13567 files changed, 1746264 insertions, 896717 deletions

diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei.  All rights reserved.
+;;
+;; This file is a part of  the programming language Ruby.  Permission is hereby
+;; granted, to either  redistribute and/or modify this file,  provided that the
+;; conditions mentioned  in the  file COPYING  are met.   Consult the  file for
+;; details.
+
+((nil .
+     ((indent-tabs-mode . nil)
+      (require-final-newline . t)
+      (tab-width . 8)
+      (show-trailing-whitespace . t)
+      (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+     ((buffer-file-coding-system . us-ascii)
+      (indent-tabs-mode . t)
+      (change-log-indent-text . 2)
+      (add-log-time-format . (lambda (&optional x y)
+        (let* ((time (or x (current-time)))
+	       (system-time-locale "C")
+	       (diff (+ (cadr time) 32400))
+	       (lo (% diff 65536))
+	       (hi (+ (car time) (/ diff 65536))))
+        (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index eeb565b08b..753d6f9892 100644
--- a/.document
+++ b/.document
@@ -9,19 +9,51 @@
 
 # prelude
 prelude.rb
-
 rbconfig.rb
 
+array.rb
+ast.rb
+dir.rb
+gc.rb
+hash.rb
+io.rb
+kernel.rb
+marshal.rb
+numeric.rb
+nilclass.rb
+pack.rb
+pathname_builtin.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
+trace_point.rb
+warning.rb
+yjit.rb
+zjit.rb
+
+# Errno::*
+known_errors.inc
+
 # the lib/ directory (which has its own .document file)
 lib
 
 # and some of the ext/ directory (which has its own .document file)
 ext
 
+# For `prism`, ruby code is in lib and c in the prism folder
+prism
+
 # rdoc files
-NEWS
+NEWS.md
 
 README.md
 README.ja.md
 
+COPYING
+COPYING.ja
+
+LEGAL
+
 doc
diff --git a/.editorconfig b/.editorconfig
index 49cc692091..4633a7acae 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -3,7 +3,7 @@ root = true
 [*]
 end_of_line = lf
 indent_size = 4
-indent_style = tab
+indent_style = space
 insert_final_newline = true
 tab_width = 8
 trim_trailing_whitespace = true
@@ -13,12 +13,18 @@ end_of_line = crlf
 
 [*.gemspec]
 indent_size = 2
-indent_style = space
 
 [*.rb]
 indent_size = 2
-indent_style = space
 
 [*.yml]
 indent_size = 2
-indent_style = space
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
index a188ffa172..4457f6f12b 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,21 +1,7 @@
-define hook-run
-  set $color_type = 0
-  set $color_highlite = 0
-  set $color_end = 0
-end
-
 define ruby_gdb_init
-  if !$color_type
-    set $color_type = "\033[31m"
-  end
-  if !$color_highlite
-    set $color_highlite = "\033[36m"
-  end
-  if !$color_end
-    set $color_end = "\033[m"
-  end
-  if ruby_dummy_gdb_enums.special_consts
-  end
+  init-if-undefined $color_type = "\033[31m"
+  init-if-undefined $color_highlite = "\033[36m"
+  init-if-undefined $color_end = "\033[m"
 end
 
