm_fiber_reuse.yml14
-rw-r--r--benchmark/vm_fiber_reuse_gc.yml12
-rw-r--r--benchmark/vm_fiber_switch.yml9
-rw-r--r--benchmark/vm_float_simple.yml8
-rw-r--r--benchmark/vm_freezeobj.yml6
-rw-r--r--benchmark/vm_freezestring.yml10
-rw-r--r--benchmark/vm_gc.rb (renamed from benchmark/bm_vm3_gc.rb)0
-rw-r--r--benchmark/vm_gc_old_full.rb (renamed from benchmark/bm_vm3_gc_old_full.rb)0
-rw-r--r--benchmark/vm_gc_old_immediate.rb (renamed from benchmark/bm_vm3_gc_old_immediate.rb)0
-rw-r--r--benchmark/vm_gc_old_lazy.rb (renamed from benchmark/bm_vm3_gc_old_lazy.rb)0
-rw-r--r--benchmark/vm_gc_short_lived.yml9
-rw-r--r--benchmark/vm_gc_short_with_complex_long.yml25
-rw-r--r--benchmark/vm_gc_short_with_long.yml13
-rw-r--r--benchmark/vm_gc_short_with_symbol.yml13
-rw-r--r--benchmark/vm_gc_wb_ary.yml12
-rw-r--r--benchmark/vm_gc_wb_ary_promoted.yml15
-rw-r--r--benchmark/vm_gc_wb_obj.yml15
-rw-r--r--benchmark/vm_gc_wb_obj_promoted.yml17
-rw-r--r--benchmark/vm_iclass_super.yml20
-rw-r--r--benchmark/vm_ivar.yml6
-rw-r--r--benchmark/vm_ivar_embedded_obj_init.yml14
-rw-r--r--benchmark/vm_ivar_extended_obj_init.yml16
-rw-r--r--benchmark/vm_ivar_generic_get.yml17
-rw-r--r--benchmark/vm_ivar_generic_set.yml14
-rw-r--r--benchmark/vm_ivar_get.yml37
-rw-r--r--benchmark/vm_ivar_get_unintialized.yml12
-rw-r--r--benchmark/vm_ivar_lazy_set.yml12
-rw-r--r--benchmark/vm_ivar_of_class.yml12
-rw-r--r--benchmark/vm_ivar_of_class_set.yml11
-rw-r--r--benchmark/vm_ivar_set.yml5
-rw-r--r--benchmark/vm_ivar_set_on_instance.yml35
-rw-r--r--benchmark/vm_ivar_set_subclass.yml20
-rw-r--r--benchmark/vm_length.yml8
-rw-r--r--benchmark/vm_lvar_cond_set.yml8
-rw-r--r--benchmark/vm_lvar_init.yml21
-rw-r--r--benchmark/vm_lvar_set.yml4
-rw-r--r--benchmark/vm_method.yml8
-rw-r--r--benchmark/vm_method_missing.yml11
-rw-r--r--benchmark/vm_method_with_block.yml8
-rw-r--r--benchmark/vm_module_ann_const_set.yml4
-rw-r--r--benchmark/vm_module_const_set.yml8
-rw-r--r--benchmark/vm_mutex.yml8
-rw-r--r--benchmark/vm_neq.yml7
-rw-r--r--benchmark/vm_newlambda.yml4
-rw-r--r--benchmark/vm_not.yml6
-rw-r--r--benchmark/vm_poly_method.yml24
-rw-r--r--benchmark/vm_poly_method_ov.yml24
-rw-r--r--benchmark/vm_poly_same_method.yml25
-rw-r--r--benchmark/vm_poly_singleton.yml18
-rw-r--r--benchmark/vm_proc.yml12
-rw-r--r--benchmark/vm_raise1.yml16
-rw-r--r--benchmark/vm_raise2.yml16
-rw-r--r--benchmark/vm_regexp.yml8
-rw-r--r--benchmark/vm_rescue.yml6
-rw-r--r--benchmark/vm_send.yml14
-rw-r--r--benchmark/vm_send_cfunc.yml3
-rw-r--r--benchmark/vm_simplereturn.yml7
-rw-r--r--benchmark/vm_string_literal.yml4
-rw-r--r--benchmark/vm_struct_big_aref_hi.yml7
-rw-r--r--benchmark/vm_struct_big_aref_lo.yml7
-rw-r--r--benchmark/vm_struct_big_aset.yml11
-rw-r--r--benchmark/vm_struct_big_href_hi.yml7
-rw-r--r--benchmark/vm_struct_big_href_lo.yml7
-rw-r--r--benchmark/vm_struct_big_hset.yml11
-rw-r--r--benchmark/vm_struct_small_aref.yml7
-rw-r--r--benchmark/vm_struct_small_aset.yml11
-rw-r--r--benchmark/vm_struct_small_href.yml7
-rw-r--r--benchmark/vm_struct_small_hset.yml7
-rw-r--r--benchmark/vm_super.yml17
-rw-r--r--benchmark/vm_swap.yml7
-rw-r--r--benchmark/vm_symbol_block_pass.rb (renamed from benchmark/bm_vm_symbol_block_pass.rb)0
-rw-r--r--benchmark/vm_thread_alive_check.yml8
-rw-r--r--benchmark/vm_thread_close.rb (renamed from benchmark/bm_vm_thread_close.rb)0
-rw-r--r--benchmark/vm_thread_condvar1.rb28
-rw-r--r--benchmark/vm_thread_condvar2.rb35
-rw-r--r--benchmark/vm_thread_create_join.rb (renamed from benchmark/bm_vm_thread_create_join.rb)0
-rw-r--r--benchmark/vm_thread_mutex1.rb (renamed from benchmark/bm_vm_thread_mutex1.rb)0
-rw-r--r--benchmark/vm_thread_mutex2.rb (renamed from benchmark/bm_vm_thread_mutex2.rb)0
-rw-r--r--benchmark/vm_thread_mutex3.rb (renamed from benchmark/bm_vm_thread_mutex3.rb)0
-rw-r--r--benchmark/vm_thread_pass.rb15
-rw-r--r--benchmark/vm_thread_pass_flood.rb10
-rw-r--r--benchmark/vm_thread_pipe.rb (renamed from benchmark/bm_vm_thread_pipe.rb)0
-rw-r--r--benchmark/vm_thread_queue.rb18
-rw-r--r--benchmark/vm_thread_sized_queue.rb20
-rw-r--r--benchmark/vm_thread_sized_queue2.rb23
-rw-r--r--benchmark/vm_thread_sized_queue3.rb22
-rw-r--r--benchmark/vm_thread_sized_queue4.rb26
-rw-r--r--benchmark/vm_thread_sleep.yml4
-rw-r--r--benchmark/vm_unif1.yml7
-rw-r--r--benchmark/vm_yield.yml13
-rw-r--r--benchmark/vm_zsuper.yml18
-rw-r--r--benchmark/wc.input.base25
-rw-r--r--bignum.c1968
-rwxr-xr-xbin/erb171
-rwxr-xr-xbin/gem19
-rwxr-xr-xbin/rdoc44
-rw-r--r--bootstraptest/pending.rb24
-rwxr-xr-xbootstraptest/runner.rb837
-rw-r--r--bootstraptest/test_attr.rb16
-rw-r--r--bootstraptest/test_autoload.rb30
-rw-r--r--bootstraptest/test_constant_cache.rb187
-rw-r--r--bootstraptest/test_env.rb12
-rw-r--r--bootstraptest/test_eval.rb40
-rw-r--r--bootstraptest/test_exception.rb2
-rw-r--r--bootstraptest/test_fiber.rb39
-rw-r--r--bootstraptest/test_flow.rb18
-rw-r--r--bootstraptest/test_fork.rb4
-rw-r--r--bootstraptest/test_insns.rb440
-rw-r--r--bootstraptest/test_io.rb9
-rw-r--r--bootstraptest/test_jump.rb30
-rw-r--r--bootstraptest/test_literal.rb21
-rw-r--r--bootstraptest/test_literal_suffix.rb6
-rw-r--r--bootstraptest/test_method.rb2
-rw-r--r--bootstraptest/test_objectspace.rb9
-rw-r--r--bootstraptest/test_proc.rb17
-rw-r--r--bootstraptest/test_ractor.rb1628
-rw-r--r--bootstraptest/test_syntax.rb8
-rw-r--r--bootstraptest/test_thread.rb46
-rw-r--r--bootstraptest/test_yjit.rb3530
-rw-r--r--bootstraptest/test_yjit_30k_ifelse.rb241023
-rw-r--r--bootstraptest/test_yjit_30k_methods.rb121018
-rw-r--r--bootstraptest/test_yjit_rust_port.rb422
-rw-r--r--builtin.c69
-rw-r--r--builtin.h121
-rw-r--r--ccan/build_assert/build_assert.h12
-rw-r--r--ccan/check_type/check_type.h28
-rw-r--r--ccan/container_of/container_of.h52
-rw-r--r--ccan/list/list.h612
-rw-r--r--ccan/str/str.h9
-rw-r--r--class.c2194
-rw-r--r--common.mk16829
-rw-r--r--compar.c162
-rw-r--r--compile.c16431
-rw-r--r--complex.c1930
-rw-r--r--configure.ac4570
-rw-r--r--configure.in4684
-rw-r--r--constant.h21
-rw-r--r--cont.c3618
-rw-r--r--coroutine/amd64/Context.S46
-rw-r--r--coroutine/amd64/Context.h85
-rw-r--r--coroutine/arm32/Context.S33
-rw-r--r--coroutine/arm32/Context.h59
-rw-r--r--coroutine/arm64/Context.S73
-rw-r--r--coroutine/arm64/Context.h83
-rw-r--r--coroutine/asyncify/Context.c10
-rw-r--r--coroutine/asyncify/Context.h93
-rw-r--r--coroutine/emscripten/Context.c8
-rw-r--r--coroutine/emscripten/Context.h77
-rw-r--r--coroutine/ppc/Context.S90
-rw-r--r--coroutine/ppc/Context.h58
-rw-r--r--coroutine/ppc64/Context.S89
-rw-r--r--coroutine/ppc64/Context.h57
-rw-r--r--coroutine/ppc64le/Context.S75
-rw-r--r--coroutine/ppc64le/Context.h57
-rw-r--r--coroutine/pthread/Context.c272
-rw-r--r--coroutine/pthread/Context.h63
-rw-r--r--coroutine/riscv64/Context.S87
-rw-r--r--coroutine/riscv64/Context.h46
-rw-r--r--coroutine/ucontext/Context.c23
-rw-r--r--coroutine/ucontext/Context.h79
-rw-r--r--coroutine/universal/Context.S16
-rw-r--r--coroutine/universal/Context.h21
-rw-r--r--coroutine/win32/Context.S47
-rw-r--r--coroutine/win32/Context.asm55
-rw-r--r--coroutine/win32/Context.h65
-rw-r--r--coroutine/win64/Context.S77
-rw-r--r--coroutine/win64/Context.asm79
-rw-r--r--coroutine/win64/Context.h75
-rw-r--r--coroutine/x86/Context.S42
-rw-r--r--coroutine/x86/Context.h61
-rw-r--r--coverage/README4
-rw-r--r--cygwin/GNUmakefile.in59
-rw-r--r--darray.h179
-rw-r--r--debug.c553
-rw-r--r--debug_counter.c152
-rw-r--r--debug_counter.h434
-rw-r--r--defs/gmake.mk427
-rw-r--r--defs/id.def70
-rw-r--r--defs/keywords4
-rw-r--r--defs/known_errors.def251
-rw-r--r--defs/lex.c.src4
-rw-r--r--defs/separated_version.mk38
-rw-r--r--defs/universal.mk5
-rw-r--r--dir.c2996
-rw-r--r--dir.rb314
-rw-r--r--dln.c1432
-rw-r--r--dln.h26
-rw-r--r--dln_find.c284
-rw-r--r--dmydln.c2
-rw-r--r--dmyenc.c2
-rw-r--r--doc/.document9
-rw-r--r--doc/ChangeLog-0.60_to_1.114
-rw-r--r--doc/ChangeLog-1.8.04
-rw-r--r--doc/ChangeLog-1.9.340
-rw-r--r--doc/ChangeLog-2.0.014
-rw-r--r--doc/ChangeLog-2.1.06
-rw-r--r--doc/ChangeLog-2.3.015
-rw-r--r--doc/ChangeLog-2.4.09492
-rw-r--r--doc/ChangeLog-YARV60
-rw-r--r--doc/NEWS-1.8.7669
-rw-r--r--doc/NEWS-1.9.2509
-rw-r--r--doc/NEWS-2.0.0531
-rw-r--r--doc/NEWS-2.1.0376
-rw-r--r--doc/NEWS-2.2.0361
-rw-r--r--doc/NEWS-2.3.0404
-rw-r--r--doc/NEWS/NEWS-1.8.7669
-rw-r--r--doc/NEWS/NEWS-1.9.1 (renamed from doc/NEWS-1.9.1)0
-rw-r--r--doc/NEWS/NEWS-1.9.2509
-rw-r--r--doc/NEWS/NEWS-1.9.3 (renamed from doc/NEWS-1.9.3)0
-rw-r--r--doc/NEWS/NEWS-2.0.0529
-rw-r--r--doc/NEWS/NEWS-2.1.0376
-rw-r--r--doc/NEWS/NEWS-2.2.0359
-rw-r--r--doc/NEWS/NEWS-2.3.0384
-rw-r--r--doc/NEWS/NEWS-2.4.0399
-rw-r--r--doc/NEWS/NEWS-2.5.0565
-rw-r--r--doc/NEWS/NEWS-2.6.0662
-rw-r--r--doc/NEWS/NEWS-2.7.0845
-rw-r--r--doc/NEWS/NEWS-3.0.0.md829
-rw-r--r--doc/NEWS/NEWS-3.1.0.md660
-rw-r--r--doc/bsearch.rdoc120
-rw-r--r--doc/bug_triaging.rdoc79
-rw-r--r--doc/case_mapping.rdoc116
-rw-r--r--doc/character_selectors.rdoc97
-rw-r--r--doc/command_injection.rdoc29
-rw-r--r--doc/contributing.md12
-rw-r--r--doc/contributing.rdoc462
-rw-r--r--doc/contributing/building_ruby.md172
-rw-r--r--doc/contributing/documentation_guide.md435
-rw-r--r--doc/contributing/making_changes_to_ruby.md28
-rw-r--r--doc/contributing/making_changes_to_stdlibs.md49
-rw-r--r--doc/contributing/reporting_issues.md91
-rw-r--r--doc/contributing/testing_ruby.md138
-rw-r--r--doc/contributors.rdoc778
-rw-r--r--doc/csv/arguments/io.rdoc5
-rw-r--r--doc/csv/options/common/col_sep.rdoc63
-rw-r--r--doc/csv/options/common/quote_char.rdoc42
-rw-r--r--doc/csv/options/common/row_sep.rdoc100
-rw-r--r--doc/csv/options/generating/force_quotes.rdoc17
-rw-r--r--doc/csv/options/generating/quote_empty.rdoc12
-rw-r--r--doc/csv/options/generating/write_converters.rdoc33
-rw-r--r--doc/csv/options/generating/write_empty_value.rdoc15
-rw-r--r--doc/csv/options/generating/write_headers.rdoc29
-rw-r--r--doc/csv/options/generating/write_nil_value.rdoc14
-rw-r--r--doc/csv/options/parsing/converters.rdoc46
-rw-r--r--doc/csv/options/parsing/empty_value.rdoc13
-rw-r--r--doc/csv/options/parsing/field_size_limit.rdoc39
-rw-r--r--doc/csv/options/parsing/header_converters.rdoc43
-rw-r--r--doc/csv/options/parsing/headers.rdoc63
-rw-r--r--doc/csv/options/parsing/liberal_parsing.rdoc19
-rw-r--r--doc/csv/options/parsing/nil_value.rdoc12
-rw-r--r--doc/csv/options/parsing/return_headers.rdoc22
-rw-r--r--doc/csv/options/parsing/skip_blanks.rdoc31
-rw-r--r--doc/csv/options/parsing/skip_lines.rdoc37
-rw-r--r--doc/csv/options/parsing/strip.rdoc15
-rw-r--r--doc/csv/options/parsing/unconverted_fields.rdoc27
-rw-r--r--doc/csv/recipes/filtering.rdoc156
-rw-r--r--doc/csv/recipes/generating.rdoc244
-rw-r--r--doc/csv/recipes/parsing.rdoc543
-rw-r--r--doc/csv/recipes/recipes.rdoc6
-rw-r--r--doc/date/calendars.rdoc62
-rw-r--r--doc/dig_methods.rdoc82
-rw-r--r--doc/dtrace_probes.rdoc78
-rw-r--r--doc/encodings.rdoc479
-rw-r--r--doc/etc.rd.ja75
-rw-r--r--doc/examples/files.rdoc26
-rw-r--r--doc/extension.ja.rdoc319
-rw-r--r--doc/extension.rdoc698
-rw-r--r--doc/fiber.md232
-rw-r--r--doc/format_specifications.rdoc348
-rw-r--r--doc/globals.rdoc89
-rw-r--r--doc/implicit_conversion.rdoc221
-rw-r--r--doc/irb/irb.rd.ja91
-rw-r--r--doc/keywords.rdoc10
-rw-r--r--doc/maintainers.rdoc396
-rw-r--r--doc/marshal.rdoc4
-rw-r--r--doc/matchdata/begin.rdoc30
-rw-r--r--doc/matchdata/end.rdoc30
-rw-r--r--doc/matchdata/offset.rdoc31
-rw-r--r--doc/math/math.rdoc117
-rw-r--r--doc/memory_view.md167
-rw-r--r--doc/mjit/mjit.md39
-rw-r--r--doc/net-http/examples.rdoc31
-rw-r--r--doc/net-http/included_getters.rdoc3
-rw-r--r--doc/optparse/.document1
-rw-r--r--doc/optparse/argument_converters.rdoc380
-rw-r--r--doc/optparse/creates_option.rdoc7
-rw-r--r--doc/optparse/option_params.rdoc509
-rw-r--r--doc/optparse/ruby/argument_keywords.rb6
-rw-r--r--doc/optparse/ruby/argument_strings.rb6
-rw-r--r--doc/optparse/ruby/argv.rb2
-rw-r--r--doc/optparse/ruby/array.rb6
-rw-r--r--doc/optparse/ruby/basic.rb17
-rw-r--r--doc/optparse/ruby/block.rb9
-rw-r--r--doc/optparse/ruby/collected_options.rb8
-rw-r--r--doc/optparse/ruby/custom_converter.rb9
-rw-r--r--doc/optparse/ruby/date.rb6
-rw-r--r--doc/optparse/ruby/datetime.rb6
-rw-r--r--doc/optparse/ruby/decimal_integer.rb7
-rw-r--r--doc/optparse/ruby/decimal_numeric.rb7
-rw-r--r--doc/optparse/ruby/default_values.rb8
-rw-r--r--doc/optparse/ruby/descriptions.rb15
-rw-r--r--doc/optparse/ruby/explicit_array_values.rb9
-rw-r--r--doc/optparse/ruby/explicit_hash_values.rb9
-rw-r--r--doc/optparse/ruby/false_class.rb6
-rw-r--r--doc/optparse/ruby/float.rb6
-rw-r--r--doc/optparse/ruby/help.rb18
-rw-r--r--doc/optparse/ruby/help_banner.rb7
-rw-r--r--doc/optparse/ruby/help_format.rb25
-rw-r--r--doc/optparse/ruby/help_program_name.rb7
-rw-r--r--doc/optparse/ruby/integer.rb6
-rw-r--r--doc/optparse/ruby/long_names.rb9
-rw-r--r--doc/optparse/ruby/long_optional.rb6
-rw-r--r--doc/optparse/ruby/long_required.rb6
-rw-r--r--doc/optparse/ruby/long_simple.rb9
-rw-r--r--doc/optparse/ruby/long_with_negation.rb6
-rw-r--r--doc/optparse/ruby/match_converter.rb9
-rw-r--r--doc/optparse/ruby/matched_values.rb6
-rw-r--r--doc/optparse/ruby/method.rb11
-rw-r--r--doc/optparse/ruby/missing_options.rb12
-rw-r--r--doc/optparse/ruby/mixed_names.rb12
-rw-r--r--doc/optparse/ruby/name_abbrev.rb9
-rw-r--r--doc/optparse/ruby/no_abbreviation.rb10
-rw-r--r--doc/optparse/ruby/numeric.rb6
-rw-r--r--doc/optparse/ruby/object.rb6
-rw-r--r--doc/optparse/ruby/octal_integer.rb7
-rw-r--r--doc/optparse/ruby/optional_argument.rb9
-rw-r--r--doc/optparse/ruby/parse.rb13
-rw-r--r--doc/optparse/ruby/parse_bang.rb13
-rw-r--r--doc/optparse/ruby/proc.rb13
-rw-r--r--doc/optparse/ruby/regexp.rb6
-rw-r--r--doc/optparse/ruby/required_argument.rb9
-rw-r--r--doc/optparse/ruby/shellwords.rb6
-rw-r--r--doc/optparse/ruby/short_names.rb9
-rw-r--r--doc/optparse/ruby/short_optional.rb6
-rw-r--r--doc/optparse/ruby/short_range.rb6
-rw-r--r--doc/optparse/ruby/short_required.rb6
-rw-r--r--doc/optparse/ruby/short_simple.rb9
-rw-r--r--doc/optparse/ruby/string.rb6
-rw-r--r--doc/optparse/ruby/terminator.rb6
-rw-r--r--doc/optparse/ruby/time.rb6
-rw-r--r--doc/optparse/ruby/true_class.rb6
-rw-r--r--doc/optparse/ruby/uri.rb6
-rw-r--r--doc/optparse/tutorial.rdoc835
-rw-r--r--doc/packed_data.rdoc590
-rw-r--r--doc/ractor.md952
-rw-r--r--doc/rdoc/markup_reference.rb1257
-rw-r--r--doc/regexp.rdoc144
-rw-r--r--doc/security.rdoc19
-rw-r--r--doc/shell.rd.ja335
-rw-r--r--doc/signals.rdoc106
-rw-r--r--doc/standard_library.rdoc94
-rw-r--r--doc/strftime_formatting.rdoc527
-rw-r--r--doc/string/b.rdoc14
-rw-r--r--doc/string/bytes.rdoc6
-rw-r--r--doc/string/bytesize.rdoc11
-rw-r--r--doc/string/center.rdoc16
-rw-r--r--doc/string/chars.rdoc5
-rw-r--r--doc/string/chomp.rdoc29
-rw-r--r--doc/string/chop.rdoc16
-rw-r--r--doc/string/codepoints.rdoc6
-rw-r--r--doc/string/delete_prefix.rdoc8
-rw-r--r--doc/string/delete_suffix.rdoc8
-rw-r--r--doc/string/each_byte.rdoc17
-rw-r--r--doc/string/each_char.rdoc17
-rw-r--r--doc/string/each_codepoint.rdoc18
-rw-r--r--doc/string/each_grapheme_cluster.rdoc12
-rw-r--r--doc/string/each_line.rdoc60
-rw-r--r--doc/string/end_with_p.rdoc11
-rw-r--r--doc/string/force_encoding.rdoc20
-rw-r--r--doc/string/grapheme_clusters.rdoc6
-rw-r--r--doc/string/index.rdoc38
-rw-r--r--doc/string/length.rdoc13
-rw-r--r--doc/string/ljust.rdoc16
-rw-r--r--doc/string/new.rdoc51
-rw-r--r--doc/string/ord.rdoc6
-rw-r--r--doc/string/partition.rdoc24
-rw-r--r--doc/string/rjust.rdoc16
-rw-r--r--doc/string/rpartition.rdoc24
-rw-r--r--doc/string/scrub.rdoc25
-rw-r--r--doc/string/split.rdoc86
-rw-r--r--doc/string/start_with_p.rdoc18
-rw-r--r--doc/string/sum.rdoc11
-rw-r--r--doc/symbol/casecmp.rdoc27
-rw-r--r--doc/symbol/casecmp_p.rdoc26
-rw-r--r--doc/syntax.rdoc7
-rw-r--r--doc/syntax/assignment.rdoc33
-rw-r--r--doc/syntax/calling_methods.rdoc115
-rw-r--r--doc/syntax/comments.rdoc253
-rw-r--r--doc/syntax/control_expressions.rdoc108
-rw-r--r--doc/syntax/exceptions.rdoc9
-rw-r--r--doc/syntax/literals.rdoc300
-rw-r--r--doc/syntax/methods.rdoc267
-rw-r--r--doc/syntax/miscellaneous.rdoc32
-rw-r--r--doc/syntax/modules_and_classes.rdoc42
-rw-r--r--doc/syntax/pattern_matching.rdoc540
-rw-r--r--doc/syntax/precedence.rdoc6
-rw-r--r--doc/syntax/refinements.rdoc68
-rw-r--r--doc/timezones.rdoc108
-rw-r--r--doc/transcode.rdoc52
-rw-r--r--doc/yarvarch.en (renamed from template/yarvarch.en)0
-rw-r--r--doc/yarvarch.ja (renamed from template/yarvarch.ja)0
-rw-r--r--doc/yjit/yjit.md417
-rw-r--r--doc/yjit/yjit_hacking.md75
-rw-r--r--enc/Makefile.in6
-rw-r--r--enc/ascii.c15
-rw-r--r--enc/big5.c6
-rw-r--r--enc/cesu_8.c469
-rw-r--r--enc/cp949.c4
-rw-r--r--enc/depend10282
-rw-r--r--enc/emacs_mule.c4
-rw-r--r--enc/encdb.c4
-rw-r--r--enc/encinit.c.erb1
-rw-r--r--enc/euc_jp.c8
-rw-r--r--enc/euc_kr.c27
-rw-r--r--enc/euc_tw.c2
-rw-r--r--enc/gb18030.c3
-rw-r--r--enc/gb2312.c4
-rw-r--r--enc/gbk.c2
-rw-r--r--enc/iso_8859_1.c33
-rw-r--r--enc/iso_8859_10.c41
-rw-r--r--enc/iso_8859_11.c4
-rw-r--r--enc/iso_8859_13.c41
-rw-r--r--enc/iso_8859_14.c50
-rw-r--r--enc/iso_8859_15.c47
-rw-r--r--enc/iso_8859_16.c46
-rw-r--r--enc/iso_8859_2.c34
-rw-r--r--enc/iso_8859_3.c43
-rw-r--r--enc/iso_8859_4.c29
-rw-r--r--enc/iso_8859_5.c22
-rw-r--r--enc/iso_8859_6.c4
-rw-r--r--enc/iso_8859_7.c48
-rw-r--r--enc/iso_8859_8.c4
-rw-r--r--enc/iso_8859_9.c47
-rw-r--r--enc/jis/props.h227
-rw-r--r--enc/jis/props.h.blt58
-rw-r--r--enc/jis/props.kwd6
-rw-r--r--enc/jis/props.src6
-rw-r--r--enc/koi8_r.c3
-rw-r--r--enc/koi8_u.c2
-rwxr-xr-xenc/make_encmake.rb14
-rw-r--r--enc/mktable.c42
-rw-r--r--enc/prelude.rb4
-rw-r--r--enc/shift_jis.c531
-rw-r--r--enc/shift_jis.h546
-rw-r--r--enc/trans/GB/GB12345%UCS.src61
-rw-r--r--enc/trans/GB/GB2312%UCS.src75
-rw-r--r--enc/trans/GB/UCS%GB12345.src61
-rw-r--r--enc/trans/GB/UCS%GB2312.src75
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src2
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src2
-rw-r--r--enc/trans/cesu_8.trans85
-rw-r--r--enc/trans/escape.trans3
-rw-r--r--enc/trans/ibm720-tbl.rb122
-rw-r--r--enc/trans/newline.trans30
-rw-r--r--enc/trans/single_byte.trans12
-rw-r--r--enc/trans/transdb.c2
-rw-r--r--enc/trans/windows-1255-tbl.rb3
-rw-r--r--enc/unicode.c272
-rw-r--r--enc/unicode/15.0.0/casefold.h7629
-rw-r--r--enc/unicode/15.0.0/name2ctype.h45690
-rw-r--r--enc/unicode/9.0.0/casefold.h7068
-rw-r--r--enc/unicode/9.0.0/name2ctype.h35389
-rwxr-xr-xenc/unicode/case-folding.rb412
-rw-r--r--enc/us_ascii.c9
-rw-r--r--enc/utf_16_32.h2
-rw-r--r--enc/utf_16be.c2
-rw-r--r--enc/utf_16le.c2
-rw-r--r--enc/utf_32be.c21
-rw-r--r--enc/utf_32le.c20
-rw-r--r--enc/utf_8.c16
-rw-r--r--enc/windows_1250.c37
-rw-r--r--enc/windows_1251.c37
-rw-r--r--enc/windows_1252.c31
-rw-r--r--enc/windows_1253.c45
-rw-r--r--enc/windows_1254.c79
-rw-r--r--enc/windows_1257.c52
-rw-r--r--enc/windows_31j.c10
-rw-r--r--enc/x_emoji.h4
-rw-r--r--encindex.h13
-rw-r--r--encoding.c1273
-rw-r--r--enum.c3559
-rw-r--r--enumerator.c3636
-rw-r--r--error.c2295
-rw-r--r--eval.c1818
-rw-r--r--eval_error.c604
-rw-r--r--eval_intern.h200
-rw-r--r--eval_jump.c65
-rw-r--r--ext/-test-/RUBY_ALIGNOF/c.c15
-rw-r--r--ext/-test-/RUBY_ALIGNOF/cpp.cpp9
-rw-r--r--ext/-test-/RUBY_ALIGNOF/depend162
-rw-r--r--ext/-test-/RUBY_ALIGNOF/extconf.rb6
-rw-r--r--ext/-test-/abi/abi.c11
-rw-r--r--ext/-test-/abi/extconf.rb4
-rw-r--r--ext/-test-/arith_seq/beg_len_step/beg_len_step.c19
-rw-r--r--ext/-test-/arith_seq/beg_len_step/depend161
-rw-r--r--ext/-test-/arith_seq/beg_len_step/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/depend161
-rw-r--r--ext/-test-/arith_seq/extract/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/extract.c27
-rw-r--r--ext/-test-/array/concat/depend162
-rw-r--r--ext/-test-/array/concat/extconf.rb2
-rw-r--r--ext/-test-/array/concat/to_ary_concat.c38
-rw-r--r--ext/-test-/array/resize/depend149
-rw-r--r--ext/-test-/array/resize/resize.c6
-rw-r--r--ext/-test-/auto_ext.rb1
-rw-r--r--ext/-test-/bignum/big2str.c14
-rw-r--r--ext/-test-/bignum/bigzero.c2
-rw-r--r--ext/-test-/bignum/depend1087
-rw-r--r--ext/-test-/bignum/div.c10
-rw-r--r--ext/-test-/bignum/intpack.c42
-rw-r--r--ext/-test-/bignum/mul.c30
-rw-r--r--ext/-test-/bignum/str2big.c18
-rw-r--r--ext/-test-/bug-14834/bug-14384.c39
-rw-r--r--ext/-test-/bug-14834/depend162
-rw-r--r--ext/-test-/bug-14834/extconf.rb2
-rw-r--r--ext/-test-/bug-3571/bug.c2
-rw-r--r--ext/-test-/bug-3571/depend162
-rw-r--r--ext/-test-/bug-5832/depend162
-rw-r--r--ext/-test-/bug_reporter/depend162
-rw-r--r--ext/-test-/class/depend300
-rw-r--r--ext/-test-/cxxanyargs/cxxanyargs.cpp961
-rw-r--r--ext/-test-/cxxanyargs/depend13
-rw-r--r--ext/-test-/cxxanyargs/extconf.rb46
-rw-r--r--ext/-test-/cxxanyargs/failure.cpp13
-rw-r--r--ext/-test-/cxxanyargs/failurem1.cpp13
-rw-r--r--ext/-test-/debug/depend449
-rw-r--r--ext/-test-/debug/inspector.c14
-rw-r--r--ext/-test-/debug/profile_frames.c27
-rw-r--r--ext/-test-/dln/empty/depend159
-rw-r--r--ext/-test-/dln/empty/empty.c2
-rw-r--r--ext/-test-/econv/append.c15
-rw-r--r--ext/-test-/econv/extconf.rb3
-rw-r--r--ext/-test-/econv/init.c11
-rw-r--r--ext/-test-/enumerator_kw/depend162
-rw-r--r--ext/-test-/enumerator_kw/enumerator_kw.c22
-rw-r--r--ext/-test-/enumerator_kw/extconf.rb1
-rw-r--r--ext/-test-/eval/eval.c13
-rw-r--r--ext/-test-/eval/extconf.rb2
-rw-r--r--ext/-test-/exception/depend612
-rw-r--r--ext/-test-/exception/enc_raise.c2
-rw-r--r--ext/-test-/exception/ensured.c14
-rw-r--r--ext/-test-/fatal/depend162
-rw-r--r--ext/-test-/fatal/rb_fatal.c3
-rw-r--r--ext/-test-/file/depend469
-rw-r--r--ext/-test-/file/extconf.rb1
-rw-r--r--ext/-test-/file/fs.c47
-rw-r--r--ext/-test-/float/depend327
-rw-r--r--ext/-test-/funcall/depend162
-rw-r--r--ext/-test-/funcall/funcall.c72
-rw-r--r--ext/-test-/funcall/passing_block.c30
-rw-r--r--ext/-test-/gvl/call_without_gvl/call_without_gvl.c50
-rw-r--r--ext/-test-/gvl/call_without_gvl/depend149
-rw-r--r--ext/-test-/hash/depend322
-rw-r--r--ext/-test-/integer/core_ext.c21
-rw-r--r--ext/-test-/integer/depend465
-rw-r--r--ext/-test-/iseq_load/depend162
-rw-r--r--ext/-test-/iter/break.c4
-rw-r--r--ext/-test-/iter/depend482
-rw-r--r--ext/-test-/iter/yield.c2
-rw-r--r--ext/-test-/load/dot.dot/depend159
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c2
-rw-r--r--ext/-test-/load/protect/depend162
-rw-r--r--ext/-test-/load/protect/extconf.rb1
-rw-r--r--ext/-test-/load/protect/protect.c19
-rw-r--r--ext/-test-/marshal/compat/depend162
-rw-r--r--ext/-test-/marshal/internal_ivar/depend162
-rw-r--r--ext/-test-/marshal/internal_ivar/internal_ivar.c20
-rw-r--r--ext/-test-/marshal/usr/depend162
-rw-r--r--ext/-test-/memory_status/depend162
-rw-r--r--ext/-test-/memory_status/extconf.rb12
-rw-r--r--ext/-test-/memory_status/memory_status.c80
-rw-r--r--ext/-test-/memory_view/depend163
-rw-r--r--ext/-test-/memory_view/extconf.rb5
-rw-r--r--ext/-test-/memory_view/memory_view.c450
-rw-r--r--ext/-test-/method/depend322
-rw-r--r--ext/-test-/notimplement/bug.c2
-rw-r--r--ext/-test-/notimplement/depend162
-rw-r--r--ext/-test-/num2int/depend162
-rw-r--r--ext/-test-/num2int/num2int.c26
-rw-r--r--ext/-test-/path_to_class/depend162
-rw-r--r--ext/-test-/popen_deadlock/depend163
-rw-r--r--ext/-test-/popen_deadlock/extconf.rb1
-rw-r--r--ext/-test-/postponed_job/depend164
-rw-r--r--ext/-test-/postponed_job/postponed_job.c49
-rw-r--r--ext/-test-/printf/depend177
-rw-r--r--ext/-test-/printf/printf.c72
-rw-r--r--ext/-test-/proc/depend482
-rw-r--r--ext/-test-/proc/super.c2
-rw-r--r--ext/-test-/random/bad_version.c135
-rw-r--r--ext/-test-/random/depend482
-rw-r--r--ext/-test-/random/extconf.rb3
-rw-r--r--ext/-test-/random/init.c11
-rw-r--r--ext/-test-/random/loop.c111
-rw-r--r--ext/-test-/rational/depend168
-rw-r--r--ext/-test-/rational/rat.c23
-rw-r--r--ext/-test-/rb_call_super_kw/depend162
-rw-r--r--ext/-test-/rb_call_super_kw/extconf.rb1
-rw-r--r--ext/-test-/rb_call_super_kw/rb_call_super_kw.c15
-rw-r--r--ext/-test-/recursion/depend162
-rw-r--r--ext/-test-/regexp/depend323
-rw-r--r--ext/-test-/regexp/extconf.rb3
-rw-r--r--ext/-test-/regexp/init.c11
-rw-r--r--ext/-test-/regexp/parse_depth_limit.c23
-rw-r--r--ext/-test-/scan_args/depend162
-rw-r--r--ext/-test-/scan_args/extconf.rb1
-rw-r--r--ext/-test-/scan_args/scan_args.c305
-rw-r--r--ext/-test-/st/foreach/depend162
-rw-r--r--ext/-test-/st/foreach/foreach.c110
-rw-r--r--ext/-test-/st/numhash/depend162
-rw-r--r--ext/-test-/st/numhash/numhash.c21
-rw-r--r--ext/-test-/st/update/depend162
-rw-r--r--ext/-test-/st/update/update.c12
-rw-r--r--ext/-test-/string/capacity.c13
-rw-r--r--ext/-test-/string/coderange.c20
-rw-r--r--ext/-test-/string/cstr.c30
-rw-r--r--ext/-test-/string/depend2543
-rw-r--r--ext/-test-/string/ellipsize.c2
-rw-r--r--ext/-test-/string/enc_associate.c2
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c16
-rw-r--r--ext/-test-/string/fstring.c17
-rw-r--r--ext/-test-/string/init.c2
-rw-r--r--ext/-test-/string/modify.c2
-rw-r--r--ext/-test-/string/new.c21
-rw-r--r--ext/-test-/string/nofree.c2
-rw-r--r--ext/-test-/string/normalize.c4
-rw-r--r--ext/-test-/string/qsort.c16
-rw-r--r--ext/-test-/string/rb_interned_str.c14
-rw-r--r--ext/-test-/string/rb_str_dup.c35
-rw-r--r--ext/-test-/string/set_len.c12
-rw-r--r--ext/-test-/struct/depend642
-rw-r--r--ext/-test-/struct/len.c13
-rw-r--r--ext/-test-/struct/member.c2
-rw-r--r--ext/-test-/symbol/depend322
-rw-r--r--ext/-test-/symbol/init.c16
-rw-r--r--ext/-test-/symbol/type.c6
-rw-r--r--ext/-test-/thread/instrumentation/depend164
-rw-r--r--ext/-test-/thread/instrumentation/extconf.rb2
-rw-r--r--ext/-test-/thread/instrumentation/instrumentation.c141
-rw-r--r--ext/-test-/thread_fd/depend161
-rw-r--r--ext/-test-/thread_fd/extconf.rb2
-rw-r--r--ext/-test-/thread_fd/thread_fd.c30
-rw-r--r--ext/-test-/time/depend487
-rw-r--r--ext/-test-/time/init.c2
-rw-r--r--ext/-test-/time/leap_second.c15
-rw-r--r--ext/-test-/time/new.c2
-rw-r--r--ext/-test-/tracepoint/depend298
-rw-r--r--ext/-test-/tracepoint/gc_hook.c39
-rw-r--r--ext/-test-/tracepoint/tracepoint.c54
-rw-r--r--ext/-test-/typeddata/depend162
-rw-r--r--ext/-test-/typeddata/typeddata.c26
-rw-r--r--ext/-test-/vm/at_exit.c12
-rw-r--r--ext/-test-/vm/depend149
-rw-r--r--ext/-test-/wait/depend174
-rw-r--r--ext/-test-/wait/extconf.rb2
-rw-r--r--ext/-test-/wait/wait.c39
-rw-r--r--ext/-test-/wait_for_single_fd/depend15
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb2
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c30
-rw-r--r--ext/-test-/win32/console/attribute.c31
-rw-r--r--ext/-test-/win32/dln/depend4
-rw-r--r--ext/-test-/win32/dln/extconf.rb6
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c10
-rw-r--r--ext/.document43
-rw-r--r--ext/Setup3
-rw-r--r--ext/Setup.atheos1
-rw-r--r--ext/Setup.nacl44
-rw-r--r--ext/Setup.nt1
-rw-r--r--ext/bigdecimal/bigdecimal.c4270
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec43
-rw-r--r--ext/bigdecimal/bigdecimal.h239
-rw-r--r--ext/bigdecimal/bits.h141
-rw-r--r--ext/bigdecimal/depend318
-rw-r--r--ext/bigdecimal/extconf.rb80
-rw-r--r--ext/bigdecimal/feature.h68
-rw-r--r--ext/bigdecimal/lib/bigdecimal.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb10
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb18
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb161
-rw-r--r--ext/bigdecimal/missing.c27
-rw-r--r--ext/bigdecimal/missing.h196
-rw-r--r--ext/bigdecimal/missing/dtoa.c3462
-rw-r--r--ext/bigdecimal/sample/linear.rb21
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb10
-rw-r--r--ext/bigdecimal/static_assert.h54
-rw-r--r--ext/cgi/escape/depend161
-rw-r--r--ext/cgi/escape/escape.c457
-rw-r--r--ext/continuation/depend149
-rw-r--r--ext/coverage/coverage.c553
-rw-r--r--ext/coverage/depend186
-rw-r--r--ext/coverage/lib/coverage.rb14
-rw-r--r--ext/date/date.gemspec34
-rw-r--r--ext/date/date_core.c2991
-rw-r--r--ext/date/date_parse.c488
-rw-r--r--ext/date/date_strftime.c2
-rw-r--r--ext/date/date_strptime.c187
-rw-r--r--ext/date/depend634
-rw-r--r--ext/date/extconf.rb10
-rw-r--r--ext/date/lib/date.rb29
-rw-r--r--ext/date/prereq.mk15
-rw-r--r--ext/date/update-abbr52
-rw-r--r--ext/date/zonetab.h2096
-rw-r--r--ext/date/zonetab.list162
-rw-r--r--ext/dbm/dbm.c1160
-rw-r--r--ext/dbm/depend13
-rw-r--r--ext/dbm/extconf.rb290
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c3
-rw-r--r--ext/digest/bubblebabble/depend153
-rw-r--r--ext/digest/bubblebabble/extconf.rb2
-rw-r--r--ext/digest/depend151
-rw-r--r--ext/digest/digest.c127
-rw-r--r--ext/digest/digest.gemspec44
-rw-r--r--ext/digest/digest.h23
-rw-r--r--ext/digest/digest_conf.rb21
-rw-r--r--ext/digest/extconf.rb2
-rw-r--r--ext/digest/lib/digest.rb18
-rw-r--r--ext/digest/lib/digest/loader.rb3
-rw-r--r--ext/digest/lib/digest/version.rb5
-rw-r--r--ext/digest/md5/depend319
-rw-r--r--ext/digest/md5/extconf.rb2
-rw-r--r--ext/digest/md5/md5.c2
-rw-r--r--ext/digest/md5/md5cc.h7
-rw-r--r--ext/digest/md5/md5init.c33
-rw-r--r--ext/digest/md5/md5ossl.h15
-rw-r--r--ext/digest/rmd160/depend318
-rw-r--r--ext/digest/rmd160/extconf.rb6
-rw-r--r--ext/digest/rmd160/rmd160init.c33
-rw-r--r--ext/digest/rmd160/rmd160ossl.h20
-rw-r--r--ext/digest/sha1/depend319
-rw-r--r--ext/digest/sha1/extconf.rb4
-rw-r--r--ext/digest/sha1/sha1init.c35
-rw-r--r--ext/digest/sha1/sha1ossl.h22
-rw-r--r--ext/digest/sha2/depend318
-rw-r--r--ext/digest/sha2/extconf.rb4
-rw-r--r--ext/digest/sha2/lib/sha2.rb46
-rw-r--r--ext/digest/sha2/lib/sha2/loader.rb3
-rw-r--r--ext/digest/sha2/sha2.c16
-rw-r--r--ext/digest/sha2/sha2init.c16
-rw-r--r--ext/digest/sha2/sha2ossl.h27
-rw-r--r--ext/erb/escape/escape.c95
-rw-r--r--ext/erb/escape/extconf.rb7
-rw-r--r--ext/etc/depend162
-rw-r--r--ext/etc/etc.c211
-rw-r--r--ext/etc/etc.gemspec43
-rw-r--r--ext/etc/extconf.rb17
-rw-r--r--ext/etc/mkconstants.rb18
-rwxr-xr-xext/extmk.rb447
-rw-r--r--ext/fcntl/depend151
-rw-r--r--ext/fcntl/extconf.rb2
-rw-r--r--ext/fcntl/fcntl.c33
-rw-r--r--ext/fcntl/fcntl.gemspec21
-rw-r--r--ext/fiber/depend1
-rw-r--r--ext/fiber/extconf.rb4
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c171
-rw-r--r--ext/fiddle/conversions.c241
-rw-r--r--ext/fiddle/conversions.h17
-rw-r--r--ext/fiddle/depend1272
-rw-r--r--ext/fiddle/extconf.rb151
-rw-r--r--ext/fiddle/extlibs2
-rw-r--r--ext/fiddle/fiddle.c357
-rw-r--r--ext/fiddle/fiddle.gemspec59
-rw-r--r--ext/fiddle/fiddle.h152
-rw-r--r--ext/fiddle/function.c366
-rw-r--r--ext/fiddle/handle.c141
-rw-r--r--ext/fiddle/lib/fiddle.rb53
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb27
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb134
-rw-r--r--ext/fiddle/lib/fiddle/function.rb13
-rw-r--r--ext/fiddle/lib/fiddle/import.rb22
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb56
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb383
-rw-r--r--ext/fiddle/lib/fiddle/types.rb37
-rw-r--r--ext/fiddle/lib/fiddle/value.rb29
-rw-r--r--ext/fiddle/lib/fiddle/version.rb3
-rw-r--r--ext/fiddle/memory_view.c321
-rw-r--r--ext/fiddle/pinned.c123
-rw-r--r--ext/fiddle/pointer.c186
-rw-r--r--[-rwxr-xr-x]ext/fiddle/win32/fficonfig.h0
-rwxr-xr-xext/fiddle/win32/libffi-config.rb4
-rw-r--r--[-rwxr-xr-x]ext/fiddle/win32/libffi.mk.tmpl0
-rw-r--r--ext/gdbm/README1
-rw-r--r--ext/gdbm/depend13
-rw-r--r--ext/gdbm/extconf.rb19
-rw-r--r--ext/gdbm/gdbm.c1309
-rw-r--r--ext/io/console/console.c896
-rw-r--r--ext/io/console/depend167
-rw-r--r--ext/io/console/extconf.rb19
-rw-r--r--ext/io/console/io-console.gemspec40
-rw-r--r--ext/io/console/lib/console/size.rb2
-rw-r--r--ext/io/console/win32_vk.inc364
-rw-r--r--ext/io/console/win32_vk.list2
-rw-r--r--ext/io/nonblock/depend161
-rw-r--r--ext/io/nonblock/io-nonblock.gemspec25
-rw-r--r--ext/io/nonblock/nonblock.c69
-rw-r--r--ext/io/wait/depend162
-rw-r--r--ext/io/wait/extconf.rb31
-rw-r--r--ext/io/wait/io-wait.gemspec38
-rw-r--r--ext/io/wait/wait.c274
-rw-r--r--ext/json/VERSION1
-rw-r--r--ext/json/depend2
-rw-r--r--ext/json/extconf.rb1
-rw-r--r--ext/json/fbuffer/fbuffer.h3
-rw-r--r--ext/json/generator/depend164
-rw-r--r--ext/json/generator/generator.c297
-rw-r--r--ext/json/generator/generator.h8
-rw-r--r--ext/json/json.gemspecbin5473 -> 2279 bytes-rw-r--r--ext/json/lib/json.rb578
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb4
-rw-r--r--ext/json/lib/json/add/complex.rb5
-rw-r--r--ext/json/lib/json/add/ostruct.rb2
-rw-r--r--ext/json/lib/json/add/rational.rb5
-rw-r--r--ext/json/lib/json/add/regexp.rb4
-rw-r--r--ext/json/lib/json/add/set.rb29
-rw-r--r--ext/json/lib/json/common.rb497
-rw-r--r--ext/json/lib/json/version.rb2
-rw-r--r--ext/json/parser/depend163
-rw-r--r--ext/json/parser/extconf.rb28
-rw-r--r--ext/json/parser/parser.c4703
-rw-r--r--ext/json/parser/parser.h8
-rw-r--r--ext/json/parser/parser.rl196
-rw-r--r--ext/json/parser/prereq.mk5
-rw-r--r--ext/mathn/complex/complex.c7
-rw-r--r--ext/mathn/complex/extconf.rb4
-rw-r--r--ext/mathn/rational/extconf.rb4
-rw-r--r--ext/mathn/rational/rational.c7
-rw-r--r--ext/monitor/depend161
-rw-r--r--ext/monitor/extconf.rb2
-rw-r--r--ext/monitor/lib/monitor.rb284
-rw-r--r--ext/monitor/monitor.c225
-rw-r--r--ext/nkf/depend159
-rw-r--r--ext/nkf/nkf-utf8/config.h2
-rw-r--r--ext/nkf/nkf-utf8/nkf.c75
-rw-r--r--ext/nkf/nkf-utf8/nkf.h4
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c158
-rw-r--r--ext/nkf/nkf.c102
-rw-r--r--ext/nkf/nkf.gemspec24
-rw-r--r--ext/objspace/depend524
-rw-r--r--ext/objspace/extconf.rb2
-rw-r--r--ext/objspace/lib/objspace.rb142
-rw-r--r--ext/objspace/lib/objspace/trace.rb45
-rw-r--r--ext/objspace/object_tracing.c272
-rw-r--r--ext/objspace/objspace.c693
-rw-r--r--ext/objspace/objspace_dump.c875
-rw-r--r--ext/openssl/History.md676
-rw-r--r--ext/openssl/depend5406
-rw-r--r--ext/openssl/deprecation.rb26
-rw-r--r--ext/openssl/extconf.rb248
-rw-r--r--ext/openssl/lib/openssl.rb32
-rw-r--r--ext/openssl/lib/openssl/bn.rb5
-rw-r--r--ext/openssl/lib/openssl/buffering.rb116
-rw-r--r--ext/openssl/lib/openssl/cipher.rb2
-rw-r--r--ext/openssl/lib/openssl/config.rb473
-rw-r--r--ext/openssl/lib/openssl/digest.rb29
-rw-r--r--ext/openssl/lib/openssl/hmac.rb78
-rw-r--r--ext/openssl/lib/openssl/marshal.rb30
-rw-r--r--ext/openssl/lib/openssl/pkcs5.rb22
-rw-r--r--ext/openssl/lib/openssl/pkey.rb505
-rw-r--r--ext/openssl/lib/openssl/ssl.rb225
-rw-r--r--ext/openssl/lib/openssl/version.rb5
-rw-r--r--ext/openssl/lib/openssl/x509.rb219
-rw-r--r--ext/openssl/openssl.gemspec56
-rw-r--r--ext/openssl/openssl_missing.c141
-rw-r--r--ext/openssl/openssl_missing.h156
-rw-r--r--ext/openssl/ossl.c556
-rw-r--r--ext/openssl/ossl.h127
-rw-r--r--ext/openssl/ossl_asn1.c911
-rw-r--r--ext/openssl/ossl_asn1.h4
-rw-r--r--ext/openssl/ossl_bio.c73
-rw-r--r--ext/openssl/ossl_bio.h5
-rw-r--r--ext/openssl/ossl_bn.c579
-rw-r--r--ext/openssl/ossl_bn.h7
-rw-r--r--ext/openssl/ossl_cipher.c225
-rw-r--r--ext/openssl/ossl_cipher.h2
-rw-r--r--ext/openssl/ossl_config.c455
-rw-r--r--ext/openssl/ossl_config.h11
-rw-r--r--ext/openssl/ossl_digest.c150
-rw-r--r--ext/openssl/ossl_digest.h2
-rw-r--r--ext/openssl/ossl_engine.c208
-rw-r--r--ext/openssl/ossl_hmac.c216
-rw-r--r--ext/openssl/ossl_kdf.c311
-rw-r--r--ext/openssl/ossl_kdf.h6
-rw-r--r--ext/openssl/ossl_ns_spki.c51
-rw-r--r--ext/openssl/ossl_ocsp.c238
-rw-r--r--ext/openssl/ossl_ocsp.h6
-rw-r--r--ext/openssl/ossl_pkcs12.c62
-rw-r--r--ext/openssl/ossl_pkcs5.c180
-rw-r--r--ext/openssl/ossl_pkcs5.h6
-rw-r--r--ext/openssl/ossl_pkcs7.c164
-rw-r--r--ext/openssl/ossl_pkcs7.h16
-rw-r--r--ext/openssl/ossl_pkey.c1525
-rw-r--r--ext/openssl/ossl_pkey.h125
-rw-r--r--ext/openssl/ossl_pkey_dh.c478
-rw-r--r--ext/openssl/ossl_pkey_dsa.c523
-rw-r--r--ext/openssl/ossl_pkey_ec.c787
-rw-r--r--ext/openssl/ossl_pkey_rsa.c763
-rw-r--r--ext/openssl/ossl_rand.c64
-rw-r--r--ext/openssl/ossl_ssl.c1647
-rw-r--r--ext/openssl/ossl_ssl.h5
-rw-r--r--ext/openssl/ossl_ssl_session.c131
-rw-r--r--ext/openssl/ossl_ts.c1539
-rw-r--r--ext/openssl/ossl_ts.h16
-rw-r--r--ext/openssl/ossl_version.h15
-rw-r--r--ext/openssl/ossl_x509.c102
-rw-r--r--ext/openssl/ossl_x509.h16
-rw-r--r--ext/openssl/ossl_x509attr.c10
-rw-r--r--ext/openssl/ossl_x509cert.c282
-rw-r--r--ext/openssl/ossl_x509crl.c98
-rw-r--r--ext/openssl/ossl_x509ext.c40
-rw-r--r--ext/openssl/ossl_x509name.c170
-rw-r--r--ext/openssl/ossl_x509req.c104
-rw-r--r--ext/openssl/ossl_x509revoked.c43
-rw-r--r--ext/openssl/ossl_x509store.c448
-rw-r--r--ext/openssl/ruby_missing.h32
-rw-r--r--ext/pathname/depend161
-rw-r--r--ext/pathname/extconf.rb2
-rw-r--r--ext/pathname/lib/pathname.rb53
-rw-r--r--ext/pathname/pathname.c460
-rw-r--r--ext/pathname/pathname.gemspec25
-rw-r--r--ext/psych/.gitignore12
-rw-r--r--ext/psych/depend819
-rw-r--r--ext/psych/extconf.rb72
-rw-r--r--ext/psych/lib/psych.rb427
-rw-r--r--ext/psych/lib/psych/class_loader.rb20
-rw-r--r--ext/psych/lib/psych/coder.rb2
-rw-r--r--ext/psych/lib/psych/core_ext.rb23
-rw-r--r--ext/psych/lib/psych/deprecated.rb86
-rw-r--r--ext/psych/lib/psych/exception.rb20
-rw-r--r--ext/psych/lib/psych/handler.rb11
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb4
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb4
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb2
-rw-r--r--ext/psych/lib/psych/json/stream.rb6
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb4
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb2
-rw-r--r--ext/psych/lib/psych/nodes.rb16
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb4
-rw-r--r--ext/psych/lib/psych/nodes/document.rb4
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb4
-rw-r--r--ext/psych/lib/psych/nodes/node.rb29
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb6
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb4
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb4
-rw-r--r--ext/psych/lib/psych/omap.rb2
-rw-r--r--ext/psych/lib/psych/parser.rb15
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb86
-rw-r--r--ext/psych/lib/psych/set.rb2
-rw-r--r--ext/psych/lib/psych/stream.rb2
-rw-r--r--ext/psych/lib/psych/streaming.rb2
-rw-r--r--ext/psych/lib/psych/syntax_error.rb4
-rw-r--r--ext/psych/lib/psych/tree_builder.rb52
-rw-r--r--ext/psych/lib/psych/versions.rb10
-rw-r--r--ext/psych/lib/psych/visitors.rb14
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb2
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb2
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb4
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb90
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb22
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb221
-rw-r--r--ext/psych/lib/psych/y.rb2
-rw-r--r--ext/psych/psych.c9
-rw-r--r--ext/psych/psych.gemspec61
-rw-r--r--ext/psych/psych.h3
-rw-r--r--ext/psych/psych_emitter.c47
-rw-r--r--ext/psych/psych_parser.c170
-rw-r--r--ext/psych/psych_to_ruby.c4
-rw-r--r--ext/psych/psych_yaml_tree.c12
-rw-r--r--ext/psych/yaml/LICENSE19
-rw-r--r--ext/psych/yaml/api.c1415
-rw-r--r--ext/psych/yaml/config.h10
-rw-r--r--ext/psych/yaml/dumper.c394
-rw-r--r--ext/psych/yaml/emitter.c2329
-rw-r--r--ext/psych/yaml/loader.c459
-rw-r--r--ext/psych/yaml/parser.c1370
-rw-r--r--ext/psych/yaml/reader.c469
-rw-r--r--ext/psych/yaml/scanner.c3576
-rw-r--r--ext/psych/yaml/writer.c141
-rw-r--r--ext/psych/yaml/yaml.h1971
-rw-r--r--ext/psych/yaml/yaml_private.h664
-rw-r--r--ext/pty/depend170
-rw-r--r--ext/pty/extconf.rb12
-rw-r--r--ext/pty/lib/expect.rb27
-rw-r--r--ext/pty/pty.c338
-rw-r--r--ext/racc/cparse/README2
-rw-r--r--ext/racc/cparse/cparse.c50
-rw-r--r--ext/racc/cparse/depend150
-rw-r--r--ext/racc/cparse/extconf.rb7
-rw-r--r--ext/rbconfig/sizeof/depend320
-rw-r--r--ext/rbconfig/sizeof/extconf.rb2
-rw-r--r--ext/readline/.gitignore1
-rw-r--r--ext/readline/depend161
-rw-r--r--ext/readline/depend-gem4
-rw-r--r--ext/readline/extconf.rb11
-rw-r--r--ext/readline/readline-ext.gemspec22
-rw-r--r--ext/readline/readline.c217
-rw-r--r--ext/ripper/depend203
-rw-r--r--ext/ripper/eventids2.c342
-rw-r--r--ext/ripper/extconf.rb13
-rw-r--r--ext/ripper/lib/ripper.rb10
-rw-r--r--ext/ripper/lib/ripper/core.rb4
-rw-r--r--ext/ripper/lib/ripper/filter.rb12
-rw-r--r--ext/ripper/lib/ripper/lexer.rb234
-rw-r--r--ext/ripper/lib/ripper/sexp.rb53
-rw-r--r--ext/ripper/tools/dsl.rb88
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/generate-param-macros.rb2
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/generate.rb15
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/preproc.rb57
-rw-r--r--[-rwxr-xr-x]ext/ripper/tools/strip.rb2
-rw-r--r--ext/rubyvm/depend2
-rw-r--r--ext/rubyvm/extconf.rb1
-rw-r--r--ext/rubyvm/lib/forwardable/impl.rb16
-rw-r--r--ext/sdbm/_sdbm.c952
-rw-r--r--ext/sdbm/depend25
-rw-r--r--ext/sdbm/extconf.rb5
-rw-r--r--ext/sdbm/init.c1067
-rw-r--r--ext/sdbm/sdbm.h86
-rw-r--r--ext/socket/addrinfo.h36
-rw-r--r--ext/socket/ancdata.c298
-rw-r--r--ext/socket/basicsocket.c173
-rw-r--r--ext/socket/constants.c7
-rw-r--r--ext/socket/depend2614
-rw-r--r--ext/socket/extconf.rb35
-rw-r--r--ext/socket/getaddrinfo.c900
-rw-r--r--ext/socket/getnameinfo.c226
-rw-r--r--ext/socket/ifaddr.c77
-rw-r--r--ext/socket/init.c508
-rw-r--r--ext/socket/ipsocket.c224
-rw-r--r--ext/socket/lib/socket.rb143
-rw-r--r--ext/socket/mkconstants.rb71
-rw-r--r--ext/socket/option.c113
-rw-r--r--ext/socket/raddrinfo.c556
-rw-r--r--ext/socket/rubysocket.h121
-rw-r--r--ext/socket/socket.c676
-rw-r--r--ext/socket/sockssocket.c18
-rw-r--r--ext/socket/tcpserver.c26
-rw-r--r--ext/socket/tcpsocket.c41
-rw-r--r--ext/socket/udpsocket.c66
-rw-r--r--ext/socket/unixserver.c33
-rw-r--r--ext/socket/unixsocket.c205
-rw-r--r--ext/stringio/depend161
-rw-r--r--ext/stringio/extconf.rb1
-rw-r--r--ext/stringio/stringio.c833
-rw-r--r--ext/stringio/stringio.gemspec38
-rw-r--r--ext/strscan/depend162
-rw-r--r--ext/strscan/extconf.rb12
-rw-r--r--ext/strscan/strscan.c579
-rw-r--r--ext/strscan/strscan.gemspec41
-rw-r--r--ext/syslog/depend149
-rw-r--r--ext/syslog/extconf.rb2
-rw-r--r--ext/syslog/lib/syslog/logger.rb4
-rw-r--r--ext/syslog/syslog.c34
-rw-r--r--ext/syslog/syslog.gemspec23
-rw-r--r--ext/win32/depend2
-rw-r--r--ext/win32/extconf.rb2
-rw-r--r--ext/win32/lib/Win32API.rb47
-rw-r--r--ext/win32/lib/win32/importer.rb9
-rw-r--r--ext/win32/lib/win32/registry.rb43
-rw-r--r--ext/win32/lib/win32/resolv.rb29
-rw-r--r--ext/win32/lib/win32/resolv9x.rb253
-rw-r--r--ext/win32/lib/win32/sspi.rb627
-rw-r--r--ext/win32/resolv/depend17
-rw-r--r--ext/win32/resolv/resolv.c18
-rw-r--r--ext/win32ole/lib/win32ole.rb33
-rw-r--r--ext/win32ole/sample/xml.rb12
-rw-r--r--ext/win32ole/win32ole.c473
-rw-r--r--ext/win32ole/win32ole.gemspec22
-rw-r--r--ext/win32ole/win32ole.h16
-rw-r--r--ext/win32ole/win32ole_error.c4
-rw-r--r--ext/win32ole/win32ole_error.h3
-rw-r--r--ext/win32ole/win32ole_event.c48
-rw-r--r--ext/win32ole/win32ole_method.c45
-rw-r--r--ext/win32ole/win32ole_method.h2
-rw-r--r--ext/win32ole/win32ole_param.c5
-rw-r--r--ext/win32ole/win32ole_record.c5
-rw-r--r--ext/win32ole/win32ole_record.h2
-rw-r--r--ext/win32ole/win32ole_type.c15
-rw-r--r--ext/win32ole/win32ole_type.h2
-rw-r--r--ext/win32ole/win32ole_typelib.c25
-rw-r--r--ext/win32ole/win32ole_typelib.h2
-rw-r--r--ext/win32ole/win32ole_variable.c8
-rw-r--r--ext/win32ole/win32ole_variable.h2
-rw-r--r--ext/win32ole/win32ole_variant.c38
-rw-r--r--ext/win32ole/win32ole_variant.h2
-rw-r--r--ext/win32ole/win32ole_variant_m.c56
-rw-r--r--ext/win32ole/win32ole_variant_m.h2
-rw-r--r--ext/zlib/.gitignore1
-rw-r--r--ext/zlib/depend161
-rw-r--r--ext/zlib/extconf.rb89
-rw-r--r--ext/zlib/zlib.c1031
-rw-r--r--ext/zlib/zlib.gemspec31
-rw-r--r--file.c4866
-rw-r--r--gc.c13038
-rw-r--r--gc.h61
-rw-r--r--gc.rb296
-rw-r--r--gem_prelude.rb34
-rw-r--r--gems/bundled_gems23
-rw-r--r--gems/lib/core_assertions.rb1
-rw-r--r--gems/lib/envutil.rb1
-rw-r--r--gems/lib/rake/extensiontask.rb12
-rw-r--r--golf_prelude.rb9
-rw-r--r--goruby.c39
-rw-r--r--hash.c7144
-rw-r--r--hrtime.h227
-rw-r--r--ia64.s42
-rw-r--r--id_table.c1512
-rw-r--r--id_table.h10
-rw-r--r--include/ruby.h31
-rw-r--r--include/ruby/assert.h234
-rw-r--r--include/ruby/atomic.h890
-rw-r--r--include/ruby/backward.h35
-rw-r--r--include/ruby/backward/2/assume.h56
-rw-r--r--include/ruby/backward/2/attributes.h165
-rw-r--r--include/ruby/backward/2/bool.h36
-rw-r--r--include/ruby/backward/2/gcc_version_since.h37
-rw-r--r--include/ruby/backward/2/inttypes.h131
-rw-r--r--include/ruby/backward/2/limits.h99
-rw-r--r--include/ruby/backward/2/long_long.h73
-rw-r--r--include/ruby/backward/2/r_cast.h32
-rw-r--r--include/ruby/backward/2/rmodule.h36
-rw-r--r--include/ruby/backward/2/stdalign.h30
-rw-r--r--include/ruby/backward/2/stdarg.h69
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/cxxanyargs.hpp700
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h47
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/debug.h629
-rw-r--r--include/ruby/defines.h363
-rw-r--r--include/ruby/encoding.h447
-rw-r--r--include/ruby/fiber/scheduler.h374
-rw-r--r--include/ruby/intern.h1026
-rw-r--r--include/ruby/internal/abi.h58
-rw-r--r--include/ruby/internal/anyargs.h398
-rw-r--r--include/ruby/internal/arithmetic.h39
-rw-r--r--include/ruby/internal/arithmetic/char.h81
-rw-r--r--include/ruby/internal/arithmetic/double.h72
-rw-r--r--include/ruby/internal/arithmetic/fixnum.h60
-rw-r--r--include/ruby/internal/arithmetic/gid_t.h41
-rw-r--r--include/ruby/internal/arithmetic/int.h264
-rw-r--r--include/ruby/internal/arithmetic/intptr_t.h74
-rw-r--r--include/ruby/internal/arithmetic/long.h356
-rw-r--r--include/ruby/internal/arithmetic/long_long.h135
-rw-r--r--include/ruby/internal/arithmetic/mode_t.h41
-rw-r--r--include/ruby/internal/arithmetic/off_t.h62
-rw-r--r--include/ruby/internal/arithmetic/pid_t.h41
-rw-r--r--include/ruby/internal/arithmetic/short.h113
-rw-r--r--include/ruby/internal/arithmetic/size_t.h66
-rw-r--r--include/ruby/internal/arithmetic/st_data_t.h75
-rw-r--r--include/ruby/internal/arithmetic/uid_t.h41
-rw-r--r--include/ruby/internal/assume.h87
-rw-r--r--include/ruby/internal/attr/alloc_size.h32
-rw-r--r--include/ruby/internal/attr/artificial.h46
-rw-r--r--include/ruby/internal/attr/cold.h37
-rw-r--r--include/ruby/internal/attr/const.h46
-rw-r--r--include/ruby/internal/attr/constexpr.h84
-rw-r--r--include/ruby/internal/attr/deprecated.h75
-rw-r--r--include/ruby/internal/attr/diagnose_if.h42
-rw-r--r--include/ruby/internal/attr/enum_extensibility.h32
-rw-r--r--include/ruby/internal/attr/error.h32
-rw-r--r--include/ruby/internal/attr/flag_enum.h33
-rw-r--r--include/ruby/internal/attr/forceinline.h40
-rw-r--r--include/ruby/internal/attr/format.h38
-rw-r--r--include/ruby/internal/attr/maybe_unused.h38
-rw-r--r--include/ruby/internal/attr/noalias.h69
-rw-r--r--include/ruby/internal/attr/nodiscard.h45
-rw-r--r--include/ruby/internal/attr/noexcept.h91
-rw-r--r--include/ruby/internal/attr/noinline.h35
-rw-r--r--include/ruby/internal/attr/nonnull.h34
-rw-r--r--include/ruby/internal/attr/nonstring.h32
-rw-r--r--include/ruby/internal/attr/noreturn.h48
-rw-r--r--include/ruby/internal/attr/pure.h43
-rw-r--r--include/ruby/internal/attr/restrict.h44
-rw-r--r--include/ruby/internal/attr/returns_nonnull.h37
-rw-r--r--include/ruby/internal/attr/warning.h32
-rw-r--r--include/ruby/internal/attr/weakref.h32
-rw-r--r--include/ruby/internal/cast.h50
-rw-r--r--include/ruby/internal/compiler_is.h45
-rw-r--r--include/ruby/internal/compiler_is/apple.h40
-rw-r--r--include/ruby/internal/compiler_is/clang.h37
-rw-r--r--include/ruby/internal/compiler_is/gcc.h45
-rw-r--r--include/ruby/internal/compiler_is/intel.h40
-rw-r--r--include/ruby/internal/compiler_is/msvc.h56
-rw-r--r--include/ruby/internal/compiler_is/sunpro.h54
-rw-r--r--include/ruby/internal/compiler_since.h61
-rw-r--r--include/ruby/internal/config.h155
-rw-r--r--include/ruby/internal/constant_p.h38
-rw-r--r--include/ruby/internal/core.h35
-rw-r--r--include/ruby/internal/core/rarray.h585
-rw-r--r--include/ruby/internal/core/rbasic.h158
-rw-r--r--include/ruby/internal/core/rbignum.h80
-rw-r--r--include/ruby/internal/core/rclass.h93
-rw-r--r--include/ruby/internal/core/rdata.h386
-rw-r--r--include/ruby/internal/core/rfile.h51
-rw-r--r--include/ruby/internal/core/rhash.h144
-rw-r--r--include/ruby/internal/core/rmatch.h146
-rw-r--r--include/ruby/internal/core/robject.h176
-rw-r--r--include/ruby/internal/core/rregexp.h168
-rw-r--r--include/ruby/internal/core/rstring.h578
-rw-r--r--include/ruby/internal/core/rstruct.h121
-rw-r--r--include/ruby/internal/core/rtypeddata.h604
-rw-r--r--include/ruby/internal/ctype.h545
-rw-r--r--include/ruby/internal/dllexport.h112
-rw-r--r--include/ruby/internal/dosish.h89
-rw-r--r--include/ruby/internal/encoding/coderange.h202
-rw-r--r--include/ruby/internal/encoding/ctype.h258
-rw-r--r--include/ruby/internal/encoding/encoding.h1060
-rw-r--r--include/ruby/internal/encoding/pathname.h184
-rw-r--r--include/ruby/internal/encoding/re.h46
-rw-r--r--include/ruby/internal/encoding/sprintf.h78
-rw-r--r--include/ruby/internal/encoding/string.h346
-rw-r--r--include/ruby/internal/encoding/symbol.h100
-rw-r--r--include/ruby/internal/encoding/transcode.h562
-rw-r--r--include/ruby/internal/error.h582
-rw-r--r--include/ruby/internal/eval.h400
-rw-r--r--include/ruby/internal/event.h154
-rw-r--r--include/ruby/internal/fl_type.h948
-rw-r--r--include/ruby/internal/gc.h62
-rw-r--r--include/ruby/internal/glob.h113
-rw-r--r--include/ruby/internal/globals.h209
-rw-r--r--include/ruby/internal/has/attribute.h163
-rw-r--r--include/ruby/internal/has/builtin.h117
-rw-r--r--include/ruby/internal/has/c_attribute.h38
-rw-r--r--include/ruby/internal/has/cpp_attribute.h86
-rw-r--r--include/ruby/internal/has/declspec_attribute.h47
-rw-r--r--include/ruby/internal/has/extension.h33
-rw-r--r--include/ruby/internal/has/feature.h31
-rw-r--r--include/ruby/internal/has/warning.h31
-rw-r--r--include/ruby/internal/intern/array.h657
-rw-r--r--include/ruby/internal/intern/bignum.h846
-rw-r--r--include/ruby/internal/intern/class.h394
-rw-r--r--include/ruby/internal/intern/compar.h62
-rw-r--r--include/ruby/internal/intern/complex.h253
-rw-r--r--include/ruby/internal/intern/cont.h282
-rw-r--r--include/ruby/internal/intern/dir.h42
-rw-r--r--include/ruby/internal/intern/enum.h73
-rw-r--r--include/ruby/internal/intern/enumerator.h259
-rw-r--r--include/ruby/internal/intern/error.h287
-rw-r--r--include/ruby/internal/intern/eval.h222
-rw-r--r--include/ruby/internal/intern/file.h213
-rw-r--r--include/ruby/internal/intern/gc.h392
-rw-r--r--include/ruby/internal/intern/hash.h320
-rw-r--r--include/ruby/internal/intern/io.h661
-rw-r--r--include/ruby/internal/intern/load.h218
-rw-r--r--include/ruby/internal/intern/marshal.h112
-rw-r--r--include/ruby/internal/intern/numeric.h208
-rw-r--r--include/ruby/internal/intern/object.h501
-rw-r--r--include/ruby/internal/intern/parse.h194
-rw-r--r--include/ruby/internal/intern/proc.h353
-rw-r--r--include/ruby/internal/intern/process.h273
-rw-r--r--include/ruby/internal/intern/random.h116
-rw-r--r--include/ruby/internal/intern/range.h89
-rw-r--r--include/ruby/internal/intern/rational.h172
-rw-r--r--include/ruby/internal/intern/re.h249
-rw-r--r--include/ruby/internal/intern/ruby.h77
-rw-r--r--include/ruby/internal/intern/select.h86
-rw-r--r--include/ruby/internal/intern/select/largesize.h214
-rw-r--r--include/ruby/internal/intern/select/posix.h144
-rw-r--r--include/ruby/internal/intern/select/win32.h259
-rw-r--r--include/ruby/internal/intern/signal.h152
-rw-r--r--include/ruby/internal/intern/sprintf.h159
-rw-r--r--include/ruby/internal/intern/string.h1757
-rw-r--r--include/ruby/internal/intern/struct.h203
-rw-r--r--include/ruby/internal/intern/thread.h492
-rw-r--r--include/ruby/internal/intern/time.h161
-rw-r--r--include/ruby/internal/intern/variable.h628
-rw-r--r--include/ruby/internal/intern/vm.h431
-rw-r--r--include/ruby/internal/interpreter.h304
-rw-r--r--include/ruby/internal/iterator.h513
-rw-r--r--include/ruby/internal/memory.h666
-rw-r--r--include/ruby/internal/method.h205
-rw-r--r--include/ruby/internal/module.h177
-rw-r--r--include/ruby/internal/newobj.h195
-rw-r--r--include/ruby/internal/rgengc.h443
-rw-r--r--include/ruby/internal/scan_args.h534
-rw-r--r--include/ruby/internal/special_consts.h362
-rw-r--r--include/ruby/internal/static_assert.h77
-rw-r--r--include/ruby/internal/stdalign.h135
-rw-r--r--include/ruby/internal/stdbool.h51
-rw-r--r--include/ruby/internal/symbol.h332
-rw-r--r--include/ruby/internal/value.h133
-rw-r--r--include/ruby/internal/value_type.h449
-rw-r--r--include/ruby/internal/variable.h337
-rw-r--r--include/ruby/internal/warning_push.h124
-rw-r--r--include/ruby/internal/xmalloc.h392
-rw-r--r--include/ruby/io.h993
-rw-r--r--include/ruby/io/buffer.h92
-rw-r--r--include/ruby/memory_view.h325
-rw-r--r--include/ruby/missing.h244
-rw-r--r--include/ruby/onigmo.h952
-rw-r--r--include/ruby/oniguruma.h880
-rw-r--r--include/ruby/ractor.h264
-rw-r--r--include/ruby/random.h359
-rw-r--r--include/ruby/re.h199
-rw-r--r--include/ruby/regex.h21
-rw-r--r--include/ruby/ruby.h2691
-rw-r--r--include/ruby/st.h186
-rw-r--r--include/ruby/subst.h9
-rw-r--r--include/ruby/thread.h246
-rw-r--r--include/ruby/thread_native.h187
-rw-r--r--include/ruby/util.h260
-rw-r--r--include/ruby/version.h159
-rw-r--r--include/ruby/vm.h62
-rw-r--r--include/ruby/win32.h228
-rw-r--r--inits.c53
-rw-r--r--insns.def2197
-rw-r--r--internal.h1727
-rw-r--r--internal/array.h163
-rw-r--r--internal/basic_operators.h64
-rw-r--r--internal/bignum.h246
-rw-r--r--internal/bits.h565
-rw-r--r--internal/class.h187
-rw-r--r--internal/cmdlineopt.h61
-rw-r--r--internal/compar.h29
-rw-r--r--internal/compile.h35
-rw-r--r--internal/compilers.h107
-rw-r--r--internal/complex.h29
-rw-r--r--internal/cont.h32
-rw-r--r--internal/dir.h16
-rw-r--r--internal/enc.h19
-rw-r--r--internal/encoding.h32
-rw-r--r--internal/enum.h18
-rw-r--r--internal/enumerator.h21
-rw-r--r--internal/error.h191
-rw-r--r--internal/eval.h33
-rw-r--r--internal/file.h38
-rw-r--r--internal/fixnum.h184
-rw-r--r--internal/gc.h192
-rw-r--r--internal/hash.h244
-rw-r--r--internal/imemo.h242
-rw-r--r--internal/inits.h50
-rw-r--r--internal/io.h38
-rw-r--r--internal/load.h18
-rw-r--r--internal/loadpath.h16
-rw-r--r--internal/math.h23
-rw-r--r--internal/missing.h18
-rw-r--r--internal/numeric.h275
-rw-r--r--internal/object.h61
-rw-r--r--internal/parse.h25
-rw-r--r--internal/proc.h32
-rw-r--r--internal/process.h137
-rw-r--r--internal/ractor.h6
-rw-r--r--internal/random.h16
-rw-r--r--internal/range.h40
-rw-r--r--internal/rational.h72
-rw-r--r--internal/re.h30
-rw-r--r--internal/sanitizers.h190
-rw-r--r--internal/serial.h23
-rw-r--r--internal/signal.h21
-rw-r--r--internal/static_assert.h16
-rw-r--r--internal/string.h147
-rw-r--r--internal/struct.h153
-rw-r--r--internal/symbol.h42
-rw-r--r--internal/thread.h56
-rw-r--r--internal/time.h37
-rw-r--r--internal/transcode.h20
-rw-r--r--internal/util.h27
-rw-r--r--internal/variable.h90
-rw-r--r--internal/vm.h134
-rw-r--r--internal/warnings.h16
-rw-r--r--io.c11913
-rw-r--r--io.rb123
-rw-r--r--io_buffer.c3515
-rw-r--r--iseq.c3593
-rw-r--r--iseq.h304
-rw-r--r--kernel.rb178
-rw-r--r--lex.c.blt121
-rw-r--r--lib/English.gemspec22
-rw-r--r--lib/English.rb54
-rw-r--r--lib/abbrev.gemspec22
-rw-r--r--lib/abbrev.rb2
-rw-r--r--lib/base64.gemspec20
-rw-r--r--lib/base64.rb15
-rw-r--r--lib/benchmark.rb44
-rw-r--r--lib/benchmark/benchmark.gemspec29
-rw-r--r--lib/benchmark/version.rb4
-rw-r--r--lib/bundler.rb662
-rw-r--r--lib/bundler/.document1
-rw-r--r--lib/bundler/build_metadata.rb43
-rw-r--r--lib/bundler/bundler.gemspec43
-rw-r--r--lib/bundler/capistrano.rb22
-rw-r--r--lib/bundler/cli.rb894
-rw-r--r--lib/bundler/cli/add.rb47
-rw-r--r--lib/bundler/cli/binstubs.rb57
-rw-r--r--lib/bundler/cli/cache.rb43
-rw-r--r--lib/bundler/cli/check.rb40
-rw-r--r--lib/bundler/cli/clean.rb25
-rw-r--r--lib/bundler/cli/common.rb130
-rw-r--r--lib/bundler/cli/config.rb203
-rw-r--r--lib/bundler/cli/console.rb43
-rw-r--r--lib/bundler/cli/doctor.rb157
-rw-r--r--lib/bundler/cli/exec.rb88
-rw-r--r--lib/bundler/cli/fund.rb36
-rw-r--r--lib/bundler/cli/gem.rb465
-rw-r--r--lib/bundler/cli/info.rb94
-rw-r--r--lib/bundler/cli/init.rb51
-rw-r--r--lib/bundler/cli/inject.rb60
-rw-r--r--lib/bundler/cli/install.rb189
-rw-r--r--lib/bundler/cli/issue.rb41
-rw-r--r--lib/bundler/cli/list.rb66
-rw-r--r--lib/bundler/cli/lock.rb70
-rw-r--r--lib/bundler/cli/open.rb31
-rw-r--r--lib/bundler/cli/outdated.rb297
-rw-r--r--lib/bundler/cli/platform.rb48
-rw-r--r--lib/bundler/cli/plugin.rb41
-rw-r--r--lib/bundler/cli/pristine.rb52
-rw-r--r--lib/bundler/cli/remove.rb17
-rw-r--r--lib/bundler/cli/show.rb75
-rw-r--r--lib/bundler/cli/update.rb122
-rw-r--r--lib/bundler/cli/viz.rb31
-rw-r--r--lib/bundler/compact_index_client.rb119
-rw-r--r--lib/bundler/compact_index_client/cache.rb101
-rw-r--r--lib/bundler/compact_index_client/gem_parser.rb28
-rw-r--r--lib/bundler/compact_index_client/updater.rb117
-rw-r--r--lib/bundler/constants.rb7
-rw-r--r--lib/bundler/current_ruby.rb108
-rw-r--r--lib/bundler/definition.rb961
-rw-r--r--lib/bundler/dependency.rb97
-rw-r--r--lib/bundler/deployment.rb69
-rw-r--r--lib/bundler/deprecate.rb44
-rw-r--r--lib/bundler/digest.rb71
-rw-r--r--lib/bundler/dsl.rb583
-rw-r--r--lib/bundler/endpoint_specification.rb143
-rw-r--r--lib/bundler/env.rb150
-rw-r--r--lib/bundler/environment_preserver.rb86
-rw-r--r--lib/bundler/errors.rb175
-rw-r--r--lib/bundler/feature_flag.rb53
-rw-r--r--lib/bundler/fetcher.rb320
-rw-r--r--lib/bundler/fetcher/base.rb50
-rw-r--r--lib/bundler/fetcher/compact_index.rb133
-rw-r--r--lib/bundler/fetcher/dependency.rb78
-rw-r--r--lib/bundler/fetcher/downloader.rb89
-rw-r--r--lib/bundler/fetcher/index.rb25
-rw-r--r--lib/bundler/force_platform.rb18
-rw-r--r--lib/bundler/friendly_errors.rb126
-rw-r--r--lib/bundler/gem_helper.rb237
-rw-r--r--lib/bundler/gem_helpers.rb117
-rw-r--r--lib/bundler/gem_tasks.rb7
-rw-r--r--lib/bundler/gem_version_promoter.rb145
-rw-r--r--lib/bundler/graph.rb152
-rw-r--r--lib/bundler/index.rb175
-rw-r--r--lib/bundler/injector.rb287
-rw-r--r--lib/bundler/inline.rb73
-rw-r--r--lib/bundler/installer.rb267
-rw-r--r--lib/bundler/installer/gem_installer.rb84
-rw-r--r--lib/bundler/installer/parallel_installer.rb220
-rw-r--r--lib/bundler/installer/standalone.rb103
-rw-r--r--lib/bundler/lazy_specification.rb159
-rw-r--r--lib/bundler/lockfile_generator.rb95
-rw-r--r--lib/bundler/lockfile_parser.rb225
-rw-r--r--lib/bundler/man/.document1
-rw-r--r--lib/bundler/man/bundle-add.182
-rw-r--r--lib/bundler/man/bundle-add.1.ronn58
-rw-r--r--lib/bundler/man/bundle-binstubs.142
-rw-r--r--lib/bundler/man/bundle-binstubs.1.ronn41
-rw-r--r--lib/bundler/man/bundle-cache.161
-rw-r--r--lib/bundler/man/bundle-cache.1.ronn79
-rw-r--r--lib/bundler/man/bundle-check.131
-rw-r--r--lib/bundler/man/bundle-check.1.ronn26
-rw-r--r--lib/bundler/man/bundle-clean.124
-rw-r--r--lib/bundler/man/bundle-clean.1.ronn18
-rw-r--r--lib/bundler/man/bundle-config.1512
-rw-r--r--lib/bundler/man/bundle-config.1.ronn405
-rw-r--r--lib/bundler/man/bundle-console.153
-rw-r--r--lib/bundler/man/bundle-console.1.ronn44
-rw-r--r--lib/bundler/man/bundle-doctor.144
-rw-r--r--lib/bundler/man/bundle-doctor.1.ronn33
-rw-r--r--lib/bundler/man/bundle-exec.1165
-rw-r--r--lib/bundler/man/bundle-exec.1.ronn152
-rw-r--r--lib/bundler/man/bundle-gem.1105
-rw-r--r--lib/bundler/man/bundle-gem.1.ronn117
-rw-r--r--lib/bundler/man/bundle-help.113
-rw-r--r--lib/bundler/man/bundle-help.1.ronn12
-rw-r--r--lib/bundler/man/bundle-info.120
-rw-r--r--lib/bundler/man/bundle-info.1.ronn17
-rw-r--r--lib/bundler/man/bundle-init.129
-rw-r--r--lib/bundler/man/bundle-init.1.ronn31
-rw-r--r--lib/bundler/man/bundle-inject.136
-rw-r--r--lib/bundler/man/bundle-inject.1.ronn24
-rw-r--r--lib/bundler/man/bundle-install.1313
-rw-r--r--lib/bundler/man/bundle-install.1.ronn382
-rw-r--r--lib/bundler/man/bundle-list.150
-rw-r--r--lib/bundler/man/bundle-list.1.ronn33
-rw-r--r--lib/bundler/man/bundle-lock.184
-rw-r--r--lib/bundler/man/bundle-lock.1.ronn94
-rw-r--r--lib/bundler/man/bundle-open.152
-rw-r--r--lib/bundler/man/bundle-open.1.ronn27
-rw-r--r--lib/bundler/man/bundle-outdated.1152
-rw-r--r--lib/bundler/man/bundle-outdated.1.ronn105
-rw-r--r--lib/bundler/man/bundle-platform.171
-rw-r--r--lib/bundler/man/bundle-platform.1.ronn49
-rw-r--r--lib/bundler/man/bundle-plugin.181
-rw-r--r--lib/bundler/man/bundle-plugin.1.ronn59
-rw-r--r--lib/bundler/man/bundle-pristine.134
-rw-r--r--lib/bundler/man/bundle-pristine.1.ronn34
-rw-r--r--lib/bundler/man/bundle-remove.131
-rw-r--r--lib/bundler/man/bundle-remove.1.ronn23
-rw-r--r--lib/bundler/man/bundle-show.123
-rw-r--r--lib/bundler/man/bundle-show.1.ronn21
-rw-r--r--lib/bundler/man/bundle-update.1394
-rw-r--r--lib/bundler/man/bundle-update.1.ronn351
-rw-r--r--lib/bundler/man/bundle-version.135
-rw-r--r--lib/bundler/man/bundle-version.1.ronn24
-rw-r--r--lib/bundler/man/bundle-viz.142
-rw-r--r--lib/bundler/man/bundle-viz.1.ronn32
-rw-r--r--lib/bundler/man/bundle.1141
-rw-r--r--lib/bundler/man/bundle.1.ronn116
-rw-r--r--lib/bundler/man/gemfile.5736
-rw-r--r--lib/bundler/man/gemfile.5.ronn543
-rw-r--r--lib/bundler/man/index.txt29
-rw-r--r--lib/bundler/match_metadata.rb13
-rw-r--r--lib/bundler/match_platform.rb23
-rw-r--r--lib/bundler/match_remote_metadata.rb29
-rw-r--r--lib/bundler/mirror.rb221
-rw-r--r--lib/bundler/plugin.rb352
-rw-r--r--lib/bundler/plugin/api.rb81
-rw-r--r--lib/bundler/plugin/api/source.rb320
-rw-r--r--lib/bundler/plugin/dsl.rb53
-rw-r--r--lib/bundler/plugin/events.rb61
-rw-r--r--lib/bundler/plugin/index.rb185
-rw-r--r--lib/bundler/plugin/installer.rb112
-rw-r--r--lib/bundler/plugin/installer/git.rb34
-rw-r--r--lib/bundler/plugin/installer/rubygems.rb19
-rw-r--r--lib/bundler/plugin/source_list.rb31
-rw-r--r--lib/bundler/process_lock.rb24
-rw-r--r--lib/bundler/remote_specification.rb117
-rw-r--r--lib/bundler/resolver.rb427
-rw-r--r--lib/bundler/resolver/base.rb107
-rw-r--r--lib/bundler/resolver/candidate.rb94
-rw-r--r--lib/bundler/resolver/incompatibility.rb15
-rw-r--r--lib/bundler/resolver/package.rb72
-rw-r--r--lib/bundler/resolver/root.rb25
-rw-r--r--lib/bundler/resolver/spec_group.rb82
-rw-r--r--lib/bundler/retry.rb66
-rw-r--r--lib/bundler/ruby_dsl.rb24
-rw-r--r--lib/bundler/ruby_version.rb124
-rw-r--r--lib/bundler/rubygems_ext.rb355
-rw-r--r--lib/bundler/rubygems_gem_installer.rb172
-rw-r--r--lib/bundler/rubygems_integration.rb562
-rw-r--r--lib/bundler/runtime.rb307
-rw-r--r--lib/bundler/safe_marshal.rb31
-rw-r--r--lib/bundler/self_manager.rb168
-rw-r--r--lib/bundler/settings.rb507
-rw-r--r--lib/bundler/settings/validator.rb102
-rw-r--r--lib/bundler/setup.rb30
-rw-r--r--lib/bundler/shared_helpers.rb343
-rw-r--r--lib/bundler/similarity_detector.rb63
-rw-r--r--lib/bundler/source.rb114
-rw-r--r--lib/bundler/source/gemspec.rb18
-rw-r--r--lib/bundler/source/git.rb379
-rw-r--r--lib/bundler/source/git/git_proxy.rb431
-rw-r--r--lib/bundler/source/metadata.rb62
-rw-r--r--lib/bundler/source/path.rb260
-rw-r--r--lib/bundler/source/path/installer.rb53
-rw-r--r--lib/bundler/source/rubygems.rb512
-rw-r--r--lib/bundler/source/rubygems/remote.rb68
-rw-r--r--lib/bundler/source/rubygems_aggregate.rb68
-rw-r--r--lib/bundler/source_list.rb227
-rw-r--r--lib/bundler/source_map.rb71
-rw-r--r--lib/bundler/spec_set.rb216
-rw-r--r--lib/bundler/stub_specification.rb116
-rw-r--r--lib/bundler/templates/.document1
-rw-r--r--lib/bundler/templates/Executable27
-rw-r--r--lib/bundler/templates/Executable.bundler109
-rw-r--r--lib/bundler/templates/Executable.standalone14
-rw-r--r--lib/bundler/templates/Gemfile5
-rw-r--r--lib/bundler/templates/newgem/CHANGELOG.md.tt5
-rw-r--r--lib/bundler/templates/newgem/CODE_OF_CONDUCT.md.tt84
-rw-r--r--lib/bundler/templates/newgem/Cargo.toml.tt7
-rw-r--r--lib/bundler/templates/newgem/Gemfile.tt26
-rw-r--r--lib/bundler/templates/newgem/LICENSE.txt.tt21
-rw-r--r--lib/bundler/templates/newgem/README.md.tt45
-rw-r--r--lib/bundler/templates/newgem/Rakefile.tt67
-rw-r--r--lib/bundler/templates/newgem/bin/console.tt11
-rw-r--r--lib/bundler/templates/newgem/bin/setup.tt8
-rw-r--r--lib/bundler/templates/newgem/circleci/config.yml.tt25
-rw-r--r--lib/bundler/templates/newgem/exe/newgem.tt3
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/Cargo.toml.tt15
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf-c.rb.tt10
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf-rust.rb.tt6
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.c.tt9
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.h.tt6
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/src/lib.rs.tt12
-rw-r--r--lib/bundler/templates/newgem/github/workflows/main.yml.tt37
-rw-r--r--lib/bundler/templates/newgem/gitignore.tt23
-rw-r--r--lib/bundler/templates/newgem/gitlab-ci.yml.tt18
-rw-r--r--lib/bundler/templates/newgem/lib/newgem.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/lib/newgem/version.rb.tt9
-rw-r--r--lib/bundler/templates/newgem/newgem.gemspec.tt51
-rw-r--r--lib/bundler/templates/newgem/rspec.tt3
-rw-r--r--lib/bundler/templates/newgem/rubocop.yml.tt13
-rw-r--r--lib/bundler/templates/newgem/sig/newgem.rbs.tt8
-rw-r--r--lib/bundler/templates/newgem/spec/newgem_spec.rb.tt11
-rw-r--r--lib/bundler/templates/newgem/spec/spec_helper.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/standard.yml.tt3
-rw-r--r--lib/bundler/templates/newgem/test/minitest/test_helper.rb.tt6
-rw-r--r--lib/bundler/templates/newgem/test/minitest/test_newgem.rb.tt13
-rw-r--r--lib/bundler/templates/newgem/test/test-unit/newgem_test.rb.tt15
-rw-r--r--lib/bundler/templates/newgem/test/test-unit/test_helper.rb.tt6
-rw-r--r--lib/bundler/ui.rb9
-rw-r--r--lib/bundler/ui/rg_proxy.rb19
-rw-r--r--lib/bundler/ui/shell.rb165
-rw-r--r--lib/bundler/ui/silent.rb85
-rw-r--r--lib/bundler/uri_credentials_filter.rb43
-rw-r--r--lib/bundler/uri_normalizer.rb23
-rw-r--r--lib/bundler/vendor/.document1
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool.rb128
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/timed_stack.rb174
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/version.rb3
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/wrapper.rb56
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils.rb2706
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent.rb1073
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/connection.rb40
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/pool.rb53
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/timed_stack_multi.rb79
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub.rb31
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/assignment.rb20
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/basic_package_source.rb189
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/failure_writer.rb182
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/incompatibility.rb150
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/package.rb43
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/partial_solution.rb121
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/rubygems.rb45
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/solve_failure.rb19
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/static_package_source.rb60
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/term.rb105
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version.rb3
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_constraint.rb129
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_range.rb411
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_solver.rb248
-rw-r--r--lib/bundler/vendor/pub_grub/lib/pub_grub/version_union.rb178
-rw-r--r--lib/bundler/vendor/thor/lib/thor.rb516
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions.rb340
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_file.rb104
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_link.rb61
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/directory.rb108
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/empty_directory.rb143
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/file_manipulation.rb375
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/inject_into_file.rb119
-rw-r--r--lib/bundler/vendor/thor/lib/thor/base.rb699
-rw-r--r--lib/bundler/vendor/thor/lib/thor/command.rb142
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/hash_with_indifferent_access.rb103
-rw-r--r--lib/bundler/vendor/thor/lib/thor/error.rb115
-rw-r--r--lib/bundler/vendor/thor/lib/thor/group.rb281
-rw-r--r--lib/bundler/vendor/thor/lib/thor/invocation.rb178
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor.rb17
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/basic.rb37
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/readline.rb88
-rw-r--r--lib/bundler/vendor/thor/lib/thor/nested_context.rb29
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/argument.rb70
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/arguments.rb179
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/option.rb159
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/options.rb255
-rw-r--r--lib/bundler/vendor/thor/lib/thor/rake_compat.rb72
-rw-r--r--lib/bundler/vendor/thor/lib/thor/runner.rb325
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell.rb81
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/basic.rb512
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/color.rb157
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/html.rb126
-rw-r--r--lib/bundler/vendor/thor/lib/thor/util.rb284
-rw-r--r--lib/bundler/vendor/thor/lib/thor/version.rb3
-rw-r--r--lib/bundler/vendor/tsort/lib/tsort.rb452
-rw-r--r--lib/bundler/vendor/uri/lib/uri.rb104
-rw-r--r--lib/bundler/vendor/uri/lib/uri/common.rb729
-rw-r--r--lib/bundler/vendor/uri/lib/uri/file.rb100
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ftp.rb267
-rw-r--r--lib/bundler/vendor/uri/lib/uri/generic.rb1587
-rw-r--r--lib/bundler/vendor/uri/lib/uri/http.rb125
-rw-r--r--lib/bundler/vendor/uri/lib/uri/https.rb23
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldap.rb261
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldaps.rb22
-rw-r--r--lib/bundler/vendor/uri/lib/uri/mailto.rb293
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc2396_parser.rb539
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb119
-rw-r--r--lib/bundler/vendor/uri/lib/uri/version.rb6
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ws.rb83
-rw-r--r--lib/bundler/vendor/uri/lib/uri/wss.rb23
-rw-r--r--lib/bundler/vendored_fileutils.rb4
-rw-r--r--lib/bundler/vendored_persistent.rb15
-rw-r--r--lib/bundler/vendored_pub_grub.rb4
-rw-r--r--lib/bundler/vendored_thor.rb8
-rw-r--r--lib/bundler/vendored_tsort.rb4
-rw-r--r--lib/bundler/vendored_uri.rb4
-rw-r--r--lib/bundler/version.rb13
-rw-r--r--lib/bundler/vlad.rb17
-rw-r--r--lib/bundler/worker.rb117
-rw-r--r--lib/bundler/yaml_serializer.rb89
-rw-r--r--lib/cgi.rb7
-rw-r--r--lib/cgi/cgi.gemspec42
-rw-r--r--lib/cgi/cookie.rb68
-rw-r--r--lib/cgi/core.rb107
-rw-r--r--lib/cgi/html.rb12
-rw-r--r--lib/cgi/session.rb72
-rw-r--r--lib/cgi/session/pstore.rb21
-rw-r--r--lib/cgi/util.rb121
-rw-r--r--lib/cmath.rb435
-rw-r--r--lib/csv.rb4346
-rw-r--r--lib/csv/core_ext/array.rb9
-rw-r--r--lib/csv/core_ext/string.rb9
-rw-r--r--lib/csv/csv.gemspec64
-rw-r--r--lib/csv/delete_suffix.rb18
-rw-r--r--lib/csv/fields_converter.rb89
-rw-r--r--lib/csv/input_record_separator.rb18
-rw-r--r--lib/csv/match_p.rb20
-rw-r--r--lib/csv/parser.rb1289
-rw-r--r--lib/csv/row.rb757
-rw-r--r--lib/csv/table.rb1055
-rw-r--r--lib/csv/version.rb6
-rw-r--r--lib/csv/writer.rb210
-rw-r--r--lib/debug.rb1111
-rw-r--r--lib/delegate.rb142
-rw-r--r--lib/delegate/delegate.gemspec29
-rw-r--r--lib/did_you_mean.rb155
-rw-r--r--lib/did_you_mean/core_ext/name_error.rb57
-rw-r--r--lib/did_you_mean/did_you_mean.gemspec27
-rw-r--r--lib/did_you_mean/experimental.rb2
-rw-r--r--lib/did_you_mean/formatter.rb44
-rw-r--r--lib/did_you_mean/formatters/plain_formatter.rb4
-rw-r--r--lib/did_you_mean/formatters/verbose_formatter.rb10
-rw-r--r--lib/did_you_mean/jaro_winkler.rb87
-rw-r--r--lib/did_you_mean/levenshtein.rb57
-rw-r--r--lib/did_you_mean/spell_checker.rb46
-rw-r--r--lib/did_you_mean/spell_checkers/key_error_checker.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/method_name_checker.rb79
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/class_name_checker.rb49
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/variable_name_checker.rb85
-rw-r--r--lib/did_you_mean/spell_checkers/null_checker.rb6
-rw-r--r--lib/did_you_mean/spell_checkers/pattern_key_name_checker.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/require_path_checker.rb39
-rw-r--r--lib/did_you_mean/tree_spell_checker.rb109
-rw-r--r--lib/did_you_mean/verbose.rb2
-rw-r--r--lib/did_you_mean/version.rb3
-rw-r--r--lib/drb/acl.rb10
-rw-r--r--lib/drb/drb.gemspec43
-rw-r--r--lib/drb/drb.rb324
-rw-r--r--lib/drb/extserv.rb6
-rw-r--r--lib/drb/extservm.rb14
-rw-r--r--lib/drb/gw.rb2
-rw-r--r--lib/drb/observer.rb2
-rw-r--r--lib/drb/ssl.rb14
-rw-r--r--lib/drb/timeridconv.rb2
-rw-r--r--lib/drb/unix.rb8
-rw-r--r--lib/drb/version.rb3
-rw-r--r--lib/drb/weakidconv.rb59
-rw-r--r--lib/e2mmap.rb172
-rw-r--r--lib/erb.gemspec38
-rw-r--r--lib/erb.rb700
-rw-r--r--lib/erb/compiler.rb471
-rw-r--r--lib/erb/def_method.rb46
-rw-r--r--lib/erb/util.rb62
-rw-r--r--lib/erb/version.rb5
-rw-r--r--lib/error_highlight.rb2
-rw-r--r--lib/error_highlight/base.rb514
-rw-r--r--lib/error_highlight/core_ext.rb47
-rw-r--r--lib/error_highlight/error_highlight.gemspec27
-rw-r--r--lib/error_highlight/formatter.rb23
-rw-r--r--lib/error_highlight/version.rb3
-rw-r--r--lib/fileutils.gemspec31
-rw-r--r--lib/fileutils.rb1922
-rw-r--r--lib/find.gemspec24
-rw-r--r--lib/find.rb15
-rw-r--r--lib/forwardable.rb108
-rw-r--r--lib/forwardable/forwardable.gemspec26
-rw-r--r--lib/forwardable/impl.rb17
-rw-r--r--lib/getoptlong.rb598
-rw-r--r--lib/getoptlong/getoptlong.gemspec30
-rw-r--r--lib/ipaddr.gemspec36
-rw-r--r--lib/ipaddr.rb248
-rw-r--r--lib/irb.rb554
-rw-r--r--lib/irb/.document1
-rw-r--r--lib/irb/cmd/backtrace.rb21
-rw-r--r--lib/irb/cmd/break.rb21
-rw-r--r--lib/irb/cmd/catch.rb21
-rw-r--r--lib/irb/cmd/chws.rb20
-rw-r--r--lib/irb/cmd/continue.rb17
-rw-r--r--lib/irb/cmd/debug.rb136
-rw-r--r--lib/irb/cmd/delete.rb17
-rw-r--r--lib/irb/cmd/edit.rb61
-rw-r--r--lib/irb/cmd/finish.rb17
-rw-r--r--lib/irb/cmd/fork.rb15
-rw-r--r--lib/irb/cmd/help.rb39
-rw-r--r--lib/irb/cmd/info.rb21
-rw-r--r--lib/irb/cmd/irb_info.rb37
-rw-r--r--lib/irb/cmd/load.rb43
-rw-r--r--lib/irb/cmd/ls.rb116
-rw-r--r--lib/irb/cmd/measure.rb48
-rw-r--r--lib/irb/cmd/next.rb17
-rw-r--r--lib/irb/cmd/nop.rb42
-rw-r--r--lib/irb/cmd/pushws.rb26
-rw-r--r--lib/irb/cmd/show_cmds.rb39
-rw-r--r--lib/irb/cmd/show_source.rb112
-rw-r--r--lib/irb/cmd/step.rb17
-rw-r--r--lib/irb/cmd/subirb.rb46
-rw-r--r--lib/irb/cmd/whereami.rb25
-rw-r--r--lib/irb/color.rb266
-rw-r--r--lib/irb/color_printer.rb50
-rw-r--r--lib/irb/completion.rb411
-rw-r--r--lib/irb/context.rb290
-rw-r--r--lib/irb/easter-egg.rb138
-rw-r--r--lib/irb/ext/change-ws.rb1
-rw-r--r--lib/irb/ext/history.rb58
-rw-r--r--lib/irb/ext/loader.rb66
-rw-r--r--lib/irb/ext/math-mode.rb48
-rw-r--r--lib/irb/ext/multi-irb.rb14
-rw-r--r--lib/irb/ext/save-history.rb47
-rw-r--r--lib/irb/ext/tracer.rb16
-rw-r--r--lib/irb/ext/use-loader.rb11
-rw-r--r--lib/irb/ext/workspaces.rb1
-rw-r--r--lib/irb/extend-command.rb300
-rw-r--r--lib/irb/frame.rb19
-rw-r--r--lib/irb/help.rb3
-rw-r--r--lib/irb/init.rb241
-rw-r--r--lib/irb/input-method.rb315
-rw-r--r--lib/irb/inspector.rb20
-rw-r--r--lib/irb/irb.gemspec40
-rw-r--r--lib/irb/lc/.document4
-rw-r--r--lib/irb/lc/error.rb68
-rw-r--r--lib/irb/lc/help-message95
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb6
-rw-r--r--lib/irb/lc/ja/error.rb70
-rw-r--r--lib/irb/lc/ja/help-message30
-rw-r--r--lib/irb/locale.rb19
-rw-r--r--lib/irb/magic-file.rb2
-rw-r--r--lib/irb/notifier.rb28
-rw-r--r--lib/irb/output-method.rb14
-rw-r--r--lib/irb/ruby-lex.rb1651
-rw-r--r--lib/irb/ruby-token.rb267
-rw-r--r--lib/irb/ruby_logo.aa37
-rw-r--r--lib/irb/slex.rb282
-rw-r--r--lib/irb/src_encoding.rb6
-rw-r--r--lib/irb/version.rb5
-rw-r--r--lib/irb/workspace.rb103
-rw-r--r--lib/irb/xmp.rb4
-rw-r--r--lib/logger.rb1118
-rw-r--r--lib/logger/errors.rb9
-rw-r--r--lib/logger/formatter.rb36
-rw-r--r--lib/logger/log_device.rb207
-rw-r--r--lib/logger/logger.gemspec26
-rw-r--r--lib/logger/period.rb47
-rw-r--r--lib/logger/severity.rb19
-rw-r--r--lib/logger/version.rb5
-rw-r--r--lib/mathn.rb170
-rw-r--r--lib/matrix.rb2172
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb883
-rw-r--r--lib/matrix/lup_decomposition.rb219
-rw-r--r--lib/mkmf.rb390
-rw-r--r--lib/monitor.rb303
-rw-r--r--lib/mutex_m.gemspec27
-rw-r--r--lib/mutex_m.rb26
-rw-r--r--lib/net/ftp.rb1328
-rw-r--r--lib/net/http.rb2308
-rw-r--r--lib/net/http/backward.rb40
-rw-r--r--lib/net/http/exceptions.rb54
-rw-r--r--lib/net/http/generic_request.rb126
-rw-r--r--lib/net/http/header.rb821
-rw-r--r--lib/net/http/net-http.gemspec39
-rw-r--r--lib/net/http/proxy_delta.rb2
-rw-r--r--lib/net/http/request.rb79
-rw-r--r--lib/net/http/requests.rb352
-rw-r--r--lib/net/http/response.rb387
-rw-r--r--lib/net/http/responses.rb1314
-rw-r--r--lib/net/http/status.rb84
-rw-r--r--lib/net/https.rb4
-rw-r--r--lib/net/imap.rb3647
-rw-r--r--lib/net/net-protocol.gemspec33
-rw-r--r--lib/net/pop.rb1022
-rw-r--r--lib/net/protocol.rb210
-rw-r--r--lib/net/smtp.rb1080
-rw-r--r--lib/observer.rb31
-rw-r--r--lib/observer/observer.gemspec32
-rw-r--r--lib/open-uri.gemspec25
-rw-r--r--lib/open-uri.rb92
-rw-r--r--lib/open3.rb147
-rw-r--r--lib/open3/open3.gemspec33
-rw-r--r--lib/open3/version.rb3
-rw-r--r--lib/optparse.rb478
-rw-r--r--lib/optparse/ac.rb9
-rw-r--r--lib/optparse/date.rb2
-rw-r--r--lib/optparse/kwargs.rb22
-rw-r--r--lib/optparse/optparse.gemspec30
-rw-r--r--lib/optparse/shellwords.rb2
-rw-r--r--lib/optparse/time.rb2
-rw-r--r--lib/optparse/uri.rb2
-rw-r--r--lib/ostruct.rb453
-rw-r--r--lib/ostruct/ostruct.gemspec27
-rw-r--r--lib/pp.gemspec27
-rw-r--r--lib/pp.rb205
-rw-r--r--lib/prettyprint.gemspec22
-rw-r--r--lib/prettyprint.rb6
-rw-r--r--lib/prime.rb467
-rw-r--r--lib/profile.rb11
-rw-r--r--lib/profiler.rb149
-rw-r--r--lib/pstore.rb599
-rw-r--r--lib/pstore/pstore.gemspec32
-rw-r--r--lib/racc.rb6
-rw-r--r--lib/racc/compat.rb33
-rw-r--r--lib/racc/debugflags.rb60
-rw-r--r--lib/racc/exception.rb16
-rw-r--r--lib/racc/grammar.rb1118
-rw-r--r--lib/racc/grammarfileparser.rb561
-rw-r--r--lib/racc/info.rb17
-rw-r--r--lib/racc/iset.rb92
-rw-r--r--lib/racc/logfilegenerator.rb212
-rw-r--r--lib/racc/parser-text.rb637
-rw-r--r--lib/racc/parser.rb85
-rw-r--r--lib/racc/parserfilegenerator.rb468
-rw-r--r--lib/racc/racc.gemspec58
-rw-r--r--lib/racc/rdoc/grammar.en.rdoc219
-rw-r--r--lib/racc/sourcetext.rb35
-rw-r--r--lib/racc/state.rb972
-rw-r--r--lib/racc/statetransitiontable.rb311
-rw-r--r--lib/racc/static.rb5
-rw-r--r--lib/random/formatter.rb245
-rw-r--r--lib/rbconfig/.document1
-rw-r--r--lib/rbconfig/datadir.rb14
-rw-r--r--lib/rdoc.rb120
-rw-r--r--lib/rdoc/.document2
-rw-r--r--lib/rdoc/alias.rb2
-rw-r--r--lib/rdoc/anon_class.rb2
-rw-r--r--lib/rdoc/any_method.rb75
-rw-r--r--lib/rdoc/attr.rb2
-rw-r--r--lib/rdoc/class_module.rb8
-rw-r--r--lib/rdoc/code_object.rb11
-rw-r--r--lib/rdoc/code_objects.rb5
-rw-r--r--lib/rdoc/comment.rb43
-rw-r--r--lib/rdoc/constant.rb6
-rw-r--r--lib/rdoc/context.rb102
-rw-r--r--lib/rdoc/context/section.rb17
-rw-r--r--lib/rdoc/cross_reference.rb110
-rw-r--r--lib/rdoc/encoding.rb88
-rw-r--r--lib/rdoc/erb_partial.rb4
-rw-r--r--lib/rdoc/erbio.rb12
-rw-r--r--lib/rdoc/extend.rb2
-rw-r--r--lib/rdoc/generator.rb13
-rw-r--r--lib/rdoc/generator/darkfish.rb93
-rw-r--r--lib/rdoc/generator/json_index.rb11
-rw-r--r--lib/rdoc/generator/markup.rb18
-rw-r--r--lib/rdoc/generator/pot.rb8
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb2
-rw-r--r--lib/rdoc/generator/pot/po.rb6
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb22
-rw-r--r--lib/rdoc/generator/ri.rb2
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml4
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml24
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml4
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml32
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml4
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml10
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml32
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml10
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml8
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml33
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml116
-rw-r--r--lib/rdoc/generator/template/darkfish/css/rdoc.css84
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Bold.ttfbin71200 -> 138268 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Regular.ttfbin71692 -> 138680 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js123
-rw-r--r--lib/rdoc/generator/template/darkfish/js/jquery.js4
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js65
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml31
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml36
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js45
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js12
-rw-r--r--lib/rdoc/ghost_method.rb2
-rw-r--r--lib/rdoc/i18n.rb8
-rw-r--r--lib/rdoc/i18n/locale.rb4
-rw-r--r--lib/rdoc/i18n/text.rb10
-rw-r--r--lib/rdoc/include.rb2
-rw-r--r--lib/rdoc/known_classes.rb11
-rw-r--r--lib/rdoc/markdown.rb2098
-rw-r--r--lib/rdoc/markdown/entities.rb2
-rw-r--r--lib/rdoc/markdown/literals.rb124
-rw-r--r--lib/rdoc/markup.rb727
-rw-r--r--lib/rdoc/markup/attr_changer.rb2
-rw-r--r--lib/rdoc/markup/attr_span.rb12
-rw-r--r--lib/rdoc/markup/attribute_manager.rb167
-rw-r--r--lib/rdoc/markup/attributes.rb14
-rw-r--r--lib/rdoc/markup/blank_line.rb2
-rw-r--r--lib/rdoc/markup/block_quote.rb2
-rw-r--r--lib/rdoc/markup/document.rb2
-rw-r--r--lib/rdoc/markup/formatter.rb49
-rw-r--r--lib/rdoc/markup/formatter_test_case.rb764
-rw-r--r--lib/rdoc/markup/hard_break.rb2
-rw-r--r--lib/rdoc/markup/heading.rb8
-rw-r--r--lib/rdoc/markup/include.rb2
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb2
-rw-r--r--lib/rdoc/markup/inline.rb2
-rw-r--r--lib/rdoc/markup/list.rb2
-rw-r--r--lib/rdoc/markup/list_item.rb2
-rw-r--r--lib/rdoc/markup/paragraph.rb2
-rw-r--r--lib/rdoc/markup/parser.rb132
-rw-r--r--lib/rdoc/markup/pre_process.rb24
-rw-r--r--lib/rdoc/markup/raw.rb2
-rw-r--r--lib/rdoc/markup/regexp_handling.rb41
-rw-r--r--lib/rdoc/markup/rule.rb2
-rw-r--r--lib/rdoc/markup/special.rb41
-rw-r--r--lib/rdoc/markup/table.rb47
-rw-r--r--lib/rdoc/markup/text_formatter_test_case.rb115
-rw-r--r--lib/rdoc/markup/to_ansi.rb2
-rw-r--r--lib/rdoc/markup/to_bs.rb10
-rw-r--r--lib/rdoc/markup/to_html.rb121
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb67
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb20
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb39
-rw-r--r--lib/rdoc/markup/to_label.rb22
-rw-r--r--lib/rdoc/markup/to_markdown.rb18
-rw-r--r--lib/rdoc/markup/to_rdoc.rb65
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb3
-rw-r--r--lib/rdoc/markup/to_test.rb2
-rw-r--r--lib/rdoc/markup/to_tt_only.rb6
-rw-r--r--lib/rdoc/markup/verbatim.rb2
-rw-r--r--lib/rdoc/meta_method.rb2
-rw-r--r--lib/rdoc/method_attr.rb6
-rw-r--r--lib/rdoc/mixin.rb2
-rw-r--r--lib/rdoc/normal_class.rb8
-rw-r--r--lib/rdoc/normal_module.rb4
-rw-r--r--lib/rdoc/options.rb189
-rw-r--r--lib/rdoc/parser.rb89
-rw-r--r--lib/rdoc/parser/c.rb395
-rw-r--r--lib/rdoc/parser/changelog.rb169
-rw-r--r--lib/rdoc/parser/markdown.rb2
-rw-r--r--lib/rdoc/parser/rd.rb2
-rw-r--r--lib/rdoc/parser/ripper_state_lex.rb590
-rw-r--r--lib/rdoc/parser/ruby.rb1132
-rw-r--r--lib/rdoc/parser/ruby_tools.rb67
-rw-r--r--lib/rdoc/parser/simple.rb6
-rw-r--r--lib/rdoc/parser/text.rb2
-rw-r--r--lib/rdoc/rd.rb9
-rw-r--r--lib/rdoc/rd/block_parser.rb117
-rw-r--r--lib/rdoc/rd/inline.rb10
-rw-r--r--lib/rdoc/rd/inline_parser.rb275
-rw-r--r--lib/rdoc/rdoc.gemspec242
-rw-r--r--lib/rdoc/rdoc.rb135
-rw-r--r--lib/rdoc/require.rb2
-rw-r--r--lib/rdoc/ri.rb11
-rw-r--r--lib/rdoc/ri/driver.rb274
-rw-r--r--lib/rdoc/ri/formatter.rb2
-rw-r--r--lib/rdoc/ri/paths.rb22
-rw-r--r--lib/rdoc/ri/store.rb2
-rw-r--r--lib/rdoc/ri/task.rb4
-rw-r--r--lib/rdoc/ruby_lex.rb1371
-rw-r--r--lib/rdoc/ruby_token.rb461
-rw-r--r--lib/rdoc/rubygems_hook.rb22
-rw-r--r--lib/rdoc/servlet.rb35
-rw-r--r--lib/rdoc/single_class.rb7
-rw-r--r--lib/rdoc/stats.rb9
-rw-r--r--lib/rdoc/stats/normal.rb42
-rw-r--r--lib/rdoc/stats/quiet.rb2
-rw-r--r--lib/rdoc/stats/verbose.rb2
-rw-r--r--lib/rdoc/store.rb109
-rw-r--r--lib/rdoc/task.rb10
-rw-r--r--lib/rdoc/test_case.rb204
-rw-r--r--lib/rdoc/text.rb53
-rw-r--r--lib/rdoc/token_stream.rb89
-rw-r--r--lib/rdoc/tom_doc.rb29
-rw-r--r--lib/rdoc/top_level.rb12
-rw-r--r--lib/rdoc/version.rb10
-rw-r--r--lib/readline.gemspec33
-rw-r--r--lib/readline.rb7
-rw-r--r--lib/reline.rb600
-rw-r--r--lib/reline/ansi.rb350
-rw-r--r--lib/reline/config.rb401
-rw-r--r--lib/reline/general_io.rb109
-rw-r--r--lib/reline/history.rb76
-rw-r--r--lib/reline/key_actor.rb7
-rw-r--r--lib/reline/key_actor/base.rb19
-rw-r--r--lib/reline/key_actor/emacs.rb517
-rw-r--r--lib/reline/key_actor/vi_command.rb518
-rw-r--r--lib/reline/key_actor/vi_insert.rb517
-rw-r--r--lib/reline/key_stroke.rb105
-rw-r--r--lib/reline/kill_ring.rb125
-rw-r--r--lib/reline/line_editor.rb3357
-rw-r--r--lib/reline/reline.gemspec25
-rw-r--r--lib/reline/terminfo.rb174
-rw-r--r--lib/reline/unicode.rb665
-rw-r--r--lib/reline/unicode/east_asian_width.rb1164
-rw-r--r--lib/reline/version.rb3
-rw-r--r--lib/reline/windows.rb497
-rw-r--r--lib/resolv-replace.gemspec22
-rw-r--r--lib/resolv.gemspec22
-rw-r--r--lib/resolv.rb243
-rw-r--r--lib/rexml/attlistdecl.rb63
-rw-r--r--lib/rexml/attribute.rb192
-rw-r--r--lib/rexml/cdata.rb68
-rw-r--r--lib/rexml/child.rb97
-rw-r--r--lib/rexml/comment.rb80
-rw-r--r--lib/rexml/doctype.rb270
-rw-r--r--lib/rexml/document.rb291
-rw-r--r--lib/rexml/dtd/attlistdecl.rb11
-rw-r--r--lib/rexml/dtd/dtd.rb47
-rw-r--r--lib/rexml/dtd/elementdecl.rb18
-rw-r--r--lib/rexml/dtd/entitydecl.rb57
-rw-r--r--lib/rexml/dtd/notationdecl.rb40
-rw-r--r--lib/rexml/element.rb1241
-rw-r--r--lib/rexml/encoding.rb51
-rw-r--r--lib/rexml/entity.rb174
-rw-r--r--lib/rexml/formatters/default.rb112
-rw-r--r--lib/rexml/formatters/pretty.rb142
-rw-r--r--lib/rexml/formatters/transitive.rb58
-rw-r--r--lib/rexml/functions.rb395
-rw-r--r--lib/rexml/instruction.rb71
-rw-r--r--lib/rexml/light/node.rb196
-rw-r--r--lib/rexml/namespace.rb48
-rw-r--r--lib/rexml/node.rb76
-rw-r--r--lib/rexml/output.rb30
-rw-r--r--lib/rexml/parent.rb166
-rw-r--r--lib/rexml/parseexception.rb52
-rw-r--r--lib/rexml/parsers/baseparser.rb533
-rw-r--r--lib/rexml/parsers/lightparser.rb59
-rw-r--r--lib/rexml/parsers/pullparser.rb197
-rw-r--r--lib/rexml/parsers/sax2parser.rb273
-rw-r--r--lib/rexml/parsers/streamparser.rb53
-rw-r--r--lib/rexml/parsers/treeparser.rb101
-rw-r--r--lib/rexml/parsers/ultralightparser.rb57
-rw-r--r--lib/rexml/parsers/xpathparser.rb657
-rw-r--r--lib/rexml/quickpath.rb266
-rw-r--r--lib/rexml/rexml.rb32
-rw-r--r--lib/rexml/sax2listener.rb98
-rw-r--r--lib/rexml/security.rb28
-rw-r--r--lib/rexml/source.rb297
-rw-r--r--lib/rexml/streamlistener.rb93
-rw-r--r--lib/rexml/syncenumerator.rb33
-rw-r--r--lib/rexml/text.rb426
-rw-r--r--lib/rexml/undefinednamespaceexception.rb9
-rw-r--r--lib/rexml/validation/relaxng.rb539
-rw-r--r--lib/rexml/validation/validation.rb144
-rw-r--r--lib/rexml/validation/validationexception.rb10
-rw-r--r--lib/rexml/xmldecl.rb116
-rw-r--r--lib/rexml/xmltokens.rb85
-rw-r--r--lib/rexml/xpath.rb81
-rw-r--r--lib/rexml/xpath_parser.rb704
-rw-r--r--lib/rinda/rinda.gemspec28
-rw-r--r--lib/rinda/rinda.rb1
-rw-r--r--lib/rinda/ring.rb9
-rw-r--r--lib/rinda/tuplespace.rb3
-rw-r--r--lib/rss.rb92
-rw-r--r--lib/rss/0.9.rb462
-rw-r--r--lib/rss/1.0.rb485
-rw-r--r--lib/rss/2.0.rb143
-rw-r--r--lib/rss/atom.rb840
-rw-r--r--lib/rss/content.rb34
-rw-r--r--lib/rss/content/1.0.rb10
-rw-r--r--lib/rss/content/2.0.rb12
-rw-r--r--lib/rss/converter.rb171
-rw-r--r--lib/rss/dublincore.rb164
-rw-r--r--lib/rss/dublincore/1.0.rb13
-rw-r--r--lib/rss/dublincore/2.0.rb13
-rw-r--r--lib/rss/dublincore/atom.rb17
-rw-r--r--lib/rss/image.rb198
-rw-r--r--lib/rss/itunes.rb413
-rw-r--r--lib/rss/maker.rb79
-rw-r--r--lib/rss/maker/0.9.rb509
-rw-r--r--lib/rss/maker/1.0.rb436
-rw-r--r--lib/rss/maker/2.0.rb224
-rw-r--r--lib/rss/maker/atom.rb173
-rw-r--r--lib/rss/maker/base.rb945
-rw-r--r--lib/rss/maker/content.rb22
-rw-r--r--lib/rss/maker/dublincore.rb122
-rw-r--r--lib/rss/maker/entry.rb164
-rw-r--r--lib/rss/maker/feed.rb427
-rw-r--r--lib/rss/maker/image.rb112
-rw-r--r--lib/rss/maker/itunes.rb243
-rw-r--r--lib/rss/maker/slash.rb34
-rw-r--r--lib/rss/maker/syndication.rb19
-rw-r--r--lib/rss/maker/taxonomy.rb119
-rw-r--r--lib/rss/maker/trackback.rb62
-rw-r--r--lib/rss/parser.rb571
-rw-r--r--lib/rss/rexmlparser.rb50
-rw-r--r--lib/rss/rss.rb1353
-rw-r--r--lib/rss/slash.rb52
-rw-r--r--lib/rss/syndication.rb69
-rw-r--r--lib/rss/taxonomy.rb148
-rw-r--r--lib/rss/trackback.rb291
-rw-r--r--lib/rss/utils.rb200
-rw-r--r--lib/rss/xml-stylesheet.rb106
-rw-r--r--lib/rss/xml.rb72
-rw-r--r--lib/rss/xmlparser.rb95
-rw-r--r--lib/rss/xmlscanner.rb122
-rw-r--r--lib/ruby2_keywords.gemspec23
-rw-r--r--lib/ruby_vm/mjit/c_pointer.rb329
-rw-r--r--lib/ruby_vm/mjit/c_type.rb91
-rw-r--r--lib/ruby_vm/mjit/compiler.rb952
-rw-r--r--lib/ruby_vm/mjit/hooks.rb32
-rw-r--r--lib/rubygems.rb744
-rw-r--r--lib/rubygems/LICENSE.txt54
-rw-r--r--lib/rubygems/available_set.rb18
-rw-r--r--lib/rubygems/basic_specification.rb90
-rw-r--r--lib/rubygems/bundler_version_finder.rb77
-rw-r--r--lib/rubygems/command.rb196
-rw-r--r--lib/rubygems/command_manager.rb84
-rw-r--r--lib/rubygems/commands/build_command.rb105
-rw-r--r--lib/rubygems/commands/cert_command.rb207
-rw-r--r--lib/rubygems/commands/check_command.rb45
-rw-r--r--lib/rubygems/commands/cleanup_command.rb91
-rw-r--r--lib/rubygems/commands/contents_command.rb64
-rw-r--r--lib/rubygems/commands/dependency_command.rb112
-rw-r--r--lib/rubygems/commands/environment_command.rb44
-rw-r--r--lib/rubygems/commands/exec_command.rb249
-rw-r--r--lib/rubygems/commands/fetch_command.rb55
-rw-r--r--lib/rubygems/commands/generate_index_command.rb41
-rw-r--r--lib/rubygems/commands/help_command.rb36
-rw-r--r--lib/rubygems/commands/info_command.rb38
-rw-r--r--lib/rubygems/commands/install_command.rb152
-rw-r--r--lib/rubygems/commands/list_command.rb19
-rw-r--r--lib/rubygems/commands/lock_command.rb24
-rw-r--r--lib/rubygems/commands/mirror_command.rb8
-rw-r--r--lib/rubygems/commands/open_command.rb50
-rw-r--r--lib/rubygems/commands/outdated_command.rb12
-rw-r--r--lib/rubygems/commands/owner_command.rb69
-rw-r--r--lib/rubygems/commands/pristine_command.rb162
-rw-r--r--lib/rubygems/commands/push_command.rb97
-rw-r--r--lib/rubygems/commands/query_command.rb359
-rw-r--r--lib/rubygems/commands/rdoc_command.rb62
-rw-r--r--lib/rubygems/commands/search_command.rb18
-rw-r--r--lib/rubygems/commands/server_command.rb91
-rw-r--r--lib/rubygems/commands/setup_command.rb557
-rw-r--r--lib/rubygems/commands/signin_command.rb34
-rw-r--r--lib/rubygems/commands/signout_command.rb32
-rw-r--r--lib/rubygems/commands/sources_command.rb86
-rw-r--r--lib/rubygems/commands/specification_command.rb60
-rw-r--r--lib/rubygems/commands/stale_command.rb7
-rw-r--r--lib/rubygems/commands/uninstall_command.rb154
-rw-r--r--lib/rubygems/commands/unpack_command.rb91
-rw-r--r--lib/rubygems/commands/update_command.rb246
-rw-r--r--lib/rubygems/commands/which_command.rb29
-rw-r--r--lib/rubygems/commands/yank_command.rb56
-rw-r--r--lib/rubygems/compatibility.rb34
-rw-r--r--lib/rubygems/config_file.rb256
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb20
-rw-r--r--[-rwxr-xr-x]lib/rubygems/core_ext/kernel_require.rb208
-rw-r--r--lib/rubygems/core_ext/kernel_warn.rb50
-rw-r--r--lib/rubygems/core_ext/tcpsocket_init.rb54
-rw-r--r--lib/rubygems/defaults.rb210
-rw-r--r--lib/rubygems/dependency.rb98
-rw-r--r--lib/rubygems/dependency_installer.rb275
-rw-r--r--lib/rubygems/dependency_list.rb65
-rw-r--r--lib/rubygems/deprecate.rb124
-rw-r--r--lib/rubygems/doctor.rb56
-rw-r--r--lib/rubygems/errors.rb24
-rw-r--r--lib/rubygems/exceptions.rb97
-rw-r--r--lib/rubygems/ext.rb15
-rw-r--r--lib/rubygems/ext/build_error.rb4
-rw-r--r--lib/rubygems/ext/builder.rb166
-rw-r--r--lib/rubygems/ext/cargo_builder.rb360
-rw-r--r--lib/rubygems/ext/cargo_builder/link_flag_converter.rb27
-rw-r--r--lib/rubygems/ext/cmake_builder.rb13
-rw-r--r--lib/rubygems/ext/configure_builder.rb15
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb101
-rw-r--r--lib/rubygems/ext/rake_builder.rb39
-rw-r--r--lib/rubygems/gem_runner.rb42
-rw-r--r--lib/rubygems/gemcutter_utilities.rb284
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_listener.rb105
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_listener/response.rb163
-rw-r--r--lib/rubygems/gemcutter_utilities/webauthn_poller.rb78
-rw-r--r--lib/rubygems/indexer.rb102
-rw-r--r--lib/rubygems/install_default_message.rb6
-rw-r--r--lib/rubygems/install_message.rb6
-rw-r--r--lib/rubygems/install_update_options.rb193
-rw-r--r--lib/rubygems/installer.rb548
-rw-r--r--lib/rubygems/installer_test_case.rb196
-rw-r--r--lib/rubygems/installer_uninstaller_utils.rb29
-rw-r--r--lib/rubygems/local_remote_options.rb54
-rw-r--r--lib/rubygems/mock_gem_ui.rb15
-rw-r--r--lib/rubygems/name_tuple.rb33
-rw-r--r--lib/rubygems/openssl.rb7
-rw-r--r--lib/rubygems/optparse.rb3
-rw-r--r--lib/rubygems/optparse/.document1
-rw-r--r--lib/rubygems/optparse/lib/optionparser.rb2
-rw-r--r--lib/rubygems/optparse/lib/optparse.rb2308
-rw-r--r--lib/rubygems/optparse/lib/optparse/ac.rb54
-rw-r--r--lib/rubygems/optparse/lib/optparse/date.rb18
-rw-r--r--lib/rubygems/optparse/lib/optparse/kwargs.rb22
-rw-r--r--lib/rubygems/optparse/lib/optparse/shellwords.rb7
-rw-r--r--lib/rubygems/optparse/lib/optparse/time.rb11
-rw-r--r--lib/rubygems/optparse/lib/optparse/uri.rb7
-rw-r--r--lib/rubygems/optparse/lib/optparse/version.rb71
-rw-r--r--lib/rubygems/package.rb359
-rw-r--r--lib/rubygems/package/digest_io.rb10
-rw-r--r--lib/rubygems/package/file_source.rb14
-rw-r--r--lib/rubygems/package/io_source.rb10
-rw-r--r--lib/rubygems/package/old.rb45
-rw-r--r--lib/rubygems/package/source.rb2
-rw-r--r--lib/rubygems/package/tar_header.rb157
-rw-r--r--lib/rubygems/package/tar_reader.rb34
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb119
-rw-r--r--lib/rubygems/package/tar_test_case.rb147
-rw-r--r--lib/rubygems/package/tar_writer.rb60
-rw-r--r--lib/rubygems/package_task.rb18
-rw-r--r--lib/rubygems/path_support.rb28
-rw-r--r--lib/rubygems/platform.rb188
-rw-r--r--lib/rubygems/psych_additions.rb10
-rw-r--r--lib/rubygems/psych_tree.rb5
-rw-r--r--lib/rubygems/query_utils.rb351
-rw-r--r--lib/rubygems/rdoc.rb330
-rw-r--r--lib/rubygems/remote_fetcher.rb234
-rw-r--r--lib/rubygems/request.rb127
-rw-r--r--lib/rubygems/request/connection_pools.rb53
-rw-r--r--lib/rubygems/request/http_pool.rb13
-rw-r--r--lib/rubygems/request/https_pool.rb5
-rw-r--r--lib/rubygems/request_set.rb185
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb343
-rw-r--r--lib/rubygems/request_set/lockfile.rb66
-rw-r--r--lib/rubygems/request_set/lockfile/parser.rb88
-rw-r--r--lib/rubygems/request_set/lockfile/tokenizer.rb28
-rw-r--r--lib/rubygems/requirement.rb133
-rw-r--r--lib/rubygems/resolver.rb180
-rw-r--r--lib/rubygems/resolver/activation_request.rb89
-rw-r--r--lib/rubygems/resolver/api_set.rb69
-rw-r--r--lib/rubygems/resolver/api_set/gem_parser.rb20
-rw-r--r--lib/rubygems/resolver/api_specification.rb55
-rw-r--r--lib/rubygems/resolver/best_set.rb32
-rw-r--r--lib/rubygems/resolver/composed_set.rb20
-rw-r--r--lib/rubygems/resolver/conflict.rb42
-rw-r--r--lib/rubygems/resolver/current_set.rb6
-rw-r--r--lib/rubygems/resolver/dependency_request.rb17
-rw-r--r--lib/rubygems/resolver/git_set.rb18
-rw-r--r--lib/rubygems/resolver/git_specification.rb24
-rw-r--r--lib/rubygems/resolver/index_set.rb22
-rw-r--r--lib/rubygems/resolver/index_specification.rb53
-rw-r--r--lib/rubygems/resolver/installed_specification.rb18
-rw-r--r--lib/rubygems/resolver/installer_set.rb131
-rw-r--r--lib/rubygems/resolver/local_specification.rb10
-rw-r--r--lib/rubygems/resolver/lock_set.rb28
-rw-r--r--lib/rubygems/resolver/lock_specification.rb28
-rw-r--r--lib/rubygems/resolver/molinillo.rb3
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo.rb11
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/resolution_state.rb7
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/specification_provider.rb8
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph.rb78
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/action.rb3
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb18
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_vertex.rb7
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb16
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/log.rb24
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/set_payload.rb7
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/tag.rb11
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/vertex.rb67
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/errors.rb90
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/gem_metadata.rb3
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/specification_provider.rb14
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/ui.rb4
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolution.rb667
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolver.rb5
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/state.rb12
-rw-r--r--lib/rubygems/resolver/requirement_list.rb4
-rw-r--r--lib/rubygems/resolver/set.rb8
-rw-r--r--lib/rubygems/resolver/source_set.rb13
-rw-r--r--lib/rubygems/resolver/spec_specification.rb20
-rw-r--r--lib/rubygems/resolver/specification.rb35
-rw-r--r--lib/rubygems/resolver/stats.rb1
-rw-r--r--lib/rubygems/resolver/vendor_set.rb14
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb14
-rw-r--r--lib/rubygems/s3_uri_signer.rb177
-rw-r--r--lib/rubygems/safe_yaml.rb59
-rw-r--r--lib/rubygems/security.rb189
-rw-r--r--lib/rubygems/security/policies.rb98
-rw-r--r--lib/rubygems/security/policy.rb91
-rw-r--r--lib/rubygems/security/signer.rb107
-rw-r--r--lib/rubygems/security/trust_dir.rb30
-rw-r--r--lib/rubygems/security_option.rb43
-rw-r--r--lib/rubygems/server.rb867
-rw-r--r--lib/rubygems/shellwords.rb3
-rw-r--r--lib/rubygems/source.rb126
-rw-r--r--lib/rubygems/source/git.rb80
-rw-r--r--lib/rubygems/source/installed.rb12
-rw-r--r--lib/rubygems/source/local.rb92
-rw-r--r--lib/rubygems/source/lock.rb16
-rw-r--r--lib/rubygems/source/specific_file.rb15
-rw-r--r--lib/rubygems/source/vendor.rb8
-rw-r--r--lib/rubygems/source_list.rb26
-rw-r--r--lib/rubygems/source_local.rb6
-rw-r--r--lib/rubygems/source_specific_file.rb5
-rw-r--r--lib/rubygems/spec_fetcher.rb120
-rw-r--r--lib/rubygems/specification.rb1844
-rw-r--r--lib/rubygems/specification_policy.rb507
-rw-r--r--lib/rubygems/ssl_certs/rubygems.global.ssl.fastly.net/DigiCertHighAssuranceEVRootCA.pem23
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/AddTrustExternalCARoot.pem25
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA.pem (renamed from lib/rubygems/ssl_certs/index.rubygems.org/GlobalSignRootCA.pem)0
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA_R3.pem21
-rw-r--r--lib/rubygems/stub_specification.rb81
-rw-r--r--lib/rubygems/syck_hack.rb77
-rw-r--r--lib/rubygems/test_case.rb1516
-rw-r--r--lib/rubygems/test_utilities.rb384
-rw-r--r--lib/rubygems/text.rb67
-rw-r--r--lib/rubygems/tsort.rb3
-rw-r--r--lib/rubygems/tsort/.document1
-rw-r--r--lib/rubygems/tsort/lib/tsort.rb452
-rw-r--r--lib/rubygems/uninstaller.rb229
-rw-r--r--lib/rubygems/unknown_command_spell_checker.rb21
-rw-r--r--lib/rubygems/update_suggestion.rb69
-rw-r--r--lib/rubygems/uri.rb126
-rw-r--r--lib/rubygems/uri_formatter.rb9
-rw-r--r--lib/rubygems/user_interaction.rb230
-rw-r--r--lib/rubygems/util.rb127
-rw-r--r--lib/rubygems/util/licenses.rb830
-rw-r--r--lib/rubygems/util/list.rb3
-rw-r--r--lib/rubygems/validator.rb66
-rw-r--r--lib/rubygems/version.rb131
-rw-r--r--lib/rubygems/version_option.rb29
-rw-r--r--lib/scanf.rb776
-rw-r--r--lib/securerandom.gemspec22
-rw-r--r--lib/securerandom.rb246
-rw-r--r--lib/set.rb742
-rw-r--r--lib/set/set.gemspec23
-rw-r--r--lib/set/sorted_set.rb6
-rw-r--r--lib/shell.rb457
-rw-r--r--lib/shell/builtin-command.rb147
-rw-r--r--lib/shell/command-processor.rb668
-rw-r--r--lib/shell/error.rb26
-rw-r--r--lib/shell/filter.rb138
-rw-r--r--lib/shell/process-controller.rb311
-rw-r--r--lib/shell/system-command.rb159
-rw-r--r--lib/shell/version.rb16
-rw-r--r--lib/shellwords.gemspec22
-rw-r--r--lib/shellwords.rb55
-rw-r--r--lib/singleton.rb34
-rw-r--r--lib/singleton/singleton.gemspec30
-rw-r--r--lib/sync.rb329
-rw-r--r--lib/syntax_suggest.rb3
-rw-r--r--lib/syntax_suggest/api.rb201
-rw-r--r--lib/syntax_suggest/around_block_scan.rb232
-rw-r--r--lib/syntax_suggest/block_expand.rb165
-rw-r--r--lib/syntax_suggest/capture/before_after_keyword_ends.rb85
-rw-r--r--lib/syntax_suggest/capture/falling_indent_lines.rb71
-rw-r--r--lib/syntax_suggest/capture_code_context.rb245
-rw-r--r--lib/syntax_suggest/clean_document.rb306
-rw-r--r--lib/syntax_suggest/cli.rb130
-rw-r--r--lib/syntax_suggest/code_block.rb100
-rw-r--r--lib/syntax_suggest/code_frontier.rb178
-rw-r--r--lib/syntax_suggest/code_line.rb237
-rw-r--r--lib/syntax_suggest/code_search.rb139
-rw-r--r--lib/syntax_suggest/core_ext.rb114
-rw-r--r--lib/syntax_suggest/display_code_with_line_numbers.rb70
-rw-r--r--lib/syntax_suggest/display_invalid_blocks.rb83
-rw-r--r--lib/syntax_suggest/explain_syntax.rb103
-rw-r--r--lib/syntax_suggest/left_right_lex_count.rb168
-rw-r--r--lib/syntax_suggest/lex_all.rb55
-rw-r--r--lib/syntax_suggest/lex_value.rb70
-rw-r--r--lib/syntax_suggest/parse_blocks_from_indent_line.rb60
-rw-r--r--lib/syntax_suggest/pathname_from_message.rb59
-rw-r--r--lib/syntax_suggest/priority_engulf_queue.rb63
-rw-r--r--lib/syntax_suggest/priority_queue.rb105
-rw-r--r--lib/syntax_suggest/ripper_errors.rb36
-rw-r--r--lib/syntax_suggest/scan_history.rb134
-rw-r--r--lib/syntax_suggest/syntax_suggest.gemspec32
-rw-r--r--lib/syntax_suggest/unvisited_lines.rb36
-rw-r--r--lib/syntax_suggest/version.rb5
-rw-r--r--lib/tempfile.gemspec22
-rw-r--r--lib/tempfile.rb236
-rw-r--r--lib/thwait.rb141
-rw-r--r--lib/time.gemspec24
-rw-r--r--lib/time.rb308
-rw-r--r--lib/timeout.rb179
-rw-r--r--lib/timeout/timeout.gemspec30
-rw-r--r--lib/tmpdir.gemspec26
-rw-r--r--lib/tmpdir.rb100
-rw-r--r--lib/tracer.rb287
-rw-r--r--lib/tsort.gemspec22
-rw-r--r--lib/tsort.rb20
-rw-r--r--lib/ubygems.rb11
-rw-r--r--lib/un.gemspec24
-rw-r--r--lib/un.rb94
-rw-r--r--lib/unicode_normalize.rb79
-rw-r--r--lib/unicode_normalize/normalize.rb22
-rw-r--r--lib/unicode_normalize/tables.rb10332
-rw-r--r--lib/uri.rb74
-rw-r--r--lib/uri/common.rb302
-rw-r--r--lib/uri/file.rb100
-rw-r--r--lib/uri/ftp.rb68
-rw-r--r--lib/uri/generic.rb530
-rw-r--r--lib/uri/http.rb100
-rw-r--r--lib/uri/https.rb6
-rw-r--r--lib/uri/ldap.rb84
-rw-r--r--lib/uri/ldaps.rb5
-rw-r--r--lib/uri/mailto.rb65
-rw-r--r--lib/uri/rfc2396_parser.rb83
-rw-r--r--lib/uri/rfc3986_parser.rb34
-rw-r--r--lib/uri/uri.gemspec31
-rw-r--r--lib/uri/version.rb6
-rw-r--r--lib/uri/ws.rb83
-rw-r--r--lib/uri/wss.rb23
-rw-r--r--lib/weakref.rb53
-rw-r--r--lib/weakref/weakref.gemspec34
-rw-r--r--lib/webrick.rb227
-rw-r--r--lib/webrick/accesslog.rb159
-rw-r--r--lib/webrick/cgi.rb309
-rw-r--r--lib/webrick/config.rb152
-rw-r--r--lib/webrick/cookie.rb172
-rw-r--r--lib/webrick/httpauth.rb96
-rw-r--r--lib/webrick/httpauth/authenticator.rb117
-rw-r--r--lib/webrick/httpauth/basicauth.rb108
-rw-r--r--lib/webrick/httpauth/digestauth.rb408
-rw-r--r--lib/webrick/httpauth/htdigest.rb132
-rw-r--r--lib/webrick/httpauth/htgroup.rb94
-rw-r--r--lib/webrick/httpauth/htpasswd.rb125
-rw-r--r--lib/webrick/httpproxy.rb338
-rw-r--r--lib/webrick/httprequest.rb587
-rw-r--r--lib/webrick/httpresponse.rb471
-rw-r--r--lib/webrick/https.rb87
-rw-r--r--lib/webrick/httpserver.rb280
-rw-r--r--lib/webrick/httpservlet.rb23
-rw-r--r--lib/webrick/httpservlet/abstract.rb154
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb47
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb122
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb88
-rw-r--r--lib/webrick/httpservlet/filehandler.rb523
-rw-r--r--lib/webrick/httpservlet/prochandler.rb47
-rw-r--r--lib/webrick/httpstatus.rb198
-rw-r--r--lib/webrick/httputils.rb510
-rw-r--r--lib/webrick/log.rb156
-rw-r--r--lib/webrick/server.rb380
-rw-r--r--lib/webrick/ssl.rb202
-rw-r--r--lib/webrick/utils.rb270
-rw-r--r--lib/webrick/version.rb18
-rw-r--r--lib/yaml.rb27
-rw-r--r--lib/yaml/store.rb22
-rw-r--r--lib/yaml/yaml.gemspec23
-rwxr-xr-xlibexec/bundle38
-rwxr-xr-xlibexec/bundler4
-rwxr-xr-xlibexec/erb164
-rwxr-xr-xlibexec/irb (renamed from bin/irb)0
-rwxr-xr-xlibexec/racc320
-rwxr-xr-xlibexec/rdoc43
-rwxr-xr-xlibexec/ri (renamed from bin/ri)0
-rwxr-xr-xlibexec/syntax_suggest7
-rw-r--r--load.c1498
-rw-r--r--loadpath.c1
-rw-r--r--localeinit.c54
-rw-r--r--main.c40
-rw-r--r--man/erb.125
-rw-r--r--man/goruby.14
-rw-r--r--man/index.txt25
-rw-r--r--man/irb.1129
-rw-r--r--man/ri.1244
-rw-r--r--man/ruby.1139
-rw-r--r--marshal.c2203
-rw-r--r--marshal.rb40
-rw-r--r--math.c844
-rw-r--r--memory_view.c872
-rw-r--r--method.h154
-rw-r--r--mini_builtin.c97
-rw-r--r--miniinit.c2
-rw-r--r--misc/README18
-rwxr-xr-xmisc/expand_tabs.rb208
-rw-r--r--misc/inf-ruby.el418
-rwxr-xr-xmisc/lldb_cruby.py748
-rw-r--r--misc/lldb_disasm.py250
-rw-r--r--misc/lldb_rb/commands/command_template.py30
-rw-r--r--misc/lldb_rb/commands/heap_page_command.py26
-rw-r--r--misc/lldb_rb/commands/rclass_ext_command.py14
-rw-r--r--misc/lldb_rb/constants.py4
-rw-r--r--misc/lldb_rb/rb_base_command.py69
-rw-r--r--misc/lldb_yjit.py47
-rw-r--r--misc/rb_optparse.bash5
-rw-r--r--[-rwxr-xr-x]misc/rb_optparse.zsh15
-rw-r--r--misc/rdoc-mode.el166
-rw-r--r--misc/ruby-additional.el181
-rw-r--r--misc/ruby-electric.el569
-rw-r--r--misc/ruby-mode.el1584
-rw-r--r--misc/ruby-style.el17
-rw-r--r--misc/rubydb2x.el104
-rw-r--r--misc/rubydb3x.el115
-rw-r--r--misc/test_lldb_cruby.rb40
-rw-r--r--missing/alloca.c2
-rw-r--r--missing/crypt.h5
-rw-r--r--missing/dtoa.c3470
-rw-r--r--missing/dup2.c60
-rw-r--r--missing/erf.c15
-rw-r--r--missing/explicit_bzero.c12
-rw-r--r--missing/file.h3
-rw-r--r--missing/fileblocks.c1
-rw-r--r--missing/finite.c9
-rw-r--r--missing/flock.c13
-rw-r--r--missing/isinf.c69
-rw-r--r--missing/isnan.c32
-rw-r--r--missing/langinfo.c2
-rw-r--r--missing/memcmp.c3
-rw-r--r--missing/mt19937.c158
-rw-r--r--missing/nan.c28
-rw-r--r--missing/procstat_vm.c85
-rw-r--r--missing/setproctitle.c5
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/strerror.c2
-rw-r--r--missing/strtol.c27
-rw-r--r--missing/tgamma.c44
-rw-r--r--missing/x86_64-chkstk.S (renamed from missing/x86_64-chkstk.s)0
-rw-r--r--mjit.c1999
-rw-r--r--mjit.h145
-rw-r--r--mjit.rb37
-rw-r--r--mjit_c.c43
-rw-r--r--mjit_c.h97
-rw-r--r--mjit_c.rb807
-rw-r--r--nacl/GNUmakefile.in100
-rw-r--r--nacl/README.nacl51
-rw-r--r--nacl/create_nmf.rb70
-rw-r--r--nacl/dirent.h15
-rw-r--r--nacl/example.html150
-rwxr-xr-xnacl/nacl-config.rb61
-rw-r--r--nacl/package.rb113
-rw-r--r--nacl/pepper_main.c732
-rw-r--r--nacl/resource.h8
-rw-r--r--nacl/select.h7
-rw-r--r--nacl/signal.h6
-rw-r--r--nacl/stat.h10
-rw-r--r--nacl/unistd.h9
-rw-r--r--nacl/utime.h11
-rw-r--r--nilclass.rb25
-rw-r--r--node.c2073
-rw-r--r--node.h580
-rw-r--r--numeric.c6174
-rw-r--r--numeric.rb405
-rw-r--r--object.c3245
-rw-r--r--pack.c2754
-rw-r--r--pack.rb31
-rw-r--r--parse.y13007
-rw-r--r--prelude.rb152
-rw-r--r--probes.d11
-rw-r--r--probes_helper.h37
-rw-r--r--proc.c3081
-rw-r--r--process.c4165
-rw-r--r--ractor.c3327
-rw-r--r--ractor.rb842
-rw-r--r--ractor_core.h342
-rw-r--r--random.c1496
-rw-r--r--range.c2313
-rw-r--r--rational.c2489
-rw-r--r--re.c3314
-rw-r--r--regcomp.c746
-rw-r--r--regenc.c86
-rw-r--r--regenc.h154
-rw-r--r--regerror.c77
-rw-r--r--regexec.c1941
-rw-r--r--regint.h484
-rw-r--r--regparse.c1404
-rw-r--r--regparse.h59
-rw-r--r--regsyntax.c15
-rw-r--r--ruby-runner.c93
-rw-r--r--ruby.c2935
-rw-r--r--ruby_assert.h64
-rw-r--r--ruby_atomic.h256
-rw-r--r--rubystub.c29
-rw-r--r--safe.c128
-rw-r--r--sample/README2
-rw-r--r--sample/biorhythm.rb9
-rw-r--r--sample/cbreak.rb8
-rw-r--r--sample/coverage.rb2
-rw-r--r--sample/delegate.rb2
-rw-r--r--sample/dir.rb2
-rw-r--r--sample/drb/README.ja.rdoc2
-rw-r--r--sample/drb/README.rdoc4
-rw-r--r--sample/drb/dchats.rb3
-rw-r--r--sample/drb/dhasen.rb1
-rw-r--r--sample/drb/dlogd.rb1
-rw-r--r--sample/drb/dqueue.rb1
-rw-r--r--sample/drb/http0serv.rb9
-rw-r--r--sample/drb/name.rb4
-rw-r--r--sample/drb/old_tuplespace.rb4
-rw-r--r--sample/drb/ring_echo.rb1
-rw-r--r--sample/drb/simpletuple.rb2
-rw-r--r--sample/dualstack-httpd.rb1
-rw-r--r--sample/export.rb2
-rw-r--r--sample/exyacc.rb2
-rw-r--r--sample/fact.rb4
-rw-r--r--sample/fib.py2
-rw-r--r--sample/freq.rb12
-rw-r--r--sample/from.rb2
-rw-r--r--sample/getoptlong/abbrev.rb9
-rw-r--r--sample/getoptlong/aliases.rb8
-rw-r--r--sample/getoptlong/argv.rb12
-rw-r--r--sample/getoptlong/each.rb12
-rw-r--r--sample/getoptlong/fibonacci.rb62
-rw-r--r--sample/getoptlong/permute.rb12
-rw-r--r--sample/getoptlong/require_order.rb13
-rw-r--r--sample/getoptlong/return_in_order.rb13
-rw-r--r--sample/getoptlong/simple.rb7
-rw-r--r--sample/getoptlong/types.rb10
-rw-r--r--sample/iseq_loader.rb6
-rw-r--r--sample/list.rb5
-rw-r--r--sample/list3.rb2
-rwxr-xr-xsample/mine.rb8
-rw-r--r--sample/mpart.rb44
-rw-r--r--sample/observ.rb3
-rw-r--r--sample/occur.rb2
-rw-r--r--sample/occur2.rb13
-rw-r--r--sample/openssl/c_rehash.rb3
-rw-r--r--sample/openssl/cert2text.rb7
-rw-r--r--sample/openssl/certstore.rb7
-rw-r--r--sample/openssl/echo_cli.rb2
-rw-r--r--sample/openssl/echo_svr.rb8
-rw-r--r--sample/openssl/gen_csr.rb14
-rw-r--r--sample/openssl/smime_read.rb11
-rw-r--r--sample/openssl/smime_write.rb15
-rw-r--r--sample/philos.rb1
-rw-r--r--sample/pty/expect_sample.rb14
-rw-r--r--sample/pty/script.rb2
-rw-r--r--sample/pty/shl.rb47
-rw-r--r--sample/ripper/ruby2html.rb6
-rwxr-xr-xsample/rss/blend.rb79
-rwxr-xr-xsample/rss/convert.rb69
-rwxr-xr-xsample/rss/list_description.rb91
-rwxr-xr-xsample/rss/re_read.rb64
-rwxr-xr-xsample/rss/rss_recent.rb85
-rw-r--r--[-rwxr-xr-x]sample/test.rb2
-rw-r--r--sample/testunit/adder.rb13
-rw-r--r--sample/testunit/subtracter.rb12
-rw-r--r--sample/testunit/tc_adder.rb18
-rw-r--r--sample/testunit/tc_subtracter.rb18
-rw-r--r--sample/testunit/ts_examples.rb7
-rw-r--r--sample/timeout.rb18
-rw-r--r--sample/trick2013/kinaba/remarks.markdown4
-rw-r--r--sample/trick2013/mame/music-box.mp4bin580724 -> 0 bytes-rw-r--r--sample/trick2013/mame/remarks.markdown4
-rw-r--r--sample/trick2013/yhara/entry.rb2
-rw-r--r--sample/trick2015/kinaba/entry.rb6
-rw-r--r--sample/trick2015/ksk_1/remarks.markdown2
-rw-r--r--sample/trick2015/ksk_2/remarks.markdown4
-rw-r--r--sample/trick2018/01-kinaba/authors.markdown3
-rw-r--r--sample/trick2018/01-kinaba/entry.rb8
-rw-r--r--sample/trick2018/01-kinaba/remarks.markdown55
-rw-r--r--sample/trick2018/02-mame/authors.markdown3
-rw-r--r--sample/trick2018/02-mame/entry.rb15
-rw-r--r--sample/trick2018/02-mame/remarks.markdown16
-rw-r--r--sample/trick2018/03-tompng/Gemfile2
-rw-r--r--sample/trick2018/03-tompng/Gemfile.lock13
-rw-r--r--sample/trick2018/03-tompng/authors.markdown3
-rw-r--r--sample/trick2018/03-tompng/entry.rb31
-rw-r--r--sample/trick2018/03-tompng/output.txt44
-rw-r--r--sample/trick2018/03-tompng/remarks.markdown19
-rw-r--r--sample/trick2018/03-tompng/trick.pngbin0 -> 5661 bytes-rw-r--r--sample/trick2018/04-colin/authors.markdown3
-rw-r--r--sample/trick2018/04-colin/entry.rb2
-rw-r--r--sample/trick2018/04-colin/remarks.markdown62
-rw-r--r--sample/trick2018/05-tompng/authors.markdown3
-rw-r--r--sample/trick2018/05-tompng/entry.rb41
-rw-r--r--sample/trick2018/05-tompng/preview_of_output.pngbin0 -> 66800 bytes-rw-r--r--sample/trick2018/05-tompng/remarks.markdown31
-rw-r--r--sample/trick2018/README.md16
-rw-r--r--sample/trick2022/01-tompng/Gemfile2
-rw-r--r--sample/trick2022/01-tompng/Gemfile.lock13
-rw-r--r--sample/trick2022/01-tompng/authors.markdown3
-rw-r--r--sample/trick2022/01-tompng/entry.rb40
-rw-r--r--sample/trick2022/01-tompng/remarks.markdown51
-rw-r--r--sample/trick2022/02-tompng/authors.markdown3
-rw-r--r--sample/trick2022/02-tompng/entry.rb32
-rw-r--r--sample/trick2022/02-tompng/remarks.markdown32
-rw-r--r--sample/trick2022/03-mame/authors.markdown3
-rw-r--r--sample/trick2022/03-mame/entry.rb27
-rw-r--r--sample/trick2022/03-mame/remarks.markdown96
-rw-r--r--sample/trick2022/03-mame/test.txt13
-rw-r--r--sample/trick2022/README.md14
-rw-r--r--sample/uumerge.rb2
-rw-r--r--sample/webrick/demo-app.rb66
-rw-r--r--sample/webrick/demo-multipart.cgi12
-rw-r--r--sample/webrick/demo-servlet.rb6
-rw-r--r--sample/webrick/demo-urlencoded.cgi12
-rw-r--r--sample/webrick/hello.cgi11
-rw-r--r--sample/webrick/hello.rb8
-rw-r--r--sample/webrick/httpd.rb23
-rw-r--r--sample/webrick/httpproxy.rb25
-rw-r--r--sample/webrick/httpsd.rb33
-rw-r--r--scheduler.c687
-rw-r--r--shape.c825
-rw-r--r--shape.h232
-rw-r--r--signal.c1115
-rw-r--r--siphash.c113
-rw-r--r--siphash.h2
-rw-r--r--sparc.c6
-rw-r--r--spec/README31
-rw-r--r--spec/README.md160
-rw-r--r--spec/bundler/bundler/build_metadata_spec.rb49
-rw-r--r--spec/bundler/bundler/bundler_spec.rb378
-rw-r--r--spec/bundler/bundler/cli_spec.rb262
-rw-r--r--spec/bundler/bundler/compact_index_client/updater_spec.rb59
-rw-r--r--spec/bundler/bundler/definition_spec.rb292
-rw-r--r--spec/bundler/bundler/dependency_spec.rb157
-rw-r--r--spec/bundler/bundler/digest_spec.rb24
-rw-r--r--spec/bundler/bundler/dsl_spec.rb308
-rw-r--r--spec/bundler/bundler/endpoint_specification_spec.rb83
-rw-r--r--spec/bundler/bundler/env_spec.rb236
-rw-r--r--spec/bundler/bundler/environment_preserver_spec.rb79
-rw-r--r--spec/bundler/bundler/fetcher/base_spec.rb76
-rw-r--r--spec/bundler/bundler/fetcher/compact_index_spec.rb109
-rw-r--r--spec/bundler/bundler/fetcher/dependency_spec.rb283
-rw-r--r--spec/bundler/bundler/fetcher/downloader_spec.rb255
-rw-r--r--spec/bundler/bundler/fetcher/index_spec.rb82
-rw-r--r--spec/bundler/bundler/fetcher_spec.rb192
-rw-r--r--spec/bundler/bundler/friendly_errors_spec.rb234
-rw-r--r--spec/bundler/bundler/gem_helper_spec.rb451
-rw-r--r--spec/bundler/bundler/gem_version_promoter_spec.rb163
-rw-r--r--spec/bundler/bundler/index_spec.rb36
-rw-r--r--spec/bundler/bundler/installer/gem_installer_spec.rb50
-rw-r--r--spec/bundler/bundler/installer/parallel_installer_spec.rb46
-rw-r--r--spec/bundler/bundler/installer/spec_installation_spec.rb66
-rw-r--r--spec/bundler/bundler/lockfile_parser_spec.rb153
-rw-r--r--spec/bundler/bundler/mirror_spec.rb331
-rw-r--r--spec/bundler/bundler/plugin/api/source_spec.rb88
-rw-r--r--spec/bundler/bundler/plugin/api_spec.rb83
-rw-r--r--spec/bundler/bundler/plugin/dsl_spec.rb38
-rw-r--r--spec/bundler/bundler/plugin/events_spec.rb22
-rw-r--r--spec/bundler/bundler/plugin/index_spec.rb204
-rw-r--r--spec/bundler/bundler/plugin/installer_spec.rb131
-rw-r--r--spec/bundler/bundler/plugin/source_list_spec.rb25
-rw-r--r--spec/bundler/bundler/plugin_spec.rb337
-rw-r--r--spec/bundler/bundler/remote_specification_spec.rb187
-rw-r--r--spec/bundler/bundler/resolver/candidate_spec.rb21
-rw-r--r--spec/bundler/bundler/retry_spec.rb81
-rw-r--r--spec/bundler/bundler/ruby_dsl_spec.rb120
-rw-r--r--spec/bundler/bundler/ruby_version_spec.rb500
-rw-r--r--spec/bundler/bundler/rubygems_integration_spec.rb104
-rw-r--r--spec/bundler/bundler/settings/validator_spec.rb111
-rw-r--r--spec/bundler/bundler/settings_spec.rb337
-rw-r--r--spec/bundler/bundler/shared_helpers_spec.rb506
-rw-r--r--spec/bundler/bundler/source/git/git_proxy_spec.rb150
-rw-r--r--spec/bundler/bundler/source/git_spec.rb73
-rw-r--r--spec/bundler/bundler/source/path_spec.rb31
-rw-r--r--spec/bundler/bundler/source/rubygems/remote_spec.rb172
-rw-r--r--spec/bundler/bundler/source/rubygems_spec.rb47
-rw-r--r--spec/bundler/bundler/source_list_spec.rb459
-rw-r--r--spec/bundler/bundler/source_spec.rb174
-rw-r--r--spec/bundler/bundler/spec_set_spec.rb77
-rw-r--r--spec/bundler/bundler/stub_specification_spec.rb47
-rw-r--r--spec/bundler/bundler/ui/shell_spec.rb60
-rw-r--r--spec/bundler/bundler/ui_spec.rb41
-rw-r--r--spec/bundler/bundler/uri_credentials_filter_spec.rb127
-rw-r--r--spec/bundler/bundler/worker_spec.rb69
-rw-r--r--spec/bundler/bundler/yaml_serializer_spec.rb194
-rw-r--r--spec/bundler/cache/cache_path_spec.rb32
-rw-r--r--spec/bundler/cache/gems_spec.rb327
-rw-r--r--spec/bundler/cache/git_spec.rb276
-rw-r--r--spec/bundler/cache/path_spec.rb169
-rw-r--r--spec/bundler/cache/platform_spec.rb49
-rw-r--r--spec/bundler/commands/add_spec.rb305
-rw-r--r--spec/bundler/commands/binstubs_spec.rb556
-rw-r--r--spec/bundler/commands/cache_spec.rb428
-rw-r--r--spec/bundler/commands/check_spec.rb554
-rw-r--r--spec/bundler/commands/clean_spec.rb916
-rw-r--r--spec/bundler/commands/config_spec.rb580
-rw-r--r--spec/bundler/commands/console_spec.rb141
-rw-r--r--spec/bundler/commands/doctor_spec.rb146
-rw-r--r--spec/bundler/commands/exec_spec.rb1254
-rw-r--r--spec/bundler/commands/fund_spec.rb82
-rw-r--r--spec/bundler/commands/help_spec.rb90
-rw-r--r--spec/bundler/commands/info_spec.rb249
-rw-r--r--spec/bundler/commands/init_spec.rb207
-rw-r--r--spec/bundler/commands/inject_spec.rb117
-rw-r--r--spec/bundler/commands/install_spec.rb1106
-rw-r--r--spec/bundler/commands/issue_spec.rb16
-rw-r--r--spec/bundler/commands/licenses_spec.rb37
-rw-r--r--spec/bundler/commands/list_spec.rb195
-rw-r--r--spec/bundler/commands/lock_spec.rb1273
-rw-r--r--spec/bundler/commands/newgem_spec.rb1662
-rw-r--r--spec/bundler/commands/open_spec.rb176
-rw-r--r--spec/bundler/commands/outdated_spec.rb1368
-rw-r--r--spec/bundler/commands/platform_spec.rb1307
-rw-r--r--spec/bundler/commands/post_bundle_message_spec.rb205
-rw-r--r--spec/bundler/commands/pristine_spec.rb221
-rw-r--r--spec/bundler/commands/remove_spec.rb732
-rw-r--r--spec/bundler/commands/show_spec.rb224
-rw-r--r--spec/bundler/commands/update_spec.rb1715
-rw-r--r--spec/bundler/commands/version_spec.rb47
-rw-r--r--spec/bundler/commands/viz_spec.rb144
-rw-r--r--spec/bundler/install/allow_offline_install_spec.rb99
-rw-r--r--spec/bundler/install/binstubs_spec.rb49
-rw-r--r--spec/bundler/install/bundler_spec.rb268
-rw-r--r--spec/bundler/install/deploy_spec.rb550
-rw-r--r--spec/bundler/install/failure_spec.rb51
-rw-r--r--spec/bundler/install/gemfile/eval_gemfile_spec.rb122
-rw-r--r--spec/bundler/install/gemfile/force_ruby_platform_spec.rb118
-rw-r--r--spec/bundler/install/gemfile/gemspec_spec.rb697
-rw-r--r--spec/bundler/install/gemfile/git_spec.rb1630
-rw-r--r--spec/bundler/install/gemfile/groups_spec.rb403
-rw-r--r--spec/bundler/install/gemfile/install_if_spec.rb44
-rw-r--r--spec/bundler/install/gemfile/lockfile_spec.rb48
-rw-r--r--spec/bundler/install/gemfile/path_spec.rb984
-rw-r--r--spec/bundler/install/gemfile/platform_spec.rb618
-rw-r--r--spec/bundler/install/gemfile/ruby_spec.rb123
-rw-r--r--spec/bundler/install/gemfile/sources_spec.rb1672
-rw-r--r--spec/bundler/install/gemfile/specific_platform_spec.rb971
-rw-r--r--spec/bundler/install/gemfile_spec.rb118
-rw-r--r--spec/bundler/install/gems/compact_index_spec.rb954
-rw-r--r--spec/bundler/install/gems/dependency_api_spec.rb759
-rw-r--r--spec/bundler/install/gems/env_spec.rb107
-rw-r--r--spec/bundler/install/gems/flex_spec.rb370
-rw-r--r--spec/bundler/install/gems/fund_spec.rb164
-rw-r--r--spec/bundler/install/gems/mirror_spec.rb39
-rw-r--r--spec/bundler/install/gems/native_extensions_spec.rb188
-rw-r--r--spec/bundler/install/gems/post_install_spec.rb150
-rw-r--r--spec/bundler/install/gems/resolving_spec.rb600
-rw-r--r--spec/bundler/install/gems/standalone_spec.rb515
-rw-r--r--spec/bundler/install/gems/win32_spec.rb25
-rw-r--r--spec/bundler/install/gemspecs_spec.rb161
-rw-r--r--spec/bundler/install/git_spec.rb174
-rw-r--r--spec/bundler/install/global_cache_spec.rb254
-rw-r--r--spec/bundler/install/path_spec.rb226
-rw-r--r--spec/bundler/install/prereleases_spec.rb54
-rw-r--r--spec/bundler/install/process_lock_spec.rb57
-rw-r--r--spec/bundler/install/redownload_spec.rb91
-rw-r--r--spec/bundler/install/security_policy_spec.rb72
-rw-r--r--spec/bundler/install/yanked_spec.rb233
-rw-r--r--spec/bundler/lock/git_spec.rb162
-rw-r--r--spec/bundler/lock/lockfile_spec.rb1608
-rw-r--r--spec/bundler/other/cli_dispatch_spec.rb20
-rw-r--r--spec/bundler/other/ext_spec.rb65
-rw-r--r--spec/bundler/other/major_deprecation_spec.rb649
-rw-r--r--spec/bundler/plugins/command_spec.rb78
-rw-r--r--spec/bundler/plugins/hook_spec.rb109
-rw-r--r--spec/bundler/plugins/install_spec.rb381
-rw-r--r--spec/bundler/plugins/list_spec.rb60
-rw-r--r--spec/bundler/plugins/source/example_spec.rb452
-rw-r--r--spec/bundler/plugins/source_spec.rb111
-rw-r--r--spec/bundler/plugins/uninstall_spec.rb49
-rw-r--r--spec/bundler/quality_es_spec.rb61
-rw-r--r--spec/bundler/quality_spec.rb245
-rw-r--r--spec/bundler/realworld/dependency_api_spec.rb46
-rw-r--r--spec/bundler/realworld/double_check_spec.rb40
-rw-r--r--spec/bundler/realworld/edgecases_spec.rb516
-rw-r--r--spec/bundler/realworld/ffi_spec.rb57
-rw-r--r--spec/bundler/realworld/fixtures/warbler/.gitignore1
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile7
-rw-r--r--spec/bundler/realworld/fixtures/warbler/Gemfile.lock30
-rw-r--r--spec/bundler/realworld/fixtures/warbler/bin/warbler-example.rb3
-rw-r--r--spec/bundler/realworld/fixtures/warbler/demo/demo.gemspec10
-rw-r--r--spec/bundler/realworld/gemfile_source_header_spec.rb53
-rw-r--r--spec/bundler/realworld/git_spec.rb11
-rw-r--r--spec/bundler/realworld/mirror_probe_spec.rb131
-rw-r--r--spec/bundler/realworld/parallel_spec.rb66
-rw-r--r--spec/bundler/realworld/slow_perf_spec.rb33
-rw-r--r--spec/bundler/resolver/basic_spec.rb350
-rw-r--r--spec/bundler/resolver/platform_spec.rb427
-rw-r--r--spec/bundler/runtime/executable_spec.rb169
-rw-r--r--spec/bundler/runtime/gem_tasks_spec.rb106
-rw-r--r--spec/bundler/runtime/inline_spec.rb626
-rw-r--r--spec/bundler/runtime/load_spec.rb113
-rw-r--r--spec/bundler/runtime/platform_spec.rb464
-rw-r--r--spec/bundler/runtime/require_spec.rb465
-rw-r--r--spec/bundler/runtime/self_management_spec.rb126
-rw-r--r--spec/bundler/runtime/setup_spec.rb1557
-rw-r--r--spec/bundler/runtime/with_unbundled_env_spec.rb302
-rw-r--r--spec/bundler/spec_helper.rb119
-rw-r--r--spec/bundler/support/artifice/compact_index.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_api_missing.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/compact_index_checksum_mismatch.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index_concurrent_download.rb32
-rw-r--r--spec/bundler/support/artifice/compact_index_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/compact_index_extra.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api.rb6
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_host_redirect.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_no_gem.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update.rb38
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update_no_etag_not_incremental.rb40
-rw-r--r--spec/bundler/support/artifice/compact_index_precompiled_before.rb25
-rw-r--r--spec/bundler/support/artifice/compact_index_range_not_satisfiable.rb34
-rw-r--r--spec/bundler/support/artifice/compact_index_rate_limited.rb48
-rw-r--r--spec/bundler/support/artifice/compact_index_redirects.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_dependencies.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_gem_checksum.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_500.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_api_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/endpoint_extra.rb33
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_api.rb34
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_fallback.rb19
-rw-r--r--spec/bundler/support/artifice/endpoint_host_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail.rb6
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_mirror_source.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint_timeout.rb15
-rw-r--r--spec/bundler/support/artifice/fail.rb29
-rw-r--r--spec/bundler/support/artifice/helpers/artifice.rb30
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index.rb118
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index_extra.rb33
-rw-r--r--spec/bundler/support/artifice/helpers/compact_index_extra_api.rb48
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint.rb112
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_extra.rb29
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_fallback.rb15
-rw-r--r--spec/bundler/support/artifice/helpers/endpoint_marshal_fail.rb9
-rw-r--r--spec/bundler/support/artifice/helpers/rack_request.rb100
-rw-r--r--spec/bundler/support/artifice/used_cassettes.txt20908
-rw-r--r--spec/bundler/support/artifice/vcr.rb152
-rw-r--r--spec/bundler/support/artifice/windows.rb45
-rw-r--r--spec/bundler/support/build_metadata.rb49
-rw-r--r--spec/bundler/support/builders.rb677
-rw-r--r--spec/bundler/support/bundle.rb10
-rw-r--r--spec/bundler/support/command_execution.rb33
-rw-r--r--spec/bundler/support/filters.rb38
-rw-r--r--spec/bundler/support/hax.rb53
-rw-r--r--spec/bundler/support/helpers.rb597
-rw-r--r--spec/bundler/support/indexes.rb419
-rw-r--r--spec/bundler/support/matchers.rb237
-rw-r--r--spec/bundler/support/path.rb311
-rw-r--r--spec/bundler/support/permissions.rb12
-rw-r--r--spec/bundler/support/platforms.rb106
-rw-r--r--spec/bundler/support/rubygems_ext.rb177
-rw-r--r--spec/bundler/support/rubygems_version_manager.rb120
-rw-r--r--spec/bundler/support/silent_logger.rb10
-rw-r--r--spec/bundler/support/switch_rubygems.rb4
-rw-r--r--spec/bundler/support/the_bundle.rb35
-rw-r--r--spec/bundler/update/gemfile_spec.rb47
-rw-r--r--spec/bundler/update/gems/fund_spec.rb50
-rw-r--r--spec/bundler/update/gems/post_install_spec.rb76
-rw-r--r--spec/bundler/update/git_spec.rb336
-rw-r--r--spec/bundler/update/path_spec.rb19
-rw-r--r--spec/bundler/update/redownload_spec.rb34
-rw-r--r--spec/default.mspec74
-rw-r--r--spec/mspec/.rspec1
-rw-r--r--spec/mspec/Gemfile4
-rw-r--r--spec/mspec/Gemfile.lock26
-rw-r--r--spec/mspec/LICENSE22
-rw-r--r--spec/mspec/README.md84
-rw-r--r--spec/mspec/Rakefile6
-rwxr-xr-xspec/mspec/bin/mkspec7
-rwxr-xr-xspec/mspec/bin/mkspec.bat1
-rwxr-xr-xspec/mspec/bin/mspec7
-rwxr-xr-xspec/mspec/bin/mspec-ci7
-rwxr-xr-xspec/mspec/bin/mspec-ci.bat1
-rwxr-xr-xspec/mspec/bin/mspec-run7
-rwxr-xr-xspec/mspec/bin/mspec-run.bat1
-rwxr-xr-xspec/mspec/bin/mspec-tag7
-rwxr-xr-xspec/mspec/bin/mspec-tag.bat1
-rwxr-xr-xspec/mspec/bin/mspec.bat1
-rw-r--r--spec/mspec/lib/mspec.rb8
-rwxr-xr-xspec/mspec/lib/mspec/commands/mkspec.rb145
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-ci.rb79
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-run.rb87
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-tag.rb133
-rwxr-xr-xspec/mspec/lib/mspec/commands/mspec.rb120
-rw-r--r--spec/mspec/lib/mspec/expectations.rb2
-rw-r--r--spec/mspec/lib/mspec/expectations/expectations.rb39
-rw-r--r--spec/mspec/lib/mspec/expectations/should.rb41
-rw-r--r--spec/mspec/lib/mspec/guards.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/block_device.rb16
-rw-r--r--spec/mspec/lib/mspec/guards/bug.rb29
-rw-r--r--spec/mspec/lib/mspec/guards/conflict.rb23
-rw-r--r--spec/mspec/lib/mspec/guards/endian.rb25
-rw-r--r--spec/mspec/lib/mspec/guards/feature.rb45
-rw-r--r--spec/mspec/lib/mspec/guards/guard.rb141
-rw-r--r--spec/mspec/lib/mspec/guards/platform.rb104
-rw-r--r--spec/mspec/lib/mspec/guards/quarantine.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/superuser.rb25
-rw-r--r--spec/mspec/lib/mspec/guards/support.rb14
-rw-r--r--spec/mspec/lib/mspec/guards/version.rb72
-rw-r--r--spec/mspec/lib/mspec/helpers.rb13
-rw-r--r--spec/mspec/lib/mspec/helpers/argf.rb35
-rw-r--r--spec/mspec/lib/mspec/helpers/argv.rb44
-rw-r--r--spec/mspec/lib/mspec/helpers/datetime.rb48
-rw-r--r--spec/mspec/lib/mspec/helpers/fixture.rb24
-rw-r--r--spec/mspec/lib/mspec/helpers/flunk.rb3
-rw-r--r--spec/mspec/lib/mspec/helpers/fs.rb64
-rw-r--r--spec/mspec/lib/mspec/helpers/io.rb87
-rw-r--r--spec/mspec/lib/mspec/helpers/mock_to_path.rb6
-rw-r--r--spec/mspec/lib/mspec/helpers/numeric.rb80
-rw-r--r--spec/mspec/lib/mspec/helpers/ruby_exe.rb189
-rw-r--r--spec/mspec/lib/mspec/helpers/scratch.rb21
-rw-r--r--spec/mspec/lib/mspec/helpers/tmp.rb48
-rw-r--r--spec/mspec/lib/mspec/helpers/warning.rb21
-rw-r--r--spec/mspec/lib/mspec/matchers.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/base.rb79
-rw-r--r--spec/mspec/lib/mspec/matchers/be_an_instance_of.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/be_ancestor_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_close.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/be_computed_by.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/be_empty.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_kind_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nan.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nil.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true_or_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/block_caller.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/complain.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/eql.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal_element.rb78
-rw-r--r--spec/mspec/lib/mspec/matchers/have_class_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_constant.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_protected_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_public_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_singleton_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/include.rb31
-rw-r--r--spec/mspec/lib/mspec/matchers/include_any_of.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/infinity.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/match_yaml.rb50
-rw-r--r--spec/mspec/lib/mspec/matchers/method.rb10
-rw-r--r--spec/mspec/lib/mspec/matchers/output.rb67
-rw-r--r--spec/mspec/lib/mspec/matchers/output_to_fd.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/raise_error.rb93
-rw-r--r--spec/mspec/lib/mspec/matchers/respond_to.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/signed_zero.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/skip.rb5
-rw-r--r--spec/mspec/lib/mspec/matchers/variable.rb24
-rw-r--r--spec/mspec/lib/mspec/mocks.rb3
-rw-r--r--spec/mspec/lib/mspec/mocks/mock.rb212
-rw-r--r--spec/mspec/lib/mspec/mocks/object.rb28
-rw-r--r--spec/mspec/lib/mspec/mocks/proxy.rb186
-rw-r--r--spec/mspec/lib/mspec/runner.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/actions.rb6
-rw-r--r--spec/mspec/lib/mspec/runner/actions/constants_leak_checker.rb84
-rw-r--r--spec/mspec/lib/mspec/runner/actions/filter.rb40
-rw-r--r--spec/mspec/lib/mspec/runner/actions/leakchecker.rb319
-rw-r--r--spec/mspec/lib/mspec/runner/actions/profile.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tag.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/taglist.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tagpurge.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tally.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timeout.rb93
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timer.rb22
-rw-r--r--spec/mspec/lib/mspec/runner/context.rb237
-rw-r--r--spec/mspec/lib/mspec/runner/evaluate.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/example.rb34
-rw-r--r--spec/mspec/lib/mspec/runner/exception.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/filters/match.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/filters/profile.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters/regexp.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/filters/tag.rb29
-rw-r--r--spec/mspec/lib/mspec/runner/formatters.rb13
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/base.rb144
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/describe.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/dotted.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/file.rb24
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/html.rb81
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/junit.rb87
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/method.rb95
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/multi.rb47
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/profile.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/specdoc.rb41
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/spinner.rb111
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/stats.rb57
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/summary.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/unit.rb20
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/yaml.rb38
-rw-r--r--spec/mspec/lib/mspec/runner/mspec.rb422
-rw-r--r--spec/mspec/lib/mspec/runner/object.rb26
-rw-r--r--spec/mspec/lib/mspec/runner/parallel.rb98
-rw-r--r--spec/mspec/lib/mspec/runner/shared.rb14
-rw-r--r--spec/mspec/lib/mspec/runner/tag.rb38
-rw-r--r--spec/mspec/lib/mspec/utils/deprecate.rb6
-rw-r--r--spec/mspec/lib/mspec/utils/format.rb24
-rw-r--r--spec/mspec/lib/mspec/utils/name_map.rb126
-rw-r--r--spec/mspec/lib/mspec/utils/options.rb504
-rw-r--r--spec/mspec/lib/mspec/utils/script.rb299
-rw-r--r--spec/mspec/lib/mspec/utils/version.rb52
-rw-r--r--spec/mspec/lib/mspec/utils/warnings.rb53
-rw-r--r--spec/mspec/lib/mspec/version.rb5
-rw-r--r--spec/mspec/spec/commands/fixtures/four.txt0
-rw-r--r--spec/mspec/spec/commands/fixtures/level2/three_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/one_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/three.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/two_spec.rb1
-rw-r--r--spec/mspec/spec/commands/mkspec_spec.rb363
-rw-r--r--spec/mspec/spec/commands/mspec_ci_spec.rb150
-rw-r--r--spec/mspec/spec/commands/mspec_run_spec.rb173
-rw-r--r--spec/mspec/spec/commands/mspec_spec.rb207
-rw-r--r--spec/mspec/spec/commands/mspec_tag_spec.rb414
-rw-r--r--spec/mspec/spec/expectations/expectations_spec.rb29
-rw-r--r--spec/mspec/spec/expectations/should_spec.rb61
-rw-r--r--spec/mspec/spec/fixtures/a_spec.rb15
-rw-r--r--spec/mspec/spec/fixtures/b_spec.rb7
-rw-r--r--spec/mspec/spec/fixtures/chatty_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/config.mspec8
-rw-r--r--spec/mspec/spec/fixtures/die_spec.rb7
-rwxr-xr-xspec/mspec/spec/fixtures/my_ruby4
-rw-r--r--spec/mspec/spec/fixtures/object_methods_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/print_interpreter_spec.rb4
-rw-r--r--spec/mspec/spec/fixtures/should.rb75
-rw-r--r--spec/mspec/spec/fixtures/tagging_spec.rb16
-rw-r--r--spec/mspec/spec/guards/block_device_spec.rb46
-rw-r--r--spec/mspec/spec/guards/bug_spec.rb151
-rw-r--r--spec/mspec/spec/guards/conflict_spec.rb53
-rw-r--r--spec/mspec/spec/guards/endian_spec.rb55
-rw-r--r--spec/mspec/spec/guards/feature_spec.rb120
-rw-r--r--spec/mspec/spec/guards/guard_spec.rb421
-rw-r--r--spec/mspec/spec/guards/platform_spec.rb337
-rw-r--r--spec/mspec/spec/guards/quarantine_spec.rb35
-rw-r--r--spec/mspec/spec/guards/superuser_spec.rb35
-rw-r--r--spec/mspec/spec/guards/support_spec.rb54
-rw-r--r--spec/mspec/spec/guards/user_spec.rb20
-rw-r--r--spec/mspec/spec/guards/version_spec.rb112
-rw-r--r--spec/mspec/spec/helpers/argf_spec.rb37
-rw-r--r--spec/mspec/spec/helpers/argv_spec.rb27
-rw-r--r--spec/mspec/spec/helpers/datetime_spec.rb44
-rw-r--r--spec/mspec/spec/helpers/fixture_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/flunk_spec.rb20
-rw-r--r--spec/mspec/spec/helpers/fs_spec.rb195
-rw-r--r--spec/mspec/spec/helpers/io_spec.rb136
-rw-r--r--spec/mspec/spec/helpers/mock_to_path_spec.rb23
-rw-r--r--spec/mspec/spec/helpers/numeric_spec.rb31
-rw-r--r--spec/mspec/spec/helpers/ruby_exe_spec.rb256
-rw-r--r--spec/mspec/spec/helpers/scratch_spec.rb24
-rw-r--r--spec/mspec/spec/helpers/suppress_warning_spec.rb19
-rw-r--r--spec/mspec/spec/helpers/tmp_spec.rb27
-rw-r--r--spec/mspec/spec/integration/interpreter_spec.rb18
-rw-r--r--spec/mspec/spec/integration/object_methods_spec.rb18
-rw-r--r--spec/mspec/spec/integration/run_spec.rb71
-rw-r--r--spec/mspec/spec/integration/tag_spec.rb59
-rw-r--r--spec/mspec/spec/matchers/base_spec.rb228
-rw-r--r--spec/mspec/spec/matchers/be_an_instance_of_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/be_ancestor_of_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_close_spec.rb48
-rw-r--r--spec/mspec/spec/matchers/be_computed_by_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/be_empty_spec.rb26
-rw-r--r--spec/mspec/spec/matchers/be_false_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_kind_of_spec.rb31
-rw-r--r--spec/mspec/spec/matchers/be_nan_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_nil_spec.rb27
-rw-r--r--spec/mspec/spec/matchers/be_true_or_false_spec.rb19
-rw-r--r--spec/mspec/spec/matchers/be_true_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/block_caller_spec.rb13
-rw-r--r--spec/mspec/spec/matchers/complain_spec.rb102
-rw-r--r--spec/mspec/spec/matchers/eql_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/equal_element_spec.rb75
-rw-r--r--spec/mspec/spec/matchers/equal_spec.rb32
-rw-r--r--spec/mspec/spec/matchers/have_class_variable_spec.rb49
-rw-r--r--spec/mspec/spec/matchers/have_constant_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/have_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_instance_variable_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/have_method_spec.rb55
-rw-r--r--spec/mspec/spec/matchers/have_private_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_private_method_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/have_protected_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_public_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_singleton_method_spec.rb45
-rw-r--r--spec/mspec/spec/matchers/include_any_of_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/include_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/infinity_spec.rb34
-rw-r--r--spec/mspec/spec/matchers/match_yaml_spec.rb39
-rw-r--r--spec/mspec/spec/matchers/output_spec.rb84
-rw-r--r--spec/mspec/spec/matchers/output_to_fd_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/raise_error_spec.rb183
-rw-r--r--spec/mspec/spec/matchers/respond_to_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/signed_zero_spec.rb32
-rw-r--r--spec/mspec/spec/mocks/mock_spec.rb530
-rw-r--r--spec/mspec/spec/mocks/proxy_spec.rb405
-rw-r--r--spec/mspec/spec/runner/actions/filter_spec.rb84
-rw-r--r--spec/mspec/spec/runner/actions/tag_spec.rb313
-rw-r--r--spec/mspec/spec/runner/actions/taglist_spec.rb152
-rw-r--r--spec/mspec/spec/runner/actions/tagpurge_spec.rb154
-rw-r--r--spec/mspec/spec/runner/actions/tally_spec.rb355
-rw-r--r--spec/mspec/spec/runner/actions/timer_spec.rb44
-rw-r--r--spec/mspec/spec/runner/context_spec.rb1028
-rw-r--r--spec/mspec/spec/runner/example_spec.rb117
-rw-r--r--spec/mspec/spec/runner/exception_spec.rb146
-rw-r--r--spec/mspec/spec/runner/filters/a.yaml4
-rw-r--r--spec/mspec/spec/runner/filters/b.yaml11
-rw-r--r--spec/mspec/spec/runner/filters/match_spec.rb34
-rw-r--r--spec/mspec/spec/runner/filters/profile_spec.rb117
-rw-r--r--spec/mspec/spec/runner/filters/regexp_spec.rb31
-rw-r--r--spec/mspec/spec/runner/filters/tag_spec.rb92
-rw-r--r--spec/mspec/spec/runner/formatters/describe_spec.rb67
-rw-r--r--spec/mspec/spec/runner/formatters/dotted_spec.rb284
-rw-r--r--spec/mspec/spec/runner/formatters/file_spec.rb84
-rw-r--r--spec/mspec/spec/runner/formatters/html_spec.rb220
-rw-r--r--spec/mspec/spec/runner/formatters/junit_spec.rb159
-rw-r--r--spec/mspec/spec/runner/formatters/method_spec.rb177
-rw-r--r--spec/mspec/spec/runner/formatters/multi_spec.rb68
-rw-r--r--spec/mspec/spec/runner/formatters/specdoc_spec.rb106
-rw-r--r--spec/mspec/spec/runner/formatters/spinner_spec.rb83
-rw-r--r--spec/mspec/spec/runner/formatters/summary_spec.rb26
-rw-r--r--spec/mspec/spec/runner/formatters/unit_spec.rb73
-rw-r--r--spec/mspec/spec/runner/formatters/yaml_spec.rb134
-rw-r--r--spec/mspec/spec/runner/mspec_spec.rb597
-rw-r--r--spec/mspec/spec/runner/shared_spec.rb90
-rw-r--r--spec/mspec/spec/runner/tag_spec.rb123
-rw-r--r--spec/mspec/spec/runner/tags.txt4
-rw-r--r--spec/mspec/spec/spec_helper.rb68
-rw-r--r--spec/mspec/spec/utils/deprecate_spec.rb17
-rw-r--r--spec/mspec/spec/utils/name_map_spec.rb175
-rw-r--r--spec/mspec/spec/utils/options_spec.rb1302
-rw-r--r--spec/mspec/spec/utils/script_spec.rb470
-rw-r--r--spec/mspec/spec/utils/version_spec.rb45
-rwxr-xr-xspec/mspec/tool/find.rb10
-rwxr-xr-xspec/mspec/tool/pull-latest-mspec-spec26
-rw-r--r--spec/mspec/tool/remove_old_guards.rb70
-rw-r--r--spec/mspec/tool/sync/.gitignore4
-rw-r--r--spec/mspec/tool/sync/sync-rubyspec.rb254
-rwxr-xr-xspec/mspec/tool/tag_from_output.rb63
-rwxr-xr-xspec/mspec/tool/wrap_with_guard.rb28
-rw-r--r--spec/ruby/.gitignore5
-rw-r--r--spec/ruby/.mspec.constants234
-rw-r--r--spec/ruby/.rubocop.yml185
-rw-r--r--spec/ruby/.rubocop_todo.yml137
-rw-r--r--spec/ruby/CONTRIBUTING.md295
-rw-r--r--spec/ruby/LICENSE22
-rw-r--r--spec/ruby/README.md157
-rw-r--r--spec/ruby/TODO8
-rw-r--r--spec/ruby/command_line/backtrace_limit_spec.rb48
-rw-r--r--spec/ruby/command_line/dash_a_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_c_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_d_spec.rb22
-rw-r--r--spec/ruby/command_line/dash_e_spec.rb41
-rw-r--r--spec/ruby/command_line/dash_encoding_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_external_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_internal_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_l_spec.rb31
-rw-r--r--spec/ruby/command_line/dash_n_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_p_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_r_spec.rb28
-rw-r--r--spec/ruby/command_line/dash_s_spec.rb52
-rw-r--r--spec/ruby/command_line/dash_upper_c_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_upper_e_spec.rb37
-rw-r--r--spec/ruby/command_line/dash_upper_f_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_upper_i_spec.rb51
-rw-r--r--spec/ruby/command_line/dash_upper_k_spec.rb65
-rw-r--r--spec/ruby/command_line/dash_upper_s_spec.rb29
-rw-r--r--spec/ruby/command_line/dash_upper_u_spec.rb45
-rw-r--r--spec/ruby/command_line/dash_upper_w_spec.rb44
-rw-r--r--spec/ruby/command_line/dash_upper_x_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_v_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_w_spec.rb10
-rw-r--r--spec/ruby/command_line/dash_x_spec.rb21
-rw-r--r--spec/ruby/command_line/error_message_spec.rb11
-rw-r--r--spec/ruby/command_line/feature_spec.rb71
-rw-r--r--spec/ruby/command_line/fixtures/backtrace.rb35
-rw-r--r--spec/ruby/command_line/fixtures/bad_syntax.rb1
-rw-r--r--spec/ruby/command_line/fixtures/bin/bad_embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/dash_s_fail1
-rw-r--r--spec/ruby/command_line/fixtures/bin/embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/hybrid_launcher.sh4
-rwxr-xr-xspec/ruby/command_line/fixtures/bin/launcher.rb2
-rw-r--r--spec/ruby/command_line/fixtures/change_directory_script.rb1
-rw-r--r--spec/ruby/command_line/fixtures/conditional_range.txt5
-rw-r--r--spec/ruby/command_line/fixtures/dash_s_script.rb12
-rw-r--r--spec/ruby/command_line/fixtures/debug.rb10
-rw-r--r--spec/ruby/command_line/fixtures/debug_info.rb11
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files_diff_enc.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_one_literal.rb2
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required.rb1
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required_diff_enc.rbbin0 -> 121 bytes-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_two_literals.rb1
-rw-r--r--spec/ruby/command_line/fixtures/full_names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/loadpath.rb1
-rw-r--r--spec/ruby/command_line/fixtures/names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/passwd_file.txt3
-rw-r--r--spec/ruby/command_line/fixtures/require.rb1
-rw-r--r--spec/ruby/command_line/fixtures/rubyopt.rb1
-rw-r--r--spec/ruby/command_line/fixtures/test_file.rb1
-rw-r--r--spec/ruby/command_line/fixtures/verbose.rb1
-rw-r--r--spec/ruby/command_line/frozen_strings_spec.rb29
-rw-r--r--spec/ruby/command_line/rubylib_spec.rb69
-rw-r--r--spec/ruby/command_line/rubyopt_spec.rb185
-rw-r--r--spec/ruby/command_line/shared/change_directory.rb21
-rw-r--r--spec/ruby/command_line/shared/verbose.rb9
-rw-r--r--spec/ruby/command_line/syntax_error_spec.rb13
-rw-r--r--spec/ruby/core/argf/argf_spec.rb11
-rw-r--r--spec/ruby/core/argf/argv_spec.rb19
-rw-r--r--spec/ruby/core/argf/binmode_spec.rb43
-rw-r--r--spec/ruby/core/argf/bytes_spec.rb16
-rw-r--r--spec/ruby/core/argf/chars_spec.rb16
-rw-r--r--spec/ruby/core/argf/close_spec.rb35
-rw-r--r--spec/ruby/core/argf/closed_spec.rb18
-rw-r--r--spec/ruby/core/argf/codepoints_spec.rb16
-rw-r--r--spec/ruby/core/argf/each_byte_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_char_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_codepoint_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_line_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_spec.rb6
-rw-r--r--spec/ruby/core/argf/eof_spec.rb10
-rw-r--r--spec/ruby/core/argf/file_spec.rb21
-rw-r--r--spec/ruby/core/argf/filename_spec.rb6
-rw-r--r--spec/ruby/core/argf/fileno_spec.rb6
-rw-r--r--spec/ruby/core/argf/fixtures/bin_file.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file1.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file2.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/filename.rb3
-rw-r--r--spec/ruby/core/argf/fixtures/lineno.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/rewind.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/stdin.txt2
-rw-r--r--spec/ruby/core/argf/getc_spec.rb20
-rw-r--r--spec/ruby/core/argf/gets_spec.rb49
-rw-r--r--spec/ruby/core/argf/lineno_spec.rb30
-rw-r--r--spec/ruby/core/argf/lines_spec.rb16
-rw-r--r--spec/ruby/core/argf/path_spec.rb6
-rw-r--r--spec/ruby/core/argf/pos_spec.rb38
-rw-r--r--spec/ruby/core/argf/read_nonblock_spec.rb80
-rw-r--r--spec/ruby/core/argf/read_spec.rb85
-rw-r--r--spec/ruby/core/argf/readchar_spec.rb19
-rw-r--r--spec/ruby/core/argf/readline_spec.rb23
-rw-r--r--spec/ruby/core/argf/readlines_spec.rb6
-rw-r--r--spec/ruby/core/argf/readpartial_spec.rb75
-rw-r--r--spec/ruby/core/argf/rewind_spec.rb39
-rw-r--r--spec/ruby/core/argf/seek_spec.rb63
-rw-r--r--spec/ruby/core/argf/set_encoding_spec.rb41
-rw-r--r--spec/ruby/core/argf/shared/each_byte.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_char.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_codepoint.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_line.rb62
-rw-r--r--spec/ruby/core/argf/shared/eof.rb24
-rw-r--r--spec/ruby/core/argf/shared/filename.rb28
-rw-r--r--spec/ruby/core/argf/shared/fileno.rb24
-rw-r--r--spec/ruby/core/argf/shared/getc.rb17
-rw-r--r--spec/ruby/core/argf/shared/gets.rb99
-rw-r--r--spec/ruby/core/argf/shared/pos.rb31
-rw-r--r--spec/ruby/core/argf/shared/read.rb58
-rw-r--r--spec/ruby/core/argf/shared/readlines.rb22
-rw-r--r--spec/ruby/core/argf/skip_spec.rb42
-rw-r--r--spec/ruby/core/argf/tell_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_a_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_i_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_io_spec.rb23
-rw-r--r--spec/ruby/core/argf/to_s_spec.rb14
-rw-r--r--spec/ruby/core/array/allocate_spec.rb19
-rw-r--r--spec/ruby/core/array/any_spec.rb37
-rw-r--r--spec/ruby/core/array/append_spec.rb40
-rw-r--r--spec/ruby/core/array/array_spec.rb7
-rw-r--r--spec/ruby/core/array/assoc_spec.rb40
-rw-r--r--spec/ruby/core/array/at_spec.rb56
-rw-r--r--spec/ruby/core/array/bsearch_index_spec.rb85
-rw-r--r--spec/ruby/core/array/bsearch_spec.rb84
-rw-r--r--spec/ruby/core/array/clear_spec.rb32
-rw-r--r--spec/ruby/core/array/clone_spec.rb31
-rw-r--r--spec/ruby/core/array/collect_spec.rb11
-rw-r--r--spec/ruby/core/array/combination_spec.rb74
-rw-r--r--spec/ruby/core/array/compact_spec.rb51
-rw-r--r--spec/ruby/core/array/comparison_spec.rb97
-rw-r--r--spec/ruby/core/array/concat_spec.rb74
-rw-r--r--spec/ruby/core/array/constructor_spec.rb24
-rw-r--r--spec/ruby/core/array/count_spec.rb15
-rw-r--r--spec/ruby/core/array/cycle_spec.rb101
-rw-r--r--spec/ruby/core/array/deconstruct_spec.rb9
-rw-r--r--spec/ruby/core/array/delete_at_spec.rb41
-rw-r--r--spec/ruby/core/array/delete_if_spec.rb52
-rw-r--r--spec/ruby/core/array/delete_spec.rb46
-rw-r--r--spec/ruby/core/array/difference_spec.rb22
-rw-r--r--spec/ruby/core/array/dig_spec.rb52
-rw-r--r--spec/ruby/core/array/drop_spec.rb64
-rw-r--r--spec/ruby/core/array/drop_while_spec.rb28
-rw-r--r--spec/ruby/core/array/dup_spec.rb31
-rw-r--r--spec/ruby/core/array/each_index_spec.rb42
-rw-r--r--spec/ruby/core/array/each_spec.rb77
-rw-r--r--spec/ruby/core/array/element_reference_spec.rb50
-rw-r--r--spec/ruby/core/array/element_set_spec.rb537
-rw-r--r--spec/ruby/core/array/empty_spec.rb10
-rw-r--r--spec/ruby/core/array/eql_spec.rb19
-rw-r--r--spec/ruby/core/array/equal_value_spec.rb51
-rw-r--r--spec/ruby/core/array/fetch_spec.rb55
-rw-r--r--spec/ruby/core/array/fill_spec.rb336
-rw-r--r--spec/ruby/core/array/filter_spec.rb14
-rw-r--r--spec/ruby/core/array/find_index_spec.rb6
-rw-r--r--spec/ruby/core/array/first_spec.rb93
-rw-r--r--spec/ruby/core/array/fixtures/classes.rb584
-rw-r--r--spec/ruby/core/array/fixtures/encoded_strings.rb69
-rw-r--r--spec/ruby/core/array/flatten_spec.rb278
-rw-r--r--spec/ruby/core/array/frozen_spec.rb16
-rw-r--r--spec/ruby/core/array/hash_spec.rb83
-rw-r--r--spec/ruby/core/array/include_spec.rb33
-rw-r--r--spec/ruby/core/array/index_spec.rb6
-rw-r--r--spec/ruby/core/array/initialize_spec.rb156
-rw-r--r--spec/ruby/core/array/insert_spec.rb78
-rw-r--r--spec/ruby/core/array/inspect_spec.rb7
-rw-r--r--spec/ruby/core/array/intersect_spec.rb17
-rw-r--r--spec/ruby/core/array/intersection_spec.rb19
-rw-r--r--spec/ruby/core/array/join_spec.rb50
-rw-r--r--spec/ruby/core/array/keep_if_spec.rb11
-rw-r--r--spec/ruby/core/array/last_spec.rb87
-rw-r--r--spec/ruby/core/array/length_spec.rb7
-rw-r--r--spec/ruby/core/array/map_spec.rb11
-rw-r--r--spec/ruby/core/array/max_spec.rb116
-rw-r--r--spec/ruby/core/array/min_spec.rb121
-rw-r--r--spec/ruby/core/array/minmax_spec.rb14
-rw-r--r--spec/ruby/core/array/minus_spec.rb7
-rw-r--r--spec/ruby/core/array/multiply_spec.rb104
-rw-r--r--spec/ruby/core/array/new_spec.rb122
-rw-r--r--spec/ruby/core/array/pack/a_spec.rb73
-rw-r--r--spec/ruby/core/array/pack/at_spec.rb30
-rw-r--r--spec/ruby/core/array/pack/b_spec.rb113
-rw-r--r--spec/ruby/core/array/pack/buffer_spec.rb50
-rw-r--r--spec/ruby/core/array/pack/c_spec.rb85
-rw-r--r--spec/ruby/core/array/pack/comment_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/d_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/e_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/empty_spec.rb11
-rw-r--r--spec/ruby/core/array/pack/f_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/g_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/h_spec.rb205
-rw-r--r--spec/ruby/core/array/pack/i_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/j_spec.rb217
-rw-r--r--spec/ruby/core/array/pack/l_spec.rb221
-rw-r--r--spec/ruby/core/array/pack/m_spec.rb317
-rw-r--r--spec/ruby/core/array/pack/n_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/p_spec.rb38
-rw-r--r--spec/ruby/core/array/pack/percent_spec.rb7
-rw-r--r--spec/ruby/core/array/pack/q_spec.rb61
-rw-r--r--spec/ruby/core/array/pack/s_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/shared/basic.rb97
-rw-r--r--spec/ruby/core/array/pack/shared/encodings.rb16
-rw-r--r--spec/ruby/core/array/pack/shared/float.rb287
-rw-r--r--spec/ruby/core/array/pack/shared/integer.rb441
-rw-r--r--spec/ruby/core/array/pack/shared/numeric_basic.rb50
-rw-r--r--spec/ruby/core/array/pack/shared/string.rb48
-rw-r--r--spec/ruby/core/array/pack/shared/taint.rb2
-rw-r--r--spec/ruby/core/array/pack/shared/unicode.rb104
-rw-r--r--spec/ruby/core/array/pack/u_spec.rb140
-rw-r--r--spec/ruby/core/array/pack/v_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/w_spec.rb52
-rw-r--r--spec/ruby/core/array/pack/x_spec.rb65
-rw-r--r--spec/ruby/core/array/pack/z_spec.rb44
-rw-r--r--spec/ruby/core/array/partition_spec.rb43
-rw-r--r--spec/ruby/core/array/permutation_spec.rb138
-rw-r--r--spec/ruby/core/array/plus_spec.rb43
-rw-r--r--spec/ruby/core/array/pop_spec.rb124
-rw-r--r--spec/ruby/core/array/prepend_spec.rb7
-rw-r--r--spec/ruby/core/array/product_spec.rb68
-rw-r--r--spec/ruby/core/array/push_spec.rb7
-rw-r--r--spec/ruby/core/array/rassoc_spec.rb38
-rw-r--r--spec/ruby/core/array/reject_spec.rb143
-rw-r--r--spec/ruby/core/array/repeated_combination_spec.rb84
-rw-r--r--spec/ruby/core/array/repeated_permutation_spec.rb94
-rw-r--r--spec/ruby/core/array/replace_spec.rb7
-rw-r--r--spec/ruby/core/array/reverse_each_spec.rb43
-rw-r--r--spec/ruby/core/array/reverse_spec.rb42
-rw-r--r--spec/ruby/core/array/rindex_spec.rb80
-rw-r--r--spec/ruby/core/array/rotate_spec.rb129
-rw-r--r--spec/ruby/core/array/sample_spec.rb144
-rw-r--r--spec/ruby/core/array/select_spec.rb14
-rw-r--r--spec/ruby/core/array/shared/clone.rb20
-rw-r--r--spec/ruby/core/array/shared/collect.rb109
-rw-r--r--spec/ruby/core/array/shared/delete_if.rb13
-rw-r--r--spec/ruby/core/array/shared/difference.rb78
-rw-r--r--spec/ruby/core/array/shared/enumeratorize.rb5
-rw-r--r--spec/ruby/core/array/shared/eql.rb92
-rw-r--r--spec/ruby/core/array/shared/index.rb37
-rw-r--r--spec/ruby/core/array/shared/inspect.rb107
-rw-r--r--spec/ruby/core/array/shared/intersection.rb84
-rw-r--r--spec/ruby/core/array/shared/join.rb112
-rw-r--r--spec/ruby/core/array/shared/keep_if.rb60
-rw-r--r--spec/ruby/core/array/shared/length.rb11
-rw-r--r--spec/ruby/core/array/shared/push.rb33
-rw-r--r--spec/ruby/core/array/shared/replace.rb60
-rw-r--r--spec/ruby/core/array/shared/select.rb32
-rw-r--r--spec/ruby/core/array/shared/slice.rb889
-rw-r--r--spec/ruby/core/array/shared/union.rb79
-rw-r--r--spec/ruby/core/array/shared/unshift.rb64
-rw-r--r--spec/ruby/core/array/shift_spec.rb120
-rw-r--r--spec/ruby/core/array/shuffle_spec.rb96
-rw-r--r--spec/ruby/core/array/size_spec.rb7
-rw-r--r--spec/ruby/core/array/slice_spec.rb246
-rw-r--r--spec/ruby/core/array/sort_by_spec.rb52
-rw-r--r--spec/ruby/core/array/sort_spec.rb252
-rw-r--r--spec/ruby/core/array/sum_spec.rb71
-rw-r--r--spec/ruby/core/array/take_spec.rb40
-rw-r--r--spec/ruby/core/array/take_while_spec.rb28
-rw-r--r--spec/ruby/core/array/to_a_spec.rb24
-rw-r--r--spec/ruby/core/array/to_ary_spec.rb20
-rw-r--r--spec/ruby/core/array/to_h_spec.rb79
-rw-r--r--spec/ruby/core/array/to_s_spec.rb8
-rw-r--r--spec/ruby/core/array/transpose_spec.rb53
-rw-r--r--spec/ruby/core/array/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/array/union_spec.rb25
-rw-r--r--spec/ruby/core/array/uniq_spec.rb217
-rw-r--r--spec/ruby/core/array/unshift_spec.rb7
-rw-r--r--spec/ruby/core/array/values_at_spec.rb74
-rw-r--r--spec/ruby/core/array/zip_spec.rb71
-rw-r--r--spec/ruby/core/basicobject/__id__spec.rb6
-rw-r--r--spec/ruby/core/basicobject/__send___spec.rb10
-rw-r--r--spec/ruby/core/basicobject/basicobject_spec.rb91
-rw-r--r--spec/ruby/core/basicobject/equal_spec.rb52
-rw-r--r--spec/ruby/core/basicobject/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/basicobject/fixtures/classes.rb33
-rw-r--r--spec/ruby/core/basicobject/fixtures/common.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/remove_method_missing.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/singleton_method.rb10
-rw-r--r--spec/ruby/core/basicobject/initialize_spec.rb13
-rw-r--r--spec/ruby/core/basicobject/instance_eval_spec.rb248
-rw-r--r--spec/ruby/core/basicobject/instance_exec_spec.rb107
-rw-r--r--spec/ruby/core/basicobject/method_missing_spec.rb39
-rw-r--r--spec/ruby/core/basicobject/not_equal_spec.rb53
-rw-r--r--spec/ruby/core/basicobject/not_spec.rb11
-rw-r--r--spec/ruby/core/basicobject/singleton_method_added_spec.rb145
-rw-r--r--spec/ruby/core/basicobject/singleton_method_removed_spec.rb24
-rw-r--r--spec/ruby/core/basicobject/singleton_method_undefined_spec.rb24
-rw-r--r--spec/ruby/core/binding/clone_spec.rb7
-rw-r--r--spec/ruby/core/binding/dup_spec.rb7
-rw-r--r--spec/ruby/core/binding/eval_spec.rb152
-rw-r--r--spec/ruby/core/binding/fixtures/classes.rb66
-rw-r--r--spec/ruby/core/binding/fixtures/irb.rb3
-rw-r--r--spec/ruby/core/binding/fixtures/irbrc1
-rw-r--r--spec/ruby/core/binding/fixtures/location.rb6
-rw-r--r--spec/ruby/core/binding/irb_spec.rb16
-rw-r--r--spec/ruby/core/binding/local_variable_defined_spec.rb46
-rw-r--r--spec/ruby/core/binding/local_variable_get_spec.rb56
-rw-r--r--spec/ruby/core/binding/local_variable_set_spec.rb71
-rw-r--r--spec/ruby/core/binding/local_variables_spec.rb35
-rw-r--r--spec/ruby/core/binding/receiver_spec.rb11
-rw-r--r--spec/ruby/core/binding/shared/clone.rb34
-rw-r--r--spec/ruby/core/binding/source_location_spec.rb9
-rw-r--r--spec/ruby/core/builtin_constants/builtin_constants_spec.rb49
-rw-r--r--spec/ruby/core/class/allocate_spec.rb41
-rw-r--r--spec/ruby/core/class/attached_object_spec.rb31
-rw-r--r--spec/ruby/core/class/dup_spec.rb64
-rw-r--r--spec/ruby/core/class/fixtures/classes.rb47
-rw-r--r--spec/ruby/core/class/inherited_spec.rb101
-rw-r--r--spec/ruby/core/class/initialize_spec.rb34
-rw-r--r--spec/ruby/core/class/new_spec.rb155
-rw-r--r--spec/ruby/core/class/subclasses_spec.rb60
-rw-r--r--spec/ruby/core/class/superclass_spec.rb27
-rw-r--r--spec/ruby/core/comparable/between_spec.rb25
-rw-r--r--spec/ruby/core/comparable/clamp_spec.rb78
-rw-r--r--spec/ruby/core/comparable/equal_value_spec.rb114
-rw-r--r--spec/ruby/core/comparable/fixtures/classes.rb36
-rw-r--r--spec/ruby/core/comparable/gt_spec.rb43
-rw-r--r--spec/ruby/core/comparable/gte_spec.rb47
-rw-r--r--spec/ruby/core/comparable/lt_spec.rb49
-rw-r--r--spec/ruby/core/comparable/lte_spec.rb46
-rw-r--r--spec/ruby/core/complex/abs2_spec.rb9
-rw-r--r--spec/ruby/core/complex/abs_spec.rb6
-rw-r--r--spec/ruby/core/complex/angle_spec.rb6
-rw-r--r--spec/ruby/core/complex/arg_spec.rb6
-rw-r--r--spec/ruby/core/complex/coerce_spec.rb70
-rw-r--r--spec/ruby/core/complex/comparison_spec.rb25
-rw-r--r--spec/ruby/core/complex/conj_spec.rb6
-rw-r--r--spec/ruby/core/complex/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/complex/constants_spec.rb7
-rw-r--r--spec/ruby/core/complex/denominator_spec.rb13
-rw-r--r--spec/ruby/core/complex/divide_spec.rb6
-rw-r--r--spec/ruby/core/complex/eql_spec.rb31
-rw-r--r--spec/ruby/core/complex/equal_value_spec.rb93
-rw-r--r--spec/ruby/core/complex/exponent_spec.rb61
-rw-r--r--spec/ruby/core/complex/fdiv_spec.rb129
-rw-r--r--spec/ruby/core/complex/finite_spec.rb32
-rw-r--r--spec/ruby/core/complex/hash_spec.rb16
-rw-r--r--spec/ruby/core/complex/imag_spec.rb6
-rw-r--r--spec/ruby/core/complex/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/complex/infinite_spec.rb32
-rw-r--r--spec/ruby/core/complex/inspect_spec.rb16
-rw-r--r--spec/ruby/core/complex/integer_spec.rb11
-rw-r--r--spec/ruby/core/complex/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/complex/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/complex/minus_spec.rb45
-rw-r--r--spec/ruby/core/complex/multiply_spec.rb49
-rw-r--r--spec/ruby/core/complex/negative_spec.rb13
-rw-r--r--spec/ruby/core/complex/numerator_spec.rb19
-rw-r--r--spec/ruby/core/complex/phase_spec.rb6