 # set prompt \033[36m(gdb)\033[m\040
@@ -65,7 +51,7 @@ define rp
     printf "%sT_OBJECT%s: ", $color_type, $color_end
     print ((struct RObject *)($arg0))->basic
     if ($flags & ROBJECT_EMBED)
-      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
+      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (RSHAPE_CAPACITY(rb_obj_shape_id($arg0)))
     else
       print (((struct RObject *)($arg0))->as.heap)
       if (((struct RObject*)($arg0))->as.heap.numiv) > 0
@@ -97,13 +83,11 @@ define rp
     set $regsrc = ((struct RRegexp*)($arg0))->src
     set $rsflags = ((struct RBasic*)$regsrc)->flags
     printf "%sT_REGEXP%s: ", $color_type, $color_end
-    set $len = ($rsflags & RUBY_FL_USER1) ? \
-            ((struct RString*)$regsrc)->as.heap.len : \
-            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    set $len = ((struct RString*)($arg0))->len
     set print address off
     output *(char *)(($rsflags & RUBY_FL_USER1) ? \
-	    ((struct RString*)$regsrc)->as.heap.ptr : \
-	    ((struct RString*)$regsrc)->as.ary) @ $len
+            ((struct RString*)$regsrc)->as.heap.ptr : \
+            ((struct RString*)$regsrc)->as.embed.ary) @ $len
     set print address on
     printf " len:%ld ", $len
     if $flags & RUBY_FL_USER6
@@ -124,26 +108,26 @@ define rp
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       printf "(embed) "
       if ($len == 0)
-	printf "{(empty)} "
+        printf "{(empty)} "
       else
-	print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
-	printf " "
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+        printf " "
       end
     else
       set $len = ((struct RArray*)($arg0))->as.heap.len
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       if ($flags & RUBY_FL_USER2)
-	printf "(shared) shared="
-	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
-	printf " "
+        printf "(shared) shared="
+        output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
+        printf " "
       else
-	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+        printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
       end
       if ($len == 0)
-	printf "{(empty)} "
+        printf "{(empty)} "
       else
-	print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
-	printf " "
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+        printf " "
       end
     end
     print (struct RArray *)($arg0)
@@ -154,10 +138,16 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_HASH
     printf "%sT_HASH%s: ", $color_type, $color_end,
-    if ((struct RHash *)($arg0))->ntbl
-      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+    if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+      set $st = (struct st_table *)((uintptr_t)($arg0) + sizeof(struct RHash))
+      printf "st len=%ld ", $st->num_entries
+      print $st
+    else
+      printf "li len=%ld bound=%ld ", \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
+	print (struct ar_table_struct *)((uintptr_t)($arg0) + sizeof(struct RHash))
     end
-    print (struct RHash *)($arg0)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
     set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
@@ -195,12 +185,14 @@ define rp
     print (struct RBasic *)($arg0)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_DATA
-    if ((struct RTypedData *)($arg0))->typed_flag == 1
-      printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
-      print (struct RTypedData *)($arg0)
+    set $data = (struct RTypedData *)($arg0)
+    set $type = (const rb_data_type_t *)($data->type & ~1)
+    printf "%sT_DATA%s(%s): ", $color_type, $color_end, $type->wrap_struct_name
+    print *$type
+    if ($data->type & 1)
+      print (void *)&$data->data
     else
-      printf "%sT_DATA%s: ", $color_type, $color_end
-      print (struct RData *)($arg0)
+      print $data
     end
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
@@ -259,6 +251,10 @@ define rp
     printf "%sT_ZOMBIE%s: ", $color_type, $color_end
     print (struct RData *)($arg0)
   else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+    printf "%sT_MOVED%s: ", $color_type, $color_end
+    print *(struct RMoved *)$arg0
+  else
     printf "%sunknown%s: ", $color_type, $color_end
     print (struct RBasic *)($arg0)
   end
@@ -294,6 +290,7 @@ define rp
   end
   end
   end
+  end
 end
 document rp
   Print a Ruby's VALUE.
@@ -429,13 +426,11 @@ end
 
 define output_string
   set $flags = ((struct RBasic*)($arg0))->flags
-  set $len = ($flags & RUBY_FL_USER1) ? \
-          ((struct RString*)($arg0))->as.heap.len : \
-          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+  set $len = ((struct RString*)($arg0))->len
   if $len > 0
     output *(char *)(($flags & RUBY_FL_USER1) ? \
-	    ((struct RString*)($arg0))->as.heap.ptr : \
-	    ((struct RString*)($arg0))->as.ary) @ $len
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
   else
     output ""
   end
@@ -443,13 +438,11 @@ end
 
 define print_string
   set $flags = ((struct RBasic*)($arg0))->flags
-  set $len = ($flags & RUBY_FL_USER1) ? \
-          ((struct RString*)($arg0))->as.heap.len : \
-          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+  set $len = ((struct RString*)($arg0))->len
   if $len > 0
     printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
-	    ((struct RString*)($arg0))->as.heap.ptr : \
-	    ((struct RString*)($arg0))->as.ary) @ $len
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
   end
 end
 
@@ -532,14 +525,14 @@ document rp_bignum
 end
 
 define rp_class
+  set $class_and_classext = (struct RClass_and_rb_classext_t *)($arg0)
   printf "(struct RClass *) %p", (void*)$arg0
-  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
-    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+  if $class_and_classext->classext->origin_ != (VALUE)$arg0
+    printf " -> %p", $class_and_classext->classext->origin_
   end
   printf "\n"
   rb_classname $arg0
-  print/x *(struct RClass *)($arg0)
-  print *((struct RClass *)($arg0))->ptr
+  print/x *$class_and_classext
 end
 document rp_class
   Print the content of a Class/Module.
@@ -678,11 +671,6 @@ define nd_stts
 end
 
 
-define nd_entry
-  printf "%su3.entry%s: ", $color_highlite, $color_end
-  p ($arg0).u3.entry
-end
-
 define nd_vid
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -698,12 +686,6 @@ define nd_cval
   rp ($arg0).u3.value
 end
 
-
-define nd_cnt
-  printf "%su3.cnt%s: ", $color_highlite, $color_end
-  p ($arg0).u3.cnt
-end
-
 define nd_tbl
   printf "%su1.tbl%s: ", $color_highlite, $color_end
   p ($arg0).u1.tbl
@@ -742,12 +724,6 @@ define nd_lit
   rp ($arg0).u1.value
 end
 
-
-define nd_frml
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
 define nd_rest
   printf "%su2.argc%s: ", $color_highlite, $color_end
   p ($arg0).u2.argc
@@ -774,12 +750,6 @@ define nd_args
   rp ($arg0).u3.node
 end
 
-
-define nd_noex
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
 define nd_defn
   printf "%su3.node%s: ", $color_highlite, $color_end
   rp ($arg0).u3.node
@@ -797,17 +767,6 @@ define nd_new
 end
 
 
-define nd_cfnc
-  printf "%su1.cfunc%s: ", $color_highlite, $color_end
-  p ($arg0).u1.cfunc
-end
-
-define nd_argc
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-
 define nd_cname
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -886,22 +845,22 @@ define rb_numtable_entry
     set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
     while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
       if $rb_numtable_p.k == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p.k
-	set $rb_numtable_rec = $rb_numtable_p.v
-	set $rb_numtable_p = 0
+        set $rb_numtable_key = $rb_numtable_p.k
+        set $rb_numtable_rec = $rb_numtable_p.v
+        set $rb_numtable_p = 0
       else
-	set $rb_numtable_p = $rb_numtable_p + 1
+        set $rb_numtable_p = $rb_numtable_p + 1
       end
     end
   else
     set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
     while $rb_numtable_p
       if $rb_numtable_p->key == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p->key
-	set $rb_numtable_rec = $rb_numtable_p->record
-	set $rb_numtable_p = 0
+        set $rb_numtable_key = $rb_numtable_p->key
+        set $rb_numtable_rec = $rb_numtable_p->record
+        set $rb_numtable_p = 0
       else
-	set $rb_numtable_p = $rb_numtable_p->next
+        set $rb_numtable_p = $rb_numtable_p->next
       end
     end
   end
@@ -939,10 +898,10 @@ document rb_method_entry
 end
 
 define rb_classname
-  # up to 128bit int
-  set $rb_classname = rb_mod_name($arg0)
-  if $rb_classname != RUBY_Qnil
-    rp $rb_classname
+  set $rb_classname = ((struct RClass_and_rb_classext_t*)$arg0)->classext->classpath
+  if $rb_classname != RUBY_Qfalse
+    print_string $rb_classname
+    printf "\n"
   else
     echo anonymous class/module\n
   end
@@ -979,7 +938,7 @@ define iseq
       set $operand_size = ((INSN*)($arg0))->operand_size
       set $operands = ((INSN*)($arg0))->operands
       while $i < $operand_size
-	rp $operands[$i++]
+        rp $operands[$i++]
       end
     end
   end
@@ -997,8 +956,8 @@ end
 
 define rb_ps_vm
   print $ps_vm = (rb_vm_t*)$arg0
-  set $ps_thread_ln = $ps_vm->living_threads.n.next
-  set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
+  set $ps_thread_ln      = $ps_vm->ractor.main_ractor.threads.set.n.next
+  set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
   while 1
     set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
     set $ps_thread = (VALUE)($ps_thread_th->self)
@@ -1015,30 +974,61 @@ end
 
 define print_lineno
   set $cfp = $arg0
-  set $iseq = $cfp->iseq
+  set $iseq = rb_get_cfp_iseq($cfp)
   set $pos = $cfp->pc - $iseq->body->iseq_encoded
   if $pos != 0
     set $pos = $pos - 1
   end
 