-rw-r--r--spec/ruby/core/complex/plus_spec.rb45
-rw-r--r--spec/ruby/core/complex/polar_spec.rb43
-rw-r--r--spec/ruby/core/complex/positive_spec.rb13
-rw-r--r--spec/ruby/core/complex/quo_spec.rb6
-rw-r--r--spec/ruby/core/complex/rationalize_spec.rb31
-rw-r--r--spec/ruby/core/complex/real_spec.rb28
-rw-r--r--spec/ruby/core/complex/rect_spec.rb10
-rw-r--r--spec/ruby/core/complex/rectangular_spec.rb10
-rw-r--r--spec/ruby/core/complex/shared/abs.rb10
-rw-r--r--spec/ruby/core/complex/shared/arg.rb9
-rw-r--r--spec/ruby/core/complex/shared/conjugate.rb8
-rw-r--r--spec/ruby/core/complex/shared/divide.rb82
-rw-r--r--spec/ruby/core/complex/shared/image.rb8
-rw-r--r--spec/ruby/core/complex/shared/rect.rb94
-rw-r--r--spec/ruby/core/complex/to_c_spec.rb12
-rw-r--r--spec/ruby/core/complex/to_f_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_i_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_r_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_s_spec.rb44
-rw-r--r--spec/ruby/core/complex/uminus_spec.rb11
-rw-r--r--spec/ruby/core/conditionvariable/broadcast_spec.rb40
-rw-r--r--spec/ruby/core/conditionvariable/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/core/conditionvariable/signal_spec.rb77
-rw-r--r--spec/ruby/core/conditionvariable/wait_spec.rb175
-rw-r--r--spec/ruby/core/data/constants_spec.rb35
-rw-r--r--spec/ruby/core/dir/chdir_spec.rb124
-rw-r--r--spec/ruby/core/dir/children_spec.rb134
-rw-r--r--spec/ruby/core/dir/chroot_spec.rb47
-rw-r--r--spec/ruby/core/dir/close_spec.rb19
-rw-r--r--spec/ruby/core/dir/delete_spec.rb15
-rw-r--r--spec/ruby/core/dir/dir_spec.rb7
-rw-r--r--spec/ruby/core/dir/each_child_spec.rb106
-rw-r--r--spec/ruby/core/dir/each_spec.rb64
-rw-r--r--spec/ruby/core/dir/element_reference_spec.rb33
-rw-r--r--spec/ruby/core/dir/empty_spec.rb31
-rw-r--r--spec/ruby/core/dir/entries_spec.rb70
-rw-r--r--spec/ruby/core/dir/exist_spec.rb15
-rw-r--r--spec/ruby/core/dir/fileno_spec.rb37
-rw-r--r--spec/ruby/core/dir/fixtures/common.rb204
-rw-r--r--spec/ruby/core/dir/foreach_spec.rb68
-rw-r--r--spec/ruby/core/dir/getwd_spec.rb15
-rw-r--r--spec/ruby/core/dir/glob_spec.rb253
-rw-r--r--spec/ruby/core/dir/home_spec.rb88
-rw-r--r--spec/ruby/core/dir/initialize_spec.rb23
-rw-r--r--spec/ruby/core/dir/inspect_spec.rb24
-rw-r--r--spec/ruby/core/dir/mkdir_spec.rb107
-rw-r--r--spec/ruby/core/dir/open_spec.rb15
-rw-r--r--spec/ruby/core/dir/path_spec.rb15
-rw-r--r--spec/ruby/core/dir/pos_spec.rb40
-rw-r--r--spec/ruby/core/dir/pwd_spec.rb39
-rw-r--r--spec/ruby/core/dir/read_spec.rb76
-rw-r--r--spec/ruby/core/dir/rewind_spec.rb36
-rw-r--r--spec/ruby/core/dir/rmdir_spec.rb15
-rw-r--r--spec/ruby/core/dir/seek_spec.rb19
-rw-r--r--spec/ruby/core/dir/shared/chroot.rb44
-rw-r--r--spec/ruby/core/dir/shared/closed.rb9
-rw-r--r--spec/ruby/core/dir/shared/delete.rb63
-rw-r--r--spec/ruby/core/dir/shared/exist.rb56
-rw-r--r--spec/ruby/core/dir/shared/glob.rb484
-rw-r--r--spec/ruby/core/dir/shared/open.rb73
-rw-r--r--spec/ruby/core/dir/shared/path.rb30
-rw-r--r--spec/ruby/core/dir/shared/pos.rb51
-rw-r--r--spec/ruby/core/dir/shared/pwd.rb45
-rw-r--r--spec/ruby/core/dir/tell_spec.rb18
-rw-r--r--spec/ruby/core/dir/to_path_spec.rb15
-rw-r--r--spec/ruby/core/dir/unlink_spec.rb15
-rw-r--r--spec/ruby/core/encoding/_dump_spec.rb5
-rw-r--r--spec/ruby/core/encoding/_load_spec.rb5
-rw-r--r--spec/ruby/core/encoding/aliases_spec.rb43
-rw-r--r--spec/ruby/core/encoding/ascii_compatible_spec.rb11
-rw-r--r--spec/ruby/core/encoding/compatible_spec.rb379
-rw-r--r--spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb37
-rw-r--r--spec/ruby/core/encoding/converter/constants_spec.rb131
-rw-r--r--spec/ruby/core/encoding/converter/convert_spec.rb45
-rw-r--r--spec/ruby/core/encoding/converter/convpath_spec.rb24
-rw-r--r--spec/ruby/core/encoding/converter/destination_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/converter/finish_spec.rb36
-rw-r--r--spec/ruby/core/encoding/converter/insert_output_spec.rb5
-rw-r--r--spec/ruby/core/encoding/converter/inspect_spec.rb13
-rw-r--r--spec/ruby/core/encoding/converter/last_error_spec.rb91
-rw-r--r--spec/ruby/core/encoding/converter/new_spec.rb119
-rw-r--r--spec/ruby/core/encoding/converter/primitive_convert_spec.rb211
-rw-r--r--spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb68
-rw-r--r--spec/ruby/core/encoding/converter/putback_spec.rb56
-rw-r--r--spec/ruby/core/encoding/converter/replacement_spec.rb72
-rw-r--r--spec/ruby/core/encoding/converter/search_convpath_spec.rb30
-rw-r--r--spec/ruby/core/encoding/converter/source_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/default_external_spec.rb71
-rw-r--r--spec/ruby/core/encoding/default_internal_spec.rb74
-rw-r--r--spec/ruby/core/encoding/dummy_spec.rb14
-rw-r--r--spec/ruby/core/encoding/find_spec.rb82
-rw-r--r--spec/ruby/core/encoding/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/encoding/inspect_spec.rb19
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb33
-rw-r--r--spec/ruby/core/encoding/list_spec.rb49
-rw-r--r--spec/ruby/core/encoding/locale_charmap_spec.rb56
-rw-r--r--spec/ruby/core/encoding/name_list_spec.rb23
-rw-r--r--spec/ruby/core/encoding/name_spec.rb5
-rw-r--r--spec/ruby/core/encoding/names_spec.rb35
-rw-r--r--spec/ruby/core/encoding/replicate_spec.rb75
-rw-r--r--spec/ruby/core/encoding/shared/name.rb15
-rw-r--r--spec/ruby/core/encoding/to_s_spec.rb5
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb27
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb29
-rw-r--r--spec/ruby/core/enumerable/all_spec.rb181
-rw-r--r--spec/ruby/core/enumerable/any_spec.rb194
-rw-r--r--spec/ruby/core/enumerable/chain_spec.rb23
-rw-r--r--spec/ruby/core/enumerable/chunk_spec.rb72
-rw-r--r--spec/ruby/core/enumerable/chunk_while_spec.rb42
-rw-r--r--spec/ruby/core/enumerable/collect_concat_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/collect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/compact_spec.rb11
-rw-r--r--spec/ruby/core/enumerable/count_spec.rb59
-rw-r--r--spec/ruby/core/enumerable/cycle_spec.rb104
-rw-r--r--spec/ruby/core/enumerable/detect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/drop_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/drop_while_spec.rb50
-rw-r--r--spec/ruby/core/enumerable/each_cons_spec.rb105
-rw-r--r--spec/ruby/core/enumerable/each_entry_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/each_slice_spec.rb107
-rw-r--r--spec/ruby/core/enumerable/each_with_index_spec.rb53
-rw-r--r--spec/ruby/core/enumerable/each_with_object_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/entries_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/filter_map_spec.rb24
-rw-r--r--spec/ruby/core/enumerable/filter_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/find_all_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/find_index_spec.rb89
-rw-r--r--spec/ruby/core/enumerable/find_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/first_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/fixtures/classes.rb345
-rw-r--r--spec/ruby/core/enumerable/flat_map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/grep_spec.rb102
-rw-r--r--spec/ruby/core/enumerable/grep_v_spec.rb91
-rw-r--r--spec/ruby/core/enumerable/group_by_spec.rb37
-rw-r--r--spec/ruby/core/enumerable/include_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/inject_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/lazy_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/max_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/max_spec.rb119
-rw-r--r--spec/ruby/core/enumerable/member_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/min_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/min_spec.rb123
-rw-r--r--spec/ruby/core/enumerable/minmax_by_spec.rb44
-rw-r--r--spec/ruby/core/enumerable/minmax_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/none_spec.rb147
-rw-r--r--spec/ruby/core/enumerable/one_spec.rb149
-rw-r--r--spec/ruby/core/enumerable/partition_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/reduce_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/reject_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/reverse_each_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/select_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/shared/collect.rb107
-rw-r--r--spec/ruby/core/enumerable/shared/collect_concat.rb54
-rw-r--r--spec/ruby/core/enumerable/shared/entries.rb16
-rw-r--r--spec/ruby/core/enumerable/shared/enumerable_enumeratorized.rb33
-rw-r--r--spec/ruby/core/enumerable/shared/enumeratorized.rb42
-rw-r--r--spec/ruby/core/enumerable/shared/find.rb77
-rw-r--r--spec/ruby/core/enumerable/shared/find_all.rb31
-rw-r--r--spec/ruby/core/enumerable/shared/include.rb34
-rw-r--r--spec/ruby/core/enumerable/shared/inject.rb77
-rw-r--r--spec/ruby/core/enumerable/shared/take.rb63
-rw-r--r--spec/ruby/core/enumerable/slice_after_spec.rb61
-rw-r--r--spec/ruby/core/enumerable/slice_before_spec.rb64
-rw-r--r--spec/ruby/core/enumerable/slice_when_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sort_by_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/sort_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sum_spec.rb50
-rw-r--r--spec/ruby/core/enumerable/take_spec.rb13
-rw-r--r--spec/ruby/core/enumerable/take_while_spec.rb51
-rw-r--r--spec/ruby/core/enumerable/tally_spec.rb80
-rw-r--r--spec/ruby/core/enumerable/to_a_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/to_h_spec.rb88
-rw-r--r--spec/ruby/core/enumerable/uniq_spec.rb78
-rw-r--r--spec/ruby/core/enumerable/zip_spec.rb46
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/begin_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/each_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/end_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/eq_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/exclude_end_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/first_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/hash_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/inspect_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/last_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/new_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/size_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/step_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/chain/each_spec.rb15
-rw-r--r--spec/ruby/core/enumerator/chain/initialize_spec.rb31
-rw-r--r--spec/ruby/core/enumerator/chain/inspect_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/chain/rewind_spec.rb51
-rw-r--r--spec/ruby/core/enumerator/chain/size_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/each_spec.rb89
-rw-r--r--spec/ruby/core/enumerator/each_with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/each_with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enum_for_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enumerator_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/feed_spec.rb52
-rw-r--r--spec/ruby/core/enumerator/first_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/fixtures/common.rb9
-rw-r--r--spec/ruby/core/enumerator/generator/each_spec.rb40
-rw-r--r--spec/ruby/core/enumerator/generator/initialize_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/initialize_spec.rb65
-rw-r--r--spec/ruby/core/enumerator/inspect_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_while_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_concat_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/compact_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_spec.rb58
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_while_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/eager_spec.rb27
-rw-r--r--spec/ruby/core/enumerator/lazy/enum_for_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_map_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/lazy/find_all_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/fixtures/classes.rb54
-rw-r--r--spec/ruby/core/enumerator/lazy/flat_map_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/lazy/force_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_spec.rb121
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_v_spec.rb123
-rw-r--r--spec/ruby/core/enumerator/lazy/initialize_spec.rb63
-rw-r--r--spec/ruby/core/enumerator/lazy/lazy_spec.rb32
-rw-r--r--spec/ruby/core/enumerator/lazy/map_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/lazy/reject_spec.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/select_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect.rb62
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect_concat.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/select.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/to_enum.rb55
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_after_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_before_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_when_spec.rb14
-rw-r--r--spec/ruby/core/enumerator/lazy/take_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/take_while_spec.rb60
-rw-r--r--spec/ruby/core/enumerator/lazy/to_enum_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/uniq_spec.rb74
-rw-r--r--spec/ruby/core/enumerator/lazy/with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/zip_spec.rb86
-rw-r--r--spec/ruby/core/enumerator/new_spec.rb119
-rw-r--r--spec/ruby/core/enumerator/next_spec.rb38
-rw-r--r--spec/ruby/core/enumerator/next_values_spec.rb55
-rw-r--r--spec/ruby/core/enumerator/peek_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/peek_values_spec.rb57
-rw-r--r--spec/ruby/core/enumerator/plus_spec.rb33
-rw-r--r--spec/ruby/core/enumerator/produce_spec.rb34
-rw-r--r--spec/ruby/core/enumerator/rewind_spec.rb70
-rw-r--r--spec/ruby/core/enumerator/size_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/to_enum_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/with_index_spec.rb72
-rw-r--r--spec/ruby/core/enumerator/with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/yielder/append_spec.rb35
-rw-r--r--spec/ruby/core/enumerator/yielder/initialize_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/to_proc_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/yielder/yield_spec.rb33
-rw-r--r--spec/ruby/core/env/assoc_spec.rb31
-rw-r--r--spec/ruby/core/env/clear_spec.rb20
-rw-r--r--spec/ruby/core/env/delete_if_spec.rb54
-rw-r--r--spec/ruby/core/env/delete_spec.rb49
-rw-r--r--spec/ruby/core/env/each_key_spec.rb34
-rw-r--r--spec/ruby/core/env/each_pair_spec.rb6
-rw-r--r--spec/ruby/core/env/each_spec.rb6
-rw-r--r--spec/ruby/core/env/each_value_spec.rb34
-rw-r--r--spec/ruby/core/env/element_reference_spec.rb76
-rw-r--r--spec/ruby/core/env/element_set_spec.rb6
-rw-r--r--spec/ruby/core/env/empty_spec.rb23
-rw-r--r--spec/ruby/core/env/except_spec.rb36
-rw-r--r--spec/ruby/core/env/fetch_spec.rb63
-rw-r--r--spec/ruby/core/env/filter_spec.rb13
-rw-r--r--spec/ruby/core/env/fixtures/common.rb9
-rw-r--r--spec/ruby/core/env/has_key_spec.rb6
-rw-r--r--spec/ruby/core/env/has_value_spec.rb6
-rw-r--r--spec/ruby/core/env/include_spec.rb6
-rw-r--r--spec/ruby/core/env/index_spec.rb14
-rw-r--r--spec/ruby/core/env/indexes_spec.rb1
-rw-r--r--spec/ruby/core/env/indices_spec.rb1
-rw-r--r--spec/ruby/core/env/inspect_spec.rb11
-rw-r--r--spec/ruby/core/env/invert_spec.rb16
-rw-r--r--spec/ruby/core/env/keep_if_spec.rb54
-rw-r--r--spec/ruby/core/env/key_spec.rb11
-rw-r--r--spec/ruby/core/env/keys_spec.rb14
-rw-r--r--spec/ruby/core/env/length_spec.rb6
-rw-r--r--spec/ruby/core/env/member_spec.rb6
-rw-r--r--spec/ruby/core/env/merge_spec.rb6
-rw-r--r--spec/ruby/core/env/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/env/rehash_spec.rb7
-rw-r--r--spec/ruby/core/env/reject_spec.rb101
-rw-r--r--spec/ruby/core/env/replace_spec.rb51
-rw-r--r--spec/ruby/core/env/select_spec.rb13
-rw-r--r--spec/ruby/core/env/shared/each.rb65
-rw-r--r--spec/ruby/core/env/shared/include.rb23
-rw-r--r--spec/ruby/core/env/shared/key.rb31
-rw-r--r--spec/ruby/core/env/shared/length.rb13
-rw-r--r--spec/ruby/core/env/shared/select.rb61
-rw-r--r--spec/ruby/core/env/shared/store.rb60
-rw-r--r--spec/ruby/core/env/shared/to_hash.rb33
-rw-r--r--spec/ruby/core/env/shared/update.rb106
-rw-r--r--spec/ruby/core/env/shared/value.rb22
-rw-r--r--spec/ruby/core/env/shift_spec.rb47
-rw-r--r--spec/ruby/core/env/size_spec.rb6
-rw-r--r--spec/ruby/core/env/slice_spec.rb27
-rw-r--r--spec/ruby/core/env/spec_helper.rb26
-rw-r--r--spec/ruby/core/env/store_spec.rb6
-rw-r--r--spec/ruby/core/env/to_a_spec.rb18
-rw-r--r--spec/ruby/core/env/to_h_spec.rb58
-rw-r--r--spec/ruby/core/env/to_hash_spec.rb6
-rw-r--r--spec/ruby/core/env/to_s_spec.rb7
-rw-r--r--spec/ruby/core/env/update_spec.rb6
-rw-r--r--spec/ruby/core/env/value_spec.rb6
-rw-r--r--spec/ruby/core/env/values_at_spec.rb38
-rw-r--r--spec/ruby/core/env/values_spec.rb14
-rw-r--r--spec/ruby/core/exception/backtrace_locations_spec.rb39
-rw-r--r--spec/ruby/core/exception/backtrace_spec.rb93
-rw-r--r--spec/ruby/core/exception/case_compare_spec.rb39
-rw-r--r--spec/ruby/core/exception/cause_spec.rb56
-rw-r--r--spec/ruby/core/exception/dup_spec.rb74
-rw-r--r--spec/ruby/core/exception/equal_value_spec.rb68
-rw-r--r--spec/ruby/core/exception/errno_spec.rb67
-rw-r--r--spec/ruby/core/exception/exception_spec.rb69
-rw-r--r--spec/ruby/core/exception/exit_value_spec.rb13
-rw-r--r--spec/ruby/core/exception/fixtures/common.rb95
-rw-r--r--spec/ruby/core/exception/frozen_error_spec.rb22
-rw-r--r--spec/ruby/core/exception/full_message_spec.rb106
-rw-r--r--spec/ruby/core/exception/hierarchy_spec.rb62
-rw-r--r--spec/ruby/core/exception/inspect_spec.rb24
-rw-r--r--spec/ruby/core/exception/interrupt_spec.rb60
-rw-r--r--spec/ruby/core/exception/io_error_spec.rb45
-rw-r--r--spec/ruby/core/exception/key_error_spec.rb19
-rw-r--r--spec/ruby/core/exception/load_error_spec.rb21
-rw-r--r--spec/ruby/core/exception/message_spec.rb27
-rw-r--r--spec/ruby/core/exception/name_error_spec.rb28
-rw-r--r--spec/ruby/core/exception/name_spec.rb43
-rw-r--r--spec/ruby/core/exception/new_spec.rb7
-rw-r--r--spec/ruby/core/exception/no_method_error_spec.rb136
-rw-r--r--spec/ruby/core/exception/reason_spec.rb13
-rw-r--r--spec/ruby/core/exception/receiver_spec.rb58
-rw-r--r--spec/ruby/core/exception/result_spec.rb21
-rw-r--r--spec/ruby/core/exception/set_backtrace_spec.rb56
-rw-r--r--spec/ruby/core/exception/shared/new.rb18
-rw-r--r--spec/ruby/core/exception/signal_exception_spec.rb123
-rw-r--r--spec/ruby/core/exception/signm_spec.rb9
-rw-r--r--spec/ruby/core/exception/signo_spec.rb9
-rw-r--r--spec/ruby/core/exception/standard_error_spec.rb23
-rw-r--r--spec/ruby/core/exception/status_spec.rb9
-rw-r--r--spec/ruby/core/exception/success_spec.rb15
-rw-r--r--spec/ruby/core/exception/system_call_error_spec.rb143
-rw-r--r--spec/ruby/core/exception/system_exit_spec.rb59
-rw-r--r--spec/ruby/core/exception/to_s_spec.rb37
-rw-r--r--spec/ruby/core/exception/top_level_spec.rb45
-rw-r--r--spec/ruby/core/exception/uncaught_throw_error_spec.rb12
-rw-r--r--spec/ruby/core/false/and_spec.rb11
-rw-r--r--spec/ruby/core/false/case_compare_spec.rb14
-rw-r--r--spec/ruby/core/false/dup_spec.rb7
-rw-r--r--spec/ruby/core/false/falseclass_spec.rb15
-rw-r--r--spec/ruby/core/false/inspect_spec.rb7
-rw-r--r--spec/ruby/core/false/or_spec.rb11
-rw-r--r--spec/ruby/core/false/to_s_spec.rb15
-rw-r--r--spec/ruby/core/false/xor_spec.rb11
-rw-r--r--spec/ruby/core/fiber/blocking_spec.rb79
-rw-r--r--spec/ruby/core/fiber/fixtures/classes.rb12
-rw-r--r--spec/ruby/core/fiber/new_spec.rb39
-rw-r--r--spec/ruby/core/fiber/raise_spec.rb119
-rw-r--r--spec/ruby/core/fiber/resume_spec.rb79
-rw-r--r--spec/ruby/core/fiber/shared/blocking.rb41
-rw-r--r--spec/ruby/core/fiber/storage_spec.rb117
-rw-r--r--spec/ruby/core/fiber/yield_spec.rb49
-rw-r--r--spec/ruby/core/file/absolute_path_spec.rb94
-rw-r--r--spec/ruby/core/file/atime_spec.rb57
-rw-r--r--spec/ruby/core/file/basename_spec.rb183
-rw-r--r--spec/ruby/core/file/birthtime_spec.rb60
-rw-r--r--spec/ruby/core/file/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/file/chardev_spec.rb6
-rw-r--r--spec/ruby/core/file/chmod_spec.rb185
-rw-r--r--spec/ruby/core/file/chown_spec.rb144
-rw-r--r--spec/ruby/core/file/constants/constants_spec.rb31
-rw-r--r--spec/ruby/core/file/constants_spec.rb141
-rw-r--r--spec/ruby/core/file/ctime_spec.rb51
-rw-r--r--spec/ruby/core/file/delete_spec.rb6
-rw-r--r--spec/ruby/core/file/directory_spec.rb10
-rw-r--r--spec/ruby/core/file/dirname_spec.rb124
-rw-r--r--spec/ruby/core/file/empty_spec.rb13
-rw-r--r--spec/ruby/core/file/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/exist_spec.rb6
-rw-r--r--spec/ruby/core/file/expand_path_spec.rb265
-rw-r--r--spec/ruby/core/file/extname_spec.rb76
-rw-r--r--spec/ruby/core/file/file_spec.rb16
-rw-r--r--spec/ruby/core/file/fixtures/common.rb22
-rw-r--r--spec/ruby/core/file/fixtures/do_not_remove1
-rw-r--r--spec/ruby/core/file/fixtures/file_types.rb66
-rw-r--r--spec/ruby/core/file/flock_spec.rb106
-rw-r--r--spec/ruby/core/file/fnmatch_spec.rb10
-rw-r--r--spec/ruby/core/file/ftype_spec.rb82
-rw-r--r--spec/ruby/core/file/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/file/identical_spec.rb6
-rw-r--r--spec/ruby/core/file/initialize_spec.rb19
-rw-r--r--spec/ruby/core/file/inspect_spec.rb17
-rw-r--r--spec/ruby/core/file/join_spec.rb148
-rw-r--r--spec/ruby/core/file/lchmod_spec.rb32
-rw-r--r--spec/ruby/core/file/lchown_spec.rb59
-rw-r--r--spec/ruby/core/file/link_spec.rb39
-rw-r--r--spec/ruby/core/file/lstat_spec.rb33
-rw-r--r--spec/ruby/core/file/lutime_spec.rb38
-rw-r--r--spec/ruby/core/file/mkfifo_spec.rb51
-rw-r--r--spec/ruby/core/file/mtime_spec.rb53
-rw-r--r--spec/ruby/core/file/new_spec.rb162
-rw-r--r--spec/ruby/core/file/null_spec.rb15
-rw-r--r--spec/ruby/core/file/open_spec.rb704
-rw-r--r--spec/ruby/core/file/owned_spec.rb35
-rw-r--r--spec/ruby/core/file/path_spec.rb40
-rw-r--r--spec/ruby/core/file/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/printf_spec.rb18
-rw-r--r--spec/ruby/core/file/read_spec.rb6
-rw-r--r--spec/ruby/core/file/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/readlink_spec.rb86
-rw-r--r--spec/ruby/core/file/realdirpath_spec.rb104
-rw-r--r--spec/ruby/core/file/realpath_spec.rb94
-rw-r--r--spec/ruby/core/file/rename_spec.rb37
-rw-r--r--spec/ruby/core/file/reopen_spec.rb32
-rw-r--r--spec/ruby/core/file/setgid_spec.rb36
-rw-r--r--spec/ruby/core/file/setuid_spec.rb38
-rw-r--r--spec/ruby/core/file/shared/fnmatch.rb249
-rw-r--r--spec/ruby/core/file/shared/open.rb12
-rw-r--r--spec/ruby/core/file/shared/path.rb94
-rw-r--r--spec/ruby/core/file/shared/read.rb15
-rw-r--r--spec/ruby/core/file/shared/stat.rb32
-rw-r--r--spec/ruby/core/file/shared/unlink.rb61
-rw-r--r--spec/ruby/core/file/size_spec.rb119
-rw-r--r--spec/ruby/core/file/socket_spec.rb42
-rw-r--r--spec/ruby/core/file/split_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/atime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/birthtime_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blksize_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blockdev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/blocks_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/chardev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/comparison_spec.rb66
-rw-r--r--spec/ruby/core/file/stat/ctime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/dev_major_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_minor_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/directory_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/file_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/fixtures/classes.rb5
-rw-r--r--spec/ruby/core/file/stat/ftype_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/gid_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/grpowned_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/ino_spec.rb28
-rw-r--r--spec/ruby/core/file/stat/inspect_spec.rb26
-rw-r--r--spec/ruby/core/file/stat/mode_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/mtime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/new_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/nlink_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/owned_spec.rb33
-rw-r--r--spec/ruby/core/file/stat/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/rdev_major_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_minor_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setgid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setuid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/size_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/socket_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/sticky_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/symlink_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/uid_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/world_readable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/world_writable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/zero_spec.rb7
-rw-r--r--spec/ruby/core/file/stat_spec.rb55
-rw-r--r--spec/ruby/core/file/sticky_spec.rb50
-rw-r--r--spec/ruby/core/file/symlink_spec.rb57
-rw-r--r--spec/ruby/core/file/to_path_spec.rb6
-rw-r--r--spec/ruby/core/file/truncate_spec.rb177
-rw-r--r--spec/ruby/core/file/umask_spec.rb57
-rw-r--r--spec/ruby/core/file/unlink_spec.rb6
-rw-r--r--spec/ruby/core/file/utime_spec.rb104
-rw-r--r--spec/ruby/core/file/world_readable_spec.rb12
-rw-r--r--spec/ruby/core/file/world_writable_spec.rb12
-rw-r--r--spec/ruby/core/file/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/zero_spec.rb13
-rw-r--r--spec/ruby/core/filetest/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/chardev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/directory_spec.rb10
-rw-r--r--spec/ruby/core/filetest/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/executable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/exist_spec.rb6
-rw-r--r--spec/ruby/core/filetest/file_spec.rb10
-rw-r--r--spec/ruby/core/filetest/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/filetest/identical_spec.rb6
-rw-r--r--spec/ruby/core/filetest/owned_spec.rb6
-rw-r--r--spec/ruby/core/filetest/pipe_spec.rb6
-rw-r--r--spec/ruby/core/filetest/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/readable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/setgid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/setuid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/size_spec.rb34
-rw-r--r--spec/ruby/core/filetest/socket_spec.rb6
-rw-r--r--spec/ruby/core/filetest/sticky_spec.rb7
-rw-r--r--spec/ruby/core/filetest/symlink_spec.rb10
-rw-r--r--spec/ruby/core/filetest/world_readable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/world_writable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/writable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/zero_spec.rb13
-rw-r--r--spec/ruby/core/float/abs_spec.rb6
-rw-r--r--spec/ruby/core/float/angle_spec.rb6
-rw-r--r--spec/ruby/core/float/arg_spec.rb6
-rw-r--r--spec/ruby/core/float/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/float/ceil_spec.rb21
-rw-r--r--spec/ruby/core/float/coerce_spec.rb18
-rw-r--r--spec/ruby/core/float/comparison_spec.rb113
-rw-r--r--spec/ruby/core/float/constants_spec.rb55
-rw-r--r--spec/ruby/core/float/denominator_spec.rb29
-rw-r--r--spec/ruby/core/float/divide_spec.rb43
-rw-r--r--spec/ruby/core/float/divmod_spec.rb43
-rw-r--r--spec/ruby/core/float/dup_spec.rb8
-rw-r--r--spec/ruby/core/float/eql_spec.rb16
-rw-r--r--spec/ruby/core/float/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/float/exponent_spec.rb15
-rw-r--r--spec/ruby/core/float/fdiv_spec.rb6
-rw-r--r--spec/ruby/core/float/finite_spec.rb19
-rw-r--r--spec/ruby/core/float/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/float/fixtures/coerce.rb15
-rw-r--r--spec/ruby/core/float/float_spec.rb19
-rw-r--r--spec/ruby/core/float/floor_spec.rb21
-rw-r--r--spec/ruby/core/float/gt_spec.rb38
-rw-r--r--spec/ruby/core/float/gte_spec.rb38
-rw-r--r--spec/ruby/core/float/hash_spec.rb11
-rw-r--r--spec/ruby/core/float/infinite_spec.rb19
-rw-r--r--spec/ruby/core/float/inspect_spec.rb6
-rw-r--r--spec/ruby/core/float/lt_spec.rb38
-rw-r--r--spec/ruby/core/float/lte_spec.rb39
-rw-r--r--spec/ruby/core/float/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/float/minus_spec.rb12
-rw-r--r--spec/ruby/core/float/modulo_spec.rb10
-rw-r--r--spec/ruby/core/float/multiply_spec.rb17
-rw-r--r--spec/ruby/core/float/nan_spec.rb9
-rw-r--r--spec/ruby/core/float/negative_spec.rb33
-rw-r--r--spec/ruby/core/float/next_float_spec.rb49
-rw-r--r--spec/ruby/core/float/numerator_spec.rb39
-rw-r--r--spec/ruby/core/float/phase_spec.rb6
-rw-r--r--spec/ruby/core/float/plus_spec.rb12
-rw-r--r--spec/ruby/core/float/positive_spec.rb33
-rw-r--r--spec/ruby/core/float/prev_float_spec.rb49
-rw-r--r--spec/ruby/core/float/quo_spec.rb6
-rw-r--r--spec/ruby/core/float/rationalize_spec.rb43
-rw-r--r--spec/ruby/core/float/round_spec.rb194
-rw-r--r--spec/ruby/core/float/shared/abs.rb21
-rw-r--r--spec/ruby/core/float/shared/arg.rb36
-rw-r--r--spec/ruby/core/float/shared/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/core/float/shared/comparison_exception_in_coerce.rb11
-rw-r--r--spec/ruby/core/float/shared/equal.rb38
-rw-r--r--spec/ruby/core/float/shared/modulo.rb48
-rw-r--r--spec/ruby/core/float/shared/quo.rb59
-rw-r--r--spec/ruby/core/float/shared/to_i.rb14
-rw-r--r--spec/ruby/core/float/shared/to_s.rb308
-rw-r--r--spec/ruby/core/float/to_f_spec.rb9
-rw-r--r--spec/ruby/core/float/to_i_spec.rb6
-rw-r--r--spec/ruby/core/float/to_int_spec.rb6
-rw-r--r--spec/ruby/core/float/to_r_spec.rb5
-rw-r--r--spec/ruby/core/float/to_s_spec.rb6
-rw-r--r--spec/ruby/core/float/truncate_spec.rb14
-rw-r--r--spec/ruby/core/float/uminus_spec.rb28
-rw-r--r--spec/ruby/core/float/uplus_spec.rb9
-rw-r--r--spec/ruby/core/float/zero_spec.rb9
-rw-r--r--spec/ruby/core/gc/auto_compact_spec.rb26
-rw-r--r--spec/ruby/core/gc/count_spec.rb17
-rw-r--r--spec/ruby/core/gc/disable_spec.rb18
-rw-r--r--spec/ruby/core/gc/enable_spec.rb13
-rw-r--r--spec/ruby/core/gc/garbage_collect_spec.rb15
-rw-r--r--spec/ruby/core/gc/measure_total_time_spec.rb19
-rw-r--r--spec/ruby/core/gc/profiler/clear_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/disable_spec.rb16
-rw-r--r--spec/ruby/core/gc/profiler/enable_spec.rb17
-rw-r--r--spec/ruby/core/gc/profiler/enabled_spec.rb21
-rw-r--r--spec/ruby/core/gc/profiler/report_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/result_spec.rb7
-rw-r--r--spec/ruby/core/gc/profiler/total_time_spec.rb7
-rw-r--r--spec/ruby/core/gc/start_spec.rb12
-rw-r--r--spec/ruby/core/gc/stat_spec.rb62
-rw-r--r--spec/ruby/core/gc/stress_spec.rb27
-rw-r--r--spec/ruby/core/gc/total_time_spec.rb15
-rw-r--r--spec/ruby/core/hash/allocate_spec.rb15
-rw-r--r--spec/ruby/core/hash/any_spec.rb30
-rw-r--r--spec/ruby/core/hash/assoc_spec.rb50
-rw-r--r--spec/ruby/core/hash/clear_spec.rb32
-rw-r--r--spec/ruby/core/hash/clone_spec.rb12
-rw-r--r--spec/ruby/core/hash/compact_spec.rb59
-rw-r--r--spec/ruby/core/hash/compare_by_identity_spec.rb138
-rw-r--r--spec/ruby/core/hash/constructor_spec.rb110
-rw-r--r--spec/ruby/core/hash/deconstruct_keys_spec.rb23
-rw-r--r--spec/ruby/core/hash/default_proc_spec.rb80
-rw-r--r--spec/ruby/core/hash/default_spec.rb46
-rw-r--r--spec/ruby/core/hash/delete_if_spec.rb44
-rw-r--r--spec/ruby/core/hash/delete_spec.rb44
-rw-r--r--spec/ruby/core/hash/dig_spec.rb66
-rw-r--r--spec/ruby/core/hash/each_key_spec.rb23
-rw-r--r--spec/ruby/core/hash/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_value_spec.rb23
-rw-r--r--spec/ruby/core/hash/element_reference_spec.rb134
-rw-r--r--spec/ruby/core/hash/element_set_spec.rb7
-rw-r--r--spec/ruby/core/hash/empty_spec.rb15
-rw-r--r--spec/ruby/core/hash/eql_spec.rb9
-rw-r--r--spec/ruby/core/hash/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/hash/except_spec.rb34
-rw-r--r--spec/ruby/core/hash/fetch_spec.rb44
-rw-r--r--spec/ruby/core/hash/fetch_values_spec.rb35
-rw-r--r--spec/ruby/core/hash/filter_spec.rb10
-rw-r--r--spec/ruby/core/hash/fixtures/classes.rb75
-rw-r--r--spec/ruby/core/hash/fixtures/name.rb30
-rw-r--r--spec/ruby/core/hash/flatten_spec.rb62
-rw-r--r--spec/ruby/core/hash/gt_spec.rb42
-rw-r--r--spec/ruby/core/hash/gte_spec.rb42
-rw-r--r--spec/ruby/core/hash/has_key_spec.rb7
-rw-r--r--spec/ruby/core/hash/has_value_spec.rb7
-rw-r--r--spec/ruby/core/hash/hash_spec.rb53
-rw-r--r--spec/ruby/core/hash/include_spec.rb7
-rw-r--r--spec/ruby/core/hash/index_spec.rb9
-rw-r--r--spec/ruby/core/hash/initialize_spec.rb61
-rw-r--r--spec/ruby/core/hash/inspect_spec.rb7
-rw-r--r--spec/ruby/core/hash/invert_spec.rb27
-rw-r--r--spec/ruby/core/hash/keep_if_spec.rb37
-rw-r--r--spec/ruby/core/hash/key_spec.rb12
-rw-r--r--spec/ruby/core/hash/keys_spec.rb23
-rw-r--r--spec/ruby/core/hash/length_spec.rb7
-rw-r--r--spec/ruby/core/hash/lt_spec.rb42
-rw-r--r--spec/ruby/core/hash/lte_spec.rb42
-rw-r--r--spec/ruby/core/hash/member_spec.rb7
-rw-r--r--spec/ruby/core/hash/merge_spec.rb100
-rw-r--r--spec/ruby/core/hash/new_spec.rb36
-rw-r--r--spec/ruby/core/hash/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/hash/rehash_spec.rb84
-rw-r--r--spec/ruby/core/hash/reject_spec.rb95
-rw-r--r--spec/ruby/core/hash/replace_spec.rb7
-rw-r--r--spec/ruby/core/hash/ruby2_keywords_hash_spec.rb59
-rw-r--r--spec/ruby/core/hash/select_spec.rb10
-rw-r--r--spec/ruby/core/hash/shared/comparison.rb15
-rw-r--r--spec/ruby/core/hash/shared/each.rb124
-rw-r--r--spec/ruby/core/hash/shared/eql.rb204
-rw-r--r--spec/ruby/core/hash/shared/equal.rb90
-rw-r--r--spec/ruby/core/hash/shared/greater_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/index.rb37
-rw-r--r--spec/ruby/core/hash/shared/iteration.rb19
-rw-r--r--spec/ruby/core/hash/shared/key.rb38
-rw-r--r--spec/ruby/core/hash/shared/length.rb12
-rw-r--r--spec/ruby/core/hash/shared/less_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/replace.rb51
-rw-r--r--spec/ruby/core/hash/shared/select.rb91
-rw-r--r--spec/ruby/core/hash/shared/store.rb115
-rw-r--r--spec/ruby/core/hash/shared/to_s.rb89
-rw-r--r--spec/ruby/core/hash/shared/update.rb76
-rw-r--r--spec/ruby/core/hash/shared/value.rb14
-rw-r--r--spec/ruby/core/hash/shared/values_at.rb9
-rw-r--r--spec/ruby/core/hash/shift_spec.rb101
-rw-r--r--spec/ruby/core/hash/size_spec.rb7
-rw-r--r--spec/ruby/core/hash/slice_spec.rb53
-rw-r--r--spec/ruby/core/hash/sort_spec.rb17
-rw-r--r--spec/ruby/core/hash/store_spec.rb7
-rw-r--r--spec/ruby/core/hash/to_a_spec.rb39
-rw-r--r--spec/ruby/core/hash/to_h_spec.rb72
-rw-r--r--spec/ruby/core/hash/to_hash_spec.rb14
-rw-r--r--spec/ruby/core/hash/to_proc_spec.rb99
-rw-r--r--spec/ruby/core/hash/to_s_spec.rb7
-rw-r--r--spec/ruby/core/hash/transform_keys_spec.rb147
-rw-r--r--spec/ruby/core/hash/transform_values_spec.rb97
-rw-r--r--spec/ruby/core/hash/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/hash/update_spec.rb7
-rw-r--r--spec/ruby/core/hash/value_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_at_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_spec.rb10
-rw-r--r--spec/ruby/core/integer/abs_spec.rb6
-rw-r--r--spec/ruby/core/integer/allbits_spec.rb37
-rw-r--r--spec/ruby/core/integer/anybits_spec.rb36
-rw-r--r--spec/ruby/core/integer/bit_and_spec.rb97
-rw-r--r--spec/ruby/core/integer/bit_length_spec.rb76
-rw-r--r--spec/ruby/core/integer/bit_or_spec.rb89
-rw-r--r--spec/ruby/core/integer/bit_xor_spec.rb93
-rw-r--r--spec/ruby/core/integer/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/integer/ceil_spec.rb19
-rw-r--r--spec/ruby/core/integer/chr_spec.rb257
-rw-r--r--spec/ruby/core/integer/coerce_spec.rb104
-rw-r--r--spec/ruby/core/integer/comparison_spec.rb177
-rw-r--r--spec/ruby/core/integer/complement_spec.rb20
-rw-r--r--spec/ruby/core/integer/constants_spec.rb41
-rw-r--r--spec/ruby/core/integer/denominator_spec.rb20
-rw-r--r--spec/ruby/core/integer/digits_spec.rb41
-rw-r--r--spec/ruby/core/integer/div_spec.rb146
-rw-r--r--spec/ruby/core/integer/divide_spec.rb89
-rw-r--r--spec/ruby/core/integer/divmod_spec.rb117
-rw-r--r--spec/ruby/core/integer/downto_spec.rb69
-rw-r--r--spec/ruby/core/integer/dup_spec.rb13
-rw-r--r--spec/ruby/core/integer/element_reference_spec.rb188
-rw-r--r--spec/ruby/core/integer/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/integer/even_spec.rb40
-rw-r--r--spec/ruby/core/integer/exponent_spec.rb7
-rw-r--r--spec/ruby/core/integer/fdiv_spec.rb100
-rw-r--r--spec/ruby/core/integer/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/integer/floor_spec.rb19
-rw-r--r--spec/ruby/core/integer/gcd_spec.rb69
-rw-r--r--spec/ruby/core/integer/gcdlcm_spec.rb53
-rw-r--r--spec/ruby/core/integer/gt_spec.rb43
-rw-r--r--spec/ruby/core/integer/gte_spec.rb43
-rw-r--r--spec/ruby/core/integer/integer_spec.rb20
-rw-r--r--spec/ruby/core/integer/lcm_spec.rb58
-rw-r--r--spec/ruby/core/integer/left_shift_spec.rb211
-rw-r--r--spec/ruby/core/integer/lt_spec.rb45
-rw-r--r--spec/ruby/core/integer/lte_spec.rb53
-rw-r--r--spec/ruby/core/integer/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/integer/minus_spec.rb43
-rw-r--r--spec/ruby/core/integer/modulo_spec.rb10
-rw-r--r--spec/ruby/core/integer/multiply_spec.rb45
-rw-r--r--spec/ruby/core/integer/next_spec.rb6
-rw-r--r--spec/ruby/core/integer/nobits_spec.rb36
-rw-r--r--spec/ruby/core/integer/numerator_spec.rb18
-rw-r--r--spec/ruby/core/integer/odd_spec.rb38
-rw-r--r--spec/ruby/core/integer/ord_spec.rb17
-rw-r--r--spec/ruby/core/integer/plus_spec.rb58
-rw-r--r--spec/ruby/core/integer/pow_spec.rb51
-rw-r--r--spec/ruby/core/integer/pred_spec.rb11
-rw-r--r--spec/ruby/core/integer/rationalize_spec.rb39
-rw-r--r--spec/ruby/core/integer/remainder_spec.rb51
-rw-r--r--spec/ruby/core/integer/right_shift_spec.rb233
-rw-r--r--spec/ruby/core/integer/round_spec.rb83
-rw-r--r--spec/ruby/core/integer/shared/abs.rb18
-rw-r--r--spec/ruby/core/integer/shared/arithmetic_coerce.rb31
-rw-r--r--spec/ruby/core/integer/shared/comparison_coerce.rb11
-rw-r--r--spec/ruby/core/integer/shared/equal.rb58
-rw-r--r--spec/ruby/core/integer/shared/exponent.rb126
-rw-r--r--spec/ruby/core/integer/shared/integer_rounding.rb19
-rw-r--r--spec/ruby/core/integer/shared/modulo.rb74
-rw-r--r--spec/ruby/core/integer/shared/next.rb25
-rw-r--r--spec/ruby/core/integer/shared/to_i.rb8
-rw-r--r--spec/ruby/core/integer/size_spec.rb34
-rw-r--r--spec/ruby/core/integer/sqrt_spec.rb31
-rw-r--r--spec/ruby/core/integer/succ_spec.rb6
-rw-r--r--spec/ruby/core/integer/times_spec.rb79
-rw-r--r--spec/ruby/core/integer/to_f_spec.rb23
-rw-r--r--spec/ruby/core/integer/to_i_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_int_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_r_spec.rb26
-rw-r--r--spec/ruby/core/integer/to_s_spec.rb95
-rw-r--r--spec/ruby/core/integer/truncate_spec.rb19
-rw-r--r--spec/ruby/core/integer/try_convert_spec.rb40
-rw-r--r--spec/ruby/core/integer/uminus_spec.rb30
-rw-r--r--spec/ruby/core/integer/upto_spec.rb69
-rw-r--r--spec/ruby/core/integer/zero_spec.rb21
-rw-r--r--spec/ruby/core/io/advise_spec.rb86
-rw-r--r--spec/ruby/core/io/binmode_spec.rb64
-rw-r--r--spec/ruby/core/io/binread_spec.rb47
-rw-r--r--spec/ruby/core/io/binwrite_spec.rb6
-rw-r--r--spec/ruby/core/io/bytes_spec.rb47
-rw-r--r--spec/ruby/core/io/chars_spec.rb30
-rw-r--r--spec/ruby/core/io/close_on_exec_spec.rb76
-rw-r--r--spec/ruby/core/io/close_read_spec.rb60
-rw-r--r--spec/ruby/core/io/close_spec.rb118
-rw-r--r--spec/ruby/core/io/close_write_spec.rb64
-rw-r--r--spec/ruby/core/io/closed_spec.rb20
-rw-r--r--spec/ruby/core/io/codepoints_spec.rb38
-rw-r--r--spec/ruby/core/io/constants_spec.rb19
-rw-r--r--spec/ruby/core/io/copy_stream_spec.rb322
-rw-r--r--spec/ruby/core/io/dup_spec.rb106
-rw-r--r--spec/ruby/core/io/each_byte_spec.rb57
-rw-r--r--spec/ruby/core/io/each_char_spec.rb12
-rw-r--r--spec/ruby/core/io/each_codepoint_spec.rb43
-rw-r--r--spec/ruby/core/io/each_line_spec.rb11
-rw-r--r--spec/ruby/core/io/each_spec.rb11
-rw-r--r--spec/ruby/core/io/eof_spec.rb107
-rw-r--r--spec/ruby/core/io/external_encoding_spec.rb225
-rw-r--r--spec/ruby/core/io/fcntl_spec.rb8
-rw-r--r--spec/ruby/core/io/fdatasync_spec.rb5
-rw-r--r--spec/ruby/core/io/fileno_spec.rb12
-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16BE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16LE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32BE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32LE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/classes.rb218
-rw-r--r--spec/ruby/core/io/fixtures/copy_in_out.rb2
-rw-r--r--spec/ruby/core/io/fixtures/copy_stream.txt6
-rw-r--r--spec/ruby/core/io/fixtures/empty.txt0
-rw-r--r--spec/ruby/core/io/fixtures/incomplete.txt1
-rw-r--r--spec/ruby/core/io/fixtures/lines.txt9
-rw-r--r--spec/ruby/core/io/fixtures/no_bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/numbered_lines.txt5
-rw-r--r--spec/ruby/core/io/fixtures/one_byte.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_binary.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_euc_jp.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_text.txt1
-rw-r--r--spec/ruby/core/io/fixtures/reopen_stdout.rb3
-rw-r--r--spec/ruby/core/io/flush_spec.rb37
-rw-r--r--spec/ruby/core/io/for_fd_spec.rb10
-rw-r--r--spec/ruby/core/io/foreach_spec.rb81
-rw-r--r--spec/ruby/core/io/fsync_spec.rb24
-rw-r--r--spec/ruby/core/io/getbyte_spec.rb42
-rw-r--r--spec/ruby/core/io/getc_spec.rb42
-rw-r--r--spec/ruby/core/io/gets_spec.rb315
-rw-r--r--spec/ruby/core/io/initialize_spec.rb49
-rw-r--r--spec/ruby/core/io/inspect_spec.rb23
-rw-r--r--spec/ruby/core/io/internal_encoding_spec.rb147
-rw-r--r--spec/ruby/core/io/io_spec.rb11
-rw-r--r--spec/ruby/core/io/ioctl_spec.rb32
-rw-r--r--spec/ruby/core/io/isatty_spec.rb6
-rw-r--r--spec/ruby/core/io/lineno_spec.rb136
-rw-r--r--spec/ruby/core/io/lines_spec.rb46
-rw-r--r--spec/ruby/core/io/new_spec.rb12
-rw-r--r--spec/ruby/core/io/nonblock_spec.rb70
-rw-r--r--spec/ruby/core/io/open_spec.rb86
-rw-r--r--spec/ruby/core/io/output_spec.rb27
-rw-r--r--spec/ruby/core/io/path_spec.rb14
-rw-r--r--spec/ruby/core/io/pid_spec.rb35
-rw-r--r--spec/ruby/core/io/pipe_spec.rb225
-rw-r--r--spec/ruby/core/io/popen_spec.rb271
-rw-r--r--spec/ruby/core/io/pos_spec.rb11
-rw-r--r--spec/ruby/core/io/pread_spec.rb50
-rw-r--r--spec/ruby/core/io/print_spec.rb66
-rw-r--r--spec/ruby/core/io/printf_spec.rb32
-rw-r--r--spec/ruby/core/io/putc_spec.rb11
-rw-r--r--spec/ruby/core/io/puts_spec.rb139
-rw-r--r--spec/ruby/core/io/pwrite_spec.rb43
-rw-r--r--spec/ruby/core/io/read_nonblock_spec.rb148
-rw-r--r--spec/ruby/core/io/read_spec.rb627
-rw-r--r--spec/ruby/core/io/readbyte_spec.rb24
-rw-r--r--spec/ruby/core/io/readchar_spec.rb110
-rw-r--r--spec/ruby/core/io/readline_spec.rb86
-rw-r--r--spec/ruby/core/io/readlines_spec.rb236
-rw-r--r--spec/ruby/core/io/readpartial_spec.rb111
-rw-r--r--spec/ruby/core/io/reopen_spec.rb313
-rw-r--r--spec/ruby/core/io/rewind_spec.rb53
-rw-r--r--spec/ruby/core/io/seek_spec.rb79
-rw-r--r--spec/ruby/core/io/select_spec.rb120
-rw-r--r--spec/ruby/core/io/set_encoding_by_bom_spec.rb262
-rw-r--r--spec/ruby/core/io/set_encoding_spec.rb238
-rw-r--r--spec/ruby/core/io/shared/binwrite.rb78
-rw-r--r--spec/ruby/core/io/shared/chars.rb73
-rw-r--r--spec/ruby/core/io/shared/codepoints.rb54
-rw-r--r--spec/ruby/core/io/shared/each.rb267
-rw-r--r--spec/ruby/core/io/shared/gets_ascii.rb19
-rw-r--r--spec/ruby/core/io/shared/new.rb404
-rw-r--r--spec/ruby/core/io/shared/pos.rb78
-rw-r--r--spec/ruby/core/io/shared/readlines.rb263
-rw-r--r--spec/ruby/core/io/shared/tty.rb24
-rw-r--r--spec/ruby/core/io/shared/write.rb99
-rw-r--r--spec/ruby/core/io/stat_spec.rb24
-rw-r--r--spec/ruby/core/io/sync_spec.rb64
-rw-r--r--spec/ruby/core/io/sysopen_spec.rb50
-rw-r--r--spec/ruby/core/io/sysread_spec.rb132
-rw-r--r--spec/ruby/core/io/sysseek_spec.rb49
-rw-r--r--spec/ruby/core/io/syswrite_spec.rb81
-rw-r--r--spec/ruby/core/io/tell_spec.rb7
-rw-r--r--spec/ruby/core/io/to_i_spec.rb12
-rw-r--r--spec/ruby/core/io/to_io_spec.rb21
-rw-r--r--spec/ruby/core/io/try_convert_spec.rb49
-rw-r--r--spec/ruby/core/io/tty_spec.rb6
-rw-r--r--spec/ruby/core/io/ungetbyte_spec.rb54
-rw-r--r--spec/ruby/core/io/ungetc_spec.rb148
-rw-r--r--spec/ruby/core/io/write_nonblock_spec.rb95
-rw-r--r--spec/ruby/core/io/write_spec.rb204
-rw-r--r--spec/ruby/core/kernel/Array_spec.rb97
-rw-r--r--spec/ruby/core/kernel/Complex_spec.rb272
-rw-r--r--spec/ruby/core/kernel/Float_spec.rb345
-rw-r--r--spec/ruby/core/kernel/Hash_spec.rb63
-rw-r--r--spec/ruby/core/kernel/Integer_spec.rb801
-rw-r--r--spec/ruby/core/kernel/Rational_spec.rb6
-rw-r--r--spec/ruby/core/kernel/String_spec.rb106
-rw-r--r--spec/ruby/core/kernel/__callee___spec.rb48
-rw-r--r--spec/ruby/core/kernel/__dir___spec.rb37
-rw-r--r--spec/ruby/core/kernel/__method___spec.rb40
-rw-r--r--spec/ruby/core/kernel/abort_spec.rb15
-rw-r--r--spec/ruby/core/kernel/at_exit_spec.rb70
-rw-r--r--spec/ruby/core/kernel/autoload_spec.rb175
-rw-r--r--spec/ruby/core/kernel/backtick_spec.rb84
-rw-r--r--spec/ruby/core/kernel/binding_spec.rb51
-rw-r--r--spec/ruby/core/kernel/block_given_spec.rb38
-rw-r--r--spec/ruby/core/kernel/caller_locations_spec.rb84
-rw-r--r--spec/ruby/core/kernel/caller_spec.rb70
-rw-r--r--spec/ruby/core/kernel/case_compare_spec.rb135
-rw-r--r--spec/ruby/core/kernel/catch_spec.rb127
-rw-r--r--spec/ruby/core/kernel/chomp_spec.rb65
-rw-r--r--spec/ruby/core/kernel/chop_spec.rb53
-rw-r--r--spec/ruby/core/kernel/class_spec.rb26
-rw-r--r--spec/ruby/core/kernel/clone_spec.rb209
-rw-r--r--spec/ruby/core/kernel/comparison_spec.rb31
-rw-r--r--spec/ruby/core/kernel/define_singleton_method_spec.rb114
-rw-r--r--spec/ruby/core/kernel/display_spec.rb6
-rw-r--r--spec/ruby/core/kernel/dup_spec.rb67
-rw-r--r--spec/ruby/core/kernel/enum_for_spec.rb5
-rw-r--r--spec/ruby/core/kernel/eql_spec.rb10
-rw-r--r--spec/ruby/core/kernel/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/kernel/eval_spec.rb439
-rw-r--r--spec/ruby/core/kernel/exec_spec.rb18
-rw-r--r--spec/ruby/core/kernel/exit_spec.rb27
-rw-r--r--spec/ruby/core/kernel/extend_spec.rb79
-rw-r--r--spec/ruby/core/kernel/fail_spec.rb42
-rw-r--r--spec/ruby/core/kernel/fixtures/Complex.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/__callee__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/__dir__.rb2
-rw-r--r--spec/ruby/core/kernel/fixtures/__method__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/at_exit.rb3
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_b.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_d.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module2.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_frozen.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_at_exit.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_locations.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/classes.rb504
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_locals.rb6
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_with_lambda.rb12
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_without_lambda.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/singleton_methods.rb13
-rw-r--r--spec/ruby/core/kernel/fixtures/test.rb362
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_core_method.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_require.rb1
-rw-r--r--spec/ruby/core/kernel/fixtures/warn_require_caller.rb2
-rw-r--r--spec/ruby/core/kernel/fork_spec.rb15
-rw-r--r--spec/ruby/core/kernel/format_spec.rb15
-rw-r--r--spec/ruby/core/kernel/freeze_spec.rb91
-rw-r--r--spec/ruby/core/kernel/frozen_spec.rb76
-rw-r--r--spec/ruby/core/kernel/gets_spec.rb17
-rw-r--r--spec/ruby/core/kernel/global_variables_spec.rb26
-rw-r--r--spec/ruby/core/kernel/gsub_spec.rb96
-rw-r--r--spec/ruby/core/kernel/initialize_clone_spec.rb28
-rw-r--r--spec/ruby/core/kernel/initialize_copy_spec.rb29
-rw-r--r--spec/ruby/core/kernel/initialize_dup_spec.rb20
-rw-r--r--spec/ruby/core/kernel/inspect_spec.rb31
-rw-r--r--spec/ruby/core/kernel/instance_of_spec.rb40
-rw-r--r--spec/ruby/core/kernel/instance_variable_defined_spec.rb41
-rw-r--r--spec/ruby/core/kernel/instance_variable_get_spec.rb111
-rw-r--r--spec/ruby/core/kernel/instance_variable_set_spec.rb105
-rw-r--r--spec/ruby/core/kernel/instance_variables_spec.rb40
-rw-r--r--spec/ruby/core/kernel/is_a_spec.rb6
-rw-r--r--spec/ruby/core/kernel/iterator_spec.rb14
-rw-r--r--spec/ruby/core/kernel/itself_spec.rb9
-rw-r--r--spec/ruby/core/kernel/kind_of_spec.rb6
-rw-r--r--spec/ruby/core/kernel/lambda_spec.rb150
-rw-r--r--spec/ruby/core/kernel/load_spec.rb40
-rw-r--r--spec/ruby/core/kernel/local_variables_spec.rb48
-rw-r--r--spec/ruby/core/kernel/loop_spec.rb79
-rw-r--r--spec/ruby/core/kernel/match_spec.rb30
-rw-r--r--spec/ruby/core/kernel/method_spec.rb61
-rw-r--r--spec/ruby/core/kernel/methods_spec.rb101
-rw-r--r--spec/ruby/core/kernel/nil_spec.rb12
-rw-r--r--spec/ruby/core/kernel/not_match_spec.rb21
-rw-r--r--spec/ruby/core/kernel/object_id_spec.rb6
-rw-r--r--spec/ruby/core/kernel/open_spec.rb167
-rw-r--r--spec/ruby/core/kernel/p_spec.rb85
-rw-r--r--spec/ruby/core/kernel/pp_spec.rb9
-rw-r--r--spec/ruby/core/kernel/print_spec.rb24
-rw-r--r--spec/ruby/core/kernel/printf_spec.rb63
-rw-r--r--spec/ruby/core/kernel/private_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/proc_spec.rb58
-rw-r--r--spec/ruby/core/kernel/protected_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/public_method_spec.rb32
-rw-r--r--spec/ruby/core/kernel/public_methods_spec.rb76
-rw-r--r--spec/ruby/core/kernel/public_send_spec.rb116
-rw-r--r--spec/ruby/core/kernel/putc_spec.rb39
-rw-r--r--spec/ruby/core/kernel/puts_spec.rb29
-rw-r--r--spec/ruby/core/kernel/raise_spec.rb57
-rw-r--r--spec/ruby/core/kernel/rand_spec.rb197
-rw-r--r--spec/ruby/core/kernel/readline_spec.rb12
-rw-r--r--spec/ruby/core/kernel/readlines_spec.rb12
-rw-r--r--spec/ruby/core/kernel/remove_instance_variable_spec.rb72
-rw-r--r--spec/ruby/core/kernel/require_relative_spec.rb437
-rw-r--r--spec/ruby/core/kernel/require_spec.rb34
-rw-r--r--spec/ruby/core/kernel/respond_to_missing_spec.rb100
-rw-r--r--spec/ruby/core/kernel/respond_to_spec.rb72
-rw-r--r--spec/ruby/core/kernel/select_spec.rb18
-rw-r--r--spec/ruby/core/kernel/send_spec.rb68
-rw-r--r--spec/ruby/core/kernel/set_trace_func_spec.rb12
-rw-r--r--spec/ruby/core/kernel/shared/dup_clone.rb91
-rw-r--r--spec/ruby/core/kernel/shared/kind_of.rb55
-rw-r--r--spec/ruby/core/kernel/shared/lambda.rb11
-rw-r--r--spec/ruby/core/kernel/shared/load.rb207
-rw-r--r--spec/ruby/core/kernel/shared/method.rb56
-rw-r--r--spec/ruby/core/kernel/shared/require.rb808
-rw-r--r--spec/ruby/core/kernel/shared/sprintf.rb993
-rw-r--r--spec/ruby/core/kernel/shared/sprintf_encoding.rb67
-rw-r--r--spec/ruby/core/kernel/shared/then.rb20
-rw-r--r--spec/ruby/core/kernel/singleton_class_spec.rb29
-rw-r--r--spec/ruby/core/kernel/singleton_method_spec.rb41
-rw-r--r--spec/ruby/core/kernel/singleton_methods_spec.rb192
-rw-r--r--spec/ruby/core/kernel/sleep_spec.rb62
-rw-r--r--spec/ruby/core/kernel/spawn_spec.rb25
-rw-r--r--spec/ruby/core/kernel/sprintf_spec.rb24
-rw-r--r--spec/ruby/core/kernel/srand_spec.rb73
-rw-r--r--spec/ruby/core/kernel/sub_spec.rb26
-rw-r--r--spec/ruby/core/kernel/syscall_spec.rb12
-rw-r--r--spec/ruby/core/kernel/system_spec.rb115
-rw-r--r--spec/ruby/core/kernel/taint_spec.rb19
-rw-r--r--spec/ruby/core/kernel/tainted_spec.rb21
-rw-r--r--spec/ruby/core/kernel/tap_spec.rb13
-rw-r--r--spec/ruby/core/kernel/test_spec.rb109
-rw-r--r--spec/ruby/core/kernel/then_spec.rb6
-rw-r--r--spec/ruby/core/kernel/throw_spec.rb80
-rw-r--r--spec/ruby/core/kernel/to_enum_spec.rb5
-rw-r--r--spec/ruby/core/kernel/to_s_spec.rb8
-rw-r--r--spec/ruby/core/kernel/trace_var_spec.rb54
-rw-r--r--spec/ruby/core/kernel/trap_spec.rb9
-rw-r--r--spec/ruby/core/kernel/trust_spec.rb20
-rw-r--r--spec/ruby/core/kernel/untaint_spec.rb20
-rw-r--r--spec/ruby/core/kernel/untrace_var_spec.rb12
-rw-r--r--spec/ruby/core/kernel/untrust_spec.rb19
-rw-r--r--spec/ruby/core/kernel/untrusted_spec.rb20
-rw-r--r--spec/ruby/core/kernel/warn_spec.rb309
-rw-r--r--spec/ruby/core/kernel/yield_self_spec.rb6
-rw-r--r--spec/ruby/core/main/define_method_spec.rb28
-rw-r--r--spec/ruby/core/main/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement.rb7
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement_user.rb11
-rw-r--r--spec/ruby/core/main/fixtures/using.rb1
-rw-r--r--spec/ruby/core/main/fixtures/using_in_main.rb5
-rw-r--r--spec/ruby/core/main/fixtures/using_in_method.rb5
-rw-r--r--spec/ruby/core/main/fixtures/wrapped_include.rb1
-rw-r--r--spec/ruby/core/main/include_spec.rb16
-rw-r--r--spec/ruby/core/main/private_spec.rb52
-rw-r--r--spec/ruby/core/main/public_spec.rb53
-rw-r--r--spec/ruby/core/main/ruby2_keywords_spec.rb9
-rw-r--r--spec/ruby/core/main/to_s_spec.rb7
-rw-r--r--spec/ruby/core/main/using_spec.rb152
-rw-r--r--spec/ruby/core/marshal/dump_spec.rb650
-rw-r--r--spec/ruby/core/marshal/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/marshal/fixtures/marshal_data.rb420
-rw-r--r--spec/ruby/core/marshal/fixtures/random.dumpbin0 -> 2520 bytes-rw-r--r--spec/ruby/core/marshal/float_spec.rb77
-rw-r--r--spec/ruby/core/marshal/load_spec.rb6
-rw-r--r--spec/ruby/core/marshal/major_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/minor_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/restore_spec.rb6
-rw-r--r--spec/ruby/core/marshal/shared/load.rb987
-rw-r--r--spec/ruby/core/matchdata/allocate_spec.rb8
-rw-r--r--spec/ruby/core/matchdata/begin_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/captures_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/dup_spec.rb14
-rw-r--r--spec/ruby/core/matchdata/element_reference_spec.rb116
-rw-r--r--spec/ruby/core/matchdata/end_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/eql_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/matchdata/hash_spec.rb5
-rw-r--r--spec/ruby/core/matchdata/inspect_spec.rb23
-rw-r--r--spec/ruby/core/matchdata/length_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/match_length_spec.rb34
-rw-r--r--spec/ruby/core/matchdata/match_spec.rb34
-rw-r--r--spec/ruby/core/matchdata/named_captures_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/names_spec.rb33
-rw-r--r--spec/ruby/core/matchdata/offset_spec.rb30
-rw-r--r--spec/ruby/core/matchdata/post_match_spec.rb26
-rw-r--r--spec/ruby/core/matchdata/pre_match_spec.rb26
-rw-r--r--spec/ruby/core/matchdata/regexp_spec.rb24
-rw-r--r--spec/ruby/core/matchdata/shared/eql.rb26
-rw-r--r--spec/ruby/core/matchdata/shared/length.rb5
-rw-r--r--spec/ruby/core/matchdata/size_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/string_spec.rb25
-rw-r--r--spec/ruby/core/matchdata/to_a_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/to_s_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/values_at_spec.rb76
-rw-r--r--spec/ruby/core/math/acos_spec.rb56
-rw-r--r--spec/ruby/core/math/acosh_spec.rb41
-rw-r--r--spec/ruby/core/math/asin_spec.rb48
-rw-r--r--spec/ruby/core/math/asinh_spec.rb42
-rw-r--r--spec/ruby/core/math/atan2_spec.rb54
-rw-r--r--spec/ruby/core/math/atan_spec.rb40
-rw-r--r--spec/ruby/core/math/atanh_spec.rb14
-rw-r--r--spec/ruby/core/math/cbrt_spec.rb27
-rw-r--r--spec/ruby/core/math/constants_spec.rb22
-rw-r--r--spec/ruby/core/math/cos_spec.rb42
-rw-r--r--spec/ruby/core/math/cosh_spec.rb37
-rw-r--r--spec/ruby/core/math/erf_spec.rb44
-rw-r--r--spec/ruby/core/math/erfc_spec.rb43
-rw-r--r--spec/ruby/core/math/exp_spec.rb37
-rw-r--r--spec/ruby/core/math/fixtures/classes.rb28
-rw-r--r--spec/ruby/core/math/frexp_spec.rb37
-rw-r--r--spec/ruby/core/math/gamma_spec.rb69
-rw-r--r--spec/ruby/core/math/hypot_spec.rb41
-rw-r--r--spec/ruby/core/math/ldexp_spec.rb60
-rw-r--r--spec/ruby/core/math/lgamma_spec.rb54
-rw-r--r--spec/ruby/core/math/log10_spec.rb43
-rw-r--r--spec/ruby/core/math/log2_spec.rb41
-rw-r--r--spec/ruby/core/math/log_spec.rb57
-rw-r--r--spec/ruby/core/math/sin_spec.rb39
-rw-r--r--spec/ruby/core/math/sinh_spec.rb37
-rw-r--r--spec/ruby/core/math/sqrt_spec.rb40
-rw-r--r--spec/ruby/core/math/tan_spec.rb42
-rw-r--r--spec/ruby/core/math/tanh_spec.rb39
-rw-r--r--spec/ruby/core/method/arity_spec.rb222
-rw-r--r--spec/ruby/core/method/call_spec.rb7
-rw-r--r--spec/ruby/core/method/case_compare_spec.rb7
-rw-r--r--spec/ruby/core/method/clone_spec.rb14
-rw-r--r--spec/ruby/core/method/compose_spec.rb100
-rw-r--r--spec/ruby/core/method/curry_spec.rb36
-rw-r--r--spec/ruby/core/method/element_reference_spec.rb7
-rw-r--r--spec/ruby/core/method/eql_spec.rb6
-rw-r--r--spec/ruby/core/method/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/method/fixtures/classes.rb246
-rw-r--r--spec/ruby/core/method/hash_spec.rb15
-rw-r--r--spec/ruby/core/method/inspect_spec.rb6
-rw-r--r--spec/ruby/core/method/name_spec.rb22
-rw-r--r--spec/ruby/core/method/original_name_spec.rb22
-rw-r--r--spec/ruby/core/method/owner_spec.rb32
-rw-r--r--spec/ruby/core/method/parameters_spec.rb270
-rw-r--r--spec/ruby/core/method/private_spec.rb21
-rw-r--r--spec/ruby/core/method/protected_spec.rb21
-rw-r--r--spec/ruby/core/method/public_spec.rb21
-rw-r--r--spec/ruby/core/method/receiver_spec.rb22
-rw-r--r--spec/ruby/core/method/shared/call.rb51
-rw-r--r--spec/ruby/core/method/shared/eql.rb94
-rw-r--r--spec/ruby/core/method/shared/to_s.rb85
-rw-r--r--spec/ruby/core/method/source_location_spec.rb113
-rw-r--r--spec/ruby/core/method/super_method_spec.rb66
-rw-r--r--spec/ruby/core/method/to_proc_spec.rb104
-rw-r--r--spec/ruby/core/method/to_s_spec.rb6
-rw-r--r--spec/ruby/core/method/unbind_spec.rb54
-rw-r--r--spec/ruby/core/module/alias_method_spec.rb173
-rw-r--r--spec/ruby/core/module/ancestors_spec.rb70
-rw-r--r--spec/ruby/core/module/append_features_spec.rb61
-rw-r--r--spec/ruby/core/module/attr_accessor_spec.rb119
-rw-r--r--spec/ruby/core/module/attr_reader_spec.rb80
-rw-r--r--spec/ruby/core/module/attr_spec.rb168
-rw-r--r--spec/ruby/core/module/attr_writer_spec.rb90
-rw-r--r--spec/ruby/core/module/autoload_spec.rb1012
-rw-r--r--spec/ruby/core/module/case_compare_spec.rb31
-rw-r--r--spec/ruby/core/module/class_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/class_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/class_variable_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/class_variable_get_spec.rb76
-rw-r--r--spec/ruby/core/module/class_variable_set_spec.rb62
-rw-r--r--spec/ruby/core/module/class_variables_spec.rb34
-rw-r--r--spec/ruby/core/module/comparison_spec.rb36
-rw-r--r--spec/ruby/core/module/const_added_spec.rb125
-rw-r--r--spec/ruby/core/module/const_defined_spec.rb154
-rw-r--r--spec/ruby/core/module/const_get_spec.rb251
-rw-r--r--spec/ruby/core/module/const_missing_spec.rb36
-rw-r--r--spec/ruby/core/module/const_set_spec.rb142
-rw-r--r--spec/ruby/core/module/const_source_location_spec.rb225
-rw-r--r--spec/ruby/core/module/constants_spec.rb97
-rw-r--r--spec/ruby/core/module/define_method_spec.rb805
-rw-r--r--spec/ruby/core/module/define_singleton_method_spec.rb15
-rw-r--r--spec/ruby/core/module/deprecate_constant_spec.rb61
-rw-r--r--spec/ruby/core/module/eql_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/module/extend_object_spec.rb56
-rw-r--r--spec/ruby/core/module/extended_spec.rb44
-rw-r--r--spec/ruby/core/module/fixtures/autoload.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_abc.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_c.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_callback.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_concur.rb9
-rw-r--r--spec/ruby/core/module/fixtures/autoload_d.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_autoload.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require_current_file.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_e.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_empty.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_ex1.rb16
-rw-r--r--spec/ruby/core/module/fixtures/autoload_exception.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_f.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_g.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_h.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_i.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_j.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_k.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_lm.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_location.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_nested.rb8
-rw-r--r--spec/ruby/core/module/fixtures/autoload_never_set.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_o.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_overridden.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_r.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_raise.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_nested.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_no_constant.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_s.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_self_during_require.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_subclass.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_t.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_v.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w2.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_x.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_z.rb5
-rw-r--r--spec/ruby/core/module/fixtures/classes.rb627
-rw-r--r--spec/ruby/core/module/fixtures/constant_unicode.rb5
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload.rb6
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_a.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_b.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_c.rb3
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_d.rb4
-rw-r--r--spec/ruby/core/module/fixtures/module.rb4
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo.rb6
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo/bar_baz.rb11
-rw-r--r--spec/ruby/core/module/fixtures/name.rb10
-rw-r--r--spec/ruby/core/module/fixtures/path1/load_path.rb9
-rw-r--r--spec/ruby/core/module/fixtures/path2/load_path.rb1
-rw-r--r--spec/ruby/core/module/fixtures/refine.rb25
-rw-r--r--spec/ruby/core/module/fixtures/repeated_concurrent_autoload.rb8
-rw-r--r--spec/ruby/core/module/freeze_spec.rb6
-rw-r--r--spec/ruby/core/module/gt_spec.rb36
-rw-r--r--spec/ruby/core/module/gte_spec.rb33
-rw-r--r--spec/ruby/core/module/include_spec.rb577
-rw-r--r--spec/ruby/core/module/included_modules_spec.rb14
-rw-r--r--spec/ruby/core/module/included_spec.rb44
-rw-r--r--spec/ruby/core/module/initialize_copy_spec.rb18
-rw-r--r--spec/ruby/core/module/initialize_spec.rb18
-rw-r--r--spec/ruby/core/module/instance_method_spec.rb111
-rw-r--r--spec/ruby/core/module/instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/lt_spec.rb36
-rw-r--r--spec/ruby/core/module/lte_spec.rb33
-rw-r--r--spec/ruby/core/module/method_added_spec.rb83
-rw-r--r--spec/ruby/core/module/method_defined_spec.rb98
-rw-r--r--spec/ruby/core/module/method_removed_spec.rb33
-rw-r--r--spec/ruby/core/module/method_undefined_spec.rb33
-rw-r--r--spec/ruby/core/module/module_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/module_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/module_function_spec.rb285
-rw-r--r--spec/ruby/core/module/name_spec.rb130
-rw-r--r--spec/ruby/core/module/nesting_spec.rb31
-rw-r--r--spec/ruby/core/module/new_spec.rb31
-rw-r--r--spec/ruby/core/module/prepend_features_spec.rb64
-rw-r--r--spec/ruby/core/module/prepend_spec.rb761
-rw-r--r--spec/ruby/core/module/prepended_spec.rb25
-rw-r--r--spec/ruby/core/module/private_class_method_spec.rb93
-rw-r--r--spec/ruby/core/module/private_constant_spec.rb32
-rw-r--r--spec/ruby/core/module/private_instance_methods_spec.rb54
-rw-r--r--spec/ruby/core/module/private_method_defined_spec.rb120
-rw-r--r--spec/ruby/core/module/private_spec.rb107
-rw-r--r--spec/ruby/core/module/protected_instance_methods_spec.rb57
-rw-r--r--spec/ruby/core/module/protected_method_defined_spec.rb120
-rw-r--r--spec/ruby/core/module/protected_spec.rb69
-rw-r--r--spec/ruby/core/module/public_class_method_spec.rb96
-rw-r--r--spec/ruby/core/module/public_constant_spec.rb38
-rw-r--r--spec/ruby/core/module/public_instance_method_spec.rb65
-rw-r--r--spec/ruby/core/module/public_instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/public_method_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/public_spec.rb57
-rw-r--r--spec/ruby/core/module/refine_spec.rb1051
-rw-r--r--spec/ruby/core/module/remove_class_variable_spec.rb44
-rw-r--r--spec/ruby/core/module/remove_const_spec.rb105
-rw-r--r--spec/ruby/core/module/remove_method_spec.rb131
-rw-r--r--spec/ruby/core/module/ruby2_keywords_spec.rb319
-rw-r--r--spec/ruby/core/module/shared/class_eval.rb168
-rw-r--r--spec/ruby/core/module/shared/class_exec.rb29
-rw-r--r--spec/ruby/core/module/shared/equal_value.rb14
-rw-r--r--spec/ruby/core/module/shared/set_visibility.rb186
-rw-r--r--spec/ruby/core/module/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/module/to_s_spec.rb68
-rw-r--r--spec/ruby/core/module/undef_method_spec.rb181
-rw-r--r--spec/ruby/core/module/using_spec.rb377
-rw-r--r--spec/ruby/core/mutex/lock_spec.rb34
-rw-r--r--spec/ruby/core/mutex/locked_spec.rb36
-rw-r--r--spec/ruby/core/mutex/owned_spec.rb55
-rw-r--r--spec/ruby/core/mutex/sleep_spec.rb103
-rw-r--r--spec/ruby/core/mutex/synchronize_spec.rb66
-rw-r--r--spec/ruby/core/mutex/try_lock_spec.rb32
-rw-r--r--spec/ruby/core/mutex/unlock_spec.rb38
-rw-r--r--spec/ruby/core/nil/and_spec.rb11
-rw-r--r--spec/ruby/core/nil/case_compare_spec.rb13
-rw-r--r--spec/ruby/core/nil/dup_spec.rb7
-rw-r--r--spec/ruby/core/nil/inspect_spec.rb7
-rw-r--r--spec/ruby/core/nil/match_spec.rb21
-rw-r--r--spec/ruby/core/nil/nil_spec.rb7
-rw-r--r--spec/ruby/core/nil/nilclass_spec.rb15
-rw-r--r--spec/ruby/core/nil/or_spec.rb11
-rw-r--r--spec/ruby/core/nil/rationalize_spec.rb16
-rw-r--r--spec/ruby/core/nil/to_a_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_c_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_f_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_h_spec.rb8
-rw-r--r--spec/ruby/core/nil/to_i_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_r_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_s_spec.rb15
-rw-r--r--spec/ruby/core/nil/xor_spec.rb11
-rw-r--r--spec/ruby/core/numeric/abs2_spec.rb34
-rw-r--r--spec/ruby/core/numeric/abs_spec.rb6
-rw-r--r--spec/ruby/core/numeric/angle_spec.rb6
-rw-r--r--spec/ruby/core/numeric/arg_spec.rb6
-rw-r--r--spec/ruby/core/numeric/ceil_spec.rb15
-rw-r--r--spec/ruby/core/numeric/clone_spec.rb32
-rw-r--r--spec/ruby/core/numeric/coerce_spec.rb59
-rw-r--r--spec/ruby/core/numeric/comparison_spec.rb48
-rw-r--r--spec/ruby/core/numeric/conj_spec.rb6
-rw-r--r--spec/ruby/core/numeric/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/numeric/denominator_spec.rb24
-rw-r--r--spec/ruby/core/numeric/div_spec.rb22
-rw-r--r--spec/ruby/core/numeric/divmod_spec.rb15
-rw-r--r--spec/ruby/core/numeric/dup_spec.rb16
-rw-r--r--spec/ruby/core/numeric/eql_spec.rb22
-rw-r--r--spec/ruby/core/numeric/fdiv_spec.rb32
-rw-r--r--spec/ruby/core/numeric/finite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/fixtures/classes.rb17
-rw-r--r--spec/ruby/core/numeric/floor_spec.rb14
-rw-r--r--spec/ruby/core/numeric/i_spec.rb15
-rw-r--r--spec/ruby/core/numeric/imag_spec.rb6
-rw-r--r--spec/ruby/core/numeric/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/numeric/infinite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/integer_spec.rb8
-rw-r--r--spec/ruby/core/numeric/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/numeric/modulo_spec.rb24
-rw-r--r--spec/ruby/core/numeric/negative_spec.rb41
-rw-r--r--spec/ruby/core/numeric/nonzero_spec.rb18
-rw-r--r--spec/ruby/core/numeric/numerator_spec.rb33
-rw-r--r--spec/ruby/core/numeric/numeric_spec.rb7
-rw-r--r--spec/ruby/core/numeric/phase_spec.rb6
-rw-r--r--spec/ruby/core/numeric/polar_spec.rb50
-rw-r--r--spec/ruby/core/numeric/positive_spec.rb41
-rw-r--r--spec/ruby/core/numeric/quo_spec.rb64
-rw-r--r--spec/ruby/core/numeric/real_spec.rb37
-rw-r--r--spec/ruby/core/numeric/rect_spec.rb6
-rw-r--r--spec/ruby/core/numeric/rectangular_spec.rb6
-rw-r--r--spec/ruby/core/numeric/remainder_spec.rb67
-rw-r--r--spec/ruby/core/numeric/round_spec.rb14
-rw-r--r--spec/ruby/core/numeric/shared/abs.rb19
-rw-r--r--spec/ruby/core/numeric/shared/arg.rb38
-rw-r--r--spec/ruby/core/numeric/shared/conj.rb20
-rw-r--r--spec/ruby/core/numeric/shared/imag.rb26
-rw-r--r--spec/ruby/core/numeric/shared/quo.rb7
-rw-r--r--spec/ruby/core/numeric/shared/rect.rb48
-rw-r--r--spec/ruby/core/numeric/shared/step.rb416
-rw-r--r--spec/ruby/core/numeric/singleton_method_added_spec.rb41
-rw-r--r--spec/ruby/core/numeric/step_spec.rb198
-rw-r--r--spec/ruby/core/numeric/to_c_spec.rb45
-rw-r--r--spec/ruby/core/numeric/to_int_spec.rb10
-rw-r--r--spec/ruby/core/numeric/truncate_spec.rb14
-rw-r--r--spec/ruby/core/numeric/uminus_spec.rb31
-rw-r--r--spec/ruby/core/numeric/uplus_spec.rb9
-rw-r--r--spec/ruby/core/numeric/zero_spec.rb18
-rw-r--r--spec/ruby/core/objectspace/_id2ref_spec.rb52
-rw-r--r--spec/ruby/core/objectspace/add_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/call_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/count_objects_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/define_finalizer_spec.rb194
-rw-r--r--spec/ruby/core/objectspace/each_object_spec.rb213
-rw-r--r--spec/ruby/core/objectspace/finalizers_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/fixtures/classes.rb64
-rw-r--r--spec/ruby/core/objectspace/garbage_collect_spec.rb22
-rw-r--r--spec/ruby/core/objectspace/remove_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/undefine_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_key_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/each_value_spec.rb11
-rw-r--r--spec/ruby/core/objectspace/weakmap/element_reference_spec.rb24
-rw-r--r--spec/ruby/core/objectspace/weakmap/element_set_spec.rb38
-rw-r--r--spec/ruby/core/objectspace/weakmap/include_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/inspect_spec.rb25
-rw-r--r--spec/ruby/core/objectspace/weakmap/key_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/keys_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/length_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/member_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/each.rb10
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/include.rb30
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/members.rb14
-rw-r--r--spec/ruby/core/objectspace/weakmap/shared/size.rb14
-rw-r--r--spec/ruby/core/objectspace/weakmap/size_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap/values_spec.rb6
-rw-r--r--spec/ruby/core/objectspace/weakmap_spec.rb12
-rw-r--r--spec/ruby/core/proc/allocate_spec.rb9
-rw-r--r--spec/ruby/core/proc/arity_spec.rb640
-rw-r--r--spec/ruby/core/proc/binding_spec.rb21
-rw-r--r--spec/ruby/core/proc/block_pass_spec.rb21
-rw-r--r--spec/ruby/core/proc/call_spec.rb16
-rw-r--r--spec/ruby/core/proc/case_compare_spec.rb16
-rw-r--r--spec/ruby/core/proc/clone_spec.rb6
-rw-r--r--spec/ruby/core/proc/compose_spec.rb162
-rw-r--r--spec/ruby/core/proc/curry_spec.rb180
-rw-r--r--spec/ruby/core/proc/dup_spec.rb6
-rw-r--r--spec/ruby/core/proc/element_reference_spec.rb27
-rw-r--r--spec/ruby/core/proc/eql_spec.rb12
-rw-r--r--spec/ruby/core/proc/equal_value_spec.rb12
-rw-r--r--spec/ruby/core/proc/fixtures/common.rb51
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref.rb9
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref_frozen.rb10
-rw-r--r--spec/ruby/core/proc/fixtures/source_location.rb55
-rw-r--r--spec/ruby/core/proc/hash_spec.rb17
-rw-r--r--spec/ruby/core/proc/inspect_spec.rb6
-rw-r--r--spec/ruby/core/proc/lambda_spec.rb60
-rw-r--r--spec/ruby/core/proc/new_spec.rb201
-rw-r--r--spec/ruby/core/proc/parameters_spec.rb118
-rw-r--r--spec/ruby/core/proc/ruby2_keywords_spec.rb78
-rw-r--r--spec/ruby/core/proc/shared/call.rb99
-rw-r--r--spec/ruby/core/proc/shared/call_arguments.rb29
-rw-r--r--spec/ruby/core/proc/shared/compose.rb22
-rw-r--r--spec/ruby/core/proc/shared/dup.rb10
-rw-r--r--spec/ruby/core/proc/shared/equal.rb100
-rw-r--r--spec/ruby/core/proc/shared/to_s.rb60
-rw-r--r--spec/ruby/core/proc/source_location_spec.rb86
-rw-r--r--spec/ruby/core/proc/to_proc_spec.rb9
-rw-r--r--spec/ruby/core/proc/to_s_spec.rb6
-rw-r--r--spec/ruby/core/proc/yield_spec.rb16
-rw-r--r--spec/ruby/core/process/_fork_spec.rb24
-rw-r--r--spec/ruby/core/process/abort_spec.rb6
-rw-r--r--spec/ruby/core/process/clock_getres_spec.rb33
-rw-r--r--spec/ruby/core/process/clock_gettime_spec.rb152
-rw-r--r--spec/ruby/core/process/constants_spec.rb86
-rw-r--r--spec/ruby/core/process/daemon_spec.rb118
-rw-r--r--spec/ruby/core/process/detach_spec.rb75
-rw-r--r--spec/ruby/core/process/egid_spec.rb58
-rw-r--r--spec/ruby/core/process/euid_spec.rb56
-rw-r--r--spec/ruby/core/process/exec_spec.rb241
-rw-r--r--spec/ruby/core/process/exit_spec.rb10
-rw-r--r--spec/ruby/core/process/fixtures/clocks.rb18
-rw-r--r--spec/ruby/core/process/fixtures/common.rb88
-rw-r--r--spec/ruby/core/process/fixtures/daemon.rb111
-rw-r--r--spec/ruby/core/process/fixtures/in.txt1
-rw-r--r--spec/ruby/core/process/fixtures/kill.rb45
-rw-r--r--spec/ruby/core/process/fixtures/map_fd.rb9
-rw-r--r--spec/ruby/core/process/fixtures/setpriority.rb12
-rw-r--r--spec/ruby/core/process/fork_spec.rb6
-rw-r--r--spec/ruby/core/process/getpgid_spec.rb17
-rw-r--r--spec/ruby/core/process/getpgrp_spec.rb7
-rw-r--r--spec/ruby/core/process/getpriority_spec.rb23
-rw-r--r--spec/ruby/core/process/getrlimit_spec.rb100
-rw-r--r--spec/ruby/core/process/gid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/gid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/gid_spec.rb22
-rw-r--r--spec/ruby/core/process/groups_spec.rb67
-rw-r--r--spec/ruby/core/process/initgroups_spec.rb22
-rw-r--r--spec/ruby/core/process/kill_spec.rb132
-rw-r--r--spec/ruby/core/process/last_status_spec.rb18
-rw-r--r--spec/ruby/core/process/maxgroups_spec.rb19
-rw-r--r--spec/ruby/core/process/pid_spec.rb9
-rw-r--r--spec/ruby/core/process/ppid_spec.rb9
-rw-r--r--spec/ruby/core/process/set_proctitle_spec.rb23
-rw-r--r--spec/ruby/core/process/setpgid_spec.rb29
-rw-r--r--spec/ruby/core/process/setpgrp_spec.rb37
-rw-r--r--spec/ruby/core/process/setpriority_spec.rb60
-rw-r--r--spec/ruby/core/process/setrlimit_spec.rb241
-rw-r--r--spec/ruby/core/process/setsid_spec.rb16
-rw-r--r--spec/ruby/core/process/spawn_spec.rb756
-rw-r--r--spec/ruby/core/process/status/bit_and_spec.rb5
-rw-r--r--spec/ruby/core/process/status/coredump_spec.rb5
-rw-r--r--spec/ruby/core/process/status/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/process/status/exited_spec.rb32
-rw-r--r--spec/ruby/core/process/status/exitstatus_spec.rb25
-rw-r--r--spec/ruby/core/process/status/inspect_spec.rb5
-rw-r--r--spec/ruby/core/process/status/pid_spec.rb15
-rw-r--r--spec/ruby/core/process/status/right_shift_spec.rb5
-rw-r--r--spec/ruby/core/process/status/signaled_spec.rb31
-rw-r--r--spec/ruby/core/process/status/stopped_spec.rb5
-rw-r--r--spec/ruby/core/process/status/stopsig_spec.rb5
-rw-r--r--spec/ruby/core/process/status/success_spec.rb41
-rw-r--r--spec/ruby/core/process/status/termsig_spec.rb43
-rw-r--r--spec/ruby/core/process/status/to_i_spec.rb13
-rw-r--r--spec/ruby/core/process/status/to_int_spec.rb5
-rw-r--r--spec/ruby/core/process/status/to_s_spec.rb5
-rw-r--r--spec/ruby/core/process/status/wait_spec.rb102
-rw-r--r--spec/ruby/core/process/sys/getegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/geteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/issetugid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/seteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setregid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setreuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setrgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setruid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setuid_spec.rb5
-rw-r--r--spec/ruby/core/process/times_spec.rb39
-rw-r--r--spec/ruby/core/process/uid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/uid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/uid_spec.rb57
-rw-r--r--spec/ruby/core/process/wait2_spec.rb45
-rw-r--r--spec/ruby/core/process/wait_spec.rb91
-rw-r--r--spec/ruby/core/process/waitall_spec.rb48
-rw-r--r--spec/ruby/core/process/waitpid2_spec.rb5
-rw-r--r--spec/ruby/core/process/waitpid_spec.rb13
-rw-r--r--spec/ruby/core/queue/append_spec.rb6
-rw-r--r--spec/ruby/core/queue/clear_spec.rb6
-rw-r--r--spec/ruby/core/queue/close_spec.rb6
-rw-r--r--spec/ruby/core/queue/closed_spec.rb6
-rw-r--r--spec/ruby/core/queue/deq_spec.rb6
-rw-r--r--spec/ruby/core/queue/empty_spec.rb6
-rw-r--r--spec/ruby/core/queue/enq_spec.rb6
-rw-r--r--spec/ruby/core/queue/initialize_spec.rb49
-rw-r--r--spec/ruby/core/queue/length_spec.rb6
-rw-r--r--spec/ruby/core/queue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/queue/pop_spec.rb6
-rw-r--r--spec/ruby/core/queue/push_spec.rb6
-rw-r--r--spec/ruby/core/queue/shift_spec.rb6
-rw-r--r--spec/ruby/core/queue/size_spec.rb6
-rw-r--r--spec/ruby/core/random/bytes_spec.rb30
-rw-r--r--spec/ruby/core/random/default_spec.rb45
-rw-r--r--spec/ruby/core/random/equal_value_spec.rb37
-rw-r--r--spec/ruby/core/random/fixtures/classes.rb15
-rw-r--r--spec/ruby/core/random/new_seed_spec.rb24
-rw-r--r--spec/ruby/core/random/new_spec.rb37
-rw-r--r--spec/ruby/core/random/rand_spec.rb224
-rw-r--r--spec/ruby/core/random/random_number_spec.rb8
-rw-r--r--spec/ruby/core/random/seed_spec.rb29
-rw-r--r--spec/ruby/core/random/shared/bytes.rb17
-rw-r--r--spec/ruby/core/random/shared/rand.rb9
-rw-r--r--spec/ruby/core/random/srand_spec.rb39
-rw-r--r--spec/ruby/core/random/urandom_spec.rb25
-rw-r--r--spec/ruby/core/range/begin_spec.rb6
-rw-r--r--spec/ruby/core/range/bsearch_spec.rb436
-rw-r--r--spec/ruby/core/range/case_compare_spec.rb19
-rw-r--r--spec/ruby/core/range/clone_spec.rb26
-rw-r--r--spec/ruby/core/range/count_spec.rb12
-rw-r--r--spec/ruby/core/range/cover_spec.rb10
-rw-r--r--spec/ruby/core/range/dup_spec.rb23
-rw-r--r--spec/ruby/core/range/each_spec.rb114
-rw-r--r--spec/ruby/core/range/end_spec.rb6
-rw-r--r--spec/ruby/core/range/eql_spec.rb10
-rw-r--r--spec/ruby/core/range/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/range/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/range/first_spec.rb53
-rw-r--r--spec/ruby/core/range/fixtures/classes.rb90
-rw-r--r--spec/ruby/core/range/frozen_spec.rb27
-rw-r--r--spec/ruby/core/range/hash_spec.rb24
-rw-r--r--spec/ruby/core/range/include_spec.rb10
-rw-r--r--spec/ruby/core/range/initialize_spec.rb50
-rw-r--r--spec/ruby/core/range/inspect_spec.rb29
-rw-r--r--spec/ruby/core/range/last_spec.rb59
-rw-r--r--spec/ruby/core/range/max_spec.rb103
-rw-r--r--spec/ruby/core/range/member_spec.rb10
-rw-r--r--spec/ruby/core/range/min_spec.rb88
-rw-r--r--spec/ruby/core/range/minmax_spec.rb132
-rw-r--r--spec/ruby/core/range/new_spec.rb79
-rw-r--r--spec/ruby/core/range/percent_spec.rb16
-rw-r--r--spec/ruby/core/range/range_spec.rb7
-rw-r--r--spec/ruby/core/range/shared/begin.rb10
-rw-r--r--spec/ruby/core/range/shared/cover.rb193
-rw-r--r--spec/ruby/core/range/shared/cover_and_include.rb76
-rw-r--r--spec/ruby/core/range/shared/end.rb10
-rw-r--r--spec/ruby/core/range/shared/equal_value.rb51
-rw-r--r--spec/ruby/core/range/shared/include.rb91
-rw-r--r--spec/ruby/core/range/size_spec.rb65
-rw-r--r--spec/ruby/core/range/step_spec.rb514
-rw-r--r--spec/ruby/core/range/to_a_spec.rb39
-rw-r--r--spec/ruby/core/range/to_s_spec.rb23
-rw-r--r--spec/ruby/core/rational/abs_spec.rb5
-rw-r--r--spec/ruby/core/rational/ceil_spec.rb5
-rw-r--r--spec/ruby/core/rational/coerce_spec.rb5
-rw-r--r--spec/ruby/core/rational/comparison_spec.rb22
-rw-r--r--spec/ruby/core/rational/denominator_spec.rb5
-rw-r--r--spec/ruby/core/rational/div_spec.rb17
-rw-r--r--spec/ruby/core/rational/divide_spec.rb19
-rw-r--r--spec/ruby/core/rational/divmod_spec.rb13
-rw-r--r--spec/ruby/core/rational/equal_value_spec.rb17
-rw-r--r--spec/ruby/core/rational/exponent_spec.rb5
-rw-r--r--spec/ruby/core/rational/fdiv_spec.rb5
-rw-r--r--spec/ruby/core/rational/floor_spec.rb5
-rw-r--r--spec/ruby/core/rational/hash_spec.rb5
-rw-r--r--spec/ruby/core/rational/inspect_spec.rb5
-rw-r--r--spec/ruby/core/rational/integer_spec.rb12
-rw-r--r--spec/ruby/core/rational/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/rational/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/rational/minus_spec.rb51
-rw-r--r--spec/ruby/core/rational/modulo_spec.rb5
-rw-r--r--spec/ruby/core/rational/multiply_spec.rb19
-rw-r--r--spec/ruby/core/rational/numerator_spec.rb5
-rw-r--r--spec/ruby/core/rational/plus_spec.rb18
-rw-r--r--spec/ruby/core/rational/quo_spec.rb5
-rw-r--r--spec/ruby/core/rational/rational_spec.rb11
-rw-r--r--spec/ruby/core/rational/rationalize_spec.rb36
-rw-r--r--spec/ruby/core/rational/remainder_spec.rb5
-rw-r--r--spec/ruby/core/rational/round_spec.rb6
-rw-r--r--spec/ruby/core/rational/to_f_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_i_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_r_spec.rb20
-rw-r--r--spec/ruby/core/rational/to_s_spec.rb5
-rw-r--r--spec/ruby/core/rational/truncate_spec.rb5
-rw-r--r--spec/ruby/core/rational/zero_spec.rb13
-rw-r--r--spec/ruby/core/refinement/append_features_spec.rb21
-rw-r--r--spec/ruby/core/refinement/extend_object_spec.rb21
-rw-r--r--spec/ruby/core/refinement/import_methods_spec.rb34
-rw-r--r--spec/ruby/core/refinement/include_spec.rb27
-rw-r--r--spec/ruby/core/refinement/prepend_features_spec.rb21
-rw-r--r--spec/ruby/core/refinement/prepend_spec.rb27
-rw-r--r--spec/ruby/core/regexp/case_compare_spec.rb35
-rw-r--r--spec/ruby/core/regexp/casefold_spec.rb8
-rw-r--r--spec/ruby/core/regexp/compile_spec.rb19
-rw-r--r--spec/ruby/core/regexp/encoding_spec.rb62
-rw-r--r--spec/ruby/core/regexp/eql_spec.rb6
-rw-r--r--spec/ruby/core/regexp/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/regexp/escape_spec.rb6
-rw-r--r--spec/ruby/core/regexp/fixed_encoding_spec.rb36
-rw-r--r--spec/ruby/core/regexp/hash_spec.rb20
-rw-r--r--spec/ruby/core/regexp/initialize_spec.rb23
-rw-r--r--spec/ruby/core/regexp/inspect_spec.rb44
-rw-r--r--spec/ruby/core/regexp/last_match_spec.rb56
-rw-r--r--spec/ruby/core/regexp/match_spec.rb146
-rw-r--r--spec/ruby/core/regexp/named_captures_spec.rb35
-rw-r--r--spec/ruby/core/regexp/names_spec.rb29
-rw-r--r--spec/ruby/core/regexp/new_spec.rb19
-rw-r--r--spec/ruby/core/regexp/options_spec.rb54
-rw-r--r--spec/ruby/core/regexp/quote_spec.rb6
-rw-r--r--spec/ruby/core/regexp/shared/equal_value.rb31
-rw-r--r--spec/ruby/core/regexp/shared/new.rb609
-rw-r--r--spec/ruby/core/regexp/shared/quote.rb41
-rw-r--r--spec/ruby/core/regexp/source_spec.rb47
-rw-r--r--spec/ruby/core/regexp/timeout_spec.rb35
-rw-r--r--spec/ruby/core/regexp/to_s_spec.rb62
-rw-r--r--spec/ruby/core/regexp/try_convert_spec.rb21
-rw-r--r--spec/ruby/core/regexp/union_spec.rb159
-rw-r--r--spec/ruby/core/signal/fixtures/trap_all.rb15
-rw-r--r--spec/ruby/core/signal/list_spec.rb68
-rw-r--r--spec/ruby/core/signal/signame_spec.rb22
-rw-r--r--spec/ruby/core/signal/trap_spec.rb293
-rw-r--r--spec/ruby/core/sizedqueue/append_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/clear_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/close_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/closed_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/deq_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/empty_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/enq_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/length_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/max_spec.rb10
-rw-r--r--spec/ruby/core/sizedqueue/new_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/pop_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/push_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/shift_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/size_spec.rb6
-rw-r--r--spec/ruby/core/string/allocate_spec.rb19
-rw-r--r--spec/ruby/core/string/append_spec.rb13
-rw-r--r--spec/ruby/core/string/ascii_only_spec.rb83
-rw-r--r--spec/ruby/core/string/b_spec.rb15
-rw-r--r--spec/ruby/core/string/byteindex_spec.rb16
-rw-r--r--spec/ruby/core/string/bytes_spec.rb55
-rw-r--r--spec/ruby/core/string/bytesize_spec.rb33
-rw-r--r--spec/ruby/core/string/byteslice_spec.rb33
-rw-r--r--spec/ruby/core/string/capitalize_spec.rb216
-rw-r--r--spec/ruby/core/string/case_compare_spec.rb8
-rw-r--r--spec/ruby/core/string/casecmp_spec.rb194
-rw-r--r--spec/ruby/core/string/center_spec.rb130
-rw-r--r--spec/ruby/core/string/chars_spec.rb15
-rw-r--r--spec/ruby/core/string/chomp_spec.rb374
-rw-r--r--spec/ruby/core/string/chop_spec.rb126
-rw-r--r--spec/ruby/core/string/chr_spec.rb42
-rw-r--r--spec/ruby/core/string/clear_spec.rb37
-rw-r--r--spec/ruby/core/string/clone_spec.rb61
-rw-r--r--spec/ruby/core/string/codepoints_spec.rb18
-rw-r--r--spec/ruby/core/string/comparison_spec.rb112
-rw-r--r--spec/ruby/core/string/concat_spec.rb26
-rw-r--r--spec/ruby/core/string/count_spec.rb105
-rw-r--r--spec/ruby/core/string/crypt_spec.rb92
-rw-r--r--spec/ruby/core/string/dedup_spec.rb8
-rw-r--r--spec/ruby/core/string/delete_prefix_spec.rb91
-rw-r--r--spec/ruby/core/string/delete_spec.rb124
-rw-r--r--spec/ruby/core/string/delete_suffix_spec.rb91
-rw-r--r--spec/ruby/core/string/downcase_spec.rb202
-rw-r--r--spec/ruby/core/string/dump_spec.rb404
-rw-r--r--spec/ruby/core/string/dup_spec.rb65
-rw-r--r--spec/ruby/core/string/each_byte_spec.rb61
-rw-r--r--spec/ruby/core/string/each_char_spec.rb7
-rw-r--r--spec/ruby/core/string/each_codepoint_spec.rb8
-rw-r--r--spec/ruby/core/string/each_grapheme_cluster_spec.rb17
-rw-r--r--spec/ruby/core/string/each_line_spec.rb9
-rw-r--r--spec/ruby/core/string/element_reference_spec.rb35
-rw-r--r--spec/ruby/core/string/element_set_spec.rb588
-rw-r--r--spec/ruby/core/string/empty_spec.rb12
-rw-r--r--spec/ruby/core/string/encode_spec.rb226
-rw-r--r--spec/ruby/core/string/encoding_spec.rb188
-rw-r--r--spec/ruby/core/string/end_with_spec.rb8
-rw-r--r--spec/ruby/core/string/eql_spec.rb21
-rw-r--r--spec/ruby/core/string/equal_value_spec.rb8
-rw-r--r--spec/ruby/core/string/fixtures/classes.rb60
-rw-r--r--spec/ruby/core/string/fixtures/freeze_magic_comment.rb3
-rw-r--r--spec/ruby/core/string/fixtures/iso-8859-9-encoding.rb9
-rw-r--r--spec/ruby/core/string/fixtures/to_c.rb5
-rw-r--r--spec/ruby/core/string/fixtures/utf-8-encoding.rb7
-rw-r--r--spec/ruby/core/string/force_encoding_spec.rb71
-rw-r--r--spec/ruby/core/string/freeze_spec.rb17
-rw-r--r--spec/ruby/core/string/getbyte_spec.rb69
-rw-r--r--spec/ruby/core/string/grapheme_clusters_spec.rb13
-rw-r--r--spec/ruby/core/string/gsub_spec.rb625
-rw-r--r--spec/ruby/core/string/hash_spec.rb9
-rw-r--r--spec/ruby/core/string/hex_spec.rb49
-rw-r--r--spec/ruby/core/string/include_spec.rb49
-rw-r--r--spec/ruby/core/string/index_spec.rb321
-rw-r--r--spec/ruby/core/string/initialize_spec.rb26
-rw-r--r--spec/ruby/core/string/insert_spec.rb81
-rw-r--r--spec/ruby/core/string/inspect_spec.rb520
-rw-r--r--spec/ruby/core/string/intern_spec.rb7
-rw-r--r--spec/ruby/core/string/length_spec.rb7
-rw-r--r--spec/ruby/core/string/lines_spec.rb19
-rw-r--r--spec/ruby/core/string/ljust_spec.rb113
-rw-r--r--spec/ruby/core/string/lstrip_spec.rb77
-rw-r--r--spec/ruby/core/string/match_spec.rb167
-rw-r--r--spec/ruby/core/string/modulo_spec.rb778
-rw-r--r--spec/ruby/core/string/multiply_spec.rb7
-rw-r--r--spec/ruby/core/string/new_spec.rb61
-rw-r--r--spec/ruby/core/string/next_spec.rb11
-rw-r--r--spec/ruby/core/string/oct_spec.rb88
-rw-r--r--spec/ruby/core/string/ord_spec.rb33
-rw-r--r--spec/ruby/core/string/partition_spec.rb63
-rw-r--r--spec/ruby/core/string/plus_spec.rb36
-rw-r--r--spec/ruby/core/string/prepend_spec.rb54
-rw-r--r--spec/ruby/core/string/replace_spec.rb7
-rw-r--r--spec/ruby/core/string/reverse_spec.rb79
-rw-r--r--spec/ruby/core/string/rindex_spec.rb387
-rw-r--r--spec/ruby/core/string/rjust_spec.rb113
-rw-r--r--spec/ruby/core/string/rpartition_spec.rb71
-rw-r--r--spec/ruby/core/string/rstrip_spec.rb95
-rw-r--r--spec/ruby/core/string/scan_spec.rb175
-rw-r--r--spec/ruby/core/string/scrub_spec.rb175
-rw-r--r--spec/ruby/core/string/setbyte_spec.rb111
-rw-r--r--spec/ruby/core/string/shared/chars.rb66
-rw-r--r--spec/ruby/core/string/shared/codepoints.rb62
-rw-r--r--spec/ruby/core/string/shared/concat.rb150
-rw-r--r--spec/ruby/core/string/shared/dedup.rb57
-rw-r--r--spec/ruby/core/string/shared/each_char_without_block.rb26
-rw-r--r--spec/ruby/core/string/shared/each_codepoint_without_block.rb33
-rw-r--r--spec/ruby/core/string/shared/each_line.rb172
-rw-r--r--spec/ruby/core/string/shared/each_line_without_block.rb17
-rw-r--r--spec/ruby/core/string/shared/encode.rb247
-rw-r--r--spec/ruby/core/string/shared/eql.rb38
-rw-r--r--spec/ruby/core/string/shared/equal_value.rb29
-rw-r--r--spec/ruby/core/string/shared/grapheme_clusters.rb16
-rw-r--r--spec/ruby/core/string/shared/length.rb55
-rw-r--r--spec/ruby/core/string/shared/partition.rb51
-rw-r--r--spec/ruby/core/string/shared/replace.rb47
-rw-r--r--spec/ruby/core/string/shared/slice.rb562
-rw-r--r--spec/ruby/core/string/shared/strip.rb24
-rw-r--r--spec/ruby/core/string/shared/succ.rb96
-rw-r--r--spec/ruby/core/string/shared/to_a.rb9
-rw-r--r--spec/ruby/core/string/shared/to_s.rb13
-rw-r--r--spec/ruby/core/string/shared/to_sym.rb72
-rw-r--r--spec/ruby/core/string/size_spec.rb7
-rw-r--r--spec/ruby/core/string/slice_spec.rb441
-rw-r--r--spec/ruby/core/string/split_spec.rb614
-rw-r--r--spec/ruby/core/string/squeeze_spec.rb118
-rw-r--r--spec/ruby/core/string/start_with_spec.rb18
-rw-r--r--spec/ruby/core/string/string_spec.rb7
-rw-r--r--spec/ruby/core/string/strip_spec.rb61
-rw-r--r--spec/ruby/core/string/sub_spec.rb522
-rw-r--r--spec/ruby/core/string/succ_spec.rb11
-rw-r--r--spec/ruby/core/string/sum_spec.rb22
-rw-r--r--spec/ruby/core/string/swapcase_spec.rb201
-rw-r--r--spec/ruby/core/string/to_c_spec.rb41
-rw-r--r--spec/ruby/core/string/to_f_spec.rb70
-rw-r--r--spec/ruby/core/string/to_i_spec.rb337
-rw-r--r--spec/ruby/core/string/to_r_spec.rb58
-rw-r--r--spec/ruby/core/string/to_s_spec.rb7
-rw-r--r--spec/ruby/core/string/to_str_spec.rb7
-rw-r--r--spec/ruby/core/string/to_sym_spec.rb7
-rw-r--r--spec/ruby/core/string/tr_s_spec.rb131
-rw-r--r--spec/ruby/core/string/tr_spec.rb126
-rw-r--r--spec/ruby/core/string/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/string/uminus_spec.rb6
-rw-r--r--spec/ruby/core/string/undump_spec.rb441
-rw-r--r--spec/ruby/core/string/unicode_normalize_spec.rb115
-rw-r--r--spec/ruby/core/string/unicode_normalized_spec.rb74
-rw-r--r--spec/ruby/core/string/unpack/a_spec.rb66
-rw-r--r--spec/ruby/core/string/unpack/at_spec.rb29
-rw-r--r--spec/ruby/core/string/unpack/b_spec.rb217
-rw-r--r--spec/ruby/core/string/unpack/c_spec.rb73
-rw-r--r--spec/ruby/core/string/unpack/comment_spec.rb25
-rw-r--r--spec/ruby/core/string/unpack/d_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/e_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/f_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/g_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/h_spec.rb155
-rw-r--r--spec/ruby/core/string/unpack/i_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/j_spec.rb272
-rw-r--r--spec/ruby/core/string/unpack/l_spec.rb265
-rw-r--r--spec/ruby/core/string/unpack/m_spec.rb192
-rw-r--r--spec/ruby/core/string/unpack/n_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/p_spec.rb44
-rw-r--r--spec/ruby/core/string/unpack/percent_spec.rb7
-rw-r--r--spec/ruby/core/string/unpack/q_spec.rb64
-rw-r--r--spec/ruby/core/string/unpack/s_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/shared/basic.rb21
-rw-r--r--spec/ruby/core/string/unpack/shared/float.rb311
-rw-r--r--spec/ruby/core/string/unpack/shared/integer.rb399
-rw-r--r--spec/ruby/core/string/unpack/shared/string.rb51
-rw-r--r--spec/ruby/core/string/unpack/shared/taint.rb2
-rw-r--r--spec/ruby/core/string/unpack/shared/unicode.rb70
-rw-r--r--spec/ruby/core/string/unpack/u_spec.rb97
-rw-r--r--spec/ruby/core/string/unpack/v_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/w_spec.rb45
-rw-r--r--spec/ruby/core/string/unpack/x_spec.rb62
-rw-r--r--spec/ruby/core/string/unpack/z_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack1_spec.rb36
-rw-r--r--spec/ruby/core/string/unpack_spec.rb34
-rw-r--r--spec/ruby/core/string/upcase_spec.rb194
-rw-r--r--spec/ruby/core/string/uplus_spec.rb22
-rw-r--r--spec/ruby/core/string/upto_spec.rb104
-rw-r--r--spec/ruby/core/string/valid_encoding/utf_8_spec.rb214
-rw-r--r--spec/ruby/core/string/valid_encoding_spec.rb135
-rw-r--r--spec/ruby/core/struct/clone_spec.rb7
-rw-r--r--spec/ruby/core/struct/deconstruct_keys_spec.rb76
-rw-r--r--spec/ruby/core/struct/deconstruct_spec.rb10
-rw-r--r--spec/ruby/core/struct/dig_spec.rb52
-rw-r--r--spec/ruby/core/struct/dup_spec.rb23
-rw-r--r--spec/ruby/core/struct/each_pair_spec.rb33
-rw-r--r--spec/ruby/core/struct/each_spec.rb27
-rw-r--r--spec/ruby/core/struct/element_reference_spec.rb52
-rw-r--r--spec/ruby/core/struct/element_set_spec.rb29
-rw-r--r--spec/ruby/core/struct/eql_spec.rb13
-rw-r--r--spec/ruby/core/struct/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/struct/filter_spec.rb10
-rw-r--r--spec/ruby/core/struct/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/struct/hash_spec.rb64
-rw-r--r--spec/ruby/core/struct/initialize_spec.rb51
-rw-r--r--spec/ruby/core/struct/inspect_spec.rb12
-rw-r--r--spec/ruby/core/struct/instance_variable_get_spec.rb16
-rw-r--r--spec/ruby/core/struct/instance_variables_spec.rb16
-rw-r--r--spec/ruby/core/struct/keyword_init_spec.rb21
-rw-r--r--spec/ruby/core/struct/length_spec.rb12
-rw-r--r--spec/ruby/core/struct/members_spec.rb13
-rw-r--r--spec/ruby/core/struct/new_spec.rb234
-rw-r--r--spec/ruby/core/struct/select_spec.rb10
-rw-r--r--spec/ruby/core/struct/shared/accessor.rb7
-rw-r--r--spec/ruby/core/struct/shared/dup.rb9
-rw-r--r--spec/ruby/core/struct/shared/equal_value.rb37
-rw-r--r--spec/ruby/core/struct/shared/inspect.rb5
-rw-r--r--spec/ruby/core/struct/shared/select.rb26
-rw-r--r--spec/ruby/core/struct/size_spec.rb11
-rw-r--r--spec/ruby/core/struct/struct_spec.rb43
-rw-r--r--spec/ruby/core/struct/to_a_spec.rb12
-rw-r--r--spec/ruby/core/struct/to_h_spec.rb56
-rw-r--r--spec/ruby/core/struct/to_s_spec.rb12
-rw-r--r--spec/ruby/core/struct/values_at_spec.rb59
-rw-r--r--spec/ruby/core/struct/values_spec.rb11
-rw-r--r--spec/ruby/core/symbol/all_symbols_spec.rb19
-rw-r--r--spec/ruby/core/symbol/capitalize_spec.rb41
-rw-r--r--spec/ruby/core/symbol/case_compare_spec.rb11
-rw-r--r--spec/ruby/core/symbol/casecmp_spec.rb144
-rw-r--r--spec/ruby/core/symbol/comparison_spec.rb51
-rw-r--r--spec/ruby/core/symbol/downcase_spec.rb25
-rw-r--r--spec/ruby/core/symbol/dup_spec.rb7
-rw-r--r--spec/ruby/core/symbol/element_reference_spec.rb6
-rw-r--r--spec/ruby/core/symbol/empty_spec.rb11
-rw-r--r--spec/ruby/core/symbol/encoding_spec.rb23
-rw-r--r--spec/ruby/core/symbol/end_with_spec.rb8
-rw-r--r--spec/ruby/core/symbol/equal_value_spec.rb14
-rw-r--r--spec/ruby/core/symbol/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/symbol/id2name_spec.rb6
-rw-r--r--spec/ruby/core/symbol/inspect_spec.rb105
-rw-r--r--spec/ruby/core/symbol/intern_spec.rb11
-rw-r--r--spec/ruby/core/symbol/length_spec.rb6
-rw-r--r--spec/ruby/core/symbol/match_spec.rb77
-rw-r--r--spec/ruby/core/symbol/name_spec.rb19
-rw-r--r--spec/ruby/core/symbol/next_spec.rb6
-rw-r--r--spec/ruby/core/symbol/shared/id2name.rb16
-rw-r--r--spec/ruby/core/symbol/shared/length.rb23
-rw-r--r--spec/ruby/core/symbol/shared/slice.rb262
-rw-r--r--spec/ruby/core/symbol/shared/succ.rb18
-rw-r--r--spec/ruby/core/symbol/size_spec.rb6
-rw-r--r--spec/ruby/core/symbol/slice_spec.rb6
-rw-r--r--spec/ruby/core/symbol/start_with_spec.rb8
-rw-r--r--spec/ruby/core/symbol/succ_spec.rb6
-rw-r--r--spec/ruby/core/symbol/swapcase_spec.rb29
-rw-r--r--spec/ruby/core/symbol/symbol_spec.rb19
-rw-r--r--spec/ruby/core/symbol/to_proc_spec.rb99
-rw-r--r--spec/ruby/core/symbol/to_s_spec.rb6
-rw-r--r--spec/ruby/core/symbol/to_sym_spec.rb9
-rw-r--r--spec/ruby/core/symbol/upcase_spec.rb21
-rw-r--r--spec/ruby/core/systemexit/initialize_spec.rb26
-rw-r--r--spec/ruby/core/systemexit/success_spec.rb13
-rw-r--r--spec/ruby/core/thread/abort_on_exception_spec.rb106
-rw-r--r--spec/ruby/core/thread/add_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/alive_spec.rb58
-rw-r--r--spec/ruby/core/thread/allocate_spec.rb9
-rw-r--r--spec/ruby/core/thread/backtrace/limit_spec.rb15
-rw-r--r--spec/ruby/core/thread/backtrace/location/absolute_path_spec.rb102
-rw-r--r--spec/ruby/core/thread/backtrace/location/base_label_spec.rb49
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path.rb4
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_main.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_method_added.rb10
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/classes.rb35
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_required.rb3
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/path.rb2
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/subdir/absolute_path_main_chdir.rb11
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/subdir/sibling.rb1
-rw-r--r--spec/ruby/core/thread/backtrace/location/inspect_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/label_spec.rb37
-rw-r--r--spec/ruby/core/thread/backtrace/location/lineno_spec.rb23
-rw-r--r--spec/ruby/core/thread/backtrace/location/path_spec.rb124
-rw-r--r--spec/ruby/core/thread/backtrace/location/to_s_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace_locations_spec.rb79
-rw-r--r--spec/ruby/core/thread/backtrace_spec.rb69
-rw-r--r--spec/ruby/core/thread/current_spec.rb31
-rw-r--r--spec/ruby/core/thread/element_reference_spec.rb44
-rw-r--r--spec/ruby/core/thread/element_set_spec.rb51
-rw-r--r--spec/ruby/core/thread/exclusive_spec.rb49
-rw-r--r--spec/ruby/core/thread/exit_spec.rb15
-rw-r--r--spec/ruby/core/thread/fetch_spec.rb36
-rw-r--r--spec/ruby/core/thread/fixtures/classes.rb297
-rw-r--r--spec/ruby/core/thread/fork_spec.rb9
-rw-r--r--spec/ruby/core/thread/group_spec.rb5
-rw-r--r--spec/ruby/core/thread/handle_interrupt_spec.rb125
-rw-r--r--spec/ruby/core/thread/ignore_deadlock_spec.rb21
-rw-r--r--spec/ruby/core/thread/initialize_spec.rb27
-rw-r--r--spec/ruby/core/thread/inspect_spec.rb6
-rw-r--r--spec/ruby/core/thread/join_spec.rb70
-rw-r--r--spec/ruby/core/thread/key_spec.rb53
-rw-r--r--spec/ruby/core/thread/keys_spec.rb44
-rw-r--r--spec/ruby/core/thread/kill_spec.rb25
-rw-r--r--spec/ruby/core/thread/list_spec.rb55
-rw-r--r--spec/ruby/core/thread/main_spec.rb10
-rw-r--r--spec/ruby/core/thread/name_spec.rb54
-rw-r--r--spec/ruby/core/thread/native_thread_id_spec.rb17
-rw-r--r--spec/ruby/core/thread/new_spec.rb83
-rw-r--r--spec/ruby/core/thread/pass_spec.rb8
-rw-r--r--spec/ruby/core/thread/pending_interrupt_spec.rb32
-rw-r--r--spec/ruby/core/thread/priority_spec.rb72
-rw-r--r--spec/ruby/core/thread/raise_spec.rb232
-rw-r--r--spec/ruby/core/thread/report_on_exception_spec.rb157
-rw-r--r--spec/ruby/core/thread/run_spec.rb8
-rw-r--r--spec/ruby/core/thread/set_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/shared/exit.rb200
-rw-r--r--spec/ruby/core/thread/shared/start.rb41
-rw-r--r--spec/ruby/core/thread/shared/to_s.rb53
-rw-r--r--spec/ruby/core/thread/shared/wakeup.rb62
-rw-r--r--spec/ruby/core/thread/start_spec.rb9
-rw-r--r--spec/ruby/core/thread/status_spec.rb60
-rw-r--r--spec/ruby/core/thread/stop_spec.rb54
-rw-r--r--spec/ruby/core/thread/terminate_spec.rb7
-rw-r--r--spec/ruby/core/thread/thread_variable_get_spec.rb25
-rw-r--r--spec/ruby/core/thread/thread_variable_set_spec.rb26
-rw-r--r--spec/ruby/core/thread/thread_variable_spec.rb21
-rw-r--r--spec/ruby/core/thread/thread_variables_spec.rb29
-rw-r--r--spec/ruby/core/thread/to_s_spec.rb6
-rw-r--r--spec/ruby/core/thread/value_spec.rb31
-rw-r--r--spec/ruby/core/thread/wakeup_spec.rb7
-rw-r--r--spec/ruby/core/threadgroup/add_spec.rb39
-rw-r--r--spec/ruby/core/threadgroup/default_spec.rb11
-rw-r--r--spec/ruby/core/threadgroup/enclose_spec.rb24
-rw-r--r--spec/ruby/core/threadgroup/enclosed_spec.rb14
-rw-r--r--spec/ruby/core/threadgroup/list_spec.rb23
-rw-r--r--spec/ruby/core/time/_dump_spec.rb55
-rw-r--r--spec/ruby/core/time/_load_spec.rb52
-rw-r--r--spec/ruby/core/time/asctime_spec.rb6
-rw-r--r--spec/ruby/core/time/at_spec.rb291
-rw-r--r--spec/ruby/core/time/ceil_spec.rb44
-rw-r--r--spec/ruby/core/time/comparison_spec.rb104
-rw-r--r--spec/ruby/core/time/ctime_spec.rb6
-rw-r--r--spec/ruby/core/time/day_spec.rb6
-rw-r--r--spec/ruby/core/time/dst_spec.rb6
-rw-r--r--spec/ruby/core/time/dup_spec.rb46
-rw-r--r--spec/ruby/core/time/eql_spec.rb29
-rw-r--r--spec/ruby/core/time/fixtures/classes.rb106
-rw-r--r--spec/ruby/core/time/floor_spec.rb36
-rw-r--r--spec/ruby/core/time/friday_spec.rb11
-rw-r--r--spec/ruby/core/time/getgm_spec.rb6
-rw-r--r--spec/ruby/core/time/getlocal_spec.rb167
-rw-r--r--spec/ruby/core/time/getutc_spec.rb6
-rw-r--r--spec/ruby/core/time/gm_spec.rb10
-rw-r--r--spec/ruby/core/time/gmt_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/gmt_spec.rb8
-rw-r--r--spec/ruby/core/time/gmtime_spec.rb6
-rw-r--r--spec/ruby/core/time/gmtoff_spec.rb6
-rw-r--r--spec/ruby/core/time/hash_spec.rb11
-rw-r--r--spec/ruby/core/time/hour_spec.rb17
-rw-r--r--spec/ruby/core/time/inspect_spec.rb33
-rw-r--r--spec/ruby/core/time/isdst_spec.rb6
-rw-r--r--spec/ruby/core/time/local_spec.rb11
-rw-r--r--spec/ruby/core/time/localtime_spec.rb152
-rw-r--r--spec/ruby/core/time/mday_spec.rb6
-rw-r--r--spec/ruby/core/time/min_spec.rb17
-rw-r--r--spec/ruby/core/time/minus_spec.rb121
-rw-r--r--spec/ruby/core/time/mktime_spec.rb11
-rw-r--r--spec/ruby/core/time/mon_spec.rb6
-rw-r--r--spec/ruby/core/time/monday_spec.rb11
-rw-r--r--spec/ruby/core/time/month_spec.rb6
-rw-r--r--spec/ruby/core/time/new_spec.rb458
-rw-r--r--spec/ruby/core/time/now_spec.rb51
-rw-r--r--spec/ruby/core/time/nsec_spec.rb31
-rw-r--r--spec/ruby/core/time/plus_spec.rb118
-rw-r--r--spec/ruby/core/time/round_spec.rb35
-rw-r--r--spec/ruby/core/time/saturday_spec.rb11
-rw-r--r--spec/ruby/core/time/sec_spec.rb7
-rw-r--r--spec/ruby/core/time/shared/asctime.rb6
-rw-r--r--spec/ruby/core/time/shared/day.rb15
-rw-r--r--spec/ruby/core/time/shared/getgm.rb9
-rw-r--r--spec/ruby/core/time/shared/gm.rb70
-rw-r--r--spec/ruby/core/time/shared/gmt_offset.rb59
-rw-r--r--spec/ruby/core/time/shared/gmtime.rb33
-rw-r--r--spec/ruby/core/time/shared/inspect.rb21
-rw-r--r--spec/ruby/core/time/shared/isdst.rb8
-rw-r--r--spec/ruby/core/time/shared/local.rb42
-rw-r--r--spec/ruby/core/time/shared/month.rb15
-rw-r--r--spec/ruby/core/time/shared/now.rb33
-rw-r--r--spec/ruby/core/time/shared/time_params.rb267
-rw-r--r--spec/ruby/core/time/shared/to_i.rb16
-rw-r--r--spec/ruby/core/time/strftime_spec.rb93
-rw-r--r--spec/ruby/core/time/subsec_spec.rb27
-rw-r--r--spec/ruby/core/time/succ_spec.rb39
-rw-r--r--spec/ruby/core/time/sunday_spec.rb11
-rw-r--r--spec/ruby/core/time/thursday_spec.rb11
-rw-r--r--spec/ruby/core/time/time_spec.rb7
-rw-r--r--spec/ruby/core/time/to_a_spec.rb12
-rw-r--r--spec/ruby/core/time/to_f_spec.rb7
-rw-r--r--spec/ruby/core/time/to_i_spec.rb6
-rw-r--r--spec/ruby/core/time/to_r_spec.rb11
-rw-r--r--spec/ruby/core/time/to_s_spec.rb6
-rw-r--r--spec/ruby/core/time/tuesday_spec.rb11
-rw-r--r--spec/ruby/core/time/tv_nsec_spec.rb5
-rw-r--r--spec/ruby/core/time/tv_sec_spec.rb6
-rw-r--r--spec/ruby/core/time/tv_usec_spec.rb5
-rw-r--r--spec/ruby/core/time/usec_spec.rb43
-rw-r--r--spec/ruby/core/time/utc_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/utc_spec.rb58
-rw-r--r--spec/ruby/core/time/wday_spec.rb9
-rw-r--r--spec/ruby/core/time/wednesday_spec.rb11
-rw-r--r--spec/ruby/core/time/yday_spec.rb21
-rw-r--r--spec/ruby/core/time/year_spec.rb17
-rw-r--r--spec/ruby/core/time/zone_spec.rb104
-rw-r--r--spec/ruby/core/tracepoint/allow_reentry_spec.rb32
-rw-r--r--spec/ruby/core/tracepoint/binding_spec.rb21
-rw-r--r--spec/ruby/core/tracepoint/callee_id_spec.rb18
-rw-r--r--spec/ruby/core/tracepoint/defined_class_spec.rb27
-rw-r--r--spec/ruby/core/tracepoint/disable_spec.rb76
-rw-r--r--spec/ruby/core/tracepoint/enable_spec.rb574
-rw-r--r--spec/ruby/core/tracepoint/enabled_spec.rb15
-rw-r--r--spec/ruby/core/tracepoint/eval_script_spec.rb23
-rw-r--r--spec/ruby/core/tracepoint/event_spec.rb22
-rw-r--r--spec/ruby/core/tracepoint/fixtures/classes.rb40
-rw-r--r--spec/ruby/core/tracepoint/inspect_spec.rb134
-rw-r--r--spec/ruby/core/tracepoint/lineno_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/method_id_spec.rb15
-rw-r--r--spec/ruby/core/tracepoint/new_spec.rb72
-rw-r--r--spec/ruby/core/tracepoint/parameters_spec.rb28
-rw-r--r--spec/ruby/core/tracepoint/path_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/raised_exception_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/return_value_spec.rb17
-rw-r--r--spec/ruby/core/tracepoint/self_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/trace_spec.rb10
-rw-r--r--spec/ruby/core/true/and_spec.rb11
-rw-r--r--spec/ruby/core/true/case_compare_spec.rb13
-rw-r--r--spec/ruby/core/true/dup_spec.rb7
-rw-r--r--spec/ruby/core/true/inspect_spec.rb7
-rw-r--r--spec/ruby/core/true/or_spec.rb11
-rw-r--r--spec/ruby/core/true/to_s_spec.rb15
-rw-r--r--spec/ruby/core/true/trueclass_spec.rb15
-rw-r--r--spec/ruby/core/true/xor_spec.rb11
-rw-r--r--spec/ruby/core/unboundmethod/arity_spec.rb207
-rw-r--r--spec/ruby/core/unboundmethod/bind_call_spec.rb50
-rw-r--r--spec/ruby/core/unboundmethod/bind_spec.rb61
-rw-r--r--spec/ruby/core/unboundmethod/clone_spec.rb12
-rw-r--r--spec/ruby/core/unboundmethod/eql_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/equal_value_spec.rb157
-rw-r--r--spec/ruby/core/unboundmethod/fixtures/classes.rb103
-rw-r--r--spec/ruby/core/unboundmethod/hash_spec.rb22
-rw-r--r--spec/ruby/core/unboundmethod/inspect_spec.rb7
-rw-r--r--spec/ruby/core/unboundmethod/name_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/original_name_spec.rb22
-rw-r--r--spec/ruby/core/unboundmethod/owner_spec.rb33
-rw-r--r--spec/ruby/core/unboundmethod/parameters_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/private_spec.rb21
-rw-r--r--spec/ruby/core/unboundmethod/protected_spec.rb21
-rw-r--r--spec/ruby/core/unboundmethod/public_spec.rb21
-rw-r--r--spec/ruby/core/unboundmethod/shared/to_s.rb44
-rw-r--r--spec/ruby/core/unboundmethod/source_location_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/super_method_spec.rb51
-rw-r--r--spec/ruby/core/unboundmethod/to_s_spec.rb7
-rw-r--r--spec/ruby/core/warning/element_reference_spec.rb20
-rw-r--r--spec/ruby/core/warning/element_set_spec.rb35
-rw-r--r--spec/ruby/core/warning/warn_spec.rb90
-rw-r--r--spec/ruby/default.mspec50
-rw-r--r--spec/ruby/fixtures/basicobject/method_missing.rb55
-rw-r--r--spec/ruby/fixtures/class.rb142
-rw-r--r--spec/ruby/fixtures/class_variables.rb58
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dylib1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/b/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/c/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/concurrent.rb12
-rw-r--r--spec/ruby/fixtures/code/concurrent2.rb8
-rw-r--r--spec/ruby/fixtures/code/concurrent3.rb2
-rw-r--r--spec/ruby/fixtures/code/concurrent_require_fixture.rb4
-rw-r--r--spec/ruby/fixtures/code/file_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/gem/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/line_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/load_ext_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dylib1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dylib1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture_and__FILE__.rb1
-rw-r--r--spec/ruby/fixtures/code/load_wrap_fixture.rb12
-rw-r--r--spec/ruby/fixtures/code/load_wrap_method_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code/methods_fixture.rb364
-rw-r--r--spec/ruby/fixtures/code/raise_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/recursive_load_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/recursive_require_fixture.rb3
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink1.rb1
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink2/symlink2.rb1
-rw-r--r--spec/ruby/fixtures/code_loading.rb41
-rw-r--r--spec/ruby/fixtures/constants.rb323
-rw-r--r--spec/ruby/fixtures/enumerator/classes.rb15
-rw-r--r--spec/ruby/fixtures/math/common.rb3
-rw-r--r--spec/ruby/fixtures/rational.rb14
-rw-r--r--spec/ruby/fixtures/reflection.rb352
-rw-r--r--spec/ruby/language/BEGIN_spec.rb41
-rw-r--r--spec/ruby/language/END_spec.rb15
-rw-r--r--spec/ruby/language/README30
-rw-r--r--spec/ruby/language/alias_spec.rb276
-rw-r--r--spec/ruby/language/and_spec.rb80
-rw-r--r--spec/ruby/language/array_spec.rb162
-rw-r--r--spec/ruby/language/block_spec.rb1102
-rw-r--r--spec/ruby/language/break_spec.rb383
-rw-r--r--spec/ruby/language/case_spec.rb445
-rw-r--r--spec/ruby/language/class_spec.rb363
-rw-r--r--spec/ruby/language/class_variable_spec.rb116
-rw-r--r--spec/ruby/language/comment_spec.rb13
-rw-r--r--spec/ruby/language/constants_spec.rb750
-rw-r--r--spec/ruby/language/def_spec.rb798
-rw-r--r--spec/ruby/language/defined_spec.rb1171
-rw-r--r--spec/ruby/language/delegation_spec.rb65
-rw-r--r--spec/ruby/language/encoding_spec.rb36
-rw-r--r--spec/ruby/language/ensure_spec.rb331
-rw-r--r--spec/ruby/language/execution_spec.rb15
-rw-r--r--spec/ruby/language/file_spec.rb21
-rw-r--r--spec/ruby/language/fixtures/argv_encoding.rb1
-rw-r--r--spec/ruby/language/fixtures/array.rb32
-rw-r--r--spec/ruby/language/fixtures/begin_file.rb3
-rw-r--r--spec/ruby/language/fixtures/binary_symbol.rb4
-rw-r--r--spec/ruby/language/fixtures/block.rb61
-rw-r--r--spec/ruby/language/fixtures/break.rb291
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel.rb9
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_block.rb23
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_method.rb17
-rw-r--r--spec/ruby/language/fixtures/bytes_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/case_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/classes.rb31
-rw-r--r--spec/ruby/language/fixtures/coding_us_ascii.rb11
-rw-r--r--spec/ruby/language/fixtures/coding_utf_8.rb11
-rw-r--r--spec/ruby/language/fixtures/constant_visibility.rb114
-rw-r--r--spec/ruby/language/fixtures/constants_sclass.rb54
-rw-r--r--spec/ruby/language/fixtures/def.rb14
-rw-r--r--spec/ruby/language/fixtures/defined.rb306
-rw-r--r--spec/ruby/language/fixtures/delegation.rb11
-rw-r--r--spec/ruby/language/fixtures/dollar_zero.rb6
-rw-r--r--spec/ruby/language/fixtures/emacs_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/ensure.rb121
-rw-r--r--spec/ruby/language/fixtures/file.rb1
-rw-r--r--spec/ruby/language/fixtures/for_scope.rb15
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_diff_enc.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_no_comment.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_one_literal.rb4
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_diff_enc.rbbin0 -> 181 bytes-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_no_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_two_literals.rb3
-rw-r--r--spec/ruby/language/fixtures/hash_strings_binary.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_usascii.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_utf8.rb7
-rw-r--r--spec/ruby/language/fixtures/magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/match_operators.rb9
-rw-r--r--spec/ruby/language/fixtures/metaclass.rb33
-rw-r--r--spec/ruby/language/fixtures/module.rb24
-rw-r--r--spec/ruby/language/fixtures/next.rb134
-rw-r--r--spec/ruby/language/fixtures/no_magic_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/precedence.rb16
-rw-r--r--spec/ruby/language/fixtures/print_magic_comment_result_at_exit.rb3
-rw-r--r--spec/ruby/language/fixtures/private.rb59
-rw-r--r--spec/ruby/language/fixtures/rescue.rb67
-rw-r--r--spec/ruby/language/fixtures/rescue_captures.rb107
-rw-r--r--spec/ruby/language/fixtures/return.rb135
-rw-r--r--spec/ruby/language/fixtures/second_line_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/second_token_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/send.rb141
-rwxr-xr-xspec/ruby/language/fixtures/shebang_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/squiggly_heredoc.rb71
-rw-r--r--spec/ruby/language/fixtures/super.rb742
-rw-r--r--spec/ruby/language/fixtures/utf16-be-nobom.rbbin0 -> 68 bytes-rw-r--r--spec/ruby/language/fixtures/utf16-le-nobom.rbbin0 -> 69 bytes-rw-r--r--spec/ruby/language/fixtures/utf8-bom.rb2
-rw-r--r--spec/ruby/language/fixtures/utf8-nobom.rb2
-rw-r--r--spec/ruby/language/fixtures/variables.rb85
-rw-r--r--spec/ruby/language/fixtures/vim_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/yield.rb41
-rw-r--r--spec/ruby/language/for_spec.rb182
-rw-r--r--spec/ruby/language/hash_spec.rb258
-rw-r--r--spec/ruby/language/heredoc_spec.rb109
-rw-r--r--spec/ruby/language/if_spec.rb371
-rw-r--r--spec/ruby/language/keyword_arguments_spec.rb397
-rw-r--r--spec/ruby/language/lambda_spec.rb620
-rw-r--r--spec/ruby/language/line_spec.rb45
-rw-r--r--spec/ruby/language/loop_spec.rb67
-rw-r--r--spec/ruby/language/magic_comment_spec.rb92
-rw-r--r--spec/ruby/language/match_spec.rb81
-rw-r--r--spec/ruby/language/metaclass_spec.rb143
-rw-r--r--spec/ruby/language/method_spec.rb1856
-rw-r--r--spec/ruby/language/module_spec.rb110
-rw-r--r--spec/ruby/language/next_spec.rb410
-rw-r--r--spec/ruby/language/not_spec.rb51
-rw-r--r--spec/ruby/language/numbered_parameters_spec.rb118
-rw-r--r--spec/ruby/language/numbers_spec.rb105
-rw-r--r--spec/ruby/language/optional_assignments_spec.rb496
-rw-r--r--spec/ruby/language/or_spec.rb90
-rw-r--r--spec/ruby/language/order_spec.rb75
-rw-r--r--spec/ruby/language/pattern_matching_spec.rb1403
-rw-r--r--spec/ruby/language/precedence_spec.rb445
-rw-r--r--spec/ruby/language/predefined/data_spec.rb48
-rw-r--r--spec/ruby/language/predefined/fixtures/data1.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data2.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/data3.rb6
-rw-r--r--spec/ruby/language/predefined/fixtures/data4.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data5.rb5
-rw-r--r--spec/ruby/language/predefined/fixtures/data_offset.rb12
-rw-r--r--spec/ruby/language/predefined/fixtures/data_only.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/empty_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/print_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic_required.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id_required.rb1
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_required_before.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_values.rb9
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables_required.rb2
-rw-r--r--spec/ruby/language/predefined/toplevel_binding_spec.rb34
-rw-r--r--spec/ruby/language/predefined_spec.rb1394
-rw-r--r--spec/ruby/language/private_spec.rb67
-rw-r--r--spec/ruby/language/proc_spec.rb247
-rw-r--r--spec/ruby/language/range_spec.rb30
-rw-r--r--spec/ruby/language/redo_spec.rb66
-rw-r--r--spec/ruby/language/regexp/anchors_spec.rb179
-rw-r--r--spec/ruby/language/regexp/back-references_spec.rb140
-rw-r--r--spec/ruby/language/regexp/character_classes_spec.rb642
-rw-r--r--spec/ruby/language/regexp/empty_checks_spec.rb135
-rw-r--r--spec/ruby/language/regexp/encoding_spec.rb148
-rw-r--r--spec/ruby/language/regexp/escapes_spec.rb169
-rw-r--r--spec/ruby/language/regexp/grouping_spec.rb63
-rw-r--r--spec/ruby/language/regexp/interpolation_spec.rb58
-rw-r--r--spec/ruby/language/regexp/modifiers_spec.rb115
-rw-r--r--spec/ruby/language/regexp/repetition_spec.rb142
-rw-r--r--spec/ruby/language/regexp/subexpression_call_spec.rb50
-rw-r--r--spec/ruby/language/regexp_spec.rb169
-rw-r--r--spec/ruby/language/rescue_spec.rb515
-rw-r--r--spec/ruby/language/retry_spec.rb52
-rw-r--r--spec/ruby/language/return_spec.rb490
-rw-r--r--spec/ruby/language/safe_navigator_spec.rb99
-rw-r--r--spec/ruby/language/safe_spec.rb27
-rw-r--r--spec/ruby/language/send_spec.rb570
-rw-r--r--spec/ruby/language/shared/__FILE__.rb23
-rw-r--r--spec/ruby/language/shared/__LINE__.rb15
-rw-r--r--spec/ruby/language/singleton_class_spec.rb293
-rw-r--r--spec/ruby/language/source_encoding_spec.rb61
-rw-r--r--spec/ruby/language/string_spec.rb299
-rw-r--r--spec/ruby/language/super_spec.rb434
-rw-r--r--spec/ruby/language/symbol_spec.rb106
-rw-r--r--spec/ruby/language/throw_spec.rb81
-rw-r--r--spec/ruby/language/undef_spec.rb72
-rw-r--r--spec/ruby/language/unless_spec.rb43
-rw-r--r--spec/ruby/language/until_spec.rb234
-rw-r--r--spec/ruby/language/variables_spec.rb870
-rw-r--r--spec/ruby/language/while_spec.rb344
-rw-r--r--spec/ruby/language/yield_spec.rb225
-rw-r--r--spec/ruby/library/English/English_spec.rb171
-rw-r--r--spec/ruby/library/English/alias_spec.rb14
-rw-r--r--spec/ruby/library/abbrev/abbrev_spec.rb31
-rw-r--r--spec/ruby/library/base64/decode64_spec.rb29
-rw-r--r--spec/ruby/library/base64/encode64_spec.rb23
-rw-r--r--spec/ruby/library/base64/strict_decode64_spec.rb41
-rw-r--r--spec/ruby/library/base64/strict_encode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_decode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_encode64_spec.rb20
-rw-r--r--spec/ruby/library/bigdecimal/BigDecimal_spec.rb269
-rw-r--r--spec/ruby/library/bigdecimal/abs_spec.rb50
-rw-r--r--spec/ruby/library/bigdecimal/add_spec.rb193
-rw-r--r--spec/ruby/library/bigdecimal/case_compare_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/ceil_spec.rb104
-rw-r--r--spec/ruby/library/bigdecimal/clone_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/coerce_spec.rb26
-rw-r--r--spec/ruby/library/bigdecimal/comparison_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/constants_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/div_spec.rb110
-rw-r--r--spec/ruby/library/bigdecimal/divide_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/divmod_spec.rb180
-rw-r--r--spec/ruby/library/bigdecimal/double_fig_spec.rb9
-rw-r--r--spec/ruby/library/bigdecimal/dup_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/eql_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/equal_value_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/exponent_spec.rb27
-rw-r--r--spec/ruby/library/bigdecimal/finite_spec.rb34
-rw-r--r--spec/ruby/library/bigdecimal/fix_spec.rb57
-rw-r--r--spec/ruby/library/bigdecimal/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/bigdecimal/floor_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/frac_spec.rb48
-rw-r--r--spec/ruby/library/bigdecimal/gt_spec.rb96
-rw-r--r--spec/ruby/library/bigdecimal/gte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/hash_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/infinite_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/inspect_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/limit_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/lt_spec.rb94
-rw-r--r--spec/ruby/library/bigdecimal/lte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/minus_spec.rb66
-rw-r--r--spec/ruby/library/bigdecimal/mode_spec.rb36
-rw-r--r--spec/ruby/library/bigdecimal/modulo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/mult_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/multiply_spec.rb41
-rw-r--r--spec/ruby/library/bigdecimal/nan_spec.rb23
-rw-r--r--spec/ruby/library/bigdecimal/nonzero_spec.rb29
-rw-r--r--spec/ruby/library/bigdecimal/plus_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/power_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/precs_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/quo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/remainder_spec.rb92
-rw-r--r--spec/ruby/library/bigdecimal/round_spec.rb242
-rw-r--r--spec/ruby/library/bigdecimal/shared/clone.rb13
-rw-r--r--spec/ruby/library/bigdecimal/shared/eql.rb61
-rw-r--r--spec/ruby/library/bigdecimal/shared/modulo.rb125
-rw-r--r--spec/ruby/library/bigdecimal/shared/mult.rb97
-rw-r--r--spec/ruby/library/bigdecimal/shared/power.rb72
-rw-r--r--spec/ruby/library/bigdecimal/shared/quo.rb67
-rw-r--r--spec/ruby/library/bigdecimal/shared/to_int.rb16
-rw-r--r--spec/ruby/library/bigdecimal/sign_spec.rb46
-rw-r--r--spec/ruby/library/bigdecimal/split_spec.rb86
-rw-r--r--spec/ruby/library/bigdecimal/sqrt_spec.rb112
-rw-r--r--spec/ruby/library/bigdecimal/sub_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/to_d_spec.rb10
-rw-r--r--spec/ruby/library/bigdecimal/to_f_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/to_i_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/to_int_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/to_r_spec.rb28
-rw-r--r--spec/ruby/library/bigdecimal/to_s_spec.rb97
-rw-r--r--spec/ruby/library/bigdecimal/truncate_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/uminus_spec.rb58
-rw-r--r--spec/ruby/library/bigdecimal/uplus_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/util_spec.rb40
-rw-r--r--spec/ruby/library/bigdecimal/zero_spec.rb27
-rw-r--r--spec/ruby/library/bigmath/log_spec.rb10
-rw-r--r--spec/ruby/library/cgi/cookie/domain_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/expires_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/initialize_spec.rb147
-rw-r--r--spec/ruby/library/cgi/cookie/name_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/parse_spec.rb26
-rw-r--r--spec/ruby/library/cgi/cookie/path_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/secure_spec.rb70
-rw-r--r--spec/ruby/library/cgi/cookie/to_s_spec.rb33
-rw-r--r--spec/ruby/library/cgi/cookie/value_spec.rb76
-rw-r--r--spec/ruby/library/cgi/escapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/escapeHTML_spec.rb17
-rw-r--r--spec/ruby/library/cgi/escape_spec.rb18
-rw-r--r--spec/ruby/library/cgi/htmlextension/a_spec.rb49
-rw-r--r--spec/ruby/library/cgi/htmlextension/base_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/blockquote_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/br_spec.rb22
-rw-r--r--spec/ruby/library/cgi/htmlextension/caption_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_group_spec.rb76
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/doctype_spec.rb27
-rw-r--r--spec/ruby/library/cgi/htmlextension/file_field_spec.rb72
-rw-r--r--spec/ruby/library/cgi/htmlextension/fixtures/common.rb15
-rw-r--r--spec/ruby/library/cgi/htmlextension/form_spec.rb58
-rw-r--r--spec/ruby/library/cgi/htmlextension/frame_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/frameset_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/hidden_spec.rb59
-rw-r--r--spec/ruby/library/cgi/htmlextension/html_spec.rb66
-rw-r--r--spec/ruby/library/cgi/htmlextension/image_button_spec.rb69
-rw-r--r--spec/ruby/library/cgi/htmlextension/img_spec.rb83
-rw-r--r--spec/ruby/library/cgi/htmlextension/multipart_form_spec.rb64
-rw-r--r--spec/ruby/library/cgi/htmlextension/password_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/popup_menu_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_button_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_group_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/reset_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/scrolling_list_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/shared/popup_menu.rb94
-rw-r--r--spec/ruby/library/cgi/htmlextension/submit_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/text_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/textarea_spec.rb73
-rw-r--r--spec/ruby/library/cgi/http_header_spec.rb8
-rw-r--r--spec/ruby/library/cgi/initialize_spec.rb133
-rw-r--r--spec/ruby/library/cgi/out_spec.rb51
-rw-r--r--spec/ruby/library/cgi/parse_spec.rb24
-rw-r--r--spec/ruby/library/cgi/pretty_spec.rb24
-rw-r--r--spec/ruby/library/cgi/print_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_charset_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_encoding_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_language_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/auth_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cache_control_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/content_length_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/content_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cookies_spec.rb10
-rw-r--r--spec/ruby/library/cgi/queryextension/element_reference_spec.rb27
-rw-r--r--spec/ruby/library/cgi/queryextension/from_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/gateway_interface_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/has_key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/include_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/keys_spec.rb20
-rw-r--r--spec/ruby/library/cgi/queryextension/multipart_spec.rb40
-rw-r--r--spec/ruby/library/cgi/queryextension/negotiate_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/params_spec.rb37
-rw-r--r--spec/ruby/library/cgi/queryextension/path_info_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/path_translated_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/pragma_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/query_string_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie2_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/referer_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_addr_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_ident_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_user_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/request_method_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/script_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_port_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/server_protocol_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_software_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/shared/has_key.rb19
-rw-r--r--spec/ruby/library/cgi/queryextension/user_agent_spec.rb22
-rw-r--r--spec/ruby/library/cgi/rfc1123_date_spec.rb10
-rw-r--r--spec/ruby/library/cgi/shared/http_header.rb112
-rw-r--r--spec/ruby/library/cgi/unescapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/unescapeHTML_spec.rb44
-rw-r--r--spec/ruby/library/cgi/unescape_spec.rb15
-rw-r--r--spec/ruby/library/coverage/fixtures/eval_code.rb11
-rw-r--r--spec/ruby/library/coverage/fixtures/second_class.rb5
-rw-r--r--spec/ruby/library/coverage/fixtures/some_class.rb16
-rw-r--r--spec/ruby/library/coverage/fixtures/start_coverage.rb3
-rw-r--r--spec/ruby/library/coverage/peek_result_spec.rb64
-rw-r--r--spec/ruby/library/coverage/result_spec.rb141
-rw-r--r--spec/ruby/library/coverage/running_spec.rb20
-rw-r--r--spec/ruby/library/coverage/start_spec.rb12
-rw-r--r--spec/ruby/library/csv/basicwriter/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/data_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/fixtures/one_line.csv1
-rw-r--r--spec/ruby/library/csv/foreach_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_line_spec.rb30
-rw-r--r--spec/ruby/library/csv/generate_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_spec.rb32
-rw-r--r--spec/ruby/library/csv/iobuf/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/liberal_parsing_spec.rb19
-rw-r--r--spec/ruby/library/csv/open_spec.rb6
-rw-r--r--spec/ruby/library/csv/parse_spec.rb93
-rw-r--r--spec/ruby/library/csv/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/readlines_spec.rb35
-rw-r--r--spec/ruby/library/csv/streambuf/add_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/buf_size_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/drop_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/element_reference_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/get_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/idx_is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/rel_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/add_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/append_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/create_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/generate_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/terminate_spec.rb6
-rw-r--r--spec/ruby/library/date/accessor_spec.rb91
-rw-r--r--spec/ruby/library/date/add_month_spec.rb38
-rw-r--r--spec/ruby/library/date/add_spec.rb30
-rw-r--r--spec/ruby/library/date/ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/append_spec.rb6
-rw-r--r--spec/ruby/library/date/asctime_spec.rb6
-rw-r--r--spec/ruby/library/date/boat_spec.rb24
-rw-r--r--spec/ruby/library/date/case_compare_spec.rb6
-rw-r--r--spec/ruby/library/date/civil_spec.rb7
-rw-r--r--spec/ruby/library/date/commercial_spec.rb17
-rw-r--r--spec/ruby/library/date/commercial_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/constants_spec.rb48
-rw-r--r--spec/ruby/library/date/conversions_spec.rb43
-rw-r--r--spec/ruby/library/date/ctime_spec.rb6
-rw-r--r--spec/ruby/library/date/cwday_spec.rb6
-rw-r--r--spec/ruby/library/date/cweek_spec.rb6
-rw-r--r--spec/ruby/library/date/cwyear_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_to_time_spec.rb6
-rw-r--r--spec/ruby/library/date/day_spec.rb9
-rw-r--r--spec/ruby/library/date/downto_spec.rb18
-rw-r--r--spec/ruby/library/date/england_spec.rb6
-rw-r--r--spec/ruby/library/date/eql_spec.rb12
-rw-r--r--spec/ruby/library/date/format/bag/method_missing_spec.rb6
-rw-r--r--spec/ruby/library/date/format/bag/to_hash_spec.rb6
-rw-r--r--spec/ruby/library/date/friday_spec.rb12
-rw-r--r--spec/ruby/library/date/gregorian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/gregorian_spec.rb16
-rw-r--r--spec/ruby/library/date/hash_spec.rb8
-rw-r--r--spec/ruby/library/date/infinity/abs_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/coerce_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/d_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/finite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/infinite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/nan_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uminus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uplus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/zero_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity_spec.rb67
-rw-r--r--spec/ruby/library/date/inspect_spec.rb6
-rw-r--r--spec/ruby/library/date/iso8601_spec.rb35
-rw-r--r--spec/ruby/library/date/italy_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_spec.rb15
-rw-r--r--spec/ruby/library/date/jd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_civil_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_commercial_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ld_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ordinal_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_wday_spec.rb6
-rw-r--r--spec/ruby/library/date/julian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/julian_spec.rb16
-rw-r--r--spec/ruby/library/date/ld_spec.rb6
-rw-r--r--spec/ruby/library/date/ld_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/leap_spec.rb10
-rw-r--r--spec/ruby/library/date/mday_spec.rb6
-rw-r--r--spec/ruby/library/date/minus_month_spec.rb23
-rw-r--r--spec/ruby/library/date/minus_spec.rb30
-rw-r--r--spec/ruby/library/date/mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/mjd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/mon_spec.rb6
-rw-r--r--spec/ruby/library/date/monday_spec.rb8
-rw-r--r--spec/ruby/library/date/month_spec.rb9
-rw-r--r--spec/ruby/library/date/new_spec.rb8
-rw-r--r--spec/ruby/library/date/new_start_spec.rb6
-rw-r--r--spec/ruby/library/date/next_day_spec.rb14
-rw-r--r--spec/ruby/library/date/next_month_spec.rb29
-rw-r--r--spec/ruby/library/date/next_spec.rb6
-rw-r--r--spec/ruby/library/date/next_year_spec.rb12
-rw-r--r--spec/ruby/library/date/ordinal_spec.rb7
-rw-r--r--spec/ruby/library/date/ordinal_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/parse_spec.rb159
-rw-r--r--spec/ruby/library/date/plus_spec.rb20
-rw-r--r--spec/ruby/library/date/prev_day_spec.rb14
-rw-r--r--spec/ruby/library/date/prev_month_spec.rb29
-rw-r--r--spec/ruby/library/date/prev_year_spec.rb12
-rw-r--r--spec/ruby/library/date/relationship_spec.rb20
-rw-r--r--spec/ruby/library/date/rfc3339_spec.rb13
-rw-r--r--spec/ruby/library/date/right_shift_spec.rb6
-rw-r--r--spec/ruby/library/date/saturday_spec.rb8
-rw-r--r--spec/ruby/library/date/shared/civil.rb57
-rw-r--r--spec/ruby/library/date/shared/commercial.rb39
-rw-r--r--spec/ruby/library/date/shared/jd.rb14
-rw-r--r--spec/ruby/library/date/shared/new_bang.rb14
-rw-r--r--spec/ruby/library/date/shared/ordinal.rb22
-rw-r--r--spec/ruby/library/date/shared/parse.rb54
-rw-r--r--spec/ruby/library/date/shared/parse_eu.rb37
-rw-r--r--spec/ruby/library/date/shared/parse_us.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_civil.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_commercial.rb34
-rw-r--r--spec/ruby/library/date/shared/valid_jd.rb20
-rw-r--r--spec/ruby/library/date/shared/valid_ordinal.rb26
-rw-r--r--spec/ruby/library/date/start_spec.rb6
-rw-r--r--spec/ruby/library/date/step_spec.rb56
-rw-r--r--spec/ruby/library/date/strftime_spec.rb49
-rw-r--r--spec/ruby/library/date/strptime_spec.rb149
-rw-r--r--spec/ruby/library/date/succ_spec.rb6
-rw-r--r--spec/ruby/library/date/sunday_spec.rb8
-rw-r--r--spec/ruby/library/date/thursday_spec.rb8
-rw-r--r--spec/ruby/library/date/time_to_day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/to_s_spec.rb6
-rw-r--r--spec/ruby/library/date/today_spec.rb14
-rw-r--r--spec/ruby/library/date/tuesday_spec.rb8
-rw-r--r--spec/ruby/library/date/upto_spec.rb16
-rw-r--r--spec/ruby/library/date/valid_civil_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_commercial_spec.rb8
-rw-r--r--spec/ruby/library/date/valid_date_spec.rb7
-rw-r--r--spec/ruby/library/date/valid_jd_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_ordinal_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_time_spec.rb6
-rw-r--r--spec/ruby/library/date/wday_spec.rb9
-rw-r--r--spec/ruby/library/date/wednesday_spec.rb8
-rw-r--r--spec/ruby/library/date/yday_spec.rb6
-rw-r--r--spec/ruby/library/date/year_spec.rb9
-rw-r--r--spec/ruby/library/date/zone_to_diff_spec.rb6
-rw-r--r--spec/ruby/library/datetime/_strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/add_spec.rb9
-rw-r--r--spec/ruby/library/datetime/civil_spec.rb6
-rw-r--r--spec/ruby/library/datetime/commercial_spec.rb6
-rw-r--r--spec/ruby/library/datetime/hour_spec.rb47
-rw-r--r--spec/ruby/library/datetime/httpdate_spec.rb6
-rw-r--r--spec/ruby/library/datetime/iso8601_spec.rb10
-rw-r--r--spec/ruby/library/datetime/jd_spec.rb6
-rw-r--r--spec/ruby/library/datetime/jisx0301_spec.rb10
-rw-r--r--spec/ruby/library/datetime/min_spec.rb6
-rw-r--r--spec/ruby/library/datetime/minute_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_spec.rb52
-rw-r--r--spec/ruby/library/datetime/now_spec.rb25
-rw-r--r--spec/ruby/library/datetime/offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/ordinal_spec.rb6
-rw-r--r--spec/ruby/library/datetime/parse_spec.rb127
-rw-r--r--spec/ruby/library/datetime/rfc2822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/rfc3339_spec.rb10
-rw-r--r--spec/ruby/library/datetime/rfc822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_spec.rb6
-rw-r--r--spec/ruby/library/datetime/shared/min.rb40
-rw-r--r--spec/ruby/library/datetime/shared/sec.rb45
-rw-r--r--spec/ruby/library/datetime/strftime_spec.rb61
-rw-r--r--spec/ruby/library/datetime/strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/subtract_spec.rb19
-rw-r--r--spec/ruby/library/datetime/to_date_spec.rb37
-rw-r--r--spec/ruby/library/datetime/to_datetime_spec.rb9
-rw-r--r--spec/ruby/library/datetime/to_s_spec.rb17
-rw-r--r--spec/ruby/library/datetime/to_time_spec.rb50
-rw-r--r--spec/ruby/library/datetime/xmlschema_spec.rb10
-rw-r--r--spec/ruby/library/datetime/zone_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_method_spec.rb52
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_methods_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegate_class/private_instance_methods_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegate_class/protected_instance_methods_spec.rb29
-rw-r--r--spec/ruby/library/delegate/delegate_class/public_instance_methods_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegate_class/respond_to_missing_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegator/case_compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/complement_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/eql_spec.rb35
-rw-r--r--spec/ruby/library/delegate/delegator/equal_spec.rb13
-rw-r--r--spec/ruby/library/delegate/delegator/equal_value_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/frozen_spec.rb39
-rw-r--r--spec/ruby/library/delegate/delegator/hash_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/marshal_spec.rb21
-rw-r--r--spec/ruby/library/delegate/delegator/method_spec.rb69
-rw-r--r--spec/ruby/library/delegate/delegator/methods_spec.rb37
-rw-r--r--spec/ruby/library/delegate/delegator/not_equal_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/not_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/private_methods_spec.rb20
-rw-r--r--spec/ruby/library/delegate/delegator/protected_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/public_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/send_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/taint_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/tap_spec.rb16
-rw-r--r--spec/ruby/library/delegate/delegator/trust_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/untaint_spec.rb8
-rw-r--r--spec/ruby/library/delegate/delegator/untrust_spec.rb8
-rw-r--r--spec/ruby/library/delegate/fixtures/classes.rb60
-rw-r--r--spec/ruby/library/digest/bubblebabble_spec.rb29
-rw-r--r--spec/ruby/library/digest/hexencode_spec.rb31
-rw-r--r--spec/ruby/library/digest/instance/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/instance/new_spec.rb19
-rw-r--r--spec/ruby/library/digest/instance/shared/update.rb8
-rw-r--r--spec/ruby/library/digest/instance/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/md5/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/equal_spec.rb37
-rw-r--r--spec/ruby/library/digest/md5/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/md5/shared/sample.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/md5/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/to_s_spec.rb24
-rw-r--r--spec/ruby/library/digest/md5/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha1/digest_spec.rb20
-rw-r--r--spec/ruby/library/digest/sha1/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha1/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha2/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha256/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha256/file_spec.rb47
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha256/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha256/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha256/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha256/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha384/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha384/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/shared/constants.rb19
-rw-r--r--spec/ruby/library/digest/sha384/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha384/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha384/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha384/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha512/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha512/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha512/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha512/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha512/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha512/update_spec.rb7
-rw-r--r--spec/ruby/library/drb/fixtures/test_server.rb8
-rw-r--r--spec/ruby/library/drb/start_service_spec.rb28
-rw-r--r--spec/ruby/library/erb/def_class_spec.rb29
-rw-r--r--spec/ruby/library/erb/def_method_spec.rb26
-rw-r--r--spec/ruby/library/erb/def_module_spec.rb27
-rw-r--r--spec/ruby/library/erb/defmethod/def_erb_method_spec.rb64
-rw-r--r--spec/ruby/library/erb/filename_spec.rb40
-rw-r--r--spec/ruby/library/erb/fixtures/classes.rb5
-rw-r--r--spec/ruby/library/erb/new_spec.rb157
-rw-r--r--spec/ruby/library/erb/result_spec.rb86
-rw-r--r--spec/ruby/library/erb/run_spec.rb96
-rw-r--r--spec/ruby/library/erb/src_spec.rb33
-rw-r--r--spec/ruby/library/erb/util/h_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/html_escape_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/shared/html_escape.rb42
-rw-r--r--spec/ruby/library/erb/util/shared/url_encode.rb42
-rw-r--r--spec/ruby/library/erb/util/u_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/url_encode_spec.rb7
-rw-r--r--spec/ruby/library/etc/confstr_spec.rb14
-rw-r--r--spec/ruby/library/etc/endgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/endpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrgid_spec.rb69
-rw-r--r--spec/ruby/library/etc/getgrnam_spec.rb30
-rw-r--r--spec/ruby/library/etc/getlogin_spec.rb43
-rw-r--r--spec/ruby/library/etc/getpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getpwnam_spec.rb28
-rw-r--r--spec/ruby/library/etc/getpwuid_spec.rb36
-rw-r--r--spec/ruby/library/etc/group_spec.rb27
-rw-r--r--spec/ruby/library/etc/nprocessors_spec.rb9
-rw-r--r--spec/ruby/library/etc/passwd_spec.rb15
-rw-r--r--spec/ruby/library/etc/shared/windows.rb7
-rw-r--r--spec/ruby/library/etc/struct_group_spec.rb35
-rw-r--r--spec/ruby/library/etc/struct_passwd_spec.rb43
-rw-r--r--spec/ruby/library/etc/sysconf_spec.rb22
-rw-r--r--spec/ruby/library/etc/sysconfdir_spec.rb8
-rw-r--r--spec/ruby/library/etc/systmpdir_spec.rb8
-rw-r--r--spec/ruby/library/expect/expect_spec.rb62
-rw-r--r--spec/ruby/library/fiber/alive_spec.rb46
-rw-r--r--spec/ruby/library/fiber/current_spec.rb63
-rw-r--r--spec/ruby/library/fiber/resume_spec.rb35
-rw-r--r--spec/ruby/library/fiber/transfer_spec.rb128
-rw-r--r--spec/ruby/library/fiddle/handle/initialize_spec.rb10
-rw-r--r--spec/ruby/library/find/find_spec.rb30
-rw-r--r--spec/ruby/library/find/fixtures/common.rb174
-rw-r--r--spec/ruby/library/find/prune_spec.rb12
-rw-r--r--spec/ruby/library/getoptlong/each_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/each_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/error_message_spec.rb23
-rw-r--r--spec/ruby/library/getoptlong/get_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/get_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/initialize_spec.rb28
-rw-r--r--spec/ruby/library/getoptlong/ordering_spec.rb38
-rw-r--r--spec/ruby/library/getoptlong/set_options_spec.rb98
-rw-r--r--spec/ruby/library/getoptlong/shared/each.rb18
-rw-r--r--spec/ruby/library/getoptlong/shared/get.rb62
-rw-r--r--spec/ruby/library/getoptlong/terminate_spec.rb30
-rw-r--r--spec/ruby/library/getoptlong/terminated_spec.rb17
-rw-r--r--spec/ruby/library/io-wait/wait_readable_spec.rb27
-rw-r--r--spec/ruby/library/io-wait/wait_writable_spec.rb20
-rw-r--r--spec/ruby/library/ipaddr/hton_spec.rb30
-rw-r--r--spec/ruby/library/ipaddr/ipv4_conversion_spec.rb44
-rw-r--r--spec/ruby/library/ipaddr/new_spec.rb110
-rw-r--r--spec/ruby/library/ipaddr/operator_spec.rb82
-rw-r--r--spec/ruby/library/ipaddr/reverse_spec.rb27
-rw-r--r--spec/ruby/library/ipaddr/to_s_spec.rb20
-rw-r--r--spec/ruby/library/logger/device/close_spec.rb31
-rw-r--r--spec/ruby/library/logger/device/new_spec.rb47
-rw-r--r--spec/ruby/library/logger/device/write_spec.rb51
-rw-r--r--spec/ruby/library/logger/fixtures/common.rb9
-rw-r--r--spec/ruby/library/logger/logger/add_spec.rb81
-rw-r--r--spec/ruby/library/logger/logger/close_spec.rb20
-rw-r--r--spec/ruby/library/logger/logger/datetime_format_spec.rb60
-rw-r--r--spec/ruby/library/logger/logger/debug_spec.rb52
-rw-r--r--spec/ruby/library/logger/logger/error_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/fatal_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/info_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/new_spec.rb118
-rw-r--r--spec/ruby/library/logger/logger/unknown_spec.rb36
-rw-r--r--spec/ruby/library/logger/logger/warn_spec.rb53
-rw-r--r--spec/ruby/library/logger/severity_spec.rb13
-rw-r--r--spec/ruby/library/matrix/I_spec.rb9
-rw-r--r--spec/ruby/library/matrix/antisymmetric_spec.rb38
-rw-r--r--spec/ruby/library/matrix/build_spec.rb76
-rw-r--r--spec/ruby/library/matrix/clone_spec.rb28
-rw-r--r--spec/ruby/library/matrix/coerce_spec.rb11
-rw-r--r--spec/ruby/library/matrix/collect_spec.rb9
-rw-r--r--spec/ruby/library/matrix/column_size_spec.rb16
-rw-r--r--spec/ruby/library/matrix/column_spec.rb38
-rw-r--r--spec/ruby/library/matrix/column_vector_spec.rb28
-rw-r--r--spec/ruby/library/matrix/column_vectors_spec.rb29
-rw-r--r--spec/ruby/library/matrix/columns_spec.rb45
-rw-r--r--spec/ruby/library/matrix/conj_spec.rb9
-rw-r--r--spec/ruby/library/matrix/conjugate_spec.rb9
-rw-r--r--spec/ruby/library/matrix/constructor_spec.rb68
-rw-r--r--spec/ruby/library/matrix/det_spec.rb10
-rw-r--r--spec/ruby/library/matrix/determinant_spec.rb10
-rw-r--r--spec/ruby/library/matrix/diagonal_spec.rb75
-rw-r--r--spec/ruby/library/matrix/divide_spec.rb57
-rw-r--r--spec/ruby/library/matrix/each_spec.rb77
-rw-r--r--spec/ruby/library/matrix/each_with_index_spec.rb84
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalue_matrix_spec.rb12
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalues_spec.rb25
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvector_matrix_spec.rb23
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvectors_spec.rb25
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/initialize_spec.rb27
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/to_a_spec.rb21
-rw-r--r--spec/ruby/library/matrix/element_reference_spec.rb26
-rw-r--r--spec/ruby/library/matrix/empty_spec.rb71
-rw-r--r--spec/ruby/library/matrix/eql_spec.rb14
-rw-r--r--spec/ruby/library/matrix/equal_value_spec.rb14
-rw-r--r--spec/ruby/library/matrix/exponent_spec.rb67
-rw-r--r--spec/ruby/library/matrix/find_index_spec.rb149
-rw-r--r--spec/ruby/library/matrix/fixtures/classes.rb7
-rw-r--r--spec/ruby/library/matrix/hash_spec.rb18
-rw-r--r--spec/ruby/library/matrix/hermitian_spec.rb37
-rw-r--r--spec/ruby/library/matrix/identity_spec.rb9
-rw-r--r--spec/ruby/library/matrix/imag_spec.rb9
-rw-r--r--spec/ruby/library/matrix/imaginary_spec.rb9
-rw-r--r--spec/ruby/library/matrix/inspect_spec.rb30
-rw-r--r--spec/ruby/library/matrix/inv_spec.rb10
-rw-r--r--spec/ruby/library/matrix/inverse_from_spec.rb9
-rw-r--r--spec/ruby/library/matrix/inverse_spec.rb10
-rw-r--r--spec/ruby/library/matrix/lower_triangular_spec.rb27
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/determinant_spec.rb24
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/initialize_spec.rb16
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/l_spec.rb21
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/p_spec.rb21
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/solve_spec.rb56
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/to_a_spec.rb36
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/u_spec.rb21
-rw-r--r--spec/ruby/library/matrix/map_spec.rb9
-rw-r--r--spec/ruby/library/matrix/minor_spec.rb88
-rw-r--r--spec/ruby/library/matrix/minus_spec.rb45
-rw-r--r--spec/ruby/library/matrix/multiply_spec.rb71
-rw-r--r--spec/ruby/library/matrix/new_spec.rb11
-rw-r--r--spec/ruby/library/matrix/normal_spec.rb29
-rw-r--r--spec/ruby/library/matrix/orthogonal_spec.rb29
-rw-r--r--spec/ruby/library/matrix/permutation_spec.rb35
-rw-r--r--spec/ruby/library/matrix/plus_spec.rb45
-rw-r--r--spec/ruby/library/matrix/rank_spec.rb22
-rw-r--r--spec/ruby/library/matrix/real_spec.rb46
-rw-r--r--spec/ruby/library/matrix/rect_spec.rb9
-rw-r--r--spec/ruby/library/matrix/rectangular_spec.rb9
-rw-r--r--spec/ruby/library/matrix/regular_spec.rb34
-rw-r--r--spec/ruby/library/matrix/round_spec.rb24
-rw-r--r--spec/ruby/library/matrix/row_size_spec.rb16
-rw-r--r--spec/ruby/library/matrix/row_spec.rb39
-rw-r--r--spec/ruby/library/matrix/row_vector_spec.rb27
-rw-r--r--spec/ruby/library/matrix/row_vectors_spec.rb29
-rw-r--r--spec/ruby/library/matrix/rows_spec.rb44
-rw-r--r--spec/ruby/library/matrix/scalar/Fail_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/Raise_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/divide_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/exponent_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/included_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/initialize_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/minus_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/multiply_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar/plus_spec.rb9
-rw-r--r--spec/ruby/library/matrix/scalar_spec.rb70
-rw-r--r--spec/ruby/library/matrix/shared/collect.rb26
-rw-r--r--spec/ruby/library/matrix/shared/conjugate.rb20
-rw-r--r--spec/ruby/library/matrix/shared/determinant.rb38
-rw-r--r--spec/ruby/library/matrix/shared/equal_value.rb33
-rw-r--r--spec/ruby/library/matrix/shared/identity.rb19
-rw-r--r--spec/ruby/library/matrix/shared/imaginary.rb20
-rw-r--r--spec/ruby/library/matrix/shared/inverse.rb38
-rw-r--r--spec/ruby/library/matrix/shared/rectangular.rb18
-rw-r--r--spec/ruby/library/matrix/shared/trace.rb12
-rw-r--r--spec/ruby/library/matrix/shared/transpose.rb19
-rw-r--r--spec/ruby/library/matrix/singular_spec.rb34
-rw-r--r--spec/ruby/library/matrix/spec_helper.rb35
-rw-r--r--spec/ruby/library/matrix/square_spec.rb31
-rw-r--r--spec/ruby/library/matrix/symmetric_spec.rb32
-rw-r--r--spec/ruby/library/matrix/t_spec.rb9
-rw-r--r--spec/ruby/library/matrix/to_a_spec.rb14
-rw-r--r--spec/ruby/library/matrix/to_s_spec.rb9
-rw-r--r--spec/ruby/library/matrix/tr_spec.rb10
-rw-r--r--spec/ruby/library/matrix/trace_spec.rb10
-rw-r--r--spec/ruby/library/matrix/transpose_spec.rb9
-rw-r--r--spec/ruby/library/matrix/unit_spec.rb9
-rw-r--r--spec/ruby/library/matrix/unitary_spec.rb36
-rw-r--r--spec/ruby/library/matrix/upper_triangular_spec.rb27
-rw-r--r--spec/ruby/library/matrix/vector/cross_product_spec.rb17
-rw-r--r--spec/ruby/library/matrix/vector/each2_spec.rb52
-rw-r--r--spec/ruby/library/matrix/vector/eql_spec.rb19
-rw-r--r--spec/ruby/library/matrix/vector/inner_product_spec.rb25
-rw-r--r--spec/ruby/library/matrix/vector/normalize_spec.rb21
-rw-r--r--spec/ruby/library/matrix/zero_spec.rb55
-rw-r--r--spec/ruby/library/mkmf/mkmf_spec.rb7
-rw-r--r--spec/ruby/library/monitor/enter_spec.rb28
-rw-r--r--spec/ruby/library/monitor/mon_initialize_spec.rb31
-rw-r--r--spec/ruby/library/monitor/new_cond_spec.rb88
-rw-r--r--spec/ruby/library/monitor/synchronize_spec.rb41
-rw-r--r--spec/ruby/library/monitor/try_enter_spec.rb39
-rw-r--r--spec/ruby/library/net/FTPError_spec.rb11
-rw-r--r--spec/ruby/library/net/FTPPermError_spec.rb15
-rw-r--r--spec/ruby/library/net/FTPProtoError_spec.rb15
-rw-r--r--spec/ruby/library/net/FTPReplyError_spec.rb15
-rw-r--r--spec/ruby/library/net/FTPTempError_spec.rb15
-rw-r--r--spec/ruby/library/net/ftp/abort_spec.rb65
-rw-r--r--spec/ruby/library/net/ftp/acct_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/binary_spec.rb27
-rw-r--r--spec/ruby/library/net/ftp/chdir_spec.rb102
-rw-r--r--spec/ruby/library/net/ftp/close_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/closed_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/connect_spec.rb52
-rw-r--r--spec/ruby/library/net/ftp/debug_mode_spec.rb26
-rw-r--r--spec/ruby/library/net/ftp/default_passive_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/delete_spec.rb62
-rw-r--r--spec/ruby/library/net/ftp/dir_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/fixtures/default_passive.rb3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/passive.rb2
-rw-r--r--spec/ruby/library/net/ftp/fixtures/putbinaryfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/puttextfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/server.rb277
-rw-r--r--spec/ruby/library/net/ftp/get_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/getbinaryfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/getdir_spec.rb10
-rw-r--r--spec/ruby/library/net/ftp/gettextfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/help_spec.rb69
-rw-r--r--spec/ruby/library/net/ftp/initialize_spec.rb408
-rw-r--r--spec/ruby/library/net/ftp/last_response_code_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/last_response_spec.rb28
-rw-r--r--spec/ruby/library/net/ftp/lastresp_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/list_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/login_spec.rb198
-rw-r--r--spec/ruby/library/net/ftp/ls_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/mdtm_spec.rb41
-rw-r--r--spec/ruby/library/net/ftp/mkdir_spec.rb64
-rw-r--r--spec/ruby/library/net/ftp/mtime_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/nlst_spec.rb95
-rw-r--r--spec/ruby/library/net/ftp/noop_spec.rb41
-rw-r--r--spec/ruby/library/net/ftp/open_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/passive_spec.rb31
-rw-r--r--spec/ruby/library/net/ftp/put_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/putbinaryfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/puttextfile_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/pwd_spec.rb56
-rw-r--r--spec/ruby/library/net/ftp/quit_spec.rb36
-rw-r--r--spec/ruby/library/net/ftp/rename_spec.rb97
-rw-r--r--spec/ruby/library/net/ftp/resume_spec.rb26
-rw-r--r--spec/ruby/library/net/ftp/retrbinary_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/retrlines_spec.rb37
-rw-r--r--spec/ruby/library/net/ftp/return_code_spec.rb27
-rw-r--r--spec/ruby/library/net/ftp/rmdir_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/sendcmd_spec.rb57
-rw-r--r--spec/ruby/library/net/ftp/set_socket_spec.rb11
-rw-r--r--spec/ruby/library/net/ftp/shared/getbinaryfile.rb150
-rw-r--r--spec/ruby/library/net/ftp/shared/gettextfile.rb100
-rw-r--r--spec/ruby/library/net/ftp/shared/last_response_code.rb25
-rw-r--r--spec/ruby/library/net/ftp/shared/list.rb104
-rw-r--r--spec/ruby/library/net/ftp/shared/putbinaryfile.rb167
-rw-r--r--spec/ruby/library/net/ftp/shared/puttextfile.rb120
-rw-r--r--spec/ruby/library/net/ftp/shared/pwd.rb3
-rw-r--r--spec/ruby/library/net/ftp/site_spec.rb56
-rw-r--r--spec/ruby/library/net/ftp/size_spec.rb51
-rw-r--r--spec/ruby/library/net/ftp/spec_helper.rb5
-rw-r--r--spec/ruby/library/net/ftp/status_spec.rb70
-rw-r--r--spec/ruby/library/net/ftp/storbinary_spec.rb51
-rw-r--r--spec/ruby/library/net/ftp/storlines_spec.rb46
-rw-r--r--spec/ruby/library/net/ftp/system_spec.rb51
-rw-r--r--spec/ruby/library/net/ftp/voidcmd_spec.rb57
-rw-r--r--spec/ruby/library/net/ftp/welcome_spec.rb28
-rw-r--r--spec/ruby/library/net/http/HTTPBadResponse_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPClientExcepton_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPFatalError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPHeaderSyntaxError_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPRetriableError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPServerException_spec.rb12
-rw-r--r--spec/ruby/library/net/http/http/Proxy_spec.rb35
-rw-r--r--spec/ruby/library/net/http/http/active_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/address_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/close_on_empty_response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/http/copy_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/delete_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/finish_spec.rb29
-rw-r--r--spec/ruby/library/net/http/http/fixtures/http_server.rb123
-rw-r--r--spec/ruby/library/net/http/http/get2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/get_print_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_response_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_spec.rb96
-rw-r--r--spec/ruby/library/net/http/http/head2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/head_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/http_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/https_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/initialize_spec.rb46
-rw-r--r--spec/ruby/library/net/http/http/inspect_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_2_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/lock_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/mkcol_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/move_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/new_spec.rb86
-rw-r--r--spec/ruby/library/net/http/http/newobj_spec.rb48
-rw-r--r--spec/ruby/library/net/http/http/open_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/options_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/port_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/post2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/post_form_spec.rb22
-rw-r--r--spec/ruby/library/net/http/http/post_spec.rb74
-rw-r--r--spec/ruby/library/net/http/http/propfind_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proppatch_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proxy_address_spec.rb31
-rw-r--r--spec/ruby/library/net/http/http/proxy_class_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/proxy_pass_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_port_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_user_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/put2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/put_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/read_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/request_get_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_head_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_post_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_put_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_spec.rb109
-rw-r--r--spec/ruby/library/net/http/http/request_types_spec.rb254
-rw-r--r--spec/ruby/library/net/http/http/send_request_spec.rb61
-rw-r--r--spec/ruby/library/net/http/http/set_debug_output_spec.rb33
-rw-r--r--spec/ruby/library/net/http/http/shared/request_get.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_head.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_post.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_put.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/started.rb26
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_1.rb6
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_2.rb6
-rw-r--r--spec/ruby/library/net/http/http/socket_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/start_spec.rb111
-rw-r--r--spec/ruby/library/net/http/http/started_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/trace_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/unlock_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/use_ssl_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/version_1_2_spec.rb20
-rw-r--r--spec/ruby/library/net/http/httpexceptions/fixtures/classes.rb5
-rw-r--r--spec/ruby/library/net/http/httpexceptions/initialize_spec.rb17
-rw-r--r--spec/ruby/library/net/http/httpexceptions/response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_exist_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_stream_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/exec_spec.rb131