-  set $i = 0
-  set $size = $iseq->body->insns_info_size
-  set $table = $iseq->body->insns_info
+  set $index = 0
+  set $size = $iseq->body->insns_info.size
+  set $table = $iseq->body->insns_info.body
+  set $positions = $iseq->body->insns_info.positions
   #printf "size: %d\n", $size
   if $size == 0
   else
-    set $i = 1
-    while $i < $size
-      #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $table[$i].position, $table[$i].line_no, $pos
-      if $table[$i].position > $pos
-        loop_break
+  if $size == 1
+    printf "%d", $table[0].line_no
+  else
+    if $positions
+      # get_insn_info_linear_search
+      set $index = 1
+      while $index < $size
+        #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+        if $positions[$index] > $pos
+          loop_break
+        end
+        set $index = $index + 1
+        if $positions[$index] == $pos
+          loop_break
+        end
       end
-      set $i = $i + 1
-      if $table[$i].position == $pos
-        loop_break
+    else
+      # get_insn_info_succinct_bitvector
+      set $sd = $iseq->body->insns_info.succ_index_table
+      set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+      if $pos < $immediate_table_size
+        set $i = $pos / 9
+        set $j = $pos % 9
+        set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+      else
+        set $block_index = ($pos - $immediate_table_size) / 512
+        set $block = &$sd->succ_part[$block_index]
+        set $block_bit_index = ($pos - $immediate_table_size) % 512
+        set $small_block_index = $block_bit_index / 64
+        set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+        set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+        set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+        set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+        set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+        set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+        set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+        set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+        set $index = $block->rank + $small_block_popcount + $popcnt
       end
     end
-    printf "%d", $table[$i-1].line_no
+    printf "%d", $table[$index-1].line_no
+  end
   end
 end
 
@@ -1065,9 +1055,9 @@ define print_id
   else
     set $serial = (rb_id_serial_t)$id
   end
-  if $serial && $serial <= global_symbols.last_id
+  if $serial && $serial < ruby_global_symbols.next_id
     set $idx = $serial / ID_ENTRY_UNIT
-    set $ids = (struct RArray *)global_symbols.ids
+    set $ids = (struct RArray *)ruby_global_symbols.ids
     set $flags = $ids->basic.flags
     if ($flags & RUBY_FL_USER1)
       set $idsptr = $ids->as.ary
@@ -1088,12 +1078,12 @@ define print_id
           set $aryptr = $ary->as.heap.ptr
           set $arylen = $ary->as.heap.len
         end
-        set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
-	if $result != RUBY_Qnil
+        set $result = $aryptr[($serial % ID_ENTRY_UNIT) + $t]
+        if $result != RUBY_Qnil
           print_string $result
-	else
-	  echo undef
-	end
+        else
+          echo undef
+        end
       end
     end
   end
@@ -1118,20 +1108,21 @@ define rb_ps_thread
   set $ps_thread = (struct RTypedData*)$arg0
   set $ps_thread_th = (rb_thread_t*)$ps_thread->data
   printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
-    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+    $ps_thread, $ps_thread_th, $ps_thread_th->nt
   set $cfp = $ps_thread_th->ec->cfp
   set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
   while $cfp < $cfpend
-    if $cfp->iseq
-      if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+    if $cfp->_iseq
+      set $iseq = rb_get_cfp_iseq($cfp)
+      if !((VALUE)$iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
         printf "%d:ifunc ", $cfpend-$cfp
         set print symbol-filename on
-        output/a $cfp->iseq.body
+        output/a $iseq.body
         set print symbol-filename off
         printf "\n"
       else
       if $cfp->pc
-        set $location = $cfp->iseq->body->location
+        set $location = $iseq->body->location
         printf "%d:", $cfpend-$cfp
         print_pathobj $location.pathobj
         printf ":"
@@ -1266,9 +1257,9 @@ document rb_count_objects
   Counts all objects grouped by type.
 end
 
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+# Details: https://github.com/ruby/ruby/wiki/Machine-Instructions-Trace-with-GDB
 define trace_machine_instructions
-  set logging on
+  set logging enabled
   set height 0
   set width 0
   display/i $pc
@@ -1303,5 +1294,39 @@ define dump_node
   set $flags = ((struct RBasic*)($str))->flags
   printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
                         ((struct RString*)$str)->as.heap.ptr : \
-                        ((struct RString*)$str)->as.ary)
-end
+                        ((struct RString*)$str)->as.embed.ary)
+end
+
+define print_flags
+  printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+  printf "RUBY_FL_PROMOTED    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED ? "1" : "0"
+  printf "RUBY_FL_FINALIZE    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+  printf "RUBY_FL_SHAREABLE   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
+  printf "RUBY_FL_EXIVAR      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+  printf "RUBY_FL_FREEZE      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+  printf "RUBY_FL_USER0       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+  printf "RUBY_FL_USER1       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+  printf "RUBY_FL_USER2       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+  printf "RUBY_FL_USER3       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+  printf "RUBY_FL_USER4       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+  printf "RUBY_FL_USER5       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+  printf "RUBY_FL_USER6       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+  printf "RUBY_FL_USER7       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+  printf "RUBY_FL_USER8       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+  printf "RUBY_FL_USER9       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+  printf "RUBY_FL_USER10      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+  printf "RUBY_FL_USER11      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+  printf "RUBY_FL_USER12      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+  printf "RUBY_FL_USER13      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+  printf "RUBY_FL_USER14      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+  printf "RUBY_FL_USER15      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+  printf "RUBY_FL_USER16      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+  printf "RUBY_FL_USER17      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+  printf "RUBY_FL_USER18      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
+
+source -s misc/gdb.py
+
+# Moved from beginning, since it fails on older gdbs
+set startup-with-shell off
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..d752612085
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,54 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+c5e9af9c9d890578182a21e7b71b50334cd5579e
+e63a2115f64433b21cb5dd67c5bf8b30f87ef293
+712ac99e4d0384a941c80a9f48f62943ba7d97c0
+d1474affa8e105bece209cc9d594bb0a989859e1
+2da92388b948821269b18d6b178a680f17e41750
+5062c0c621d887367af8a054e5e5d83d7ec57dd3
+
+# Indentation
+0e4bad888e605d424b9222ae0ca43f85c1634e5e
+61aa46c41648c6d1e9b0daa1a292de551fde78df
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
+
+# Make prism_compile.c indentation consistent
+40b2c8e5e7e6e5f83cee9276dc9c1922a69292d6
+d2c5867357ed88eccc28c2b3bd4a46e206e7ff85
+
+# Miss-and-revived commits
+a0f7de814ae5c299d6ce99bed5fb308a05d50ba0
+d4e24021d39e1f80f0055b55d91f8d5f22e15084
+7a56c316418980b8a41fcbdc94067b2bda2ad112
+e90282be7ba1bc8e3119f6e1a2c80356ceb3f80a
+26a9e0b4e31f7b5a9cbd755e0a15823a8fa51bae
+2f53985da9ee593fe524d408256835667938c7d7
+bf01f6ae89a95d8f5572e050facfe311c8c28aaf
+7480cd8d37fd71a41ce12b759090051c7e14fb5a
+
+# Win32: EOL code of batch files
+23f9a0d655c4d405bb2397a147a1523436205486
+b839989fd22fef85e2af19de1bc83aa72a5b22bd
+
+# ZJIT cargo-insta snapshot raw string literals
+b78e0a6ddf7df8a7568ea71284f593423c739551
diff --git a/.gitattributes b/.gitattributes
index 6ca2f89462..f98c091e3f 100644
--- a/.gitattributes
+++ b/.gitattributes
@@ -1,6 +1,14 @@
 *.gemspec diff=ruby
 *.rb diff=ruby
+*.inc.rs linguist-generated=true