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/inspect_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/method_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/path_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/request_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/response_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/set_body_internal_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/add_field_spec.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/canonical_each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/chunked_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpheader/content_length_spec.rb54
-rw-r--r--spec/ruby/library/net/http/httpheader/content_range_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/content_type_spec.rb26
-rw-r--r--spec/ruby/library/net/http/httpheader/delete_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_name_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_header_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_key_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_name_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_value_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/element_reference_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/element_set_spec.rb41
-rw-r--r--spec/ruby/library/net/http/httpheader/fetch_spec.rb68
-rw-r--r--spec/ruby/library/net/http/httpheader/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/net/http/httpheader/form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/get_fields_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/initialize_http_header_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/key_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/length_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/main_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpheader/proxy_basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/range_length_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/range_spec.rb48
-rw-r--r--spec/ruby/library/net/http/httpheader/set_content_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_range_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_capitalized.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_header.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_name.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_content_type.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_form_data.rb27
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_range.rb89
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/size.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/size_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/sub_type_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/to_hash_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpheader/type_params_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httprequest/initialize_spec.rb45
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_permitted_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/entity_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/exception_type_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/http_version_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpresponse/initialize_spec.rb11
-rw-r--r--spec/ruby/library/net/http/httpresponse/inspect_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpresponse/message_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/msg_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_body_spec.rb86
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_new_spec.rb23
-rw-r--r--spec/ruby/library/net/http/httpresponse/reading_body_spec.rb58
-rw-r--r--spec/ruby/library/net/http/httpresponse/response_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/shared/body.rb20
-rw-r--r--spec/ruby/library/net/http/httpresponse/value_spec.rb24
-rw-r--r--spec/ruby/library/objectspace/fixtures/trace.rb5
-rw-r--r--spec/ruby/library/objectspace/memsize_of_all_spec.rb22
-rw-r--r--spec/ruby/library/objectspace/memsize_of_spec.rb34
-rw-r--r--spec/ruby/library/objectspace/reachable_objects_from_spec.rb61
-rw-r--r--spec/ruby/library/objectspace/trace_object_allocations_spec.rb149
-rw-r--r--spec/ruby/library/objectspace/trace_spec.rb15
-rw-r--r--spec/ruby/library/observer/add_observer_spec.rb23
-rw-r--r--spec/ruby/library/observer/count_observers_spec.rb23
-rw-r--r--spec/ruby/library/observer/delete_observer_spec.rb19
-rw-r--r--spec/ruby/library/observer/delete_observers_spec.rb19
-rw-r--r--spec/ruby/library/observer/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/observer/notify_observers_spec.rb31
-rw-r--r--spec/ruby/library/open3/capture2_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture3_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_r_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_rw_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_start_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_w_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen3_spec.rb41
-rw-r--r--spec/ruby/library/openssl/cipher_spec.rb9
-rw-r--r--spec/ruby/library/openssl/config/freeze_spec.rb22
-rw-r--r--spec/ruby/library/openssl/digest_spec.rb63
-rw-r--r--spec/ruby/library/openssl/hmac/digest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/hmac/hexdigest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/random/pseudo_bytes_spec.rb8
-rw-r--r--spec/ruby/library/openssl/random/random_bytes_spec.rb6
-rw-r--r--spec/ruby/library/openssl/random/shared/random_bytes.rb29
-rw-r--r--spec/ruby/library/openssl/shared/constants.rb11
-rw-r--r--spec/ruby/library/openssl/x509/name/parse_spec.rb48
-rw-r--r--spec/ruby/library/openssl/x509/name/verify_spec.rb78
-rw-r--r--spec/ruby/library/openstruct/delete_field_spec.rb19
-rw-r--r--spec/ruby/library/openstruct/element_reference_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/element_set_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/equal_value_spec.rb28
-rw-r--r--spec/ruby/library/openstruct/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/openstruct/frozen_spec.rb40
-rw-r--r--spec/ruby/library/openstruct/initialize_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/inspect_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/openstruct/marshal_load_spec.rb12
-rw-r--r--spec/ruby/library/openstruct/method_missing_spec.rb24
-rw-r--r--spec/ruby/library/openstruct/new_spec.rb20
-rw-r--r--spec/ruby/library/openstruct/shared/inspect.rb20
-rw-r--r--spec/ruby/library/openstruct/to_h_spec.rb68
-rw-r--r--spec/ruby/library/openstruct/to_s_spec.rb8
-rw-r--r--spec/ruby/library/optionparser/order_spec.rb28
-rw-r--r--spec/ruby/library/optionparser/parse_spec.rb28
-rw-r--r--spec/ruby/library/pathname/absolute_spec.rb22
-rw-r--r--spec/ruby/library/pathname/birthtime_spec.rb16
-rw-r--r--spec/ruby/library/pathname/divide_spec.rb6
-rw-r--r--spec/ruby/library/pathname/empty_spec.rb32
-rw-r--r--spec/ruby/library/pathname/equal_value_spec.rb14
-rw-r--r--spec/ruby/library/pathname/glob_spec.rb84
-rw-r--r--spec/ruby/library/pathname/hash_spec.rb14
-rw-r--r--spec/ruby/library/pathname/inspect_spec.rb10
-rw-r--r--spec/ruby/library/pathname/join_spec.rb40
-rw-r--r--spec/ruby/library/pathname/new_spec.rb23
-rw-r--r--spec/ruby/library/pathname/parent_spec.rb18
-rw-r--r--spec/ruby/library/pathname/pathname_spec.rb19
-rw-r--r--spec/ruby/library/pathname/plus_spec.rb6
-rw-r--r--spec/ruby/library/pathname/realdirpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/realpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/relative_path_from_spec.rb51
-rw-r--r--spec/ruby/library/pathname/relative_spec.rb22
-rw-r--r--spec/ruby/library/pathname/root_spec.rb26
-rw-r--r--spec/ruby/library/pathname/shared/plus.rb8
-rw-r--r--spec/ruby/library/pathname/sub_spec.rb15
-rw-r--r--spec/ruby/library/pp/pp_spec.rb30
-rw-r--r--spec/ruby/library/prime/each_spec.rb170
-rw-r--r--spec/ruby/library/prime/instance_spec.rb24
-rw-r--r--spec/ruby/library/prime/int_from_prime_division_spec.rb16
-rw-r--r--spec/ruby/library/prime/integer/each_prime_spec.rb16
-rw-r--r--spec/ruby/library/prime/integer/from_prime_division_spec.rb16
-rw-r--r--spec/ruby/library/prime/integer/prime_division_spec.rb22
-rw-r--r--spec/ruby/library/prime/integer/prime_spec.rb20
-rw-r--r--spec/ruby/library/prime/next_spec.rb10
-rw-r--r--spec/ruby/library/prime/prime_division_spec.rb28
-rw-r--r--spec/ruby/library/prime/prime_spec.rb20
-rw-r--r--spec/ruby/library/prime/shared/next.rb8
-rw-r--r--spec/ruby/library/prime/succ_spec.rb10
-rw-r--r--spec/ruby/library/rbconfig/rbconfig_spec.rb101
-rw-r--r--spec/ruby/library/rbconfig/sizeof/limits_spec.rb40
-rw-r--r--spec/ruby/library/rbconfig/sizeof/sizeof_spec.rb30
-rw-r--r--spec/ruby/library/rbconfig/unicode_emoji_version_spec.rb23
-rw-r--r--spec/ruby/library/rbconfig/unicode_version_spec.rb23
-rw-r--r--spec/ruby/library/readline/basic_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/basic_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_quote_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_append_character_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_case_fold_spec.rb18
-rw-r--r--spec/ruby/library/readline/completion_proc_spec.rb22
-rw-r--r--spec/ruby/library/readline/constants_spec.rb18
-rw-r--r--spec/ruby/library/readline/emacs_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/readline/filename_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/history/append_spec.rb28
-rw-r--r--spec/ruby/library/readline/history/delete_at_spec.rb38
-rw-r--r--spec/ruby/library/readline/history/each_spec.rb23
-rw-r--r--spec/ruby/library/readline/history/element_reference_spec.rb35
-rw-r--r--spec/ruby/library/readline/history/element_set_spec.rb35
-rw-r--r--spec/ruby/library/readline/history/empty_spec.rb13
-rw-r--r--spec/ruby/library/readline/history/history_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/length_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/pop_spec.rb23
-rw-r--r--spec/ruby/library/readline/history/push_spec.rb26
-rw-r--r--spec/ruby/library/readline/history/shared/size.rb14
-rw-r--r--spec/ruby/library/readline/history/shift_spec.rb23
-rw-r--r--spec/ruby/library/readline/history/size_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/to_s_spec.rb9
-rw-r--r--spec/ruby/library/readline/readline_spec.rb26
-rw-r--r--spec/ruby/library/readline/spec_helper.rb11
-rw-r--r--spec/ruby/library/readline/vi_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/resolv/fixtures/hosts1
-rw-r--r--spec/ruby/library/resolv/get_address_spec.rb19
-rw-r--r--spec/ruby/library/resolv/get_addresses_spec.rb12
-rw-r--r--spec/ruby/library/resolv/get_name_spec.rb18
-rw-r--r--spec/ruby/library/resolv/get_names_spec.rb11
-rw-r--r--spec/ruby/library/rexml/attribute/clone_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/element_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/equal_value_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/hash_spec.rb16
-rw-r--r--spec/ruby/library/rexml/attribute/initialize_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attribute/inspect_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attribute/namespace_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attribute/node_type_spec.rb13
-rw-r--r--spec/ruby/library/rexml/attribute/prefix_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attribute/remove_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/to_s_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/to_string_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/value_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attribute/write_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attribute/xpath_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attributes/add_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/append_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/delete_all_spec.rb34
-rw-r--r--spec/ruby/library/rexml/attributes/delete_spec.rb30
-rw-r--r--spec/ruby/library/rexml/attributes/each_attribute_spec.rb25
-rw-r--r--spec/ruby/library/rexml/attributes/each_spec.rb26
-rw-r--r--spec/ruby/library/rexml/attributes/element_reference_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/element_set_spec.rb28
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_ns_spec.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_spec.rb32
-rw-r--r--spec/ruby/library/rexml/attributes/initialize_spec.rb21
-rw-r--r--spec/ruby/library/rexml/attributes/length_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/namespaces_spec.rb9
-rw-r--r--spec/ruby/library/rexml/attributes/prefixes_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attributes/shared/add.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/shared/length.rb13
-rw-r--r--spec/ruby/library/rexml/attributes/size_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attributes/to_a_spec.rb22
-rw-r--r--spec/ruby/library/rexml/cdata/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/cdata/initialize_spec.rb27
-rw-r--r--spec/ruby/library/rexml/cdata/shared/to_s.rb11
-rw-r--r--spec/ruby/library/rexml/cdata/to_s_spec.rb10
-rw-r--r--spec/ruby/library/rexml/cdata/value_spec.rb10
-rw-r--r--spec/ruby/library/rexml/document/add_element_spec.rb34
-rw-r--r--spec/ruby/library/rexml/document/add_spec.rb60
-rw-r--r--spec/ruby/library/rexml/document/clone_spec.rb23
-rw-r--r--spec/ruby/library/rexml/document/doctype_spec.rb18
-rw-r--r--spec/ruby/library/rexml/document/encoding_spec.rb25
-rw-r--r--spec/ruby/library/rexml/document/expanded_name_spec.rb19
-rw-r--r--spec/ruby/library/rexml/document/new_spec.rb39
-rw-r--r--spec/ruby/library/rexml/document/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/document/root_spec.rb15
-rw-r--r--spec/ruby/library/rexml/document/stand_alone_spec.rb22
-rw-r--r--spec/ruby/library/rexml/document/version_spec.rb17
-rw-r--r--spec/ruby/library/rexml/document/write_spec.rb38
-rw-r--r--spec/ruby/library/rexml/document/xml_decl_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/add_attribute_spec.rb44
-rw-r--r--spec/ruby/library/rexml/element/add_attributes_spec.rb25
-rw-r--r--spec/ruby/library/rexml/element/add_element_spec.rb41
-rw-r--r--spec/ruby/library/rexml/element/add_namespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/add_text_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/attribute_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/attributes_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/cdatas_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/clone_spec.rb32
-rw-r--r--spec/ruby/library/rexml/element/comments_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/delete_attribute_spec.rb42
-rw-r--r--spec/ruby/library/rexml/element/delete_element_spec.rb52
-rw-r--r--spec/ruby/library/rexml/element/delete_namespace_spec.rb28
-rw-r--r--spec/ruby/library/rexml/element/document_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_attribute_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_text_spec.rb34
-rw-r--r--spec/ruby/library/rexml/element/element_reference_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/get_text_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_attributes_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/has_elements_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/has_text_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/inspect_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/instructions_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/namespace_spec.rb30
-rw-r--r--spec/ruby/library/rexml/element/namespaces_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/new_spec.rb38
-rw-r--r--spec/ruby/library/rexml/element/next_element_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/element/prefixes_spec.rb26
-rw-r--r--spec/ruby/library/rexml/element/previous_element_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/raw_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/root_spec.rb31
-rw-r--r--spec/ruby/library/rexml/element/text_spec.rb49
-rw-r--r--spec/ruby/library/rexml/element/texts_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/whitespace_spec.rb26
-rw-r--r--spec/ruby/library/rexml/node/each_recursive_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/find_first_recursive_spec.rb28
-rw-r--r--spec/ruby/library/rexml/node/index_in_parent_spec.rb18
-rw-r--r--spec/ruby/library/rexml/node/next_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/node/parent_spec.rb23
-rw-r--r--spec/ruby/library/rexml/node/previous_sibling_node_spec.rb24
-rw-r--r--spec/ruby/library/rexml/shared/each_element.rb36
-rw-r--r--spec/ruby/library/rexml/shared/elements_to_a.rb34
-rw-r--r--spec/ruby/library/rexml/text/append_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/clone_spec.rb13
-rw-r--r--spec/ruby/library/rexml/text/comparison_spec.rb28
-rw-r--r--spec/ruby/library/rexml/text/empty_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/indent_text_spec.rb26
-rw-r--r--spec/ruby/library/rexml/text/inspect_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/new_spec.rb51
-rw-r--r--spec/ruby/library/rexml/text/node_type_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/normalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/read_with_substitution_spec.rb15
-rw-r--r--spec/ruby/library/rexml/text/to_s_spec.rb20
-rw-r--r--spec/ruby/library/rexml/text/unnormalize_spec.rb11
-rw-r--r--spec/ruby/library/rexml/text/value_spec.rb40
-rw-r--r--spec/ruby/library/rexml/text/wrap_spec.rb23
-rw-r--r--spec/ruby/library/rexml/text/write_with_substitution_spec.rb36
-rw-r--r--spec/ruby/library/ripper/lex_spec.rb23
-rw-r--r--spec/ruby/library/ripper/sexp_spec.rb13
-rw-r--r--spec/ruby/library/rubygems/gem/bin_path_spec.rb34
-rw-r--r--spec/ruby/library/rubygems/gem/load_path_insert_index_spec.rb10
-rw-r--r--spec/ruby/library/securerandom/base64_spec.rb55
-rw-r--r--spec/ruby/library/securerandom/bytes_spec.rb8
-rw-r--r--spec/ruby/library/securerandom/hex_spec.rb54
-rw-r--r--spec/ruby/library/securerandom/random_bytes_spec.rb53
-rw-r--r--spec/ruby/library/securerandom/random_number_spec.rb97
-rw-r--r--spec/ruby/library/set/add_spec.rb27
-rw-r--r--spec/ruby/library/set/append_spec.rb7
-rw-r--r--spec/ruby/library/set/case_compare_spec.rb12
-rw-r--r--spec/ruby/library/set/case_equality_spec.rb7
-rw-r--r--spec/ruby/library/set/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/compare_by_identity_spec.rb143
-rw-r--r--spec/ruby/library/set/comparison_spec.rb29
-rw-r--r--spec/ruby/library/set/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/disjoint_spec.rb23
-rw-r--r--spec/ruby/library/set/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/each_spec.rb26
-rw-r--r--spec/ruby/library/set/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/enumerable/to_set_spec.rb21
-rw-r--r--spec/ruby/library/set/eql_spec.rb15
-rw-r--r--spec/ruby/library/set/equal_value_spec.rb33
-rw-r--r--spec/ruby/library/set/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/filter_spec.rb6
-rw-r--r--spec/ruby/library/set/fixtures/set_like.rb31
-rw-r--r--spec/ruby/library/set/flatten_merge_spec.rb23
-rw-r--r--spec/ruby/library/set/flatten_spec.rb53
-rw-r--r--spec/ruby/library/set/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/include_spec.rb7
-rw-r--r--spec/ruby/library/set/initialize_clone_spec.rb18
-rw-r--r--spec/ruby/library/set/initialize_spec.rb73
-rw-r--r--spec/ruby/library/set/inspect_spec.rb7
-rw-r--r--spec/ruby/library/set/intersect_spec.rb23
-rw-r--r--spec/ruby/library/set/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/join_spec.rb31
-rw-r--r--spec/ruby/library/set/keep_if_spec.rb38
-rw-r--r--spec/ruby/library/set/length_spec.rb7
-rw-r--r--spec/ruby/library/set/map_spec.rb7
-rw-r--r--spec/ruby/library/set/member_spec.rb7
-rw-r--r--spec/ruby/library/set/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/pretty_print_spec.rb19
-rw-r--r--spec/ruby/library/set/proper_subset_spec.rb41
-rw-r--r--spec/ruby/library/set/proper_superset_spec.rb41
-rw-r--r--spec/ruby/library/set/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/select_spec.rb6
-rw-r--r--spec/ruby/library/set/shared/add.rb14
-rw-r--r--spec/ruby/library/set/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/shared/include.rb29
-rw-r--r--spec/ruby/library/set/shared/inspect.rb15
-rw-r--r--spec/ruby/library/set/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/shared/length.rb6
-rw-r--r--spec/ruby/library/set/shared/select.rb42
-rw-r--r--spec/ruby/library/set/shared/union.rb15
-rw-r--r--spec/ruby/library/set/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/add_spec.rb42
-rw-r--r--spec/ruby/library/set/sortedset/append_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/case_equality_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/classify_spec.rb30
-rw-r--r--spec/ruby/library/set/sortedset/clear_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/collect_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/constructor_spec.rb18
-rw-r--r--spec/ruby/library/set/sortedset/delete_if_spec.rb41
-rw-r--r--spec/ruby/library/set/sortedset/delete_spec.rb40
-rw-r--r--spec/ruby/library/set/sortedset/difference_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/divide_spec.rb37
-rw-r--r--spec/ruby/library/set/sortedset/each_spec.rb29
-rw-r--r--spec/ruby/library/set/sortedset/empty_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/eql_spec.rb19
-rw-r--r--spec/ruby/library/set/sortedset/equal_value_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/exclusion_spec.rb21
-rw-r--r--spec/ruby/library/set/sortedset/filter_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/flatten_merge_spec.rb11
-rw-r--r--spec/ruby/library/set/sortedset/flatten_spec.rb47
-rw-r--r--spec/ruby/library/set/sortedset/hash_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/include_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/initialize_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/inspect_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/intersection_spec.rb14
-rw-r--r--spec/ruby/library/set/sortedset/keep_if_spec.rb34
-rw-r--r--spec/ruby/library/set/sortedset/length_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/map_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/member_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/merge_spec.rb22
-rw-r--r--spec/ruby/library/set/sortedset/minus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/plus_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_cycle_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/proper_subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/proper_superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/reject_spec.rb45
-rw-r--r--spec/ruby/library/set/sortedset/replace_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/select_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/shared/add.rb14
-rw-r--r--spec/ruby/library/set/sortedset/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/sortedset/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/include.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/length.rb6
-rw-r--r--spec/ruby/library/set/sortedset/shared/select.rb35
-rw-r--r--spec/ruby/library/set/sortedset/shared/union.rb15
-rw-r--r--spec/ruby/library/set/sortedset/size_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/sortedset_spec.rb22
-rw-r--r--spec/ruby/library/set/sortedset/subset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/subtract_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/superset_spec.rb36
-rw-r--r--spec/ruby/library/set/sortedset/to_a_spec.rb20
-rw-r--r--spec/ruby/library/set/sortedset/union_spec.rb14
-rw-r--r--spec/ruby/library/set/subset_spec.rb41
-rw-r--r--spec/ruby/library/set/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/superset_spec.rb41
-rw-r--r--spec/ruby/library/set/to_a_spec.rb8
-rw-r--r--spec/ruby/library/set/to_s_spec.rb11
-rw-r--r--spec/ruby/library/set/union_spec.rb11
-rw-r--r--spec/ruby/library/shellwords/shellwords_spec.rb34
-rw-r--r--spec/ruby/library/singleton/allocate_spec.rb8
-rw-r--r--spec/ruby/library/singleton/clone_spec.rb8
-rw-r--r--spec/ruby/library/singleton/dump_spec.rb14
-rw-r--r--spec/ruby/library/singleton/dup_spec.rb8
-rw-r--r--spec/ruby/library/singleton/fixtures/classes.rb18
-rw-r--r--spec/ruby/library/singleton/instance_spec.rb30
-rw-r--r--spec/ruby/library/singleton/load_spec.rb21
-rw-r--r--spec/ruby/library/singleton/new_spec.rb8
-rw-r--r--spec/ruby/library/socket/addrinfo/afamily_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/bind_spec.rb28
-rw-r--r--spec/ruby/library/socket/addrinfo/canonname_spec.rb27
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_from_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_to_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/family_addrinfo_spec.rb115
-rw-r--r--spec/ruby/library/socket/addrinfo/foreach_spec.rb9
-rw-r--r--spec/ruby/library/socket/addrinfo/getaddrinfo_spec.rb91
-rw-r--r--spec/ruby/library/socket/addrinfo/getnameinfo_spec.rb42
-rw-r--r--spec/ruby/library/socket/addrinfo/initialize_spec.rb591
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_sockaddr_spec.rb50
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_spec.rb65
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_address_spec.rb66
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_port_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_spec.rb64
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_unpack_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_loopback_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_multicast_spec.rb29
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_private_spec.rb47
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_linklocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_loopback_spec.rb45
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_global_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_linklocal_spec.rb19
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_nodelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_orglocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_sitelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_multicast_spec.rb48
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_sitelocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_to_ipv4_spec.rb71
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unique_local_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unspecified_spec.rb15
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4compat_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4mapped_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/listen_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_dump_spec.rb84
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_load_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/pfamily_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/protocol_spec.rb24
-rw-r--r--spec/ruby/library/socket/addrinfo/shared/to_sockaddr.rb51
-rw-r--r--spec/ruby/library/socket/addrinfo/socktype_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/tcp_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/to_s_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/to_sockaddr_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/udp_spec.rb36
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_path_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_spec.rb71
-rw-r--r--spec/ruby/library/socket/ancillarydata/cmsg_is_spec.rb33
-rw-r--r--spec/ruby/library/socket/ancillarydata/data_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/family_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/initialize_spec.rb284
-rw-r--r--spec/ruby/library/socket/ancillarydata/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/ancillarydata/ip_pktinfo_spec.rb145
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_addr_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_ifindex_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_spec.rb89
-rw-r--r--spec/ruby/library/socket/ancillarydata/level_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/type_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/unix_rights_spec.rb61
-rw-r--r--spec/ruby/library/socket/basicsocket/close_read_spec.rb43
-rw-r--r--spec/ruby/library/socket/basicsocket/close_write_spec.rb48
-rw-r--r--spec/ruby/library/socket/basicsocket/connect_address_spec.rb154
-rw-r--r--spec/ruby/library/socket/basicsocket/do_not_reverse_lookup_spec.rb103
-rw-r--r--spec/ruby/library/socket/basicsocket/for_fd_spec.rb38
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeereid_spec.rb36
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeername_spec.rb25
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockname_spec.rb28
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockopt_spec.rb188
-rw-r--r--spec/ruby/library/socket/basicsocket/ioctl_spec.rb42
-rw-r--r--spec/ruby/library/socket/basicsocket/local_address_spec.rb10
-rw-r--r--spec/ruby/library/socket/basicsocket/read_nonblock_spec.rb44
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_nonblock_spec.rb91
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_spec.rb159
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_nonblock_spec.rb224
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_spec.rb197
-rw-r--r--spec/ruby/library/socket/basicsocket/remote_address_spec.rb10
-rw-r--r--spec/ruby/library/socket/basicsocket/send_spec.rb220
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_nonblock_spec.rb118
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_spec.rb111
-rw-r--r--spec/ruby/library/socket/basicsocket/setsockopt_spec.rb336
-rw-r--r--spec/ruby/library/socket/basicsocket/shutdown_spec.rb155
-rw-r--r--spec/ruby/library/socket/basicsocket/write_nonblock_spec.rb43
-rw-r--r--spec/ruby/library/socket/constants/constants_spec.rb108
-rw-r--r--spec/ruby/library/socket/fixtures/classes.rb164
-rw-r--r--spec/ruby/library/socket/fixtures/send_io.txt1
-rw-r--r--spec/ruby/library/socket/ipsocket/addr_spec.rb105
-rw-r--r--spec/ruby/library/socket/ipsocket/getaddress_spec.rb25
-rw-r--r--spec/ruby/library/socket/ipsocket/peeraddr_spec.rb117
-rw-r--r--spec/ruby/library/socket/ipsocket/recvfrom_spec.rb123
-rw-r--r--spec/ruby/library/socket/option/bool_spec.rb27
-rw-r--r--spec/ruby/library/socket/option/initialize_spec.rb83
-rw-r--r--spec/ruby/library/socket/option/inspect_spec.rb19
-rw-r--r--spec/ruby/library/socket/option/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/option/linger_spec.rb76
-rw-r--r--spec/ruby/library/socket/option/new_spec.rb35
-rw-r--r--spec/ruby/library/socket/shared/address.rb249
-rw-r--r--spec/ruby/library/socket/shared/pack_sockaddr.rb106
-rw-r--r--spec/ruby/library/socket/shared/partially_closable_sockets.rb13
-rw-r--r--spec/ruby/library/socket/shared/socketpair.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_loop_spec.rb84
-rw-r--r--spec/ruby/library/socket/socket/accept_nonblock_spec.rb141
-rw-r--r--spec/ruby/library/socket/socket/accept_spec.rb121
-rw-r--r--spec/ruby/library/socket/socket/bind_spec.rb150
-rw-r--r--spec/ruby/library/socket/socket/connect_nonblock_spec.rb149
-rw-r--r--spec/ruby/library/socket/socket/connect_spec.rb56
-rw-r--r--spec/ruby/library/socket/socket/for_fd_spec.rb30
-rw-r--r--spec/ruby/library/socket/socket/getaddrinfo_spec.rb373
-rw-r--r--spec/ruby/library/socket/socket/gethostbyaddr_spec.rb124
-rw-r--r--spec/ruby/library/socket/socket/gethostbyname_spec.rb135
-rw-r--r--spec/ruby/library/socket/socket/gethostname_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/getifaddrs_spec.rb117
-rw-r--r--spec/ruby/library/socket/socket/getnameinfo_spec.rb147
-rw-r--r--spec/ruby/library/socket/socket/getservbyname_spec.rb32
-rw-r--r--spec/ruby/library/socket/socket/getservbyport_spec.rb23
-rw-r--r--spec/ruby/library/socket/socket/initialize_spec.rb87
-rw-r--r--spec/ruby/library/socket/socket/ip_address_list_spec.rb50
-rw-r--r--spec/ruby/library/socket/socket/ipv6only_bang_spec.rb20
-rw-r--r--spec/ruby/library/socket/socket/listen_spec.rb66
-rw-r--r--spec/ruby/library/socket/socket/local_address_spec.rb43
-rw-r--r--spec/ruby/library/socket/socket/new_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_nonblock_spec.rb118
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_spec.rb92
-rw-r--r--spec/ruby/library/socket/socket/remote_address_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/socket_spec.rb38
-rw-r--r--spec/ruby/library/socket/socket/socketpair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sysaccept_spec.rb91
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_loop_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/tcp_spec.rb70
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_on_spec.rb47
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_spec.rb59
-rw-r--r--spec/ruby/library/socket/socket/udp_server_recv_spec.rb35
-rw-r--r--spec/ruby/library/socket/socket/udp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/unix_server_loop_spec.rb58
-rw-r--r--spec/ruby/library/socket/socket/unix_server_socket_spec.rb48
-rw-r--r--spec/ruby/library/socket/socket/unix_spec.rb45
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_in_spec.rb46
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_un_spec.rb26
-rw-r--r--spec/ruby/library/socket/spec_helper.rb13
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_nonblock_spec.rb85
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_spec.rb119
-rw-r--r--spec/ruby/library/socket/tcpserver/gets_spec.rb16
-rw-r--r--spec/ruby/library/socket/tcpserver/initialize_spec.rb101
-rw-r--r--spec/ruby/library/socket/tcpserver/listen_spec.rb22
-rw-r--r--spec/ruby/library/socket/tcpserver/new_spec.rb131
-rw-r--r--spec/ruby/library/socket/tcpserver/sysaccept_spec.rb66
-rw-r--r--spec/ruby/library/socket/tcpsocket/gethostbyname_spec.rb119
-rw-r--r--spec/ruby/library/socket/tcpsocket/initialize_spec.rb66
-rw-r--r--spec/ruby/library/socket/tcpsocket/local_address_spec.rb73
-rw-r--r--spec/ruby/library/socket/tcpsocket/open_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/partially_closable_spec.rb21
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_nonblock_spec.rb48
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_spec.rb28
-rw-r--r--spec/ruby/library/socket/tcpsocket/remote_address_spec.rb72
-rw-r--r--spec/ruby/library/socket/tcpsocket/setsockopt_spec.rb45
-rw-r--r--spec/ruby/library/socket/tcpsocket/shared/new.rb102
-rw-r--r--spec/ruby/library/socket/udpsocket/bind_spec.rb83
-rw-r--r--spec/ruby/library/socket/udpsocket/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/udpsocket/initialize_spec.rb40
-rw-r--r--spec/ruby/library/socket/udpsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/udpsocket/local_address_spec.rb80
-rw-r--r--spec/ruby/library/socket/udpsocket/new_spec.rb34
-rw-r--r--spec/ruby/library/socket/udpsocket/open_spec.rb13
-rw-r--r--spec/ruby/library/socket/udpsocket/recvfrom_nonblock_spec.rb102
-rw-r--r--spec/ruby/library/socket/udpsocket/remote_address_spec.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/send_spec.rb154
-rw-r--r--spec/ruby/library/socket/udpsocket/write_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/accept_nonblock_spec.rb92
-rw-r--r--spec/ruby/library/socket/unixserver/accept_spec.rb117
-rw-r--r--spec/ruby/library/socket/unixserver/for_fd_spec.rb23
-rw-r--r--spec/ruby/library/socket/unixserver/initialize_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixserver/listen_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixserver/open_spec.rb26
-rw-r--r--spec/ruby/library/socket/unixserver/shared/new.rb22
-rw-r--r--spec/ruby/library/socket/unixserver/sysaccept_spec.rb52
-rw-r--r--spec/ruby/library/socket/unixsocket/addr_spec.rb36
-rw-r--r--spec/ruby/library/socket/unixsocket/initialize_spec.rb38
-rw-r--r--spec/ruby/library/socket/unixsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/unixsocket/local_address_spec.rb96
-rw-r--r--spec/ruby/library/socket/unixsocket/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixsocket/open_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/pair_spec.rb39
-rw-r--r--spec/ruby/library/socket/unixsocket/partially_closable_spec.rb25
-rw-r--r--spec/ruby/library/socket/unixsocket/path_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/peeraddr_spec.rb30
-rw-r--r--spec/ruby/library/socket/unixsocket/recv_io_spec.rb87
-rw-r--r--spec/ruby/library/socket/unixsocket/recvfrom_spec.rb98
-rw-r--r--spec/ruby/library/socket/unixsocket/remote_address_spec.rb45
-rw-r--r--spec/ruby/library/socket/unixsocket/send_io_spec.rb58
-rw-r--r--spec/ruby/library/socket/unixsocket/shared/new.rb24
-rw-r--r--spec/ruby/library/socket/unixsocket/socketpair_spec.rb40
-rw-r--r--spec/ruby/library/stringio/append_spec.rb81
-rw-r--r--spec/ruby/library/stringio/binmode_spec.rb23
-rw-r--r--spec/ruby/library/stringio/bytes_spec.rb29
-rw-r--r--spec/ruby/library/stringio/chars_spec.rb29
-rw-r--r--spec/ruby/library/stringio/close_read_spec.rb31
-rw-r--r--spec/ruby/library/stringio/close_spec.rb23
-rw-r--r--spec/ruby/library/stringio/close_write_spec.rb31
-rw-r--r--spec/ruby/library/stringio/closed_read_spec.rb12
-rw-r--r--spec/ruby/library/stringio/closed_spec.rb16
-rw-r--r--spec/ruby/library/stringio/closed_write_spec.rb12
-rw-r--r--spec/ruby/library/stringio/codepoints_spec.rb19
-rw-r--r--spec/ruby/library/stringio/each_byte_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_char_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_codepoint_spec.rb9
-rw-r--r--spec/ruby/library/stringio/each_line_spec.rb23
-rw-r--r--spec/ruby/library/stringio/each_spec.rb27
-rw-r--r--spec/ruby/library/stringio/eof_spec.rb11
-rw-r--r--spec/ruby/library/stringio/external_encoding_spec.rb25
-rw-r--r--spec/ruby/library/stringio/fcntl_spec.rb8
-rw-r--r--spec/ruby/library/stringio/fileno_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fixtures/classes.rb15
-rw-r--r--spec/ruby/library/stringio/flush_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fsync_spec.rb9
-rw-r--r--spec/ruby/library/stringio/getbyte_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getc_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getch_spec.rb44
-rw-r--r--spec/ruby/library/stringio/getpass_spec.rb11
-rw-r--r--spec/ruby/library/stringio/gets_spec.rb250
-rw-r--r--spec/ruby/library/stringio/initialize_spec.rb307
-rw-r--r--spec/ruby/library/stringio/inspect_spec.rb19
-rw-r--r--spec/ruby/library/stringio/internal_encoding_spec.rb10
-rw-r--r--spec/ruby/library/stringio/isatty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/length_spec.rb7
-rw-r--r--spec/ruby/library/stringio/lineno_spec.rb30
-rw-r--r--spec/ruby/library/stringio/lines_spec.rb53
-rw-r--r--spec/ruby/library/stringio/new_spec.rb8
-rw-r--r--spec/ruby/library/stringio/open_spec.rb215
-rw-r--r--spec/ruby/library/stringio/path_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pid_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pos_spec.rb28
-rw-r--r--spec/ruby/library/stringio/print_spec.rb102
-rw-r--r--spec/ruby/library/stringio/printf_spec.rb91
-rw-r--r--spec/ruby/library/stringio/putc_spec.rb103
-rw-r--r--spec/ruby/library/stringio/puts_spec.rb184
-rw-r--r--spec/ruby/library/stringio/read_nonblock_spec.rb53
-rw-r--r--spec/ruby/library/stringio/read_spec.rb62
-rw-r--r--spec/ruby/library/stringio/readbyte_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readchar_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readline_spec.rb150
-rw-r--r--spec/ruby/library/stringio/readlines_spec.rb118
-rw-r--r--spec/ruby/library/stringio/readpartial_spec.rb80
-rw-r--r--spec/ruby/library/stringio/reopen_spec.rb281
-rw-r--r--spec/ruby/library/stringio/rewind_spec.rb24
-rw-r--r--spec/ruby/library/stringio/seek_spec.rb67
-rw-r--r--spec/ruby/library/stringio/set_encoding_spec.rb20
-rw-r--r--spec/ruby/library/stringio/shared/codepoints.rb45
-rw-r--r--spec/ruby/library/stringio/shared/each.rb163
-rw-r--r--spec/ruby/library/stringio/shared/each_byte.rb48
-rw-r--r--spec/ruby/library/stringio/shared/each_char.rb36
-rw-r--r--spec/ruby/library/stringio/shared/eof.rb24
-rw-r--r--spec/ruby/library/stringio/shared/getc.rb43
-rw-r--r--spec/ruby/library/stringio/shared/isatty.rb5
-rw-r--r--spec/ruby/library/stringio/shared/length.rb5
-rw-r--r--spec/ruby/library/stringio/shared/read.rb127
-rw-r--r--spec/ruby/library/stringio/shared/readchar.rb29
-rw-r--r--spec/ruby/library/stringio/shared/sysread.rb15
-rw-r--r--spec/ruby/library/stringio/shared/tell.rb12
-rw-r--r--spec/ruby/library/stringio/shared/write.rb121
-rw-r--r--spec/ruby/library/stringio/size_spec.rb7
-rw-r--r--spec/ruby/library/stringio/string_spec.rb50
-rw-r--r--spec/ruby/library/stringio/stringio_spec.rb8
-rw-r--r--spec/ruby/library/stringio/sync_spec.rb19
-rw-r--r--spec/ruby/library/stringio/sysread_spec.rb48
-rw-r--r--spec/ruby/library/stringio/syswrite_spec.rb19
-rw-r--r--spec/ruby/library/stringio/tell_spec.rb7
-rw-r--r--spec/ruby/library/stringio/truncate_spec.rb62
-rw-r--r--spec/ruby/library/stringio/tty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/ungetbyte_spec.rb42
-rw-r--r--spec/ruby/library/stringio/ungetc_spec.rb72
-rw-r--r--spec/ruby/library/stringio/write_nonblock_spec.rb25
-rw-r--r--spec/ruby/library/stringio/write_spec.rb19
-rw-r--r--spec/ruby/library/stringscanner/append_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/beginning_of_line_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/bol_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/check_spec.rb25
-rw-r--r--spec/ruby/library/stringscanner/check_until_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/clear_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/concat_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/dup_spec.rb39
-rw-r--r--spec/ruby/library/stringscanner/element_reference_spec.rb60
-rw-r--r--spec/ruby/library/stringscanner/empty_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/eos_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/exist_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/get_byte_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/getbyte_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/getch_spec.rb35
-rw-r--r--spec/ruby/library/stringscanner/initialize_spec.rb27
-rw-r--r--spec/ruby/library/stringscanner/inspect_spec.rb20
-rw-r--r--spec/ruby/library/stringscanner/match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/matched_size_spec.rb24
-rw-r--r--spec/ruby/library/stringscanner/matched_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/must_C_version_spec.rb8
-rw-r--r--spec/ruby/library/stringscanner/peek_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/peep_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/pointer_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/pos_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/post_match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/pre_match_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/reset_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/rest_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/rest_spec.rb48
-rw-r--r--spec/ruby/library/stringscanner/restsize_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/scan_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/scan_spec.rb87
-rw-r--r--spec/ruby/library/stringscanner/scan_until_spec.rb29
-rw-r--r--spec/ruby/library/stringscanner/search_full_spec.rb36
-rw-r--r--spec/ruby/library/stringscanner/shared/bol.rb25
-rw-r--r--spec/ruby/library/stringscanner/shared/concat.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/eos.rb17
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range.rb11
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range_matched.rb13
-rw-r--r--spec/ruby/library/stringscanner/shared/get_byte.rb29
-rw-r--r--spec/ruby/library/stringscanner/shared/peek.rb39
-rw-r--r--spec/ruby/library/stringscanner/shared/pos.rb52
-rw-r--r--spec/ruby/library/stringscanner/shared/rest_size.rb18
-rw-r--r--spec/ruby/library/stringscanner/shared/terminate.rb8
-rw-r--r--spec/ruby/library/stringscanner/size_spec.rb17
-rw-r--r--spec/ruby/library/stringscanner/skip_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/skip_until_spec.rb24
-rw-r--r--spec/ruby/library/stringscanner/string_spec.rb40
-rw-r--r--spec/ruby/library/stringscanner/terminate_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/unscan_spec.rb28
-rw-r--r--spec/ruby/library/syslog/alert_spec.rb10
-rw-r--r--spec/ruby/library/syslog/close_spec.rb58
-rw-r--r--spec/ruby/library/syslog/constants_spec.rb41
-rw-r--r--spec/ruby/library/syslog/crit_spec.rb10
-rw-r--r--spec/ruby/library/syslog/debug_spec.rb10
-rw-r--r--spec/ruby/library/syslog/emerg_spec.rb16
-rw-r--r--spec/ruby/library/syslog/err_spec.rb10
-rw-r--r--spec/ruby/library/syslog/facility_spec.rb48
-rw-r--r--spec/ruby/library/syslog/ident_spec.rb35
-rw-r--r--spec/ruby/library/syslog/info_spec.rb10
-rw-r--r--spec/ruby/library/syslog/inspect_spec.rb39
-rw-r--r--spec/ruby/library/syslog/instance_spec.rb13
-rw-r--r--spec/ruby/library/syslog/log_spec.rb56
-rw-r--r--spec/ruby/library/syslog/mask_spec.rb113
-rw-r--r--spec/ruby/library/syslog/notice_spec.rb10
-rw-r--r--spec/ruby/library/syslog/open_spec.rb92
-rw-r--r--spec/ruby/library/syslog/opened_spec.rb39
-rw-r--r--spec/ruby/library/syslog/options_spec.rb48
-rw-r--r--spec/ruby/library/syslog/reopen_spec.rb10
-rw-r--r--spec/ruby/library/syslog/shared/log.rb39
-rw-r--r--spec/ruby/library/syslog/shared/reopen.rb40
-rw-r--r--spec/ruby/library/syslog/warning_spec.rb10
-rw-r--r--spec/ruby/library/tempfile/_close_spec.rb21
-rw-r--r--spec/ruby/library/tempfile/callback_spec.rb6
-rw-r--r--spec/ruby/library/tempfile/close_spec.rb57
-rw-r--r--spec/ruby/library/tempfile/delete_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/initialize_spec.rb46
-rw-r--r--spec/ruby/library/tempfile/length_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/open_spec.rb97
-rw-r--r--spec/ruby/library/tempfile/path_spec.rb26
-rw-r--r--spec/ruby/library/tempfile/shared/length.rb21
-rw-r--r--spec/ruby/library/tempfile/shared/unlink.rb12
-rw-r--r--spec/ruby/library/tempfile/size_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/unlink_spec.rb7
-rw-r--r--spec/ruby/library/thread/queue_spec.rb8
-rw-r--r--spec/ruby/library/thread/sizedqueue_spec.rb8
-rw-r--r--spec/ruby/library/time/httpdate_spec.rb21
-rw-r--r--spec/ruby/library/time/iso8601_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc2822_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc822_spec.rb7
-rw-r--r--spec/ruby/library/time/shared/rfc2822.rb65
-rw-r--r--spec/ruby/library/time/shared/xmlschema.rb53
-rw-r--r--spec/ruby/library/time/to_date_spec.rb42
-rw-r--r--spec/ruby/library/time/to_datetime_spec.rb41
-rw-r--r--spec/ruby/library/time/to_time_spec.rb15
-rw-r--r--spec/ruby/library/time/xmlschema_spec.rb7
-rw-r--r--spec/ruby/library/timeout/error_spec.rb8
-rw-r--r--spec/ruby/library/timeout/timeout_spec.rb42
-rw-r--r--spec/ruby/library/tmpdir/dir/mktmpdir_spec.rb117
-rw-r--r--spec/ruby/library/tmpdir/dir/tmpdir_spec.rb10
-rw-r--r--spec/ruby/library/uri/decode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/decode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/eql_spec.rb10
-rw-r--r--spec/ruby/library/uri/equality_spec.rb46
-rw-r--r--spec/ruby/library/uri/escape/decode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/encode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/extract_spec.rb86
-rw-r--r--spec/ruby/library/uri/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/uri/fixtures/normalization.rb54
-rw-r--r--spec/ruby/library/uri/ftp/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/merge_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/new2_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/path_spec.rb26
-rw-r--r--spec/ruby/library/uri/ftp/set_typecode_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/to_s_spec.rb15
-rw-r--r--spec/ruby/library/uri/ftp/typecode_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/absolute_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/build2_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/coerce_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_ary_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/default_port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/eql_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/equal_value_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/fragment_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/hash_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/host_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/merge_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/minus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/normalize_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/opaque_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/password_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/path_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/plus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/query_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/registry_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/relative_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_from_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/scheme_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/select_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_fragment_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_host_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_opaque_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_password_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_path_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_port_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_query_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_scheme_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_user_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_userinfo_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/use_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/user_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/userinfo_spec.rb10
-rw-r--r--spec/ruby/library/uri/http/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/http/request_uri_spec.rb16
-rw-r--r--spec/ruby/library/uri/join_spec.rb59
-rw-r--r--spec/ruby/library/uri/ldap/attributes_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/dn_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/extensions_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/filter_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/scope_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/set_attributes_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_dn_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_extensions_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_filter_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_scope_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/build_spec.rb92
-rw-r--r--spec/ruby/library/uri/mailto/headers_spec.rb10
-rw-r--r--spec/ruby/library/uri/mailto/set_headers_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/set_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_mailtext_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_rfc822text_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_spec.rb10
-rw-r--r--spec/ruby/library/uri/merge_spec.rb20
-rw-r--r--spec/ruby/library/uri/normalize_spec.rb35
-rw-r--r--spec/ruby/library/uri/parse_spec.rb203
-rw-r--r--spec/ruby/library/uri/parser/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/extract_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/join_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/make_regexp_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/parse_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/plus_spec.rb459
-rw-r--r--spec/ruby/library/uri/regexp_spec.rb18
-rw-r--r--spec/ruby/library/uri/route_from_spec.rb23
-rw-r--r--spec/ruby/library/uri/route_to_spec.rb26
-rw-r--r--spec/ruby/library/uri/select_spec.rb27
-rw-r--r--spec/ruby/library/uri/set_component_spec.rb45
-rw-r--r--spec/ruby/library/uri/shared/eql.rb17
-rw-r--r--spec/ruby/library/uri/shared/extract.rb83
-rw-r--r--spec/ruby/library/uri/shared/join.rb56
-rw-r--r--spec/ruby/library/uri/shared/parse.rb199
-rw-r--r--spec/ruby/library/uri/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/uri_spec.rb29
-rw-r--r--spec/ruby/library/uri/util/make_components_hash_spec.rb6
-rw-r--r--spec/ruby/library/weakref/__getobj___spec.rb17
-rw-r--r--spec/ruby/library/weakref/allocate_spec.rb8
-rw-r--r--spec/ruby/library/weakref/fixtures/classes.rb26
-rw-r--r--spec/ruby/library/weakref/new_spec.rb13
-rw-r--r--spec/ruby/library/weakref/send_spec.rb37
-rw-r--r--spec/ruby/library/weakref/weakref_alive_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/fixtures/classes.rb22
-rw-r--r--spec/ruby/library/win32ole/fixtures/event.xml4
-rw-r--r--spec/ruby/library/win32ole/win32ole/_getproperty_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/_invoke_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/codepage_spec.rb13
-rw-r--r--spec/ruby/library/win32ole/win32ole/connect_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/win32ole/const_load_spec.rb32
-rw-r--r--spec/ruby/library/win32ole/win32ole/constants_spec.rb42
-rw-r--r--spec/ruby/library/win32ole/win32ole/create_guid_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/invoke_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/locale_spec.rb29
-rw-r--r--spec/ruby/library/win32ole/win32ole/new_spec.rb25
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_func_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_get_methods_spec.rb16
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_help_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_obj_help_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_put_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/setproperty_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/ole_method.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/setproperty.rb23
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/on_event_spec.rb70
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/dispid_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_interface_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpcontext_spec.rb26
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpfile_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpstring_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invkind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invoke_kind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/offset_vtbl_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/params_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_vtype_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/shared/name.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_opt_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/visible_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/default_spec.rb31
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/input_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/optional_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/retval_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/shared/name.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/guid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpcontext_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpfile_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpstring_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/major_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/minor_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/new_spec.rb40
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_classes_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_methods_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progids_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/shared/name.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/src_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typekind_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typelibs_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/variables_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/visible_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_detail_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/shared/name.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/value_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/variable_kind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/varkind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/visible_spec.rb18
-rw-r--r--spec/ruby/library/yaml/dump_spec.rb56
-rw-r--r--spec/ruby/library/yaml/dump_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/fixtures/common.rb4
-rw-r--r--spec/ruby/library/yaml/fixtures/example_class.rb7
-rw-r--r--spec/ruby/library/yaml/fixtures/strings.rb36
-rw-r--r--spec/ruby/library/yaml/fixtures/test_yaml.yml2
-rw-r--r--spec/ruby/library/yaml/load_file_spec.rb13
-rw-r--r--spec/ruby/library/yaml/load_spec.rb10
-rw-r--r--spec/ruby/library/yaml/load_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_file_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_spec.rb22
-rw-r--r--spec/ruby/library/yaml/shared/each_document.rb18
-rw-r--r--spec/ruby/library/yaml/shared/load.rb136
-rw-r--r--spec/ruby/library/yaml/to_yaml_spec.rb98
-rw-r--r--spec/ruby/library/yaml/unsafe_load_spec.rb9
-rw-r--r--spec/ruby/library/zlib/adler32_spec.rb46
-rw-r--r--spec/ruby/library/zlib/crc32_spec.rb54
-rw-r--r--spec/ruby/library/zlib/crc_table_spec.rb80
-rw-r--r--spec/ruby/library/zlib/deflate/deflate_spec.rb133
-rw-r--r--spec/ruby/library/zlib/deflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/deflate/params_spec.rb17
-rw-r--r--spec/ruby/library/zlib/deflate/set_dictionary_spec.rb14
-rw-r--r--spec/ruby/library/zlib/deflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/gunzip_spec.rb14
-rw-r--r--spec/ruby/library/zlib/gzip_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipfile/close_spec.rb21
-rw-r--r--spec/ruby/library/zlib/gzipfile/closed_spec.rb16
-rw-r--r--spec/ruby/library/zlib/gzipfile/comment_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipfile/orig_name_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_byte_spec.rb51
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_line_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/eof_spec.rb54
-rw-r--r--spec/ruby/library/zlib/gzipreader/getc_spec.rb39
-rw-r--r--spec/ruby/library/zlib/gzipreader/gets_spec.rb22
-rw-r--r--spec/ruby/library/zlib/gzipreader/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/pos_spec.rb24
-rw-r--r--spec/ruby/library/zlib/gzipreader/read_spec.rb66
-rw-r--r--spec/ruby/library/zlib/gzipreader/readpartial_spec.rb17
-rw-r--r--spec/ruby/library/zlib/gzipreader/rewind_spec.rb47
-rw-r--r--spec/ruby/library/zlib/gzipreader/shared/each.rb49
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetbyte_spec.rb120
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetc_spec.rb284
-rw-r--r--spec/ruby/library/zlib/gzipwriter/append_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipwriter/mtime_spec.rb38
-rw-r--r--spec/ruby/library/zlib/gzipwriter/write_spec.rb36
-rw-r--r--spec/ruby/library/zlib/inflate/append_spec.rb60
-rw-r--r--spec/ruby/library/zlib/inflate/finish_spec.rb28
-rw-r--r--spec/ruby/library/zlib/inflate/inflate_spec.rb159
-rw-r--r--spec/ruby/library/zlib/inflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/inflate/set_dictionary_spec.rb20
-rw-r--r--spec/ruby/library/zlib/inflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zlib_version_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zstream/adler_spec.rb11
-rw-r--r--spec/ruby/library/zlib/zstream/avail_in_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/avail_out_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/data_type_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/flush_next_out_spec.rb14
-rw-r--r--spec/ruby/optional/capi/README13
-rw-r--r--spec/ruby/optional/capi/array_spec.rb497
-rw-r--r--spec/ruby/optional/capi/basic_object_spec.rb24
-rw-r--r--spec/ruby/optional/capi/bignum_spec.rb224
-rw-r--r--spec/ruby/optional/capi/binding_spec.rb28
-rw-r--r--spec/ruby/optional/capi/boolean_spec.rb33
-rw-r--r--spec/ruby/optional/capi/class_spec.rb492
-rw-r--r--spec/ruby/optional/capi/complex_spec.rb45
-rw-r--r--spec/ruby/optional/capi/constants_spec.rb325
-rw-r--r--spec/ruby/optional/capi/data_spec.rb52
-rw-r--r--spec/ruby/optional/capi/debug_spec.rb66
-rw-r--r--spec/ruby/optional/capi/encoding_spec.rb694
-rw-r--r--spec/ruby/optional/capi/enumerator_spec.rb66
-rw-r--r--spec/ruby/optional/capi/exception_spec.rb147
-rw-r--r--spec/ruby/optional/capi/ext/.gitignore9
-rw-r--r--spec/ruby/optional/capi/ext/array_spec.c297
-rw-r--r--spec/ruby/optional/capi/ext/basic_object_spec.c19
-rw-r--r--spec/ruby/optional/capi/ext/bignum_spec.c106
-rw-r--r--spec/ruby/optional/capi/ext/binding_spec.c19
-rw-r--r--spec/ruby/optional/capi/ext/boolean_spec.c33
-rw-r--r--spec/ruby/optional/capi/ext/class_id_under_autoload_spec.c13
-rw-r--r--spec/ruby/optional/capi/ext/class_spec.c179
-rw-r--r--spec/ruby/optional/capi/ext/class_under_autoload_spec.c13
-rw-r--r--spec/ruby/optional/capi/ext/complex_spec.c45
-rw-r--r--spec/ruby/optional/capi/ext/constants_spec.c178
-rw-r--r--spec/ruby/optional/capi/ext/data_spec.c89
-rw-r--r--spec/ruby/optional/capi/ext/debug_spec.c93
-rw-r--r--spec/ruby/optional/capi/ext/encoding_spec.c371
-rw-r--r--spec/ruby/optional/capi/ext/enumerator_spec.c32
-rw-r--r--spec/ruby/optional/capi/ext/exception_spec.c59
-rw-r--r--spec/ruby/optional/capi/ext/fiber_spec.c69
-rw-r--r--spec/ruby/optional/capi/ext/file_spec.c29
-rw-r--r--spec/ruby/optional/capi/ext/fixnum_spec.c26
-rw-r--r--spec/ruby/optional/capi/ext/float_spec.c47
-rw-r--r--spec/ruby/optional/capi/ext/gc_spec.c97
-rw-r--r--spec/ruby/optional/capi/ext/globals_spec.c161
-rw-r--r--spec/ruby/optional/capi/ext/hash_spec.c160
-rw-r--r--spec/ruby/optional/capi/ext/integer_spec.c41
-rw-r--r--spec/ruby/optional/capi/ext/io_spec.c312
-rw-r--r--spec/ruby/optional/capi/ext/kernel_spec.c405
-rw-r--r--spec/ruby/optional/capi/ext/language_spec.c42
-rw-r--r--spec/ruby/optional/capi/ext/marshal_spec.c24
-rw-r--r--spec/ruby/optional/capi/ext/module_spec.c176
-rw-r--r--spec/ruby/optional/capi/ext/module_under_autoload_spec.c15
-rw-r--r--spec/ruby/optional/capi/ext/mutex_spec.c55
-rw-r--r--spec/ruby/optional/capi/ext/numeric_spec.c130
-rw-r--r--spec/ruby/optional/capi/ext/object_spec.c528
-rw-r--r--spec/ruby/optional/capi/ext/proc_spec.c132
-rw-r--r--spec/ruby/optional/capi/ext/range_spec.c50
-rw-r--r--spec/ruby/optional/capi/ext/rational_spec.c54
-rw-r--r--spec/ruby/optional/capi/ext/rbasic_spec.c100
-rw-r--r--spec/ruby/optional/capi/ext/regexp_spec.c74
-rw-r--r--spec/ruby/optional/capi/ext/rubyspec.h37
-rw-r--r--spec/ruby/optional/capi/ext/st_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/string_spec.c719
-rw-r--r--spec/ruby/optional/capi/ext/struct_spec.c85
-rw-r--r--spec/ruby/optional/capi/ext/symbol_spec.c116
-rw-r--r--spec/ruby/optional/capi/ext/thread_spec.c188
-rw-r--r--spec/ruby/optional/capi/ext/time_spec.c81
-rw-r--r--spec/ruby/optional/capi/ext/tracepoint_spec.c49
-rw-r--r--spec/ruby/optional/capi/ext/typed_data_spec.c189
-rw-r--r--spec/ruby/optional/capi/ext/util_spec.c126
-rw-r--r--spec/ruby/optional/capi/fiber_spec.rb89
-rw-r--r--spec/ruby/optional/capi/file_spec.rb89
-rw-r--r--spec/ruby/optional/capi/fixnum_spec.rb101
-rw-r--r--spec/ruby/optional/capi/fixtures/class.rb104
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_at.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_from.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_object.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/encoding.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/foo.rb1
-rw-r--r--spec/ruby/optional/capi/fixtures/module.rb39
-rw-r--r--spec/ruby/optional/capi/fixtures/module_autoload.rb4
-rw-r--r--spec/ruby/optional/capi/fixtures/object.rb29
-rw-r--r--spec/ruby/optional/capi/fixtures/path_to_class.rb6
-rw-r--r--spec/ruby/optional/capi/fixtures/proc.rb20
-rw-r--r--spec/ruby/optional/capi/fixtures/read.txt1
-rw-r--r--spec/ruby/optional/capi/float_spec.rb43
-rw-r--r--spec/ruby/optional/capi/gc_spec.rb105
-rw-r--r--spec/ruby/optional/capi/globals_spec.rb293
-rw-r--r--spec/ruby/optional/capi/hash_spec.rb274
-rw-r--r--spec/ruby/optional/capi/integer_spec.rb290
-rw-r--r--spec/ruby/optional/capi/io_spec.rb418
-rw-r--r--spec/ruby/optional/capi/kernel_spec.rb696
-rw-r--r--spec/ruby/optional/capi/language_spec.rb37
-rw-r--r--spec/ruby/optional/capi/marshal_spec.rb46
-rw-r--r--spec/ruby/optional/capi/module_spec.rb431
-rw-r--r--spec/ruby/optional/capi/mutex_spec.rb89
-rw-r--r--spec/ruby/optional/capi/numeric_spec.rb495
-rw-r--r--spec/ruby/optional/capi/object_spec.rb1007
-rw-r--r--spec/ruby/optional/capi/proc_spec.rb135
-rw-r--r--spec/ruby/optional/capi/rake_helper.rb22
-rw-r--r--spec/ruby/optional/capi/range_spec.rb95
-rw-r--r--spec/ruby/optional/capi/rational_spec.rb57
-rw-r--r--spec/ruby/optional/capi/rbasic_spec.rb42
-rw-r--r--spec/ruby/optional/capi/regexp_spec.rb128
-rw-r--r--spec/ruby/optional/capi/shared/rbasic.rb29
-rw-r--r--spec/ruby/optional/capi/spec_helper.rb147
-rw-r--r--spec/ruby/optional/capi/st_spec.rb41
-rw-r--r--spec/ruby/optional/capi/string_spec.rb1293
-rw-r--r--spec/ruby/optional/capi/struct_spec.rb211
-rw-r--r--spec/ruby/optional/capi/symbol_spec.rb180
-rw-r--r--spec/ruby/optional/capi/thread_spec.rb189
-rw-r--r--spec/ruby/optional/capi/time_spec.rb296
-rw-r--r--spec/ruby/optional/capi/tracepoint_spec.rb56
-rw-r--r--spec/ruby/optional/capi/typed_data_spec.rb88
-rw-r--r--spec/ruby/optional/capi/util_spec.rb326
-rw-r--r--spec/ruby/security/cve_2010_1330_spec.rb19
-rw-r--r--spec/ruby/security/cve_2011_4815_spec.rb47
-rw-r--r--spec/ruby/security/cve_2013_4164_spec.rb15
-rw-r--r--spec/ruby/security/cve_2014_8080_spec.rb34
-rw-r--r--spec/ruby/security/cve_2017_17742_spec.rb37
-rw-r--r--spec/ruby/security/cve_2018_16396_spec.rb7
-rw-r--r--spec/ruby/security/cve_2018_6914_spec.rb55
-rw-r--r--spec/ruby/security/cve_2018_8778_spec.rb10
-rw-r--r--spec/ruby/security/cve_2018_8779_spec.rb30
-rw-r--r--spec/ruby/security/cve_2018_8780_spec.rb43
-rw-r--r--spec/ruby/security/cve_2019_8321_spec.rb20
-rw-r--r--spec/ruby/security/cve_2019_8322_spec.rb21
-rw-r--r--spec/ruby/security/cve_2019_8323_spec.rb36
-rw-r--r--spec/ruby/security/cve_2019_8325_spec.rb46
-rw-r--r--spec/ruby/security/cve_2020_10663_spec.rb39
-rw-r--r--spec/ruby/shared/basicobject/method_missing.rb124
-rw-r--r--spec/ruby/shared/basicobject/send.rb128
-rw-r--r--spec/ruby/shared/enumerable/minmax.rb24
-rw-r--r--spec/ruby/shared/enumerator/enum_for.rb57
-rw-r--r--spec/ruby/shared/enumerator/with_index.rb33
-rw-r--r--spec/ruby/shared/enumerator/with_object.rb42
-rw-r--r--spec/ruby/shared/fiber/resume.rb58
-rw-r--r--spec/ruby/shared/file/blockdev.rb9
-rw-r--r--spec/ruby/shared/file/chardev.rb9
-rw-r--r--spec/ruby/shared/file/directory.rb66
-rw-r--r--spec/ruby/shared/file/executable.rb83
-rw-r--r--spec/ruby/shared/file/executable_real.rb81
-rw-r--r--spec/ruby/shared/file/exist.rb24
-rw-r--r--spec/ruby/shared/file/file.rb45
-rw-r--r--spec/ruby/shared/file/grpowned.rb39
-rw-r--r--spec/ruby/shared/file/identical.rb51
-rw-r--r--spec/ruby/shared/file/owned.rb3
-rw-r--r--spec/ruby/shared/file/pipe.rb3
-rw-r--r--spec/ruby/shared/file/readable.rb49
-rw-r--r--spec/ruby/shared/file/readable_real.rb39
-rw-r--r--spec/ruby/shared/file/setgid.rb2
-rw-r--r--spec/ruby/shared/file/setuid.rb2
-rw-r--r--spec/ruby/shared/file/size.rb124
-rw-r--r--spec/ruby/shared/file/socket.rb3
-rw-r--r--spec/ruby/shared/file/sticky.rb29
-rw-r--r--spec/ruby/shared/file/symlink.rb46
-rw-r--r--spec/ruby/shared/file/world_readable.rb49
-rw-r--r--spec/ruby/shared/file/world_writable.rb49
-rw-r--r--spec/ruby/shared/file/writable.rb44
-rw-r--r--spec/ruby/shared/file/writable_real.rb49
-rw-r--r--spec/ruby/shared/file/zero.rb68
-rw-r--r--spec/ruby/shared/hash/key_error.rb23
-rw-r--r--spec/ruby/shared/io/putc.rb57
-rw-r--r--spec/ruby/shared/kernel/complex.rb133
-rw-r--r--spec/ruby/shared/kernel/equal.rb54
-rw-r--r--spec/ruby/shared/kernel/object_id.rb80
-rw-r--r--spec/ruby/shared/kernel/raise.rb149
-rw-r--r--spec/ruby/shared/math/atanh.rb44
-rw-r--r--spec/ruby/shared/process/abort.rb36
-rw-r--r--spec/ruby/shared/process/exit.rb120
-rw-r--r--spec/ruby/shared/process/fork.rb90
-rw-r--r--spec/ruby/shared/queue/clear.rb12
-rw-r--r--spec/ruby/shared/queue/close.rb14
-rw-r--r--spec/ruby/shared/queue/closed.rb12
-rw-r--r--spec/ruby/shared/queue/deque.rb147
-rw-r--r--spec/ruby/shared/queue/empty.rb12
-rw-r--r--spec/ruby/shared/queue/enque.rb18
-rw-r--r--spec/ruby/shared/queue/length.rb9
-rw-r--r--spec/ruby/shared/queue/num_waiting.rb16
-rw-r--r--spec/ruby/shared/rational/Rational.rb141
-rw-r--r--spec/ruby/shared/rational/abs.rb11
-rw-r--r--spec/ruby/shared/rational/arithmetic_exception_in_coerce.rb11
-rw-r--r--spec/ruby/shared/rational/ceil.rb45
-rw-r--r--spec/ruby/shared/rational/coerce.rb34
-rw-r--r--spec/ruby/shared/rational/comparison.rb95
-rw-r--r--spec/ruby/shared/rational/denominator.rb14
-rw-r--r--spec/ruby/shared/rational/div.rb54
-rw-r--r--spec/ruby/shared/rational/divide.rb71
-rw-r--r--spec/ruby/shared/rational/divmod.rb42
-rw-r--r--spec/ruby/shared/rational/equal_value.rb39
-rw-r--r--spec/ruby/shared/rational/exponent.rb196
-rw-r--r--spec/ruby/shared/rational/fdiv.rb5
-rw-r--r--spec/ruby/shared/rational/floor.rb45
-rw-r--r--spec/ruby/shared/rational/hash.rb9
-rw-r--r--spec/ruby/shared/rational/inspect.rb14
-rw-r--r--spec/ruby/shared/rational/marshal_dump.rb5
-rw-r--r--spec/ruby/shared/rational/marshal_load.rb5
-rw-r--r--spec/ruby/shared/rational/modulo.rb43
-rw-r--r--spec/ruby/shared/rational/multiply.rb62
-rw-r--r--spec/ruby/shared/rational/numerator.rb10
-rw-r--r--spec/ruby/shared/rational/plus.rb48
-rw-r--r--spec/ruby/shared/rational/quo.rb5
-rw-r--r--spec/ruby/shared/rational/remainder.rb5
-rw-r--r--spec/ruby/shared/rational/round.rb106
-rw-r--r--spec/ruby/shared/rational/to_f.rb16
-rw-r--r--spec/ruby/shared/rational/to_i.rb12
-rw-r--r--spec/ruby/shared/rational/to_r.rb11
-rw-r--r--spec/ruby/shared/rational/to_s.rb14
-rw-r--r--spec/ruby/shared/rational/truncate.rb45
-rw-r--r--spec/ruby/shared/sizedqueue/enque.rb113
-rw-r--r--spec/ruby/shared/sizedqueue/max.rb47
-rw-r--r--spec/ruby/shared/sizedqueue/new.rb23
-rw-r--r--spec/ruby/shared/sizedqueue/num_waiting.rb12
-rw-r--r--spec/ruby/shared/string/end_with.rb61
-rw-r--r--spec/ruby/shared/string/start_with.rb76
-rw-r--r--spec/ruby/shared/string/times.rb68
-rw-r--r--spec/ruby/shared/time/strftime_for_date.rb273
-rw-r--r--spec/ruby/shared/time/strftime_for_time.rb181
-rw-r--r--spec/ruby/spec_helper.rb38
-rw-r--r--spec/syntax_suggest/fixtures/derailed_require_tree.rb.txt74
-rwxr-xr-xspec/syntax_suggest/fixtures/rexe.rb.txt569
-rw-r--r--spec/syntax_suggest/fixtures/routes.rb.txt121
-rw-r--r--spec/syntax_suggest/fixtures/ruby_buildpack.rb.txt1344
-rw-r--r--spec/syntax_suggest/fixtures/syntax_tree.rb.txt9234
-rw-r--r--spec/syntax_suggest/fixtures/this_project_extra_def.rb.txt64
-rw-r--r--spec/syntax_suggest/fixtures/webmock.rb.txt35
-rw-r--r--spec/syntax_suggest/integration/exe_cli_spec.rb27
-rw-r--r--spec/syntax_suggest/integration/ruby_command_line_spec.rb193
-rw-r--r--spec/syntax_suggest/integration/syntax_suggest_spec.rb239
-rw-r--r--spec/syntax_suggest/spec_helper.rb104
-rw-r--r--spec/syntax_suggest/unit/api_spec.rb108
-rw-r--r--spec/syntax_suggest/unit/around_block_scan_spec.rb165
-rw-r--r--spec/syntax_suggest/unit/block_expand_spec.rb230
-rw-r--r--spec/syntax_suggest/unit/capture/before_after_keyword_ends_spec.rb47
-rw-r--r--spec/syntax_suggest/unit/capture/falling_indent_lines_spec.rb44
-rw-r--r--spec/syntax_suggest/unit/capture_code_context_spec.rb229
-rw-r--r--spec/syntax_suggest/unit/clean_document_spec.rb260
-rw-r--r--spec/syntax_suggest/unit/cli_spec.rb224
-rw-r--r--spec/syntax_suggest/unit/code_block_spec.rb77
-rw-r--r--spec/syntax_suggest/unit/code_frontier_spec.rb135
-rw-r--r--spec/syntax_suggest/unit/code_line_spec.rb165
-rw-r--r--spec/syntax_suggest/unit/code_search_spec.rb505
-rw-r--r--spec/syntax_suggest/unit/core_ext_spec.rb34
-rw-r--r--spec/syntax_suggest/unit/display_invalid_blocks_spec.rb174
-rw-r--r--spec/syntax_suggest/unit/explain_syntax_spec.rb255
-rw-r--r--spec/syntax_suggest/unit/lex_all_spec.rb29
-rw-r--r--spec/syntax_suggest/unit/pathname_from_message_spec.rb56
-rw-r--r--spec/syntax_suggest/unit/priority_queue_spec.rb95
-rw-r--r--spec/syntax_suggest/unit/scan_history_spec.rb114
-rw-r--r--sprintf.c1766
-rw-r--r--st.c3027
-rw-r--r--strftime.c78
-rw-r--r--string.c11309
-rw-r--r--string.rb552
-rw-r--r--struct.c1934
-rw-r--r--symbol.c1081
-rw-r--r--symbol.h41
-rw-r--r--symbol.rb15
-rw-r--r--template/Doxyfile.tmpl2568
-rw-r--r--template/GNUmakefile.in31
-rw-r--r--template/Makefile.in728
-rw-r--r--template/builtin_binary.inc.tmpl30
-rw-r--r--template/call_iseq_optimized.inc.tmpl68
-rw-r--r--template/configure-ext.mk.tmpl46
-rw-r--r--template/depend.tmpl2
-rw-r--r--template/encdb.h.tmpl50
-rw-r--r--template/extinit.c.tmpl17
-rw-r--r--template/exts.mk.tmpl171
-rw-r--r--template/fake.rb.in43
-rw-r--r--template/id.c.tmpl7
-rw-r--r--template/id.h.tmpl36
-rw-r--r--template/insns.inc.tmpl20
-rw-r--r--template/insns_info.inc.tmpl83
-rw-r--r--template/limits.c.tmpl97
-rw-r--r--template/minsns.inc.tmpl14
-rw-r--r--template/opt_sc.inc.tmpl32
-rw-r--r--template/optinsn.inc.tmpl30
-rw-r--r--template/optunifs.inc.tmpl35
-rw-r--r--template/prelude.c.tmpl245
-rwxr-xr-xtemplate/ruby-gdb.in6
-rwxr-xr-xtemplate/ruby-lldb.in6
-rw-r--r--template/ruby-runner.h.in6
-rw-r--r--template/ruby.pc.in21
-rw-r--r--template/sizes.c.tmpl5
-rw-r--r--template/transdb.h.tmpl21
-rw-r--r--template/unicode_norm_gen.tmpl26
-rw-r--r--template/verconf.h.tmpl6
-rw-r--r--template/vm.inc.tmpl29
-rw-r--r--template/vmtc.inc.tmpl18
-rw-r--r--template/yasmdata.rb.tmpl20
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_beg_len_step.rb52
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_extract.rb40
-rw-r--r--test/-ext-/array/test_resize.rb8
-rw-r--r--test/-ext-/array/test_to_ary_concat.rb20
-rw-r--r--test/-ext-/bignum/test_big2str.rb38
-rw-r--r--test/-ext-/bignum/test_bigzero.rb18
-rw-r--r--test/-ext-/bignum/test_div.rb38
-rw-r--r--test/-ext-/bignum/test_mul.rb260
-rw-r--r--test/-ext-/bignum/test_pack.rb737
-rw-r--r--test/-ext-/bignum/test_str2big.rb52
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb17
-rw-r--r--test/-ext-/debug/test_debug.rb16
-rw-r--r--test/-ext-/debug/test_profile_frames.rb74
-rw-r--r--test/-ext-/econv/test_append.rb23
-rw-r--r--test/-ext-/eval/test_eval.rb12
-rw-r--r--test/-ext-/exception/test_data_error.rb2
-rw-r--r--test/-ext-/exception/test_enc_raise.rb2
-rw-r--r--test/-ext-/exception/test_ensured.rb2
-rw-r--r--test/-ext-/exception/test_exception_at_throwing.rb18
-rw-r--r--test/-ext-/float/test_nextafter.rb4
-rw-r--r--test/-ext-/funcall/test_passing_block.rb46
-rw-r--r--test/-ext-/gvl/test_last_thread.rb3
-rw-r--r--test/-ext-/gvl/test_ubf_async_safe.rb20
-rw-r--r--test/-ext-/hash/test_delete.rb2
-rw-r--r--test/-ext-/integer/test_integer.rb17
-rw-r--r--test/-ext-/integer/test_my_integer.rb2
-rw-r--r--test/-ext-/iseq_load/test_iseq_load.rb89
-rw-r--r--test/-ext-/iter/test_yield_block.rb12
-rw-r--r--test/-ext-/load/script.rb2
-rw-r--r--test/-ext-/load/test_protect.rb14
-rw-r--r--test/-ext-/marshal/test_internal_ivar.rb8
-rw-r--r--test/-ext-/method/test_arity.rb4
-rw-r--r--test/-ext-/num2int/test_num2int.rb42
-rw-r--r--test/-ext-/popen_deadlock/test_popen_deadlock.rb2
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb12
-rw-r--r--test/-ext-/proc/test_bmethod.rb4
-rw-r--r--test/-ext-/rational/test_rat.rb44
-rw-r--r--test/-ext-/string/test_capacity.rb65
-rw-r--r--test/-ext-/string/test_cstr.rb14
-rw-r--r--test/-ext-/string/test_ellipsize.rb2
-rw-r--r--test/-ext-/string/test_enc_associate.rb4
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb9
-rw-r--r--test/-ext-/string/test_external_new.rb17
-rw-r--r--test/-ext-/string/test_fstring.rb47
-rw-r--r--test/-ext-/string/test_interned_str.rb12
-rw-r--r--test/-ext-/string/test_modify_expand.rb4
-rw-r--r--test/-ext-/string/test_normalize.rb8
-rw-r--r--test/-ext-/string/test_rb_str_dup.rb18
-rw-r--r--test/-ext-/string/test_set_len.rb48
-rw-r--r--test/-ext-/struct/test_duplicate.rb4
-rw-r--r--test/-ext-/struct/test_len.rb10
-rw-r--r--test/-ext-/symbol/noninterned_name.rb17
-rw-r--r--test/-ext-/symbol/test_inadvertent_creation.rb44
-rw-r--r--test/-ext-/symbol/test_type.rb14
-rw-r--r--test/-ext-/test_abi.rb47
-rw-r--r--test/-ext-/test_bug-14834.rb12
-rw-r--r--test/-ext-/test_enumerator_kw.rb11
-rw-r--r--test/-ext-/test_notimplement.rb31
-rw-r--r--test/-ext-/test_printf.rb17
-rw-r--r--test/-ext-/test_random.rb45
-rw-r--r--test/-ext-/test_scan_args.rb259
-rw-r--r--test/-ext-/thread/test_instrumentation_api.rb91
-rw-r--r--test/-ext-/thread_fd/test_thread_fd_close.rb24
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb24
-rw-r--r--test/-ext-/typeddata/test_typeddata.rb9
-rw-r--r--test/-ext-/wait/test_wait.rb36
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb46
-rw-r--r--test/-ext-/win32/test_console_attr.rb29
-rw-r--r--test/-ext-/win32/test_dln.rb14
-rw-r--r--test/base64/test_base64.rb2
-rw-r--r--test/benchmark/test_benchmark.rb21
-rw-r--r--test/bigdecimal/helper.rb39
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1308
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb104
-rw-r--r--test/bigdecimal/test_bigmath.rb2
-rw-r--r--test/bigdecimal/test_ractor.rb23
-rw-r--r--test/bigdecimal/testbase.rb28
-rw-r--r--test/cgi/test_cgi_cookie.rb103
-rw-r--r--test/cgi/test_cgi_core.rb16
-rw-r--r--test/cgi/test_cgi_header.rb20
-rw-r--r--test/cgi/test_cgi_modruby.rb2
-rw-r--r--test/cgi/test_cgi_multipart.rb15
-rw-r--r--test/cgi/test_cgi_session.rb10
-rw-r--r--test/cgi/test_cgi_tag_helper.rb2
-rw-r--r--test/cgi/test_cgi_util.rb207
-rw-r--r--test/coverage/autostart.rb2
-rw-r--r--test/coverage/main.rb1
-rw-r--r--test/coverage/test_coverage.rb976
-rw-r--r--test/csv/base.rb9
-rw-r--r--test/csv/helper.rb42
-rw-r--r--test/csv/interface/test_delegation.rb47
-rw-r--r--test/csv/interface/test_read.rb381
-rw-r--r--test/csv/interface/test_read_write.rb124
-rw-r--r--test/csv/interface/test_write.rb217
-rw-r--r--test/csv/parse/test_column_separator.rb40
-rw-r--r--test/csv/parse/test_convert.rb165
-rw-r--r--test/csv/parse/test_each.rb23
-rw-r--r--test/csv/parse/test_general.rb341
-rw-r--r--test/csv/parse/test_header.rb342
-rw-r--r--test/csv/parse/test_inputs_scanner.rb63
-rw-r--r--test/csv/parse/test_invalid.rb52
-rw-r--r--test/csv/parse/test_liberal_parsing.rb171
-rw-r--r--test/csv/parse/test_quote_char_nil.rb93
-rw-r--r--test/csv/parse/test_read.rb27
-rw-r--r--test/csv/parse/test_rewind.rb40
-rw-r--r--test/csv/parse/test_row_separator.rb16
-rw-r--r--test/csv/parse/test_skip_lines.rb118
-rw-r--r--test/csv/parse/test_strip.rb112
-rw-r--r--test/csv/parse/test_unconverted_fields.rb117
-rwxr-xr-xtest/csv/test_csv_parsing.rb222
-rwxr-xr-xtest/csv/test_csv_writing.rb98
-rw-r--r--[-rwxr-xr-x]test/csv/test_data_converters.rb284
-rw-r--r--[-rwxr-xr-x]test/csv/test_encodings.rb109
-rw-r--r--[-rwxr-xr-x]test/csv/test_features.rb204
-rwxr-xr-xtest/csv/test_headers.rb298
-rwxr-xr-xtest/csv/test_interface.rb369
-rw-r--r--test/csv/test_patterns.rb27
-rw-r--r--[-rwxr-xr-x]test/csv/test_row.rb89
-rw-r--r--[-rwxr-xr-x]test/csv/test_table.rb318
-rw-r--r--test/csv/ts_all.rb21
-rw-r--r--test/csv/write/test_converters.rb53
-rw-r--r--test/csv/write/test_force_quotes.rb78
-rw-r--r--test/csv/write/test_general.rb246
-rw-r--r--test/csv/write/test_quote_empty.rb70
-rw-r--r--test/date/test_date.rb58
-rw-r--r--test/date/test_date_arith.rb33
-rw-r--r--test/date/test_date_attr.rb25
-rw-r--r--test/date/test_date_base.rb443
-rw-r--r--test/date/test_date_compat.rb2
-rw-r--r--test/date/test_date_conv.rb37
-rw-r--r--test/date/test_date_marshal.rb23
-rw-r--r--test/date/test_date_new.rb118
-rw-r--r--test/date/test_date_parse.rb211
-rw-r--r--test/date/test_date_ractor.rb27
-rw-r--r--test/date/test_date_strftime.rb22
-rw-r--r--test/date/test_date_strptime.rb30
-rw-r--r--test/date/test_switch_hitter.rb82
-rw-r--r--test/dbm/test_dbm.rb632
-rw-r--r--test/did_you_mean/core_ext/test_name_error_extension.rb55
-rw-r--r--test/did_you_mean/edit_distance/test_jaro_winkler.rb36
-rw-r--r--test/did_you_mean/fixtures/book.rb4
-rw-r--r--test/did_you_mean/fixtures/mini_dir.yml15
-rw-r--r--test/did_you_mean/fixtures/rspec_dir.yml112
-rw-r--r--test/did_you_mean/helper.rb43
-rw-r--r--test/did_you_mean/spell_checking/test_class_name_check.rb81
-rw-r--r--test/did_you_mean/spell_checking/test_key_name_check.rb54
-rw-r--r--test/did_you_mean/spell_checking/test_method_name_check.rb165
-rw-r--r--test/did_you_mean/spell_checking/test_pattern_key_name_check.rb20
-rw-r--r--test/did_you_mean/spell_checking/test_require_path_check.rb32
-rw-r--r--test/did_you_mean/spell_checking/test_uncorrectable_name_check.rb15
-rw-r--r--test/did_you_mean/spell_checking/test_variable_name_check.rb152
-rw-r--r--test/did_you_mean/test_ractor_compatibility.rb117
-rw-r--r--test/did_you_mean/test_spell_checker.rb78
-rw-r--r--test/did_you_mean/test_tree_spell_checker.rb170
-rw-r--r--test/did_you_mean/tree_spell/change_word.rb61
-rw-r--r--test/did_you_mean/tree_spell/human_typo.rb69
-rw-r--r--test/did_you_mean/tree_spell/test_change_word.rb38
-rw-r--r--test/did_you_mean/tree_spell/test_human_typo.rb24
-rw-r--r--test/digest/test_digest.rb25
-rw-r--r--test/digest/test_digest_extend.rb15
-rw-r--r--test/digest/test_ractor.rb97
-rw-r--r--test/drb/drbtest.rb129
-rw-r--r--test/drb/test_acl.rb101
-rw-r--r--test/drb/test_drb.rb191
-rw-r--r--test/drb/test_drbobject.rb69
-rw-r--r--test/drb/test_drbssl.rb63
-rw-r--r--test/drb/test_drbunix.rb26
-rw-r--r--test/drb/ut_drb.rb21
-rw-r--r--test/drb/ut_eval.rb37
-rw-r--r--test/dtrace/helper.rb100
-rw-r--r--test/dtrace/test_array_create.rb8
-rw-r--r--test/dtrace/test_function_entry.rb9
-rw-r--r--test/dtrace/test_hash_create.rb6
-rw-r--r--test/dtrace/test_method_cache.rb2
-rw-r--r--test/dtrace/test_require.rb6
-rw-r--r--test/dtrace/test_singleton_function.rb9
-rw-r--r--test/dtrace/test_string.rb6
-rw-r--r--test/erb/test_erb.rb231
-rw-r--r--test/erb/test_erb_command.rb12
-rw-r--r--test/erb/test_erb_m17n.rb2
-rw-r--r--test/error_highlight/test_error_highlight.rb1290
-rw-r--r--test/etc/test_etc.rb36
-rw-r--r--test/excludes/TestArray.rb1
-rw-r--r--test/excludes/TestGem.rb4
-rw-r--r--test/excludes/TestThread.rb12
-rw-r--r--test/excludes/TestThreadQueue.rb9
-rw-r--r--test/excludes/_appveyor/TestArray.rb7
-rw-r--r--test/fiber/autoload.rb3
-rw-r--r--test/fiber/http.rb54
-rw-r--r--test/fiber/scheduler.rb363
-rw-r--r--test/fiber/test_address_resolve.rb278
-rw-r--r--test/fiber/test_backtrace.rb22
-rw-r--r--test/fiber/test_enumerator.rb53
-rw-r--r--test/fiber/test_io.rb222
-rw-r--r--test/fiber/test_io_buffer.rb158
-rw-r--r--test/fiber/test_mutex.rb240
-rw-r--r--test/fiber/test_process.rb72
-rw-r--r--test/fiber/test_queue.rb54
-rw-r--r--test/fiber/test_ractor.rb23
-rw-r--r--test/fiber/test_scheduler.rb226
-rw-r--r--test/fiber/test_sleep.rb71
-rw-r--r--test/fiber/test_storage.rb115
-rw-r--r--test/fiber/test_thread.rb130
-rw-r--r--test/fiber/test_timeout.rb51
-rw-r--r--test/fiddle/helper.rb92
-rw-r--r--test/fiddle/test_c_struct_builder.rb69
-rw-r--r--test/fiddle/test_c_struct_entry.rb132
-rw-r--r--test/fiddle/test_c_union_entity.rb17
-rw-r--r--test/fiddle/test_closure.rb114
-rw-r--r--test/fiddle/test_cparser.rb185
-rw-r--r--test/fiddle/test_fiddle.rb43
-rw-r--r--test/fiddle/test_func.rb120
-rw-r--r--test/fiddle/test_function.rb177
-rw-r--r--test/fiddle/test_handle.rb63
-rw-r--r--test/fiddle/test_import.rb403
-rw-r--r--test/fiddle/test_memory_view.rb143
-rw-r--r--test/fiddle/test_pack.rb37
-rw-r--r--test/fiddle/test_pinned.rb28
-rw-r--r--test/fiddle/test_pointer.rb128
-rw-r--r--test/fileutils/clobber.rb7
-rw-r--r--test/fileutils/fileasserts.rb2
-rw-r--r--test/fileutils/test_dryrun.rb4
-rw-r--r--test/fileutils/test_fileutils.rb483
-rw-r--r--test/fileutils/test_nowrite.rb4
-rw-r--r--test/fileutils/test_verbose.rb4
-rw-r--r--test/fileutils/visibility_tests.rb7
-rw-r--r--test/fixtures/fake_sorted_set_gem/sorted_set.rb9
-rw-r--r--test/gdbm/test_gdbm.rb728
-rw-r--r--test/io/console/test_io_console.rb306
-rw-r--r--test/io/nonblock/test_flush.rb22
-rw-r--r--test/io/wait/test_io_wait.rb58
-rw-r--r--test/io/wait/test_io_wait_uncommon.rb77
-rw-r--r--test/io/wait/test_ractor.rb17
-rw-r--r--test/irb/helper.rb76
-rw-r--r--test/irb/test_cmd.rb692
-rw-r--r--test/irb/test_color.rb291
-rw-r--r--test/irb/test_color_printer.rb69
-rw-r--r--test/irb/test_completion.rb349
-rw-r--r--test/irb/test_context.rb643
-rw-r--r--test/irb/test_debug_cmd.rb303
-rw-r--r--test/irb/test_history.rb209
-rw-r--r--test/irb/test_init.rb177
-rw-r--r--test/irb/test_input_method.rb79
-rw-r--r--test/irb/test_option.rb7
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb48
-rw-r--r--test/irb/test_ruby_lex.rb725
-rw-r--r--test/irb/test_workspace.rb129
-rw-r--r--test/irb/yamatanooroti/test_rendering.rb249
-rw-r--r--test/json/fixtures/fail29.json1
-rw-r--r--test/json/fixtures/fail30.json1
-rw-r--r--test/json/fixtures/fail31.json1
-rw-r--r--test/json/fixtures/fail32.json1
-rw-r--r--test/json/json_addition_test.rb8
-rw-r--r--test/json/json_common_interface_test.rb51
-rw-r--r--test/json/json_encoding_test.rb2
-rw-r--r--test/json/json_fixtures_test.rb10
-rw-r--r--test/json/json_generator_test.rb43
-rw-r--r--test/json/json_parser_test.rb60
-rw-r--r--test/json/ractor_test.rb30
-rw-r--r--test/json/test_helper.rb10
-rw-r--r--test/lib/-test-/integer.rb14
-rw-r--r--test/lib/envutil.rb273
-rw-r--r--test/lib/find_executable.rb22
-rw-r--r--test/lib/iseq_loader_checker.rb75
-rw-r--r--test/lib/jit_support.rb98
-rw-r--r--test/lib/leakchecker.rb201
-rw-r--r--test/lib/memory_status.rb144
-rw-r--r--test/lib/minitest/README.txt457
-rw-r--r--test/lib/minitest/autorun.rb14
-rw-r--r--test/lib/minitest/benchmark.rb418
-rw-r--r--test/lib/minitest/mock.rb196
-rw-r--r--test/lib/minitest/unit.rb1402
-rw-r--r--test/lib/profile_test_all.rb91
-rw-r--r--test/lib/test/unit.rb1035
-rw-r--r--test/lib/test/unit/assertions.rb859
-rw-r--r--test/lib/test/unit/parallel.rb191
-rw-r--r--test/lib/test/unit/testcase.rb36
-rw-r--r--test/lib/tracepointchecker.rb119
-rw-r--r--test/lib/with_different_ofs.rb6
-rw-r--r--test/lib/zombie_hunter.rb9
-rw-r--r--test/logger/test_formatter.rb35
-rw-r--r--test/logger/test_logdevice.rb311
-rw-r--r--test/logger/test_logger.rb68
-rw-r--r--test/logger/test_logperiod.rb80
-rw-r--r--test/logger/test_severity.rb12
-rw-r--r--test/matrix/test_matrix.rb612
-rw-r--r--test/matrix/test_vector.rb220
-rw-r--r--test/minitest/metametameta.rb71
-rw-r--r--test/minitest/test_minitest_benchmark.rb131
-rw-r--r--test/minitest/test_minitest_mock.rb404
-rw-r--r--test/minitest/test_minitest_unit.rb1778
-rw-r--r--test/misc/test_ruby_mode.rb183
-rw-r--r--test/mkmf/base.rb236
-rw-r--r--test/mkmf/test_config.rb16
-rw-r--r--test/mkmf/test_constant.rb60
-rw-r--r--test/mkmf/test_convertible.rb48
-rw-r--r--test/mkmf/test_egrep_cpp.rb13
-rw-r--r--test/mkmf/test_find_executable.rb82
-rw-r--r--test/mkmf/test_flags.rb92
-rw-r--r--test/mkmf/test_framework.rb70
-rw-r--r--test/mkmf/test_have_func.rb18
-rw-r--r--test/mkmf/test_have_library.rb84
-rw-r--r--test/mkmf/test_have_macro.rb46
-rw-r--r--test/mkmf/test_install.rb28
-rw-r--r--test/mkmf/test_libs.rb153
-rw-r--r--test/mkmf/test_mkmf.rb13
-rw-r--r--test/mkmf/test_pkg_config.rb66
-rw-r--r--test/mkmf/test_signedness.rb38
-rw-r--r--test/mkmf/test_sizeof.rb74
-rw-r--r--test/monitor/test_monitor.rb133
-rw-r--r--test/net/fixtures/Makefile15
-rw-r--r--test/net/fixtures/cacert.pem24
-rw-r--r--test/net/fixtures/dhparams.pem29
-rw-r--r--test/net/fixtures/server.crt21
-rw-r--r--test/net/fixtures/server.key27
-rw-r--r--test/net/ftp/test_buffered_socket.rb42
-rw-r--r--test/net/ftp/test_ftp.rb1669
-rw-r--r--test/net/ftp/test_mlsx_entry.rb98
-rw-r--r--test/net/http/test_http.rb441
-rw-r--r--test/net/http/test_http_request.rb19
-rw-r--r--test/net/http/test_httpheader.rb73
-rw-r--r--test/net/http/test_httpresponse.rb359
-rw-r--r--test/net/http/test_https.rb261
-rw-r--r--test/net/http/test_https_proxy.rb2
-rw-r--r--test/net/http/utils.rb27
-rw-r--r--test/net/imap/Makefile15
-rw-r--r--test/net/imap/cacert.pem66
-rw-r--r--test/net/imap/server.crt48
-rw-r--r--test/net/imap/server.key15
-rw-r--r--test/net/imap/test_imap.rb609
-rw-r--r--test/net/imap/test_imap_response_parser.rb294
-rw-r--r--test/net/pop/test_pop.rb137
-rw-r--r--test/net/protocol/test_protocol.rb138
-rw-r--r--test/net/smtp/test_response.rb100
-rw-r--r--test/net/smtp/test_smtp.rb102
-rw-r--r--test/net/smtp/test_ssl_socket.rb92
-rw-r--r--test/nkf/test_kconv.rb8
-rw-r--r--test/objspace/test_objspace.rb609
-rw-r--r--test/objspace/test_ractor.rb17
-rw-r--r--test/open-uri/test_open-uri.rb385
-rw-r--r--test/open-uri/test_ssl.rb411
-rw-r--r--test/openssl/fixtures/pkey/certificate.derbin0 -> 1325 bytes-rw-r--r--test/openssl/fixtures/pkey/dh-1.pem13
-rw-r--r--test/openssl/fixtures/pkey/dh1024.pem5
-rw-r--r--test/openssl/fixtures/pkey/dsa1024.pem12
-rw-r--r--test/openssl/fixtures/pkey/dsa256.pem8
-rw-r--r--test/openssl/fixtures/pkey/dsa512.pem8
-rw-r--r--test/openssl/fixtures/pkey/empty.der0
-rw-r--r--test/openssl/fixtures/pkey/empty.pem0
-rw-r--r--test/openssl/fixtures/pkey/fullchain.pem56
-rw-r--r--test/openssl/fixtures/pkey/garbage.txt1
-rw-r--r--test/openssl/fixtures/pkey/p256.pem5
-rw-r--r--test/openssl/fixtures/pkey/p256_too_large.pem5
-rw-r--r--test/openssl/fixtures/pkey/p384_invalid.pem6
-rw-r--r--test/openssl/fixtures/pkey/rsa-1.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-2.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-3.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa1024.pem15
-rw-r--r--test/openssl/fixtures/pkey/rsa2048.pem27
-rw-r--r--test/openssl/test_asn1.rb845
-rw-r--r--test/openssl/test_bn.rb415
-rw-r--r--test/openssl/test_buffering.rb19
-rw-r--r--test/openssl/test_cipher.rb567
-rw-r--r--test/openssl/test_config.rb201
-rw-r--r--test/openssl/test_digest.rb140
-rw-r--r--test/openssl/test_engine.rb49
-rw-r--r--test/openssl/test_fips.rb21
-rw-r--r--test/openssl/test_hmac.rb81
-rw-r--r--test/openssl/test_kdf.rb183
-rw-r--r--test/openssl/test_ns_spki.rb13
-rw-r--r--test/openssl/test_ocsp.rb90
-rw-r--r--test/openssl/test_ossl.rb65
-rw-r--r--test/openssl/test_pair.rb305
-rw-r--r--test/openssl/test_pkcs12.rb331
-rw-r--r--test/openssl/test_pkcs5.rb98
-rw-r--r--test/openssl/test_pkcs7.rb67
-rw-r--r--test/openssl/test_pkey.rb206
-rw-r--r--test/openssl/test_pkey_dh.rb136
-rw-r--r--test/openssl/test_pkey_dsa.rb163
-rw-r--r--test/openssl/test_pkey_ec.rb345
-rw-r--r--test/openssl/test_pkey_rsa.rb478
-rw-r--r--test/openssl/test_random.rb8
-rw-r--r--test/openssl/test_ssl.rb1437
-rw-r--r--test/openssl/test_ssl_session.rb435
-rw-r--r--test/openssl/test_ts.rb680
-rw-r--r--test/openssl/test_x509attr.rb31
-rw-r--r--test/openssl/test_x509cert.rb282
-rw-r--r--test/openssl/test_x509crl.rb134
-rw-r--r--test/openssl/test_x509ext.rb29
-rw-r--r--test/openssl/test_x509name.rb156
-rw-r--r--test/openssl/test_x509req.rb72
-rw-r--r--test/openssl/test_x509store.rb443
-rw-r--r--test/openssl/ut_eof.rb20
-rw-r--r--test/openssl/utils.rb539
-rw-r--r--test/optparse/test_acceptable.rb18
-rw-r--r--test/optparse/test_autoconf.rb13
-rw-r--r--test/optparse/test_bash_completion.rb9
-rw-r--r--test/optparse/test_cclass.rb2
-rw-r--r--test/optparse/test_did_you_mean.rb48
-rw-r--r--test/optparse/test_getopts.rb4
-rw-r--r--test/optparse/test_kwargs.rb38
-rw-r--r--test/optparse/test_load.rb141
-rw-r--r--test/optparse/test_noarg.rb27
-rw-r--r--test/optparse/test_optarg.rb15
-rw-r--r--test/optparse/test_optparse.rb47
-rw-r--r--test/optparse/test_placearg.rb21
-rw-r--r--test/optparse/test_reqarg.rb27
-rw-r--r--test/optparse/test_summary.rb36
-rw-r--r--test/optparse/test_zsh_completion.rb4
-rw-r--r--test/ostruct/test_ostruct.rb244
-rw-r--r--test/pathname/test_pathname.rb332
-rw-r--r--test/pathname/test_ractor.rb22
-rw-r--r--test/psych/handlers/test_recorder.rb2
-rw-r--r--test/psych/helper.rb52
-rw-r--r--test/psych/json/test_stream.rb2
-rw-r--r--test/psych/nodes/test_enumerable.rb2
-rw-r--r--test/psych/test_alias_and_anchor.rb14
-rw-r--r--test/psych/test_array.rb32
-rw-r--r--test/psych/test_boolean.rb2
-rw-r--r--test/psych/test_class.rb6
-rw-r--r--test/psych/test_coder.rb143
-rw-r--r--test/psych/test_date_time.rb55
-rw-r--r--test/psych/test_deprecated.rb132
-rw-r--r--test/psych/test_document.rb4
-rw-r--r--test/psych/test_emitter.rb14
-rw-r--r--test/psych/test_encoding.rb25
-rw-r--r--test/psych/test_exception.rb84
-rw-r--r--test/psych/test_hash.rb102
-rw-r--r--test/psych/test_json_tree.rb2
-rw-r--r--test/psych/test_marshalable.rb14
-rw-r--r--test/psych/test_merge_keys.rb36
-rw-r--r--test/psych/test_nil.rb6
-rw-r--r--test/psych/test_null.rb2
-rw-r--r--test/psych/test_numeric.rb14
-rw-r--r--test/psych/test_object.rb17
-rw-r--r--test/psych/test_object_references.rb14
-rw-r--r--test/psych/test_omap.rb6
-rw-r--r--test/psych/test_parser.rb88
-rw-r--r--test/psych/test_psych.rb300
-rw-r--r--test/psych/test_ractor.rb50
-rw-r--r--test/psych/test_safe_load.rb112
-rw-r--r--test/psych/test_scalar.rb7
-rw-r--r--test/psych/test_scalar_scanner.rb106
-rw-r--r--test/psych/test_serialize_subclasses.rb6
-rw-r--r--test/psych/test_set.rb8
-rw-r--r--test/psych/test_stream.rb18
-rw-r--r--test/psych/test_string.rb57
-rw-r--r--test/psych/test_struct.rb8
-rw-r--r--test/psych/test_symbol.rb2
-rw-r--r--test/psych/test_tainted.rb131
-rw-r--r--test/psych/test_to_yaml_properties.rb64
-rw-r--r--test/psych/test_tree_builder.rb16
-rw-r--r--test/psych/test_yaml.rb47
-rw-r--r--test/psych/test_yaml_special_cases.rb130
-rw-r--r--test/psych/test_yamldbm.rb2
-rw-r--r--test/psych/test_yamlstore.rb49
-rw-r--r--test/psych/visitors/test_depth_first.rb2
-rw-r--r--test/psych/visitors/test_emitter.rb2
-rw-r--r--test/psych/visitors/test_to_ruby.rb7
-rw-r--r--test/psych/visitors/test_yaml_tree.rb42
-rw-r--r--test/racc/assets/cadenza.y170
-rw-r--r--test/racc/assets/cast.y926
-rw-r--r--test/racc/assets/chk.y126
-rw-r--r--test/racc/assets/conf.y16
-rw-r--r--test/racc/assets/csspool.y729
-rw-r--r--test/racc/assets/digraph.y29
-rw-r--r--test/racc/assets/echk.y118
-rw-r--r--test/racc/assets/edtf.y583
-rw-r--r--test/racc/assets/err.y60
-rw-r--r--test/racc/assets/error_recovery.y35
-rw-r--r--test/racc/assets/expect.y7
-rw-r--r--test/racc/assets/firstline.y4
-rw-r--r--test/racc/assets/huia.y318
-rw-r--r--test/racc/assets/ichk.y102
-rw-r--r--test/racc/assets/ifelse.y14
-rw-r--r--test/racc/assets/intp.y546
-rw-r--r--test/racc/assets/journey.y47
-rw-r--r--test/racc/assets/liquor.y313
-rw-r--r--test/racc/assets/machete.y423
-rw-r--r--test/racc/assets/macruby.y2197
-rw-r--r--test/racc/assets/mailp.y437
-rw-r--r--test/racc/assets/mediacloth.y599
-rw-r--r--test/racc/assets/mof.y649
-rw-r--r--test/racc/assets/namae.y302
-rw-r--r--test/racc/assets/nasl.y626
-rw-r--r--test/racc/assets/newsyn.y25
-rw-r--r--test/racc/assets/noend.y4
-rw-r--r--test/racc/assets/nokogiri-css.y255
-rw-r--r--test/racc/assets/nonass.y41
-rw-r--r--test/racc/assets/normal.y27
-rw-r--r--test/racc/assets/norule.y4
-rw-r--r--test/racc/assets/nullbug1.y25
-rw-r--r--test/racc/assets/nullbug2.y15
-rw-r--r--test/racc/assets/opal.y1807
-rw-r--r--test/racc/assets/opt.y123
-rw-r--r--test/racc/assets/percent.y35
-rw-r--r--test/racc/assets/php_serialization.y98
-rw-r--r--test/racc/assets/recv.y97
-rw-r--r--test/racc/assets/riml.y665
-rw-r--r--test/racc/assets/rrconf.y14
-rw-r--r--test/racc/assets/ruby18.y1943
-rw-r--r--test/racc/assets/ruby19.y2174
-rw-r--r--test/racc/assets/ruby20.y2350
-rw-r--r--test/racc/assets/ruby21.y2359
-rw-r--r--test/racc/assets/ruby22.y2381
-rw-r--r--test/racc/assets/scan.y72
-rw-r--r--test/racc/assets/syntax.y50
-rw-r--r--test/racc/assets/tp_plus.y622
-rw-r--r--test/racc/assets/twowaysql.y278
-rw-r--r--test/racc/assets/unterm.y5
-rw-r--r--test/racc/assets/useless.y12
-rw-r--r--test/racc/assets/yyerr.y46
-rw-r--r--test/racc/bench.y36
-rw-r--r--test/racc/case.rb111
-rw-r--r--test/racc/infini.y8
-rw-r--r--test/racc/regress/README.txt7
-rw-r--r--test/racc/regress/cadenza796
-rw-r--r--test/racc/regress/cast3945
-rw-r--r--test/racc/regress/csspool2314
-rw-r--r--test/racc/regress/edtf1794
-rw-r--r--test/racc/regress/huia1681
-rw-r--r--test/racc/regress/journey222
-rw-r--r--test/racc/regress/liquor885
-rw-r--r--test/racc/regress/machete833
-rw-r--r--test/racc/regress/mediacloth1463
-rw-r--r--test/racc/regress/mof1368
-rw-r--r--test/racc/regress/namae634
-rw-r--r--test/racc/regress/nasl2548
-rw-r--r--test/racc/regress/nokogiri-css836
-rw-r--r--test/racc/regress/opal10107
-rw-r--r--test/racc/regress/php_serialization336
-rw-r--r--test/racc/regress/riml4037
-rw-r--r--test/racc/regress/ruby189945
-rw-r--r--test/racc/regress/ruby2211180
-rw-r--r--test/racc/regress/tp_plus1933
-rw-r--r--test/racc/regress/twowaysql556
-rw-r--r--test/racc/scandata/brace7
-rw-r--r--test/racc/scandata/gvar1
-rw-r--r--test/racc/scandata/normal4
-rw-r--r--test/racc/scandata/percent18
-rw-r--r--test/racc/scandata/slash10
-rw-r--r--test/racc/src.intp34
-rw-r--r--test/racc/start.y20
-rw-r--r--test/racc/test_chk_y.rb52
-rw-r--r--test/racc/test_grammar_file_parser.rb15
-rw-r--r--test/racc/test_racc_command.rb339
-rw-r--r--test/racc/test_scan_y.rb52
-rw-r--r--test/racc/testscanner.rb51
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text2
-rw-r--r--test/rdoc/helper.rb5
-rw-r--r--test/rdoc/support/formatter_test_case.rb764
-rw-r--r--test/rdoc/support/test_case.rb217
-rw-r--r--test/rdoc/support/text_formatter_test_case.rb115
-rw-r--r--test/rdoc/test_rdoc_alias.rb5
-rw-r--r--test/rdoc/test_rdoc_any_method.rb132
-rw-r--r--test/rdoc/test_rdoc_attr.rb7
-rw-r--r--test/rdoc/test_rdoc_class_module.rb68
-rw-r--r--test/rdoc/test_rdoc_code_object.rb16
-rw-r--r--test/rdoc/test_rdoc_comment.rb17
-rw-r--r--test/rdoc/test_rdoc_constant.rb12
-rw-r--r--test/rdoc/test_rdoc_context.rb117
-rw-r--r--test/rdoc/test_rdoc_context_section.rb14
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb88
-rw-r--r--test/rdoc/test_rdoc_encoding.rb110
-rw-r--r--test/rdoc/test_rdoc_extend.rb13
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb147
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb51
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb4
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb4
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb4
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb4
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb4
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb12
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb6
-rw-r--r--test/rdoc/test_rdoc_include.rb16
-rw-r--r--test/rdoc/test_rdoc_markdown.rb131
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb16
-rw-r--r--test/rdoc/test_rdoc_markup.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb79
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb12
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb6
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb61
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb64
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb22
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb317
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb130
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb25
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb8
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb4
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb4
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb5
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb9
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb5
-rw-r--r--test/rdoc/test_rdoc_options.rb243
-rw-r--r--test/rdoc/test_rdoc_parser.rb28
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb362
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb177
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb4
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb4
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb1351
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb4
-rw-r--r--test/rdoc/test_rdoc_rd.rb4
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb27
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb4
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb4
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb274
-rw-r--r--test/rdoc/test_rdoc_require.rb11
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb293
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb18
-rw-r--r--test/rdoc/test_rdoc_ruby_lex.rb422
-rw-r--r--test/rdoc/test_rdoc_ruby_token.rb20
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb101
-rw-r--r--test/rdoc/test_rdoc_servlet.rb47
-rw-r--r--test/rdoc/test_rdoc_single_class.rb4
-rw-r--r--test/rdoc/test_rdoc_stats.rb4
-rw-r--r--test/rdoc/test_rdoc_store.rb71
-rw-r--r--test/rdoc/test_rdoc_task.rb19
-rw-r--r--test/rdoc/test_rdoc_text.rb68
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb41
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb68
-rw-r--r--test/rdoc/test_rdoc_top_level.rb14
-rw-r--r--test/rdoc/xref_data.rb77
-rw-r--r--test/rdoc/xref_test_case.rb36
-rw-r--r--test/readline/helper.rb29
-rw-r--r--test/readline/test_readline.rb681
-rw-r--r--test/readline/test_readline_history.rb197
-rw-r--r--test/reline/helper.rb125
-rw-r--r--test/reline/test_config.rb412
-rw-r--r--test/reline/test_history.rb308
-rw-r--r--test/reline/test_key_actor_emacs.rb2354
-rw-r--r--test/reline/test_key_actor_vi.rb1465
-rw-r--r--test/reline/test_key_stroke.rb79
-rw-r--r--test/reline/test_kill_ring.rb268
-rw-r--r--test/reline/test_macro.rb41
-rw-r--r--test/reline/test_reline.rb386
-rw-r--r--test/reline/test_reline_key.rb53
-rw-r--r--test/reline/test_string_processing.rb81
-rw-r--r--test/reline/test_terminfo.rb61
-rw-r--r--test/reline/test_unicode.rb25
-rw-r--r--test/reline/test_within_pipe.rb78
-rw-r--r--test/reline/windows/test_key_event_record.rb41
-rwxr-xr-xtest/reline/yamatanooroti/multiline_repl215
-rw-r--r--test/reline/yamatanooroti/termination_checker.rb30
-rw-r--r--test/reline/yamatanooroti/test_rendering.rb1345
-rw-r--r--test/resolv/test_addr.rb37
-rw-r--r--test/resolv/test_dns.rb259
-rw-r--r--test/resolv/test_mdns.rb27
-rw-r--r--test/resolv/test_resource.rb4
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin50154 -> 0 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin161690 -> 0 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/utf16.xmlbin207464 -> 0 bytes-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/listener.rb51
-rw-r--r--test/rexml/parse/test_document_type_declaration.rb50
-rw-r--r--test/rexml/parse/test_notation_declaration.rb100
-rw-r--r--test/rexml/parser/test_sax2.rb203
-rw-r--r--test/rexml/parser/test_tree.rb43
-rw-r--r--test/rexml/parser/test_ultra_light.rb70
-rw-r--r--test/rexml/rexml_test_utils.rb7
-rw-r--r--test/rexml/test_attributes.rb223
-rw-r--r--test/rexml/test_attributes_mixin.rb32
-rw-r--r--test/rexml/test_changing_encoding.rb45
-rw-r--r--test/rexml/test_comment.rb26
-rw-r--r--test/rexml/test_contrib.rb585
-rw-r--r--test/rexml/test_core.rb1468
-rw-r--r--test/rexml/test_doctype.rb107
-rw-r--r--test/rexml/test_document.rb416
-rw-r--r--test/rexml/test_elements.rb119
-rw-r--r--test/rexml/test_encoding.rb108
-rw-r--r--test/rexml/test_entity.rb206
-rw-r--r--test/rexml/test_functions.rb225
-rw-r--r--test/rexml/test_functions_number.rb35
-rw-r--r--test/rexml/test_jaxen.rb130
-rw-r--r--test/rexml/test_light.rb107
-rw-r--r--test/rexml/test_lightparser.rb16
-rw-r--r--test/rexml/test_listener.rb131
-rw-r--r--test/rexml/test_martin_fowler.rb40
-rw-r--r--test/rexml/test_namespace.rb41
-rw-r--r--test/rexml/test_order.rb110
-rw-r--r--test/rexml/test_preceding_sibling.rb41
-rw-r--r--test/rexml/test_pullparser.rb103
-rw-r--r--test/rexml/test_rexml_issuezilla.rb19
-rw-r--r--test/rexml/test_sax.rb287
-rw-r--r--test/rexml/test_stream.rb130
-rw-r--r--test/rexml/test_text.rb22
-rw-r--r--test/rexml/test_ticket_80.rb59
-rw-r--r--test/rexml/test_validation_rng.rb793
-rw-r--r--test/rexml/test_xml_declaration.rb36
-rw-r--r--test/rexml/xpath/test_attribute.rb30
-rw-r--r--test/rexml/xpath/test_axis_preceding_sibling.rb40
-rw-r--r--test/rexml/xpath/test_base.rb1090
-rw-r--r--test/rexml/xpath/test_node.rb43
-rw-r--r--test/rexml/xpath/test_predicate.rb83
-rw-r--r--test/rexml/xpath/test_text.rb75
-rw-r--r--test/rinda/test_rinda.rb256
-rw-r--r--test/ripper/assert_parse_files.rb32
-rw-r--r--test/ripper/dummyparser.rb73
-rw-r--r--test/ripper/test_files.rb24
-rw-r--r--test/ripper/test_files_ext.rb8
-rw-r--r--test/ripper/test_files_lib.rb14
-rw-r--r--test/ripper/test_files_sample.rb8
-rw-r--r--test/ripper/test_files_test.rb8
-rw-r--r--test/ripper/test_files_test_1.rb9
-rw-r--r--test/ripper/test_files_test_2.rb9
-rw-r--r--test/ripper/test_filter.rb13
-rw-r--r--test/ripper/test_lexer.rb317
-rw-r--r--test/ripper/test_parser_events.rb449
-rw-r--r--test/ripper/test_ripper.rb90
-rw-r--r--test/ripper/test_scanner_events.rb215
-rw-r--r--test/ripper/test_sexp.rb454
-rw-r--r--test/rss/dot.pngbin111 -> 0 bytes-rw-r--r--test/rss/rss-assertions.rb2091
-rw-r--r--test/rss/rss-testcase.rb479
-rw-r--r--test/rss/test_1.0.rb308
-rw-r--r--test/rss/test_2.0.rb412
-rw-r--r--test/rss/test_accessor.rb104
-rw-r--r--test/rss/test_atom.rb684
-rw-r--r--test/rss/test_content.rb105
-rw-r--r--test/rss/test_dublincore.rb270
-rw-r--r--test/rss/test_image.rb215
-rw-r--r--test/rss/test_inherit.rb41
-rw-r--r--test/rss/test_itunes.rb348
-rw-r--r--test/rss/test_maker_0.9.rb475
-rw-r--r--test/rss/test_maker_1.0.rb517
-rw-r--r--test/rss/test_maker_2.0.rb758
-rw-r--r--test/rss/test_maker_atom_entry.rb394
-rw-r--r--test/rss/test_maker_atom_feed.rb455
-rw-r--r--test/rss/test_maker_content.rb48
-rw-r--r--test/rss/test_maker_dc.rb150
-rw-r--r--test/rss/test_maker_image.rb63
-rw-r--r--test/rss/test_maker_itunes.rb470
-rw-r--r--test/rss/test_maker_slash.rb38
-rw-r--r--test/rss/test_maker_sy.rb45
-rw-r--r--test/rss/test_maker_taxo.rb82
-rw-r--r--test/rss/test_maker_trackback.rb42
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb84
-rw-r--r--test/rss/test_parser.rb65
-rw-r--r--test/rss/test_parser_1.0.rb529
-rw-r--r--test/rss/test_parser_2.0.rb123
-rw-r--r--test/rss/test_parser_atom_entry.rb164
-rw-r--r--test/rss/test_parser_atom_feed.rb277
-rw-r--r--test/rss/test_setup_maker_0.9.rb247
-rw-r--r--test/rss/test_setup_maker_1.0.rb551
-rw-r--r--test/rss/test_setup_maker_2.0.rb309
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb410
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb446
-rw-r--r--test/rss/test_setup_maker_itunes.rb144
-rw-r--r--test/rss/test_setup_maker_slash.rb39
-rw-r--r--test/rss/test_slash.rb65
-rw-r--r--test/rss/test_syndication.rb126
-rw-r--r--test/rss/test_taxonomy.rb173
-rw-r--r--test/rss/test_to_s.rb677
-rw-r--r--test/rss/test_trackback.rb136
-rw-r--r--test/rss/test_version.rb10
-rw-r--r--test/rss/test_xml-stylesheet.rb109
-rw-r--r--test/ruby/bug-13526.rb22
-rw-r--r--test/ruby/enc/test_case_comprehensive.rb29
-rw-r--r--test/ruby/enc/test_case_mapping.rb58
-rw-r--r--test/ruby/enc/test_case_options.rb12
-rw-r--r--test/ruby/enc/test_cesu8.rb113
-rw-r--r--test/ruby/enc/test_emoji_breaks.rb155
-rw-r--r--test/ruby/enc/test_grapheme_breaks.rb92
-rw-r--r--test/ruby/enc/test_regex_casefold.rb8
-rw-r--r--test/ruby/enc/test_utf16.rb112
-rw-r--r--test/ruby/enc/test_utf32.rb68
-rw-r--r--test/ruby/lbtest.rb1
-rw-r--r--test/ruby/marshaltestlib.rb4
-rw-r--r--test/ruby/sentence.rb2
-rw-r--r--test/ruby/test_alias.rb75
-rw-r--r--test/ruby/test_argf.rb886
-rw-r--r--test/ruby/test_arithmetic_sequence.rb491
-rw-r--r--test/ruby/test_arity.rb44
-rw-r--r--test/ruby/test_array.rb1179
-rw-r--r--test/ruby/test_assignment.rb216
-rw-r--r--test/ruby/test_ast.rb1063
-rw-r--r--test/ruby/test_autoload.rb353
-rw-r--r--test/ruby/test_backtrace.rb132
-rw-r--r--test/ruby/test_basicinstructions.rb6
-rw-r--r--test/ruby/test_beginendblock.rb54
-rw-r--r--test/ruby/test_bignum.rb131
-rw-r--r--test/ruby/test_call.rb29
-rw-r--r--test/ruby/test_case.rb12
-rw-r--r--test/ruby/test_class.rb277
-rw-r--r--test/ruby/test_clone.rb88
-rw-r--r--test/ruby/test_comparable.rb32
-rw-r--r--test/ruby/test_complex.rb357
-rw-r--r--test/ruby/test_complex2.rb2
-rw-r--r--test/ruby/test_complexrational.rb28
-rw-r--r--test/ruby/test_const.rb43
-rw-r--r--test/ruby/test_continuation.rb26
-rw-r--r--test/ruby/test_data.rb249
-rw-r--r--test/ruby/test_default_gems.rb16
-rw-r--r--test/ruby/test_defined.rb169
-rw-r--r--test/ruby/test_dir.rb400
-rw-r--r--test/ruby/test_dir_m17n.rb93
-rw-r--r--test/ruby/test_dup.rb110
-rw-r--r--test/ruby/test_econv.rb27
-rw-r--r--test/ruby/test_encoding.rb66
-rw-r--r--test/ruby/test_enum.rb446
-rw-r--r--test/ruby/test_enumerator.rb405
-rw-r--r--test/ruby/test_env.rb1042
-rw-r--r--test/ruby/test_eval.rb152
-rw-r--r--test/ruby/test_exception.rb933
-rw-r--r--test/ruby/test_extlibs.rb85
-rw-r--r--test/ruby/test_fiber.rb308
-rw-r--r--test/ruby/test_file.rb160
-rw-r--r--test/ruby/test_file_exhaustive.rb376
-rw-r--r--test/ruby/test_fixnum.rb1
-rw-r--r--test/ruby/test_flip.rb34
-rw-r--r--test/ruby/test_float.rb219
-rw-r--r--test/ruby/test_fnmatch.rb37
-rw-r--r--test/ruby/test_frozen.rb30
-rw-r--r--test/ruby/test_frozen_error.rb57
-rw-r--r--test/ruby/test_gc.rb270
-rw-r--r--test/ruby/test_gc_compact.rb456
-rw-r--r--test/ruby/test_hash.rb967
-rw-r--r--test/ruby/test_ifunless.rb2
-rw-r--r--test/ruby/test_inlinecache.rb110
-rw-r--r--test/ruby/test_insns_leaf.rb46
-rw-r--r--test/ruby/test_integer.rb436
-rw-r--r--test/ruby/test_integer_comb.rb24
-rw-r--r--test/ruby/test_io.rb1089
-rw-r--r--test/ruby/test_io_buffer.rb562
-rw-r--r--test/ruby/test_io_m17n.rb155
-rw-r--r--test/ruby/test_io_timeout.rb58
-rw-r--r--test/ruby/test_iseq.rb586
-rw-r--r--test/ruby/test_iterator.rb34
-rw-r--r--test/ruby/test_key_error.rb42
-rw-r--r--test/ruby/test_keyword.rb3870
-rw-r--r--test/ruby/test_lambda.rb217
-rw-r--r--test/ruby/test_lazy_enumerator.rb166
-rw-r--r--test/ruby/test_literal.rb165
-rw-r--r--test/ruby/test_m17n.rb142
-rw-r--r--test/ruby/test_m17n_comb.rb42
-rw-r--r--test/ruby/test_marshal.rb358
-rw-r--r--test/ruby/test_math.rb55
-rw-r--r--test/ruby/test_memory_view.rb341
-rw-r--r--test/ruby/test_method.rb713
-rw-r--r--test/ruby/test_method_cache.rb76
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb8
-rw-r--r--test/ruby/test_mjit.rb1327
-rw-r--r--test/ruby/test_mjit_debug.rb17
-rw-r--r--test/ruby/test_module.rb1412
-rw-r--r--test/ruby/test_name_error.rb156
-rw-r--r--test/ruby/test_nomethod_error.rb109
-rw-r--r--test/ruby/test_not.rb2
-rw-r--r--test/ruby/test_notimp.rb85
-rw-r--r--test/ruby/test_numeric.rb208
-rw-r--r--test/ruby/test_object.rb233
-rw-r--r--test/ruby/test_objectspace.rb78
-rw-r--r--test/ruby/test_optimization.rb569
-rw-r--r--test/ruby/test_pack.rb153
-rw-r--r--test/ruby/test_parse.rb909
-rw-r--r--test/ruby/test_path.rb8
-rw-r--r--test/ruby/test_pattern_matching.rb1713
-rw-r--r--test/ruby/test_pipe.rb19
-rw-r--r--test/ruby/test_primitive.rb78
-rw-r--r--test/ruby/test_proc.rb643
-rw-r--r--test/ruby/test_process.rb658
-rw-r--r--test/ruby/test_rand.rb391
-rw-r--r--test/ruby/test_random_formatter.rb123
-rw-r--r--test/ruby/test_range.rb593
-rw-r--r--test/ruby/test_rational.rb413
-rw-r--r--test/ruby/test_refinement.rb1206
-rw-r--r--test/ruby/test_regexp.rb746
-rw-r--r--test/ruby/test_require.rb478
-rw-r--r--test/ruby/test_require_lib.rb27
-rw-r--r--test/ruby/test_rubyoptions.rb457
-rw-r--r--test/ruby/test_rubyvm.rb57
-rw-r--r--test/ruby/test_rubyvm_mjit.rb105
-rw-r--r--test/ruby/test_settracefunc.rb1518
-rw-r--r--test/ruby/test_shapes.rb441
-rw-r--r--test/ruby/test_signal.rb124
-rw-r--r--test/ruby/test_sprintf.rb124
-rw-r--r--test/ruby/test_stack.rb82
-rw-r--r--test/ruby/test_string.rb1747
-rw-r--r--test/ruby/test_struct.rb174
-rw-r--r--test/ruby/test_super.rb200
-rw-r--r--test/ruby/test_symbol.rb225
-rw-r--r--test/ruby/test_syntax.rb1297
-rw-r--r--test/ruby/test_system.rb41
-rw-r--r--test/ruby/test_thread.rb608
-rw-r--r--test/ruby/test_thread_cv.rb252
-rw-r--r--test/ruby/test_thread_queue.rb708
-rw-r--r--test/ruby/test_threadgroup.rb1
-rw-r--r--test/ruby/test_time.rb380
-rw-r--r--test/ruby/test_time_tz.rb450
-rw-r--r--test/ruby/test_trace.rb11
-rw-r--r--test/ruby/test_transcode.rb217
-rw-r--r--test/ruby/test_undef.rb18
-rw-r--r--test/ruby/test_unicode_escape.rb19
-rw-r--r--test/ruby/test_variable.rb182
-rw-r--r--test/ruby/test_vm_dump.rb23
-rw-r--r--test/ruby/test_weakmap.rb110
-rw-r--r--test/ruby/test_yield.rb2
-rw-r--r--test/ruby/test_yjit.rb1333
-rw-r--r--test/ruby/test_yjit_exit_locations.rb110
-rw-r--r--test/rubygems/alternate_cert.pem28
-rw-r--r--test/rubygems/alternate_cert_32.pem30
-rw-r--r--test/rubygems/alternate_key.pem50
-rw-r--r--test/rubygems/bad_rake.rb1
-rw-r--r--test/rubygems/bogussources.rb9
-rw-r--r--test/rubygems/bundler_test_gem.rb421
-rw-r--r--test/rubygems/ca_cert.pem139
-rw-r--r--test/rubygems/child_cert.pem31
-rw-r--r--test/rubygems/child_cert_32.pem31
-rw-r--r--test/rubygems/child_key.pem50
-rw-r--r--test/rubygems/client.pem148
-rw-r--r--test/rubygems/data/excon-0.7.7.gemspec.rzbin0 -> 388 bytes-rw-r--r--test/rubygems/data/null-required-ruby-version.gemspec.rzbin0 -> 403 bytes-rw-r--r--test/rubygems/data/null-required-rubygems-version.gemspec.rzbin0 -> 421 bytes-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin554 -> 0 bytes-rw-r--r--test/rubygems/data/pry-0.4.7.gemspec.rzbin0 -> 433 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem52
-rw-r--r--test/rubygems/expired_cert.pem30
-rw-r--r--test/rubygems/fake_certlib/openssl.rb1
-rw-r--r--test/rubygems/fix_openssl_warnings.rb13
-rw-r--r--test/rubygems/future_cert.pem30
-rw-r--r--test/rubygems/future_cert_32.pem30
-rw-r--r--test/rubygems/good_rake.rb1
-rw-r--r--test/rubygems/grandchild_cert.pem31
-rw-r--r--test/rubygems/grandchild_cert_32.pem31
-rw-r--r--test/rubygems/grandchild_key.pem50
-rw-r--r--test/rubygems/helper.rb1643
-rw-r--r--test/rubygems/installer_test_case.rb248
-rw-r--r--test/rubygems/invalid_issuer_cert.pem32
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem32
-rw-r--r--test/rubygems/invalid_key.pem50
-rw-r--r--test/rubygems/invalid_signer_cert.pem30
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem30
-rw-r--r--test/rubygems/invalidchild_cert.pem31
-rw-r--r--test/rubygems/invalidchild_cert_32.pem31
-rw-r--r--test/rubygems/invalidchild_key.pem50
-rw-r--r--test/rubygems/multifactor_auth_utilities.rb111
-rw-r--r--test/rubygems/package/tar_test_case.rb175
-rw-r--r--test/rubygems/packages/Bluebie-legs-0.6.2.gembin0 -> 14336 bytes-rw-r--r--test/rubygems/packages/ascii_binder-0.1.10.1.gembin0 -> 244736 bytes-rw-r--r--test/rubygems/packages/ill-formatted-platform-1.0.0.10.gembin0 -> 10240 bytes-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb1
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb3
-rw-r--r--test/rubygems/private3072_key.pem40
-rw-r--r--test/rubygems/private_ec_key.pem9
-rw-r--r--test/rubygems/private_key.pem50
-rw-r--r--test/rubygems/public3072_cert.pem25
-rw-r--r--test/rubygems/public_cert.pem32
-rw-r--r--test/rubygems/public_cert_32.pem30
-rw-r--r--test/rubygems/public_key.pem14
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb3
-rw-r--r--test/rubygems/rubygems_plugin.rb8
-rw-r--r--test/rubygems/simple_gem.rb1
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec2
-rw-r--r--test/rubygems/specifications/rubyforge-0.0.1.gemspec14
-rw-r--r--test/rubygems/ssl_cert.pem95
-rw-r--r--test/rubygems/ssl_key.pem38
-rw-r--r--test/rubygems/test_bundled_ca.rb92
-rw-r--r--test/rubygems/test_config.rb22
-rw-r--r--test/rubygems/test_deprecate.rb101
-rw-r--r--test/rubygems/test_exit.rb17
-rw-r--r--test/rubygems/test_gem.rb1667
-rw-r--r--test/rubygems/test_gem_available_set.rb50
-rw-r--r--test/rubygems/test_gem_bundler_version_finder.rb127
-rw-r--r--test/rubygems/test_gem_command.rb233
-rw-r--r--test/rubygems/test_gem_command_manager.rb216
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb671
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb415
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb23
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb195
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb119
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb124
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb108
-rw-r--r--test/rubygems/test_gem_commands_exec_command.rb853
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb197
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb48
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb53
-rw-r--r--test/rubygems/test_gem_commands_info_command.rb70
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb864
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb13
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb26
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb8
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb58
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb435
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb419
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb378
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb447
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb8
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb54
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb470
-rw-r--r--test/rubygems/test_gem_commands_signin_command.rb259
-rw-r--r--test/rubygems/test_gem_commands_signout_command.rb30
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb347
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb138
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb16
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb413
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb79
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb536
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb28
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb255
-rw-r--r--test/rubygems/test_gem_config_file.rb226
-rw-r--r--test/rubygems/test_gem_dependency.rb188
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb737
-rw-r--r--test/rubygems/test_gem_dependency_list.rb131
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb14
-rw-r--r--test/rubygems/test_gem_doctor.rb124
-rw-r--r--test/rubygems/test_gem_ext_builder.rb244
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder.rb167
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/.gitignore1
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/custom_name.gemspec10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/Cargo.lock233
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/Cargo.toml10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/ext/custom_name_lib/src/lib.rs27
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/custom_name/lib/custom_name.rb3
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/.gitignore1
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/Cargo.lock247
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/Cargo.toml10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/rust_ruby_example.gemspec10
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder/rust_ruby_example/src/lib.rs51
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder_link_flag_converter.rb34
-rw-r--r--test/rubygems/test_gem_ext_cargo_builder_unit.rb60
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb71
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb57
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb170
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb110
-rw-r--r--test/rubygems/test_gem_gem_runner.rb68
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb281
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb12
-rw-r--r--test/rubygems/test_gem_indexer.rb226
-rw-r--r--test/rubygems/test_gem_install_update_options.rb113
-rw-r--r--test/rubygems/test_gem_installer.rb2071
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb29
-rw-r--r--test/rubygems/test_gem_name_tuple.rb12
-rw-r--r--test/rubygems/test_gem_package.rb788
-rw-r--r--test/rubygems/test_gem_package_old.rb115
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb179
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb65
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb198
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb239
-rw-r--r--test/rubygems/test_gem_package_task.rb84
-rw-r--r--test/rubygems/test_gem_path_support.rb80
-rw-r--r--test/rubygems/test_gem_platform.rb597
-rw-r--r--test/rubygems/test_gem_rdoc.rb175
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb958
-rw-r--r--test/rubygems/test_gem_request.rb352
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb91
-rw-r--r--test/rubygems/test_gem_request_set.rb307
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb557
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb191
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_parser.rb151
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_tokenizer.rb275
-rw-r--r--test/rubygems/test_gem_requirement.rb232
-rw-r--r--test/rubygems/test_gem_resolver.rb366
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb51
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb159
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb106
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb67
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb6
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb32
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb34
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb48
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb46
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb32
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb41
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb15
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb158
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb18
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb34
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb38
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb6
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb22
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb22
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb24
-rw-r--r--test/rubygems/test_gem_security.rb194
-rw-r--r--test/rubygems/test_gem_security_policy.rb258
-rw-r--r--test/rubygems/test_gem_security_signer.rb107
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb32
-rw-r--r--test/rubygems/test_gem_server.rb409
-rw-r--r--test/rubygems/test_gem_silent_ui.rb90
-rw-r--r--test/rubygems/test_gem_source.rb134
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb27
-rw-r--r--test/rubygems/test_gem_source_git.rb157
-rw-r--r--test/rubygems/test_gem_source_installed.rb36
-rw-r--r--test/rubygems/test_gem_source_list.rb11
-rw-r--r--test/rubygems/test_gem_source_local.rb32
-rw-r--r--test/rubygems/test_gem_source_lock.rb66
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb38
-rw-r--r--test/rubygems/test_gem_source_subpath_problem.rb50
-rw-r--r--test/rubygems/test_gem_source_vendor.rb30
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb147
-rw-r--r--test/rubygems/test_gem_specification.rb2468
-rw-r--r--test/rubygems/test_gem_stream_ui.rb124
-rw-r--r--test/rubygems/test_gem_stub_specification.rb143
-rw-r--r--test/rubygems/test_gem_text.rb28
-rw-r--r--test/rubygems/test_gem_uninstaller.rb388
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb10
-rw-r--r--test/rubygems/test_gem_update_suggestion.rb209
-rw-r--r--test/rubygems/test_gem_uri.rb41
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb32
-rw-r--r--test/rubygems/test_gem_util.rb85
-rw-r--r--test/rubygems/test_gem_validator.rb28
-rw-r--r--test/rubygems/test_gem_version.rb157
-rw-r--r--test/rubygems/test_gem_version_option.rb47
-rw-r--r--test/rubygems/test_kernel.rb113
-rw-r--r--test/rubygems/test_project_sanity.rb49
-rw-r--r--test/rubygems/test_remote_fetch_error.rb17
-rw-r--r--test/rubygems/test_require.rb630
-rw-r--r--test/rubygems/test_rubygems.rb76
-rw-r--r--test/rubygems/test_webauthn_listener.rb143
-rw-r--r--test/rubygems/test_webauthn_listener_response.rb93
-rw-r--r--test/rubygems/test_webauthn_poller.rb124
-rw-r--r--test/rubygems/utilities.rb435
-rw-r--r--test/rubygems/wrong_key_cert.pem30
-rw-r--r--test/rubygems/wrong_key_cert_32.pem30
-rw-r--r--test/runner.rb53
-rw-r--r--test/scanf/data.txt6
-rw-r--r--test/scanf/test_scanf.rb304
-rw-r--r--test/scanf/test_scanfblocks.rb82
-rw-r--r--test/scanf/test_scanfio.rb21
-rw-r--r--test/sdbm/test_sdbm.rb542
-rw-r--r--test/shell/test_command_processor.rb69
-rw-r--r--test/socket/test_addrinfo.rb28
-rw-r--r--test/socket/test_basicsocket.rb79
-rw-r--r--test/socket/test_nonblock.rb16
-rw-r--r--test/socket/test_socket.rb95
-rw-r--r--test/socket/test_sockopt.rb2
-rw-r--r--test/socket/test_tcp.rb54
-rw-r--r--test/socket/test_udp.rb15
-rw-r--r--test/socket/test_unix.rb178
-rw-r--r--test/stringio/test_ractor.rb23
-rw-r--r--test/stringio/test_stringio.rb266
-rw-r--r--test/strscan/test_ractor.rb28
-rw-r--r--test/strscan/test_stringscanner.rb415
-rw-r--r--test/syslog/test_syslog_logger.rb15
-rw-r--r--test/test_abbrev.rb2
-rw-r--r--test/test_cmath.rb76
-rw-r--r--test/test_delegate.rb167
-rw-r--r--test/test_extlibs.rb79
-rw-r--r--test/test_find.rb35
-rw-r--r--test/test_forwardable.rb78
-rw-r--r--test/test_getoptlong.rb163
-rw-r--r--test/test_ipaddr.rb215
-rw-r--r--test/test_mathn.rb120
-rw-r--r--test/test_mutex_m.rb33
-rw-r--r--test/test_observer.rb2
-rw-r--r--test/test_open3.rb74
-rw-r--r--test/test_pp.rb49
-rw-r--r--test/test_prime.rb196
-rw-r--r--test/test_pstore.rb57
-rw-r--r--test/test_pty.rb37
-rw-r--r--test/test_securerandom.rb137
-rw-r--r--test/test_set.rb234
-rw-r--r--test/test_shellwords.rb27
-rw-r--r--test/test_sorted_set.rb45
-rw-r--r--test/test_syslog.rb9
-rw-r--r--test/test_tempfile.rb86
-rw-r--r--test/test_time.rb95
-rw-r--r--test/test_timeout.rb66
-rw-r--r--test/test_tmpdir.rb101
-rw-r--r--test/test_tracer.rb56
-rw-r--r--test/test_trick.rb214
-rw-r--r--test/test_unicode_normalize.rb20
-rw-r--r--test/test_weakref.rb2
-rw-r--r--test/test_win32api.rb24
-rw-r--r--test/testunit/test4test_hideskip.rb10
-rw-r--r--test/testunit/test4test_redefinition.rb14
-rw-r--r--test/testunit/test4test_sorting.rb18
-rw-r--r--test/testunit/test_assertion.rb17
-rw-r--r--test/testunit/test_hideskip.rb17
-rw-r--r--test/testunit/test_parallel.rb192
-rw-r--r--test/testunit/test_redefinition.rb16
-rw-r--r--test/testunit/test_sorting.rb18
-rw-r--r--test/testunit/tests_for_parallel/runner.rb14
-rw-r--r--test/thread/test_cv.rb225
-rw-r--r--test/thread/test_queue.rb547
-rw-r--r--test/thread/test_sync.rb64
-rw-r--r--test/uri/test_common.rb122
-rw-r--r--test/uri/test_file.rb67
-rw-r--r--test/uri/test_generic.rb275
-rw-r--r--test/uri/test_http.rb36
-rw-r--r--test/uri/test_ldap.rb10
-rw-r--r--test/uri/test_mailto.rb63
-rw-r--r--test/uri/test_parser.rb56
-rw-r--r--test/uri/test_ws.rb71
-rw-r--r--test/uri/test_wss.rb71
-rw-r--r--test/webrick/test_cgi.rb170
-rw-r--r--test/webrick/test_cookie.rb132
-rw-r--r--test/webrick/test_filehandler.rb324
-rw-r--r--test/webrick/test_httpauth.rb204
-rw-r--r--test/webrick/test_httpproxy.rb290
-rw-r--r--test/webrick/test_httprequest.rb417
-rw-r--r--test/webrick/test_httpresponse.rb160
-rw-r--r--test/webrick/test_httpserver.rb418
-rw-r--r--test/webrick/test_server.rb162
-rw-r--r--test/webrick/test_ssl_server.rb40
-rw-r--r--test/webrick/test_utils.rb110
-rw-r--r--test/webrick/utils.rb72
-rw-r--r--test/win32ole/available_ole.rb41
-rw-r--r--test/win32ole/test_err_in_callback.rb2
-rw-r--r--test/win32ole/test_ole_methods.rb2
-rw-r--r--test/win32ole/test_thread.rb2
-rw-r--r--test/win32ole/test_win32ole.rb58
-rw-r--r--test/win32ole/test_win32ole_event.rb90
-rw-r--r--test/win32ole/test_win32ole_method.rb13
-rw-r--r--test/win32ole/test_win32ole_method_event.rb36
-rw-r--r--test/win32ole/test_win32ole_param.rb53
-rw-r--r--test/win32ole/test_win32ole_param_event.rb30
-rw-r--r--test/win32ole/test_win32ole_record.rb20
-rw-r--r--test/win32ole/test_win32ole_type.rb52
-rw-r--r--test/win32ole/test_win32ole_type_event.rb44
-rw-r--r--test/win32ole/test_win32ole_variable.rb4
-rw-r--r--test/win32ole/test_win32ole_variant.rb2
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb2
-rw-r--r--test/win32ole/test_word.rb11
-rw-r--r--test/yaml/test_store.rb180
-rw-r--r--test/zlib/test_zlib.rb384
-rw-r--r--thread.c4340
-rw-r--r--thread_none.c284
-rw-r--r--thread_none.h20
-rw-r--r--thread_pthread.c2571
-rw-r--r--thread_pthread.h117
-rw-r--r--thread_sync.c1458
-rw-r--r--thread_sync.rb68
-rw-r--r--thread_win32.c626
-rw-r--r--thread_win32.h45
-rw-r--r--time.c4393
-rw-r--r--timev.h38
-rw-r--r--timev.rb404
-rw-r--r--tool/annocheck/Dockerfile4
-rw-r--r--tool/annocheck/Dockerfile-copy7
-rwxr-xr-xtool/bisect.sh59
-rw-r--r--tool/bundler/dev_gems.rb19
-rw-r--r--tool/bundler/dev_gems.rb.lock57
-rw-r--r--tool/bundler/rubocop_gems.rb12
-rw-r--r--tool/bundler/rubocop_gems.rb.lock73
-rw-r--r--tool/bundler/standard_gems.rb12
-rw-r--r--tool/bundler/standard_gems.rb.lock81
-rw-r--r--tool/bundler/test_gems.rb12
-rw-r--r--tool/bundler/test_gems.rb.lock45
-rwxr-xr-xtool/change_maker.rb47
-rwxr-xr-xtool/checksum.rb8
-rw-r--r--tool/ci_functions.sh29
-rw-r--r--tool/colors (renamed from test/colors)0
-rwxr-xr-xtool/darwin-cc6
-rwxr-xr-xtool/disable_ipv6.sh9
-rw-r--r--tool/downloader.rb344
-rwxr-xr-xtool/enc-case-folding.rb416
-rw-r--r--tool/enc-emoji-citrus-gen.rb8
-rwxr-xr-xtool/enc-unicode.rb273
-rw-r--r--tool/eval.rb4
-rwxr-xr-xtool/expand-config.rb16
-rwxr-xr-xtool/extlibs.rb348
-rw-r--r--tool/fake.rb48
-rwxr-xr-xtool/fetch-bundled_gems.rb31
-rwxr-xr-xtool/file2lastrev.rb100
-rwxr-xr-xtool/format-release262
-rwxr-xr-xtool/gem-unpack.rb21
-rwxr-xr-xtool/gen-mailmap.rb47
-rwxr-xr-xtool/gen_ruby_tapset.rb13
-rw-r--r--tool/generic_erb.rb66
-rwxr-xr-xtool/git-refresh46
-rw-r--r--tool/gperf.sed23
-rwxr-xr-xtool/id2token.rb12
-rwxr-xr-xtool/ifchange34
-rwxr-xr-xtool/insns2vm.rb17
-rw-r--r--tool/install-sh6
-rwxr-xr-xtool/instruction.rb1354
-rwxr-xr-xtool/intern_ids.rb35
-rwxr-xr-xtool/leaked-globals65
-rw-r--r--tool/lib/-test-/integer.rb14
-rw-r--r--tool/lib/bundled_gem.rb68
-rw-r--r--tool/lib/colorize.rb55
-rw-r--r--tool/lib/core_assertions.rb821
-rw-r--r--tool/lib/envutil.rb380
-rw-r--r--tool/lib/find_executable.rb22
-rw-r--r--tool/lib/gc_checker.rb36
-rw-r--r--tool/lib/iseq_loader_checker.rb81
-rw-r--r--tool/lib/jisx0208.rb (renamed from tool/jisx0208.rb)0
-rw-r--r--tool/lib/leakchecker.rb321
-rw-r--r--tool/lib/memory_status.rb151
-rw-r--r--tool/lib/output.rb57
-rw-r--r--tool/lib/profile_test_all.rb91
-rw-r--r--tool/lib/test/unit.rb1822
-rw-r--r--tool/lib/test/unit/assertions.rb833
-rw-r--r--tool/lib/test/unit/parallel.rb212
-rw-r--r--tool/lib/test/unit/testcase.rb296
-rw-r--r--tool/lib/tracepointchecker.rb126
-rw-r--r--tool/lib/vcs.rb845
-rw-r--r--tool/lib/vpath.rb92
-rw-r--r--tool/lib/webrick.rb232
-rw-r--r--tool/lib/webrick/.document6
-rw-r--r--tool/lib/webrick/accesslog.rb157
-rw-r--r--tool/lib/webrick/cgi.rb313
-rw-r--r--tool/lib/webrick/compat.rb (renamed from lib/webrick/compat.rb)0
-rw-r--r--tool/lib/webrick/config.rb158
-rw-r--r--tool/lib/webrick/cookie.rb172
-rw-r--r--tool/lib/webrick/htmlutils.rb (renamed from lib/webrick/htmlutils.rb)0
-rw-r--r--tool/lib/webrick/httpauth.rb96
-rw-r--r--tool/lib/webrick/httpauth/authenticator.rb117
-rw-r--r--tool/lib/webrick/httpauth/basicauth.rb116
-rw-r--r--tool/lib/webrick/httpauth/digestauth.rb395
-rw-r--r--tool/lib/webrick/httpauth/htdigest.rb132
-rw-r--r--tool/lib/webrick/httpauth/htgroup.rb97
-rw-r--r--tool/lib/webrick/httpauth/htpasswd.rb158
-rw-r--r--tool/lib/webrick/httpauth/userdb.rb (renamed from lib/webrick/httpauth/userdb.rb)0
-rw-r--r--tool/lib/webrick/httpproxy.rb354
-rw-r--r--tool/lib/webrick/httprequest.rb636
-rw-r--r--tool/lib/webrick/httpresponse.rb564
-rw-r--r--tool/lib/webrick/https.rb152
-rw-r--r--tool/lib/webrick/httpserver.rb293
-rw-r--r--tool/lib/webrick/httpservlet.rb23
-rw-r--r--tool/lib/webrick/httpservlet/abstract.rb152
-rw-r--r--tool/lib/webrick/httpservlet/cgi_runner.rb47
-rw-r--r--tool/lib/webrick/httpservlet/cgihandler.rb126
-rw-r--r--tool/lib/webrick/httpservlet/erbhandler.rb88
-rw-r--r--tool/lib/webrick/httpservlet/filehandler.rb552
-rw-r--r--tool/lib/webrick/httpservlet/prochandler.rb47
-rw-r--r--tool/lib/webrick/httpstatus.rb194
-rw-r--r--tool/lib/webrick/httputils.rb512
-rw-r--r--tool/lib/webrick/httpversion.rb (renamed from lib/webrick/httpversion.rb)0
-rw-r--r--tool/lib/webrick/log.rb156
-rw-r--r--tool/lib/webrick/server.rb381
-rw-r--r--tool/lib/webrick/ssl.rb215
-rw-r--r--tool/lib/webrick/utils.rb265
-rw-r--r--tool/lib/webrick/version.rb18
-rw-r--r--tool/lib/zombie_hunter.rb10
-rwxr-xr-xtool/ln_sr.rb131
-rw-r--r--tool/m4/_colorize_result_prepare.m434
-rw-r--r--tool/m4/ac_msg_result.m45
-rw-r--r--tool/m4/colorize_result.m49
-rw-r--r--tool/m4/ruby_append_option.m45
-rw-r--r--tool/m4/ruby_append_options.m47
-rw-r--r--tool/m4/ruby_check_builtin_func.m410
-rw-r--r--tool/m4/ruby_check_builtin_setjmp.m427
-rw-r--r--tool/m4/ruby_check_printf_prefix.m429
-rw-r--r--tool/m4/ruby_check_setjmp.m417
-rw-r--r--tool/m4/ruby_check_signedness.m45
-rw-r--r--tool/m4/ruby_check_sizeof.m4108
-rw-r--r--tool/m4/ruby_check_sysconf.m413
-rw-r--r--tool/m4/ruby_cppoutfile.m418
-rw-r--r--tool/m4/ruby_decl_attribute.m445
-rw-r--r--tool/m4/ruby_default_arch.m412
-rw-r--r--tool/m4/ruby_define_if.m46
-rw-r--r--tool/m4/ruby_defint.m440
-rw-r--r--tool/m4/ruby_dtrace_available.m420
-rw-r--r--tool/m4/ruby_dtrace_postprocess.m430
-rw-r--r--tool/m4/ruby_func_attribute.m47
-rw-r--r--tool/m4/ruby_mingw32.m424
-rw-r--r--tool/m4/ruby_prepend_option.m45
-rw-r--r--tool/m4/ruby_prog_gnu_ld.m410
-rw-r--r--tool/m4/ruby_prog_makedirs.m49
-rw-r--r--tool/m4/ruby_replace_funcs.m413
-rw-r--r--tool/m4/ruby_replace_type.m468
-rw-r--r--tool/m4/ruby_require_funcs.m413
-rw-r--r--tool/m4/ruby_rm_recursive.m418
-rw-r--r--tool/m4/ruby_setjmp_type.m452
-rw-r--r--tool/m4/ruby_stack_grow_direction.m430
-rw-r--r--tool/m4/ruby_thread.m480
-rw-r--r--tool/m4/ruby_try_cflags.m419
-rw-r--r--tool/m4/ruby_try_cxxflags.m417
-rw-r--r--tool/m4/ruby_try_ldflags.m415
-rw-r--r--tool/m4/ruby_type_attribute.m48
-rw-r--r--tool/m4/ruby_universal_arch.m4122
-rw-r--r--tool/m4/ruby_wasm_tools.m424
-rw-r--r--tool/m4/ruby_werror_flag.m418
-rwxr-xr-xtool/make-snapshot487
-rw-r--r--tool/make_hgraph.rb7
-rwxr-xr-xtool/mdoc2man.rb52
-rwxr-xr-xtool/merger.rb405
-rwxr-xr-xtool/mjit/bindgen.rb435
-rw-r--r--tool/mjit_archflag.sh40
-rw-r--r--tool/mjit_tabs.rb67
-rw-r--r--tool/mk_builtin_loader.rb411
-rw-r--r--tool/mk_call_iseq_optimized.rb72
-rwxr-xr-xtool/mkconfig.rb142
-rwxr-xr-xtool/mkrunnable.rb28
-rwxr-xr-xtool/node_name.rb8
-rwxr-xr-xtool/outdate-bundled-gems.rb135
-rw-r--r--tool/prereq.status44
-rwxr-xr-xtool/rbinstall.rb729
-rw-r--r--tool/rbs_skip_tests11
-rwxr-xr-xtool/rbuninstall.rb18
-rwxr-xr-xtool/redmine-backporter.rb239
-rwxr-xr-xtool/release.sh47
-rwxr-xr-xtool/releng/gen-mail.rb55
-rwxr-xr-xtool/releng/gen-release-note.rb36
-rwxr-xr-xtool/releng/update-www-meta.rb213
-rw-r--r--tool/ruby_vm/controllers/application_controller.rb26
-rw-r--r--tool/ruby_vm/helpers/c_escape.rb128
-rw-r--r--tool/ruby_vm/helpers/dumper.rb114
-rw-r--r--tool/ruby_vm/helpers/scanner.rb53
-rw-r--r--tool/ruby_vm/loaders/insns_def.rb100
-rw-r--r--tool/ruby_vm/loaders/opt_insn_unif_def.rb34
-rw-r--r--tool/ruby_vm/loaders/opt_operand_def.rb56
-rw-r--r--tool/ruby_vm/loaders/vm_opts_h.rb37
-rw-r--r--tool/ruby_vm/models/attribute.rb59
-rwxr-xr-xtool/ruby_vm/models/bare_instructions.rb240
-rw-r--r--tool/ruby_vm/models/c_expr.rb41
-rw-r--r--tool/ruby_vm/models/instructions.rb22
-rw-r--r--tool/ruby_vm/models/instructions_unifications.rb43
-rw-r--r--tool/ruby_vm/models/operands_unifications.rb142
-rw-r--r--tool/ruby_vm/models/trace_instructions.rb71
-rw-r--r--tool/ruby_vm/models/typemap.rb63
-rw-r--r--tool/ruby_vm/scripts/converter.rb29
-rw-r--r--tool/ruby_vm/scripts/insns2vm.rb101
-rw-r--r--tool/ruby_vm/tests/.gitkeep0
-rw-r--r--tool/ruby_vm/views/_attributes.erb35
-rw-r--r--tool/ruby_vm/views/_c_expr.erb17
-rw-r--r--tool/ruby_vm/views/_comptime_insn_stack_increase.erb62
-rw-r--r--tool/ruby_vm/views/_copyright.erb31
-rw-r--r--tool/ruby_vm/views/_insn_entry.erb76
-rw-r--r--tool/ruby_vm/views/_insn_len_info.erb28
-rw-r--r--tool/ruby_vm/views/_insn_name_info.erb44
-rw-r--r--tool/ruby_vm/views/_insn_operand_info.erb53
-rw-r--r--tool/ruby_vm/views/_insn_sp_pc_dependency.erb27
-rw-r--r--tool/ruby_vm/views/_insn_type_chars.erb32
-rw-r--r--tool/ruby_vm/views/_leaf_helpers.erb54
-rw-r--r--tool/ruby_vm/views/_notice.erb22
-rw-r--r--tool/ruby_vm/views/_sp_inc_helpers.erb37
-rw-r--r--tool/ruby_vm/views/_trace_instruction.erb21
-rw-r--r--tool/ruby_vm/views/insns.inc.erb26
-rw-r--r--tool/ruby_vm/views/insns_info.inc.erb22
-rw-r--r--tool/ruby_vm/views/lib/ruby_vm/mjit/instruction.rb.erb40
-rw-r--r--tool/ruby_vm/views/mjit_sp_inc.inc.erb17
-rw-r--r--tool/ruby_vm/views/opt_sc.inc.erb40
-rw-r--r--tool/ruby_vm/views/optinsn.inc.erb71
-rw-r--r--tool/ruby_vm/views/optunifs.inc.erb21
-rw-r--r--tool/ruby_vm/views/vm.inc.erb30
-rw-r--r--tool/ruby_vm/views/vmtc.inc.erb21
-rw-r--r--tool/run-gcov.rb54
-rw-r--r--tool/run-lcov.rb164
-rwxr-xr-xtool/runruby.rb117
-rw-r--r--tool/search-cgvars.rb55
-rwxr-xr-xtool/strip-rdoc.rb30
-rwxr-xr-xtool/sync_default_gems.rb753
-rwxr-xr-xtool/test-annocheck.sh33
-rw-r--r--tool/test-bundled-gems.rb109
-rw-r--r--tool/test-coverage.rb118
-rw-r--r--tool/test/runner.rb23
-rw-r--r--tool/test/test_jisx0208.rb2
-rwxr-xr-xtool/test/test_sync_default_gems.rb76
-rw-r--r--tool/test/testunit/metametameta.rb70
-rw-r--r--tool/test/testunit/test4test_hideskip.rb14
-rw-r--r--tool/test/testunit/test4test_redefinition.rb14
-rw-r--r--tool/test/testunit/test4test_sorting.rb18
-rw-r--r--tool/test/testunit/test_assertion.rb53
-rw-r--r--tool/test/testunit/test_hideskip.rb21
-rw-r--r--tool/test/testunit/test_minitest_unit.rb1488
-rw-r--r--tool/test/testunit/test_parallel.rb219
-rw-r--r--tool/test/testunit/test_redefinition.rb11
-rw-r--r--tool/test/testunit/test_sorting.rb75
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_first.rb (renamed from test/testunit/tests_for_parallel/ptest_first.rb)0
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_forth.rb (renamed from test/testunit/tests_for_parallel/ptest_forth.rb)0
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_second.rb (renamed from test/testunit/tests_for_parallel/ptest_second.rb)0
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_third.rb (renamed from test/testunit/tests_for_parallel/ptest_third.rb)0
-rw-r--r--tool/test/testunit/tests_for_parallel/runner.rb14
-rw-r--r--tool/test/testunit/tests_for_parallel/test4test_hungup.rb15
-rw-r--r--tool/test/webrick/.htaccess (renamed from test/webrick/.htaccess)0
-rw-r--r--tool/test/webrick/test_cgi.rb170
-rw-r--r--tool/test/webrick/test_config.rb17
-rw-r--r--tool/test/webrick/test_cookie.rb141
-rw-r--r--tool/test/webrick/test_do_not_reverse_lookup.rb (renamed from test/webrick/test_do_not_reverse_lookup.rb)0
-rw-r--r--tool/test/webrick/test_filehandler.rb403
-rw-r--r--tool/test/webrick/test_htgroup.rb19
-rw-r--r--tool/test/webrick/test_htmlutils.rb (renamed from test/webrick/test_htmlutils.rb)0
-rw-r--r--tool/test/webrick/test_httpauth.rb366
-rw-r--r--tool/test/webrick/test_httpproxy.rb467
-rw-r--r--tool/test/webrick/test_httprequest.rb488
-rw-r--r--tool/test/webrick/test_httpresponse.rb282
-rw-r--r--tool/test/webrick/test_https.rb112
-rw-r--r--tool/test/webrick/test_httpserver.rb543
-rw-r--r--tool/test/webrick/test_httpstatus.rb35
-rw-r--r--tool/test/webrick/test_httputils.rb (renamed from test/webrick/test_httputils.rb)0
-rw-r--r--tool/test/webrick/test_httpversion.rb (renamed from test/webrick/test_httpversion.rb)0
-rw-r--r--tool/test/webrick/test_server.rb191
-rw-r--r--tool/test/webrick/test_ssl_server.rb67
-rw-r--r--tool/test/webrick/test_utils.rb110
-rw-r--r--tool/test/webrick/utils.rb84
-rw-r--r--tool/test/webrick/webrick.cgi (renamed from test/webrick/webrick.cgi)0
-rw-r--r--tool/test/webrick/webrick.rhtml4
-rw-r--r--tool/test/webrick/webrick_long_filename.cgi (renamed from test/webrick/webrick_long_filename.cgi)0
-rw-r--r--tool/transcode-tblgen.rb56
-rw-r--r--tool/transform_mjit_header.rb319
-rwxr-xr-xtool/travis_retry.sh13
-rwxr-xr-xtool/travis_wait.sh18
-rw-r--r--tool/update-NEWS-refs.rb37
-rwxr-xr-xtool/update-bundled_gems.rb23
-rwxr-xr-xtool/update-deps56
-rw-r--r--tool/vcs.rb359
-rw-r--r--tool/vpath.rb87
-rwxr-xr-xtool/wasm-clangw9
-rwxr-xr-xtool/ytab.sed64
-rw-r--r--trace_point.rb420
-rw-r--r--transcode.c884
-rw-r--r--transcode_data.h37
-rw-r--r--transient_heap.c991
-rw-r--r--transient_heap.h65
-rw-r--r--util.c3674
-rw-r--r--variable.c3874
-rw-r--r--variable.h29
-rw-r--r--version.c102
-rw-r--r--version.h72
-rw-r--r--vm.c3848
-rw-r--r--vm_args.c1085
-rw-r--r--vm_backtrace.c1283
-rw-r--r--vm_callinfo.h550
-rw-r--r--vm_core.h1621
-rw-r--r--vm_debug.h99
-rw-r--r--vm_dump.c1395
-rw-r--r--vm_eval.c2357
-rw-r--r--vm_exec.c105
-rw-r--r--vm_exec.h95
-rw-r--r--vm_insnhelper.c6745
-rw-r--r--vm_insnhelper.h225
-rw-r--r--vm_method.c2629
-rw-r--r--vm_opts.h36
-rw-r--r--vm_sync.c301
-rw-r--r--vm_sync.h137
-rw-r--r--vm_trace.c1730
-rw-r--r--vsnprintf.c44
-rw-r--r--warning.rb53
-rw-r--r--wasm/GNUmakefile.in32
-rw-r--r--wasm/README.md70
-rw-r--r--wasm/asyncify.h23
-rw-r--r--wasm/fiber.c83
-rw-r--r--wasm/fiber.h43
-rw-r--r--wasm/machine.c62
-rw-r--r--wasm/machine.h25
-rw-r--r--wasm/machine_core.S25
-rw-r--r--wasm/missing.c199
-rw-r--r--wasm/runtime.c47
-rw-r--r--wasm/setjmp.c204
-rw-r--r--wasm/setjmp.h95
-rw-r--r--wasm/setjmp_core.S27
-rw-r--r--wasm/tests/fiber_test.c66
-rw-r--r--wasm/tests/machine_test.c115
-rw-r--r--wasm/tests/setjmp_test.c108
-rwxr-xr-xwasm/wasm-opt36
-rw-r--r--win32/.document1
-rw-r--r--win32/Makefile.sub459
-rw-r--r--win32/README.win32100
-rwxr-xr-xwin32/configure.bat78
-rw-r--r--win32/dir.h10
-rw-r--r--win32/file.c723
-rw-r--r--win32/file.h39
-rwxr-xr-xwin32/ifchange.bat44
-rwxr-xr-xwin32/mkexports.rb28
-rwxr-xr-xwin32/resource.rb4
-rwxr-xr-xwin32/rm.bat2
-rwxr-xr-x[-rw-r--r--]win32/rtname.cmd0
-rw-r--r--win32/ruby.manifest8
-rw-r--r--win32/setup.mak206
-rw-r--r--win32/win32.c6794
-rw-r--r--win32/winmain.c4
-rw-r--r--yjit.c1109
-rw-r--r--yjit.h70
-rw-r--r--yjit.rb356
-rw-r--r--yjit/.gitignore2
-rw-r--r--yjit/Cargo.lock49
-rw-r--r--yjit/Cargo.toml47
-rw-r--r--yjit/bindgen/Cargo.lock311
-rw-r--r--yjit/bindgen/Cargo.toml10
-rw-r--r--yjit/bindgen/src/main.rs430
-rw-r--r--yjit/not_gmake.mk14
-rw-r--r--yjit/src/asm/arm64/README.md16
-rw-r--r--yjit/src/asm/arm64/arg/bitmask_imm.rs255
-rw-r--r--yjit/src/asm/arm64/arg/condition.rs52
-rw-r--r--yjit/src/asm/arm64/arg/inst_offset.rs47
-rw-r--r--yjit/src/asm/arm64/arg/mod.rs18
-rw-r--r--yjit/src/asm/arm64/arg/sf.rs19
-rw-r--r--yjit/src/asm/arm64/arg/shifted_imm.rs81
-rw-r--r--yjit/src/asm/arm64/arg/sys_reg.rs6
-rw-r--r--yjit/src/asm/arm64/arg/truncate.rs66
-rw-r--r--yjit/src/asm/arm64/inst/atomic.rs86
-rw-r--r--yjit/src/asm/arm64/inst/branch.rs100
-rw-r--r--yjit/src/asm/arm64/inst/branch_cond.rs78
-rw-r--r--yjit/src/asm/arm64/inst/breakpoint.rs55
-rw-r--r--yjit/src/asm/arm64/inst/call.rs104
-rw-r--r--yjit/src/asm/arm64/inst/conditional.rs73
-rw-r--r--yjit/src/asm/arm64/inst/data_imm.rs143
-rw-r--r--yjit/src/asm/arm64/inst/data_reg.rs192
-rw-r--r--yjit/src/asm/arm64/inst/halfword_imm.rs179
-rw-r--r--yjit/src/asm/arm64/inst/load_literal.rs89
-rw-r--r--yjit/src/asm/arm64/inst/load_register.rs108
-rw-r--r--yjit/src/asm/arm64/inst/load_store.rs249
-rw-r--r--yjit/src/asm/arm64/inst/load_store_exclusive.rs109
-rw-r--r--yjit/src/asm/arm64/inst/logical_imm.rs154
-rw-r--r--yjit/src/asm/arm64/inst/logical_reg.rs207
-rw-r--r--yjit/src/asm/arm64/inst/mod.rs50
-rw-r--r--yjit/src/asm/arm64/inst/mov.rs155
-rw-r--r--yjit/src/asm/arm64/inst/nop.rs44
-rw-r--r--yjit/src/asm/arm64/inst/pc_rel.rs107
-rw-r--r--yjit/src/asm/arm64/inst/reg_pair.rs212
-rw-r--r--yjit/src/asm/arm64/inst/sbfm.rs103
-rw-r--r--yjit/src/asm/arm64/inst/shift_imm.rs147
-rw-r--r--yjit/src/asm/arm64/inst/sys_reg.rs86
-rw-r--r--yjit/src/asm/arm64/inst/test_bit.rs133
-rw-r--r--yjit/src/asm/arm64/mod.rs1580
-rw-r--r--yjit/src/asm/arm64/opnd.rs195
-rw-r--r--yjit/src/asm/mod.rs792
-rw-r--r--yjit/src/asm/x86_64/mod.rs1415
-rw-r--r--yjit/src/asm/x86_64/tests.rs449
-rw-r--r--yjit/src/backend/arm64/mod.rs1491
-rw-r--r--yjit/src/backend/ir.rs1576
-rw-r--r--yjit/src/backend/mod.rs8
-rw-r--r--yjit/src/backend/tests.rs331
-rw-r--r--yjit/src/backend/x86_64/mod.rs895
-rw-r--r--yjit/src/codegen.rs7721
-rw-r--r--yjit/src/core.rs2400
-rw-r--r--yjit/src/cruby.rs715
-rw-r--r--yjit/src/cruby_bindings.inc.rs1310
-rw-r--r--yjit/src/disasm.rs269
-rw-r--r--yjit/src/invariants.rs567
-rw-r--r--yjit/src/lib.rs18
-rw-r--r--yjit/src/options.rs174
-rw-r--r--yjit/src/stats.rs640
-rw-r--r--yjit/src/utils.rs274
-rw-r--r--yjit/src/virtualmem.rs443
-rw-r--r--yjit/src/yjit.rs136
-rw-r--r--yjit/yjit.mk69
10214 files changed, 1534259 insertions, 380033 deletions
diff --git a/.appveyor.yml b/.appveyor.yml
new file mode 100644
index 0000000000..05ff204541
--- /dev/null
+++ b/.appveyor.yml
@@ -0,0 +1,134 @@
+---
+version: '{build}'
+init:
+ - git config --global user.name git
+ - git config --global user.email svn-admin@ruby-lang.org
+ - git config --global core.autocrlf false
+ - git config --global core.eol lf
+ - git config --global advice.detachedHead 0
+shallow_clone: true
+clone_depth: 10
+platform:
+ - x64
+skip_commits:
+ message: /\[DOC\]/
+ files:
+ - doc/*
+ - '**/*.md'
+ - '**/*.rdoc'
+ - '**/.document'
+ - '**/*.[1-8]'
+ - '**/*.ronn'
+environment:
+ ruby_version: "24-%Platform%"
+ matrix:
+ # Test only the oldest supported version because AppVeyor is unstable, its concurrency
+ # is limited, and compatibility issues that happen only in newer versions are rare.
+ # You may test some other stuff on GitHub Actions instead.
+ - build: vs
+ vs: 120 # Visual Studio 2013
+ ssl: OpenSSL-v111
+ # The worker image name. This is NOT the Visual Studio version we're using here.
+ APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
+ GEMS_FOR_TEST: ""
+ RELINE_TEST_ENCODING: "UTF-8"
+cache:
+ - c:\Tools\vcpkg\installed\
+for:
+-
+ matrix:
+ only:
+ - build: vs
+ install:
+ - ver
+ - chcp
+ - SET BITS=%Platform:x86=32%
+ - SET BITS=%BITS:x=%
+ - SET OPENSSL_DIR=C:\%ssl%-Win%BITS%
+ - cd C:\Tools\vcpkg
+ - git pull -q
+ - .\bootstrap-vcpkg.bat
+ - ps: Start-FileDownload 'https://github.com/microsoft/vcpkg-tool/releases/download/2023-08-09/vcpkg.exe' -FileName 'C:\Tools\vcpkg\vcpkg.exe'
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - vcpkg --triplet %Platform%-windows install --x-use-aria2 libffi libyaml readline zlib
+ - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
+ - SET vcvars
+ - '"%vcvars%" %Platform:x64=amd64%'
+ - SET ruby_path=C:\Ruby%ruby_version:-x86=%
+ - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
+ - ruby --version
+ - 'cl'
+ - echo> Makefile srcdir=.
+ - echo>> Makefile MSC_VER=0
+ - echo>> Makefile RT=none
+ - echo>> Makefile RT_VER=0
+ - echo>> Makefile BUILTIN_ENCOBJS=nul
+ - type win32\Makefile.sub >> Makefile
+ - nmake %mflags% up VCSUP="echo Update OK"
+ - nmake %mflags% extract-extlibs
+ - del Makefile
+ - mkdir \usr\local\bin
+ - mkdir \usr\local\include
+ - mkdir \usr\local\lib
+ - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
+ - for %%I in (c:\Tools\vcpkg\installed\%Platform%-windows\bin\*.dll) do (
+ if not %%~nI == readline mklink \usr\local\bin\%%~nxI %%I
+ )
+ - attrib +r /s /d
+ - mkdir %Platform%-mswin_%vs%
+ build_script:
+ - set HAVE_GIT=no
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - cd %Platform%-mswin_%vs%
+ - >-
+ ..\win32\configure.bat
+ --with-opt-dir="/usr/local;c:/Tools/vcpkg/installed/%Platform%-windows"
+ --with-openssl-dir=%OPENSSL_DIR:\=/%
+ - nmake -l
+ - nmake install-nodoc
+ - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
+ - if not "%GEMS_FOR_TEST%" == "" \usr\bin\gem install --no-document %GEMS_FOR_TEST%
+ - \usr\bin\ruby -ropenssl -e "puts 'Build ' + OpenSSL::OPENSSL_VERSION, 'Runtime ' + OpenSSL::OPENSSL_LIBRARY_VERSION"
+ test_script:
+ - set /a JOBS=%NUMBER_OF_PROCESSORS%
+ - nmake -l "TESTOPTS=-v -q" btest
+ - nmake -l "TESTOPTS=-v -q" test-basic
+ - >-
+ nmake -l "TESTOPTS=--timeout-scale=3.0
+ --excludes=../test/excludes/_appveyor -j%JOBS%
+ --exclude win32ole
+ --exclude test_bignum
+ --exclude test_syntax
+ --exclude test_open-uri
+ --exclude test_bundled_ca
+ " test-all
+ # separately execute tests without -j which may crash worker with -j.
+ - >-
+ nmake -l
+ "TESTOPTS=--timeout-scale=3.0 --excludes=../test/excludes/_appveyor"
+ TESTS="
+ ../test/win32ole
+ ../test/ruby/test_bignum.rb
+ ../test/ruby/test_syntax.rb
+ ../test/open-uri/test_open-uri.rb
+ ../test/rubygems/test_bundled_ca.rb
+ " test-all
+ - nmake -l test-spec MSPECOPT=-fs # not using `-j` because sometimes `mspec -j` silently dies on Windows
+notifications:
+ - provider: Webhook
+ method: POST
+ url:
+ secure: CcFlJNDJ/a6to7u3Z4Fnz6dScEPNx7hTha2GkSRlV+1U6dqmxY/7uBcLXYb9gR3jfQk6w+2o/HrjNAyXMNGU/JOka3s2WRI4VKitzM+lQ08owvJIh0R7LxrGH0J2e81U # ruby-lang slack: ruby/simpler-alerts-bot
+ body: >-
+ {{^isPullRequest}}
+ {
+ "ci": "AppVeyor CI",
+ "env": "Visual Studio 2013",
+ "url": "{{buildUrl}}",
+ "commit": "{{commitId}}",
+ "branch": "{{branch}}"
+ }
+ {{/isPullRequest}}
+ on_build_success: false
+ on_build_failure: true
+ on_build_status_changed: false
diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei. All rights reserved.
+;;
+;; This file is a part of the programming language Ruby. Permission is hereby
+;; granted, to either redistribute and/or modify this file, provided that the
+;; conditions mentioned in the file COPYING are met. Consult the file for
+;; details.
+
+((nil .
+ ((indent-tabs-mode . nil)
+ (require-final-newline . t)
+ (tab-width . 8)
+ (show-trailing-whitespace . t)
+ (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+ ((buffer-file-coding-system . us-ascii)
+ (indent-tabs-mode . t)
+ (change-log-indent-text . 2)
+ (add-log-time-format . (lambda (&optional x y)
+ (let* ((time (or x (current-time)))
+ (system-time-locale "C")
+ (diff (+ (cadr time) 32400))
+ (lo (% diff 65536))
+ (hi (+ (car time) (/ diff 65536))))
+ (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index fb27ba325d..3a6b0c238c 100644
--- a/.document
+++ b/.document
@@ -5,9 +5,31 @@
# Process all the C source files
*.c
+*.y
# prelude
prelude.rb
+rbconfig.rb
+
+array.rb
+ast.rb
+dir.rb
+gc.rb
+io.rb
+kernel.rb
+marshal.rb
+mjit.rb
+numeric.rb
+nilclass.rb
+pack.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
+trace_point.rb
+warning.rb
+yjit.rb
# the lib/ directory (which has its own .document file)
lib
@@ -16,11 +38,17 @@ lib
ext
# rdoc files
-ChangeLog
-
-NEWS
+NEWS.md
README.md
README.ja.md
+COPYING
+COPYING.ja
+
+LEGAL
+
+# win32/README.win32 linked from README.md
+win32
+
doc
diff --git a/.editorconfig b/.editorconfig
index 67abf4b978..4633a7acae 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -2,15 +2,29 @@ root = true
[*]
end_of_line = lf
+indent_size = 4
+indent_style = space
insert_final_newline = true
-trim_trailing_whitespace = true
tab_width = 8
-indent_style = tab
-indent_size = 4
+trim_trailing_whitespace = true
-[**.bat]
+[*.bat]
end_of_line = crlf
-[**.rb]
-indent_style = space
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
indent_size = 2
diff --git a/.gdbinit b/.gdbinit
index d31ccaa7df..34d044caf6 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,3 +1,5 @@
+set startup-with-shell off
+
define hook-run
set $color_type = 0
set $color_highlite = 0
@@ -63,7 +65,15 @@ define rp
else
if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
printf "%sT_OBJECT%s: ", $color_type, $color_end
- print (struct RObject *)($arg0)
+ print ((struct RObject *)($arg0))->basic
+ if ($flags & ROBJECT_EMBED)
+ print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
+ else
+ print (((struct RObject *)($arg0))->as.heap)
+ if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+ print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+ end
+ end
else
if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
@@ -89,14 +99,15 @@ define rp
set $regsrc = ((struct RRegexp*)($arg0))->src
set $rsflags = ((struct RBasic*)$regsrc)->flags
printf "%sT_REGEXP%s: ", $color_type, $color_end
+ set $len = ($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.len : \
+ (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
set print address off
- output (char *)(($rsflags & RUBY_FL_USER1) ? \
+ output *(char *)(($rsflags & RUBY_FL_USER1) ? \
((struct RString*)$regsrc)->as.heap.ptr : \
- ((struct RString*)$regsrc)->as.ary)
+ ((struct RString*)$regsrc)->as.ary) @ $len
set print address on
- printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.len : \
- (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ printf " len:%ld ", $len
if $flags & RUBY_FL_USER6
printf "(none) "
end
@@ -117,7 +128,7 @@ define rp
if ($len == 0)
printf "{(empty)} "
else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
printf " "
end
else
@@ -125,7 +136,7 @@ define rp
printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
if ($flags & RUBY_FL_USER2)
printf "(shared) shared="
- output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+ output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
printf " "
else
printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
@@ -133,7 +144,7 @@ define rp
if ($len == 0)
printf "{(empty)} "
else
- output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
printf " "
end
end
@@ -145,34 +156,27 @@ define rp
else
if ($flags & RUBY_T_MASK) == RUBY_T_HASH
printf "%sT_HASH%s: ", $color_type, $color_end,
- if ((struct RHash *)($arg0))->ntbl
- printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+ if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+ printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
+ else
+ printf "li len=%ld bound=%ld ", \
+ ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+ ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
end
print (struct RHash *)($arg0)
else
if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
- printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
- (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
((struct RStruct *)($arg0))->as.heap.len)
+ printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
print (struct RStruct *)($arg0)
- x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ((struct RStruct *)($arg0))->as.ary : \
- ((struct RStruct *)($arg0))->as.heap.ptr)
+ output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ((struct RStruct *)($arg0))->as.ary : \
+ ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
else
if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
- printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
- (($flags & RUBY_FL_USER1) != 0), \
- (($flags & RUBY_FL_USER2) ? \
- ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
- ((struct RBignum*)($arg0))->as.heap.len)
- if $flags & RUBY_FL_USER2
- printf "(embed) "
- end
- print (struct RBignum *)($arg0)
- x/xw (($flags & RUBY_FL_USER2) ? \
- ((struct RBignum*)($arg0))->as.ary : \
- ((struct RBignum*)($arg0))->as.heap.digits)
+ rp_bignum $arg0
else
if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
printf "%sT_RATIONAL%s: ", $color_type, $color_end
@@ -247,7 +251,7 @@ define rp
else
if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
printf "%sT_IMEMO%s(", $color_type, $color_end
- output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
+ output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
printf "): "
rp_imemo $arg0
else
@@ -261,6 +265,10 @@ define rp
printf "%sT_ZOMBIE%s: ", $color_type, $color_end
print (struct RData *)($arg0)
else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+ printf "%sT_MOVED%s: ", $color_type, $color_end
+ print *(struct RMoved *)$arg0
+ else
printf "%sunknown%s: ", $color_type, $color_end
print (struct RBasic *)($arg0)
end
@@ -296,6 +304,7 @@ define rp
end
end
end
+ end
end
document rp
Print a Ruby's VALUE.
@@ -327,6 +336,9 @@ define rp_id
if $id == idLTLT
printf "(:<<)\n"
else
+ if $id == idGTGT
+ printf "(:>>)\n"
+ else
if $id == idLE
printf "(:<=)\n"
else
@@ -354,6 +366,18 @@ define rp_id
if $id == idASET
printf "(:[]=)\n"
else
+ if $id == idCOLON2
+ printf "(:'::')\n"
+ else
+ if $id == idANDOP
+ printf "(:&&)\n"
+ else
+ if $id == idOROP
+ printf "(:||)\n"
+ else
+ if $id == idANDDOT
+ printf "(:&.)\n"
+ else
if $id <= tLAST_OP_ID
printf "O"
else
@@ -385,12 +409,13 @@ define rp_id
end
end
printf "(%ld): ", $id
- set $str = lookup_id_str($id)
- if $str
- rp_string $str
- else
- echo undef\n
- end
+ print_id $id
+ echo \n
+ end
+ end
+ end
+ end
+ end
end
end
end
@@ -415,21 +440,33 @@ end
define output_string
set $flags = ((struct RBasic*)($arg0))->flags
- printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+ set $len = ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ output *(char *)(($flags & RUBY_FL_USER1) ? \
((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary)
+ ((struct RString*)($arg0))->as.ary) @ $len
+ else
+ output ""
+ end
end
-define rp_string
+define print_string
set $flags = ((struct RBasic*)($arg0))->flags
- set print address off
- output (char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary)
- set print address on
- printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+ set $len = ($flags & RUBY_FL_USER1) ? \
((struct RString*)($arg0))->as.heap.len : \
(($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary) @ $len
+ end
+end
+
+define rp_string
+ output_string $arg0
+ printf " bytesize:%ld ", $len
if !($flags & RUBY_FL_USER1)
printf "(embed) "
else
@@ -460,22 +497,67 @@ document rp_string
Print the content of a String.
end
+define rp_bignum
+ set $flags = ((struct RBignum*)($arg0))->basic.flags
+ set $len = (($flags & RUBY_FL_USER2) ? \
+ ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+ ((struct RBignum*)($arg0))->as.heap.len)
+ printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+ (($flags & RUBY_FL_USER1) != 0), $len
+ if $flags & RUBY_FL_USER2
+ printf "(embed) "
+ end
+ print (struct RBignum *)($arg0)
+ set $ptr = (($flags & RUBY_FL_USER2) ? \
+ ((struct RBignum*)($arg0))->as.ary : \
+ ((struct RBignum*)($arg0))->as.heap.digits)
+ set $len = $len-1
+ printf "0x%x", $ptr[$len]
+ while $len > 0
+ set $len = $len-1
+ set $val = $ptr[$len]
+ set $w = sizeof($ptr[0])
+ printf "_"
+ if $w > 8
+ printf "%.32x", $val
+ else
+ if $w > 4
+ printf "%.16x", $val
+ else
+ if $w > 2
+ printf "%.8x", $val
+ else
+ if $w > 1
+ printf "%.4x", $val
+ else
+ printf "%.2x", $val
+ end
+ end
+ end
+ end
+ end
+ printf "\n"
+end
+document rp_bignum
+ Print the content of a Bignum.
+end
+
define rp_class
printf "(struct RClass *) %p", (void*)$arg0
- if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
- printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+ if RCLASS_ORIGIN((struct RClass *)($arg0)) != $arg0
+ printf " -> %p", RCLASS_ORIGIN((struct RClass *)($arg0))
end
printf "\n"
rb_classname $arg0
- print *(struct RClass *)($arg0)
- print *((struct RClass *)($arg0))->ptr
+ print/x *(struct RClass *)($arg0)
+ print *RCLASS_EXT((struct RClass *)($arg0))
end
document rp_class
Print the content of a Class/Module.
end
define rp_imemo
- set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask)
+ set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
if $flags == imemo_cref
printf "(rb_cref_t *) %p\n", (void*)$arg0
print *(rb_cref_t *)$arg0
@@ -627,12 +709,6 @@ define nd_cval
rp ($arg0).u3.value
end
-
-define nd_cnt
- printf "%su3.cnt%s: ", $color_highlite, $color_end
- p ($arg0).u3.cnt
-end
-
define nd_tbl
printf "%su1.tbl%s: ", $color_highlite, $color_end
p ($arg0).u1.tbl
@@ -671,12 +747,6 @@ define nd_lit
rp ($arg0).u1.value
end
-
-define nd_frml
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
define nd_rest
printf "%su2.argc%s: ", $color_highlite, $color_end
p ($arg0).u2.argc
@@ -703,12 +773,6 @@ define nd_args
rp ($arg0).u3.node
end
-
-define nd_noex
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
define nd_defn
printf "%su3.node%s: ", $color_highlite, $color_end
rp ($arg0).u3.node
@@ -726,17 +790,6 @@ define nd_new
end
-define nd_cfnc
- printf "%su1.cfunc%s: ", $color_highlite, $color_end
- p ($arg0).u1.cfunc
-end
-
-define nd_argc
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-
define nd_cname
printf "%su1.id%s: ", $color_highlite, $color_end
p ($arg0).u1.id
@@ -798,7 +851,7 @@ end
define nd_tree
set $buf = (struct RString *)rb_str_buf_new(0)
- call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
+ call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
printf "%s\n", $buf->as.heap.ptr
end
@@ -869,8 +922,7 @@ end
define rb_classname
# up to 128bit int
- set $rb_classname_permanent = "0123456789ABCDEF"
- set $rb_classname = classname($arg0, $rb_classname_permanent)
+ set $rb_classname = rb_mod_name($arg0)
if $rb_classname != RUBY_Qnil
rp $rb_classname
else
@@ -919,7 +971,7 @@ define iseq
end
define rb_ps
- rb_ps_vm ruby_current_vm
+ rb_ps_vm ruby_current_vm_ptr
end
document rb_ps
Dump all threads and their callstacks
@@ -927,8 +979,8 @@ end
define rb_ps_vm
print $ps_vm = (rb_vm_t*)$arg0
- set $ps_thread_ln = $ps_vm->living_threads.n.next
- set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
+ set $ps_thread_ln = $ps_vm->ractor.main_ractor.threads.set.n.next
+ set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
while 1
set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
set $ps_thread = (VALUE)($ps_thread_th->self)
@@ -951,45 +1003,74 @@ define print_lineno
set $pos = $pos - 1
end
- set $i = 0
- set $size = $iseq->body->line_info_size
- set $table = $iseq->body->line_info_table
+ set $index = 0
+ set $size = $iseq->body->insns_info.size
+ set $table = $iseq->body->insns_info.body
+ set $positions = $iseq->body->insns_info.positions
#printf "size: %d\n", $size
if $size == 0
else
- set $i = 1
- while $i < $size
- #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $table[$i].position, $table[$i].line_no, $pos
- if $table[$i].position > $pos
- loop_break
+ if $size == 1
+ printf "%d", $table[0].line_no
+ else
+ if $positions
+ # get_insn_info_linear_search
+ set $index = 1
+ while $index < $size
+ #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+ if $positions[$index] > $pos
+ loop_break
+ end
+ set $index = $index + 1
+ if $positions[$index] == $pos
+ loop_break
+ end
end
- set $i = $i + 1
- if $table[$i].position == $pos
- loop_break
+ else
+ # get_insn_info_succinct_bitvector
+ set $sd = $iseq->body->insns_info.succ_index_table
+ set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+ if $pos < $immediate_table_size
+ set $i = $pos / 9
+ set $j = $pos % 9
+ set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+ else
+ set $block_index = ($pos - $immediate_table_size) / 512
+ set $block = &$sd->succ_part[$block_index]
+ set $block_bit_index = ($pos - $immediate_table_size) % 512
+ set $small_block_index = $block_bit_index / 64
+ set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+ set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+ set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+ set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+ set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+ set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+ set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+ set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+ set $index = $block->rank + $small_block_popcount + $popcnt
end
end
- printf "%d", $table[$i-1].line_no
+ printf "%d", $table[$index-1].line_no
+ end
end
end
define check_method_entry
- # get $immeo and $can_be_svar and return $me
set $imemo = (struct RBasic *)$arg0
- set $can_be_svar = $arg1
if $imemo != RUBY_Qfalse
set $type = ($imemo->flags >> 12) & 0x07
if $type == imemo_ment
set $me = (rb_callable_method_entry_t *)$imemo
else
if $type == imemo_svar
- set $imemo == ((struct vm_svar *)$imemo)->cref_or_me
- check_method_entry $imemo 0
+ set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+ check_method_entry $imemo
end
end
end
end
-define output_id
+define print_id
set $id = $arg0
# rb_id_to_serial
if $id > tLAST_OP_ID
@@ -997,9 +1078,9 @@ define output_id
else
set $serial = (rb_id_serial_t)$id
end
- if $serial && $serial <= global_symbols.last_id
+ if $serial && $serial <= ruby_global_symbols.last_id
set $idx = $serial / ID_ENTRY_UNIT
- set $ids = (struct RArray *)global_symbols.ids
+ set $ids = (struct RArray *)ruby_global_symbols.ids
set $flags = $ids->basic.flags
if ($flags & RUBY_FL_USER1)
set $idsptr = $ids->as.ary
@@ -1021,31 +1102,59 @@ define output_id
set $arylen = $ary->as.heap.len
end
set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
- output_string $result
+ if $result != RUBY_Qnil
+ print_string $result
+ else
+ echo undef
+ end
end
end
end
end
+define print_pathobj
+ set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+ print_string $arg0
+ end
+ if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+ if $flags & RUBY_FL_USER1
+ set $str = ((struct RArray*)($arg0))->as.ary[0]
+ else
+ set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+ end
+ print_string $str
+ end
+end
+
define rb_ps_thread
set $ps_thread = (struct RTypedData*)$arg0
set $ps_thread_th = (rb_thread_t*)$ps_thread->data
printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
$ps_thread, $ps_thread_th, $ps_thread_th->thread_id
- set $cfp = $ps_thread_th->cfp
- set $cfpend = (rb_control_frame_t *)($ps_thread_th->stack + $ps_thread_th->stack_size)-1
+ set $cfp = $ps_thread_th->ec->cfp
+ set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
while $cfp < $cfpend
if $cfp->iseq
+ if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+ printf "%d:ifunc ", $cfpend-$cfp
+ set print symbol-filename on
+ output/a $cfp->iseq.body
+ set print symbol-filename off
+ printf "\n"
+ else
if $cfp->pc
set $location = $cfp->iseq->body->location
- output_string $location.path
+ printf "%d:", $cfpend-$cfp
+ print_pathobj $location.pathobj
printf ":"
print_lineno $cfp
printf ":in `"
- output_string $location.label
+ print_string $location.label
printf "'\n"
else
- printf "???.rb:???:in `???'\n"
+ printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+ end
end
else
# if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
@@ -1057,7 +1166,7 @@ define rb_ps_thread
set $env_specval = $ep[-1]
set $env_me_cref = $ep[-2]
while ($env_specval & 0x02) != 0
- check_method_entry $env_me_cref 0
+ check_method_entry $env_me_cref
if $me != 0
loop_break
end
@@ -1066,17 +1175,18 @@ define rb_ps_thread
set $env_me_cref = $ep[-2]
end
if $me == 0
- check_method_entry $env_me_cref 1
+ check_method_entry $env_me_cref
end
+ printf "%d:", $cfpend-$cfp
set print symbol-filename on
output/a $me->def->body.cfunc.func
set print symbol-filename off
set $mid = $me->def->original_id
printf ":in `"
- output_id $mid
+ print_id $mid
printf "'\n"
else
- printf "unknown_frame:???:in `???'\n"
+ printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
end
end
set $cfp = $cfp + 1
@@ -1084,7 +1194,7 @@ define rb_ps_thread
end
define rb_count_objects
- set $objspace = ruby_current_vm->objspace
+ set $objspace = ruby_current_vm_ptr->objspace
set $counts_00 = 0
set $counts_01 = 0
set $counts_02 = 0
@@ -1169,7 +1279,7 @@ document rb_count_objects
Counts all objects grouped by type.
end
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+# Details: https://bugs.ruby-lang.org/projects/ruby-master/wiki/MachineInstructionsTraceWithGDB
define trace_machine_instructions
set logging on
set height 0
@@ -1208,3 +1318,33 @@ define dump_node
((struct RString*)$str)->as.heap.ptr : \
((struct RString*)$str)->as.ary)
end
+
+define print_flags
+ printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+ printf "RUBY_FL_PROMOTED0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
+ printf "RUBY_FL_PROMOTED1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
+ printf "RUBY_FL_FINALIZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+ printf "RUBY_FL_SHAREABLE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
+ printf "RUBY_FL_EXIVAR : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+ printf "RUBY_FL_FREEZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+ printf "RUBY_FL_USER0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+ printf "RUBY_FL_USER1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+ printf "RUBY_FL_USER2 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+ printf "RUBY_FL_USER3 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+ printf "RUBY_FL_USER4 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+ printf "RUBY_FL_USER5 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+ printf "RUBY_FL_USER6 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+ printf "RUBY_FL_USER7 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+ printf "RUBY_FL_USER8 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+ printf "RUBY_FL_USER9 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+ printf "RUBY_FL_USER10 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+ printf "RUBY_FL_USER11 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+ printf "RUBY_FL_USER12 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+ printf "RUBY_FL_USER13 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+ printf "RUBY_FL_USER14 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+ printf "RUBY_FL_USER15 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+ printf "RUBY_FL_USER16 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+ printf "RUBY_FL_USER17 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+ printf "RUBY_FL_USER18 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..6c5eac5a0f
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,23 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
diff --git a/.gitattributes b/.gitattributes
index d9785fad00..d0c2d266b4 100644
--- a/.gitattributes
+++ b/.gitattributes
@@ -1,5 +1,8 @@
*.gemspec diff=ruby
*.rb diff=ruby
+bin svn-properties=svn:ignore=ruby
bin/* diff=ruby
tool/update-deps diff=ruby
tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/codeql/codeql-config.yml b/.github/codeql/codeql-config.yml
new file mode 100644
index 0000000000..91f82b842b
--- /dev/null
+++ b/.github/codeql/codeql-config.yml
@@ -0,0 +1,3 @@
+name: "CodeQL config for the Ruby language"
+
+languages: cpp
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..bc63aca35b
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,6 @@
+version: 2
+updates:
+ - package-ecosystem: 'github-actions'
+ directory: '/'
+ schedule:
+ interval: 'monthly'
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..ebaafe3bf0
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,80 @@
+name: BASERUBY Check
+
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ baseruby:
+ name: BASERUBY
+ runs-on: ubuntu-22.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ strategy:
+ matrix:
+ ruby:
+ - ruby-2.2
+# - ruby-2.3
+# - ruby-2.4
+# - ruby-2.5
+# - ruby-2.6
+# - ruby-2.7
+ - ruby-3.0
+ - ruby-3.1
+
+ steps:
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache
+ - uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+ with:
+ ruby-version: ${{ matrix.ruby }}
+ bundler: none
+ - run: echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: sudo apt-get install build-essential autoconf bison libyaml-dev
+ - run: ./autogen.sh
+ - run: ./configure --disable-install-doc
+ - run: make common-srcs
+ - run: make incs
+ - run: make all
+ - run: make test
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / BASERUBY @ ${{ matrix.ruby }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
new file mode 100644
index 0000000000..070c0fa1dd
--- /dev/null
+++ b/.github/workflows/bundled_gems.yml
@@ -0,0 +1,166 @@
+name: bundled_gems
+
+on:
+ push:
+ branches: [ "master" ]
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ pull_request:
+ branches: [ "master" ]
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ merge_group:
+ branches: [ "master" ]
+ paths:
+ - '.github/workflows/bundled_gems.yml'
+ - 'gems/bundled_gems'
+ schedule:
+ - cron: '45 6 * * *'
+ workflow_dispatch:
+
+permissions: # added using https://github.com/step-security/secure-workflows
+ contents: read
+
+jobs:
+ update:
+ permissions:
+ contents: write # for Git to git push
+ if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+ name: update ${{ github.workflow }}
+ runs-on: ubuntu-latest
+ steps:
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache-${{ github.sha }}
+ restore-keys: |
+ downloaded-cache
+
+ - name: Download previous gems list
+ run: |
+ data=bundled_gems.json
+ mkdir -p .downloaded-cache
+ ln -s .downloaded-cache/$data .
+ curl -O -R -z ./$data https://stdgems.org/$data
+
+ - name: Update bundled gems list
+ run: |
+ ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems
+
+ - name: Maintain updated gems list in NEWS
+ run: |
+ #!ruby
+ require 'json'
+ news = File.read("NEWS.md")
+ prev = news[/since the \*+(\d+\.\d+\.\d+)\*+/, 1]
+ prevs = [prev, prev.sub(/\.\d+\z/, '')]
+ %W[bundled].each do |type|
+ last = JSON.parse(File.read("#{type}_gems.json"))['gems'].filter_map do |g|
+ v = g['versions'].values_at(*prevs).compact.first
+ g = g['gem']
+ g = 'RubyGems' if g == 'rubygems'
+ [g, v] if v
+ end.to_h
+ changed = File.foreach("gems/#{type}_gems").filter_map do |l|
+ next if l.start_with?("#")
+ g, v = l.split(" ", 3)
+ [g, v] unless last[g] == v
+ end
+ changed, added = changed.partition {|g, _| last[g]}
+ news.sub!(/^\*( +)The following #{type} gems? are updated\.\n+\K(?: \1\*( +).*\n)*/) do
+ mark = "#{$1} *#{$2}"
+ changed.map {|g, v|"#{mark}#{g} #{v}\n"}.join("")
+ end or next
+ news.sub!(/^\*( +)The following default gems are now bundled gems\.\n+\K(?: \1\*( +).*\n)*/) do
+ mark = "#{$1} *#{$2}"
+ added.map {|g, v|"#{mark}#{g} #{v}\n"}.join("")
+ end or next unless added.empty?
+ File.write("NEWS.md", news)
+ end
+ shell: ruby {0}
+
+ - name: Check diffs
+ id: diff
+ run: |
+ git add -- NEWS.md
+ git diff --no-ext-diff --ignore-submodules --quiet -- gems/bundled_gems
+ continue-on-error: true
+
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Build
+ run: |
+ ./autogen.sh
+ ./configure -C --disable-install-doc
+ make
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Prepare bundled gems
+ run: |
+ make -s prepare-gems
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Test bundled gems
+ run: |
+ make -s test-bundled-gems
+ git add -- gems/bundled_gems
+ timeout-minutes: 30
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ if: ${{ steps.diff.outcome == 'failure' }}
+
+ - name: Show diffs
+ id: show
+ run: |
+ git diff --cached --color --no-ext-diff --ignore-submodules --exit-code --
+ continue-on-error: true
+
+ - name: Commit
+ run: |
+ git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+ message="Update bundled gems list at "
+ if [ ${{ steps.diff.outcome }} = success ]; then
+ git commit --message="${message}${GITHUB_SHA:0:30} [ci skip]"
+ else
+ git commit --message="${message}${TODAY}"
+ fi
+ git push origin ${GITHUB_REF#refs/heads/}
+ env:
+ EMAIL: svn-admin@ruby-lang.org
+ GIT_AUTHOR_NAME: git
+ GIT_COMMITTER_NAME: git
+ if: ${{ github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull') && steps.show.outcome == 'failure' }}
+
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / update",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..79b2916feb
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,78 @@
+name: Check Dependencies
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ update-deps:
+ strategy:
+ matrix:
+ os: [ubuntu-22.04]
+ fail-fast: true
+ runs-on: ${{ matrix.os }}
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ if: ${{ contains(matrix.os, 'ubuntu') }}
+ - name: Install libraries
+ run: |
+ brew install gmp libffi openssl@1.1 zlib autoconf automake libtool readline
+ if: ${{ contains(matrix.os, 'macos') }}
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache
+ - run: ./autogen.sh
+ - name: Run configure
+ run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+ - run: make all golf
+ - run: ruby tool/update-deps --fix
+ - run: git diff --no-ext-diff --ignore-submodules --exit-code
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / Dependencies need to update",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
new file mode 100644
index 0000000000..8dba76fbe2
--- /dev/null
+++ b/.github/workflows/codeql-analysis.yml
@@ -0,0 +1,75 @@
+name: "Code scanning - action"
+
+on:
+ # push:
+ # paths-ignore:
+ # - 'doc/**'
+ # - '**/man'
+ # - '**.md'
+ # - '**.rdoc'
+ # - '**/.document'
+ # pull_request:
+ # paths-ignore:
+ # - 'doc/**'
+ # - '**/man'
+ # - '**.md'
+ # - '**.rdoc'
+ # - '**/.document'
+ schedule:
+ - cron: '0 12 * * *'
+ workflow_dispatch:
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+ contents: read
+
+jobs:
+ CodeQL-Build:
+
+ # CodeQL runs on ubuntu-latest and windows-latest
+ permissions:
+ actions: read # for github/codeql-action/init to get workflow details
+ contents: read # for actions/checkout to fetch code
+ security-events: write # for github/codeql-action/autobuild to send a status report
+ runs-on: ubuntu-latest
+ # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') && github.event.head_commit.pusher.name != 'dependabot[bot]' }}
+
+ env:
+ enable_install_doc: no
+
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+
+ - name: Checkout repository
+ uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: .downloaded-cache
+ key: downloaded-cache
+
+ - name: Remove an obsolete rubygems vendored file
+ run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
+
+ - name: Initialize CodeQL
+ uses: github/codeql-action/init@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
+ with:
+ config-file: ./.github/codeql/codeql-config.yml
+ trap-caching: false
+
+ - name: Set ENV
+ run: echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+
+ - name: Autobuild
+ uses: github/codeql-action/autobuild@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
+
+ - name: Perform CodeQL Analysis
+ uses: github/codeql-action/analyze@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.37
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..caf12cc0f4
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,281 @@
+name: Compilations
+
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+# GitHub actions does not support YAML anchors. This creative use of
+# environment variables (plus the "echo $GITHUB_ENV" hack) is to reroute that
+# restriction.
+env:
+ default_cc: clang-15
+ append_cc: ''
+
+ # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+ # to optimize binaries. Also GitHub Actions run on relatively modern CPUs
+ # compared to, say, GCC 4 or Clang 3. We don't specify `-march=native`
+ # because compilers tend not understand what the CPU is.
+ optflags: '-O1'
+
+ # -g0 disables backtraces when SEGV. Do not set that.
+ debugflags: '-ggdb3'
+
+ default_configure: >-
+ --enable-debug-env
+ --disable-install-doc
+ --with-ext=-test-/cxxanyargs,+
+ append_configure: >-
+ --without-valgrind
+ --without-jemalloc
+ --without-gmp
+
+ UPDATE_UNICODE: >-
+ UNICODE_FILES=.
+ UNICODE_PROPERTY_FILES=.
+ UNICODE_AUXILIARY_FILES=.
+ UNICODE_EMOJI_FILES=.
+ CONFIGURE_TTY: never
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUBY_DEBUG: ci rgengc
+ RUBY_TESTOPTS: >-
+ -q
+ --color=always
+ --tty=no
+
+permissions:
+ contents: read
+
+jobs:
+ compile:
+ strategy:
+ fail-fast: false
+ matrix:
+ env:
+ - {}
+ entry:
+ - { name: gcc-12, env: { default_cc: gcc-12 } }
+ - { name: gcc-11, env: { default_cc: gcc-11 } }
+ - { name: gcc-10, env: { default_cc: gcc-10 } }
+ - { name: gcc-9, env: { default_cc: gcc-9 } }
+ - { name: gcc-8, env: { default_cc: gcc-8 } }
+ - { name: gcc-7, env: { default_cc: gcc-7 } }
+ - name: 'gcc-13 LTO'
+ container: gcc-13
+ env:
+ default_cc: 'gcc-13 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
+ optflags: '-O2'
+ shared: disable
+ # check: true
+ - { name: clang-16, env: { default_cc: clang-16 } }
+ - { name: clang-15, env: { default_cc: clang-15 } }
+ - { name: clang-14, env: { default_cc: clang-14 } }
+ - { name: clang-13, env: { default_cc: clang-13 } }
+ - { name: clang-12, env: { default_cc: clang-12 } }
+ - { name: clang-11, env: { default_cc: clang-11 } }
+ - { name: clang-10, env: { default_cc: clang-10 } }
+ # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o.
+ - { name: clang-9, env: { default_cc: clang-9, append_configure: '--disable-yjit' } }
+ - { name: clang-8, env: { default_cc: clang-8, append_configure: '--disable-yjit' } }
+ - { name: clang-7, env: { default_cc: clang-7, append_configure: '--disable-yjit' } }
+ - { name: clang-6.0, env: { default_cc: clang-6.0, append_configure: '--disable-yjit' } }
+ - name: 'clang-16 LTO'
+ container: clang-16
+ env:
+ default_cc: 'clang-16 -flto=auto'
+ optflags: '-O2'
+ shared: disable
+ # check: true
+
+# - { name: aarch64-linux-gnu, crosshost: aarch64-linux-gnu, container: crossbuild-essential-arm64 }
+# - { name: arm-linux-gnueabi, crosshost: arm-linux-gnueabi }
+# - { name: arm-linux-gnueabihf, crosshost: arm-linux-gnueabihf }
+# - { name: i686-w64-mingw32, crosshost: i686-w64-mingw32 }
+# - { name: powerpc-linux-gnu, crosshost: powerpc-linux-gnu }
+# - { name: powerpc64le-linux-gnu, crosshost: powerpc64le-linux-gnu, container: crossbuild-essential-ppc64el }
+# - { name: s390x-linux-gnu, crosshost: s390x-linux-gnu, container: crossbuild-essential-s390x }
+# - { name: x86_64-w64-mingw32, crosshost: x86_64-w64-mingw32, container: mingw-w64 }
+
+ # -Wno-strict-prototypes is necessary with current clang-15 since
+ # older autoconf generate functions without prototype and -pedantic
+ # now implies strict-prototypes. Disabling the error but leaving the
+ # warning generates a lot of noise from use of ANYARGS in
+ # rb_define_method() and friends.
+ # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
+ - { name: c99, env: { append_cc: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+# - { name: c11, env: { append_cc: '-std=c11 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+# - { name: c17, env: { append_cc: '-std=c17 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+ - { name: c2x, env: { append_cc: '-std=c2x -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
+ - { name: c++98, env: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+# - { name: c++11, env: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+# - { name: c++14, env: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+# - { name: c++17, env: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+ - { name: c++2a, env: { CXXFLAGS: '-std=c++2a -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
+
+ - { name: '-O0', env: { optflags: '-O0 -march=x86-64 -mtune=generic' } }
+# - { name: '-O3', env: { optflags: '-O3 -march=x86-64 -mtune=generic' }, check: true }
+
+ - { name: gmp, env: { append_configure: '--with-gmp' } }
+ - { name: jemalloc, env: { append_configure: '--with-jemalloc' } }
+ - { name: valgrind, env: { append_configure: '--with-valgrind' } }
+ - { name: 'coroutine=ucontext', env: { append_configure: '--with-coroutine=ucontext' } }
+ - { name: 'coroutine=pthread', env: { append_configure: '--with-coroutine=pthread' } }
+ - { name: disable-jit-support, env: { append_configure: '--disable-jit-support' } }
+ - { name: disable-dln, env: { append_configure: '--disable-dln' } }
+ - { name: enable-mkmf-verbose, env: { append_configure: '--enable-mkmf-verbose' } }
+ - { name: disable-rubygems, env: { append_configure: '--disable-rubygems' } }
+ - { name: RUBY_DEVEL, env: { append_configure: '--enable-devel' } }
+
+ - { name: OPT_THREADED_CODE=1, env: { cppflags: '-DOPT_THREADED_CODE=1' } }
+ - { name: OPT_THREADED_CODE=2, env: { cppflags: '-DOPT_THREADED_CODE=2' } }
+ - { name: OPT_THREADED_CODE=3, env: { cppflags: '-DOPT_THREADED_CODE=3' } }
+
+ - { name: NDEBUG, env: { cppflags: '-DNDEBUG' } }
+ - { name: RUBY_DEBUG, env: { cppflags: '-DRUBY_DEBUG' } }
+# - { name: ARRAY_DEBUG, env: { cppflags: '-DARRAY_DEBUG' } }
+# - { name: BIGNUM_DEBUG, env: { cppflags: '-DBIGNUM_DEBUG' } }
+# - { name: CCAN_LIST_DEBUG, env: { cppflags: '-DCCAN_LIST_DEBUG' } }
+# - { name: CPDEBUG=-1, env: { cppflags: '-DCPDEBUG=-1' } }
+# - { name: ENC_DEBUG, env: { cppflags: '-DENC_DEBUG' } }
+# - { name: GC_DEBUG, env: { cppflags: '-DGC_DEBUG' } }
+# - { name: HASH_DEBUG, env: { cppflags: '-DHASH_DEBUG' } }
+# - { name: ID_TABLE_DEBUG, env: { cppflags: '-DID_TABLE_DEBUG' } }
+# - { name: RGENGC_DEBUG=-1, env: { cppflags: '-DRGENGC_DEBUG=-1' } }
+# - { name: SYMBOL_DEBUG, env: { cppflags: '-DSYMBOL_DEBUG' } }
+
+# - { name: RGENGC_CHECK_MODE, env: { cppflags: '-DRGENGC_CHECK_MODE' } }
+# - { name: TRANSIENT_HEAP_CHECK_MODE, env: { cppflags: '-DTRANSIENT_HEAP_CHECK_MODE' } }
+# - { name: VM_CHECK_MODE, env: { cppflags: '-DVM_CHECK_MODE' } }
+
+ - { name: USE_EMBED_CI=0, env: { cppflags: '-DUSE_EMBED_CI=0' } }
+ - name: USE_FLONUM=0,
+ env:
+ cppflags: '-DUSE_FLONUM=0'
+ # yjit requires FLONUM for the pointer tagging scheme
+ append_configure: '--disable-yjit'
+# - { name: USE_GC_MALLOC_OBJ_INFO_DETAILS, env: { cppflags: '-DUSE_GC_MALLOC_OBJ_INFO_DETAILS' } }
+ - { name: USE_LAZY_LOAD, env: { cppflags: '-DUSE_LAZY_LOAD' } }
+# - { name: USE_RINCGC=0, env: { cppflags: '-DUSE_RINCGC=0' } }
+# - { name: USE_SYMBOL_GC=0, env: { cppflags: '-DUSE_SYMBOL_GC=0' } }
+# - { name: USE_THREAD_CACHE=0, env: { cppflags: '-DUSE_THREAD_CACHE=0' } }
+# - { name: USE_TRANSIENT_HEAP=0, env: { cppflags: '-DUSE_TRANSIENT_HEAP=0' } }
+# - { name: USE_RUBY_DEBUG_LOG=1, env: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' } }
+ - { name: USE_RVARGC=0, env: { cppflags: '-DUSE_RVARGC=0' } }
+# - { name: USE_RVARGC=1, env: { cppflags: '-DUSE_RVARGC=1' } }
+# - { name: USE_DEBUG_COUNTER, env: { cppflags: '-DUSE_DEBUG_COUNTER=1', RUBY_DEBUG_COUNTER_DISABLE: '1' } }
+
+ - { name: DEBUG_FIND_TIME_NUMGUESS, env: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' } }
+ - { name: DEBUG_INTEGER_PACK, env: { cppflags: '-DDEBUG_INTEGER_PACK' } }
+# - { name: ENABLE_PATH_CHECK, env: { cppflags: '-DENABLE_PATH_CHECK' } }
+
+ - { name: GC_DEBUG_STRESS_TO_CLASS, env: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' } }
+# - { name: GC_ENABLE_LAZY_SWEEP=0, env: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' } }
+# - { name: GC_PROFILE_DETAIL_MEMOTY, env: { cppflags: '-DGC_PROFILE_DETAIL_MEMOTY' } }
+# - { name: GC_PROFILE_MORE_DETAIL, env: { cppflags: '-DGC_PROFILE_MORE_DETAIL' } }
+
+# - { name: CALC_EXACT_MALLOC_SIZE, env: { cppflags: '-DCALC_EXACT_MALLOC_SIZE' } }
+# - { name: MALLOC_ALLOCATED_SIZE_CHECK, env: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' } }
+
+# - { name: IBF_ISEQ_ENABLE_LOCAL_BUFFER, env: { cppflags: '-DIBF_ISEQ_ENABLE_LOCAL_BUFFER' } }
+
+# - { name: RGENGC_ESTIMATE_OLDMALLOC, env: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' } }
+# - { name: RGENGC_FORCE_MAJOR_GC, env: { cppflags: '-DRGENGC_FORCE_MAJOR_GC' } }
+# - { name: RGENGC_OBJ_INFO, env: { cppflags: '-DRGENGC_OBJ_INFO' } }
+# - { name: RGENGC_OLD_NEWOBJ_CHECK, env: { cppflags: '-DRGENGC_OLD_NEWOBJ_CHECK' } }
+# - { name: RGENGC_PROFILE, env: { cppflags: '-DRGENGC_PROFILE' } }
+
+# - { name: VM_DEBUG_BP_CHECK, env: { cppflags: '-DVM_DEBUG_BP_CHECK' } }
+# - { name: VM_DEBUG_VERIFY_METHOD_CACHE, env: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' } }
+
+ - { name: MJIT_FORCE_ENABLE, env: { cppflags: '-DMJIT_FORCE_ENABLE' } }
+ - { name: YJIT_FORCE_ENABLE, env: { cppflags: '-DYJIT_FORCE_ENABLE' } }
+
+ name: ${{ matrix.entry.name }}
+ runs-on: ubuntu-latest
+ container:
+ image: ghcr.io/ruby/ruby-ci-image:${{ matrix.entry.container || matrix.entry.env.default_cc || 'clang-15' }}
+ options: --user root
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ env: ${{ matrix.entry.env || matrix.env }}
+ steps:
+ - run: id
+ working-directory:
+ - run: mkdir build
+ working-directory:
+ - name: setenv
+ run: |
+ echo "GNUMAKEFLAGS=-sj$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: >
+ ../src/configure -C ${default_configure} ${append_configure}
+ --${{
+ matrix.entry.crosshost && 'host' || 'with-gcc'
+ }}=${{
+ matrix.entry.crosshost || '"${default_cc}${append_cc:+ $append_cc}"'
+ }}
+ --${{ matrix.entry.shared || 'enable' }}-shared
+ - run: make extract-extlibs
+ - run: make incs
+ - run: make showflags
+ - run: make
+ - run: make leaked-globals
+ - run: make test
+ - run: make install
+ if: ${{ matrix.entry.check }}
+ - run: make test-tool
+ if: ${{ matrix.entry.check }}
+ - run: make test-all TESTS='-- ruby -ext-'
+ if: ${{ matrix.entry.check }}
+ - run: make test-spec
+ env:
+ CHECK_LEAKS: true
+ if: ${{ matrix.entry.check }}
+ - run: make test-annocheck
+ if: ${{ matrix.entry.check && endsWith(matrix.entry.name, 'annocheck') }}
+
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.entry.name }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..d8dc58b119
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,113 @@
+name: macOS
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: ["check"] # "test-bundler-parallel", "test-bundled-gems"
+ os:
+ - macos-13
+ - macos-14
+ - macos-15
+ fail-fast: false
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ runs-on: ${{ matrix.os }}
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Install libraries
+ run: |
+ brew install gmp libffi openssl@1.1 zlib autoconf automake libtool readline bison
+ working-directory: src
+ - name: Set ENV
+ run: |
+ echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+ echo "PATH="/usr/local/opt/bison/bin:/opt/homebrew/opt/bison/bin:$PATH"" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc --with-openssl-dir=$(brew --prefix openssl@1.1) --with-readline-dir=$(brew --prefix readline)
+ - run: make incs
+ - run: make prepare-gems
+ if: ${{ matrix.test_task == 'test-bundled-gems' }}
+ - run: make
+ - run: make leaked-globals
+ if: ${{ matrix.test_task == 'check' }}
+ - name: make ${{ matrix.test_task }}
+ run: |
+ make -s ${{ matrix.test_task }} ${TESTS:+TESTS=`echo "$TESTS" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|'`}
+ timeout-minutes: 40
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TESTS: ${{ matrix.test_task == 'check' && matrix.skipped_tests || '' }}
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ PRECHECK_BUNDLED_GEMS: "no"
+ - name: make skipped tests
+ run: |
+ make -s test-all TESTS=`echo "$TESTS" | sed 's| |$$/ -n/|g;s|^|-n/|;s|$|$$/|'`
+ env:
+ GNUMAKEFLAGS: ""
+ RUBY_TESTOPTS: "-v --tty=no"
+ TESTS: ${{ matrix.skipped_tests }}
+ PRECHECK_BUNDLED_GEMS: "no"
+ if: ${{ matrix.test_task == 'check' && matrix.skipped_tests != '' }}
+ continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / ${{ matrix.test_task }}${{ matrix.configure }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..0df917d3d8
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,179 @@
+name: MinGW
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+ make:
+ runs-on: windows-2022
+ name: ${{ github.workflow }} (${{ matrix.msystem }})
+ env:
+ MSYSTEM: ${{ matrix.msystem }}
+ MSYS2_ARCH: x86_64
+ CHOST: "x86_64-w64-mingw32"
+ CFLAGS: "-march=x86-64 -mtune=generic -O3 -pipe"
+ CXXFLAGS: "-march=x86-64 -mtune=generic -O3 -pipe"
+ CPPFLAGS: "-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048"
+ LDFLAGS: "-pipe"
+ UPDATE_UNICODE: "UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ strategy:
+ matrix:
+ include:
+ # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
+ - msystem: "UCRT64"
+ base_ruby: head
+ test_task: "check"
+ test-all-opts: "--name=!/TestObjSpace#test_reachable_objects_during_iteration/"
+ fail-fast: false
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: git config
+ run: |
+ git config --global core.autocrlf false
+ git config --global core.eol lf
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Set up Ruby & MSYS2
+ uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+ with:
+ ruby-version: ${{ matrix.base_ruby }}
+ - name: set env
+ run: |
+ echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV
+
+ - name: where check
+ run: |
+ # show where
+ mv /c/Windows/System32/libcrypto-1_1-x64.dll /c/Windows/System32/libcrypto-1_1-x64.dll_
+ mv /c/Windows/System32/libssl-1_1-x64.dll /c/Windows/System32/libssl-1_1-x64.dll_
+ result=true
+ for e in gcc.exe ragel.exe make.exe bison.exe libcrypto-1_1-x64.dll libssl-1_1-x64.dll; do
+ echo '##['group']'$'\033[93m'$e$'\033[m'
+ where $e || result=false
+ echo '##['endgroup']'
+ done
+ $result
+
+ - name: version check
+ run: |
+ # show version
+ result=true
+ for e in gcc ragel make bison "openssl version"; do
+ case "$e" in *" "*) ;; *) e="$e --version";; esac
+ echo '##['group']'$'\033[93m'$e$'\033[m'
+ $e || result=false
+ echo '##['endgroup']'
+ done
+ $result
+
+ - name: autogen
+ run: |
+ ./autogen.sh
+ working-directory: src
+
+ - name: configure
+ run: >
+ ../src/configure --disable-install-doc --prefix=/.
+ --build=$CHOST --host=$CHOST --target=$CHOST
+
+ - name: update
+ run: |
+ make incs
+
+ - name: download gems
+ run: |
+ make update-gems
+
+ - name: make all
+ timeout-minutes: 30
+ run: |
+ make
+
+ - run: make leaked-globals
+
+ - name: make install
+ run: |
+ make DESTDIR=../install install-nodoc
+
+ - name: test
+ timeout-minutes: 5
+ run: |
+ make test
+ if: ${{matrix.test_task == 'check' || matrix.test_task == 'test'}}
+
+ - name: test-all
+ timeout-minutes: 45
+ run: |
+ # Actions uses UTF8, causes test failures, similar to normal OS setup
+ chcp.com 437
+ make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
+ env:
+ RUBY_TESTOPTS: >-
+ --retry --job-status=normal --show-skip --timeout-scale=1.5
+ ${{ matrix.test-all-opts }}
+ BUNDLER_VERSION:
+ if: ${{matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/')}}
+
+ - name: test-spec
+ timeout-minutes: 10
+ run: |
+ make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
+ if: ${{matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/')}}
+
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} ${{ matrix.msystem }} / ${{ matrix.test_task }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
+ shell: sh
diff --git a/.github/workflows/mjit-bindgen.yml b/.github/workflows/mjit-bindgen.yml
new file mode 100644
index 0000000000..26f8a1b2aa
--- /dev/null
+++ b/.github/workflows/mjit-bindgen.yml
@@ -0,0 +1,104 @@
+name: MJIT bindgen
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ include:
+ - task: mjit-bindgen
+ fail-fast: false
+ runs-on: ubuntu-22.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y \
+ build-essential \
+ libssl-dev libyaml-dev libreadline6-dev \
+ zlib1g-dev libncurses5-dev libffi-dev \
+ libclang1-14 \
+ bison autoconf
+ sudo apt-get install -q -y pkg-config || :
+ - name: Set up Ruby
+ uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+ with:
+ ruby-version: '3.1'
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install --enable-yjit=dev_nodebug
+ - run: make incs
+ - run: make
+ - run: make install
+ - run: make ${{ matrix.task }}
+ - run: git diff --exit-code
+ working-directory: src
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ matrix.os }} / ${{ matrix.test_task }}${{ matrix.configure }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/mjit.yml b/.github/workflows/mjit.yml
new file mode 100644
index 0000000000..6f7181489a
--- /dev/null
+++ b/.github/workflows/mjit.yml
@@ -0,0 +1,113 @@
+name: MJIT
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '**.[1-8]'
+ - '**.ronn'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ - '**.[1-8]'
+ - '**.ronn'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [check] # to make job names consistent
+ mjit_opts: [--mjit-wait]
+ fail-fast: false
+ runs-on: ubuntu-latest
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ env:
+ TESTOPTS: '-q --tty=no'
+ RUN_OPTS: '--disable-gems ${{ matrix.mjit_opts }} --mjit-debug=-ggdb3'
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc cppflags=-DVM_CHECK_MODE
+ - run: make incs
+ - run: make
+ - run: sudo make -s install
+ - name: Run test
+ run: |
+ unset GNUMAKEFLAGS
+ make -s test RUN_OPTS="$RUN_OPTS"
+ timeout-minutes: 60
+ # - name: Run test-all
+ # run: |
+ # ulimit -c unlimited
+ # make -s test-all RUN_OPTS="$RUN_OPTS"
+ # timeout-minutes: 60
+ - name: Run test-spec
+ run: |
+ unset GNUMAKEFLAGS
+ make -s test-spec RUN_OPTS="$RUN_OPTS"
+ timeout-minutes: 60
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.mjit_opts }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
new file mode 100644
index 0000000000..5d4474d978
--- /dev/null
+++ b/.github/workflows/publish.yml
@@ -0,0 +1,18 @@
+name: Start release workflow
+on:
+ push:
+ tags:
+ - '*'
+
+jobs:
+ notify:
+ runs-on: ubuntu-latest
+ steps:
+ - name: Build release package
+ run: |
+ curl -L -X POST \
+ -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+ -H "Accept: application/vnd.github+json" \
+ -H "X-GitHub-Api-Version: 2022-11-28" \
+ https://api.github.com/repos/ruby/actions/dispatches \
+ -d '{"event_type": "${{ github.ref }}"}'
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
new file mode 100644
index 0000000000..c12a95362d
--- /dev/null
+++ b/.github/workflows/scorecards.yml
@@ -0,0 +1,72 @@
+# This workflow uses actions that are not certified by GitHub. They are provided
+# by a third-party and are governed by separate terms of service, privacy
+# policy, and support documentation.
+
+name: Scorecards supply-chain security
+on:
+ # For Branch-Protection check. Only the default branch is supported. See
+ # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
+ branch_protection_rule:
+ # To guarantee Maintained check is occasionally updated. See
+ # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
+ schedule:
+ - cron: '22 4 * * 2'
+ push:
+ branches: [ "master" ]
+
+# Declare default permissions as read only.
+permissions: read-all
+
+jobs:
+ analysis:
+ name: Scorecards analysis
+ runs-on: ubuntu-latest
+ permissions:
+ # Needed to upload the results to code-scanning dashboard.
+ security-events: write
+ # Needed to publish results and get a badge (see publish_results below).
+ id-token: write
+ # Uncomment the permissions below if installing in a private repository.
+ # contents: read
+ # actions: read
+
+ steps:
+ - name: "Checkout code"
+ uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ persist-credentials: false
+
+ - name: "Run analysis"
+ uses: ossf/scorecard-action@ea651e62978af7915d09fe2e282747c798bf2dab # v2.4.1
+ with:
+ results_file: results.sarif
+ results_format: sarif
+ # (Optional) Read-only PAT token. Uncomment the `repo_token` line below if:
+ # - you want to enable the Branch-Protection check on a *public* repository, or
+ # - you are installing Scorecards on a *private* repository
+ # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action#authentication-with-pat.
+ repo_token: ${{ secrets.SCORECARD_READ_TOKEN }}
+
+ # Public repositories:
+ # - Publish results to OpenSSF REST API for easy access by consumers
+ # - Allows the repository to include the Scorecard badge.
+ # - See https://github.com/ossf/scorecard-action#publishing-results.
+ # For private repositories:
+ # - `publish_results` will always be set to `false`, regardless
+ # of the value entered here.
+ publish_results: true
+
+ # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
+ # format to the repository Actions tab.
+ - name: "Upload artifact"
+ uses: actions/upload-artifact@ea165f8d65b6e75b540449e92b4886f43607fa02 # v4.6.2
+ with:
+ name: SARIF file
+ path: results.sarif
+ retention-days: 5
+
+ # Upload the results to GitHub's code scanning dashboard.
+ - name: "Upload to code-scanning"
+ uses: github/codeql-action/upload-sarif@959cbb7472c4d4ad70cdfe6f4976053fe48ab394 # v2.1.27
+ with:
+ sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..4521195a2b
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,71 @@
+name: Rubyspec Version Guards Check
+
+on:
+ push:
+ paths:
+ - 'spec/**'
+ - '!spec/*.md'
+ pull_request:
+ paths:
+ - 'spec/**'
+ - '!spec/*.md'
+ merge_group:
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ rubyspec:
+ name: Rubyspec
+
+ runs-on: ubuntu-22.04
+
+ if: >-
+ ${{!(false
+ || contains(github.event.head_commit.message, '[DOC]')
+ || contains(github.event.head_commit.message, 'Document')
+ || contains(github.event.pull_request.title, '[DOC]')
+ || contains(github.event.pull_request.title, 'Document')
+ || contains(github.event.pull_request.labels.*.name, 'Document')
+ || (github.event_name == 'push' && github.actor == 'dependabot[bot]')
+ )}}
+
+ strategy:
+ matrix:
+ # Specs from ruby/spec should still run on all supported Ruby versions.
+ # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+ ruby:
+ - ruby-3.1
+ - ruby-3.2
+
+ steps:
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+
+ - uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+ with:
+ ruby-version: ${{ matrix.ruby }}
+ bundler: none
+
+ - run: gem install webrick
+
+ - run: ruby ../mspec/bin/mspec
+ working-directory: spec/ruby
+ env:
+ CHECK_LEAKS: true
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / rubyspec @ ${{ matrix.ruby }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() }}
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..4fbca1170e
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,146 @@
+name: Ubuntu
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ # main variables included in the job name
+ test_task: [check]
+ configure: [cppflags=-DRUBY_DEBUG] # default to use more assertions
+ arch: ['']
+ # specify all jobs with `include` to avoid testing duplicated things
+ include:
+ - test_task: check
+ - test_task: check
+ arch: i686
+ configure: '' # test without -DRUBY_DEBUG as well
+ - test_task: check
+ configure: "--enable-shared --enable-load-relative"
+ - test_task: test-all TESTS=--repeat-count=2
+ - test_task: test-bundler-parallel
+ - test_task: test-bundled-gems
+ fail-fast: false
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUBY_DEBUG: ci
+ SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
+ runs-on: ubuntu-22.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - name: Install libraries
+ env:
+ arch: ${{matrix.arch}}
+ run: |
+ set -x
+ arch=${arch:+:${arch/i[3-6]86/i386}}
+ ${arch:+sudo dpkg --add-architecture ${arch#:}}
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y \
+ ${arch:+cross}build-essential${arch/:/-} \
+ libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+ zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+ bison autoconf ruby
+ sudo apt-get install -q -y pkg-config${arch} || :
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ env:
+ arch: ${{matrix.arch}}
+ run: >-
+ $SETARCH ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+ ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+ - run: $SETARCH make incs
+ - run: $SETARCH make prepare-gems
+ if: ${{ matrix.test_task == 'test-bundled-gems' }}
+ - run: $SETARCH make
+ - run: $SETARCH make leaked-globals
+ if: ${{ matrix.test_task == 'check' }}
+ - name: Create dummy files in build dir
+ run: |
+ $SETARCH ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+ if: ${{ matrix.test_task == 'check' }}
+ - name: make ${{ matrix.test_task }}
+ run: |
+ $SETARCH make -s ${{ matrix.test_task }} ${TESTS:+TESTS=`echo "$TESTS" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|'`}
+ timeout-minutes: 40
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TESTS: ${{ matrix.test_task == 'check' && matrix.skipped_tests || '' }}
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ PRECHECK_BUNDLED_GEMS: "no"
+ - name: make skipped tests
+ run: |
+ $SETARCH make -s test-all TESTS=`echo "$TESTS" | sed 's| |$$/ -n/|g;s|^|-n/|;s|$|$$/|'`
+ env:
+ GNUMAKEFLAGS: ""
+ RUBY_TESTOPTS: "-v --tty=no"
+ TESTS: ${{ matrix.skipped_tests }}
+ if: ${{ matrix.test_task == 'check' && matrix.skipped_tests != '' }}
+ continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
new file mode 100644
index 0000000000..27920b5821
--- /dev/null
+++ b/.github/workflows/wasm.yml
@@ -0,0 +1,146 @@
+name: WebAssembly
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ entry:
+# # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
+# - { name: O0-debuginfo, optflags: "-O0", debugflags: "-g", wasmoptflags: "-O1" }
+# - { name: O1, optflags: "-O1", debugflags: "" , wasmoptflags: "-O1" }
+ - { name: O2, optflags: "-O2", debugflags: "" , wasmoptflags: "-O2" }
+# - { name: O3, optflags: "-O3", debugflags: "" , wasmoptflags: "-O3" }
+# # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
+# - { name: O4, optflags: "-O3", debugflags: "" , wasmoptflags: "-O4" }
+# - { name: Oz, optflags: "-Oz", debugflags: "" , wasmoptflags: "-Oz" }
+ fail-fast: false
+ env:
+ RUBY_TESTOPTS: '-q --tty=no'
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ WASI_SDK_VERSION_MAJOR: 14
+ WASI_SDK_VERSION_MINOR: 0
+ BINARYEN_VERSION: 109
+ WASMTIME_VERSION: v0.33.0
+ runs-on: ubuntu-22.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - name: Install libraries
+ run: |
+ set -ex
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y ruby bison make autoconf git wget
+
+ wasi_sdk_deb="wasi-sdk_${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}_amd64.deb"
+ wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
+ sudo dpkg -i "$wasi_sdk_deb"
+ rm -f "$wasi_sdk_deb"
+
+ mkdir build-sdk
+ pushd build-sdk
+
+ wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
+ wget -O - "$wasmtime_url" | tar xJf -
+ sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
+
+ binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
+ binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
+ wget -O - "$binaryen_url" | tar xfz -
+ sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
+ working-directory: src
+ - name: Set ENV
+ run: |
+ echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+ echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+
+ - uses: ruby/setup-ruby@13e7a03dc3ac6c3798f4570bfead2aed4d96abfb # v1.244.0
+ with:
+ ruby-version: '3.0'
+ bundler: none
+
+ - name: Download config.guess with wasi version
+ run: |
+ rm tool/config.guess tool/config.sub
+ ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
+ working-directory: src
+
+ - name: Run configure
+ run: |
+ ../src/configure \
+ --host wasm32-unknown-wasi \
+ --with-static-linked-ext \
+ LDFLAGS=" \
+ -Xlinker --stack-first \
+ -Xlinker -z -Xlinker stack-size=16777216 \
+ " \
+ optflags="${{ matrix.entry.optflags }}" \
+ debugflags="${{ matrix.entry.debugflags }}" \
+ wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
+
+ # miniruby may not be built when cross-compling
+ - run: make mini ruby
+ - name: Run basictest
+ run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
+ working-directory: src
+ - name: Run bootstraptest (no thread)
+ run: |
+ NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
+ ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
+ working-directory: src
+
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.name }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..c2bd4881c2
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,149 @@
+name: Windows
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ make:
+ strategy:
+ matrix:
+ include:
+ - vs: 2022
+ vcvers: -vcvars_ver=14.2
+ fail-fast: false
+ runs-on: windows-${{ matrix.vs }}
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ name: VisualStudio ${{ matrix.vs }}
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ PATCH: C:\msys64\usr\bin\patch.exe
+ OS_VER: windows-${{ matrix.vs }}
+ steps:
+ - run: md build
+ working-directory:
+ - uses: msys2/setup-msys2@61f9e5e925871ba6c9e3e8da24ede83ea27fa91f # v2.27.0
+ id: setup-msys2
+ with:
+ update: true
+ install: bison patch
+ - name: patch path
+ shell: msys2 {0}
+ run: echo PATCH=$(cygpath -wa $(command -v patch)) >> $GITHUB_ENV
+ if: ${{ steps.setup-msys2.outcome == 'success' }}
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: C:\vcpkg\installed
+ key: ${{ runner.os }}-vcpkg-installed-windows-${{ matrix.vs }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-vcpkg-installed-windows-${{ matrix.vs }}-
+ ${{ runner.os }}-vcpkg-installed-windows-
+ - name: Install libraries with vcpkg
+ run: |
+ iex "& {$(irm get.scoop.sh)} -RunAsAdmin"
+ Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
+ scoop install cmake@3.31.6
+ vcpkg --triplet x64-windows install libffi libyaml openssl readline zlib
+ shell:
+ pwsh
+ - name: git config
+ run: |
+ git config --global core.autocrlf false
+ git config --global core.eol lf
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: setup env
+ # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+ # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+ # msys2/setup-msys2 installs MSYS2 to D:/a/_temp/msys64/usr/bin
+ run: |
+ set Path=D:/a/_temp/msys64/usr/bin;%Path%
+ if not "%VCVARS%" == "" goto :vcset
+ set VCVARS="C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+ if not exist %VCVARS% set VCVARS="C:\Program Files\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+ :vcset
+ set | C:\msys64\usr\bin\sort > old.env
+ call %VCVARS% ${{ matrix.vcvers || ''}}
+ set TMP=%USERPROFILE%\AppData\Local\Temp
+ set TEMP=%USERPROFILE%\AppData\Local\Temp
+ set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+ set | C:\msys64\usr\bin\sort > new.env
+ C:\msys64\usr\bin\comm -13 old.env new.env >> %GITHUB_ENV%
+ del *.env
+ - name: compiler version
+ run: cl
+ - name: link libraries
+ run: |
+ for %%I in (C:\vcpkg\installed\x64-windows\bin\*.dll) do (
+ if not %%~nI == readline mklink %%~nxI %%I
+ )
+ for %%I in (libcrypto-1_1-x64 libssl-1_1-x64) do (
+ ren c:\Windows\System32\%%I.dll %%I.dll_
+ )
+ - name: Configure
+ run: >-
+ ../src/win32/configure.bat --disable-install-doc
+ --with-opt-dir=C:/vcpkg/installed/x64-windows
+ - run: nmake incs
+ - run: nmake extract-extlibs
+ - run: nmake
+ env:
+ YACC: bison.exe
+ - run: nmake test
+ timeout-minutes: 5
+ - run: nmake test-spec
+ timeout-minutes: 10
+ - run: nmake test-all
+ env:
+ RUBY_TESTOPTS: -j${{env.TEST_JOBS}} --job-status=normal
+ timeout-minutes: 60
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "VS${{ matrix.vs }} / ${{ matrix.test_task || 'check' }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
+ shell: cmd
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
new file mode 100644
index 0000000000..0b7b9046e9
--- /dev/null
+++ b/.github/workflows/yjit-ubuntu.yml
@@ -0,0 +1,170 @@
+name: YJIT Ubuntu
+on:
+ push:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ pull_request:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+ merge_group:
+ paths-ignore:
+ - 'doc/**'
+ - '**/man'
+ - '**.md'
+ - '**.rdoc'
+ - '**/.document'
+
+concurrency:
+ group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+ cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+ contents: read
+
+jobs:
+ cargo:
+ name: Rust cargo test
+ # GitHub Action's image seems to already contain a Rust 1.58.0.
+ runs-on: ubuntu-22.04
+ steps:
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ # For now we can't run cargo test --offline because it complains about the
+ # capstone dependency, even though the dependency is optional
+ #- run: cargo test --offline
+ - run: RUST_BACKTRACE=1 cargo test
+ working-directory: yjit
+ # Also compile and test with all features enabled
+ - run: RUST_BACKTRACE=1 cargo test --all-features
+ working-directory: yjit
+ # Check that we can build in release mode too
+ - run: cargo build --release
+ working-directory: yjit
+ make:
+ strategy:
+ fail-fast: false
+ matrix:
+ include:
+ - test_task: 'yjit-bindgen'
+ hint: 'To fix: use patch in logs'
+ configure: '--with-gcc=clang-14 --enable-yjit=dev'
+ libclang_path: '/usr/lib/llvm-14/lib/libclang.so.1'
+
+ - test_task: "check"
+ # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
+ #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
+ configure: "RUSTC='rustc +1.58.0'"
+ rust_version: "1.58.0"
+
+ - test_task: "check"
+ configure: "--enable-yjit=dev"
+
+ - test_task: "check"
+ configure: "--enable-yjit=dev"
+ yjit_opts: "--yjit-call-threshold=1 --yjit-verify-ctx"
+
+ - test_task: "test-all TESTS=--repeat-count=2"
+ configure: "--enable-yjit=dev"
+
+ - test_task: "test-bundled-gems"
+ configure: "--enable-yjit=dev"
+
+ - test_task: "yjit-bench"
+ configure: "--enable-yjit=dev"
+ yjit_bench_opts: "--yjit-stats"
+ env:
+ GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+ RUN_OPTS: ${{ matrix.yjit_opts }}
+ YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+ RUBY_DEBUG: ci
+ BUNDLE_JOBS: 8 # for yjit-bench
+ runs-on: ubuntu-22.04
+ if: ${{ !contains(github.event.head_commit.message, '[DOC]') && !contains(github.event.pull_request.labels.*.name, 'Documentation') }}
+ steps:
+ - run: mkdir build
+ working-directory:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev bison autoconf ruby
+ - name: Install Rust
+ if: ${{ matrix.rust_version }}
+ run: rustup install ${{ matrix.rust_version }} --profile minimal
+ - name: git config
+ run: |
+ git config --global advice.detachedHead 0
+ git config --global init.defaultBranch garbage
+ - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
+ with:
+ path: src
+ - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
+ with:
+ path: src/.downloaded-cache
+ key: downloaded-cache
+ - name: Fixed world writable dirs
+ run: |
+ chmod -v go-w $HOME $HOME/.config
+ sudo chmod -R go-w /usr/share
+ sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v go-w $d; done' || :
+ - name: Set ENV
+ run: |
+ echo "GNUMAKEFLAGS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+ - run: ./autogen.sh
+ working-directory: src
+ - name: Run configure
+ run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+ - run: make incs
+ - run: make prepare-gems
+ if: ${{ matrix.test_task == 'test-bundled-gems' }}
+ - run: make -j
+ - run: make leaked-globals
+ if: ${{ matrix.test_task == 'check' }}
+ - name: Create dummy files in build dir
+ run: |
+ ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+ if: ${{ matrix.test_task == 'check' }}
+ - name: Enable YJIT through ENV
+ run: echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+ # Check that the binary was built with YJIT
+ - name: Check YJIT enabled
+ run: ./miniruby --yjit -v | grep "+YJIT"
+ - name: make ${{ matrix.test_task }}
+ run: make -s -j ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS"
+ timeout-minutes: 60
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ TEST_BUNDLED_GEMS_ALLOW_FAILURES: ""
+ PRECHECK_BUNDLED_GEMS: "no"
+ LIBCLANG_PATH: ${{ matrix.libclang_path }}
+ continue-on-error: ${{ matrix.test_task == 'yjit-bench' }}
+ - name: Show ${{ github.event.pull_request.base.ref }} GitHub URL for yjit-bench comparison
+ run: echo "https://github.com/${BASE_REPO}/commit/${BASE_SHA}"
+ env:
+ BASE_REPO: ${{ github.event.pull_request.base.repo.full_name }}
+ BASE_SHA: ${{ github.event.pull_request.base.sha }}
+ if: ${{ matrix.test_task == 'yjit-bench' && startsWith(github.event_name, 'pull') }}
+ - uses: ruby/action-slack@0bd85c72233cdbb6a0fe01d37aaeff1d21b5fce1 # v3.2.1
+ with:
+ payload: |
+ {
+ "ci": "GitHub Actions",
+ "env": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.configure }}",
+ "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+ "commit": "${{ github.sha }}",
+ "branch": "${{ github.ref_name }}"
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+ if: ${{ failure() && github.event_name == 'push' }}
+
+defaults:
+ run:
+ working-directory: build
diff --git a/.gitignore b/.gitignore
index 9757768786..99d32a1825 100644
--- a/.gitignore
+++ b/.gitignore
@@ -4,38 +4,53 @@
*.a
*.bak
*.bc
+*.bundle
*.dSYM
*.dmyh
*.dylib
*.elc
*.i
+*.ii
*.inc
*.log
*.o
+*.o.tmp
*.obj
+*.old
*.orig
+*.pch
*.pdb
+*.rbinc
*.rej
*.s
*.sav
+*.sl
+*.so
+*.so.*
*.swp
*.yarb
*~
-.*-*
.*.list
.*.time
.DS_Store
+.bundle
.ccmalloc
.ext
.pc
.ppack
.svn
+.time
+.ruby-version
Makefile
-Makefile.old
cygruby*.def
extconf.h
y.output
y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+lcov*.info
# /
/*-fake.rb
@@ -45,13 +60,13 @@ y.tab.c
/*.pc
/*.rc
/*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
/COPYING.LIB
-/ChangeLog-*
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
+/ChangeLog
/Doxyfile
/GNUmakefile
-/GNUmakefile.old
/README.atheos
/README.fat-patch
/README.v6
@@ -59,6 +74,7 @@ y.tab.c
/archive
/autom4te*.cache
/automake
+/benchmark/benchmark-driver
/beos
/bmlog-*
/breakpoints.gdb
@@ -82,6 +98,9 @@ y.tab.c
/goruby
/id.[ch]
/largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
/lex.c
/libruby*.*
/miniprelude.c
@@ -97,19 +116,25 @@ y.tab.c
/ppack
/prelude.c
/preview
+/probes.dmyh
/probes.h
/rbconfig.rb
/rename2.h
/repack
/revision.h
+/revision.tmp
/riscos
/rubicon
/ruby
/ruby-runner
/ruby-runner.h
/ruby-man.rd.gz
+/rubyspec_temp
+/run.gdb
/sizes.c
+/static-ruby
/test.rb
+/test-coverage.dat
/tmp
/transdb.h
/uncommon.mk
@@ -118,7 +143,15 @@ y.tab.c
/web
/yasmdata.rb
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+/bin/goruby
+/bin/ruby
+
# /benchmark/
+/benchmark/bm_require.data
/benchmark/bmx_*.rb
/benchmark/fasta.output.*
/benchmark/wc.input
@@ -126,25 +159,37 @@ y.tab.c
/enc/*.def
/enc/*.exp
/enc/*.lib
+/enc/jis/props.h
/enc/unicode/data
+# /coroutine/
+!/coroutine/**/*.s
+
# /enc/trans/
/enc/trans/*.c
/enc/trans/*.def
/enc/trans/*.exp
/enc/trans/*.lib
-/enc/trans/.time
+
+# /exe/
+/exe/goruby
+/exe/ruby
# /ext/
/ext/extinit.c
+/ext/configure-ext.mk
+/ext/*/exts.mk
+
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
/ext/-test-/win32/dln/dlntest.exp
/ext/-test-/win32/dln/dlntest.lib
-# /ext/dl/callback/
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
+# /ext/-test-/gems
+/ext/-test-/gems
# /ext/etc/
/ext/etc/constdefs.h
@@ -154,9 +199,11 @@ y.tab.c
# /ext/rbconfig/
/ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
# /ext/ripper/
/ext/ripper/eventids1.c
+/ext/ripper/.eventids2-check
/ext/ripper/eventids2table.c
/ext/ripper/ripper.*
/ext/ripper/ids1
@@ -169,10 +216,18 @@ y.tab.c
# /gems
/gems/*.gem
+/gems/src
+/gems/*-*
-# /spec/
-/spec/mspec
-/spec/rubyspec
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
+
+# /misc/
+/misc/**/__pycache__
+
+# /spec/bundler
+/.rspec_status
# /tool/
/tool/config.guess
@@ -180,4 +235,16 @@ y.tab.c
# /win32/
/win32/*.ico
-/win32/.time
+
+# MJIT
+/include/ruby-*/*/rb_mjit_min_header-*.h
+/lib/ruby_vm/mjit/instruction.rb
+/mjit_config.h
+/rb_mjit_header.h
+
+# YJIT
+/yjit-bench
+/yjit_exit_locations.dump
+
+# /wasm/
+/wasm/tests/*.wasm
diff --git a/.indent.pro b/.indent.pro
index 6a207a0554..1d61cbcad1 100644
--- a/.indent.pro
+++ b/.indent.pro
@@ -2,12 +2,15 @@
-nbbb
-nbc
-br
+-brs
-nbs
-ncdb
--ce
--cli0.5
+-nce
+-cdw
+-cli2
+-cbi2
-ndj
--ei
+-ncs
-nfc1
-i4
-l120
@@ -16,6 +19,14 @@
-psl
-sc
-sob
+-sbi4
+-nut
+-par
-TID
-TVALUE
+-Tst_data_t
+-Tst_index_t
+-Tst_table
+-Trb_data_type_t
+-TFILE
diff --git a/.rdoc_options b/.rdoc_options
new file mode 100644
index 0000000000..760507c7a2
--- /dev/null
+++ b/.rdoc_options
@@ -0,0 +1,4 @@
+---
+page_dir: doc
+main_page: README.md
+title: Documentation for Ruby development version
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 24ce0c9113..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,102 +0,0 @@
-# Copyright (C) 2011 Urabe, Shyouhei. All rights reserved.
-#
-# This file is a part of the programming language Ruby. Permission is hereby
-# granted, to either redistribute or modify this file, provided that the
-# conditions mentioned in the file COPYING are met. Consult the file for
-# details.
-
-# This is a Travis-CI build configuration file. The list of configurations
-# available is located in
-#
-# http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-# http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-# Language specification.
-language: c
-sudo: false
-
-# Compilers. Several compilers are provided in Travis, so we try them all.
-# The value set here is visible via $CC environment variable.
-compiler:
- - gcc
-
-os:
- - linux
-
-# Dependencies. Some header files are missing in a Travis' worker VM, so we
-# have to install them. The "1.9.1" here is OK. It is the most adopted
-# version string for Debian/Ubuntu, and no dependencies have been changed so
-# far since the 1.9.1 release.
-before_install:
- - "CONFIG_FLAG="
- - "JOBS='-j 4'"
-
-# Script is where the test runs. Note we just do "make test", not other tests
-# like test-all, test-rubyspec. This is because they take too much time,
-# enough for Travis to shut down the VM as being stalled.
-before_script:
- - "uname -a"
- - "uname -r"
- - "rm -fr .ext autom4te.cache"
- - "echo $TERM"
- - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
- - "autoconf"
- - "mkdir config_1st config_2nd"
- - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
- - "cp -pr config.status .ext/include config_1st"
- - "make reconfig"
- - "cp -pr config.status .ext/include config_2nd"
- - "diff -ru config_1st config_2nd"
- - "make after-update BASERUBY=ruby"
- - "make -s $JOBS"
- - "make update-rubyspec"
-script:
- - "make test TESTOPTS=--color=never"
- - "make test-all TESTOPTS='-q -j3 --color=never --job-status=normal'"
- - "make test-rubyspec MSPECOPT=-fm"
-
-# Branch matrix. Not all branches are Travis-ready so we limit branches here.
-branches:
- only:
- - trunk
- - ruby_2_1
- - ruby_2_2
- - ruby_2_3
- - /^feature\//
- - /^bug\//
-
-# We want to be notified when something happens.
-notifications:
- irc:
- channels:
- - "irc.freenode.org#ruby-core"
- - "irc.freenode.org#ruby-ja"
- on_success: change # [always|never|change] # default: always
- on_failure: always # [always|never|change] # default: always
- template:
- - "%{message} by @%{author}: See %{build_url}"
-
- # Update ruby-head installed on Travis CI so other projects can test against it.
- webhooks:
- urls:
- - "https://rubies.travis-ci.org/rebuild/ruby-head"
- on_success: always
- on_failure: never
-
- email:
- - ko1c-failure@atdot.net
- - shibata.hiroshi@gmail.com
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
diff --git a/BSDL b/BSDL
index a009caefea..66d93598aa 100644
--- a/BSDL
+++ b/BSDL
@@ -4,10 +4,10 @@ Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
+ notice, this list of conditions and the following disclaimer.
2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index ffdf2dd4b8..13df6087ca 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -1,4 +1 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
diff --git a/COPYING b/COPYING
index 426810a7fb..48e5a96de7 100644
--- a/COPYING
+++ b/COPYING
@@ -2,55 +2,55 @@ Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
You can redistribute it and/or modify it under either the terms of the
2-clause BSDL (see the file BSDL), or the conditions below:
- 1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
- 2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
- a) place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
- b) use the modified software only within your corporation or
- organization.
+ b. use the modified software only within your corporation or
+ organization.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 3. You may distribute the software in object code or binary form,
- provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+ provided that you do at least ONE of the following:
- a) distribute the binaries and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
+ a. distribute the binaries and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
- b) accompany the distribution with the machine-readable source of
- the software.
+ b. accompany the distribution with the machine-readable source of
+ the software.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 4. You may modify and include the part of the software into any other
- software (possibly commercial). But some files in the distribution
- are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+ software (possibly commercial). But some files in the distribution
+ are not written by the author, so that they are not under these terms.
- For the list of those files and their copying conditions, see the
- file LEGAL.
+ For the list of those files and their copying conditions, see the
+ file LEGAL.
- 5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
+5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
- 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index e50d01c8d1..230376bc60 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -2,50 +2,50 @@
または以下に示す条件で本プログラムを再配布できます
2-clause BSDLについてはBSDLファイルを参照して下さい.
- 1. 複製は制限なく自由です.
+1. 複製は制限なく自由です.
- 2. 以下の条件のいずれかを満たす時に本プログラムのソースを
- 自由に変更できます.
+2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+ 自由に変更できます.
- (a) ネットニューズにポストしたり,作者に変更を送付する
- などの方法で,変更を公開する.
+ a. ネットニューズにポストしたり,作者に変更を送付する
+ などの方法で,変更を公開する.
- (b) 変更した本プログラムを自分の所属する組織内部だけで
- 使う.
+ b. 変更した本プログラムを自分の所属する組織内部だけで
+ 使う.
- (c) 変更点を明示したうえ,ソフトウェアの名前を変更する.
- そのソフトウェアを配布する時には変更前の本プログラ
- ムも同時に配布する.または変更前の本プログラムのソー
- スの入手法を明示する.
+ c. 変更点を明示したうえ,ソフトウェアの名前を変更する.
+ そのソフトウェアを配布する時には変更前の本プログラ
+ ムも同時に配布する.または変更前の本プログラムのソー
+ スの入手法を明示する.
- (d) その他の変更条件を作者と合意する.
+ d. その他の変更条件を作者と合意する.
- 3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
- ルしたオブジェクトコードや実行形式でも配布できます.
+3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+ ルしたオブジェクトコードや実行形式でも配布できます.
- (a) バイナリを受け取った人がソースを入手できるように,
- ソースの入手法を明示する.
+ a. バイナリを受け取った人がソースを入手できるように,
+ ソースの入手法を明示する.
- (b) 機械可読なソースコードを添付する.
+ b. 機械可読なソースコードを添付する.
- (c) 変更を行ったバイナリは名前を変更したうえ,オリジナ
- ルのソースコードの入手法を明示する.
+ c. 変更を行ったバイナリは名前を変更したうえ,オリジナ
+ ルのソースコードの入手法を明示する.
- (d) その他の配布条件を作者と合意する.
+ d. その他の配布条件を作者と合意する.
- 4. 他のプログラムへの引用はいかなる目的であれ自由です.た
- だし,本プログラムに含まれる他の作者によるコードは,そ
- れぞれの作者の意向による制限が加えられる場合があります.
+4. 他のプログラムへの引用はいかなる目的であれ自由です.た
+ だし,本プログラムに含まれる他の作者によるコードは,そ
+ れぞれの作者の意向による制限が加えられる場合があります.
- それらファイルの一覧とそれぞれの配布条件などに付いては
- LEGALファイルを参照してください.
+ それらファイルの一覧とそれぞれの配布条件などに付いては
+ LEGALファイルを参照してください.
- 5. 本プログラムへの入力となるスクリプトおよび,本プログラ
- ムからの出力の権利は本プログラムの作者ではなく,それぞ
- れの入出力を生成した人に属します.また,本プログラムに
- 組み込まれるための拡張ライブラリについても同様です.
+5. 本プログラムへの入力となるスクリプトおよび,本プログラ
+ ムからの出力の権利は本プログラムの作者ではなく,それぞ
+ れの入出力を生成した人に属します.また,本プログラムに
+ 組み込まれるための拡張ライブラリについても同様です.
- 6. 本プログラムは無保証です.作者は本プログラムをサポート
- する意志はありますが,プログラム自身のバグあるいは本プ
- ログラムの実行などから発生するいかなる損害に対しても責
- 任を持ちません.
+6. 本プログラムは無保証です.作者は本プログラムをサポート
+ する意志はありますが,プログラム自身のバグあるいは本プ
+ ログラムの実行などから発生するいかなる損害に対しても責
+ 任を持ちません.
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index 256b71ff9b..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,8046 +0,0 @@
-Fri Sep 9 13:14:53 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * News: Announcing update to Unicode version 9.0.0 [ci skip]
-
-Fri Sep 9 10:10:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_const_search): warn with the actual class/module
- name which defines the deprecated constant.
-
- * variable.c (rb_const_search): raise with the actual class/module
- name which defines the private constant.
-
-Thu Sep 8 17:47:18 2016 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * array.c (flatten): use rb_obj_class instead of rb_class_of
- because rb_class_of may return a singleton class.
- [ruby-dev:49781] [Bug #12738]
-
-Thu Sep 8 17:40:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/rbinstall.rb (gem): use the bindir of each gemspec instead
- of hardcoded 'bin', since rdoc 5.0.0 overrides it.
-
-Thu Sep 8 16:47:03 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * eval.c (rb_mod_s_used_modules): rename Module.used_refinements to
- Module.used_modules. [Feature #7418] [ruby-core:49805]
-
-Thu Sep 8 14:21:48 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/psych/psych.gemspec, lib/rdoc/rdoc.gemspec: Use file list instead of
- git output. It shows warning message when invoke `make install`
- [Bug #12736][ruby-dev:49778]
-
-Thu Sep 8 13:41:46 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * insns.def (setclassvariable, setconstant): warn when self is a
- refinement. [Bug #10103] [ruby-core:64143]
-
-Thu Sep 8 11:29:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * hash.c (rb_hash_transform_values, rb_hash_transform_values_bang):
- Rename map_v to transform_values.
- [Feature #12512] [ruby-core:76095]
-
- * test/ruby/test_hash.rb: ditto.
-
-Thu Sep 8 10:08:35 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * {ext,test}/openssl: Import Ruby/OpenSSL 2.0.0.beta.2. The full commit
- history since v2.0.0.beta.1 can be found at:
- https://github.com/ruby/openssl/compare/v2.0.0.beta.1...v2.0.0.beta.2
-
-Thu Sep 8 07:23:34 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rdoc/*, test/rdoc/*: Update rdoc-5.0.0.beta2
- Fixed ri parse defect with left-hand matched classes.
- https://github.com/rdoc/rdoc/pull/420
-
-Thu Sep 8 01:12:47 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * eval.c (rb_mod_s_used_refinements): new method
- Module.used_refinements. based on the patch by Charlie
- Somerville. [Feature #7418] [ruby-core:49805]
-
-Wed Sep 7 17:50:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/util.h (setenv): remove POSIX-noncompliant
- definition with 2 arguments.
-
-Wed Sep 7 17:35:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * unicode/8.0.0/casefold.h, name2ctype.h, unicode/data/8.0.0:
- removing directories/files related to Unicode version 8.0.0
-
-Wed Sep 7 17:21:55 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/timeout.rb (Timeout#timeout): add custom error message
- argument. [Feature #11650]
-
-Wed Sep 7 17:13:05 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Updated Unicode version to 9.0.0 [Feature #12513]
-
- * unicode/9.0.0/casefold.h, name2ctype.h, unicode/data/9.0.0:
- new directories/files for Unicode version 9.0.0
-
-Wed Sep 7 16:00:45 2016 Tanaka Akira <akr@fsij.org>
-
- * lib/open-uri.rb: Allow http to https redirection.
- Note that https to http is still forbidden.
- [ruby-core:20485] [Feature #859] by Roman Shterenzon.
-
-Wed Sep 7 14:56:59 2016 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * lib/csv.rb (CSV::{Row,Table}#{each,delete_if}): returns an enumerator
- if no block is given. [ruby-core:75346] [Feature #12347]
-
- * test/csv/test_row.rb: add test for above.
-
- * test/csv/test_table.rb: ditto.
-
-Wed Sep 7 14:50:01 2016 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * gems/bundled_gems: update to power_assert 0.3.1.
-
-Wed Sep 7 12:16:09 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/psych/*, test/psych/*: Update psych-2.1.1
- This version fixed following pull requests.
- https://github.com/tenderlove/psych/pull/284
- https://github.com/tenderlove/psych/pull/276
-
-Wed Sep 7 11:51:06 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rdoc/*, test/rdoc/*: Update rdoc-5.0.0.beta1
- This version is mostly same as r56072. It contains to remove code
- for Ruby 1.8
-
-Tue Sep 6 09:23:06 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rdoc/rdoc.gemspec: partly reverted for default gem installer.
- upstream configuration is not working on ruby core repository.
-
-Mon Sep 5 19:35:22 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rdoc/*, test/rdoc/*: Update rdoc/rdoc master(f191513)
- https://github.com/rdoc/rdoc/blob/master/History.rdoc#423--2016--
- https://github.com/rdoc/rdoc/blob/master/History.rdoc#422--2016-02-09
-
-Sun Sep 4 00:17:55 2016 Sho Hashimoto <sho-h@ruby-lang.org>
-
- * proc.c: [DOC] fix Object#define_singleton_method and
- main.define_method return value. [ci skip]
-
-Sat Sep 3 11:28:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread_pthread.c (ruby_init_stack): check stack bounds even if
- get_main_stack succeeded, on the "co-routine" case.
- https://github.com/ruby/ruby/commit/53953ee#commitcomment-18887413
-
-Fri Sep 2 16:06:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * internal.h (MEMO_V1_SET, MEMO_V2_SET): fix typos. use the macro
- parameter, not the local variable.
-
-Fri Sep 2 00:55:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (timestamp_file): move extmk.rb specific tricks
- from lib/mkmf.rb. keep RUBYCOMMONDIR prefix not to conflict
- with a timestamp file in the toplevel.
-
-Thu Sep 1 14:24:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (gems): move dirty hacks for bundled gems from
- mkmf.rb.
-
- * lib/mkmf.rb (create_makefile): yield all configuration strings.
-
-Wed Aug 31 17:39:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (create_makefile): make gem.build_complete file
- under TARGET_SO_DIR and install it only when the gem build
- succeeded. [ruby-core:77057] [Bug #12681]
-
-Wed Aug 31 15:36:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: move TARGET_SO_DIR stuffs to mkmf.rb.
-
- * lib/mkmf.rb (create_makefile): create target shared object files
- under $(TARGET_SO_DIR) which is $sodir if it is defined with
- $extout. [ruby-core:77058] [Bug #12681]
-
-Wed Aug 31 01:56:55 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * doc/extension.ja.rdoc: [DOC] Fix a typo. [ci skip]
-
-Wed Aug 31 00:52:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: make the gems target directory under the expanded
- name. [ruby-core:77102] [Bug #12714]
-
-Tue Aug 30 15:27:27 2016 Kouhei Yanagita <yanagi@shakenbu.org>
-
- * ext/json/lib/json/add/ostruct.rb (OpenStruct.json_create):
- Correct documentation, fix the name of values. [Fix GH-1421]
-
-Tue Aug 30 14:53:34 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * io.c (nogvl_fsync, nogvl_fdatasync): on Windows, just ignore if the
- fd is associated to non-disk device. if call fsync and/or fdatasync
- with such fds, it causes Errno::EBADF exception and the behavior is
- incompatible with ruby 2.1 and earlier unintentionally introduced.
-
-Tue Aug 30 03:38:35 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_dump.c (backtrace): use rip in the saved context for the case
- the SIGSEGV is received when the process is in userland.
- Note that ip in the stack should be used if the signal is received
- when it is in kernel (when it is calling syscall) [Bug #12711]
-
-Sat Aug 27 10:26:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (rb_ary_concat_multi): take multiple arguments. based
- on the patch by Satoru Horie. [Feature #12333]
-
- * string.c (rb_str_concat_multi, rb_str_prepend_multi): ditto.
-
-Thu Aug 25 00:42:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/file.c (append_wstr): remove a codepage argument, and use
- INVALID_CODE_PAGE for conversion by econv.
-
- * win32/file.c (append_wstr): exclude the terminator from the
- result length when input len == -1.
-
-Wed Aug 24 22:41:30 2016 Kouhei Sutou <kou@cozmixng.org>
-
- * gc.c (gc_reset_malloc_info): Remove too much ";".
-
-Wed Aug 24 20:07:57 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * include/ruby/defines.h (ALWAYS_INLINE): Add alternative definition.
- Fix compile error with compilers that do not have force inline
- attribute, including old version of fcc on Solaris 10.
- [ruby-dev:49773] [Bug #12701]
-
-Wed Aug 24 16:56:26 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * .gdbinit: follow r55766's VM change.
-
-Wed Aug 24 12:57:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_mod_initialize, rb_class_initialize): [DOC] these
- methods do not invoke module_eval/class_eval, just eval the
- given block under the new module/class but sharing the context
- with the surrounding scope like those methods.
- [ruby-core:77023] [Bug #12696]
-
-Tue Aug 23 10:34:40 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/psych/test_psych.rb (test_load_file_with_fallback): fix
- Tempfile leak. https://github.com/tenderlove/psych/pull/288
-
-Tue Aug 23 10:15:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_fs_setter): check and convert $; value at
- assignment.
-
-Tue Aug 23 02:09:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_split_m): show $; name in error message when it
- is a wrong object.
-
-Mon Aug 22 16:29:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/csv.rb (CSV#shift): store partial quoted strings in an array
- and join at last, to improve performance with very long quoted
- lines. [ruby-core:76987] [Bug #12691]
-
-Mon Aug 22 14:35:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * man/irb.1: remove useless -width option.
- [ruby-dev:49767] [Bug #12692]
-
-Mon Aug 22 09:02:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (Init_ISeq): undefine allocator of InstructionSequence,
- to get rid of segfaults at method call on uninitialized object.
-
-Sat Aug 21 05:47:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (enum_sort): prevent wasteful array duplication.
-
-Sat Aug 20 11:20:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * rubystub.c: generalize win32/stub.c.
-
-Fri Aug 19 11:39:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (primary): allow parenthesised statement as a method
- argument. [Feature #12686]
-
-Fri Aug 19 09:12:45 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (vm_set_main_stack): TOPLEVEL_BINDING must be built.
- http://www.viva64.com/en/b/0414/#ID0EQ1CI [ruby-core:76973]
-
-Fri Aug 19 01:00:53 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * proc.c (mnew_missing): Remove an unused argument.
- After r51126 rid is not used.
-
-Thu Aug 18 09:26:52 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * gems/bundled_gems: bump to test-unit-3.2.1
-
-Thu Aug 18 02:36:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/rbinstall.rb: skip gems which failed to build extensions.
- [ruby-dev:49764] [Bug #12683]
-
-Wed Aug 17 23:35:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gems/bundled_gems (tk): bump up to 0.1.1.
-
-Wed Aug 17 23:14:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: build gem extensions into separate directories
-
- * tool/rbinstall.rb: install pre-built gem extension files gem
- extension directories. [ruby-core:76931] [Bug #12681]
-
-Tue Aug 16 21:04:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (UNICODE_HDR_DIR): separate unicode header files from
- unicode data files. [ruby-core:76879] [Bug #12677]
-
-Tue Aug 16 11:17:51 2016 Koichi ITO <koic.ito@gmail.com>
-
- * lib/net/http/header.rb: Fix typo. [ci skip][fix GH-1407]
- * transcode.c: ditto.
-
-Tue Aug 16 11:02:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/make-snapshot (package): save generated header files from
- unicode data. [ruby-core:76879] [Bug #12677]
-
-Mon Aug 15 20:31:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * node.c (dump_array): show nd_alen field in NODE_ARRAY only in
- the first node. it is nd_end in the rest nodes.
-
-Mon Aug 15 16:41:32 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * appveyor.yml: Update libressl version to 2.3.7.
-
-Mon Aug 15 11:46:50 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): extension libraries in gems cannot link
- statically.
-
-Sun Aug 14 22:35:40 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * id_table.c (hash_table_extend): should not shrink the table than
- the previous capacity. [ruby-core:76534] [Bug #12614]
-
-Sun Aug 14 18:51:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gems/bundled_gems: add gemified tk 0.1.0.
- this needs `extract-gems` to build.
-
-Sun Aug 14 14:54:14 2016 Kouhei Sutou <kou@cozmixng.org>
-
- * object.c (InitVM_Object): Update referenced document path.
-
-Sat Aug 13 23:08:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (num_funcall0, num_funcall1): get rid of infinite
- recursion in fallback methods of Numeric.
-
-Sat Aug 13 11:10:08 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (command_asgn, arg): fix syntax errors with chained
- assignment with op assign. [Bug #12669]
-
-Sat Aug 13 10:52:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt, arg): rescue modifier in command op assignment
- should be limited to rhs only. [ruby-core:75621] [Bug #12402]
-
-Sat Aug 13 07:51:40 2016 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_val2variant): fix integer conversion in
- cygwin64.
-
-Fri Aug 12 21:05:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/webrick/config.rb (WEBrick::Config::General):
- disable reverse lookup by default. [ruby-core:45514] [Feature #6559]
- Socket.do_not_reverse_lookup is true by default but WEBrick
- overwrote it.
- patch by Eric Hodel [ruby-core:45527]
-
-Fri Aug 12 12:50:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (rb_syntax_error_append): fix newline in syntax error
- message to the beginning, not after file name and line number.
- [Feature #11951]
-
-Thu Aug 11 16:24:23 2016 Ferdinand Niedermann <nerdinand@nerdinand.com>
-
- * compar.c (cmp_clamp): Introduce Comparable#clamp. [Feature #10594]
-
-Thu Aug 11 03:16:59 2016 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/prime.rb: Optimize prime?
- Adapted from patch by Jabari Zakiya [#12665]
-
- * test/test_prime.rb: Improve test
-
-Wed Aug 10 22:37:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (command_rhs, arg_rhs): introduce new rules to reduce
- repeated rules with rescue modifier.
-
-Wed Aug 10 17:26:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (command_asgn): rescue modifier in command assignment
- should be limited to rhs only. [ruby-core:75621] [Bug #12402]
-
-Wed Aug 10 15:35:03 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/resolv/resolv.c: needs windows.h for iphlpapi.h on
- cygwin. [ruby-core:76791] [Bug #12663]
-
- * ext/win32/resolv/resolv.c (w32error_make_error): use
- Win32::Resolv::Error, an alias of Win32::Registry::Error.
-
-Tue Aug 9 17:50:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * hash.c (rb_hash_map_v, rb_hash_map_v_bang): implement Hash#map_v and
- Hash#map_v! [Feature #12512] [ruby-core:76095]
-
- * test/ruby/test_hash.rb: add tests for above change.
-
-Tue Aug 9 16:09:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_insnhelper.c (vm_getivar): use always_inline because
- gcc7 doesn't inline this without always_inline.
-
-Tue Aug 9 15:41:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/tk: Tk is removed from stdlib. [Feature #8539]
- https://github.com/ruby/tk is the new upstream.
-
-Tue Aug 9 00:12:31 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * doc/maintainers.rdoc: Remove moved file section.
-
-Mon Aug 8 20:56:46 2016 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/sample/excel1.rb, ext/win32ole/sample/excel2.rb,
- ext/win32ole/sample/excel3.rb, ext/win32ole/sample/ie.rb,
- ext/win32ole/sample/ienavi.rb, ext/win32ole/sample/ienavi2.rb: use
- true instead of deprecated TRUE. [ci skip]
-
-Mon Aug 8 12:51:12 2016 Zarko Todorovski <zarko@ca.ibm.com>
-
- * internal.h (RBASIC_CLEAR_CLASS): Reroute ANSI C's strict
- aliasing rule.
- [ruby-core:74427][Bug #12191][ruby-core:76747][Bug #12657]
-
-Sun Aug 7 18:08:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (InitVM_Object): deprecate toplevel constants TRUE,
- FALSE, and NIL. [Feature #12574]
-
-Sun Aug 7 06:48:21 2016 Eric Wong <e@80x24.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_write_internal):
- avoid undefined behavior
- * test/openssl/test_pair.rb (test_write_zero): new test
- [ruby-core:76751] [Bug #12660]
-
-Sat Aug 6 09:35:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * id_table.h (rb_id_table_iterator_result): add dummy sentinel
- member because C standard prohibits a trailing comma.
-
-Sat Aug 6 00:39:44 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (env_enc_str_new): make string for an environment
- variable name or value.
-
- * hash.c (env_name_new): make environment value string with the
- encoding for its name.
-
-Fri Aug 5 23:18:35 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * hash.c (env_str_new): taint the string. get rid of a test failure
- introduced at r55811.
-
-Fri Aug 5 17:04:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (w32_getenv): call rb_w32_getenv and rb_w32_ugetenv via
- this pointer without further comparisons.
-
-Thu Aug 4 11:54:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (env_assoc): the encoding of the value should be the
- locale, as well as other methods, [], fetch, values, etc.
-
-Wed Aug 3 21:31:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (reg_fragment_enc_error): compile_error is different
- between parser and ripper. [ruby-core:76397] [Bug #12651]
-
-Wed Aug 3 17:15:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_obj_clone2): restrict freeze option to true other
- than false which only has the effect. [Feature #12300]
-
-Wed Aug 3 10:47:07 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: introduce VM_FRAME_RUBYFRAME_P()
- and VM_FRAME_CFRAME_P().
- Most of case, RUBY_VM_NORMAL_ISEQ_P() is no
- longer needed.
-
- * vm_core.h: introduce rb_obj_is_iseq().
-
- * cont.c, vm.c: VM_FRAME_MAGIC_DUMMY with
- VM_FRAME_FLAG_CFRAME.
-
-Wed Aug 3 09:25:16 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: rename macros and make them inline functions.
-
- * rename VM_FRAME_TYPE_FINISH_P() to VM_FRAME_FINISHED_P().
- * rename VM_FRAME_TYPE_BMETHOD_P() to VM_FRAME_BMETHOD_P().
-
-Wed Aug 03 09:15:02 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: introduce VM_FRAME_FLAG_CFRAME to represent cfp->iseq
- type.
-
-Tue Aug 2 21:42:40 2016 Chia-sheng Chen <qitar888@gmail.com>
-
- * math.c (tanh): make faster by the extract form if three
- hyperbolic functions are unavailable. [Feature #12647]
-
-Tue Aug 2 12:37:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/option.c, ext/socket/rubysocket.h (inet_ntop): share
- the fallback definition. [ruby-core:76646] [Bug #12645]
-
-Tue Aug 2 04:07:29 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (set_pioinfo_extra): use more reliable way to search
- the position of pioinfo of VC14, and also support debug library of it.
- patched by davispuh AT gmail.com
- [ruby-core:76644] [Bug #12644]
- this fixes also [Bug #12631]
-
-Mon Aug 1 21:39:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: [EXPERIMENTAL] build extension libraries in
- extracted gems.
-
-Mon Aug 1 16:07:18 2016 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * include/ruby/ruby.h (struct RStruct): no longer.
-
- * internal.h (struct RStruct): moved here.
-
- * struct.c (rb_struct_ptr): a compensation function for the lack
- of RSTRUCT_PTR. But now that we have RSTRUCT_GET/SET, that must
- not be used anyway. I mark this deprecated. Dont use it.
-
-Mon Aug 1 14:50:06 2016 Jeremy Evans <code@jeremyevans.net>
-
- * object.c (rb_obj_clone2): Allow Object#clone to take freeze:
- false keyword argument to not freeze the clone.
- [ruby-core:75017][Feature #12300]
-
- * test/ruby/test_object.rb (TestObject): test for it.
-
-Mon Aug 1 12:16:19 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/json/*, test/json/json_parser_test.rb: Update json-2.0.2.
-
-Sun Jul 31 16:17:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/resolv/resolv.c (get_dns_server_list): [Win32] get DNS
- servers only for connected network devices by GetNetworkParams
- API. [Bug #12604]
-
-Sat Jul 30 12:13:26 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c (String#downcase), NEWS: Mentioned that case mapping for all
- of ISO-8859-1~16 is now supported. [ci skip]
-
-Sat Jul 30 12:00:01 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_2.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-2, by Yushiro Ishii.
-
-Fri Jul 29 20:57:12 2016 chuanshuo <lilijreey@126.com>
-
- * *.c: rename rb_funcall2 to rb_funcallv, except for extensions
- which are/will be/may be gems. [Fix GH-1406]
-
-Fri Jul 29 10:51:34 2016 Koichi Sasada <ko1@atdot.net>
-
- * proc.c (env_write): remove unused function.
-
-Fri Jul 29 10:49:52 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h (VM_LOCAL_P): should return an integer value.
- reported at
- http://d.hatena.ne.jp/nagachika/20160728/ruby_trunk_changes_55764_55770
-
-Fri Jul 29 04:23:08 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h (VM_ENV_LOCAL_P): return truthy (0 or not) value.
-
- * vm.c (rb_vm_make_proc_lambda): use VM_ENV_ESCAPED_P() macro.
-
-Fri Jul 29 03:49:04 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm.c, internal.h: remove RubyVM::Env class and all of env objects
- are imemo objects (imemo_env).
-
- * NEWS: describe this change. I believe nobody touch these objects
- because there are no method defined.
-
- * vm_core.h: remove the following definitions.
- * rb_cEnv decl.
- * GetEnvPtr() because Env is no longer T_DATA object.
-
- * vm_core.h (rb_env_t): fix layout for imemo values.
-
- * vm_core.h (vm_assert_env): added.
-
- * vm_core.h (vm_env_new): added.
-
-Thu Jul 28 19:53:21 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_core.h: revisit the structure of frame, block and env.
- [Bug #12628]
-
- This patch introduce many changes.
-
- * Introduce concept of "Block Handler (BH)" to represent
- passed blocks.
-
- * move rb_control_frame_t::flag to ep[0] (as a special local
- variable). This flags represents not only frame type, but also
- env flags such as escaped.
-
- * rename `rb_block_t` to `struct rb_block`.
-
- * Make Proc, Binding and RubyVM::Env objects wb-protected.
-
- Check [Bug #12628] for more details.
-
-Thu Jul 28 15:05:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (ruby_fl_type): use __extension__ to get rid
- of pedantic warning against RUBY_FL_USER19.
- https://github.com/skylightio/skylight-ruby/issues/64
-
- * include/ruby/ruby.h (rb_mul_size_overflow): ditto for use of
- int128.
-
-Wed Jul 27 10:32:59 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/windows_1253.c: Remove dead code found by Coverity Scan.
-
-Tue Jul 26 22:43:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (run_finalizer): make saved running finalizer state
- volatile to ensure not to be clobbered by longjmp.
-
-Tue Jul 26 19:26:00 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_insnhelper.c: introduce rb_vm_pop_frame() and use it
- instead of setting rb_thread_t::cfp directly.
-
- * vm_insnhelper.c (vm_pop_frame): return the result of
- finish frame or not.
-
-Tue Jul 26 19:06:39 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (rb_raw_obj_info): support to show Proc obj.
-
-Tue Jul 26 18:55:55 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_mark): add `inline' explicitly.
- I expected to inline this function implicitly at the loop
- (ex: marking T_ARRAY objects) but sometimes it remains as
- normal call.
-
-Tue Jul 26 16:33:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/windows_1257.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1257, by Sho Koike.
-
-Tue Jul 26 16:19:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/windows_1250.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1250, by Sho Koike.
-
- * ChangeLog: Fixed order of previous two entries.
-
-Tue Jul 26 15:54:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/windows_1253.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1253, by Takumi Koyama.
-
-Tue Jul 26 15:30:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/windows_1251.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1251, by Shunsuke Sato.
-
-Tue Jul 26 13:04:59 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Add explicit skip test for
- availability of Unicode data files.
-
-Mon Jul 25 21:33:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * range.c (check_step_domain): check step argument domain by <=>
- method, instead of < and >.
-
-Mon Jul 25 21:11:32 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * doc/maintainers.rdoc: fix filenames.
-
-Mon Jul 25 16:59:00 2016 Koichi Sasada <ko1@atdot.net>
-
- * debug.c (ruby_debug_printf): use rb_raw_obj_info()
- instead of rb_inspect() because it is more robust way
- to see object internal.
-
-Sun Jul 24 16:33:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * regenc.h/c, include/ruby/oniguruma.h, enc/ascii.c, big5.c, cp949.c,
- emacs_mule.c, euc_jp.c, euc_kr.c, euc_tw.c, gb18030.c, gbk.c,
- iso_8859_1|2|3|4|5|6|7|8|9|10|11|13|14|15|16.c, koi8_r.c, koi8_u.c,
- shift_jis.c, unicode.c, us_ascii.c, utf_16|32be|le.c, utf_8.c,
- windows_1250|51|52|53|54|57.c, windows_31j.c, unicode.c:
- Remove conditional compilation macro ONIG_CASE_MAPPING. [Feature #12386].
-
-Sun Jul 24 12:53:42 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/maintainers.rdoc: xmlrpc is bundled gem from Ruby 2.4.
-
-Sun Jul 24 12:07:39 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/maintainers.rdoc: Update OpenSSL maintainer.
-
-Sat Jul 23 22:43:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * internal.h (Check_Type): inline check for the object type.
-
-Sat Jul 23 04:06:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (RTEST, NIL_P): use RUBY prefixed name in
- macros.
-
-Sat Jul 23 01:41:29 2016 Eric Wong <e@80x24.org>
-
- * lib/webrick/httpservlet/cgihandler.rb (do_GET): delete HTTP_PROXY
- * test/webrick/test_cgi.rb (test_cgi_env): new test
- * test/webrick/webrick.cgi (do_GET): new endpoint to dump env
- [ruby-core:76511] [Bug #12610]
-
-Fri Jul 22 19:55:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm.c (vm_set_main_stack): remove unnecessary check. toplevel
- binding must be initialized. [Bug #12611] (N1)
-
- * win32/win32.c (w32_symlink): fix return type. [Bug #12611] (N3)
-
- * string.c (rb_str_split_m): simplify the condition.
- [Bug #12611](N4)
-
-Fri Jul 22 17:13:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c (String#dump): Change escaping of non-ASCII characters in
- UTF-8 to use upper-case four-digit hexadecimal escapes without braces
- where possible [Feature #12419].
-
- * test/ruby/test_string.rb (test_dump): Add tests for above.
-
-Fri Jul 22 10:35:35 2016 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/attribute.rb (REXML::Attribute#to_string): Fix wrong
- entry reference name of double quote.
- [Bug #12609][ruby-core:76509]
- Patch by Joseph Marrero. Thanks!!!
-
-Fri Jul 22 10:32:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * template/unicode_norm_gen.tmpl: Remove
- UnicodeNormalize::UNICODE_VERSION at origin [Feature #12546].
-
-Fri Jul 22 09:23:51 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * LEGAL: Added entries for files under the USD license.
- [Bug #12598][ruby-core:76428][ci skip]
-
-Fri Jul 22 09:19:57 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * LEGAL: Added entry for `lib/rdoc/generator/template/darkfish/css/fonts.css`
- [Misc #12550][ruby-core:76255][ci skip]
-
-Fri Jul 22 06:28:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (run_finalizer): push and exec tag just once, instead of
- protecting for each finalizer.
-
- * gc.c (gc_start_internal, rb_gc_start): set finalizing flag
- whenever calling deferred finalizers not to recurse.
-
-Thu Jul 21 22:26:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * missing/strl{cat,cpy}.c: Update latest upstream files.
- [Misc #12205][ruby-core:74487]
- * LEGAL: Update license for missing/strl{cat,cpy}.c.
-
-Thu Jul 21 21:53:30 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * LEGAL: added file list with Public domain license.
- [ruby-core:76254][Bug #12549]
-
-Wed Jul 20 17:44:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enumerator.c (lazy_uniq): new method Enumerator::Lazy#uniq.
- [Feature #11090]
-
- * enum.c (enum_uniq): new method Enumerable#uniq.
- [Feature #11090]
-
-Wed Jul 20 17:35:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_hash_add_new_element): add new element or do nothing
- if it is contained already.
-
- * array.c (ary_add_hash, ary_add_hash_by): use
- rb_hash_add_new_element.
-
-Tue Jul 19 18:21:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * lib/unicode_normalize/tables.rb: Remove
- UnicodeNormalize::UNICODE_VERSION (#12546).
-
-Tue Jul 19 15:38:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_local_constants_i): exclude private constants
- when excluding inherited constants too. [Bug #12345]
-
-Sun Jul 17 23:42:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * numeric.c (num_finite_p, num_infinite_p): Add Numeric#finite? and
- Numeric#infinite? [Feature #12039] [ruby-core:73618]
-
- * complex.c (rb_complex_finite_p): Add Complex#finite?
-
- * complex.c (rb_complex_infinite_p): Add Complex#infinite?
-
- * test/ruby/test_bignum.rb: Add test for Integer#finite? and
- Integer#infinite?
-
- * test/ruby/test_fixnum.rb: ditto.
-
- * test/ruby/test_rational.rb: Add test for Rational#finite? and
- Rational#infinite?
-
- * test/ruby/test_complex.rb: Add test for Complex#finite? and
- Complex#infinite?
-
-Sun Jul 17 20:59:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk, enc/depend (casefold.h, name2ctype.h): move to
- unicode data directory per version.
-
-Sat Jul 16 06:26:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk, enc/Makefile.in: moved timestamp files for
- directories under the specific directory, to get rid of match
- with files under the source directory.
-
-Fri Jul 15 22:05:13 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c (str_buf_cat): Fix potential integer overflow of capa.
- In addition, termlen is used instead of +1.
-
-Fri Jul 15 21:30:38 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c (str_buf_cat): Fix capa size for embed string.
- Fix bug in r55547. [Bug #12536]
-
-Fri Jul 15 18:13:15 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * gems/bundled_gems: update latest gems.
-
-Fri Jul 15 17:08:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (ruby_strtod): do not underflow only by preceding zeros,
- which may be canceled out by the exponent.
- http://twitter.com/kazuho/status/753829998767714305
-
-Fri Jul 15 09:53:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/unicode/case-folding.rb, tool/enc-unicode.rb: check if
- Unicode versions are consistent with each other.
-
-Fri Jul 15 08:25:15 2016 Jeremy Evans <code@jeremyevans.net>
-
- * string.c (STR_BUF_MIN_SIZE): reduce from 128 to 127
- [ruby-core:76371] [Feature #12025]
- * string.c (rb_str_buf_new): adjust for above reduction
-
-Thu Jul 14 17:26:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (enc/unicode/name2ctype.h): remove stale recipe,
- which did not support Unicode age properties.
-
- * common.mk (enc/unicode/name2ctype.h): update by --header option
- of tool/enc-unicode.rb. enc/unicode/name2ctype.kwd file has not
- been used.
-
- * common.mk (enc/unicode/name2ctype.kwd): rule to create from
- Unicode data files, used only when the target does not exist.
-
-Thu Jul 14 13:10:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/json/lib/json/ext: remove stale directory. bundled
- extension libraries are placed under the directory for each
- architectures, but not mixed with plain text script libraries.
-
-Thu Jul 14 12:48:47 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/json/**/*.rb: merge original files from upstream repository.
- It only fixes styles of frozen string literal.
-
-Wed Jul 13 22:23:03 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/json/json_common_interface_test.rb: use assert_raise instead of
- assert_raises.
-
-Wed Jul 13 22:14:23 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/lib/test/unit.rb: added test files with `_test` suffix for json
- upstream.
- * test/json: merge original test files from json upstream.
-
-Wed Jul 13 18:09:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_9.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-9, by Kazuki Iijima.
-
- * enc/iso_8859_9.c: Exclude dotless i/I with dot from case-insensitive
- matching because they are not a case pair.
-
- * test/ruby/enc/test_iso_8859.rb: Make test coverage for ISO-8859-9
- a bit more complete.
-
-Wed Jul 13 17:21:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/windows_1252.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for Windows-1252, by Serina Tai.
-
- * test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
-
-Wed Jul 13 16:19:14 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_7.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-7, by Kosuke Kurihara.
-
- * test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
-
-Wed Jul 13 16:08:08 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_mark_roots): should mark the VM object itself to mark
- singleton class of the VM object.
- Before this patch, we only set mark bit for the VM object and
- invoke mark function separately.
- [Bug #12583]
-
- * test/ruby/test_gc.rb: add a test.
-
-Wed Jul 13 15:59:59 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * math.c (_USE_MATH_DEFINES): it must be set before including internal.h
- because internal.h includes ruby.h, ruby.h includes win32.h, and
- win32.h includes system's math.h.
- this change is to get rid of a compiler warning (redefinition of
- a macro) introduced at r55641.
-
-Wed Jul 13 15:19:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_1.c, enc/iso_8859_4.c: Avoid setting modification flag if
- there is no modification.
-
-Wed Jul 13 14:40:04 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_5.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-5, by Masaru Onodera.
-
- * test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
-
-Wed Jul 13 14:28:33 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * math.c (rb_math_sqrt): r55646 must use f_signbit.
-
-Wed Jul 13 14:22:50 2016 Koichi Sasada <ko1@atdot.net>
-
- * iseq.c (Init_ISeq): undef ISeq.translate and ISeq.load_iseq
- to prevent calling super classes' methods.
-
- Without this patch, you can write workaround like:
-
- class << RubyVM::InstructionSequence
- def translate; end
- undef translate
- end
-
- * test/ruby/test_iseq.rb: add a test.
-
-Wed Jul 13 14:16:03 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_method.c (method_entry_get_without_cache): check
- undefined method even if ruby_running is FALSE.
-
- We haven't call "undef"ed methods before ruby_running.
- So that this issue does not make troubles.
-
-Wed Jul 13 14:15:22 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/windows_1254.c: Adjust variable/macro names.
-
-Wed Jul 13 13:19:12 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_9.c, enc/windows_1254.c: Split Windows-1254 from
- ISO-8859-9 to be able to implement different case conversions.
-
-Wed Jul 13 13:08:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_7.c, enc/windows_1253.c: Split Windows-1253 from
- ISO-8859-7 to be able to implement different case conversions.
-
-Wed Jul 13 10:50:12 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_13.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-13, by Kanon Shindo.
-
-Wed Jul 13 10:31:39 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_13.c, enc/windows_1257.c: Split Windows-1257 from
- ISO-8859-13 to be able to implement different case conversions.
-
-Wed Jul 13 09:02:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_3.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-3, by Takuya Miyamoto.
-
- * test/ruby/enc/test_case_comprehensive.rb: Extend special treatment
- for Turkic.
-
- * enc/iso_8859_3.c: Exclude dotless i/I with dot from case-insensitive
- matching because they are not a case pair.
-
-Wed Jul 13 08:40:21 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_iso_8859.rb: Exclude dotless i/I with dot from
- case-insensitive matching because they are not a case pair.
-
-Tue Jul 12 23:13:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * math.c (rb_math_sqrt): [EXPERIMENTAL] move Complex sqrt support
- from mathn.rb.
-
-Tue Jul 12 01:25:09 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * configure.in, lib/mkmf.rb, win32/Makefile.sub (CSRCFLAG): make the
- compiler option replacable in Makefile.
-
- * win32/Makefile.sub (OUTFLAG, COUTFLAG): ditto.
-
- * win32/Makeile.sub, win32/setup.mak (CC): should not append `-nologo`
- option forcely.
-
-Mon Jul 11 18:05:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_1.c: Moved test for lowercase characters without
- uppercase equivalent.
-
-Mon Jul 11 17:49:25 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_4.c, enc/iso_8859_10.c, enc/iso_8859_14.c,
- enc/iso_8859_15.c, enc/iso_8859_16.c: Replace case-by-case code with
- lookup in ENC_ISO_8859_xx_TO_LOWER_CASE table.
-
-Mon Jul 11 16:00:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_each, strio_readlines): convert
- arguments just once before reading, instead of conversions for
- each lines, as r55603.
-
-Sun Jul 10 19:53:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_10.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-10, by Toya Hosokawa.
-
-Sun Jul 10 19:33:47 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Changed testing logic to
- catch unintended modifications of characters that do not have a case
- equivalent in the respective encoding.
- * enc/iso_8859_1.c, enc/iso_8859_15.c: Fixed unintended modifications of
- micro sign and y with diaeresis.
-
-Sun Jul 10 17:05:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_4.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-4, by Kotaro Yoshida.
-
-Sun Jul 10 16:17:47 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Fixed a comment
- (message belongs to last commit). [ci skip]
-
-Sun Jul 10 14:27:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (ruby_dtoa): [EXPERIMENTAL] adjust the case that the
- Float value is close to the exact but unrepresentable middle
- value of two values in the given precision, as r55604.
-
-Sun Jul 10 08:57:20 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * thread.c: Fixed implicit conversion error with Apple clang-800.0.31
-
-Sat Jul 9 12:43:09 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/getoptlong.rb: use false instead of FALSE.
-
-Fri Jul 8 21:49:28 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * thread.c (rb_wait_for_single_fd): Clean up fds.revents every time
- before calling ppoll(2). [Bug #12575] [ruby-dev:49725]
-
-Fri Jul 8 14:16:48 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * vm_args.c (vm_caller_setup_arg_block): call rb_sym_to_proc()
- directly to reduce method dispatch overhead.
-
-Fri Jul 8 08:43:31 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * io.c (rb_io_s_read): add description of pipes to the documentation
- of IO.read.
-
-Fri Jul 8 03:54:22 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_args.c (setup_parameters_complex): don't raise ArgumentError
- if an array is given for instance_exec with optional argument.
- [ruby-core:76300] [Bug #12568]
- https://github.com/rails/rails/pull/25699
-
-Fri Jul 8 00:47:36 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_eval.c (yield_under): change prototype to get argc/argv.
-
- * vm_eval.c (specific_eval): change for above.
-
- * vm_eval.c (rb_obj_instance_exec): avoid object allocation.
-
- * vm_eval.c (rb_mod_module_exec): ditto.
-
-Thu Jul 7 20:08:37 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * vm_args.c (vm_caller_setup_arg_block): disable symbol block
- argument optimization when tail call optimization is enabled,
- in order to avoid SEGV. [ruby-core:76288] [Bug #12565]
-
-Thu Jul 7 16:37:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (flo_round): [EXPERIMENTAL] adjust the case that the
- receiver is close to the exact but unrepresentable middle value
- of two values in the given precision.
- http://d.hatena.ne.jp/hnw/20160702
-
-Thu Jul 7 16:31:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_s_foreach, rb_io_s_readlines): convert arguments
- just once before reading, instead of conversions for each lines.
-
-Wed Jul 6 19:54:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_14.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-14, by Yutaro Tada.
-
-Wed Jul 6 19:24:48 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_1.c, enc/iso_8859_15.c, enc/iso_8859_16.c:
- Align indenting to onigmo convention.
-
-Wed Jul 6 18:59:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_15.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-15, by Maho Harada.
-
-Wed Jul 6 18:34:21 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_16.c, test/ruby/enc/test_case_comprehensive.rb:
- Implement non-ASCII case conversion for ISO-8859-16, by Satoshi Kayama.
-
-Wed Jul 6 14:44:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): store $headers in LOCAL_HDRS for
- depend files.
-
- * ext/digest/digest_conf.rb (digest_conf): add implementation
- specific headers to $header.
-
- * ext/digest/{md5,rmd160,sha1,sha2}/depend: add LOCAL_HDRS to the
- dependencies.
-
-Wed Jul 6 08:59:35 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/http/generic_request.rb (write_header): A Request-Line must
- not contain CR or LF.
-
-Wed Jul 6 07:11:27 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/ftp.rb (putline): raise an ArgumentError when
- CR or LF is included in a line.
-
-Tue Jul 5 20:49:30 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/json/*, test/json/*: Update json-2.0.1.
- Changes of 2.0.0: https://github.com/flori/json/blob/f679ebd0c69a94e3e70a897ac9a229f5779c2ee1/CHANGES.md#2015-09-11-200
- Changes of 2.0.1: https://github.com/flori/json/blob/f679ebd0c69a94e3e70a897ac9a229f5779c2ee1/CHANGES.md#2016-07-01-201
- [Feature #12542][ruby-dev:49706][fix GH-1395]
-
-Tue Jul 5 19:39:49 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c (rb_str_change_terminator_length): New function to change
- termlen and resize heap for the terminator. This is split from
- rb_str_fill_terminator (str_fill_term) because filling terminator
- and changing terminator length are different things. [Bug #12536]
-
- * internal.h: declaration for rb_str_change_terminator_length.
-
- * string.c (str_fill_term): Simplify only to zero-fill the terminator.
- For non-shared strings, it assumes that (capa + termlen) bytes of
- heap is allocated. This partially reverts r55557.
-
- * encoding.c (rb_enc_associate_index): rb_str_change_terminator_length
- is used, and it should be called whenever the termlen is changed.
-
- * string.c (str_capacity): New static function to return capacity
- of a string with the given termlen, because the termlen may
- sometimes be different from TERM_LEN(str) especially during
- changing termlen or filling terminator with specific termlen.
-
- * string.c (rb_str_capacity): Use str_capacity.
-
-Tue Jul 5 11:07:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * pack.c (pack_pack): use union instead of bare variable to ease
- optimizations and avoid assigning x87 floating point number.
- [ruby-core:74496] [Bug #12209]
-
- * pack.c (pack_unpack): ditto.
-
-Mon Jul 4 13:56:34 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * process.c: define sig_t if not exist.
- at least Solaris 10 and 11 doesn't have sig_t.
-
-Mon Jul 4 13:08:48 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * random.c (random_ulong_limited): avoid left shift count >= width of
- type on 32bit environment.
-
-Sun Jul 3 18:51:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb, test_regex_casefold.rb,
- test/test_unicode_normalize.rb: Replace UNICODE_VERSION from
- UnicodeNormalize with RbConfig::CONFIG['UNICODE_VERSION'] from
- feature 12460.
-
-Sun Jul 3 06:04:09 2016 Eric Wong <e@80x24.org>
-
- * process.c (disable_child_handler_fork_child): simplify
- [ruby-core:75781] [Misc #12439]
-
-Sun Jul 3 05:25:46 2016 Eric Wong <e@80x24.org>
-
- * tool/asm_parse.rb: add description
- * tool/change_maker.rb: ditto
- * tool/downloader.rb: ditto
- * tool/eval.rb: ditto
- * tool/expand-config.rb: ditto
- * tool/extlibs.rb: ditto
- * tool/fake.rb: ditto
- * tool/file2lastrev.rb: ditto
- * tool/gem-unpack.rb: ditto
- * tool/gen_dummy_probes.rb: ditto
- * tool/gen_ruby_tapset.rb: ditto
- * tool/generic_erb.rb: ditto
- * tool/id2token.rb: ditto
- * tool/ifchange: ditto
- * tool/insns2vm.rb: ditto
- * tool/instruction.rb: ditto
- * tool/jisx0208.rb: ditto
- * tool/merger.rb: ditto
- * tool/mkrunnable.rb: ditto
- * tool/node_name.rb: ditto
- * tool/parse.rb: ditto
- * tool/rbinstall.rb: ditto
- * tool/rbuninstall.rb: ditto
- * tool/rmdirs: ditto
- * tool/runruby.rb: ditto
- * tool/strip-rdoc.rb: ditto
- * tool/vcs.rb: ditto
- * tool/vtlh.rb: ditto
- * tool/ytab.sed: ditto
- * tool/enc-unicode.rb: fix typo
- * tool/mk_call_iseq_optimized.rb: ditto
- * tool/update-deps: ditto
- [ruby-core:76215] [Bug #12539]
- by Noah Gibbs <the.codefolio.guy@gmail.com>
-
-Sat Jul 2 18:04:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/mailto.rb (initialize): RFC3986_Parser#split sets opaque
- only if the URI has path-rootless, not path-empty.
- [ruby-core:76055] [Bug #12498]
- patched by Chris Heisterkamp <cheister@squareup.com>
-
-Sat Jul 2 04:26:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regcomp.c (noname_disable_map): don't optimize out group 0
- Ruby's Regexp doesn't allow normal numbered groups if the regexp
- has named groups. On such case it optimizes out related NT_ENCLOSE.
- But even on the case it can use \g<0>.
- This fix not to remove NT_ENCLOSE whose regnum is 0.
- [ruby-core:75828] [Bug #12454]
-
-Sat Jul 2 03:09:27 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c: Partially reverts r55547 and r55555.
- ChangeLog about the reverted changes are also deleted in this file.
- [Bug #12536] [ruby-dev:49699] [ruby-dev:49702]
-
-Sat Jul 2 02:22:22 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c (str_fill_term): When termlen increases, re-allocation
- of memory for termlen should always be needed.
- In this fix, if possible, decrease capa instead of realloc.
- [Bug #12536] [ruby-dev:49699]
-
-Fri Jul 1 20:20:20 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c: Specify termlen as far as possible.
- Additional fix for [Bug #12536] [ruby-dev:49699].
-
- * string.c (str_new_static): Specify termlen from the given encoding
- when creating a new String object is needed.
-
- * string.c (rb_tainted_str_new_with_enc): New function to create a
- tainted String object with the given encoding. This means that
- the termlen is correctly specified. Currently static function.
- The function name might be renamed to rb_tainted_enc_str_new
- or rb_enc_tainted_str_new.
-
- * string.c (rb_external_str_new_with_enc): Use encoding by using the
- above rb_tainted_str_new_with_enc().
-
-Fri Jul 1 19:38:57 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * test/fiddle/test_pointer.rb (test_to_str, test_to_s, test_aref_aset):
- Attempt to use independent strings for destructive tests that
- directly modify values on memory by using Fiddle::Pointer.
- [Bug #12537] [ruby-dev:49700]
-
-Fri Jul 1 18:20:00 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * .gdbinit (rb_ps_thread): show the detail of cfunc in ruby level
- backtrace.
-
-Fri Jul 1 13:26:39 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c (rb_str_subseq, str_substr): When RSTRING_EMBED_LEN_MAX
- is used, TERM_LEN(str) should be considered with it because
- embedded strings are also processed by TERM_FILL.
- Additional fix for [Bug #12536] [ruby-dev:49699].
-
-Fri Jul 1 12:11:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * .gdbinit (rb_count_objects): added gdb version of count_objects().
-
-Fri Jul 1 04:32:52 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * .gdbinit (rb_ps_thread): show ruby level backtrace.
- Usually you can call `rb_ps` to show ruby level backtraces
- for all living threads.
- Note that it can call with core file like `gcore <pid>`
- and `gdb ruby core.<pid>`.
-
-Thu Jun 30 19:15:13 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * string.c: Fix memory corruptions when using UTF-16/32 strings.
- [Bug #12536] [ruby-dev:49699]
-
- * string.c (rb_str_new_with_class): Use TERM_LEN of the "obj".
-
- * string.c (rb_str_plus, rb_str_justify): Use str_new0 which is aware
- of termlen.
-
- * string.c (str_shared_replace): Copy +termlen bytes instead of +1.
-
- * string.c (rb_str_times): termlen should not be included in capa.
-
- * string.c (RESIZE_CAPA_TERM): When using RSTRING_EMBED_LEN_MAX,
- termlen should be counted with it because embedded strings are
- also processed by TERM_FILL.
-
- * string.c (rb_str_capacity, str_shared_replace, str_buf_cat): ditto.
-
- * string.c (rb_str_drop_bytes, rb_str_setbyte, str_byte_substr): ditto.
-
-Wed Jun 29 22:24:37 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/psych/lib/psych_jars.rb: removed needless file required to JRuby.
-
-Wed Jun 29 22:21:38 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c: The "reuse" behavior of d2i_ functions does
- not work well with OpenSSL 1.0.0t. So avoid it.
-
-Wed Jun 29 15:18:28 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * insns.def (opt_succ): optimize like r55515. (but this argument is
- constant)
-
-Wed Jun 29 12:41:58 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/ruby/test_refinement.rb: skip
- test_prepend_after_refine_wb_miss on ARM or MIPS.
- [ruby-core:76031] [Bug #12491]
-
-Wed Jun 29 08:45:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (passed_block): convert passed block symbol to proc.
- based on the patch by Daisuke Sato in [ruby-dev:49695].
- [Bug #12531]
-
-Wed Jun 29 03:34:41 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * bignum.c (rb_big2ulong): the old logic seems to try to avoid
- calculating `-(long)(num-1)-1` if `num` is not LONG_MIN. (Note that
- `-LONG_MIN` may be larger than LONG_MAX) But C compilers can
- optimize it into single NEG instruction.
- Therefore those two conditions can be single if-body.
-
- * bignum.c (rb_big2long): ditto.
-
- * bignum.c (rb_big2ull): ditto.
-
- * bignum.c (rb_big2ll): ditto.
-
-Tue Jun 28 22:55:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/pstore.rb (PStore::CHECKSUM_ALGO): extract the algorithm for
- checksum, instead of qualified names for each times.
-
-Tue Jun 28 22:29:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bootstraptest/runner.rb: do not use safe navigation operator.
- this runner may run on older ruby. partially revert r53110
- (GH-1142 patched by @mlarraz).
-
-Tue Jun 28 22:09:09 2016 Akio Tajima <artonx@yahoo.co.jp>
-
- * lib/fileutils.rb: rescue Errno:EACCES for chown.
- [Bug #12520]
-
-Tue Jun 28 18:38:09 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * ext/digest/md5/md5ossl.h: Remove excess semicolons.
- Suppress warning on Solaris with Oracle Solaris Studio 12.
- [ruby-dev:49692] [Bug #12524]
-
- * ext/digest/md5/md5cc.h: ditto.
- * ext/digest/sha1/sha1cc.h: ditto.
- * ext/digest/sha1/sha1ossl.h: ditto.
- * ext/digest/sha2/sha2cc.h: ditto.
- * ext/digest/sha2/sha2ossl.h: ditto.
- * ext/openssl/ossl_pkey_rsa.c: ditto.
-
-Tue Jun 28 15:56:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/enc/test_case_comprehensive.rb: noting to test if
- Unicode data files are available.
- [ruby-core:76160] [Bug #12433]
-
- * test/test_unicode_normalize.rb: ditto.
-
-Tue Jun 28 15:20:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/net/http.rb (Net::HTTP#proxy_uri): cache the case no proxy
- is used.
-
-Tue Jun 28 09:56:29 2016 Stefan Schussler <mail@stefanschuessler.de>
-
- * object.c (rb_mod_eqq): [DOC] Fix typo in RDoc. [Fix GH-1393]
-
-Tue Jun 28 02:41:32 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * insns.def (opt_plus): use `- 1` instead of `& (~1)` to allow
- compilers to use x86 LEA instruction (3 operand).
- Even if 3 operand LEA's latency is 3 cycle after SandyBridge,
- it reduces code size and can be faster because of super scalar.
-
- * insns.def (opt_plus): calculate and use rb_int2big.
- On positive Fixnum overflow, `recv - 1 + obj` doesn't carry
- because recv's msb and obj's msb are 0, and resulted msb is 1.
- Therefore simply rshift and cast as signed long works fine.
- On negative Fixnum overflow, it will carry because both arguments'
- msb are 1, and resulted msb is also 1.
- In this case it needs to restore carried sign bit after rshift.
-
-Mon Jun 27 16:58:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/fileutils.rb (FileUtils#install): accecpt symbolic mode, as
- well as chmod.
-
- * lib/fileutils.rb (FileUtils#install): add owner and group
- options.
-
-Mon Jun 27 08:56:55 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (ADD_TRACE): ignore trace instruction on non-positive
- line.
-
- * parse.y (coverage): get rid of ArgumentError when the starting
- line number is not positive. [ruby-core:76141] [Bug #12517]
-
-Sun Jun 26 10:20:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32/lib/Win32API.rb (Win32API#initialize): Cygwin
- 2.5.2-1 (perhaps) seems to no longer append ".dll" suffix
- implicitly.
-
- * ext/win32/lib/win32/resolv.rb (Win32::Resolv): ditto. Fix the
- error reported by yamataka AT u08.itscom.net in
- [ruby-list:50339], and pointed out and patched by cerberus AT
- m3.kcn.ne.jp in [ruby-list:50341].
-
-Sat Jun 25 10:07:52 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * test/openssl/test_ocsp.rb: Ignore errors caused by bugs that exist in
- LibreSSL >= 2.3.1.
-
-Sat Jun 25 02:33:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_method.c (vm_respond_to): try method_missing if respond_to?
- is undefined, as if it is the default definition.
- [ruby-core:75377] [Bug #12353]
-
-Fri Jun 24 17:04:21 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/psych/*, test/psych/*: Update psych 2.1.0
- This version fixed [Bug #11988][ruby-core:72850]
-
-Fri Jun 24 13:12:41 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*:
- Update rubygems 2.6.5 and 2.6.6.
- Release note of 2.6.5: https://github.com/rubygems/rubygems/commit/656f5d94dc888d78d0d00f3598a4fa37391aac80
- Release note of 2.6.6: https://github.com/rubygems/rubygems/commit/ccb9c3300c063f5b5656669972d24a10ef8afbf5
-
-Fri Jun 24 09:17:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (lib/unicode_normalize/tables.rb): should not depend
- on Unicode data files unless ALWAYS_UPDATE_UNICODE=yes, to get
- rid of downloading Unicode data unnecessary. [ruby-dev:49681]
-
- * common.mk (enc/unicode/casefold.h): update Unicode files in a
- sub-make, not to let the header depend on the files always.
-
- * enc/unicode/case-folding.rb: if gperf is not usable, assume the
- existing file is OK.
-
-Tue Jun 21 19:44:54 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_regex_casefold.rb: Add Windows-1251, KOI8-R, and
- KOI8-U to encodings; definitely removed EUC-JP.
-
-Tue Jun 21 19:32:23 2016 Mark St.Godard <markstgodard@gmail.com>
-
- * lib/webrick/httprequest.rb (setup_forwarded_info): Use the first
- value in X-Forwarded-Proto, if header contains multiple comma
- separated values. Some middlewares may add these values to the
- list, not replacing. [Fix GH-1386]
-
-Tue Jun 21 17:17:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/test_io.rb: Skip test_readpartial_with_not_empty_buffer,
- test_read_buffer_error, test_read_unlocktmp_ensure,
- test_readpartial_unlocktmp_ensure, and
- test_sysread_unlocktmp_ensure on cygwin,
- because these tests repeatedly hang. This makes test_io.rb
- complete in finite time on cygwin.
-
- * ChangeLog: Fix test_in.rb -> test_io.rb (two instances).
-
-Tue Jun 21 16:38:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_casemap): do not put code with side effects
- inside RSTRING_PTR() macro which evaluates the argument multiple
- times.
-
-Tue Jun 21 16:13:45 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_casemap): fix memory leak.
-
-Tue Jun 21 16:12:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_casemap): int is too small for string size.
-
-Tue Jun 21 15:42:22 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/test_io.rb: Skip test_read_buffer_error on cygwin,
- because this test repeatedly hangs.
-
-Tue Jun 21 15:35:14 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * LEGAL: Added filenames and copyrights for some files in
- enc/trans/JIS.
-
-Tue Jun 21 00:56:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (get_special_folder): fix calling convention of
- SHGetPathFromIDListEx, which should be WINAPI. pointed out by
- @arton at http://twitter.com/arton/status/744884064277016576
-
-Tue Jun 21 00:22:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in, include/ruby/defines.h (RUBY_USE_SETJMPEX):
- include setjmpex.h only when using setjmpex() for RUBY_SETJMP.
- the header of mingw32 overrides setjmp() by setjmpex().
-
-Mon Jun 20 18:39:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/test_io.rb: Skip test_open_fifo_does_not_block_other_threads
- on cygwin. Fifos seem to work okay in cygwin, but this test repeatedly
- hangs.
-
-Mon Jun 20 13:35:06 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * vm.c (invoke_bmethod, invoke_block_from_c_0): revert r52104
- partially to avoid "self has wrong type to call super in this
- context" errors.
- [ruby-core:72724] [Bug #11954]
-
-Mon Jun 20 12:53:38 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * test/rubygems/test_gem_remote_fetcher.rb: OpenSSL::PKey::DH#priv_key=
- is not defined when ext/openssl is built with OpenSSL 1.1.0.
- https://github.com/rubygems/rubygems/pull/1648
- [ruby-core:75225] [Feature #12324]
-
-Sun Jun 19 21:25:43 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c: Add OCSP::SingleResponse that represents an
- OCSP SingleResponse structure. Also add two new methods #responses
- and #find_response to OCSP::BasicResponse. A BasicResponse has one or
- more SingleResponse. We have OCSP::BasicResponse#status that returns
- them as an array of arrays, each containing the content of a
- SingleResponse, but this is not useful. When validating an OCSP
- response, we need to look into the each SingleResponse and check their
- validity but it is not simple. For example, when validating for a
- certificate 'cert', the code would be like:
-
- # certid_target is an OpenSSL::OCSP::CertificateId for cert
- basic = res.basic
- result = basic.status.any? do |ary|
- ary[0].cmp(certid_target) &&
- ary[4] <= Time.now && (!ary[5] || Time.now <= ary[5])
- end
-
- Adding OCSP::SingleResponse at the same time allows exposing
- OCSP_check_validity(). With this, the code above can be rewritten as:
-
- basic = res.basic
- single = basic.find_response(certid_target)
- result = single.check_validity
-
- * test/openssl/test_ocsp.rb: Test this.
-
-Sun Jun 19 18:40:19 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspbres_add_status): Allow specifying
- the times (thisUpdate, nextUpdate and revocationTime) with Time
- objects. Currently they accepts only relative seconds from the current
- time. This is inconvenience, especially for revocationTime. When
- Integer is passed, they are still treated as relative times. Since the
- type check is currently done with rb_Integer(), this is a slightly
- incompatible change. Hope no one passes a relative time as String or
- Time object...
- Also, allow passing nil as nextUpdate. It is optional.
-
- * ext/openssl/ruby_missing.h: Define RB_INTEGER_TYPE_P() if not defined.
- openssl gem will be released before Ruby 2.4.0.
-
-Sun Jun 19 18:39:38 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c: Implement OCSP::{CertificateId,Request,
- BasicResponse,Response}#initialize_copy.
- [ruby-core:75504] [Bug #12381]
-
- * test/openssl/test_ocsp.rb: Test them.
-
-Sun Jun 19 18:29:50 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkey_dh.c, ext/openssl/ossl_pkey_dsa.c,
- ext/openssl/ossl_pkey_ec.c, ext/openssl/ossl_pkey_rsa.c: Implement
- initialize_copy method for OpenSSL::PKey::*.
- [ruby-core:75504] [Bug #12381]
-
- * test/openssl/test_pkey_dh.rb, test/openssl/test_pkey_dsa.rb,
- test/openssl/test_pkey_ec.rb, test/openssl/test_pkey_rsa.rb: Test they
- actually copy the OpenSSL objects, and modifications to cloned object
- don't affect the original object.
-
-Sun Jun 19 16:55:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/test_dir_m17n.rb: Skip tests with non-UTF-8 encodings
- on cygwin. Cygwin can use the Unicode PUA (private use area) to store
- bytes from non-UTF-8 filenames (see
- https://cygwin.com/cygwin-ug-net/using-specialnames.html#pathnames-specialchars),
- but we are not supporting this. [Bug #12443]
-
-Sun Jun 19 15:01:18 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * localeinit.c: Fix filesystem encoding for cygwin to UTF-8 (see
- https://cygwin.com/cygwin-ug-net/using-specialnames.html#pathnames-unusual)
-
-Sun Jun 19 14:31:07 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkey.h, ext/openssl/ossl_pkey_dh.c,
- ext/openssl/ossl_pkey_dsa.c, ext/openssl/ossl_pkey_rsa.c: A few days
- ago, OpenSSL changed {DH,DSA,RSA}_get0_*() to take const BIGNUM **.
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=fd809cfdbd6e32b6b67b68c59f6d55fbed7a9327
- [ruby-core:75225] [Feature #12324]
-
-Sun Jun 19 11:19:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_path_to_class): consider the string length
- instead of a terminator.
-
- * variable.c (rb_path_to_class): search the constant at once
- instead of checking if defined and then getting it.
-
-Sat Jun 18 14:01:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/rubygems/test_gem_installer.rb: Fixed broken test with extension
- build. https://github.com/rubygems/rubygems/pull/1645
-
-Sat Jun 18 13:59:54 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems
- HEAD(2c6d256). It contains to update vendored Molinillo to 0.5.0.
- https://github.com/rubygems/rubygems/pull/1638
-
-Sat Jun 18 10:13:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (build-ext), ext/extmk.rb: use variable EXTENCS
- different than ENCOBJS, to get rid of circular dependency.
- build libencs when linking encodings statically.
- [ruby-core:75618] [Bug #12401]
-
-Sat Jun 18 08:52:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_getline): fix pointer index
- overflow. reported by Guido Vranken <guido AT guidovranken.nl>.
-
-Thu Jun 16 16:35:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (Init_class_hierarchy): prevent rb_cObject which is the
- class tree root, from GC. [ruby-dev:49666] [Bug #12492]
-
-Thu Jun 16 12:17:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (tr_trans): adjust buffer size by processed and rest
- lengths, instead of doubling repeatedly.
-
-Thu Jun 16 11:15:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (tr_trans): consider terminator length and fix heap
- overflow. reported by Guido Vranken <guido AT guidovranken.nl>.
-
-Thu Jun 16 00:02:32 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_verify, ossl_ocspbres_verify):
- Use ossl_clear_error() so that they don't print warnings to stderr and
- leak errors in the OpenSSL error queue. Also, check the return value
- of OCSP_*_verify() correctly. They can return -1 on verification
- failure.
-
-Wed Jun 15 19:52:23 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_sign, ossl_ocspbres_sign): Allow
- specifying hash algorithm used in signing. They are hard coded to use
- SHA-1.
- Based on a patch provided by Tim Shirley <tidoublemy@gmail.com>.
- [ruby-core:70915] [Feature #11552] [GH ruby/openssl#28]
-
- * test/openssl/test_ocsp.rb: Test sign-verify works.
-
-Wed Jun 15 01:46:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c: [DOC] fix rdoc directive, and an example of negative
- value. [ruby-core:76025] [Bug #12487]
-
-Wed Jun 15 01:44:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/mkconfig.rb: provide Unicode Version information as
- RbConfig::CONFIG['UNICODE_VERSION'].
- [ruby-core:75845] [Feature #12460]
-
-Wed Jun 15 00:01:18 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/ruby/enc/test_case_comprehensive.rb
- (TestComprehensiveCaseFold::read_data): use \A and \z instead of
- ^ and $ in regexp.
-
-Tue Jun 14 23:43:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/backward.h (rb_cFixnum, rb_cBignum): remove the
- backward compatibility macros, to fail incompatible extension
- libraries early. [Bug #12427]
-
-Tue Jun 14 22:22:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * strftime.c (rb_strftime_with_timespec): limit the result string
- size by the format length, to get rid of unlimited memory use.
-
-Tue Jun 14 22:11:11 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspcid_get_issuer_name_hash,
- ossl_ocspcid_get_issuer_key_hash, ossl_ocspcid_get_hash_algorithm):
- Add accessor methods OCSP::CertificateId#issuer_name_hash,
- #issuer_key_hash, #hash_algorithm.
- Based on a patch provided by Paul Kehrer <paul.l.kehrer@gmail.com>.
- [ruby-core:48062] [Feature #7181]
-
- * test/openssl/test_ocsp.rb: Test these new methods.
-
-Tue Jun 14 22:07:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/date/date_strftime.c (date_strftime_with_tmx): reject too
- large precision to get rid of buffer overflow.
- reported by Guido Vranken <guido AT guidovranken.nl>.
-
-Tue Jun 14 21:40:42 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspbres_to_der, ossl_ocspcid_to_der):
- Implement #to_der methods for OCSP::BasicResponse and
- OCSP::CertificateId.
-
- (ossl_ocspreq_initialize, ossl_ocspres_initialize): Use GetOCSP*()
- instead of raw DATA_PTR().
-
- (ossl_ocspbres_initialize, ossl_ocspcid_initialize): Allow
- initializing from DER string.
-
- (Init_ossl_ocsp): Define new #to_der methods.
-
- * test/openssl/test_ocsp.rb: Test these changes. Also add missing tests
- for OCSP::{Response,Request}#to_der.
-
-Tue Jun 14 21:35:00 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/openssl_missing.h (DH_set0_pqg, RSA_set0_key):
- DH_set0_pqg() allows 'q' to be NULL. Fix a typo in RSA_set0_key().
- Fixes r55285. [ruby-core:75225] [Feature #12324]
-
-Mon Jun 14 10:19:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * NEWS: describe Integer#digits.
-
-Mon Jun 13 21:09:40 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * thread.c (debug_deadlock_check): show thread lock dependency and
- backtrace [Feature #8214] [ruby-dev:47217]
-
- * thread.c (thread_status_name): show "sleep_forever" instead of
- "sleep" if called from inspect.
-
-Mon Jun 13 20:50:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (reg_named_capture_assign_iter): remove named capture
- conflict warnings. it is just annoying rather than useful.
- [ruby-core:75416] [Bug #12359]
-
-Mon Jun 13 20:04:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * numeric.c (rb_int_digits, rb_fix_digits, rb_int_digits_bigbase):
- Add Integer#digits to extract columns in place-value notation
- [Feature #12447] [ruby-core:75799]
-
- * test/ruby/test_integer.rb: Add tests for the above change.
-
- * test/ruby/test_bignum.rb: ditto.
-
-Mon Jun 13 20:34:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (RUBY_INTEGER_UNIFICATION): macro to tell if
- Integer is integrated. [ruby-core:75718][Bug #12427]
-
- * include/ruby/backward.h, internal.h (rb_cFixnum, rb_cBignum):
- fallback to rb_cInteger.
-
- * bignum.c, numeric.c, ext/json/generator/generator.{c,h}: use the
- macro.
-
-Mon Jun 13 16:58:53 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Add tests for full Unicode
- swapcase.
-
-Sun Jun 12 14:48:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Add tests for ASCII-only
- swapcase; store calculated values in hashes.
-
-Sun Jun 12 14:05:45 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_get_auth_tag,
- ossl_cipher_set_auth_tag): Check if the cipher flags retrieved by
- EVP_CIPHER_CTX_flags() includes EVP_CIPH_FLAG_AEAD_CIPHER to see if
- the cipher supports AEAD. AES-GCM was the only supported in OpenSSL
- 1.0.1.
-
- (Init_ossl_cipher): Fix doc; OpenSSL::Cipher::AES.new(128, :GCM) can't
- work.
-
- * ext/openssl/openssl_missing.h: Define EVP_CTRL_AEAD_{GET,SET}_TAG if
- missing. They are added in OpenSSL 1.1.0, and have the same value as
- EVP_CTRL_GCM_{GET,SET}_TAG and EVP_CTRL_CCM_{GET,SET}_TAG.
-
-Sun Jun 12 13:47:42 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * test/openssl/test_engine.rb (test_openssl_engine_builtin,
- test_openssl_engine_by_id_string): Skip test if 'openssl' engine is
- already loaded. And test the number increased by Engine.load{_by_id,},
- not the total count of loaded engines. Previously, we called
- OpenSSL::Engine.cleanup every time running a test case, but we no
- longer can do it.
- [ruby-core:75225] [Feature #12324]
-
-Sun Jun 12 09:24:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (append_fspath): normalize directory name to be appended
- on OS X. [ruby-core:75957] [Ruby trunk Bug#12483]
- https://github.com/rails/rails/issues/25303#issuecomment-224834804
-
-Sat Jun 11 23:07:32 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/forwardable.rb (_delegator_method): get rid of a warning which
- causes test failures introduced at r55376.
-
-Sat Jun 11 18:37:58 2016 Marcus Stollsteimer <sto.mar@web.de>
-
- * ext/json/lib/*.rb: Removed some comments. Because these are unnecessary
- class description. [ci skip][Bug #12255][ruby-core:74835]
-
-Sat Jun 11 15:19:38 2016 takiy33 <takiy33@users.noreply.github.com>
-
- * lib/net/smtp.rb: [DOC] Remove dead link on documentation for
- Japanese of SMTP. [Fix GH-1380]
-
-Sat Jun 11 15:02:45 2016 Grant Hutchins <github@nertzy.com>
-
- * string.c (rb_str_oct): [DOC] fix typo, hornored -> honored.
- [Fix GH-1379]
-
-Sat Jun 11 14:04:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/objspace/objspace_dump.c: generate valid JSON for dump_all.
-
-Sat Jun 11 13:52:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/forwardable.rb (_delegator_method): remove __send__ call if
- possible, so that more optimizations will be enabled.
-
-Sat Jun 11 11:24:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/iso_8859.h (SHARP_s): name frequently used codepoint.
-
-Sat Jun 11 09:58:45 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_1.c: Revert to older version of code.
-
-Sat Jun 11 09:46:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/iso_8859_1.c: Implement non-ASCII case mapping.
-
- * test/ruby/enc/test_case_comprehensive.rb: Tests for above.
-
- * string.c: Add iso-8859-1 to supported encodings.
-
-Sat Jun 11 09:31:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/forwardable.rb (_delegator_method): leave the backtrace
- untouched during accessor. forwardable.rb does not appear in
- the backtrace during delegated method because of tail-call
- optimization.
-
-Sat Jun 11 01:38:31 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * include/ruby/defines.h (GCC_VERSION_SINCE): Fix logic error by
- adding parentheses. Fix failures of TestMkmf::TestConvertible
- with GCC 3.4.3 on Solaris 10. [Bug #12479] [ruby-dev:49660]
-
-Fri Jun 10 21:54:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/forwardable.rb (Forwardable._delegator_method): extract
- method generator and deal with non-module objects.
- [ruby-dev:49656] [Bug #12478]
-
-Fri Jun 10 17:35:11 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Special-case :ascii option in rb_str_capitalize_bang and
- rb_str_swapcase_bang.
-
-Fri Jun 10 17:12:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Special-case :ascii option in rb_str_upcase_bang (retry).
-
-Fri Jun 10 14:48:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (get_env_cstr): ensure NUL-terminated.
- [ruby-dev:49655] [Bug #12475]
-
- * string.c (rb_str_fill_terminator): return the pointer to the
- NUL-terminated content.
-
-Thu Jun 9 21:42:00 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_asn1.c (asn1integer_to_num): Use
- ASN1_ENUMERATED_to_BN() to convert an ASN1_ENUMERATED to a BN.
- Starting from OpenSSL 1.1.0, ASN1_INTEGER_to_BN() rejects
- non-ASN1_INTEGER objects. The format of INTEGER and ENUMERATED are
- almost identical so they behaved in the same way in OpenSSL <= 1.0.2.
- [ruby-core:75225] [Feature #12324]
-
- * test/openssl/test_asn1.rb (test_decode_enumerated): Test that it
- works.
-
-Thu Jun 9 21:10:04 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * tool/ifchange: fix timestamp error when target without
- directory.
-
-Thu Jun 9 19:46:22 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ssl.c: Add define guards for OPENSSL_NO_EC.
- SSL_CTX_set_ecdh_auto() is defined even when ECDH is disabled in
- OpenSSL's configuration. This fixes r55214.
-
- * test/openssl/test_pair.rb (test_ecdh_curves): Skip if the OpenSSL does
- not support ECDH.
-
- * test/openssl/utils.rb (start_server): Ignore error in
- SSLContext#ecdh_curves=.
-
-Thu Jun 9 18:12:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (un-runnable): fail with proper error message.
- [ruby-core:75905] [Bug #12472]
-
-Thu Jun 9 15:32:17 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (RBCONFIG): use ifchange tool to see if the content is
- changed and update the timestamp file.
-
- * tool/mkconfig.rb: remove ifchange features.
-
- * tool/ifchange: make target directory if it does not exist with
- its parent directories.
-
- * win32/ifchange.bat: drop support for command.com used on old
- systems.
-
-Thu Jun 9 15:03:35 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Check for CRYPTO_malloc() and SSL_new().
- OpenSSL_add_all_digests() and SSL_library_init() are deprecated and
- converted to macros in OpenSSL 1.1.0.
- [ruby-core:75225] [Feature #12324]
-
-Wed Jun 8 23:09:51 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * string.c (rb_str_ascii_casemap): fix compile error.
-
-Wed Jun 8 22:22:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Revert previous commit (possibility of endless loop).
-
-Wed Jun 8 21:57:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Special-case :ascii option in rb_str_upcase_bang.
-
-Wed Jun 8 21:28:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: New static function rb_str_ascii_casemap; special-casing
- :ascii option in rb_str_upcase_bang and rb_str_downcase_bang.
-
- * regenc.c: Fix a bug (wrong use of unnecessary slack at end of string).
-
- * regenc.h -> include/ruby/oniguruma.h: Move declaration of
- onigenc_ascii_only_case_map so that it is visible in string.c.
-
-Wed Jun 8 20:33:44 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * include/ruby/intern.h: Remove excess semicolons in PUREFUNC().
- Fix failure of TestMkmf::TestConvertible on Solaris with
- Oracle Solaris Studio 12. [ruby-dev:49651] [Bug #12470]
- * internal.h: ditto.
-
-Wed Jun 8 16:03:09 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/smtp.rb (getok, get_response): raise an ArgumentError when
- CR or LF is included in a line, because they are not allowed in
- RFC5321. Thanks, Jeremy Daer.
-
-Tue Jun 7 21:27:25 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * test/rubygems/*_{cert,cert_32}.pem: Regenerate test certificates for
- OpenSSL 1.1.0. This is already in upstream.
- https://github.com/rubygems/rubygems/commit/9be5c53939440a61c4bba73cfffbeb5cfadf72be
- [ruby-core:75225] [Feature #12324]
-
-Tue Jun 7 21:27:17 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * test/open-uri/test_ssl.rb: Regenerate test certificates. The test CA
- certificate was incorrectly generated. A CA certificate must have the
- basic constraints extension with cA bit set to TRUE. OpenSSL <= 1.0.2
- allowed the error when the certificate is in the trusted store but
- OpenSSL 1.1.0 no longer does.
- [ruby-core:75225] [Feature #12324]
-
-Tue Jun 7 21:20:38 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * test/openssl/test_x509name.rb: Don't register OID for 'emailAddress'
- and 'serialNumber'. A recent change in OpenSSL made OBJ_create()
- reject an already existing OID. They were needed to run tests with
- OpenSSL 0.9.6 which is now unsupported.
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=52832e470f5fe8c222249ae5b539aeb3c74cdb25
- [ruby-core:75225] [Feature #12324]
-
- * test/openssl/test_ssl_session.rb (test_server_session): Duplicate
- SSL::Session before re-adding to the session store. OpenSSL 1.1.0
- starts rejecting SSL_SESSION once removed by SSL_CTX_remove_session().
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=7c2d4fee2547650102cd16d23f8125b76112ae75
-
- * test/openssl/test_pkey_ec.rb (setup): Remove X25519 from @keys. X25519
- is new in OpenSSL 1.1.0 but this is for key agreement and not for
- signing.
-
- * test/openssl/test_pair.rb, test/openssl/test_ssl.rb,
- test/openssl/utils.rb: Set security level to 0 when using aNULL cipher
- suites.
-
- * test/openssl/utils.rb: Use 1024 bits DSA key for client certificates.
-
- * test/openssl/test_engine.rb: Run each test in separate process.
- We can no longer cleanup engines explicitly as ENGINE_cleanup() was
- removed.
- https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=6d4fb1d59e61aacefa25edc4fe5acfe1ac93f743
-
- * ext/openssl/ossl_engine.c (ossl_engine_s_cleanup): Add a note to the
- RDoc for Engine.cleanup.
-
- * ext/openssl/lib/openssl/digest.rb: Don't define constants for DSS,
- DSS1 and SHA(-0) when using with OpenSSL 1.1.0. They are removed.
-
- * test/openssl/test_digest.rb, test/openssl/test_pkey_dsa.rb,
- test/openssl/test_pkey_dsa.rb, test/openssl/test_ssl.rb,
- test/openssl/test_x509cert.rb, test/openssl/test_x509req.rb: Don't
- test unsupported hash functions.
-
-Tue Jun 7 17:49:52 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive: Change test for encodings
- without any non-ASCII case conversions from ASCII-only test
- to full test.
-
-Tue Jun 7 17:18:39 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c (rb_str_upcase_bang, rb_str_capitalize_bang,
- rb_str_swapcase_bang): Switch to use primitive.
-
-Tue Jun 7 16:44:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c (rb_str_downcase_bang): Switch to use primitive except if
- conversion can be done ASCII-only.
-
-Tue Jun 7 16:13:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive: Add regression tests for
- current ASCII-only case conversion.
-
-Tue Jun 7 15:28:38 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive: Fix method name
- (generate_casefold_tests -> generate_case_mapping_tests).
-
-Tue Jun 7 15:05:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * regenc.h/c: Rename onigenc_not_support_case_map to
- onigenc_ascii_only_case_map.
-
- * regenc.h: Add definition of onigenc_single_byte_ascii_only_case_map.
-
- * enc/iso_8859_X.c, windows_125X.c, ascii.c, us-ascii.c, koi8_x.c:
- Replace onigenc_not_support_case_map by
- onigenc_single_byte_ascii_only_case_map.
-
- * enc/big5.c, cp949.c, emacs_mule.c, euc_X.c, gbX.c, shift_jis.c,
- windows_31j.c: Replace onigenc_not_support_case_map by
- onigenc_ascii_only_case_map.
-
-Tue Jun 7 14:57:09 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Check for SSL_CTX_set_min_proto_version()
- macro added in OpenSSL 1.1.0. Version-specific methods, such as
- TLSv1_method(), are deprecated in OpenSSL 1.1.0. We need to use
- version-flexible methods (TLS_*method() or SSLv23_*method()) and
- disable other protocol versions as necessary.
- [ruby-core:75225] [Feature #12324]
-
- * ext/openssl/ossl_ssl.c: Use SSL_CTX_set_{min,max}_proto_version() to
- fix the protocol version.
-
-Tue Jun 7 12:55:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * regenc.c (onigenc_not_support_case_map): Move to end of file;
- (onigenc_single_byte_ascii_only_case_map): Add new function.
-
-Tue Jun 7 09:26:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * regenc.c (onigenc_not_support_case_map): Rewrite to work correctly
- in ASCII range.
-
-Mon Jun 6 23:00:00 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * appveyor.yml: Update libressl version to 2.3.5.
-
-Mon Jun 6 18:37:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_throw_start): check if the iseq is symbol
- proc, class definition should not be a symbol proc.
- [ruby-core:75856] [Bug #12462]
-
-Mon Jun 6 18:36:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Added UTF-16BE/LE and UTF-32BE/LE to supported encodings
- for Unicode case mapping.
-
- * test/ruby/enc/test_case_comprehensive.rb: Tests for above
- functionality; fixed an encoding issue in assertion error message.
-
-Mon Jun 6 17:29:35 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Speed up testing for small
- encodings by preselecting codepoints.
-
-Mon Jun 6 17:10:50 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_free): Use EVP_CIPHER_CTX_free()
- to free EVP_CIPHER_CTX allocated by EVP_CIPHER_CTX_new().
- [ruby-core:75225] [Feature #12324]
-
-Mon Jun 6 13:37:08 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c Change rb_str_casemap to use encoding primitive
- case_map instead of directly calling onigenc_unicode_case_map.
-
-Mon Jun 6 13:16:46 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_mapping.rb:
- Remove :lithuanian guard for Unicode case mapping.
-
-Mon Jun 6 10:39:56 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/openssl_missing.h: Include ruby/config.h. r55285 added
- some inline functions but VC does not recognize 'inline' keyword.
-
-Mon Jun 6 09:25:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (thread_start_func_2): report raised exception if
- report_on_exception flag is set. [Feature #6647]
-
-Mon Jun 6 01:36:24 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Check existence of SSL_is_server(). This
- function was introduced in OpenSSL 1.0.2.
- [ruby-core:75225] [Feature #12324]
-
- * ext/openssl/openssl_missing.h: Implement SSL_is_server() if missing.
-
- * ext/openssl/ossl_ssl.c (ssl_info_cb): Use SSL_is_server() to see if
- the SSL is server. The state machine in OpenSSL was rewritten and
- SSL_get_state() no longer returns SSL_ST_ACCEPT.
-
- (ossl_ssl_cipher_to_ary, ossl_sslctx_session_get_cb): Add some
- `const`s to suppress warning.
-
-Mon Jun 6 01:18:10 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_asn1.c (decode_bool): Do the same thing as
- d2i_ASN1_BOOLEAN() does by ourselves. This function is removed in
- OpenSSL 1.1.0.
- [ruby-core:75225] [Feature #12324]
-
-Mon Jun 6 00:34:16 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Check existence of accessor functions that
- don't exist in OpenSSL 0.9.8. OpenSSL 1.1.0 made most of its
- structures opaque and requires use of these accessor functions.
- [ruby-core:75225] [Feature #12324]
-
- * ext/openssl/openssl_missing.[ch]: Implement them if missing.
-
- * ext/openssl/ossl*.c: Use these accessor functions.
-
- * test/openssl/test_hmac.rb: Add missing test for HMAC#reset.
-
-Mon Jun 6 00:00:13 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/openssl_missing.[ch]: Implement EVP_PKEY_get0_*() and
- {RSA,DSA,EC_KEY,DH}_get0_*() functions.
- OpenSSL 1.1.0 makes EVP_PKEY/RSA/DSA/DH opaque. We used to provide
- setter methods for each parameter of each PKey type, for example
- PKey::RSA#e=, but this is no longer possible because the new API
- RSA_set0_key() requires the 'n' at the same time. This commit adds
- deprecation warning to them and adds PKey::*#set_* methods as direct
- wrapper for those new APIs. For example, 'rsa.e = 3' now needs to be
- rewritten as 'rsa.set_key(rsa.n, 3, rsa.d)'.
- [ruby-core:75225] [Feature #12324]
-
- * ext/openssl/ossl_pkey*.[ch]: Use the new accessor functions. Implement
- RSA#set_{key,factors,crt_params}, DSA#set_{key,pqg}, DH#set_{key,pqg}.
- Emit a warning with rb_warning() when old setter methods are used.
-
- * test/drb/ut_array_drbssl.rb, test/drb/ut_drb_drbssl.rb,
- test/rubygems/test_gem_remote_fetcher.rb: Don't set a priv_key for DH
- object that are used in tmp_dh_callback. Generating a new key pair
- every time should be fine - actually the private exponent is ignored
- in OpenSSL >= 1.0.2f/1.0.1r even if we explicitly set.
- https://www.openssl.org/news/secadv/20160128.txt
-
-Sun Jun 5 22:06:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * configure.in: Fix the timing to detect the appropriate C++ compiler
- in OS X.
-
-Sun Jun 5 21:42:24 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Check absence of CRYPTO_lock() to see if the
- OpenSSL has the new threading API. In OpenSSL <= 1.0.2, an application
- had to set locking callbacks to use OpenSSL in a multi-threaded
- environment. OpenSSL 1.1.0 now finds pthreads or Windows threads so we
- don't need to do something special.
- [ruby-core:75225] [Feature #12324]
-
- Also check existence of *_up_ref(). Some structures in OpenSSL have
- a reference counter. We used to increment it with CRYPTO_add() which
- is a part of the old API.
-
- * ext/openssl/openssl_missing.h: Implement *_up_ref() if missing.
-
- * ext/openssl/ossl.c: Don't set locking callbacks if unneeded.
-
- * ext/openssl/ossl_pkey.c, ext/openssl/ossl_ssl.c,
- ext/openssl/ossl_x509cert.c, ext/openssl/ossl_x509crl.c,
- ext/openssl/ossl_x509store.c: Use *_up_ref() instead of CRYPTO_add().
-
-Sun Jun 5 21:38:13 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Check if RAND_pseudo_bytes() is usable. It is
- marked as deprecated in OpenSSL 1.1.0.
- [ruby-core:75225] [Feature #12324]
-
- * ext/openssl/ossl_rand.c: Disable Random.pseudo_bytes if
- RAND_pseudo_bytes() is unavailable.
-
- * test/openssl/test_random.rb: Don't test Random.pseudo_bytes if not
- defined.
-
-Sun Jun 5 19:06:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * NEWS: Add news about Unicode-wide case mapping for
- String/Symbol#upcase/downcase/swapcase/capitalize(!).
-
-Sun Jun 5 15:24:33 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb:
- Remove :lithuanian guard for Unicode case mapping.
-
-Sun Jun 5 14:46:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Remove :lithuanian guard for Unicode case mapping.
-
-Sat Jun 4 10:54:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * missing/crypt.h (struct crypt_data): remove unnecessary member
- "initialized".
-
- * missing/crypt.c (des_setkey_r): nothing to be initialized in
- crypt_data.
-
- * configure.in (struct crypt_data): check for "initialized" in
- struct crypt_data, which may be only in glibc, and isn't on AIX
- at least.
-
-Sat Jun 4 10:38:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c: unify MAX_PATH, _MAX_PATH, and MAXPATHLEN to
- PATH_MAX, except for MAX_PATH in get_special_folder for an API
- limit.
-
-Fri Jun 3 21:27:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (process_options): rb_str_conv_enc() never set encoding
- of the source string, but returns the string itself if the
- conversion failed. then the instance variable does not need to
- be set again.
-
-Fri Jun 3 18:04:37 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ruby.c (process_options): need to duplicate path before passing it to
- rb_str_conv_enc() because the function might call rb_enc_associate()
- internally. this fixes test failures on Windows introduced at r55260.
-
-Fri Jun 3 17:44:25 2016 Reiner Herrmann <reiner@reiner-h.de>
-
- * lib/mkmf.rb (create_makefile): sort lists of source and object
- files in generated Makefile, unless given by extconf.rb.
- [Fix GH-1367]
-
-Thu Jun 2 21:18:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (get_special_folder): use SHGetPathFromIDListEx if
- available instead of old SHGetPathFromIDListW, to check the
- buffer size.
-
-Thu Jun 2 17:05:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (ruby_init_loadpath_safe): remove MAXPATHLEN restriction
- for Windows 10.
-
-Thu Jun 2 16:51:35 2016 Koichi ITO <koic.ito@gmail.com>
-
- * misc/ruby-mode.el (ruby-here-doc-beg-re),
- (ruby-here-doc-beg-match, ruby-parse-partial): Support for
- `squiggly heredoc' syntax in ruby-mode. [Fix GH-1372]
-
-Thu Jun 2 10:24:48 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Raise ArgumentError when invalid string is detected in
- case mapping methods.
-
- * enc/unicode.c: Check for invalid string and signal with negative
- length value.
-
- * test/ruby/enc/test_case_mapping.rb: Add tests for above.
-
- * test/ruby/test_m17n_comb.rb: Add a message to clarify test failure.
-
-Wed Jun 1 21:41:05 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Check existence of ASN1_TIME_adj(). The old
- ASN1_TIME_set() is not Year 2038 ready on sizeof(time_t) == 4
- environment. This function was added in OpenSSL 1.0.0.
- [ruby-core:45552] [Bug #6571]
-
- * ext/openssl/ossl_asn1.c (ossl_time_split): Added. Split the argument
- (Time) into the number of days elapsed since the epoch and the
- remainder seconds to conform to ASN1_TIME_adj().
- (obj_to_asn1utime, obj_to_asn1gtime): Use ossl_time_split() and
- ASN1_*TIME_adj().
-
- * ext/openssl/ossl_asn1.h: Add the function prototype for
- ossl_time_split().
-
- * ext/openssl/ossl_x509.[ch]: Add ossl_x509_time_adjust(). Similarly to
- obj_to_asn1*time(), use X509_time_adj_ex() instead of X509_time_adj().
-
- * ext/openssl/ossl_x509cert.c, ext/openssl/ossl_x509crl.c,
- ext/openssl/ossl_x509revoked.c: Use ossl_x509_time_adjust().
-
-Wed Jun 1 15:58:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: revert r55237. replace crypt, not crypt_r, and
- check if crypt is broken more.
-
- * missing/crypt.c: move crypt_r.c
-
- * string.c (rb_str_crypt): use crypt_r if provided by the system.
-
-Wed Jun 1 14:07:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * missing/crypt_r.c (a64toi): initialize statically and fix out of
- bounds access when salt is not 7bit clean.
-
-Wed Jun 1 11:34:59 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (MISSING): fixed build error introduced at r55237.
-
-Wed Jun 1 09:48:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_crypt): use reentrant crypt_r.
-
-Wed Jun 1 09:37:26 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * missing/crypt.c (des_setkey): void function never returns any value.
-
-Wed Jun 1 09:16:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * crypt.h: separate header file from missing/crypt.c.
-
- * missing/crypt.c (crypt_r, setkey_r, encrypt_r): add reentrant
- versions.
-
-Wed Jun 1 02:25:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * missing/crypt.c: fix size macros to use configured values
- for platforms long is larger than 32bit.
- [ruby-core:75792] [Bug #12446]
-
-Tue May 31 17:28:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Completion.candidate): get rid of
- nil as key names. [ruby-core:75773] [Bug #12438]
-
- * lib/optparse.rb (OptionParser#make_switch): char class option
- cannot be NoArgument, default to RequiredArgument.
-
-Tue May 31 00:30:11 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/raddrinfo.c (host_str, port_str): Use StringValueCStr
- instead of (Safe)StringValue, to detect NUL byte in the string.
-
-Mon May 30 22:02:01 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_asn1.c (time_to_time_t): Use NUM2TIMET() instead of
- NUM2LONG(). time_t may be larger than long.
- [ruby-core:45552] [Bug #6571]
-
-Mon May 30 21:15:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Document current behavior for other case mapping methods
- on String. [ci skip]
-
-Mon May 30 20:00:25 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Document current situation for String#downcase. [ci skip]
-
-Mon May 30 18:29:28 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): Enable the automatic
- curve selection for ECDH by calling SSL_CTX_set_ecdh_auto(). With
- this a TLS server automatically selects a curve which both the client
- and the server support to use in ECDH. This changes the default
- behavior but users can still disable ECDH by excluding 'ECDH' cipher
- suites from the cipher list (with SSLContext#ciphers=). This commit
- also deprecate #tmp_ecdh_callback=. It was added in Ruby 2.3.0. It
- wraps SSL_CTX_set_tmp_ecdh_callback() which will be removed in OpenSSL
- 1.1.0. Its callback receives two values 'is_export' and 'keylength'
- but both are completely useless for determining a curve to use in
- ECDH. The automatic curve selection was introduced to replace this.
-
- (ossl_sslctx_setup): Deprecate SSLContext#tmp_ecdh_callback=. Emit a
- warning if this is in use.
-
- (ossl_sslctx_set_ecdh_curves): Add SSLContext#ecdh_curves=. Wrap
- SSL_CTX_set1_curves_list(). If it is not available, this falls back
- to SSL_CTX_set_tmp_ecdh().
-
- (Init_ossl_ssl): Define SSLContext#ecdh_curves=.
-
- * ext/openssl/extconf.rb: Check the existence of EC_curve_nist2nid(),
- SSL_CTX_set1_curves_list(), SSL_CTX_set_ecdh_auto() and
- SSL_CTX_set_tmp_ecdh_callback().
-
- * ext/openssl/openssl_missing.[ch]: Implement EC_curve_nist2nid() if
- missing.
-
- * test/openssl/test_pair.rb (test_ecdh_callback): Use
- EnvUtil.suppress_warning to suppress deprecated warning.
-
- (test_ecdh_curves): Test that SSLContext#ecdh_curves= works.
-
- * test/openssl/utils.rb (start_server): Use SSLContext#ecdh_curves=.
-
-Mon May 30 16:28:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/raddrinfo.c (host_str, port_str): use RSTRING_LEN
- instead of strlen, since RSTRING_PTR StringValueCStr may not be
- NUL-terminated when SHARABLE_MIDDLE_SUBSTRING=1. reported by
- @tmtms, http://twitter.com/tmtms/status/736910516229005312
-
-Mon May 30 16:20:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (str_fill_term): return new pointer reallocated by
- filling terminator.
-
-Mon May 30 14:54:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (enc_subseq): share the return value and
- the buffer as possible.
-
-Mon May 30 14:50:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (str_substr, rb_str_aref): refactor not to create
- unnecessary empty string.
-
- * string.c (str_byte_substr, str_byte_aref): ditto.
-
-Mon May 30 00:09:37 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/-test-/auto_ext.rb: fixed a heedless bug introduced at r55198.
- this change will make RubyCI green.
-
-Sun May 29 22:58:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regexec.c (ONIGENC_IS_MBC_ASCII_WORD): redefine optimized one.
- WORD of Ruby's ascii compatible encoding is always [a-zA-Z0-9_].
-
-Sun May 29 22:44:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regexec.c (match_at): make compilers optimize harder.
-
-Sun May 29 12:08:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/-test-/auto_ext.rb (auto_ext): utility method to create
- extension libraries for tests.
-
-Sat May 28 20:40:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-additional.el (ruby-insert-heredoc-code-block): insert
- here document code block for assert_separately mainly.
-
-Sat May 28 20:34:19 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/test_unicode_normalize.rb: Add test to check for availability of
- Unicode data file; refactoring; fix an error with tests for destructive
- method (unicode_normalize!).
-
-Sat May 28 19:08:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Add error messages to tests
- for data file availability; refactoring.
-
-Sat May 28 14:00:10 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/lib/openssl/ssl.rb (SSLSocket): Move the implementation of
- SSLSocket#initialize to C. Initialize the SSL (OpenSSL object) in it.
- Currently this is delayed until ossl_ssl_setup(), which is called from
- SSLSocket#accept or #connect. Say we call SSLSocket#hostname= with an
- illegal value. We expect an exception to be raised in #hostname= but
- actually we get it in the later SSLSocket#connect. Because the SSL is
- not ready at #hostname=, the actual call of SSL_set_tlsext_host_name()
- is also delayed.
- This also fixes: [ruby-dev:49376] [Bug #11724]
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_initialize): Added. Almost the same
- as the Ruby version but this instantiate the SSL object at the same
- time.
-
- (ossl_ssl_setup): Adjust to the changes. Just set the underlying IO to
- the SSL.
-
- (ssl_started): Added. Make use of SSL_get_fd(). This returns -1 if not
- yet set by SSL_set_fd().
-
- (ossl_ssl_data_get_struct): Removed. Now GetSSL() checks that the SSL
- exists.
-
- (ossl_ssl_set_session): Don't call ossl_ssl_setup() here as now the
- SSL is already instantiated in #initialize.
-
- (ossl_ssl_shutdown, ossl_start_ssl, ossl_ssl_read_internal,
- ossl_ssl_write_internal, ossl_ssl_stop, ossl_ssl_get_cert,
- ossl_ssl_get_peer_cert, ossl_ssl_get_peer_cert_chain,
- ossl_ssl_get_version, ossl_ssl_get_cipher, ossl_ssl_get_state,
- ossl_ssl_pending, ossl_ssl_session_reused,
- ossl_ssl_get_verify_result, ossl_ssl_get_client_ca_list,
- ossl_ssl_npn_protocol, ossl_ssl_alpn_protocol, ossl_ssl_tmp_key): Use
- GetSSL() instead of ossl_ssl_data_get_struct(). Use ssl_started().
-
- (Init_ossl_ssl): Add method declarations of SSLSocket#{initialize,
- hostname=}.
-
- * ext/openssl/ossl_ssl.h (GetSSL): Check that the SSL is not NULL. It
- should not be NULL because we now set it in #initialize.
-
- * ext/openssl/ossl_ssl_session.c (ossl_ssl_session_initialize): No need
- to check if the SSL is NULL.
-
-Sat May 28 10:47:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * gems/bundled_gems: Update latest releases, power_assert-0.3.0,
- test-unit 3.1.9, minitest 5.9.0, did_you_mean 1.0.1
-
-Sat May 28 10:45:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * addr2line.c: drop support for ATARI ST platform. It was
- discontinued more than two decades ago. [fix GH-1350] Patch by
- @cremno
- * include/ruby/ruby.h: ditto.
- * io.c: ditto.
-
-Sat May 28 10:39:47 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Converted exception for
- unavailable Unicode data files to failed assertion.
-
-Sat May 28 10:26:18 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/cgi/util.rb: added missing quote.
- [fix GH-1363][ci skip] Patch by @dwaller
-
-Fri May 27 17:38:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_local_constants_i): exclude hidden constants.
- [ruby-core:75575] [Bug #12389]
-
-Fri May 27 17:09:44 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * transcode.c (str_transcode0): scrub in the given encoding when
- the source encoding is given, not in the encoding of the
- receiver. [ruby-core:75732] [Bug #12431]
-
-Fri May 27 15:07:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args): remove nul padding which
- caused syntax error if fmt is not a string literal.
-
- * include/ruby/ruby.h (rb_scan_args_verify): suppress array-bounds
- warnings by old clang.
-
- * include/ruby/ruby.h (rb_scan_args0): make extractor macros
- inline functions, which do not validate the format and are
- unnecessary to be expanded.
-
-Fri May 27 01:00:36 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * symbol.c (is_identchar): use ISDIGIT instead of rb_enc_isalnum.
- Though rb_enc_isalnum is encoding aware function, its argument here
- is *m, which is a single byte. Therefore ISDIGIT is faster.
-
- * symbol.c (is_special_global_name): ditto.
-
- * symbol.c (rb_enc_symname_type): ditto.
-
-Fri May 27 00:39:40 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args): add nul padding here to
- apply to all references.
-
- * include/ruby/ruby.h (rb_scan_args_verify): move length mismatch
- check outside conditional operators.
-
-Thu May 26 14:21:10 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkey_dh.c (ossl_dh_compute_key): Check that the DH
- has 'p' (the prime) before calling DH_size(). We can create a DH with
- no parameter but DH_size() does not check and dereferences NULL.
- [ruby-core:75720] [Bug #12428]
-
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_sign): Ditto. DSA_size() does
- not check dsa->q.
-
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
- ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
- ossl_rsa_private_decrypt): Ditto. RSA_size() does not check rsa->n.
-
-Thu May 26 14:13:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args_count): verify length with
- counting variables together.
-
-Thu May 26 09:45:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_comprehensive.rb: Add set of comprehensive
- (across most Unicode characters; later across most character encodings)
- tests for case mapping.
-
-Thu May 26 05:00:13 2016 Benoit Daloze <eregontp@gmail.com>
-
- * class.c (rb_define_class): Fix documentation.
-
-Wed May 25 20:50:12 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (unescape_nonascii): scan hex up to only 3 characters.
- [Bug #12420] [Bug #12423]
-
-Wed May 25 19:07:19 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Handle DOTLESS_i by hand because it isn't involved in folding.
-
-Wed May 25 18:30:53 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regparse.c (fetch_token_in_cc): raise error if given octal escaped
- character is too big. [Bug #12420] [Bug #12423]
-
-Wed May 25 17:45:15 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl, test/openssl: Drop OpenSSL < 0.9.8 support.
-
-Wed May 25 17:43:30 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/openssl_missing.h, ext/openssl/ossl.h: Remove
- unnecessary 'extern "C"' blocks. We don't use C++ and these headers
- are local to ext/openssl, so there is no need to enclose with it.
-
-Wed May 25 17:42:58 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: Remove check of OPENSSL_FIPS macro. This is
- unneeded because we can check the macro directly in source code,
- just as we already do for OPENSSL_NO_* macros.
-
- * ext/openssl/ossl.c: Replace occurrences of HAVE_OPENSSL_FIPS with
- OPENSSL_FIPS.
-
-Wed May 25 17:13:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_scan_args): merge code for n_trail.
-
-Wed May 25 17:11:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args_validate): move failed
- condition to the terminal. [ruby-core:75714] [Bug #12426]
-
-Wed May 25 13:13:37 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regcomp.c: remove condition for debug output because prelude
- doesn't use regexp now.
-
-Wed May 25 13:10:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regcomp.c (compile_length_tree): return error code immediately
- if compile_length_tree raised error [Bug #12418]
-
-Wed May 25 08:01:39 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Fix flag error for switch from titlecase to lowercase.
-
- * test/ruby/enc/test_case_mapping.rb: Tests for above error.
-
-Wed May 25 01:13:55 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkey_ec.c (ec_key_new_from_group): Create a new
- EC_KEY on given EC group. Extracted from ossl_ec_key_initialize().
- (ossl_ec_key_s_generate): Added. Create a new EC instance and
- generate a random private and public key.
- (ossl_ec_key_initialize): Use ec_key_new_from_group().
- (Init_ossl_ec): Define the new method EC.generate. This change is
- for consistency with other PKey types. [ruby-core:45541] [Bug #6567]
-
- * test/openssl/test_pkey_ec.rb: Test that EC.generate works.
-
-Wed May 25 00:37:16 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_key_generate_key): Fix up RDoc.
- (Init_ossl_ec): Rename EC#generate_key to EC#generate_key!. Make the
- old name an alias of #generate_key!. This change is for consistency
- with other PKey types. [ruby-core:45541] [Bug #6567]
-
- * test/openssl/test_pkey_ec.rb: Use EC#generate_key! instead of
- EC#generate_key.
-
-Wed May 25 00:23:05 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args_set): check the arity after
- adjusting argc for an option hash, for optimization in simpler
- cases.
-
-Wed May 25 00:21:52 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (XCFLAGS): merge flags only for ruby itself from
- ruby_cflags.
-
-Tue May 24 22:04:15 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_set_key, ossl_cipher_set_iv):
- Reject too long values as well as too short ones. Currently they
- just truncate the input but this would hide bugs and lead to
- unexpected encryption/decryption results.
-
- * test/openssl/test_cipher.rb: Test that Cipher#key= and #iv= reject
- Strings with invalid length.
-
-Tue May 24 21:32:21 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): Use
- ASN1_OCTET_STRING_set() instead of M_ASN1_OCTET_STRING_set(). Macros
- prefixed by "M_" are discouraged to be used from outside OpenSSL
- library[1].
- (ossl_x509ext_get_value): Likewise, use ASN1_STRING_print() instead
- of M_ASN1_OCTET_STRING_print().
- [1] https://git.openssl.org/gitweb/?p=openssl.git;a=blob;f=CHANGES;h=bf61913d7b01212b4d8b2f3c13d71d645914f67c;hb=b6079a7835f61daa9fb2cbf9addfa86049523933#l878
-
- * ext/openssl/ossl.h: Include openssl/asn1.h instead of
- openssl/asn1_mac.h. It just includes openssl/asn1.h and defines some
- additional "M_" macros.
-
-Tue May 24 18:52:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args_verify): verify the format to
- scan if no invalid chars and variable argument length matching,
- at the compile time if possible.
-
-Tue May 24 17:18:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/defines.h (ERRORFUNC, WARNINGFUNC): add fallback
- definitions.
-
-Tue May 24 16:37:43 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (ruby_cflags): separate from optflags [Bug #12409]
- -fexcess-precision=standard and -fp-model precise are set to this now.
-
- * configure.in (cflags): use ruby_cflags.
-
-Tue May 24 16:20:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ERRORFUNC, WARNINGFUNC): __error__ and __warning__
- attributes take a parenthesized string literal.
-
-Tue May 24 12:35:56 2016 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * common.mk: sort lines, and add missing dependencies suggested
- by tool/update-deps
-
-Mon May 23 21:33:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/missing.h (isfinite): move from numeric.c.
-
-Mon May 23 21:09:06 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl.c (Init_openssl): Avoid reference to unset global
- variable. ossl_raise() may be called before dOSSL is set. Since
- global variables default to 0 and the default value of dOSSL set in
- Init_openssl() is also Qfalse, there is no real issue but confusing.
- Patch by Bertram Scharpf <software@bertram-scharpf.de>
- [ruby-core:58264] [Bug #9101]
-
-Mon May 23 20:32:16 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_asn1.c, ext/openssl/ossl_bn.c,
- ext/openssl/ossl_cipher.c, ext/openssl/ossl_digest.c
- ext/openssl/ossl_engine.c, ext/openssl/ossl_ns_spki.c
- ext/openssl/ossl_pkcs12.c, ext/openssl/ossl_pkcs7.c
- ext/openssl/ossl_pkey.c, ext/openssl/ossl_pkey_ec.c
- ext/openssl/ossl_rand.c, ext/openssl/ossl_ssl.c
- ext/openssl/ossl_x509attr.c, ext/openssl/ossl_x509cert.c
- ext/openssl/ossl_x509ext.c, ext/openssl/ossl_x509store.c: Use
- StringValueCStr() where NUL-terminated string is expected.
-
-Mon May 23 20:20:12 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (isfinite): get rid of a warning on
- cygwin. [Bug #12417][ruby-core:75691]
-
-Mon May 23 19:41:27 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_rand.c (ossl_rand_egd, ossl_rand_egd_bytes):
- RAND_egd{_bytes,}() return -1 on failure, not 0.
- Patch by cremno phobia <cremno@mail.ru>
- [ruby-core:63795] [Bug #10053]
- (ossl_pseudo_bytes): Similar, RAND_pseudo_bytes() may return 0 or
- -1 on failure.
-
-Mon May 23 15:52:07 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (isfinite): isfinite does not always
- exist. fixed build error on Windows introduced at r55123.
-
-Mon May 23 13:19:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args0): make compile error if the
- format is wrong or does not match with the variable argument
- length if possible.
-
-Mon May 23 12:47:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args0): raise fatal error if
- variable argument length does not match, it is a bug in the code
- which uses rb_scan_args, not a runtime error.
-
-Mon May 23 12:30:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): consider
- non-finite float values not to raise FloatDomainError.
- [ruby-core:75682] [Bug #12414]
-
-Mon May 23 12:21:18 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * array.c (rb_ary_fill): suppress warnings: 'item' may be used
- uninitialized in this function
-
-Mon May 23 07:41:49 2016 Eric Wong <e@80x24.org>
-
- * dir.c (dir_close): update RDoc for 2.3 #close change
- [ruby-core:75679] [Bug #12413]
-
-Sun May 22 20:01:21 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/timeridconv.rb: use finalizer trick instead of thread.
-
- * test/drb/ut_timerholder.rb: ditto.
-
-Sun May 22 17:25:18 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_options.rb: adjust test class name
- to match file name
-
-Sun May 22 17:24:07 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * rename test/ruby/enc/test_casing_options.rb to test_case_options.rb
- for consistency
-
-Sun May 22 17:06:55 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * transcode.c (enc_arg, str_transcode_enc_args, econv_args):
- remove volatile, and add GC guards in callers.
- [ruby-core:75664] [Bug #12411]
-
-Sun May 22 16:27:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/-test-/integer/core_ext.c: move testutil/integer.c.
-
- * test/lib/-test-/integer.rb: extract implementation details from
- test/unit/assertions.rb. [Bug #12408]
-
-Sun May 22 14:57:43 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * include/ruby/oniguruma.h: Extend OnigEncodingTypeDefine to define a
- new encoding primitive 'case_map' for case mapping
-
- * enc/utf-8.c, utf_16be/le.c, utf_32be/le.c:
- add onigenc_unicode_case_map as case_map primitive
-
- * enc/ascii.c, big5.c, cp949.c, emacs_mule.c, euc_jp/kr/tw.c, gb18030.c,
- gbk.c, iso_8859_1/2/3/4/5/6/7/8/9/10/11/13/14/15/16.c, koi8_r/u.c,
- shift_jis.c, us_ascii.c, windows_1250/1251/1252.c:
- add onigenc_not_support_case_map as case_map primitive
-
-Sun May 22 14:45:45 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * regenc.h/c: Define new function onigenc_not_support_case_map
-
-Sun May 22 12:14:06 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args): use original rb_scan_args
- when fmt is dynamic.
-
-Sun May 22 11:41:12 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * class.c (rb_scan_args): moved to bottom of the file to make the
- effect of `#undef rb_scan_args` the minimum.
-
- * include/ruby/ruby.h (rb_scan_args): overwrite only if GCC and
- optimized. Visual C++ 14 or later can compile it but make it
- conservative.
-
-Sat May 21 22:45:50 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args): don't use ALWAYS_INLINE with
- `inline`. if gcc needs this duplication, do in ALWAYS_INLINE macro.
-
-Sat May 21 21:11:56 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_scan_args): use __VA_ARGS__ instead of
- va_arg to allow compilers optimize more aggressive.
- https://gustedt.wordpress.com/2011/07/10/avoid-writing-va_arg-functions/
- rb_scan_args is now expected to be statically resolved.
-
-Sun May 22 02:41:52 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/zlib/zlib.c: remove hacky macro introduced at r30437.
-
- * ext/zlib/zlib.c (gzfile_make_header): cast as long (instead of int).
-
- * ext/zlib/zlib.c (gzfile_make_footer): ditto.
-
-Sat May 21 21:07:18 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (ALWAYS_INLINE): force compilers the function inlined.
-
-Sat May 21 16:16:03 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_stop): Don't free the SSL struct
- here. Since some methods such as SSLSocket#connect releases GVL,
- there is a chance of use after free if we free the SSL from another
- thread. SSLSocket#stop was documented as "prepares it for another
- connection" so this is a slightly incompatible change. However when
- this sentence was added (r30090, Add toplevel documentation for
- OpenSSL, 2010-12-06), it didn't actually. The current behavior is
- from r40304 (Correct shutdown behavior w.r.t GC., 2013-04-15).
- [ruby-core:74978] [Bug #12292]
-
- * ext/openssl/lib/openssl/ssl.rb (sysclose): Update doc.
-
- * test/openssl/test_ssl.rb: Test this.
-
-Sat May 21 14:41:14 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl.c: [DOC] Fix SSL client example. The variable name
- was wrong. Patch by Andreas Tiefenthaler <at@an-ti.eu> (@pxlpnk).
- [GH ruby/openssl#32]
-
-Sat May 21 14:25:38 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkey_ec.c: rename PKey::EC#private_key? and
- #public_key? to #private? and #public? for consistency with other
- PKey types. Old names remain as alias. [ruby-core:45541] [Bug #6567]
-
- * test/openssl/test_pkey_ec.rb (test_check_key): check private? and
- public? works correctly.
-
-Sat May 21 12:40:36 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/lib/openssl/buffering.rb (read_nonblock, readpartial):
- Remove impossible EOFError raise. Patch by Zach Anker
- <zanker@squareup.com>. [GH ruby/openssl#23]
-
-Sat May 21 11:18:42 2016 Evgeni Golov <evgeni@golov.de>
-
- * lib/ipaddr.rb: [DOC] fix documentation of IN6MASK to mention
- IPv6. [Fix GH-1349]
-
-Sat May 21 11:12:53 2016 Dan Martinez <dfm@razorwind.org>
-
- * io.c (Init_IO): [DOC] define dummy ARGF instead of ARGF.class to
- re-enable the generation of ARGF documentation. [Fix GH-1358]
-
-Sat May 21 11:07:29 2016 0x01f7 <souk.0x01f7@gmail.com>
-
- * doc/syntax/methods.rdoc (Method Names): add proper closing tag.
- [Fix GH-1356]
-
-Sat May 21 09:26:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_CHECK_SETJMP): fix missing macro definition
- for the configured result. fix up r55021.
-
-Sat May 21 00:36:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (rb_execarg_commandline): build command line string
- from argument vector in rb_execarg.
- [ruby-core:75611] [Bug #12398]
-
-Fri May 20 23:25:42 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl.c (ossl_pem_passwd_value): Added. Convert the
- argument to String with StringValue() and validate the length is in
- 4..PEM_BUFSIZE. PEM_BUFSIZE is a macro defined in OpenSSL headers.
- (ossl_pem_passwd_cb): When reading/writing encrypted PEM format, we
- used to pass the password to PEM_def_callback() directly but it was
- problematic. It is not NUL character safe. And surprisingly, it
- silently truncates the password to 1024 bytes. [GH ruby/openssl#51]
-
- * ext/openssl/ossl.h: Add function prototype declaration of newly
- added ossl_pem_passwd_value().
-
- * ext/openssl/ossl_pkey.c (ossl_pkey_new_from_data): Use
- ossl_pem_passwd_value() to validate the password String.
-
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize, ossl_dsa_export):
- ditto.
-
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_key_initialize,
- ossl_ec_key_to_string): ditto.
-
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize, ossl_rsa_export):
- ditto.
-
- * test/openssl/test_pkey_{dsa,ec,rsa}.rb: test this.
-
-Fri May 20 23:45:53 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * id_table.c (list_id_table_init): When unaligned word access is
- prohibited and sizeof(VALUE) is 8 (64-bit machines),
- capa should always be even number for 8-byte word alignment
- of the values of a table. This code assumes that sizeof(ID) is 4,
- sizeof(VALUE) is 8, and xmalloc() returns 8-byte aligned memory.
- This fixes bus error on 64-bit SPARC Solaris 10.
- [Bug #12406][ruby-dev:49631]
-
-Fri May 20 22:30:09 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * symbol.h (rb_id2sym): Use HAVE_BUILTIN___BUILTIN_CONSTANT_P
-
-Fri May 20 22:19:00 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * ext/date/date_core.c: [DOC] fix typos.
- [fix GH-1360] patched by @soundasleep
-
-Fri May 20 21:26:58 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * include/ruby/defines.h (RB_GNUC_EXTENSION, RB_GNUC_EXTENSION_BLOCK):
- macros for skipping __extension__ on non-GCC compilers.
- * eval_error.c (warn_print): use RB_GNUC_EXTENSION_BLOCK instead of
- __extension__ because __extension__ is a GNU extension.
- Fix compile error on Solaris 10 with Oracle Solaris Studio 12.x.
- [Bug #12397] [ruby-dev:49629].
- * internal.h (rb_fstring_cstr, rb_fstring_enc_cstr): ditto
- * include/ruby/encoding.h (rb_enc_str_new, rb_enc_str_new_cstr): ditto
- * include/ruby/intern.h (rb_str_new, rb_str_new_cstr,
- rb_usascii_str_new, rb_utf8_str_new, rb_tainted_str_new_cstr,
- rb_usascii_str_new_cstr, rb_utf8_str_new_cstr,
- rb_external_str_new_cstr, rb_locale_str_new_cstr,
- rb_str_buf_new_cstr, rb_str_cat_cstr, rb_exc_new_cstr): ditto
-
-Fri May 20 21:17:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32ole/win32ole.c (fole_missing): make substring or dup to
- share the content if possible.
-
-Fri May 20 19:48:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * internal.h (NEW_PARTIAL_MEMO_FOR): shrink buffer array not to
- mark non-VALUE fields. fix check_rvalue_consistency abort with
- RGENGC_CHECK_MODE=2.
-
- * internal.h (NEW_CMP_OPT_MEMO): exclude struct cmp_opt_data from
- the valid array range.
-
- * enum.c (slicewhen_i): exclude inverted too.
-
-Thu May 19 21:21:57 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * re.c (rb_reg_match_m_p): [DOC] fix return value in rdoc.
-
- * test/ruby/test_regexp.rb (TestRegexp#test_match_p): add some
- tests from document.
-
-Thu May 19 13:22:44 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl.c (Init_openssl): register an ex_data index for
- X509_STORE and X509_STORE_CTX respectively. Since they don't share
- the ex_data index registry, we can't use the same index.
- (ossl_verify_cb): use the the correct index.
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_verify_callback): ditto.
-
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_vfy_cb): ditto.
- (ossl_x509stctx_verify): ditto.
-
- * ext/openssl/ossl.h (void ossl_clear_error): add extern declarations
- of ossl_store_{ctx_,}ex_verify_cb_idx.
-
- * ext/openssl/openssl_missing.c: remove X509_STORE_set_ex_data and
- X509_STORE_get_ex_data.
-
- * ext/openssl/openssl_missing.h: implement X509_STORE_get_ex_data,
- X509_STORE_set_ex_data and X509_STORE_get_ex_new_index as macros.
-
-Thu May 19 13:11:35 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): check that the
- argument is an OpenSSL::ASN1::Data before converting to ASN1_TYPE.
- This fixes SEGV on OpenSSL::X509::Attribute#value=(non-asn1-value).
-
- * test/openssl/test_x509attr.rb: add tests for OpenSSL::X509::Attribute.
-
-Thu May 19 12:10:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (rb_reg_match_m_p): fix match against empty string.
- rb_str_offset returns the end when the position exceeds the
- length. fix the range parameter of onig_search.
- [ruby-core:75604] [Bug #12394]
-
-Thu May 19 11:37:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (rb_reg_match_m_p): should return false if no match, as the
- document says. [Feature #8110]
-
-Thu May 19 00:17:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (reg_names_iter): specify capacify
-
-Wed May 18 21:29:59 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * thread.c (recursive_list_access): a object id may be a Bignum. so,
- the list must be a objhash, instead of a identhash.
- this fixes many test errors on mswin64 CI.
-
-Wed May 18 19:33:54 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (rb_reg_match_m_p): Introduce Regexp#match?, which returns
- bool and doesn't save backref.
-
-Wed May 18 16:52:03 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): pop errors
- leaked by PKCS12_parse(). This is a bug in OpenSSL, which exists
- in the versions before the version 1.0.0t, 1.0.1p, 1.0.2d.
-
-Wed May 18 16:04:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/downloader.rb (Downloader::RubyGems.download): verify gems
- only if RubyGems is 2.4 or later. old RubyGems fails to verify
- almost all of bundled gems.
-
-Wed May 18 14:52:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_modify_expand): check integer overflow.
- [ruby-core:75592] [Bug #12390]
-
-Wed May 18 13:11:44 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (match_ary_subseq): get subseq of match array without creating
- temporary array.
-
- * re.c (match_ary_aref): get element(s) of match array without creating
- temporary array.
-
- * re.c (match_aref): Use match_ary_subseq with handling irregulars.
-
- * re.c (match_values_at): Use match_ary_aref.
-
-Wed May 18 13:03:07 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_x509cert.c (ossl_x509_verify): X509_verify()
- family may put errors on 0 return (0 means verification failure).
- Clear OpenSSL error queue before return to Ruby. Since the queue is
- thread global, remaining errors in the queue can cause an unexpected
- error in the next OpenSSL operation. [ruby-core:48284] [Bug #7215]
-
- * ext/openssl/ossl_x509crl.c (ossl_x509crl_verify): ditto.
-
- * ext/openssl/ossl_x509req.c (ossl_x509req_verify): ditto.
-
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_verify): ditto.
-
- * ext/openssl/ossl_pkey_dh.c (dh_generate): clear the OpenSSL error
- queue before re-raising exception.
-
- * ext/openssl/ossl_pkey_dsa.c (dsa_generate): ditto.
-
- * ext/openssl/ossl_pkey_rsa.c (rsa_generate): ditto.
-
- * ext/openssl/ossl_ssl.c (ossl_start_ssl): ditto.
-
- * test/openssl: check that OpenSSL.errors is empty every time after
- running a test case.
-
-Wed May 18 12:07:42 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl.c (ossl_clear_error): Extracted from
- ossl_make_error(). This prints errors in the OpenSSL error queue if
- OpenSSL.debug is true, and clears the queue.
- (ossl_make_error): use ossl_clear_error().
-
- * ext/openssl/ossl.h: add prototype declaration of ossl_make_error().
- (OSSL_BIO_reset) use ossl_clear_error() to clear the queue. Clearing
- silently makes debugging difficult.
-
- * ext/openssl/ossl_engine.c (ossl_engine_s_by_id): ditto.
-
- * ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): ditto.
-
- * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_verify): ditto.
-
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
-
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_key_initialize): ditto.
- (ossl_ec_group_initialize): ditto.
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): ditto.
-
-Wed May 18 11:53:49 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_pkey_ec.c (ossl_ec_point_mul): Validate the
- arguments before passing to EC_POINT(s)_mul(). Add description of this
- method. [ruby-core:65152] [Bug #10268]
-
- * test/openssl/test_pkey_ec.rb (test_ec_point_mul): Test that
- OpenSSL::PKey::EC::Point#mul works.
-
-Wed May 18 11:19:59 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/ossl_bn.c (try_convert_to_bnptr): Extracted from
- GetBNPtr(). This doesn't raise exception but returns NULL on error.
- (GetBNPtr): Raise TypeError if conversion fails.
- (ossl_bn_eq): Implement BN#==.
- (ossl_bn_eql): #eql? should not raise TypeError even if the argument
- is not compatible with BN.
- (ossl_bn_hash): Implement BN#hash.
-
- * ext/openssl/ossl_bn.c (Init_ossl_bn): Define #== and #hash.
-
- * test/openssl/test_bn.rb: Test BN#eql?, #== and #hash
-
-Wed May 18 10:17:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (RB_INTEGER_TYPE_P): new macro and
- underlying inline function to check if the object is an
- Integer (Fixnum or Bignum).
-
-Wed May 18 09:52:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (enum_sum, hash_sum, hash_sum_i, enum_sum_i, sum_iter):
- Optimize for hashes when each method isn't redefined.
-
-Wed May 18 09:14:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (enum_sum, int_range_sum): Extract int_range_sum from
- enum_sum.
-
-Wed May 18 03:16:06 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (match_values_at): fix regression at r55036.
- MatchData#values_at accepts Range.
-
-Wed May 18 02:02:58 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (match_aref): remove useless condition and call rb_fix2int.
- rb_reg_nth_match handles negative index.
-
-Wed May 18 01:57:43 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (match_values_at): MatchData#values_at supports named captures
- [Feature #9179]
-
- * re.c (namev_to_backref_number): separated.
-
-Wed May 18 00:05:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (enum_sum): Optimize for a range from int to int.
-
- * test/ruby/test_enum.rb (test_range_sum): Move from test_range.rb,
- and add assertions for some conditions.
-
- * test/ruby/test_enum.rb (test_hash_sum): Move from test_hash.rb.
-
- * test/ruby/test_hash.rb, test/ruby/test_range.rb: Remove test_sum.
-
-Tue May 17 23:08:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (enum_sum): [DOC] Write documentation.
-
-Tue May 17 22:53:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (enum_sum): Implement Enumerable#sum.
-
- * test/ruby/test_enum.rb (test_sum): Test sum for Enumerable.
-
- * test/ruby/test_hash.rb (test_sum): Test sum for Hash.
-
- * test/ruby/test_range.rb (test_sum): Test sum for Range.
-
-Tue May 17 22:11:41 2016 Tanaka Akira <akr@fsij.org>
-
- * object.c, numeric.c, enum.c, ext/-test-/bignum/mul.c,
- lib/rexml/quickpath.rb, lib/rexml/text.rb, lib/rexml/xpath_parser.rb,
- lib/rubygems/specification.rb, lib/uri/generic.rb,
- bootstraptest/test_eval.rb, basictest/test.rb,
- test/-ext-/bignum/test_big2str.rb, test/-ext-/bignum/test_div.rb,
- test/-ext-/bignum/test_mul.rb, test/-ext-/bignum/test_str2big.rb,
- test/csv/test_data_converters.rb, test/date/test_date.rb,
- test/json/test_json_generate.rb, test/minitest/test_minitest_mock.rb,
- test/openssl/test_cipher.rb, test/rexml/test_jaxen.rb,
- test/ruby/test_array.rb, test/ruby/test_basicinstructions.rb,
- test/ruby/test_bignum.rb, test/ruby/test_case.rb,
- test/ruby/test_class.rb, test/ruby/test_complex.rb,
- test/ruby/test_enum.rb, test/ruby/test_eval.rb,
- test/ruby/test_iseq.rb, test/ruby/test_literal.rb,
- test/ruby/test_math.rb, test/ruby/test_module.rb,
- test/ruby/test_numeric.rb, test/ruby/test_range.rb,
- test/ruby/test_rational.rb, test/ruby/test_refinement.rb,
- test/ruby/test_rubyvm.rb, test/ruby/test_struct.rb,
- test/ruby/test_variable.rb, test/rubygems/test_gem_specification.rb,
- test/thread/test_queue.rb: Use Integer instead of Fixnum and Bignum.
-
-Tue May 17 15:26:10 2016 Tanaka Akira <akr@fsij.org>
-
- * [Feature #12005] Unify Fixnum and Bignum into Integer
-
- * include/ruby/ruby.h (rb_class_of): Return rb_cInteger for fixnums.
-
- * insns.def (INTEGER_REDEFINED_OP_FLAG): Unified from
- FIXNUM_REDEFINED_OP_FLAG and BIGNUM_REDEFINED_OP_FLAG.
-
- * vm_core.h: Ditto.
-
- * vm_insnhelper.c (opt_eq_func): Use INTEGER_REDEFINED_OP_FLAG instead
- of FIXNUM_REDEFINED_OP_FLAG.
-
- * vm.c (vm_redefinition_check_flag): Use rb_cInteger instead of
- rb_cFixnum and rb_cBignum.
- (C): Use Integer instead of Fixnum and Bignum.
-
- * numeric.c (fix_succ): Removed.
- (Init_Numeric): Define Fixnum as Integer.
-
- * bignum.c (bignew): Use rb_cInteger instead of rb_cBignum.
- (rb_int_coerce): replaced from rb_big_coerce and return fixnums
- as-is.
- (Init_Bignum): Define Bignum as Integer.
- Don't define ===.
-
- * error.c (builtin_class_name): Return "Integer" for fixnums.
-
- * sprintf.c (ruby__sfvextra): Use rb_cInteger instead of rb_cFixnum.
-
- * ext/-test-/testutil: New directory to test.
- Currently it provides utilities for fixnum and bignum.
-
- * ext/json/generator/generator.c: Define mInteger_to_json.
-
- * lib/mathn.rb (Fixnum#/): Redefinition removed.
-
-Tue May 17 11:58:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_CHECK_BUILTIN_SETJMP): declare t as NORETURN
- to suppress warnings by -Wsuggest-attribute=noreturn.
- [ruby-core:75510] [Bug #12383]
-
-Tue May 17 10:40:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_CHECK_SETJMP): needs the header and proper
- arguments for builtin setjmp functions.
-
-Mon May 16 20:00:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.h: Additional uses of ONIG_CASE_MAPPING compilation switch
-
-Mon May 16 19:46:33 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * include/ruby/oniguruma.h: Introducing ONIG_CASE_MAPPING compilation
- switch
-
- * include/ruby/oniguruma.h, enc/unicode.h: Using ONIG_CASE_MAPPING
- compilation switch
-
-Mon May 16 19:29:31 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * gems/bundled_gems: Update xmlrpc-0.1.1. xmlrpc-0.1.0 didn't allow
- to install on 2.4.0dev.
-
-Mon May 16 13:28:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (FUNC_STDCALL, FUNC_CDECL, FUNC_FASTCALL): set
- macro names explicitly to the old names, which are accidentally
- changed at r54985, for backward compatibilities.
- fiddle also depends on these names to fallback to ANSI names.
- [ruby-core:75494] [Bug #12377]
-
-Mon May 16 11:39:02 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/xmlrpc.rb, lib/xmlrpc/*, test/xmlrpc: XMLRPC is bundled gem
- on Ruby 2.4. It is extracted to https://github.com/ruby/xmlrpc
- [Feature #12160][ruby-core:74239]
- * gems/bundled_gems: ditto.
-
-Mon May 16 06:06:21 2016 Eric Wong <e@80x24.org>
-
- * proc.c: fix RDoc of Proc#===/call/yield/[]
- [Bug #12332]
-
-Sun May 15 20:55:31 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/timeridconv.rb: don't use keeper thread. [Bug #12342]
-
- * test/drb/ut_timerholder.rb: ditto.
-
-Sun May 15 16:15:25 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * array.c (rb_ary_entry): extract rb_ary_elt to organize if-conditions
- and check whether is embedded at once.
-
-Sun May 15 10:57:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_insnhelper.c (vm_get_ev_const): warn deprecated constant even
- in the class context. [ruby-core:75505] [Bug #12382]
-
-Sun May 15 03:13:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * iseq.h (struct iseq_compile_data): use struct rb_id_table
- instead of st_table.
-
- * iseq.c (prepare_iseq_build): don't allocate ivar_cache_table
- until it has at least one element.
-
- * iseq.c (compile_data_free): free ivar_cache_table only if it
- is allocated.