 bin svn-properties=svn:ignore=ruby
 bin/* diff=ruby
 tool/update-deps diff=ruby
 tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
+
+# To strip CR from the batch files, set the `diff.dos.textconv` filter
+# like as `git config diff.dos.textconv $'sed \'s/\r$//\''`.
+*.bat diff=dos
+*.cmd diff=dos
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/actions/capiext/action.yml b/.github/actions/capiext/action.yml
new file mode 100644
index 0000000000..ed69c8ac5e
--- /dev/null
+++ b/.github/actions/capiext/action.yml
@@ -0,0 +1,86 @@
+name: rubyspec C-API extensions
+
+inputs:
+  builddir:
+    required: false
+    default: '.'
+  make:
+    required: false
+    default: 'make -s'
+
+outputs:
+  key:
+    value: >-
+      ${{
+      !steps.restore.outputs.cache-hit &&
+      github.ref == 'refs/heads/master' &&
+      steps.config.outputs.key
+      }}
+
+runs:
+  using: composite
+
+  steps:
+    - id: config
+      shell: bash
+      run: |
+        eval $(grep -e '^arch *=' -e '^ruby_version *=' -e '^DLEXT *=' Makefile |
+            sed 's/ *= */=/')
+        case "${ruby_version}" in
+        *+*) key=capiexts-${arch}-${ruby_version}-${{ hashFiles('src/spec/ruby/optional/capi/ext/*.[ch]') }};;
+        *)   key=;;
+        esac
+        echo version=$ruby_version >> $GITHUB_OUTPUT
+        echo key="$key" >> $GITHUB_OUTPUT
+        echo DLEXT=$DLEXT >> $GITHUB_OUTPUT
+      working-directory: ${{ inputs.builddir }}
+
+    - name: Restore previous CAPI extensions
+      uses: actions/cache/restore@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      id: cache
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.config.outputs.key }}
+
+    - name: Run test-spec with previous CAPI extension binaries
+      id: check
+      shell: bash
+      run: | # zizmor: ignore[template-injection]
+        touch spec/ruby/optional/capi/ext/*.$DLEXT
+        [ ! -f spec/ruby/optional/capi/ext/\*.$DLEXT ]
+        ${{ inputs.make }} SPECOPTS=optional/capi test-spec
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: ${{ steps.cache.outputs.cache-hit }}
+
+    - name: Strip CAPI extensions
+      id: strip
+      shell: bash
+      run: |
+        rm -f spec/ruby/optional/capi/ext/*.c
+        [ "$DLEXT" = bundle ] || # separated to .dSYM directories
+        strip spec/ruby/optional/capi/ext/*.$DLEXT
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: >-
+        ${{true
+        && ! steps.cache.outputs.cache-hit
+        && github.ref_name == 'master'
+        }}
+
+    - name: Save CAPI extensions
+      uses: actions/cache/save@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.strip.outcome == 'success' }}
+
+    - shell: bash
+      run: |
+        echo "::error::Change from ${prev} detected; bump up ABI version"
+      env:
+        prev: ${{ steps.config.outputs.version }}
+      if: ${{ always() && steps.check.outcome == 'failure' }}
diff --git a/.github/actions/compilers/action.yml b/.github/actions/compilers/action.yml
new file mode 100644
index 0000000000..c700bbfe9e
--- /dev/null
+++ b/.github/actions/compilers/action.yml
@@ -0,0 +1,164 @@
+name: Compiles ruby in a container
+description: >-
+  Makes ruby using a dedicated container
+
+inputs:
+  tag:
+    required: false
+    default: clang-20
+    description: >-
+      container image tag to use in this run.
+
+  with_gcc:
+    required: false
+    description: >-
+      override compiler path & flags.
+
+  CFLAGS:
+    required: false
+    description: >-
+      C compiler flags to override.
+
+  CXXFLAGS:
+    required: false
+    description: >-
+      C++ compiler flags to override.
+
+  optflags:
+    required: false
+    # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+    # to optimize binaries.  Also GitHub Actions run on relatively modern CPUs
+    # compared to, say, GCC 4 or Clang 3.  We don't specify `-march=native`
+    # because compilers tend not understand what the CPU is.
+    default: '-O1'
+    description: >-
+      Compiler flags for optimisations.
+
+  cppflags:
+    required: false
+    description: >-
+      Additional preprocessor flags.
+
+  append_configure:
+    required: false
+    default: >-
+      --without-valgrind
+      --without-jemalloc
+      --without-gmp
+    description: >-
+      flags to append to configure.
+
+  enable_shared:
+    required: false