-
- * compile.c (get_ivar_ic_value): allocate if the table is not
- allocated yet.
-
-Sat May 14 09:04:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (pkg_config): use xsystem consistently to set up
- library path environment variable as well as latter pkg-config
- calls. [ruby-dev:49619] [Bug #12379]
-
-Sat May 14 00:16:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * random.c (make_seed_value): append leading-zero-guard and get
- rid of making a local copy of the seed.
-
-Fri May 13 08:46:42 2016 cremno <cremno@mail.ru>
-
- * NEWS: drop FreeBSD < 4 support. [Fix GH-1339]
- The most recent version affected by this is 3.5 and was released
- in 2000.
- https://www.freebsd.org/releases/3.5R/announce.html
- https://en.wikipedia.org/wiki/History_of_FreeBSD#Version_history
-
-Fri May 13 03:12:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/defines.h (GCC_VERSION_SINCE): moved from internal.h.
-
-Fri May 13 03:11:20 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (__builtin_constant_p): check.
-
- * internal.h: Use HAVE_BUILTIN___BUILTIN_CONSTANT_P
-
-Fri May 13 03:10:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: use alternative keyword
- to avoid macros conflicts with them.
-
-Thu May 12 01:54:08 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (try_func): get rid of conflict of declarations of
- main(). checking local symbol reference does not make sense.
-
-Thu May 12 00:18:19 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (HAVE_QSORT_S): use qsort_s only for Visual Studio
- 2012 or later, because VS2010 seems to causes a SEGV in
- test/ruby/test_enum.rb.
-
-Wed May 11 23:59:47 2016 Masaya Tarui <tarui@ruby-lang.org>
-
- * vm_insnhelper.c (vm_getivar): describe fast-path explicit
- (compiler friendly). [Bug #12274].
-
-Wed May 11 21:30:07 2016 Masaya Tarui <tarui@ruby-lang.org>
-
- * compile.c (iseq_compile_each): share InlineCache during same
- instance variable accesses. Reducing memory consumption,
- rising cache hit rate and rising branch prediction hit rate
- are expected. A part of [Bug #12274].
-
- * iseq.h (struct iseq_compile_data): introduce instance
- variable IC table for sharing.
-
- * iseq.c (prepare_iseq_build, compile_data_free):
- construct/destruct above table.
-
-Wed May 11 17:18:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (ruby_qsort): use qsort_s if available, for Microsoft
- Visual Studio 2005 (msvcr80.dll) and mingw.
-
-Wed May 11 10:33:26 2016 Marcus Stollsteimer <sto.mar@web.de>
-
- * COPYING: Remove trailing-whitespaces.
- [ci skip][fix GH-1348]
-
-Tue May 10 21:05:45 2016 Benoit Daloze <eregontp@gmail.com>
-
- * insns.def (defineclass): Also raise an error when redeclaring the
- superclass of a class as Object and it has another superclass.
- [Bug #12367] [ruby-core:75446]
-
- * test/ruby/test_class.rb: test for above.
-
-Tue May 10 14:57:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * random.c (obj_random_bytes): base on bytes method instead of
- rand method, not to call toplevel rand method.
-
-Tue May 10 13:07:28 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (-fexcess-precision=standard): before r54895 -std=c99
- is specified and it implied -fexcess-precision=standard.
- Now with -std=gnu99, it should be explicitly specified.
- https://gcc.gnu.org/onlinedocs/gcc/Optimize-Options.html
-
-Mon May 9 10:51:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (rb_thread_atfork_internal): move th to an argument.
-
- * thread.c (rb_thread_atfork): do not repeat GET_THREAD().
-
-Mon May 9 10:46:36 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (rb_thread_atfork, rb_thread_atfork_before_exec): do
- nothing unless working fork is available.
-
- * thread_sync.c (rb_mutex_abandon_all): define only if working
- fork is available.
-
- * thread_sync.c (rb_mutex_abandon_keeping_mutexes): ditto.
-
- * thread_sync.c (rb_mutex_abandon_locking_mutex): ditto.
-
- * thread_win32.c (gvl_init): never used.
-
-Mon May 9 07:18:06 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * include/ruby/{defines,ruby}.h: need to define function attributes
- alternatives in defines.h instead of ruby.h, because they are used
- in oniguruma.h and the header used without including ruby.h at
- encoding library sources.
-
-Mon May 9 06:30:12 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * include/ruby/ruby.h (CONSTFUNC, PUREFUNC): fixed build errors on
- non-gcc build environments introduced at r54952.
-
-Mon May 9 02:51:51 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * gc.c (rb_gc_unprotect_logging): throw rb_memerror when it cannot
- allocate memory. This is pointed out by Facebook's Infer.
-
- * gc.c (gc_prof_setup_new_record): ditto.
-
- * regparse.c (parse_regexp): ditto.
-
- * util.c (MALLOC): use xmalloc and xfree like above.
-
-Mon May 9 02:39:16 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: check function attribute const and pure,
- and define CONSTFUNC and PUREFUNC if available.
- Note that I don't add those options as default because
- it still shows many false-positive (it seems not to consider
- longjmp).
-
- * vm_eval.c (stack_check): get rb_thread_t* as an argument
- to avoid duplicate call of GET_THREAD().
-
-Sun May 8 21:01:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/openssl/extconf.rb: assume it doesn't have SSLv2 related
- functions when OPENSSL_NO_SSL2 is defined.
- Usually openssl's header and the library (libssl) have the same
- set of functions, but on some environment the library has functions
- whose headers doesn't declare. (openssl/opensslconf.h and libssl.so
- aren't be synchronized)
- To detect such case explicitly check feature macro and remove
- related functions.
-
-Sun May 8 18:51:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_home_dir_of): return the default home path if the
- user name is the current user name, on platforms where struct
- pwd is not supported. a temporary measure against
- [Bug #12226].
-
-Sun May 8 08:51:38 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: add -Wsuggest-attribute=format and suppress warnings.
-
-Sun May 8 08:31:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: add -Wsuggest-attribute=noreturn and suppress warnings.
-
-Sun May 8 08:19:16 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: add -Werror=implicit-int to avoid missing type of
- function declaration.
-
-Sat May 7 22:22:37 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/webrick/ssl.rb: Accept string value for SSLCertName. It is used
- to invoke ssl server with command line.
- [fix GH-1329] Patch by @kerlin
- * test/webrick/test_ssl_server.rb: Added test for GH-1329
-
-Sat May 7 21:55:12 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/webrick/test_ssl_server.rb: Added basic test for `webrick/ssl`
-
-Sat May 7 16:22:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * random.c (int_pair_to_real_inclusive): optimize to multiply
- without Bignum.
-
-Sat May 7 07:58:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (rb_exec_getargs): honor the expected argument types
- over the conversion method. the basic language functionality
- should be robust. [ruby-core:75388] [Bug #12355]
-
-Fri May 6 08:16:26 2016 David Silva <david.silva@digital.cabinet-office.gov.uk>
-
- * enum.c (enum_find): [DOC] add more examples to the documentation
- of Enumerable#detect, to show that it equals to Enumerable#find.
- [Fix GH-1340]
-
-Thu May 5 18:08:31 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * test/ruby/test_complexrational.rb: Remove duplicated raise.
-
-Thu May 5 14:41:05 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * string.c (rb_str_sub): Fix a special match variable name.
- [ci skip]
-
-Thu May 5 12:22:17 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_eval_cmd, rb_catch_obj): use TH_JUMP_TAG with the
- same rb_thread_t used for TH_PUSH_TAG, instead of JUMP_TAG with
- the current thread global variable.
-
-Thu May 5 10:49:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * random.c (fill_random_bytes_syscall): use arc4random_buf if
- available.
-
-Wed May 4 23:13:58 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * numeric.c (fix_plus): Remove rb_nucomp_add prototype
- declaration.
-
- * numeric.c (fix_mul): Remove rb_nucomp_mul prototype
- declaration.
-
- * internal.h (rb_nucomp_add, rb_nucomp_mul): add prototype
- declarations.
-
-Wed May 4 18:38:00 2016 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * lib/net/http/header.rb (Net::HTTPHeader#{each_header,each_name,
- each_capitalized_name,each_value,each_capitalized}): Return
- sized enumerators.
-
- * test/net/http/test_httpheader.rb: add test for above.
-
-Wed May 4 17:53:15 2016 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * lib/set.rb (Set#{delete_if,keep_if,collect!,reject!,select!,classify,divide},
- SortedSet#{delete_if,keep_if}): Return sized enumerators.
-
- * test/test_set.rb: add test for above.
-
-Tue May 3 23:25:48 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * numeric.c: [DOC] Update result of 123456789 ** -2.
- [ruby-dev:49606] [Bug #12339]
-
-Tue May 3 23:13:16 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * internal.h (RCOMPLEX_SET_IMAG): undef RCOMPLEX_SET_IMAG
- instead of duplicated undef RCOMPLEX_SET_REAL.
-
-Tue May 3 22:55:07 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * complex.c (rb_complex_set_imag): Fix to properly set imag
- of complex.
-
-Tue May 3 22:19:55 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (warnflags): use -std=gnu99 instead of
- -std=iso9899:1999. [Feature #12336]
-
-Tue May 3 22:10:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (count_utf8_lead_bytes_with_word): Use __builtin_popcount
- only if it can use SSE 4.2 POPCNT whose latency is 3 cycle.
-
- * internal.h (rb_popcount64): use __builtin_popcountll because now
- it is in fast path.
-
-Tue May 3 14:19:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (new_if_gen): set newline flag to NODE_IF to trace all
- if/elsif statements. [ruby-core:67720] [Bug #10763]
-
-Tue May 3 05:35:54 2016 Eric Wong <e@80x24.org>
-
- * process.c (disable_child_handler_fork_child):
- initialize handler for SIGPIPE for !POSIX_SIGNAL
-
-Mon May 2 23:03:42 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c, include/ruby/win32.h (rb_w32_utruncate): implements new
- truncate alternative which accepts UTF-8 path.
-
- * file.c (truncate): use above function.
- [Bug #12340]
-
-Mon May 2 20:59:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (str_coderange): to avoid function call when the string already
- has coderange information.
-
- * re.c (rb_reg_prepare_enc): add shortcut path when the regexp has
- the same encoding of given string.
-
- * re.c (rb_reg_prepare_re): avoid duplicated allocation of
- onig_errmsg_buffer.
-
-
-Mon May 2 12:34:52 2016 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_refinement.rb (test_inspect): Use Integer instead of
- Fixnum.
-
-Mon May 2 06:58:38 2016 Tanaka Akira <akr@fsij.org>
-
- * complex.c: Don't refer rb_cFixnum and rb_cBignum.
- (k_fixnum_p): Use FIXNUM_P.
- (k_bignum_p): Use RB_TYPE_P.
-
-Mon May 2 01:27:59 2016 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_numeric.rb (test_step): Use Integer::FIXNUM_MAX.
-
-Mon May 2 01:15:01 2016 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_module.rb (test_name): Use Integer instead of Fixnum.
-
-Mon May 2 01:00:04 2016 Tanaka Akira <akr@fsij.org>
-
- * test/lib/test/unit/assertions.rb (assert_fixnum): Defined.
- (assert_bignum): Defined.
-
- * test/ruby/test_bignum.rb: Use assert_bignum.
-
- * test/ruby/test_integer_comb.rb: Use assert_fixnum and assert_bignum.
-
- * test/ruby/test_optimization.rb: Ditto.
-
-Mon May 2 00:41:53 2016 Tanaka Akira <akr@fsij.org>
-
- * vm_trace.c (recalc_remove_ruby_vm_event_flags): Add a cast to
- avoid signed integer overflow.
-
-Mon May 2 00:06:04 2016 Tanaka Akira <akr@fsij.org>
-
- * test/lib/envutil.rb: Define Integer::{FIXNUM_MIN,FIXNUM_MAX}.
-
- * test/ruby/test_bignum.rb: Use Integer::{FIXNUM_MIN,FIXNUM_MAX}.
-
- * test/ruby/test_bignum.rb: Ditto.
-
- * test/ruby/test_integer_comb.rb: Ditto.
-
- * test/ruby/test_marshal.rb: Ditto.
-
- * test/ruby/test_optimization.rb: Ditto.
-
-Sun May 1 23:59:59 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * array.c (rb_ary_sum): fix for mathn
-
- * test/ruby/test_array.rb (test_sum): ditto.
-
-Sun May 1 23:51:54 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/lib/test/unit.rb (Options#non_options): fixed wrong regexp.
- if both positives and negatives were specified, positives had to
- be specified from the beginning.
-
-Sun May 1 21:00:07 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c: drop Win2K support.
-
-Sun May 1 20:39:47 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * cont.c, hash.c, random.c, win32/win32.c: cleanup some Win9x/ME/NT4
- support leftovers.
- [fix GH-1328] patched by @cremno
-
-Sun May 1 07:30:44 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (search_nonascii): use nlz on big endian environments.
-
- * internal.h (nlz_intptr): defined.
-
-Sun May 1 00:03:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (__builtin_ctz): check.
-
- * configure.in (__builtin_ctzll): check.
-
- * internal.h (rb_popcount32): defined for ntz_int32.
- it can use __builtin_popcount but this function is not used on
- GCC environment because it uses __builtin_ctz.
- When another function uses this, using __builtin_popcount
- should be re-considered.
-
- * internal.h (rb_popcount64): ditto.
-
- * internal.h (ntz_int32): defined for ntz_intptr.
-
- * internal.h (ntz_int64): defined for ntz_intptr.
-
- * internal.h (ntz_intptr): defined as ntz for uintptr_t.
-
- * string.c (search_nonascii): unroll and use ntz.
-
-Sat Apr 30 21:54:13 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (Init_Numeric): Gather Fixnum method definitions.
-
-Sat Apr 30 21:28:14 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_div): Define Integer#/.
-
- * bignum.c (rb_big_div): Don't define Bignum#/.
-
- * lib/mathn.rb (Integer#/): Replace Integer#/ instead of Bignum#/.
-
-Sat Apr 30 21:11:08 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_plus): Define Integer#+.
-
- * bignum.c (rb_big_plus): Don't define Bignum#+.
-
-Sat Apr 30 21:01:20 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_minus): Define Integer#-.
-
- * bignum.c (rb_big_minus): Don't define Bignum#-.
-
-Sat Apr 30 20:53:33 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_mul): Define Integer#*.
-
- * bignum.c (rb_big_mul): Don't define Bignum#*.
-
-Sat Apr 30 20:30:44 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_modulo): Define Integer#%.
-
- * bignum.c (rb_big_modulo): Don't define Bignum#%.
-
-Sat Apr 30 20:17:08 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_equal): Define Integer#==.
-
- * bignum.c (rb_big_eq): Don't define Bignum#==.
-
-Sat Apr 30 19:41:15 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_gt): Define Integer#>.
-
- * bignum.c (rb_big_gt): Don't define Bignum#>.
- Renamed from big_gt.
-
- * internal.h (rb_big_gt): Declared.
-
-Sat Apr 30 19:24:40 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_ge): Define Integer#>=.
-
- * bignum.c (rb_big_ge): Don't define Bignum#>=.
- Renamed from big_ge.
-
- * internal.h (rb_big_ge): Declared.
-
-Sat Apr 30 19:20:40 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/standard_library.rdoc: Remove obsoleted classes and modules.
-
-Sat Apr 30 19:09:23 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_lt): Define Integer#<.
-
- * bignum.c (rb_big_lt): Don't define Bignum#<.
- Renamed from big_lt.
-
- * internal.h (rb_big_lt): Declared.
-
-Sat Apr 30 18:44:05 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_le): Define Integer#<=.
-
- * bignum.c (rb_big_le): Don't define Bignum#<=.
- Renamed from big_le.
-
- * internal.h (rb_big_le): Declared.
-
-Sat Apr 30 18:11:44 2016 Tanaka Akira <akr@fsij.org>
-
- * bignum.c (Init_Bignum): Define Integer::GMP_VERSION.
-
-Sat Apr 30 16:58:18 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_remainder): Define Integer#remainder.
-
- * bignum.c (rb_big_remainder): Don't define Bignum#remainder.
-
- * internal.h (rb_big_remainder): Declared.
-
-Sat Apr 30 15:29:24 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_uminus): {Fixnum,Bignum}#-@ is unified into
- Integer.
-
- * bignum.c (rb_big_uminus): Don't define Bignum#-@.
-
-Sat Apr 30 14:42:20 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_idiv): {Fixnum,Bignum}#div is unified into
- Integer.
-
- * bignum.c (rb_big_idiv): Don't define Bignum#div.
-
-Sat Apr 30 14:25:55 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_modulo): {Fixnum,Bignum}#modulo is unified into
- Integer.
-
- * bignum.c (rb_big_modulo): Don't define Bignum#modulo.
-
-Sat Apr 30 14:04:30 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_divmod): {Fixnum,Bignum}#divmod is unified into
- Integer.
-
- * bignum.c (rb_big_divmod): Don't define Bignum#divmod.
-
-Sat Apr 30 13:20:00 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_fdiv): {Fixnum,Bignum}#fdiv is unified into
- Integer.
-
- * bignum.c (rb_big_fdiv): Don't define Bignum#fdiv.
-
-Sat Apr 30 12:25:43 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_pow): {Fixnum,Bignum}#** is unified into
- Integer.
-
- * bignum.c (rb_big_pow): Don't define Bignum#**.
-
-Sat Apr 30 12:28:59 2016 Tanaka Akira <akr@fsij.org>
-
- * bignum.c (rb_big_comp): Renamed from rb_big_neg.
-
- * numeric.c (fix_comp): Renamed from fix_rev.
-
-Sat Apr 30 12:25:43 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_comp): {Fixnum,Bignum}#~ is unified into
- Integer.
-
- * bignum.c (rb_big_neg): Don't define Bignum#~.
-
- * internal.h (rb_big_neg): Declared.
-
-Sat Apr 30 12:07:42 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_and): {Fixnum,Bignum}#& is unified into
- Integer.
-
- * bignum.c (rb_big_and): Don't define Bignum#&.
-
-Sat Apr 30 11:56:15 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/thread: removed dummy extension library. thread_sync.c
- provides "thread.rb" already.
-
-Sat Apr 30 11:53:48 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_or): {Fixnum,Bignum}#| is unified into
- Integer.
-
- * bignum.c (rb_big_or): Don't define Bignum#|.
-
-Sat Apr 30 11:18:47 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * vm_trace.c: Fix typos. [ci skip]
-
-Sat Apr 30 10:09:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/pty/pty.c (establishShell): honor USER environment variable
- and login name over uid, one uid can be shared by some login
- names.
-
-Fri Apr 29 22:40:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * doc/maintainers.rdoc (ext/io/nonblock): still maintained, as
- well as ext/io/wait, which is the origin.
-
-Fri Apr 29 21:18:12 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * doc/maintainers.rdoc (ext/win32): of course, it's still maintained.
-
-Fri Apr 29 21:03:10 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * gems/bundled_gems: Update latest gems, test-unit-3.1.8 and rake-11.1.2.
-
-Fri Apr 29 20:43:02 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/maintainers.rdoc: Update latest maintainers list on Ruby 2.4
-
-Fri Apr 29 19:52:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/maintainers.rdoc: Removed deprecated entries. These are already deleted.
-
-Fri Apr 29 19:48:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/maintainers.rdoc: Removed Ruby 1.8 entries. It's not necessary to
- Ruby 2.4 or later.
-
-Thu Apr 28 17:03:17 2016 Nicholas Maccharoli <nmaccharoli@gmail.com>
-
- * hash.c (rb_hash_update_{block,func}_callback): dry up hash
- update callback code. [Fix GH-1338]
-
-Thu Apr 28 16:52:05 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (rb_reg_prepare_enc): use rb_enc_asciicompat(enc) instead of
- rb_enc_str_asciicompat_p(str) to avoid useless rb_enc_get(str) call.
-
-Thu Apr 28 16:33:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb: [DOC] fix example code. base on the code by
- Semyon Gaivoronskiy in [ruby-core:75224]. [Bug #12323]
-
-Thu Apr 28 09:33:03 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.4.
- Please see entries of 2.6.4 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
-
-Thu Apr 28 04:49:07 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * configure.in (rb_cv_lgamma_r_pm0): check if lgamma_r(+0.0)
- returns positive infinity, in addition to lgamma_r(-0.0).
- AIX returns an incorrect result of negative infinity.
-
- * math.c (ruby_lgamma_r): handle +0.0, in addition to -0.0.
-
-Thu Apr 28 01:11:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * time.c: define _DEFAULT_SOURCE because glibc 2.20 deprecates
- _BSD_SOURCE.
- https://sourceware.org/glibc/wiki/Release/2.20
-
-Thu Apr 28 00:27:55 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_xor): {Fixnum,Bignum}#^ is unified into
- Integer.
-
- * bignum.c (rb_big_xor): Don't define Bignum#^.
-
-Wed Apr 27 20:53:59 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_aref): {Fixnum,Bignum}#[] is unified into
- Integer.
-
- * bignum.c (rb_big_aref): Don't define Bignum#<<.
-
- * internal.h (rb_big_aref): Declared.
-
-Wed Apr 27 16:10:35 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/instruction.rb: fix to follow current implementation.
-
-Wed Apr 27 15:47:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_s_new): warn if a block is given,
- as well as IO.new.
-
-Wed Apr 27 14:29:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (ruby_only_for_internal_use): raise fatal error when
- deprecated function only for internal use is called, not just a
- warning.
-
-Tue Apr 26 23:42:30 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/redmine-backporter.rb (rel): should not raise exceptions even if
- the user input is wrong. only reports the error and continue process.
-
-Tue Apr 26 23:35:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (process_options): convert -e script to the encoding
- given by a command line option on Windows. assume it is the
- expected encoding. [ruby-dev:49461] [Bug #11900]
-
-Tue Apr 26 21:11:02 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_lshift): {Fixnum,Bignum}#<< is unified into
- Integer.
-
- * bignum.c (rb_big_lshift): Don't define Bignum#<<.
-
-Tue Apr 26 20:59:40 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_rshift): {Fixnum,Bignum}#>> is unified into
- Integer.
-
- * bignum.c (rb_big_rshift): Don't define Bignum#>>.
-
-Tue Apr 26 20:46:16 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_size): {Fixnum,Bignum}#size is unified into Integer.
-
- * bignum.c (rb_big_size_m): Don't define Bignum#size.
-
- * internal.h (rb_big_size_m): Declared.
-
-Tue Apr 26 20:09:08 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (rb_int_bit_length): {Fixnum,Bignum}#bit_length is
- unified into Integer.
-
- * bignum.c (rb_big_bit_length): Don't define Bignum#bit_length.
-
- * internal.h (rb_big_bit_length): Declared.
-
-Tue Apr 26 19:56:16 2016 Tanaka Akira <akr@fsij.org>
-
- * numeric.c (int_abs): Integer#{abs,magnitude} moved from
- Fixnum and Bignum.
-
- * bignum.c (rb_big_abs): Don't define Bignum#{abs,magnitude}.
-
- * internal.h (rb_big_abs): Declared.
-
-Mon Apr 25 14:39:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/rbconfig/sizeof/extconf.rb: just check the existence of each
- types, to reduce configuration time, especially cross-compiling.
-
- * template/sizes.c.tmpl: calculate sizes of checked types at
- compilation time.
-
-Mon Apr 25 11:27:27 2016 Marcus Stollsteimer <sto.mar@web.de>
-
- * doc/extension.rdoc: Improvements to english grammars.
- [Bug #12246][ruby-core:74792][ci skip]
-
-Mon Apr 25 11:17:50 2016 Marcus Stollsteimer <sto.mar@web.de>
-
- * encoding.c: Fix return value of `Encoding::ISO8859_1.name`
- [Bug #12313][ruby-core:75147][ci skip]
- * ext/bigdecimal/bigdecimal.c: Fix code sample of `BigDecimal.new`
-
-Sun Apr 24 23:29:16 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * configure.in: add missing -lm for AIX.
-
-Sun Apr 24 18:33:58 2016 Kazuki Tsujimoto <kazuki@callcc.net>
-
- * vm_insnhelper.c (INLINE): disable r54738 if __NO_INLINE__ is defined.
- It caused "undefined reference to `vm_getivar'".
-
-Sun Apr 24 09:32:12 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * test/ruby/test_array.rb: Add test cases for Array#sum with
- non-numeric objects.
-
-Sun Apr 24 04:21:27 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_insnhelper.c (INLINE): define as `inline` when it is optimized.
- define as `static inline` when it is not optimized to keep
- the symbol generated.
-
- * vm_insnhelper.c (vm_getivar): use `INLINE` to force inline
- so that a compiler inlines it into vm_getinstancevariable
- and optimizes out is_attr and related branches.
-
- * vm_insnhelper.c (vm_getivar): use `inline` to recommend inline.
- Without this vm1_ivar_set is degraded.
-
- benchmark results:
- minimum results in each 5 measurements.
- Execution time (sec)
- name ruby 2.4.0dev (2016-04-23 trunk 54727) [x86_64-linux] ruby 2.4.0dev (2016-04-23 trunk 54733) [x86_64-linux] built-ruby
- loop_whileloop 0.641 0.642 0.646
- vm1_ivar* 1.002 0.999 0.831
- vm1_ivar_set* 0.369 1.106 0.362
-
- Speedup ratio: compare with the result of `ruby 2.4.0dev (2016-04-23
- trunk 54727) [x86_64-linux]' (greater is better)
- name ruby 2.4.0dev (2016-04-23 trunk 54733) [x86_64-linux]
- built-ruby
- loop_whileloop
- 0.998 0.991
- vm1_ivar*
- 1.003 1.205
- vm1_ivar_set*
- 0.334 1.018
-
-Sat Apr 23 18:01:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * vm_insnhelper.c (vm_getivar): specify inline instead of static inline.
- vm_getivar is called by vm_call_ivar and vm_getinstancevariable.
- At least with GCC 4.8 and 5.3 on Linux, they are inlining it into
- vm_call_ivar but not vm_getinstancevariable.
- By `inline`, they correctly inline it and gains performance.
-
- Speedup ratio: compare with the result of `ruby 2.4.0dev (2016-04-23
- trunk 54727) [x86_64-linux]' (greater is better)
- name built-ruby
- loop_whileloop 1.001
- vm1_ivar* 1.189
- vm1_ivar_set* 1.024
-
- Note the `inline`'s meaning is different between old GCC
- and C99. Old GCC's inline means C99's extern inline.
- https://gcc.gnu.org/onlinedocs/gcc/Inline.html
- Since Ruby specify -std=iso9899:1999, it works like C99.
-
-Sat Apr 23 16:11:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_mul_size_overflow): use UNLIKELY
- by user side to improve generality.
-
-Sat Apr 23 16:10:02 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/ruby.h (RB_LIKELY): use prefix in ruby.h.
-
- * intern.h (LIKELY): define with RB_LIKELY.
-
-Sat Apr 23 13:27:25 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * NEWS: Add descriptions for Time#to_time updates.
- [Bug #12271]
-
-Sat Apr 23 13:21:24 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * NEWS: Add descriptions for DateTime#to_time updates.
- [Bug #12189]
-
-Sat Apr 23 11:21:27 2016 Marcus Stollsteimer <sto.mar@web.de>
-
- * ext/date/date_core.c (Init_date_core): [DOC] Convert DateTime
- documentation to RDoc from Markdown.
- [ruby-core:75136] [Bug #12311]
-
-Sat Apr 23 09:03:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c: cygwin does not use w32_cmdvector, command line can be
- other than UTF-8. [ruby-dev:49519] [Bug #12184]
-
-Sat Apr 23 01:00:03 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * configure.in: don't use the system-provided round(3) on AIX.
- In AIX, round(0.49999999999999994) returns 1.0.
- Use round() in numeric.c instead.
-
-Fri Apr 22 21:00:44 2016 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_time_tz.rb: Tests depends on Europe/Moscow removed
- to avoid test failures due to the tzdata change.
- https://github.com/eggert/tz/commit/8ee11a301cf173afb0c76e0315b9f9ec8ebb9d95
- Found by naruse.
-
-Fri Apr 22 20:18:40 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_mul_size_overflow): added to handle
- mul overflow efficiently.
-
- * include/ruby/ruby.h (rb_alloc_tmp_buffer2): use rb_mul_size_overflow
- and avoid division where it can define DSIZE_T.
-
- * gc.c (xmalloc2_size): moved from ruby.h and use rb_mul_size_overflow.
-
-Fri Apr 22 20:34:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (time_asctime): [DOC] add ctime example, not only
- asctime. [ruby-core:75126] [Bug #12310]
-
-Fri Apr 22 18:44:32 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * variable.c: use uint32_t instead of long to avoid confusion about
- the type of ivtbl->numiv.
-
-Fri Apr 22 15:09:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval_jump.c (exec_end_procs_chain): restore previous error info
- for each end procs. [ruby-core:75038] [Bug #12302]
-
-Fri Apr 22 15:04:56 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/redmine-backporter.rb: the fullpath of merger.rb is too long to
- copy&paste on Windows. show shorter name instead on the platform.
- I'm sure that the user of this command on Windows is only me.
-
-Fri Apr 22 14:52:04 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/merger.rb: remove temporary file.
-
-Fri Apr 22 11:27:03 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/net/http.rb: Improve documentation for SSL requests via GET method.
- [fix GH-1325][ci skip] Patch by @jsyeo
-
-Fri Apr 22 10:51:13 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/webrick/ssl.rb: Support to add SSLCiphers option.
- [fix GH-1321] Patch by @rhadoo
-
-Fri Apr 22 10:43:19 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * file.c, win32/file.c: Removed obsoleted safe level checks.
- [fix GH-1327] Patch by @cremno
-
-Fri Apr 22 10:01:48 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * benchmark/bm_so_meteor_contest.rb: fix a typo.
- [fix GH-1330][ci skip] Patch by @sachin21
-
-Fri Apr 22 04:57:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * gc.c (rb_alloc_tmp_buffer_with_count): added like xmalloc2 to
- avoid duplicated check of size.
-
- * gc.c (ruby_xmalloc2): added to keep separate layers.
-
- * include/ruby/ruby.h (rb_alloc_tmp_buffer2): added to check
- the size more statically.
-
-Fri Apr 22 04:54:40 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/ruby.h (LIKELY): moved from internal.h.
-
- * include/ruby/ruby.h (UNLIKELY): ditto.
-
-Thu Apr 21 01:44:19 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * gc.c (objspace_malloc_prepare): remove size check because it is
- used by objspace_xmalloc and objspace_xcalloc.
- objspace_xmalloc introduces its own check in this commit.
- objspace_xcalloc checks with xmalloc2_size (ruby_xmalloc2_size).
-
- * gc.c (objspace_xmalloc0): common xmalloc function.
-
- * gc.c (objspace_xmalloc): introduce its own size check.
-
- * gc.c (objspace_xmalloc2): separated from ruby_xmalloc2 to clarify
- the layer who has the responsibility to check the size.
-
- * gc.c (objspace_xrealloc): remove duplicated size check.
-
- * gc.c (ruby_xmalloc2): use objspace_xmalloc2.
-
- * include/ruby/ruby.h (ruby_xmalloc2_size): follow the size limit
- as SSIZE_MAX. Note that ISO C says size_t is unsigned integer.
-
-Thu Apr 21 12:14:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check if succeeded in creating config.h.
-
- * tool/ifchange: ignore failures when TEST_COLORS unmatched. just
- use the default value if expected name is not contained in it.
- [ruby-core:75046] [Bug #12303]
-
-Wed Apr 20 17:33:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/cgi/escape/escape.c (cgiesc_unescape): define unescape
- method instead of _unescape, and should pass the optional
- argument to the super method.
-
- * lib/cgi/util.rb (CGI::Util#_unescape): remove intermediate
- method.
-
-Wed Apr 20 15:52:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (syntax_error_initialize): move the default message,
- "compile error", from parse.y. the default parameter should
- belong to the class definition.
-
- * parse.y (yycompile0): use the default parameter.
-
-Wed Apr 20 10:25:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (append_compile_error): use rb_syntax_error_append.
-
- * error.c (rb_syntax_error_append): append messages into a
- SyntaxError exception instance.
-
- * parse.y (yycompile0): make new SyntaxError instance in main
- mode, otherwise error_buffer should be a SyntaxError if error
- has occurred.
-
-Tue Apr 19 17:42:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (err_vcatf): rename, and separate appending message from
- creating a string buffer.
-
- * error.c (rb_syntax_error_append): merge rb_error_vsprintf and
- rb_compile_err_append.
-
- * parse.y (parser_compile_error): use rb_syntax_error_append.
-
-Tue Apr 19 13:46:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (append_compile_error, compile_bug): pass iseq and get
- error info and file from it, not by the thread error info.
-
- * error.c (rb_report_bug_valist): take va_list instead of variadic
- arguments, and just report the bug but not abort.
-
-Tue Apr 19 13:18:12 2016 Naotoshi Seo <sonots@gmail.com>
-
- * lib/time.rb: revert r54167 because it would break
- backward compatibilities, and it is documented that
- Time.parse does not take into account time zone
- abbreations other than ones described in RFC 822
-
-Tue Apr 19 13:12:03 2016 Naotoshi Seo <sonots@gmail.com>
-
- * ChangeLog: Fix dates of previous commits
-
-Tue Apr 19 12:45:03 2016 Naotoshi Seo <sonots@gmail.com>
-
- * ChangeLog: Add descriptions for logger updates
- * NEWS: Add descriptions for logger updates
-
-Tue Apr 19 12:45:02 2016 Naotoshi Seo <sonots@gmail.com>
-
- * lib/logger.rb: Add shift_period_suffix option
-
-Tue Apr 19 12:45:01 2016 Naotoshi Seo <sonots@gmail.com>
-
- * lib/logger.rb: Allow specifying logger parameters in constructor
- such as level, progname, datetime_format, formatter.
-
-Mon Apr 18 16:07:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_peephole_optimize): should not replace the
- current target INSN, not to follow the replaced dangling link in
- the caller. [ruby-core:74993] [Bug #11816]
-
-Mon Apr 18 12:56:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (flo_truncate): add an optional parameter, digits, as
- well as Float#round. [Feature #12245]
-
- * numeric.c (int_truncate): add an optional parameter, digits, as
- well as Integer#round. [Feature #12245]
-
-Sun Apr 17 04:18:56 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * tool/redmine-backporter.rb: revisions are strings.
-
-Sat Apr 16 14:26:49 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * ext/date/date_core.c : remove not used f_getlocal macro.
- After r54553 f_getlocal macro is not used.
-
-Sat Apr 16 14:15:24 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * ext/date/date_core.c : remove not used f_utc6 macro.
- After r54169 f_utc6 macro is not used.
-
-Sat Apr 16 10:00:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * struct.c (struct_make_members_list, rb_struct_s_def): member
- names should be unique. [ruby-core:74971] [Bug #12291]
-
- * struct.c (struct_make_members_list): extract making member name
- list from char* va_list, with creating symbols without
- intermediate IDs.
-
-Sat Apr 16 01:33:27 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * tool/redmine-backporter.rb: sort revisions.
-
-Sat Apr 16 01:16:02 2016 Tanaka Akira <akr@fsij.org>
-
- * array.c (rb_ary_sum): Don't yield same element twice.
- Found by nagachika.
-
-Sat Apr 16 01:03:32 2016 Tanaka Akira <akr@fsij.org>
-
- * array.c (rb_ary_sum): Fix SEGV by [1/2r, 1].sum.
-
-Fri Apr 15 23:52:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * rational.c (rb_rational_plus): rename from rb_rational_add
- to be aligned with rb_fix_plus.
-
- * array.c (rb_ary_sum): ditto.
-
- * internal.h: ditto.
-
-Fri Apr 15 23:42:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * rational.c (rb_rational_add): rename from nurat_add.
-
- * array.c (rb_ary_sum): use rb_rational_add directly.
-
- * test/ruby/test_array.rb (test_sum): add assertions for an array of
- Rational values.
-
-Fri Apr 15 22:31:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * array.c (rb_ary_sum): apply the precision compensated algorithm
- for an array in which Rational and Float values are mixed.
-
- * test/ruby/test_array.rb (test_sum): add assertions for the above
- change.
-
-Fri Apr 15 22:30:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (rb_thread_setname): defer setting native thread name
- set in initialize until the native thread is created.
- [ruby-core:74963] [Bug #12290]
-
-Fri Apr 15 20:27:16 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/irb/ext/save-history.rb: Fix NoMethodError when method is not defined.
-
-Fri Apr 15 15:38:58 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * common.mk (benchmark): order options for built-ruby and compare-ruby.
-
-Fri Apr 15 14:14:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * test/ruby/test_array.rb (test_sum): add assertions for Rational and
- Complex numbers.
-
-Fri Apr 15 10:07:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/console/console.c (console_key_pressed_p): raise the same
- exception, "unknown virtual key code", for names with nul chars.
- though console_win32_vk() considers the length and can deal with
- nul chars, rb_sprintf() raised at PRIsVALUE previously, so quote
- it if it is unprintable.
-
-Fri Apr 15 09:02:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/console/console.c (rb_sym2str): fallback definition for
- older ruby. [ruby-core:74953] [Bug #12284]
-
-Thu Apr 14 21:46:36 2016 Tanaka Akira <akr@fsij.org>
-
- * array.c (rb_ary_sum): Support the optional argument, init, and
- block.
-
-Thu Apr 14 19:02:41 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/irb/ext/save-history.rb: suppress warning: method redefined;
- discarding old save_history=.
-
-Thu Apr 14 14:58:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/tk/tkutil/tkutil.c (tk_hash_kv): the third argument can be
- nil not only an Array. reported by @windwiny at
- https://github.com/ruby/ruby/commit/cdaa94e#commitcomment-17096618
-
-Thu Apr 14 14:28:55 2016 cremno phobia <cremno@mail.ru>
-
- * cont.c (fiber_initialize_machine_stack_context): fix wrong
- _MSC_VER check, should be decimal but not hexadecimal.
- [ruby-core:74936] [Bug #12279]
-
-Wed Apr 13 22:51:38 2016 Tanaka Akira <akr@fsij.org>
-
- * array.c (rb_ary_sum): Array#sum is implemented.
- Kahan's compensated summation algorithm for precise sum of float
- numbers is moved from ary_inject_op in enum.c.
-
- * enum.c (ary_inject_op): Don't specialize for float numbers.
-
- [ruby-core:74569] [Feature #12217] proposed by mrkn.
-
-Wed Apr 13 15:56:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (flo_ceil): add an optional parameter, digits, as
- well as Float#round. [Feature #12245]
-
- * numeric.c (flo_floor): add an optional parameter, digits, as
- well as Float#round. [Feature #12245]
-
- * numeric.c (int_ceil): add an optional parameter, digits, as
- well as Integer#round. [Feature #12245]
-
- * numeric.c (int_floor): add an optional parameter, digits, as
- well as Integer#round. [Feature #12245]
-
-Wed Apr 13 14:47:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (Init_File): add alias File.empty? to File.zero?.
- [Feature #9969]
-
-Wed Apr 13 14:36:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (assign_in_cond): allow multiple assignment in
- conditional expression. [Feature #10617]
-
-Wed Apr 13 14:11:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (rb_big_size): add wrapper function of BIGSIZE and
- rename the method function with _m suffix.
-
- * numeric.c (int_round_zero_p): extracted from rb_int_round.
- optimize for Bignum, and convert VALUE returned by Numeric#size
- to long.
-
-Wed Apr 13 12:00:08 2016 Koichi Sasada <ko1@atdot.net>
-
- * test/ruby/test_basicinstructions.rb: add a test to check access
- instance variables on special const objects.
-
- All of such objects are frozen, so that we can not set instance
- variables for them. But we can read instance variables and return
- default value (nil).
-
-Tue Apr 12 20:40:35 2016 Kaneko Yuichiro <spiketeika@gmail.com>
-
- * ext/date/date_core.c (time_to_time): should preserve timezone
- info. [ruby-core:74889] [Bug #12271]
-
-Tue Apr 12 11:51:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (new_label_body): initialize bit fields, since
- compile_data_alloc does not clear the memory. [Bug #12082]
-
-Mon Apr 11 20:18:43 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm_backtrace.c (frame2klass): filter only for imemo_ment.
- T_IMEMO/imemo_iseq can be passed here.
-
-Mon Apr 11 17:43:04 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_optimize): disable tail call optimization in
- rescued, rescue, and ensure blocks.
- [ruby-core:73871] [Bug #12082]
-
-Mon Apr 11 06:54:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (apply2files): apply to a VALUE vector instead of a
- temporary array.
-
-Sun Apr 10 20:54:16 2016 Joe Swatosh <joe.swatosh@gmail.com>
-
- * ext/win32/lib/win32/registry.rb (DeleteValue, DeleteKey): fix
- API names. [ruby-core:74863] [Bug #12264]
-
-Sun Apr 10 17:47:42 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_realpath_internal): no argument conversions since
- this internal function does not need to_path and encoding
- conversions, not to be affected by the default internal
- encoding.
-
-Sat Apr 9 10:03:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * load.c (rb_f_load): raise with the original path name before
- encoding conversion.
-
-Sat Apr 9 02:05:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (rb_cstr_parse_inum): [EXPERIMENTAL] new function to
- parse integer in C-string with length. the name and the
- arguments may be changed in the future.
-
- * bignum.c (rb_str_to_inum): preserve encoding of the argument in
- error messages, and no longer needs to copy non-terminated
- strings.
-
- * bignum.c (rb_str2big_{poweroftwo,normal,karatsuba,gmp}): ditto.
-
-Thu Apr 7 19:04:03 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * doc/regexp.rdoc (comments): [DOC] terminators cannot appear in
- comments. [ruby-core:74838] [Bug #12256]
-
-Thu Apr 7 11:24:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/tk/tkutil/tkutil.c (cbsubst_initialize): fix out-of-bound
- access when no arguments given. `p Tk::Event.new` crashed.
-
-Fri Apr 1 01:26:00 2016 Benoit Daloze <eregontp@gmail.com>
-
- * ext/coverage/coverage.c: Fully reset coverage to not persist global state.
- It was returning old file coverages as empty arrays to the user.
- [ruby-core:74596] [Bug #12220]
-
- * ext/coverage/coverage.c (rb_coverages): remove unused static state.
-
- * thread.c: Moved and renamed coverage_clear_result_i to reset_coverage_i.
-
- * test/coverage/test_coverage.rb: improve precision of tests.
-
-Wed Apr 6 22:41:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_lgamma_r_m0): fix the condition for
- lgamma_r(-0.0). [Bug #12249]
-
-Wed Apr 6 17:38:42 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * tool/downloader.rb (RubyGems.download): follow the change of the
- rubygems ssl_certs directory tree introduced by previous commit.
-
-Wed Apr 6 15:00:27 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.3.
- Please see entries of 2.6.3 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
-
-Wed Apr 6 14:13:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_lgamma_r_m0): check if lgamma_r(-0.0)
- returns negative infinity. [Bug #12249]
-
- * math.c (ruby_lgamma_r): define by the configured result.
-
-Wed Apr 6 10:56:15 2016 Anton Davydov <antondavydov.o@gmail.com>
-
- * lib/logger.rb (Logger#level=): remove unnecessary local
- variable.
-
- * lib/logger.rb (Logger#initialize, Logger#reopen): [DOC] mention
- the default values. cherrypicked from [GH-1319].
-
-Wed Apr 6 10:17:53 2016 cremno phobia <cremno@mail.ru>
-
- * math.c (ruby_lgamma_r): missing/lgamma_r.c is used on Windows,
- since msvcrt does not provide it.
-
- * missing/lgamma_r.c (lgamma_r): fix lgamma(-0.0).
- [ruby-core:74823] [Bug #12249]
-
-Wed Apr 6 01:22:55 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * math.c (ruby_lgamma_r): mswin's lgamma_r also seems to be wrong.
- cf. [Bug #12249]
-
-Wed Apr 6 00:53:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * math.c (ruby_lgamma_r): fix lgamma(-0.0) on mingw and OSX.
-
- * math.c (ruby_tgamma): fix tgamma(-0.0) on mingw.
- [ruby-core:74817] [Bug #12249]
-
-Tue Apr 5 14:50:28 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c (mime_putc): fix typo.
- [Bug #12202] [ruby-core:74802]
-
-Tue Apr 5 00:06:44 2016 Aeris <aeris@imirhil.fr>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_tmp_key): Access to ephemeral
- TLS session key in case of forward secrecy cipher. Only
- available since OpenSSL 1.0.2. [Fix GH-1318]
-
- * ext/openssl/extconf.rb: Check for SSL_get_server_tmp_key.
-
-Mon Apr 4 23:37:05 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_core.h (rb_vm_struct): make at_exit a single linked list but
- not RArray, not to mark the registered functions by the write
- barrier. based on the patches by Evan Phoenix.
- [ruby-core:73908] [Bug #12095]
-
-Mon Apr 4 17:43:45 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: change default value of
- RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO 0.3 -> 0.2
- RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO 0.8 -> 0.65
-
- These values are same as Ruby 2.0.0.
-
- This change cause GC counts.
- However, generational GC reduced each (minor) GC time and
- increase memory locality. So that not so big impact on my
- benchmarking results.
- (surprisingly, this fix speed up programs on some cases)
-
- You can change these values by environment variables
- if you feel wrong.
-
-Mon Apr 4 17:36:52 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (get_envparam_double): take an upper_bound.
-
- And also take an accept_zero flag which allow to accept zero
- even if lower_bound is set.
-
- * gc.c (ruby_gc_set_params): fix parameters.
-
- RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO set 0.9 as *lower_bound*, so that
- it should be upper_bound.
- Set RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO as lower bound.
-
- Also set lower/upper bound of RUBY_GC_HEAP_FREE_SLOTS_GOAL_RATIO to
- RUBY_GC_HEAP_FREE_SLOTS_MIN/MAX_RATIO.
-
-Mon Apr 4 16:41:32 2016 Koichi Sasada <ko1@atdot.net>
-
- * vm.c (Init_VM): should pass tokens.
-
-Sun Apr 3 09:34:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (flodivmod): round division if it is a finite number
- and module is required.
-
- * numeric.c (dbl2ival): do not round here.
-
- * numeric.c (flo_ceil): use dbl2ival.
-
- * numeric.c (flo_round): round explicitly.
-
-Sat Apr 2 15:24:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/intern.h (rb_check_arity): returns argc.
-
-Fri Apr 1 20:58:33 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Data generation to implement
- swapcase functionality for titlecase characters. Swapcase isn't defined
- by Unicode, because the purpose/usage of swapcase is unclear anyway.
- The implementation follows a proposal from Nobu, swapping the case of
- each component of a titlecase character individually.
- This means that the titlecase characters have to be decomposed.
-
- * enc/unicode.c: Code using the above data.
-
- * test/ruby/enc/test_case_mapping.rb: Tests for the above.
-
-Fri Apr 1 14:55:28 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * configure.in (AC_CONFIG_FILES): $srcdir/.git can be a file pointing
- the real git_dir, such as when the git working tree is a "linked
- working tree" (a working tree created by git-worktree). So use
- git-rev-parse --git-dir to check if $srcdir is the top-level of a git
- repository, not just checking if the $srcdir/.git directory does exist
- or not. [ruby-core:74759] [Bug #12239]
-
- * tool/change_maker.rb: use tool/vcs.rb to detect VCS. This used to have
- its own VCS detection code, while we have tool/vcs.rb.
-
- * tool/vcs.rb (detect): remove code duplication
-
-Fri Apr 1 04:50:44 2016 Eric Wong <e@80x24.org>
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc):
- enable SSL_MODE_ACCEPT_MOVING_WRITE_BUFFER by default
- [Bug #12126]
-
-Fri Apr 1 01:13:55 2016 Benoit Daloze <eregontp@gmail.com>
-
- * thread.c (update_coverage): Do not track coverage in loaded files
- after Coverage.result. Avoids out-of-bounds access. [Bug #12237]
-
- * ext/coverage/coverage.c (coverage_clear_result_i): document.
-
-Thu Mar 31 19:16:16 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: need to set initial value of GC_HEAP_FREE_SLOTS_GOAL_RATIO.
-
-Thu Mar 31 17:50:27 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: change additional allocation policy.
-
- Introduce new environment variable
- RUBY_GC_HEAP_FREE_SLOTS_GOAL_RATIO (goal_ratio) to calculate the
- ratio of additional memory.
-
- Before this change, we add pages with the following formula
- (when free_slots < total_pages * RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO):
- next_pages = total_pages * RUBY_GC_HEAP_GROWTH_FACTOR
-
- This addition can allocate too much.
-
- With this change, we increase pages to satisfy the following formula:
- next_free_slots = next_total_slots * goal_ratio
- where
- next_free_slots = free_slots + adding_slots
- next_total_slots = total_slots + adding_slots.
-
- If you want to prepare many free slots, increase this ratio.
-
- If this variable is 0, then simply multiply
- RUBY_GC_HEAP_GROWTH_FACTOR.
-
- * gc.c (get_envparam_double): enable to accept 0.
-
-Thu Mar 31 17:48:25 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_marks_finish): fix syntax error.
-
-Thu Mar 31 16:49:36 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: simplify allocate/free detecting logic at the end of marking.
-
- Before this change, heap_pages_min_slots are calculated at the
- beginning sweeping phase. And this value is used at the end of
- *next* marking phase.
-
- To simplify it, we use this value at the end of this marking phase.
- It means that we don't need to store this value as global state.
-
- Also heap_pages_max_slots is calculated at the begging of sweeping
- phase and used at the end of sweeping phase.
- To simplify this logic, we introduced new global value
- heap_pages_freeable_pages it means extra pages count we can free.
- gc_sweep_step() checks this value and moves empty pages to tomb_heap
- not more than this value.
-
- Because of this fix, heap_pages_swept_slots is no longer needed.
-
- * gc.c (rb_objspace_t::heap_pages): restruct the objspace global
- status.
-
- remove the following fields
- * swept_slots (and heap_pages_swept_slots)
- * min_free_slots (and heap_pages_min_free_slots)
- * max_free_slots (and heap_pages_max_free_slots)
- And add the following filed.
- * freeable_pages (and heap_pages_freeable_pages)
-
- * gc.c (heap_pages_free_unused_pages): unlink tomb heap pages
- because tomb heap should have only freeable pages.
-
- * gc.c (heap_extend_pages): add parameters for future extension.
-
-Thu Mar 31 16:43:02 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: add GC parameters to configure the following values:
- * RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO:
- allocate additional pages when free slots is lower than
- the value (total_slots * (this ratio)).
- * RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO:
- allow to free pages when free slots is greater than
- the value (total_slots * (this ratio)).
-
- Before this change, these values are hard coded.
-
- * gc.c (ruby_gc_params_t): ditto.
-
- * gc.c (ruby_gc_set_params): ditto.
-
-Thu Mar 31 15:59:17 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_verify_heap_page): check the number of zombies.
-
- * gc.c (gc_verify_heap_pages): check also tomb heap.
-
-Thu Mar 31 15:48:18 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c (gc_page_sweep): return free slots count.
-
- * gc.c (gc_sweep_step): use returned free slots count.
-
- * gc.c (gc_sweep_step): change variable name `next'
- to `next_sweep_page'.
-
-Thu Mar 31 11:33:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/date/date_core.c (d_lite_strftime, dt_lite_strftime): [DOC]
- fix indent not to be a big sole verbatim.
-
-Thu Mar 31 11:18:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/date/date_core.c (Init_date_core): [DOC] fix misplaced doc
- of DateTime. [ruby-core:74729] [Bug #12233]
-
-Thu Mar 31 03:41:02 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: Merge upstream 69f7e74dde.
- fix indent.
-
-Wed Mar 30 16:33:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * extension.rdoc, extension.ja.rdoc: [DOC] Fix some errors.
- Renamed files, wrong method names or argument types; the example
- GetDBM macro is now updated to the current version of the actual
- code. patch by Marcus Stollsteimer in [ruby-core:74690].
- [Bug #12228]
-
-Wed Mar 30 09:46:01 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/open-uri.rb: Use `userinfo` for authenticated proxy.
- [fix GH-1148] Patch by @SokichiFujita
- * test/open-uri/test_open-uri.rb: ditto.
- [fix GH-1309] Patch by @jdamick
-
-Wed Mar 30 01:56:06 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: Merge upstream 4f3edf80a0.
- patched by Anton Sivakov [Bug #12201] [Bug #12202]
-
-Wed Mar 30 01:54:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/redmine-backporter.rb: add given revision to current changesets
- on associating the revision to the related ticket.
-
-Wed Mar 30 01:53:17 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/merger.rb: update revision.h before merge.
-
-Tue Mar 29 19:33:54 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * addr2line.c: define toupper for its use. fix r54391.
-
-Tue Mar 29 19:23:46 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * include/ruby/ruby.h (rb_isupper, rb_islower, rb_isalpha, rb_isdigit,
- rb_isalnum, rb_isxdigit, rb_isblank, rb_isspace, rb_isblank,
- rb_iscntrl, rb_isprint, rb_ispunct, rb_isgraph,
- rb_tolower, rb_toupper): use inline function to avoid function call.
-
- * include/ruby/ruby.h (rb_isascii): use inline function to clarify
- the logic.
-
-Tue Mar 29 18:56:55 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/redmine-backporter.rb (backport): show merger.rb's path.
-
- * tool/redmine-backporter.rb (show): show current issue again if no
- ticket number is given.
-
- * tool/redmine-backporter.rb (rel): show error message if current
- bugs.ruby-lang.org doesn't support the API.
-
-Tue Mar 29 18:54:34 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * tool/merger.rb: support to backport header as backport identifier.
- Now you can specify by 'merge revision(s) 49254: [Backport #10738]'.
-
-Tue Mar 29 16:53:44 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Tweaked handling of 6
- special cases in CaseUnfold_11_Table.
-
- * enc/unicode.c: Adjustments for above.
-
- * test/ruby/enc/test_case_mapping.rb: Tests for the above: Some tests in
- test_titlecase activated; test_greek added. A test in test_cherokee fixed.
-
-Tue Mar 29 13:31:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Cleaned up some comments.
-
-Tue Mar 29 13:24:56 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Removing data for idempotent
- titlecasing.
-
- * enc/unicode.c: Adjust code to data removal.
-
-Tue Mar 29 12:45:18 2016 Laurent Arnoud <laurent@spkdev.net>
-
- * lib/webrick/httpresponse.rb: Move error_body to method. It allow to
- override the body more easily. [fix GH-1307]
- * test/webrick/test_httpresponse.rb: ditto.
-
-Tue Mar 29 06:40:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (rb_compile_err_append): rb_thread_t::base_block is no
- longer used.
-
- * iseq.c (rb_iseq_compile_with_option): ditto, no protection is
- needed.
-
-Tue Mar 29 06:39:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (struct parser_params): move parse_in_eval flag from
- rb_thread_t.
-
- * parse.y (rb_parser_set_context): set parsing context, not only
- mild error flag.
-
- * iseq.c (rb_iseq_compile_with_option): the parser now refers no
- thread local states to be restored.
-
- * vm_eval.c (eval_string_with_cref): ditto.
-
-Mon Mar 28 21:24:02 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * numeric.c (int_pos_p): fix typos.
-
-Mon Mar 28 14:54:49 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Refactoring in preparation for data reduction for
- titlecase.
-
-Mon Mar 28 14:36:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Minor refactoring for I WITH DOT ABOVE.
-
-Mon Mar 28 14:26:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Removed code now covered by data from table.
-
-Mon Mar 28 11:49:21 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Adding comments. [ci skip]
-
-Mon Mar 28 11:30:23 2016 Shinichi Maeshima <netwillnet@gmail.com>
-
- * lib/rubygems.rb: Fix `Gem.find_spec_for_exe` picks oldest gem.
- https://github.com/travis-ci/travis-ci/issues/5798
- https://github.com/rubygems/rubygems/pull/1566
- * test/rubygems/test_gem.rb: ditto.
-
-Mon Mar 28 11:26:31 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.2.
- Please see entries of 2.6.2 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
-
-Mon Mar 28 11:02:31 2016 Hiroshi Shirosaki <h.shirosaki@gmail.com>
-
- * lib/rubygems/test_case.rb: Fix test on Windows for inconsistent temp path.
- https://github.com/rubygems/rubygems/pull/1554
- [Bug #12193][ruby-core:74431]
-
-Mon Mar 28 08:19:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_str_format): refactor floating point format of
- Rational by using generic Integer functions.
-
- * sprintf.c (rb_str_format): fix buffer overflow, length must be
- greater than precision. reported by William Bowling <will AT
- wbowling.info>.
-
-Sun Mar 27 12:13:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_str_format): convert Rational to floating point
- format by using generic Integer functions, not by methods which
- can be overwritten.
-
-Sat Mar 26 10:55:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (rb_int2str): conversion function to String for
- generic Integer.
-
- * numeric.c (rb_int_round): rounding function for generic
- Integers.
-
- * numeric.c (rb_int_{uminus,plus,minus,mul,idiv,modulo}): basic
- arithmetic functions for generic Integers.
-
- * numeric.c (FIXNUM_{POSITIVE,NEGATIVE,ZERO}_P): predict macros
- only for Fixnum.
-
-Sat Mar 26 06:34:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * localeinit.c (rb_locale_charmap_index): fix prototype.
- patched by Andreas Schwab [Bug #12218]
-
-Fri Mar 25 16:40:48 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_mapping.rb: Additional tests title case;
- some not yet activated.
-
-Fri Mar 25 13:38:11 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * ext/openssl/extconf.rb: check SSL_CTX_set_next_proto_select_cb
- function rather than OPENSSL_NPN_NEGOTIATED macro. it exists
- even if it is disabled by OpenSSL configuration.
- [ruby-core:74384] [Bug #12182]
-
- * ext/openssl/ossl_ssl.c: update #ifdef(s) as above.
-
- * test/openssl/test_ssl.rb: skip NPN tests if NPN is disabled.
-
-Fri Mar 25 11:08:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/uri/http.rb (URI::HTTP#initialize): [DOC] fix example,
- missing mandatory arguments. [ruby-core:74540] [Bug #12215]
-
-Fri Mar 25 01:50:58 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * thread_pthread.c (reserve_stack): fix reserving position where
- the stack growing bottom to top. [Bug #12118]
-
-Fri Mar 25 01:10:42 2016 Sebastian Schuberth <sschuberth@gmail.com>
-
- * lib/mkmf.rb (find_executable0): On Windows, it is actually valid
- to surround individual PATH directory entries with double
- quotes. Remove these before joining the path as otherwise the
- literal quotes would become part of the path, resulting in the
- executable not to be found. [Fix GH-1305]
-
-Thu Mar 24 22:38:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * strftime.c (FMT, FMTV): remove recursive-assignments to get rid
- of undefined behavior. [ruby-core:74532] [Bug #12213]
-
-Thu Mar 24 17:44:02 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * strftime.c (FMT_PADDING): extract format for padding.
-
- * strftime.c (FMT_PRECISION): extract precision formula.
-
- * strftime.c (FMTV): append formatted string to expand the result.
-
-Thu Mar 24 14:20:21 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * strftime.c (STRFTIME): deal with case conversion flags for
- recursive formats.
-
-Thu Mar 24 12:43:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/date/date_core.c (dt_lite_iso8601): strftimev() always
- returns a String, so append them directly.
-
- * ext/date/date_core.c (d_lite_jisx0301, iso8601_timediv),
- (dt_lite_jisx0301): format by the format string in local buffer
- to prevent intermediate strings from GC.
-
- * ext/date/date_core.c (mk_inspect_raw, mk_inspect): inspect by
- "%+"PRIsVALUE, to prevent intermediate strings from GC.
-
-Thu Mar 24 11:43:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * strftime.c (rb_strftime_with_timespec): remove unnecessary
- check, as `s` equals to `endp` when recursed STRFTIME resized
- the capacity same as the size.
-
-Wed Mar 23 21:48:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (ary_inject_op): put subtract operation out of if-clause.
-
-Wed Mar 23 21:38:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * enum.c (ary_inject_op): Use Kahan's compensated summation algorithm
- for summing up float values.
-
-Wed Mar 23 20:56:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * strftime.c (rb_strftime_with_timespec): append formatted results
- to the given string with expanding, and also deal with NUL chars.
-
- * strftime.c (rb_strftime, rb_strftime_timespec): return formatted
- string, not the length put in the given buffer.
-
- * time.c (rb_strftime_alloc): no longer needs to retry with
- reallocating buffers.
-
- * time.c (time_strftime): no longer needs to split by NUL chars.
-
-Wed Mar 23 14:23:54 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/rdoc/ri/driver.rb (interactive): rescue NotFoundError raised in
- expand_name. (display_name rescues NotFoundError by itself,
- the original logic looks buggy...)
-
-Wed Mar 23 11:44:53 2016 cremno <cremno@mail.ru>
-
- * marshal.c (r_long): cast to `signed char`, which is used
- already, instead of SIGN_EXTEND_CHAR.
-
- * parse.y: SIGN_EXTEND_CHAR is no longer used. [Fix GH-1302]
-
-Wed Mar 23 11:38:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL_PARAM):
- * add missing parentheses and remove double quotes.
- * rename to get rid of recursive references.
- * as --excludes-dir option is for a path name, its argument
- should be converted.
- [ruby-dev:49526] [Bug #12199]
-
-Wed Mar 23 10:39:38 2016 Koichi ITO <koic.ito@gmail.com>
-
- * variable.c: Added documentation about order of `Module#constants`
- [ci skip][Bug #12121][ruby-dev:49505][fix GH-1301]
-
-Tue Mar 22 21:08:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * include/ruby/oniguruma.h: Additional flag for characters that are titlecase.
-
- * enc/unicode/case-folding.rb, casefold.h: Using above flag in data.
-
- * enc/unicode.c: Marking capitalized character as unmodified if it is
- already titlecase.
-
- * test/ruby/enc/test_case_mapping.rb: Tests for above functionality.
-
-Tue Mar 22 14:18:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (lambda_body, parser_yylex): warn mismatched indentation
- of lambda block.
-
-Tue Mar 22 11:36:49 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * time.c (wmul): wrong condition.
- fixed many test failures on 32bit and LLP64 platforms.
-
-Tue Mar 22 10:31:34 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * time.c (wdiv, wmod): wdivmod0() assumes the 3rd and the 4th arguments
- are valid pointers.
- maybe checking them in wdivmod0() is better manner, but I guess that
- passing real dummy pointers may be faster than checking and branching
- in wdivmod0().
- this commit fixes SEGV on 32bit and LLP64 platforms.
-
-Tue Mar 22 10:24:04 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * time.c (divmodv): void function never returns any value.
-
-Tue Mar 22 10:11:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/lib/test/unit.rb (Test::Unit::StatusLine#failed): print
- failed messages only if replacing mode, otherwise defer them
- until the end, to get rid of interleaving failures with progress
- messages. refix r54195.
-
-Tue Mar 22 03:45:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * time.c (MUL_OVERFLOW_FIXWV_P): defined for FIXWV.
-
- * time.c (wmul): use MUL_OVERFLOW_FIXWV_P and only switch.
-
- * time.c (wmul): use mul which has Fixnum optimization.
-
- * time.c (rb_time_magnify): If WIDEVALUE_IS_WIDER, wmul() has the same
- optimized logic, else mul() has also the similar logic for Fixnum.
-
- * time.c (rb_time_unmagnify): almost ditto.
-
-Tue Mar 22 03:10:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * time.c (divmodv): add the case both arguments are Fixnum.
-
- * time.c (wquo): use quo which has Fixnum optimization.
-
- * time.c (wdivmod0): added for WIDEVALUE_IS_WIDER.
-
- * time.c (wdivmod): use wdivmod0 and divmodv.
- divmodv has Fixnum optimization.
-
- * time.c (wdiv): use wdivmod0 and div to avoid the use of divmodv which
- calls id_quo whose return value is array.
-
- * time.c (wmod): use wdivmod0 and mod to avoid the use of divmodv which
- calls id_quo whose return value is array.
-
-Mon Mar 21 22:32:50 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * internal.h (rb_fix_divmod_fix): like r54213, use FIX2NUM only if
- x == FIXNUM_MIN && y == -1. This must be a rare case and it is
- expected compiler to handle well.
-
-Mon Mar 21 22:15:11 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * time.c (mod): Add Fixnum case.
-
- * time.c (quo): c can be Fixnum except a == FIXNUM_MIN && b == -1.
- Such case can be optimized out because quo()'s argument is constant.
-
-Mon Mar 21 22:09:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * internal.h (rb_fix_mul_fix): multiply converted values, not
- object VALUEs.
-
-Mon Mar 21 20:18:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (TEST_EXCLUDES, EXCLUDE_TESTFRAMEWORK): use full spell
- long option.
-
- * cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL): suppress path name
- conversions by msys2. [ruby-dev:49525] [Bug #12199]
-
-Mon Mar 21 19:09:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (enc_succ_alnum_char): try to skip an invalid character
- gap between GREEK CAPITAL RHO and SIGMA.
- [ruby-core:74478] [Bug #12204]
-
-Mon Mar 21 18:55:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * node.c (rb_gc_mark_node): NODE_MATCH2 can have nd_args, u3,
- since r54100.
-
-Sun Mar 20 21:17:13 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * internal.h (rb_int128t2big): declare only when HAVE_INT128_T.
- fixed a compile error with VC++ introduced at r54203.
-
-Sun Mar 20 20:10:14 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * internal.h (DLONG): defined if long is 32bit (and LONG_LONG is 64bit;
- but LONG_LONG is always defined as 64bit), or there's int128_t.
-
- * internal.h (DL2NUM): defined if DLONG is defined.
-
- * internal.h (rb_fix_mul_fix): defined for `Fixnum * Fixnum`.
-
- * insns.def (opt_mul): use rb_fix_mul_fix().
-
- * numeric.c (fix_mul): ditto.
-
- * time.c (mul): ditto.
-
-Sun Mar 20 18:53:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (fix_gt, fix_ge, fix_lt, fix_le): optimize comparisons
- Fixnum against Bignum by rb_big_cmp in inversed order without
- new Bignum instance.
-
-Sun Mar 20 18:44:52 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * time.c (add): remove FIXABLE() which is in LONG2NUM().
-
- * time.c (sub): ditto.
-
- * time.c (mul): ditto.
-
-Sun Mar 20 04:46:02 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * bignum.c (rb_big_cmp): reduce the code.
-
- * bignum.c (rb_big_eq): If normalized bignum is still bignum,
- it must be larger than fixnum.
-
-Sat Mar 20 00:58:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * include/ruby/intern.h (rb_big_odd_p, rb_big_even_p): move to
- internal.h so that they are exported only for ruby itself.
-
- * internal.h (rb_big_odd_p, rb_big_even_p): ditto.
-
-Sat Mar 19 21:56:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/lib/test/unit.rb (Test::Unit::StatusLine#failed): defer
- failed messages until the end in verbose mode, to get rid of
- interleaving failures with progress messages.
-
-Sat Mar 19 21:53:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (fix_cmp): invert the result as the comparison is
- inverted.
-
-Sat Mar 19 18:32:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * numeric.c (int_to_f): raise NotImplementedError when a receiver
- class is unknown.
-
- * test/-ext-/integer/test_my_integer.rb (test_my_integer_to_f): modify
- a test for the above change.
-
-Sat Mar 19 18:21:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * bignum.c (Bignum#<=>): remove it because they are unified with
- Integer#<=>.
-
- * numeric.c (Integer#<=>, Fixnum#<=>): move <=> method from Fixnum to
- Integer.
-
- * numeric.c (int_cmp): add this method for Integer#<=>.
-
- * test/-ext-/integer/test_my_integer.rb (test_my_integer_cmp): add a
- test to examine Integer#<=> for unknown subclasses.
-
-Sat Mar 19 14:46:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (rb_iseq_compile_with_option): make the parser in mild
- error.
-
- * load.c (rb_load_internal0): ditto.
-
- * parse.y (yycompile0): return the error message within the error
- to be raised. [Feature #11951]
-
- * parse.y (parser_compile_error): accumulate error messages in the
- error_buffer.
-
-Sat Mar 19 03:57:13 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * time.c (LOCALTIME): organize #ifdefs.
-
- * time.c (GMTIME): define only ifndef HAVE_STRUCT_TM_TM_GMTOFF.
-
-Sat Mar 19 03:53:31 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (rb_cv_member_struct_tm_tm_gmtoff): For Linux (glibc)
- define _BSD_SOURCE for time.h to define struct tm.tm_gmtoff.
-
- * time.c: define _BSD_SOURCE at the top.
-
-Sat Mar 19 03:00:50 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/-ext-/time/test_new.rb (test_timespec_new): change a gmtoff
- test to a better one that does not depend on whether the current
- time is in summer time or not.
-
-Fri Mar 19 00:00:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * bignum.c (rb_big_to_f, Bignum#to_f): removed them because they are
- unified with int_to_f and Integer#to_f.
-
- * numeric.c (int_to_f): treat Bignum values directly.
-
-Fri Mar 18 23:41:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * numeric.c (int_to_f, fix_to_f): rename fix_to_f to int_to_f, and add
- treatment for subclasses which don't have definitions of to_f method.
-
- * numeric.c (Integer#to_f, Fixnum#to_f): move to_f method from Fixnum
- to Integer.
-
- * ext/-test-/integer/my_integer.c: define helper class for testing
- to_f method for a subclass of Integer.
-
- * ext/-test-/integer/extconf.rb: ditto.
-
- * ext/-test-/integer/init.c: ditto.
-
- * test/-ext-/integer/test_my_integer.rb: examine to_f method for a
- subclass of Integer.
-
-Fri Mar 18 22:32:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * include/ruby/intern.h (rb_big_hash): Move to internal.h.
-
- * internal.h: ditto.
-
-Fri Mar 18 22:10:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * bignum.c (Bignum#eql?): remove its definition because it is unified
- with Numeric#eql?.
-
- * numeric.c (num_eql): treat Bignum values directly.
-
-Fri Mar 18 21:57:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * bignum.c (rb_big_to_s, Bignum#to_s): remove its definition because
- it is unified with Integer#to_s.
-
- * numeric.c (int_to_s): treat Bignum values directly.
-
-Fri Mar 18 21:30:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * numeric.c (int_to_s): Move from fix_to_s.
-
- * numeric.c (Integer#to_s): Move from Fixnum#to_s.
-
-Fri Mar 18 16:22:24 2016 Victor Nawothnig <Victor.Nawothnig@gmail.com>
-
- * parse.y (parse_numvar): NTH_REF must be less than a half of
- INT_MAX, as it is left-shifted to be ORed with back-ref flag.
- [ruby-core:74444] [Bug#12192] [Fix GH-1296]
-
-Fri Mar 18 12:25:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (tick): fix missing close parenthesis. [Fix GH-1291]
-
-Fri Mar 18 10:24:12 2016 Naotoshi Seo <sonots@gmail.com>
-
- * ext/date/date_core.c (datetime_to_time): preserve timezone info
- [Bug #12189] [Fix GH-1295]
-
-Fri Mar 18 10:17:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * bignum.c (rb_big_hash): make it public function to be available in
- other source files, and remove documentation comment for Bignum#hash.
-
- * bignum.c (Bignum#hash): remove its definition because it is unified
- with Object#hash.
-
- * include/ruby/intern.h (rb_big_hash): add a prototype declaration.
-
- * hash.c (any_hash): treat Bignum values directly.
-
-Fri Mar 18 02:35:12 2016 Naotoshi Seo <sonots@gmail.com>
-
- * lib/time.rb (parse, strptime): Fix Time.parse/strptime does not
- have compatibility with DateTime.parse/strptime in terms of parsing
- timezone [Bug #12190] [Fix GH-1297]
-
-Fri Mar 18 02:17:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * numeric.c (fix_zero_p, fix_even_p, fix_odd_p): remove needless
- functions.
-
-Fri Mar 18 02:15:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * numeric.c (int_even_p): treat Fixnum and Bignum values directly.
-
-Fri Mar 18 02:07:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * bignum.c (Bignum#even?, Bignum#odd?): remove definitions
- because they are unified with Integer#even? and Integer#odd?.
-
- * numeric.c (Fixnum#zero?, Fixnum#even?, Fixnum#odd?): remove
- definitions because they are unified with Numeric#zero?,
- Integer#even?, and Integer#odd?.
-
- * numeric.c (num_zero_p, int_odd_p): treat Fixnum and
- Bignum values directly.
-
- * test/ruby/test_integer.rb (test_odd_p_even_p): remove meaningless
- test case.
-
-Fri Mar 18 01:51:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * bignum.c (rb_big_even_p, rb_big_odd_p): make them public functions
- to be available in other source files.
-
- * include/ruby/intern.h (rb_big_even_p, rb_big_odd_p): add prototype
- declarations.
-
-Fri Mar 18 00:25:56 2016 Tanaka Akira <akr@fsij.org>
-
- * enum.c (ary_inject_op): Implement the specialized code for sum of
- float numbers.
-
-Fri Mar 18 00:15:05 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * numeric.c (num_step): use rb_equal for zero check. rb_num_coerce_cmp
- created an object which caused extra overhead.
-
-Thu Mar 17 22:21:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/ruby.h (RB_GC_GUARD_PTR): remove intermediate
- macro, and expand for each RB_GC_GUARD. [Fix GH-1293]
-
-Thu Mar 17 22:08:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (iseq_specialized_instruction): move specialization
- for opt_newarray_max/min from translation phase.
-
-Thu Mar 17 21:52:09 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * array.c, enum.c: make rdoc format consistent.
-
-Thu Mar 17 21:47:57 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * NEWS: add Array#max, #min, and the optimization. [Feature #12172]
-
-Thu Mar 17 21:45:02 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * compile.c (NODE_CALL): add optimization shortcut for Array#max/min.
- Now `[x, y].max` is optimized so that a temporal array object is not
- created in some condition. [Feature #12172]
-
- * insns.def (opt_newarray_max, opt_newarray_min): added.
-
-Thu Mar 17 21:35:52 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * array.c (rb_ary_max, rb_ary_min): implement Array#max and min with
- arguments. replace super call with rb_nmin_run.
-
- * enum.c (nmin_run): exported (as rb_nmin_run).
-
- * internal.h: added a prototype for rb_nmin_run.
-
-Thu Mar 17 21:24:52 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * array.c (rb_ary_max, rb_ary_min): implement a block by itself instead
- of delegating Enumerable#max/min.
-
-Thu Mar 17 21:09:34 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * array.c (rb_ary_max, rb_ary_min): Array#max and Array#min added.
- [Feature #12172]
-
- * internal.h (OPTIMIZED_CMP): moved from enum.c so that array.c can
- use it.
-
- * test/ruby/test_array.rb (test_max, test_min): tests for Array#max
- and Array#min.
-
- * test/ruby/test_enum.rb (test_max, test_min): revised a bit to test
- Enumerable#max and #min explicitly.
-
-Thu Mar 17 21:02:42 2016 Yusuke Endoh <mame@ruby-lang.org>
-
- * internal.c: struct cmp_opt_data added for refactoring out a data
- structure for CMP_OPTIMIZABLE
-
- * array.c (struct ary_sort_data): use struct cmp_opt_data.
-
- * enum.c (struct min_t, max_t, min_max_t): use struct cmp_opt_data.
-
-Thu Mar 17 20:55:21 2016 Tanaka Akira <akr@fsij.org>
-
- * enum.c (ary_inject_op): Extracted from enum_inject.
-
-Thu Mar 17 18:39:04 2016 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_inject): Implement the specialized code for sum of
- integers including Bignums.
-
- * internal.h (rb_fix_plus): Declared to be usable from enum_inject.
-
- * numeric.c (rb_fix_plus): Defined.
-
-Thu Mar 17 17:20:28 2016 Anton Davydov <antondavydov.o@gmail.com>
-
- * thread_sync.c: [DOC] Update documentation for Queue class
- description. [Fix GH-1292]
-
-Thu Mar 17 17:14:51 2016 Dinar Valeev <dvaleev@suse.com>
-
- * gc.c (tick): Use __builtin_ppc_get_timebase for POWER arch.
- [Fix GH-1291]
-
-Thu Mar 17 11:51:48 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/securerandom.rb (gen_random): to avoid blocking on Windows.
- On Windows OpenSSL RAND_bytes (underlying implementation is
- RAND_poll in crypto/rand/rand_win.c) may be blocked at
- NetStatisticsGet.
- https://wiki.openssl.org/index.php/Random_Numbers#Windows_Issues
- Instead of this, use Random.raw_seed directly (whose implementation
- CryptGenRandom is one of the source of
- entropy of RAND_poll on Windows).
- https://wiki.openssl.org/index.php/Random_Numbers
- Note: CryptGenRandom function is PRNG and doesn't check its entropy,
- so it won't block. [Bug #12139]
- https://msdn.microsoft.com/ja-jp/library/windows/desktop/aa379942.aspx
- https://tools.ietf.org/html/rfc4086#section-7.1.3
- https://eprint.iacr.org/2007/419.pdf
- http://www.cs.huji.ac.il/~dolev/pubs/thesis/msc-thesis-leo.pdf
-
-Thu Mar 17 12:09:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Fixed two macro definitions.
- * test/ruby/enc/test_case_mapping.rb: Test cases that detected
- the above bugs.
-
-Thu Mar 17 11:36:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/option.c (inspect_tcpi_msec): more accurate condition
- for TCPI msec member inspection function.
- [ruby-core:74388] [Bug #12185]
-
-Thu Mar 17 08:13:43 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/-ext-/time/test_new.rb (test_timespec_new): Time#gmtoff values
- are the same only when both or neither of the Time objects are in
- summer time (daylight-saving time).
-
-Thu Mar 17 07:17:36 2016 Eric Hodel <drbrain@segment7.net>
-
- * marshal.c (r_object0): raise ArgumentError when linking to undefined
- object.
-
-Thu Mar 17 00:45:00 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * test/ruby/test_bignum.rb: Make sure to use Bignum values in the tests.
-
-Wed Mar 16 23:10:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * defs/keywords (alias, undef): symbol literals are allowed.
-
- * parse.y (parse_percent): should parse symbol literals for alias
- and undef. [ruby-dev:47681] [Bug #8851]
-
-Wed Mar 16 21:39:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * enc/trans/JIS: update Unicode's notice. [Bug #11844]
-
-Wed Mar 16 20:03:35 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * proc.c (proc_binding): proc from symbol can not make a binding.
- [ruby-core:74100] [Bug #12137]
-
-Wed Mar 16 18:42:45 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_mapping.rb: Fixed and activated a test for Cherokee.
-
-Wed Mar 16 17:58:56 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_mapping.rb: Fixed a logical error.
-
-Wed Mar 16 17:57:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_mapping.rb: Adding tests for Cherokee.
- One test not yet working.
- (with Kimihito Matsui)
-
-Wed Mar 16 15:44:05 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_mapping.rb: Adding tests for actual Unicode
- case mapping. Fixing some aliasing issues.
- (with Kimihito Matsui)
-
-Tue Mar 15 21:38:28 2016 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_inject): Consider redefinition of Fixnum#+.
- [ruby-dev:49510] [Bug#12178] Reported by usa.
-
-Tue Mar 15 20:32:57 2016 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_inject): Implement the specialized code for :+ operator
- for Fixnums.
-
-Tue Mar 15 20:21:01 2016 Tanaka Akira <akr@fsij.org>
-
- * enum.c (enum_inject): Implement the specialized code for self is an
- array and a symbol operator is given.
-
-Tue Mar 15 16:29:51 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Eliminating common code.
- (with Kimihito Matsui)
-
-Tue Mar 15 16:17:09 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Expansion of some code repetition in preparation for
- elimination of common code pieces.
- (with Kimihito Matsui)
-
-Tue Mar 15 13:49:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Additional macros and code to use mapping data in
- CaseMappingSpecials array.
- (with Kimihito Matsui)
-
-Tue Mar 15 13:41:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * internal.h (rb_gc_mark_global_tbl): should be private,
- but was accidentally exported.
-
-Tue Mar 15 12:51:06 2016 Marcus Stollsteimer <sto.mar@web.de>
-
- * doc/extension.ja.rdoc: Fix RDoc markup in doc/extension*.rdoc.
- [ci skip][Bug #12143][ruby-core:74143]
- * doc/extension.rdoc: ditto.
-
-Tue Mar 15 09:56:41 2016 Ian Lunderskov <ian.lunderskov@gmail.com>
-
- * time.c: Minor typo in Time#dst? documentation.
- [ci skip][fix GH-1290]
-
-Tue Mar 15 04:36:41 2016 Charles Oliver Nutter <headius@headius.com>
-
- * test/ruby/test_rubyoptions.rb (test_disable): add tests for
- --disable-gems and --disable-did_you_mean.
-
-Tue Mar 15 03:35:04 2016 Eric Hodel <drbrain@segment7.net>
-
- * marshal.c (r_object0): Fix Marshal crash for corrupt extended object.
-
-Tue Mar 15 01:22:27 2016 Charles Oliver Nutter <headius@headius.com>
-
- * test/ruby/test_rubyoptions.rb: make version matching support
- JRuby's version output.
-
-Mon Mar 14 19:05:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * bignum.c (big2str_2bdigits): reduce div instruction.
-
-Mon Mar 14 18:39:53 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * include/ruby/oniguruma.h, enc/unicode.c: Adjusting flag assignments
- and macros to work with unified CaseMappingSpecials array.
- (with Kimihito Matsui)
-
-Mon Mar 14 16:53:37 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (compile_named_capture_assign): optimize named capture
- assignments, by replacing repeating global variable accesses
- with `dup`, and by returning the matched result instead of
- re-getting it from the MatchData.
-
- * parse.y (reg_named_capture_assign_gen): build just assignment
- nodes for the optimization.
-
-Mon Mar 14 16:02:59 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (ruby_is_fd_loadable): now return -1 if loadable but
- may block.
-
- * ruby.c (open_load_file): wait to read by the result of
- ruby_is_fd_loadable, without fstat.
-
-Mon Mar 14 13:38:38 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * numeric.c (fix2str): improve r54092 like rb_int2big().
-
-Mon Mar 14 10:02:23 2016 Eric Wong <e@80x24.org>
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): document as MT-unsafe
- [ruby-core:73803] [Bug #12069]
-
-Sun Mar 13 09:43:23 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/win32.h (O_SHARE_DELETE): change to fit Fixnum
- limit. [ruby-core:74285] [Bug #12171]
-
-Sun Mar 13 09:15:45 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (rb_fix2str): fix edge case, accidentally generated
- wrong Fixnum from LONG_MIN.
-
-Sat Mar 12 09:50:27 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_f_catch): [DOC] fix malformed RDoc syntax, "+...+"
- cannot enclose non-identifier characters.
- a patch by Sebastian S in [ruby-core:74278]. [Bug#12170]
-
-Sat Mar 12 02:44:48 2016 Tanaka Akira <akr@fsij.org>
-
- * test/lib/test/unit.rb: describe !/REGEXP/ in the help message.
-
-Fri Mar 11 17:03:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/lib/test/unit.rb (Options#non_options): make regexp name
- options prefixed with "!" negative filters.
-
- * common.mk (TEST_EXCLUDES): use negative filter to exclude memory
- leak tests. -x option excludes test files, not test methods.
-
-Fri Mar 11 16:11:27 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Streamlining approach to
- case mapping data not available from case folding by unifying all
- three cases (special title, special upper, special lower).
- * enc/unicode.c: Adjust macro names for above (macros are currently inactive).
- (with Kimihito Matsui)
-
-Thu Mar 10 17:34:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (prepare_iseq_build): enable coverage by coverage_enabled
- option, not by parse_in_eval flag in the thread context.
-
- * iseq.h (rb_compile_option_struct): add coverage_enabled flag.
-
- * parse.y (yycompile0): set coverage_enabled flag if coverage
- array is made.
-
-Thu Mar 10 15:19:54 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * node.c (dump_option): nd_compile_option is a hidden hash object,
- cannot call inspect on it.
-
-Thu Mar 10 09:49:54 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/socket/test_socket.rb (test_udp_recvmsg_truncation):
- AIX does not set the MSG_TRUNC flag for a message partially read
- by recvmsg(2) with the MSG_PEEK flag set.
-
-Wed Mar 9 16:48:45 2016 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/driver.rb: fix my last commit (syntax error).
-
-Wed Mar 9 16:41:44 2016 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/driver.rb: fix output messages.
-
- * benchmark/memory_wrapper.rb: use respond_to? because
- member? does not work well.
-
-Wed Mar 9 16:20:25 2016 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/driver.rb: support memory usage benchmark.
- use `--measure-target=[target]'.
- Now, we can use the following targets:
- * real (default): real time which returns process time in sec.
- * peak: peak memory usage (physical memory) in bytes.
- * size: last memory usage (physical memory) in bytes.
-
- * benchmark/memory_wrapper.rb: ditto.
-
-Wed Mar 9 15:04:22 2016 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/bm_vm3_gc_old_full.rb: add GC.start benchmark.
-
- * benchmark/bm_vm3_gc_old_immediate.rb: ditto.
-
- * benchmark/bm_vm3_gc_old_lazy.rb: ditto.
-
-Wed Mar 9 14:59:11 2016 Koichi Sasada <ko1@atdot.net>
-
- * benchmark/driver.rb: exit benchmarking if a benchmark process
- receives signals.
-
-Wed Mar 9 13:22:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/lib/memory_status.rb: make Memory::Status independent of
- MiniTest::Skip.
-
- * test/lib/test/unit/assertions.rb (assert_no_memory_leak): skip
- if Memory::Status is not available.
-
-Wed Mar 9 09:19:55 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/io/wait/test_io_wait.rb (test_wait_readwrite_timeout):
- select(2) in AIX returns "readable" for the write-side fd
- of a pipe, so it is not possible to use a pipe to test
- the read-write timeout of IO#wait on AIX.
-
-Wed Mar 9 03:35:22 2016 Charles Oliver Nutter <headius@headius.com>
-
- * test/ruby/test_require.rb (test_require_with_loaded_features_pop):
- Only remove PATH so threads don't accidentally double-pop.
-
-Wed Mar 9 00:29:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_method.c (rb_alias): the original name should be properly
- available method_added method, set the name before calling the
- hook.
-
-Wed Mar 9 00:07:03 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/logger.rb (Logger::LogDevice#initialize): define using
- keyword arguments.
-
-Tue Mar 8 23:37:07 2016 Charles Oliver Nutter <headius@headius.com>
-
- * test/ruby/test_array.rb: split out the test for no stack error
- on large input for test_permutation, test_repeated_permutation,
- and test_repeated_combination, and make them all timeout:30.
-
-Tue Mar 8 17:20:21 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * intern.h (rb_divmod): assume compilers `/` and `%` comply C99
- and reduce branching. If a compiler doesn't comply, add #ifdefs.
-
- * intern.h (rb_div): added for Ruby's behavior.
-
- * intern.h (rb_mod): added for Ruby's behavior.
-
- * insns.def (opt_div): use rb_div.
-
- * insns.def (opt_mod): use rb_mod.
-
- * numeric.c (fixdivmod): removed.
-
- * numeric.c (fix_divide): use rb_div.
-
- * numeric.c (fix_mod): use rb_mod.
-
- * numeric.c (fix_divmod): use rb_divmod.
-
-Tue Mar 8 17:53:09 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * insns.def (opt_mod): show its method name on ZeroDivisionError.
- [Bug #12158]
-
-Tue Mar 8 17:33:38 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_write_console): now no need to check
- ERROR_CALL_NOT_IMPLEMENTED because it is for old Win9X.
-
-Tue Mar 8 16:54:29 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_write_console): stop the VT100 emulation if the
- console supports it natively.
-
-Tue Mar 8 08:13:01 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/net/imap/test_imap.rb (test_idle_timeout): Because of the
- timeout specified in "imap.idle(0.2)", there is no guarantee that
- the server thread has done all the work before the client thread
- performs the assertions. It depends on the thread scheduling.
- Add checks to avoid false positives (on AIX, particularly).
-
-Tue Mar 8 00:42:22 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ruby.c (warn_cr_in_shebang): meaningless check on DOSISH platforms.
- fixed a test failure introduced at r53998.
-
-Tue Mar 8 00:27:53 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb: fix method name typo.
- [ruby-core:72513] [Bug #11893] The patch provided by Akira Matsuda.
-
-
-Tue Mar 8 00:25:08 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tcllib/toolbar.rb: fix method name typo.
- [ruby-core:72511] [Bug #11891] The patch provided by Akira Matsuda.
-
-
-Tue Mar 8 00:21:58 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/blt/tree.rb: fix method name typo.
- [ruby-core:72510] [Bug #11890] The patch provided by Akira Matsuda.
-
-
-Tue Mar 8 00:11:47 2016 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * ext/tk/lib/tk/menubar.rb: fix a typo in font name. [ruby-core:72505]
- [Bug #11886] The patch provided by Akira Matsuda.
-
- * ext/tk/sample/*.rb: ditto.
-
-Mon Mar 7 13:32:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_define_class, rb_define_class_id_under): raise
- ArgumentError if super is 0, deprecated behavior which has been
- warned long time.
-
-Mon Mar 7 13:28:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * internal.h: move function declarations for class internals from
- include/ruby/intern.h.
-
-Mon Mar 7 10:58:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32ole/win32ole_event.c (rescue_callback): use
- rb_write_error_str instead of rb_write_error, to respect
- the encoding and prevent the message from GC.
-
- * internal.h (rb_write_error_str): export.
-
-Mon Mar 7 01:38:41 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/ruby/test_process.rb (test_execopts_gid): Skip a test
- that is known to fail on AIX. AIX allows setgid to
- a supplementary group, but Ruby does not allow the "-e"
- option when setgid'ed, so the test does not work as intended.
-
-Sun Mar 6 22:43:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_obj_display): [DOC] fix output of Array, as Array#to_s
- is same as Array#inspect since 1.9.
-
-Sat Mar 5 09:50:58 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/socket/test_addrinfo.rb (test_ipv6_address_predicates):
- IN6_IS_ADDR_V4COMPAT and IN6_IS_ADDR_V4MAPPED are broken
- on AIX, so skip related tests.
-
-Sat Mar 5 09:17:54 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/rinda/test_rinda.rb (test_make_socket_ipv4_multicast):
- The fifth argument to getsockopt(2) should be modified to
- indicate the actual size of the value on return,
- but not in AIX. This is a know bug. Skip related tests.
- * test/rinda/test_rinda.rb (test_ring_server_ipv4_multicast):
- ditto.
- * test/rinda/test_rinda.rb (test_make_socket_unicast): ditto.
- * test/socket/test_basicsocket.rb (test_getsockopt): ditto.
- * test/socket/test_sockopt.rb (test_bool): ditto.
-
-Sat Mar 5 07:36:27 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/-ext-/float/test_nextafter.rb: In AIX,
- nextafter(+0.0,-0.0)=+0.0, and nextafter(-0.0,+0.0)=-0.0,
- but they should return -0.0 and +0.0, respectively. This is
- a known bug in nextafter(3) on AIX, so skip related tests.
-
-Sat Mar 5 07:14:10 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * test/zlib/test_zlib.rb (test_adler32_combine, test_crc32_combine):
- Skip two tests on AIX because zconf.h in zlib does not correctly
- recognize _LARGE_FILES in AIX. The problem was already reported
- to zlib, and skip these tests until it is fixed.
-
-Sat Mar 5 03:07:40 2016 Rei Odaira <Rei.Odaira@gmail.com>
-
- * thread_pthread.c (getstack): __pi_stacksize returned by
- pthread_getthrds_np() is wrong on AIX. Use
- __pi_stackend - __pi_stackaddr instead.
-
-Fri Mar 4 19:19:42 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: use 2 bits with unsigned int for rb_objspace::flags::mode
- because it always returns 0 to 2 (non-negative value).
-
-Fri Mar 4 18:42:08 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename "enum gc_stat" to "enum gc_mode"
- because there is a same name (no related) function gc_stat().
-
- Also gc_stat_* are renamed to gc_mode_*,
- gc_stat_transition() to gc_mode_transition(),
- rb_objspace::flags::stat is renamed to rb_objspace::flags::mode.
-
- Change rb_objspace::flags::mode from 2 bits to 3 bits because VC++
- returns negative enum value with 2 bits.
-
- * gc.c (gc_mode): add a macro to access rb_objspace::flags::mode
- with verification code (verification is enabled only on
- RGENGC_CHECK_MODE > 0).
-
- * gc.c (gc_mode_set): same macro for setter.
-
-Fri Mar 4 09:28:18 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.1.
- Please see entries of 2.6.0 and 2.6.1 on
- https://github.com/rubygems/rubygems/blob/master/History.txt
- [fix GH-1270] Patch by @segiddins
-
-Thu Mar 3 14:09:00 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/ostruct.rb (modifiable?, new_ostruct_member!, table!):
- rename methods for internal use with suffixes and make private,
- [ruby-core:71069] [Bug #11587]
-
-Wed Mar 2 16:28:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (method_missing): call by found method entry and get
- rid of searching the same method entry twice.
-
- * vm_eval.c (vm_call0_body): calling method_missing method is
- method_missing().
-
-Wed Mar 2 15:13:33 2016 herwinw <herwin@quarantainenet.nl>
-
- * lib/xmlrpc.rb: Removed broken parser named XMLScanStreamParser.
- It's not works with current Ruby version.
- [fix GH-1271][ruby-core:59588][Bug #9369]
- * lib/xmlrpc/config.rb: ditto.
- * lib/xmlrpc/parser.rb: ditto.
-
-Wed Mar 2 15:08:33 2016 herwinw <herwin@quarantainenet.nl>
-
- * lib/xmlrpc.rb: Removed broken parser named XMLTreeParser.
- Required gem of its parser didn't compile on newer Ruby versions.
- [fix GH-1271][ruby-core:59590][Bug #9370]
- * lib/xmlrpc/config.rb: ditto.
- * lib/xmlrpc/parser.rb: ditto.
-
-Tue Mar 1 11:25:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/fileutils.rb: use keyword arguments instead of option
- hashes.
-
-Mon Feb 29 16:50:20 2016 hanachin <hanachin@gmail.com>
-
- * array.c (rb_ary_push_m): [DOC] Remove trailing comma from
- Array#push example, as other Array examples doesn't put trailing
- comma. [Fix GH-1279]
-
-Mon Feb 29 16:31:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk, tool/mkconfig.rb: set cross_compiling option from
- Makefile, but not from rbconfig.rb, which is just going to be
- created by this command.
-
-Sun Feb 28 23:13:49 2016 C.J. Collier <cjcollier@linuxfoundation.org>
-
- * configure.in: Add summary to end of configure output.
- [Fix GH-1275]
-
-Sun Feb 28 20:23:36 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (error_print): Add verbose failure messages and
- avoid infamous DRb::DRbConnError. [Feature #12101]
-
-Sun Feb 28 13:40:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (nometh_err_initialize): add private_call? parameter.
-
- * error.c (nometh_err_private_call_p): add private_call? method,
- to tell if the exception raised in private form FCALL or VCALL.
- [Feature #12043]
-
- * vm_eval.c (make_no_method_exception): append private_call?
- argument.
-
- * vm_insnhelper.c (ci_missing_reason): copy FCALL flag.
-
-Sun Feb 28 10:19:47 2016 Ryan T. Hosford <tad.hosford@gmail.com>
-
- * array.c (rb_ary_and): clarify that set intersection returns the
- unique elements common to both arrays.
-
- * array.c (rb_ary_or): clarify that union preserves the order from
- the given arrays.
-
-Sat Feb 27 17:05:29 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Reducing size of TitleCase
- table by eliminating duplicates.
- (with Kimihito Matsui)
-
-Fri Feb 26 14:40:48 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (num_step_scan_args): comparison String with Numeric
- should raise TypeError. it is an invalid type, but not a
- mismatch the number of arguments. [ruby-core:62430] [Bug #9810]
-
-Fri Feb 26 14:39:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * doc/extension.rdoc, doc/extension.ja.rdoc: add editor local
- variables, with commenting out by :enddoc: directives which are
- just ignored unless code object mode. [Bug #12111]
-
-Fri Feb 26 12:25:56 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/extension.ja.rdoc: removed rendering error caused by editor specific
- configuration on http://docs.ruby-lang.org/en/trunk/extension_rdoc.html .
- [Bug #12111][ruby-core:73990]
-
-Fri Feb 26 11:21:41 2016 herwinw <herwin@quarantainenet.nl>
-
- * lib/xmlrpc.rb: Removed references to NQXML. It's obsoleted parser.
- [fix GH-1245][ruby-core:59593][Feature #9371]
- * lib/xmlrpc/config.rb: ditto.
- * lib/xmlrpc/parser.rb: ditto.
-
-Fri Feb 26 11:10:19 2016 Rick Salevsky <rsalevsky@suse.com>
-
- * lib/tmpdir.rb: Unify to coding-style for method definition.
- [fix GH-1252]
-
-Fri Feb 26 11:02:04 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * README.md: update markdown syntax for anchor tag.
- [fix GH-1265] Patch by @lukBarros
-
-Fri Feb 26 10:52:29 2016 Alex Boyd <alex@opengroove.org>
-
- * lib/irb.rb: avoid to needless truncation when using back_trace_limit option.
- [fix GH-1205][ruby-core:72773][Bug #11969]
-
-Fri Feb 26 08:11:58 2016 Aaron Patterson <tenderlove@ruby-lang.org>
-
- * gem_prelude.rb: Reduce system calls by activating the `did_you_mean`
- gem before requiring the gem. Activating the gem puts the gem on
- the load path, where simply requiring the file will search every gem
- that's installed until it can find a gem that contains the
- `did_you_mean` file.
-
-Thu Feb 25 19:04:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb: Adding possibility for debugging output
- for TitleCase table in casefold.h.
- (with Kimihito Matsui)
-
-Wed Feb 24 22:31:13 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * include/ruby/oniguruma.h: Rearranging flag assignments and making
- space for titlecase indices; adding additional macros to add or
- extract titlecase index; adding comments for better documentation.
- * enc/unicode.c: Moving some macros to include/ruby/oniguruma.h;
- activating use of titlecase indices.
- (with Kimihito Matsui)
-
-Wed Feb 24 21:03:04 2016 Tanaka Akira <akr@fsij.org>
-
- * random.c (limited_rand): Add a specialized path for when the limit fits
- in 32 bit.
-
-Tue Feb 23 21:52:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Outputting actual titlecase
- data (new table, with indices from other tables).
- * enc/unicode.c: Ignoring titlecase data indices for the moment.
- (with Kimihito Matsui)
-
-Tue Feb 23 15:21:14 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Reading casing data from
- SpecialCasing.txt.
- (with Kimihito Matsui)
-
-Mon Feb 22 18:33:55 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Adding flag for title-case,
- not yet operational.
- (with Kimihito Matsui)
-
-Mon Feb 22 18:17:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Fixed bug that avoided inclusion
- of compatibility characters in upper-/lower-case mappings.
- (with Kimihito Matsui)
-
-Sun Feb 21 13:57:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cgi/escape/escape.c: Optimize CGI.unescape performance by C ext
- for ASCII-compatible encodings. [Fix GH-1250]
-
-Sun Feb 21 13:56:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * cgi/escape/escape.c: Optimize CGI.unescapeHTML performance by C
- ext for ASCII-compatible encodings. [Fix GH-1242]
-
-Sat Feb 20 15:38:16 2016 Eric Wong <e@80x24.org>
-
- * doc/extension.rdoc: update paths for defs/ directory
-
-Sat Feb 20 14:44:15 2016 Lucas Buchala <lucasbuchala@gmail.com>
-
- * vm_eval.c (rb_mod_module_eval): [DOC] Fix documentation
- signature for Module#module_eval. [Fix GH-1258]
-
-Sat Feb 20 14:40:44 2016 Adam O'Connor <northband@gmail.com>
-
- * README.md: a few grammatical changes to the main Ruby README.md.
- [Fix GH-1259]
-
-Sat Feb 20 13:04:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (push_pattern, push_glob): deal with read paths as UTF-8
- to stat later, on Windows as well as OS X.
- [ruby-core:73868] [Bug #12081]
-
-Sat Feb 20 01:53:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_mod_const_get): make error message at uninterned
- string consistent with symbols. [ruby-dev:49498] [Bug #12089]
-
-Fri Feb 19 23:37:52 2016 Masahiro Tomita <tommy@tmtm.org>
-
- * lib/find.rb (Find#find): raise with the given path name if it
- does not exist. [ruby-dev:49497] [Bug #12087]
-
-Fri Feb 19 12:44:57 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Activated use of case mapping data in CaseUnfold_11 array.
- (with Kimihito Matsui)
-
-Fri Feb 19 11:08:32 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: add cygwin case, nothing excluded.
- [ruby-core:73806] [Bug#12071]
-
-Thu Feb 18 21:32:15 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * man/irb.1: fix output in EXAMPLES.
-
-Thu Feb 18 21:05:47 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (sym_match_m): delegate to String#match but not
- String#=~. [ruby-core:72864] [Bug #11991]
-
-Thu Feb 18 14:15:38 2016 Shota Fukumori <her@sorah.jp>
-
- * re.c: Add MatchData#named_captures
- [Feature #11999] [ruby-core:72897]
-
- * test/ruby/test_regexp.rb(test_match_data_named_captures): Test for above.
-
- * NEWS: News about MatchData#named_captures.
-
-Wed Feb 17 21:41:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * defs/id.def (predefined): add idLASTLINE and idBACKREF for $_
- and $~ respectively.
-
- * parse.y: use idLASTLINE and idBACKREF instead of rb_intern.
-
-Wed Feb 17 20:23:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_init): fix segfault and memory leak, consider
- wide char encoding terminator.
-
-Wed Feb 17 12:14:59 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (rb_str_init): introduce String.new(capacity: size)
- [Feature #12024]
-
-Tue Feb 16 19:10:08 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, casefold.h: Used only first element
- (rather than all) of target in CaseUnfold_11 array.
- (with Kimihito Matsui)
-
-Tue Feb 16 18:24:38 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (compare_with_zero): fix variable name, rb_cmperr
- requires VALUEs but not an ID.
-
-Tue Feb 16 17:34:18 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (rb_dir_s_empty_p): add Dir.empty? method, which tells the
- argument is the name of an empty directory. [Feature #10121]
-
-Tue Feb 16 09:51:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/rbinstall.rb (without_destdir): just strip a drive letter
- which is prepended by with_destdir.
- pointed out by @DavidEGrayson.
- https://github.com/ruby/ruby/commit/0e5f9ae#commitcomment-16101763
-
-Tue Feb 16 04:42:13 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * insns.def (opt_plus): simply use LONG2NUM() instead of wrongly
- complex overflow case.
-
- * insns.def (opt_sub): ditto.
-
-Tue Feb 16 02:49:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/rbinstall.rb (without_destdir): compare with the destdir
- after stripping a drive letter, on dosish platforms.
- pointed out by @DavidEGrayson.
- https://github.com/ruby/ruby/commit/d0cf23b#commitcomment-16100407
-
-Mon Feb 15 15:44:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parse_ident): allow keyword arguments just after a
- method where the same name local variable is defined.
- [ruby-core:73816] [Bug#12073]
-
-Mon Feb 15 14:43:28 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb: Added debugging option
- (with Kimihito Matsui)
-
-Sun Feb 14 17:31:50 2016 Lars Kanis <lars@greiz-reinsdorf.de>
-
- * lib/mkmf.rb (with_{cpp,c,ld}flags): copy caller strings not to
- be modified, in append_{cpp,c,ld}flags respectively.
- [Fix GH-1246]
-
-Sun Feb 14 16:18:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (setup_exception): set the cause only if it is explicitly
- given or not set yet. [Bug #12068]
-
-Sat Feb 13 21:44:58 2016 Tanaka Akira <akr@fsij.org>
-
- * hash.c (rb_hash_invert): [DOC] more examples.
-
-Sat Feb 13 17:30:49 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#find_proxy): support CIDR in
- no_proxy. [ruby-core:73769] [Feature#12062]
-
-Sat Feb 13 17:11:58 2016 Fabian Wiesel <fabian.wiesel@sap.com>
-
- * lib/uri/generic.rb (find_proxy): exclude white-spaces and allow
- for a leading dot in the domain name in no_proxy.
- [ruby-core:54542] [Feature #8317]
-
-Fri Feb 12 12:20:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (name_err_initialize, nometh_err_initialize): [DOC] fix
- argument positions. optional parameters except for the message
- are placed at the last.
-
-Fri Feb 12 11:49:49 2016 Anthony Dmitriyev <antstorm@gmail.com>
-
- * net/ftp.rb: add NullSocket#closed? to fix closing not opened
- connection. [Fix GH-1232]
-
-Fri Feb 12 11:17:38 2016 Bogdan <bogdanvlviv@gmail.com>
-
- * re.c (rb_reg_initialize_m): [DOC] fix missing right bracket.
- [Fix GH-1243]
-
-Thu Feb 11 14:57:58 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_CHECK_SIZEOF, RUBY_DEFINT): fix for types
- which are conditionally available depending on architectures
- when universal binary, e.g., __int128.
-
-Thu Feb 11 06:26:18 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (RUBY_DEFINT): use Parameter Expansion.
-
-Thu Feb 11 05:33:24 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in (int128_t): don't check HAVE_XXX (for example
- HAVE___INT128) because RUBY_CHECK_SIZEOF() don't define it for
- config.h and use of $ac_cv_sizeof___int128 alternates the check.
- (and don't need to define because users shouldn't know that)
-
-Wed Feb 10 12:03:41 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ARFLAGS): check if deterministic mode flag is
- effective, which is on by default on Ubuntu.
-
-Tue Feb 9 16:36:23 2016 Naotoshi Seo <sonots@gmail.com>
-
- * lib/logger.rb: Remove block from Logger.add as it's not needed
- patch provided by Daniel Lobato Garcia [fix GH-1240] [Bug #12054]
-
-Tue Feb 9 14:32:23 2016 Zachary Scott <zzak@ruby-lang.org>
-
- * ext/zlib/zlib.c: Document mtime header behavior with patch by @schneems
- Fixes [GH-1129]: https://github.com/ruby/ruby/pull/1129
-
-Tue Feb 9 13:52:49 2016 Zachary Scott <zzak@ruby-lang.org>
-
- * re.c: Remove deprecated kcode argument from Regexp.new and compile
- patch provided by Dylan Pulliam [Bug #11495]
-
-Mon Feb 8 21:26:19 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb, enc/unicode/casefold.h: Flags for
- upper/lower conversion added (titlecase and SpecialCasing still missing)
- (with Kimihito Matsui)
-
-Mon Feb 8 20:43:57 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c, enc/unicode.c: Disassociating ONIGENC_CASE_FOLD flag from
- ONIGENC_CASE_DOWNCASE.
- (with Kimihito Matsui)
-
-Mon Feb 8 13:00:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Shortened macros for enc/unicode/casefold.h to
- single-letter; use flags in casefold.h for logic.
-
- * enc/unicode/case-folding.rb: Added flag for case folding.
- Changed parameter passing.
-
- * enc/unicode/casefold.h: New flags added.
- (with Kimihito Matsui)
-
-Mon Feb 8 10:30:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (feature_option): raise a runtime error if ambiguous
- feature name is given, in the future. [Bug #12050]
-
-Mon Feb 8 09:43:57 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Removed enc/unicode/casefold.h from automatic build because
- some CI systems don't have gperf. Creation of enc/unicode/casefold.h
- is now possible with make unicode-up. This is intended as a temporary measure.
-
-Sun Feb 7 22:10:08 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Added two more precondition files for enc/unicode/casefold.h
-
- * enc/unicode.c: Added shortening macros for enc/unicode/casefold.h
-
- * enc/unicode/case-folding.rb: Fixed file encoding for CaseFolding.txt
- to ASCII-8BIT (should fix some ci errors). Clarified usage. Created
- class MapItem. Partially implemented class CaseMapping.
- (with Kimihito Matsui)
-
-Sun Feb 7 14:12:32 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb: Fixing parameter passing.
- (with Kimihito Matsui)
-
-Sun Feb 7 11:44:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode/case-folding.rb: New classes CaseMapping/CaseMappingDummy
- to pass as parameters; not yet implemented or used.
- (with Kimihito Matsui)
-
-Sun Feb 7 11:16:00 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: using new option in recipe for enc/unicode/casefold.h
-
- * enc/unicode/case-folding.rb: Correctly specify argument to new option.
- (with Kimihito Matsui)
-
-Sun Feb 7 10:43:27 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- (this commit message applies to the previous commit)
- * common.mk: explicit recipe for enc/unicode/casefold.h
-
- * enc/unicode/case-folding.rb: Adding -m option to prepare for using
- multiple data files.
- (with Kimihito Matsui)
-
-Sat Feb 6 22:30:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/cgi/util.rb (escapeHTML, unescapeHTML): consider
- ASCII-incompatible encodings. [Fix GH-1239]
-
-Sat Feb 6 15:18:28 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_regex_casefold.rb: Added data-based testing for
- String#downcase :fold.
-
- * enc/unicode.c: Fixed a range error (lowest non-ASCII character affected
- by case operations is U+00B5, MICRO SIGN)
-
- * test/ruby/enc/test_case_mapping.rb: Explicit test for case folding of
- MICRO SIGN to Greek mu.
- (with Kimihito Matsui)
-
-Sat Feb 6 14:51:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_regex_casefold.rb: Tests for three case folding
- primitives (mbc_case_fold, get_case_fold_codes_by_str,
- apply_all_case_fold) in the various encodings. Currently only known
- good encodings are tested to avoid test failures. For bug hunting,
- start by adding more encodings with
- generate_test_casefold encoding
- (with Kimihito Matsui)
-
-Sat Feb 6 14:37:16 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c, test/ruby/enc/test_case_mapping.rb: Implemented :fold
- option for String#downcase by using case folding data from
- regular expression engine, and added a few simple tests.
- (with Kimihito Matsui)
-
-Fri Feb 5 20:08:59 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_case_mapping.rb: added tests for :ascii option.
- (with Kimihito Matsui)
-
-Fri Feb 5 12:22:20 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * insns.def (opt_mult): Use int128_t for overflow detection.
-
- * bignum.c (rb_uint128t2big): added for opt_mult.
-
- * bignum.c (rb_uint128t2big): added for rb_uint128t2big..
-
- * configure.in: define int128_t, uint128_t and related MACROs.
- Initially introduced by r41379 but reverted by r50749.
-
-Thu Feb 4 21:05:17 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Activated :ascii flag for ASCII-only case conversion
- (with Kimihito Matsui)
-
-Thu Feb 4 17:38:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (reg_set_source): make source string frozen without
- copying.
-
- * re.c (rb_reg_initialize_m): refactor initialization with
- encoding.
-
-Thu Feb 4 15:35:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_fstring_enc_new, rb_fstring_enc_cstr): functions to
- make fstring with encoding.
-
-Thu Feb 4 14:42:29 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Added Unicode data file SpecialCasing.txt to be additionally
- downloaded (with Kimihito Matsui)
-
-Thu Feb 4 12:39:08 2016 joker1007 <kakyoin.hierophant@gmail.com>
-
- * cgi/escape/escape.c: Optimize CGI.escape performance by C ext
- for ASCII-compatible encodings. [Fix GH-1238]
-
-Thu Feb 4 11:53:56 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Introduce two variables (UNICODE_DATA_DIR and
- UNICODE_SRC_DATA_DIR) to eliminate repetitions.
-
-Wed Feb 3 12:13:20 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * string.c (str_new_frozen): if the given string is embeddedable
- but not embedded, embed a new copied string. [Bug #11946]
-
-Wed Feb 3 08:25:38 2016 boshan <boshan@subsplash.com>
-
- * ext/openssl/ossl_pkey.c (Init_ossl_pkey): [DOC] Fix typo
- "encrypted" to "decrypted". [Fix GH-1235]
-
-Wed Feb 3 08:21:32 2016 Seiei Miyagi <hanachin@gmail.com>
-
- * ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): Fix
- Ripper.lex error in dedenting squiggly heredoc. heredoc tree is
- also an array of Elem in the outer tree. [Fix GH-1234]
-
-Wed Feb 3 02:33:39 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c (rb_reg_prepare_enc): use already compiled US-ASCII regexp
- if given string is ASCII only.
- 121.2s to 113.9s on my x86_64-freebsd10.2 Intel Core i5 661
-
-Tue Feb 2 13:02:03 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * re.c: Introduce RREGEXP_PTR.
- patch by dbussink.
- partially merge https://github.com/ruby/ruby/pull/497
-
- * include/ruby/ruby.h: ditto.
-
- * gc.c: ditto.
-
- * ext/strscan/strscan.c: ditto.
-
- * parse.y: ditto.
-
- * string.c: ditto.
-
-Tue Feb 2 09:08:27 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems/specification.rb: `coding` is effective only first
- line except shebang.
-
- * lib/rubygems/package.rb, lib/rubygems/package/*: ditto.
-
-Mon Feb 1 21:41:58 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.5.2.
- It supports to enable frozen string literal and add `--norc` option for
- disable to `.gemrc` configuration.
- See 2.5.2 release notes for other fixes and enhancements.
- https://github.com/rubygems/rubygems/blob/a8aa3bac723f045c52471c7b9328310a048561e0/History.txt#L3
-
-Sun Jan 31 12:33:13 2016 Dan Kreiger <dan@dankreiger.com>
-
- * test/drb/ut_large.rb (multiply, avg, median): add additional
- math operations to DRbLarge. [Fix GH-1086]
-
-Sun Jan 31 12:19:15 2016 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_file_exhaustive.rb (test_lstat): Add lacking test
- for File#lstat. [Fix GH-1231]
-
-Sun Jan 31 12:15:33 2016 Prayag Verma <prayag.verma@gmail.com>
-
- * doc/standard_library.rdoc: fix typo [Fix GH-1230]
- Spelling mistakes -
- outputing > outputting
- publich > publish
-
-Sat Jan 30 15:18:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_eval.c (rb_check_funcall_with_hook): also should call the
- given hook before returning Qundef when overridden respond_to?
- method returned false. [ruby-core:73556] [Bug #12030]
-
-Fri Jan 29 17:40:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/file.c (rb_readlink): drop garbage after the substitute
- name, as rb_w32_read_reparse_point returns the expected buffer
- size but "\??\" prefix is dropped from the result.
-
- * win32/win32.c (w32_readlink): ditto, including NUL-terminator.
-
-Fri Jan 29 17:07:27 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (fileattr_to_unixmode, rb_w32_reparse_symlink_p): volume
- mount point should be treated as directory, not symlink.
- [ruby-core:72483] [Bug #11874]
-
- * win32/win32.c (rb_w32_read_reparse_point): check the reparse point is
- a volume mount point or not.
-
- * win32/file.c (rb_readlink): follow above change (but this pass won't
- be used).
-
-Fri Jan 29 16:17:07 2016 Lucas Buchala <lucasbuchala@gmail.com>
-
- * enum.c (enum_take_while, enum_drop_while): rename block
- parameter to obj, since they are generic objects. [Fix GH-1226]
-
-Fri Jan 29 14:15:26 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/erb.rb (ERB::Compiler#detect_magic_comment): allow
- frozen-string-literal in comment as well as encoding.
-
- * lib/erb.rb (ERB#def_method): insert def line just before the
- first non-comment and non-empty line, not to leave duplicated
- and stale magic comments.
-
-Fri Jan 29 11:13:33 2016 Jeremy Evans <code@jeremyevans.net>
-
- * lib/erb.rb (ERB#set_eoutvar): explicitly make mutable string as
- a buffer to make ERB work with --enable-frozen-string-literal.
- [ruby-core:73561] [Bug #12031]
-
-Fri Jan 29 10:44:56 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/net/http/header.rb: Warn nil variable on HTTP Header.
- It caused to NoMethodError. [fix GH-952][fix GH-641] Patch by @teosz
- * test/net/http/test_httpheader.rb: Added test for nil HTTP Header.
-
-Thu Jan 28 17:31:43 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/socket.c (sock_gethostname): support unlimited size
- hostname.
-
-Wed Jan 27 21:03:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/-ext-/string/test_capacity.rb: Added missing library.
-
-Wed Jan 27 18:53:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Fixed bit mask in macro OnigCodePointCount
-
-Wed Jan 27 17:54:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Protect code point count by macro, in order to
- be able to use the remaining bits for flags.
- (with Kimihito Matsui)
-
-Wed Jan 27 16:34:35 2016 boshan <boshan@subsplash.com>
-
- * lib/tempfile.rb (Tempfile#initialize): [DOC] the first parameter
- `basename` is optional and defaulted to an empty string since
- [GH-523]. [Fix GH-1225]
-
-Wed Jan 27 16:25:54 2016 Koichi ITO <koic.ito@gmail.com>
-
- * array.c (rb_ary_dig): [DOC] fix the exception class to be raised
- when intermediate object does not have dig method. TypeError
- will be raised now. [Fix GH-1224]
-
-Tue Jan 26 19:36:15 2016 Aggelos Avgerinos <evaggelos.avgerinos@gmail.com>
-
- * array.c (permute0, rpermute0): [DOC] Substitute indexes ->
- indices in documentation for consistency. [Fix GH-1222]
-
-Tue Jan 26 15:21:37 2016 Eric Wong <e@80x24.org>
-
- * compile.c (caller_location): use rb_fstring_cstr for "<compiled>"
- (it is converted to fstring anyways inside rb_iseq_new_with_opt)
- * iseq.c (iseqw_s_compile): ditto
- * iseq.c (rb_iseq_new_main): use rb_fstring_cstr for "<main>"
- * vm.c (Init_VM): ditto, share with with above
- * iseq.c (iseqw_s_compile_file): rb_fstring before rb_io_t->pathv
- share "<main>" with above
- * vm.c (rb_binding_add_dynavars): fstring "<temp>" immediately
-
-Tue Jan 26 15:14:01 2016 Kazuki Yamaguchi <k@rhe.jp>
-
- * compile.c (iseq_peephole_optimize): don't apply tailcall
- optimization to send/invokesuper instructions with blockiseq.
- This is a follow-up to the changes in r51903; blockiseq is now
- the third operand of send/invokesuper instructions.
- [ruby-core:73413] [Bug #12018]
-
-Tue Jan 26 14:26:46 2016 Eric Wong <e@80x24.org>
-
- * signal.c (sig_list): use fstring for hash key
- * test/ruby/test_signal.rb (test_signal_list_dedupe_keys): added
-
-Tue Jan 26 13:08:34 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (rb_f_kill): should immediately deliver reserved
- signals SIGILL and SIGFPE, not only SIGSEGV and SIGBUS.
-
-Tue Jan 26 07:57:28 2016 Joseph Tibbertsma <josephtibbertsma@gmail.com>
-
- * gc.c (RVALUE_PAGE_WB_UNPROTECTED): fix a typo of argument name.
- [Fix GH-1221]
-
-Mon Jan 25 17:26:54 2016 Eric Wong <e@80x24.org>
-
- * ruby_assert.h (RUBY_ASSERT_WHEN): fix reference to macro name
- * vm_core.h: include ruby_assert.h before using
- [ruby-core:73371]
-
-Mon Jan 25 15:55:30 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.c (sym_check_asciionly): more informative error message
- with the encoding name and the inspected content.
- [ruby-core:73398] [Feature #12016]
-
-Mon Jan 25 09:38:26 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/ruby/test_string.rb: added testcase for next!, succ and succ!
- [fix GH-1213] Patch by @K0mAtoru
-
-Mon Jan 25 09:32:25 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/webrick/httpservlet/filehandler.rb: fix documentation for namespace.
- [fix GH-1219][ci skip] Patch by @leafac
-
-Sun Jan 24 19:34:23 2016 Eric Wong <e@80x24.org>
-
- * vm_insnhelper.c (vm_check_if_namespace): tiny size reduction
-
-Sun Jan 24 18:12:36 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Simplifying Unicode data file download logic to make
- it more reliable (including additional fix not in r53633) [Bug #12007]
-
-Sun Jan 24 16:54:11 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/wait/wait.c (io_wait_readwrite): [EXPERIMENTAL] allow to
- wait for multiple modes, readable and writable, at once. the
- arguments may change in the future. [Feature #12013]
-
-Sat Jan 23 22:30:59 2016 K0mA <mctj1218@gmail.com>
-
- * test/ruby/test_array.rb (test_keep_if): Add test for
- Array#keep_if separate from Array#select! [Fix GH-1218]
-
-Sat Jan 23 20:54:26 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * common.mk: revert r53633. It broke rubyci and travis.
- https://travis-ci.org/ruby/ruby/builds/104259623
-
-Sat Jan 23 20:10:29 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * range.c (range_eqq): revert r51585 because rb_call_super() is
- called in range_include() and thus r51585 doesn't work when the
- receiver Range object consists of non linear objects such as Date
- objects.
- [ruby-core:72908] [Bug #12003]
-
-Sat Jan 23 18:37:37 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * ChangeLog: Fixing wrong time on previous commit, and adding
- previous commit message to svn [ci skip]
-
-Sat Jan 23 18:30:30 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Simplifying Unicode data file download logic to make
- it more reliable [Bug #12007]
-
-Sat Jan 23 16:29:42 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * tool/downloader.rb: Fixed a logical error, improved documentation
-
-Sat Jan 23 11:42:43 2016 Peter Suschlik <ps@neopoly.de>
-
- * README.md: Use SVG Travis badge over PNG for better quality and
- device support. [Fix GH-1214] [Fix GH-1216]
-
-Sat Jan 23 11:29:16 2016 Pascal Betz <pascal.betz@simplificator.com>
-
- * lib/csv.rb: Update documentation of CSV header converter for
- r45498, [GH-575]. [Fix GH-1215]
-
-Fri Jan 22 17:36:46 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * vm_core.h (VM_ASSERT): use RUBY_ASSERT instead of rb_bug.
-
- * error.c (rb_assert_failure): assertion with stack dump.
-
- * ruby_assert.h (RUBY_ASSERT): new header for the assertion.
-
-Fri Jan 22 00:25:57 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * regparse.c (fetch_name_with_level): allow non word characters
- at the first character. [Feature #11949]
-
- * regparse.c (fetch_name): ditto.
-
-Thu Jan 21 17:34:01 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * marshal.c (r_object0): honor Marshal.load post proc
- value for TYPE_LINK. by Hiroshi Nakamura <nahi@ruby-lang.org>
- https://github.com/ruby/ruby/pull/1204 fix GH-1204
-
-Thu Jan 21 16:37:50 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * Makefile.in (update-rubyspec): fix r53208 like r53451.
-
-Wed Jan 20 20:58:25 2016 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * common.mk, Makefile.in: update-config_files is only for Unix
- platforms.
-
-Wed Jan 20 17:13:39 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/extlibs.rb: add --cache option to change cache directory.
-
-Tue Jan 19 17:03:40 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * common.mk: Added Unicode data file CaseFolding.txt to be additionally
- downloaded (with Kimihito Matsui)
-
-Tue Jan 19 10:09:58 2016 Sho Hashimoto <sho-h@ruby-lang.org>
-
- * lib/shell.rb (Shell.debug_output_exclusive_unlock): remove
- because Mutex#exclusive_unlock was already deleted. [fix GH-1185]
-
-Tue Jan 19 09:38:27 2016 Nick Cox <nick@nickcox.me>
-
- * vm_method.c: fix grammar in respond_to? warning.
- [fix GH-1047]
-
-Mon Jan 18 14:37:07 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_here_document): an escaped newline is not an
- actual newline, and the rest part should not be dedented.
- [ruby-core:72855] [Bug #11989]
-
-Mon Jan 18 12:04:34 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/ruby/test_string.rb: Added extra testcase for test_rstrip_bang
- and test_lstrip_bang. [fix GH-1178] Patch by @Matrixbirds
-
-Mon Jan 18 11:47:27 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * string.c: fix a typo. [fix GH-1202][ci skip] Patch by @sunboshan
-
-Sun Jan 17 21:15:30 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * configure.in: improve ICC (Intel C Compiler) support.
-
- * configure.in (CXX): The name of icc's c++ compiler is `icpc`.
-
- * configure.in (warnings): Add `-diag-disable=2259` to suppress
- noisy warnings: "non-pointer conversion from "..." to "..." may
- lose significant bits".
-
- * configure.in (optflags): Add `-fp-model precise` like -fno-fast-math.
-
- * lib/mkmf.rb: icc supports -Werror=division-by-zero
- and -Werror=deprecated-declarations, but doesn't support
- -Wdivision-by-zero and -Wdeprecated-declarations.
-
-Sun Jan 17 20:40:10 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Any kind of option is now taking the new code path for
- upcase/downcase/capitalize/swapcase. :lithuanian can be used for
- testing if no specific option is desired.
- * test/ruby/enc/test_case_mapping.rb: Adjusted to above.
- (with Kimihito Matsui)
-
-Sun Jan 17 20:10:10 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Fixed a logical error and some comments.
- * test/ruby/enc/test_case_mapping.rb: Made tests more general.
- (with Kimihito Matsui)
-
-Sun Jan 17 17:41:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Removed artificial expansion for Turkic,
- added hand-coded support for Turkic, fixed logic for swapcase.
- * string.c: Made use of new case mapping code possible from upcase,
- capitalize, and swapcase (with :lithuanian as a guard).
- * test/ruby/enc/test_case_mapping.rb: Adjusted for above.
- (with Kimihito Matsui)
-
-Sun Jan 17 15:30:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/option.c (sockopt_bool): relax boolean size to be one
- too not only sizeof(int). Winsock getsockopt() returns a single
- byte as a boolean socket option. [ruby-core:72730] [Bug #11958]
-
-Sun Jan 17 14:43:01 2016 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_env.rb: [Fix GH-1201]
- * Extract test code for ENV#keep_if from ENV#select_bang
- * Add a test case for ENV#select_bang,keep_if
-
-Sun Jan 17 14:42:25 2016 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_env.rb: [Fix GH-1201]
- * Extract test code for ENV#delete_if from ENV#reject_bang
- * Add a test case for ENV#reject_bang,delete_if
-
-Sun Jan 17 14:40:22 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/option.c (check_size): extract a macro to check
- binary data size, with a consistent message.
-
- * ext/socket/option.c (sockopt_byte): fix error message,
- sizeof(int) differs from sizeof(unsigned char) in general.
-
-Sat Jan 16 21:16:21 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (xstring): reset heredoc indent after dedenting,
- so that following string literal would not be dedented.
- [ruby-core:72857] [Bug #11990]
-
-Sat Jan 16 17:24:24 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * enc/unicode.c: Artificial mapping to test buffer expansion code.
- * string.c: Fixed buffer expansion logic.
- * test/ruby/enc/test_case_mapping.rb: Tests for above.
- (with Kimihito Matsui)
-
-Sat Jan 16 16:47:14 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ext/openssl/lib/openssl/pkey.rb: Added 2048 bit DH parameter.
- * test/openssl/test_pkey_dh.rb: ditto.
-
-Sat Jan 16 10:51:19 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * enc/unicode.c: fix implicit conversion error with clang. fixup r53548.
- * string.c: ditto.
-
-Sat Jan 16 10:31:00 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * common.mk: test-sample was changed to test-basic.
- [Feature #11982][ruby-core:72823]
- * basictest/runner.rb: ditto. rename from tool/rubytest.rb.
- * basictest/test.rb: ditto. rename from sample/test.rb.
- * defs/gmake.mk: picked from r53540
- * sample/test.rb: backward compatibility for chkbuild.
-
-Sat Jan 16 10:23:23 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c, enc/unicode.c: New code path as a preparation for Unicode-wide
- case mapping. The code path is currently guarded by the :lithuanian
- option to avoid accidental problems in daily use.
- * test/ruby/enc/test_case_mapping.rb: Test for above.
- * string.c: function 'check_case_options': fixed logical errors
- (with Kimihito Matsui)
-
-Fri Jan 15 20:20:20 2016 Naohisa Goto <ngotogenome@gmail.com>
-
- * regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): The value of
- UNALIGNED_WORD_ACCESS should be used to determine whether
- unaligned word access is allowed or not. After this commit,
- ./configure CPPFLAGS="-DUNALIGNED_WORD_ACCESS=0" disables
- unaligned word access even on platforms that support the feature.
-
-Fri Jan 15 16:12:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (string1): reset heredoc indent for each string literal
- so that concatenated string would not be dedented.
- [ruby-core:72857] [Bug #11990]
-
-Thu Jan 14 20:01:00 2016 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#to_s): change encoding to
- UTF-8 as Ruby 2.2/ by Koichi ITO <koic.ito@gmail.com>
- https://github.com/ruby/ruby/pull/1188 fix GH-1188
-
-Thu Jan 14 17:36:16 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_f_global_variables): add matched back references
- only, as well as defined? operator.
-
-Thu Jan 14 16:12:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_str_format): format exact number more exactly.
-
-Thu Jan 14 15:08:43 2016 Tony Arcieri <bascule@gmail.com>
-
- * Remove 512-bit DH group. It's affected by LogJam Attack.
- https://weakdh.org/
- [fix GH-1196][Bug #11968][ruby-core:72766]
-
-Thu Jan 14 11:44:29 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_f_global_variables): add $1..$9 only if $~ is
- set. fix the condition removed at r14014.
-
-Wed Jan 13 17:21:45 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * .travis.yml: removed commented-out code.
-
-Wed Jan 13 17:14:54 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * .travis.yml: removed osx code. follow up with r53517
-
-Wed Jan 13 16:56:19 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * iseq.c (rb_iseq_mark): mark parent iseq to prevent dynamically
- generated iseq by eval from GC. [ruby-core:72620] [Bug #11928]
-
-Wed Jan 13 03:42:58 2016 Eric Wong <e@80x24.org>
-
- * class.c (Init_class_hierarchy): resolve name for rb_cObject ASAP
- * object.c (rb_mod_const_set): move name resolution to rb_const_set
- * variable.c (rb_const_set): do class resolution here
- [ruby-core:72807] [Bug #11977]
-
-Wed Jan 13 00:37:12 2016 Satoshi Ohmori <sachin21dev@gmail.com>
-
- * man/ruby.1: fix double word typo. [Fix GH-1194]
-
-Tue Jan 12 21:01:09 2016 Benoit Daloze <eregontp@gmail.com>
-
- * common.mk: update URL and name for the Ruby spec suite.
-
-Tue Jan 12 19:52:19 2016 sorah (Shota Fukumori) <her@sorah.jp>
-
- * lib/forwardable.rb: Convert given accessors to String.
-
- r53381 changed to accept only Symbol or String for accessors, but
- there are several rubygems that pass classes (e.g. Array,
- Hash, ...) as accessors. Prior r53381, it was accepted because Class#to_s
- returns its class name. After r53381 given accessors are checked
- with define_method, but it accepts only Symbol or String, otherwise
- raises TypeError.
-
- def_delegator Foo, :some_method
-
- This change is to revert unexpected incompatibility. But this behavior
- may change in the future.
-
-Mon Jan 12 18:41:41 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: made a variable name more grammatically correct
-
-Mon Jan 12 18:34:34 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: minor grammar fix [ci skip]
-
-Mon Jan 12 16:09:09 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * test/ruby/enc/test_casing_options.rb: Tests for option
- parsing/checking for upcase/downcase/capitalize/swapcase
- (see r53503; with Kimihito Matsui)
-
-Mon Jan 12 16:03:03 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * string.c: Added option parsing/checking for upcase/downcase/
- capitalize/swapcase (with Kimihito Matsui)
-
-Mon Jan 11 21:28:28 2016 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * include/ruby/oniguruma.h: Added flags needed for upcase/downcase
- Unicode addition (with Kimihito Matsui)
-
-Mon Jan 11 09:50:24 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check if the API version number is consistent with
- the program version number.
-
-Sun Jan 10 20:57:25 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (compile_massign_lhs): when index ends with splat,
- append rhs value to it like POSTARG, since VM_CALL_ARGS_SPLAT
- splats the last argument only. [ruby-core:72777] [Bug #11970]
-
-Sun Jan 10 15:45:10 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/missing.h (explicit_bzero_by_memset_s): remove
- inline implementation by memset_s, which needs a macro before
- including headers and can cause problems in extension libraries
- by the order of the macro and headers.
-
-Sun Jan 10 13:41:36 2016 Eric Wong <e@80x24.org>
-
- * io.c (rb_deferr): remove long obsolete global
-
-Sun Jan 10 09:14:42 2016 Eric Wong <e@80x24.org>
-
- * ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
- eliminate chomp
- * lib/net/http.rb (connect): eliminate delete
- * lib/net/http/header.rb (basic_encode): ditto
- * lib/net/imap.rb (authenticate): eliminate gsub
- (self.encode_utf7): shorten delete arg
- * lib/net/smtp.rb (base64_encode): eliminate gsub
- * lib/open-uri.rb (OpenURI.open_http): eliminate delete
- * lib/rss/rss.rb: ditto
- * lib/securerandom.rb (base64): ditto
- (urlsafe_base64): eliminate delete!
- * lib/webrick/httpauth/digestauth.rb (split_param_value):
- eliminate chop
- * lib/webrick/httpproxy.rb (do_CONNECT): eliminate delete
- (setup_upstream_proxy_authentication): ditto
- [ruby-core:72666] [Feature #11938]
-
-Sat Jan 9 23:19:14 2016 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_hash.rb (test_try_convert): Add test for
- Hash.try_convert. [Fix GH-1190]
-
-Sat Jan 9 23:15:25 2016 Jon Moss <maclover7@users.noreply.github.com>
-
- * ext/openssl/ossl.c: Add missing variables to documentation
- examples. [Fix GH-1189]
-
-Sat Jan 9 18:25:57 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * symbol.h (is_attrset_id): ASET is an attrset ID. fix
- unexpected safe call instead of an ordinary ASET.
-
-Sat Jan 9 10:44:33 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in, win32/setup.mak: extract RUBY_PROGRAM_VERSION from
- RUBY_VERSION in version.h instead of RUBY_API_VERSION numbers in
- include/ruby/version.h, and cut it into version numbers.
-
-Sat Jan 9 07:13:33 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename PAGE_* to HEAP_PAGE_* because PAGE_SIZE is used
- in Mac OS X.
-
- * test/ruby/test_gc.rb: catch up this fix.
-
-Sat Jan 9 05:45:40 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: PAGE_BITMAP_PLANES (the number of bitmap) is 4, not 3.
-
-Sat Jan 9 05:42:57 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename constant names HEAP_* to PAGE_*.
-
- Keys of GC::INTERNAL_CONSTANTS are also renamed.
-
- * test/ruby/test_gc.rb: catch up this fix.
-
-Fri Jan 8 22:30:06 2016 Akinori MUSHA <knu@iDaemons.org>
-
- * doc/regexp.rdoc: [DOC] Elaborate on the \G anchor. [ci skip]
-
-Fri Jan 8 19:49:27 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: remove heap_page::body. Instead of this field,
- heap_page::start field works well.
-
-Fri Jan 8 19:31:52 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: rename rb_heap_t::page_length to rb_heap_t::total_pages.
-
- `page_length' is not clear (we may understand with length of
- a page).
-
-Fri Jan 8 17:07:14 2016 Koichi Sasada <ko1@atdot.net>
-
- * gc.c: remove heap_page::heap. This field is only used to recognize
- whether a page is in a tomb or not. Instead of this field,
- heap_page::flags::in_tomb (1 bit field) is added.
-
- Also type of heap_page::(total|free|final)_slots are changed from
- int to short. 2B is enough for them.
-
-Fri Jan 8 09:33:59 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * iseq.c (rb_iseq_compile_with_option): move variable initialization
- code to avoid maybe-uninitialized warnings by gcc 4.8.
-
-Fri Jan 8 00:03:22 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * enum.c (enum_min, enum_max): do the same optimization as r53454.
-
-Thu Jan 7 22:32:21 2016 Kenta Murata <mrkn@mrkn.jp>
-
- * ruby.h: undef HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P
- and HAVE_BUILTIN___BUILTIN_TYPES_COMPATIBLE_P on C++.
- [ruby-core:72736] [Bug #11962]
-
-Thu Jan 7 22:02:21 2016 Shugo Maeda <shugo@ruby-lang.org>
-
- * enum.c (enum_minmax): optimize object comparison in
- Enumerable#minmax.
-
-Thu Jan 7 14:49:12 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * thread.c (rb_thread_pending_interrupt_p): no pending interrupt
- before initialization.
-
- * thread.c (thread_raise_m, rb_thread_kill): uninitialized thread
- cannot interrupt. [ruby-core:72732] [Bug #11959]
-
-Thu Jan 7 11:34:14 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * include/ruby/backward.h (ruby_show_copyright_to_die): for source
- code backward compatibility.
-
- * ruby.c (process_options): return Qtrue to exit the process
- successfully.
-
- * version.c (ruby_show_copyright): no longer exit.
-
-Wed Jan 6 17:22:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#order!): add `into` optional
- keyword argument to store the results. [Feature #11191]
-
-Tue Jan 5 21:44:37 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * ChangeLog: fix wrong class name.
-
-Tue Jan 5 21:43:50 2016 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_string.rb(test_chr): added test for String#chr
- [fix GH-1179]
-
-Tue Jan 5 21:32:26 2016 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_numeric.rb (test_nonzero_p): added test for Numeric#nonzero?
- [fix GH-1187]
-
-Tue Jan 5 11:47:23 2016 Damir Gaynetdinov <damir.gaynetdinov@gmail.com>
-
- * doc/marshal.rdoc: Clarify object references example, that the
- reference is same object. [Fix GH-1156]
-
-Tue Jan 5 05:06:51 2016 Eric Wong <e@80x24.org>
-
- * ext/stringio/stringio.c (strio_binmode): implement to set encoding
- * test/stringio/test_stringio.rb (test_binmode): new test
- [ruby-core:72699] [Bug #11945]
-
-Mon Jan 4 15:44:37 2016 Sho Hashimoto <sho-h@ruby-lang.org>
-
- * variable.c (rb_mod_deprecate_constant): [DOC] added
- documentation for Module#deprecate_constant. [ci skip]
-
-Mon Jan 4 15:36:38 2016 Sho Hashimoto <sho-h@ruby-lang.org>
-
- * thread_sync.c: [DOC] remove SizedQueue#close argument.
- [ci skip]
-
-Mon Jan 4 10:14:24 2016 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * test/coverage/test_coverage.rb: ignored test when enabled to coverage.
- It lead to crash with `make test-all`.
-
-Mon Jan 4 08:10:44 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * insns.def (opt_case_dispatch): Move a comment to the
- appropriate position.
- [ci skip]
-
-Sun Jan 3 23:55:13 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rubygems/security.rb (DIGEST_ALGORITHM, KEY_ALGORITHM):
- should check same name as the used constants.
- [ruby-core:72674] [Bug #11940]
-
-Sun Jan 3 19:22:01 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * aclocal.m4: add fallback file for non-aclocal environments.
- [ruby-core:72683] [Bug #11942]
-
-Sun Jan 3 13:56:49 2016 Yuichiro Kaneko <yui-knk@ruby-lang.org>
-
- * eval_error.c (rb_print_undef): Use `rb_method_visibility_t`
- instead of `int`.
- * eval_intern.h (rb_print_undef): ditto
- * proc.c (mnew_internal): ditto
- * vm_method.c (rb_export_method): ditto
- [Misc #11649] [ruby-core:71311] [fix GH-1078]
-
-Sun Jan 3 12:12:09 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * acinclude.m4: rename aclocal.m4, which should be generated by
- aclocal. [ruby-core:72675] [Bug #11941]
-
-Sat Jan 2 21:07:55 2016 Eric Wong <e@80x24.org>
-
- * thread_sync.c (queue_do_pop): avoid cast with Qfalse
- (rb_szqueue_push): ditto, use queue_sleep wrapper
-
-Sat Jan 2 16:16:14 2016 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/erb.rb: Allow ERB subclass to add token easily.
- [Feature #11936]
-
- * test/erb/test_erb.rb: ditto.
-
-Sat Jan 2 14:44:31 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (regexp): set_yylval_num sets u1, should use nd_tag
- instead of nd_state. [ruby-core:72638] [Bug #11932]
-
-Sat Jan 2 02:27:22 2016 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/ostruct.rb: Fix case of frozen object with initializer.
- Bug revealed by RubySpec [ruby-core:72639]
-
-Fri Jan 1 22:01:52 2016 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * NEWS: mention CSV's liberal_parsing option.
-
-Fri Jan 1 19:38:23 2016 okkez <okkez000@gmail.com>
-
- * doc/NEWS-2.3.0: fix double words typo.
- [ci skip][fix GH-1183]
-
-Fri Jan 1 15:28:56 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (remove_unreachable_chunk): decrease count of
- call_info in removed instructions. fix up r53402.
-
-Fri Jan 1 12:05:53 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * compile.c (remove_unreachable_chunk): remove unreferred label
- to optimize away unreachable chunk.
-
-Fri Jan 1 11:42:57 2016 James Edward Gray II <james@graysoftinc.com>
-
- * lib/csv.rb (CSV): Add a liberal_parsing option.
- Patch by Braden Anderson. [#11839]
- * test/csv/test_features.rb: test liberal_parsing
-
-Fri Jan 1 10:27:28 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * tool/mkconfig.rb (RbConfig): prefix SDKROOT to oldincludedir
- not includedir, the latter is outside the ruby installation.
- [ruby-core:72496] [Bug #11881]
-
-Fri Jan 1 08:53:02 2016 Yuki Kurihara <co000ri@gmail.com>
-
- * test/ruby/test_lazy_enumerator.rb (test_take_bad_arg): Add test
- code in case of Enumerator::Lazy#take called with negative number.
- [ruby-dev:49467] [Bug #11933]
-
-Fri Jan 1 05:06:20 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_here_document): update indent for each line in
- indented here document with single-quotes.
- [ruby-core:72479] [Bug #11871]
-
-Fri Jan 1 03:26:44 2016 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/ostruct.rb (freeze): define deferred accessors before
- freezing to get rid of an error when just reading frozen
- OpenStruct.
-
-Thu Dec 31 14:36:45 2015 Marc-Andre Lafortune <ruby-core@marc-andre.ca>
-
- * lib/ostruct.rb: Fix new_ostruct_member to correctly avoid
- redefinition [#11901]
-
-Thu Dec 31 02:45:12 2015 NARUSE, Yui <naruse@ruby-lang.org>
-
- * test/ruby/test_module.rb (test_classpath): r53376 may change
- the order of m.constants.
- `make TESTS='-v ruby/test_class.rb ruby/test_module.rb' test-all`
- may fail after that.
- http://rubyci.s3.amazonaws.com/tk2-243-31075/ruby-trunk/log/20151230T164202Z.log.html.gz
-
-Thu Dec 31 02:20:00 2015 Benoit Daloze <eregontp@gmail.com>
-
- * common.mk (help): Fix typo.
-
-Wed Dec 30 20:53:09 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/net/http/responses.rb: Added new response class for 451 status code.
- * lib/net/http.rb: documentation for HTTPUnavailableForLegalReasons
-
-Wed Dec 30 20:45:45 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * lib/webrick/httpstatus.rb: Added HTTP 451 Status Code.
- [fix GH-1167] Patch by @MuhammetDilmac
- https://tools.ietf.org/html/draft-tbray-http-legally-restricted-status-00
-
-Wed Dec 30 20:25:52 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/syntax/calling_methods.rdoc: fix old operator for safe navigation
- operator. [ci skip][fix GH-1182] Patch by @dougo
-
-Wed Dec 30 16:43:23 2015 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_string.rb (test_ord): Add test for String#ord.
- [Fix GH-1181]
-
-Wed Dec 30 11:28:57 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/forwardable.rb (def_instance_delegator): adjust backtrace of
- method body by tail call optimization. adjusting the delegated
- target is still done by deleting backtrace.
-
- * lib/forwardable.rb (def_single_delegator): ditto.
-
-Wed Dec 30 11:18:42 2015 Elliot Winkler <elliot.winkler@gmail.com>
-
- * lib/forwardable.rb (def_instance_delegator) fix delegating to
- 'args' and 'block', clashing with local variables in generated
- methods. [ruby-core:72579] [Bug #11916]
-
- * lib/forwardable.rb (def_single_delegator): ditto.
-
-Wed Dec 30 09:58:56 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_class_inherited_p): search the corresponding
- ancestor to prepended module from prepending class itself.
- [ruby-core:72493] [Bug #11878]
-
-Wed Dec 30 09:20:00 2015 Yuki Kurihara <co000ri@gmail.com>
-
- * test/stringio/test_io.rb (test_flag): add assertion for error when
- text and binary mode are mixed.
- [ruby-dev:49465] [Feature #11921]
-
-Wed Dec 30 08:43:59 2015 Yuki Kurihara <co000ri@gmail.com>
-
- * test/stringio/test_stringio.rb (test_initialize): add test for
- StringIO#initialize. [ruby-core:72585] [Feature #11920]
-
-Wed Dec 30 05:19:24 2015 Eric Wong <e@80x24.org>
-
- * class.c (struct clone_const_arg): adjust for id_table
- (clone_const): ditto
- (clone_const_i): ditto
- (rb_mod_init_copy): ditto
- (rb_singleton_class_clone_and_attach): ditto
- (rb_include_class_new): ditto
- (include_modules_at): ditto
- * constant.h (rb_free_const_table): ditto
- * gc.c (free_const_entry_i): ditto
- (rb_free_const_table): ditto
- (obj_memsize_of): ditto
- (mark_const_entry_i): ditto
- (mark_const_tbl): ditto
- * internal.h (struct rb_classext_struct): ditto
- * object.c (rb_mod_const_set): resolve class name on assignment
- * variable.c (const_update): replace with const_tbl_update
- (const_tbl_update): new function
- (fc_i): adjust for id_table
- (find_class_path): ditto
- (autoload_const_set): st_update => const_tbl_update
- (rb_const_remove): adjust for id_table
- (sv_i): ditto
- (rb_local_constants_i): ditto
- (rb_local_constants): ditto
- (rb_mod_const_at): ditto
- (rb_mod_const_set): ditto
- (rb_const_lookup): ditto
- [ruby-core:72112] [Feature #11614]
-
-Wed Dec 30 04:10:13 2015 CHIKANAGA Tomoyuki <nagachika@ruby-lang.org>
-
- * thread_pthread.c (rb_thread_create_timer_thread): destroy attr even
- if pthread_create() failed.
-
-Wed Dec 30 02:55:09 2015 Eric Wong <e@80x24.org>
-
- * thread_pthread.c (setup_communication_pipe): delay setting owner
- (rb_thread_create_timer_thread): until thread creation succeeds
- [ruby-core:72590] [Bug #11922]
-
-Tue Dec 29 19:12:46 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (proc_options): -W command line option should be able to
- override -w in RUBYOPT environment variable.
-
-Tue Dec 29 17:54:16 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (ignored_block): warn if a block is given to `using`,
- which is probably for `Module.new`.
-
-Tue Dec 29 12:48:34 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/ostruct.rb (OpenStruct): make respond_to? working on
- just-allocated objects for workaround of Psych.
- [ruby-core:72501] [Bug #11884]
-
-Tue Dec 29 10:35:00 2015 Kenta Murata <mrkn@mrkn.jp>
-
- * test/mkmf/test_have_func.rb (test_have_func):
- Add assertion to examine the existence of HAVE_RUBY_INIT.
-
- * test/mkmf/test_have_func.rb (test_not_have_func):
- Add assertion to examine the absence of HAVE_RUBY_INIT.
-
-Tue Dec 29 06:50:42 2015 Eric Wong <e@80x24.org>
-
- * thread_sync.c: static classes
-
-Tue Dec 29 05:30:30 2015 Eric Wong <e@80x24.org>
-
- * lib/resolv.rb (Resolv::IPv6.create): avoid modifying frozen
- * test/resolv/test_dns.rb (test_ipv6_create): test for above
- [Bug #11910] [ruby-core:72559]
-
-Mon Dec 28 14:55:57 2015 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_string.rb (TestString#test_rstrip_bang): Add test
- for String#rstrip!. [Fix GH-1176]
-
-Mon Dec 28 09:18:53 2015 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_string.rb (TestString#test_lstrip_bang): Add test
- for String#lstrip!. [Fix GH-1176]
-
-Sun Dec 27 23:32:26 2015 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_variant2val): refactoring.
-
-Sun Dec 27 21:14:42 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * process.c (rb_execarg_parent_start1): need to convert the encoding to
- ospath's one.
-
-Sun Dec 27 20:54:22 2015 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
- reported by naruse via twitter.
-
- * process.c (rb_execarg_addopt): need to convert the encoding to
- ospath's one.
-
-Sun Dec 27 20:00:31 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * enc/x_emoji.h: fix dead-link.
-
-Sun Dec 27 19:55:55 2015 SHIBATA Hiroshi <hsbt@ruby-lang.org>
-
- * doc/NEWS-2.3.0: fix a typo.
-
-Sun Dec 27 18:08:15 2015 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * string.c (rb_str_lstrip_bang, rb_str_rstrip_bang): [DOC] Fix
- ruby-doc comments for String#rstrip! and lstrip!. It looks like
- dropped bang. [Fix GH-1175]
-
-Sun Dec 27 15:14:20 2015 Eric Wong <e@80x24.org>
-
- * io.c (io_getpartial): remove unused kwarg from template
- * test/ruby/test_io.rb (test_readpartial_bad_args): new
- [Bug #11885]
-
-Sun Dec 27 11:50:53 2015 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_string.rb (test_rstrip, test_lstrip): Add tests
- for String#lstrip and rstrip. The test cases are used from
- string.c ruby-doc comments. [Fix GH-1174]
-
-Sun Dec 27 11:47:46 2015 Kuniaki IGARASHI <igaiga@gmail.com>
-
- * test/ruby/test_string.rb (test_insert): Add test for
- String#insert. The test cases are written in string.c
- comments as a reference. [Fix GH-1173]
-
-Sun Dec 27 11:03:33 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (show_bitstack): trace stack_type value if yydebug.
-
-Sun Dec 27 10:03:14 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enc/depend (enc, trans): fix version dependency, shared object
- files depend on the RUBY_SO_NAME value for runtime link.
-
-Sun Dec 27 09:47:20 2015 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_vstr2wc, ole_variant2val): fix blank
- string conversion.
- [Bug #11880]
- Thanks Akio Tajima for the patch!
-
-Sun Dec 27 09:34:53 2015 craft4coder <yooobuntu@163.com>
-
- * doc/extension.rdoc: [DOC] `nul` should be uppercase.
- change 'nul' => 'NUL'. [Fix GH-1172]
-
-Sat Dec 26 18:29:01 2015 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/xmlrpc/client.rb: Support SSL options in async methods of
- XMLRPC::Client.
- [Bug #11489]
- Reported by Aleksandar Kostadinov. Thanks!!!
-
-Sat Dec 26 11:26:38 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * miniinit.c (Init_enc): add some common aliases of built-in
- encodings. [ruby-core:72481] [Bug #11872]
-
-Fri Dec 25 22:43:26 2015 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: extract RUBY_RELEASE_DAY at generating Makefile.
-
- * version.h (RUBY_RELEASE_DATE): construct from RUBY_RELEASE_YEAR,
- RUBY_RELEASE_MONTH, and RUBY_RELEASE_DAY.
-
-Fri Dec 25 21:33:06 2015 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * version.h (RUBY_VERSION): 2.4.0 development has started.
-
-Fri Dec 25 14:12:12 2015 Martin Duerst <duerst@it.aoyama.ac.jp>
-
- * doc/ChangeLog-2.3.0, ext/tk/lib/tkextlib/SUPPORT_STATUS,
- include/ruby/version.h: minor grammar fixes [ci skip]
-
-Fri Dec 25 08:23:22 2015 Tadashi Saito <tad.a.digger@gmail.com>
-
- * compile.c, cont.c, doc, man: fix common misspelling.
- [ruby-core:72466] [Bug #11870]
-
-
-For the changes before 2.3.0, see doc/ChangeLog-2.3.0
-For the changes before 2.2.0, see doc/ChangeLog-2.2.0
-For the changes before 2.1.0, see doc/ChangeLog-2.1.0
-For the changes before 2.0.0, see doc/ChangeLog-2.0.0
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
-
-Local variables:
-coding: us-ascii
-add-log-time-format: (lambda ()
- (let* ((time (current-time))
- (system-time-locale "C")
- (diff (+ (cadr time) 32400))
- (lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
- (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-change-log-indent-text: 2
-end:
-vim: tabstop=8 shiftwidth=2
diff --git a/LEGAL b/LEGAL
index cd1cce2de1..0423d57ac9 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,184 +1,331 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
All the files in this distribution are covered under either the Ruby's
license (see the file COPYING) or public-domain except some files
mentioned below.
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
+[addr2line.c]
+
+ A part of this file is from FreeBSD.
- These files are licensed under the CC0.
+ >>>
+ Copyright (c) 1986, 1988, 1991, 1993::
+ The Regents of the University of California. All rights reserved.
- http://creativecommons.org/choose/zero/
+ (c) UNIX System Laboratories, Inc.
-ccan/list/list.h
+ All or some portions of this file are derived from material licensed
+ to the University of California by American Telephone and Telegraph
+ Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ the permission of UNIX System Laboratories, Inc.
- This file is licensed under the MIT License.
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 4. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
- Permission is hereby granted, free of charge, to any person obtaining a copy
- of this software and associated documentation files (the "Software"), to deal
- in the Software without restriction, including without limitation the rights
- to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
- copies of the Software, and to permit persons to whom the Software is
- furnished to do so, subject to the following conditions:
+ @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+ These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+ This file is licensed under the {MIT License}[rdoc-label:label-MIT+License].
+
+[coroutine]
+
+ Unless otherwise specified, these files are licensed under the
+ {MIT License}[rdoc-label:label-MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+ Onigmo (Oniguruma-mod) LICENSE
+
+ >>>
+ Copyright (c) 2002-2009:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ Copyright (c) 2011-2014:: K.Takata <kentkt AT csc DOT jp>
+ All rights reserved.
- The above copyright notice and this permission notice shall be included in
- all copies or substantial portions of the Software.
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
- IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
- FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
- AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
- LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
- OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
- THE SOFTWARE.
-
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma ---- (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
- When this software is partly used or it is distributed with Ruby,
- this of Ruby follows the license of Ruby.
-
-enc/trans/GB/GB12345%UCS.src:
-enc/trans/GB/UCS%GB12345.src:
-
- Copyright (c) 1991-1994 Unicode, Inc. All Rights reserved.
-
- This file is provided as-is by Unicode, Inc. (The Unicode Consortium).
- No claims are made as to fitness for any particular purpose. No
- warranties of any kind are expressed or implied. The recipient
- agrees to determine applicability of information provided. If this
- file has been provided on magnetic media by Unicode, Inc., the sole
- remedy for any claim will be exchange of defective media within 90
- days of receipt.
-
- Recipient is granted the right to make copies in any form for
- internal distribution and to freely use the information supplied
- in the creation of products supporting Unicode. Unicode, Inc.
- specifically excludes the right to re-distribute this file directly
- to third parties or other organizations whether for profit or not.
-
-
-enc/trans/GB/GB2312%UCS.src:
-enc/trans/GB/UCS%GB2312.src:
-
- Copyright (c) 1991-1999 Unicode, Inc. All Rights reserved.
-
- This file is provided as-is by Unicode, Inc. (The Unicode Consortium).
- No claims are made as to fitness for any particular purpose. No
- warranties of any kind are expressed or implied. The recipient
- agrees to determine applicability of information provided. If this
- file has been provided on optical media by Unicode, Inc., the sole
- remedy for any claim will be exchange of defective media within 90
- days of receipt.
-
- Unicode, Inc. hereby grants the right to freely use the information
- supplied in this file in the creation of products supporting the
- Unicode Standard, and to make copies of this file in any form for
- internal or external distribution as long as this notice remains
- attached.
-
-enc/trans/JIS/JISX0201-KANA%UCS.src:
-enc/trans/JIS/JISX0208@1990%UCS.src:
-enc/trans/JIS/JISX0212%UCS.src:
-enc/trans/JIS/UCS%JISX0201-KANA.src:
-enc/trans/JIS/UCS%JISX0208@1990.src:
-enc/trans/JIS/UCS%JISX0212.src:
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ Oniguruma LICENSE
+
+ >>>
+ Copyright (c) 2002-2009:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ * https://github.com/k-takata/Onigmo/
+ * https://github.com/kkos/oniguruma
+ * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+ When this software is partly used or it is distributed with Ruby,
+ this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
+
+ >>>
+ Copyright (c) 2006-2007:: Byte <byte AT mail DOT kna DOT ru>
+ K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
+
+ >>>
+ Copyright (c) 2002-2007:: K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+ These files have this explanatory texts.
+
+ >>>
+ This mapping data was created from files provided by Unicode, Inc.
+ (The Unicode Consortium). The files were used to create a product supporting
+ Unicode, as explicitly permitted in the files' copyright notices.
+ Please note that Unicode, Inc. never made any claims as to fitness of these
+ files for any particular purpose, and has ceased to publish the files many
+ years ago.
+
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
+
+ These files are copyrighted as the following.
+
+ >>>
© 2015 Unicode®, Inc.
+
For terms of use, see http://www.unicode.org/terms_of_use.html
-enc/trans/JIS/JISX0213-1%UCS@BMP.src:
-enc/trans/JIS/JISX0213-1%UCS@SIP.src:
-enc/trans/JIS/JISX0213-2%UCS@BMP.src:
-enc/trans/JIS/JISX0213-2%UCS@SIP.src:
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+ These files are copyrighted as the following.
+
+ >>>
+ Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001:: I'O, All Rights Reserved.
+ Copyright (C) 2006:: Project X0213, All Rights Reserved.
+ You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
- Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- Copyright (C) 2001 I'O, All Rights Reserved.
- Copyright (C) 2006 Project X0213, All Rights Reserved.
- You can use, modify, distribute this table freely.
+ These files are copyrighted as the following.
-enc/trans/JIS/UCS@BMP%JISX0213-1.src:
-enc/trans/JIS/UCS@BMP%JISX0213-2.src:
-enc/trans/JIS/UCS@SIP%JISX0213-1.src:
-enc/trans/JIS/UCS@SIP%JISX0213-2.src:
+ >>>
+ Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001:: I'O, All Rights Reserved.
+ You can use, modify, distribute this table freely.
- Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- Copyright (C) 2001 I'O, All Rights Reserved.
- You can use, modify, distribute this table freely.
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
-configure:
+ >>>
+ Copyright (C) 2001-2005:: International Business Machines
+ Corporation and others. All Rights Reserved.
+
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
+
+ >>>
+ Copyright (C) 2001-2002:: International Business Machines
+ Corporation and others. All Rights Reserved.
+
+
+[configure]
This file is free software.
- Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+ >>>
+ Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
This configure script is free software; the Free Software Foundation
gives unlimited permission to copy, distribute and modify it.
-tool/config.guess:
-tool/config.sub:
+[tool/config.guess]
+[tool/config.sub]
As long as you distribute these files with the file configure, they
are covered under the Ruby's license.
- Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
- Free Software Foundation, Inc.
+ >>>
+ Copyright 1992-2018:: Free Software Foundation, Inc.
This file is free software; you can redistribute it and/or modify it
under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2 of the License, or
+ the Free Software Foundation; either version 3 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful, but
@@ -187,54 +334,85 @@ tool/config.sub:
General Public License for more details.
You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ along with this program; if not, see <https://www.gnu.org/licenses/>.
As a special exception to the GNU General Public License, if you
distribute this file as part of a program that contains a
configuration script generated by Autoconf, you may include it under
- the same distribution terms that you use for the rest of that program.
-
-parse.c:
-
- This file is licensed under the GPL, but is incorporated into Ruby and
+ the same distribution terms that you use for the rest of that
+ program. This Exception is an additional permission under section 7
+ of the GNU General Public License, version 3 ("GPLv3").
+
+[tool/lib/test/*]
+[tool/lib/core_assertions.rb]
+
+ Some of methods on these files are based on MiniTest 4. MiniTest 4 is
+ distributed under the MIT License.
+
+ >>>
+ Copyright (c) Ryan Davis, seattle.rb
+
+ Permission is hereby granted, free of charge, to any person obtaining
+ a copy of this software and associated documentation files (the
+ 'Software'), to deal in the Software without restriction, including
+ without limitation the rights to use, copy, modify, merge, publish,
+ distribute, sublicense, and/or sell copies of the Software, and to
+ permit persons to whom the Software is furnished to do so, subject to
+ the following conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+ MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+ IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+ CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+ TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+ SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+[parse.c]
+[parse.h]
+
+ These files are licensed under the GPL, but are incorporated into Ruby and
redistributed under the terms of the Ruby license, as permitted by the
exception to the GPL below.
- Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
- Free Software Foundation, Inc.
+ >>>
+ Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
- This program is free software; you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2, or (at your option)
- any later version.
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or
+ (at your option) any later version.
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 51 Franklin Street, Fifth Floor,
- Boston, MA 02110-1301, USA. */
+ You should have received a copy of the GNU General Public License
+ along with this program. If not, see <http://www.gnu.org/licenses/>.
- /* As a special exception, you may create a larger work that contains
- part or all of the Bison parser skeleton and distribute that work
- under terms of your choice, so long as that work isn't itself a
- parser generator using the skeleton or a modified version thereof
- as a parser skeleton. Alternatively, if you modify or redistribute
- the parser skeleton itself, you may (at your option) remove this
- special exception, which will cause the skeleton and the resulting
- Bison output files to be licensed under the GNU General Public
- License without this special exception.
+ As a special exception, you may create a larger work that contains
+ part or all of the Bison parser skeleton and distribute that work
+ under terms of your choice, so long as that work isn't itself a
+ parser generator using the skeleton or a modified version thereof
+ as a parser skeleton. Alternatively, if you modify or redistribute
+ the parser skeleton itself, you may (at your option) remove this
+ special exception, which will cause the skeleton and the resulting
+ Bison output files to be licensed under the GNU General Public
+ License without this special exception.
- This special exception was added by the Free Software Foundation in
- version 2.2 of Bison. */
+ This special exception was added by the Free Software Foundation in
+ version 2.2 of Bison.
-util.c (partly):
+[missing/dtoa.c]
- Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+ This file is under these licenses.
+
+ >>>
+ Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
Permission to use, copy, modify, and distribute this software for any
purpose without fee is hereby granted, provided that this entire notice
@@ -247,71 +425,74 @@ util.c (partly):
REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-win32/win32.[ch]:
+ >>>
+ Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
You can apply the Artistic License to these files. (or GPL,
alternatively)
- Copyright (c) 1993, Intergraph Corporation
+ >>>
+ Copyright (c) 1993:: Intergraph Corporation
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the perl README file.
-util.c (partly):
-
- Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-random.c
+[missing/mt19937.c]
This file is under the new-style BSD license.
- A C-program for MT19937, with initialization improved 2002/2/10.
+ >>>
+ A C-program for MT19937, with initialization improved 2002/2/10.::
Coded by Takuji Nishimura and Makoto Matsumoto.
+
This is a faster version by taking Shawn Cokus's optimization,
Matthe Bellew's simplification, Isaku Wada's real version.
Before using, initialize the state by using init_genrand(seed)
or init_by_array(init_key, key_length).
- Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
- All rights reserved.
+ Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- 3. The names of its contributors may not be used to endorse or promote
- products derived from this software without specific prior written
- permission.
+ 3. The names of its contributors may not be used to endorse or promote
+ products derived from this software without specific prior written
+ permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -330,12 +511,15 @@ random.c
http://www.math.keio.ac.jp/matumoto/emt.html
email: matumoto@math.keio.ac.jp
-vm_dump.c:procstat_vm
+ The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
+
+[missing/procstat_vm.c]
This file is under the new-style BSD license.
- Copyright (c) 2007 Robert N. M. Watson
- All rights reserved.
+ >>>
+ Copyright (c) 2007:: Robert N. M. Watson
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -360,147 +544,65 @@ vm_dump.c:procstat_vm
$FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-vsnprintf.c:
+[vsnprintf.c]
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
+ >>>
+ Copyright (c) 1990, 1993::
+ The Regents of the University of California. All rights reserved.
This code is derived from software contributed to Berkeley by
Chris Torek.
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
- IMPORTANT NOTE:
- --------------
- From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
- paragraph 3 above is now null and void.
-
-st.c:
-strftime.c:
-include/ruby/st.h:
-missing/acosh.c:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/lgamma_r.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strerror.c:
-missing/strstr.c:
-missing/strtol.c:
-missing/tgamma.c:
-ext/date/date_strftime.c:
-ext/digest/sha1/sha1.[ch]:
-ext/sdbm/_sdbm.c:
-ext/sdbm/sdbm.h:
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/erf.c]
+[missing/hypot.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
These files are all under public domain.
-missing/crypt.c:
+[missing/crypt.c]
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
- Copyright (c) 1989, 1993
- The Regents of the University of California. All rights reserved.
+ >>>
+ Copyright (c) 1989, 1993::
+ The Regents of the University of California. All rights reserved.
This code is derived from software contributed to Berkeley by
Tom Truscott.
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
+[missing/setproctitle.c]
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-missing/setproctitle.c
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
+ This file is under the {old-style BSD license}[rdoc-label:label-Old-style+BSD+license].
- Copyright 2003 Damien Miller
- Copyright (c) 1983, 1995-1997 Eric P. Allman
- Copyright (c) 1988, 1993
- The Regents of the University of California. All rights reserved.
+ >>>
+ Copyright 2003:: Damien Miller
+ Copyright (c) 1983, 1995-1997:: Eric P. Allman
+ Copyright (c) 1988, 1993::
+ The Regents of the University of California. All rights reserved.
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-missing/strlcat.c
-missing/strlcpy.c
+[missing/strlcat.c]
+[missing/strlcpy.c]
These files are under an ISC-style license.
- Copyright (c) 1998, 2015 Todd C. Miller <Todd.Miller@courtesan.com>
+ >>>
+ Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
Permission to use, copy, modify, and distribute this software for any
purpose with or without fee is hereby granted, provided that the above
@@ -514,23 +616,26 @@ missing/strlcpy.c
ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
-missing/langinfo.c
+[missing/langinfo.c]
This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
Ruby uses a modified version. The file contains the following
author/copyright notice:
- Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
- Permission to use, copy, modify, and distribute this software
- for any purpose and without fee is hereby granted. The author
- disclaims all warranties with regard to this software.
+ >>>
+ Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+ Permission to use, copy, modify, and distribute this software
+ for any purpose and without fee is hereby granted. The author
+ disclaims all warranties with regard to this software.
-ext/digest/md5/md5.[ch]:
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
These files are under the following license. Ruby uses modified
versions of them.
- Copyright (C) 1999, 2000 Aladdin Enterprises. All rights reserved.
+ >>>
+ Copyright (C) 1999, 2000:: Aladdin Enterprises. All rights reserved.
This software is provided 'as-is', without any express or implied
warranty. In no event will the authors be held liable for any damages
@@ -551,23 +656,27 @@ ext/digest/md5/md5.[ch]:
L. Peter Deutsch
ghost@aladdin.com
-ext/digest/rmd160/rmd160.[ch]:
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
These files have the following copyright information, and by the
author we are allowed to use it under the new-style BSD license.
- AUTHOR: Antoon Bosselaers, ESAT-COSIC
+ >>>
+ AUTHOR:: Antoon Bosselaers, ESAT-COSIC
(Arranged for libc by Todd C. Miller)
- DATE: 1 March 1996
+ DATE:: 1 March 1996
- Copyright (c) Katholieke Universiteit Leuven
+ Copyright (c):: Katholieke Universiteit Leuven
1996, All Rights Reserved
-ext/digest/sha2/sha2.[ch]:
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
These files are under the new-style BSD license.
- Copyright 2000 Aaron D. Gifford. All rights reserved.
+ >>>
+ Copyright 2000:: Aaron D. Gifford. All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
@@ -593,51 +702,123 @@ ext/digest/sha2/sha2.[ch]:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/json/generator/generator.c:
+[ext/json/generator/generator.c]
- Copyright 2001-2004 Unicode, Inc.
+ The file contains the following copyright notice.
- Disclaimer
+ >>>
+ Copyright 2001-2004:: Unicode, Inc.
- This source code is provided as is by Unicode, Inc. No claims are
- made as to fitness for any particular purpose. No warranties of any
- kind are expressed or implied. The recipient agrees to determine
- applicability of information provided. If this file has been
- purchased on magnetic or optical media from Unicode, Inc., the
- sole remedy for any claim will be exchange of defective media
- within 90 days of receipt.
+ Disclaimer::
- Limitations on Rights to Redistribute This Code
+ This source code is provided as is by Unicode, Inc. No claims are
+ made as to fitness for any particular purpose. No warranties of any
+ kind are expressed or implied. The recipient agrees to determine
+ applicability of information provided. If this file has been
+ purchased on magnetic or optical media from Unicode, Inc., the
+ sole remedy for any claim will be exchange of defective media
+ within 90 days of receipt.
- Unicode, Inc. hereby grants the right to freely use the information
- supplied in this file in the creation of products supporting the
- Unicode Standard, and to make copies of this file in any form
- for internal or external distribution as long as this notice
- remains attached.
+ Limitations on Rights to Redistribute This Code::
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
+ Unicode, Inc. hereby grants the right to freely use the information
+ supplied in this file in the creation of products supporting the
+ Unicode Standard, and to make copies of this file in any form
+ for internal or external distribution as long as this notice
+ remains attached.
+
+[ext/nkf/nkf-utf8/config.h]
+[ext/nkf/nkf-utf8/nkf.c]
+[ext/nkf/nkf-utf8/utf8tbl.c]
These files are under the following license. So to speak, it is
copyrighted semi-public-domain software.
- Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
- Everyone is permitted to do anything on this program
- including copying, modifying, improving,
- as long as you don't try to pretend that you wrote it.
- i.e., the above copyright notice has to appear in all copies.
- Binary distribution requires original version messages.
- You don't have to ask before copying, redistribution or publishing.
- THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+ >>>
+ Copyright (C) 1987:: Fujitsu LTD. (Itaru ICHIKAWA)
+
+ Everyone is permitted to do anything on this program
+ including copying, modifying, improving,
+ as long as you don't try to pretend that you wrote it.
+ i.e., the above copyright notice has to appear in all copies.
+ Binary distribution requires original version messages.
+ You don't have to ask before copying, redistribution or publishing.
+ THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+[ext/psych]
+[test/psych]
+
+ The files under these directories are under the following license, except for
+ ext/psych/yaml.
+
+ >>>
+ Copyright 2009:: Aaron Patterson, et al.
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the 'Software'), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+ THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+[ext/psych/yaml]
+
+ The files under this directory are under the following license.
+
+ >>>
+ Copyright (c) 2006:: Kirill Simonov
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the "Software"), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+[ext/pty/pty.c]
+
+ >>>
+ C) Copyright 1998:: by Akinori Ito.
+
+ This software may be redistributed freely for this purpose, in full
+ or in part, provided that this entire copyright notice is included
+ on any copies of this software and applications and derivations thereof.
+
+ This software is provided on an "as is" basis, without warranty of any
+ kind, either expressed or implied, as to any matter including, but not
+ limited to warranty of fitness of purpose, or merchantability, or
+ results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
These files are under the new-style BSD license.
- Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+ >>>
+ Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
All rights reserved.
Redistribution and use in source and binary forms, with or without
@@ -664,23 +845,275 @@ ext/socket/getnameinfo.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/win32ole/win32ole.c:
+[ext/win32ole/win32ole.c]
You can apply the Artistic License to this file. (or GPL,
alternatively)
- (c) 1995 Microsoft Corporation. All rights reserved.
+ >>>
+ (c) 1995:: Microsoft Corporation. All rights reserved.
Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
- Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+ Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
<gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the README file
of the Perl distribution.
-lib/rdoc/generator/template/darkfish/css/fonts.css:
+ The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
+
+ This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+
+[spec/mspec]
+[spec/ruby]
+
+ The files under these directories are under the following license.
+
+ >>>
+ Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+
+ Permission is hereby granted, free of charge, to any person
+ obtaining a copy of this software and associated documentation
+ files (the "Software"), to deal in the Software without
+ restriction, including without limitation the rights to use,
+ copy, modify, merge, publish, distribute, sublicense, and/or sell
+ copies of the Software, and to permit persons to whom the
+ Software is furnished to do so, subject to the following
+ conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+ OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+ HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+ WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+ FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+ OTHER DEALINGS IN THE SOFTWARE.
+
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+ RubyGems is under the following license.
+
+ >>>
+ RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+ Weirich and others. You can redistribute it and/or modify it under
+ either the terms of the {MIT license}[rdoc-label:label-MIT+License], or the conditions
+ below:
+
+ 1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
+
+ 2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
+
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
+
+ b. use the modified software only within your corporation or
+ organization.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
+
+ 3. You may distribute the software in object code or executable
+ form, provided that you do at least ONE of the following:
+
+ a. distribute the executables and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
+
+ b. accompany the distribution with the machine-readable source of
+ the software.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
- This file is licensed under the SIL Open Font License.
+ 4. You may modify and include the part of the software into any other
+ software (possibly commercial).
- http://scripts.sil.org/OFL
+ 5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
+
+ 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[spec/bundler]
+
+ Bundler is under the following license.
+
+ >>>
+ Portions copyright (c) 2010:: Andre Arko
+ Portions copyright (c) 2009:: Engine Yard
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/thor]
+
+ Thor is under the following license.
+
+ >>>
+ Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/rubygems/resolver/molinillo]
+
+ molinillo is under the following license.
+
+ >>>
+ Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/pub_grub]
+
+ pub_grub is under the following license.
+
+ >>>
+ Copyright (c) 2018 John Hawthorn
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/connection_pool]
+
+ connection_pool is under the following license.
+
+ >>>
+ Copyright (c) 2011 Mike Perham
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/bundler/vendor/net-http-persistent]
+
+ net-http-persistent is under the following license.
+
+ >>>
+ Copyright (c) Eric Hodel, Aaron Patterson
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+ did_you_mean is under the following license.
+
+ >>>
+ Copyright (c) 2014-2016 Yuki Nishijima
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[lib/error_highlight]
+[lib/error_highlight.rb]
+[test/error_highlight]
+
+ error_highlight is under the following license.
+
+ >>>
+ Copyright (c) 2021 Yusuke Endoh
+
+ {MIT License}[rdoc-label:label-MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+ These files are very old copy of then-called "The Great Computer Language
+ Shootout". LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+ site has been lost. Upstream diverged to delete several benchmarks listed
+ above.
+
+== MIT License
+>>>
+ Permission is hereby granted, free of charge, to any person obtaining
+ a copy of this software and associated documentation files (the
+ "Software"), to deal in the Software without restriction, including
+ without limitation the rights to use, copy, modify, merge, publish,
+ distribute, sublicense, and/or sell copies of the Software, and to
+ permit persons to whom the Software is furnished to do so, subject to
+ the following conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+ MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+ LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+ OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+ WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ IMPORTANT NOTE::
+
+ From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+ paragraph 3 above is now null and void.
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 9c8748aa4d..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,549 +0,0 @@
-SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
-
-CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
-PURIFY =
-AUTOCONF = autoconf
-ACLOCAL = aclocal
-CONFIGURE = @CONFIGURE@
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
-
-empty =
-CC_VERSION = @CC_VERSION@
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
- $(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
- $(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
-
-#### End of system configuration section. ####
-
-MAJOR= @MAJOR@
-MINOR= @MINOR@
-TEENY= @TEENY@
-RUBY_PROGRAM_VERSION = @RUBY_PROGRAM_VERSION@
-
-LIBRUBY_A = @LIBRUBY_A@
-LIBRUBY_SO = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY = @LIBRUBY@
-LIBRUBYARG = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
- eval.$(OBJEXT) \
- gc.$(OBJEXT) \
- hash.$(OBJEXT) \
- load.$(OBJEXT) \
- object.$(OBJEXT) \
- parse.$(OBJEXT) \
- string.$(OBJEXT) \
- symbol.$(OBJEXT) \
- vm.$(OBJEXT)
-
-THREAD_MODEL = @THREAD_MODEL@
-
-PREP = @PREP@
-ARCHFILE = @ARCHFILE@
-SETUP =
-EXTSTATIC = @EXTSTATIC@
-ENCSTATIC = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS = @MKDIR_P@
-CP = cp
-MV = mv
-RM = rm -f
-RMDIR = @RMDIR@
-RMDIRS = @RMDIRS@
-RMALL = @RMALL@
-NM = @NM@
-AR = @AR@
-ARFLAGS = @ARFLAGS@
-RANLIB = @RANLIB@
-AS = @AS@
-ASFLAGS = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP = @OBJDUMP@
-OBJCOPY = @OBJCOPY@
-VCS = @VCS@
-VCSUP = @VCSUP@
-DTRACE = @DTRACE@
-DTRACE_EXT = @DTRACE_EXT@
-DTRACE_OBJ = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
-
-OBJEXT = @OBJEXT@
-ASMEXT = S
-DLEXT = @DLEXT@
-MANTYPE = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C = enc/trans/newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C = prelude.c
-RBCONFIG = .rbconfig.time
-
-SRC_FILE = $<
-OS_SRC_FILE = $<
-DEST_FILE = $@
-OS_DEST_FILE = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
-
-DESTDIR = @DESTDIR@
-
-configure_args = @configure_args@
-#### End of variables
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-all:
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
- @-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
-
-$(PROGRAM):
- @$(RM) $@
- $(ECHO) linking $@
- $(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
- $(Q) $(POSTLINK)
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
- @$(RM) $@
- $(ECHO) linking static-library $@
- $(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
- @-$(RANLIB) $@ 2> /dev/null || true
- $(ECHO) verifying static-library $@
- @$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
- @$(RM) conftest$(EXEEXT) conftest.c
-
-$(LIBRUBY_SO):
- @-$(PRE_LIBRUBY_UPDATE)
- $(ECHO) linking shared-library $@
- $(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
- -$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
- -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
- $(Q) $(POSTLINK)
- @-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
- File.symlink "$(LIBRUBY_SO)", link}' \
- $(LIBRUBY_ALIASES) || true
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
- @./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-ruby-runner.h: template/ruby-runner.h.in
- @./config.status --file=$@:$(srcdir)/template/$(@F).in
-
-ruby-runner$(EXEEXT): ruby-runner.c ruby-runner.h
- $(Q) $(PURIFY) $(CC) $(CFLAGS) $(CPPFLAGS) -DRUBY_INSTALL_NAME=$(RUBY_INSTALL_NAME) $(LDFLAGS) $(LIBS) $(OUTFLAG)$@ $<
-
-$(RBCONFIG): $(PREP)
-
-rbconfig.rb: $(RBCONFIG)
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
- $(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
- $(ECHO) installing cross-compiling stuff
- $(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
- $(Q) $(BASERUBY) -p \
- -e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
- -e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
- rbconfig.rb > fake-rbconfig.rb
- $(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
- $(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
- @$(RM) fake.rb fake-rbconfig.rb
- $(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
- $(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
- $(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
- $(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile: $(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
- @[ -f $@ ] && mv $@ $@.old
- MAKE=$(MAKE) $(SHELL) ./config.status $@
- @cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
- { \
- echo "all:; -@rm -f conftest.mk"; \
- echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
- echo ".force:"; \
- } > conftest.mk || exit 1; \
- $(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
- { echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
- sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status: $(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
- $(srcdir)/include/ruby/version.h
- @PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
- set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in $(srcdir)/aclocal.m4
- $(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
-
-$(srcdir)/aclocal.m4:
- $(CHDIR) $(srcdir) && \
- type $(ACLOCAL) >/dev/null 2>&1 && exec $(ACLOCAL); \
- touch $(@F)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make # HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
- @\
- if cmp -s $(srcdir)/defs/lex.c.src $?; then \
- [ $(Q) ] && echo copying $@ || set -x; \
- $(CP) $(srcdir)/lex.c.blt $@; \
- else \
- [ $(Q) ] && echo generating $@ || set -x; \
- gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
- | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
- > $@.tmp && \
- $(MV) $@.tmp $@ && \
- $(CP) $? $(srcdir)/defs/lex.c.src && \
- $(CP) $@ $(srcdir)/lex.c.blt; \
- fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-enc/jis/props.h: enc/jis/props.kwd
- $(MAKEDIRS) $(@D)
- @set +e; \
- if cmp -s $(?:.kwd=.src) $?; then \
- set -x; \
- $(CP) $(?:.kwd=.h.blt) $@; \
- else \
- set -x; \
- gperf $(JIS_PROPS_OPTIONS) $? | \
- sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
- $(CP) $? $(?:.kwd=.src) && \
- $(CP) $@ $(?:.kwd=.h.blt); \
- fi
-
-.c.@OBJEXT@:
- @$(ECHO) compiling $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
- @$(ECHO) assembling $<
- $(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
- @$(ECHO) translating $<
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
- @$(ECHO) preprocessing $<
- $(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
- @$(ECHO) translating probes $<
- $(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
- $(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
- $(Q) $(RM) $@.tmp
-
-.dmyh.h:
- @$(ECHO) making dummy $(DEST_FILE)
- $(Q)echo '#include "$(*F).dmyh"' > $@
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
- $(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
- $(RM) $(DTRACE_REBUILD_OBJS) $@; \
- $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
- $(MAKE) $(DTRACE_REBUILD_OBJS); \
- fi
- $(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
- @$(ECHO) processing probes in object files
- $(Q) $(RM) $@
- $(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
- @$(ECHO) generating a glommed object with DTrace probes for static library
- $(Q) $(LD) -r -o $@ $(OBJS)
-
-clean-local::
- $(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
- enc/encinit.c enc/encinit.$(OBJEXT)
- -$(Q)$(RM) $(pkgconfig_DATA)
-
-distclean-local::
- $(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
- -$(Q)$(RM) run.gdb
- -$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
- -$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
- @cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
- test "$$#" = 0 && set .; \
- set dummy `\
- find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
- `; shift; \
- cd ..; \
- for dir do \
- echo $(@:-ext=)ing "$$dir"; \
- (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
- case "$@" in \
- *distclean-ext*|*realclean-ext*) \
- $(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
- esac; \
- done
- -$(Q)$(RM) ext/extinit.$(OBJEXT)
-
-distclean-ext realclean-ext::
- -$(Q)$(RM) ext/extinit.c
- -$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
-
-clean-enc distclean-enc realclean-enc:
- @test -f "$(ENC_MK)" || exit 0; \
- echo $(@:-enc=ing) encodings; \
- exec $(MAKE) $(MAKE_ENC) $(@:-enc=)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
- $(ECHO) compiling $@
- $(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-update-src::
- @$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-update-download:: update-config_files
-
-after-update:: common-srcs
-
-update-mspec:
- @$(CHDIR) $(srcdir); \
- if [ -d spec/mspec ]; then \
- echo updating mspec ...; \
- $(Q1:0=:) set -x; \
- cd spec/mspec && \
- exec git pull; \
- else \
- echo retrieving mspec ...; \
- $(Q1:0=:) set -x; \
- exec git clone $(MSPEC_GIT_URL) spec/mspec; \
- fi
- $(Q)cd $(srcdir)/spec/mspec && exec git --no-pager log -1 --oneline
-
-update-rubyspec: update-mspec
- @$(CHDIR) $(srcdir); \
- if [ -d spec/rubyspec ]; then \
- echo updating rubyspec ...; \
- $(Q1:0=:) set -x; \
- cd spec/rubyspec && \
- exec git pull; \
- else \
- echo retrieving rubyspec ...; \
- $(Q1:0=:) set -x; \
- exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
- fi
- $(Q)cd $(srcdir)/spec/rubyspec && exec git --no-pager log -1 --oneline
-
-test-rubyspec-precheck:
- @if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here. make update-rubyspec first.; exit 1; fi
-
-update-doclie:
- @$(CHDIR) $(srcdir); \
- if [ -d coverage/doclie ]; then \
- echo updating doclie ...; \
- $(Q1:0=:) set -x; \
- cd coverage/doclie && \
- git fetch && \
- exec git checkout $(DOCLIE_GIT_REF); \
- else \
- echo retrieving doclie ...; \
- $(Q1:0=:) set -x; \
- exec git clone --branch $(DOCLIE_GIT_REF) $(DOCLIE_GIT_URL) coverage/doclie; \
- fi
-
-update-simplecov-html:
- @$(CHDIR) $(srcdir); \
- if [ -d coverage/simplecov-html ]; then \
- echo updating simplecov-html ...; \
- $(Q1:0=:) set -x; \
- cd coverage/simplecov-html && \
- git fetch && \
- exec git checkout $(SIMPLECOV_HTML_GIT_REF); \
- else \
- echo retrieving simplecov-html ...; \
- exec git clone --branch $(SIMPLECOV_HTML_GIT_REF) $(SIMPLECOV_HTML_GIT_URL) coverage/simplecov-html; \
- fi
-
-update-simplecov:
- @$(CHDIR) $(srcdir); \
- if [ -d coverage/simplecov ]; then \
- echo updating simplecov ...; \
- $(Q1:0=:) set -x; \
- cd coverage/simplecov && \
- git fetch && \
- exec git checkout $(SIMPLECOV_GIT_REF); \
- else \
- echo retrieving simplecov ...; \
- $(Q1:0=:) set -x; \
- exec git clone --branch $(SIMPLECOV_GIT_REF) $(SIMPLECOV_GIT_URL) coverage/simplecov; \
- fi
-
-update-coverage: update-simplecov update-simplecov-html update-doclie
-
-INSNS = opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
- vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
- $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
- $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
- $(ECHO) generating $@
- $(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
- @$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
- sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
- -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
-
-un-runnable:
- $(ECHO) cannot make runnable, configure with --enable-load-relative.
- $(Q) exit 1
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 986db329b3..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,211 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.4.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with. For a full list of changes
-with all sufficient information, see the ChangeLog file or Redmine
-(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
-
-== Changes since the 2.3.0 release
-
-=== Language changes
-
-* Multiple assignment in conditional expression is now allowed.
- [Feature #10617]
-
-=== Core classes updates (outstanding ones only)
-
-* Array
-
- * Array#max and Array#min. [Feature #12172]
- This may cause a tiny incompatibility: if you redefine
- Enumerable#max and call max to an Array, your redefinition will be
- now ignored. You should also redefine Array#max.
-
- * Array#sum [Feature #12217]
- This is different from Enumerable#sum in that Array#sum doesn't depend on
- the definition of each method.
-
-* Comparable
-
- * Comparable#clamp. [Feature #10594]
-
-* Dir
-
- * Dir.empty?. [Feature #10121]
-
-* Enumerable
-
- * Enumerable#sum [Feature #12217]
- * Enumerable#uniq [Feature #11090]
-
-* Enumerator::Lazy
-
- * Enumerator::Lazy#uniq [Feature #11090]
-
-* File
-
- * File.empty?. [Feature #9969]
-
-* Float
-
- * Float#ceil, Float#floor, and Float#truncate now take an optional
- digits, as well as Float#round. [Feature #12245]
-
-* Hash
-
- * Hash#transform_values and Hash#transform_values! [Feature #12512]
-
-* Integer
-
- * Integer#ceil, Integer#floor, and Integer#truncate now take an optional
- digits, as well as Integer#round. [Feature #12245]
-
- * Fixnum and Bignum are unified into Integer [Feature #12005]
-
- * Integer#digits for extracting columns of place-value notation [Feature #12447]
-
-* Kernel
-
- * Kernel#clone now takes an optional keyword argument, freeze flag.
- [Feature #12300]
-
-* MatchData
-
- * MatchData#named_captures [Feature #11999]
- * MatchData#values_at supports named captures [Feature #9179]
-
-* Regexp
-
- * Regexp#match? [Feature #8110]
- This returns bool and doesn't save backref.
-
-* Regexp/String: Updated Unicode version from 8.0.0 to 9.0.0 [Feature #12513]
-
-* RubyVM::Env
-
- * RubyVM::Env was removed.
-
-* String
-
- * String#upcase, String#downcase, String#capitalize, String#swapcase and
- their bang variants work for all of Unicode, and are no longer limited
- to ASCII. Supported encodings are UTF-8, UTF-16BE/LE, UTF-32BE/LE, and
- ISO-8859-1~16. Variations are available with options. See the documentation
- of String#downcase for details. [Feature #10085]
-
- * String.new(capacity: size) [Feature #12024]
-
-* Symbol
-
- * Symbol#match now returns MatchData. [Bug #11991]
-
- * Symbol#upcase, Symbol#downcase, Symbol#capitalize, and Symbol#swapcase now
- work for all of Unicode. See the documentation of String#downcase
- for details. [Feature #10085]
-
-* Thread
-
- * Thread#report_on_exception and Thread.report_on_exception
- [Feature #6647]
-
-=== Stdlib updates (outstanding ones only)
-
-* CSV
-
- * Add a liberal_parsing option. [Feature #11839]
-
-* Logger
-
- * Allow specifying logger parameters in constructor such
- as level, progname, datetime_format, formatter. [Feature #12224]
- * Add shift_period_suffix option. [Feature #10772]
-
-* OpenSSL
-
- * OpenSSL is extracted as a gem and the upstream has been migrated to
- https://github.com/ruby/openssl. OpenSSL still remains as a default gem.
- Refer to its History.md for the full release note. [Feature #9612]
-
-* optparse
-
- * Add an into option. [Feature #11191]
-
-=== Compatibility issues (excluding feature bug fixes)
-
-* Array#sum and Enumerable#sum are implemented. [Feature #12217]
- Ruby itself has no compatibility problem because Ruby didn't have sum method
- for arrays before Ruby 2.4.
- However many third party gems, activesupport, facets, simple_stats, etc,
- defines sum method. These implementations are mostly compatible but
- there are subtle differences.
- Ruby's sum method should be mostly compatible but it is impossible to
- be perfectly compatible with all of them.
-
-* Fixnum and Bignum are unified into Integer [Feature #12005]
- Fixnum class and Bignum class is removed.
- Integer class is changed from abstract class to concrete class.
- For example, 0 is an instance of Integer: 0.class returns Integer.
- The constants Fixnum and Bignum is bound to Integer.
- So obj.kind_of?(Fixnum) works as obj.kind_of?(Integer).
- At C-level, Fixnum object and Bignum object should be distinguished by
- FIXNUM_P(obj) and RB_TYPE_P(obj, T_BIGNUM).
- RUBY_INTEGER_UNIFICATION can be used to detect this feature.
- ruby-2.4.0-preview1 (temporally) removes rb_cFixnum and rb_cBignum
- to check the effect of incompatibility.
- (rb_cFixnum and rb_cBignum may be defined as rb_cInteger later if
- compilation failure of extension library is too big problem.)
-
-* String/Symbol#upcase/downcase/swapcase/capitalize(!) now work for all of
- Unicode, not only for ASCII. [Feature #10085]
- No change is needed if the data is in ASCII anyway or if the limitation
- to ASCII was only tolerated while waiting for a more extensive implementation.
- A change (using the :ascii option) is needed in cases where Unicode data
- is processed, but the operation has to be limited to ASCII only.
- A good example of this are internationalized domain names.
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* DateTime
-
- * DateTime#to_time now preserves timezone. [Bug #12189]
-
-* Time
-
- * Time#to_time now preserves timezone. [Bug #12271]
-
-* thread
-
- * the extension library is removed. Till 2.0 it was a pure ruby script
- "thread.rb", which has precedence over "thread.so", and has been provided
- in $LOADED_FEATURES since 2.1.
-
-* Tk
- * Tk is removed from stdlib. [Feature #8539]
- https://github.com/ruby/tk is the new upstream.
-
-=== C API updates
-
-* ruby_show_version() will no longer exits the process, if
- RUBY_SHOW_COPYRIGHT_TO_DIE is set to 0. This will be the default in
- the future.
-
-=== Supported platform changes
-
-* FreeBSD < 4 is no longer supported
-
-=== Implementation improvements
-
-* In some condition, `[x, y].max` and `[x, y].min` are optimized
- so that a temporal array is not created. The concrete condition is
- an implementation detail: currently, the array literal must have no
- splat, must have at least one expression but literal, the length must
- be <= 0x100, and Array#max and min must not be redefined. It will work
- in most casual and real-life use case where it is written with intent
- to `Math.max(x, y)`.
-
-* Thread deadlock detection now shows their backtrace and dependency. [Feature #8214]
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..f6c3c6fc97
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,820 @@
+# NEWS for Ruby 3.2.0
+
+This document is a list of user-visible feature changes
+since the **3.1.0** release, except for bug fixes.
+
+Note that each entry is kept to a minimum, see links for details.
+
+## Language changes
+
+* Anonymous rest and keyword rest arguments can now be passed as
+ arguments, instead of just used in method parameters.