+    default: true
+    description: >-
+      Whether to build libruby.so.
+
+  check:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make check`
+
+  test_all:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-all` with options for test-all.
+
+  test_spec:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-spec` with options for mspec.
+
+  static_exts:
+    required: false
+    description: >-
+      whitespace separated list of extensions that need be linked statically.
+
+runs:
+  using: composite
+  steps:
+    - shell: bash
+      run: docker pull --quiet "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}"
+      env:
+        INPUT_TAG: ${{ inputs.tag }}
+
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        github.repository == 'ruby/ruby' ||
+        (github.repository != 'ruby/ruby' && env.LAUNCHABLE_TOKEN)
+        }}
+
+    - name: compile
+      shell: bash
+      run: >-
+        docker run
+        --rm
+        --user=root
+        --volume "${GITHUB_WORKSPACE}:/github/workspace:ro"
+        --workdir=/github/workspace
+        --entrypoint=/github/workspace/.github/actions/compilers/entrypoint.sh
+        --env CI
+        --env GITHUB_ACTION
+        --env INPUT_WITH_GCC
+        --env INPUT_CFLAGS
+        --env INPUT_CXXFLAGS
+        --env INPUT_OPTFLAGS
+        --env INPUT_CPPFLAGS
+        --env INPUT_APPEND_CONFIGURE
+        --env INPUT_CHECK
+        --env INPUT_TEST_ALL
+        --env INPUT_TEST_SPEC
+        --env INPUT_ENABLE_SHARED
+        --env INPUT_STATIC_EXTS
+        --env LAUNCHABLE_ORGANIZATION
+        --env LAUNCHABLE_WORKSPACE
+        --env LAUNCHABLE_ENABLED
+        --env GITHUB_PR_HEAD_SHA
+        --env GITHUB_PULL_REQUEST_URL
+        --env GITHUB_REF
+        --env GITHUB_ACTIONS
+        --env GITHUB_RUN_ID
+        --env GITHUB_REPOSITORY
+        --env GITHUB_WORKFLOW
+        --env GITHUB_RUN_NUMBER
+        --env GITHUB_EVENT_NAME
+        --env GITHUB_SHA
+        --env GITHUB_HEAD_REF
+        --env GITHUB_SERVER_URL
+        "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}"
+      env:
+        INPUT_TAG: ${{ inputs.tag }}
+        INPUT_WITH_GCC: ${{ inputs.with_gcc || inputs.tag }}
+        INPUT_CFLAGS: ${{ inputs.CFLAGS }}
+        INPUT_CXXFLAGS: ${{ inputs.CXXFLAGS }}
+        INPUT_OPTFLAGS: ${{ inputs.OPTFLAGS }}
+        INPUT_CPPFLAGS: ${{ inputs.cppflags }}
+        INPUT_APPEND_CONFIGURE: ${{ inputs.append_configure }}
+        INPUT_CHECK: ${{ inputs.check }}
+        INPUT_TEST_ALL: ${{ inputs.test_all }}
+        INPUT_TEST_SPEC: ${{ inputs.test_spec }}
+        INPUT_ENABLE_SHARED: ${{ inputs.enable_shared }}
+        INPUT_STATIC_EXTS: ${{ inputs.static_exts }}
+        LAUNCHABLE_ORGANIZATION: ${{ github.repository_owner }}
+        LAUNCHABLE_WORKSPACE: ${{ github.event.repository.name }}
+        LAUNCHABLE_ENABLED: ${{ steps.enable-launchable.outputs.enable-launchable || false }}
+        GITHUB_PR_HEAD_SHA: ${{ github.event.pull_request.head.sha || github.sha }}
+        GITHUB_PULL_REQUEST_URL: ${{ github.event.pull_request.html_url }}
+        GITHUB_REF: ${{ github.ref }}
+
+    # Clean up non-default docker images to save disk space.
+    # The default image (clang-20) is reused across multiple steps
+    # within the same job, so we keep it to avoid redundant pulls.
+    - name: clean up docker image
+      shell: bash
+      run: docker rmi "ghcr.io/ruby/ruby-ci-image:${INPUT_TAG}" || true
+      if: ${{ always() && inputs.tag != 'clang-20' }}
+      env:
+        INPUT_TAG: ${{ inputs.tag }}
diff --git a/.github/actions/compilers/entrypoint.sh b/.github/actions/compilers/entrypoint.sh
new file mode 100755
index 0000000000..b554151091
--- /dev/null
+++ b/.github/actions/compilers/entrypoint.sh
@@ -0,0 +1,90 @@
+#! /bin/bash
+
+# Copyright (c) 2024 Ruby developers.  All rights reserved.
+#
+# This file is  a part of the programming language  Ruby.  Permission is hereby
+# granted, to  either redistribute and/or  modify this file, provided  that the
+# conditions  mentioned in  the file  COPYING are  met.  Consult  the file  for
+# details.
+
+grouped()
+{
+    echo "::group::${@}"
+    "${@}"
+    echo "::endgroup::"
+}
+
+set -e
+set -u
+set -o pipefail
+
+srcdir="/github/workspace/src"
+builddir="$(mktemp -dt)"
+
+export GITHUB_WORKFLOW='Compilations'