+ [[Feature #18351]]
+
+ ```ruby
+ def foo(*)
+ bar(*)
+ end
+ def baz(**)
+ quux(**)
+ end
+ ```
+
+* A proc that accepts a single positional argument and keywords will
+ no longer autosplat. [[Bug #18633]]
+
+ ```ruby
+ proc{|a, **k| a}.call([1, 2])
+ # Ruby 3.1 and before
+ # => 1
+ # Ruby 3.2 and after
+ # => [1, 2]
+ ```
+
+* Constant assignment evaluation order for constants set on explicit
+ objects has been made consistent with single attribute assignment
+ evaluation order. With this code:
+
+ ```ruby
+ foo::BAR = baz
+ ```
+
+ `foo` is now called before `baz`. Similarly, for multiple assignments
+ to constants, left-to-right evaluation order is used. With this
+ code:
+
+ ```ruby
+ foo1::BAR1, foo2::BAR2 = baz1, baz2
+ ```
+
+ The following evaluation order is now used:
+
+ 1. `foo1`
+ 2. `foo2`
+ 3. `baz1`
+ 4. `baz2`
+
+ [[Bug #15928]]
+
+* "Find pattern" is no longer experimental.
+ [[Feature #18585]]
+
+* Methods taking a rest parameter (like `*args`) and wishing to delegate keyword
+ arguments through `foo(*args)` must now be marked with `ruby2_keywords`
+ (if not already the case). In other words, all methods wishing to delegate
+ keyword arguments through `*args` must now be marked with `ruby2_keywords`,
+ with no exception. This will make it easier to transition to other ways of
+ delegation once a library can require Ruby 3+. Previously, the `ruby2_keywords`
+ flag was kept if the receiving method took `*args`, but this was a bug and an
+ inconsistency. A good technique to find the potentially-missing `ruby2_keywords`
+ is to run the test suite, for where it fails find the last method which must
+ receive keyword arguments, use `puts nil, caller, nil` there, and check each
+ method/block on the call chain which must delegate keywords is correctly marked
+ as `ruby2_keywords`. [[Bug #18625]] [[Bug #16466]]
+
+ ```ruby
+ def target(**kw)
+ end
+
+ # Accidentally worked without ruby2_keywords in Ruby 2.7-3.1, ruby2_keywords
+ # needed in 3.2+. Just like (*args, **kwargs) or (...) would be needed on
+ # both #foo and #bar when migrating away from ruby2_keywords.
+ ruby2_keywords def bar(*args)
+ target(*args)
+ end
+
+ ruby2_keywords def foo(*args)
+ bar(*args)
+ end
+
+ foo(k: 1)
+ ```
+
+## Core classes updates
+
+Note: We're only listing outstanding class updates.
+
+* Fiber
+
+ * Introduce Fiber.[] and Fiber.[]= for inheritable fiber storage.
+ Introduce Fiber#storage and Fiber#storage= (experimental) for
+ getting and resetting the current storage. Introduce
+ `Fiber.new(storage:)` for setting the storage when creating a
+ fiber. [[Feature #19078]]
+
+ Existing Thread and Fiber local variables can be tricky to use.
+ Thread-local variables are shared between all fibers, making it
+ hard to isolate, while Fiber-local variables can be hard to
+ share. It is often desirable to define unit of execution
+ ("execution context") such that some state is shared between all
+ fibers and threads created in that context. This is what Fiber
+ storage provides.
+
+ ```ruby
+ def log(message)
+ puts "#{Fiber[:request_id]}: #{message}"
+ end
+
+ def handle_requests
+ while request = read_request
+ Fiber.schedule do
+ Fiber[:request_id] = SecureRandom.uuid
+
+ request.messages.each do |message|
+ Fiber.schedule do
+ log("Handling #{message}") # Log includes inherited request_id.
+ end
+ end
+ end
+ end
+ end
+ ```
+
+ You should generally consider Fiber storage for any state which
+ you want to be shared implicitly between all fibers and threads
+ created in a given context, e.g. a connection pool, a request
+ id, a logger level, environment variables, configuration, etc.
+
+* Fiber::Scheduler
+
+ * Introduce `Fiber::Scheduler#io_select` for non-blocking IO.select.
+ [[Feature #19060]]
+
+* IO
+
+ * Introduce IO#timeout= and IO#timeout which can cause
+ IO::TimeoutError to be raised if a blocking operation exceeds the
+ specified timeout. [[Feature #18630]]
+
+ ```ruby
+ STDIN.timeout = 1
+ STDIN.read # => Blocking operation timed out! (IO::TimeoutError)
+ ```
+
+ * Introduce `IO.new(..., path:)` and promote `File#path` to `IO#path`.
+ [[Feature #19036]]
+
+* Class
+
+ * Class#attached_object, which returns the object for which
+ the receiver is the singleton class. Raises TypeError if the
+ receiver is not a singleton class.
+ [[Feature #12084]]
+
+ ```ruby
+ class Foo; end
+
+ Foo.singleton_class.attached_object #=> Foo
+ Foo.new.singleton_class.attached_object #=> #<Foo:0x000000010491a370>
+ Foo.attached_object #=> TypeError: `Foo' is not a singleton class
+ nil.singleton_class.attached_object #=> TypeError: `NilClass' is not a singleton class
+ ```
+
+* Data
+
+ * New core class to represent simple immutable value object. The class is
+ similar to Struct and partially shares an implementation, but has more
+ lean and strict API. [[Feature #16122]]
+
+ ```ruby
+ Measure = Data.define(:amount, :unit)
+ distance = Measure.new(100, 'km') #=> #<data Measure amount=100, unit="km">
+ weight = Measure.new(amount: 50, unit: 'kg') #=> #<data Measure amount=50, unit="kg">
+ weight.with(amount: 40) #=> #<data Measure amount=40, unit="kg">
+ weight.amount #=> 50
+ weight.amount = 40 #=> NoMethodError: undefined method `amount='
+ ```
+
+* Encoding
+
+ * Encoding#replicate has been deprecated and will be removed in 3.3. [[Feature #18949]]
+ * The dummy `Encoding::UTF_16` and `Encoding::UTF_32` encodings no longer
+ try to dynamically guess the endian based on a byte order mark.
+ Use `Encoding::UTF_16BE`/`UTF_16LE` and `Encoding::UTF_32BE`/`UTF_32LE` instead.
+ This change speeds up getting the encoding of a String. [[Feature #18949]]
+ * Limit maximum encoding set size by 256.
+ If exceeding maximum size, `EncodingError` will be raised. [[Feature #18949]]
+
+* Enumerator
+
+ * Enumerator.product has been added. Enumerator::Product is the implementation. [[Feature #18685]]
+
+* Exception
+
+ * Exception#detailed_message has been added.
+ The default error printer calls this method on the Exception object
+ instead of #message. [[Feature #18564]]
+
+* Hash
+
+ * Hash#shift now always returns nil if the hash is
+ empty, instead of returning the default value or
+ calling the default proc. [[Bug #16908]]
+
+* Integer
+
+ * Integer#ceildiv has been added. [[Feature #18809]]
+
+* Kernel
+
+ * Kernel#binding raises RuntimeError if called from a non-Ruby frame
+ (such as a method defined in C). [[Bug #18487]]
+
+* MatchData
+
+ * MatchData#byteoffset has been added. [[Feature #13110]]
+ * MatchData#deconstruct has been added. [[Feature #18821]]
+ * MatchData#deconstruct_keys has been added. [[Feature #18821]]
+
+* Module
+
+ * Module.used_refinements has been added. [[Feature #14332]]
+ * Module#refinements has been added. [[Feature #12737]]
+ * Module#const_added has been added. [[Feature #17881]]
+ * Module#undefined_instance_methods has been added. [[Feature #12655]]
+
+* Proc
+
+ * Proc#dup returns an instance of subclass. [[Bug #17545]]
+ * Proc#parameters now accepts lambda keyword. [[Feature #15357]]
+
+* Process
+ * Added `RLIMIT_NPTS` constant to FreeBSD platform
+
+* Regexp
+
+ * The cache-based optimization is introduced.
+ Many (but not all) Regexp matching is now in linear time, which
+ will prevent regular expression denial of service (ReDoS)
+ vulnerability. [[Feature #19104]]
+
+ * Regexp.linear_time? is introduced. [[Feature #19194]]
+
+ * Regexp.new now supports passing the regexp flags not only as an Integer,
+ but also as a String. Unknown flags raise ArgumentError.
+ Otherwise, anything other than `true`, `false`, `nil` or Integer will be warned.
+ [[Feature #18788]]
+
+ * Regexp.timeout= has been added. Also, Regexp.new new supports timeout keyword.
+ See [[Feature #17837]]
+
+* Refinement
+
+ * Refinement#refined_class has been added. [[Feature #12737]]
+
+* RubyVM::AbstractSyntaxTree
+
+ * Add `error_tolerant` option for `parse`, `parse_file` and `of`. [[Feature #19013]]
+ With this option
+
+ 1. SyntaxError is suppressed
+ 2. AST is returned for invalid input
+ 3. `end` is complemented when a parser reaches to the end of input but `end` is insufficient
+ 4. `end` is treated as keyword based on indent
+
+ ```ruby
+ # Without error_tolerant option
+ root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY)
+ def m
+ a = 10
+ if
+ end
+ RUBY
+ # => <internal:ast>:33:in `parse': syntax error, unexpected `end' (SyntaxError)
+
+ # With error_tolerant option
+ root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY, error_tolerant: true)
+ def m
+ a = 10
+ if
+ end
+ RUBY
+ p root # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-4:3>
+
+ # `end` is treated as keyword based on indent
+ root = RubyVM::AbstractSyntaxTree.parse(<<~RUBY, error_tolerant: true)
+ module Z
+ class Foo
+ foo.
+ end
+
+ def bar
+ end
+ end
+ RUBY
+ p root.children[-1].children[-1].children[-1].children[-2..-1]
+ # => [#<RubyVM::AbstractSyntaxTree::Node:CLASS@2:2-4:5>, #<RubyVM::AbstractSyntaxTree::Node:DEFN@6:2-7:5>]
+ ```
+
+ * Add `keep_tokens` option for `parse`, `parse_file` and `of`. Add `#tokens` and `#all_tokens`
+ for RubyVM::AbstractSyntaxTree::Node [[Feature #19070]]
+
+ ```ruby
+ root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+ root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+ ```
+
+* Set
+
+ * Set is now available as a built-in class without the need for `require "set"`. [[Feature #16989]]
+ It is currently autoloaded via the Set constant or a call to Enumerable#to_set.
+
+* String
+
+ * String#byteindex and String#byterindex have been added. [[Feature #13110]]
+ * Update Unicode to Version 15.0.0 and Emoji Version 15.0. [[Feature #18639]]
+ (also applies to Regexp)
+ * String#bytesplice has been added. [[Feature #18598]]
+ * String#dedup has been added as an alias to String#-@. [[Feature #18595]]
+
+* Struct
+
+ * A Struct class can also be initialized with keyword arguments
+ without `keyword_init: true` on Struct.new [[Feature #16806]]
+
+ ```ruby
+ Post = Struct.new(:id, :name)
+ Post.new(1, "hello") #=> #<struct Post id=1, name="hello">
+ # From Ruby 3.2, the following code also works without keyword_init: true.
+ Post.new(id: 1, name: "hello") #=> #<struct Post id=1, name="hello">
+ ```
+
+* Thread
+
+ * Thread.each_caller_location is added. [[Feature #16663]]
+
+* Thread::Queue
+
+ * Thread::Queue#pop(timeout: sec) is added. [[Feature #18774]]
+
+* Thread::SizedQueue
+
+ * Thread::SizedQueue#pop(timeout: sec) is added. [[Feature #18774]]
+ * Thread::SizedQueue#push(timeout: sec) is added. [[Feature #18944]]
+
+* Time
+
+ * Time#deconstruct_keys is added, allowing to use Time instances
+ in pattern-matching expressions [[Feature #19071]]
+
+ * Time.new now can parse a string like generated by Time#inspect
+ and return a Time instance based on the given argument.
+ [[Feature #18033]]
+
+* SyntaxError
+ * SyntaxError#path has been added. [[Feature #19138]]
+
+* TracePoint
+
+ * TracePoint#binding now returns `nil` for `c_call`/`c_return` TracePoints.
+ [[Bug #18487]]
+ * TracePoint#enable `target_thread` keyword argument now defaults to the
+ current thread if a block is given and `target` and `target_line` keyword
+ arguments are not passed. [[Bug #16889]]
+
+* UnboundMethod
+
+ * `UnboundMethod#==` returns `true` if the actual method is same. For example,
+ `String.instance_method(:object_id) == Array.instance_method(:object_id)`
+ returns `true`. [[Feature #18798]]
+
+ * `UnboundMethod#inspect` does not show the receiver of `instance_method`.
+ For example `String.instance_method(:object_id).inspect` returns
+ `"#<UnboundMethod: Kernel#object_id()>"`
+ (was `"#<UnboundMethod: String(Kernel)#object_id()>"`).
+
+* GC
+
+ * Expose `need_major_gc` via `GC.latest_gc_info`. [GH-6791]
+
+* ObjectSpace
+
+ * `ObjectSpace.dump_all` dump shapes as well. [GH-6868]
+
+## Stdlib updates
+
+* Bundler
+
+ * Bundler now uses [PubGrub] resolver instead of [Molinillo] for performance improvement.
+ * Add --ext=rust support to bundle gem for creating simple gems with Rust extensions.
+ [[GH-rubygems-6149]]
+ * Make cloning git repos faster [[GH-rubygems-4475]]
+
+* RubyGems
+
+ * Add mswin support for cargo builder. [[GH-rubygems-6167]]
+
+* CGI
+
+ * `CGI.escapeURIComponent` and `CGI.unescapeURIComponent` are added.
+ [[Feature #18822]]
+
+* Coverage
+
+ * `Coverage.setup` now accepts `eval: true`. By this, `eval` and related methods are
+ able to generate code coverage. [[Feature #19008]]
+
+ * `Coverage.supported?(mode)` enables detection of what coverage modes are
+ supported. [[Feature #19026]]
+
+* Date
+
+ * Added `Date#deconstruct_keys` and `DateTime#deconstruct_keys` same as [[Feature #19071]]
+
+* ERB
+
+ * `ERB::Util.html_escape` is made faster than `CGI.escapeHTML`.
+ * It no longer allocates a String object when no character needs to be escaped.
+ * It skips calling `#to_s` method when an argument is already a String.
+ * `ERB::Escape.html_escape` is added as an alias to `ERB::Util.html_escape`,
+ which has not been monkey-patched by Rails.
+ * `ERB::Util.url_encode` is made faster using `CGI.escapeURIComponent`.
+ * `-S` option is removed from `erb` command.
+
+* FileUtils
+
+ * Add FileUtils.ln_sr method and `relative:` option to FileUtils.ln_s.
+ [[Feature #18925]]
+
+* IRB
+
+ * debug.gem integration commands have been added: `debug`, `break`, `catch`,
+ `next`, `delete`, `step`, `continue`, `finish`, `backtrace`, `info`
+ * They work even if you don't have `gem "debug"` in your Gemfile.
+ * See also: [What's new in Ruby 3.2's IRB?](https://st0012.dev/whats-new-in-ruby-3-2-irb)
+ * More Pry-like commands and features have been added.
+ * `edit` and `show_cmds` (like Pry's `help`) are added.
+ * `ls` takes `-g` or `-G` option to filter out outputs.
+ * `show_source` is aliased from `$` and accepts unquoted inputs.
+ * `whereami` is aliased from `@`.
+
+* Net::Protocol
+
+ * Improve `Net::BufferedIO` performance. [[GH-net-protocol-14]]
+
+* Pathname
+
+ * Added `Pathname#lutime`. [[GH-pathname-20]]
+
+* Socket
+
+ * Added the following constants for supported platforms.
+ * `SO_INCOMING_CPU`
+ * `SO_INCOMING_NAPI_ID`
+ * `SO_RTABLE`
+ * `SO_SETFIB`
+ * `SO_USER_COOKIE`
+ * `TCP_KEEPALIVE`
+ * `TCP_CONNECTION_INFO`
+
+* SyntaxSuggest
+
+ * The feature of `syntax_suggest` formerly `dead_end` is integrated in Ruby.
+ [[Feature #18159]]
+
+* UNIXSocket
+
+ * Add support for UNIXSocket on Windows. Emulate anonymous sockets. Add
+ support for File.socket? and File::Stat#socket? where possible.
+ [[Feature #19135]]
+
+* The following default gems are updated.
+
+ * RubyGems 3.4.1
+ * abbrev 0.1.1
+ * benchmark 0.2.1
+ * bigdecimal 3.1.3
+ * bundler 2.4.1
+ * cgi 0.3.6
+ * csv 3.2.6
+ * date 3.3.3
+ * delegate 0.3.0
+ * did_you_mean 1.6.3
+ * digest 3.1.1
+ * drb 2.1.1
+ * english 0.7.2
+ * erb 4.0.2
+ * error_highlight 0.5.1
+ * etc 1.4.2
+ * fcntl 1.0.2
+ * fiddle 1.1.1
+ * fileutils 1.7.0
+ * forwardable 1.3.3
+ * getoptlong 0.2.0
+ * io-console 0.6.0
+ * io-nonblock 0.2.0
+ * io-wait 0.3.0
+ * ipaddr 1.2.5
+ * irb 1.6.2
+ * json 2.6.3
+ * logger 1.5.3
+ * mutex_m 0.1.2
+ * net-http 0.4.0
+ * net-protocol 0.2.1
+ * nkf 0.1.2
+ * open-uri 0.3.0
+ * open3 0.1.2
+ * openssl 3.1.0
+ * optparse 0.3.1
+ * ostruct 0.5.5
+ * pathname 0.2.1
+ * pp 0.4.0
+ * pstore 0.1.2
+ * psych 5.0.1
+ * racc 1.6.2
+ * rdoc 6.5.0
+ * readline-ext 0.1.5
+ * reline 0.3.2
+ * resolv 0.2.2
+ * resolv-replace 0.1.1
+ * securerandom 0.2.2
+ * set 1.0.3
+ * stringio 3.0.4
+ * strscan 3.0.5
+ * syntax_suggest 1.0.2
+ * syslog 0.1.1
+ * tempfile 0.1.3
+ * time 0.2.1
+ * timeout 0.3.1
+ * tmpdir 0.1.3
+ * tsort 0.1.1
+ * un 0.2.1
+ * uri 0.12.0
+ * weakref 0.1.2
+ * win32ole 1.8.9
+ * yaml 0.2.1
+ * zlib 3.0.0
+
+* The following bundled gems are updated.
+
+ * minitest 5.16.3
+ * power_assert 2.0.3
+ * test-unit 3.5.7
+ * net-ftp 0.2.0
+ * net-imap 0.3.4
+ * net-pop 0.1.2
+ * net-smtp 0.3.3
+ * rbs 2.8.2
+ * typeprof 0.21.3
+ * debug 1.7.1
+
+See GitHub releases like [GitHub Releases of Logger](https://github.com/ruby/logger/releases) or changelog for details of the default gems or bundled gems.
+
+## Supported platforms
+
+* WebAssembly/WASI is added. See [wasm/README.md] and [ruby.wasm] for more details. [[Feature #18462]]
+
+## Compatibility issues
+
+* `String#to_c` currently treat a sequence of underscores as an end of Complex
+ string. [[Bug #19087]]
+
+* Now `ENV.clone` raises `TypeError` as well as `ENV.dup` [[Bug #17767]]
+
+### Removed constants
+
+The following deprecated constants are removed.
+
+* `Fixnum` and `Bignum` [[Feature #12005]]
+* `Random::DEFAULT` [[Feature #17351]]
+* `Struct::Group`
+* `Struct::Passwd`
+
+### Removed methods
+
+The following deprecated methods are removed.
+
+* `Dir.exists?` [[Feature #17391]]
+* `File.exists?` [[Feature #17391]]
+* `Kernel#=~` [[Feature #15231]]
+* `Kernel#taint`, `Kernel#untaint`, `Kernel#tainted?`
+ [[Feature #16131]]
+* `Kernel#trust`, `Kernel#untrust`, `Kernel#untrusted?`
+ [[Feature #16131]]
+* `Method#public?`, `Method#private?`, `Method#protected?`,
+ `UnboundMethod#public?`, `UnboundMethod#private?`, `UnboundMethod#protected?`
+ [[Bug #18729]] [[Bug #18751]] [[Bug #18435]]
+
+### Source code incompatibility of extension libraries
+
+* Extension libraries provide PRNG, subclasses of Random, need updates.
+ See [PRNG update] below for more information. [[Bug #19100]]
+
+### Error printer
+
+* Ruby no longer escapes control characters and backslashes in an
+ error message. [[Feature #18367]]
+
+### Constant lookup when defining a class/module
+
+* When defining a class/module directly under the Object class by class/module
+ statement, if there is already a class/module defined by `Module#include`
+ with the same name, the statement was handled as "open class" in Ruby 3.1 or before.
+ Since Ruby 3.2, a new class is defined instead. [[Feature #18832]]
+
+## Stdlib compatibility issues
+
+* Psych no longer bundles libyaml sources.
+ And also Fiddle no longer bundles libffi sources.
+ Users need to install the libyaml/libffi library themselves via the package
+ manager like apt, yum, brew, etc.
+
+ Psych and fiddle supported the static build with specific version of libyaml
+ and libffi sources. You can build psych with libyaml-0.2.5 like this.
+
+ ```bash
+ $ ./configure --with-libyaml-source-dir=/path/to/libyaml-0.2.5
+ ```
+
+ And you can build fiddle with libffi-3.4.4 like this.
+
+ ```bash
+ $ ./configure --with-libffi-source-dir=/path/to/libffi-3.4.4
+ ```
+
+ [[Feature #18571]]
+
+* Check cookie name/path/domain characters in `CGI::Cookie`. [[CVE-2021-33621]]
+
+* `URI.parse` return empty string in host instead of nil. [[sec-156615]]
+
+## C API updates
+
+### Updated C APIs
+
+The following APIs are updated.
+
+* PRNG update
+
+ `rb_random_interface_t` in ruby/random.h updated and versioned.
+ Extension libraries which use this interface and built for older
+ versions need to rebuild with adding `init_int32` function.
+
+### Added C APIs
+
+* `VALUE rb_hash_new_capa(long capa)` was added to created hashes with the desired capacity.
+* `rb_internal_thread_add_event_hook` and `rb_internal_thread_add_event_hook` were added to instrument threads scheduling.
+ The following events are available:
+ * `RUBY_INTERNAL_THREAD_EVENT_STARTED`
+ * `RUBY_INTERNAL_THREAD_EVENT_READY`
+ * `RUBY_INTERNAL_THREAD_EVENT_RESUMED`
+ * `RUBY_INTERNAL_THREAD_EVENT_SUSPENDED`
+ * `RUBY_INTERNAL_THREAD_EVENT_EXITED`
+* `rb_debug_inspector_current_depth` and `rb_debug_inspector_frame_depth` are added for debuggers.
+
+### Removed C APIs
+
+The following deprecated APIs are removed.
+
+* `rb_cData` variable.
+* "taintedness" and "trustedness" functions. [[Feature #16131]]
+
+## Implementation improvements
+
+* Fixed several race conditions in Kernel#autoload. [[Bug #18782]]
+* Cache invalidation for expressions referencing constants is now
+ more fine-grained. `RubyVM.stat(:global_constant_state)` was
+ removed because it was closely tied to the previous caching scheme
+ where setting any constant invalidates all caches in the system.
+ New keys, `:constant_cache_invalidations` and `:constant_cache_misses`,
+ were introduced to help with use cases for `:global_constant_state`.
+ [[Feature #18589]]
+* The cache-based optimization for Regexp matching is introduced.
+ [[Feature #19104]]
+* [Variable Width Allocation](https://shopify.engineering/ruby-variable-width-allocation)
+ is now enabled by default. [[Feature #18239]]
+* Added a new instance variable caching mechanism, called object shapes, which
+ improves inline cache hits for most objects and allows us to generate very
+ efficient JIT code. Objects whose instance variables are defined in a
+ consistent order will see the most performance benefits.
+ [[Feature #18776]]
+* Speed up marking instruction sequences by using a bitmap to find "markable"
+ objects. This change results in faster major collections.
+ [[Feature #18875]]
+
+## JIT
+
+### YJIT
+
+* YJIT is no longer experimental
+ * Has been tested on production workloads for over a year and proven to be quite stable.
+* YJIT now supports both x86-64 and arm64/aarch64 CPUs on Linux, MacOS, BSD and other UNIX platforms.
+ * This release brings support for Mac M1/M2, AWS Graviton and Raspberry Pi 4.
+* Building YJIT now requires Rust 1.58.0+. [[Feature #18481]]
+ * In order to ensure that CRuby is built with YJIT, please install `rustc` >= 1.58.0
+ before running `./configure`
+ * Please reach out to the YJIT team should you run into any issues.
+* Physical memory for JIT code is lazily allocated. Unlike Ruby 3.1,
+ the RSS of a Ruby process is minimized because virtual memory pages
+ allocated by `--yjit-exec-mem-size` will not be mapped to physical
+ memory pages until actually utilized by JIT code.
+* Introduce Code GC that frees all code pages when the memory consumption
+ by JIT code reaches `--yjit-exec-mem-size`.
+ * `RubyVM::YJIT.runtime_stats` returns Code GC metrics in addition to
+ existing `inline_code_size` and `outlined_code_size` keys:
+ `code_gc_count`, `live_page_count`, `freed_page_count`, and `freed_code_size`.
+* Most of the statistics produced by `RubyVM::YJIT.runtime_stats` are now available in release builds.
+ * Simply run ruby with `--yjit-stats` to compute and dump stats (incurs some run-time overhead).
+* YJIT is now optimized to take advantage of object shapes. [[Feature #18776]]
+* Take advantage of finer-grained constant invalidation to invalidate less code when defining new constants. [[Feature #18589]]
+* The default `--yjit-exec-mem-size` is changed to 64 (MiB).
+* The default `--yjit-call-threshold` is changed to 30.
+
+### MJIT
+
+* The MJIT compiler is re-implemented in Ruby as `ruby_vm/mjit/compiler`.
+* MJIT compiler is executed under a forked Ruby process instead of
+ doing it in a native thread called MJIT worker. [[Feature #18968]]
+ * As a result, Microsoft Visual Studio (MSWIN) is no longer supported.
+* MinGW is no longer supported. [[Feature #18824]]
+* Rename `--mjit-min-calls` to `--mjit-call-threshold`.
+* Change default `--mjit-max-cache` back from 10000 to 100.
+
+[Feature #12005]: https://bugs.ruby-lang.org/issues/12005
+[Feature #12084]: https://bugs.ruby-lang.org/issues/12084
+[Feature #12655]: https://bugs.ruby-lang.org/issues/12655
+[Feature #12737]: https://bugs.ruby-lang.org/issues/12737
+[Feature #13110]: https://bugs.ruby-lang.org/issues/13110
+[Feature #14332]: https://bugs.ruby-lang.org/issues/14332
+[Feature #15231]: https://bugs.ruby-lang.org/issues/15231
+[Feature #15357]: https://bugs.ruby-lang.org/issues/15357
+[Bug #15928]: https://bugs.ruby-lang.org/issues/15928
+[Feature #16122]: https://bugs.ruby-lang.org/issues/16122
+[Feature #16131]: https://bugs.ruby-lang.org/issues/16131
+[Bug #16466]: https://bugs.ruby-lang.org/issues/16466
+[Feature #16663]: https://bugs.ruby-lang.org/issues/16663
+[Feature #16806]: https://bugs.ruby-lang.org/issues/16806
+[Bug #16889]: https://bugs.ruby-lang.org/issues/16889
+[Bug #16908]: https://bugs.ruby-lang.org/issues/16908
+[Feature #16989]: https://bugs.ruby-lang.org/issues/16989
+[Feature #17351]: https://bugs.ruby-lang.org/issues/17351
+[Feature #17391]: https://bugs.ruby-lang.org/issues/17391
+[Bug #17545]: https://bugs.ruby-lang.org/issues/17545
+[Bug #17767]: https://bugs.ruby-lang.org/issues/17767
+[Feature #17837]: https://bugs.ruby-lang.org/issues/17837
+[Feature #17881]: https://bugs.ruby-lang.org/issues/17881
+[Feature #18033]: https://bugs.ruby-lang.org/issues/18033
+[Feature #18159]: https://bugs.ruby-lang.org/issues/18159
+[Feature #18239]: https://bugs.ruby-lang.org/issues/18239#note-17
+[Feature #18351]: https://bugs.ruby-lang.org/issues/18351
+[Feature #18367]: https://bugs.ruby-lang.org/issues/18367
+[Bug #18435]: https://bugs.ruby-lang.org/issues/18435
+[Feature #18462]: https://bugs.ruby-lang.org/issues/18462
+[Feature #18481]: https://bugs.ruby-lang.org/issues/18481
+[Bug #18487]: https://bugs.ruby-lang.org/issues/18487
+[Feature #18564]: https://bugs.ruby-lang.org/issues/18564
+[Feature #18571]: https://bugs.ruby-lang.org/issues/18571
+[Feature #18585]: https://bugs.ruby-lang.org/issues/18585
+[Feature #18589]: https://bugs.ruby-lang.org/issues/18589
+[Feature #18595]: https://bugs.ruby-lang.org/issues/18595
+[Feature #18598]: https://bugs.ruby-lang.org/issues/18598
+[Bug #18625]: https://bugs.ruby-lang.org/issues/18625
+[Feature #18630]: https://bugs.ruby-lang.org/issues/18630
+[Bug #18633]: https://bugs.ruby-lang.org/issues/18633
+[Feature #18639]: https://bugs.ruby-lang.org/issues/18639
+[Feature #18685]: https://bugs.ruby-lang.org/issues/18685
+[Bug #18729]: https://bugs.ruby-lang.org/issues/18729
+[Bug #18751]: https://bugs.ruby-lang.org/issues/18751
+[Feature #18774]: https://bugs.ruby-lang.org/issues/18774
+[Feature #18776]: https://bugs.ruby-lang.org/issues/18776
+[Bug #18782]: https://bugs.ruby-lang.org/issues/18782
+[Feature #18788]: https://bugs.ruby-lang.org/issues/18788
+[Feature #18798]: https://bugs.ruby-lang.org/issues/18798
+[Feature #18809]: https://bugs.ruby-lang.org/issues/18809
+[Feature #18821]: https://bugs.ruby-lang.org/issues/18821
+[Feature #18822]: https://bugs.ruby-lang.org/issues/18822
+[Feature #18824]: https://bugs.ruby-lang.org/issues/18824
+[Feature #18832]: https://bugs.ruby-lang.org/issues/18832
+[Feature #18875]: https://bugs.ruby-lang.org/issues/18875
+[Feature #18925]: https://bugs.ruby-lang.org/issues/18925
+[Feature #18944]: https://bugs.ruby-lang.org/issues/18944
+[Feature #18949]: https://bugs.ruby-lang.org/issues/18949
+[Feature #18968]: https://bugs.ruby-lang.org/issues/18968
+[Feature #19008]: https://bugs.ruby-lang.org/issues/19008
+[Feature #19013]: https://bugs.ruby-lang.org/issues/19013
+[Feature #19026]: https://bugs.ruby-lang.org/issues/19026
+[Feature #19036]: https://bugs.ruby-lang.org/issues/19036
+[Feature #19060]: https://bugs.ruby-lang.org/issues/19060
+[Feature #19070]: https://bugs.ruby-lang.org/issues/19070
+[Feature #19071]: https://bugs.ruby-lang.org/issues/19071
+[Feature #19078]: https://bugs.ruby-lang.org/issues/19078
+[Bug #19087]: https://bugs.ruby-lang.org/issues/19087
+[Bug #19100]: https://bugs.ruby-lang.org/issues/19100
+[Feature #19104]: https://bugs.ruby-lang.org/issues/19104
+[Feature #19135]: https://bugs.ruby-lang.org/issues/19135
+[Feature #19138]: https://bugs.ruby-lang.org/issues/19138
+[Feature #19194]: https://bugs.ruby-lang.org/issues/19194
+[Molinillo]: https://github.com/CocoaPods/Molinillo
+[PubGrub]: https://github.com/jhawthorn/pub_grub
+[GH-net-protocol-14]: https://github.com/ruby/net-protocol/pull/14
+[GH-pathname-20]: https://github.com/ruby/pathname/pull/20
+[GH-6791]: https://github.com/ruby/ruby/pull/6791
+[GH-6868]: https://github.com/ruby/ruby/pull/6868
+[GH-rubygems-4475]: https://github.com/rubygems/rubygems/pull/4475
+[GH-rubygems-6149]: https://github.com/rubygems/rubygems/pull/6149
+[GH-rubygems-6167]: https://github.com/rubygems/rubygems/pull/6167
+[sec-156615]: https://hackerone.com/reports/156615
+[CVE-2021-33621]: https://www.ruby-lang.org/en/news/2022/11/22/http-response-splitting-in-cgi-cve-2021-33621/
+[wasm/README.md]: https://github.com/ruby/ruby/blob/master/wasm/README.md
+[ruby.wasm]: https://github.com/ruby/ruby.wasm
diff --git a/README.ja.md b/README.ja.md
index 9d6131e416..93c0131690 100644
--- a/README.ja.md
+++ b/README.ja.md
@@ -1,3 +1,10 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: MJIT](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
# Rubyとは
Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です. Rubyは純粋なオブジェクト指向言語として設計されているので,
@@ -10,83 +17,86 @@ Rubyはテキスト処理関係の能力などに優れ,Perlと同じくらい
* シンプルな文法
* 普通のオブジェクト指向機能(クラス,メソッドコールなど)
-* 特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
+* 特殊なオブジェクト指向機能(Mixin,特異メソッドなど)
* 演算子オーバーロード
* 例外処理機能
* イテレータとクロージャ
* ガーベージコレクタ
* ダイナミックローディング (アーキテクチャによる)
-* 移植性が高い.多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく,Windows, Mac OS
- X,BeOSなどの上でも動く cf.
- http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+* 移植性が高い.多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく,Windows, macOS,
+ Haikuなどの上でも動く cf.
+ https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
## 入手法
-### FTPで
+サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
+
+https://www.ruby-lang.org/ja/downloads/
+
+を参照してください.
-以下の場所においてあります.
+### Git
-ftp://ftp.ruby-lang.org/pub/ruby/
+ミラーをGitHubに公開しています. 以下のコマンドでリポジトリを取得できます.
-### Subversionで
+ $ git clone https://github.com/ruby/ruby.git
-開発先端のソースコードは次のコマンドで取得できます.
+他のブランチの一覧は次のコマンドで見られます.
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+ $ git ls-remote https://github.com/ruby/ruby.git
-他に開発中のブランチの一覧は次のコマンドで見られます.
+Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります.
+コミッタはこちらを使います.
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+### Subversion
-### Gitで
+古いRubyのバージョンのソースコードは次のコマンドでも取得できます.
-SubversionのミラーをGitHubに公開しています. 以下のコマンドでリポジトリを取得できます.
+ $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
+
+他のブランチの一覧は次のコマンドで見られます.
+
+ $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
- $ git clone git://github.com/ruby/ruby.git
## ホームページ
RubyのホームページのURLは
-http://www.ruby-lang.org/
+https://www.ruby-lang.org/
です.
## メーリングリスト
-Rubyのメーリングリストがあります.参加希望の方は
-
-mailto:ruby-list-request@ruby-lang.org
-
-まで本文に
+Rubyのメーリングリストがあります.参加希望の方は [ruby-list-request@ruby-lang.org] まで本文に
subscribe
と書いて送って下さい.
-Ruby開発者向けメーリングリストもあります.こちらではrubyのバグ,将来の仕様拡張など実装上の問題について議論されています. 参加希望の方は
-
-mailto:ruby-dev-request@ruby-lang.org
-
-までruby-listと同様の方法でメールしてください.
+Ruby開発者向けメーリングリストもあります.こちらではrubyのバグ,将来の仕様拡張など実装上の問題について議論されています.
+参加希望の方は [ruby-dev-request@ruby-lang.org] までruby-listと同様の方法でメールしてください.
Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
英語でrubyについて話し合うruby-talkメーリングリストもあります.参加方法はどれも同じです.
+[ruby-list-request@ruby-lang.org]: mailto:ruby-list-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+[ruby-dev-request@ruby-lang.org]: mailto:ruby-dev-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
+
## コンパイル・インストール
以下の手順で行ってください.
-1. もし `configure` ファイルが見つからない,もしくは `configure.in` より古いようなら, `autoconf` を実行して
- 新しく `configure` を生成する
+1. (Gitリポジトリから取得したソースをビルドする場合) `./autogen.sh` を実行して新しく `configure` を生成する
2. `configure` を実行して `Makefile` などを生成する
環境によってはデフォルトのCコンパイラ用オプションが付きます. `configure` オプションで `optflags=..`
`warnflags=..` 等で上書きできます.
-3. (必要ならば)`defines.h` を編集する
+3. (必要ならば)`include/ruby/defines.h` を編集する
多分,必要無いと思います.
@@ -95,7 +105,8 @@ Ruby拡張モジュールについて話し合うruby-extメーリングリス
`ext/Setup` に記述したモジュールは静的にリンクされます.
ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
- メントを外す必要があります.また,このアーキテクチャで拡張モジュールを利用するためには,あらかじめ静的にリンクをしておく必要があります.
+ メントを外す必要があります.
+ また,このアーキテクチャで拡張モジュールを利用するためには,あらかじめ静的にリンクをしておく必要があります.
5. `make` を実行してコンパイルする
@@ -155,17 +166,17 @@ UNIXであれば `configure` がほとんどの差異を吸収してくれるは
## フィードバック
-Rubyに関する質問は Ruby-Talk(英語)や Ruby-List(日本語) (https://www.ruby-lang.org/ja/community/mailing-lists) や,
-stackoverflow (http://ja.stackoverflow.com/) などのWebサイトに投稿してください.
+Rubyに関する質問は [Ruby-Talk](英語)や [Ruby-List](日本語)や,
+[stackoverflow] などのWebサイトに投稿してください.
-バグ報告は http://bugs.ruby-lang.org で受け付けています.
+バグ報告は https://bugs.ruby-lang.org で受け付けています.
+[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
+[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
+[stackoverflow]: https://ja.stackoverflow.com/
## 著者
Rubyのオリジナル版は,1995年にまつもとゆきひろ氏によって設計・開発されました.
<mailto:matz@ruby-lang.org>
-
----
-created at: Thu Aug 3 11:57:36 JST 1995
diff --git a/README.md b/README.md
index f79ba9c718..c445448c71 100644
--- a/README.md
+++ b/README.md
@@ -1,167 +1,91 @@
-[![Build Status](https://travis-ci.org/ruby/ruby.svg)](https://travis-ci.org/ruby/ruby)
-[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/trunk?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/trunk)
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: MJIT](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MJIT")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
-# What's Ruby
+# What is Ruby?
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming. It has many features to process text files and to do system
-management tasks (as in Perl). It is simple, straight-forward, and
-extensible.
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
## Features of Ruby
-* Simple Syntax
-* **Normal** Object-oriented Features (e.g. class, method calls)
-* **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
-* Operator Overloading
-* Exception Handling
-* Iterators and Closures
-* Garbage Collection
-* Dynamic Loading of Object Files (on some architectures)
-* Highly Portable (works on many Unix-like/POSIX compatible platforms as
- well as Windows, Mac OS X, BeOS, etc.) cf.
- http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+ well as Windows, macOS, etc.) cf.
+ https://github.com/ruby/ruby/blob/master/doc/maintainers.rdoc#label-Platform+Maintainers
-
-## How to get Ruby
+## How to get Ruby with Git
For a complete list of ways to install Ruby, including using third-party tools
like rvm, see:
-http://www.ruby-lang.org/en/downloads/
-
-The Ruby distribution files can be found on the following FTP site:
-
-ftp://ftp.ruby-lang.org/pub/ruby/
-
-The trunk of the Ruby source tree can be checked out with the following
-command:
+https://www.ruby-lang.org/en/downloads/
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+The mirror of the Ruby source tree can be checked out with the following command:
-Or if you are using git then use the following command:
+ $ git clone https://github.com/ruby/ruby.git
- $ git clone git://github.com/ruby/ruby.git
-
-There are some other branches under development. Try the following command
+There are some other branches under development. Try the following command
to see the list of branches:
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+ $ git ls-remote https://github.com/ruby/ruby.git
+
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
-Or if you are using git then use the following command:
+## How to build
- $ git ls-remote git://github.com/ruby/ruby.git
+see [Building Ruby](doc/contributing/building_ruby.md)
## Ruby home page
-The URL of the Ruby home page is:
+https://www.ruby-lang.org/
-http://www.ruby-lang.org/
+## Documentation
+
+- [English](https://docs.ruby-lang.org/en/master/index.html)
+- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
## Mailing list
-There is a mailing list to talk about Ruby. To subscribe to this list, please
+There is a mailing list to discuss Ruby. To subscribe to this list, please
send the following phrase:
subscribe
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
-
-## How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-1. If you want to use Microsoft Visual C++ to compile ruby, read
- win32/README.win32 instead of this document.
-
-2. If `./configure` does not exist or is older than configure.in, run
- `autoconf` to (re)generate configure.
-
-3. Run `./configure`, which will generate `config.h` and `Makefile`.
-
- Some C compiler flags may be added by default depending on your
- environment. Specify `optflags=..` and `warnflags=..` as necessary to
- override them.
-
-4. Edit `defines.h` if you need. Usually this step will not be needed.
-
-5. Remove comment mark(`#`) before the module names from `ext/Setup` (or add
- module names if not present), if you want to link modules statically.
+in the mail body (not subject) to the address [ruby-talk-request@ruby-lang.org].
- If you don't want to compile non static extension modules (probably on
- architectures which do not allow dynamic loading), remove comment mark
- from the line "`#option nodynamic`" in `ext/Setup`.
-
- Usually this step will not be needed.
-
-6. Run `make`.
-
-7. Optionally, run '`make check`' to check whether the compiled Ruby
- interpreter works well. If you see the message "`check succeeded`", your
- ruby works as it should (hopefully).
-
-8. Run '`make install`'
-
- This command will create the following directories and install files into
- them.
-
- * `${DESTDIR}${prefix}/bin`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib`
- * `${DESTDIR}${prefix}/lib/ruby`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/share/man/man1`
- * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
- If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
- `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
- **NOTE**: teeny of the API version may be different from one of Ruby's
- program version
-
- You may have to be a super user to install ruby.
-
-
-If you fail to compile ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
-
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
+[ruby-talk-request@ruby-lang.org]: mailto:ruby-talk-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe
## Copying
-See the file [COPYING](COPYING).
+See the file [COPYING](rdoc-ref:COPYING).
## Feedback
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(http://stackoverflow.com).
-
-Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
-
-[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
+Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
+or on websites like https://stackoverflow.com.
-##Contributing
+Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
-See the file [CONTRIBUTING.md](CONTRIBUTING.md)
+## Contributing
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing_md.html), which includes setup and build instructions.
## The Author
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
-<mailto:matz@ruby-lang.org>
+<matz@ruby-lang.org>
diff --git a/acinclude.m4 b/acinclude.m4
deleted file mode 100644
index 99b24e6d93..0000000000
--- a/acinclude.m4
+++ /dev/null
@@ -1,46 +0,0 @@
-# -*- autoconf -*-
-
-AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
- msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
- AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
- msg_begin="`tput smso 2>/dev/null`"
- AS_CASE(["$msg_begin"], ['@<:@'*m],
- [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
- msg_checking="${msg_begin}33m"
- AS_IF([test ${TEST_COLORS:+set}], [
- msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
- msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
- msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
- ])
- msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
- msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
- msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
- msg_reset="${msg_begin}m"
- ])
- AS_UNSET(msg_begin)
- ])
- AS_REQUIRE_SHELL_FN([colorize_result],
- [AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
- [AS_CASE(["$[]1"],
- [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
- [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
- [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
-])
-
-AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
- AS_LITERAL_IF([$1],
- [m4_case([$1],
- [yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
- [no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
- [AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
- [colorize_result "$1"]) dnl
-])
-
-AC_DEFUN([AC_CHECKING],[dnl
-AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
-
-AC_DEFUN([AC_MSG_RESULT], [dnl
-{ _AS_ECHO_LOG([result: $1])
-COLORIZE_RESULT([$1]); dnl
-}])
diff --git a/aclocal.m4 b/aclocal.m4
index 56e944be8f..e69de29bb2 100644
--- a/aclocal.m4
+++ b/aclocal.m4
@@ -1,15 +0,0 @@
-# generated automatically by aclocal 1.15 -*- Autoconf -*-
-
-# Copyright (C) 1996-2014 Free Software Foundation, Inc.
-
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
-m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
-m4_include([acinclude.m4])
diff --git a/addr2line.c b/addr2line.c
index a20e5000c4..e5f25293e2 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -8,14 +8,26 @@
**********************************************************************/
-#include "ruby/config.h"
+#if defined(__clang__)
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
#include "ruby/missing.h"
#include "addr2line.h"
#include <stdio.h>
#include <errno.h>
-#ifdef USE_ELF
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
#include <fcntl.h>
#include <limits.h>
@@ -28,12 +40,6 @@
#include <sys/stat.h>
#include <unistd.h>
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
/* Make alloca work the best possible way. */
#ifdef __GNUC__
# ifndef alloca
@@ -57,24 +63,20 @@ void *alloca();
# include <dlfcn.h>
#endif
-#define DW_LNS_copy 0x01
-#define DW_LNS_advance_pc 0x02
-#define DW_LNS_advance_line 0x03
-#define DW_LNS_set_file 0x04
-#define DW_LNS_set_column 0x05
-#define DW_LNS_negate_stmt 0x06
-#define DW_LNS_set_basic_block 0x07
-#define DW_LNS_const_add_pc 0x08
-#define DW_LNS_fixed_advance_pc 0x09
-#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
-#define DW_LNS_set_isa 0x0c /* DWARF3 */
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence 0x01
-#define DW_LNE_set_address 0x02
-#define DW_LNE_define_file 0x03
-#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+# include <elf_abi.h>
+# else
+# include <elf.h>
+# endif
#ifndef ElfW
# if SIZEOF_VOIDP == 8
@@ -90,13 +92,44 @@ void *alloca();
# define ELF_ST_TYPE ELF32_ST_TYPE
# endif
#endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+ /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+# include <zlib.h>
+# define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
#ifndef PATH_MAX
#define PATH_MAX 4096
#endif
-int kprintf(const char *fmt, ...);
+#define DW_LNS_copy 0x01
+#define DW_LNS_advance_pc 0x02
+#define DW_LNS_advance_line 0x03
+#define DW_LNS_set_file 0x04
+#define DW_LNS_set_column 0x05
+#define DW_LNS_negate_stmt 0x06
+#define DW_LNS_set_basic_block 0x07
+#define DW_LNS_const_add_pc 0x08
+#define DW_LNS_fixed_advance_pc 0x09
+#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
+#define DW_LNS_set_isa 0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence 0x01
+#define DW_LNE_set_address 0x02
+#define DW_LNE_define_file 0x03
+#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
-typedef struct {
+PRINTF_ARGS(static int kprintf(const char *fmt, ...), 1, 2);
+
+typedef struct line_info {
const char *dirname;
const char *filename;
const char *path; /* object path */
@@ -105,27 +138,72 @@ typedef struct {
uintptr_t base_addr;
uintptr_t saddr;
const char *sname; /* function name */
+
+ struct line_info *next;
} line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
+
+struct dwarf_section {
+ char *ptr;
+ size_t size;
+ uint64_t flags;
+};
+
+typedef struct obj_info {
const char *path; /* object path */
- int fd;
- void *mapped;
+ char *mapped;
size_t mapped_size;
+ void *uncompressed;
uintptr_t base_addr;
- obj_info_t *next;
+ uintptr_t vmaddr;
+ struct dwarf_section debug_abbrev;
+ struct dwarf_section debug_info;
+ struct dwarf_section debug_line;
+ struct dwarf_section debug_ranges;
+ struct dwarf_section debug_str_offsets;
+ struct dwarf_section debug_addr;
+ struct dwarf_section debug_rnglists;
+ struct dwarf_section debug_str;
+ struct dwarf_section debug_line_str;
+ struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 9
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+ struct dwarf_section *ary[] = {
+ &obj->debug_abbrev,
+ &obj->debug_info,
+ &obj->debug_line,
+ &obj->debug_ranges,
+ &obj->debug_str_offsets,
+ &obj->debug_addr,
+ &obj->debug_rnglists,
+ &obj->debug_str,
+ &obj->debug_line_str
+ };
+ if (n < 0 || DWARF_SECTION_COUNT <= n) {
+ abort();
+ }
+ return ary[n];
+}
+
+struct debug_section_definition {
+ const char *name;
+ struct dwarf_section *dwarf;
};
/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
+static char binary_filename[PATH_MAX + 1];
static unsigned long
-uleb128(char **p)
+uleb128(const char **p)
{
unsigned long r = 0;
int s = 0;
for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
+ unsigned char b = (unsigned char)*(*p)++;
if (b < 0x80) {
r += (unsigned long)b << s;
break;
@@ -137,12 +215,12 @@ uleb128(char **p)
}
static long
-sleb128(char **p)
+sleb128(const char **p)
{
long r = 0;
int s = 0;
for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
+ unsigned char b = (unsigned char)*(*p)++;
if (b < 0x80) {
if (b & 0x40) {
r -= (0x80 - b) << s;
@@ -159,7 +237,7 @@ sleb128(char **p)
}
static const char *
-get_nth_dirname(unsigned long dir, char *p)
+get_nth_dirname(unsigned long dir, const char *p)
{
if (!dir--) {
return "";
@@ -176,137 +254,191 @@ get_nth_dirname(unsigned long dir, char *p)
return p;
}
+static const char *parse_ver5_debug_line_header(const char *p, int idx, uint8_t format, obj_info_t *obj, const char **out_path, uint64_t *out_directory_index);
+
static void
-fill_filename(int file, char *include_directories, char *filenames,
- line_info_t *line)
+fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories, const char *filenames, line_info_t *line, obj_info_t *obj)
{
int i;
- char *p = filenames;
- char *filename;
+ const char *p = filenames;
+ const char *filename;
unsigned long dir;
- for (i = 1; i <= file; i++) {
- filename = p;
- if (!*p) {
- /* Need to output binary file name? */
- kprintf("Unexpected file number %d in %s\n",
- file, binary_filename);
- return;
- }
- while (*p) p++;
- p++;
- dir = uleb128(&p);
- /* last modified. */
- uleb128(&p);
- /* size of the file. */
- uleb128(&p);
-
- if (i == file) {
- line->filename = filename;
- line->dirname = get_nth_dirname(dir, include_directories);
- }
+ if (version >= 5) {
+ const char *path;
+ uint64_t directory_index = -1;
+ parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index);
+ line->filename = path;
+ parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL);
+ line->dirname = path;
+ }
+ else {
+ for (i = 1; i <= file; i++) {
+ filename = p;
+ if (!*p) {
+ /* Need to output binary file name? */
+ kprintf("Unexpected file number %d in %s at %tx\n",
+ file, binary_filename, filenames - obj->mapped);
+ return;
+ }
+ while (*p) p++;
+ p++;
+ dir = uleb128(&p);
+ /* last modified. */
+ uleb128(&p);
+ /* size of the file. */
+ uleb128(&p);
+
+ if (i == file) {
+ line->filename = filename;
+ line->dirname = get_nth_dirname(dir, include_directories);
+ }
+ }
}
}
static void
fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
- char *include_directories, char *filenames,
+ uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
obj_info_t *obj, line_info_t *lines, int offset)
{
int i;
- addr += obj->base_addr;
+ addr += obj->base_addr - obj->vmaddr;
for (i = offset; i < num_traces; i++) {
uintptr_t a = (uintptr_t)traces[i];
/* We assume one line code doesn't result >100 bytes of native code.
We may want more reliable way eventually... */
if (addr < a && a < addr + 100) {
- fill_filename(file, include_directories, filenames, &lines[i]);
+ fill_filename(file, format, version, include_directories, filenames, &lines[i], obj);
lines[i].line = line;
}
}
}
-static void
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
- obj_info_t *obj, line_info_t *lines, int offset)
+struct LineNumberProgramHeader {
+ uint64_t unit_length;
+ uint16_t version;
+ uint8_t format; /* 4 or 8 */
+ uint64_t header_length;
+ uint8_t minimum_instruction_length;
+ uint8_t maximum_operations_per_instruction;
+ uint8_t default_is_stmt;
+ int8_t line_base;
+ uint8_t line_range;
+ uint8_t opcode_base;
+ /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+ const char *include_directories;
+ const char *filenames;
+ const char *cu_start;
+ const char *cu_end;
+};
+
+static int
+parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header)
{
- char *p, *cu_end, *cu_start, *include_directories, *filenames;
- unsigned long unit_length;
- int default_is_stmt, line_base;
- unsigned int header_length, minimum_instruction_length, line_range,
- opcode_base;
- /* unsigned char *standard_opcode_lengths; */
+ const char *p = *pp;
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
+ }
- /* The registers. */
- unsigned long addr = 0;
- unsigned int file = 1;
- unsigned int line = 1;
- /* unsigned int column = 0; */
- int is_stmt;
- /* int basic_block = 0; */
- /* int end_sequence = 0; */
- /* int prologue_end = 0; */
- /* int epilogue_begin = 0; */
- /* unsigned int isa = 0; */
+ header->cu_end = p + header->unit_length;
- p = *debug_line;
+ header->version = *(uint16_t *)p;
+ p += sizeof(uint16_t);
+ if (header->version > 5) return -1;
- unit_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
- if (unit_length == 0xffffffff) {
- unit_length = *(unsigned long *)p;
- p += sizeof(unsigned long);
+ if (header->version >= 5) {
+ /* address_size = *(uint8_t *)p++; */
+ /* segment_selector_size = *(uint8_t *)p++; */
+ p += 2;
}
- cu_end = p + unit_length;
-
- /*dwarf_version = *(unsigned short *)p;*/
- p += 2;
-
- header_length = *(unsigned int *)p;
- p += sizeof(unsigned int);
+ header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+ p += header->format;
+ header->cu_start = p + header->header_length;
- cu_start = p + header_length;
+ header->minimum_instruction_length = *(uint8_t *)p++;
- minimum_instruction_length = *(unsigned char *)p;
- p++;
+ if (header->version >= 4) {
+ /* maximum_operations_per_instruction = *(uint8_t *)p; */
+ if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+ p++;
+ }
- is_stmt = default_is_stmt = *(unsigned char *)p;
- p++;
+ header->default_is_stmt = *(uint8_t *)p++;
+ header->line_base = *(int8_t *)p++;
+ header->line_range = *(uint8_t *)p++;
+ header->opcode_base = *(uint8_t *)p++;
+ /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+ p += header->opcode_base - 1;
+
+ if (header->version >= 5) {
+ header->include_directories = p;
+ p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL);
+ header->filenames = p;
+ }
+ else {
+ header->include_directories = p;
- line_base = *(signed char *)p;
- p++;
+ /* temporary measure for compress-debug-sections */
+ if (p >= header->cu_end) return -1;
- line_range = *(unsigned char *)p;
- p++;
+ /* skip include directories */
+ while (*p) {
+ p = memchr(p, '\0', header->cu_end - p);
+ if (!p) return -1;
+ p++;
+ }
+ p++;
- opcode_base = *(unsigned char *)p;
- p++;
+ header->filenames = p;
+ }
- /* standard_opcode_lengths = (unsigned char *)p - 1; */
- p += opcode_base - 1;
+ *pp = header->cu_start;
- include_directories = p;
+ return 0;
+}
- /* skip include directories */
- while (*p) {
- while (*p) p++;
- p++;
- }
- p++;
+static int
+parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ const char *p = (const char *)*debug_line;
+ struct LineNumberProgramHeader header;
- filenames = p;
+ /* The registers. */
+ unsigned long addr = 0;
+ unsigned int file = 1;
+ unsigned int line = 1;
+ /* unsigned int column = 0; */
+ int is_stmt;
+ /* int basic_block = 0; */
+ /* int end_sequence = 0; */
+ /* int prologue_end = 0; */
+ /* int epilogue_begin = 0; */
+ /* unsigned int isa = 0; */
- p = cu_start;
+ if (parse_debug_line_header(obj, &p, &header))
+ return -1;
+ is_stmt = header.default_is_stmt;
#define FILL_LINE() \
do { \
fill_line(num_traces, traces, addr, file, line, \
- include_directories, filenames, \
+ header.format, \
+ header.version, \
+ header.include_directories, \
+ header.filenames, \
obj, lines, offset); \
/*basic_block = prologue_end = epilogue_begin = 0;*/ \
} while (0)
- while (p < cu_end) {
+ while (p < header.cu_end) {
unsigned long a;
unsigned char op = *p++;
switch (op) {
@@ -314,7 +446,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
FILL_LINE();
break;
case DW_LNS_advance_pc:
- a = uleb128(&p);
+ a = uleb128(&p) * header.minimum_instruction_length;
addr += a;
break;
case DW_LNS_advance_line: {
@@ -335,12 +467,13 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
/*basic_block = 1; */
break;
case DW_LNS_const_add_pc:
- a = ((255 - opcode_base) / line_range) *
- minimum_instruction_length;
+ a = ((255UL - header.opcode_base) / header.line_range) *
+ header.minimum_instruction_length;
addr += a;
break;
case DW_LNS_fixed_advance_pc:
- a = *(unsigned char *)p++;
+ a = *(uint16_t *)p;
+ p += sizeof(uint16_t);
addr += a;
break;
case DW_LNS_set_prologue_end:
@@ -353,7 +486,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
/* isa = (unsigned int)*/(void)uleb128(&p);
break;
case 0:
- a = *(unsigned char *)p++;
+ a = uleb128(&p);
op = *p++;
switch (op) {
case DW_LNE_end_sequence:
@@ -363,7 +496,7 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
file = 1;
line = 1;
/* column = 0; */
- is_stmt = default_is_stmt;
+ is_stmt = header.default_is_stmt;
/* end_sequence = 0; */
/* isa = 0; */
break;
@@ -385,33 +518,34 @@ parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
}
break;
default: {
- unsigned long addr_incr;
- unsigned long line_incr;
- a = op - opcode_base;
- addr_incr = (a / line_range) * minimum_instruction_length;
- line_incr = line_base + (a % line_range);
- addr += (unsigned int)addr_incr;
- line += (unsigned int)line_incr;
+ uint8_t adjusted_opcode = op - header.opcode_base;
+ uint8_t operation_advance = adjusted_opcode / header.line_range;
+ /* NOTE: this code doesn't support VLIW */
+ addr += operation_advance * header.minimum_instruction_length;
+ line += header.line_base + (adjusted_opcode % header.line_range);
FILL_LINE();
}
}
}
- *debug_line = p;
+ *debug_line = (char *)p;
+ return 0;
}
-static void
+static int
parse_debug_line(int num_traces, void **traces,
- char *debug_line, unsigned long size,
+ const char *debug_line, unsigned long size,
obj_info_t *obj, line_info_t *lines, int offset)
{
- char *debug_line_end = debug_line + size;
+ const char *debug_line_end = debug_line + size;
while (debug_line < debug_line_end) {
- parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
+ if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
+ return -1;
}
if (debug_line != debug_line_end) {
kprintf("Unexpected size of .debug_line in %s\n",
binary_filename);
}
+ return 0;
}
/* read file and fill lines */
@@ -420,22 +554,38 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
obj_info_t **objp, line_info_t *lines, int offset);
static void
-append_obj(obj_info_t **objp) {
+append_obj(obj_info_t **objp)
+{
obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
if (*objp) (*objp)->next = newobj;
*objp = newobj;
}
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ * - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ * - /usr/bin/ruby.debug
+ * - /usr/bin/.debug/ruby.debug
+ * - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
static void
-follow_debuglink(char *debuglink, int num_traces, void **traces,
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
obj_info_t **objp, line_info_t *lines, int offset)
{
- /* Ideally we should check 4 paths to follow gnu_debuglink,
- but we handle only one case for now as this format is used
- by some linux distributions. See GDB's info for detail. */
static const char global_debug_dir[] = "/usr/lib/debug";
- char *p, *subdir;
+ const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+ char *p;
obj_info_t *o1 = *objp, *o2;
+ size_t len;
p = strrchr(binary_filename, '/');
if (!p) {
@@ -443,11 +593,44 @@ follow_debuglink(char *debuglink, int num_traces, void **traces,
}
p[1] = '\0';
- subdir = (char *)alloca(strlen(binary_filename) + 1);
- strcpy(subdir, binary_filename);
- strcpy(binary_filename, global_debug_dir);
- strlcat(binary_filename, subdir, PATH_MAX);
- strlcat(binary_filename, debuglink, PATH_MAX);
+ len = strlen(binary_filename);
+ if (len >= PATH_MAX - global_debug_dir_len)
+ len = PATH_MAX - global_debug_dir_len - 1;
+ memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+ memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+ len += global_debug_dir_len;
+ strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+ append_obj(objp);
+ o2 = *objp;
+ o2->base_addr = o1->base_addr;
+ o2->path = o1->path;
+ fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+ const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+ char *p;
+ obj_info_t *o1 = *objp, *o2;
+ size_t i;
+
+ if (PATH_MAX < global_debug_dir_len + 1 + build_id_size * 2 + 6) return;
+
+ memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+ p = binary_filename + global_debug_dir_len;
+ for (i = 0; i < build_id_size; i++) {
+ static const char tbl[] = "0123456789abcdef";
+ unsigned char n = build_id[i];
+ *p++ = tbl[n / 16];
+ *p++ = tbl[n % 16];
+ if (i == 0) *p++ = '/';
+ }
+ strcpy(p, ".debug");
append_obj(objp);
o2 = *objp;
@@ -455,6 +638,1367 @@ follow_debuglink(char *debuglink, int num_traces, void **traces,
o2->path = o1->path;
fill_lines(num_traces, traces, 0, objp, lines, offset);
}
+#endif
+
+enum
+{
+ DW_TAG_compile_unit = 0x11,
+ DW_TAG_inlined_subroutine = 0x1d,
+ DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+ DW_AT_sibling = 0x01,
+ DW_AT_location = 0x02,
+ DW_AT_name = 0x03,
+ /* Reserved 0x04 */
+ /* Reserved 0x05 */
+ /* Reserved 0x06 */
+ /* Reserved 0x07 */
+ /* Reserved 0x08 */
+ DW_AT_ordering = 0x09,
+ /* Reserved 0x0a */
+ DW_AT_byte_size = 0x0b,
+ /* Reserved 0x0c */
+ DW_AT_bit_size = 0x0d,
+ /* Reserved 0x0e */
+ /* Reserved 0x0f */
+ DW_AT_stmt_list = 0x10,
+ DW_AT_low_pc = 0x11,
+ DW_AT_high_pc = 0x12,
+ DW_AT_language = 0x13,
+ /* Reserved 0x14 */
+ DW_AT_discr = 0x15,
+ DW_AT_discr_value = 0x16,
+ DW_AT_visibility = 0x17,
+ DW_AT_import = 0x18,
+ DW_AT_string_length = 0x19,
+ DW_AT_common_reference = 0x1a,
+ DW_AT_comp_dir = 0x1b,
+ DW_AT_const_value = 0x1c,
+ DW_AT_containing_type = 0x1d,
+ DW_AT_default_value = 0x1e,
+ /* Reserved 0x1f */
+ DW_AT_inline = 0x20,
+ DW_AT_is_optional = 0x21,
+ DW_AT_lower_bound = 0x22,
+ /* Reserved 0x23 */
+ /* Reserved 0x24 */
+ DW_AT_producer = 0x25,
+ /* Reserved 0x26 */
+ DW_AT_prototyped = 0x27,
+ /* Reserved 0x28 */
+ /* Reserved 0x29 */
+ DW_AT_return_addr = 0x2a,
+ /* Reserved 0x2b */
+ DW_AT_start_scope = 0x2c,
+ /* Reserved 0x2d */
+ DW_AT_bit_stride = 0x2e,
+ DW_AT_upper_bound = 0x2f,
+ /* Reserved 0x30 */
+ DW_AT_abstract_origin = 0x31,
+ DW_AT_accessibility = 0x32,
+ DW_AT_address_class = 0x33,
+ DW_AT_artificial = 0x34,
+ DW_AT_base_types = 0x35,
+ DW_AT_calling_convention = 0x36,
+ DW_AT_count = 0x37,
+ DW_AT_data_member_location = 0x38,
+ DW_AT_decl_column = 0x39,
+ DW_AT_decl_file = 0x3a,
+ DW_AT_decl_line = 0x3b,
+ DW_AT_declaration = 0x3c,
+ DW_AT_discr_list = 0x3d,
+ DW_AT_encoding = 0x3e,
+ DW_AT_external = 0x3f,
+ DW_AT_frame_base = 0x40,
+ DW_AT_friend = 0x41,
+ DW_AT_identifier_case = 0x42,
+ /* Reserved 0x43 */
+ DW_AT_namelist_item = 0x44,
+ DW_AT_priority = 0x45,
+ DW_AT_segment = 0x46,
+ DW_AT_specification = 0x47,
+ DW_AT_static_link = 0x48,
+ DW_AT_type = 0x49,
+ DW_AT_use_location = 0x4a,
+ DW_AT_variable_parameter = 0x4b,
+ DW_AT_virtuality = 0x4c,
+ DW_AT_vtable_elem_location = 0x4d,
+ DW_AT_allocated = 0x4e,
+ DW_AT_associated = 0x4f,
+ DW_AT_data_location = 0x50,
+ DW_AT_byte_stride = 0x51,
+ DW_AT_entry_pc = 0x52,
+ DW_AT_use_UTF8 = 0x53,
+ DW_AT_extension = 0x54,
+ DW_AT_ranges = 0x55,
+ DW_AT_trampoline = 0x56,
+ DW_AT_call_column = 0x57,
+ DW_AT_call_file = 0x58,
+ DW_AT_call_line = 0x59,
+ DW_AT_description = 0x5a,
+ DW_AT_binary_scale = 0x5b,
+ DW_AT_decimal_scale = 0x5c,
+ DW_AT_small = 0x5d,
+ DW_AT_decimal_sign = 0x5e,
+ DW_AT_digit_count = 0x5f,
+ DW_AT_picture_string = 0x60,
+ DW_AT_mutable = 0x61,
+ DW_AT_threads_scaled = 0x62,
+ DW_AT_explicit = 0x63,
+ DW_AT_object_pointer = 0x64,
+ DW_AT_endianity = 0x65,
+ DW_AT_elemental = 0x66,
+ DW_AT_pure = 0x67,
+ DW_AT_recursive = 0x68,
+ DW_AT_signature = 0x69,
+ DW_AT_main_subprogram = 0x6a,
+ DW_AT_data_bit_offset = 0x6b,
+ DW_AT_const_expr = 0x6c,
+ DW_AT_enum_class = 0x6d,
+ DW_AT_linkage_name = 0x6e,
+ DW_AT_string_length_bit_size = 0x6f,
+ DW_AT_string_length_byte_size = 0x70,
+ DW_AT_rank = 0x71,
+ DW_AT_str_offsets_base = 0x72,
+ DW_AT_addr_base = 0x73,
+ DW_AT_rnglists_base = 0x74,
+ /* Reserved 0x75 */
+ DW_AT_dwo_name = 0x76,
+ DW_AT_reference = 0x77,
+ DW_AT_rvalue_reference = 0x78,
+ DW_AT_macros = 0x79,
+ DW_AT_call_all_calls = 0x7a,
+ DW_AT_call_all_source_calls = 0x7b,
+ DW_AT_call_all_tail_calls = 0x7c,
+ DW_AT_call_return_pc = 0x7d,
+ DW_AT_call_value = 0x7e,
+ DW_AT_call_origin = 0x7f,
+ DW_AT_call_parameter = 0x80,
+ DW_AT_call_pc = 0x81,
+ DW_AT_call_tail_call = 0x82,
+ DW_AT_call_target = 0x83,
+ DW_AT_call_target_clobbered = 0x84,
+ DW_AT_call_data_location = 0x85,
+ DW_AT_call_data_value = 0x86,
+ DW_AT_noreturn = 0x87,
+ DW_AT_alignment = 0x88,
+ DW_AT_export_symbols = 0x89,
+ DW_AT_deleted = 0x8a,
+ DW_AT_defaulted = 0x8b,
+ DW_AT_loclists_base = 0x8c,
+ DW_AT_lo_user = 0x2000,
+ DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+ DW_FORM_addr = 0x01,
+ /* Reserved 0x02 */
+ DW_FORM_block2 = 0x03,
+ DW_FORM_block4 = 0x04,
+ DW_FORM_data2 = 0x05,
+ DW_FORM_data4 = 0x06,
+ DW_FORM_data8 = 0x07,
+ DW_FORM_string = 0x08,
+ DW_FORM_block = 0x09,
+ DW_FORM_block1 = 0x0a,
+ DW_FORM_data1 = 0x0b,
+ DW_FORM_flag = 0x0c,
+ DW_FORM_sdata = 0x0d,
+ DW_FORM_strp = 0x0e,
+ DW_FORM_udata = 0x0f,
+ DW_FORM_ref_addr = 0x10,
+ DW_FORM_ref1 = 0x11,
+ DW_FORM_ref2 = 0x12,
+ DW_FORM_ref4 = 0x13,
+ DW_FORM_ref8 = 0x14,
+ DW_FORM_ref_udata = 0x15,
+ DW_FORM_indirect = 0x16,
+ DW_FORM_sec_offset = 0x17,
+ DW_FORM_exprloc = 0x18,
+ DW_FORM_flag_present = 0x19,
+ DW_FORM_strx = 0x1a,
+ DW_FORM_addrx = 0x1b,
+ DW_FORM_ref_sup4 = 0x1c,
+ DW_FORM_strp_sup = 0x1d,
+ DW_FORM_data16 = 0x1e,
+ DW_FORM_line_strp = 0x1f,
+ DW_FORM_ref_sig8 = 0x20,
+ DW_FORM_implicit_const = 0x21,
+ DW_FORM_loclistx = 0x22,
+ DW_FORM_rnglistx = 0x23,
+ DW_FORM_ref_sup8 = 0x24,
+ DW_FORM_strx1 = 0x25,
+ DW_FORM_strx2 = 0x26,
+ DW_FORM_strx3 = 0x27,
+ DW_FORM_strx4 = 0x28,
+ DW_FORM_addrx1 = 0x29,
+ DW_FORM_addrx2 = 0x2a,
+ DW_FORM_addrx3 = 0x2b,
+ DW_FORM_addrx4 = 0x2c
+};
+
+/* Range list entry encodings */
+enum {
+ DW_RLE_end_of_list = 0x00,
+ DW_RLE_base_addressx = 0x01,
+ DW_RLE_startx_endx = 0x02,
+ DW_RLE_startx_length = 0x03,
+ DW_RLE_offset_pair = 0x04,
+ DW_RLE_base_address = 0x05,
+ DW_RLE_start_end = 0x06,
+ DW_RLE_start_length = 0x07
+};
+
+enum {
+ VAL_none = 0,
+ VAL_cstr = 1,
+ VAL_data = 2,
+ VAL_uint = 3,
+ VAL_int = 4,
+ VAL_addr = 5
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+ obj_info_t *obj;
+ const char *file;
+ uint8_t current_version;
+ const char *current_cu;
+ uint64_t current_low_pc;
+ uint64_t current_str_offsets_base;
+ uint64_t current_addr_base;
+ uint64_t current_rnglists_base;
+ const char *debug_line_cu_end;
+ uint8_t debug_line_format;
+ uint16_t debug_line_version;
+ const char *debug_line_files;
+ const char *debug_line_directories;
+ const char *p;
+ const char *cu_end;
+ const char *pend;
+ const char *q0;
+ const char *q;
+ int format; // 4 or 8
+ uint8_t address_size;
+ int level;
+ const char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+ ptrdiff_t pos;
+ int tag;
+ int has_children;
+} DIE;
+
+typedef struct {
+ union {
+ const char *ptr;
+ uint64_t uint64;
+ int64_t int64;
+ uint64_t addr_idx;
+ } as;
+ uint64_t off;
+ uint64_t at;
+ uint64_t form;
+ size_t size;
+ int type;
+} DebugInfoValue;
+
+#if defined(WORDS_BIGENDIAN)
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
+#else
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+#endif
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+ return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+ return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+ return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 1);
+ return (uint8_t)*p;
+}
+
+static uint16_t
+read_uint16(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 2);
+ return get_uint16((const uint8_t *)p);
+}
+
+static uint32_t
+read_uint24(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 3);
+ return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
+}
+
+static uint32_t
+read_uint32(const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = (p + 4);
+ return get_uint32((const uint8_t *)p);
+}
+
+static uint64_t
+read_uint64(const char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 8);
+ return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(const char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+ return get_uint64(p);
+#else
+ return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+ if (reader->format == 4) {
+ return read_uint32(&reader->p);
+ } else { /* 64 bit */
+ return read_uint64(&reader->p);
+ }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+ return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+ return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+ reader->file = obj->mapped;
+ reader->obj = obj;
+ reader->p = obj->debug_info.ptr;
+ reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+ reader->debug_line_cu_end = obj->debug_line.ptr;
+ reader->current_low_pc = 0;
+ reader->current_str_offsets_base = 0;
+ reader->current_addr_base = 0;
+ reader->current_rnglists_base = 0;
+}
+
+static void
+di_skip_die_attributes(const char **p)
+{
+ for (;;) {
+ uint64_t at = uleb128(p);
+ uint64_t form = uleb128(p);
+ if (!at && !form) break;
+ switch (form) {
+ default:
+ break;
+ case DW_FORM_implicit_const:
+ sleb128(p);
+ break;
+ }
+ }
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+ uint64_t prev = 0;
+ const char *p = reader->q0;
+ for (;;) {
+ uint64_t abbrev_number = uleb128(&p);
+ if (abbrev_number <= prev) break;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ reader->abbrev_table[abbrev_number] = p;
+ }
+ prev = abbrev_number;
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ di_skip_die_attributes(&p);
+ }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader)
+{
+ const char *p;
+ struct LineNumberProgramHeader header;
+
+ p = (const char *)reader->debug_line_cu_end;
+ if (parse_debug_line_header(reader->obj, &p, &header))
+ return -1;
+
+ reader->debug_line_cu_end = (char *)header.cu_end;
+ reader->debug_line_format = header.format;
+ reader->debug_line_version = header.version;
+ reader->debug_line_directories = (char *)header.include_directories;
+ reader->debug_line_files = (char *)header.filenames;
+
+ return 0;
+}
+
+static void
+set_addr_idx_value(DebugInfoValue *v, uint64_t n)
+{
+ v->as.addr_idx = n;
+ v->type = VAL_addr;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+ v->as.uint64 = n;
+ v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+ v->as.int64 = n;
+ v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, const char *s)
+{
+ v->as.ptr = s;
+ v->off = 0;
+ v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
+{
+ v->as.ptr = s;
+ v->off = off;
+ v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, const char *s)
+{
+ v->as.ptr = s;
+ v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+ if (v->as.ptr) {
+ return v->as.ptr + v->off;
+ } else {
+ return NULL;
+ }
+}
+
+static const char *
+resolve_strx(DebugInfoReader *reader, uint64_t idx)
+{
+ const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
+ uint64_t off;
+ if (reader->format == 4) {
+ off = ((uint32_t *)p)[idx];
+ }
+ else {
+ off = ((uint64_t *)p)[idx];
+ }
+ return reader->obj->debug_str.ptr + off;
+}
+
+static void
+debug_info_reader_read_addr_value(DebugInfoReader *reader, DebugInfoValue *v)
+{
+ if (reader->address_size == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->address_size == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+}
+
+static void
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v)
+{
+ switch (form) {
+ case DW_FORM_addr:
+ debug_info_reader_read_addr_value(reader, v);
+ break;
+ case DW_FORM_block2:
+ v->size = read_uint16(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block4:
+ v->size = read_uint32(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_data4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_data8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_string:
+ v->size = strlen(reader->p);
+ set_cstr_value(v, reader->p);
+ reader->p += v->size + 1;
+ break;
+ case DW_FORM_block:
+ v->size = uleb128(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block1:
+ v->size = read_uint8(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_flag:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_sdata:
+ set_int_value(v, read_sleb128(reader));
+ break;
+ case DW_FORM_strp:
+ set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+ break;
+ case DW_FORM_udata:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_addr:
+ if (reader->current_version <= 2) {
+ // DWARF Version 2 specifies that references have
+ // the same size as an address on the target system
+ debug_info_reader_read_addr_value(reader, v);
+ } else {
+ if (reader->format == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->format == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown format:%d", reader->format);
+ abort();
+ }
+ }
+ break;
+ case DW_FORM_ref1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_ref2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_ref4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_ref8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_ref_udata:
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_indirect:
+ /* TODO: read the referred value */
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_sec_offset:
+ set_uint_value(v, read_uint(reader)); /* offset */
+ /* addrptr: debug_addr */
+ /* lineptr: debug_line */
+ /* loclist: debug_loclists */
+ /* loclistptr: debug_loclists */
+ /* macptr: debug_macro */
+ /* rnglist: debug_rnglists */
+ /* rnglistptr: debug_rnglists */
+ /* stroffsetsptr: debug_str_offsets */
+ break;
+ case DW_FORM_exprloc:
+ v->size = (size_t)read_uleb128(reader);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_flag_present:
+ set_uint_value(v, 1);
+ break;
+ case DW_FORM_strx:
+ set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
+ break;
+ case DW_FORM_addrx:
+ set_addr_idx_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_ref_sup4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_strp_sup:
+ set_uint_value(v, read_uint(reader));
+ /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+ break;
+ case DW_FORM_data16:
+ v->size = 16;
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_line_strp:
+ set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
+ break;
+ case DW_FORM_ref_sig8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_implicit_const:
+ set_int_value(v, sleb128(&reader->q));
+ break;
+ case DW_FORM_loclistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_rnglistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_sup8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_strx1:
+ set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
+ break;
+ case DW_FORM_strx2:
+ set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
+ break;
+ case DW_FORM_strx3:
+ set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
+ break;
+ case DW_FORM_strx4:
+ set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
+ break;
+ case DW_FORM_addrx1:
+ set_addr_idx_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_addrx2:
+ set_addr_idx_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_addrx3:
+ set_addr_idx_value(v, read_uint24(&reader->p));
+ break;
+ case DW_FORM_addrx4:
+ set_addr_idx_value(v, read_uint32(&reader->p));
+ break;
+ case 0:
+ goto fail;
+ break;
+ }
+ return;
+
+ fail:
+ fprintf(stderr, "%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+ exit(1);
+}
+
+/* find abbrev in current compilation unit */
+static const char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number)
+{
+ const char *p;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ return reader->abbrev_table[abbrev_number];
+ }
+ p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+ /* skip 255th record */
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ di_skip_die_attributes(&p);
+ for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+ if (n == 0) {
+ fprintf(stderr,"%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+ exit(1);
+ }
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ di_skip_die_attributes(&p);
+ }
+ return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n)
+{
+ size_t i;
+ fprintf(stderr, " 0 1 2 3 4 5 6 7 8 9 A B C D E F\n");
+ for (i=0; i < n; i++){
+ switch (i & 15) {
+ case 0:
+ fprintf(stderr, "%02" PRIdSIZE ": %02X ", i/16, p[i]);
+ break;
+ case 15:
+ fprintf(stderr, "%02X\n", p[i]);
+ break;
+ default:
+ fprintf(stderr, "%02X ", p[i]);
+ break;
+ }
+ }
+ if ((i & 15) != 15) {
+ fprintf(stderr, "\n");
+ }
+}
+#define hexdump(p,n) hexdump0((const unsigned char *)p, n)
+
+static void
+div_inspect(DebugInfoValue *v)
+{
+ switch (v->type) {
+ case VAL_uint:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
+ break;
+ case VAL_int:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+ break;
+ case VAL_cstr:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+ break;
+ case VAL_data:
+ fprintf(stderr,"%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
+ hexdump(v->as.ptr, 16);
+ break;
+ }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die)
+{
+ uint64_t abbrev_number = uleb128(&reader->p);
+ if (abbrev_number == 0) {
+ reader->level--;
+ return NULL;
+ }
+
+ reader->q = di_find_abbrev(reader, abbrev_number);
+
+ die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+ die->tag = (int)uleb128(&reader->q); /* tag */
+ die->has_children = *reader->q++; /* has_children */
+ if (die->has_children) {
+ reader->level++;
+ }
+ return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp)
+{
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return NULL;
+ vp->at = at;
+ vp->form = form;
+ debug_info_reader_read_value(reader, form, vp);
+ return vp;
+}
+
+static void
+di_skip_records(DebugInfoReader *reader)
+{
+ for (;;) {
+ DebugInfoValue v = {{}};
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return;
+ debug_info_reader_read_value(reader, form, &v);
+ }
+}
+
+typedef struct addr_header {
+ const char *ptr;
+ uint64_t unit_length;
+ uint8_t format;
+ uint8_t address_size;
+ /* uint8_t segment_selector_size; */
+} addr_header_t;
+
+static void
+addr_header_init(obj_info_t *obj, addr_header_t *header) {
+ const char *p = obj->debug_addr.ptr;
+
+ header->ptr = p;
+
+ if (!p) return;
+
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
+ }
+
+ p += 2; /* version */
+ header->address_size = *p++;
+ p++; /* segment_selector_size */
+}
+
+static uint64_t
+read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
+ if (header->address_size == 4) {
+ return ((uint32_t*)(header->ptr + addr_base))[idx];
+ }
+ else {
+ return ((uint64_t*)(header->ptr + addr_base))[idx];
+ }
+}
+
+typedef struct rnglists_header {
+ uint64_t unit_length;
+ uint8_t format;
+ uint8_t address_size;
+ uint32_t offset_entry_count;
+} rnglists_header_t;
+
+static void
+rnglists_header_init(obj_info_t *obj, rnglists_header_t *header) {
+ const char *p = obj->debug_rnglists.ptr;
+
+ if (!p) return;
+
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
+ }
+
+ p += 2; /* version */
+ header->address_size = *p++;
+ p++; /* segment_selector_size */
+ header->offset_entry_count = *(uint32_t *)p;
+}
+
+typedef struct {
+ uint64_t low_pc;
+ uint64_t high_pc;
+ uint64_t ranges;
+ bool low_pc_set;
+ bool high_pc_set;
+ bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
+{
+ uint64_t n = 0;
+ if (v->type == VAL_uint) {
+ n = v->as.uint64;
+ }
+ else if (v->type == VAL_addr) {
+ n = read_addr(addr_header, addr_base, v->as.addr_idx);
+ }
+ switch (v->at) {
+ case DW_AT_low_pc:
+ ptr->low_pc = n;
+ ptr->low_pc_set = true;
+ break;
+ case DW_AT_high_pc:
+ if (v->form == DW_FORM_addr) {
+ ptr->high_pc = n;
+ }
+ else {
+ ptr->high_pc = ptr->low_pc + n;
+ }
+ ptr->high_pc_set = true;
+ break;
+ case DW_AT_ranges:
+ ptr->ranges = n;
+ ptr->ranges_set = true;
+ break;
+ }
+}
+
+static uint64_t
+read_dw_form_addr(DebugInfoReader *reader, const char **ptr)
+{
+ const char *p = *ptr;
+ *ptr = p + reader->address_size;
+ if (reader->address_size == 4) {
+ return read_uint32(&p);
+ } else if (reader->address_size == 8) {
+ return read_uint64(&p);
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ exit(1);
+ }
+ if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ else if (ptr->ranges_set) {
+ /* TODO: support base address selection entry */
+ const char *p;
+ uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+ bool base_valid = true;
+ if (reader->current_version >= 5) {
+ if (rnglists_header->offset_entry_count == 0) {
+ // DW_FORM_sec_offset
+ p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
+ }
+ else {
+ // DW_FORM_rnglistx
+ const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
+ if (rnglists_header->format == 4) {
+ p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
+ }
+ else {
+ p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
+ }
+ }
+ for (;;) {
+ uint8_t rle = read_uint8(&p);
+ uintptr_t from = 0, to = 0;
+ if (rle == DW_RLE_end_of_list) break;
+ switch (rle) {
+ case DW_RLE_base_addressx:
+ uleb128(&p);
+ base_valid = false; /* not supported yet */
+ break;
+ case DW_RLE_startx_endx:
+ uleb128(&p);
+ uleb128(&p);
+ break;
+ case DW_RLE_startx_length:
+ uleb128(&p);
+ uleb128(&p);
+ break;
+ case DW_RLE_offset_pair:
+ if (!base_valid) break;
+ from = (uintptr_t)base + uleb128(&p);
+ to = (uintptr_t)base + uleb128(&p);
+ break;
+ case DW_RLE_base_address:
+ base = read_dw_form_addr(reader, &p);
+ base_valid = true;
+ break;
+ case DW_RLE_start_end:
+ from = (uintptr_t)read_dw_form_addr(reader, &p);
+ to = (uintptr_t)read_dw_form_addr(reader, &p);
+ break;
+ case DW_RLE_start_length:
+ from = (uintptr_t)read_dw_form_addr(reader, &p);
+ to = from + uleb128(&p);
+ break;
+ }
+ if (from <= addr && addr < to) {
+ return from;
+ }
+ }
+ return false;
+ }
+ p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ if (from == UINTPTR_MAX) {
+ /* base address selection entry */
+ base = to;
+ }
+ else if (base + from <= addr && addr < base + to) {
+ return (uintptr_t)base + from;
+ }
+ }
+ }
+ else if (ptr->low_pc_set) {
+ if (ptr->low_pc == addr) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ return false;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ fprintf(stderr,"low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+ exit(1);
+ }
+ fprintf(stderr,"low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+ }
+ else if (ptr->ranges_set) {
+ char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ fprintf(stderr,"low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ fprintf(stderr,"%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+ }
+ fprintf(stderr,"\n");
+ }
+ else if (ptr->low_pc_set) {
+ fprintf(stderr,"low_pc:%"PRIx64"\n",ptr->low_pc);
+ }
+ else {
+ fprintf(stderr,"empty\n");
+ }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader)
+{
+ uint64_t unit_length;
+ uint16_t version;
+ uint64_t debug_abbrev_offset;
+ reader->format = 4;
+ reader->current_cu = reader->p;
+ unit_length = read_uint32(&reader->p);
+ if (unit_length == 0xffffffff) {
+ unit_length = read_uint64(&reader->p);
+ reader->format = 8;
+ }
+ reader->cu_end = reader->p + unit_length;
+ version = read_uint16(&reader->p);
+ reader->current_version = version;
+ if (version > 5) {
+ return -1;
+ }
+ else if (version == 5) {
+ /* unit_type = */ read_uint8(&reader->p);
+ reader->address_size = read_uint8(&reader->p);
+ debug_abbrev_offset = read_uint(reader);
+ }
+ else {
+ debug_abbrev_offset = read_uint(reader);
+ reader->address_size = read_uint8(&reader->p);
+ }
+ reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+ reader->level = 0;
+ di_read_debug_abbrev_cu(reader);
+ if (di_read_debug_line_cu(reader)) return -1;
+
+#if defined(__GNUC__) && !defined(__clang__) && !defined(__INTEL_COMPILER_BUILD_DATE)
+ /* Though DWARF specifies "the applicable base address defaults to the base
+ address of the compilation unit", but GCC seems to use zero as default */
+#else
+ do {
+ DIE die;
+
+ if (!di_read_die(reader, &die)) continue;
+
+ if (die.tag != DW_TAG_compile_unit) {
+ di_skip_records(reader);
+ break;
+ }
+
+ reader->current_str_offsets_base = 0;
+ reader->current_addr_base = 0;
+ reader->current_rnglists_base = 0;
+
+ DebugInfoValue low_pc = {{}};
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_low_pc:
+ // clang may output DW_AT_addr_base after DW_AT_low_pc.
+ // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
+ low_pc = v;
+ break;
+ case DW_AT_str_offsets_base:
+ reader->current_str_offsets_base = v.as.uint64;
+ break;
+ case DW_AT_addr_base:
+ reader->current_addr_base = v.as.uint64;
+ break;
+ case DW_AT_rnglists_base:
+ reader->current_rnglists_base = v.as.uint64;
+ break;
+ }
+ }
+ // Resolve the DW_FORM_addr of DW_AT_low_pc
+ switch (low_pc.type) {
+ case VAL_uint:
+ reader->current_low_pc = low_pc.as.uint64;
+ break;
+ case VAL_addr:
+ {
+ addr_header_t header;
+ addr_header_init(reader->obj, &header);
+ reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
+ }
+ break;
+ }
+ } while (0);
+#endif
+ return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line)
+{
+ const char *p = reader->p;
+ const char *q = reader->q;
+ int level = reader->level;
+ DIE die;
+
+ switch (form) {
+ case DW_FORM_ref1:
+ case DW_FORM_ref2:
+ case DW_FORM_ref4:
+ case DW_FORM_ref8:
+ case DW_FORM_ref_udata:
+ reader->p = reader->current_cu + abstract_origin;
+ break;
+ case DW_FORM_ref_addr:
+ goto finish; /* not supported yet */
+ case DW_FORM_ref_sig8:
+ goto finish; /* not supported yet */
+ case DW_FORM_ref_sup4:
+ case DW_FORM_ref_sup8:
+ goto finish; /* not supported yet */
+ default:
+ goto finish;
+ }
+ if (!di_read_die(reader, &die)) goto finish;
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_name:
+ line->sname = get_cstr_value(&v);
+ break;
+ }
+ }
+
+ finish:
+ reader->p = p;
+ reader->q = q;
+ reader->level = level;
+}
+
+static void
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+ line_info_t *lines, int offset) {
+
+ addr_header_t addr_header = {};
+ addr_header_init(reader->obj, &addr_header);
+
+ rnglists_header_t rnglists_header = {};
+ rnglists_header_init(reader->obj, &rnglists_header);
+
+ while (reader->p < reader->cu_end) {
+ DIE die;
+ ranges_t ranges = {};
+ line_info_t line = {};
+
+ if (!di_read_die(reader, &die)) continue;
+ /* fprintf(stderr,"%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+ if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+ skip_die:
+ di_skip_records(reader);
+ continue;
+ }
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ /* ptrdiff_t pos = reader->p - reader->p0; */
+ if (!di_read_record(reader, &v)) break;
+ /* fprintf(stderr,"\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+ /* div_inspect(&v); */
+ switch (v.at) {
+ case DW_AT_name:
+ line.sname = get_cstr_value(&v);
+ break;
+ case DW_AT_call_file:
+ fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj);
+ break;
+ case DW_AT_call_line:
+ line.line = (int)v.as.uint64;
+ break;
+ case DW_AT_low_pc:
+ case DW_AT_high_pc:
+ case DW_AT_ranges:
+ ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
+ break;
+ case DW_AT_declaration:
+ goto skip_die;
+ case DW_AT_inline:
+ /* 1 or 3 */
+ break; /* goto skip_die; */
+ case DW_AT_abstract_origin:
+ read_abstract_origin(reader, v.form, v.as.uint64, &line);
+ break; /* goto skip_die; */
+ }
+ }
+ /* ranges_inspect(reader, &ranges); */
+ /* fprintf(stderr,"%d:%tx: %x ",__LINE__,diepos,die.tag); */
+ for (int i=offset; i < num_traces; i++) {
+ uintptr_t addr = (uintptr_t)traces[i];
+ uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+ uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header);
+ if (saddr) {
+ /* fprintf(stdout, "%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+ if (lines[i].sname) {
+ line_info_t *lp = malloc(sizeof(line_info_t));
+ memcpy(lp, &lines[i], sizeof(line_info_t));
+ lines[i].next = lp;
+ lp->dirname = line.dirname;
+ lp->filename = line.filename;
+ lp->line = line.line;
+ lp->saddr = 0;
+ }
+ lines[i].path = reader->obj->path;
+ lines[i].base_addr = line.base_addr;
+ lines[i].sname = line.sname;
+ lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+ }
+ }
+ }
+}
+
+// This function parses the following attributes of Line Number Program Header in DWARF 5:
+//
+// * directory_entry_format_count
+// * directory_entry_format
+// * directories_count
+// * directories
+//
+// or
+//
+// * file_name_entry_format_count
+// * file_name_entry_format
+// * file_names_count
+// * file_names
+//
+// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
+static const char *
+parse_ver5_debug_line_header(const char *p, int idx, uint8_t format, obj_info_t *obj, const char **out_path, uint64_t *out_directory_index) {
+ int i, j;
+ int entry_format_count = *(uint8_t *)p++;
+ const char *entry_format = p;
+
+ /* skip the part of entry_format */
+ for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
+
+ int entry_count = (int)uleb128(&p);
+
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ reader.format = format;
+ reader.p = p;
+ for (j = 0; j < entry_count; j++) {
+ const char *format = entry_format;
+ for (i = 0; i < entry_format_count; i++) {
+ DebugInfoValue v = {{}};
+ unsigned long dw_lnct = uleb128(&format);
+ unsigned long dw_form = uleb128(&format);
+ debug_info_reader_read_value(&reader, dw_form, &v);
+ if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
+ *out_path = v.as.ptr + v.off;
+ if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
+ *out_directory_index = v.as.uint64;
+ }
+ if (j == idx) return 0;
+ }
+
+ return reader.p;
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+ *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+ ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+ unsigned long destsize = chdr->ch_size;
+ int ret = 0;
+
+ if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+ /* unsupported compression type */
+ return 0;
+ }
+
+ *ptr = malloc(destsize);
+ if (!*ptr) return 0;
+ ret = uncompress((Bytef *)*ptr, &destsize,
+ (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+ shdr->sh_size - sizeof(ElfW(Chdr)));
+ if (ret != Z_OK) goto fail;
+ return destsize;
+
+fail:
+ free(*ptr);
+ *ptr = NULL;
+#endif
+ return 0;
+}
/* read file and fill lines */
static uintptr_t
@@ -463,10 +2007,10 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
{
int i, j;
char *shstr;
- char *section_name;
ElfW(Ehdr) *ehdr;
ElfW(Shdr) *shdr, *shstr_shdr;
- ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+ ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+ ElfW(Shdr) *note_gnu_build_id = NULL;
int fd;
off_t filesize;
char *file;
@@ -502,6 +2046,7 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
kprintf("mmap: %s\n", strerror(e));
goto fail;
}
+ close(fd);
ehdr = (ElfW(Ehdr) *)file;
if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
@@ -509,11 +2054,8 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
* Huh? Maybe filename was overridden by setproctitle() and
* it match non-elf file.
*/
- close(fd);
goto fail;
}
-
- obj->fd = fd;
obj->mapped = file;
obj->mapped_size = (size_t)filesize;
@@ -523,7 +2065,7 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
shstr = file + shstr_shdr->sh_offset;
for (i = 0; i < ehdr->e_shnum; i++) {
- section_name = shstr + shdr[i].sh_name;
+ char *section_name = shstr + shdr[i].sh_name;
switch (shdr[i].sh_type) {
case SHT_STRTAB:
if (!strcmp(section_name, ".strtab")) {
@@ -541,13 +2083,44 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
/* if (!strcmp(section_name, ".dynsym")) */
dynsym_shdr = shdr + i;
break;
+ case SHT_NOTE:
+ if (!strcmp(section_name, ".note.gnu.build-id")) {
+ note_gnu_build_id = shdr + i;
+ }
+ break;
case SHT_PROGBITS:
- if (!strcmp(section_name, ".debug_line")) {
- debug_line_shdr = shdr + i;
- }
- else if (!strcmp(section_name, ".gnu_debuglink")) {
+ if (!strcmp(section_name, ".gnu_debuglink")) {
gnu_debuglink_shdr = shdr + i;
}
+ else {
+ const char *debug_section_names[] = {
+ ".debug_abbrev",
+ ".debug_info",
+ ".debug_line",
+ ".debug_ranges",
+ ".debug_str_offsets",
+ ".debug_addr",
+ ".debug_rnglists",
+ ".debug_str",
+ ".debug_line_str"
+ };
+
+ for (j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(section_name, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + shdr[i].sh_offset;
+ s->size = shdr[i].sh_size;
+ s->flags = shdr[i].sh_flags;
+ if (s->flags & SHF_COMPRESSED) {
+ s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+ if (!s->size) goto fail;
+ }
+ break;
+ }
+ }
break;
}
}
@@ -559,20 +2132,22 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
char *strtab = file + dynstr_shdr->sh_offset;
ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- Dl_info info;
- void *h, *s;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
- h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
- if (!h) continue;
- s = dlsym(h, strtab + sym->st_name);
- if (!s) continue;
- if (dladdr(s, &info)) {
- dladdr_fbase = (uintptr_t)info.dli_fbase;
- break;
- }
- }
+ void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+ if (handle) {
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ Dl_info info;
+ void *s;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+ s = dlsym(handle, strtab + sym->st_name);
+ if (s && dladdr(s, &info)) {
+ obj->base_addr = dladdr_fbase;
+ dladdr_fbase = (uintptr_t)info.dli_fbase;
+ break;
+ }
+ }
+ dlclose(handle);
+ }
if (ehdr->e_type == ET_EXEC) {
obj->base_addr = 0;
}
@@ -583,33 +2158,48 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
}
}
- if (!symtab_shdr) {
- symtab_shdr = dynsym_shdr;
- strtab_shdr = dynstr_shdr;
- }
-
- if (symtab_shdr && strtab_shdr) {
- char *strtab = file + strtab_shdr->sh_offset;
- ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
- int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
- for (i = offset; i < num_traces; i++) {
- uintptr_t d = (uintptr_t)traces[i] - saddr;
- if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
- continue;
- /* fill symbol name and addr from .symtab */
- lines[i].sname = strtab + sym->st_name;
- lines[i].saddr = saddr;
- lines[i].path = obj->path;
- lines[i].base_addr = obj->base_addr;
- }
- }
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ i = 0;
+ while (reader.p < reader.pend) {
+ /* fprintf(stderr, "%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+ if (di_read_cu(&reader)) goto use_symtab;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+ else {
+ /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+ if (!symtab_shdr) {
+ /* This file doesn't have symtab, use dynsym instead */
+ symtab_shdr = dynsym_shdr;
+ strtab_shdr = dynstr_shdr;
+ }
+
+ if (symtab_shdr && strtab_shdr) {
+ char *strtab = file + strtab_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+ int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t d = (uintptr_t)traces[i] - saddr;
+ if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+ lines[i].saddr = saddr;
+ lines[i].path = obj->path;
+ lines[i].base_addr = obj->base_addr;
+ }
+ }
+ }
}
- if (!debug_line_shdr) {
+ if (!obj->debug_line.ptr) {
/* This file doesn't have .debug_line section,
let's check .gnu_debuglink section instead. */
if (gnu_debuglink_shdr && check_debuglink) {
@@ -617,21 +2207,251 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
num_traces, traces,
objp, lines, offset);
}
+ if (note_gnu_build_id && check_debuglink) {
+ ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+ const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+ follow_debuglink_build_id(build_id, nhdr->n_descsz,
+ num_traces, traces,
+ objp, lines, offset);
+ }
goto finish;
}
- parse_debug_line(num_traces, traces,
- file + debug_line_shdr->sh_offset,
- debug_line_shdr->sh_size,
- obj, lines, offset);
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
finish:
return dladdr_fbase;
fail:
return (uintptr_t)-1;
}
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+# ifdef __LP64__
+# define LP(x) x##_64
+# else
+# define LP(x) x
+# endif
+ int fd;
+ off_t filesize;
+ char *file, *p = NULL;
+ obj_info_t *obj = *objp;
+ struct LP(mach_header) *header;
+ uintptr_t dladdr_fbase = 0;
+
+ {
+ char *s = binary_filename;
+ char *base = strrchr(binary_filename, '/')+1;
+ size_t max = PATH_MAX;
+ size_t size = strlen(binary_filename);
+ size_t basesize = size - (base - binary_filename);
+ s += size;
+ max -= size;
+ p = s;
+ size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+ if (size == 0) goto fail;
+ s += size;
+ max -= size;
+ if (max <= basesize) goto fail;
+ memcpy(s, base, basesize);
+ s[basesize] = 0;
+
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ *p = 0; /* binary_filename becomes original file name */
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ goto fail;
+ }
+ }
+ }
+
+ filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ kprintf("lseek: %s\n", strerror(e));
+ goto fail;
+ }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+ if (filesize > (off_t)SIZE_MAX) {
+ close(fd);
+ kprintf("Too large file %s\n", binary_filename);
+ goto fail;
+ }
+#endif
+ lseek(fd, 0, SEEK_SET);
+ /* async-signal unsafe */
+ file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+ if (file == MAP_FAILED) {
+ int e = errno;
+ close(fd);
+ kprintf("mmap: %s\n", strerror(e));
+ goto fail;
+ }
+ close(fd);
+
+ obj->mapped = file;
+ obj->mapped_size = (size_t)filesize;
+
+ header = (struct LP(mach_header) *)file;
+ if (header->magic == LP(MH_MAGIC)) {
+ /* non universal binary */
+ p = file;
+ }
+ else if (header->magic == FAT_CIGAM) {
+ struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+ struct fat_header *fat = (struct fat_header *)file;
+ char *q = file + sizeof(*fat);
+ uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+ /* fprintf(stderr,"%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+ for (uint32_t i = 0; i < nfat_arch; i++) {
+ struct fat_arch *arch = (struct fat_arch *)q;
+ cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+ cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+ uint32_t offset = __builtin_bswap32(arch->offset);
+ /* fprintf(stderr,"%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+ if (mhp->cputype == cputype &&
+ (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+ p = file + offset;
+ file = p;
+ header = (struct LP(mach_header) *)p;
+ if (header->magic == LP(MH_MAGIC)) {
+ goto found_mach_header;
+ }
+ break;
+ }
+ q += sizeof(*arch);
+ }
+ kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+ else {
+ kprintf("'%s' is not a "
+# ifdef __LP64__
+ "64"
+# else
+ "32"
+# endif
+ "-bit Mach-O file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+found_mach_header:
+ p += sizeof(*header);
+
+ for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+ struct load_command *lcmd = (struct load_command *)p;
+ switch (lcmd->cmd) {
+ case LP(LC_SEGMENT):
+ {
+ static const char *debug_section_names[] = {
+ "__debug_abbrev",
+ "__debug_info",
+ "__debug_line",
+ "__debug_ranges",
+ "__debug_str_offsets",
+ "__debug_addr",
+ "__debug_rnglists",
+ "__debug_str",
+ "__debug_line_str",
+ };
+ struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+ if (strcmp(scmd->segname, "__TEXT") == 0) {
+ obj->vmaddr = scmd->vmaddr;
+ }
+ else if (strcmp(scmd->segname, "__DWARF") == 0) {
+ p += sizeof(struct LP(segment_command));
+ for (uint64_t i = 0; i < scmd->nsects; i++) {
+ struct LP(section) *sect = (struct LP(section) *)p;
+ p += sizeof(struct LP(section));
+ for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(sect->sectname, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + sect->offset;
+ s->size = sect->size;
+ s->flags = sect->flags;
+ if (s->flags & SHF_COMPRESSED) {
+ goto fail;
+ }
+ break;
+ }
+ }
+ }
+ }
+ break;
+
+ case LC_SYMTAB:
+ {
+ struct symtab_command *cmd = (struct symtab_command *)lcmd;
+ struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+ char *strtab = file + cmd->stroff, *sname = 0;
+ uint32_t j;
+ uintptr_t saddr = 0;
+ /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
+ for (j = 0; j < cmd->nsyms; j++) {
+ uintptr_t symsize, d;
+ struct LP(nlist) *e = &nl[j];
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ if (e->n_type != N_FUN) continue;
+ if (e->n_sect) {
+ saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+ sname = strtab + e->n_un.n_strx;
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ continue;
+ }
+ for (int k = offset; k < num_traces; k++) {
+ d = (uintptr_t)traces[k] - saddr;
+ symsize = e->n_value;
+ /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+ if (lines[k].line > 0 || d > (uintptr_t)symsize)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[k].sname) lines[k].sname = sname;
+ lines[k].saddr = saddr;
+ lines[k].path = obj->path;
+ lines[k].base_addr = obj->base_addr;
+ }
+ }
+ }
+ }
+ p += lcmd->cmdsize;
+ }
+
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ while (reader.p < reader.pend) {
+ if (di_read_cu(&reader)) goto fail;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
+ return dladdr_fbase;
+fail:
+ return (uintptr_t)-1;
+}
+#endif
#define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
+#if defined(__FreeBSD__) || defined(__DragonFly__)
# include <sys/sysctl.h>
#endif
/* ssize_t main_exe_path(void)
@@ -640,17 +2460,22 @@ fail:
* and returns strlen(binary_filename).
* it is NUL terminated.
*/
-#if defined(__linux__)
-ssize_t
+#if defined(__linux__) || defined(__NetBSD__)
+static ssize_t
main_exe_path(void)
{
-# define PROC_SELF_EXE "/proc/self/exe"
+# if defined(__linux__)
+# define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+# define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+ if (len < 0) return 0;
binary_filename[len] = 0;
return len;
}
-#elif defined(__FreeBSD__)
-ssize_t
+#elif defined(__FreeBSD__) || defined(__DragonFly__)
+static ssize_t
main_exe_path(void)
{
int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
@@ -663,10 +2488,69 @@ main_exe_path(void)
len--; /* sysctl sets strlen+1 */
return len;
}
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(void)
+{
+ int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+ if (len == 0) return 0;
+ binary_filename[len] = 0;
+ return len;
+}
#else
#undef HAVE_MAIN_EXE_PATH
#endif
+static void
+print_line0(line_info_t *line, void *address)
+{
+ uintptr_t addr = (uintptr_t)address;
+ uintptr_t d = addr - line->saddr;
+ if (!address) {
+ /* inlined */
+ if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+ }
+ }
+ else if (!line->path) {
+ kprintf("[0x%"PRIxPTR"]\n", addr);
+ }
+ else if (!line->sname) {
+ kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+ }
+ else if (!line->saddr) {
+ kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
+ }
+ else if (line->line <= 0) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+ d, addr);
+ }
+ else if (!line->filename) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+ d, addr, line->line);
+ }
+ else if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+ d, addr, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+ d, addr, line->filename, line->line);
+ }
+}
+
+static void
+print_line(line_info_t *line, void *address)
+{
+ print_line0(line, address);
+ if (line->next) {
+ print_line(line->next, NULL);
+ }
+}
+
void
rb_dump_backtrace_with_lines(int num_traces, void **traces)
{
@@ -676,6 +2560,7 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
obj_info_t *obj = NULL;
/* 2 is NULL + main executable */
void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+
#ifdef HAVE_MAIN_EXE_PATH
char *main_path = NULL; /* used on printing backtrace */
ssize_t len;
@@ -706,8 +2591,8 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
/* if the binary is strip-ed, this may effect */
for (p=dladdr_fbases; *p; p++) {
if (*p == info.dli_fbase) {
- lines[i].path = info.dli_fname;
- lines[i].sname = info.dli_sname;
+ if (info.dli_fname) lines[i].path = info.dli_fname;
+ if (info.dli_sname) lines[i].sname = info.dli_sname;
goto next_line;
}
}
@@ -717,9 +2602,14 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
obj->base_addr = (uintptr_t)info.dli_fbase;
path = info.dli_fname;
obj->path = path;
- lines[i].path = path;
- strcpy(binary_filename, path);
- fill_lines(num_traces, traces, 1, &obj, lines, i);
+ if (path) lines[i].path = path;
+ if (info.dli_sname) {
+ lines[i].sname = info.dli_sname;
+ lines[i].saddr = (uintptr_t)info.dli_saddr;
+ }
+ strlcpy(binary_filename, path, PATH_MAX);
+ if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
+ break;
}
next_line:
continue;
@@ -727,46 +2617,36 @@ next_line:
/* output */
for (i = 0; i < num_traces; i++) {
- line_info_t *line = &lines[i];
- uintptr_t addr = (uintptr_t)traces[i];
- uintptr_t d = addr - line->saddr;
- if (!line->path) {
- kprintf("[0x%lx]\n", addr);
- }
- else if (!line->saddr || !line->sname) {
- kprintf("%s [0x%lx]\n", line->path, addr);
- }
- else if (line->line <= 0) {
- kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
- d, addr);
- }
- else if (!line->filename) {
- kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
- d, addr, line->line);
- }
- else if (line->dirname && line->dirname[0]) {
- kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
- d, addr, line->dirname, line->filename, line->line);
- }
- else {
- kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
- d, addr, line->filename, line->line);
- }
+ print_line(&lines[i], traces[i]);
+
/* FreeBSD's backtrace may show _start and so on */
- if (line->sname && strcmp("main", line->sname) == 0)
+ if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
break;
}
/* free */
while (obj) {
obj_info_t *o = obj;
- obj = o->next;
- if (o->fd) {
- munmap(o->mapped, o->mapped_size);
- close(o->fd);
+ for (i=0; i < DWARF_SECTION_COUNT; i++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+ if (s->flags & SHF_COMPRESSED) {
+ free(s->ptr);
+ }
+ }
+ if (obj->mapped_size) {
+ munmap(obj->mapped, obj->mapped_size);
}
+ obj = o->next;
free(o);
}
+ for (i = 0; i < num_traces; i++) {
+ line_info_t *line = lines[i].next;
+ while (line) {
+ line_info_t *l = line;
+ line = line->next;
+ free(l);
+ }
+ }
free(lines);
free(dladdr_fbases);
}
@@ -812,7 +2692,7 @@ next_line:
#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
#define hex2ascii(hex) (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static const char hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
static inline int imax(int a, int b) { return (a > b ? a : b); }
static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
@@ -826,7 +2706,7 @@ static void putce(int c)
(void)ret;
}
-int
+static int
kprintf(const char *fmt, ...)
{
va_list ap;
diff --git a/addr2line.h b/addr2line.h
index d99f010934..f09b665800 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,3 +1,5 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
/**********************************************************************
addr2line.h -
@@ -8,10 +10,7 @@
**********************************************************************/
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef USE_ELF
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
void
rb_dump_backtrace_with_lines(int num_traces, void **traces);
diff --git a/appveyor.yml b/appveyor.yml
deleted file mode 100644
index 2cda4817a6..0000000000
--- a/appveyor.yml
+++ /dev/null
@@ -1,37 +0,0 @@
----
-shallow_clone: true
-platform: x64
-install:
- - SET
- - '"C:\Program Files (x86)\Microsoft Visual Studio 12.0\VC\vcvarsall.bat" amd64'
- - SET PATH=\usr\local\bin;C:\Ruby22-x64\bin;C:\Ruby21-x64\Devkit\mingw\bin;%PATH%;C:\msys64\usr\bin
- - ruby --version
- - 'cl'
- - SET
- - mkdir \usr\local\bin
- - mkdir \usr\local\include
- - mkdir \usr\local\lib
- - ps: Start-FileDownload 'http://ftp.openbsd.org/pub/OpenBSD/LibreSSL/libressl-2.3.7-windows.zip'
- - 7z x libressl-2.3.7-windows.zip
- - copy libressl-2.3.7-windows\x64\libcrypto-37.lib \usr\local\lib\crypto.lib
- - copy libressl-2.3.7-windows\x64\libssl-38.lib \usr\local\lib\ssl.lib
- - copy libressl-2.3.7-windows\x64\libcrypto-37.dll \usr\local\bin
- - copy libressl-2.3.7-windows\x64\libssl-38.dll \usr\local\bin
- - xcopy /e libressl-2.3.7-windows\include \usr\local\include
- - ps: Start-FileDownload 'http://zlib.net/zlib128.zip'
- - 7z x zlib128.zip
- - cd zlib-1.2.8
- - nmake -f win32/Makefile.msc
- - copy zlib1.dll \usr\local\bin
- - copy zlib.lib \usr\local\lib
- - copy zconf.h \usr\local\include
- - copy zlib.h \usr\local\include
-build_script:
- - cd %APPVEYOR_BUILD_FOLDER%
- - win32\configure.bat --without-ext=+,dbm,gdbm,readline --with-opt-dir=/usr/local
- - nmake -l up
- - nmake -l
- - nmake install-nodoc
-test_script:
- - nmake -l "OPTS=-v -q" btest
- - nmake -l "OPTS=-v -q" test-basic
diff --git a/array.c b/array.c
index 4e60177121..b76e9a64a3 100644
--- a/array.c
+++ b/array.c
@@ -11,51 +11,107 @@
**********************************************************************/
+#include "debug_counter.h"
+#include "id.h"
#include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
#include "probes.h"
-#include "id.h"
+#include "ruby/encoding.h"
+#include "ruby/st.h"
+#include "ruby/util.h"
+#include "transient_heap.h"
+#include "builtin.h"
-#ifndef ARRAY_DEBUG
+#if !ARRAY_DEBUG
+# undef NDEBUG
# define NDEBUG
#endif
#include "ruby_assert.h"
VALUE rb_cArray;
-static ID id_cmp, id_div, id_power;
+/* Flags of RArray
+ *
+ * 1: RARRAY_EMBED_FLAG
+ * The array is embedded (its contents follow the header, rather than
+ * being on a separately allocated buffer).
+ * 2: RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
+ * The array is shared. The buffer this array points to is owned by
+ * another array (the shared root).
+ * if USE_RVARGC
+ * 3-9: RARRAY_EMBED_LEN
+ * The length of the array when RARRAY_EMBED_FLAG is set.
+ * else
+ * 3-4: RARRAY_EMBED_LEN
+ * The length of the array when RARRAY_EMBED_FLAG is set.
+ * endif
+ * 12: RARRAY_SHARED_ROOT_FLAG
+ * The array is a shared root that does reference counting. The buffer
+ * this array points to is owned by this array but may be pointed to
+ * by other arrays.
+ * Note: Frozen arrays may be a shared root without this flag being
+ * set. Frozen arrays do not have reference counting because
+ * they cannot be modified. Not updating the reference count
+ * improves copy-on-write performance. Their reference count is
+ * assumed to be infinity.
+ * 13: RARRAY_TRANSIENT_FLAG
+ * The buffer of the array is allocated on the transient heap.
+ * 14: RARRAY_PTR_IN_USE_FLAG
+ * The buffer of the array is in use. This is only used during
+ * debugging.
+ */
+
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
#define ARY_DEFAULT_SIZE 16
#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
-# define ARY_SHARED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
- (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
- FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+ return RB_TYPE_P(ary, T_ARRAY);
+}
#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (assert(!ARY_EMBED_P(a)), assert(!ARY_SHARED_ROOT_P(a)), \
+ RARRAY(a)->as.heap.aux.capa)
+
#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
#define ARY_EMBED_LEN(a) \
(assert(ARY_EMBED_P(a)), \
(long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
- (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+ (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (assert(should_be_T_ARRAY((VALUE)(a))), \
+ !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
#define FL_SET_EMBED(a) do { \
assert(!ARY_SHARED_P(a)); \
FL_SET((a), RARRAY_EMBED_FLAG); \
+ RARY_TRANSIENT_UNSET(a); \
+ ary_verify(a); \
} while (0)
+
#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
#define FL_SET_SHARED(ary) do { \
assert(!ARY_EMBED_P(ary)); \
- FL_SET((ary), ELTS_SHARED); \
+ FL_SET((ary), RARRAY_SHARED_FLAG); \
} while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
#define ARY_SET_PTR(ary, p) do { \
assert(!ARY_EMBED_P(ary)); \
@@ -65,7 +121,6 @@ static ID id_cmp, id_div, id_power;
#define ARY_SET_EMBED_LEN(ary, n) do { \
long tmp_n = (n); \
assert(ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
} while (0)
@@ -97,8 +152,8 @@ static ID id_cmp, id_div, id_power;
} \
} while (0)
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
- ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
+ ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
#define ARY_SET_CAPA(ary, n) do { \
assert(!ARY_EMBED_P(ary)); \
assert(!ARY_SHARED_P(ary)); \
@@ -106,44 +161,185 @@ static ID id_cmp, id_div, id_power;
RARRAY(ary)->as.heap.aux.capa = (n); \
} while (0)
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
#define ARY_SET_SHARED(ary, value) do { \
const VALUE _ary_ = (ary); \
const VALUE _value_ = (value); \
assert(!ARY_EMBED_P(_ary_)); \
assert(ARY_SHARED_P(_ary_)); \
- assert(ARY_SHARED_ROOT_P(_value_)); \
- RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+ assert(!OBJ_FROZEN(_ary_)); \
+ assert(ARY_SHARED_ROOT_P(_value_) || OBJ_FROZEN(_value_)); \
+ RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared_root, _value_); \
} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
- (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
+
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
assert(ARY_SHARED_ROOT_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ assert((value) >= 0); \
RARRAY(ary)->as.heap.aux.capa = (value); \
} while (0)
#define FL_SET_SHARED_ROOT(ary) do { \
+ assert(!OBJ_FROZEN(ary)); \
assert(!ARY_EMBED_P(ary)); \
+ assert(!RARRAY_TRANSIENT_P(ary)); \
FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
} while (0)
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+ assert(!ARY_SHARED_P(a));
+ assert(!OBJ_FROZEN(a));
+
+ RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+static long
+ary_embed_capa(VALUE ary)
+{
+#if USE_RVARGC
+ size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
+ assert(size % sizeof(VALUE) == 0);
+ return size / sizeof(VALUE);
+#else
+ return RARRAY_EMBED_LEN_MAX;
+#endif
+}
+
+static size_t
+ary_embed_size(long capa)
+{
+ return offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
+}
+
+static bool
+ary_embeddable_p(long capa)
+{
+#if USE_RVARGC
+ return rb_gc_size_allocatable_p(ary_embed_size(capa));
+#else
+ return capa <= RARRAY_EMBED_LEN_MAX;
+#endif
+}
+
+bool
+rb_ary_embeddable_p(VALUE ary)
+{
+ /* An array cannot be turned embeddable when the array is:
+ * - Shared root: other objects may point to the buffer of this array
+ * so we cannot make it embedded.
+ * - Frozen: this array may also be a shared root without the shared root
+ * flag.
+ * - Shared: we don't want to re-embed an array that points to a shared
+ * root (to save memory).
+ */
+ return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
+}
+
+size_t
+rb_ary_size_as_embedded(VALUE ary)
+{
+ size_t real_size;
+
+ if (ARY_EMBED_P(ary)) {
+ real_size = ary_embed_size(ARY_EMBED_LEN(ary));
+ }
+ else if (rb_ary_embeddable_p(ary)) {
+ real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
+ }
+ else {
+ real_size = sizeof(struct RArray);
+ }
+ return real_size;
+}
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+ assert(RB_TYPE_P(ary, T_ARRAY));
+
+ if (ARY_SHARED_P(ary)) {
+ VALUE root = ARY_SHARED_ROOT(ary);
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ const VALUE *root_ptr = RARRAY_CONST_PTR_TRANSIENT(root);
+ long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+ assert(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
+ assert(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+ ary_verify(root);
+ }
+ else if (ARY_EMBED_P(ary)) {
+ assert(!RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_SHARED_P(ary));
+ assert(RARRAY_LEN(ary) <= ary_embed_capa(ary));
+ }
+ else {
+#if 1
+ const VALUE *ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ long i, len = RARRAY_LEN(ary);
+ volatile VALUE v;
+ if (len > 1) len = 1; /* check only HEAD */
+ for (i=0; i<len; i++) {
+ v = ptr[i]; /* access check */
+ }
+ v = v;
+#endif
+ }
+
+#if USE_TRANSIENT_HEAP
+ if (RARRAY_TRANSIENT_P(ary)) {
+ assert(rb_transient_heap_managed_ptr_p(RARRAY_CONST_PTR_TRANSIENT(ary)));
+ }
+#endif
+
+ rb_transient_heap_verify();
+
+ return ary;
+}
void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_ary_verify(VALUE ary)
+{
+ ary_verify(ary);
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+ return (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary);
+}
+
+void
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
+
+void
+rb_mem_clear(VALUE *mem, long size)
{
while (size--) {
- *mem++ = Qnil;
+ *mem++ = Qnil;
}
}
static void
ary_mem_clear(VALUE ary, long beg, long size)
{
- RARRAY_PTR_USE(ary, ptr, {
- rb_mem_clear(ptr + beg, size);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ rb_mem_clear(ptr + beg, size);
});
}
@@ -151,44 +347,38 @@ static inline void
memfill(register VALUE *mem, register long size, register VALUE val)
{
while (size--) {
- *mem++ = val;
+ *mem++ = val;
}
}
static void
ary_memfill(VALUE ary, long beg, long size, VALUE val)
{
- RARRAY_PTR_USE(ary, ptr, {
- memfill(ptr + beg, size, val);
- RB_OBJ_WRITTEN(ary, Qundef, val);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ memfill(ptr + beg, size, val);
+ RB_OBJ_WRITTEN(ary, Qundef, val);
});
}
static void
ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
{
-#if 1
assert(!ARY_SHARED_P(buff_owner_ary));
if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
- rb_gc_writebarrier_remember(buff_owner_ary);
- RARRAY_PTR_USE(ary, ptr, {
- MEMCPY(ptr+beg, argv, VALUE, argc);
- });
+ rb_gc_writebarrier_remember(buff_owner_ary);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMCPY(ptr+beg, argv, VALUE, argc);
+ });
}
else {
- int i;
- RARRAY_PTR_USE(ary, ptr, {
- for (i=0; i<argc; i++) {
- RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
- }
- });
+ int i;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ for (i=0; i<argc; i++) {
+ RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+ }
+ });
}
-#else
- /* giveup write barrier (traditional way) */
- RARRAY_PTR(buff_owner_ary);
- MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
}
static void
@@ -197,49 +387,198 @@ ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
ary_memcpy0(ary, beg, argc, argv, ary);
}
+static VALUE *
+ary_heap_alloc(VALUE ary, size_t capa)
+{
+ VALUE *ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * capa);
+
+ if (ptr != NULL) {
+ RARY_TRANSIENT_SET(ary);
+ }
+ else {
+ RARY_TRANSIENT_UNSET(ary);
+ ptr = ALLOC_N(VALUE, capa);
+ }
+
+ return ptr;
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ /* ignore it */
+ }
+ else {
+ ruby_sized_xfree((void *)ptr, size);
+ }
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ }
+}
+
+static size_t
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+ size_t alloc_capa = new_capa;
+ size_t old_capa = ARY_HEAP_CAPA(ary);
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ if (new_capa <= old_capa) {
+ /* do nothing */
+ alloc_capa = old_capa;
+ }
+ else {
+ VALUE *new_ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * new_capa);
+
+ if (new_ptr == NULL) {
+ new_ptr = ALLOC_N(VALUE, new_capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+
+ MEMCPY(new_ptr, ARY_HEAP_PTR(ary), VALUE, old_capa);
+ ARY_SET_PTR(ary, new_ptr);
+ }
+ }
+ else {
+ SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, old_capa);
+ }
+ ary_verify(ary);
+
+ return alloc_capa;
+}
+
+#if USE_TRANSIENT_HEAP
+static inline void
+rb_ary_transient_heap_evacuate_(VALUE ary, int transient, int promote)
+{
+ if (transient) {
+ assert(!ARY_SHARED_ROOT_P(ary));
+
+ VALUE *new_ptr;
+ const VALUE *old_ptr = ARY_HEAP_PTR(ary);
+ long capa = ARY_HEAP_CAPA(ary);
+
+ assert(ARY_OWNS_HEAP_P(ary));
+ assert(RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_PTR_USING_P(ary));
+
+ if (promote) {
+ new_ptr = ALLOC_N(VALUE, capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ new_ptr = ary_heap_alloc(ary, capa);
+ }
+
+ MEMCPY(new_ptr, old_ptr, VALUE, capa);
+ /* do not use ARY_SET_PTR() because they assert !frozen */
+ RARRAY(ary)->as.heap.ptr = new_ptr;
+ }
+
+ ary_verify(ary);
+}
+
+void
+rb_ary_transient_heap_evacuate(VALUE ary, int promote)
+{
+ rb_ary_transient_heap_evacuate_(ary, RARRAY_TRANSIENT_P(ary), promote);
+}
+
+void
+rb_ary_detransient(VALUE ary)
+{
+ assert(RARRAY_TRANSIENT_P(ary));
+ rb_ary_transient_heap_evacuate_(ary, TRUE, TRUE);
+}
+#else
+void
+rb_ary_detransient(VALUE ary)
+{
+ /* do nothing */
+}
+#endif
+
+void
+rb_ary_make_embedded(VALUE ary)
+{
+ assert(rb_ary_embeddable_p(ary));
+ if (!ARY_EMBED_P(ary)) {
+ const VALUE *buf = ARY_HEAP_PTR(ary);
+ long len = ARY_HEAP_LEN(ary);
+ bool was_transient = RARRAY_TRANSIENT_P(ary);
+
+ // FL_SET_EMBED also unsets the transient flag
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, len);
+
+ MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
+
+ if (!was_transient) {
+ ary_heap_free_ptr(ary, buf, len * sizeof(VALUE));
+ }
+ }
+}
+
static void
ary_resize_capa(VALUE ary, long capacity)
{
assert(RARRAY_LEN(ary) <= capacity);
assert(!OBJ_FROZEN(ary));
assert(!ARY_SHARED_P(ary));
- if (capacity > RARRAY_EMBED_LEN_MAX) {
+
+ if (capacity > ary_embed_capa(ary)) {
+ size_t new_capa = capacity;
if (ARY_EMBED_P(ary)) {
long len = ARY_EMBED_LEN(ary);
- VALUE *ptr = ALLOC_N(VALUE, (capacity));
+ VALUE *ptr = ary_heap_alloc(ary, capacity);
+
MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
FL_UNSET_EMBED(ary);
ARY_SET_PTR(ary, ptr);
ARY_SET_HEAP_LEN(ary, len);
}
else {
- SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+ new_capa = ary_heap_realloc(ary, capacity);
}
- ARY_SET_CAPA(ary, (capacity));
+ ARY_SET_CAPA(ary, new_capa);
}
else {
if (!ARY_EMBED_P(ary)) {
- long len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
+ long len = ARY_HEAP_LEN(ary);
+ long old_capa = ARY_HEAP_CAPA(ary);
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
- if (len > capacity) len = capacity;
+ if (len > capacity) len = capacity;
MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+ ary_heap_free_ptr(ary, ptr, old_capa);
+
FL_SET_EMBED(ary);
ARY_SET_LEN(ary, len);
- ruby_xfree((VALUE *)ptr);
}
}
+
+ ary_verify(ary);
}
static inline void
ary_shrink_capa(VALUE ary)
{
long capacity = ARY_HEAP_LEN(ary);
- long old_capa = RARRAY(ary)->as.heap.aux.capa;
+ long old_capa = ARY_HEAP_CAPA(ary);
assert(!ARY_SHARED_P(ary));
assert(old_capa >= capacity);
- if (old_capa > capacity)
- REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
+ if (old_capa > capacity) ary_heap_realloc(ary, capacity);
+
+ ary_verify(ary);
}
static void
@@ -248,106 +587,121 @@ ary_double_capa(VALUE ary, long min)
long new_capa = ARY_CAPA(ary) / 2;
if (new_capa < ARY_DEFAULT_SIZE) {
- new_capa = ARY_DEFAULT_SIZE;
+ new_capa = ARY_DEFAULT_SIZE;
}
if (new_capa >= ARY_MAX_SIZE - min) {
- new_capa = (ARY_MAX_SIZE - min) / 2;
+ new_capa = (ARY_MAX_SIZE - min) / 2;
}
new_capa += min;
ary_resize_capa(ary, new_capa);
+
+ ary_verify(ary);
}
static void
-rb_ary_decrement_share(VALUE shared)
+rb_ary_decrement_share(VALUE shared_root)
{
- if (shared) {
- long num = ARY_SHARED_NUM(shared) - 1;
- if (num == 0) {
- rb_ary_free(shared);
- rb_gc_force_recycle(shared);
- }
- else if (num > 0) {
- ARY_SET_SHARED_NUM(shared, num);
- }
+ if (!OBJ_FROZEN(shared_root)) {
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
}
}
static void
rb_ary_unshare(VALUE ary)
{
- VALUE shared = RARRAY(ary)->as.heap.aux.shared;
- rb_ary_decrement_share(shared);
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ rb_ary_decrement_share(shared_root);
FL_UNSET_SHARED(ary);
}
-static inline void
-rb_ary_unshare_safe(VALUE ary)
+static void
+rb_ary_reset(VALUE ary)
{
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
+ if (ARY_OWNS_HEAP_P(ary)) {
+ ary_heap_free(ary);
+ }
+ else if (ARY_SHARED_P(ary)) {
+ rb_ary_unshare(ary);
}
+
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
}
static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_increment_share(VALUE shared_root)
{
- long num = ARY_SHARED_NUM(shared);
- if (num >= 0) {
- ARY_SET_SHARED_NUM(shared, num + 1);
+ if (!OBJ_FROZEN(shared_root)) {
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+ assert(num >= 0);
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
}
- return shared;
+ return shared_root;
}
static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
{
- rb_ary_increment_share(shared);
+ rb_ary_increment_share(shared_root);
FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, shared);
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, shared_root);
}
static inline void
rb_ary_modify_check(VALUE ary)
{
rb_check_frozen(ary);
+ ary_verify(ary);
}
void
-rb_ary_modify(VALUE ary)
+rb_ary_cancel_sharing(VALUE ary)
{
- rb_ary_modify_check(ary);
if (ARY_SHARED_P(ary)) {
- long shared_len, len = RARRAY_LEN(ary);
- VALUE shared = ARY_SHARED(ary);
- if (len <= RARRAY_EMBED_LEN_MAX) {
- const VALUE *ptr = ARY_HEAP_PTR(ary);
+ long shared_len, len = RARRAY_LEN(ary);
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+ ary_verify(shared_root);
+
+ if (len <= ary_embed_capa(ary)) {
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
FL_UNSET_SHARED(ary);
FL_SET_EMBED(ary);
- MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
- rb_ary_decrement_share(shared);
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+ rb_ary_decrement_share(shared_root);
ARY_SET_EMBED_LEN(ary, len);
}
- else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
- long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
- FL_UNSET_SHARED(ary);
- ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
- ARY_SET_CAPA(ary, shared_len);
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr+shift, VALUE, len);
- });
- FL_SET_EMBED(shared);
- rb_ary_decrement_share(shared);
- }
+ else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+ long shift = RARRAY_CONST_PTR_TRANSIENT(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root);
+ FL_UNSET_SHARED(ary);
+ ARY_SET_PTR(ary, RARRAY_CONST_PTR_TRANSIENT(shared_root));
+ ARY_SET_CAPA(ary, shared_len);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr+shift, VALUE, len);
+ });
+ FL_SET_EMBED(shared_root);
+ rb_ary_decrement_share(shared_root);
+ }
else {
- VALUE *ptr = ALLOC_N(VALUE, len);
- MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+ VALUE *ptr = ary_heap_alloc(ary, len);
+ MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
rb_ary_unshare(ary);
ARY_SET_CAPA(ary, len);
ARY_SET_PTR(ary, ptr);
}
- rb_gc_writebarrier_remember(ary);
+ rb_gc_writebarrier_remember(ary);
}
+ ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+ rb_ary_modify_check(ary);
+ rb_ary_cancel_sharing(ary);
}
static VALUE
@@ -358,45 +712,58 @@ ary_ensure_room_for_push(VALUE ary, long add_len)
long capa;
if (old_len > ARY_MAX_SIZE - add_len) {
- rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ rb_raise(rb_eIndexError, "index %ld too big", new_len);
}
if (ARY_SHARED_P(ary)) {
- if (new_len > RARRAY_EMBED_LEN_MAX) {
- VALUE shared = ARY_SHARED(ary);
- if (ARY_SHARED_OCCUPIED(shared)) {
- if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
- rb_ary_modify_check(ary);
- return shared;
- }
- else {
- /* if array is shared, then it is likely it participate in push/shift pattern */
- rb_ary_modify(ary);
- capa = ARY_CAPA(ary);
- if (new_len > capa - (capa >> 6)) {
- ary_double_capa(ary, new_len);
- }
- return ary;
- }
- }
- }
+ if (new_len > ary_embed_capa(ary)) {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+ if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+ rb_ary_modify_check(ary);
+
+ ary_verify(ary);
+ ary_verify(shared_root);
+ return shared_root;
+ }
+ else {
+ /* if array is shared, then it is likely it participate in push/shift pattern */
+ rb_ary_modify(ary);
+ capa = ARY_CAPA(ary);
+ if (new_len > capa - (capa >> 6)) {
+ ary_double_capa(ary, new_len);
+ }
+ ary_verify(ary);
+ return ary;
+ }
+ }
+ }
+ ary_verify(ary);
+ rb_ary_modify(ary);
+ }
+ else {
+ rb_ary_modify_check(ary);
}
- rb_ary_modify(ary);
capa = ARY_CAPA(ary);
if (new_len > capa) {
- ary_double_capa(ary, new_len);
+ ary_double_capa(ary, new_len);
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.freeze -> ary
+ * array.freeze -> self
*
- * Calls Object#freeze on +ary+ to prevent any further
- * modification. A RuntimeError will be raised if a modification
- * attempt is made.
+ * Freezes +self+; returns +self+:
*
+ * a = []
+ * a.frozen? # => false
+ * a.freeze
+ * a.frozen? # => true
+ *
+ * An attempt to modify a frozen \Array raises FrozenError.
*/
VALUE
@@ -405,21 +772,6 @@ rb_ary_freeze(VALUE ary)
return rb_obj_freeze(ary);
}
-/*
- * call-seq:
- * ary.frozen? -> true or false
- *
- * Return +true+ if this array is frozen (or temporarily frozen
- * while being sorted). See also Object#frozen?
- */
-
-static VALUE
-rb_ary_frozen_p(VALUE ary)
-{
- if (OBJ_FROZEN(ary)) return Qtrue;
- return Qfalse;
-}
-
/* This can be used to take a snapshot of an array (with
e.g. rb_ary_replace) and check later whether the array has been
modified from the snapshot. The snapshot is cheap, though if
@@ -431,18 +783,25 @@ VALUE
rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
{
if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
- !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
- RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
- RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
- return Qtrue;
+ !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+ ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
+ ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
+ return Qtrue;
}
return Qfalse;
}
static VALUE
-ary_alloc(VALUE klass)
+ary_alloc_embed(VALUE klass, long capa)
{
- NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+ size_t size = ary_embed_size(capa);
+ assert(rb_gc_size_allocatable_p(size));
+#if !USE_RVARGC
+ assert(size <= sizeof(struct RArray));
+#endif
+ RVARGC_NEWOBJ_OF(ary, struct RArray, klass,
+ T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ size);
/* Created array is:
* FL_SET_EMBED((VALUE)ary);
* ARY_SET_EMBED_LEN((VALUE)ary, 0);
@@ -451,10 +810,19 @@ ary_alloc(VALUE klass)
}
static VALUE
+ary_alloc_heap(VALUE klass)
+{
+ RVARGC_NEWOBJ_OF(ary, struct RArray, klass,
+ T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ sizeof(struct RArray));
+ return (VALUE)ary;
+}
+
+static VALUE
empty_ary_alloc(VALUE klass)
{
RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
- return ary_alloc(klass);
+ return ary_alloc_embed(klass, 0);
}
static VALUE
@@ -463,20 +831,24 @@ ary_new(VALUE klass, long capa)
VALUE ary,*ptr;
if (capa < 0) {
- rb_raise(rb_eArgError, "negative array size (or size too big)");
+ rb_raise(rb_eArgError, "negative array size (or size too big)");
}
if (capa > ARY_MAX_SIZE) {
- rb_raise(rb_eArgError, "array size too big");
+ rb_raise(rb_eArgError, "array size too big");
}
RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
- ary = ary_alloc(klass);
- if (capa > RARRAY_EMBED_LEN_MAX) {
- ptr = ALLOC_N(VALUE, capa);
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ptr);
+ if (ary_embeddable_p(capa)) {
+ ary = ary_alloc_embed(klass, capa);
+ }
+ else {
+ ary = ary_alloc_heap(klass);
ARY_SET_CAPA(ary, capa);
+ assert(!ARY_EMBED_P(ary));
+
+ ptr = ary_heap_alloc(ary, capa);
+ ARY_SET_PTR(ary, ptr);
ARY_SET_HEAP_LEN(ary, 0);
}
@@ -492,7 +864,7 @@ rb_ary_new_capa(long capa)
VALUE
rb_ary_new(void)
{
- return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+ return rb_ary_new_capa(0);
}
VALUE
@@ -506,7 +878,7 @@ VALUE
va_start(ar, n);
for (i=0; i<n; i++) {
- ARY_SET(ary, i, va_arg(ar, VALUE));
+ ARY_SET(ary, i, va_arg(ar, VALUE));
}
va_end(ar);
@@ -514,30 +886,109 @@ VALUE
return ary;
}
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
+{
+ VALUE ary;
+
+ ary = ary_new(klass, n);
+ if (n > 0 && elts) {
+ ary_memcpy(ary, 0, n, elts);
+ ARY_SET_LEN(ary, n);
+ }
+
+ return ary;
+}
+
VALUE
rb_ary_new_from_values(long n, const VALUE *elts)
{
+ return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
+
+static VALUE
+ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+ size_t size = ary_embed_size(capa);
+ assert(rb_gc_size_allocatable_p(size));
+#if !USE_RVARGC
+ assert(size <= sizeof(struct RArray));
+#endif
+ RB_RVARGC_EC_NEWOBJ_OF(ec, ary, struct RArray, klass,
+ T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ size);
+ /* Created array is:
+ * FL_SET_EMBED((VALUE)ary);
+ * ARY_SET_EMBED_LEN((VALUE)ary, 0);
+ */
+ return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
+{
+ RB_RVARGC_EC_NEWOBJ_OF(ec, ary, struct RArray, klass,
+ T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+ sizeof(struct RArray));
+ return (VALUE)ary;
+}
+
+static VALUE
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+ VALUE ary,*ptr;
+
+ if (capa < 0) {
+ rb_raise(rb_eArgError, "negative array size (or size too big)");
+ }
+ if (capa > ARY_MAX_SIZE) {
+ rb_raise(rb_eArgError, "array size too big");
+ }
+
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+ if (ary_embeddable_p(capa)) {
+ ary = ec_ary_alloc_embed(ec, klass, capa);
+ }
+ else {
+ ary = ec_ary_alloc_heap(ec, klass);
+ ARY_SET_CAPA(ary, capa);
+ assert(!ARY_EMBED_P(ary));
+
+ ptr = ary_heap_alloc(ary, capa);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_HEAP_LEN(ary, 0);
+ }
+
+ return ary;
+}
+
+VALUE
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
+{
VALUE ary;
- ary = rb_ary_new2(n);
+ ary = ec_ary_new(ec, rb_cArray, n);
if (n > 0 && elts) {
- ary_memcpy(ary, 0, n, elts);
- ARY_SET_LEN(ary, n);
+ ary_memcpy(ary, 0, n, elts);
+ ARY_SET_LEN(ary, n);
}
return ary;
}
VALUE
-rb_ary_tmp_new(long capa)
+rb_ary_hidden_new(long capa)
{
- return ary_new(0, capa);
+ VALUE ary = ary_new(0, capa);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ return ary;
}
VALUE
-rb_ary_tmp_new_fill(long capa)
+rb_ary_hidden_new_fill(long capa)
{
- VALUE ary = ary_new(0, capa);
+ VALUE ary = rb_ary_hidden_new(capa);
ary_memfill(ary, 0, capa, Qnil);
ARY_SET_LEN(ary, capa);
return ary;
@@ -547,7 +998,29 @@ void
rb_ary_free(VALUE ary)
{
if (ARY_OWNS_HEAP_P(ary)) {
- ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ if (USE_DEBUG_COUNTER &&
+ !ARY_SHARED_ROOT_P(ary) &&
+ ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+ }
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_transient);
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+ ary_heap_free(ary);
+ }
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_embed);
+ }
+
+ if (ARY_SHARED_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared);
+ }
+ if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
}
}
@@ -555,51 +1028,69 @@ RUBY_FUNC_EXPORTED size_t
rb_ary_memsize(VALUE ary)
{
if (ARY_OWNS_HEAP_P(ary)) {
- return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+ return ARY_CAPA(ary) * sizeof(VALUE);
}
else {
- return 0;
+ return 0;
}
}
-static inline void
-ary_discard(VALUE ary)
-{
- rb_ary_free(ary);
- RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
static VALUE
ary_make_shared(VALUE ary)
{
- assert(!ARY_EMBED_P(ary));
+ assert(USE_RVARGC || !ARY_EMBED_P(ary));
+ ary_verify(ary);
+
if (ARY_SHARED_P(ary)) {
- return ARY_SHARED(ary);
+ return ARY_SHARED_ROOT(ary);
}
else if (ARY_SHARED_ROOT_P(ary)) {
- return ary;
+ return ary;
}
else if (OBJ_FROZEN(ary)) {
- ary_shrink_capa(ary);
- FL_SET_SHARED_ROOT(ary);
- ARY_SET_SHARED_NUM(ary, 1);
- return ary;
+ if (!ARY_EMBED_P(ary)) {
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ ary_shrink_capa(ary);
+ }
+ return ary;
}
else {
- long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
- NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
- FL_UNSET_EMBED(shared);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+
+ long capa = ARY_CAPA(ary);
+ long len = RARRAY_LEN(ary);
+
+ /* Shared roots cannot be embedded because the reference count
+ * (refcnt) is stored in as.heap.aux.capa. */
+ VALUE shared = ary_alloc_heap(0);
+ FL_SET_SHARED_ROOT(shared);
+
+ if (ARY_EMBED_P(ary)) {
+ /* Cannot use ary_heap_alloc because we don't want to allocate
+ * on the transient heap. */
+ VALUE *ptr = ALLOC_N(VALUE, capa);
+ ARY_SET_PTR(shared, ptr);
+ ary_memcpy(shared, 0, len, RARRAY_PTR(ary));
- ARY_SET_LEN((VALUE)shared, capa);
- ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
- ary_mem_clear((VALUE)shared, len, capa - len);
- FL_SET_SHARED_ROOT(shared);
- ARY_SET_SHARED_NUM((VALUE)shared, 1);
- FL_SET_SHARED(ary);
- ARY_SET_SHARED(ary, (VALUE)shared);
- OBJ_FREEZE(shared);
- return (VALUE)shared;
+ FL_UNSET_EMBED(ary);
+ ARY_SET_HEAP_LEN(ary, len);
+ ARY_SET_PTR(ary, ptr);
+ }
+ else {
+ ARY_SET_PTR(shared, RARRAY_PTR(ary));
+ }
+
+ ARY_SET_LEN(shared, capa);
+ ary_mem_clear(shared, len, capa - len);
+ ARY_SET_SHARED_ROOT_REFCNT(shared, 1);
+ FL_SET_SHARED(ary);
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, shared);
+
+ ary_verify(shared);
+ ary_verify(ary);
+
+ return shared;
}
}
@@ -608,9 +1099,11 @@ ary_make_substitution(VALUE ary)
{
long len = RARRAY_LEN(ary);
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE subst = rb_ary_new2(len);
- ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+ if (ary_embeddable_p(len)) {
+ VALUE subst = rb_ary_new_capa(len);
+ assert(ARY_EMBED_P(subst));
+
+ ary_memcpy(subst, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
ARY_SET_EMBED_LEN(subst, len);
return subst;
}
@@ -625,35 +1118,43 @@ rb_assoc_new(VALUE car, VALUE cdr)
return rb_ary_new3(2, car, cdr);
}
-static VALUE
-to_ary(VALUE ary)
+VALUE
+rb_to_array_type(VALUE ary)
{
- return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
}
+#define to_ary rb_to_array_type
VALUE
rb_check_array_type(VALUE ary)
{
- return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_check_to_array(VALUE ary)
+{
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+VALUE
+rb_to_array(VALUE ary)
+{
+ return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
}
/*
* call-seq:
- * Array.try_convert(obj) -> array or nil
+ * Array.try_convert(object) -> object, new_array, or nil
*
- * Tries to convert +obj+ into an array, using +to_ary+ method. Returns the
- * converted array or +nil+ if +obj+ cannot be converted for any reason.
- * This method can be used to check if an argument is an array.
+ * If +object+ is an \Array object, returns +object+.
*
- * Array.try_convert([1]) #=> [1]
- * Array.try_convert("1") #=> nil
+ * Otherwise if +object+ responds to <tt>:to_ary</tt>,
+ * calls <tt>object.to_ary</tt> and returns the result.
*
- * if tmp = Array.try_convert(arg)
- * # the argument is an array
- * elsif tmp = String.try_convert(arg)
- * # the argument is a string
- * end
+ * Returns +nil+ if +object+ does not respond to <tt>:to_ary</tt>
*
+ * Raises an exception unless <tt>object.to_ary</tt> returns an \Array object.
*/
static VALUE
@@ -662,60 +1163,76 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
return rb_check_array_type(ary);
}
+/* :nodoc: */
+static VALUE
+rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
+{
+ VALUE ary;
+
+ if (klass == rb_cArray) {
+ long size = 0;
+ if (argc > 0 && FIXNUM_P(argv[0])) {
+ size = FIX2LONG(argv[0]);
+ if (size < 0) size = 0;
+ }
+
+ ary = ary_new(klass, size);
+
+ rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
+ }
+ else {
+ ary = rb_class_new_instance_pass_kw(argc, argv, klass);
+ }
+
+ return ary;
+}
+
/*
* call-seq:
- * Array.new(size=0, default=nil)
- * Array.new(array)
- * Array.new(size) {|index| block }
+ * Array.new -> new_empty_array
+ * Array.new(array) -> new_array
+ * Array.new(size) -> new_array
+ * Array.new(size, default_value) -> new_array
+ * Array.new(size) {|index| ... } -> new_array
*
- * Returns a new array.
+ * Returns a new \Array.
*
- * In the first form, if no arguments are sent, the new array will be empty.
- * When a +size+ and an optional +default+ are sent, an array is created with
- * +size+ copies of +default+. Take notice that all elements will reference the
- * same object +default+.
+ * With no block and no arguments, returns a new empty \Array object.
*
- * The second form creates a copy of the array passed as a parameter (the
- * array is generated by calling to_ary on the parameter).
+ * With no block and a single \Array argument +array+,
+ * returns a new \Array formed from +array+:
*
- * first_array = ["Matz", "Guido"]
+ * a = Array.new([:foo, 'bar', 2])
+ * a.class # => Array
+ * a # => [:foo, "bar", 2]
*
- * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ * With no block and a single \Integer argument +size+,
+ * returns a new \Array of the given size
+ * whose elements are all +nil+:
*
- * first_array.equal? second_array #=> false
+ * a = Array.new(3)
+ * a # => [nil, nil, nil]
*
- * In the last form, an array of the given size is created. Each element in
- * this array is created by passing the element's index to the given block
- * and storing the return value.
+ * With no block and arguments +size+ and +default_value+,
+ * returns an \Array of the given size;
+ * each element is that same +default_value+:
*
- * Array.new(3){ |index| index ** 2 }
- * # => [0, 1, 4]
+ * a = Array.new(3, 'x')
+ * a # => ['x', 'x', 'x']
*
- * == Common gotchas
+ * With a block and argument +size+,
+ * returns an \Array of the given size;
+ * the block is called with each successive integer +index+;
+ * the element for that +index+ is the return value from the block:
*
- * When sending the second parameter, the same object will be used as the
- * value for all the array elements:
+ * a = Array.new(3) {|index| "Element #{index}" }
+ * a # => ["Element 0", "Element 1", "Element 2"]
*
- * a = Array.new(2, Hash.new)
- * # => [{}, {}]
- *
- * a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
- *
- * a[1]['cat'] = 'Felix'
- * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- * Since all the Array elements store the same hash, changes to one of them
- * will affect them all.
- *
- * If multiple copies are what you want, you should use the block
- * version which uses the result of that block each time an element
- * of the array needs to be initialized:
- *
- * a = Array.new(2) { Hash.new }
- * a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {}]
+ * Raises ArgumentError if +size+ is negative.
*
+ * With a block and no argument,
+ * or a single argument +0+,
+ * ignores the block and returns a new empty \Array.
*/
static VALUE
@@ -726,51 +1243,48 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
rb_ary_modify(ary);
if (argc == 0) {
- if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
- ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
- }
- rb_ary_unshare_safe(ary);
- FL_SET_EMBED(ary);
- ARY_SET_EMBED_LEN(ary, 0);
- if (rb_block_given_p()) {
- rb_warning("given block not used");
- }
- return ary;
+ rb_ary_reset(ary);
+ assert(ARY_EMBED_P(ary));
+ assert(ARY_EMBED_LEN(ary) == 0);
+ if (rb_block_given_p()) {
+ rb_warning("given block not used");
+ }
+ return ary;
}
rb_scan_args(argc, argv, "02", &size, &val);
if (argc == 1 && !FIXNUM_P(size)) {
- val = rb_check_array_type(size);
- if (!NIL_P(val)) {
- rb_ary_replace(ary, val);
- return ary;
- }
+ val = rb_check_array_type(size);
+ if (!NIL_P(val)) {
+ rb_ary_replace(ary, val);
+ return ary;
+ }
}
len = NUM2LONG(size);
/* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
if (len < 0) {
- rb_raise(rb_eArgError, "negative array size");
+ rb_raise(rb_eArgError, "negative array size");
}
if (len > ARY_MAX_SIZE) {
- rb_raise(rb_eArgError, "array size too big");
+ rb_raise(rb_eArgError, "array size too big");
}
/* recheck after argument conversion */
rb_ary_modify(ary);
ary_resize_capa(ary, len);
if (rb_block_given_p()) {
- long i;
+ long i;
- if (argc == 2) {
- rb_warn("block supersedes default value argument");
- }
- for (i=0; i<len; i++) {
- rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
- ARY_SET_LEN(ary, i + 1);
- }
+ if (argc == 2) {
+ rb_warn("block supersedes default value argument");
+ }
+ for (i=0; i<len; i++) {
+ rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+ ARY_SET_LEN(ary, i + 1);
+ }
}
else {
- ary_memfill(ary, 0, len, val);
- ARY_SET_LEN(ary, len);
+ ary_memfill(ary, 0, len, val);
+ ARY_SET_LEN(ary, len);
}
return ary;
}
@@ -778,7 +1292,7 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
/*
* Returns a new array populated with the given objects.
*
- * Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ * Array.[]( 1, 'a', /^A/) # => [1, "a", /^A/]
* Array[ 1, 'a', /^A/ ] # => [1, "a", /^A/]
* [ 1, 'a', /^A/ ] # => [1, "a", /^A/]
*/
@@ -801,26 +1315,26 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
long len = RARRAY_LEN(ary);
if (idx < 0) {
- idx += len;
- if (idx < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- idx - len, -len);
- }
+ idx += len;
+ if (idx < 0) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ idx - len, -len);
+ }
}
else if (idx >= ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", idx);
+ rb_raise(rb_eIndexError, "index %ld too big", idx);
}
rb_ary_modify(ary);
if (idx >= ARY_CAPA(ary)) {
- ary_double_capa(ary, idx);
+ ary_double_capa(ary, idx);
}
if (idx > len) {
- ary_mem_clear(ary, len, idx - len + 1);
+ ary_mem_clear(ary, len, idx - len + 1);
}
if (idx >= len) {
- ARY_SET_LEN(ary, idx + 1);
+ ARY_SET_LEN(ary, idx + 1);
}
ARY_SET(ary, idx, val);
}
@@ -832,31 +1346,87 @@ ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
assert(len >= 0);
assert(offset+len <= RARRAY_LEN(ary));
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE result = ary_alloc(klass);
- ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+ const size_t rarray_embed_capa_max = (sizeof(struct RArray) - offsetof(struct RArray, as.ary)) / sizeof(VALUE);
+
+ if ((size_t)len <= rarray_embed_capa_max && ary_embeddable_p(len)) {
+ VALUE result = ary_alloc_embed(klass, len);
+ ary_memcpy(result, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary) + offset);
ARY_SET_EMBED_LEN(result, len);
return result;
}
else {
- VALUE shared, result = ary_alloc(klass);
- FL_UNSET_EMBED(result);
+ VALUE shared = ary_make_shared(ary);
+
+ VALUE result = ary_alloc_heap(klass);
+ assert(!ARY_EMBED_P(result));
- shared = ary_make_shared(ary);
- ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+ ARY_SET_PTR(result, RARRAY_CONST_PTR_TRANSIENT(ary));
ARY_SET_LEN(result, RARRAY_LEN(ary));
rb_ary_set_shared(result, shared);
ARY_INCREASE_PTR(result, offset);
ARY_SET_LEN(result, len);
+
+ ary_verify(shared);
+ ary_verify(result);
return result;
}
}
static VALUE
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
+{
+ assert(offset >= 0);
+ assert(len >= 0);
+ assert(offset+len <= RARRAY_LEN(ary));
+ assert(step != 0);
+
+ const VALUE *values = RARRAY_CONST_PTR_TRANSIENT(ary);
+ const long orig_len = len;
+
+ if (step > 0 && step >= len) {
+ VALUE result = ary_new(klass, 1);
+ VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+ RB_OBJ_WRITE(result, ptr, values[offset]);
+ ARY_SET_EMBED_LEN(result, 1);
+ return result;
+ }
+ else if (step < 0 && step < -len) {
+ step = -len;
+ }
+
+ long ustep = (step < 0) ? -step : step;
+ len = roomof(len, ustep);
+
+ long i;
+ long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+
+ VALUE result = ary_new(klass, len);
+ if (ARY_EMBED_P(result)) {
+ VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+ for (i = 0; i < len; ++i) {
+ RB_OBJ_WRITE(result, ptr+i, values[j]);
+ j += step;
+ }
+ ARY_SET_EMBED_LEN(result, len);
+ }
+ else {
+ RARRAY_PTR_USE_TRANSIENT(result, ptr, {
+ for (i = 0; i < len; ++i) {
+ RB_OBJ_WRITE(result, ptr+i, values[j]);
+ j += step;
+ }
+ });
+ ARY_SET_LEN(result, len);
+ }
+
+ return result;
+}
+
+static VALUE
ary_make_shared_copy(VALUE ary)
{
- return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+ return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
}
enum ary_take_pos_flags
@@ -868,48 +1438,57 @@ enum ary_take_pos_flags
static VALUE
ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
{
- VALUE nv;
long n;
long len;
long offset = 0;
- rb_scan_args(argc, argv, "1", &nv);
- n = NUM2LONG(nv);
+ argc = rb_check_arity(argc, 0, 1);
+ /* the case optional argument is omitted should be handled in
+ * callers of this function. if another arity case is added,
+ * this arity check needs to rewrite. */
+ RUBY_ASSERT_ALWAYS(argc == 1);
+
+ n = NUM2LONG(argv[0]);
len = RARRAY_LEN(ary);
if (n > len) {
- n = len;
+ n = len;
}
else if (n < 0) {
- rb_raise(rb_eArgError, "negative array size");
+ rb_raise(rb_eArgError, "negative array size");
}
if (last) {
- offset = len - n;
+ offset = len - n;
}
return ary_make_partial(ary, rb_cArray, offset, n);
}
/*
* call-seq:
- * ary << obj -> ary
+ * array << object -> self
+ *
+ * Appends +object+ to +self+; returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a << :baz # => [:foo, "bar", 2, :baz]
*
- * Append---Pushes the given object on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together.
+ * Appends +object+ as one element, even if it is another \Array:
*
- * [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- * #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
+ * a = [:foo, 'bar', 2]
+ * a1 = a << [3, 4]
+ * a1 # => [:foo, "bar", 2, [3, 4]]
*
*/
VALUE
rb_ary_push(VALUE ary, VALUE item)
{
- long idx = RARRAY_LEN(ary);
+ long idx = RARRAY_LEN((ary_verify(ary), ary));
VALUE target_ary = ary_ensure_room_for_push(ary, 1);
- RARRAY_PTR_USE(ary, ptr, {
- RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ RB_OBJ_WRITE(target_ary, &ptr[idx], item);
});
ARY_SET_LEN(ary, idx + 1);
+ ary_verify(ary);
return ary;
}
@@ -925,18 +1504,24 @@ rb_ary_cat(VALUE ary, const VALUE *argv, long len)
/*
* call-seq:
- * ary.push(obj, ... ) -> ary
- *
- * Append --- Pushes the given object(s) on to the end of this array. This
- * expression returns the array itself, so several appends
- * may be chained together. See also Array#pop for the opposite
- * effect.
- *
- * a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
- * #=> ["a", "b", "c", "d", "e", "f"]
- * [1, 2, 3].push(4).push(5)
- * #=> [1, 2, 3, 4, 5]
+ * array.push(*objects) -> self
+ *
+ * Appends trailing elements.
+ *
+ * Appends each argument in +objects+ to +self+; returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.push(:baz, :bat) # => [:foo, "bar", 2, :baz, :bat]
+ *
+ * Appends each argument as one element, even if it is another \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.push([:baz, :bat], [:bam, :bad])
+ * a1 # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
+ *
+ * Array#append is an alias for Array#push.
+ *
+ * Related: #pop, #shift, #unshift.
*/
static VALUE
@@ -953,32 +1538,46 @@ rb_ary_pop(VALUE ary)
n = RARRAY_LEN(ary);
if (n == 0) return Qnil;
if (ARY_OWNS_HEAP_P(ary) &&
- n * 3 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+ n * 3 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
{
- ary_resize_capa(ary, n * 2);
+ ary_resize_capa(ary, n * 2);
}
--n;
ARY_SET_LEN(ary, n);
+ ary_verify(ary);
return RARRAY_AREF(ary, n);
}
/*
* call-seq:
- * ary.pop -> obj or nil
- * ary.pop(n) -> new_ary
+ * array.pop -> object or nil
+ * array.pop(n) -> new_array
+ *
+ * Removes and returns trailing elements.
+ *
+ * When no argument is given and +self+ is not empty,
+ * removes and returns the last element:
*
- * Removes the last element from +self+ and returns it, or
- * +nil+ if the array is empty.
+ * a = [:foo, 'bar', 2]
+ * a.pop # => 2
+ * a # => [:foo, "bar"]
*
- * If a number +n+ is given, returns an array of the last +n+ elements
- * (or less) just like <code>array.slice!(-n, n)</code> does. See also
- * Array#push for the opposite effect.
+ * Returns +nil+ if the array is empty.
*
- * a = [ "a", "b", "c", "d" ]
- * a.pop #=> "d"
- * a.pop(2) #=> ["b", "c"]
- * a #=> ["a"]
+ * When a non-negative \Integer argument +n+ is given and is in range,
+ *
+ * removes and returns the last +n+ elements in a new \Array:
+ * a = [:foo, 'bar', 2]
+ * a.pop(2) # => ["bar", 2]
+ *
+ * If +n+ is positive and out of range,
+ * removes and returns all elements:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.pop(50) # => [:foo, "bar", 2]
+ *
+ * Related: #push, #shift, #unshift.
*/
static VALUE
@@ -987,12 +1586,13 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
VALUE result;
if (argc == 0) {
- return rb_ary_pop(ary);
+ return rb_ary_pop(ary);
}
rb_ary_modify_check(ary);
result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+ ary_verify(ary);
return result;
}
@@ -1002,52 +1602,49 @@ rb_ary_shift(VALUE ary)
VALUE top;
long len = RARRAY_LEN(ary);
- rb_ary_modify_check(ary);
- if (len == 0) return Qnil;
+ if (len == 0) {
+ rb_ary_modify_check(ary);
+ return Qnil;
+ }
+
top = RARRAY_AREF(ary, 0);
- if (!ARY_SHARED_P(ary)) {
- if (len < ARY_DEFAULT_SIZE) {
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr+1, VALUE, len-1);
- }); /* WB: no new reference */
- ARY_INCREASE_LEN(ary, -1);
- return top;
- }
- assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
-
- ARY_SET(ary, 0, Qnil);
- ary_make_shared(ary);
- }
- else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
- RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
- }
- ARY_INCREASE_PTR(ary, 1); /* shift ptr */
- ARY_INCREASE_LEN(ary, -1);
+
+ rb_ary_behead(ary, 1);
return top;
}
/*
* call-seq:
- * ary.shift -> obj or nil
- * ary.shift(n) -> new_ary
+ * array.shift -> object or nil
+ * array.shift(n) -> new_array
+ *
+ * Removes and returns leading elements.
*
- * Removes the first element of +self+ and returns it (shifting all
- * other elements down by one). Returns +nil+ if the array
- * is empty.
+ * When no argument is given, removes and returns the first element:
*
- * If a number +n+ is given, returns an array of the first +n+ elements
- * (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- * containing only the remainder elements, not including what was shifted to
- * +new_ary+. See also Array#unshift for the opposite effect.
+ * a = [:foo, 'bar', 2]
+ * a.shift # => :foo
+ * a # => ['bar', 2]
*
- * args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
+ * Returns +nil+ if +self+ is empty.
*
- * args = [ "-m", "-q", "filename" ]
- * args.shift(2) #=> ["-m", "-q"]
- * args #=> ["filename"]
+ * When positive \Integer argument +n+ is given, removes the first +n+ elements;
+ * returns those elements in a new \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.shift(2) # => [:foo, 'bar']
+ * a # => [2]
+ *
+ * If +n+ is as large as or larger than <tt>self.length</tt>,
+ * removes all elements; returns those elements in a new \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.shift(3) # => [:foo, 'bar', 2]
+ *
+ * If +n+ is zero, returns a new empty \Array; +self+ is unmodified.
+ *
+ * Related: #push, #pop, #unshift.
*/
static VALUE
@@ -1057,104 +1654,147 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
long n;
if (argc == 0) {
- return rb_ary_shift(ary);
+ return rb_ary_shift(ary);
}
rb_ary_modify_check(ary);
result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
n = RARRAY_LEN(result);
- if (ARY_SHARED_P(ary)) {
- if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
- setup_occupied_shared:
- ary_mem_clear(ary, 0, n);
- }
- ARY_INCREASE_PTR(ary, n);
+ rb_ary_behead(ary,n);
+
+ return result;
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_behead(VALUE ary, long n)
+{
+ if (n <= 0) {
+ return ary;
}
- else {
- if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
- }); /* WB: no new reference */
- }
- else {
- ary_make_shared(ary);
- goto setup_occupied_shared;
- }
+
+ rb_ary_modify_check(ary);
+
+ if (!ARY_SHARED_P(ary)) {
+ if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
+ }); /* WB: no new reference */
+ ARY_INCREASE_LEN(ary, -n);
+ ary_verify(ary);
+ return ary;
+ }
+
+ ary_mem_clear(ary, 0, n);
+ ary_make_shared(ary);
}
+ else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+ ary_mem_clear(ary, 0, n);
+ }
+
+ ARY_INCREASE_PTR(ary, n);
ARY_INCREASE_LEN(ary, -n);
+ ary_verify(ary);
- return result;
+ return ary;
}
static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
+{
+ if (head - sharedp < argc) {
+ long room = capa - len - argc;
+
+ room -= room >> 4;
+ MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+ head = sharedp + argc + room;
+ }
+ ARY_SET_PTR(ary, head - argc);
+ assert(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+ ary_verify(ary);
+ return ARY_SHARED_ROOT(ary);
+}
+
+static VALUE
+ary_modify_for_unshift(VALUE ary, int argc)
{
long len = RARRAY_LEN(ary);
long new_len = len + argc;
long capa;
const VALUE *head, *sharedp;
- if (len > ARY_MAX_SIZE - argc) {
- rb_raise(rb_eIndexError, "index %ld too big", new_len);
- }
-
- if (ARY_SHARED_P(ary)) {
- VALUE shared = ARY_SHARED(ary);
- capa = RARRAY_LEN(shared);
- if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
- head = RARRAY_CONST_PTR(ary);
- sharedp = RARRAY_CONST_PTR(shared);
- goto makeroom_if_need;
- }
- }
-
rb_ary_modify(ary);
capa = ARY_CAPA(ary);
if (capa - (capa >> 6) <= new_len) {
- ary_double_capa(ary, new_len);
+ ary_double_capa(ary, new_len);
}
/* use shared array for big "queues" */
- if (new_len > ARY_DEFAULT_SIZE * 4) {
- /* make a room for unshifted items */
- capa = ARY_CAPA(ary);
- ary_make_shared(ary);
-
- head = sharedp = RARRAY_CONST_PTR(ary);
- goto makeroom;
- makeroom_if_need:
- if (head - sharedp < argc) {
- long room;
- makeroom:
- room = capa - new_len;
- room -= room >> 4;
- MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
- head = sharedp + argc + room;
- }
- ARY_SET_PTR(ary, head - argc);
- assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
- return ARY_SHARED(ary);
+ if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
+ ary_verify(ary);
+
+ /* make a room for unshifted items */
+ capa = ARY_CAPA(ary);
+ ary_make_shared(ary);
+
+ head = sharedp = RARRAY_CONST_PTR_TRANSIENT(ary);
+ return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
}
else {
- /* sliding items */
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr + argc, ptr, VALUE, len);
- });
+ /* sliding items */
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr + argc, ptr, VALUE, len);
+ });
- return ary;
+ ary_verify(ary);
+ return ary;
+ }
+}
+
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+ long len = RARRAY_LEN(ary);
+ long new_len = len + argc;
+
+ if (len > ARY_MAX_SIZE - argc) {
+ rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ }
+ else if (! ARY_SHARED_P(ary)) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ long capa = RARRAY_LEN(shared_root);
+
+ if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else if (new_len > capa) {
+ return ary_modify_for_unshift(ary, argc);
+ }
+ else {
+ const VALUE * head = RARRAY_CONST_PTR_TRANSIENT(ary);
+ void *sharedp = (void *)RARRAY_CONST_PTR_TRANSIENT(shared_root);
+
+ rb_ary_modify_check(ary);
+ return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+ }
}
}
/*
* call-seq:
- * ary.unshift(obj, ...) -> ary
+ * array.unshift(*objects) -> self
*
- * Prepends objects to the front of +self+, moving other elements upwards.
- * See also Array#shift for the opposite effect.
+ * Prepends the given +objects+ to +self+:
*
- * a = [ "b", "c", "d" ]
- * a.unshift("a") #=> ["a", "b", "c", "d"]
- * a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
+ * a = [:foo, 'bar', 2]
+ * a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
+ *
+ * Array#prepend is an alias for Array#unshift.
+ *
+ * Related: #push, #pop, #shift.
*/
static VALUE
@@ -1164,8 +1804,8 @@ rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
VALUE target_ary;
if (argc == 0) {
- rb_ary_modify_check(ary);
- return ary;
+ rb_ary_modify_check(ary);
+ return ary;
}
target_ary = ary_ensure_room_for_unshift(ary, argc);
@@ -1187,7 +1827,7 @@ rb_ary_elt(VALUE ary, long offset)
long len = RARRAY_LEN(ary);
if (len == 0) return Qnil;
if (offset < 0 || len <= offset) {
- return Qnil;
+ return Qnil;
}
return RARRAY_AREF(ary, offset);
}
@@ -1195,21 +1835,11 @@ rb_ary_elt(VALUE ary, long offset)
VALUE
rb_ary_entry(VALUE ary, long offset)
{
- long len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
- if (len == 0) return Qnil;
- if (offset < 0) {
- offset += len;
- if (offset < 0) return Qnil;
- }
- else if (len <= offset) {
- return Qnil;
- }
- return ptr[offset];
+ return rb_ary_entry_internal(ary, offset);
}
VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
{
VALUE klass;
long alen = RARRAY_LEN(ary);
@@ -1218,95 +1848,183 @@ rb_ary_subseq(VALUE ary, long beg, long len)
if (beg < 0 || len < 0) return Qnil;
if (alen < len || alen < beg + len) {
- len = alen - beg;
+ len = alen - beg;
}
- klass = rb_obj_class(ary);
+ klass = rb_cArray;
if (len == 0) return ary_new(klass, 0);
+ if (step == 0)
+ rb_raise(rb_eArgError, "slice step cannot be zero");
+ if (step == 1)
+ return ary_make_partial(ary, klass, beg, len);
+ else
+ return ary_make_partial_step(ary, klass, beg, len, step);
+}
- return ary_make_partial(ary, klass, beg, len);
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+ return rb_ary_subseq_step(ary, beg, len, 1);
}
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
/*
* call-seq:
- * ary[index] -> obj or nil
- * ary[start, length] -> new_ary or nil
- * ary[range] -> new_ary or nil
- * ary.slice(index) -> obj or nil
- * ary.slice(start, length) -> new_ary or nil
- * ary.slice(range) -> new_ary or nil
- *
- * Element Reference --- Returns the element at +index+, or returns a
- * subarray starting at the +start+ index and continuing for +length+
- * elements, or returns a subarray specified by +range+ of indices.
- *
- * Negative indices count backward from the end of the array (-1 is the last
- * element). For +start+ and +range+ cases the starting index is just before
- * an element. Additionally, an empty array is returned when the starting
- * index for an element range is at the end of the array.
- *
- * Returns +nil+ if the index (or starting index) are out of range.
- *
- * a = [ "a", "b", "c", "d", "e" ]
- * a[2] + a[0] + a[1] #=> "cab"
- * a[6] #=> nil
- * a[1, 2] #=> [ "b", "c" ]
- * a[1..3] #=> [ "b", "c", "d" ]
- * a[4..7] #=> [ "e" ]
- * a[6..10] #=> nil
- * a[-3, 3] #=> [ "c", "d", "e" ]
- * # special cases
- * a[5] #=> nil
- * a[6, 1] #=> nil
- * a[5, 1] #=> []
- * a[5..10] #=> []
+ * array[index] -> object or nil
+ * array[start, length] -> object or nil
+ * array[range] -> object or nil
+ * array[aseq] -> object or nil
+ * array.slice(index) -> object or nil
+ * array.slice(start, length) -> object or nil
+ * array.slice(range) -> object or nil
+ * array.slice(aseq) -> object or nil
+ *
+ * Returns elements from +self+; does not modify +self+.
+ *
+ * When a single \Integer argument +index+ is given, returns the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0] # => :foo
+ * a[2] # => 2
+ * a # => [:foo, "bar", 2]
+ *
+ * If +index+ is negative, counts relative to the end of +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-1] # => 2
+ * a[-2] # => "bar"
+ *
+ * If +index+ is out of range, returns +nil+.
+ *
+ * When two \Integer arguments +start+ and +length+ are given,
+ * returns a new \Array of size +length+ containing successive elements beginning at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0, 2] # => [:foo, "bar"]
+ * a[1, 2] # => ["bar", 2]
+ *
+ * If <tt>start + length</tt> is greater than <tt>self.length</tt>,
+ * returns all elements from offset +start+ to the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0, 4] # => [:foo, "bar", 2]
+ * a[1, 3] # => ["bar", 2]
+ * a[2, 2] # => [2]
+ *
+ * If <tt>start == self.size</tt> and <tt>length >= 0</tt>,
+ * returns a new empty \Array.
*
+ * If +length+ is negative, returns +nil+.
+ *
+ * When a single \Range argument +range+ is given,
+ * treats <tt>range.min</tt> as +start+ above
+ * and <tt>range.size</tt> as +length+ above:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0..1] # => [:foo, "bar"]
+ * a[1..2] # => ["bar", 2]
+ *
+ * Special case: If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ * If <tt>range.end</tt> is negative, calculates the end index from the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0..-1] # => [:foo, "bar", 2]
+ * a[0..-2] # => [:foo, "bar"]
+ * a[0..-3] # => [:foo]
+ *
+ * If <tt>range.start</tt> is negative, calculates the start index from the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-1..2] # => [2]
+ * a[-2..2] # => ["bar", 2]
+ * a[-3..2] # => [:foo, "bar", 2]
+ *
+ * If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ * a = [:foo, 'bar', 2]
+ * a[4..1] # => nil
+ * a[4..0] # => nil
+ * a[4..-1] # => nil
+ *
+ * When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ * returns an \Array of elements corresponding to the indexes produced by
+ * the sequence.
+ *
+ * a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ * a[(1..).step(2)] # => ["data1", "data2", "data3"]
+ *
+ * Unlike slicing with range, if the start or the end of the arithmetic sequence
+ * is larger than array size, throws RangeError.
+ *
+ * a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ * a[(1..11).step(2)]
+ * # RangeError (((1..11).step(2)) out of range)
+ * a[(7..).step(2)]
+ * # RangeError (((7..).step(2)) out of range)
+ *
+ * If given a single argument, and its type is not one of the listed, tries to
+ * convert it to Integer, and raises if it is impossible:
+ *
+ * a = [:foo, 'bar', 2]
+ * # Raises TypeError (no implicit conversion of Symbol into Integer):
+ * a[:foo]
+ *
+ * Array#slice is an alias for Array#[].
*/
VALUE
rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
{
- VALUE arg;
- long beg, len;
-
+ rb_check_arity(argc, 1, 2);
if (argc == 2) {
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- if (beg < 0) {
- beg += RARRAY_LEN(ary);
- }
- return rb_ary_subseq(ary, beg, len);
+ return rb_ary_aref2(ary, argv[0], argv[1]);
}
- if (argc != 1) {
- rb_scan_args(argc, argv, "11", NULL, NULL);
+ return rb_ary_aref1(ary, argv[0]);
+}
+
+static VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+ long beg = NUM2LONG(b);
+ long len = NUM2LONG(e);
+ if (beg < 0) {
+ beg += RARRAY_LEN(ary);
}
- arg = argv[0];
+ return rb_ary_subseq(ary, beg, len);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+ long beg, len, step;
+
/* special case - speeding up */
if (FIXNUM_P(arg)) {
- return rb_ary_entry(ary, FIX2LONG(arg));
+ return rb_ary_entry(ary, FIX2LONG(arg));
}
- /* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+ /* check if idx is Range or ArithmeticSequence */
+ switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
case Qfalse:
- break;
+ break;
case Qnil:
- return Qnil;
+ return Qnil;
default:
- return rb_ary_subseq(ary, beg, len);
+ return rb_ary_subseq_step(ary, beg, len, step);
}
+
return rb_ary_entry(ary, NUM2LONG(arg));
}
/*
* call-seq:
- * ary.at(index) -> obj or nil
+ * array.at(index) -> object
*
- * Returns the element at +index+. A negative index counts from the end of
- * +self+. Returns +nil+ if the index is out of range. See also
- * Array#[].
+ * Returns the element at \Integer offset +index+; does not modify +self+.
+ * a = [:foo, 'bar', 2]
+ * a.at(0) # => :foo
+ * a.at(2) # => 2
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.at(0) #=> "a"
- * a.at(-1) #=> "e"
*/
VALUE
@@ -1317,80 +2035,131 @@ rb_ary_at(VALUE ary, VALUE pos)
/*
* call-seq:
- * ary.first -> obj or nil
- * ary.first(n) -> new_ary
+ * array.first -> object or nil
+ * array.first(n) -> new_array
+ *
+ * Returns elements from +self+; does not modify +self+.
+ *
+ * When no argument is given, returns the first element:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.first # => :foo
+ * a # => [:foo, "bar", 2]
+ *
+ * If +self+ is empty, returns +nil+.
*
- * Returns the first element, or the first +n+ elements, of the array.
- * If the array is empty, the first form returns +nil+, and the
- * second form returns an empty array. See also Array#last for
- * the opposite effect.
+ * When non-negative \Integer argument +n+ is given,
+ * returns the first +n+ elements in a new \Array:
*
- * a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(2) #=> ["q", "r"]
+ * a = [:foo, 'bar', 2]
+ * a.first(2) # => [:foo, "bar"]
+ *
+ * If <tt>n >= array.size</tt>, returns all elements:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.first(50) # => [:foo, "bar", 2]
+ *
+ * If <tt>n == 0</tt> returns an new empty \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.first(0) # []
+ *
+ * Related: #last.
*/
-
static VALUE
rb_ary_first(int argc, VALUE *argv, VALUE ary)
{
if (argc == 0) {
- if (RARRAY_LEN(ary) == 0) return Qnil;
- return RARRAY_AREF(ary, 0);
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ return RARRAY_AREF(ary, 0);
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
}
}
/*
* call-seq:
- * ary.last -> obj or nil
- * ary.last(n) -> new_ary
+ * array.last -> object or nil
+ * array.last(n) -> new_array
*
- * Returns the last element(s) of +self+. If the array is empty,
- * the first form returns +nil+.
+ * Returns elements from +self+; +self+ is not modified.
*
- * See also Array#first for the opposite effect.
+ * When no argument is given, returns the last element:
*
- * a = [ "w", "x", "y", "z" ]
- * a.last #=> "z"
- * a.last(2) #=> ["y", "z"]
+ * a = [:foo, 'bar', 2]
+ * a.last # => 2
+ * a # => [:foo, "bar", 2]
+ *
+ * If +self+ is empty, returns +nil+.
+ *
+ * When non-negative \Integer argument +n+ is given,
+ * returns the last +n+ elements in a new \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.last(2) # => ["bar", 2]
+ *
+ * If <tt>n >= array.size</tt>, returns all elements:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.last(50) # => [:foo, "bar", 2]
+ *
+ * If <tt>n == 0</tt>, returns an new empty \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.last(0) # []
+ *
+ * Related: #first.
*/
VALUE
rb_ary_last(int argc, const VALUE *argv, VALUE ary)
{
if (argc == 0) {
- long len = RARRAY_LEN(ary);
- if (len == 0) return Qnil;
- return RARRAY_AREF(ary, len-1);
+ long len = RARRAY_LEN(ary);
+ if (len == 0) return Qnil;
+ return RARRAY_AREF(ary, len-1);
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
}
}
/*
* call-seq:
- * ary.fetch(index) -> obj
- * ary.fetch(index, default) -> obj
- * ary.fetch(index) { |index| block } -> obj
- *
- * Tries to return the element at position +index+, but throws an IndexError
- * exception if the referenced +index+ lies outside of the array bounds. This
- * error can be prevented by supplying a second argument, which will act as a
- * +default+ value.
- *
- * Alternatively, if a block is given it will only be executed when an
- * invalid +index+ is referenced. Negative values of +index+ count from the
- * end of the array.
- *
- * a = [ 11, 22, 33, 44 ]
- * a.fetch(1) #=> 22
- * a.fetch(-1) #=> 44
- * a.fetch(4, 'cat') #=> "cat"
- * a.fetch(100) { |i| puts "#{i} is out of bounds" }
- * #=> "100 is out of bounds"
+ * array.fetch(index) -> element
+ * array.fetch(index, default_value) -> element
+ * array.fetch(index) {|index| ... } -> element
+ *
+ * Returns the element at offset +index+.
+ *
+ * With the single \Integer argument +index+,
+ * returns the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1) # => "bar"
+ *
+ * If +index+ is negative, counts from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(-1) # => 2
+ * a.fetch(-2) # => "bar"
+ *
+ * With arguments +index+ and +default_value+,
+ * returns the element at offset +index+ if index is in range,
+ * otherwise returns +default_value+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1, nil) # => "bar"
+ *
+ * With argument +index+ and a block,
+ * returns the element at offset +index+ if index is in range
+ * (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ * a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
+ *
*/
static VALUE
@@ -1403,149 +2172,152 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
rb_scan_args(argc, argv, "11", &pos, &ifnone);
block_given = rb_block_given_p();
if (block_given && argc == 2) {
- rb_warn("block supersedes default value argument");
+ rb_warn("block supersedes default value argument");
}
idx = NUM2LONG(pos);
if (idx < 0) {
- idx += RARRAY_LEN(ary);
+ idx += RARRAY_LEN(ary);
}
if (idx < 0 || RARRAY_LEN(ary) <= idx) {
- if (block_given) return rb_yield(pos);
- if (argc == 1) {
- rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
- idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
- }
- return ifnone;
+ if (block_given) return rb_yield(pos);
+ if (argc == 1) {
+ rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+ idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+ }
+ return ifnone;
}
return RARRAY_AREF(ary, idx);
}
/*
* call-seq:
- * ary.find_index(obj) -> int or nil
- * ary.find_index { |item| block } -> int or nil
- * ary.find_index -> Enumerator
- * ary.index(obj) -> int or nil
- * ary.index { |item| block } -> int or nil
- * ary.index -> Enumerator
+ * array.index(object) -> integer or nil
+ * array.index {|element| ... } -> integer or nil
+ * array.index -> new_enumerator
+ *
+ * Returns the index of a specified element.
*
- * Returns the _index_ of the first object in +ary+ such that the object is
- * <code>==</code> to +obj+.
+ * When argument +object+ is given but no block,
+ * returns the index of the first element +element+
+ * for which <tt>object == element</tt>:
*
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+. Returns +nil+ if no
- * match is found.
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.index('bar') # => 1
*
- * See also Array#rindex.
+ * Returns +nil+ if no such element found.
*
- * An Enumerator is returned if neither a block nor argument is given.
+ * When both argument +object+ and a block are given,
+ * calls the block with each successive element;
+ * returns the index of the first element for which the block returns a truthy value:
*
- * a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
- * a.index { |x| x == "b" } #=> 1
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.index {|element| element == 'bar' } # => 1
+ *
+ * Returns +nil+ if the block never returns a truthy value.
+ *
+ * When neither an argument nor a block is given, returns a new Enumerator:
+ *
+ * a = [:foo, 'bar', 2]
+ * e = a.index
+ * e # => #<Enumerator: [:foo, "bar", 2]:index>
+ * e.each {|element| element == 'bar' } # => 1
+ *
+ * Array#find_index is an alias for Array#index.
+ *
+ * Related: #rindex.
*/
static VALUE
rb_ary_index(int argc, VALUE *argv, VALUE ary)
{
- const VALUE *ptr;
VALUE val;
- long i, len;
+ long i;
if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
- return LONG2NUM(i);
- }
- }
- return Qnil;
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ return LONG2NUM(i);
+ }
+ }
+ return Qnil;
}
rb_check_arity(argc, 0, 1);
val = argv[0];
if (rb_block_given_p())
- rb_warn("given block not used");
- len = RARRAY_LEN(ary);
- ptr = RARRAY_CONST_PTR(ary);
- for (i=0; i<len; i++) {
- VALUE e = ptr[i];
- switch (rb_equal_opt(e, val)) {
- case Qundef:
- if (!rb_equal(e, val)) break;
- case Qtrue:
- return LONG2NUM(i);
- case Qfalse:
- continue;
- }
- len = RARRAY_LEN(ary);
- ptr = RARRAY_CONST_PTR(ary);
+ rb_warn("given block not used");
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
+ return LONG2NUM(i);
+ }
}
return Qnil;
}
/*
* call-seq:
- * ary.rindex(obj) -> int or nil
- * ary.rindex { |item| block } -> int or nil
- * ary.rindex -> Enumerator
+ * array.rindex(object) -> integer or nil
+ * array.rindex {|element| ... } -> integer or nil
+ * array.rindex -> new_enumerator
+ *
+ * Returns the index of the last element for which <tt>object == element</tt>.
+ *
+ * When argument +object+ is given but no block, returns the index of the last such element found:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rindex('bar') # => 3
+ *
+ * Returns +nil+ if no such object found.
*
- * Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ * When a block is given but no argument, calls the block with each successive element;
+ * returns the index of the last element for which the block returns a truthy value:
*
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+, starting from the last
- * object.
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rindex {|element| element == 'bar' } # => 3
*
- * Returns +nil+ if no match is found.
+ * Returns +nil+ if the block never returns a truthy value.
*
- * See also Array#index.
+ * When neither an argument nor a block is given, returns a new \Enumerator:
*
- * If neither block nor argument is given, an Enumerator is returned instead.
+ * a = [:foo, 'bar', 2, 'bar']
+ * e = a.rindex
+ * e # => #<Enumerator: [:foo, "bar", 2, "bar"]:rindex>
+ * e.each {|element| element == 'bar' } # => 3
*
- * a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
- * a.rindex { |x| x == "b" } #=> 3
+ * Related: #index.
*/
static VALUE
rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
{
- const VALUE *ptr;
VALUE val;
long i = RARRAY_LEN(ary), len;
if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- while (i--) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
- return LONG2NUM(i);
- if (i > (len = RARRAY_LEN(ary))) {
- i = len;
- }
- }
- return Qnil;
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (i--) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+ return LONG2NUM(i);
+ if (i > (len = RARRAY_LEN(ary))) {
+ i = len;
+ }
+ }
+ return Qnil;
}
rb_check_arity(argc, 0, 1);
val = argv[0];
if (rb_block_given_p())
- rb_warn("given block not used");
- ptr = RARRAY_CONST_PTR(ary);
+ rb_warn("given block not used");
while (i--) {
- VALUE e = ptr[i];
- switch (rb_equal_opt(e, val)) {
- case Qundef:
- if (!rb_equal(e, val)) break;
- case Qtrue:
- return LONG2NUM(i);
- case Qfalse:
- continue;
- }
- if (i > (len = RARRAY_LEN(ary))) {
- i = len;
- }
- ptr = RARRAY_CONST_PTR(ary);
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
+ return LONG2NUM(i);
+ }
+ if (i > RARRAY_LEN(ary)) {
+ break;
+ }
}
return Qnil;
}
@@ -1568,57 +2340,64 @@ rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
olen = RARRAY_LEN(ary);
if (beg < 0) {
- beg += olen;
- if (beg < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- beg - olen, -olen);
- }
+ beg += olen;
+ if (beg < 0) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ beg - olen, -olen);
+ }
}
if (olen < len || olen < beg + len) {
- len = olen - beg;
+ len = olen - beg;
}
{
- const VALUE *optr = RARRAY_CONST_PTR(ary);
- rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+ const VALUE *optr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
}
if (beg >= olen) {
- VALUE target_ary;
- if (beg > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", beg);
- }
- target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
- len = beg + rlen;
- ary_mem_clear(ary, olen, beg - olen);
- if (rlen > 0) {
- if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
- ary_memcpy0(ary, beg, rlen, rptr, target_ary);
- }
- ARY_SET_LEN(ary, len);
+ VALUE target_ary;
+ if (beg > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", beg);
+ }
+ target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+ len = beg + rlen;
+ ary_mem_clear(ary, olen, beg - olen);
+ if (rlen > 0) {
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+ }
+ ARY_SET_LEN(ary, len);
}
else {
- long alen;
-
- if (olen - len > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
- }
- rb_ary_modify(ary);
- alen = olen + rlen - len;
- if (alen >= ARY_CAPA(ary)) {
- ary_double_capa(ary, alen);
- }
-
- if (len != rlen) {
- RARRAY_PTR_USE(ary, ptr,
- MEMMOVE(ptr + beg + rlen, ptr + beg + len,
- VALUE, olen - (beg + len)));
- ARY_SET_LEN(ary, alen);
- }
- if (rlen > 0) {
- if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
- MEMMOVE(RARRAY_PTR(ary) + beg, rptr, VALUE, rlen);
- }
+ long alen;
+
+ if (olen - len > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+ }
+ rb_ary_modify(ary);
+ alen = olen + rlen - len;
+ if (alen >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, alen);
+ }
+
+ if (len != rlen) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+ VALUE, olen - (beg + len)));
+ ARY_SET_LEN(ary, alen);
+ }
+ if (rlen > 0) {
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ /* give up wb-protected ary */
+ RB_OBJ_WB_UNPROTECT_FOR(ARRAY, ary);
+
+ /* do not use RARRAY_PTR() because it can causes GC.
+ * ary can contain T_NONE object because it is not cleared.
+ */
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg, rptr, VALUE, rlen));
+ }
}
}
@@ -1629,22 +2408,14 @@ rb_ary_set_len(VALUE ary, long len)
rb_ary_modify_check(ary);
if (ARY_SHARED_P(ary)) {
- rb_raise(rb_eRuntimeError, "can't set length of shared ");
+ rb_raise(rb_eRuntimeError, "can't set length of shared ");
}
if (len > (capa = (long)ARY_CAPA(ary))) {
- rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+ rb_bug("probable buffer overflow: %ld for %ld", len, capa);
}
ARY_SET_LEN(ary, len);
}
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary an array
- * \param len new size
- * \return \a ary
- * \post the size of \a ary is \a len.
- */
VALUE
rb_ary_resize(VALUE ary, long len)
{
@@ -1654,117 +2425,231 @@ rb_ary_resize(VALUE ary, long len)
olen = RARRAY_LEN(ary);
if (len == olen) return ary;
if (len > ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", len);
+ rb_raise(rb_eIndexError, "index %ld too big", len);
}
if (len > olen) {
- if (len >= ARY_CAPA(ary)) {
- ary_double_capa(ary, len);
- }
- ary_mem_clear(ary, olen, len - olen);
- ARY_SET_LEN(ary, len);
+ if (len >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, len);
+ }
+ ary_mem_clear(ary, olen, len - olen);
+ ARY_SET_LEN(ary, len);
}
else if (ARY_EMBED_P(ary)) {
ARY_SET_EMBED_LEN(ary, len);
}
- else if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE tmp[RARRAY_EMBED_LEN_MAX];
- MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
- ary_discard(ary);
- MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+ else if (len <= ary_embed_capa(ary)) {
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ long ptr_capa = ARY_HEAP_SIZE(ary);
+ bool is_malloc_ptr = !ARY_SHARED_P(ary) && !RARRAY_TRANSIENT_P(ary);
+
+ FL_UNSET(ary, RARRAY_TRANSIENT_FLAG);
+ FL_SET_EMBED(ary);
+
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
ARY_SET_EMBED_LEN(ary, len);
+
+ if (is_malloc_ptr) ruby_sized_xfree((void *)ptr, ptr_capa);
}
else {
- if (olen > len + ARY_DEFAULT_SIZE) {
- SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
- ARY_SET_CAPA(ary, len);
- }
- ARY_SET_HEAP_LEN(ary, len);
+ if (olen > len + ARY_DEFAULT_SIZE) {
+ size_t new_capa = ary_heap_realloc(ary, len);
+ ARY_SET_CAPA(ary, new_capa);
+ }
+ ARY_SET_HEAP_LEN(ary, len);
}
+ ary_verify(ary);
return ary;
}
+static VALUE
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
+{
+ rb_ary_store(ary, key, val);
+ return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+ VALUE rpl = rb_ary_to_ary(val);
+ rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR_TRANSIENT(rpl), RARRAY_LEN(rpl));
+ RB_GC_GUARD(rpl);
+ return val;
+}
+
/*
* call-seq:
- * ary[index] = obj -> obj
- * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
- * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
- *
- * Element Assignment --- Sets the element at +index+, or replaces a subarray
- * from the +start+ index for +length+ elements, or replaces a subarray
- * specified by the +range+ of indices.
- *
- * If indices are greater than the current capacity of the array, the array
- * grows automatically. Elements are inserted into the array at +start+ if
- * +length+ is zero.
- *
- * Negative indices will count backward from the end of the array. For
- * +start+ and +range+ cases the starting index is just before an element.
- *
- * An IndexError is raised if a negative index points past the beginning of
- * the array.
- *
- * See also Array#push, and Array#unshift.
- *
- * a = Array.new
- * a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
- * a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- * a[1..2] = [ 1, 2 ] #=> ["a", 1, 2, nil, "4"]
- * a[0, 2] = "?" #=> ["?", 2, nil, "4"]
- * a[0..2] = "A" #=> ["A", "4"]
- * a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A", nil]
- * a[1..-1] = [] #=> ["A"]
- * a[0, 0] = [ 1, 2 ] #=> [1, 2, "A"]
- * a[3, 0] = "B" #=> [1, 2, "A", "B"]
+ * array[index] = object -> object
+ * array[start, length] = object -> object
+ * array[range] = object -> object
+ *
+ * Assigns elements in +self+; returns the given +object+.
+ *
+ * When \Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ * If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0] = 'foo' # => "foo"
+ * a # => ["foo", "bar", 2]
+ *
+ * If +index+ is greater than <tt>self.length</tt>, extends the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[7] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ * If +index+ is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-1] = 'two' # => "two"
+ * a # => [:foo, "bar", "two"]
+ *
+ * When \Integer arguments +start+ and +length+ are given and +object+ is not an \Array,
+ * removes <tt>length - 1</tt> elements beginning at offset +start+,
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0, 2] = 'foo' # => "foo"
+ * a # => ["foo", 2]
+ *
+ * If +start+ is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-2, 2] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ * extends the array with +nil+, assigns +object+ at offset +start+,
+ * and ignores +length+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[6, 50] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ * If +length+ is zero, shifts elements at and following offset +start+
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1, 0] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ *
+ * If +length+ is too large for the existing array, does not extend the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1, 5] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * When \Range argument +range+ is given and +object+ is an \Array,
+ * removes <tt>length - 1</tt> elements beginning at offset +start+,
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[0..1] = 'foo' # => "foo"
+ * a # => ["foo", 2]
+ *
+ * if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[-2..2] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
+ * If the array length is less than <tt>range.begin</tt>,
+ * assigns +object+ at offset <tt>range.begin</tt>, and ignores +length+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[6..50] = 'foo' # => "foo"
+ * a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ * If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ * and assigns +object+ at offset +start+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1..0] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ *
+ * If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ * retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1..-1] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ * a = [:foo, 'bar', 2]
+ * a[1..-2] = 'foo' # => "foo"
+ * a # => [:foo, "foo", 2]
+ * a = [:foo, 'bar', 2]
+ * a[1..-3] = 'foo' # => "foo"
+ * a # => [:foo, "foo", "bar", 2]
+ * a = [:foo, 'bar', 2]
+ *
+ * If <tt>range.end</tt> is too large for the existing array,
+ * replaces array elements, but does not extend the array with +nil+ values:
+ *
+ * a = [:foo, 'bar', 2]
+ * a[1..5] = 'foo' # => "foo"
+ * a # => [:foo, "foo"]
+ *
*/
static VALUE
rb_ary_aset(int argc, VALUE *argv, VALUE ary)
{
long offset, beg, len;
- VALUE rpl;
+ rb_check_arity(argc, 2, 3);
+ rb_ary_modify_check(ary);
if (argc == 3) {
- rb_ary_modify_check(ary);
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- goto range;
+ beg = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
}
- rb_check_arity(argc, 2, 2);
- rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
- offset = FIX2LONG(argv[0]);
- goto fixnum;
+ offset = FIX2LONG(argv[0]);
+ return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
}
if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
- /* check if idx is Range */
- range:
- rpl = rb_ary_to_ary(argv[argc-1]);
- rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
- RB_GC_GUARD(rpl);
- return argv[argc-1];
+ /* check if idx is Range */
+ return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
}
offset = NUM2LONG(argv[0]);
-fixnum:
- rb_ary_store(ary, offset, argv[1]);
- return argv[1];
+ return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
}
/*
* call-seq:
- * ary.insert(index, obj...) -> ary
+ * array.insert(index, *objects) -> self
+ *
+ * Inserts given +objects+ before or after the element at \Integer index +offset+;
+ * returns +self+.
+ *
+ * When +index+ is non-negative, inserts all given +objects+
+ * before the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.insert(1, :bat, :bam) # => [:foo, :bat, :bam, "bar", 2]
*
- * Inserts the given values before the element with the given +index+.
+ * Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
*
- * Negative indices count backwards from the end of the array, where +-1+ is
- * the last element. If a negative index is used, the given values will be
- * inserted after that element, so using an index of +-1+ will insert the
- * values at the end of the array.
+ * a = [:foo, 'bar', 2]
+ * a.insert(5, :bat, :bam)
+ * a # => [:foo, "bar", 2, nil, nil, :bat, :bam]
+ *
+ * Does nothing if no objects given:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.insert(1)
+ * a.insert(50)
+ * a.insert(-50)
+ * a # => [:foo, "bar", 2]
+ *
+ * When +index+ is negative, inserts all given +objects+
+ * _after_ the element at offset <tt>index+self.size</tt>:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.insert(-2, :bat, :bam)
+ * a # => [:foo, "bar", :bat, :bam, 2]
*
- * a = %w{ a b c d }
- * a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
- * a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
*/
static VALUE
@@ -1774,13 +2659,18 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
rb_ary_modify_check(ary);
- if (argc == 1) return ary;
pos = NUM2LONG(argv[0]);
+ if (argc == 1) return ary;
if (pos == -1) {
- pos = RARRAY_LEN(ary);
+ pos = RARRAY_LEN(ary);
}
- if (pos < 0) {
- pos++;
+ else if (pos < 0) {
+ long minpos = -RARRAY_LEN(ary) - 1;
+ if (pos < minpos) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ pos, minpos);
+ }
+ pos++;
}
rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
return ary;
@@ -1797,50 +2687,104 @@ ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
/*
* call-seq:
- * ary.each { |item| block } -> ary
- * ary.each -> Enumerator
+ * array.each {|element| ... } -> self
+ * array.each -> Enumerator
+ *
+ * Iterates over array elements.
+ *
+ * When a block given, passes each successive array element to the block;
+ * returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ *
+ * Symbol foo
+ * String bar
+ * Integer 2
*
- * Calls the given block once for each element in +self+, passing that element
- * as a parameter. Returns the array itself.
+ * Allows the array to be modified during iteration:
*
- * If no block is given, an Enumerator is returned.
+ * a = [:foo, 'bar', 2]
+ * a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
*
- * a = [ "a", "b", "c" ]
- * a.each {|x| print x, " -- " }
+ * Output:
*
- * produces:
+ * foo
+ * bar
*
- * a -- b -- c --
+ * When no block given, returns a new \Enumerator:
+ * a = [:foo, 'bar', 2]
+ *
+ * e = a.each
+ * e # => #<Enumerator: [:foo, "bar", 2]:each>
+ * a1 = e.each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ *
+ * Symbol foo
+ * String bar
+ * Integer 2
+ *
+ * Related: #each_index, #reverse_each.
*/
VALUE
rb_ary_each(VALUE ary)
{
long i;
-
+ ary_verify(ary);
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_AREF(ary, i));
+ rb_yield(RARRAY_AREF(ary, i));
}
return ary;
}
/*
* call-seq:
- * ary.each_index { |index| block } -> ary
- * ary.each_index -> Enumerator
+ * array.each_index {|index| ... } -> self
+ * array.each_index -> Enumerator
+ *
+ * Iterates over array indexes.
+ *
+ * When a block given, passes each successive array index to the block;
+ * returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.each_index {|index| puts "#{index} #{a[index]}" }
+ *
+ * Output:
+ *
+ * 0 foo
+ * 1 bar
+ * 2 2
+ *
+ * Allows the array to be modified during iteration:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.each_index {|index| puts index; a.clear if index > 0 }
+ *
+ * Output:
+ *
+ * 0
+ * 1
*
- * Same as Array#each, but passes the +index+ of the element instead of the
- * element itself.
+ * When no block given, returns a new \Enumerator:
*
- * An Enumerator is returned if no block is given.
+ * a = [:foo, 'bar', 2]
+ * e = a.each_index
+ * e # => #<Enumerator: [:foo, "bar", 2]:each_index>
+ * a1 = e.each {|index| puts "#{index} #{a[index]}"}
*
- * a = [ "a", "b", "c" ]
- * a.each_index {|x| print x, " -- " }
+ * Output:
*
- * produces:
+ * 0 foo
+ * 1 bar
+ * 2 2
*
- * 0 -- 1 -- 2 --
+ * Related: #each, #reverse_each.
*/
static VALUE
@@ -1850,24 +2794,54 @@ rb_ary_each_index(VALUE ary)
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(LONG2NUM(i));
+ rb_yield(LONG2NUM(i));
}
return ary;
}
/*
* call-seq:
- * ary.reverse_each { |item| block } -> ary
- * ary.reverse_each -> Enumerator
+ * array.reverse_each {|element| ... } -> self
+ * array.reverse_each -> Enumerator
*
- * Same as Array#each, but traverses +self+ in reverse order.
+ * Iterates backwards over array elements.
*
- * a = [ "a", "b", "c" ]
- * a.reverse_each {|x| print x, " " }
+ * When a block given, passes, in reverse order, each element to the block;
+ * returns +self+:
*
- * produces:
+ * a = [:foo, 'bar', 2]
+ * a.reverse_each {|element| puts "#{element.class} #{element}" }
*
- * c b a
+ * Output:
+ *
+ * Integer 2
+ * String bar
+ * Symbol foo
+ *
+ * Allows the array to be modified during iteration:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.reverse_each {|element| puts element; a.clear if element.to_s.start_with?('b') }
+ *
+ * Output:
+ *
+ * 2
+ * bar
+ *
+ * When no block given, returns a new \Enumerator:
+ *
+ * a = [:foo, 'bar', 2]
+ * e = a.reverse_each
+ * e # => #<Enumerator: [:foo, "bar", 2]:reverse_each>
+ * a1 = e.each {|element| puts "#{element.class} #{element}" }
+ *
+ * Output:
+ *
+ * Integer 2
+ * String bar
+ * Symbol foo
+ *
+ * Related: #each, #each_index.
*/
static VALUE
@@ -1878,24 +2852,21 @@ rb_ary_reverse_each(VALUE ary)
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
len = RARRAY_LEN(ary);
while (len--) {
- long nlen;
- rb_yield(RARRAY_AREF(ary, len));
- nlen = RARRAY_LEN(ary);
- if (nlen < len) {
- len = nlen;
- }
+ long nlen;
+ rb_yield(RARRAY_AREF(ary, len));
+ nlen = RARRAY_LEN(ary);
+ if (nlen < len) {
+ len = nlen;
+ }
}
return ary;
}
/*
* call-seq:
- * ary.length -> int
- *
- * Returns the number of elements in +self+. May be zero.
+ * array.length -> an_integer
*
- * [ 1, 2, 3, 4, 5 ].length #=> 5
- * [].length #=> 0
+ * Returns the count of elements in +self+.
*/
static VALUE
@@ -1907,19 +2878,16 @@ rb_ary_length(VALUE ary)
/*
* call-seq:
- * ary.empty? -> true or false
- *
- * Returns +true+ if +self+ contains no elements.
+ * array.empty? -> true or false
*
- * [].empty? #=> true
+ * Returns +true+ if the count of elements in +self+ is zero,
+ * +false+ otherwise.
*/
static VALUE
rb_ary_empty_p(VALUE ary)
{
- if (RARRAY_LEN(ary) == 0)
- return Qtrue;
- return Qfalse;
+ return RBOOL(RARRAY_LEN(ary) == 0);
}
VALUE
@@ -1927,15 +2895,18 @@ rb_ary_dup(VALUE ary)
{
long len = RARRAY_LEN(ary);
VALUE dup = rb_ary_new2(len);
- ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+ ary_memcpy(dup, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
ARY_SET_LEN(dup, len);
+
+ ary_verify(ary);
+ ary_verify(dup);
return dup;
}
VALUE
rb_ary_resurrect(VALUE ary)
{
- return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+ return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
}
extern VALUE rb_output_fs;
@@ -1952,15 +2923,15 @@ recursive_join(VALUE obj, VALUE argp, int recur)
int *first = (int *)arg[3];
if (recur) {
- rb_raise(rb_eArgError, "recursive array join");
+ rb_raise(rb_eArgError, "recursive array join");
}
else {
- ary_join_1(obj, ary, sep, 0, result, first);
+ ary_join_1(obj, ary, sep, 0, result, first);
}
return Qnil;
}
-static void
+static long
ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
{
long i;
@@ -1968,11 +2939,40 @@ ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
for (i=0; i<max; i++) {
- val = RARRAY_AREF(ary, i);
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
- rb_str_buf_append(result, val);
- if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+ val = RARRAY_AREF(ary, i);
+ if (!RB_TYPE_P(val, T_STRING)) break;
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+ rb_str_buf_append(result, val);
+ }
+ return i;
+}
+
+static void
+ary_join_1_str(VALUE dst, VALUE src, int *first)
+{
+ rb_str_buf_append(dst, src);
+ if (*first) {
+ rb_enc_copy(dst, src);
+ *first = FALSE;
+ }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+ if (val == ary) {
+ rb_raise(rb_eArgError, "recursive array join");
+ }
+ else {
+ VALUE args[4];
+
+ *first = FALSE;
+ args[0] = val;
+ args[1] = sep;
+ args[2] = result;
+ args[3] = (VALUE)first;
+ rb_exec_recursive(recursive_join, obj, (VALUE)args);
}
}
@@ -1982,50 +2982,25 @@ ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
VALUE val, tmp;
for (; i<RARRAY_LEN(ary); i++) {
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
-
- val = RARRAY_AREF(ary, i);
- if (RB_TYPE_P(val, T_STRING)) {
- str_join:
- rb_str_buf_append(result, val);
- *first = FALSE;
- }
- else if (RB_TYPE_P(val, T_ARRAY)) {
- obj = val;
- ary_join:
- if (val == ary) {
- rb_raise(rb_eArgError, "recursive array join");
- }
- else {
- VALUE args[4];
-
- args[0] = val;
- args[1] = sep;
- args[2] = result;
- args[3] = (VALUE)first;
- rb_exec_recursive(recursive_join, obj, (VALUE)args);
- }
- }
- else {
- tmp = rb_check_string_type(val);
- if (!NIL_P(tmp)) {
- val = tmp;
- goto str_join;
- }
- tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
- if (!NIL_P(tmp)) {
- obj = val;
- val = tmp;
- goto ary_join;
- }
- val = rb_obj_as_string(val);
- if (*first) {
- rb_enc_copy(result, val);
- *first = FALSE;
- }
- goto str_join;
- }
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+
+ val = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(val, T_STRING)) {
+ ary_join_1_str(result, val, first);
+ }
+ else if (RB_TYPE_P(val, T_ARRAY)) {
+ ary_join_1_ary(val, ary, sep, result, val, first);
+ }
+ else if (!NIL_P(tmp = rb_check_string_type(val))) {
+ ary_join_1_str(result, tmp, first);
+ }
+ else if (!NIL_P(tmp = rb_check_array_type(val))) {
+ ary_join_1_ary(val, ary, sep, result, tmp, first);
+ }
+ else {
+ ary_join_1_str(result, rb_obj_as_string(val), first);
+ }
}
}
@@ -2033,36 +3008,36 @@ VALUE
rb_ary_join(VALUE ary, VALUE sep)
{
long len = 1, i;
- int taint = FALSE;
VALUE val, tmp, result;
if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
- if (OBJ_TAINTED(ary)) taint = TRUE;
if (!NIL_P(sep)) {
- StringValue(sep);
- len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+ StringValue(sep);
+ len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
}
for (i=0; i<RARRAY_LEN(ary); i++) {
- val = RARRAY_AREF(ary, i);
- tmp = rb_check_string_type(val);
-
- if (NIL_P(tmp) || tmp != val) {
- int first;
- result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
- rb_enc_associate(result, rb_usascii_encoding());
- if (taint) OBJ_TAINT(result);
- ary_join_0(ary, sep, i, result);
- first = i == 0;
- ary_join_1(ary, ary, sep, i, result, &first);
- return result;
- }
+ val = RARRAY_AREF(ary, i);
+ tmp = rb_check_string_type(val);
+
+ if (NIL_P(tmp) || tmp != val) {
+ int first;
+ long n = RARRAY_LEN(ary);
+ if (i > n) i = n;
+ result = rb_str_buf_new(len + (n-i)*10);
+ rb_enc_associate(result, rb_usascii_encoding());
+ i = ary_join_0(ary, sep, i, result);
+ first = i == 0;
+ ary_join_1(ary, ary, sep, i, result, &first);
+ return result;
+ }
- len += RSTRING_LEN(tmp);
+ len += RSTRING_LEN(tmp);
}
- result = rb_str_buf_new(len);
- if (taint) OBJ_TAINT(result);
+ result = rb_str_new(0, len);
+ rb_str_set_len(result, 0);
+
ary_join_0(ary, sep, RARRAY_LEN(ary), result);
return result;
@@ -2070,24 +3045,43 @@ rb_ary_join(VALUE ary, VALUE sep)
/*
* call-seq:
- * ary.join(separator=$,) -> str
+ * array.join ->new_string
+ * array.join(separator = $,) -> new_string
*
- * Returns a string created by converting each element of the array to
- * a string, separated by the given +separator+.
- * If the +separator+ is +nil+, it uses current $,.
- * If both the +separator+ and $, are nil, it uses empty string.
+ * Returns the new \String formed by joining the array elements after conversion.
+ * For each element +element+:
+ *
+ * - Uses <tt>element.to_s</tt> if +element+ is not a <tt>kind_of?(Array)</tt>.
+ * - Uses recursive <tt>element.join(separator)</tt> if +element+ is a <tt>kind_of?(Array)</tt>.
+ *
+ * With no argument, joins using the output field separator, <tt>$,</tt>:
+ *
+ * a = [:foo, 'bar', 2]
+ * $, # => nil
+ * a.join # => "foobar2"
+ *
+ * With \string argument +separator+, joins using that separator:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.join("\n") # => "foo\nbar\n2"
+ *
+ * Joins recursively for nested Arrays:
+ *
+ * a = [:foo, [:bar, [:baz, :bat]]]
+ * a.join # => "foobarbazbat"
*
- * [ "a", "b", "c" ].join #=> "abc"
- * [ "a", "b", "c" ].join("-") #=> "a-b-c"
*/
-
static VALUE
rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
{
VALUE sep;
- rb_scan_args(argc, argv, "01", &sep);
- if (NIL_P(sep)) sep = rb_output_fs;
+ if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+ sep = rb_output_fs;
+ if (!NIL_P(sep)) {
+ rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+ }
+ }
return rb_ary_join(ary, sep);
}
@@ -2095,32 +3089,32 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
static VALUE
inspect_ary(VALUE ary, VALUE dummy, int recur)
{
- int tainted = OBJ_TAINTED(ary);
long i;
VALUE s, str;
if (recur) return rb_usascii_str_new_cstr("[...]");
str = rb_str_buf_new2("[");
for (i=0; i<RARRAY_LEN(ary); i++) {
- s = rb_inspect(RARRAY_AREF(ary, i));
- if (OBJ_TAINTED(s)) tainted = TRUE;
- if (i > 0) rb_str_buf_cat2(str, ", ");
- else rb_enc_copy(str, s);
- rb_str_buf_append(str, s);
+ s = rb_inspect(RARRAY_AREF(ary, i));
+ if (i > 0) rb_str_buf_cat2(str, ", ");
+ else rb_enc_copy(str, s);
+ rb_str_buf_append(str, s);
}
rb_str_buf_cat2(str, "]");
- if (tainted) OBJ_TAINT(str);
return str;
}
/*
* call-seq:
- * ary.inspect -> string
- * ary.to_s -> string
+ * array.inspect -> new_string
+ *
+ * Returns the new \String formed by calling method <tt>#inspect</tt>
+ * on each array element:
*
- * Creates a string representation of +self+.
+ * a = [:foo, 'bar', 2]
+ * a.inspect # => "[:foo, \"bar\", 2]"
*
- * [ "a", "b", "c" ].to_s #=> "[\"a\", \"b\", \"c\"]"
+ * Array#to_s is an alias for Array#inspect.
*/
static VALUE
@@ -2138,59 +3132,88 @@ rb_ary_to_s(VALUE ary)
/*
* call-seq:
- * ary.to_a -> ary
+ * to_a -> self or new_array
*
- * Returns +self+.
+ * When +self+ is an instance of \Array, returns +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.to_a # => [:foo, "bar", 2]
+ *
+ * Otherwise, returns a new \Array containing the elements of +self+:
+ *
+ * class MyArray < Array; end
+ * a = MyArray.new(['foo', 'bar', 'two'])
+ * a.instance_of?(Array) # => false
+ * a.kind_of?(Array) # => true
+ * a1 = a.to_a
+ * a1 # => ["foo", "bar", "two"]
+ * a1.class # => Array # Not MyArray
*
- * If called on a subclass of Array, converts the receiver to an Array object.
*/
static VALUE
rb_ary_to_a(VALUE ary)
{
if (rb_obj_class(ary) != rb_cArray) {
- VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
- rb_ary_replace(dup, ary);
- return dup;
+ VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+ rb_ary_replace(dup, ary);
+ return dup;
}
return ary;
}
/*
* call-seq:
- * ary.to_h -> hash
+ * array.to_h -> new_hash
+ * array.to_h {|item| ... } -> new_hash
+ *
+ * Returns a new \Hash formed from +self+.
+ *
+ * When a block is given, calls the block with each array element;
+ * the block must return a 2-element \Array whose two elements
+ * form a key-value pair in the returned \Hash:
+ *
+ * a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ * h = a.to_h {|item| [item, item] }
+ * h # => {"foo"=>"foo", :bar=>:bar, 1=>1, [2, 3]=>[2, 3], {:baz=>4}=>{:baz=>4}}
*
- * Returns the result of interpreting <i>ary</i> as an array of
- * <tt>[key, value]</tt> pairs.
+ * When no block is given, +self+ must be an \Array of 2-element sub-arrays,
+ * each sub-array is formed into a key-value pair in the new \Hash:
+ *
+ * [].to_h # => {}
+ * a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ * h = a.to_h
+ * h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
*
- * [[:foo, :bar], [1, 2]].to_h
- * # => {:foo => :bar, 1 => 2}
*/
static VALUE
rb_ary_to_h(VALUE ary)
{
long i;
- VALUE hash = rb_hash_new();
+ VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+ int block_given = rb_block_given_p();
+
for (i=0; i<RARRAY_LEN(ary); i++) {
- const VALUE elt = rb_ary_elt(ary, i);
- const VALUE key_value_pair = rb_check_array_type(elt);
- if (NIL_P(key_value_pair)) {
- rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
- rb_obj_class(elt), i);
- }
- if (RARRAY_LEN(key_value_pair) != 2) {
- rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
- i, RARRAY_LEN(key_value_pair));
- }
- rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+ const VALUE e = rb_ary_elt(ary, i);
+ const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+ const VALUE key_value_pair = rb_check_array_type(elt);
+ if (NIL_P(key_value_pair)) {
+ rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+ rb_obj_class(elt), i);
+ }
+ if (RARRAY_LEN(key_value_pair) != 2) {
+ rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+ i, RARRAY_LEN(key_value_pair));
+ }
+ rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
}
return hash;
}
/*
* call-seq:
- * ary.to_ary -> ary
+ * array.to_ary -> self
*
* Returns +self+.
*/
@@ -2205,9 +3228,9 @@ static void
ary_reverse(VALUE *p1, VALUE *p2)
{
while (p1 < p2) {
- VALUE tmp = *p1;
- *p1++ = *p2;
- *p2-- = tmp;
+ VALUE tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
}
}
@@ -2219,23 +3242,23 @@ rb_ary_reverse(VALUE ary)
rb_ary_modify(ary);
if (len > 1) {
- RARRAY_PTR_USE(ary, p1, {
- p2 = p1 + len - 1; /* points last item */
- ary_reverse(p1, p2);
- }); /* WB: no new reference */
+ RARRAY_PTR_USE_TRANSIENT(ary, p1, {
+ p2 = p1 + len - 1; /* points last item */
+ ary_reverse(p1, p2);
+ }); /* WB: no new reference */
}
return ary;
}
/*
* call-seq:
- * ary.reverse! -> ary
+ * array.reverse! -> self
+ *
+ * Reverses +self+ in place:
*
- * Reverses +self+ in place.
+ * a = ['foo', 'bar', 'two']
+ * a.reverse! # => ["two", "bar", "foo"]
*
- * a = [ "a", "b", "c" ]
- * a.reverse! #=> ["c", "b", "a"]
- * a #=> ["c", "b", "a"]
*/
static VALUE
@@ -2246,12 +3269,14 @@ rb_ary_reverse_bang(VALUE ary)
/*
* call-seq:
- * ary.reverse -> new_ary
+ * array.reverse -> new_array
+ *
+ * Returns a new \Array with the elements of +self+ in reverse order:
*
- * Returns a new array containing +self+'s elements in reverse order.
+ * a = ['foo', 'bar', 'two']
+ * a1 = a.reverse
+ * a1 # => ["two", "bar", "foo"]
*
- * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
- * [ 1 ].reverse #=> [1]
*/
static VALUE
@@ -2261,9 +3286,9 @@ rb_ary_reverse_m(VALUE ary)
VALUE dup = rb_ary_new2(len);
if (len > 0) {
- const VALUE *p1 = RARRAY_CONST_PTR(ary);
- VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
- do *p2-- = *p1++; while (--len > 0);
+ const VALUE *p1 = RARRAY_CONST_PTR_TRANSIENT(ary);
+ VALUE *p2 = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(dup) + len - 1;
+ do *p2-- = *p1++; while (--len > 0);
}
ARY_SET_LEN(dup, RARRAY_LEN(ary));
return dup;
@@ -2275,73 +3300,143 @@ rotate_count(long cnt, long len)
return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
}
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+{
+ if (cnt == 1) {
+ VALUE tmp = *ptr;
+ memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+ *(ptr + len - 1) = tmp;
+ }
+ else if (cnt == len - 1) {
+ VALUE tmp = *(ptr + len - 1);
+ memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+ *ptr = tmp;
+ }
+ else {
+ --len;
+ if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+ if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+ if (len > 0) ary_reverse(ptr, ptr + len);
+ }
+}
+
VALUE
rb_ary_rotate(VALUE ary, long cnt)
{
rb_ary_modify(ary);
if (cnt != 0) {
- VALUE *ptr = RARRAY_PTR(ary);
- long len = RARRAY_LEN(ary);
-
- if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
- --len;
- if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
- if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
- if (len > 0) ary_reverse(ptr, ptr + len);
- return ary;
- }
+ long len = RARRAY_LEN(ary);
+ if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+ return ary;
+ }
}
-
return Qnil;
}
/*
* call-seq:
- * ary.rotate!(count=1) -> ary
+ * array.rotate! -> self
+ * array.rotate!(count) -> self
*
- * Rotates +self+ in place so that the element at +count+ comes first, and
- * returns +self+.
+ * Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ * When no argument given, rotates the first element to the last position:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a.rotate! # => ["bar", 2, "bar", :foo]
+ *
+ * When given a non-negative \Integer +count+,
+ * rotates +count+ elements from the beginning to the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(2)
+ * a # => [2, :foo, "bar"]
*
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of the array where +-1+ is the last element.
+ * If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(20)
+ * a # => [2, :foo, "bar"]
+ *
+ * If +count+ is zero, returns +self+ unmodified:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(0)
+ * a # => [:foo, "bar", 2]
+ *
+ * When given a negative Integer +count+, rotates in the opposite direction,
+ * from end to beginning:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(-2)
+ * a # => ["bar", 2, :foo]
+ *
+ * If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.rotate!(-5)
+ * a # => ["bar", 2, :foo]
*
- * a = [ "a", "b", "c", "d" ]
- * a.rotate! #=> ["b", "c", "d", "a"]
- * a #=> ["b", "c", "d", "a"]
- * a.rotate!(2) #=> ["d", "a", "b", "c"]
- * a.rotate!(-3) #=> ["a", "b", "c", "d"]
*/
static VALUE
rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
{
- long n = 1;
-
- switch (argc) {
- case 1: n = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
+ long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
rb_ary_rotate(ary, n);
return ary;
}
/*
* call-seq:
- * ary.rotate(count=1) -> new_ary
+ * array.rotate -> new_array
+ * array.rotate(count) -> new_array
+ *
+ * Returns a new \Array formed from +self+ with elements
+ * rotated from one end to the other.
+ *
+ * When no argument given, returns a new \Array that is like +self+,
+ * except that the first element has been rotated to the last position:
+ *
+ * a = [:foo, 'bar', 2, 'bar']
+ * a1 = a.rotate
+ * a1 # => ["bar", 2, "bar", :foo]
*
- * Returns a new array by rotating +self+ so that the element at +count+ is
- * the first element of the new array.
+ * When given a non-negative \Integer +count+,
+ * returns a new \Array with +count+ elements rotated from the beginning to the end:
*
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of +self+ where +-1+ is the last element.
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(2)
+ * a1 # => [2, :foo, "bar"]
+ *
+ * If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(20)
+ * a1 # => [2, :foo, "bar"]
+ *
+ * If +count+ is zero, returns a copy of +self+, unmodified:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(0)
+ * a1 # => [:foo, "bar", 2]
+ *
+ * When given a negative \Integer +count+, rotates in the opposite direction,
+ * from end to beginning:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(-2)
+ * a1 # => ["bar", 2, :foo]
+ *
+ * If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ * a = [:foo, 'bar', 2]
+ * a1 = a.rotate(-5)
+ * a1 # => ["bar", 2, :foo]
*
- * a = [ "a", "b", "c", "d" ]
- * a.rotate #=> ["b", "c", "d", "a"]
- * a #=> ["a", "b", "c", "d"]
- * a.rotate(2) #=> ["c", "d", "a", "b"]
- * a.rotate(-3) #=> ["b", "c", "d", "a"]
*/
static VALUE
@@ -2349,22 +3444,17 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
{
VALUE rotated;
const VALUE *ptr;
- long len, cnt = 1;
-
- switch (argc) {
- case 1: cnt = NUM2LONG(argv[0]);
- case 0: break;
- default: rb_scan_args(argc, argv, "01", NULL);
- }
+ long len;
+ long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
len = RARRAY_LEN(ary);
rotated = rb_ary_new2(len);
if (len > 0) {
- cnt = rotate_count(cnt, len);
- ptr = RARRAY_CONST_PTR(ary);
- len -= cnt;
- ary_memcpy(rotated, 0, len, ptr + cnt);
- ary_memcpy(rotated, len, cnt, ptr);
+ cnt = rotate_count(cnt, len);
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ len -= cnt;
+ ary_memcpy(rotated, 0, len, ptr + cnt);
+ ary_memcpy(rotated, len, cnt, ptr);
}
ARY_SET_LEN(rotated, RARRAY_LEN(ary));
return rotated;
@@ -2372,29 +3462,41 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
struct ary_sort_data {
VALUE ary;
- struct cmp_opt_data cmp_opt;
+ VALUE receiver;
};
static VALUE
sort_reentered(VALUE ary)
{
if (RBASIC(ary)->klass) {
- rb_raise(rb_eRuntimeError, "sort reentered");
+ rb_raise(rb_eRuntimeError, "sort reentered");
}
return Qnil;
}
+static void
+sort_returned(struct ary_sort_data *data)
+{
+ if (rb_obj_frozen_p(data->receiver)) {
+ rb_raise(rb_eFrozenError, "array frozen during sort");
+ }
+ sort_reentered(data->ary);
+}
+
static int
sort_1(const void *ap, const void *bp, void *dummy)
{
struct ary_sort_data *data = dummy;
VALUE retval = sort_reentered(data->ary);
VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ VALUE args[2];
int n;
- retval = rb_yield_values(2, a, b);
+ args[0] = a;
+ args[1] = b;
+ retval = rb_yield_values2(2, args);
n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
+ sort_returned(data);
return n;
}
@@ -2406,41 +3508,64 @@ sort_2(const void *ap, const void *bp, void *dummy)
VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
int n;
- if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Fixnum)) {
- if ((long)a > (long)b) return 1;
- if ((long)a < (long)b) return -1;
- return 0;
+ if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
+ if ((long)a > (long)b) return 1;
+ if ((long)a < (long)b) return -1;
+ return 0;
+ }
+ if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
+ return rb_str_cmp(a, b);
}
- if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
- return rb_str_cmp(a, b);
+ if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
+ return rb_float_cmp(a, b);
}
retval = rb_funcallv(a, id_cmp, 1, &b);
n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
+ sort_returned(data);
return n;
}
/*
* call-seq:
- * ary.sort! -> ary
- * ary.sort! { |a, b| block } -> ary
+ * array.sort! -> self
+ * array.sort! {|a, b| ... } -> self
+ *
+ * Returns +self+ with its elements sorted in place.
+ *
+ * With no block, compares elements using operator <tt><=></tt>
+ * (see Comparable):
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort!
+ * a # => ["a", "b", "c", "d", "e"]
+ *
+ * With a block, calls the block with each element pair;
+ * for each element pair +a+ and +b+, the block should return an integer:
+ *
+ * - Negative when +b+ is to follow +a+.
+ * - Zero when +a+ and +b+ are equivalent.
+ * - Positive when +a+ is to follow +b+.
*
- * Sorts +self+ in place.
+ * Example:
*
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort! {|a, b| a <=> b }
+ * a # => ["a", "b", "c", "d", "e"]
+ * a.sort! {|a, b| b <=> a }
+ * a # => ["e", "d", "c", "b", "a"]
*
- * The block must implement a comparison between +a+ and +b+ and return
- * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- * are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ * When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ * and may be unstable:
*
- * See also Enumerable#sort_by.
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a.sort! {|a, b| 0 }
+ * a # => ["d", "e", "c", "a", "b"]
*
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort! #=> ["a", "b", "c", "d", "e"]
- * a.sort! { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
*/
VALUE
@@ -2449,25 +3574,23 @@ rb_ary_sort_bang(VALUE ary)
rb_ary_modify(ary);
assert(!ARY_SHARED_P(ary));
if (RARRAY_LEN(ary) > 1) {
- VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
- struct ary_sort_data data;
- long len = RARRAY_LEN(ary);
-
- RBASIC_CLEAR_CLASS(tmp);
- data.ary = tmp;
- data.cmp_opt.opt_methods = 0;
- data.cmp_opt.opt_inited = 0;
- RARRAY_PTR_USE(tmp, ptr, {
- ruby_qsort(ptr, len, sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
- }); /* WB: no new reference */
- rb_ary_modify(ary);
+ VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+ struct ary_sort_data data;
+ long len = RARRAY_LEN(ary);
+ RBASIC_CLEAR_CLASS(tmp);
+ data.ary = tmp;
+ data.receiver = ary;
+ RARRAY_PTR_USE(tmp, ptr, {
+ ruby_qsort(ptr, len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2, &data);
+ }); /* WB: no new reference */
+ rb_ary_modify(ary);
if (ARY_EMBED_P(tmp)) {
if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
+ FL_SET_EMBED(ary);
}
- ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+ ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
}
else {
@@ -2485,44 +3608,65 @@ rb_ary_sort_bang(VALUE ary)
rb_ary_unshare(ary);
}
else {
- ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ ary_heap_free(ary);
}
- ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+ ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
ARY_SET_HEAP_LEN(ary, len);
- ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+ ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
}
/* tmp was lost ownership for the ptr */
FL_UNSET(tmp, FL_FREEZE);
FL_SET_EMBED(tmp);
ARY_SET_EMBED_LEN(tmp, 0);
FL_SET(tmp, FL_FREEZE);
- }
+ }
/* tmp will be GC'ed. */
RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.sort -> new_ary
- * ary.sort { |a, b| block } -> new_ary
+ * array.sort -> new_array
+ * array.sort {|a, b| ... } -> new_array
+ *
+ * Returns a new \Array whose elements are those from +self+, sorted.
+ *
+ * With no block, compares elements using operator <tt><=></tt>
+ * (see Comparable):
*
- * Returns a new array created by sorting +self+.
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort
+ * a1 # => ["a", "b", "c", "d", "e"]
*
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
+ * With a block, calls the block with each element pair;
+ * for each element pair +a+ and +b+, the block should return an integer:
*
- * The block must implement a comparison between +a+ and +b+ and return
- * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- * are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ * - Negative when +b+ is to follow +a+.
+ * - Zero when +a+ and +b+ are equivalent.
+ * - Positive when +a+ is to follow +b+.
*
+ * Example:
*
- * See also Enumerable#sort_by.
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort {|a, b| a <=> b }
+ * a1 # => ["a", "b", "c", "d", "e"]
+ * a2 = a.sort {|a, b| b <=> a }
+ * a2 # => ["e", "d", "c", "b", "a"]
*
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort { |x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ * and may be unstable:
+ *
+ * a = 'abcde'.split('').shuffle
+ * a # => ["e", "b", "d", "a", "c"]
+ * a1 = a.sort {|a, b| 0 }
+ * a1 # => ["c", "e", "b", "d", "a"]
+ *
+ * Related: Enumerable#sort_by.
*/
VALUE
@@ -2537,55 +3681,12 @@ static VALUE rb_ary_bsearch_index(VALUE ary);
/*
* call-seq:
- * ary.bsearch {|x| block } -> elem
- *
- * By using binary search, finds a value from this array which meets
- * the given condition in O(log n) where n is the size of the array.
- *
- * You can use this method in two use cases: a find-minimum mode and
- * a find-any mode. In either case, the elements of the array must be
- * monotone (or sorted) with respect to the block.
- *
- * In find-minimum mode (this is a good choice for typical use case),
- * the block must return true or false, and there must be an index i
- * (0 <= i <= ary.size) so that:
- *
- * - the block returns false for any element whose index is less than
- * i, and
- * - the block returns true for any element whose index is greater
- * than or equal to i.
- *
- * This method returns the i-th element. If i is equal to ary.size,
- * it returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * ary.bsearch {|x| x >= 4 } #=> 4
- * ary.bsearch {|x| x >= 6 } #=> 7
- * ary.bsearch {|x| x >= -1 } #=> 0
- * ary.bsearch {|x| x >= 100 } #=> nil
- *
- * In find-any mode (this behaves like libc's bsearch(3)), the block
- * must return a number, and there must be two indices i and j
- * (0 <= i <= j <= ary.size) so that:
- *
- * - the block returns a positive number for ary[k] if 0 <= k < i,
- * - the block returns zero for ary[k] if i <= k < j, and
- * - the block returns a negative number for ary[k] if
- * j <= k < ary.size.
- *
- * Under this condition, this method returns any element whose index
- * is within i...j. If i is equal to j (i.e., there is no element
- * that satisfies the block), this method returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * # try to find v such that 4 <= v < 8
- * ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- * # try to find v such that 8 <= v < 10
- * ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- * You must not mix the two modes at a time; the block must always
- * return either true/false, or always return a number. It is
- * undefined which value is actually picked up at each iteration.
+ * array.bsearch {|element| ... } -> object
+ * array.bsearch -> new_enumerator
+ *
+ * Returns an element from +self+ selected by a binary search.
+ *
+ * See {Binary Searching}[rdoc-ref:bsearch.rdoc].
*/
static VALUE
@@ -2594,22 +3695,18 @@ rb_ary_bsearch(VALUE ary)
VALUE index_result = rb_ary_bsearch_index(ary);
if (FIXNUM_P(index_result)) {
- return rb_ary_entry(ary, FIX2LONG(index_result));
+ return rb_ary_entry(ary, FIX2LONG(index_result));
}
return index_result;
}
/*
* call-seq:
- * ary.bsearch_index {|x| block } -> int or nil
- *
- * By using binary search, finds an index of a value from this array which
- * meets the given condition in O(log n) where n is the size of the array.
+ * array.bsearch_index {|element| ... } -> integer or nil
+ * array.bsearch_index -> new_enumerator
*
- * It supports two modes, depending on the nature of the block and they are
- * exactly the same as in the case of #bsearch method with the only difference
- * being that this method returns the index of the element instead of the
- * element itself. For more details consult the documentation for #bsearch.
+ * Searches +self+ as described at method #bsearch,
+ * but returns the _index_ of the found element instead of the element itself.
*/
static VALUE
@@ -2621,39 +3718,39 @@ rb_ary_bsearch_index(VALUE ary)
RETURN_ENUMERATOR(ary, 0, 0);
while (low < high) {
- mid = low + ((high - low) / 2);
- val = rb_ary_entry(ary, mid);
- v = rb_yield(val);
- if (FIXNUM_P(v)) {
- if (v == INT2FIX(0)) return INT2FIX(mid);
- smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
- }
- else if (v == Qtrue) {
- satisfied = 1;
- smaller = 1;
- }
- else if (v == Qfalse || v == Qnil) {
- smaller = 0;
- }
- else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
- const VALUE zero = INT2FIX(0);
- switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
- case 0: return INT2FIX(mid);
- case 1: smaller = 1; break;
- case -1: smaller = 0;
- }
- }
- else {
- rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
- " (must be numeric, true, false or nil)",
- rb_obj_class(v));
- }
- if (smaller) {
- high = mid;
- }
- else {
- low = mid + 1;
- }
+ mid = low + ((high - low) / 2);
+ val = rb_ary_entry(ary, mid);
+ v = rb_yield(val);
+ if (FIXNUM_P(v)) {
+ if (v == INT2FIX(0)) return INT2FIX(mid);
+ smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+ }
+ else if (v == Qtrue) {
+ satisfied = 1;
+ smaller = 1;
+ }
+ else if (!RTEST(v)) {
+ smaller = 0;
+ }
+ else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+ const VALUE zero = INT2FIX(0);
+ switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+ case 0: return INT2FIX(mid);
+ case 1: smaller = 0; break;
+ case -1: smaller = 1;
+ }
+ }
+ else {
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+ " (must be numeric, true, false or nil)",
+ rb_obj_class(v));
+ }
+ if (smaller) {
+ high = mid;
+ }
+ else {
+ low = mid + 1;
+ }
}
if (!satisfied) return Qnil;
return INT2FIX(low);
@@ -2668,13 +3765,27 @@ sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
/*
* call-seq:
- * ary.sort_by! { |obj| block } -> ary
- * ary.sort_by! -> Enumerator
+ * array.sort_by! {|element| ... } -> self
+ * array.sort_by! -> new_enumerator
+ *
+ * Sorts the elements of +self+ in place,
+ * using an ordering determined by the block; returns self.
*
- * Sorts +self+ in place using a set of keys generated by mapping the
- * values in +self+ through the given block.
+ * Calls the block with each successive element;
+ * sorts elements based on the values returned from the block.
*
- * If no block is given, an Enumerator is returned instead.
+ * For duplicates returned by the block, the ordering is indeterminate, and may be unstable.
+ *
+ * This example sorts strings based on their sizes:
+ *
+ * a = ['aaaa', 'bbb', 'cc', 'd']
+ * a.sort_by! {|element| element.size }
+ * a # => ["d", "cc", "bbb", "aaaa"]
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = ['aaaa', 'bbb', 'cc', 'd']
+ * a.sort_by! # => #<Enumerator: ["aaaa", "bbb", "cc", "d"]:sort_by!>
*
*/
@@ -2693,23 +3804,22 @@ rb_ary_sort_by_bang(VALUE ary)
/*
* call-seq:
- * ary.collect { |item| block } -> new_ary
- * ary.map { |item| block } -> new_ary
- * ary.collect -> Enumerator
- * ary.map -> Enumerator
- *
- * Invokes the given block once for each element of +self+.
+ * array.map {|element| ... } -> new_array
+ * array.map -> new_enumerator
*
- * Creates a new array containing the values returned by the block.
+ * Calls the block, if given, with each element of +self+;
+ * returns a new \Array whose elements are the return values from the block:
*
- * See also Enumerable#collect.
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map {|element| element.class }
+ * a1 # => [Symbol, String, Integer]
*
- * If no block is given, an Enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map
+ * a1 # => #<Enumerator: [:foo, "bar", 2]:map>
*
- * a = [ "a", "b", "c", "d" ]
- * a.collect { |x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
- * a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- * a #=> ["a", "b", "c", "d"]
+ * Array#collect is an alias for Array#map.
*/
static VALUE
@@ -2721,7 +3831,7 @@ rb_ary_collect(VALUE ary)
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
collect = rb_ary_new2(RARRAY_LEN(ary));
for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+ rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
}
return collect;
}
@@ -2729,23 +3839,22 @@ rb_ary_collect(VALUE ary)
/*
* call-seq:
- * ary.collect! {|item| block } -> ary
- * ary.map! {|item| block } -> ary
- * ary.collect! -> Enumerator
- * ary.map! -> Enumerator
+ * array.map! {|element| ... } -> self
+ * array.map! -> new_enumerator
+ *
+ * Calls the block, if given, with each element;
+ * replaces the element with the block's return value:
*
- * Invokes the given block once for each element of +self+, replacing the
- * element with the value returned by the block.
+ * a = [:foo, 'bar', 2]
+ * a.map! { |element| element.class } # => [Symbol, String, Integer]
*
- * See also Enumerable#collect.
+ * Returns a new \Enumerator if no block given:
*
- * If no block is given, an Enumerator is returned instead.
+ * a = [:foo, 'bar', 2]
+ * a1 = a.map!
+ * a1 # => #<Enumerator: [:foo, "bar", 2]:map!>
*
- * a = [ "a", "b", "c", "d" ]
- * a.map! {|x| x + "!" }
- * a #=> [ "a!", "b!", "c!", "d!" ]
- * a.collect!.with_index {|x, i| x[0...i] }
- * a #=> ["", "b", "c!", "d!"]
+ * Array#collect! is an alias for Array#map!.
*/
static VALUE
@@ -2756,7 +3865,7 @@ rb_ary_collect_bang(VALUE ary)
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+ rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
}
return ary;
}
@@ -2768,66 +3877,128 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
long beg, len, i, j;
for (i=0; i<argc; i++) {
- if (FIXNUM_P(argv[i])) {
- rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
- continue;
- }
- /* check if idx is Range */
- if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
- long end = olen < beg+len ? olen : beg+len;
- for (j = beg; j < end; j++) {
- rb_ary_push(result, (*func)(obj, j));
- }
- if (beg + len > j)
- rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
- continue;
- }
- rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+ if (FIXNUM_P(argv[i])) {
+ rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+ continue;
+ }
+ /* check if idx is Range */
+ if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+ long end = olen < beg+len ? olen : beg+len;
+ for (j = beg; j < end; j++) {
+ rb_ary_push(result, (*func)(obj, j));
+ }
+ if (beg + len > j)
+ rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+ continue;
+ }
+ rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
}
return result;
}
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+ long beg, len;
+ if (FIXNUM_P(idx)) {
+ beg = FIX2LONG(idx);
+ }
+ /* check if idx is Range */
+ else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+ if (len > 0) {
+ const VALUE *const src = RARRAY_CONST_PTR_TRANSIENT(ary);
+ const long end = beg + len;
+ const long prevlen = RARRAY_LEN(result);
+ if (beg < olen) {
+ rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+ }
+ if (end > olen) {
+ rb_ary_store(result, prevlen + len - 1, Qnil);
+ }
+ }
+ return result;
+ }
+ else {
+ beg = NUM2LONG(idx);
+ }
+ return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
/*
* call-seq:
- * ary.values_at(selector, ...) -> new_ary
+ * array.values_at(*indexes) -> new_array
+ *
+ * Returns a new \Array whose elements are the elements
+ * of +self+ at the given \Integer or \Range +indexes+.
+ *
+ * For each positive +index+, returns the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, 2) # => [:foo, 2]
+ * a.values_at(0..1) # => [:foo, "bar"]
+ *
+ * The given +indexes+ may be in any order, and may repeat:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(2, 0, 1, 0, 2) # => [2, :foo, "bar", :foo, 2]
+ * a.values_at(1, 0..2) # => ["bar", :foo, "bar", 2]
+ *
+ * Assigns +nil+ for an +index+ that is too large:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, 3, 1, 3) # => [:foo, nil, "bar", nil]
+ *
+ * Returns a new empty \Array if no arguments given.
+ *
+ * For each negative +index+, counts backward from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(-1, -3) # => [2, :foo]
*
- * Returns an array containing the elements in +self+ corresponding to the
- * given +selector+(s).
+ * Assigns +nil+ for an +index+ that is too small:
*
- * The selectors may be either integer indices or ranges.
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, -5, 1, -6, 2) # => [:foo, nil, "bar", nil, 2]
*
- * See also Array#select.
+ * The given +indexes+ may have a mixture of signs:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.values_at(0, -2, 1, -1) # => [:foo, "bar", "bar", 2]
*
- * a = %w{ a b c d e f }
- * a.values_at(1, 3, 5) # => ["b", "d", "f"]
- * a.values_at(1, 3, 5, 7) # => ["b", "d", "f", nil]
- * a.values_at(-1, -2, -2, -7) # => ["f", "e", "e", nil]
- * a.values_at(4..6, 3...6) # => ["e", "f", nil, "d", "e", "f"]
*/
static VALUE
rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
{
- return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+ long i, olen = RARRAY_LEN(ary);
+ VALUE result = rb_ary_new_capa(argc);
+ for (i = 0; i < argc; ++i) {
+ append_values_at_single(result, ary, olen, argv[i]);
+ }
+ RB_GC_GUARD(ary);
+ return result;
}
/*
* call-seq:
- * ary.select { |item| block } -> new_ary
- * ary.select -> Enumerator
+ * array.select {|element| ... } -> new_array
+ * array.select -> new_enumerator
*
- * Returns a new array containing all elements of +ary+
- * for which the given +block+ returns a true value.
+ * Calls the block, if given, with each element of +self+;
+ * returns a new \Array containing those elements of +self+
+ * for which the block returns a truthy value:
*
- * If no block is given, an Enumerator is returned instead.
+ * a = [:foo, 'bar', 2, :bam]
+ * a1 = a.select {|element| element.to_s.start_with?('b') }
+ * a1 # => ["bar", :bam]
*
- * [1,2,3,4,5].select { |num| num.even? } #=> [2, 4]
+ * Returns a new \Enumerator if no block given:
*
- * a = %w{ a b c d e f }
- * a.select { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select # => #<Enumerator: [:foo, "bar", 2, :bam]:select>
*
- * See also Enumerable#select.
+ * Array#filter is an alias for Array#select.
*/
static VALUE
@@ -2839,9 +4010,9 @@ rb_ary_select(VALUE ary)
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
result = rb_ary_new2(RARRAY_LEN(ary));
for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
- rb_ary_push(result, rb_ary_elt(ary, i));
- }
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ rb_ary_push(result, rb_ary_elt(ary, i));
+ }
}
return result;
}
@@ -2859,12 +4030,12 @@ select_bang_i(VALUE a)
long i1, i2;
for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
- VALUE v = RARRAY_AREF(ary, i1);
- if (!RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- arg->len[1] = ++i2;
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (!RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ arg->len[1] = ++i2;
}
return (i1 == i2) ? Qnil : ary;
}
@@ -2877,33 +4048,41 @@ select_bang_ensure(VALUE a)
long len = RARRAY_LEN(ary);
long i1 = arg->len[0], i2 = arg->len[1];
- if (i2 < i1) {
- if (i1 < len) {
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr + i2, ptr + i1, VALUE, len - i1);
- });
- }
- ARY_SET_LEN(ary, len - i1 + i2);
+ if (i2 < len && i2 < i1) {
+ long tail = 0;
+ rb_ary_modify(ary);
+ if (i1 < len) {
+ tail = len - i1;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+ });
+ }
+ ARY_SET_LEN(ary, i2 + tail);
}
return ary;
}
/*
* call-seq:
- * ary.select! {|item| block } -> ary or nil
- * ary.select! -> Enumerator
+ * array.select! {|element| ... } -> self or nil
+ * array.select! -> new_enumerator
+ *
+ * Calls the block, if given with each element of +self+;
+ * removes from +self+ those elements for which the block returns +false+ or +nil+.
*
- * Invokes the given block passing in successive elements from +self+,
- * deleting elements for which the block returns a +false+ value.
+ * Returns +self+ if any elements were removed:
*
- * The array may not be changed instantly every time the block is called.
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
*
- * If changes were made, it will return +self+, otherwise it returns +nil+.
+ * Returns +nil+ if no elements were removed.
*
- * See also Array#keep_if
+ * Returns a new \Enumerator if no block given:
*
- * If no block is given, an Enumerator is returned instead.
+ * a = [:foo, 'bar', 2, :bam]
+ * a.select! # => #<Enumerator: [:foo, "bar", 2, :bam]:select!>
*
+ * Array#filter! is an alias for Array#select!.
*/
static VALUE
@@ -2921,18 +4100,20 @@ rb_ary_select_bang(VALUE ary)
/*
* call-seq:
- * ary.keep_if { |item| block } -> ary
- * ary.keep_if -> Enumerator
+ * array.keep_if {|element| ... } -> self
+ * array.keep_if -> new_enumeration
*
- * Deletes every element of +self+ for which the given block evaluates to
- * +false+.
+ * Retains those elements for which the block returns a truthy value;
+ * deletes all other elements; returns +self+:
*
- * See also Array#select!
+ * a = [:foo, 'bar', 2, :bam]
+ * a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
*
- * If no block is given, an Enumerator is returned instead.
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [:foo, 'bar', 2, :bam]
+ * a.keep_if # => #<Enumerator: [:foo, "bar", 2, :bam]:keep_if>
*
- * a = %w{ a b c d e f }
- * a.keep_if { |v| v =~ /[aeiou]/ } #=> ["a", "e"]
*/
static VALUE
@@ -2948,32 +4129,48 @@ ary_resize_smaller(VALUE ary, long len)
{
rb_ary_modify(ary);
if (RARRAY_LEN(ary) > len) {
- ARY_SET_LEN(ary, len);
- if (len * 2 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
- ary_resize_capa(ary, len * 2);
- }
+ ARY_SET_LEN(ary, len);
+ if (len * 2 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+ ary_resize_capa(ary, len * 2);
+ }
}
}
/*
* call-seq:
- * ary.delete(obj) -> item or nil
- * ary.delete(obj) { block } -> item or result of block
+ * array.delete(obj) -> deleted_object
+ * array.delete(obj) {|nosuch| ... } -> deleted_object or block_return
+ *
+ * Removes zero or more elements from +self+.
+ *
+ * When no block is given,
+ * removes from +self+ each element +ele+ such that <tt>ele == obj</tt>;
+ * returns the last deleted element:
+ *
+ * s1 = 'bar'; s2 = 'bar'
+ * a = [:foo, s1, 2, s2]
+ * a.delete('bar') # => "bar"
+ * a # => [:foo, 2]
+ *
+ * Returns +nil+ if no elements removed.
*
- * Deletes all items from +self+ that are equal to +obj+.
+ * When a block is given,
+ * removes from +self+ each element +ele+ such that <tt>ele == obj</tt>.
*
- * Returns the last deleted item, or +nil+ if no matching item is found.
+ * If any such elements are found, ignores the block
+ * and returns the last deleted element:
*
- * If the optional code block is given, the result of the block is returned if
- * the item is not found. (To remove +nil+ elements and get an informative
- * return value, use Array#compact!)
+ * s1 = 'bar'; s2 = 'bar'
+ * a = [:foo, s1, 2, s2]
+ * deleted_obj = a.delete('bar') {|obj| fail 'Cannot happen' }
+ * a # => [:foo, 2]
+ *
+ * If no such elements are found, returns the block's return value:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.delete(:nosuch) {|obj| "#{obj} not found" } # => "nosuch not found"
*
- * a = [ "a", "b", "b", "b", "c" ]
- * a.delete("b") #=> "b"
- * a #=> ["a", "c"]
- * a.delete("z") #=> nil
- * a.delete("z") { "not found" } #=> "not found"
*/
VALUE
@@ -2983,26 +4180,27 @@ rb_ary_delete(VALUE ary, VALUE item)
long i1, i2;
for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_AREF(ary, i1);
+ VALUE e = RARRAY_AREF(ary, i1);
- if (rb_equal(e, item)) {
- v = e;
- continue;
- }
- if (i1 != i2) {
- rb_ary_store(ary, i2, e);
- }
- i2++;
+ if (rb_equal(e, item)) {
+ v = e;
+ continue;
+ }
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, e);
+ }
+ i2++;
}
if (RARRAY_LEN(ary) == i2) {
- if (rb_block_given_p()) {
- return rb_yield(item);
- }
- return Qnil;
+ if (rb_block_given_p()) {
+ return rb_yield(item);
+ }
+ return Qnil;
}
ary_resize_smaller(ary, i2);
+ ary_verify(ary);
return v;
}
@@ -3012,18 +4210,18 @@ rb_ary_delete_same(VALUE ary, VALUE item)
long i1, i2;
for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_AREF(ary, i1);
+ VALUE e = RARRAY_AREF(ary, i1);
- if (e == item) {
- continue;
- }
- if (i1 != i2) {
- rb_ary_store(ary, i2, e);
- }
- i2++;
+ if (e == item) {
+ continue;
+ }
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, e);
+ }
+ i2++;
}
if (RARRAY_LEN(ary) == i2) {
- return;
+ return;
}
ary_resize_smaller(ary, i2);
@@ -3037,33 +4235,41 @@ rb_ary_delete_at(VALUE ary, long pos)
if (pos >= len) return Qnil;
if (pos < 0) {
- pos += len;
- if (pos < 0) return Qnil;
+ pos += len;
+ if (pos < 0) return Qnil;
}
rb_ary_modify(ary);
del = RARRAY_AREF(ary, pos);
- RARRAY_PTR_USE(ary, ptr, {
- MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
});
ARY_INCREASE_LEN(ary, -1);
-
+ ary_verify(ary);
return del;
}
/*
* call-seq:
- * ary.delete_at(index) -> obj or nil
+ * array.delete_at(index) -> deleted_object or nil
+ *
+ * Deletes an element from +self+, per the given \Integer +index+.
+ *
+ * When +index+ is non-negative, deletes the element at offset +index+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.delete_at(1) # => "bar"
+ * a # => [:foo, 2]
*
- * Deletes the element at the specified +index+, returning that element, or
- * +nil+ if the +index+ is out of range.
+ * If index is too large, returns +nil+.
*
- * See also Array#slice!
+ * When +index+ is negative, counts backward from the end of the array:
*
- * a = ["ant", "bat", "cat", "dog"]
- * a.delete_at(2) #=> "cat"
- * a #=> ["ant", "bat", "dog"]
- * a.delete_at(99) #=> nil
+ * a = [:foo, 'bar', 2]
+ * a.delete_at(-2) # => "bar"
+ * a # => [:foo, 2]
+ *
+ * If +index+ is too small (far from zero), returns nil.
*/
static VALUE
@@ -3072,73 +4278,133 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
+static VALUE
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
+{
+ const long orig_len = RARRAY_LEN(ary);
+
+ if (len < 0) {
+ return Qnil;
+ }
+ else if (pos < -orig_len) {
+ return Qnil;
+ }
+ else if (pos < 0) {
+ pos += orig_len;
+ }
+ else if (orig_len < pos) {
+ return Qnil;
+ }
+ if (orig_len < pos + len) {
+ len = orig_len - pos;
+ }
+ if (len == 0) {
+ return rb_ary_new2(0);
+ }
+ else {
+ VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR_TRANSIENT(ary)+pos);
+ rb_ary_splice(ary, pos, len, 0, 0);
+ return arg2;
+ }
+}
+
/*
* call-seq:
- * ary.slice!(index) -> obj or nil
- * ary.slice!(start, length) -> new_ary or nil
- * ary.slice!(range) -> new_ary or nil
- *
- * Deletes the element(s) given by an +index+ (optionally up to +length+
- * elements) or by a +range+.
- *
- * Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- * range.
- *
- * a = [ "a", "b", "c" ]
- * a.slice!(1) #=> "b"
- * a #=> ["a", "c"]
- * a.slice!(-1) #=> "c"
- * a #=> ["a"]
- * a.slice!(100) #=> nil
- * a #=> ["a"]
+ * array.slice!(n) -> object or nil
+ * array.slice!(start, length) -> new_array or nil
+ * array.slice!(range) -> new_array or nil
+ *
+ * Removes and returns elements from +self+.
+ *
+ * When the only argument is an \Integer +n+,
+ * removes and returns the _nth_ element in +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1) # => "bar"
+ * a # => [:foo, 2]
+ *
+ * If +n+ is negative, counts backwards from the end of +self+:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(-1) # => 2
+ * a # => [:foo, "bar"]
+ *
+ * If +n+ is out of range, returns +nil+.
+ *
+ * When the only arguments are Integers +start+ and +length+,
+ * removes +length+ elements from +self+ beginning at offset +start+;
+ * returns the deleted objects in a new \Array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(0, 2) # => [:foo, "bar"]
+ * a # => [2]
+ *
+ * If <tt>start + length</tt> exceeds the array size,
+ * removes and returns all elements from offset +start+ to the end:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1, 50) # => ["bar", 2]
+ * a # => [:foo]
+ *
+ * If <tt>start == a.size</tt> and +length+ is non-negative,
+ * returns a new empty \Array.
+ *
+ * If +length+ is negative, returns +nil+.
+ *
+ * When the only argument is a \Range object +range+,
+ * treats <tt>range.min</tt> as +start+ above and <tt>range.size</tt> as +length+ above:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(1..2) # => ["bar", 2]
+ * a # => [:foo]
+ *
+ * If <tt>range.start == a.size</tt>, returns a new empty \Array.
+ *
+ * If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ * If <tt>range.end</tt> is negative, counts backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(0..-2) # => [:foo, "bar"]
+ * a # => [2]
+ *
+ * If <tt>range.start</tt> is negative,
+ * calculates the start index backwards from the end of the array:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.slice!(-2..2) # => ["bar", 2]
+ * a # => [:foo]
+ *
*/
static VALUE
rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
{
- VALUE arg1, arg2;
- long pos, len, orig_len;
+ VALUE arg1;
+ long pos, len;
rb_ary_modify_check(ary);
+ rb_check_arity(argc, 1, 2);
+ arg1 = argv[0];
+
if (argc == 2) {
- pos = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- delete_pos_len:
- if (len < 0) return Qnil;
- orig_len = RARRAY_LEN(ary);
- if (pos < 0) {
- pos += orig_len;
- if (pos < 0) return Qnil;
- }
- else if (orig_len < pos) return Qnil;
- if (orig_len < pos + len) {
- len = orig_len - pos;
- }
- if (len == 0) return rb_ary_new2(0);
- arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
- RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
- rb_ary_splice(ary, pos, len, 0, 0);
- return arg2;
- }
-
- if (argc != 1) {
- /* error report */
- rb_scan_args(argc, argv, "11", NULL, NULL);
+ pos = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
}
- arg1 = argv[0];
if (!FIXNUM_P(arg1)) {
- switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
- case Qtrue:
- /* valid range */
- goto delete_pos_len;
- case Qnil:
- /* invalid range */
- return Qnil;
- default:
- /* not a range */
- break;
- }
+ switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+ case Qtrue:
+ /* valid range */
+ return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+ case Qnil:
+ /* invalid range */
+ return Qnil;
+ default:
+ /* not a range */
+ break;
+ }
}
return rb_ary_delete_at(ary, NUM2LONG(arg1));
@@ -3150,10 +4416,11 @@ ary_reject(VALUE orig, VALUE result)
long i;
for (i = 0; i < RARRAY_LEN(orig); i++) {
- VALUE v = RARRAY_AREF(orig, i);
- if (!RTEST(rb_yield(v))) {
- rb_ary_push(result, v);
- }
+ VALUE v = RARRAY_AREF(orig, i);
+
+ if (!RTEST(rb_yield(v))) {
+ rb_ary_push(result, v);
+ }
}
return result;
}
@@ -3166,12 +4433,12 @@ reject_bang_i(VALUE a)
long i1, i2;
for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
- VALUE v = RARRAY_AREF(ary, i1);
- if (RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- arg->len[1] = ++i2;
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ arg->len[1] = ++i2;
}
return (i1 == i2) ? Qnil : ary;
}
@@ -3180,7 +4447,6 @@ static VALUE
ary_reject_bang(VALUE ary)
{
struct select_bang_arg args;
-
rb_ary_modify_check(ary);
args.ary = ary;
args.len[0] = args.len[1] = 0;
@@ -3189,37 +4455,50 @@ ary_reject_bang(VALUE ary)
/*
* call-seq:
- * ary.reject! { |item| block } -> ary or nil
- * ary.reject! -> Enumerator
+ * array.reject! {|element| ... } -> self or nil
+ * array.reject! -> new_enumerator
*
- * Deletes every element of +self+ for which the block evaluates to +true+,
- * if no changes were made returns +nil+.
+ * Removes each element for which the block returns a truthy value.
*
- * The array may not be changed instantly every time the block is called.
+ * Returns +self+ if any elements removed:
*
- * See also Enumerable#reject and Array#delete_if.
+ * a = [:foo, 'bar', 2, 'bat']
+ * a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *
+ * Returns +nil+ if no elements removed.
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [:foo, 'bar', 2]
+ * a.reject! # => #<Enumerator: [:foo, "bar", 2]:reject!>
*
- * If no block is given, an Enumerator is returned instead.
*/
static VALUE
rb_ary_reject_bang(VALUE ary)
{
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_modify(ary);
return ary_reject_bang(ary);
}
/*
* call-seq:
- * ary.reject {|item| block } -> new_ary
- * ary.reject -> Enumerator
+ * array.reject {|element| ... } -> new_array
+ * array.reject -> new_enumerator
+ *
+ * Returns a new \Array whose elements are all those from +self+
+ * for which the block returns +false+ or +nil+:
+ *
+ * a = [:foo, 'bar', 2, 'bat']
+ * a1 = a.reject {|element| element.to_s.start_with?('b') }
+ * a1 # => [:foo, 2]
*
- * Returns a new array containing the items in +self+ for which the given
- * block is not +true+. The ordering of non-rejected elements is maintained.
+ * Returns a new \Enumerator if no block given:
*
- * See also Array#delete_if
+ * a = [:foo, 'bar', 2]
+ * a.reject # => #<Enumerator: [:foo, "bar", 2]:reject>
*
- * If no block is given, an Enumerator is returned instead.
*/
static VALUE
@@ -3235,25 +4514,26 @@ rb_ary_reject(VALUE ary)
/*
* call-seq:
- * ary.delete_if { |item| block } -> ary
- * ary.delete_if -> Enumerator
+ * array.delete_if {|element| ... } -> self
+ * array.delete_if -> Enumerator
*
- * Deletes every element of +self+ for which block evaluates to +true+.
+ * Removes each element in +self+ for which the block returns a truthy value;
+ * returns +self+:
*
- * The array is changed instantly every time the block is called, not after
- * the iteration is over.
+ * a = [:foo, 'bar', 2, 'bat']
+ * a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
*
- * See also Array#reject!
+ * Returns a new \Enumerator if no block given:
*
- * If no block is given, an Enumerator is returned instead.
+ * a = [:foo, 'bar', 2]
+ * a.delete_if # => #<Enumerator: [:foo, "bar", 2]:delete_if>
*
- * scores = [ 97, 42, 75 ]
- * scores.delete_if {|score| score < 80 } #=> [97]
- */
+3 */
static VALUE
rb_ary_delete_if(VALUE ary)
{
+ ary_verify(ary);
RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
ary_reject_bang(ary);
return ary;
@@ -3263,9 +4543,9 @@ static VALUE
take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
{
VALUE *args = (VALUE *)cbarg;
- if (args[1]-- == 0) rb_iter_break();
if (argc > 1) val = rb_ary_new4(argc, argv);
rb_ary_push(args[0], val);
+ if (--args[1] == 0) rb_iter_break();
return Qnil;
}
@@ -3275,38 +4555,71 @@ take_items(VALUE obj, long n)
VALUE result = rb_check_array_type(obj);
VALUE args[2];
+ if (n == 0) return result;
if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
result = rb_ary_new2(n);
args[0] = result; args[1] = (VALUE)n;
- if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
- rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
- rb_obj_class(obj));
+ if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+ rb_obj_class(obj));
return result;
}
/*
* call-seq:
- * ary.zip(arg, ...) -> new_ary
- * ary.zip(arg, ...) { |arr| block } -> nil
+ * array.zip(*other_arrays) -> new_array
+ * array.zip(*other_arrays) {|other_array| ... } -> nil
+ *
+ * When no block given, returns a new \Array +new_array+ of size <tt>self.size</tt>
+ * whose elements are Arrays.
+ *
+ * Each nested array <tt>new_array[n]</tt> is of size <tt>other_arrays.size+1</tt>,
+ * and contains:
+ *
+ * - The _nth_ element of +self+.
+ * - The _nth_ element of each of the +other_arrays+.
+ *
+ * If all +other_arrays+ and +self+ are the same size:
+ *
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3]
+ * c = [:c0, :c1, :c2, :c3]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
+ *
+ * If any array in +other_arrays+ is smaller than +self+,
+ * fills to <tt>self.size</tt> with +nil+:
*
- * Converts any arguments to arrays, then merges elements of +self+ with
- * corresponding elements from each argument.
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2]
+ * c = [:c0, :c1]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, nil], [:a3, nil, nil]]
*
- * This generates a sequence of <code>ary.size</code> _n_-element arrays,
- * where _n_ is one more than the count of arguments.
+ * If any array in +other_arrays+ is larger than +self+,
+ * its trailing elements are ignored:
*
- * If the size of any argument is less than the size of the initial array,
- * +nil+ values are supplied.
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3, :b4]
+ * c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ * d = a.zip(b, c)
+ * d # => [[:a0, :b0, :c0], [:a1, :b1, :c1], [:a2, :b2, :c2], [:a3, :b3, :c3]]
*
- * If a block is given, it is invoked for each output +array+, otherwise an
- * array of arrays is returned.
+ * When a block is given, calls the block with each of the sub-arrays (formed as above); returns +nil+:
+ *
+ * a = [:a0, :a1, :a2, :a3]
+ * b = [:b0, :b1, :b2, :b3]
+ * c = [:c0, :c1, :c2, :c3]
+ * a.zip(b, c) {|sub_array| p sub_array} # => nil
+ *
+ * Output:
+ *
+ * [:a0, :b0, :c0]
+ * [:a1, :b1, :c1]
+ * [:a2, :b2, :c2]
+ * [:a3, :b3, :c3]
*
- * a = [ 4, 5, 6 ]
- * b = [ 7, 8, 9 ]
- * [1, 2, 3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- * [1, 2].zip(a, b) #=> [[1, 4, 7], [2, 5, 8]]
- * a.zip([1, 2], [8]) #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
*/
static VALUE
@@ -3317,51 +4630,51 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
VALUE result = Qnil;
for (i=0; i<argc; i++) {
- argv[i] = take_items(argv[i], len);
+ argv[i] = take_items(argv[i], len);
}
if (rb_block_given_p()) {
- int arity = rb_block_arity();
-
- if (arity > 1) {
- VALUE work, *tmp;
-
- tmp = ALLOCV_N(VALUE, work, argc+1);
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- tmp[0] = RARRAY_AREF(ary, i);
- for (j=0; j<argc; j++) {
- tmp[j+1] = rb_ary_elt(argv[j], i);
- }
- rb_yield_values2(argc+1, tmp);
- }
-
- if (work) ALLOCV_END(work);
- }
- else {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE tmp = rb_ary_new2(argc+1);
-
- rb_ary_push(tmp, RARRAY_AREF(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- rb_yield(tmp);
- }
- }
+ int arity = rb_block_arity();
+
+ if (arity > 1) {
+ VALUE work, *tmp;
+
+ tmp = ALLOCV_N(VALUE, work, argc+1);
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ tmp[0] = RARRAY_AREF(ary, i);
+ for (j=0; j<argc; j++) {
+ tmp[j+1] = rb_ary_elt(argv[j], i);
+ }
+ rb_yield_values2(argc+1, tmp);
+ }
+
+ if (work) ALLOCV_END(work);
+ }
+ else {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE tmp = rb_ary_new2(argc+1);
+
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_yield(tmp);
+ }
+ }
}
else {
- result = rb_ary_new_capa(len);
+ result = rb_ary_new_capa(len);
- for (i=0; i<len; i++) {
- VALUE tmp = rb_ary_new_capa(argc+1);
+ for (i=0; i<len; i++) {
+ VALUE tmp = rb_ary_new_capa(argc+1);
- rb_ary_push(tmp, RARRAY_AREF(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- rb_ary_push(result, tmp);
- }
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_ary_push(result, tmp);
+ }
}
return result;
@@ -3369,15 +4682,14 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.transpose -> new_ary
+ * array.transpose -> new_array
*
- * Assumes that +self+ is an array of arrays and transposes the rows and
- * columns.
+ * Transposes the rows and columns in an \Array of Arrays;
+ * the nested Arrays must all be the same size:
*
- * a = [[1,2], [3,4], [5,6]]
- * a.transpose #=> [[1, 3, 5], [2, 4, 6]]
+ * a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ * a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
*
- * If the length of the subarrays don't match, an IndexError is raised.
*/
static VALUE
@@ -3389,36 +4701,34 @@ rb_ary_transpose(VALUE ary)
alen = RARRAY_LEN(ary);
if (alen == 0) return rb_ary_dup(ary);
for (i=0; i<alen; i++) {
- tmp = to_ary(rb_ary_elt(ary, i));
- if (elen < 0) { /* first element */
- elen = RARRAY_LEN(tmp);
- result = rb_ary_new2(elen);
- for (j=0; j<elen; j++) {
- rb_ary_store(result, j, rb_ary_new2(alen));
- }
- }
- else if (elen != RARRAY_LEN(tmp)) {
- rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
- RARRAY_LEN(tmp), elen);
- }
- for (j=0; j<elen; j++) {
- rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
- }
+ tmp = to_ary(rb_ary_elt(ary, i));
+ if (elen < 0) { /* first element */
+ elen = RARRAY_LEN(tmp);
+ result = rb_ary_new2(elen);
+ for (j=0; j<elen; j++) {
+ rb_ary_store(result, j, rb_ary_new2(alen));
+ }
+ }
+ else if (elen != RARRAY_LEN(tmp)) {
+ rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+ RARRAY_LEN(tmp), elen);
+ }
+ for (j=0; j<elen; j++) {
+ rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+ }
}
return result;
}
/*
* call-seq:
- * ary.replace(other_ary) -> ary
- * ary.initialize_copy(other_ary) -> ary
+ * array.replace(other_array) -> self
+ *
+ * Replaces the content of +self+ with the content of +other_array+; returns +self+:
*
- * Replaces the contents of +self+ with the contents of +other_ary+,
- * truncating or expanding if necessary.
+ * a = [:foo, 'bar', 2]
+ * a.replace(['foo', :bar, 3]) # => ["foo", :bar, 3]
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
- * a #=> ["x", "y", "z"]
*/
VALUE
@@ -3428,94 +4738,270 @@ rb_ary_replace(VALUE copy, VALUE orig)
orig = to_ary(orig);
if (copy == orig) return copy;
- if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
- VALUE shared = 0;
+ rb_ary_reset(copy);
- if (ARY_OWNS_HEAP_P(copy)) {
- RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
- }
- else if (ARY_SHARED_P(copy)) {
- shared = ARY_SHARED(copy);
- FL_UNSET_SHARED(copy);
- }
- FL_SET_EMBED(copy);
- ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
- if (shared) {
- rb_ary_decrement_share(shared);
- }
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
+ /* orig has enough space to embed the contents of orig. */
+ if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
+ assert(ARY_EMBED_P(copy));
+ ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR_TRANSIENT(orig));
+ ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
}
+#if USE_RVARGC
+ /* orig is embedded but copy does not have enough space to embed the
+ * contents of orig. */
+ else if (ARY_EMBED_P(orig)) {
+ long len = ARY_EMBED_LEN(orig);
+ VALUE *ptr = ary_heap_alloc(copy, len);
+
+ FL_UNSET_EMBED(copy);
+ ARY_SET_PTR(copy, ptr);
+ ARY_SET_LEN(copy, len);
+ ARY_SET_CAPA(copy, len);
+
+ // No allocation and exception expected that could leave `copy` in a
+ // bad state from the edits above.
+ ary_memcpy(copy, 0, len, RARRAY_CONST_PTR_TRANSIENT(orig));
+ }
+#endif
+ /* Otherwise, orig is on heap and copy does not have enough space to embed
+ * the contents of orig. */
else {
- VALUE shared = ary_make_shared(orig);
- if (ARY_OWNS_HEAP_P(copy)) {
- RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
- }
- else {
- rb_ary_unshare_safe(copy);
- }
+ VALUE shared_root = ary_make_shared(orig);
FL_UNSET_EMBED(copy);
- ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- rb_ary_set_shared(copy, shared);
+ ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+ ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+ rb_ary_set_shared(copy, shared_root);
}
+ ary_verify(copy);
return copy;
}
/*
* call-seq:
- * ary.clear -> ary
+ * array.clear -> self
+ *
+ * Removes all elements from +self+:
*
- * Removes all elements from +self+.
+ * a = [:foo, 'bar', 2]
+ * a.clear # => []
*
- * a = [ "a", "b", "c", "d", "e" ]
- * a.clear #=> [ ]
*/
VALUE
rb_ary_clear(VALUE ary)
{
rb_ary_modify_check(ary);
- ARY_SET_LEN(ary, 0);
if (ARY_SHARED_P(ary)) {
- if (!ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- }
+ if (!ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
+ }
}
- else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ else {
+ ARY_SET_LEN(ary, 0);
+ if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+ ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ }
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.fill(obj) -> ary
- * ary.fill(obj, start [, length]) -> ary
- * ary.fill(obj, range ) -> ary
- * ary.fill { |index| block } -> ary
- * ary.fill(start [, length] ) { |index| block } -> ary
- * ary.fill(range) { |index| block } -> ary
+ * array.fill(obj) -> self
+ * array.fill(obj, start) -> self
+ * array.fill(obj, start, length) -> self
+ * array.fill(obj, range) -> self
+ * array.fill {|index| ... } -> self
+ * array.fill(start) {|index| ... } -> self
+ * array.fill(start, length) {|index| ... } -> self
+ * array.fill(range) {|index| ... } -> self
+ *
+ * Replaces specified elements in +self+ with specified objects; returns +self+.
+ *
+ * With argument +obj+ and no block given, replaces all elements with that one object:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a # => ["a", "b", "c", "d"]
+ * a.fill(:X) # => [:X, :X, :X, :X]
+ *
+ * With arguments +obj+ and \Integer +start+, and no block given,
+ * replaces elements based on the given start.
+ *
+ * If +start+ is in range (<tt>0 <= start < array.size</tt>),
+ * replaces all elements from offset +start+ through the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 2) # => ["a", "b", :X, :X]
*
- * The first three forms set the selected elements of +self+ (which
- * may be the entire array) to +obj+.
+ * If +start+ is too large (<tt>start >= array.size</tt>), does nothing:
*
- * A +start+ of +nil+ is equivalent to zero.
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 4) # => ["a", "b", "c", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5) # => ["a", "b", "c", "d"]
*
- * A +length+ of +nil+ is equivalent to the length of the array.
+ * If +start+ is negative, counts from the end (starting index is <tt>start + array.size</tt>):
*
- * The last three forms fill the array with the value of the given block,
- * which is passed the absolute index of each element to be filled.
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -2) # => ["a", "b", :X, :X]
*
- * Negative values of +start+ count from the end of the array, where +-1+ is
- * the last element.
+ * If +start+ is too small (less than and far from zero), replaces all elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -6) # => [:X, :X, :X, :X]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -50) # => [:X, :X, :X, :X]
+ *
+ * With arguments +obj+, \Integer +start+, and \Integer +length+, and no block given,
+ * replaces elements based on the given +start+ and +length+.
+ *
+ * If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 1, 1) # => ["a", :X, "c", "d"]
+ *
+ * If +start+ is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, -2, 1) # => ["a", "b", :X, "d"]
+ *
+ * If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5, 0) # => ["a", "b", "c", "d", nil]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 5, 2) # => ["a", "b", "c", "d", nil, :X, :X]
+ *
+ * If +length+ is zero or negative, replaces no elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, 1, 0) # => ["a", "b", "c", "d"]
+ * a.fill(:X, 1, -1) # => ["a", "b", "c", "d"]
+ *
+ * With arguments +obj+ and \Range +range+, and no block given,
+ * replaces elements based on the given range.
+ *
+ * If the range is positive and ascending (<tt>0 < range.begin <= range.end</tt>),
+ * replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (1..1)) # => ["a", :X, "c", "d"]
+ *
+ * If <tt>range.first</tt> is negative, replaces no elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-1..1)) # => ["a", "b", "c", "d"]
+ *
+ * If <tt>range.last</tt> is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (0..-2)) # => [:X, :X, :X, "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (1..-2)) # => ["a", :X, :X, "d"]
+ *
+ * If <tt>range.last</tt> and <tt>range.last</tt> are both negative,
+ * both count from the end of the array:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-1..-1)) # => ["a", "b", "c", :X]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(:X, (-2..-2)) # => ["a", "b", :X, "d"]
+ *
+ * With no arguments and a block given, calls the block with each index;
+ * replaces the corresponding element with the block's return value:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ * With argument +start+ and a block given, calls the block with each index
+ * from offset +start+ to the end; replaces the corresponding element
+ * with the block's return value.
+ *
+ * If start is in range (<tt>0 <= start < array.size</tt>),
+ * replaces from offset +start+ to the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "new_3"]
+ *
+ * If +start+ is too large(<tt>start >= array.size</tt>), does nothing:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(4) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ * If +start+ is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "new_3"]
+ *
+ * If start is too small (<tt>start <= -array.size</tt>, replaces all elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-6) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-50) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "new_3"]
+ *
+ * With arguments +start+ and +length+, and a block given,
+ * calls the block for each index specified by start length;
+ * replaces the corresponding element with the block's return value.
+ *
+ * If +start+ is in range, replaces +length+ elements beginning at offset +start+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1, 1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ * If start is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2, 1) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
+ *
+ * If +start+ is large (<tt>start >= array.size</tt>), extends +self+ with +nil+:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(5, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(5, 2) { |index| "new_#{index}" } # => ["a", "b", "c", "d", nil, "new_5", "new_6"]
+ *
+ * If +length+ is zero or less, replaces no elements:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1, 0) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
+ * a.fill(1, -1) { |index| "new_#{index}" } # => ["a", "b", "c", "d"]
+ *
+ * With arguments +obj+ and +range+, and a block given,
+ * calls the block with each index in the given range;
+ * replaces the corresponding element with the block's return value.
+ *
+ * If the range is positive and ascending (<tt>range 0 < range.begin <= range.end</tt>,
+ * replaces elements from <tt>range.begin</tt> to <tt>range.end</tt>:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1..1) { |index| "new_#{index}" } # => ["a", "new_1", "c", "d"]
+ *
+ * If +range.first+ is negative, does nothing:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-1..1) { |index| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ * If <tt>range.last</tt> is negative, counts from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(0..-2) { |index| "new_#{index}" } # => ["new_0", "new_1", "new_2", "d"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(1..-2) { |index| "new_#{index}" } # => ["a", "new_1", "new_2", "d"]
+ *
+ * If <tt>range.first</tt> and <tt>range.last</tt> are both negative,
+ * both count from the end:
+ *
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-1..-1) { |index| "new_#{index}" } # => ["a", "b", "c", "new_3"]
+ * a = ['a', 'b', 'c', 'd']
+ * a.fill(-2..-2) { |index| "new_#{index}" } # => ["a", "b", "new_2", "d"]
*
- * a = [ "a", "b", "c", "d" ]
- * a.fill("x") #=> ["x", "x", "x", "x"]
- * a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
- * a.fill("y", 0..1) #=> ["y", "y", "z", "z"]
- * a.fill { |i| i*i } #=> [0, 1, 4, 9]
- * a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
*/
static VALUE
@@ -3525,84 +5011,74 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
long beg = 0, end = 0, len = 0;
if (rb_block_given_p()) {
- rb_scan_args(argc, argv, "02", &arg1, &arg2);
- argc += 1; /* hackish */
+ rb_scan_args(argc, argv, "02", &arg1, &arg2);
+ argc += 1; /* hackish */
}
else {
- rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+ rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
}
switch (argc) {
case 1:
- beg = 0;
- len = RARRAY_LEN(ary);
- break;
+ beg = 0;
+ len = RARRAY_LEN(ary);
+ break;
case 2:
- if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
- break;
- }
- /* fall through */
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+ break;
+ }
+ /* fall through */
case 3:
- beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
- if (beg < 0) {
- beg = RARRAY_LEN(ary) + beg;
- if (beg < 0) beg = 0;
- }
- len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
- break;
+ beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+ if (beg < 0) {
+ beg = RARRAY_LEN(ary) + beg;
+ if (beg < 0) beg = 0;
+ }
+ len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+ break;
}
rb_ary_modify(ary);
if (len < 0) {
return ary;
}
if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
- rb_raise(rb_eArgError, "argument too big");
+ rb_raise(rb_eArgError, "argument too big");
}
end = beg + len;
if (RARRAY_LEN(ary) < end) {
- if (end >= ARY_CAPA(ary)) {
- ary_resize_capa(ary, end);
- }
- ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
- ARY_SET_LEN(ary, end);
+ if (end >= ARY_CAPA(ary)) {
+ ary_resize_capa(ary, end);
+ }
+ ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+ ARY_SET_LEN(ary, end);
}
- if (item == Qundef) {
- VALUE v;
- long i;
+ if (UNDEF_P(item)) {
+ VALUE v;
+ long i;
- for (i=beg; i<end; i++) {
- v = rb_yield(LONG2NUM(i));
- if (i>=RARRAY_LEN(ary)) break;
- ARY_SET(ary, i, v);
- }
+ for (i=beg; i<end; i++) {
+ v = rb_yield(LONG2NUM(i));
+ if (i>=RARRAY_LEN(ary)) break;
+ ARY_SET(ary, i, v);
+ }
}
else {
- ary_memfill(ary, beg, len, item);
+ ary_memfill(ary, beg, len, item);
}
return ary;
}
/*
* call-seq:
- * ary + other_ary -> new_ary
- *
- * Concatenation --- Returns a new array built by concatenating the
- * two arrays together to produce a third array.
+ * array + other_array -> new_array
*
- * [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
- * a = [ "a", "b", "c" ]
- * c = a + [ "d", "e", "f" ]
- * c #=> [ "a", "b", "c", "d", "e", "f" ]
- * a #=> [ "a", "b", "c" ]
+ * Returns a new \Array containing all elements of +array+
+ * followed by all elements of +other_array+:
*
- * Note that
- * x += y
- * is the same as
- * x = x + y
- * This means that it produces a new array. As a consequence,
- * repeated use of <code>+=</code> on arrays can be quite inefficient.
+ * a = [0, 1] + [2, 3]
+ * a # => [0, 1, 2, 3]
*
- * See also Array#concat.
+ * Related: #concat.
*/
VALUE
@@ -3617,8 +5093,8 @@ rb_ary_plus(VALUE x, VALUE y)
len = xlen + ylen;
z = rb_ary_new2(len);
- ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
- ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+ ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR_TRANSIENT(x));
+ ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR_TRANSIENT(y));
ARY_SET_LEN(z, len);
return z;
}
@@ -3628,29 +5104,20 @@ ary_append(VALUE x, VALUE y)
{
long n = RARRAY_LEN(y);
if (n > 0) {
- rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
+ rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR_TRANSIENT(y), n);
}
+ RB_GC_GUARD(y);
return x;
}
/*
* call-seq:
- * ary.concat(other_ary1, other_ary2,...) -> ary
- *
- * Appends the elements of +other_ary+s to +self+.
+ * array.concat(*other_arrays) -> self
*
- * [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- * [ "a" ].concat( ["b"], ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- * [ "a" ].concat #=> [ "a" ]
+ * Adds to +array+ all elements from each \Array in +other_arrays+; returns +self+:
*
- * a = [ 1, 2, 3 ]
- * a.concat( [ 4, 5 ] )
- * a #=> [ 1, 2, 3, 4, 5 ]
- *
- * a = [ 1, 2 ]
- * a.concat(a, a) #=> [1, 2, 1, 2, 1, 2]
- *
- * See also Array#+.
+ * a = [0, 1]
+ * a.concat([2, 3], [4, 5]) # => [0, 1, 2, 3, 4, 5]
*/
static VALUE
@@ -3658,15 +5125,19 @@ rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
{
rb_ary_modify_check(ary);
- if (argc > 0) {
- int i;
- VALUE args = rb_ary_tmp_new(argc);
- for (i = 0; i < argc; i++) {
- rb_ary_concat(args, argv[i]);
- }
- ary_append(ary, args);
+ if (argc == 1) {
+ rb_ary_concat(ary, argv[0]);
+ }
+ else if (argc > 1) {
+ int i;
+ VALUE args = rb_ary_hidden_new(argc);
+ for (i = 0; i < argc; i++) {
+ rb_ary_concat(args, argv[i]);
+ }
+ ary_append(ary, args);
}
+ ary_verify(ary);
return ary;
}
@@ -3678,18 +5149,19 @@ rb_ary_concat(VALUE x, VALUE y)
/*
* call-seq:
- * ary * int -> new_ary
- * ary * str -> new_string
+ * array * n -> new_array
+ * array * string_separator -> new_string
*
- * Repetition --- With a String argument, equivalent to
- * <code>ary.join(str)</code>.
+ * When non-negative argument \Integer +n+ is given,
+ * returns a new \Array built by concatenating the +n+ copies of +self+:
*
- * Otherwise, returns a new array built by concatenating the +int+ copies of
- * +self+.
+ * a = ['x', 'y']
+ * a * 3 # => ["x", "y", "x", "y", "x", "y"]
*
+ * When \String argument +string_separator+ is given,
+ * equivalent to <tt>array.join(string_separator)</tt>:
*
- * [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- * [ 1, 2, 3 ] * "," #=> "1,2,3"
+ * [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {:foo=>0}"
*
*/
@@ -3702,61 +5174,54 @@ rb_ary_times(VALUE ary, VALUE times)
tmp = rb_check_string_type(times);
if (!NIL_P(tmp)) {
- return rb_ary_join(ary, tmp);
+ return rb_ary_join(ary, tmp);
}
len = NUM2LONG(times);
if (len == 0) {
- ary2 = ary_new(rb_obj_class(ary), 0);
- goto out;
+ ary2 = ary_new(rb_cArray, 0);
+ goto out;
}
if (len < 0) {
- rb_raise(rb_eArgError, "negative argument");
+ rb_raise(rb_eArgError, "negative argument");
}
if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
- rb_raise(rb_eArgError, "argument too big");
+ rb_raise(rb_eArgError, "argument too big");
}
len *= RARRAY_LEN(ary);
- ary2 = ary_new(rb_obj_class(ary), len);
+ ary2 = ary_new(rb_cArray, len);
ARY_SET_LEN(ary2, len);
- ptr = RARRAY_CONST_PTR(ary);
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
t = RARRAY_LEN(ary);
if (0 < t) {
- ary_memcpy(ary2, 0, t, ptr);
- while (t <= len/2) {
- ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+ ary_memcpy(ary2, 0, t, ptr);
+ while (t <= len/2) {
+ ary_memcpy(ary2, t, t, RARRAY_CONST_PTR_TRANSIENT(ary2));
t *= 2;
}
if (t < len) {
- ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+ ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR_TRANSIENT(ary2));
}
}
out:
- OBJ_INFECT(ary2, ary);
-
return ary2;
}
/*
* call-seq:
- * ary.assoc(obj) -> element_ary or nil
+ * array.assoc(obj) -> found_array or nil
*
- * Searches through an array whose elements are also arrays comparing +obj+
- * with the first element of each contained array using <code>obj.==</code>.
+ * Returns the first element in +self+ that is an \Array
+ * whose first element <tt>==</tt> +obj+:
*
- * Returns the first contained array that matches (that is, the first
- * associated array), or +nil+ if no match is found.
+ * a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ * a.assoc(4) # => [4, 5, 6]
*
- * See also Array#rassoc
+ * Returns +nil+ if no such element is found.
*
- * s1 = [ "colors", "red", "blue", "green" ]
- * s2 = [ "letters", "a", "b", "c" ]
- * s3 = "foo"
- * a = [ s1, s2, s3 ]
- * a.assoc("letters") #=> [ "letters", "a", "b", "c" ]
- * a.assoc("foo") #=> nil
+ * Related: #rassoc.
*/
VALUE
@@ -3766,30 +5231,27 @@ rb_ary_assoc(VALUE ary, VALUE key)
VALUE v;
for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = rb_check_array_type(RARRAY_AREF(ary, i));
- if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
- rb_equal(RARRAY_AREF(v, 0), key))
- return v;
+ v = rb_check_array_type(RARRAY_AREF(ary, i));
+ if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+ rb_equal(RARRAY_AREF(v, 0), key))
+ return v;
}
return Qnil;
}
/*
* call-seq:
- * ary.rassoc(obj) -> element_ary or nil
- *
- * Searches through the array whose elements are also arrays.
+ * array.rassoc(obj) -> found_array or nil
*
- * Compares +obj+ with the second element of each contained array using
- * <code>obj.==</code>.
+ * Returns the first element in +self+ that is an \Array
+ * whose second element <tt>==</tt> +obj+:
*
- * Returns the first contained array that matches +obj+.
+ * a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ * a.rassoc(4) # => [2, 4]
*
- * See also Array#assoc.
+ * Returns +nil+ if no such element is found.
*
- * a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- * a.rassoc("two") #=> [2, "two"]
- * a.rassoc("four") #=> nil
+ * Related: #assoc.
*/
VALUE
@@ -3799,11 +5261,11 @@ rb_ary_rassoc(VALUE ary, VALUE value)
VALUE v;
for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = RARRAY_AREF(ary, i);
- if (RB_TYPE_P(v, T_ARRAY) &&
- RARRAY_LEN(v) > 1 &&
- rb_equal(RARRAY_AREF(v, 1), value))
- return v;
+ v = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(v, T_ARRAY) &&
+ RARRAY_LEN(v) > 1 &&
+ rb_equal(RARRAY_AREF(v, 1), value))
+ return v;
}
return Qnil;
}
@@ -3816,43 +5278,48 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
if (recur) return Qtrue; /* Subtle! */
+ /* rb_equal() can evacuate ptrs */
p1 = RARRAY_CONST_PTR(ary1);
p2 = RARRAY_CONST_PTR(ary2);
len1 = RARRAY_LEN(ary1);
for (i = 0; i < len1; i++) {
- if (*p1 != *p2) {
- if (rb_equal(*p1, *p2)) {
- len1 = RARRAY_LEN(ary1);
- if (len1 != RARRAY_LEN(ary2))
- return Qfalse;
- if (len1 < i)
- return Qtrue;
- p1 = RARRAY_CONST_PTR(ary1) + i;
- p2 = RARRAY_CONST_PTR(ary2) + i;
- }
- else {
- return Qfalse;
- }
- }
- p1++;
- p2++;
+ if (*p1 != *p2) {
+ if (rb_equal(*p1, *p2)) {
+ len1 = RARRAY_LEN(ary1);
+ if (len1 != RARRAY_LEN(ary2))
+ return Qfalse;
+ if (len1 < i)
+ return Qtrue;
+ p1 = RARRAY_CONST_PTR(ary1) + i;
+ p2 = RARRAY_CONST_PTR(ary2) + i;
+ }
+ else {
+ return Qfalse;
+ }
+ }
+ p1++;
+ p2++;
}
return Qtrue;
}
/*
* call-seq:
- * ary == other_ary -> bool
+ * array == other_array -> true or false
*
- * Equality --- Two arrays are equal if they contain the same number of
- * elements and if each element is equal to (according to Object#==) the
- * corresponding element in +other_ary+.
+ * Returns +true+ if both <tt>array.size == other_array.size</tt>
+ * and for each index +i+ in +array+, <tt>array[i] == other_array[i]</tt>:
*
- * [ "a", "c" ] == [ "a", "c", 7 ] #=> false
- * [ "a", "c", 7 ] == [ "a", "c", 7 ] #=> true
- * [ "a", "c", 7 ] == [ "a", "d", "f" ] #=> false
+ * a0 = [:foo, 'bar', 2]
+ * a1 = [:foo, 'bar', 2.0]
+ * a1 == a0 # => true
+ * [] == [] # => true
*
+ * Otherwise, returns +false+.
+ *
+ * This method is different from method Array#eql?,
+ * which compares elements using <tt>Object#eql?</tt>.
*/
static VALUE
@@ -3860,13 +5327,13 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
{
if (ary1 == ary2) return Qtrue;
if (!RB_TYPE_P(ary2, T_ARRAY)) {
- if (!rb_respond_to(ary2, idTo_ary)) {
- return Qfalse;
- }
- return rb_equal(ary2, ary1);
+ if (!rb_respond_to(ary2, idTo_ary)) {
+ return Qfalse;
+ }
+ return rb_equal(ary2, ary1);
}
if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
}
@@ -3877,18 +5344,27 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
if (recur) return Qtrue; /* Subtle! */
for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
- return Qfalse;
+ if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ return Qfalse;
}
return Qtrue;
}
/*
* call-seq:
- * ary.eql?(other) -> true or false
+ * array.eql? other_array -> true or false
+ *
+ * Returns +true+ if +self+ and +other_array+ are the same size,
+ * and if, for each index +i+ in +self+, <tt>self[i].eql? other_array[i]</tt>:
*
- * Returns +true+ if +self+ and +other+ are the same object,
- * or are both arrays with the same content (according to Object#eql?).
+ * a0 = [:foo, 'bar', 2]
+ * a1 = [:foo, 'bar', 2]
+ * a1.eql?(a0) # => true
+ *
+ * Otherwise, returns +false+.
+ *
+ * This method is different from method Array#==,
+ * which compares using method <tt>Object#==</tt>.
*/
static VALUE
@@ -3897,20 +5373,21 @@ rb_ary_eql(VALUE ary1, VALUE ary2)
if (ary1 == ary2) return Qtrue;
if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
}
/*
* call-seq:
- * ary.hash -> integer
+ * array.hash -> integer
*
- * Compute a hash-code for this array.
+ * Returns the integer hash value for +self+.
*
- * Two arrays with the same content will have the same hash code (and will
- * compare using #eql?).
+ * Two arrays with the same content will have the same hash code (and will compare using eql?):
+ *
+ * [0, 1, 2].hash == [0, 1, 2].hash # => true
+ * [0, 1, 2].hash == [0, 1, 3].hash # => false
*
- * See also Object#hash.
*/
static VALUE
@@ -3923,23 +5400,22 @@ rb_ary_hash(VALUE ary)
h = rb_hash_start(RARRAY_LEN(ary));
h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
for (i=0; i<RARRAY_LEN(ary); i++) {
- n = rb_hash(RARRAY_AREF(ary, i));
- h = rb_hash_uint(h, NUM2LONG(n));
+ n = rb_hash(RARRAY_AREF(ary, i));
+ h = rb_hash_uint(h, NUM2LONG(n));
}
h = rb_hash_end(h);
- return LONG2FIX(h);
+ return ST2FIX(h);
}
/*
* call-seq:
- * ary.include?(object) -> true or false
+ * array.include?(obj) -> true or false
*
- * Returns +true+ if the given +object+ is present in +self+ (that is, if any
- * element <code>==</code> +object+), otherwise returns +false+.
+ * Returns +true+ if for some index +i+ in +self+, <tt>obj == self[i]</tt>;
+ * otherwise +false+:
*
- * a = [ "a", "b", "c" ]
- * a.include?("b") #=> true
- * a.include?("z") #=> false
+ * [0, 1, 2].include?(2) # => true
+ * [0, 1, 2].include?(3) # => false
*/
VALUE
@@ -3949,18 +5425,28 @@ rb_ary_includes(VALUE ary, VALUE item)
VALUE e;
for (i=0; i<RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- switch (rb_equal_opt(e, item)) {
- case Qundef:
- if (rb_equal(e, item)) return Qtrue;
- break;
- case Qtrue:
- return Qtrue;
- }
+ e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, item)) {
+ return Qtrue;
+ }
}
return Qfalse;
}
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
+{
+ long i;
+ VALUE e;
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (rb_eql(item, e)) {
+ return Qtrue;
+ }
+ }
+ return Qfalse;
+}
static VALUE
recursive_cmp(VALUE ary1, VALUE ary2, int recur)
@@ -3970,45 +5456,46 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
if (recur) return Qundef; /* Subtle! */
len = RARRAY_LEN(ary1);
if (len > RARRAY_LEN(ary2)) {
- len = RARRAY_LEN(ary2);
+ len = RARRAY_LEN(ary2);
}
for (i=0; i<len; i++) {
- VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
- VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
- if (v != INT2FIX(0)) {
- return v;
- }
+ VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+ VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+ if (v != INT2FIX(0)) {
+ return v;
+ }
}
return Qundef;
}
/*
* call-seq:
- * ary <=> other_ary -> -1, 0, +1 or nil
+ * array <=> other_array -> -1, 0, or 1
+ *
+ * Returns -1, 0, or 1 as +self+ is less than, equal to, or greater than +other_array+.
+ * For each index +i+ in +self+, evaluates <tt>result = self[i] <=> other_array[i]</tt>.
+ *
+ * Returns -1 if any result is -1:
+ *
+ * [0, 1, 2] <=> [0, 1, 3] # => -1
*
- * Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- * array is less than, equal to, or greater than +other_ary+.
+ * Returns 1 if any result is 1:
*
- * Each object in each array is compared (using the <=> operator).
+ * [0, 1, 2] <=> [0, 1, 1] # => 1
*
- * Arrays are compared in an "element-wise" manner; the first element of +ary+
- * is compared with the first one of +other_ary+ using the <=> operator, then
- * each of the second elements, etc...
- * As soon as the result of any such comparison is non zero (i.e. the two
- * corresponding elements are not equal), that result is returned for the
- * whole array comparison.
+ * When all results are zero:
*
- * If all the elements are equal, then the result is based on a comparison of
- * the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- * and only if, they have the same length and the value of each element is
- * equal to the value of the corresponding element in the other array.
+ * - Returns -1 if +array+ is smaller than +other_array+:
*
- * +nil+ is returned if the +other_ary+ is not an array or if the comparison
- * of two elements returned +nil+.
+ * [0, 1, 2] <=> [0, 1, 2, 3] # => -1
*
- * [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
- * [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
- * [ 1, 2 ] <=> [ 1, :two ] #=> nil
+ * - Returns 1 if +array+ is larger than +other_array+:
+ *
+ * [0, 1, 2] <=> [0, 1] # => 1
+ *
+ * - Returns 0 if +array+ and +other_array+ are the same size:
+ *
+ * [0, 1, 2] <=> [0, 1, 2] # => 0
*
*/
@@ -4022,7 +5509,7 @@ rb_ary_cmp(VALUE ary1, VALUE ary2)
if (NIL_P(ary2)) return Qnil;
if (ary1 == ary2) return INT2FIX(0);
v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
- if (v != Qundef) return v;
+ if (!UNDEF_P(v)) return v;
len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
@@ -4035,16 +5522,17 @@ ary_add_hash(VALUE hash, VALUE ary)
long i;
for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE elt = RARRAY_AREF(ary, i);
- rb_hash_add_new_element(hash, elt, elt);
+ VALUE elt = RARRAY_AREF(ary, i);
+ rb_hash_add_new_element(hash, elt, elt);
}
return hash;
}
static inline VALUE
-ary_tmp_hash_new(void)
+ary_tmp_hash_new(VALUE ary)
{
- VALUE hash = rb_hash_new();
+ long size = RARRAY_LEN(ary);
+ VALUE hash = rb_hash_new_with_size(size);
RBASIC_CLEAR_CLASS(hash);
return hash;
@@ -4053,7 +5541,7 @@ ary_tmp_hash_new(void)
static VALUE
ary_make_hash(VALUE ary)
{
- VALUE hash = ary_tmp_hash_new();
+ VALUE hash = ary_tmp_hash_new(ary);
return ary_add_hash(hash, ary);
}
@@ -4063,8 +5551,8 @@ ary_add_hash_by(VALUE hash, VALUE ary)
long i;
for (i = 0; i < RARRAY_LEN(ary); ++i) {
- VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
- rb_hash_add_new_element(hash, k, v);
+ VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+ rb_hash_add_new_element(hash, k, v);
}
return hash;
}
@@ -4072,51 +5560,61 @@ ary_add_hash_by(VALUE hash, VALUE ary)
static VALUE
ary_make_hash_by(VALUE ary)
{
- VALUE hash = ary_tmp_hash_new();
+ VALUE hash = ary_tmp_hash_new(ary);
return ary_add_hash_by(hash, ary);
}
static inline void
ary_recycle_hash(VALUE hash)
{
- if (RHASH(hash)->ntbl) {
- st_table *tbl = RHASH(hash)->ntbl;
- RHASH(hash)->ntbl = 0;
- st_free_table(tbl);
+ assert(RBASIC_CLASS(hash) == 0);
+ if (RHASH_ST_TABLE_P(hash)) {
+ st_table *tbl = RHASH_ST_TABLE(hash);
+ st_free_table(tbl);
+ RHASH_ST_CLEAR(hash);
}
- RB_GC_GUARD(hash);
}
/*
* call-seq:
- * ary - other_ary -> new_ary
+ * array - other_array -> new_array
*
- * Array Difference
+ * Returns a new \Array containing only those elements from +array+
+ * that are not found in \Array +other_array+;
+ * items are compared using <tt>eql?</tt>;
+ * the order from +array+ is preserved:
*
- * Returns a new array that is a copy of the original array, removing any
- * items that also appear in +other_ary+. The order is preserved from the
- * original array.
+ * [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1] # => [0, 2, 3]
+ * [0, 1, 2, 3] - [3, 0] # => [1, 2]
+ * [0, 1, 2] - [4] # => [0, 1, 2]
*
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
- *
- * If you need set-like behavior, see the library class Set.
+ * Related: Array#difference.
*/
-static VALUE
+VALUE
rb_ary_diff(VALUE ary1, VALUE ary2)
{
VALUE ary3;
VALUE hash;
long i;
- hash = ary_make_hash(to_ary(ary2));
+ ary2 = to_ary(ary2);
+ if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
ary3 = rb_ary_new();
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ VALUE elt = rb_ary_elt(ary1, i);
+ if (rb_ary_includes_by_eql(ary2, elt)) continue;
+ rb_ary_push(ary3, elt);
+ }
+ return ary3;
+ }
+
+ hash = ary_make_hash(ary2);
for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
- rb_ary_push(ary3, rb_ary_elt(ary1, i));
+ if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
+ rb_ary_push(ary3, rb_ary_elt(ary1, i));
}
ary_recycle_hash(hash);
return ary3;
@@ -4124,17 +5622,73 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
/*
* call-seq:
- * ary & other_ary -> new_ary
+ * array.difference(*other_arrays) -> new_array
*
- * Set Intersection --- Returns a new array containing unique elements common to the
- * two arrays. The order is preserved from the original array.
+ * Returns a new \Array containing only those elements from +self+
+ * that are not found in any of the Arrays +other_arrays+;
+ * items are compared using <tt>eql?</tt>; order from +self+ is preserved:
*
- * It compares elements using their #hash and #eql? methods for efficiency.
+ * [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ * [0, 1, 2, 3].difference([3, 0], [1, 3]) # => [2]
+ * [0, 1, 2].difference([4]) # => [0, 1, 2]
*
- * [ 1, 1, 3, 5 ] & [ 3, 2, 1 ] #=> [ 1, 3 ]
- * [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ] #=> [ 'a', 'b' ]
+ * Returns a copy of +self+ if no arguments given.
*
- * See also Array#uniq.
+ * Related: Array#-.
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE ary_diff;
+ long i, length;
+ volatile VALUE t0;
+ bool *is_hash = ALLOCV_N(bool, t0, argc);
+ ary_diff = rb_ary_new();
+ length = RARRAY_LEN(ary);
+
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+ if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+ }
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ int j;
+ VALUE elt = rb_ary_elt(ary, i);
+ for (j = 0; j < argc; j++) {
+ if (is_hash[j]) {
+ if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
+ break;
+ }
+ else {
+ if (rb_ary_includes_by_eql(argv[j], elt)) break;
+ }
+ }
+ if (j == argc) rb_ary_push(ary_diff, elt);
+ }
+
+ ALLOCV_END(t0);
+
+ return ary_diff;
+}
+
+
+/*
+ * call-seq:
+ * array & other_array -> new_array
+ *
+ * Returns a new \Array containing each element found in both +array+ and \Array +other_array+;
+ * duplicates are omitted; items are compared using <tt>eql?</tt>:
+ *
+ * [0, 1, 2, 3] & [1, 2] # => [1, 2]
+ * [0, 1, 0, 1] & [0, 1] # => [0, 1]
+ *
+ * Preserves order from +array+:
+ *
+ * [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
+ *
+ * Related: Array#intersection.
*/
@@ -4142,28 +5696,70 @@ static VALUE
rb_ary_and(VALUE ary1, VALUE ary2)
{
VALUE hash, ary3, v;
- st_table *table;
st_data_t vv;
long i;
ary2 = to_ary(ary2);
ary3 = rb_ary_new();
- if (RARRAY_LEN(ary2) == 0) return ary3;
+ if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ if (!rb_ary_includes_by_eql(ary2, v)) continue;
+ if (rb_ary_includes_by_eql(ary3, v)) continue;
+ rb_ary_push(ary3, v);
+ }
+ return ary3;
+ }
+
hash = ary_make_hash(ary2);
- table = rb_hash_tbl_raw(hash);
for (i=0; i<RARRAY_LEN(ary1); i++) {
- v = RARRAY_AREF(ary1, i);
- vv = (st_data_t)v;
- if (st_delete(table, &vv, 0)) {
- rb_ary_push(ary3, v);
- }
+ v = RARRAY_AREF(ary1, i);
+ vv = (st_data_t)v;
+ if (rb_hash_stlike_delete(hash, &vv, 0)) {
+ rb_ary_push(ary3, v);
+ }
}
ary_recycle_hash(hash);
return ary3;
}
+/*
+ * call-seq:
+ * array.intersection(*other_arrays) -> new_array
+ *
+ * Returns a new \Array containing each element found both in +self+
+ * and in all of the given Arrays +other_arrays+;
+ * duplicates are omitted; items are compared using <tt>eql?</tt>:
+ *
+ * [0, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ * [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *
+ * Preserves order from +self+:
+ *
+ * [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ * Returns a copy of +self+ if no arguments given.
+ *
+ * Related: Array#&.
+ */
+
+static VALUE
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result = rb_ary_dup(ary);
+ int i;
+
+ for (i = 0; i < argc; i++) {
+ result = rb_ary_and(result, argv[i]);
+ }
+
+ return result;
+}
+
static int
ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
{
@@ -4172,36 +5768,60 @@ ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
return ST_CONTINUE;
}
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+ long i;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE elt = rb_ary_elt(ary, i);
+ if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+ rb_ary_push(ary_union, elt);
+ }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+ long i;
+ for (i = 0; i < RARRAY_LEN(ary2); i++) {
+ VALUE elt = RARRAY_AREF(ary2, i);
+ if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+ RB_OBJ_WRITTEN(hash, Qundef, elt);
+ }
+ }
+}
+
/*
* call-seq:
- * ary | other_ary -> new_ary
+ * array | other_array -> new_array
*
- * Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- * excluding any duplicates and preserving the order from the given arrays.
+ * Returns the union of +array+ and \Array +other_array+;
+ * duplicates are removed; order is preserved;
+ * items are compared using <tt>eql?</tt>:
*
- * It compares elements using their #hash and #eql? methods for efficiency.
+ * [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ * [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ * [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
*
- * [ "a", "b", "c" ] | [ "c", "d", "a" ] #=> [ "a", "b", "c", "d" ]
- * [ "c", "d", "a" ] | [ "a", "b", "c" ] #=> [ "c", "d", "a", "b" ]
- *
- * See also Array#uniq.
+ * Related: Array#union.
*/
static VALUE
rb_ary_or(VALUE ary1, VALUE ary2)
{
VALUE hash, ary3;
- long i;
ary2 = to_ary(ary2);
+ if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ ary3 = rb_ary_new();
+ rb_ary_union(ary3, ary1);
+ rb_ary_union(ary3, ary2);
+ return ary3;
+ }
+
hash = ary_make_hash(ary1);
+ rb_ary_union_hash(hash, ary2);
- for (i=0; i<RARRAY_LEN(ary2); i++) {
- VALUE elt = RARRAY_AREF(ary2, i);
- if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
- RB_OBJ_WRITTEN(hash, Qundef, elt);
- }
- }
ary3 = rb_hash_values(hash);
ary_recycle_hash(hash);
return ary3;
@@ -4209,114 +5829,474 @@ rb_ary_or(VALUE ary1, VALUE ary2)
/*
* call-seq:
- * ary.max -> obj
- * ary.max { |a, b| block } -> obj
- * ary.max(n) -> array
- * ary.max(n) { |a, b| block } -> array
+ * array.union(*other_arrays) -> new_array
*
- * Returns the object in _ary_ with the maximum value. The
- * first form assumes all objects implement <code>Comparable</code>;
- * the second uses the block to return <em>a <=> b</em>.
+ * Returns a new \Array that is the union of +self+ and all given Arrays +other_arrays+;
+ * duplicates are removed; order is preserved; items are compared using <tt>eql?</tt>:
*
- * a = %w(albatross dog horse)
- * a.max #=> "horse"
- * a.max { |a, b| a.length <=> b.length } #=> "albatross"
+ * [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ * [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ * [0, 1, 2, 3].union([3, 2], [1, 0]) # => [0, 1, 2, 3]
*
- * If the +n+ argument is given, maximum +n+ elements are returned
- * as an array.
+ * Returns a copy of +self+ if no arguments given.
+ *
+ * Related: Array#|.
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+ int i;
+ long sum;
+ VALUE hash, ary_union;
+
+ sum = RARRAY_LEN(ary);
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ sum += RARRAY_LEN(argv[i]);
+ }
+
+ if (sum <= SMALL_ARRAY_LEN) {
+ ary_union = rb_ary_new();
+
+ rb_ary_union(ary_union, ary);
+ for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+ return ary_union;
+ }
+
+ hash = ary_make_hash(ary);
+ for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+ ary_union = rb_hash_values(hash);
+ ary_recycle_hash(hash);
+ return ary_union;
+}
+
+/*
+ * call-seq:
+ * ary.intersect?(other_ary) -> true or false
+ *
+ * Returns +true+ if the array and +other_ary+ have at least one element in
+ * common, otherwise returns +false+:
+ *
+ * a = [ 1, 2, 3 ]
+ * b = [ 3, 4, 5 ]
+ * c = [ 5, 6, 7 ]
+ * a.intersect?(b) #=> true
+ * a.intersect?(c) #=> false
+ *
+ */
+
+static VALUE
+rb_ary_intersect_p(VALUE ary1, VALUE ary2)
+{
+ VALUE hash, v, result, shorter, longer;
+ st_data_t vv;
+ long i;
+
+ ary2 = to_ary(ary2);
+ if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
+
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
+ }
+ return Qfalse;
+ }
+
+ shorter = ary1;
+ longer = ary2;
+ if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
+ longer = ary1;
+ shorter = ary2;
+ }
+
+ hash = ary_make_hash(shorter);
+ result = Qfalse;
+
+ for (i=0; i<RARRAY_LEN(longer); i++) {
+ v = RARRAY_AREF(longer, i);
+ vv = (st_data_t)v;
+ if (rb_hash_stlike_lookup(hash, vv, 0)) {
+ result = Qtrue;
+ break;
+ }
+ }
+ ary_recycle_hash(hash);
+
+ return result;
+}
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+ RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+ VALUE v;
+ for (; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(FIXNUM_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (FIXNUM_P(v)) {
+ if ((long)vmax < (long)v) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (RB_FLOAT_TYPE_P(v)) {
+ if (rb_float_cmp(vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(STRING_P(vmax));
+
+ VALUE v;
+ for (; i < n; ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (STRING_P(v)) {
+ if (rb_str_cmp(vmax, v) < 0) {
+ vmax = v;
+ }
+ }
+ else {
+ return ary_max_generic(ary, i, vmax);
+ }
+ }
+
+ return vmax;
+}
+
+/*
+ * call-seq:
+ * array.max -> element
+ * array.max {|a, b| ... } -> element
+ * array.max(n) -> new_array
+ * array.max(n) {|a, b| ... } -> new_array
+ *
+ * Returns one of the following:
+ *
+ * - The maximum-valued element from +self+.
+ * - A new \Array of maximum-valued elements selected from +self+.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer.
+ *
+ * With no argument and no block, returns the element in +self+
+ * having the maximum value per method <tt><=></tt>:
+ *
+ * [0, 1, 2].max # => 2
+ *
+ * With an argument \Integer +n+ and no block, returns a new \Array with at most +n+ elements,
+ * in descending order per method <tt><=></tt>:
+ *
+ * [0, 1, 2, 3].max(3) # => [3, 2, 1]
+ * [0, 1, 2, 3].max(6) # => [3, 2, 1, 0]
+ *
+ * When a block is given, the block must return an \Integer.
+ *
+ * With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ * returns the element having the maximum value per the block:
+ *
+ * ['0', '00', '000'].max {|a, b| a.size <=> b.size } # => "000"
+ *
+ * With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ * in descending order per the block:
+ *
+ * ['0', '00', '000'].max(2) {|a, b| a.size <=> b.size } # => ["000", "00"]
*
- * a = %w[albatross dog horse]
- * a.max(2) #=> ["horse", "dog"]
- * a.max(2) {|a, b| a.length <=> b.length } #=> ["albatross", "horse"]
*/
static VALUE
rb_ary_max(int argc, VALUE *argv, VALUE ary)
{
- struct cmp_opt_data cmp_opt = { 0, 0 };
VALUE result = Qundef, v;
VALUE num;
long i;
- rb_scan_args(argc, argv, "01", &num);
-
- if (!NIL_P(num))
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
return rb_nmin_run(ary, num, 0, 1, 1);
+ const long n = RARRAY_LEN(ary);
if (rb_block_given_p()) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
- result = v;
- }
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+ result = v;
+ }
+ }
}
- else {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) > 0) {
- result = v;
- }
- }
- }
- if (result == Qundef) return Qnil;
+ else if (n > 0) {
+ result = RARRAY_AREF(ary, 0);
+ if (n > 1) {
+ if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+ return ary_max_opt_fixnum(ary, 1, result);
+ }
+ else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+ return ary_max_opt_string(ary, 1, result);
+ }
+ else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+ return ary_max_opt_float(ary, 1, result);
+ }
+ else {
+ return ary_max_generic(ary, 1, result);
+ }
+ }
+ }
+ if (UNDEF_P(result)) return Qnil;
return result;
}
+static VALUE
+ary_min_generic(VALUE ary, long i, VALUE vmin)
+{
+ RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+ VALUE v;
+ for (; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+
+ if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+ vmin = v;
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(FIXNUM_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (FIXNUM_P(a)) {
+ if ((long)vmin > (long)a) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (RB_FLOAT_TYPE_P(a)) {
+ if (rb_float_cmp(vmin, a) > 0) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
+static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+ const long n = RARRAY_LEN(ary);
+ RUBY_ASSERT(i > 0 && i < n);
+ RUBY_ASSERT(STRING_P(vmin));
+
+ VALUE a;
+ for (; i < n; ++i) {
+ a = RARRAY_AREF(ary, i);
+
+ if (STRING_P(a)) {
+ if (rb_str_cmp(vmin, a) > 0) {
+ vmin = a;
+ }
+ }
+ else {
+ return ary_min_generic(ary, i, vmin);
+ }
+ }
+
+ return vmin;
+}
+
/*
* call-seq:
- * ary.min -> obj
- * ary.min {| a,b | block } -> obj
- * ary.min(n) -> array
- * ary.min(n) {| a,b | block } -> array
+ * array.min -> element
+ * array.min { |a, b| ... } -> element
+ * array.min(n) -> new_array
+ * array.min(n) { |a, b| ... } -> new_array
+ *
+ * Returns one of the following:
+ *
+ * - The minimum-valued element from +self+.
+ * - A new \Array of minimum-valued elements selected from +self+.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer.
+ *
+ * With no argument and no block, returns the element in +self+
+ * having the minimum value per method <tt><=></tt>:
+ *
+ * [0, 1, 2].min # => 0
*
- * Returns the object in _ary_ with the minimum value. The
- * first form assumes all objects implement <code>Comparable</code>;
- * the second uses the block to return <em>a <=> b</em>.
+ * With \Integer argument +n+ and no block, returns a new \Array with at most +n+ elements,
+ * in ascending order per method <tt><=></tt>:
*
- * a = %w(albatross dog horse)
- * a.min #=> "albatross"
- * a.min { |a, b| a.length <=> b.length } #=> "dog"
+ * [0, 1, 2, 3].min(3) # => [0, 1, 2]
+ * [0, 1, 2, 3].min(6) # => [0, 1, 2, 3]
*
- * If the +n+ argument is given, minimum +n+ elements are returned
- * as an array.
+ * When a block is given, the block must return an Integer.
+ *
+ * With a block and no argument, calls the block <tt>self.size-1</tt> times to compare elements;
+ * returns the element having the minimum value per the block:
+ *
+ * ['0', '00', '000'].min { |a, b| a.size <=> b.size } # => "0"
+ *
+ * With an argument +n+ and a block, returns a new \Array with at most +n+ elements,
+ * in ascending order per the block:
+ *
+ * ['0', '00', '000'].min(2) {|a, b| a.size <=> b.size } # => ["0", "00"]
*
- * a = %w[albatross dog horse]
- * a.min(2) #=> ["albatross", "dog"]
- * a.min(2) {|a, b| a.length <=> b.length } #=> ["dog", "horse"]
*/
static VALUE
rb_ary_min(int argc, VALUE *argv, VALUE ary)
{
- struct cmp_opt_data cmp_opt = { 0, 0 };
VALUE result = Qundef, v;
VALUE num;
long i;
- rb_scan_args(argc, argv, "01", &num);
-
- if (!NIL_P(num))
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
return rb_nmin_run(ary, num, 0, 0, 1);
+ const long n = RARRAY_LEN(ary);
if (rb_block_given_p()) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
- result = v;
- }
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+ result = v;
+ }
+ }
}
- else {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) < 0) {
- result = v;
- }
- }
- }
- if (result == Qundef) return Qnil;
+ else if (n > 0) {
+ result = RARRAY_AREF(ary, 0);
+ if (n > 1) {
+ if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+ return ary_min_opt_fixnum(ary, 1, result);
+ }
+ else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+ return ary_min_opt_string(ary, 1, result);
+ }
+ else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+ return ary_min_opt_float(ary, 1, result);
+ }
+ else {
+ return ary_min_generic(ary, 1, result);
+ }
+ }
+ }
+ if (UNDEF_P(result)) return Qnil;
return result;
}
+/*
+ * call-seq:
+ * array.minmax -> [min_val, max_val]
+ * array.minmax {|a, b| ... } -> [min_val, max_val]
+ *
+ * Returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, either per method <tt><=></tt> or per a given block:.
+ *
+ * When no block is given, each element in +self+ must respond to method <tt><=></tt>
+ * with an \Integer;
+ * returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, per method <tt><=></tt>:
+ *
+ * [0, 1, 2].minmax # => [0, 2]
+ *
+ * When a block is given, the block must return an \Integer;
+ * the block is called <tt>self.size-1</tt> times to compare elements;
+ * returns a new 2-element \Array containing the minimum and maximum values
+ * from +self+, per the block:
+ *
+ * ['0', '00', '000'].minmax {|a, b| a.size <=> b.size } # => ["0", "000"]
+ *
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+ if (rb_block_given_p()) {
+ return rb_call_super(0, NULL);
+ }
+ return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
static int
push_value(st_data_t key, st_data_t val, st_data_t ary)
{
@@ -4326,31 +6306,33 @@ push_value(st_data_t key, st_data_t val, st_data_t ary)
/*
* call-seq:
- * ary.uniq! -> ary or nil
- * ary.uniq! { |item| ... } -> ary or nil
+ * array.uniq! -> self or nil
+ * array.uniq! {|element| ... } -> self or nil
*
- * Removes duplicate elements from +self+.
+ * Removes duplicate elements from +self+, the first occurrence always being retained;
+ * returns +self+ if any elements removed, +nil+ otherwise.
*
- * If a block is given, it will use the return value of the block for
- * comparison.
+ * With no block given, identifies and removes elements using method <tt>eql?</tt>
+ * to compare.
*
- * It compares values using their #hash and #eql? methods for efficiency.
+ * Returns +self+ if any elements removed:
*
- * +self+ is traversed in order, and the first occurrence is kept.
+ * a = [0, 0, 1, 1, 2, 2]
+ * a.uniq! # => [0, 1, 2]
*
- * Returns +nil+ if no changes are made (that is, no duplicates are found).
+ * Returns +nil+ if no elements removed.
*
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! # => ["a", "b", "c"]
+ * With a block given, calls the block for each element;
+ * identifies (using method <tt>eql?</tt>) and removes
+ * elements for which the block returns duplicate values.
*
- * b = [ "a", "b", "c" ]
- * b.uniq! # => nil
+ * Returns +self+ if any elements removed:
*
- * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ * a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ * a.uniq! {|element| element.size } # => ['a', 'aa', 'aaa']
*
+ * Returns +nil+ if no elements removed.
*/
-
static VALUE
rb_ary_uniq_bang(VALUE ary)
{
@@ -4361,22 +6343,22 @@ rb_ary_uniq_bang(VALUE ary)
if (RARRAY_LEN(ary) <= 1)
return Qnil;
if (rb_block_given_p())
- hash = ary_make_hash_by(ary);
+ hash = ary_make_hash_by(ary);
else
- hash = ary_make_hash(ary);
+ hash = ary_make_hash(ary);
hash_size = RHASH_SIZE(hash);
if (RARRAY_LEN(ary) == hash_size) {
- return Qnil;
+ return Qnil;
}
rb_ary_modify_check(ary);
ARY_SET_LEN(ary, 0);
if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
}
ary_resize_capa(ary, hash_size);
- st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+ rb_hash_foreach(hash, push_value, ary);
ary_recycle_hash(hash);
return ary;
@@ -4384,22 +6366,24 @@ rb_ary_uniq_bang(VALUE ary)
/*
* call-seq:
- * ary.uniq -> new_ary
- * ary.uniq { |item| ... } -> new_ary
- *
- * Returns a new array by removing duplicate values in +self+.
+ * array.uniq -> new_array
+ * array.uniq {|element| ... } -> new_array
*
- * If a block is given, it will use the return value of the block for comparison.
+ * Returns a new \Array containing those elements from +self+ that are not duplicates,
+ * the first occurrence always being retained.
*
- * It compares values using their #hash and #eql? methods for efficiency.
+ * With no block given, identifies and omits duplicates using method <tt>eql?</tt>
+ * to compare:
*
- * +self+ is traversed in order, and the first occurrence is kept.
+ * a = [0, 0, 1, 1, 2, 2]
+ * a.uniq # => [0, 1, 2]
*
- * a = [ "a", "a", "b", "b", "c" ]
- * a.uniq # => ["a", "b", "c"]
+ * With a block given, calls the block for each element;
+ * identifies (using method <tt>eql?</tt>) and omits duplicate values,
+ * that is, those elements for which the block returns the same value:
*
- * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ * a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ * a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
*
*/
@@ -4408,32 +6392,32 @@ rb_ary_uniq(VALUE ary)
{
VALUE hash, uniq;
- if (RARRAY_LEN(ary) <= 1)
- return rb_ary_dup(ary);
- if (rb_block_given_p()) {
- hash = ary_make_hash_by(ary);
- uniq = rb_hash_values(hash);
+ if (RARRAY_LEN(ary) <= 1) {
+ hash = 0;
+ uniq = rb_ary_dup(ary);
+ }
+ else if (rb_block_given_p()) {
+ hash = ary_make_hash_by(ary);
+ uniq = rb_hash_values(hash);
}
else {
- hash = ary_make_hash(ary);
- uniq = rb_hash_values(hash);
+ hash = ary_make_hash(ary);
+ uniq = rb_hash_values(hash);
+ }
+ if (hash) {
+ ary_recycle_hash(hash);
}
- RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
- ary_recycle_hash(hash);
return uniq;
}
/*
* call-seq:
- * ary.compact! -> ary or nil
- *
- * Removes +nil+ elements from the array.
+ * array.compact! -> self or nil
*
- * Returns +nil+ if no changes were made, otherwise returns the array.
+ * Removes all +nil+ elements from +self+.
*
- * [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- * [ "a", "b", "c" ].compact! #=> nil
+ * Returns +self+ if any elements removed, otherwise +nil+.
*/
static VALUE
@@ -4443,16 +6427,16 @@ rb_ary_compact_bang(VALUE ary)
long n;
rb_ary_modify(ary);
- p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+ p = t = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary); /* WB: no new reference */
end = p + RARRAY_LEN(ary);
while (t < end) {
- if (NIL_P(*t)) t++;
- else *p++ = *t++;
+ if (NIL_P(*t)) t++;
+ else *p++ = *t++;
}
- n = p - RARRAY_CONST_PTR(ary);
+ n = p - RARRAY_CONST_PTR_TRANSIENT(ary);
if (RARRAY_LEN(ary) == n) {
- return Qnil;
+ return Qnil;
}
ary_resize_smaller(ary, n);
@@ -4461,12 +6445,12 @@ rb_ary_compact_bang(VALUE ary)
/*
* call-seq:
- * ary.compact -> new_ary
+ * array.compact -> new_array
*
- * Returns a copy of +self+ with all +nil+ elements removed.
+ * Returns a new \Array containing all non-+nil+ elements from +self+:
*
- * [ "a", nil, "b", nil, "c", nil ].compact
- * #=> [ "a", "b", "c" ]
+ * a = [nil, 0, nil, 1, nil, 2, nil]
+ * a.compact # => [0, 1, 2]
*/
static VALUE
@@ -4479,23 +6463,29 @@ rb_ary_compact(VALUE ary)
/*
* call-seq:
- * ary.count -> int
- * ary.count(obj) -> int
- * ary.count { |item| block } -> int
+ * array.count -> an_integer
+ * array.count(obj) -> an_integer
+ * array.count {|element| ... } -> an_integer
*
- * Returns the number of elements.
+ * Returns a count of specified elements.
*
- * If an argument is given, counts the number of elements which equal +obj+
- * using <code>==</code>.
+ * With no argument and no block, returns the count of all elements:
*
- * If a block is given, counts the number of elements for which the block
- * returns a true value.
+ * [0, 1, 2].count # => 3
+ * [].count # => 0
*
- * ary = [1, 2, 4, 2]
- * ary.count #=> 4
- * ary.count(2) #=> 2
- * ary.count { |x| x%2 == 0 } #=> 3
+ * With argument +obj+, returns the count of elements <tt>==</tt> to +obj+:
*
+ * [0, 1, 2, 0.0].count(0) # => 2
+ * [0, 1, 2].count(3) # => 0
+ *
+ * With no argument and a block given, calls the block with each element;
+ * returns the count of elements for which the block returns a truthy value:
+ *
+ * [0, 1, 2, 3].count {|element| element > 1} # => 2
+ *
+ * With argument +obj+ and a block given, issues a warning, ignores the block,
+ * and returns the count of elements <tt>==</tt> to +obj+.
*/
static VALUE
@@ -4503,108 +6493,152 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
{
long i, n = 0;
- if (argc == 0) {
- VALUE v;
+ if (rb_check_arity(argc, 0, 1) == 0) {
+ VALUE v;
- if (!rb_block_given_p())
- return LONG2NUM(RARRAY_LEN(ary));
+ if (!rb_block_given_p())
+ return LONG2NUM(RARRAY_LEN(ary));
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (RTEST(rb_yield(v))) n++;
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (RTEST(rb_yield(v))) n++;
+ }
}
else {
- VALUE obj;
+ VALUE obj = argv[0];
- rb_scan_args(argc, argv, "1", &obj);
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
- }
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+ }
}
return LONG2NUM(n);
}
static VALUE
-flatten(VALUE ary, int level, int *modified)
+flatten(VALUE ary, int level)
{
- long i = 0;
- VALUE stack, result, tmp, elt;
- st_table *memo;
+ long i;
+ VALUE stack, result, tmp = 0, elt, vmemo;
+ st_table *memo = 0;
st_data_t id;
- stack = ary_new(0, ARY_DEFAULT_SIZE);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ elt = RARRAY_AREF(ary, i);
+ tmp = rb_check_array_type(elt);
+ if (!NIL_P(tmp)) {
+ break;
+ }
+ }
+ if (i == RARRAY_LEN(ary)) {
+ return ary;
+ }
+
result = ary_new(0, RARRAY_LEN(ary));
- memo = st_init_numtable();
- st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
- *modified = 0;
+ ary_memcpy(result, 0, i, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_LEN(result, i);
+
+ stack = ary_new(0, ARY_DEFAULT_SIZE);
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i + 1));
+
+ if (level < 0) {
+ vmemo = rb_hash_new();
+ RBASIC_CLEAR_CLASS(vmemo);
+ memo = st_init_numtable();
+ rb_hash_st_table_set(vmemo, memo);
+ st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+ st_insert(memo, (st_data_t)tmp, (st_data_t)Qtrue);
+ }
+
+ ary = tmp;
+ i = 0;
while (1) {
- while (i < RARRAY_LEN(ary)) {
- elt = RARRAY_AREF(ary, i++);
- if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
- rb_ary_push(result, elt);
- continue;
- }
- tmp = rb_check_array_type(elt);
- if (RBASIC(result)->klass) {
- rb_raise(rb_eRuntimeError, "flatten reentered");
- }
- if (NIL_P(tmp)) {
- rb_ary_push(result, elt);
- }
- else {
- *modified = 1;
- id = (st_data_t)tmp;
- if (st_lookup(memo, id, 0)) {
- st_free_table(memo);
- rb_raise(rb_eArgError, "tried to flatten recursive array");
- }
- st_insert(memo, id, (st_data_t)Qtrue);
- rb_ary_push(stack, ary);
- rb_ary_push(stack, LONG2NUM(i));
- ary = tmp;
- i = 0;
- }
- }
- if (RARRAY_LEN(stack) == 0) {
- break;
- }
- id = (st_data_t)ary;
- st_delete(memo, &id, 0);
- tmp = rb_ary_pop(stack);
- i = NUM2LONG(tmp);
- ary = rb_ary_pop(stack);
- }
-
- st_free_table(memo);
-
- RBASIC_SET_CLASS(result, rb_obj_class(ary));
+ while (i < RARRAY_LEN(ary)) {
+ elt = RARRAY_AREF(ary, i++);
+ if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+ rb_ary_push(result, elt);
+ continue;
+ }
+ tmp = rb_check_array_type(elt);
+ if (RBASIC(result)->klass) {
+ if (memo) {
+ RB_GC_GUARD(vmemo);
+ st_clear(memo);
+ }
+ rb_raise(rb_eRuntimeError, "flatten reentered");
+ }
+ if (NIL_P(tmp)) {
+ rb_ary_push(result, elt);
+ }
+ else {
+ if (memo) {
+ id = (st_data_t)tmp;
+ if (st_is_member(memo, id)) {
+ st_clear(memo);
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+ st_insert(memo, id, (st_data_t)Qtrue);
+ }
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i));
+ ary = tmp;
+ i = 0;
+ }
+ }
+ if (RARRAY_LEN(stack) == 0) {
+ break;
+ }
+ if (memo) {
+ id = (st_data_t)ary;
+ st_delete(memo, &id, 0);
+ }
+ tmp = rb_ary_pop(stack);
+ i = NUM2LONG(tmp);
+ ary = rb_ary_pop(stack);
+ }
+
+ if (memo) {
+ st_clear(memo);
+ }
+
+ RBASIC_SET_CLASS(result, rb_cArray);
return result;
}
/*
* call-seq:
- * ary.flatten! -> ary or nil
- * ary.flatten!(level) -> ary or nil
+ * array.flatten! -> self or nil
+ * array.flatten!(level) -> self or nil
*
- * Flattens +self+ in place.
+ * Replaces each nested \Array in +self+ with the elements from that \Array;
+ * returns +self+ if any changes, +nil+ otherwise.
*
- * Returns +nil+ if no modifications were made (i.e., the array contains no
- * subarrays.)
+ * With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
*
- * The optional +level+ argument determines the level of recursion to flatten.
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(1) # => [0, 1, [2, 3], 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(2) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(3) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten!(1) # => nil
+ *
+ * With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ *
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten! # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten! # => nil
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(-1) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten!(-2) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten!(-1) # => nil
*
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten! #=> [1, 2, 3, 4, 5]
- * a.flatten! #=> nil
- * a #=> [1, 2, 3, 4, 5]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
@@ -4613,15 +6647,14 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
int mod = 0, level = -1;
VALUE result, lv;
- rb_scan_args(argc, argv, "01", &lv);
+ lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
rb_ary_modify_check(ary);
if (!NIL_P(lv)) level = NUM2INT(lv);
if (level == 0) return Qnil;
- result = flatten(ary, level, &mod);
- if (mod == 0) {
- ary_discard(result);
- return Qnil;
+ result = flatten(ary, level);
+ if (result == ary) {
+ return Qnil;
}
if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
rb_ary_replace(ary, result);
@@ -4632,246 +6665,212 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
/*
* call-seq:
- * ary.flatten -> new_ary
- * ary.flatten(level) -> new_ary
- *
- * Returns a new array that is a one-dimensional flattening of +self+
- * (recursively).
- *
- * That is, for every element that is an array, extract its elements into
- * the new array.
- *
- * The optional +level+ argument determines the level of recursion to
- * flatten.
+ * array.flatten -> new_array
+ * array.flatten(level) -> new_array
+ *
+ * Returns a new \Array that is a recursive flattening of +self+:
+ * - Each non-Array element is unchanged.
+ * - Each \Array is replaced by its individual elements.
+ *
+ * With non-negative \Integer argument +level+, flattens recursively through +level+ levels:
+ *
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(0) # => [0, [1, [2, 3], 4], 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(1) # => [0, 1, [2, 3], 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(2) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(3) # => [0, 1, 2, 3, 4, 5]
+ *
+ * With no argument, a +nil+ argument, or with negative argument +level+, flattens all levels:
+ *
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten # => [0, 1, 2]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(-1) # => [0, 1, 2, 3, 4, 5]
+ * a = [ 0, [ 1, [2, 3], 4 ], 5 ]
+ * a.flatten(-2) # => [0, 1, 2, 3, 4, 5]
+ * [0, 1, 2].flatten(-1) # => [0, 1, 2]
*
- * s = [ 1, 2, 3 ] #=> [1, 2, 3]
- * t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
- * a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
{
- int mod = 0, level = -1;
- VALUE result, lv;
+ int level = -1;
+ VALUE result;
- rb_scan_args(argc, argv, "01", &lv);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return ary_make_shared_copy(ary);
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+ level = NUM2INT(argv[0]);
+ if (level == 0) return ary_make_shared_copy(ary);
+ }
- result = flatten(ary, level, &mod);
- OBJ_INFECT(result, ary);
+ result = flatten(ary, level);
+ if (result == ary) {
+ result = ary_make_shared_copy(ary);
+ }
return result;
}
-#define OPTHASH_GIVEN_P(opts) \
- (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
-/*
- * call-seq:
- * ary.shuffle! -> ary
- * ary.shuffle!(random: rng) -> ary
- *
- * Shuffles elements in +self+ in place.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle! #=> [2, 3, 1]
- * a #=> [2, 3, 1]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
- */
-
static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
{
- VALUE opts, randgen = rb_cRandom;
long i, len;
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
- rb_check_arity(argc, 0, 0);
rb_ary_modify(ary);
i = len = RARRAY_LEN(ary);
RARRAY_PTR_USE(ary, ptr, {
- while (i) {
- long j = RAND_UPTO(i);
- VALUE tmp;
- if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
- rb_raise(rb_eRuntimeError, "modified during shuffle");
- }
- tmp = ptr[--i];
- ptr[i] = ptr[j];
- ptr[j] = tmp;
- }
+ while (i) {
+ long j = RAND_UPTO(i);
+ VALUE tmp;
+ if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR_TRANSIENT(ary)) {
+ rb_raise(rb_eRuntimeError, "modified during shuffle");
+ }
+ tmp = ptr[--i];
+ ptr[i] = ptr[j];
+ ptr[j] = tmp;
+ }
}); /* WB: no new reference */
return ary;
}
-
-/*
- * call-seq:
- * ary.shuffle -> new_ary
- * ary.shuffle(random: rng) -> new_ary
- *
- * Returns a new array with elements of +self+ shuffled.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle #=> [2, 3, 1]
- * a #=> [1, 2, 3]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
- */
-
static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
{
ary = rb_ary_dup(ary);
- rb_ary_shuffle_bang(argc, argv, ary);
+ rb_ary_shuffle_bang(ec, ary, randgen);
return ary;
}
-
-/*
- * call-seq:
- * ary.sample -> obj
- * ary.sample(random: rng) -> obj
- * ary.sample(n) -> new_ary
- * ary.sample(n, random: rng) -> new_ary
- *
- * Choose a random element or +n+ random elements from the array.
- *
- * The elements are chosen by using random and unique indices into the array
- * in order to ensure that an element doesn't repeat itself unless the array
- * already contained duplicate elements.
- *
- * If the array is empty the first form returns +nil+ and the second form
- * returns an empty array.
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- * a.sample #=> 7
- * a.sample(4) #=> [6, 4, 2, 5]
- */
-
-
static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
{
- VALUE nv, result;
- VALUE opts, randgen = rb_cRandom;
+ VALUE result;
long n, len, i, j, k, idx[10];
long rnds[numberof(idx)];
+ long memo_threshold;
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
len = RARRAY_LEN(ary);
- if (argc == 0) {
- if (len < 2)
- i = 0;
- else
- i = RAND_UPTO(len);
+ if (!to_array) {
+ if (len < 2)
+ i = 0;
+ else
+ i = RAND_UPTO(len);
- return rb_ary_elt(ary, i);
+ return rb_ary_elt(ary, i);
}
- rb_scan_args(argc, argv, "1", &nv);
n = NUM2LONG(nv);
if (n < 0) rb_raise(rb_eArgError, "negative sample number");
if (n > len) n = len;
if (n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- rnds[i] = RAND_UPTO(len - i);
- }
+ for (i = 0; i < n; ++i) {
+ rnds[i] = RAND_UPTO(len - i);
+ }
}
k = len;
len = RARRAY_LEN(ary);
if (len < k && n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- if (rnds[i] >= len) return rb_ary_new_capa(0);
- }
+ for (i = 0; i < n; ++i) {
+ if (rnds[i] >= len) return rb_ary_new_capa(0);
+ }
}
if (n > len) n = len;
switch (n) {
case 0:
- return rb_ary_new_capa(0);
+ return rb_ary_new_capa(0);
case 1:
- i = rnds[0];
- return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+ i = rnds[0];
+ return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
case 2:
- i = rnds[0];
- j = rnds[1];
- if (j >= i) j++;
- return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+ i = rnds[0];
+ j = rnds[1];
+ if (j >= i) j++;
+ return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
case 3:
- i = rnds[0];
- j = rnds[1];
- k = rnds[2];
- {
- long l = j, g = i;
- if (j >= i) l = i, g = ++j;
- if (k >= l && (++k >= g)) ++k;
- }
- return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+ i = rnds[0];
+ j = rnds[1];
+ k = rnds[2];
+ {
+ long l = j, g = i;
+ if (j >= i) l = i, g = ++j;
+ if (k >= l && (++k >= g)) ++k;
+ }
+ return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
}
+ memo_threshold =
+ len < 2560 ? len / 128 :
+ len < 5120 ? len / 64 :
+ len < 10240 ? len / 32 :
+ len / 16;
if (n <= numberof(idx)) {
- long sorted[numberof(idx)];
- sorted[0] = idx[0] = rnds[0];
- for (i=1; i<n; i++) {
- k = rnds[i];
- for (j = 0; j < i; ++j) {
- if (k < sorted[j]) break;
- ++k;
- }
- memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
- sorted[j] = idx[i] = k;
- }
- result = rb_ary_new_capa(n);
- RARRAY_PTR_USE(result, ptr_result, {
- for (i=0; i<n; i++) {
- ptr_result[i] = RARRAY_AREF(ary, idx[i]);
- }
- });
+ long sorted[numberof(idx)];
+ sorted[0] = idx[0] = rnds[0];
+ for (i=1; i<n; i++) {
+ k = rnds[i];
+ for (j = 0; j < i; ++j) {
+ if (k < sorted[j]) break;
+ ++k;
+ }
+ memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+ sorted[j] = idx[i] = k;
+ }
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE_TRANSIENT(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+ }
+ });
+ }
+ else if (n <= memo_threshold / 2) {
+ long max_idx = 0;
+#undef RUBY_UNTYPED_DATA_WARNING
+#define RUBY_UNTYPED_DATA_WARNING 0
+ VALUE vmemo = Data_Wrap_Struct(0, 0, st_free_table, 0);
+ st_table *memo = st_init_numtable_with_size(n);
+ DATA_PTR(vmemo) = memo;
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ long r = RAND_UPTO(len-i) + i;
+ ptr_result[i] = r;
+ if (r > max_idx) max_idx = r;
+ }
+ len = RARRAY_LEN(ary);
+ if (len <= max_idx) n = 0;
+ else if (n > len) n = len;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr_ary, {
+ for (i=0; i<n; i++) {
+ long j2 = j = ptr_result[i];
+ long i2 = i;
+ st_data_t value;
+ if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+ if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+ st_insert(memo, (st_data_t)j, (st_data_t)i2);
+ ptr_result[i] = ptr_ary[j2];
+ }
+ });
+ });
+ DATA_PTR(vmemo) = 0;
+ st_free_table(memo);
}
else {
- result = rb_ary_dup(ary);
- RBASIC_CLEAR_CLASS(result);
- RB_GC_GUARD(ary);
- RARRAY_PTR_USE(result, ptr_result, {
- for (i=0; i<n; i++) {
- j = RAND_UPTO(len-i) + i;
- nv = ptr_result[j];
- ptr_result[j] = ptr_result[i];
- ptr_result[i] = nv;
- }
- });
- RBASIC_SET_CLASS_RAW(result, rb_cArray);
+ result = rb_ary_dup(ary);
+ RBASIC_CLEAR_CLASS(result);
+ RB_GC_GUARD(ary);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ j = RAND_UPTO(len-i) + i;
+ nv = ptr_result[j];
+ ptr_result[j] = ptr_result[i];
+ ptr_result[i] = nv;
+ }
+ });
+ RBASIC_SET_CLASS_RAW(result, rb_cArray);
}
ARY_SET_LEN(result, n);
@@ -4879,55 +6878,73 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
}
static VALUE
+ary_sample0(rb_execution_context_t *ec, VALUE ary)
+{
+ return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
+}
+
+static VALUE
rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
{
long mul;
VALUE n = Qnil;
if (args && (RARRAY_LEN(args) > 0)) {
- n = RARRAY_AREF(args, 0);
+ n = RARRAY_AREF(args, 0);
}
if (RARRAY_LEN(self) == 0) return INT2FIX(0);
- if (n == Qnil) return DBL2NUM(INFINITY);
+ if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
mul = NUM2LONG(n);
if (mul <= 0) return INT2FIX(0);
n = LONG2FIX(mul);
- return rb_funcallv(rb_ary_length(self), '*', 1, &n);
+ return rb_fix_mul_fix(rb_ary_length(self), n);
}
/*
* call-seq:
- * ary.cycle(n=nil) { |obj| block } -> nil
- * ary.cycle(n=nil) -> Enumerator
+ * array.cycle {|element| ... } -> nil
+ * array.cycle(count) {|element| ... } -> nil
+ * array.cycle -> new_enumerator
+ * array.cycle(count) -> new_enumerator
+ *
+ * When called with positive \Integer argument +count+ and a block,
+ * calls the block with each element, then does so again,
+ * until it has done so +count+ times; returns +nil+:
*
- * Calls the given block for each element +n+ times or forever if +nil+ is
- * given.
+ * output = []
+ * [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ * output # => [0, 1, 0, 1]
*
- * Does nothing if a non-positive number is given or the array is empty.
+ * If +count+ is zero or negative, does not call the block:
*
- * Returns +nil+ if the loop has finished without getting interrupted.
+ * [0, 1].cycle(0) {|element| fail 'Cannot happen' } # => nil
+ * [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
*
- * If no block is given, an Enumerator is returned instead.
+ * When a block is given, and argument is omitted or +nil+, cycles forever:
*
- * a = ["a", "b", "c"]
- * a.cycle { |x| puts x } # print, a, b, c, a, b, c,.. forever.
- * a.cycle(2) { |x| puts x } # print, a, b, c, a, b, c.
+ * # Prints 0 and 1 forever.
+ * [0, 1].cycle {|element| puts element }
+ * [0, 1].cycle(nil) {|element| puts element }
+ *
+ * When no block is given, returns a new \Enumerator:
+ *
+ * [0, 1].cycle(2) # => #<Enumerator: [0, 1]:cycle(2)>
+ * [0, 1].cycle # => # => #<Enumerator: [0, 1]:cycle>
+ * [0, 1].cycle.first(5) # => [0, 1, 0, 1, 0]
*
*/
-
static VALUE
rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
{
long n, i;
- VALUE nv = Qnil;
- rb_scan_args(argc, argv, "01", &nv);
+ rb_check_arity(argc, 0, 1);
RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
- if (NIL_P(nv)) {
+ if (argc == 0 || NIL_P(argv[0])) {
n = -1;
}
else {
- n = NUM2LONG(nv);
+ n = NUM2LONG(argv[0]);
if (n <= 0) return Qnil;
}
@@ -4939,11 +6956,6 @@ rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
return Qnil;
}
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
/*
* Build a ruby array of the corresponding values and yield it to the
* associated block.
@@ -4953,11 +6965,9 @@ static int
yield_indexed_values(const VALUE values, const long r, const long *const p)
{
const VALUE result = rb_ary_new2(r);
- VALUE *const result_array = RARRAY_PTR(result);
- const VALUE *const values_array = RARRAY_CONST_PTR(values);
long i;
- for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+ for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
ARY_SET_LEN(result, r);
rb_yield(result);
return !RBASIC(values)->klass;
@@ -4981,46 +6991,52 @@ permute0(const long n, const long r, long *const p, char *const used, const VALU
long i = 0, index = 0;
for (;;) {
- const char *const unused = memchr(&used[i], 0, n-i);
- if (!unused) {
- if (!index) break;
- i = p[--index]; /* pop index */
- used[i++] = 0; /* index unused */
- }
- else {
- i = unused - used;
- p[index] = i;
- used[i] = 1; /* mark index used */
- ++index;
- if (index < r-1) { /* if not done yet */
- p[index] = i = 0;
- continue;
- }
- for (i = 0; i < n; ++i) {
- if (used[i]) continue;
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "permute reentered");
- }
- }
- i = p[--index]; /* pop index */
- used[i] = 0; /* index unused */
- p[index] = ++i;
- }
+ const char *const unused = memchr(&used[i], 0, n-i);
+ if (!unused) {
+ if (!index) break;
+ i = p[--index]; /* pop index */
+ used[i++] = 0; /* index unused */
+ }
+ else {
+ i = unused - used;
+ p[index] = i;
+ used[i] = 1; /* mark index used */
+ ++index;
+ if (index < r-1) { /* if not done yet */
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ if (used[i]) continue;
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "permute reentered");
+ }
+ }
+ i = p[--index]; /* pop index */
+ used[i] = 0; /* index unused */
+ p[index] = ++i;
+ }
}
}
/*
* Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
*/
static VALUE
descending_factorial(long from, long how_many)
{
- VALUE cnt = LONG2FIX(how_many >= 0);
- while (how_many-- > 0) {
- VALUE v = LONG2FIX(from--);
- cnt = rb_funcallv(cnt, '*', 1, &v);
+ VALUE cnt;
+ if (how_many > 0) {
+ cnt = LONG2FIX(from);
+ while (--how_many > 0) {
+ long v = --from;
+ cnt = rb_int_mul(cnt, LONG2FIX(v));
+ }
+ }
+ else {
+ cnt = LONG2FIX(how_many == 0);
}
return cnt;
}
@@ -5028,16 +7044,23 @@ descending_factorial(long from, long how_many)
static VALUE
binomial_coefficient(long comb, long size)
{
- VALUE r, v;
+ VALUE r;
+ long i;
if (comb > size-comb) {
- comb = size-comb;
+ comb = size-comb;
}
if (comb < 0) {
- return LONG2FIX(0);
+ return LONG2FIX(0);
+ }
+ else if (comb == 0) {
+ return LONG2FIX(1);
}
- r = descending_factorial(size, comb);
- v = descending_factorial(comb, comb);
- return rb_funcallv(r, id_div, 1, &v);
+ r = LONG2FIX(size);
+ for (i = 1; i < comb; ++i) {
+ r = rb_int_mul(r, LONG2FIX(size - i));
+ r = rb_int_idiv(r, LONG2FIX(i + 1));
+ }
+ return r;
}
static VALUE
@@ -5051,66 +7074,118 @@ rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
/*
* call-seq:
- * ary.permutation { |p| block } -> ary
- * ary.permutation -> Enumerator
- * ary.permutation(n) { |p| block } -> ary
- * ary.permutation(n) -> Enumerator
+ * array.permutation {|element| ... } -> self
+ * array.permutation(n) {|element| ... } -> self
+ * array.permutation -> new_enumerator
+ * array.permutation(n) -> new_enumerator
+ *
+ * When invoked with a block, yield all permutations of elements of +self+; returns +self+.
+ * The order of permutations is indeterminate.
+ *
+ * When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ * are given, calls the block with all +n+-tuple permutations of +self+.
+ *
+ * Example:
+ *
+ * a = [0, 1, 2]
+ * a.permutation(2) {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * [0, 1]
+ * [0, 2]
+ * [1, 0]
+ * [1, 2]
+ * [2, 0]
+ * [2, 1]
*
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
+ * Another example:
*
- * If +n+ is not specified, yield all permutations of all elements.
+ * a = [0, 1, 2]
+ * a.permutation(3) {|permutation| p permutation }
*
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
+ * Output:
*
- * If no block is given, an Enumerator is returned instead.
+ * [0, 1, 2]
+ * [0, 2, 1]
+ * [1, 0, 2]
+ * [1, 2, 0]
+ * [2, 0, 1]
+ * [2, 1, 0]
*
- * Examples:
+ * When +n+ is zero, calls the block once with a new empty \Array:
+ *
+ * a = [0, 1, 2]
+ * a.permutation(0) {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * []
+ *
+ * When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ * does not call the block:
+ *
+ * a = [0, 1, 2]
+ * a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ * a.permutation(4) {|permutation| fail 'Cannot happen' }
+ *
+ * When a block given but no argument,
+ * behaves the same as <tt>a.permutation(a.size)</tt>:
+ *
+ * a = [0, 1, 2]
+ * a.permutation {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * [0, 1, 2]
+ * [0, 2, 1]
+ * [1, 0, 2]
+ * [1, 2, 0]
+ * [2, 0, 1]
+ * [2, 1, 0]
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.permutation # => #<Enumerator: [0, 1, 2]:permutation>
+ * a.permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
*
- * a = [1, 2, 3]
- * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(1).to_a #=> [[1],[2],[3]]
- * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(0).to_a #=> [[]] # one permutation of length 0
- * a.permutation(4).to_a #=> [] # no permutations of length 4
*/
static VALUE
rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
{
- VALUE num;
long r, n, i;
n = RARRAY_LEN(ary); /* Array length */
RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size); /* Return enumerator if no block */
- rb_scan_args(argc, argv, "01", &num);
- r = NIL_P(num) ? n : NUM2LONG(num); /* Permutation size from argument */
+ r = n;
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+ r = NUM2LONG(argv[0]); /* Permutation size from argument */
if (r < 0 || n < r) {
- /* no permutations: yield nothing */
+ /* no permutations: yield nothing */
}
else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else { /* this is the general case */
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
- char *used = (char*)(p + r);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+ char *used = (char*)(p + r);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
- MEMZERO(used, char, n); /* initialize array */
+ MEMZERO(used, char, n); /* initialize array */
- permute0(n, r, p, used, ary0); /* compute and yield permutations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ permute0(n, r, p, used, ary0); /* compute and yield permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
@@ -5123,16 +7198,16 @@ combinate0(const long len, const long n, long *const stack, const VALUE values)
MEMZERO(stack+1, long, n);
stack[0] = -1;
for (;;) {
- for (lev++; lev < n; lev++) {
- stack[lev+1] = stack[lev]+1;
- }
- if (!yield_indexed_values(values, n, stack+1)) {
- rb_raise(rb_eRuntimeError, "combination reentered");
- }
- do {
- if (lev == 0) return;
- stack[lev--]++;
- } while (stack[lev+1]+n == len+lev+1);
+ for (lev++; lev < n; lev++) {
+ stack[lev+1] = stack[lev]+1;
+ }
+ if (!yield_indexed_values(values, n, stack+1)) {
+ rb_raise(rb_eRuntimeError, "combination reentered");
+ }
+ do {
+ if (lev == 0) return;
+ stack[lev--]++;
+ } while (stack[lev+1]+n == len+lev+1);
}
}
@@ -5147,26 +7222,55 @@ rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
/*
* call-seq:
- * ary.combination(n) { |c| block } -> ary
- * ary.combination(n) -> Enumerator
+ * array.combination(n) {|element| ... } -> self
+ * array.combination(n) -> new_enumerator
+ *
+ * Calls the block, if given, with combinations of elements of +self+;
+ * returns +self+. The order of combinations is indeterminate.
+ *
+ * When a block and an in-range positive \Integer argument +n+ (<tt>0 < n <= self.size</tt>)
+ * are given, calls the block with all +n+-tuple combinations of +self+.
+ *
+ * Example:
+ *
+ * a = [0, 1, 2]
+ * a.combination(2) {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0, 1]
+ * [0, 2]
+ * [1, 2]
+ *
+ * Another example:
+ *
+ * a = [0, 1, 2]
+ * a.combination(3) {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0, 1, 2]
+ *
+ * When +n+ is zero, calls the block once with a new empty \Array:
*
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
+ * a = [0, 1, 2]
+ * a1 = a.combination(0) {|combination| p combination }
*
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
+ * Output:
*
- * If no block is given, an Enumerator is returned instead.
+ * []
*
- * Examples:
+ * When +n+ is out of range (negative or larger than <tt>self.size</tt>),
+ * does not call the block:
*
- * a = [1, 2, 3, 4]
- * a.combination(1).to_a #=> [[1],[2],[3],[4]]
- * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- * a.combination(4).to_a #=> [[1,2,3,4]]
- * a.combination(0).to_a #=> [[]] # one combination of length 0
- * a.combination(5).to_a #=> [] # no combinations of length 5
+ * a = [0, 1, 2]
+ * a.combination(-1) {|combination| fail 'Cannot happen' }
+ * a.combination(4) {|combination| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
*
*/
@@ -5179,25 +7283,25 @@ rb_ary_combination(VALUE ary, VALUE num)
RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
len = RARRAY_LEN(ary);
if (n < 0 || len < n) {
- /* yield nothing */
+ /* yield nothing */
}
else if (n == 0) {
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else {
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- volatile VALUE t0;
- long *stack = ALLOCV_N(long, t0, n+1);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ volatile VALUE t0;
+ long *stack = ALLOCV_N(long, t0, n+1);
- RBASIC_CLEAR_CLASS(ary0);
- combinate0(len, n, stack, ary0);
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ RBASIC_CLEAR_CLASS(ary0);
+ combinate0(len, n, stack, ary0);
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
@@ -5221,19 +7325,19 @@ rpermute0(const long n, const long r, long *const p, const VALUE values)
p[index] = i;
for (;;) {
- if (++index < r-1) {
- p[index] = i = 0;
- continue;
- }
- for (i = 0; i < n; ++i) {
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "repeated permute reentered");
- }
- }
- do {
- if (index <= 0) return;
- } while ((i = ++p[--index]) >= n);
+ if (++index < r-1) {
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated permute reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
}
}
@@ -5242,39 +7346,81 @@ rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
{
long n = RARRAY_LEN(ary);
long k = NUM2LONG(RARRAY_AREF(args, 0));
- VALUE v;
if (k < 0) {
- return LONG2FIX(0);
+ return LONG2FIX(0);
}
-
- v = LONG2NUM(k);
- return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
+ if (n <= 0) {
+ return LONG2FIX(!k);
+ }
+ return rb_int_positive_pow(n, (unsigned long)k);
}
/*
* call-seq:
- * ary.repeated_permutation(n) { |p| block } -> ary
- * ary.repeated_permutation(n) -> Enumerator
+ * array.repeated_permutation(n) {|permutation| ... } -> self
+ * array.repeated_permutation(n) -> new_enumerator
+ *
+ * Calls the block with each repeated permutation of length +n+ of the elements of +self+;
+ * each permutation is an \Array;
+ * returns +self+. The order of the permutations is indeterminate.
+ *
+ * When a block and a positive \Integer argument +n+ are given, calls the block with each
+ * +n+-tuple repeated permutation of the elements of +self+.
+ * The number of permutations is <tt>self.size**n</tt>.
+ *
+ * +n+ = 1:
+ *
+ * a = [0, 1, 2]
+ * a.repeated_permutation(1) {|permutation| p permutation }
*
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
+ * Output:
*
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
+ * [0]
+ * [1]
+ * [2]
*
- * If no block is given, an Enumerator is returned instead.
+ * +n+ = 2:
*
- * Examples:
+ * a.repeated_permutation(2) {|permutation| p permutation }
+ *
+ * Output:
+ *
+ * [0, 0]
+ * [0, 1]
+ * [0, 2]
+ * [1, 0]
+ * [1, 1]
+ * [1, 2]
+ * [2, 0]
+ * [2, 1]
+ * [2, 2]
+ *
+ * If +n+ is zero, calls the block once with an empty \Array.
+ *
+ * If +n+ is negative, does not call the block:
+ *
+ * a.repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.repeated_permutation(2) # => #<Enumerator: [0, 1, 2]:permutation(2)>
+ *
+ * Using Enumerators, it's convenient to show the permutations and counts
+ * for some values of +n+:
+ *
+ * e = a.repeated_permutation(0)
+ * e.size # => 1
+ * e.to_a # => [[]]
+ * e = a.repeated_permutation(1)
+ * e.size # => 3
+ * e.to_a # => [[0], [1], [2]]
+ * e = a.repeated_permutation(2)
+ * e.size # => 9
+ * e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
*
- * a = [1, 2]
- * a.repeated_permutation(1).to_a #=> [[1], [2]]
- * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
- * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
*/
-
static VALUE
rb_ary_repeated_permutation(VALUE ary, VALUE num)
{
@@ -5285,25 +7431,25 @@ rb_ary_repeated_permutation(VALUE ary, VALUE num)
r = NUM2LONG(num); /* Permutation size from argument */
if (r < 0) {
- /* no permutations: yield nothing */
+ /* no permutations: yield nothing */
}
else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else { /* this is the general case */
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, r);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, r);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
- rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
@@ -5315,19 +7461,19 @@ rcombinate0(const long n, const long r, long *const p, const long rest, const VA
p[index] = i;
for (;;) {
- if (++index < r-1) {
- p[index] = i;
- continue;
- }
- for (; i < n; ++i) {
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "repeated combination reentered");
- }
- }
- do {
- if (index <= 0) return;
- } while ((i = ++p[--index]) >= n);
+ if (++index < r-1) {
+ p[index] = i;
+ continue;
+ }
+ for (; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated combination reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
}
}
@@ -5337,35 +7483,71 @@ rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
long n = RARRAY_LEN(ary);
long k = NUM2LONG(RARRAY_AREF(args, 0));
if (k == 0) {
- return LONG2FIX(1);
+ return LONG2FIX(1);
}
return binomial_coefficient(k, n + k - 1);
}
/*
* call-seq:
- * ary.repeated_combination(n) { |c| block } -> ary
- * ary.repeated_combination(n) -> Enumerator
+ * array.repeated_combination(n) {|combination| ... } -> self
+ * array.repeated_combination(n) -> new_enumerator
*
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
+ * Calls the block with each repeated combination of length +n+ of the elements of +self+;
+ * each combination is an \Array;
+ * returns +self+. The order of the combinations is indeterminate.
*
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
+ * When a block and a positive \Integer argument +n+ are given, calls the block with each
+ * +n+-tuple repeated combination of the elements of +self+.
+ * The number of combinations is <tt>(n+1)(n+2)/2</tt>.
*
- * If no block is given, an Enumerator is returned instead.
+ * +n+ = 1:
*
- * Examples:
+ * a = [0, 1, 2]
+ * a.repeated_combination(1) {|combination| p combination }
*
- * a = [1, 2, 3]
- * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
- * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
+ * Output:
+ *
+ * [0]
+ * [1]
+ * [2]
+ *
+ * +n+ = 2:
+ *
+ * a.repeated_combination(2) {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0, 0]
+ * [0, 1]
+ * [0, 2]
+ * [1, 1]
+ * [1, 2]
+ * [2, 2]
+ *
+ * If +n+ is zero, calls the block once with an empty \Array.
+ *
+ * If +n+ is negative, does not call the block:
+ *
+ * a.repeated_combination(-1) {|combination| fail 'Cannot happen' }
+ *
+ * Returns a new \Enumerator if no block given:
+ *
+ * a = [0, 1, 2]
+ * a.repeated_combination(2) # => #<Enumerator: [0, 1, 2]:combination(2)>
+ *
+ * Using Enumerators, it's convenient to show the combinations and counts
+ * for some values of +n+:
+ *
+ * e = a.repeated_combination(0)
+ * e.size # => 1
+ * e.to_a # => [[]]
+ * e = a.repeated_combination(1)
+ * e.size # => 3
+ * e.to_a # => [[0], [1], [2]]
+ * e = a.repeated_combination(2)
+ * e.size # => 6
+ * e.to_a # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
*
*/
@@ -5378,67 +7560,105 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size); /* Return enumerator if no block */
len = RARRAY_LEN(ary);
if (n < 0) {
- /* yield nothing */
+ /* yield nothing */
}
else if (n == 0) {
- rb_yield(rb_ary_new2(0));
+ rb_yield(rb_ary_new2(0));
}
else if (n == 1) {
- for (i = 0; i < len; i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
}
else if (len == 0) {
- /* yield nothing */
+ /* yield nothing */
}
else {
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, n);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, n);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
- rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
}
return ary;
}
/*
* call-seq:
- * ary.product(other_ary, ...) -> new_ary
- * ary.product(other_ary, ...) { |p| block } -> ary
+ * array.product(*other_arrays) -> new_array
+ * array.product(*other_arrays) {|combination| ... } -> self
*
- * Returns an array of all combinations of elements from all arrays.
+ * Computes and returns or yields all combinations of elements from all the Arrays,
+ * including both +self+ and +other_arrays+:
*
- * The length of the returned array is the product of the length of +self+ and
- * the argument arrays.
+ * - The number of combinations is the product of the sizes of all the arrays,
+ * including both +self+ and +other_arrays+.
+ * - The order of the returned combinations is indeterminate.
*
- * If given a block, #product will yield all combinations and return +self+
- * instead.
+ * When no block is given, returns the combinations as an \Array of Arrays:
+ *
+ * a = [0, 1, 2]
+ * a1 = [3, 4]
+ * a2 = [5, 6]
+ * p = a.product(a1)
+ * p.size # => 6 # a.size * a1.size
+ * p # => [[0, 3], [0, 4], [1, 3], [1, 4], [2, 3], [2, 4]]
+ * p = a.product(a1, a2)
+ * p.size # => 12 # a.size * a1.size * a2.size
+ * p # => [[0, 3, 5], [0, 3, 6], [0, 4, 5], [0, 4, 6], [1, 3, 5], [1, 3, 6], [1, 4, 5], [1, 4, 6], [2, 3, 5], [2, 3, 6], [2, 4, 5], [2, 4, 6]]
+ *
+ * If any argument is an empty \Array, returns an empty \Array.
+ *
+ * If no argument is given, returns an \Array of 1-element Arrays,
+ * each containing an element of +self+:
+ *
+ * a.product # => [[0], [1], [2]]
+ *
+ * When a block is given, yields each combination as an \Array; returns +self+:
+ *
+ * a.product(a1) {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0, 3]
+ * [0, 4]
+ * [1, 3]
+ * [1, 4]
+ * [2, 3]
+ * [2, 4]
+ *
+ * If any argument is an empty \Array, does not call the block:
+ *
+ * a.product(a1, a2, []) {|combination| fail 'Cannot happen' }
+ *
+ * If no argument is given, yields each element of +self+ as a 1-element \Array:
+ *
+ * a.product {|combination| p combination }
+ *
+ * Output:
+ *
+ * [0]
+ * [1]
+ * [2]
*
- * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
- * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- * [1,2].product() #=> [[1],[2]]
- * [1,2].product([]) #=> []
*/
static VALUE
rb_ary_product(int argc, VALUE *argv, VALUE ary)
{
int n = argc+1; /* How many arrays we're operating on */
- volatile VALUE t0 = tmpary(n);
- volatile VALUE t1 = tmpbuf(n, sizeof(int));
+ volatile VALUE t0 = rb_ary_hidden_new(n);
+ volatile VALUE t1 = Qundef;
VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
- int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+ int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
VALUE result = Qnil; /* The array we'll be returning, when no block given */
long i,j;
long resultlen = 1;
RBASIC_CLEAR_CLASS(t0);
- RBASIC_CLEAR_CLASS(t1);
/* initialize the arrays of arrays */
ARY_SET_LEN(t0, n);
@@ -5451,81 +7671,84 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
/* Otherwise, allocate and fill in an array of results */
if (rb_block_given_p()) {
- /* Make defensive copies of arrays; exit if any is empty */
- for (i = 0; i < n; i++) {
- if (RARRAY_LEN(arrays[i]) == 0) goto done;
- arrays[i] = ary_make_shared_copy(arrays[i]);
- }
+ /* Make defensive copies of arrays; exit if any is empty */
+ for (i = 0; i < n; i++) {
+ if (RARRAY_LEN(arrays[i]) == 0) goto done;
+ arrays[i] = ary_make_shared_copy(arrays[i]);
+ }
}
else {
- /* Compute the length of the result array; return [] if any is empty */
- for (i = 0; i < n; i++) {
- long k = RARRAY_LEN(arrays[i]);
- if (k == 0) {
- result = rb_ary_new2(0);
- goto done;
- }
+ /* Compute the length of the result array; return [] if any is empty */
+ for (i = 0; i < n; i++) {
+ long k = RARRAY_LEN(arrays[i]);
+ if (k == 0) {
+ result = rb_ary_new2(0);
+ goto done;
+ }
if (MUL_OVERFLOW_LONG_P(resultlen, k))
- rb_raise(rb_eRangeError, "too big to product");
- resultlen *= k;
- }
- result = rb_ary_new2(resultlen);
+ rb_raise(rb_eRangeError, "too big to product");
+ resultlen *= k;
+ }
+ result = rb_ary_new2(resultlen);
}
for (;;) {
- int m;
- /* fill in one subarray */
- VALUE subarray = rb_ary_new2(n);
- for (j = 0; j < n; j++) {
- rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
- }
-
- /* put it on the result array */
- if (NIL_P(result)) {
- FL_SET(t0, FL_USER5);
- rb_yield(subarray);
- if (! FL_TEST(t0, FL_USER5)) {
- rb_raise(rb_eRuntimeError, "product reentered");
- }
- else {
- FL_UNSET(t0, FL_USER5);
- }
- }
- else {
- rb_ary_push(result, subarray);
- }
-
- /*
- * Increment the last counter. If it overflows, reset to 0
- * and increment the one before it.
- */
- m = n-1;
- counters[m]++;
- while (counters[m] == RARRAY_LEN(arrays[m])) {
- counters[m] = 0;
- /* If the first counter overflows, we are done */
- if (--m < 0) goto done;
- counters[m]++;
- }
+ int m;
+ /* fill in one subarray */
+ VALUE subarray = rb_ary_new2(n);
+ for (j = 0; j < n; j++) {
+ rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+ }
+
+ /* put it on the result array */
+ if (NIL_P(result)) {
+ FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
+ rb_yield(subarray);
+ if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
+ rb_raise(rb_eRuntimeError, "product reentered");
+ }
+ else {
+ FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
+ }
+ }
+ else {
+ rb_ary_push(result, subarray);
+ }
+
+ /*
+ * Increment the last counter. If it overflows, reset to 0
+ * and increment the one before it.
+ */
+ m = n-1;
+ counters[m]++;
+ while (counters[m] == RARRAY_LEN(arrays[m])) {
+ counters[m] = 0;
+ /* If the first counter overflows, we are done */
+ if (--m < 0) goto done;
+ counters[m]++;
+ }
}
+
done:
- tmpary_discard(t0);
- tmpbuf_discard(t1);
+ ALLOCV_END(t1);
return NIL_P(result) ? ary : result;
}
/*
* call-seq:
- * ary.take(n) -> new_ary
- *
- * Returns first +n+ elements from the array.
+ * array.take(n) -> new_array
*
- * If a negative number is given, raises an ArgumentError.
+ * Returns a new \Array containing the first +n+ element of +self+,
+ * where +n+ is a non-negative \Integer;
+ * does not modify +self+.
*
- * See also Array#drop
+ * Examples:
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.take(3) #=> [1, 2, 3]
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.take(1) # => [0]
+ * a.take(2) # => [0, 1]
+ * a.take(50) # => [0, 1, 2, 3, 4, 5]
+ * a # => [0, 1, 2, 3, 4, 5]
*
*/
@@ -5534,25 +7757,31 @@ rb_ary_take(VALUE obj, VALUE n)
{
long len = NUM2LONG(n);
if (len < 0) {
- rb_raise(rb_eArgError, "attempt to take negative size");
+ rb_raise(rb_eArgError, "attempt to take negative size");
}
return rb_ary_subseq(obj, 0, len);
}
/*
* call-seq:
- * ary.take_while { |obj| block } -> new_ary
- * ary.take_while -> Enumerator
+ * array.take_while {|element| ... } -> new_array
+ * array.take_while -> new_enumerator
*
- * Passes elements to the block until the block returns +nil+ or +false+, then
- * stops iterating and returns an array of all prior elements.
+ * Returns a new \Array containing zero or more leading elements of +self+;
+ * does not modify +self+.
*
- * If no block is given, an Enumerator is returned instead.
+ * With a block given, calls the block with each successive element of +self+;
+ * stops if the block returns +false+ or +nil+;
+ * returns a new \Array containing those elements for which the block returned a truthy value:
*
- * See also Array#drop_while
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.take_while {|element| element < 3 } # => [0, 1, 2]
+ * a.take_while {|element| true } # => [0, 1, 2, 3, 4, 5]
+ * a # => [0, 1, 2, 3, 4, 5]
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.take_while { |i| i < 3 } #=> [1, 2]
+ * With no block given, returns a new \Enumerator:
+ *
+ * [0, 1].take_while # => #<Enumerator: [0, 1]:take_while>
*
*/
@@ -5563,24 +7792,25 @@ rb_ary_take_while(VALUE ary)
RETURN_ENUMERATOR(ary, 0, 0);
for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
}
return rb_ary_take(ary, LONG2FIX(i));
}
/*
* call-seq:
- * ary.drop(n) -> new_ary
- *
- * Drops first +n+ elements from +ary+ and returns the rest of the elements in
- * an array.
+ * array.drop(n) -> new_array
*
- * If a negative number is given, raises an ArgumentError.
+ * Returns a new \Array containing all but the first +n+ element of +self+,
+ * where +n+ is a non-negative \Integer;
+ * does not modify +self+.
*
- * See also Array#take
+ * Examples:
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop(3) #=> [4, 5, 0]
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ * a.drop(1) # => [1, 2, 3, 4, 5]
+ * a.drop(2) # => [2, 3, 4, 5]
*
*/
@@ -5590,29 +7820,32 @@ rb_ary_drop(VALUE ary, VALUE n)
VALUE result;
long pos = NUM2LONG(n);
if (pos < 0) {
- rb_raise(rb_eArgError, "attempt to drop negative size");
+ rb_raise(rb_eArgError, "attempt to drop negative size");
}
result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
- if (result == Qnil) result = rb_ary_new();
+ if (NIL_P(result)) result = rb_ary_new();
return result;
}
/*
* call-seq:
- * ary.drop_while { |obj| block } -> new_ary
- * ary.drop_while -> Enumerator
+ * array.drop_while {|element| ... } -> new_array
+ * array.drop_while -> new_enumerator
+
+ * Returns a new \Array containing zero or more trailing elements of +self+;
+ * does not modify +self+.
*
- * Drops elements up to, but not including, the first element for which the
- * block returns +nil+ or +false+ and returns an array containing the
- * remaining elements.
+ * With a block given, calls the block with each successive element of +self+;
+ * stops if the block returns +false+ or +nil+;
+ * returns a new \Array _omitting_ those elements for which the block returned a truthy value:
*
- * If no block is given, an Enumerator is returned instead.
+ * a = [0, 1, 2, 3, 4, 5]
+ * a.drop_while {|element| element < 3 } # => [3, 4, 5]
*
- * See also Array#take_while
+ * With no block given, returns a new \Enumerator:
*
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
+ * [0, 1].drop_while # => # => #<Enumerator: [0, 1]:drop_while>
*
*/
@@ -5623,53 +7856,286 @@ rb_ary_drop_while(VALUE ary)
RETURN_ENUMERATOR(ary, 0, 0);
for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
}
return rb_ary_drop(ary, LONG2FIX(i));
}
/*
* call-seq:
- * ary.any? [{ |obj| block }] -> true or false
+ * array.any? -> true or false
+ * array.any? {|element| ... } -> true or false
+ * array.any?(obj) -> true or false
+ *
+ * Returns +true+ if any element of +self+ meets a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has any truthy element,
+ * +false+ otherwise:
*
- * See also Enumerable#any?
+ * [nil, 0, false].any? # => true
+ * [nil, false].any? # => false
+ * [].any? # => false
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns any truthy value, +false+ otherwise:
+ *
+ * [0, 1, 2].any? {|element| element > 1 } # => true
+ * [0, 1, 2].any? {|element| element > 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if +obj+.<tt>===</tt> any element,
+ * +false+ otherwise:
+ *
+ * ['food', 'drink'].any?(/foo/) # => true
+ * ['food', 'drink'].any?(/bar/) # => false
+ * [].any?(/foo/) # => false
+ * [0, 1, 2].any?(1) # => true
+ * [0, 1, 2].any?(3) # => false
+ *
+ * Related: Enumerable#any?
*/
static VALUE
-rb_ary_any_p(VALUE ary)
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
{
long i, len = RARRAY_LEN(ary);
- const VALUE *ptr = RARRAY_CONST_PTR(ary);
+ rb_check_arity(argc, 0, 1);
if (!len) return Qfalse;
- if (!rb_block_given_p()) {
- for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+ }
}
else {
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
- }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+ }
}
return Qfalse;
}
/*
- * call-seq:
- * ary.dig(idx, ...) -> object
+ * call-seq:
+ * array.all? -> true or false
+ * array.all? {|element| ... } -> true or false
+ * array.all?(obj) -> true or false
+ *
+ * Returns +true+ if all elements of +self+ meet a given criterion.
*
- * Extracts the nested value specified by the sequence of <i>idx</i>
- * objects by calling +dig+ at each step, returning +nil+ if any
- * intermediate step is +nil+.
+ * With no block given and no argument, returns +true+ if +self+ contains only truthy elements,
+ * +false+ otherwise:
*
- * a = [[1, [2, 3]]]
+ * [0, 1, :foo].all? # => true
+ * [0, nil, 2].all? # => false
+ * [].all? # => true
*
- * a.dig(0, 1, 1) #=> 3
- * a.dig(1, 2, 3) #=> nil
- * a.dig(0, 0, 0) #=> TypeError: Fixnum does not have #dig method
- * [42, {foo: :bar}].dig(1, :foo) #=> :bar
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns only truthy values, +false+ otherwise:
+ *
+ * [0, 1, 2].all? { |element| element < 3 } # => true
+ * [0, 1, 2].all? { |element| element < 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> every element, +false+ otherwise:
+ *
+ * ['food', 'fool', 'foot'].all?(/foo/) # => true
+ * ['food', 'drink'].all?(/bar/) # => false
+ * [].all?(/foo/) # => true
+ * [0, 0, 0].all?(0) # => true
+ * [0, 1, 2].all?(1) # => false
+ *
+ * Related: Enumerable#all?
*/
-VALUE
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * array.none? -> true or false
+ * array.none? {|element| ... } -> true or false
+ * array.none?(obj) -> true or false
+ *
+ * Returns +true+ if no element of +self+ meet a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ * +false+ otherwise:
+ *
+ * [nil, false].none? # => true
+ * [nil, 0, false].none? # => false
+ * [].none? # => true
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block returns no truthy value, +false+ otherwise:
+ *
+ * [0, 1, 2].none? {|element| element > 3 } # => true
+ * [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> no element, +false+ otherwise:
+ *
+ * ['food', 'drink'].none?(/bar/) # => true
+ * ['food', 'drink'].none?(/foo/) # => false
+ * [].none?(/foo/) # => true
+ * [0, 1, 2].none?(3) # => true
+ * [0, 1, 2].none?(1) # => false
+ *
+ * Related: Enumerable#none?
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * array.one? -> true or false
+ * array.one? {|element| ... } -> true or false
+ * array.one?(obj) -> true or false
+ *
+ * Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ * With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ * +false+ otherwise:
+ *
+ * [nil, 0].one? # => true
+ * [0, 0].one? # => false
+ * [nil, nil].one? # => false
+ * [].one? # => false
+ *
+ * With a block given and no argument, calls the block with each element in +self+;
+ * returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ *
+ * [0, 1, 2].one? {|element| element > 0 } # => false
+ * [0, 1, 2].one? {|element| element > 1 } # => true
+ * [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ * If argument +obj+ is given, returns +true+ if <tt>obj.===</tt> exactly one element,
+ * +false+ otherwise:
+ *
+ * [0, 1, 2].one?(0) # => true
+ * [0, 0, 1].one?(0) # => false
+ * [1, 1, 2].one?(0) # => false
+ * ['food', 'drink'].one?(/bar/) # => false
+ * ['food', 'drink'].one?(/foo/) # => true
+ * [].one?(/foo/) # => false
+ *
+ * Related: Enumerable#one?
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+ VALUE result = Qfalse;
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qfalse;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * array.dig(index, *identifiers) -> object
+ *
+ * Finds and returns the object in nested objects
+ * that is specified by +index+ and +identifiers+.
+ * The nested objects may be instances of various classes.
+ * See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ *
+ * Examples:
+ *
+ * a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ * a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ * a.dig(1, 2) # => [:bat, :bam]
+ * a.dig(1, 2, 0) # => :bat
+ * a.dig(1, 2, 3) # => nil
+ *
+ */
+
+static VALUE
rb_ary_dig(int argc, VALUE *argv, VALUE self)
{
rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
@@ -5679,44 +8145,57 @@ rb_ary_dig(int argc, VALUE *argv, VALUE self)
return rb_obj_dig(argc, argv, self, Qnil);
}
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+ if (n != 0)
+ v = rb_fix_plus(LONG2FIX(n), v);
+ if (!UNDEF_P(r)) {
+ v = rb_rational_plus(r, v);
+ }
+ else if (!n && z) {
+ v = rb_fix_plus(LONG2FIX(0), v);
+ }
+ return v;
+}
+
/*
* call-seq:
- * ary.sum(init=0) -> number
- * ary.sum(init=0) {|e| expr } -> number
+ * array.sum(init = 0) -> object
+ * array.sum(init = 0) {|element| ... } -> object
*
- * Returns the sum of elements.
- * For example, [e1, e2, e3].sum returns init + e1 + e2 + e3.
+ * When no block is given, returns the object equivalent to:
*
- * If a block is given, the block is applied to each element
- * before addition.
+ * sum = init
+ * array.each {|element| sum += element }
+ * sum
*
- * If <i>ary</i> is empty, it returns <i>init</i>.
+ * For example, <tt>[e1, e2, e3].sum</tt> returns <tt>init + e1 + e2 + e3</tt>.
*
- * [].sum #=> 0
- * [].sum(0.0) #=> 0.0
- * [1, 2, 3].sum #=> 6
- * [3, 5.5].sum #=> 8.5
- * [2.5, 3.0].sum(0.0) {|e| e * e } #=> 15.25
- * [Object.new].sum #=> TypeError
+ * Examples:
*
- * The (arithmetic) mean value of an array can be obtained as follows.
+ * a = [0, 1, 2, 3]
+ * a.sum # => 6
+ * a.sum(100) # => 106
*
- * mean = ary.sum(0.0) / ary.length
+ * The elements need not be numeric, but must be <tt>+</tt>-compatible
+ * with each other and with +init+:
*
- * This method can be used for non-numeric objects by
- * explicit <i>init</i> argument.
+ * a = ['abc', 'def', 'ghi']
+ * a.sum('jkl') # => "jklabcdefghi"
*
- * ["a", "b", "c"].sum("") #=> "abc"
- * [[1], [[2]], [3]].sum([]) #=> [1, [2], 3]
+ * When a block is given, it is called with each element
+ * and the block's return value (instead of the element itself) is used as the addend:
*
- * However, Array#join and Array#flatten is faster than Array#sum.
+ * a = ['zero', 1, :two]
+ * s = a.sum('Coerced and concatenated: ') {|element| element.to_s }
+ * s # => "Coerced and concatenated: zero1two"
*
- * ["a", "b", "c"].join #=> "abc"
- * [[1], [[2]], [3]].flatten(1) #=> [1, [2], 3]
+ * Notes:
*
- *
- * Array#sum method may not respect method redefinition of "+" methods
- * such as Fixnum#+.
+ * - Array#join and Array#flatten may be faster than Array#sum
+ * for an \Array of Strings or an \Array of Arrays.
+ * - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
*
*/
@@ -5727,8 +8206,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
long i, n;
int block_given;
- if (rb_scan_args(argc, argv, "01", &v) == 0)
- v = LONG2FIX(0);
+ v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
block_given = rb_block_given_p();
@@ -5748,10 +8226,10 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
n = 0;
}
}
- else if (RB_TYPE_P(e, T_BIGNUM))
+ else if (RB_BIGNUM_TYPE_P(e))
v = rb_big_plus(e, v);
else if (RB_TYPE_P(e, T_RATIONAL)) {
- if (r == Qundef)
+ if (UNDEF_P(r))
r = e;
else
r = rb_rational_plus(r, e);
@@ -5759,41 +8237,24 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
else
goto not_exact;
}
- if (n != 0)
- v = rb_fix_plus(LONG2FIX(n), v);
- if (r != Qundef) {
- /* r can be a Integer when mathn is loaded */
- if (FIXNUM_P(r))
- v = rb_fix_plus(r, v);
- else if (RB_TYPE_P(r, T_BIGNUM))
- v = rb_big_plus(r, v);
- else
- v = rb_rational_plus(r, v);
- }
+ v = finish_exact_sum(n, r, v, argc!=0);
return v;
not_exact:
- if (n != 0)
- v = rb_fix_plus(LONG2FIX(n), v);
- if (r != Qundef) {
- /* r can be a Integer when mathn is loaded */
- if (FIXNUM_P(r))
- v = rb_fix_plus(r, v);
- else if (RB_TYPE_P(r, T_BIGNUM))
- v = rb_big_plus(r, v);
- else
- v = rb_rational_plus(r, v);
- }
+ v = finish_exact_sum(n, r, v, i!=0);
if (RB_FLOAT_TYPE_P(e)) {
- /* Kahan's compensated summation algorithm */
+ /*
+ * Kahan-Babuska balancing compensated summation algorithm
+ * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+ */
double f, c;
+ double x, t;
f = NUM2DBL(v);
c = 0.0;
goto has_float_value;
for (; i < RARRAY_LEN(ary); i++) {
- double x, y, t;
e = RARRAY_AREF(ary, i);
if (block_given)
e = rb_yield(e);
@@ -5802,18 +8263,35 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
x = RFLOAT_VALUE(e);
else if (FIXNUM_P(e))
x = FIX2LONG(e);
- else if (RB_TYPE_P(e, T_BIGNUM))
+ else if (RB_BIGNUM_TYPE_P(e))
x = rb_big2dbl(e);
else if (RB_TYPE_P(e, T_RATIONAL))
x = rb_num2dbl(e);
else
goto not_float;
- y = x - c;
- t = f + y;
- c = (t - f) - y;
+ if (isnan(f)) continue;
+ if (isnan(x)) {
+ f = x;
+ continue;
+ }
+ if (isinf(x)) {
+ if (isinf(f) && signbit(x) != signbit(f))
+ f = NAN;
+ else
+ f = x;
+ continue;
+ }
+ if (isinf(f)) continue;
+
+ t = f + x;
+ if (fabs(f) >= fabs(x))
+ c += ((f - t) + x);
+ else
+ c += ((x - t) + f);
f = t;
}
+ f += c;
return DBL2NUM(f);
not_float:
@@ -5831,55 +8309,135 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
return v;
}
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+ return ary;
+}
+
/*
- * Arrays are ordered, integer-indexed collections of any object.
+ * An \Array is an ordered, integer-indexed collection of objects, called _elements_.
+ * Any object (even another array) may be an array element,
+ * and an array can contain objects of different types.
+ *
+ * == \Array Indexes
+ *
+ * \Array indexing starts at 0, as in C or Java.
+ *
+ * A positive index is an offset from the first element:
+ *
+ * - Index 0 indicates the first element.
+ * - Index 1 indicates the second element.
+ * - ...
+ *
+ * A negative index is an offset, backwards, from the end of the array:
+ *
+ * - Index -1 indicates the last element.
+ * - Index -2 indicates the next-to-last element.
+ * - ...
+ *
+ * A non-negative index is <i>in range</i> if and only if it is smaller than
+ * the size of the array. For a 3-element array:
+ *
+ * - Indexes 0 through 2 are in range.
+ * - Index 3 is out of range.
+ *
+ * A negative index is <i>in range</i> if and only if its absolute value is
+ * not larger than the size of the array. For a 3-element array:
+ *
+ * - Indexes -1 through -3 are in range.
+ * - Index -4 is out of range.
+ *
+ * Although the effective index into an array is always an integer,
+ * some methods (both within and outside of class \Array)
+ * accept one or more non-integer arguments that are
+ * {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
*
- * Array indexing starts at 0, as in C or Java. A negative index is assumed
- * to be relative to the end of the array---that is, an index of -1 indicates
- * the last element of the array, -2 is the next to last element in the
- * array, and so on.
*
* == Creating Arrays
*
- * A new array can be created by using the literal constructor
- * <code>[]</code>. Arrays can contain different types of objects. For
- * example, the array below contains an Integer, a String and a Float:
+ * You can create an \Array object explicitly with:
+ *
+ * - An {array literal}[rdoc-ref:literals.rdoc@Array+Literals]:
+ *
+ * [1, 'one', :one, [2, 'two', :two]]
+ *
+ * - A {%w or %W: string-array Literal}[rdoc-ref:literals.rdoc@25w+and+-25W-3A+String-Array+Literals]:
+ *
+ * %w[foo bar baz] # => ["foo", "bar", "baz"]
+ * %w[1 % *] # => ["1", "%", "*"]
*
- * ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ * - A {%i pr %I: symbol-array Literal}[rdoc-ref:literals.rdoc@25i+and+-25I-3A+Symbol-Array+Literals]:
*
- * An array can also be created by explicitly calling Array.new with zero, one
- * (the initial size of the Array) or two arguments (the initial size and a
- * default object).
+ * %i[foo bar baz] # => [:foo, :bar, :baz]
+ * %i[1 % *] # => [:"1", :%, :*]
*
- * ary = Array.new #=> []
- * Array.new(3) #=> [nil, nil, nil]
- * Array.new(3, true) #=> [true, true, true]
+ * - \Method Kernel#Array:
*
- * Note that the second argument populates the array with references to the
- * same object. Therefore, it is only recommended in cases when you need to
- * instantiate arrays with natively immutable objects such as Symbols,
- * numbers, true or false.
+ * Array(["a", "b"]) # => ["a", "b"]
+ * Array(1..5) # => [1, 2, 3, 4, 5]
+ * Array(key: :value) # => [[:key, :value]]
+ * Array(nil) # => []
+ * Array(1) # => [1]
+ * Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
*
- * To create an array with separate objects a block can be passed instead.
- * This method is safe to use with mutable objects such as hashes, strings or
- * other arrays:
+ * - \Method Array.new:
*
- * Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
+ * Array.new # => []
+ * Array.new(3) # => [nil, nil, nil]
+ * Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
+ * Array.new(3, true) # => [true, true, true]
*
- * This is also a quick way to build up multi-dimensional arrays:
+ * Note that the last example above populates the array
+ * with references to the same object.
+ * This is recommended only in cases where that object is a natively immutable object
+ * such as a symbol, a numeric, +nil+, +true+, or +false+.
*
- * empty_table = Array.new(3) { Array.new(3) }
- * #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ * Another way to create an array with various objects, using a block;
+ * this usage is safe for mutable objects such as hashes, strings or
+ * other arrays:
*
- * An array can also be created by using the Array() method, provided by
- * Kernel, which tries to call #to_ary, then #to_a on its argument.
+ * Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
*
- * Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ * Here is a way to create a multi-dimensional array:
+ *
+ * Array.new(3) {Array.new(3)}
+ * # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ * A number of Ruby methods, both in the core and in the standard library,
+ * provide instance method +to_a+, which converts an object to an array.
+ *
+ * - ARGF#to_a
+ * - Array#to_a
+ * - Enumerable#to_a
+ * - Hash#to_a
+ * - MatchData#to_a
+ * - NilClass#to_a
+ * - OptionParser#to_a
+ * - Range#to_a
+ * - Set#to_a
+ * - Struct#to_a
+ * - Time#to_a
+ * - Benchmark::Tms#to_a
+ * - CSV::Table#to_a
+ * - Enumerator::Lazy#to_a
+ * - Gem::List#to_a
+ * - Gem::NameTuple#to_a
+ * - Gem::Platform#to_a
+ * - Gem::RequestSet::Lockfile::Tokenizer#to_a
+ * - Gem::SourceList#to_a
+ * - OpenSSL::X509::Extension#to_a
+ * - OpenSSL::X509::Name#to_a
+ * - Racc::ISet#to_a
+ * - Rinda::RingFinger#to_a
+ * - Ripper::Lexer::Elem#to_a
+ * - RubyVM::InstructionSequence#to_a
+ * - YAML::DBM#to_a
*
* == Example Usage
*
* In addition to the methods it mixes in through the Enumerable module, the
- * Array class has proprietary methods for accessing, searching and otherwise
+ * \Array class has proprietary methods for accessing, searching and otherwise
* manipulating arrays.
*
* Some of the more common ones are illustrated below.
@@ -5927,7 +8485,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
*
* arr.drop(3) #=> [4, 5, 6]
*
- * == Obtaining Information about an Array
+ * == Obtaining Information about an \Array
*
* Arrays keep track of their own length at all times. To query an array
* about the number of elements it contains, use #length, #count or #size.
@@ -5965,7 +8523,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
* arr.insert(3, 'orange', 'pear', 'grapefruit')
* #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
*
- * == Removing Items from an Array
+ * == Removing Items from an \Array
*
* The method #pop removes the last element in an array and returns it:
*
@@ -6007,15 +8565,15 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
*
* == Iterating over Arrays
*
- * Like all classes that include the Enumerable module, Array has an each
+ * Like all classes that include the Enumerable module, \Array has an each
* method, which defines what elements should be iterated over and how. In
- * case of Array's #each, all elements in the Array instance are yielded to
+ * case of Array's #each, all elements in the \Array instance are yielded to
* the supplied block in sequence.
*
* Note that this operation leaves the array unchanged.
*
* arr = [1, 2, 3, 4, 5]
- * arr.each { |a| print a -= 10, " " }
+ * arr.each {|a| print a -= 10, " "}
* # prints: -9 -8 -7 -6 -5
* #=> [1, 2, 3, 4, 5]
*
@@ -6024,18 +8582,19 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
*
* words = %w[first second third fourth fifth sixth]
* str = ""
- * words.reverse_each { |word| str += "#{word} " }
+ * words.reverse_each {|word| str += "#{word} "}
* p str #=> "sixth fifth fourth third second first "
*
* The #map method can be used to create a new array based on the original
* array, but with the values modified by the supplied block:
*
- * arr.map { |a| 2*a } #=> [2, 4, 6, 8, 10]
+ * arr.map {|a| 2*a} #=> [2, 4, 6, 8, 10]
* arr #=> [1, 2, 3, 4, 5]
- * arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ * arr.map! {|a| a**2} #=> [1, 4, 9, 16, 25]
* arr #=> [1, 4, 9, 16, 25]
*
- * == Selecting Items from an Array
+ *
+ * == Selecting Items from an \Array
*
* Elements can be selected from an array according to criteria defined in a
* block. The selection can happen in a destructive or a non-destructive
@@ -6046,9 +8605,9 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
* === Non-destructive Selection
*
* arr = [1, 2, 3, 4, 5, 6]
- * arr.select { |a| a > 3 } #=> [4, 5, 6]
- * arr.reject { |a| a < 3 } #=> [3, 4, 5, 6]
- * arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ * arr.select {|a| a > 3} #=> [4, 5, 6]
+ * arr.reject {|a| a < 3} #=> [3, 4, 5, 6]
+ * arr.drop_while {|a| a < 4} #=> [4, 5, 6]
* arr #=> [1, 2, 3, 4, 5, 6]
*
* === Destructive Selection
@@ -6059,25 +8618,205 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
* Similar to #select vs. #reject, #delete_if and #keep_if have the exact
* opposite result when supplied with the same block:
*
- * arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ * arr.delete_if {|a| a < 4} #=> [4, 5, 6]
* arr #=> [4, 5, 6]
*
* arr = [1, 2, 3, 4, 5, 6]
- * arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ * arr.keep_if {|a| a < 4} #=> [1, 2, 3]
* arr #=> [1, 2, 3]
*
+ * == What's Here
+ *
+ * First, what's elsewhere. \Class \Array:
+ *
+ * - Inherits from {class Object}[rdoc-ref:Object@What-27s+Here].
+ * - Includes {module Enumerable}[rdoc-ref:Enumerable@What-27s+Here],
+ * which provides dozens of additional methods.
+ *
+ * Here, class \Array provides methods that are useful for:
+ *
+ * - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
+ * - {Querying}[rdoc-ref:Array@Methods+for+Querying]
+ * - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
+ * - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
+ * - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
+ * - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
+ * - {Combining}[rdoc-ref:Array@Methods+for+Combining]
+ * - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
+ * - {Converting}[rdoc-ref:Array@Methods+for+Converting]
+ * - {And more....}[rdoc-ref:Array@Other+Methods]
+ *
+ * === Methods for Creating an \Array
+ *
+ * - ::[]: Returns a new array populated with given objects.
+ * - ::new: Returns a new array.
+ * - ::try_convert: Returns a new array created from a given object.
+ *
+ * === Methods for Querying
+ *
+ * - #length, #size: Returns the count of elements.
+ * - #include?: Returns whether any element <tt>==</tt> a given object.
+ * - #empty?: Returns whether there are no elements.
+ * - #all?: Returns whether all elements meet a given criterion.
+ * - #any?: Returns whether any element meets a given criterion.
+ * - #none?: Returns whether no element <tt>==</tt> a given object.
+ * - #one?: Returns whether exactly one element <tt>==</tt> a given object.
+ * - #count: Returns the count of elements that meet a given criterion.
+ * - #find_index, #index: Returns the index of the first element that meets a given criterion.
+ * - #rindex: Returns the index of the last element that meets a given criterion.
+ * - #hash: Returns the integer hash code.
+ *
+ * === Methods for Comparing
+ *
+ * - #<=>: Returns -1, 0, or 1 * as +self+ is less than, equal to, or
+ * greater than a given object.
+ * - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element
+ * in a given object.
+ * - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding
+ * element in a given object.
+
+ * === Methods for Fetching
+ *
+ * These methods do not modify +self+.
+ *
+ * - #[]: Returns one or more elements.
+ * - #fetch: Returns the element at a given offset.
+ * - #first: Returns one or more leading elements.
+ * - #last: Returns one or more trailing elements.
+ * - #max: Returns one or more maximum-valued elements,
+ * as determined by <tt><=></tt> or a given block.
+ * - #min: Returns one or more minimum-valued elements,
+ * as determined by <tt><=></tt> or a given block.
+ * - #minmax: Returns the minimum-valued and maximum-valued elements,
+ * as determined by <tt><=></tt> or a given block.
+ * - #assoc: Returns the first element that is an array
+ * whose first element <tt>==</tt> a given object.
+ * - #rassoc: Returns the first element that is an array
+ * whose second element <tt>==</tt> a given object.
+ * - #at: Returns the element at a given offset.
+ * - #values_at: Returns the elements at given offsets.
+ * - #dig: Returns the object in nested objects
+ * that is specified by a given index and additional arguments.
+ * - #drop: Returns trailing elements as determined by a given index.
+ * - #take: Returns leading elements as determined by a given index.
+ * - #drop_while: Returns trailing elements as determined by a given block.
+ * - #take_while: Returns leading elements as determined by a given block.
+ * - #slice: Returns consecutive elements as determined by a given argument.
+ * - #sort: Returns all elements in an order determined by <tt><=></tt> or a given block.
+ * - #reverse: Returns all elements in reverse order.
+ * - #compact: Returns an array containing all non-+nil+ elements.
+ * - #select, #filter: Returns an array containing elements selected by a given block.
+ * - #uniq: Returns an array containing non-duplicate elements.
+ * - #rotate: Returns all elements with some rotated from one end to the other.
+ * - #bsearch: Returns an element selected via a binary search
+ * as determined by a given block.
+ * - #bsearch_index: Returns the index of an element selected via a binary search
+ * as determined by a given block.
+ * - #sample: Returns one or more random elements.
+ * - #shuffle: Returns elements in a random order.
+ *
+ * === Methods for Assigning
+ *
+ * These methods add, replace, or reorder elements in +self+.
+ *
+ * - #[]=: Assigns specified elements with a given object.
+ * - #push, #append, #<<: Appends trailing elements.
+ * - #unshift, #prepend: Prepends leading elements.
+ * - #insert: Inserts given objects at a given offset; does not replace elements.
+ * - #concat: Appends all elements from given arrays.
+ * - #fill: Replaces specified elements with specified objects.
+ * - #replace: Replaces the content of +self+ with the content of a given array.
+ * - #reverse!: Replaces +self+ with its elements reversed.
+ * - #rotate!: Replaces +self+ with its elements rotated.
+ * - #shuffle!: Replaces +self+ with its elements in random order.
+ * - #sort!: Replaces +self+ with its elements sorted,
+ * as determined by <tt><=></tt> or a given block.
+ * - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
+ *
+ * === Methods for Deleting
+ *
+ * Each of these methods removes elements from +self+:
+ *
+ * - #pop: Removes and returns the last element.
+ * - #shift: Removes and returns the first element.
+ * - #compact!: Removes all +nil+ elements.
+ * - #delete: Removes elements equal to a given object.
+ * - #delete_at: Removes the element at a given offset.
+ * - #delete_if: Removes elements specified by a given block.
+ * - #keep_if: Removes elements not specified by a given block.
+ * - #reject!: Removes elements specified by a given block.
+ * - #select!, #filter!: Removes elements not specified by a given block.
+ * - #slice!: Removes and returns a sequence of elements.
+ * - #uniq!: Removes duplicates.
+ *
+ * === Methods for Combining
+ *
+ * - #&: Returns an array containing elements found both in +self+ and a given array.
+ * - #intersection: Returns an array containing elements found both in +self+
+ * and in each given array.
+ * - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
+ * - #-: Returns an array containing all elements of +self+ that are not found in a given array.
+ * - #|: Returns an array containing all elements of +self+ and all elements of a given array,
+ * duplicates removed.
+ * - #union: Returns an array containing all elements of +self+ and all elements of given arrays,
+ * duplicates removed.
+ * - #difference: Returns an array containing all elements of +self+ that are not found
+ * in any of the given arrays..
+ * - #product: Returns or yields all combinations of elements from +self+ and given arrays.
+ *
+ * === Methods for Iterating
+ *
+ * - #each: Passes each element to a given block.
+ * - #reverse_each: Passes each element, in reverse order, to a given block.
+ * - #each_index: Passes each element index to a given block.
+ * - #cycle: Calls a given block with each element, then does so again,
+ * for a specified number of times, or forever.
+ * - #combination: Calls a given block with combinations of elements of +self+;
+ * a combination does not use the same element more than once.
+ * - #permutation: Calls a given block with permutations of elements of +self+;
+ * a permutation does not use the same element more than once.
+ * - #repeated_combination: Calls a given block with combinations of elements of +self+;
+ * a combination may use the same element more than once.
+ * - #repeated_permutation: Calls a given block with permutations of elements of +self+;
+ * a permutation may use the same element more than once.
+ *
+ * === Methods for Converting
+ *
+ * - #map, #collect: Returns an array containing the block return-value for each element.
+ * - #map!, #collect!: Replaces each element with a block return-value.
+ * - #flatten: Returns an array that is a recursive flattening of +self+.
+ * - #flatten!: Replaces each nested array in +self+ with the elements from that array.
+ * - #inspect, #to_s: Returns a new String containing the elements.
+ * - #join: Returns a newsString containing the elements joined by the field separator.
+ * - #to_a: Returns +self+ or a new array containing all elements.
+ * - #to_ary: Returns +self+.
+ * - #to_h: Returns a new hash formed from the elements.
+ * - #transpose: Transposes +self+, which must be an array of arrays.
+ * - #zip: Returns a new array of arrays containing +self+ and given arrays;
+ * follow the link for details.
+ *
+ * === Other Methods
+ *
+ * - #*: Returns one of the following:
+ *
+ * - With integer argument +n+, a new array that is the concatenation
+ * of +n+ copies of +self+.
+ * - With string argument +field_separator+, a new string that is equivalent to
+ * <tt>join(field_separator)</tt>.
+ *
+ * - #abbrev: Returns a hash of unambiguous abbreviations for elements.
+ * - #pack: Packs the elements into a binary sequence.
+ * - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
*/
void
Init_Array(void)
{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+ rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
@@ -6088,7 +8827,6 @@ Init_Array(void)
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
- rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -6101,17 +8839,23 @@ Init_Array(void)
rb_define_method(rb_cArray, "first", rb_ary_first, -1);
rb_define_method(rb_cArray, "last", rb_ary_last, -1);
rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+ rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+ rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+ rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+ rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+ rb_define_alias(rb_cArray, "append", "push");
rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+ rb_define_alias(rb_cArray, "prepend", "unshift");
rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
- rb_define_alias(rb_cArray, "size", "length");
+ rb_define_method(rb_cArray, "size", rb_ary_length, 0);
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
rb_define_method(rb_cArray, "index", rb_ary_index, -1);
@@ -6130,6 +8874,8 @@ Init_Array(void)
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "select", rb_ary_select, 0);
rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+ rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+ rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -6160,6 +8906,7 @@ Init_Array(void)
rb_define_method(rb_cArray, "max", rb_ary_max, -1);
rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+ rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
@@ -6168,9 +8915,6 @@ Init_Array(void)
rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
rb_define_method(rb_cArray, "count", rb_ary_count, -1);
- rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
- rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
- rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -6184,12 +8928,14 @@ Init_Array(void)
rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
- rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+ rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+ rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+ rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+ rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
- id_cmp = rb_intern("<=>");
- id_random = rb_intern("random");
- id_div = rb_intern("div");
- id_power = rb_intern("**");
+ rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
}
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..b9fa9844e6
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,69 @@
+class Array
+ # call-seq:
+ # array.shuffle!(random: Random) -> array
+ #
+ # Shuffles the elements of +self+ in place.
+ # a = [1, 2, 3] #=> [1, 2, 3]
+ # a.shuffle! #=> [2, 3, 1]
+ # a #=> [2, 3, 1]
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
+ def shuffle!(random: Random)
+ Primitive.rb_ary_shuffle_bang(random)
+ end
+
+ # call-seq:
+ # array.shuffle(random: Random) -> new_ary
+ #
+ # Returns a new array with elements of +self+ shuffled.
+ # a = [1, 2, 3] #=> [1, 2, 3]
+ # a.shuffle #=> [2, 3, 1]
+ # a #=> [1, 2, 3]
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ def shuffle(random: Random)
+ Primitive.rb_ary_shuffle(random)
+ end
+
+ # call-seq:
+ # array.sample(random: Random) -> object
+ # array.sample(n, random: Random) -> new_ary
+ #
+ # Returns random elements from +self+.
+ #
+ # When no arguments are given, returns a random element from +self+:
+ # a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ # a.sample # => 3
+ # a.sample # => 8
+ # If +self+ is empty, returns +nil+.
+ #
+ # When argument +n+ is given, returns a new \Array containing +n+ random
+ # elements from +self+:
+ # a.sample(3) # => [8, 9, 2]
+ # a.sample(6) # => [9, 6, 10, 3, 1, 4]
+ # Returns no more than <tt>a.size</tt> elements
+ # (because no new duplicates are introduced):
+ # a.sample(a.size * 2) # => [6, 4, 1, 8, 5, 9, 10, 2, 3, 7]
+ # But +self+ may contain duplicates:
+ # a = [1, 1, 1, 2, 2, 3]
+ # a.sample(a.size * 2) # => [1, 1, 3, 2, 1, 2]
+ # The argument +n+ must be a non-negative numeric value.
+ # The order of the result array is unrelated to the order of +self+.
+ # Returns a new empty \Array if +self+ is empty.
+ #
+ # The optional +random+ argument will be used as the random number generator:
+ # a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ # a.sample(random: Random.new(1)) #=> 6
+ # a.sample(4, random: Random.new(1)) #=> [6, 10, 9, 2]
+ def sample(n = (ary = false), random: Random)
+ if Primitive.mandatory_only?
+ # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
+ Primitive.ary_sample0
+ else
+ # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
+ Primitive.ary_sample(random, n, ary)
+ end
+ end
+end
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..adb7287ed3
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,773 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/parse.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+
+struct ASTNodeData {
+ rb_ast_t *ast;
+ const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ rb_gc_mark((VALUE)data->ast);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ return rb_ast_memsize(data->ast);
+}
+
+static const rb_data_type_t rb_node_type = {
+ "AST/node",
+ {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+ 0, 0,
+ RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, rb_ast_t *ast, const NODE *node)
+{
+ struct ASTNodeData *data;
+
+ TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+ data->ast = ast;
+ data->node = node;
+}
+
+static VALUE
+ast_new_internal(rb_ast_t *ast, const NODE *node)
+{
+ VALUE obj;
+
+ obj = rb_ast_node_alloc(rb_cNode);
+ setup_node(obj, ast, node);
+
+ return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+
+static VALUE
+ast_parse_new(void)
+{
+ return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(rb_ast_t *ast)
+{
+ if (!ast->body.root) {
+ rb_ast_dispose(ast);
+ rb_exc_raise(GET_EC()->errinfo);
+ }
+
+ return ast_new_internal(ast, (NODE *)ast->body.root);
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ rb_ast_t *ast = 0;
+
+ StringValue(str);
+ VALUE vparser = ast_parse_new();
+ if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+ if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+ if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+ ast = rb_parser_compile_string_path(vparser, Qnil, str, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ VALUE f;
+ rb_ast_t *ast = 0;
+ rb_encoding *enc = rb_utf8_encoding();
+
+ FilePathValue(path);
+ f = rb_file_open_str(path, "r");
+ rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+ VALUE vparser = ast_parse_new();
+ if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+ if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+ if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+ ast = rb_parser_compile_file_path(vparser, Qnil, f, 1);
+ rb_io_close(f);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+lex_array(VALUE array, int index)
+{
+ VALUE str = rb_ary_entry(array, index);
+ if (!NIL_P(str)) {
+ StringValue(str);
+ if (!rb_enc_asciicompat(rb_enc_get(str))) {
+ rb_raise(rb_eArgError, "invalid source encoding");
+ }
+ }
+ return str;
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ rb_ast_t *ast = 0;
+
+ array = rb_check_array_type(array);
+ VALUE vparser = ast_parse_new();
+ if (RTEST(keep_script_lines)) rb_parser_keep_script_lines(vparser);
+ if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+ if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+ ast = rb_parser_compile_generic(vparser, lex_array, Qnil, array, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE node_children(rb_ast_t*, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+ VALUE ary;
+ long i;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ if (nd_node_id(data->node) == node_id) return self;
+
+ ary = node_children(data->ast, data->node);
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE child = RARRAY_AREF(ary, i);
+
+ if (CLASS_OF(child) == rb_cNode) {
+ VALUE result = node_find(child, node_id);
+ if (RTEST(result)) return result;
+ }
+ }
+
+ return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+script_lines(VALUE path)
+{
+ VALUE hash, lines;
+ ID script_lines;
+ CONST_ID(script_lines, "SCRIPT_LINES__");
+ if (!rb_const_defined_at(rb_cObject, script_lines)) return Qnil;
+ hash = rb_const_get_at(rb_cObject, script_lines);
+ if (!RB_TYPE_P(hash, T_HASH)) return Qnil;
+ lines = rb_hash_lookup(hash, path);
+ if (!RB_TYPE_P(lines, T_ARRAY)) return Qnil;
+ return lines;
+}
+
+static VALUE
+node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
+{
+ int node_id;
+
+ if (!rb_frame_info_p(location)) {
+ rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
+ }
+
+ node_id = rb_get_node_id_from_frame_info(location);
+ if (node_id == -1) {
+ return Qnil;
+ }
+
+ return INT2NUM(node_id);
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+ VALUE node, lines = Qnil;
+ const rb_iseq_t *iseq;
+ int node_id;
+
+ if (rb_frame_info_p(body)) {
+ iseq = rb_get_iseq_from_frame_info(body);
+ node_id = rb_get_node_id_from_frame_info(body);
+ }
+ else {
+ iseq = NULL;
+
+ if (rb_obj_is_proc(body)) {
+ iseq = vm_proc_iseq(body);
+
+ if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
+ }
+ else {
+ iseq = rb_method_iseq(body);
+ }
+ if (iseq) {
+ node_id = ISEQ_BODY(iseq)->location.node_id;
+ }
+ }
+
+ if (!iseq) {
+ return Qnil;
+ }
+ lines = ISEQ_BODY(iseq)->variable.script_lines;
+
+ VALUE path = rb_iseq_path(iseq);
+ int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
+
+ if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
+ rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
+ }
+
+ if (!NIL_P(lines) || !NIL_P(lines = script_lines(path))) {
+ node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
+ }
+ else if (e_option) {
+ node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
+ }
+ else {
+ node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+ }
+
+ return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+ struct ASTNodeData *data;
+ VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+ return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+ return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+static VALUE
+ast_node_node_id(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2FIX(nd_node_id(data->node));
+}
+
+#define NEW_CHILD(ast, node) node ? ast_new_internal(ast, node) : Qnil
+
+static VALUE
+rb_ary_new_from_node_args(rb_ast_t *ast, long n, ...)
+{
+ va_list ar;
+ VALUE ary;
+ long i;
+
+ ary = rb_ary_new2(n);
+
+ va_start(ar, n);
+ for (i=0; i<n; i++) {
+ NODE *node;
+ node = va_arg(ar, NODE *);
+ rb_ary_push(ary, NEW_CHILD(ast, node));
+ }
+ va_end(ar);
+ return ary;
+}
+
+static VALUE
+dump_block(rb_ast_t *ast, const NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ do {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ } while (node->nd_next &&
+ nd_type_p(node->nd_next, NODE_BLOCK) &&
+ (node = node->nd_next, 1));
+ if (node->nd_next) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+ }
+
+ return ary;
+}
+
+static VALUE
+dump_array(rb_ast_t *ast, const NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+
+ while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
+ node = node->nd_next;
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+
+ return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+ if (!id) return Qnil;
+ if (!rb_id2str(id)) return Qnil;
+ return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+ ID rest;
+ CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+ return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(rb_ast_t *ast, const NODE *rest_arg)
+{
+ return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast, rest_arg) : no_name_rest();
+}
+
+static VALUE
+node_children(rb_ast_t *ast, const NODE *node)
+{
+ char name[DECIMAL_SIZE_OF_BITS(sizeof(long) * CHAR_BIT) + 2]; /* including '$' */
+
+ enum node_type type = nd_type(node);
+ switch (type) {
+ case NODE_BLOCK:
+ return dump_block(ast, node);
+ case NODE_IF:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_UNLESS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_CASE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE2:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_WHEN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_IN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_WHILE:
+ case NODE_UNTIL:
+ return rb_ary_push(rb_ary_new_from_node_args(ast, 2, node->nd_cond, node->nd_body),
+ RBOOL(node->nd_state));
+ case NODE_ITER:
+ case NODE_FOR:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_iter, node->nd_body);
+ case NODE_FOR_MASGN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_var);
+ case NODE_BREAK:
+ case NODE_NEXT:
+ case NODE_RETURN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_stts);
+ case NODE_REDO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_RETRY:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_BEGIN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_RESCUE:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_resq, node->nd_else);
+ case NODE_RESBODY:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_args, node->nd_body, node->nd_head);
+ case NODE_ENSURE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_ensr);
+ case NODE_AND:
+ case NODE_OR:
+ {
+ VALUE ary = rb_ary_new();
+
+ while (1) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_1st));
+ if (!node->nd_2nd || !nd_type_p(node->nd_2nd, type))
+ break;
+ node = node->nd_2nd;
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_2nd));
+ return ary;
+ }
+ case NODE_MASGN:
+ if (NODE_NAMED_REST_P(node->nd_args)) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_value, node->nd_head, node->nd_args);
+ }
+ else {
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_value),
+ NEW_CHILD(ast, node->nd_head),
+ no_name_rest());
+ }
+ case NODE_LASGN:
+ case NODE_DASGN:
+ case NODE_IASGN:
+ case NODE_CVASGN:
+ case NODE_GASGN:
+ if (NODE_REQUIRED_KEYWORD_P(node)) {
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+ }
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ case NODE_CDECL:
+ if (node->nd_vid) {
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ }
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_else), ID2SYM(node->nd_else->nd_mid), NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN1:
+ return rb_ary_new_from_args(4, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args->nd_head),
+ NEW_CHILD(ast, node->nd_args->nd_body));
+ case NODE_OP_ASGN2:
+ return rb_ary_new_from_args(5, NEW_CHILD(ast, node->nd_recv),
+ RBOOL(node->nd_next->nd_aid),
+ ID2SYM(node->nd_next->nd_vid),
+ ID2SYM(node->nd_next->nd_mid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_AND:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idANDOP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_OR:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idOROP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_CDECL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head),
+ ID2SYM(node->nd_aid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_CALL:
+ case NODE_OPCALL:
+ case NODE_QCALL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_FCALL:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_VCALL:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_SUPER:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_args);
+ case NODE_ZSUPER:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_LIST:
+ case NODE_VALUES:
+ return dump_array(ast, node);
+ case NODE_ZLIST:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_HASH:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_YIELD:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_LVAR:
+ case NODE_DVAR:
+ return rb_ary_new_from_args(1, var_name(node->nd_vid));
+ case NODE_IVAR:
+ case NODE_CONST:
+ case NODE_CVAR:
+ case NODE_GVAR:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_vid));
+ case NODE_NTH_REF:
+ snprintf(name, sizeof(name), "$%ld", node->nd_nth);
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_BACK_REF:
+ name[0] = '$';
+ name[1] = (char)node->nd_nth;
+ name[2] = '\0';
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_MATCH2:
+ if (node->nd_args) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_recv, node->nd_value, node->nd_args);
+ }
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_MATCH3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_MATCH:
+ case NODE_LIT:
+ case NODE_STR:
+ case NODE_XSTR:
+ return rb_ary_new_from_args(1, node->nd_lit);
+ case NODE_ONCE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_DSTR:
+ case NODE_DXSTR:
+ case NODE_DREGX:
+ case NODE_DSYM:
+ {
+ NODE *n = node->nd_next;
+ VALUE head = Qnil, next = Qnil;
+ if (n) {
+ head = NEW_CHILD(ast, n->nd_head);
+ next = NEW_CHILD(ast, n->nd_next);
+ }
+ return rb_ary_new_from_args(3, node->nd_lit, head, next);
+ }
+ case NODE_EVSTR:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ARGSCAT:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_ARGSPUSH:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_SPLAT:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_BLOCK_PASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_DEFN:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_DEFS:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_ALIAS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ case NODE_VALIAS:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_alias), ID2SYM(node->nd_orig));
+ case NODE_UNDEF:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_undef);
+ case NODE_CLASS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cpath, node->nd_super, node->nd_body);
+ case NODE_MODULE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_cpath, node->nd_body);
+ case NODE_SCLASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_body);
+ case NODE_COLON2:
+ return rb_ary_new_from_args(2, NEW_CHILD(ast, node->nd_head), ID2SYM(node->nd_mid));
+ case NODE_COLON3:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_DOT2:
+ case NODE_DOT3:
+ case NODE_FLIP2:
+ case NODE_FLIP3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_beg, node->nd_end);
+ case NODE_SELF:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_NIL:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_TRUE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_FALSE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_ERRINFO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_DEFINED:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_POSTEXE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ATTRASGN:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_args));
+ case NODE_LAMBDA:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_OPT_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_KW_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_POSTARG:
+ if (NODE_NAMED_REST_P(node->nd_1st)) {
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ }
+ return rb_ary_new_from_args(2, no_name_rest(),
+ NEW_CHILD(ast, node->nd_2nd));
+ case NODE_ARGS:
+ {
+ struct rb_args_info *ainfo = node->nd_ainfo;
+ return rb_ary_new_from_args(10,
+ INT2NUM(ainfo->pre_args_num),
+ NEW_CHILD(ast, ainfo->pre_init),
+ NEW_CHILD(ast, ainfo->opt_args),
+ var_name(ainfo->first_post_arg),
+ INT2NUM(ainfo->post_args_num),
+ NEW_CHILD(ast, ainfo->post_init),
+ (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+ ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+ : var_name(ainfo->rest_arg)),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_args)),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_rest_arg)),
+ var_name(ainfo->block_arg));
+ }
+ case NODE_SCOPE:
+ {
+ rb_ast_id_table_t *tbl = node->nd_tbl;
+ int i, size = tbl ? tbl->size : 0;
+ VALUE locals = rb_ary_new_capa(size);
+ for (i = 0; i < size; i++) {
+ rb_ary_push(locals, var_name(tbl->ids[i]));
+ }
+ return rb_ary_new_from_args(3, locals, NEW_CHILD(ast, node->nd_args), NEW_CHILD(ast, node->nd_body));
+ }
+ case NODE_ARYPTN:
+ {
+ struct rb_ary_pattern_info *apinfo = node->nd_apinfo;
+ VALUE rest = rest_arg(ast, apinfo->rest_arg);
+ return rb_ary_new_from_args(4,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, apinfo->pre_args),
+ rest,
+ NEW_CHILD(ast, apinfo->post_args));
+ }
+ case NODE_FNDPTN:
+ {
+ struct rb_fnd_pattern_info *fpinfo = node->nd_fpinfo;
+ VALUE pre_rest = rest_arg(ast, fpinfo->pre_rest_arg);
+ VALUE post_rest = rest_arg(ast, fpinfo->post_rest_arg);
+ return rb_ary_new_from_args(4,
+ NEW_CHILD(ast, node->nd_pconst),
+ pre_rest,
+ NEW_CHILD(ast, fpinfo->args),
+ post_rest);
+ }
+ case NODE_HSHPTN:
+ {
+ VALUE kwrest = node->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+ NEW_CHILD(ast, node->nd_pkwrestarg);
+
+ return rb_ary_new_from_args(3,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, node->nd_pkwargs),
+ kwrest);
+ }
+ case NODE_ERROR:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_ARGS_AUX:
+ case NODE_LAST:
+ break;
+ }
+
+ rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return node_children(data->ast, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return rb_ast_tokens(data->ast);
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+ VALUE str;
+ VALUE cname;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ cname = rb_class_path(rb_obj_class(self));
+ str = rb_str_new2("#<");
+
+ rb_str_append(str, cname);
+ rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+ node_type_to_str(data->node),
+ nd_first_lineno(data->node), nd_first_column(data->node),
+ nd_last_lineno(data->node), nd_last_column(data->node));
+
+ return str;
+}
+
+static VALUE
+ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+ VALUE ret = data->ast->body.script_lines;
+ if (!RB_TYPE_P(ret, T_ARRAY)) return Qnil;
+ return ret;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+ rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+ rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+ rb_undef_alloc_func(rb_cNode);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..f3f72c747f
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,276 @@
+# for ast.c
+
+# AbstractSyntaxTree provides methods to parse Ruby code into
+# abstract syntax trees. The nodes in the tree
+# are instances of RubyVM::AbstractSyntaxTree::Node.
+#
+# This module is MRI specific as it exposes implementation details
+# of the MRI abstract syntax tree.
+#
+# This module is experimental and its API is not stable, therefore it might
+# change without notice. As examples, the order of children nodes is not
+# guaranteed, the number of children nodes might change, there is no way to
+# access children nodes by name, etc.
+#
+# If you are looking for a stable API or an API working under multiple Ruby
+# implementations, consider using the _parser_ gem or Ripper. If you would
+# like to make RubyVM::AbstractSyntaxTree stable, please join the discussion
+# at https://bugs.ruby-lang.org/issues/14844.
+#
+module RubyVM::AbstractSyntaxTree
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Parses the given _string_ into an abstract syntax tree,
+ # returning the root node of that tree.
+ #
+ # RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+ #
+ # If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
+ # source is associated with nodes and is available via Node#script_lines.
+ #
+ # If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
+ #
+ # SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
+ # behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
+ # will produce a tree where expressions with syntax errors would be represented by
+ # Node with <tt>type=:ERROR</tt>.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
+ # # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
+ # # x = 1; p(x; y=2
+ # # ^
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
+ # # (SCOPE@1:0-1:15
+ # # tbl: [:x, :y]
+ # # args: nil
+ # # body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
+ # root.children.last.children
+ # # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
+ # # (ERROR@1:7-1:11),
+ # # (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
+ #
+ # Note that parsing continues even after the errored expresion.
+ #
+ def self.parse string, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+ Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Reads the file from _pathname_, then parses it like ::parse,
+ # returning the root node of the abstract syntax tree.
+ #
+ # SyntaxError is raised if _pathname_'s contents are not
+ # valid Ruby syntax.
+ #
+ # RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+ #
+ # See ::parse for explanation of keyword argument meaning and usage.
+ def self.parse_file pathname, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+ Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ # RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: false, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Returns AST nodes of the given _proc_ or _method_.
+ #
+ # RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+ #
+ # def hello
+ # puts "hello, world"
+ # end
+ #
+ # RubyVM::AbstractSyntaxTree.of(method(:hello))
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+ #
+ # See ::parse for explanation of keyword argument meaning and usage.
+ def self.of body, keep_script_lines: false, error_tolerant: false, keep_tokens: false
+ Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location) -> integer
+ #
+ # Returns the node id for the given backtrace location.
+ #
+ # begin
+ # raise
+ # rescue => e
+ # loc = e.backtrace_locations.first
+ # RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
+ # end # => 0
+ def self.node_id_for_backtrace_location backtrace_location
+ Primitive.node_id_for_backtrace_location backtrace_location
+ end
+
+ # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+ # RubyVM::AbstractSyntaxTree.
+ #
+ # This class is MRI specific.
+ #
+ class Node
+
+ # call-seq:
+ # node.type -> symbol
+ #
+ # Returns the type of this node as a symbol.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # root.type # => :SCOPE
+ # lasgn = root.children[2]
+ # lasgn.type # => :LASGN
+ # call = lasgn.children[1]
+ # call.type # => :OPCALL
+ def type
+ Primitive.ast_node_type
+ end
+
+ # call-seq:
+ # node.first_lineno -> integer
+ #
+ # The line number in the source code where this AST's text began.
+ def first_lineno
+ Primitive.ast_node_first_lineno
+ end
+
+ # call-seq:
+ # node.first_column -> integer
+ #
+ # The column number in the source code where this AST's text began.
+ def first_column
+ Primitive.ast_node_first_column
+ end
+
+ # call-seq:
+ # node.last_lineno -> integer
+ #
+ # The line number in the source code where this AST's text ended.
+ def last_lineno
+ Primitive.ast_node_last_lineno
+ end
+
+ # call-seq:
+ # node.last_column -> integer
+ #
+ # The column number in the source code where this AST's text ended.
+ def last_column
+ Primitive.ast_node_last_column
+ end
+
+ # call-seq:
+ # node.tokens -> array
+ #
+ # Returns tokens corresponding to the location of the node.
+ # Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+ # root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ # root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+ #
+ # Token is an array of:
+ #
+ # - id
+ # - token type
+ # - source code text
+ # - location [ first_lineno, first_column, last_lineno, last_column ]
+ def tokens
+ return nil unless all_tokens
+
+ all_tokens.each_with_object([]) do |token, a|
+ loc = token.last
+ if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
+ ([last_lineno, last_column] <=> [loc[2], loc[3]]) >= 0
+ a << token
+ end
+ end
+ end
+
+ # call-seq:
+ # node.all_tokens -> array
+ #
+ # Returns all tokens for the input script regardless the receiver node.
+ # Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+ # root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ # root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+ def all_tokens
+ Primitive.ast_node_all_tokens
+ end
+
+ # call-seq:
+ # node.children -> array
+ #
+ # Returns AST nodes under this one. Each kind of node
+ # has different children, depending on what kind of node it is.
+ #
+ # The returned array may contain other nodes or <code>nil</code>.
+ def children
+ Primitive.ast_node_children
+ end
+
+ # call-seq:
+ # node.inspect -> string
+ #
+ # Returns debugging information about this node as a string.
+ def inspect
+ Primitive.ast_node_inspect
+ end
+
+ # call-seq:
+ # node.node_id -> integer
+ #
+ # Returns an internal node_id number.
+ # Note that this is an API for ruby internal use, debugging,
+ # and research. Do not use this for any other purpose.
+ # The compatibility is not guaranteed.
+ def node_id
+ Primitive.ast_node_node_id
+ end
+
+ # call-seq:
+ # node.script_lines -> array
+ #
+ # Returns the original source code as an array of lines.
+ #
+ # Note that this is an API for ruby internal use, debugging,
+ # and research. Do not use this for any other purpose.
+ # The compatibility is not guaranteed.
+ def script_lines
+ Primitive.ast_node_script_lines
+ end
+
+ # call-seq:
+ # node.source -> string
+ #
+ # Returns the code fragment that corresponds to this AST.
+ #
+ # Note that this is an API for ruby internal use, debugging,
+ # and research. Do not use this for any other purpose.
+ # The compatibility is not guaranteed.
+ #
+ # Also note that this API may return an incomplete code fragment
+ # that does not parse; for example, a here document following
+ # an expression may be dropped.
+ def source
+ lines = script_lines
+ if lines
+ lines = lines[first_lineno - 1 .. last_lineno - 1]
+ lines[-1] = lines[-1][0...last_column]
+ lines[0] = lines[0][first_column..-1]
+ lines.join
+ else
+ nil
+ end
+ end
+ end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..f8cdf3c0c1
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,17 @@
+#!/bin/sh
+
+PWD=
+case "$0" in
+*/*) srcdir=`dirname $0`;;
+*) srcdir="";;
+esac
+
+symlink='--install --symlink'
+case " $* " in
+ *" -i "*|*" --install "*)
+ # reset to copy missing standard auxiliary files, instead of symlinks
+ symlink=
+ ;;
+esac
+
+exec ${AUTORECONF:-autoreconf} ${symlink} "$@" ${srcdir:+"$srcdir"}
diff --git a/basictest/runner.rb b/basictest/runner.rb
index 0330b6d506..0f398e7acc 100755
--- a/basictest/runner.rb
+++ b/basictest/runner.rb
@@ -17,8 +17,8 @@ $stderr.reopen($stdout)
error = ''
srcdir = File.expand_path('..', File.dirname(__FILE__))
-if opt = ENV["RUBYOPT"]
- ENV["RUBYOPT"] = opt + " -W1"
+if env = ENV["RUBYOPT"]
+ ENV["RUBYOPT"] = env + " -W1"
end
`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
if line =~ /^end of test/
diff --git a/basictest/test.rb b/basictest/test.rb
index 8472a0d14a..95875b52a6 100755
--- a/basictest/test.rb
+++ b/basictest/test.rb
@@ -35,7 +35,7 @@ class Progress
# dircolors-like style
colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
begin
- File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+ File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
colors[n] ||= c
end
rescue
@@ -984,13 +984,6 @@ test_ok($z == 0)
test_check "iterator"
-test_ok(!iterator?)
-
-def ttt
- test_ok(iterator?)
-end
-ttt{}
-
# yield at top level
test_ok(!defined?(yield))
@@ -1432,9 +1425,6 @@ marity_test(:test_ok)
marity_test(:marity_test)
marity_test(:p)
-lambda(&method(:test_ok)).call(true)
-lambda(&block_get{|a,n| test_ok(a,n)}).call(true, 2)
-
class ITER_TEST1
def a
block_given?
@@ -1739,7 +1729,7 @@ a = nil
test_ok(defined?(a))
test_ok(a == nil)
-# multiple asignment
+# multiple assignment
a, b = 1, 2
test_ok(a == 1 && b == 2)
@@ -1970,6 +1960,8 @@ test_ok(p1.call == 5)
test_ok(i7 == nil)
end
+# WASI doesn't support spawning a new process for now.
+unless /wasi/ =~ RUBY_PLATFORM
test_check "system"
test_ok(`echo foobar` == "foobar\n")
test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
@@ -2020,6 +2012,7 @@ test_ok(done)
File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+end # not /wasi/ =~ RUBY_PLATFORM
test_check "const"
TEST1 = 1
@@ -2147,7 +2140,7 @@ $_ = foobar
test_ok($_ == foobar)
class Gods
- @@rule = "Uranus" # private to Gods
+ @@rule = "Uranus"
def ruler0
@@rule
end
@@ -2170,7 +2163,7 @@ module Olympians
end
class Titans < Gods
- @@rule = "Cronus" # do not affect @@rule in Gods
+ @@rule = "Cronus" # modifies @@rule in Gods
include Olympians
def ruler4
@@rule
@@ -2185,7 +2178,14 @@ test_ok(Titans.ruler2 == "Cronus")
atlas = Titans.new
test_ok(atlas.ruler0 == "Cronus")
test_ok(atlas.ruler3 == "Zeus")
-test_ok(atlas.ruler4 == "Cronus")
+begin
+ atlas.ruler4
+rescue RuntimeError => e
+ test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+ test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
test_check "trace"
$x = 1234
@@ -2242,11 +2242,11 @@ test_check "alias"
class Alias0
def foo; "foo" end
end
-class Alias1<Alias0
+class Alias1 < Alias0
alias bar foo
def foo; "foo+" + super end
end
-class Alias2<Alias1
+class Alias2 < Alias1
alias baz foo
undef foo
end
@@ -2258,7 +2258,7 @@ test_ok(x.baz == "foo+foo")
# test_check for cache
test_ok(x.baz == "foo+foo")
-class Alias3<Alias2
+class Alias3 < Alias2
def foo
defined? super
end
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..e11381cad9
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,74 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+Usage: benchmark-driver [options] RUBY|YAML...
+ -r, --runner TYPE Specify runner type: ips, time, memory, once, block (default: ips)
+ -o, --output TYPE Specify output type: compare, simple, markdown, record, all (default: compare)
+ -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+ --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+ --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage
+ --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best)
+ --alternate Alternate executables instead of running the same executable in a row with --repeat-count
+ --bundler Install and use gems specified in Gemfile
+ --filter REGEXP Filter out benchmarks with given regexp
+ --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3)
+ --timeout SECONDS Timeout ruby command execution with timeout(1)
+ -v, --verbose Verbose mode. Multiple -v options increase visilibity (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/bm_app_answer.rb b/benchmark/app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/bm_app_answer.rb
+++ b/benchmark/app_answer.rb
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..16296af12b
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+# https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+ def initialize(x, y, z)
+ @x = x
+ @y = y
+ @z = z
+ end
+
+ attr_accessor :x, :y, :z
+
+ def vadd(b)
+ Vec.new(@x + b.x, @y + b.y, @z + b.z)
+ end
+
+ def vsub(b)
+ Vec.new(@x - b.x, @y - b.y, @z - b.z)
+ end
+
+ def vcross(b)
+ Vec.new(@y * b.z - @z * b.y,
+ @z * b.x - @x * b.z,
+ @x * b.y - @y * b.x)
+ end
+
+ def vdot(b)
+ @x * b.x + @y * b.y + @z * b.z
+ end
+
+ def vlength
+ Math.sqrt(@x * @x + @y * @y + @z * @z)
+ end
+
+ def vnormalize
+ len = vlength
+ v = Vec.new(@x, @y, @z)
+ if len > 1.0e-17 then
+ v.x = v.x / len
+ v.y = v.y / len
+ v.z = v.z / len
+ end
+ v
+ end
+end
+
+
+class Sphere
+ def initialize(center, radius)
+ @center = center
+ @radius = radius
+ end
+
+ attr_reader :center, :radius
+
+ def intersect(ray, isect)
+ rs = ray.org.vsub(@center)
+ b = rs.vdot(ray.dir)
+ c = rs.vdot(rs) - (@radius * @radius)
+ d = b * b - c
+ if d > 0.0 then
+ t = - b - Math.sqrt(d)
+
+ if t > 0.0 and t < isect.t then
+ isect.t = t
+ isect.hit = true
+ isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+ ray.org.y + ray.dir.y * t,
+ ray.org.z + ray.dir.z * t)
+ n = isect.pl.vsub(@center)
+ isect.n = n.vnormalize
+ else
+ 0.0
+ end
+ end
+ nil
+ end
+end
+
+class Plane
+ def initialize(p, n)
+ @p = p
+ @n = n
+ end
+
+ def intersect(ray, isect)
+ d = -@p.vdot(@n)
+ v = ray.dir.vdot(@n)
+ v0 = v
+ if v < 0.0 then
+ v0 = -v
+ end
+ if v0 < 1.0e-17 then
+ return
+ end
+
+ t = -(ray.org.vdot(@n) + d) / v
+
+ if t > 0.0 and t < isect.t then
+ isect.hit = true
+ isect.t = t
+ isect.n = @n
+ isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+ ray.org.y + t * ray.dir.y,
+ ray.org.z + t * ray.dir.z)
+ end
+ nil
+ end
+end
+
+class Ray
+ def initialize(org, dir)
+ @org = org
+ @dir = dir
+ end
+
+ attr_accessor :org, :dir
+end
+
+class Isect
+ def initialize
+ @t = 10000000.0
+ @hit = false
+ @pl = Vec.new(0.0, 0.0, 0.0)
+ @n = Vec.new(0.0, 0.0, 0.0)
+ end
+
+ attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+ i = f * 255.5
+ if i > 255.0 then
+ i = 255.0
+ end
+ if i < 0.0 then
+ i = 0.0
+ end
+ i.to_i
+end
+
+def otherBasis(basis, n)
+ basis[2] = Vec.new(n.x, n.y, n.z)
+ basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+ if n.x < 0.6 and n.x > -0.6 then
+ basis[1].x = 1.0
+ elsif n.y < 0.6 and n.y > -0.6 then
+ basis[1].y = 1.0
+ elsif n.z < 0.6 and n.z > -0.6 then
+ basis[1].z = 1.0
+ else
+ basis[1].x = 1.0
+ end
+
+ basis[0] = basis[1].vcross(basis[2])
+ basis[0] = basis[0].vnormalize
+
+ basis[1] = basis[2].vcross(basis[0])
+ basis[1] = basis[1].vnormalize
+end
+
+class Scene
+ def initialize
+ @spheres = Array.new
+ @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+ @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+ @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+ @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+ end
+
+ def ambient_occlusion(isect)
+ basis = Array.new
+ otherBasis(basis, isect.n)
+
+ ntheta = NAO_SAMPLES
+ nphi = NAO_SAMPLES
+ eps = 0.0001
+ occlusion = 0.0
+
+ p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+ isect.pl.y + eps * isect.n.y,
+ isect.pl.z + eps * isect.n.z)
+ nphi.times do |j|
+ ntheta.times do |i|
+ r = rand
+ phi = 2.0 * 3.14159265 * rand
+ x = Math.cos(phi) * Math.sqrt(1.0 - r)
+ y = Math.sin(phi) * Math.sqrt(1.0 - r)
+ z = Math.sqrt(r)
+
+ rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+ ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+ rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+ raydir = Vec.new(rx, ry, rz)
+ ray = Ray.new(p0, raydir)
+
+ occisect = Isect.new
+ @spheres[0].intersect(ray, occisect)
+ @spheres[1].intersect(ray, occisect)
+ @spheres[2].intersect(ray, occisect)
+ @plane.intersect(ray, occisect)
+ if occisect.hit then
+ occlusion = occlusion + 1.0
+ else
+ 0.0
+ end
+ end
+ end
+
+ occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+ Vec.new(occlusion, occlusion, occlusion)
+ end
+
+ def render(w, h, nsubsamples)
+ cnt = 0
+ nsf = nsubsamples.to_f
+ h.times do |y|
+ w.times do |x|
+ rad = Vec.new(0.0, 0.0, 0.0)
+
+ # Subsampling
+ nsubsamples.times do |v|
+ nsubsamples.times do |u|
+
+ cnt = cnt + 1
+ wf = w.to_f
+ hf = h.to_f
+ xf = x.to_f
+ yf = y.to_f
+ uf = u.to_f
+ vf = v.to_f
+
+ px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+ py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+ eye = Vec.new(px, py, -1.0).vnormalize
+
+ ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+ isect = Isect.new
+ @spheres[0].intersect(ray, isect)
+ @spheres[1].intersect(ray, isect)
+ @spheres[2].intersect(ray, isect)
+ @plane.intersect(ray, isect)
+ if isect.hit then
+ col = ambient_occlusion(isect)
+ rad.x = rad.x + col.x
+ rad.y = rad.y + col.y
+ rad.z = rad.z + col.z
+ end
+ end
+ end
+
+ r = rad.x / (nsf * nsf)
+ g = rad.y / (nsf * nsf)
+ b = rad.z / (nsf * nsf)
+ printf("%c", clamp(r))
+ printf("%c", clamp(g))
+ printf("%c", clamp(b))
+ end
+ nil
+ end
+
+ nil
+ end
+end
+
+alias printf_orig printf
+def printf *args
+ # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+ # $fp = fp
+ printf("P6\n")
+ printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n")
+ Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+benchmark:
+ app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/bm_app_factorial.rb
+++ b/benchmark/app_factorial.rb
diff --git a/benchmark/bm_app_fib.rb b/benchmark/app_fib.rb
index 34a7b2e725..34a7b2e725 100644
--- a/benchmark/bm_app_fib.rb
+++ b/benchmark/app_fib.rb
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ b/benchmark/app_lc_fizzbuzz.rb
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/bm_app_mandelbrot.rb
+++ b/benchmark/app_mandelbrot.rb
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/bm_app_raise.rb
+++ b/benchmark/app_raise.rb
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/bm_app_strconcat.rb
+++ b/benchmark/app_strconcat.rb
diff --git a/benchmark/bm_app_tak.rb b/benchmark/app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/bm_app_tak.rb
+++ b/benchmark/app_tak.rb
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/bm_app_tarai.rb
+++ b/benchmark/app_tarai.rb
diff --git a/benchmark/bm_app_uri.rb b/benchmark/app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/bm_app_uri.rb
+++ b/benchmark/app_uri.rb
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+ small_flat_ary = 5.times.to_a
+ large_flat_ary = 100.times.to_a
+ small_pairs_ary = [[1, 2]] * 5
+ large_pairs_ary = [[1, 2]] * 100
+ mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+ small_flat_ary.flatten: small_flat_ary.flatten
+ small_flat_ary.flatten!: small_flat_ary.flatten!
+ large_flat_ary.flatten: large_flat_ary.flatten
+ large_flat_ary.flatten!: large_flat_ary.flatten!
+ small_pairs_ary.flatten: small_pairs_ary.flatten
+ small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+ large_pairs_ary.flatten: large_pairs_ary.flatten
+ large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+ mostly_flat_ary.flatten: mostly_flat_ary.flatten
+ mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+ small1 = [1, 2, 3]
+ small2 = [1, 2, 3, 4, 5]
+ small3 = [2, 3, 4, 5]
+ small4 = [2]
+ big1 = [1, 2, 3, 4] * 64
+ big2 = [1, 2, 3] * 64
+ big3 = [1, 2] * 64
+
+benchmark:
+ small-&: small1 & small2 & small3 & small4
+ small-intersection: small1.intersection(small2, small3, small4)
+ big-&: big1 & big2 & big3
+ big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_f).shuffle
+ ary10 = 10.times.map(&:to_f).shuffle
+ ary100 = 100.times.map(&:to_f).shuffle
+ ary500 = 500.times.map(&:to_f).shuffle
+ ary1000 = 1000.times.map(&:to_f).shuffle
+ ary2000 = 2500.times.map(&:to_f).shuffle
+ ary3000 = 2500.times.map(&:to_f).shuffle
+ ary5000 = 5000.times.map(&:to_f).shuffle
+ ary10000 = 10000.times.map(&:to_f).shuffle
+ ary20000 = 20000.times.map(&:to_f).shuffle
+ ary50000 = 50000.times.map(&:to_f).shuffle
+ ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+ ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+ ary2 = 2.times.map(&:to_s).shuffle
+ ary10 = 10.times.map(&:to_s).shuffle
+ ary100 = 100.times.map(&:to_s).shuffle
+ ary500 = 500.times.map(&:to_s).shuffle
+ ary1000 = 1000.times.map(&:to_s).shuffle
+ ary2000 = 2500.times.map(&:to_s).shuffle
+ ary3000 = 2500.times.map(&:to_s).shuffle
+ ary5000 = 5000.times.map(&:to_s).shuffle
+ ary10000 = 10000.times.map(&:to_s).shuffle
+ ary20000 = 20000.times.map(&:to_s).shuffle
+ ary50000 = 50000.times.map(&:to_s).shuffle
+ ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+ ary2.max: ary2.max
+ ary10.max: ary10.max
+ ary100.max: ary100.max
+ ary500.max: ary500.max
+ ary1000.max: ary1000.max
+ ary2000.max: ary2000.max
+ ary3000.max: ary3000.max
+ ary5000.max: ary5000.max
+ ary10000.max: ary10000.max
+ ary20000.max: ary20000.max
+ ary50000.max: ary50000.max
+ ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary500 = 500.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary2000 = 2500.times.to_a.shuffle
+ ary3000 = 2500.times.to_a.shuffle
+ ary5000 = 5000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+ ary20000 = 20000.times.to_a.shuffle
+ ary50000 = 50000.times.to_a.shuffle
+ ary100000 = 100000.times.to_a.shuffle
+ ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+ ary2.min: ary2.min
+ ary10.min: ary10.min
+ ary100.min: ary100.min
+ ary500.min: ary500.min
+ ary1000.min: ary1000.min
+ ary2000.min: ary2000.min
+ ary3000.min: ary3000.min
+ ary5000.min: ary5000.min
+ ary10000.min: ary10000.min
+ ary20000.min: ary20000.min
+ ary50000.min: ary50000.min
+ ary100000.min: ary100000.min
+ ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+ - ary.sample
+ - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/array_shift.rb
index 798bb9e3f4..798bb9e3f4 100644
--- a/benchmark/bm_array_shift.rb
+++ b/benchmark/array_shift.rb
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 & arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 - arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 | arr2
+ end
+ end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+ ary2 = 2.times.to_a.shuffle
+ ary10 = 10.times.to_a.shuffle
+ ary100 = 100.times.to_a.shuffle
+ ary1000 = 1000.times.to_a.shuffle
+ ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+ ary2.sort: ary2.sort
+ ary10.sort: ary10.sort
+ ary100.sort: ary100.sort
+ ary1000.sort: ary1000.sort
+ ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+ class C
+ attr_accessor :x
+ def initialize
+ @x = nil
+ end
+ class_eval <<-END
+ def ar
+ #{'x;'*256}
+ end
+ def aw
+ #{'self.x = nil;'*256}
+ end
+ def arm
+ m = method(:x)
+ #{'m.call;'*256}
+ end
+ def awm
+ m = method(:x=)
+ #{'m.call(nil);'*256}
+ end
+ END
+ end
+ obj = C.new
+benchmark:
+ attr_reader: "obj.ar"
+ attr_writer: "obj.aw"
+ attr_reader_method: "obj.arm"
+ attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index 2bd6acfaf8..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-# https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
- def initialize(x, y, z)
- @x = x
- @y = y
- @z = z
- end
-
- attr_accessor :x, :y, :z
-
- def vadd(b)
- Vec.new(@x + b.x, @y + b.y, @z + b.z)
- end
-
- def vsub(b)
- Vec.new(@x - b.x, @y - b.y, @z - b.z)
- end
-
- def vcross(b)
- Vec.new(@y * b.z - @z * b.y,
- @z * b.x - @x * b.z,
- @x * b.y - @y * b.x)
- end
-
- def vdot(b)
- @x * b.x + @y * b.y + @z * b.z
- end
-
- def vlength
- Math.sqrt(@x * @x + @y * @y + @z * @z)
- end
-
- def vnormalize
- len = vlength
- v = Vec.new(@x, @y, @z)
- if len > 1.0e-17 then
- v.x = v.x / len
- v.y = v.y / len
- v.z = v.z / len
- end
- v
- end
-end
-
-
-class Sphere
- def initialize(center, radius)
- @center = center
- @radius = radius
- end
-
- attr_reader :center, :radius
-
- def intersect(ray, isect)
- rs = ray.org.vsub(@center)
- b = rs.vdot(ray.dir)
- c = rs.vdot(rs) - (@radius * @radius)
- d = b * b - c
- if d > 0.0 then
- t = - b - Math.sqrt(d)
-
- if t > 0.0 and t < isect.t then
- isect.t = t
- isect.hit = true
- isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
- ray.org.y + ray.dir.y * t,
- ray.org.z + ray.dir.z * t)
- n = isect.pl.vsub(@center)
- isect.n = n.vnormalize
- else
- 0.0
- end
- end
- nil
- end
-end
-
-class Plane
- def initialize(p, n)
- @p = p
- @n = n
- end
-
- def intersect(ray, isect)
- d = -@p.vdot(@n)
- v = ray.dir.vdot(@n)
- v0 = v
- if v < 0.0 then
- v0 = -v
- end
- if v0 < 1.0e-17 then
- return
- end
-
- t = -(ray.org.vdot(@n) + d) / v
-
- if t > 0.0 and t < isect.t then
- isect.hit = true
- isect.t = t
- isect.n = @n
- isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
- ray.org.y + t * ray.dir.y,
- ray.org.z + t * ray.dir.z)
- end
- nil
- end
-end
-
-class Ray
- def initialize(org, dir)
- @org = org
- @dir = dir
- end
-
- attr_accessor :org, :dir
-end
-
-class Isect
- def initialize
- @t = 10000000.0
- @hit = false
- @pl = Vec.new(0.0, 0.0, 0.0)
- @n = Vec.new(0.0, 0.0, 0.0)
- end
-
- attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
- i = f * 255.5
- if i > 255.0 then
- i = 255.0
- end
- if i < 0.0 then
- i = 0.0
- end
- i.to_i
-end
-
-def otherBasis(basis, n)
- basis[2] = Vec.new(n.x, n.y, n.z)
- basis[1] = Vec.new(0.0, 0.0, 0.0)
-
- if n.x < 0.6 and n.x > -0.6 then
- basis[1].x = 1.0
- elsif n.y < 0.6 and n.y > -0.6 then
- basis[1].y = 1.0
- elsif n.z < 0.6 and n.z > -0.6 then
- basis[1].z = 1.0
- else
- basis[1].x = 1.0
- end
-
- basis[0] = basis[1].vcross(basis[2])
- basis[0] = basis[0].vnormalize
-
- basis[1] = basis[2].vcross(basis[0])
- basis[1] = basis[1].vnormalize
-end
-
-class Scene
- def initialize
- @spheres = Array.new
- @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
- @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
- @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
- @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
- end
-
- def ambient_occlusion(isect)
- basis = Array.new
- otherBasis(basis, isect.n)
-
- ntheta = NAO_SAMPLES
- nphi = NAO_SAMPLES
- eps = 0.0001
- occlusion = 0.0
-
- p0 = Vec.new(isect.pl.x + eps * isect.n.x,
- isect.pl.y + eps * isect.n.y,
- isect.pl.z + eps * isect.n.z)
- nphi.times do |j|
- ntheta.times do |i|
- r = rand
- phi = 2.0 * 3.14159265 * rand
- x = Math.cos(phi) * Math.sqrt(1.0 - r)
- y = Math.sin(phi) * Math.sqrt(1.0 - r)
- z = Math.sqrt(r)
-
- rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
- ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
- rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
- raydir = Vec.new(rx, ry, rz)
- ray = Ray.new(p0, raydir)
-
- occisect = Isect.new
- @spheres[0].intersect(ray, occisect)
- @spheres[1].intersect(ray, occisect)
- @spheres[2].intersect(ray, occisect)
- @plane.intersect(ray, occisect)
- if occisect.hit then
- occlusion = occlusion + 1.0
- else
- 0.0
- end
- end
- end
-
- occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
- Vec.new(occlusion, occlusion, occlusion)
- end
-
- def render(w, h, nsubsamples)
- cnt = 0
- nsf = nsubsamples.to_f
- h.times do |y|
- w.times do |x|
- rad = Vec.new(0.0, 0.0, 0.0)
-
- # Subsampling
- nsubsamples.times do |v|
- nsubsamples.times do |u|
-
- cnt = cnt + 1
- wf = w.to_f
- hf = h.to_f
- xf = x.to_f
- yf = y.to_f
- uf = u.to_f
- vf = v.to_f
-
- px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
- py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
- eye = Vec.new(px, py, -1.0).vnormalize
-
- ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
- isect = Isect.new
- @spheres[0].intersect(ray, isect)
- @spheres[1].intersect(ray, isect)
- @spheres[2].intersect(ray, isect)
- @plane.intersect(ray, isect)
- if isect.hit then
- col = ambient_occlusion(isect)
- rad.x = rad.x + col.x
- rad.y = rad.y + col.y
- rad.z = rad.z + col.z
- end
- end
- end
-
- r = rad.x / (nsf * nsf)
- g = rad.y / (nsf * nsf)
- b = rad.z / (nsf * nsf)
- printf("%c", clamp(r))
- printf("%c", clamp(g))
- printf("%c", clamp(b))
- end
- nil
- end
-
- nil
- end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
- printf("P6\n")
- printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
- ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
-</html>
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
- nb.each{|x|
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- [-ROW, -1, 1, ROW].each{|d|
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- }
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- }
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- (0...ROW*COL).each{|i|
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- }
-end
-
-def pboard
- return # skip print
- print "No. #$no\n"
- (0...COL).each{|i|
- print "|"
- (0...ROW-NP).each{|j|
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- }
- print "\n"
- }
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- x.each{|s|
- if $b[pos+s] != -1
- f=1
- break
- end
- }
- if f == 0 then
- x.each{|s|
- $b[pos+s] = i
- }
- a << i
- setpiece(a.dup, pos)
- a.pop
- x.each{|s|
- $b[pos+s] = -1
- }
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
- for x in nb
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- for d in [-ROW, -1, 1, ROW]
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- end
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- end
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- for i in 0...ROW*COL
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- end
-end
-
-def pboard
- print "No. #$no\n"
- for i in 0...COL
- print "|"
- for j in 0...ROW-NP
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- end
- print "\n"
- end
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- for s in x do
- if $b[pos+s] != -1
- f=1
- break
- end
- end
- if f == 0 then
- for s in x do
- $b[pos+s] = i
- end
- a << i
- setpiece(a.dup, pos)
- a.pop
- for s in x do
- $b[pos+s] = -1
- end
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
deleted file mode 100644
index b8abc88f41..0000000000
--- a/benchmark/bm_require.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-1.upto(10000) do |i|
- require "c#{i}"
-end
-
-$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
deleted file mode 100644
index e54db6c6e5..0000000000
--- a/benchmark/bm_require_thread.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-i=0
-t = Thread.new do
- while true
- i = i+1 # dummy loop
- end
-end
-
-1.upto(100) do |i|
- require "c#{i}"
-end
-
-$:.pop
-t.kill
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
- x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
- (n-1).step(0,-1) do |bi|
- y[bi] += x.at(bi)
- end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
- i += 1
- hello = ''
- 4_000_000.times do |e|
- hello << STUFF
- end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-class Hi_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-def some_function(num)
- begin
- hi_function(num)
- rescue
- print "We shouldn't get here, exception is: #{$!.type}\n"
- end
-end
-
-def hi_function(num)
- begin
- lo_function(num)
- rescue Hi_Exception
- $HI = $HI + 1
- end
-end
-
-def lo_function(num)
- begin
- blowup(num)
- rescue Lo_Exception
- $LO = $LO + 1
- end
-end
-
-def blowup(num)
- if num % 2 == 0
- raise Lo_Exception.new(num)
- else
- raise Hi_Exception.new(num)
- end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
- i += 1
- some_function(i+1)
-end
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
-]
-homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
- count = 1
- mx = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- row[j] = count
- count += 1
- end
- mx[bi] = row
- end
- mx
-end
-
-def mmult(rows, cols, m1, m2)
- m3 = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- val = 0
- (0 .. (cols - 1)).each do |k|
- val += m1.at(bi).at(k) * m2.at(k).at(j)
- end
- row[j] = val
- end
- m3[bi] = row
- end
- m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
- mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index 64a7d46afe..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,563 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-# contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM: the main body is at the bottom.
-# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# 2) see how I represent a board as a bitmask by reading the blank_board comments
-# 3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
- # an array (by location) containing a bit mask for how the piece maps at the given location.
- # if the rotation is invalid at that location the mask will contain false
- attr_reader :start_masks
-
- # maps a direction to a relative location. these differ depending on whether it is an even or
- # odd row being mapped from
- @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
- @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
- def initialize( directions )
- @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
- @even_mask = mask_for_offsets( @even_offsets)
- @odd_mask = mask_for_offsets( @odd_offsets)
-
- @start_masks = Array.new(60)
-
- # create the rotational masks by placing the base mask at the location and seeing if
- # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
- # is true the piece cannot be placed
- 0.upto(59) do | offset |
- mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
- if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
- imask = compute_required( mask, offset)
- @start_masks[offset] = [ mask, imask, imask | mask ]
- else
- @start_masks[offset] = false
- end
- end
- end
-
- def compute_required( mask, offset )
- board = blank_board
- 0.upto(offset) { | i | board |= 1 << i }
- board |= mask
- return 0 if (!prunable(board | mask, offset))
- board = flood_fill(board,58)
- count = 0
- imask = 0
- 0.upto(59) do | i |
- if (board[i] == 0) then
- imask |= (1 << i)
- count += 1
- end
- end
- (count > 0 && count < 5) ? imask : 0
- end
-
- def flood_fill( board, location)
- return board if (board[location] == 1)
- board |= 1 << location
- row, col = location.divmod(6)
- board = flood_fill( board, location - 1) if (col > 0)
- board = flood_fill( board, location + 1) if (col < 4)
- if (row % 2 == 0) then
- board = flood_fill( board, location - 7) if (col > 0 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 5) if (col > 0 && row < 9)
- else
- board = flood_fill( board, location - 5) if (col < 4 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 7) if (col < 4 && row < 9)
- end
- board
- end
-
- # given a location, produces a list of relative locations covered by the piece at this rotation
- def offsets( location)
- if is_even( location) then
- @even_offsets.collect { | value | value + location }
- else
- @odd_offsets.collect { | value | value + location }
- end
- end
-
- # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
- # this is hard to explain. imagine we have this partial board:
- # 0 0 0 0 0 x [positions 0-5]
- # 0 0 1 1 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 1 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # The top-left of the piece is at position 8, the
- # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
- # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
- # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
- # 0 0 0 1 1 x [positions 0-5]
- # 0 0 1 0 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 0 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
- # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
- # this function would return
- def normalize_offsets( values)
- min = values.min
- even_min = is_even(min)
- other_min = even_min ? min + 6 : min + 7
- other_values = values.collect do | value |
- if is_even(value) then
- value + 6 - other_min
- else
- value + 7 - other_min
- end
- end
- values.collect! { | value | value - min }
-
- if even_min then
- [values, other_values]
- else
- [other_values, values]
- end
- end
-
- # produce a bitmask representation of an array of offset locations
- def mask_for_offsets( offsets )
- mask = 0
- offsets.each { | value | mask = mask + ( 1 << value ) }
- mask
- end
-
- # finds a "safe" position that a position as described by a list of directions can be placed
- # without falling off any edge of the board. the values returned a location to place the first piece
- # at so it will fit after making the described moves
- def start_adjust( directions )
- south = east = 0;
- directions.each do | direction |
- east += 1 if ( direction == :sw || direction == :nw || direction == :west )
- south += 1 if ( direction == :nw || direction == :ne )
- end
- south * 6 + east
- end
-
- # given a set of directions places the piece (as defined by a set of directions) on the board at
- # a location that will not take it off the edge
- def get_values ( directions )
- start = start_adjust(directions)
- values = [ start ]
- directions.each do | direction |
- if (start % 12 >= 6) then
- start += @@rotation_odd_adder[direction]
- else
- start += @@rotation_even_adder[direction]
- end
- values += [ start ]
- end
-
- # some moves take you back to an existing location, we'll strip duplicates
- values.uniq
- end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-# rotations -- all the rotations of the piece
-# type -- a numeic "name" of the piece
-# masks -- an array by location of all legal rotational masks (a n inner array) for that location
-# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
- attr_reader :rotations, :type, :masks
- attr_accessor :placed
-
- # transform hashes that change one direction into another when you either flip or rotate a set of directions
- @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
- @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
- def initialize( directions, type )
- @type = type
- @rotations = Array.new();
- @map = {}
-
- generate_rotations( directions )
- directions.collect! { | value | @@flip_converter[value] }
- generate_rotations( directions )
-
- # creates the masks AND a map that returns [location, rotation] for any given mask
- # this is used when a board is found and we want to draw it, otherwise the map is unused
- @masks = Array.new();
- 0.upto(59) do | i |
- even = true
- @masks[i] = @rotations.collect do | rotation |
- mask = rotation.start_masks[i]
- @map[mask[0]] = [ i, rotation ] if (mask)
- mask || nil
- end
- @masks[i].compact!
- end
- end
-
- # rotates a set of directions through all six angles and adds a Rotation to the list for each one
- def generate_rotations( directions )
- 6.times do
- rotations.push( Rotation.new(directions))
- directions.collect! { | value | @@rotate_converter[value] }
- end
- end
-
- # given a board string, adds this piece to the board at whatever location/rotation
- # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
- def fill_string( board_string)
- location, rotation = @map[@placed]
- rotation.offsets(location).each do | offset |
- row, col = offset.divmod(6)
- board_string[ row*5 + col, 1 ] = @type.to_s
- end
- end
-end
-
-# a blank bit board having this form:
-#
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
- 0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
- 0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
- (location % 12) < 6
-end
-
-# support function that create three utility maps:
-# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a five bit representation of the bits below it
-# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-# a region array has three values the first is a mask of bits in the region,
-# the second is the count of those bits and the third is identical to the first
-# examples:
-# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-# 0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
- odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
- even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
- all_odds = Array.new(0b100000)
- all_evens = Array.new(0b100000)
- bit_counts = Array.new(0b100000)
- new_regions = Array.new(0b100000)
- 0.upto(0b11111) do | i |
- bit_count = odd = even = 0
- 0.upto(4) do | bit |
- if (i[bit] == 1) then
- bit_count += 1
- odd |= odd_map[bit]
- even |= even_map[bit]
- end
- end
- all_odds[i] = odd
- all_evens[i] = even
- bit_counts[i] = bit_count
- new_regions[i] = create_regions( i)
- end
-
- $converter = []
- 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
- $bit_counts = bit_counts
- $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five. The following board is an example of a prunable board:
-# 0 0 1 0 0
-# 0 1 0 0 0
-# 1 1 0 0 0
-# 0 1 0 0 0
-# 0 0 0 0 0
-# ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-# board -- an initial bit board (6 bit padded rows, see blank_board for format)
-# location -- starting location, everything above and to the left is already full
-# slotting -- set to true only when testing initial pieces, when filling normally
-# additional assumptions are possible
-#
-# Algorithm:
-# The algorithm starts at the top row (as determined by location) and iterates a row at a time
-# maintainng counts of active open areas (kept in the collector array) each collector contains
-# three values at the start of an iteration:
-# 0: mask of bits that would be adjacent to the collector in this row
-# 1: the number of bits collected so far
-# 2: a scratch space starting as zero, but used during the computation to represent
-# the empty bits in the new row that are adjacent (position 0)
-# The exact procedure is described in-code
-def prunable( board, location, slotting = false)
- collectors = []
- # loop across the rows
- (location / 6).to_i.upto(9) do | row_on |
- # obtain a set of regions representing the bits of the current row.
- regions = $regions[(board >> (row_on * 6)) & 0b11111]
- converter = $converter[row_on]
-
- # track the number of collectors at the start of the cycle so that
- # we don't compute against newly created collectors, only existing collectors
- initial_collector_count = collectors.length
-
- # loop against the regions. For each region of the row
- # we will see if it connects to one or more existing collectors.
- # if it connects to 1 collector, the bits from the region are added to the
- # bits of the collector and the mask is placed in collector[2]
- # If the region overlaps more than one collector then all the collectors
- # it overlaps with are merged into the first one (the others are set to nil in the array)
- # if NO collectors are found then the region is copied as a new collector
- regions.each do | region |
- collector_found = nil
- region_mask = region[2]
- initial_collector_count.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- collector_mask = collector[0]
- if (collector_mask & region_mask != 0) then
- if (collector_found) then
- collector_found[0] |= collector_mask
- collector_found[1] += collector[1]
- collector_found[2] |= collector[2]
- collectors[collector_num] = nil
- else
- collector_found = collector
- collector[1] += region[1]
- collector[2] |= region_mask
- end
- end
- end
- end
- if (collector_found == nil) then
- collectors.push(Array.new(region))
- end
- end
-
- # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
- # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
- # the board is prunable. if it is a multiple of five it is removed.
- # Collector that are still active have a new adjacent value [0] set based n the matched bits
- # and have [2] cleared out for the next cycle.
- collectors.length.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- if (collector[2] == 0) then
- return true if (collector[1] % 5 != 0)
- collectors[collector_num] = nil
- else
- # if a collector matches all bits in the row then we can return unprunable early for the
- # following reasons:
- # 1) there can be no more unavailable bits bince we fill from the top left downward
- # 2) all previous regions have been closed or joined so only this region can fail
- # 3) this region must be good since there can never be only 1 region that is nuot
- # a multiple of five
- # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
- # in pieces to see what configurations work for them (the only other time this algorithm is used).
- return false if (collector[2] == 0b11111 && !slotting)
- collector[0] = converter[collector[2]]
- collector[2] = 0
- end
- end
- end
-
- # get rid of all the empty converters for the next round
- collectors.compact!
- end
- return false if (collectors.length <= 1) # 1 collector or less and the region is fine
- collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask. see prunable for what a "region" is
-def create_regions( value )
- regions = []
- cur_region = 0
- 5.times do | bit |
- if (value[bit] == 0) then
- cur_region |= 1 << bit
- else
- if (cur_region != 0 ) then
- regions.push( cur_region)
- cur_region = 0;
- end
- end
- end
- regions.push(cur_region) if (cur_region != 0)
- regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
- find_top( 1)
- find_top( 0)
- print_results
-end
-
-# show the board
-def print_results
- print "#{@boards_found} solutions found\n\n"
- print_full_board( @min_board)
- print "\n"
- print_full_board( @max_board)
- print "\n"
-end
-
-# finds solutions. This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece. It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-# Since any found solution has an inverse we want to maximize finding solutions that are not already found
-# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
-# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
-# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-# maximum number
-def find_top( rotation_skip)
- board = blank_board
- (@pieces.length-1).times do
- piece = @pieces.shift
- piece.masks[0].each do | mask, imask, cmask |
- if ((rotation_skip += 1) % 2 == 0) then
- piece.placed = mask
- find( 1, 1, board | mask)
- end
- end
- @pieces.push(piece)
- end
- piece = @pieces.shift
- @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found. depth is achieved via recursion. the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-# start_location -- where to start looking for place for the next piece at
-# placed -- number of pieces placed
-# board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
- # find the next location to place a piece by looking for an empty bit
- while board[start_location] == 1
- start_location += 1
- end
-
- @pieces.length.times do
- piece = @pieces.shift
- piece.masks[start_location].each do | mask, imask, cmask |
- if ( board & cmask == imask) then
- piece.placed = mask
- if (placed == 9) then
- add_board
- else
- find( start_location + 1, placed + 1, board | mask)
- end
- end
- end
- @pieces.push(piece)
- end
-end
-
-# print the board
-def print_full_board( board_string)
- 10.times do | row |
- print " " if (row % 2 == 1)
- 5.times do | col |
- print "#{board_string[row*5 + col,1]} "
- end
- print "\n"
- end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
- board_string = "99999999999999999999999999999999999999999999999999"
- @all_pieces.each { | piece | piece.fill_string( board_string ) }
- save( board_string)
- save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
- if (@all_boards[board_string] == nil) then
- @min_board = board_string if (board_string < @min_board)
- @max_board = board_string if (board_string > @max_board)
- @all_boards.store(board_string,true)
- @boards_found += 1
-
- # the exit motif is a time saver. Ideally the function should return, but those tests
- # take noticeable time (performance).
- if (@boards_found == @stop_count) then
- print_results
- exit(0)
- end
- end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
- Piece.new( [ :nw, :ne, :east, :east ], 2),
- Piece.new( [ :ne, :se, :east, :ne ], 7),
- Piece.new( [ :ne, :east, :ne, :nw ], 1),
- Piece.new( [ :east, :sw, :sw, :se ], 6),
- Piece.new( [ :east, :ne, :se, :ne ], 5),
- Piece.new( [ :east, :east, :east, :se ], 0),
- Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
- Piece.new( [ :se, :se, :se, :west ], 9),
- Piece.new( [ :se, :se, :east, :se ], 8),
- Piece.new( [ :east, :east, :sw, :se ], 3)
- ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
- @x, @y, @z = x, y, z
- @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
- @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
- while i < nbodies
- b2 = bodies[i]
- dx = @x - b2.x
- dy = @y - b2.y
- dz = @z - b2.z
-
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- mag = dt / (distance * distance * distance)
- b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
- @vx -= dx * b2_mass_mag
- @vy -= dy * b2_mass_mag
- @vz -= dz * b2_mass_mag
- b2.vx += dx * b_mass_mag
- b2.vy += dy * b_mass_mag
- b2.vz += dz * b_mass_mag
- i += 1
- end
-
- @x += dt * @vx
- @y += dt * @vy
- @z += dt * @vz
- end
-end
-
-def energy(bodies)
- e = 0.0
- nbodies = bodies.size
-
- for i in 0 ... nbodies
- b = bodies[i]
- e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
- for j in (i + 1) ... nbodies
- b2 = bodies[j]
- dx = b.x - b2.x
- dy = b.y - b2.y
- dz = b.z - b2.z
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- e -= (b.mass * b2.mass) / distance
- end
- end
- e
-end
-
-def offset_momentum(bodies)
- px, py, pz = 0.0, 0.0, 0.0
-
- for b in bodies
- m = b.mass
- px += b.vx * m
- py += b.vy * m
- pz += b.vz * m
- end
-
- b = bodies[0]
- b.vx = - px / SOLAR_MASS
- b.vy = - py / SOLAR_MASS
- b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
- # sun
- Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
- # jupiter
- Planet.new(
- 4.84143144246472090e+00,
- -1.16032004402742839e+00,
- -1.03622044471123109e-01,
- 1.66007664274403694e-03,
- 7.69901118419740425e-03,
- -6.90460016972063023e-05,
- 9.54791938424326609e-04),
-
- # saturn
- Planet.new(
- 8.34336671824457987e+00,
- 4.12479856412430479e+00,
- -4.03523417114321381e-01,
- -2.76742510726862411e-03,
- 4.99852801234917238e-03,
- 2.30417297573763929e-05,
- 2.85885980666130812e-04),
-
- # uranus
- Planet.new(
- 1.28943695621391310e+01,
- -1.51111514016986312e+01,
- -2.23307578892655734e-01,
- 2.96460137564761618e-03,
- 2.37847173959480950e-03,
- -2.96589568540237556e-05,
- 4.36624404335156298e-05),
-
- # neptune
- Planet.new(
- 1.53796971148509165e+01,
- -2.59193146099879641e+01,
- 1.79258772950371181e-01,
- 2.68067772490389322e-03,
- 1.62824170038242295e-03,
- -9.51592254519715870e-05,
- 5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
- i = 0
- while i < nbodies
- b = BODIES[i]
- b.move_from_i(BODIES, nbodies, dt, i + 1)
- i += 1
- end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- x += 1
- end
- end
- end
- end
- end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
- def initialize(start_state)
- @bool = start_state
- end
-
- def value
- @bool
- end
-
- def activate
- @bool = !@bool
- self
- end
-end
-
-class NthToggle < Toggle
- def initialize(start_state, max_counter)
- super start_state
- @count_max = max_counter
- @counter = 0
- end
-
- def activate
- @counter += 1
- if @counter >= @count_max
- @bool = !@bool
- @counter = 0
- end
- self
- end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
- toggle.activate.value ? 'true' : 'false'
-end
-n.times do
- toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
- ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
- ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
- def initialize()
- @z = Transformation.new 1,0,0,1
- @x = Transformation.new 0,0,0,0
- @inverse = Transformation.new 0,0,0,0
- end
-
- def next!
- @y = @z.extract(3)
- if safe? @y
- @z = produce(@y)
- @y
- else
- @z = consume @x.next!()
- next!()
- end
- end
-
- def safe?(digit)
- digit == @z.extract(4)
- end
-
- def produce(i)
- @inverse.qrst(10,-10*i,0,1).compose(@z)
- end
-
- def consume(a)
- @z.compose(a)
- end
-end
-
-
-class Transformation
- attr_reader :q, :r, :s, :t
- def initialize (q, r, s, t)
- @q,@r,@s,@t,@k = q,r,s,t,0
- end
-
- def next!()
- @q = @k = @k + 1
- @r = 4 * @k + 2
- @s = 0
- @t = 2 * @k + 1
- self
- end
-
- def extract(j)
- (@q * j + @r) / (@s * j + @t)
- end
-
- def compose(a)
- self.class.new( @q * a.q,
- @q * a.r + r * a.t,
- @s * a.q + t * a.s,
- @s * a.r + t * a.t
- )
- end
-
- def qrst *args
- initialize *args
- self
- end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
- if n >= WIDTH
- WIDTH.times {print digits.next!}
- j += WIDTH
- else
- n.times {print digits.next!}
- (WIDTH-n).times {print " "}
- j += n
- end
- puts "\t:"+j.to_s
- n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_reader :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = obj.a
- k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
- attr_accessor :a, :b
- def initialize
- @a = nil
- @b = nil
- end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- obj.a = 1
- obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m{
- }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = Const
- k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
- i += 1
- begin
- begin
- ensure
- end
- ensure
- end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
- i += 1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
- if n == 0
- ''
- else
- 10.times{
- h[Object.new] = nested_hash(h, n-1)
- }
- end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 881528845b..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- short_lived_ary[0] = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index 3c8279c956..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
- GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived[0] = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index a4067af36b..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
- attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- short_lived_obj.foo = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index eee07a0248..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
- attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
- GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
- long_lived.foo = short_lived # write barrier
- i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- j = @a
- k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- @a = 1
- @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a.length
- b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
- unless v
- # unreachable code
- v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
- v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
- v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
- v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
- v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
- end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
- i += 1
- m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
- i += 1
- !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- begin
- rescue
- end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
- i += 1
- a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
- i = 0
- while i<30_000_000 # while loop 1
- i += 1
- yield
- end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- a = [
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
- i += 1
- a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
- case :foo
- when :bar
- raise
- when :baz
- raise
- when :boo
- raise
- when :foo
- i += 1
- end
-end
-
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
deleted file mode 100644
index c62b294e0e..0000000000
--- a/benchmark/bm_vm2_case_lit.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-i = 0
-@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
-def foo(i)
- @ret[i % @ret.size]
-end
-
-while i<6_000_000 # while loop 2
- case foo(i)
- when "foo" then :foo
- when true then true
- when false then false
- when :sym then :sym
- when 6 then :fix
- when nil then nil
- when 0.1 then :float
- when 0xffffffffffffffff then :big
- end
- i += 1
-end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
- define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
deleted file mode 100644
index 58c0f7bbc3..0000000000
--- a/benchmark/bm_vm2_dstr.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-x = y = 'z'
-while i<6_000_000 # benchmark loop 2
- i += 1
- str = "foo#{x}bar#{y}baz"
-end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 307cfc28ef..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- eval("1")
-end
-
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index a8ccff7138..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
- def method_missing mid
- end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
- nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 5d16480c6b..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Thread::Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
deleted file mode 100644
index 6422c9b0d0..0000000000
--- a/benchmark/bm_vm2_newlambda.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- lambda {}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
- o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
- def m
- 1
- end
-end
-class C2
- def m
- 2
- end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
-# o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
- b
-end
-
-pr = m{
- a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
- if n > 0
- rec n-1
- else
- raise
- end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
-
- begin
- rec 1
- rescue
- # ignore
- end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
- if n > 0
- rec n-1
- else
- raise
- end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
-
- begin
- rec 10
- rescue
- # ignore
- end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
- /hoge/ =~ str
- i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
- def m
- end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
deleted file mode 100644
index 1d73036849..0000000000
--- a/benchmark/bm_vm2_string_literal.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
deleted file mode 100644
index fff940a80a..0000000000
--- a/benchmark/bm_vm2_struct_big_href_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:z]
-end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
deleted file mode 100644
index 5e4085d59d..0000000000
--- a/benchmark/bm_vm2_struct_big_href_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:k]
-end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
deleted file mode 100644
index 9c0cee4141..0000000000
--- a/benchmark/bm_vm2_struct_big_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:k] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x.a = i
-end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
deleted file mode 100644
index 2c88fee6bf..0000000000
--- a/benchmark/bm_vm2_struct_small_href.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:a]
-end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
deleted file mode 100644
index 33c36d20f1..0000000000
--- a/benchmark/bm_vm2_struct_small_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
- i += 1
- x[:a] = 1
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
- def m
- 1
- end
-end
-
-class CC < C
- def m
- super()
- end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
- obj.m
- i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
- i += 1
- m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
- def m a
- 1
- end
-end
-
-class CC < C
- def m a
- super
- end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
- obj.m 10
- i += 1
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644
index c993accdda..0000000000
--- a/benchmark/bm_vm_thread_alive_check1.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5_000.times{
- t = Thread.new{}
- while t.alive?
- Thread.pass
- end
-}
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
deleted file mode 100644
index b5b3c0bc85..0000000000
--- a/benchmark/bm_vm_thread_pass.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# Plenty Thtread.pass
-# A performance may depend on GVL implementation.
-
-tmax = (ARGV.shift || 2).to_i
-lmax = 200_000 / tmax
-
-(1..tmax).map{
- Thread.new{
- lmax.times{
- Thread.pass
- }
- }
-}.each{|t| t.join}
-
-
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
deleted file mode 100644
index 27157d1a6f..0000000000
--- a/benchmark/bm_vm_thread_pass_flood.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-1000.times{
- Thread.new{loop{Thread.pass}}
-}
-
-i = 0
-while i<10000
- i += 1
-end
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
deleted file mode 100644
index 274ceda366..0000000000
--- a/benchmark/bm_vm_thread_queue.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-require 'thread'
-
-n = 1_000_000
-q = Thread::Queue.new
-consumer = Thread.new{
- while q.pop
- # consuming
- end
-}
-
-producer = Thread.new{
- n.times{
- q.push true
- }
- q.push nil
-}
-
-consumer.join
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+ # frozen_string_literal: true
+ Warning[:experimental] = false
+ string = "The quick brown fox jumped over the lazy dog."
+ array = string.bytes
+ buffer = IO::Buffer.for(string)
+benchmark:
+ string.each_byte: |
+ upcased = String.new
+ string.each_byte do |byte|
+ upcased << (byte ^ 32)
+ end
+ array.each: |
+ upcased = String.new
+ array.each do |byte|
+ upcased << (byte ^ 32)
+ end
+ buffer.each: |
+ upcased = String.new
+ buffer.each(:U8) do |offset, byte|
+ upcased << (byte ^ 32)
+ end
+ buffer.each_byte: |
+ upcased = String.new
+ buffer.each_byte do |byte|
+ upcased << (byte ^ 32)
+ end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+ # frozen_string_literal: true
+ Warning[:experimental] = false
+ string = "The quick brown fox jumped over the lazy dog."
+ buffer = IO::Buffer.for(string)
+ format = [:U32, :U32, :U32, :U32]
+benchmark:
+ string.unpack1: |
+ [
+ string.unpack1("N"),
+ string.unpack1("N", offset: 4),
+ string.unpack1("N", offset: 8),
+ string.unpack1("N", offset: 12),
+ ]
+ buffer.get_value: |
+ [
+ buffer.get_value(:U32, 0),
+ buffer.get_value(:U32, 4),
+ buffer.get_value(:U32, 8),
+ buffer.get_value(:U32, 12),
+ ]
+ buffer.get_values: |
+ buffer.get_values(format, 0)
+ string.unpack: |
+ string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'cgi/escape'
+benchmark:
+ - script: CGI.escapeHTML("")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("abcde")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("abcd<")
+ loop_count: 20000000
+ - script: CGI.escapeHTML("'&\"<>")
+ loop_count: 5000000
+ - prelude: long_no_escape = "abcde" * 300
+ script: CGI.escapeHTML(long_no_escape)
+ loop_count: 1000000
+ - prelude: long_all_escape = "'&\"<>" * 10
+ script: CGI.escapeHTML(long_all_escape)
+ loop_count: 1000000
+ - prelude: | # http://example.com/
+ example_html = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: CGI.escapeHTML(example_html)
+ loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+ [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+ constants
+
+ # With previous behavior, this would cause all of the constant caches
+ # associated with the constant lookups listed above to invalidate, meaning
+ # they would all have to be fetched again. With current behavior, it only
+ # invalidates when a name matches, so the following constant set shouldn't
+ # impact the constant lookups listed above.
+ INVALIDATE = true
+end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+ max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100644
index eb976b4a90..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,427 +0,0 @@
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
- require 'optparse'
-rescue LoadError
- if first
- first = false
- $:.unshift File.join(File.dirname(__FILE__), '../lib')
- retry
- else
- raise
- end
-end
-
-require 'benchmark'
-require 'pp'
-require 'tempfile'
-
-class BenchmarkDriver
- def self.benchmark(opt)
- driver = self.new(opt[:execs], opt[:dir], opt)
- begin
- driver.run
- ensure
- driver.show_results
- end
- end
-
- def self.load(input, type, opt)
- case type
- when 'yaml'
- require 'yaml'
- h = YAML.load(input)
- when 'json'
- require 'json'
- h = JSON.load(input)
- else
- h = eval(input.read)
- end
- obj = allocate
- obj.instance_variable_set("@execs", h[:executables] || h["executables"])
- obj.instance_variable_set("@results", h[:results] || h["results"])
- obj.instance_variable_set("@opt", opt)
- obj
- end
-
- def output *args
- puts(*args)
- @output and @output.puts(*args)
- end
-
- def message *args
- output(*args) if @verbose
- end
-
- def message_print *args
- if @verbose
- print(*args)
- STDOUT.flush
- @output and @output.print(*args)
- end
- end
-
- def progress_message *args
- unless STDOUT.tty?
- STDERR.print(*args)
- STDERR.flush
- end
- end
-
- def initialize execs, dir, opt = {}
- @execs = execs.map{|e|
- e.strip!
- next if e.empty?
-
- if /(.+)::(.+)/ =~ e
- # ex) ruby-a::/path/to/ruby-a
- label = $1.strip
- path = $2
- version = `#{path} -v`.chomp
- else
- path = e
- version = label = `#{path} -v`.chomp
- end
- [path, label, version]
- }.compact
-
- @dir = dir
- @repeat = opt[:repeat] || 1
- @repeat = 1 if @repeat < 1
- @pattern = opt[:pattern] || nil
- @exclude = opt[:exclude] || nil
- @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
- @output = opt[:output] ? open(opt[:output], 'w') : nil
- @loop_wl1 = @loop_wl2 = nil
- @ruby_arg = opt[:ruby_arg] || nil
- @measure_target = opt[:measure_target]
- @opt = opt
-
- # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
- @results = []
-
- if @verbose
- @start_time = Time.now
- message @start_time
- @execs.each_with_index{|(path, label, version), i|
- message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
- }
- message "measure target: #{@measure_target}"
- end
- end
-
- def adjusted_results name, results
- s = nil
- results.each_with_index{|e, i|
- r = e.min
- case name
- when /^vm1_/
- if @loop_wl1
- r -= @loop_wl1[i]
- r = 0 if r < 0
- s = '*'
- end
- when /^vm2_/
- if @loop_wl2
- r -= @loop_wl2[i]
- r = 0 if r < 0
- s = '*'
- end
- end
- yield r
- }
- s
- end
-
- def show_results
- case @opt[:format]
- when :tsv
- strformat = "\t%1$s"
- numformat = "\t%1$*2$.3f"
- minwidth = 0
- name_width = 0
- when :markdown
- markdown = true
- strformat = "|%1$-*2$s"
- numformat = "|%1$*2$.3f"
- when :plain
- strformat = " %1$-*2$s"
- numformat = " %1$*2$.3f"
- end
-
- name_width ||= @results.map {|v,*| v.size}.max
- minwidth ||= 7
- width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
- output
-
- if @verbose
- message '-----------------------------------------------------------'
- message 'raw data:'
- message
- message PP.pp(@results, "", 79)
- message
- message "Elapsed time: #{Time.now - @start_time} (sec)"
- end
-
- if rawdata_output = @opt[:rawdata_output]
- h = {}
- h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
- h[:executables] = @execs
- h[:results] = @results
- if (type = File.extname(rawdata_output)).empty?
- type = rawdata_output
- rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
- end
- case type
- when 'yaml'
- require 'yaml'
- h = YAML.dump(h)
- when 'json'
- require 'json'
- h = JSON.pretty_generate(h)
- else
- require 'pp'
- h = h.pretty_inspect
- end
- open(rawdata_output, 'w') {|f| f.puts h}
- end
-
- output '-----------------------------------------------------------'
- output 'benchmark results:'
-
- if @verbose and @repeat > 1
- output "minimum results in each #{@repeat} measurements."
- end
-
- output({
- real: "Execution time (sec)",
- peak: "Memory usage (peak) (B)",
- size: "Memory usage (last size) (B)",
- }[@measure_target])
- output if markdown
- output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
- output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
- @results.each{|v, result|
- rets = []
- s = adjusted_results(v, result){|r|
- rets << sprintf(numformat, r, width[rets.size])
- }
- v += s if s
- output [v.ljust(name_width), rets].join("")
- }
-
- if @execs.size > 1
- output
- output({
- real: "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)",
- peak: "Memory consuming ratio (peak) with the result of `#{@execs[0][1]}' (greater is better)",
- size: "Memory consuming ratio (size) with the result of `#{@execs[0][1]}' (greater is better)",
- }[@measure_target])
- output if markdown
- output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
- output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
- @results.each{|v, result|
- rets = []
- first_value = nil
- s = adjusted_results(v, result){|r|
- if first_value
- if r == 0
- rets << "Error"
- else
- rets << sprintf(numformat, first_value/Float(r), width[rets.size+1])
- end
- else
- first_value = r
- end
- }
- v += s if s
- output [v.ljust(name_width), rets].join("")
- }
- end
-
- if @opt[:output]
- output
- output "Log file: #{@opt[:output]}"
- end
- end
-
- def files
- flag = {}
- @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
- next if @pattern && /#{@pattern}/ !~ File.basename(file)
- next if @exclude && /#{@exclude}/ =~ File.basename(file)
- case file
- when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
- flag[$1] = true
- end
- file
- }.compact
-
- if flag['vm1'] && !flag['whileloop']
- @files << File.join(@dir, 'bm_loop_whileloop.rb')
- elsif flag['vm2'] && !flag['whileloop2']
- @files << File.join(@dir, 'bm_loop_whileloop2.rb')
- end
-
- @files.sort!
- progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
- @files
- end
-
- def run
- files.each_with_index{|file, i|
- @i = i
- r = measure_file(file)
-
- if /bm_loop_whileloop.rb/ =~ file
- @loop_wl1 = r[1].map{|e| e.min}
- elsif /bm_loop_whileloop2.rb/ =~ file
- @loop_wl2 = r[1].map{|e| e.min}
- end
- }
- end
-
- def measure_file file
- name = File.basename(file, '.rb').sub(/^bm_/, '')
- prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
- load prepare_file if FileTest.exist?(prepare_file)
-
- if @verbose
- output
- output '-----------------------------------------------------------'
- output name
- output
- output File.read(file)
- output
- end
-
- result = [name]
- result << @execs.map{|(e, v)|
- (0...@repeat).map{
- message_print "#{v}\t"
- progress_message '.'
-
- m = measure(e, file)
- message "#{m}"
- m
- }
- }
- @results << result
- result
- end
-
- unless defined?(File::NULL)
- if File.exist?('/dev/null')
- File::NULL = '/dev/null'
- end
- end
-
- def measure executable, file
- case @measure_target
- when :real
- cmd = "#{executable} #{@ruby_arg} #{file}"
- m = Benchmark.measure{
- system(cmd, out: File::NULL)
- }
- result = m.real
- when :peak, :size
- tmp = Tempfile.new("benchmark-memory-wrapper-data")
- wrapper = "#{File.join(__dir__, 'memory_wrapper.rb')} #{tmp.path} #{@measure_target}"
- cmd = "#{executable} #{@ruby_arg} #{wrapper} #{file}"
- system(cmd, out: File::NULL)
- result = tmp.read.to_i
- tmp.close
- else
- raise "unknown measure target"
- end
-
- if $? != 0
- raise $?.inspect if $? && $?.signaled?
- output "\`#{cmd}\' exited with abnormal status (#{$?})"
- 0
- else
- result
- end
- end
-end
-
-if __FILE__ == $0
- opt = {
- :execs => [],
- :dir => File.dirname(__FILE__),
- :repeat => 1,
- :measure_target => :real,
- :output => nil,
- :raw_output => nil,
- :format => :tsv,
- }
- formats = {
- :tsv => ".tsv",
- :markdown => ".md",
- :plain => ".txt",
- }
-
- parser = OptionParser.new{|o|
- o.on('-e', '--executables [EXECS]',
- "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
- e.split(/;/).each{|path|
- opt[:execs] << path
- }
- }
- o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
- opt[:dir] = d
- }
- o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
- opt[:pattern] = p
- }
- o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
- opt[:exclude] = e
- }
- o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
- opt[:repeat] = n.to_i
- }
- o.on('-o', '--output-file [FILE]', "Output file"){|f|
- opt[:output] = f
- }
- o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
- opt[:ruby_arg] = a
- }
- o.on('--measure-target [TARGET]', 'real (execution time), peak, size (memory)'){|mt|
- opt[:measure_target] = mt.to_sym
- }
- o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
- opt[:rawdata_output] = r
- }
- o.on('--load-rawdata=FILE', 'input rawdata'){|r|
- opt[:rawdata_input] = r
- }
- o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
- opt[:format] = r
- }
- o.on('-v', '--verbose'){|v|
- opt[:verbose] = v
- }
- o.on('-q', '--quiet', "Run without notify information except result table."){|q|
- opt[:quiet] = q
- opt[:verbose] = false
- }
- }
-
- parser.parse!(ARGV)
- opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
-
- if input = opt[:rawdata_input]
- b = open(input) {|f|
- BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
- }
- b.show_results
- else
- BenchmarkDriver.benchmark(opt)
- end
-end
-
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+ num = (1..).lazy.take(100)
+ ary2 = [[1,2]].cycle.lazy.take(10)
+ ary10 = [[*1..10]].cycle.lazy.take(10)
+ ary20 = [[*1..20]].cycle.lazy.take(10)
+ ary50 = [[*1..50]].cycle.lazy.take(10)
+ ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+ num3: num.flat_map {|x| x}.take(3).to_a
+ num10: num.flat_map {|x| x}.take(3).to_a
+ ary2: ary2.flat_map {|x| x}.take(3).to_a
+ ary10: ary10.flat_map {|x| x}.take(3).to_a
+ ary20: ary20.flat_map {|x| x}.take(3).to_a
+ ary50: ary50.flat_map {|x| x}.take(3).to_a
+ ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+ a = (1..3).lazy
+ b = a.map {|x| x}
+
+benchmark:
+ first_ary: a.zip(["a", "b", "c"]).first
+ first_nonary: a.zip("a".."c").first
+ first_noarg: a.zip.first
+
+ take3_ary: a.zip(["a", "b", "c"]).take(3).force
+ take3_nonary: a.zip("a".."c").take(3).force
+ take3_noarg: a.zip.take(3).force
+
+ chain-first_ary: b.zip(["a", "b", "c"]).first
+ chain-first_nonary: b.zip("a".."c").first
+ chain-first_noarg: b.zip.first
+
+ chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+ chain-take3_nonary: b.zip("a".."c").take(3).force
+ chain-take3_noarg: b.zip.take(3).force
+
+ block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+ set2 = 2.times.to_a.shuffle.to_set
+ set10 = 10.times.to_a.shuffle.to_set
+ set100 = 100.times.to_a.shuffle.to_set
+ set1000 = 1000.times.to_a.shuffle.to_set
+ set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+ set2.min: set2.min
+ set10.min: set10.min
+ set100.min: set100.min
+ set1000.min: set1000.min
+ set10000.min: set10000.min
+ set2.max: set2.max
+ set10.max: set10.max
+ set100.max: set100.max
+ set1000.max: set1000.max
+ set10000.max: set10000.max
+ set2.minmax: set2.minmax
+ set10.minmax: set10.minmax
+ set100.minmax: set100.minmax
+ set1000.minmax: set1000.minmax
+ set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+ set2 = 2.times.to_a.shuffle.to_set
+ set10 = 10.times.to_a.shuffle.to_set
+ set100 = 100.times.to_a.shuffle.to_set
+ set1000 = 1000.times.to_a.shuffle.to_set
+ set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+ set2.sort_by: set2.sort_by { 0 }
+ set10.sort_by: set10.sort_by { 0 }
+ set100.sort_by: set100.sort_by { 0 }
+ set1000.sort_by: set1000.sort_by { 0 }
+ set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+ list = ("aaa".."zzz").to_a*10
+benchmark:
+ tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'erb'
+benchmark:
+ - script: ERB::Util.html_escape("")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("abcde")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("abcd<")
+ loop_count: 20000000
+ - script: ERB::Util.html_escape("'&\"<>")
+ loop_count: 5000000
+ - prelude: long_no_escape = "abcde" * 300
+ script: ERB::Util.html_escape(long_no_escape)
+ loop_count: 1000000
+ - prelude: long_all_escape = "'&\"<>" * 10
+ script: ERB::Util.html_escape(long_all_escape)
+ loop_count: 1000000
+ - prelude: | # http://example.com/
+ example_html = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: ERB::Util.html_escape(example_html)
+ loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+
+ src = "def self.render(title, content); #{ERB.new(data).src}; end"
+ mod = Module.new
+ mod.instance_eval(src, "(ERB)")
+benchmark:
+ erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+ def make_link(previous)
+ Fiber.new do
+ while message = previous.resume
+ Fiber.yield(message)
+ end
+ end
+ end
+
+ def make_chain(length = 1000, &block)
+ chain = Fiber.new(&block)
+
+ (length - 1).times do
+ chain = make_link(chain)
+ end
+
+ return chain
+ end
+
+ message = "Hello World!"
+
+ chain = make_chain do
+ while true
+ Fiber.yield(message)
+ end
+ end
+benchmark:
+ make_chain: |
+ make_chain(100) do
+ while true
+ Fiber.yield(message)
+ end
+ end
+ resume_chain: |
+ chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+ th = Thread.current
+ th[:key] = :val
+benchmark:
+ key?: th.key?(:key)
+ []: th[:key]
+ keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+ File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+ File.rename(a, b)
+ File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ to_f: |
+ flo.to_f
+ abs: |
+ flo.abs
+ magnitude: |
+ flo.magnitude
+ -@: |
+ -flo
+ zero?: |
+ flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+ flo = 4.2
+benchmark:
+ negative?: |
+ flo.negative?
+ positive?: |
+ flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+ floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+ to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
index 2eed7abc83..275f58b924 100644
--- a/benchmark/gc/aobench.rb
+++ b/benchmark/gc/aobench.rb
@@ -1 +1 @@
-require_relative '../bm_app_aobench.rb'
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
index af8ea722aa..83347cdd20 100644
--- a/benchmark/gc/binary_trees.rb
+++ b/benchmark/gc/binary_trees.rb
@@ -1 +1 @@
-require_relative '../bm_so_binary_trees.rb'
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
index 09a404466a..23d0b91c6c 100644
--- a/benchmark/gc/gcbench.rb
+++ b/benchmark/gc/gcbench.rb
@@ -3,11 +3,12 @@ require 'pp'
require 'optparse'
$list = true
-$gcprof = true
+$gcprof = false
opt = OptionParser.new
opt.on('-q'){$list = false}
opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
opt.parse!(ARGV)
script = File.join(File.dirname(__FILE__), ARGV.shift)
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
index 94ba74be89..8ebdff7d1d 100644
--- a/benchmark/gc/pentomino.rb
+++ b/benchmark/gc/pentomino.rb
@@ -1 +1 @@
-require_relative '../bm_app_pentomino.rb'
+require_relative '../app_pentomino'
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
index af4f8c36d4..af4f8c36d4 100644
--- a/benchmark/bm_hash_aref_dsym.rb
+++ b/benchmark/hash_aref_dsym.rb
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
index 9d7759379e..9d7759379e 100644
--- a/benchmark/bm_hash_aref_dsym_long.rb
+++ b/benchmark/hash_aref_dsym_long.rb
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
index 1346890582..1346890582 100644
--- a/benchmark/bm_hash_aref_fix.rb
+++ b/benchmark/hash_aref_fix.rb
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
index 2217274c82..2217274c82 100644
--- a/benchmark/bm_hash_aref_flo.rb
+++ b/benchmark/hash_aref_flo.rb
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
index b0913dd4bb..b0913dd4bb 100644
--- a/benchmark/bm_hash_aref_miss.rb
+++ b/benchmark/hash_aref_miss.rb
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/hash_aref_str.rb
index 19439b061b..19439b061b 100644
--- a/benchmark/bm_hash_aref_str.rb
+++ b/benchmark/hash_aref_str.rb
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
index f75d163fe6..f75d163fe6 100644
--- a/benchmark/bm_hash_aref_sym.rb
+++ b/benchmark/hash_aref_sym.rb
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
index 9dab8df7be..9dab8df7be 100644
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ b/benchmark/hash_aref_sym_long.rb
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+ h = Hash.new { :foo }
+benchmark:
+ default_aref: h[1]
+ default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+ small_hash = { a: 1 }
+ larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+ dup_small: small_hash.dup
+ dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+ hash1 = 1_000_000.times.to_h { [rand, true]}
+ hash2 = hash1.dup
+ hash2.keys[1..100_000].each { hash2.delete _1 }
+ hash2.delete hash2.first[0]
+
+benchmark:
+ hash1: hash1.first
+ hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/hash_flatten.rb
index e944aae9f2..e944aae9f2 100644
--- a/benchmark/bm_hash_flatten.rb
+++ b/benchmark/hash_flatten.rb
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
index 0c7edfed3e..0c7edfed3e 100644
--- a/benchmark/bm_hash_ident_flo.rb
+++ b/benchmark/hash_ident_flo.rb
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/hash_ident_num.rb
index b226736c6f..b226736c6f 100644
--- a/benchmark/bm_hash_ident_num.rb
+++ b/benchmark/hash_ident_num.rb
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
index 4b3b58edec..4b3b58edec 100644
--- a/benchmark/bm_hash_ident_obj.rb
+++ b/benchmark/hash_ident_obj.rb
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/hash_ident_str.rb
index 8582b38e31..8582b38e31 100644
--- a/benchmark/bm_hash_ident_str.rb
+++ b/benchmark/hash_ident_str.rb
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
index 4c81e3d28e..4c81e3d28e 100644
--- a/benchmark/bm_hash_ident_sym.rb
+++ b/benchmark/hash_ident_sym.rb
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/hash_keys.rb
index 6863cd01f9..6863cd01f9 100644
--- a/benchmark/bm_hash_keys.rb
+++ b/benchmark/hash_keys.rb
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" } }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/hash_shift.rb
index a645671a5b..a645671a5b 100644
--- a/benchmark/bm_hash_shift.rb
+++ b/benchmark/hash_shift.rb
diff --git a/benchmark/bm_hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
index ec800d0342..ec800d0342 100644
--- a/benchmark/bm_hash_shift_u16.rb
+++ b/benchmark/hash_shift_u16.rb
diff --git a/benchmark/bm_hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
index de4e0fa696..de4e0fa696 100644
--- a/benchmark/bm_hash_shift_u24.rb
+++ b/benchmark/hash_shift_u24.rb
diff --git a/benchmark/bm_hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
index 656aa55583..656aa55583 100644
--- a/benchmark/bm_hash_shift_u32.rb
+++ b/benchmark/hash_shift_u32.rb
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/hash_to_proc.rb
index 2b675bf509..2b675bf509 100644
--- a/benchmark/bm_hash_to_proc.rb
+++ b/benchmark/hash_to_proc.rb
diff --git a/benchmark/bm_hash_values.rb b/benchmark/hash_values.rb
index 069441302f..069441302f 100644
--- a/benchmark/bm_hash_values.rb
+++ b/benchmark/hash_values.rb
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ src = Zero.new
+ dst = File.open(IO::NULL, 'wb')
+ n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+ # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ require 'socket'
+ src = Zero.new
+ rd, wr = UNIXSocket.pair
+ pid = fork do
+ wr.close
+ buf = String.new
+ while rd.read(16384, buf)
+ end
+ end
+ rd.close
+ IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+ # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+ wr.close if wr
+ Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/io_file_create.rb
index 2f205c1333..2f205c1333 100644
--- a/benchmark/bm_io_file_create.rb
+++ b/benchmark/io_file_create.rb
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/io_file_read.rb
index b9e796ed30..b9e796ed30 100644
--- a/benchmark/bm_io_file_read.rb
+++ b/benchmark/io_file_read.rb
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/io_file_write.rb
index aa1be0e5fe..aa1be0e5fe 100644
--- a/benchmark/bm_io_file_write.rb
+++ b/benchmark/io_file_write.rb
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
index da9357fdc6..da9357fdc6 100644
--- a/benchmark/bm_io_nonblock_noex.rb
+++ b/benchmark/io_nonblock_noex.rb
diff --git a/benchmark/bm_io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
index 56819d049b..56819d049b 100644
--- a/benchmark/bm_io_nonblock_noex2.rb
+++ b/benchmark/io_nonblock_noex2.rb
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+ i += 1
+ w.write(src)
+ r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/bm_io_select.rb b/benchmark/io_select.rb
index 19248daeb1..19248daeb1 100644
--- a/benchmark/bm_io_select.rb
+++ b/benchmark/io_select.rb
diff --git a/benchmark/bm_io_select2.rb b/benchmark/io_select2.rb
index 10e37d71b2..10e37d71b2 100644
--- a/benchmark/bm_io_select2.rb
+++ b/benchmark/io_select2.rb
diff --git a/benchmark/bm_io_select3.rb b/benchmark/io_select3.rb
index 7d0ba1f092..7d0ba1f092 100644
--- a/benchmark/bm_io_select3.rb
+++ b/benchmark/io_select3.rb
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+ while i.read(1024)
+ end
+end
+
+100.times do
+ o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'irb/color'
+ code = <<~'CODE'
+ def self.foo # bar
+ :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+ end
+ CODE
+benchmark:
+ irb_color_complete: |
+ IRB::Color.colorize_code(code, complete: true)
+ irb_color_incomplete: |
+ IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'rbconfig'
+ irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+ irb_exec: |
+ IO.popen(irb_f, 'w') do |io|
+ io.write('exit')
+ end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+ symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+ define_method = RubyVM::InstructionSequence.compile(%{
+ def foo; end
+ def bar; end
+ def baz; end
+ def egg; end
+ def spam; end
+ }).to_binary
+
+ all = RubyVM::InstructionSequence.compile(%{
+ module Foo; def foo; :foo; end; end
+ module Bar; def bar; :bar; end; end
+ module Baz; def baz; :baz; end; end
+ class Egg; def egg; :egg; end; end
+ class Spaml; def spam; :spam; end; end
+ }).to_binary
+
+benchmark:
+ symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+ define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+ all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+ class Embedded
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ end
+ end
+
+ class Extended
+ def initialize
+ @a = 1
+ @b = 1
+ @c = 1
+ @d = 1
+ @e = 1
+ @f = 1
+ end
+ end
+benchmark:
+ embedded: Embedded.new
+ extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+ clone: "object.clone"
+ clone_true: "object.clone(freeze: true)"
+ clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+ float: "Float(42)"
+ float_true: "Float(42, exception: true)"
+ float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+ obj = Object.new
+ x = nil
+benchmark:
+ kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+ kernel_then: 1.then { |i| i + 1 }
+ kernel_then_enum: 1.then
+ kernel_yield_self: 1.yield_self { |i| i + 1 }
+ kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+ h = {a: 1}
+ def kw(a: 1) a end
+ def kws(**kw) kw end
+benchmark:
+ kw_to_kw: "kw(a: 1)"
+ kw_splat_to_kw: "kw(**h)"
+ kw_to_kw_splat: "kws(a: 1)"
+ kw_splat_to_kw_splat: "kws(**h)"
+ kw_and_splat_to_kw: "kw(a: 1, **h)"
+ kw_splats_to_kw: "kw(**h, **h)"
+ kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+ kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+ def initialize(*)
+ super
+ @stdout = $stdout
+ @strio = StringIO.new
+ $stdout = IOMultiplexer.new(@stdout, @strio)
+ end
+
+ def with_benchmark(*)
+ super
+ ensure
+ logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+ puts "\nLog file: #{logfile}"
+
+ $stdout = @stdout
+ File.write(logfile, @strio.tap(&:rewind).read)
+ end
+
+ class IOMultiplexer
+ def initialize(io1, io2)
+ @io1 = io1
+ @io2 = io2
+ end
+
+ [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+ define_method(method) do |*args|
+ @io1.send(method, *args)
+ @io2.send(method, *args)
+ end
+ end
+ end
+ private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cstime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cutime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/mjit.rb b/benchmark/lib/benchmark_driver/runner/mjit.rb
new file mode 100644
index 0000000000..3a58a620de
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/mjit.rb
@@ -0,0 +1,34 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'erb'
+
+# A runner to measure after-JIT performance easily
+class BenchmarkDriver::Runner::Mjit < BenchmarkDriver::Runner::Ips
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+ def parse(**)
+ jobs = super
+ jobs.map do |job|
+ job = job.dup
+ job.prelude = "#{job.prelude}\n#{<<~EOS}"
+ if defined?(RubyVM::MJIT) && RubyVM::MJIT.enabled?
+ __bmdv_ruby_i = 0
+ while __bmdv_ruby_i < 10000 # MJIT call threshold
+ #{job.script}
+ __bmdv_ruby_i += 1
+ end
+ RubyVM::MJIT.pause # compile
+ #{job.script}
+ RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile
+ #{job.script}
+ RubyVM::MJIT.resume; RubyVM::MJIT.pause # recompile 2
+ end
+ EOS
+ job
+ end
+ end
+ })
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ jobs = jobs.map do |job|
+ job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+ end
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => value }, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render) do |path|
+ output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+ if $?.success?
+ Integer(f.read)
+ else
+ $stdout.print(output)
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def target
+ 'peak'
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def metric
+ METRIC
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ def render
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+ key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+ key = ms.respond_to?(:rss) ? :rss : :size
+else
+ raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ end
+
+ if times > 1
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ else
+ content
+ end
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..c730b8e4a5
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob) do
+ attr_accessor :ractor
+ end
+
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+ def parse(ractor: 1, **kwargs)
+ super(**kwargs).each do |job|
+ job.ractor = ractor
+ end
+ end
+ })
+
+ private
+
+ unless private_instance_methods.include?(:run_benchmark)
+ raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+ end
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ results = job.ractor.times.map do
+ Tempfile.open('benchmark_driver_result')
+ end
+ duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+ success = execute(*context.executable.command, path, exception: false)
+ if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+ value
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ results.each(&:close)
+
+ value_duration(
+ loop_count: job.loop_count,
+ duration: duration,
+ )
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(results:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+ __bmdv_loop_before = 0
+ __bmdv_loop_after = 0
+else
+ __bmdv_loop_before = Time.new
+ #{while_loop('', loop_count, id: 0)}
+ __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+ __bmdv_time = Time
+ __bmdv_script_before = __bmdv_time.new
+ #{while_loop(script, loop_count, id: 1)}
+ __bmdv_script_after = __bmdv_time.new
+
+ (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:take)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+ RUBY
+ end
+
+ private
+
+ # id is to prevent:
+ # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+ def while_loop(content, times, id:)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+ #{content}
+ __bmdv_i#{id} += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Peak#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Peak#target
+ def target
+ 'size'
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :stime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ raise 'missing loop_count is not supported in Ruby repository'
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render(result: f.path, target: target)) do |path|
+ IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+ if $?.success?
+ Float(f.read)
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # This method is overridden by some subclasses
+ def metric
+ METRIC
+ end
+
+ # This method is overridden by some subclasses
+ def target
+ :total
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:, target:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+ #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :utime
+ end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+# 1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+ x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+ x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+ x.report %q{
+ h = {a: 1, b: 2, c: 3, d: 4}
+ }
+}
+=end
+#
+# 2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/bm_loop_for.rb b/benchmark/loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/bm_loop_for.rb
+++ b/benchmark/loop_for.rb
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/loop_generator.rb
index d3375c744c..d3375c744c 100644
--- a/benchmark/bm_loop_generator.rb
+++ b/benchmark/loop_generator.rb
diff --git a/benchmark/bm_loop_times.rb b/benchmark/loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/bm_loop_times.rb
+++ b/benchmark/loop_times.rb
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/loop_whileloop.rb
index 0072822c06..0072822c06 100644
--- a/benchmark/bm_loop_whileloop.rb
+++ b/benchmark/loop_whileloop.rb
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
index 47d02dffc4..47d02dffc4 100644
--- a/benchmark/bm_loop_whileloop2.rb
+++ b/benchmark/loop_whileloop2.rb
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
- filebase = File.join(File.dirname($0), 'fasta.output')
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- file = "#{filebase}.#{n}"
-
- unless FileTest.exist?(file)
- STDERR.puts "preparing #{file}"
-
- open(file, 'w'){|f|
- ARGV[0] = n
- $stdout = f
- load script
- $stdout = STDOUT
- }
- end
-end
-
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
index 9b8d0c6afb..9b8d0c6afb 100644
--- a/benchmark/bm_marshal_dump_flo.rb
+++ b/benchmark/marshal_dump_flo.rb
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
index 8252ad90fa..8252ad90fa 100644
--- a/benchmark/bm_marshal_dump_load_geniv.rb
+++ b/benchmark/marshal_dump_load_geniv.rb
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+ smallint_array = 1000.times.map { |x| x }
+ bigint32_array = 1000.times.map { |x| x + 2**32 }
+ bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+ smallint_dump = Marshal.dump(smallint_array)
+ bigint32_dump = Marshal.dump(bigint32_array)
+ bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+ marshal_dump_integer_small: |
+ Marshal.dump(smallint_array)
+ marshal_dump_integer_over_32_bit: |
+ Marshal.dump(bigint32_array)
+ marshal_dump_integer_over_64_bit: |
+ Marshal.dump(bigint64_array)
+ marshal_load_integer_small: |
+ Marshal.load(smallint_dump)
+ marshal_load_integer_over_32_bit: |
+ Marshal.load(bigint32_dump)
+ marshal_load_integer_over_64_bit: |
+ Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
index e29743b791..e29743b791 100644
--- a/benchmark/bm_marshal_dump_load_time.rb
+++ b/benchmark/marshal_dump_load_time.rb
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+ a = [nil] * 3
+ b = Class.new{attr_writer :a, :b, :c}.new
+ c = d = e = f = g = h = i = nil
+benchmark:
+ array2_2: "c = (a[0], a[1] = 1, 2)"
+ array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+ array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+ array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+ attr2_2: "c = (b.a, b.b = 1, 2)"
+ attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+ attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+ attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+ lvar2_2: "c = (d, e = 1, 2)"
+ lvar2_3: "c = (d, e = 1, 2, 3)"
+ lvar3_2: "c = (d, e, f = 1, 2)"
+ lvar3_3: "c = (d, e, f = 1, 2, 3)"
+ array2_2p: "(a[0], a[1] = 1, 2; nil)"
+ array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+ array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+ array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+ attr2_2p: "(b.a, b.b = 1, 2; nil)"
+ attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+ attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+ attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+ lvar2_2p: "(d, e = 1, 2; nil)"
+ lvar2_3p: "(d, e = 1, 2, 3; nil)"
+ lvar3_2p: "(d, e, f = 1, 2; nil)"
+ lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+ array2_2lv: "c = (a[0], a[1] = g, h)"
+ array2_ilv: "c = (a[0], a[1] = g, h, i)"
+ arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+ arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+ attr2_2lv: "c = (b.a, b.b = g, h)"
+ attr2_ilv: "c = (b.a, b.b = g, h, i)"
+ attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+ attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+ lvar2_2lv: "c = (d, e = g, h)"
+ lvar2_ilv: "c = (d, e = g, h, i)"
+ lvari_2lv: "c = (d, e, f = g, h)"
+ lvari_ilv: "c = (d, e, f = g, h, i)"
+ array2_2plv: "(a[0], a[1] = g, h; nil)"
+ array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+ arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+ arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+ attr2_2plv: "(b.a, b.b = g, h; nil)"
+ attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+ attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+ attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+ lvar2_2plv: "(d, e = g, h; nil)"
+ lvar2_iplv: "(d, e = g, h, i; nil)"
+ lvari_2plv: "(d, e, f = g, h; nil)"
+ lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/memory_wrapper.rb b/benchmark/memory_wrapper.rb
deleted file mode 100644
index 3f4451a037..0000000000
--- a/benchmark/memory_wrapper.rb
+++ /dev/null
@@ -1,16 +0,0 @@
-
-write_file, target, script_file = ARGV
-
-load(script_file)
-require_relative '../test/lib/memory_status'
-open(write_file, 'wb'){|f|
- ms = Memory::Status.new
- case target.to_sym
- when :peak
- key = ms.respond_to?(:hwm) ? :hwm : :peak
- when :size
- key = ms.respond_to?(:rss) ? :rss : :size
- end
-
- f.puts ms[key]
-}
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+ named_module = Kernel
+
+ module FakeName
+ def self.name
+ "NotMyame".freeze
+ end
+ end
+
+ MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+ fastpath: MOD_NAME.bind_call(Kernel)
+ slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/mjit_exivar.yml b/benchmark/mjit_exivar.yml
new file mode 100644
index 0000000000..2584fa6410
--- /dev/null
+++ b/benchmark/mjit_exivar.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ class Bench < Hash
+ def initialize
+ @exivar = nil
+ end
+
+ def exivar
+ @exivar
+ end
+ end
+
+ bench = Bench.new
+
+benchmark:
+ mjit_exivar: bench.exivar
+
+loop_count: 200000000
diff --git a/benchmark/mjit_integer.yml b/benchmark/mjit_integer.yml
new file mode 100644
index 0000000000..a6b5c9ee16
--- /dev/null
+++ b/benchmark/mjit_integer.yml
@@ -0,0 +1,32 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_abs(int) int.abs end
+ def mjit_bit_length(int) int.bit_length end
+ def mjit_comp(int) ~int end
+ def mjit_even?(int) int.even? end
+ def mjit_integer?(int) int.integer? end
+ def mjit_magnitude(int) int.magnitude end
+ def mjit_odd?(int) int.odd? end
+ def mjit_ord(int) int.ord end
+ def mjit_size(int) int.size end
+ def mjit_to_i(int) int.to_i end
+ def mjit_to_int(int) int.to_int end
+ def mjit_uminus(int) -int end
+ def mjit_zero?(int) int.zero? end
+
+benchmark:
+ - mjit_abs(-1)
+ - mjit_bit_length(100)
+ - mjit_comp(1)
+ - mjit_even?(2)
+ - mjit_integer?(0)
+ - mjit_magnitude(-1)
+ - mjit_odd?(1)
+ - mjit_ord(1)
+ - mjit_size(1)
+ - mjit_to_i(1)
+ - mjit_to_int(1)
+ - mjit_uminus(1)
+ - mjit_zero?(0)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_kernel.yml b/benchmark/mjit_kernel.yml
new file mode 100644
index 0000000000..7720e65c2c
--- /dev/null
+++ b/benchmark/mjit_kernel.yml
@@ -0,0 +1,20 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_class(obj)
+ obj.class
+ end
+
+ def mjit_frozen?(obj)
+ obj.frozen?
+ end
+
+ str = ""
+ fstr = "".freeze
+
+benchmark:
+ - mjit_class(self)
+ - mjit_class(1)
+ - mjit_frozen?(str)
+ - mjit_frozen?(fstr)
+
+loop_count: 40000000
diff --git a/benchmark/mjit_leave.yml b/benchmark/mjit_leave.yml
new file mode 100644
index 0000000000..9ac68b164b
--- /dev/null
+++ b/benchmark/mjit_leave.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def leave
+ nil
+ end
+benchmark:
+ mjit_leave: leave
+loop_count: 200000000
diff --git a/benchmark/mjit_opt_cc_insns.yml b/benchmark/mjit_opt_cc_insns.yml
new file mode 100644
index 0000000000..fed6d34bd5
--- /dev/null
+++ b/benchmark/mjit_opt_cc_insns.yml
@@ -0,0 +1,27 @@
+# opt_* insns using vm_method_cfunc_is with send-compatible operands:
+# * opt_nil_p
+# * opt_not
+# * opt_eq
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_nil?(obj)
+ obj.nil?
+ end
+
+ def mjit_not(obj)
+ !obj
+ end
+
+ def mjit_eq(a, b)
+ a == b
+ end
+
+benchmark:
+ - script: mjit_nil?(1)
+ loop_count: 40000000
+ - script: mjit_not(1)
+ loop_count: 40000000
+ - script: mjit_eq(1, nil)
+ loop_count: 8000000
+ - script: mjit_eq(nil, 1)
+ loop_count: 8000000
diff --git a/benchmark/mjit_struct_aref.yml b/benchmark/mjit_struct_aref.yml
new file mode 100644
index 0000000000..bfba1323f2
--- /dev/null
+++ b/benchmark/mjit_struct_aref.yml
@@ -0,0 +1,10 @@
+type: lib/benchmark_driver/runner/mjit
+prelude: |
+ def mjit_struct_aref(struct)
+ struct.aa
+ end
+ struct = Struct.new(:a0, :a1, :a2, :a3, :a4, :a5, :a6, :a7, :a8, :a9, :aa).new
+
+benchmark: mjit_struct_aref(struct)
+
+loop_count: 40000000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..a561fb86dc
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,27 @@
+prelude: |
+ class SimpleClass; end
+ class MediumClass
+ 10.times { include Module.new }
+ end
+ class LargeClass
+ 100.times { include Module.new }
+ end
+ class HugeClass
+ 300.times { include Module.new }
+ end
+ SimpleObj = SimpleClass.new
+ MediumObj = MediumClass.new
+ LargeObj = LargeClass.new
+ HugeObj = HugeClass.new
+benchmark:
+ simple_class_eqq_simple_obj: |
+ SimpleClass === SimpleObj
+ medium_class_eqq_simple_obj: |
+ MediumClass === SimpleObj
+ simple_class_eqq_medium_obj: |
+ SimpleClass === MediumObj
+ simple_class_eqq_large_obj: |
+ SimpleClass === LargeObj
+ simple_class_eqq_huge_obj: |
+ SimpleClass === HugeObj
+loop_count: 20000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+ class Niller; def nil?; true; end; end
+ xnil, notnil = nil, Object.new
+ niller = Niller.new
+benchmark:
+ - xnil.nil?
+ - notnil.nil?
+ - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..fba67a5f6a
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,6 @@
+benchmark:
+ to_i: |
+ nil.to_i
+ to_f: |
+ nil.to_f
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+ - 0.zero?
+ - 1.zero?
+ - 0r.zero?
+ - 1r.zero?
+ - 0i.zero?
+ - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+ int = 42
+ flo = 4.2
+benchmark:
+ real?: |
+ int.real?
+ integer?: |
+ flo.integer?
+ finite?: |
+ int.finite?
+ infinite?: |
+ int.infinite?
+ integer_real: |
+ int.real
+ float_real: |
+ flo.real
+ integr_imag: |
+ int.imag
+ float_imag: |
+ flo.imag
+ integer_conj: |
+ int.conj
+ float_conj: |
+ flo.conj
+ integer_numerator: |
+ int.numerator
+ integer_denominator: |
+ int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..93ff463e41
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,21 @@
+prelude: |
+ class Eight
+ 8.times { include(Module.new) }
+ end
+ class ThirtyTwo
+ 32.times { include(Module.new) }
+ end
+ class SixtyFour
+ 64.times { include(Module.new) }
+ end
+ class OneTwentyEight
+ 128.times { include(Module.new) }
+ end
+ # Disable GC to see raw throughput:
+ GC.disable
+benchmark:
+ allocate_8_deep: Eight.new
+ allocate_32_deep: ThirtyTwo.new
+ allocate_64_deep: SixtyFour.new
+ allocate_128_deep: OneTwentyEight.new
+loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'objspace'
+ require 'tempfile'
+ $objs = 1_000.times.map { Object.new }
+ $strings = 1_000.times.map { |i| "string #{i}" }
+ $file = Tempfile.new('heap')
+ $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+ dump_all_string: "ObjectSpace.dump_all(output: :string)"
+ dump_all_file: "ObjectSpace.dump_all(output: $file)"
+ dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 01593965d9..1ce9f76275 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
def factL(n):
r = 1
- for x in range(2, n):
+ for x in range(2, n+1):
r *= x
return r
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+ def call(*val)
+ case val
+ in [String => body]
+ [200, {}, [body]]
+ in [Integer => status]
+ [status, {}, [""]]
+ in [Integer, String] => response
+ [response[0], {}, [response[1]]]
+ in [Integer, Hash, String] => response
+ [response[0], response[1], [response[2]]]
+ end
+ end
+
+benchmark:
+ first_match: call("ok")
+ second_match: call(401)
+ third_match: call(200, "ok")
+ fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
deleted file mode 100644
index c4786f04ad..0000000000
--- a/benchmark/prepare_require.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require "fileutils"
-
-def prepare
- num_files = 10000
-
- basename = File.dirname($0)
- data_dir = File.join(basename, "bm_require.data")
-
- # skip if all of files exists
- if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
- return
- end
-
- FileUtils.mkdir_p(data_dir)
-
- 1.upto(num_files) do |i|
- f = File.open("#{data_dir}/c#{i}.rb", "w")
- f.puts <<-END
- class C#{i}
- end
- END
- end
-end
-
-prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
deleted file mode 100644
index 339ecb8b39..0000000000
--- a/benchmark/prepare_require_thread.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-load File.join(File.dirname(__FILE__), "prepare_require.rb")
-
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+ ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+ FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+ ractor_float_to_s: |
+ FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - (1..1_000_000).last(100)
+ - (1..1_000_000).last(1000)
+ - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+ - (1..10).min
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..90a029d5b9
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,30 @@
+prelude: |
+ f = File
+ pwd = Dir.pwd
+ Dir.mkdir('b') unless f.directory?('b')
+ f.write('b/a', '') unless f.file?('b/a')
+
+ relative = 'b/a'
+ absolute = File.join(pwd, relative)
+ dir = 'b'
+ file = 'a'
+
+ relative_dir = 'b/c'
+ absolute_dir = File.join(pwd, relative_dir)
+ file_dir = 'c'
+benchmark:
+ relative_nil: "f.realpath(relative, nil)"
+ absolute_nil: "f.realpath(absolute, nil)"
+ relative_relative: "f.realpath(file, dir)"
+ absolute_relative: "f.realpath(absolute, dir)"
+ relative_absolute: "f.realpath(relative, pwd)"
+ relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+ absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+ relative_relative_dir: "f.realdirpath(file_dir, dir)"
+ absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+ relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+ relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+ absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+ relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+ absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+ relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index d2dc56b1e1..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
- <<-EOP
- $DRIVER_PATH = '#{File.dirname($0)}'
- $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
- require 'benchmark'
- require 'yarvutil'
-# print '#{type}'
- begin
- puts Benchmark.measure{
- #{w}('#{file}')
- }.utime
- rescue Exception => exec_command_error_variable
- puts "\t" + exec_command_error_variable.message
- end
- EOP
-end
-
-def benchmark cmd
- rubybin = ENV['RUBY'] || RbConfig.ruby
-
- IO.popen(rubybin, 'r+'){|io|
- io.write cmd
- io.close_write
- return io.gets
- }
-end
-
-def ruby_exec file
- prog = exec_command 'ruby', file, 'load'
- benchmark prog
-end
-
-def yarv_exec file
- prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
- benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
- file = File.dirname($0) + "/bm_#{bench}.rb"
- r = ruby_exec(file).to_f
- y = yarv_exec(file).to_f
- puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
- r = ruby_exec.to_f
- y = yarv_exec.to_f
- puts r/y
-end
-
-if $0 == __FILE__
- %w{
- whileloop
- whileloop2
- times
- const
- method
- poly_method
- block
- rescue
- rescue2
- }.each{|bench|
- measure bench
- }
-end
-
-
-
-
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ 1.upto(10000) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require_thread: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ i=0
+ t = Thread.new do
+ while true
+ i = i+1 # dummy loop
+ end
+ end
+
+ 1.upto(100) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+ t.kill
+loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 0cd2363849..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results = []
-
-# prepare 'wc.input'
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
-
-def bm file
- prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
- return if prog.empty?
-
- /[a-z]+_(.+)\.rb/ =~ file
- bm_name = $1
- puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
- puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
- begin
- result = [bm_name]
- result << matzruby_exec(file) unless $rubyonly
- result << ruby_exec(file) unless $matzrubyonly
- $results << result
-
- rescue Exception => e
- puts
- puts "** benchmark failure: #{e}"
- puts e.backtrace
- end
-end
-
-def benchmark file, bin
- m = Benchmark.measure{
- `#{bin} #{$opts} #{file}`
- }
- sec = '%.3f' % m.real
- puts " #{sec}"
- sec
-end
-
-def ruby_exec file
- print 'ruby'
- benchmark file, $ruby_program
-end
-
-def matzruby_exec file
- print 'matz'
- rubylib = ENV['RUBYLIB']
- ENV['RUBYLIB'] = ''
- r = benchmark file, $matzruby_program
- ENV['RUBYLIB'] = rubylib
- r
-end
-
-if $0 == __FILE__
- ARGV.each{|arg|
- case arg
- when /\A--ruby=(.+)/
- $ruby_program = $1
- when /\A--matzruby=(.+)/
- $matzruby_program = $1
- when /\A--opts=(.+)/
- $opts = $1
- when /\A(-r|--only-ruby)\z/
- $rubyonly = true
- when /\A(-m|--only-matzruby)\z/
- $matzrubyonly = true
- end
- }
- ARGV.delete_if{|arg|
- /\A-/ =~ arg
- }
-
- puts "MatzRuby:"
- system("#{$matzruby_program} -v")
- puts "Ruby:"
- system("#{$ruby_program} -v")
- puts
-
- if ARGV.empty?
- Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
- bm file
- }
- else
- ARGV.each{|file|
- Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
- # file = "#{File.dirname(__FILE__)}/#{file}.rb"
- bm ef
- }
- }
- end
-
- puts
- puts "-- benchmark summary ---------------------------"
- $results.each{|res|
- print res.shift, "\t"
- (res||[]).each{|result|
- /([\d\.]+)/ =~ result
- print $1 + "\t" if $1
- }
- puts
- }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
- puts file
- file = File.join(File.dirname($0), 'contrib', file)
- Benchmark.bm{|x|
- x.report('ruby'){
- system("#{$rubybin} #{file}")
- }
- x.report('yarv'){
- system("#{$rubybin} -rite -I.. #{file}")
- }
- }
-end
-
-ARGV.each{|file|
- runfile file
-}
-
-
diff --git a/benchmark/bm_securerandom.rb b/benchmark/securerandom.rb
index a082ea6d5b..a082ea6d5b 100644
--- a/benchmark/bm_securerandom.rb
+++ b/benchmark/securerandom.rb
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+ x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+ (n-1).step(0,-1) do |bi|
+ y[bi] += x.at(bi)
+ end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/so_binary_trees.rb
index b1693e4109..b1693e4109 100644
--- a/benchmark/bm_so_binary_trees.rb
+++ b/benchmark/so_binary_trees.rb
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+ i += 1
+ hello = ''
+ 4_000_000.times do |e|
+ hello << STUFF
+ end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..99683505f9
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,65 @@
+prelude: |
+ #!/usr/bin/ruby
+
+ wc_input_base = <<EOS
+ Subject: Re: Who was Izchak Miller?
+ From: "Jane D. Anonymous" <nobody@yale.edu>
+ Date: 1996/04/28
+ Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
+ References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+ To: 75176.2330@compuserve.com
+ Content-Type: text/plain; charset=us-ascii
+ Organization: Yale University
+ X-Url: news:4lk6vl$gde@ns.oar.net
+ Mime-Version: 1.0
+ Newsgroups: rec.games.roguelike.nethack
+ X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
+
+ Hello there, Izchak Miller was my father. When I was younger I spent
+ many a night, hunched over the keyboard with a cup of tea, playing
+ nethack with him and my brother. my dad was a philosopher with a strong
+ weakness for fantasy/sci fi. I remember when he started to get involved
+ with the Nethack team- my brother's Dungeons and Dragons monster book
+ found a regular place beside my dad's desk. it's nice to see him living
+ on in the game he loved so much :-).
+ Tamar Miller
+
+ The following is a really long word of 5000 characters:
+
+ wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+ EOS
+
+ # prepare 'wc.input'
+
+ def prepare_wc_input(wcbase)
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ unless FileTest.exist?(wcinput)
+ data = wcbase.dup
+ 13.times{
+ data << data
+ }
+ open(wcinput, 'w'){|f| f.write data}
+ end
+ end
+
+ prepare_wc_input(wc_input_base)
+
+benchmark:
+ so_count_words: |
+ # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+ # http://www.bagley.org/~doug/shootout/
+ # with help from Paul Brannan
+ input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+ nl = nw = nc = 0
+ while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+ end
+ # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+class Hi_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+def some_function(num)
+ begin
+ hi_function(num)
+ rescue
+ print "We shouldn't get here, exception is: #{$!.type}\n"
+ end
+end
+
+def hi_function(num)
+ begin
+ lo_function(num)
+ rescue Hi_Exception
+ $HI = $HI + 1
+ end
+end
+
+def lo_function(num)
+ begin
+ blowup(num)
+ rescue Lo_Exception
+ $LO = $LO + 1
+ end
+end
+
+def blowup(num)
+ if num % 2 == 0
+ raise Lo_Exception.new(num)
+ else
+ raise Hi_Exception.new(num)
+ end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+ i += 1
+ some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/so_fannkuch.rb
index bac5ecd44c..bac5ecd44c 100644
--- a/benchmark/bm_so_fannkuch.rb
+++ b/benchmark/so_fannkuch.rb
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+]
+homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_k_nucleotide
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(100_000)
+ script: |
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org
+ #
+ # contributed by jose fco. gonzalez
+ # modified by Sokolov Yura
+
+ seq = String.new
+
+ def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+ end
+
+ def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+ end
+
+ def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+ line = input.gets while line !~ /^>THREE/
+ line = input.gets
+
+ while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+ end
+
+ [1,2].each {|i| sort_by_freq( seq,i ) }
+
+ %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+ loop_count: 1
diff --git a/benchmark/bm_so_lists.rb b/benchmark/so_lists.rb
index e8f4a2a5f7..e8f4a2a5f7 100644
--- a/benchmark/bm_so_lists.rb
+++ b/benchmark/so_lists.rb
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/bm_so_mandelbrot.rb
+++ b/benchmark/so_mandelbrot.rb
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+ count = 1
+ mx = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ row[j] = count
+ count += 1
+ end
+ mx[bi] = row
+ end
+ mx
+end
+
+def mmult(rows, cols, m1, m2)
+ m3 = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ val = 0
+ (0 .. (cols - 1)).each do |k|
+ val += m1.at(bi).at(k) * m2.at(k).at(j)
+ end
+ row[j] = val
+ end
+ m3[bi] = row
+ end
+ m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+ mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..8c136baa6c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+# contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM: the main body is at the bottom.
+# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# 2) see how I represent a board as a bitmask by reading the blank_board comments
+# 3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+ # an array (by location) containing a bit mask for how the piece maps at the given location.
+ # if the rotation is invalid at that location the mask will contain false
+ attr_reader :start_masks
+
+ # maps a direction to a relative location. these differ depending on whether it is an even or
+ # odd row being mapped from
+ @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+ @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+ def initialize( directions )
+ @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+ @even_mask = mask_for_offsets( @even_offsets)
+ @odd_mask = mask_for_offsets( @odd_offsets)
+
+ @start_masks = Array.new(60)
+
+ # create the rotational masks by placing the base mask at the location and seeing if
+ # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
+ # is true the piece cannot be placed
+ 0.upto(59) do | offset |
+ mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+ if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+ imask = compute_required( mask, offset)
+ @start_masks[offset] = [ mask, imask, imask | mask ]
+ else
+ @start_masks[offset] = false
+ end
+ end
+ end
+
+ def compute_required( mask, offset )
+ board = blank_board
+ 0.upto(offset) { | i | board |= 1 << i }
+ board |= mask
+ return 0 if (!prunable(board | mask, offset))
+ board = flood_fill(board,58)
+ count = 0
+ imask = 0
+ 0.upto(59) do | i |
+ if (board[i] == 0) then
+ imask |= (1 << i)
+ count += 1
+ end
+ end
+ (count > 0 && count < 5) ? imask : 0
+ end
+
+ def flood_fill( board, location)
+ return board if (board[location] == 1)
+ board |= 1 << location
+ row, col = location.divmod(6)
+ board = flood_fill( board, location - 1) if (col > 0)
+ board = flood_fill( board, location + 1) if (col < 4)
+ if (row % 2 == 0) then
+ board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+ else
+ board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+ end
+ board
+ end
+
+ # given a location, produces a list of relative locations covered by the piece at this rotation
+ def offsets( location)
+ if is_even( location) then
+ @even_offsets.collect { | value | value + location }
+ else
+ @odd_offsets.collect { | value | value + location }
+ end
+ end
+
+ # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+ # this is hard to explain. imagine we have this partial board:
+ # 0 0 0 0 0 x [positions 0-5]
+ # 0 0 1 1 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 1 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # The top-left of the piece is at position 8, the
+ # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+ # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+ # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
+ # 0 0 0 1 1 x [positions 0-5]
+ # 0 0 1 0 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 0 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+ # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+ # this function would return
+ def normalize_offsets( values)
+ min = values.min
+ even_min = is_even(min)
+ other_min = even_min ? min + 6 : min + 7
+ other_values = values.collect do | value |
+ if is_even(value) then
+ value + 6 - other_min
+ else
+ value + 7 - other_min
+ end
+ end
+ values.collect! { | value | value - min }
+
+ if even_min then
+ [values, other_values]
+ else
+ [other_values, values]
+ end
+ end
+
+ # produce a bitmask representation of an array of offset locations
+ def mask_for_offsets( offsets )
+ mask = 0
+ offsets.each { | value | mask = mask + ( 1 << value ) }
+ mask
+ end
+
+ # finds a "safe" position that a position as described by a list of directions can be placed
+ # without falling off any edge of the board. the values returned a location to place the first piece
+ # at so it will fit after making the described moves
+ def start_adjust( directions )
+ south = east = 0;
+ directions.each do | direction |
+ east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+ south += 1 if ( direction == :nw || direction == :ne )
+ end
+ south * 6 + east
+ end
+
+ # given a set of directions places the piece (as defined by a set of directions) on the board at
+ # a location that will not take it off the edge
+ def get_values( directions )
+ start = start_adjust(directions)
+ values = [ start ]
+ directions.each do | direction |
+ if (start % 12 >= 6) then
+ start += @@rotation_odd_adder[direction]
+ else
+ start += @@rotation_even_adder[direction]
+ end
+ values += [ start ]
+ end
+
+ # some moves take you back to an existing location, we'll strip duplicates
+ values.uniq
+ end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+# rotations -- all the rotations of the piece
+# type -- a numeic "name" of the piece
+# masks -- an array by location of all legal rotational masks (a n inner array) for that location
+# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+ attr_reader :rotations, :type, :masks
+ attr_accessor :placed
+
+ # transform hashes that change one direction into another when you either flip or rotate a set of directions
+ @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+ @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+ def initialize( directions, type )
+ @type = type
+ @rotations = Array.new();
+ @map = {}
+
+ generate_rotations( directions )
+ directions.collect! { | value | @@flip_converter[value] }
+ generate_rotations( directions )
+
+ # creates the masks AND a map that returns [location, rotation] for any given mask
+ # this is used when a board is found and we want to draw it, otherwise the map is unused
+ @masks = Array.new();
+ 0.upto(59) do | i |
+ even = true
+ @masks[i] = @rotations.collect do | rotation |
+ mask = rotation.start_masks[i]
+ @map[mask[0]] = [ i, rotation ] if (mask)
+ mask || nil
+ end
+ @masks[i].compact!
+ end
+ end
+
+ # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+ def generate_rotations( directions )
+ 6.times do
+ rotations.push( Rotation.new(directions))
+ directions.collect! { | value | @@rotate_converter[value] }
+ end
+ end
+
+ # given a board string, adds this piece to the board at whatever location/rotation
+ # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+ def fill_string( board_string)
+ location, rotation = @map[@placed]
+ rotation.offsets(location).each do | offset |
+ row, col = offset.divmod(6)
+ board_string[ row*5 + col, 1 ] = @type.to_s
+ end
+ end
+end
+
+# a blank bit board having this form:
+#
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+ 0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+ 0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+ (location % 12) < 6
+end
+
+# support function that create three utility maps:
+# $converter -- for each row an array that maps a five bit row (via array mapping)
+# to the a five bit representation of the bits below it
+# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+# a region array has three values the first is a mask of bits in the region,
+# the second is the count of those bits and the third is identical to the first
+# examples:
+# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+# 0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+ odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+ even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+ all_odds = Array.new(0b100000)
+ all_evens = Array.new(0b100000)
+ bit_counts = Array.new(0b100000)
+ new_regions = Array.new(0b100000)
+ 0.upto(0b11111) do | i |
+ bit_count = odd = even = 0
+ 0.upto(4) do | bit |
+ if (i[bit] == 1) then
+ bit_count += 1
+ odd |= odd_map[bit]
+ even |= even_map[bit]
+ end
+ end
+ all_odds[i] = odd
+ all_evens[i] = even
+ bit_counts[i] = bit_count
+ new_regions[i] = create_regions( i)
+ end
+
+ $converter = []
+ 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+ $bit_counts = bit_counts
+ $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five. The following board is an example of a prunable board:
+# 0 0 1 0 0
+# 0 1 0 0 0
+# 1 1 0 0 0
+# 0 1 0 0 0
+# 0 0 0 0 0
+# ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+# board -- an initial bit board (6 bit padded rows, see blank_board for format)
+# location -- starting location, everything above and to the left is already full
+# slotting -- set to true only when testing initial pieces, when filling normally
+# additional assumptions are possible
+#
+# Algorithm:
+# The algorithm starts at the top row (as determined by location) and iterates a row at a time
+# maintainng counts of active open areas (kept in the collector array) each collector contains
+# three values at the start of an iteration:
+# 0: mask of bits that would be adjacent to the collector in this row
+# 1: the number of bits collected so far
+# 2: a scratch space starting as zero, but used during the computation to represent
+# the empty bits in the new row that are adjacent (position 0)
+# The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+ collectors = []
+ # loop across the rows
+ (location / 6).to_i.upto(9) do | row_on |
+ # obtain a set of regions representing the bits of the current row.
+ regions = $regions[(board >> (row_on * 6)) & 0b11111]
+ converter = $converter[row_on]
+
+ # track the number of collectors at the start of the cycle so that
+ # we don't compute against newly created collectors, only existing collectors
+ initial_collector_count = collectors.length
+
+ # loop against the regions. For each region of the row
+ # we will see if it connects to one or more existing collectors.
+ # if it connects to 1 collector, the bits from the region are added to the
+ # bits of the collector and the mask is placed in collector[2]
+ # If the region overlaps more than one collector then all the collectors
+ # it overlaps with are merged into the first one (the others are set to nil in the array)
+ # if NO collectors are found then the region is copied as a new collector
+ regions.each do | region |
+ collector_found = nil
+ region_mask = region[2]
+ initial_collector_count.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ collector_mask = collector[0]
+ if (collector_mask & region_mask != 0) then
+ if (collector_found) then
+ collector_found[0] |= collector_mask
+ collector_found[1] += collector[1]
+ collector_found[2] |= collector[2]
+ collectors[collector_num] = nil
+ else
+ collector_found = collector
+ collector[1] += region[1]
+ collector[2] |= region_mask
+ end
+ end
+ end
+ end
+ if (collector_found == nil) then
+ collectors.push(Array.new(region))
+ end
+ end
+
+ # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+ # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
+ # the board is prunable. if it is a multiple of five it is removed.
+ # Collector that are still active have a new adjacent value [0] set based n the matched bits
+ # and have [2] cleared out for the next cycle.
+ collectors.length.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ if (collector[2] == 0) then
+ return true if (collector[1] % 5 != 0)
+ collectors[collector_num] = nil
+ else
+ # if a collector matches all bits in the row then we can return unprunable early for the
+ # following reasons:
+ # 1) there can be no more unavailable bits bince we fill from the top left downward
+ # 2) all previous regions have been closed or joined so only this region can fail
+ # 3) this region must be good since there can never be only 1 region that is nuot
+ # a multiple of five
+ # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+ # in pieces to see what configurations work for them (the only other time this algorithm is used).
+ return false if (collector[2] == 0b11111 && !slotting)
+ collector[0] = converter[collector[2]]
+ collector[2] = 0
+ end
+ end
+ end
+
+ # get rid of all the empty converters for the next round
+ collectors.compact!
+ end
+ return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+ collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask. see prunable for what a "region" is
+def create_regions( value )
+ regions = []
+ cur_region = 0
+ 5.times do | bit |
+ if (value[bit] == 0) then
+ cur_region |= 1 << bit
+ else
+ if (cur_region != 0 ) then
+ regions.push( cur_region)
+ cur_region = 0;
+ end
+ end
+ end
+ regions.push(cur_region) if (cur_region != 0)
+ regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+ find_top( 1)
+ find_top( 0)
+ print_results
+end
+
+# show the board
+def print_results
+ print "#{@boards_found} solutions found\n\n"
+ print_full_board( @min_board)
+ print "\n"
+ print_full_board( @max_board)
+ print "\n"
+end
+
+# finds solutions. This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece. It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+# Since any found solution has an inverse we want to maximize finding solutions that are not already found
+# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
+# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
+# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+# maximum number
+def find_top( rotation_skip)
+ board = blank_board
+ (@pieces.length-1).times do
+ piece = @pieces.shift
+ piece.masks[0].each do | mask, imask, cmask |
+ if ((rotation_skip += 1) % 2 == 0) then
+ piece.placed = mask
+ find( 1, 1, board | mask)
+ end
+ end
+ @pieces.push(piece)
+ end
+ piece = @pieces.shift
+ @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found. depth is achieved via recursion. the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+# start_location -- where to start looking for place for the next piece at
+# placed -- number of pieces placed
+# board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+ # find the next location to place a piece by looking for an empty bit
+ while board[start_location] == 1
+ start_location += 1
+ end
+
+ @pieces.length.times do
+ piece = @pieces.shift
+ piece.masks[start_location].each do | mask, imask, cmask |
+ if ( board & cmask == imask) then
+ piece.placed = mask
+ if (placed == 9) then
+ add_board
+ else
+ find( start_location + 1, placed + 1, board | mask)
+ end
+ end
+ end
+ @pieces.push(piece)
+ end
+end
+
+# print the board
+def print_full_board( board_string)
+ 10.times do | row |
+ print " " if (row % 2 == 1)
+ 5.times do | col |
+ print "#{board_string[row*5 + col,1]} "
+ end
+ print "\n"
+ end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+ board_string = "99999999999999999999999999999999999999999999999999"
+ @all_pieces.each { | piece | piece.fill_string( board_string ) }
+ save( board_string)
+ save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+ if (@all_boards[board_string] == nil) then
+ @min_board = board_string if (board_string < @min_board)
+ @max_board = board_string if (board_string > @max_board)
+ @all_boards.store(board_string,true)
+ @boards_found += 1
+
+ # the exit motif is a time saver. Ideally the function should return, but those tests
+ # take noticeable time (performance).
+ if (@boards_found == @stop_count) then
+ print_results
+ exit(0)
+ end
+ end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+ Piece.new( [ :nw, :ne, :east, :east ], 2),
+ Piece.new( [ :ne, :se, :east, :ne ], 7),
+ Piece.new( [ :ne, :east, :ne, :nw ], 1),
+ Piece.new( [ :east, :sw, :sw, :se ], 6),
+ Piece.new( [ :east, :ne, :se, :ne ], 5),
+ Piece.new( [ :east, :east, :east, :se ], 0),
+ Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+ Piece.new( [ :se, :se, :se, :west ], 9),
+ Piece.new( [ :se, :se, :east, :se ], 8),
+ Piece.new( [ :east, :east, :sw, :se ], 3)
+ ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..9884fc4edc
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+ @x, @y, @z = x, y, z
+ @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+ @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+ while i < nbodies
+ b2 = bodies[i]
+ dx = @x - b2.x
+ dy = @y - b2.y
+ dz = @z - b2.z
+
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ mag = dt / (distance * distance * distance)
+ b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+ @vx -= dx * b2_mass_mag
+ @vy -= dy * b2_mass_mag
+ @vz -= dz * b2_mass_mag
+ b2.vx += dx * b_mass_mag
+ b2.vy += dy * b_mass_mag
+ b2.vz += dz * b_mass_mag
+ i += 1
+ end
+
+ @x += dt * @vx
+ @y += dt * @vy
+ @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+ e = 0.0
+ nbodies = bodies.size
+
+ for i in 0 ... nbodies
+ b = bodies[i]
+ e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+ for j in (i + 1) ... nbodies
+ b2 = bodies[j]
+ dx = b.x - b2.x
+ dy = b.y - b2.y
+ dz = b.z - b2.z
+ distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+ e -= (b.mass * b2.mass) / distance
+ end
+ end
+ e
+end
+
+def offset_momentum(bodies)
+ px, py, pz = 0.0, 0.0, 0.0
+
+ for b in bodies
+ m = b.mass
+ px += b.vx * m
+ py += b.vy * m
+ pz += b.vz * m
+ end
+
+ b = bodies[0]
+ b.vx = - px / SOLAR_MASS
+ b.vy = - py / SOLAR_MASS
+ b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+ # sun
+ Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+ # jupiter
+ Planet.new(
+ 4.84143144246472090e+00,
+ -1.16032004402742839e+00,
+ -1.03622044471123109e-01,
+ 1.66007664274403694e-03,
+ 7.69901118419740425e-03,
+ -6.90460016972063023e-05,
+ 9.54791938424326609e-04),
+
+ # saturn
+ Planet.new(
+ 8.34336671824457987e+00,
+ 4.12479856412430479e+00,
+ -4.03523417114321381e-01,
+ -2.76742510726862411e-03,
+ 4.99852801234917238e-03,
+ 2.30417297573763929e-05,
+ 2.85885980666130812e-04),
+
+ # uranus
+ Planet.new(
+ 1.28943695621391310e+01,
+ -1.51111514016986312e+01,
+ -2.23307578892655734e-01,
+ 2.96460137564761618e-03,
+ 2.37847173959480950e-03,
+ -2.96589568540237556e-05,
+ 4.36624404335156298e-05),
+
+ # neptune
+ Planet.new(
+ 1.53796971148509165e+01,
+ -2.59193146099879641e+01,
+ 1.79258772950371181e-01,
+ 2.68067772490389322e-03,
+ 1.62824170038242295e-03,
+ -9.51592254519715870e-05,
+ 5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+ i = 0
+ while i < nbodies
+ b = BODIES[i]
+ b.move_from_i(BODIES, nbodies, dt, i + 1)
+ i += 1
+ end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ n.times do
+ x += 1
+ end
+ end
+ end
+ end
+ end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/bm_so_nsieve.rb
+++ b/benchmark/so_nsieve.rb
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
index 6f958ee44e..6f958ee44e 100644
--- a/benchmark/bm_so_nsieve_bits.rb
+++ b/benchmark/so_nsieve_bits.rb
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+ def initialize(start_state)
+ @bool = start_state
+ end
+
+ def value
+ @bool
+ end
+
+ def activate
+ @bool = !@bool
+ self
+ end
+end
+
+class NthToggle < Toggle
+ def initialize(start_state, max_counter)
+ super start_state
+ @count_max = max_counter
+ @counter = 0
+ end
+
+ def activate
+ @counter += 1
+ if @counter >= @count_max
+ @bool = !@bool
+ @counter = 0
+ end
+ self
+ end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+ toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+ ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+ ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/bm_so_partial_sums.rb
+++ b/benchmark/so_partial_sums.rb
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
new file mode 100644
index 0000000000..9a537b2d1c
--- /dev/null
+++ b/benchmark/so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+ def initialize()
+ @z = Transformation.new 1,0,0,1
+ @x = Transformation.new 0,0,0,0
+ @inverse = Transformation.new 0,0,0,0
+ end
+
+ def next!
+ @y = @z.extract(3)
+ if safe? @y
+ @z = produce(@y)
+ @y
+ else
+ @z = consume @x.next!()
+ next!()
+ end
+ end
+
+ def safe?(digit)
+ digit == @z.extract(4)
+ end
+
+ def produce(i)
+ @inverse.qrst(10,-10*i,0,1).compose(@z)
+ end
+
+ def consume(a)
+ @z.compose(a)
+ end
+end
+
+
+class Transformation
+ attr_reader :q, :r, :s, :t
+ def initialize(q, r, s, t)
+ @q,@r,@s,@t,@k = q,r,s,t,0
+ end
+
+ def next!()
+ @q = @k = @k + 1
+ @r = 4 * @k + 2
+ @s = 0
+ @t = 2 * @k + 1
+ self
+ end
+
+ def extract(j)
+ (@q * j + @r) / (@s * j + @t)
+ end
+
+ def compose(a)
+ self.class.new( @q * a.q,
+ @q * a.r + r * a.t,
+ @s * a.q + t * a.s,
+ @s * a.r + t * a.t
+ )
+ end
+
+ def qrst *args
+ initialize *args
+ self
+ end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+ if n >= WIDTH
+ WIDTH.times {print digits.next!}
+ j += WIDTH
+ else
+ n.times {print digits.next!}
+ (WIDTH-n).times {print " "}
+ j += n
+ end
+ puts "\t:"+j.to_s
+ n -= WIDTH
+end
+
diff --git a/benchmark/bm_so_random.rb b/benchmark/so_random.rb
index a66b9e8e63..a66b9e8e63 100644
--- a/benchmark/bm_so_random.rb
+++ b/benchmark/so_random.rb
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_reverse_complement
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(2_500_000)
+ script: |
+ # The Great Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ #
+ # Contributed by Peter Bjarke Olsen
+ # Modified by Doug King
+
+ seq=Array.new
+
+ def revcomp(seq)
+ seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+ stringlen=seq.length
+ 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+ while input.gets
+ if $_ =~ />/
+ if seq.length != 0
+ revcomp(seq.join)
+ seq=Array.new
+ end
+ puts $_
+ else
+ $_.sub(/\n/,'')
+ seq.push $_
+ end
+ end
+ revcomp(seq.join)
+ loop_count: 1
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/so_sieve.rb
index 43dc302648..43dc302648 100644
--- a/benchmark/bm_so_sieve.rb
+++ b/benchmark/so_sieve.rb
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/bm_so_spectralnorm.rb
+++ b/benchmark/so_spectralnorm.rb
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+ str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+benchmark:
+ capitalize-1: str1.capitalize
+ capitalize-10: str10.capitalize
+ capitalize-100: str100.capitalize
+ capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..2354040a04
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,26 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10
+ lstr1000 = lstr100 * 10
+ lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ lnonascii10 = lnonascii1 * 10
+ lnonascii100 = lnonascii10 * 10
+ lnonascii1000 = lnonascii100 * 10
+ ustr1 = [*"A".."Z",*"0".."9"].join("")
+ ustr10 = ustr1 * 10
+ ustr100 = ustr10 * 10
+ ustr1000 = ustr100 * 10
+ unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ unonascii10 = unonascii1 * 10
+ unonascii100 = unonascii10 * 10
+ unonascii1000 = unonascii100 * 10
+benchmark:
+ casecmp-1: lstr1.casecmp(ustr1)
+ casecmp-10: lstr10.casecmp(ustr10)
+ casecmp-100: lstr100.casecmp(ustr100)
+ casecmp-1000: lstr1000.casecmp(ustr1000)
+ casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+ casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+ casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+ casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+ lstr1 = [*"a".."z",*"0".."9"].join("")
+ lstr10 = lstr1 * 10
+ lstr100 = lstr10 * 10
+ lstr1000 = lstr100 * 10
+ lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ lnonascii10 = lnonascii1 * 10
+ lnonascii100 = lnonascii10 * 10
+ lnonascii1000 = lnonascii100 * 10
+ ustr1 = [*"A".."Z",*"0".."9"].join("")
+ ustr10 = ustr1 * 10
+ ustr100 = ustr10 * 10
+ ustr1000 = ustr100 * 10
+ unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ unonascii10 = unonascii1 * 10
+ unonascii100 = unonascii10 * 10
+ unonascii1000 = unonascii100 * 10
+benchmark:
+ casecmp_p-1: lstr1.casecmp?(ustr1)
+ casecmp_p-10: lstr10.casecmp?(ustr10)
+ casecmp_p-100: lstr100.casecmp?(ustr100)
+ casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+ casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+ casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+ casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+ casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
new file mode 100644
index 0000000000..e65c00cca9
--- /dev/null
+++ b/benchmark/string_concat.yml
@@ -0,0 +1,45 @@
+prelude: |
+ CHUNK = "a" * 64
+ UCHUNK = "é" * 32
+ GC.disable # GC causes a lot of variance
+benchmark:
+ binary_concat_7bit: |
+ buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ utf8_concat_7bit: |
+ buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+ utf8_concat_UTF8: |
+ buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+ interpolation: |
+ buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+ "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"A".."Z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ downcase-1: str1.upcase
+ downcase-10: str10.upcase
+ downcase-100: str100.upcase
+ downcase-1000: str1000.upcase
+ downcase-nonascii1: nonascii1.downcase
+ downcase-nonascii10: nonascii10.downcase
+ downcase-nonascii100: nonascii100.downcase
+ downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
new file mode 100644
index 0000000000..7783111082
--- /dev/null
+++ b/benchmark/string_index.rb
@@ -0,0 +1,3 @@
+str1 = "あ" * 1024 + "い" # not single byte optimizable
+str2 = "い"
+100_000.times { str1.index(str2) }
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
new file mode 100644
index 0000000000..b0d60201a9
--- /dev/null
+++ b/benchmark/string_scan_re.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
new file mode 100644
index 0000000000..42440bd948
--- /dev/null
+++ b/benchmark/string_scan_str.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan('abc') }
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+ long_string = "x"*1000+"-hår"
+benchmark:
+ regexp-short: |
+ "x-hår".slice!(/-(.)(.)(.)/, 3)
+ regexp-long: |
+ long_string.dup.slice!(/-(.)(.)(.)/, 3)
+ string-short: |
+ "x-hår".slice!("r")
+ string-long: |
+ long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+ str1 = [*0..5].join(" ") + " "
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+benchmark:
+ to_chars-1: str1.split('')
+ to_chars-10: str10.split('')
+ to_chars-100: str100.split('')
+ to_chars-1000: str1000.split('')
+ to_words-1: str1.split(' ')
+ to_words-10: str10.split(' ')
+ to_words-100: str100.split(' ')
+ to_words-1000: str1000.split(' ')
+ re_chars-1: str1.split(//)
+ re_chars-10: str10.split(//)
+ re_chars-100: str100.split(//)
+ re_chars-1000: str1000.split(//)
+ re_space-1: str1.split(/ /)
+ re_space-10: str10.split(/ /)
+ re_space-100: str100.split(/ /)
+ re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ swapcase-1: str1.swapcase
+ swapcase-10: str10.swapcase
+ swapcase-100: str100.swapcase
+ swapcase-1000: str1000.swapcase
+ swapcase-nonascii1: nonascii1.swapcase
+ swapcase-nonascii10: nonascii10.swapcase
+ swapcase-nonascii100: nonascii100.swapcase
+ swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+ str1 = [*"a".."z",*"0".."9"].join("")
+ str10 = str1 * 10
+ str100 = str10 * 10
+ str1000 = str100 * 10
+ nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+ nonascii10 = nonascii1 * 10
+ nonascii100 = nonascii10 * 10
+ nonascii1000 = nonascii100 * 10
+benchmark:
+ upcase-1: str1.upcase
+ upcase-10: str10.upcase
+ upcase-100: str100.upcase
+ upcase-1000: str1000.upcase
+ upcase-nonascii1: nonascii1.upcase
+ upcase-nonascii10: nonascii10.upcase
+ upcase-nonascii100: nonascii100.upcase
+ upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+ # frozen_string_literal: true
+benchmark:
+ - 'Time.at(0)'
+ - 'Time.at(0, 500)'
+ - 'Time.at(0, in: "+09:00")'
+ - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - 'Time.new(2021)'
+ - 'Time.new(2021, 8, 22)'
+ - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_now.yml b/benchmark/time_now.yml
new file mode 100644
index 0000000000..f6d6a31489
--- /dev/null
+++ b/benchmark/time_now.yml
@@ -0,0 +1,3 @@
+benchmark:
+ - 'Time.now'
+ - 'Time.now(in: "+09:00")'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..6060b58bc6
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,10 @@
+prelude: |
+ require 'time'
+ inspect = "2021-08-23 09:57:02 +0900"
+ iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+ - Time.iso8601(iso8601)
+ - Time.parse(iso8601)
+ - Time.parse(inspect)
+ - Time.new(iso8601) rescue Time.iso8601(iso8601)
+ - Time.new(inspect) rescue Time.parse(inspect)
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'time'
+benchmark:
+ - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+ - Time.strptime("1", "%s")
+ - Time.strptime("0 +0100", "%s %z")
+ - Time.strptime("0 UTC", "%s %z")
+ - Time.strptime("1.5", "%s.%N")
+ - Time.strptime("1.000000000001", "%s.%N")
+ - Time.strptime("20010203 -0200", "%Y%m%d %z")
+ - Time.strptime("20010203 UTC", "%Y%m%d %z")
+ - Time.strptime("2018-365", "%Y-%j")
+ - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
new file mode 100644
index 0000000000..505021c701
--- /dev/null
+++ b/benchmark/time_subsec.rb
@@ -0,0 +1,2 @@
+t = Time.now
+4000000.times { t.subsec }
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_array: |
+ a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ attr_reader :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+ end
+ obj = C.new
+benchmark:
+ vm_attr_ivar: |
+ j = obj.a
+ k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ attr_accessor :a, :b
+ def initialize
+ @a = nil
+ @b = nil
+ end
+ end
+ obj = C.new
+benchmark:
+ vm_attr_ivar_set: |
+ obj.a = 1
+ obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/vm_backtrace.rb
index 0fbf73e1ca..0fbf73e1ca 100644
--- a/benchmark/bm_vm3_backtrace.rb
+++ b/benchmark/vm_backtrace.rb
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+ vm_bigarray: |
+ a = [
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ 1,2,3,4,5,6,7,8,9,10,
+ ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_bighash: |
+ a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+ def m
+ yield
+ end
+benchmark:
+ vm_block: |
+ m{
+ }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+ p = proc{_1}
+ o = Object.new
+ def o.each
+ i = 0
+ while i < 3_000_000 do
+ yield i
+ i += 1
+ end
+ end
+
+benchmark:
+ - name: block_handler_type_iseq
+ script: |
+ o.each{_1}
+
+ - name: block_handler_type_symbol
+ script: |
+ o.each(&:itself)
+
+ - name: block_handler_type_proc
+ script: |
+ o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+ def m &b
+ end
+benchmark:
+ vm_blockparam: |
+ m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644
index 0000000000..a7d8d366ea
--- /dev/null
+++ b/benchmark/vm_blockparam_call.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m &b
+ b.call
+ end
+benchmark:
+ vm_blockparam_call: |
+ m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml
new file mode 100644
index 0000000000..841f5e7a63
--- /dev/null
+++ b/benchmark/vm_blockparam_pass.yml
@@ -0,0 +1,12 @@
+prelude: |
+ def bp_yield
+ yield
+ end
+
+ def bp_pass &b
+ bp_yield &b
+ end
+benchmark:
+ vm_blockparam_pass: |
+ bp_pass{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml
new file mode 100644
index 0000000000..8ea9b46ed2
--- /dev/null
+++ b/benchmark/vm_blockparam_yield.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def bp_yield &b
+ yield
+ end
+benchmark:
+ vm_blockparam_yield: |
+ bp_yield{}
+loop_count: 30000000
diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml
new file mode 100644
index 0000000000..b26a491a15
--- /dev/null
+++ b/benchmark/vm_case.yml
@@ -0,0 +1,13 @@
+benchmark:
+ vm_case: |
+ case :foo
+ when :bar
+ raise
+ when :baz
+ raise
+ when :boo
+ raise
+ when :foo
+ # noop
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml
new file mode 100644
index 0000000000..cacc4f0464
--- /dev/null
+++ b/benchmark/vm_case_classes.yml
@@ -0,0 +1,9 @@
+benchmark:
+ vm_case_classes: |
+ case :foo
+ when Hash
+ raise
+ when Array
+ raise
+ end
+loop_count: 6000000
diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml
new file mode 100644
index 0000000000..9f91801544
--- /dev/null
+++ b/benchmark/vm_case_lit.yml
@@ -0,0 +1,23 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_case_lit: |
+ i = 0
+ @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+ def foo(i)
+ @ret[i % @ret.size]
+ end
+
+ while i<6_000_000
+ case foo(i)
+ when "foo" then :foo
+ when true then true
+ when false then false
+ when :sym then :sym
+ when 6 then :fix
+ when nil then nil
+ when 0.1 then :float
+ when 0xffffffffffffffff then :big
+ end
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb
index 9661323cd2..9661323cd2 100644
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ b/benchmark/vm_clearmethodcache.rb
diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml
new file mode 100644
index 0000000000..8939ca0cd3
--- /dev/null
+++ b/benchmark/vm_const.yml
@@ -0,0 +1,13 @@
+prelude: |
+ Const = 1
+ A = B = C = D = E = F = G = H = I = J = K = L = M = N = O = P = Q = R = S = T = U = V = W = X = Y = Z = 1
+ def foo
+ A; B; C; D; E; F; G; H; I; J; K; L; M; N; O; P; Q; R; S; T; U; V; W; X; Y; Z
+ end
+benchmark:
+ vm_const: |
+ j = Const
+ k = Const
+ vm_const_many: |
+ foo
+loop_count: 30000000
diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml
new file mode 100644
index 0000000000..1d0e161829
--- /dev/null
+++ b/benchmark/vm_cvar.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class A
+ @@foo = 1
+
+ def self.foo
+ @@foo
+ end
+
+ ("A".."Z").each do |module_name|
+ eval <<-EOM
+ module #{module_name}
+ end
+
+ include #{module_name}
+ EOM
+ end
+ end
+benchmark:
+ vm_cvar: A.foo
+loop_count: 600000
diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml
new file mode 100644
index 0000000000..347e0cfd33
--- /dev/null
+++ b/benchmark/vm_defined_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+ class Object
+ define_method(:m){}
+ end
+benchmark:
+ vm_defined_method: |
+ m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml
new file mode 100644
index 0000000000..30c7a3193c
--- /dev/null
+++ b/benchmark/vm_dstr.yml
@@ -0,0 +1,6 @@
+prelude: |
+ x = y = 'z'
+benchmark:
+ vm_dstr: |
+ str = "foo#{x}bar#{y}baz"
+loop_count: 6000000
diff --git a/benchmark/vm_dstr_ary.rb b/benchmark/vm_dstr_ary.rb
new file mode 100644
index 0000000000..1d3aa3b97b
--- /dev/null
+++ b/benchmark/vm_dstr_ary.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = []
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_bool.rb b/benchmark/vm_dstr_bool.rb
new file mode 100644
index 0000000000..631ca54755
--- /dev/null
+++ b/benchmark/vm_dstr_bool.rb
@@ -0,0 +1,7 @@
+i = 0
+x = true
+y = false
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb
new file mode 100644
index 0000000000..becf0861c7
--- /dev/null
+++ b/benchmark/vm_dstr_class_module.rb
@@ -0,0 +1,10 @@
+i = 0
+class A; end unless defined?(A)
+module B; end unless defined?(B)
+x = A
+y = B
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
+
diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb
new file mode 100644
index 0000000000..caaa395192
--- /dev/null
+++ b/benchmark/vm_dstr_digit.rb
@@ -0,0 +1,7 @@
+i = 0
+x = 0
+y = 9
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_int.rb b/benchmark/vm_dstr_int.rb
new file mode 100644
index 0000000000..ed380d7595
--- /dev/null
+++ b/benchmark/vm_dstr_int.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{i}bar#{i}baz"
+end
diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb
new file mode 100644
index 0000000000..ec4f5d6c67
--- /dev/null
+++ b/benchmark/vm_dstr_nil.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = nil
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb
new file mode 100644
index 0000000000..fb78637ead
--- /dev/null
+++ b/benchmark/vm_dstr_obj.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = Object.new
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb
new file mode 100644
index 0000000000..99ff7b98fb
--- /dev/null
+++ b/benchmark/vm_dstr_obj_def.rb
@@ -0,0 +1,8 @@
+i = 0
+o = Object.new
+def o.to_s; -""; end
+x = y = o
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_str.rb b/benchmark/vm_dstr_str.rb
new file mode 100644
index 0000000000..45fc107892
--- /dev/null
+++ b/benchmark/vm_dstr_str.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = ""
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_sym.rb b/benchmark/vm_dstr_sym.rb
new file mode 100644
index 0000000000..484b8f8150
--- /dev/null
+++ b/benchmark/vm_dstr_sym.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = :z
+while i<6_000_000 # benchmark loop 2
+ i += 1
+ str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml
new file mode 100644
index 0000000000..4ea62f30de
--- /dev/null
+++ b/benchmark/vm_ensure.yml
@@ -0,0 +1,14 @@
+# Not utilizing loop_count since using it for this is too unstable for now
+benchmark:
+ vm_ensure: |
+ i = 0
+ while i<30_000_000
+ i += 1
+ begin
+ begin
+ ensure
+ end
+ ensure
+ end
+ end
+loop_count: 1
diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml
new file mode 100644
index 0000000000..7ba1a8d1de
--- /dev/null
+++ b/benchmark/vm_eval.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_eval: |
+ eval("1")
+loop_count: 6000000
diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml
new file mode 100644
index 0000000000..b5a54e1ddf
--- /dev/null
+++ b/benchmark/vm_fiber_allocate.yml
@@ -0,0 +1,8 @@
+prelude: |
+ # Disable GC to see raw throughput:
+ GC.disable
+benchmark:
+ vm_fiber_allocate: |
+ fiber = Fiber.new{Fiber.yield}
+ fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml
new file mode 100644
index 0000000000..b83d3152d4
--- /dev/null
+++ b/benchmark/vm_fiber_count.yml
@@ -0,0 +1,10 @@
+# On Linux, you will need to increase the maximum number of memory maps:
+# sudo sysctl -w vm.max_map_count=200000
+prelude: |
+ fibers = []
+benchmark:
+ vm_fiber_count: |
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml
new file mode 100644
index 0000000000..4ca41085b1
--- /dev/null
+++ b/benchmark/vm_fiber_reuse.yml
@@ -0,0 +1,14 @@
+prelude: |
+ GC.disable
+ fibers = []
+benchmark:
+ vm_fiber_reuse: |
+ 1024.times do
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+ end
+
+ fibers.clear
+ GC.start
+loop_count: 200
diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml
new file mode 100644
index 0000000000..892622f121
--- /dev/null
+++ b/benchmark/vm_fiber_reuse_gc.yml
@@ -0,0 +1,12 @@
+# https://bugs.ruby-lang.org/issues/16009
+prelude: |
+ fibers = []
+benchmark:
+ vm_fiber_reuse_gc: |
+ 2000.times do
+ fiber = Fiber.new{Fiber.yield}
+ fibers << fiber
+ fiber.resume
+ end
+ fibers.clear
+loop_count: 100
diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml
new file mode 100644
index 0000000000..3de36b66eb
--- /dev/null
+++ b/benchmark/vm_fiber_switch.yml
@@ -0,0 +1,9 @@
+prelude: |
+ # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+ fib = Fiber.new do
+ loop { Fiber.yield }
+ end
+benchmark:
+ vm_fiber_switch: |
+ fib.resume
+loop_count: 20000000
diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml
new file mode 100644
index 0000000000..92f5fd52ab
--- /dev/null
+++ b/benchmark/vm_float_simple.yml
@@ -0,0 +1,8 @@
+prelude: |
+ f = 0.0
+benchmark:
+ vm_float_simple: |
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+ f += 0.1; f -= 0.1
+loop_count: 30000000
diff --git a/benchmark/vm_freezeobj.yml b/benchmark/vm_freezeobj.yml
new file mode 100644
index 0000000000..69a795a354
--- /dev/null
+++ b/benchmark/vm_freezeobj.yml
@@ -0,0 +1,6 @@
+prelude: |
+ objs = 100000.times.map { Object.new }
+benchmark:
+ vm_freeze_obj: |
+ objs.map(&:freeze)
+loop_count: 600
diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml
new file mode 100644
index 0000000000..facc9aa043
--- /dev/null
+++ b/benchmark/vm_freezestring.yml
@@ -0,0 +1,10 @@
+prelude: |
+ class String
+ def freeze
+ -self
+ end
+ end
+benchmark:
+ vm_freezestring: |
+ "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
+loop_count: 6000000
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/vm_gc.rb
index e668026915..e668026915 100644
--- a/benchmark/bm_vm3_gc.rb
+++ b/benchmark/vm_gc.rb
diff --git a/benchmark/bm_vm3_gc_old_full.rb b/benchmark/vm_gc_old_full.rb
index cfdfc8c5a5..cfdfc8c5a5 100644
--- a/benchmark/bm_vm3_gc_old_full.rb
+++ b/benchmark/vm_gc_old_full.rb
diff --git a/benchmark/bm_vm3_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb
index ad22feb655..ad22feb655 100644
--- a/benchmark/bm_vm3_gc_old_immediate.rb
+++ b/benchmark/vm_gc_old_immediate.rb
diff --git a/benchmark/bm_vm3_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb
index b74d44baf1..b74d44baf1 100644
--- a/benchmark/bm_vm3_gc_old_lazy.rb
+++ b/benchmark/vm_gc_old_lazy.rb
diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml
new file mode 100644
index 0000000000..29c803fee3
--- /dev/null
+++ b/benchmark/vm_gc_short_lived.yml
@@ -0,0 +1,9 @@
+benchmark:
+ vm_gc_short_lived: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml
new file mode 100644
index 0000000000..4b6c3ed7b9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_complex_long.yml
@@ -0,0 +1,25 @@
+prelude: |
+ def nested_hash h, n
+ if n == 0
+ ''
+ else
+ 10.times{
+ h[Object.new] = nested_hash(h, n-1)
+ }
+ end
+ end
+
+ long_lived = Hash.new
+ nested_hash long_lived, 6
+
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_complex_long: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml
new file mode 100644
index 0000000000..03ba0f95a9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_long.yml
@@ -0,0 +1,13 @@
+prelude: |
+ long_lived = Array.new(1_000_000){|i| "#{i}"}
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_long: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml
new file mode 100644
index 0000000000..129b8bf4ed
--- /dev/null
+++ b/benchmark/vm_gc_short_with_symbol.yml
@@ -0,0 +1,13 @@
+prelude: |
+ 50_000.times{|i| sym = "sym#{i}".to_sym}
+ GC.start
+ GC.start
+benchmark:
+ vm_gc_short_with_symbol: |
+ a = '' # short-lived String
+ b = ''
+ c = ''
+ d = ''
+ e = ''
+ f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml
new file mode 100644
index 0000000000..e3293e72d0
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary.yml
@@ -0,0 +1,12 @@
+prelude: |
+ short_lived_ary = []
+
+ if RUBY_VERSION >= "2.2.0"
+ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_ary: |
+ short_lived_ary[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml
new file mode 100644
index 0000000000..003995945b
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary_promoted.yml
@@ -0,0 +1,15 @@
+prelude: |
+ long_lived = []
+
+ if RUBY_VERSION > "2.2.0"
+ 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+ elsif
+ GC.start
+ end
+
+ short_lived = ''
+
+benchmark:
+ vm_gc_wb_ary_promoted: |
+ long_lived[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml
new file mode 100644
index 0000000000..a2a2ce2d18
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj.yml
@@ -0,0 +1,15 @@
+prelude: |
+ class C
+ attr_accessor :foo
+ end
+ short_lived_obj = C.new
+
+ if RUBY_VERSION >= "2.2.0"
+ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_obj: |
+ short_lived_obj.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml
new file mode 100644
index 0000000000..00a454ba72
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj_promoted.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class C
+ attr_accessor :foo
+ end
+ long_lived = C.new
+
+ if RUBY_VERSION >= "2.2.0"
+ 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+ elsif
+ GC.start
+ end
+
+ short_lived = ''
+benchmark:
+ vm_gc_wb_obj_promoted: |
+ long_lived.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml
new file mode 100644
index 0000000000..21bb7db247
--- /dev/null
+++ b/benchmark/vm_iclass_super.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class C
+ def m
+ 1
+ end
+
+ ("A".."M").each do |module_name|
+ eval <<-EOM
+ module #{module_name}
+ def m; super; end
+ end
+ prepend #{module_name}
+ EOM
+ end
+ end
+
+ obj = C.new
+benchmark:
+ vm_iclass_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml
new file mode 100644
index 0000000000..119531d5ef
--- /dev/null
+++ b/benchmark/vm_ivar.yml
@@ -0,0 +1,6 @@
+prelude: "@a = 1\n"
+benchmark:
+ vm_ivar: |
+ j = @a
+ k = @a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_embedded_obj_init.yml b/benchmark/vm_ivar_embedded_obj_init.yml
new file mode 100644
index 0000000000..74fe20a630
--- /dev/null
+++ b/benchmark/vm_ivar_embedded_obj_init.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_embedded_obj_init: |
+ c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_extended_obj_init.yml b/benchmark/vm_ivar_extended_obj_init.yml
new file mode 100644
index 0000000000..f054bab282
--- /dev/null
+++ b/benchmark/vm_ivar_extended_obj_init.yml
@@ -0,0 +1,16 @@
+prelude: |
+ class C
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ @d = nil
+ @e = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_extended_obj_init: |
+ c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_get.yml b/benchmark/vm_ivar_generic_get.yml
new file mode 100644
index 0000000000..dae2d37671
--- /dev/null
+++ b/benchmark/vm_ivar_generic_get.yml
@@ -0,0 +1,17 @@
+prelude: |
+ class C < Array
+ attr_reader :a, :b, :c
+ def initialize
+ @a = nil
+ @b = nil
+ @c = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_generic_get: |
+ c.a
+ c.b
+ c.c
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_set.yml b/benchmark/vm_ivar_generic_set.yml
new file mode 100644
index 0000000000..102a6577fb
--- /dev/null
+++ b/benchmark/vm_ivar_generic_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+ class C < Array
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ end
+ end
+
+ c = C.new
+benchmark:
+ vm_ivar_generic_set: |
+ c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_get.yml b/benchmark/vm_ivar_get.yml
new file mode 100644
index 0000000000..9174af6965
--- /dev/null
+++ b/benchmark/vm_ivar_get.yml
@@ -0,0 +1,37 @@
+prelude: |
+ class Example
+ def initialize
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+ @levar = 1
+ end
+
+ def get_value_loop
+ sum = 0
+
+ i = 0
+ while i < 1000000
+ # 10 times to de-emphasize loop overhead
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ sum += @levar
+ i += 1
+ end
+
+ return sum
+ end
+ end
+
+ obj = Example.new
+benchmark:
+ vm_ivar_get: |
+ obj.get_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_get_unintialized.yml b/benchmark/vm_ivar_get_unintialized.yml
new file mode 100644
index 0000000000..a1ccfb06ce
--- /dev/null
+++ b/benchmark/vm_ivar_get_unintialized.yml
@@ -0,0 +1,12 @@
+prelude: |
+ class Example
+ def read
+ @uninitialized
+ end
+ end
+
+ obj = Example.new
+benchmark:
+ vm_ivar_get_uninitialized: |
+ obj.read
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_lazy_set.yml b/benchmark/vm_ivar_lazy_set.yml
new file mode 100644
index 0000000000..7372ffcfbc
--- /dev/null
+++ b/benchmark/vm_ivar_lazy_set.yml
@@ -0,0 +1,12 @@
+prelude: |
+ class Example
+ def lazy_set
+ @uninitialized ||= 123
+ end
+ end
+
+ objs = 10000000.times.map { Example.new }
+benchmark:
+ vm_ivar_lazy_set: |
+ objs.each(&:lazy_set)
+loop_count: 1
diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml
new file mode 100644
index 0000000000..172e28b2fd
--- /dev/null
+++ b/benchmark/vm_ivar_of_class.yml
@@ -0,0 +1,12 @@
+prelude: |
+ class C
+ @a = 1
+ def self.a
+ _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+ _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+ end
+ end
+benchmark:
+ vm_ivar_of_class: |
+ a = C.a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml
new file mode 100644
index 0000000000..2ea5199423
--- /dev/null
+++ b/benchmark/vm_ivar_of_class_set.yml
@@ -0,0 +1,11 @@
+prelude: |
+ class C
+ @a = 1
+ def self.a o
+ @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;
+ end
+ end
+benchmark:
+ vm_ivar_of_class_set: |
+ a = C.a(nil)
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml
new file mode 100644
index 0000000000..8bbb60043b
--- /dev/null
+++ b/benchmark/vm_ivar_set.yml
@@ -0,0 +1,5 @@
+benchmark:
+ vm_ivar_set: |
+ @a = 1
+ @b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set_on_instance.yml b/benchmark/vm_ivar_set_on_instance.yml
new file mode 100644
index 0000000000..91857b7742
--- /dev/null
+++ b/benchmark/vm_ivar_set_on_instance.yml
@@ -0,0 +1,35 @@
+prelude: |
+ class TheClass
+ def initialize
+ @v0 = 1
+ @v1 = 2
+ @v3 = 3
+ @levar = 1
+ end
+
+ def set_value_loop
+ # 1M
+ i = 0
+ while i < 1000000
+ # 10 times to de-emphasize loop overhead
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ @levar = i
+ i += 1
+ end
+ end
+ end
+
+ obj = TheClass.new
+
+benchmark:
+ vm_ivar_set_on_instance: |
+ obj.set_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml
new file mode 100644
index 0000000000..bc8bf5bf6b
--- /dev/null
+++ b/benchmark/vm_ivar_set_subclass.yml
@@ -0,0 +1,20 @@
+prelude: |
+ class A
+ def set_ivars
+ @a = nil
+ @b = nil
+ @c = nil
+ @d = nil
+ @e = nil
+ end
+ end
+ class B < A; end
+ class C < A; end
+
+ b = B.new
+ c = C.new
+benchmark:
+ vm_ivar_init_subclass: |
+ b.set_ivars
+ c.set_ivars
+loop_count: 3000000
diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml
new file mode 100644
index 0000000000..5fd94e7d86
--- /dev/null
+++ b/benchmark/vm_length.yml
@@ -0,0 +1,8 @@
+prelude: |
+ a = 'abc'
+ b = [1, 2, 3]
+benchmark:
+ vm_length: |
+ a.length
+ b.length
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_cond_set.yml b/benchmark/vm_lvar_cond_set.yml
new file mode 100644
index 0000000000..1845f9d12e
--- /dev/null
+++ b/benchmark/vm_lvar_cond_set.yml
@@ -0,0 +1,8 @@
+benchmark:
+ vm_lvar_cond_set: |
+ a ||= 1
+ b ||= 1
+ c ||= 1
+ d ||= 1
+ nil
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml
new file mode 100644
index 0000000000..70a9b1c0ca
--- /dev/null
+++ b/benchmark/vm_lvar_init.yml
@@ -0,0 +1,21 @@
+# while loop cost is not removed because `i` is used in the script
+benchmark:
+ vm_lvar_init: |
+ def m v
+ unless v
+ # unreachable code
+ v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+ v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+ v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+ v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+ v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+ end
+ end
+
+ i = 0
+
+ while i<30_000_000
+ i += 1
+ m i
+ end
+loop_count: 1
diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml
new file mode 100644
index 0000000000..f29f763d81
--- /dev/null
+++ b/benchmark/vm_lvar_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_lvar_set: |
+ a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+loop_count: 30000000
diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml
new file mode 100644
index 0000000000..d45e4ec572
--- /dev/null
+++ b/benchmark/vm_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m
+ nil
+ end
+benchmark:
+ vm_method: |
+ m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml
new file mode 100644
index 0000000000..3da456c0bb
--- /dev/null
+++ b/benchmark/vm_method_missing.yml
@@ -0,0 +1,11 @@
+prelude: |
+ class C
+ def method_missing mid
+ end
+ end
+
+ obj = C.new
+benchmark:
+ vm_method_missing: |
+ obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml
new file mode 100644
index 0000000000..281a481394
--- /dev/null
+++ b/benchmark/vm_method_with_block.yml
@@ -0,0 +1,8 @@
+prelude: |
+ def m
+ nil
+ end
+benchmark:
+ vm_method_with_block: |
+ m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+loop_count: 6000000
diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml
new file mode 100644
index 0000000000..243229ba4a
--- /dev/null
+++ b/benchmark/vm_module_ann_const_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_module_ann_const_set: |
+ Module.new.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml
new file mode 100644
index 0000000000..e5a24181a9
--- /dev/null
+++ b/benchmark/vm_module_const_set.yml
@@ -0,0 +1,8 @@
+prelude: |
+ module M
+ end
+ $VERBOSE = nil
+benchmark:
+ vm_module_const_set: |
+ M.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml
new file mode 100644
index 0000000000..abcf1e28ce
--- /dev/null
+++ b/benchmark/vm_mutex.yml
@@ -0,0 +1,8 @@
+prelude: |
+ require 'thread'
+
+ m = Thread::Mutex.new
+benchmark:
+ vm_mutex: |
+ m.synchronize{}
+loop_count: 6000000
diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml
new file mode 100644
index 0000000000..fb04d15ae8
--- /dev/null
+++ b/benchmark/vm_neq.yml
@@ -0,0 +1,7 @@
+prelude: |
+ obj1 = Object.new
+ obj2 = Object.new
+benchmark:
+ vm_neq: |
+ obj1 != obj2
+loop_count: 30000000
diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml
new file mode 100644
index 0000000000..0b9787d91a
--- /dev/null
+++ b/benchmark/vm_newlambda.yml
@@ -0,0 +1,4 @@
+benchmark:
+ vm_newlambda: |
+ lambda {}
+loop_count: 6000000
diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml
new file mode 100644
index 0000000000..c68dde3c50
--- /dev/null
+++ b/benchmark/vm_not.yml
@@ -0,0 +1,6 @@
+prelude: |
+ obj = Object.new
+benchmark:
+ vm_not: |
+ !obj
+loop_count: 30000000
diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml
new file mode 100644
index 0000000000..dd2f4e71de
--- /dev/null
+++ b/benchmark/vm_poly_method.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_method: |
+ class C1
+ def m
+ 1
+ end
+ end
+ class C2
+ def m
+ 2
+ end
+ end
+
+ o1 = C1.new
+ o2 = C2.new
+
+ i = 0
+ while i<6_000_000
+ o = (i % 2 == 0) ? o1 : o2
+ o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml
new file mode 100644
index 0000000000..bca1b62729
--- /dev/null
+++ b/benchmark/vm_poly_method_ov.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+ vm_poly_method_ov: |
+ class C1
+ def m
+ 1
+ end
+ end
+ class C2
+ def m
+ 2
+ end
+ end
+
+ o1 = C1.new
+ o2 = C2.new
+
+ i = 0
+ while i<6_000_000
+ o = (i % 2 == 0) ? o1 : o2
+ # o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+ i += 1
+ end
+loop_count: 1
diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml
new file mode 100644
index 0000000000..6c5404ac84
--- /dev/null
+++ b/benchmark/vm_poly_same_method.yml
@@ -0,0 +1,25 @@
+prelude: |
+ module AR; end
+ class AR::Base
+ def create_or_update
+ nil
+ end
+ def save
+ create_or_update
+ end
+ end
+ class Foo < AR::Base; end
+ class Bar < AR::Base; end
+ o1 = Foo.new
+ o2 = Bar.new
+benchmark:
+ vm_poly_same_method: |
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+ o1.save; o2.save;
+loop_count: 6000000
diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml
new file mode 100644
index 0000000000..c7923160fb
--- /dev/null
+++ b/benchmark/vm_poly_singleton.yml