+export CONFIGURE_TTY='never'
+export RUBY_DEBUG='ci rgengc'
+export RUBY_TESTOPTS='-q --color=always --tty=no'
+export RUBY_DEBUG_COUNTER_DISABLE='1'
+export GNUMAKEFLAGS="-j$((1 + $(nproc)))"
+
+case "x${INPUT_ENABLE_SHARED}" in
+x | xno | xfalse )
+    enable_shared='--disable-shared'
+    ;;
+*)
+    enable_shared='--enable-shared'
+    ;;
+esac
+
+pushd ${builddir}
+
+grouped git config --global --add safe.directory ${srcdir}
+
+grouped ${srcdir}/configure        \
+    -C                             \
+    --with-gcc="${INPUT_WITH_GCC}" \
+    --enable-debug-env             \
+    --disable-install-doc          \
+    --with-ext=-test-/cxxanyargs,+ \
+    --without-git                  \
+    ${enable_shared}               \
+    ${INPUT_APPEND_CONFIGURE}      \
+    CFLAGS="${INPUT_CFLAGS}"       \
+    CXXFLAGS="${INPUT_CXXFLAGS}"   \
+    optflags="${INPUT_OPTFLAGS}"   \
+    cppflags="${INPUT_CPPFLAGS}"   \
+    debugflags='-ggdb3' # -g0 disables backtraces when SEGV.  Do not set that.
+
+popd
+
+if [[ -n "${INPUT_STATIC_EXTS}" ]]; then
+    echo "::group::ext/Setup"
+    set -x
+    mkdir ${builddir}/ext
+    (
+        for ext in ${INPUT_STATIC_EXTS}; do
+            echo "${ext}"
+        done
+    ) >> ${builddir}/ext/Setup
+    set +x
+    echo "::endgroup::"
+fi
+
+if [ -n "$INPUT_TEST_ALL" ]; then
+  tests=" -- $INPUT_TEST_ALL"
+else
+  tests=" -- ruby -ext-"
+fi
+
+pushd ${builddir}
+
+grouped make showflags
+grouped make all
+# grouped make install
+
+# Run only `make test` by default. Run other tests if specified.
+grouped make test
+if [[ -n "$INPUT_CHECK" ]]; then grouped make test-tool; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_ALL" ]]; then grouped make test-all TESTS="$tests"; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_SPEC" ]]; then grouped env CHECK_LEAKS=true make test-spec MSPECOPT="$INPUT_TEST_SPEC"; fi
diff --git a/.github/actions/launchable/setup/action.yml b/.github/actions/launchable/setup/action.yml
new file mode 100644
index 0000000000..305878492c
--- /dev/null
+++ b/.github/actions/launchable/setup/action.yml
@@ -0,0 +1,337 @@
+name: Set up Launchable
+description: >-
+  Install the required dependencies and execute the necessary Launchable commands for test recording
+
+inputs:
+  os:
+    required: true
+    description: The operating system that CI runs on. This value is used in Launchable flavor.
+
+  test-opts:
+    default: none
+    required: false
+    description: >-
+      Test options that determine how tests are run.
+      This value is used in the Launchable flavor.
+
+  launchable-token:
+    required: false
+    description: >-
+      Launchable token is needed if you want to run Launchable on your forked repository.
+      See https://github.com/ruby/ruby/wiki/CI-Servers#launchable-ci for details.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to create Launchable report file.
+
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes. Launchable retrieves the commit information
+      from the directory.
+
+  test-task:
+    required: false
+    default: ${{ matrix.test_task }}
+    description: >-
+      Specifies a single test task to be executed.
+      This value is used in the Launchable flavor.
+      Either 'test-task' or 'multi-test-tasks' must be configured.
+
+  test-tasks:
+    required: false
+    default: '[]'
+    description: >-
+      Specifies an array of multiple test tasks to be executed.
+      For example: '["test", "test-all"]'.
+      If you want to run a single test task, use the 'test-task' input instead.
+
+  is-yjit:
+    required: false
+    default: 'false'
+    description: >-
+      Whether this workflow is executed on YJIT.
+
+  is-zjit:
+    required: false
+    default: 'false'
+    description: >-
+      Whether this workflow is executed on ZJIT.
+
+outputs:
+  stdout_report_path:
+    value: ${{ steps.global.outputs.stdout_report_path }}
+    description: >-
+      Report file path for standard output.
+
+  stderr_report_path:
+    value: ${{ steps.global.outputs.stderr_report_path }}
+    description: >-
+      Report file path for standard error.
+
+runs:
+  using: composite
+
+  steps:
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        (github.repository == 'ruby/ruby'
+          || (github.repository != 'ruby/ruby'
+          && env.LAUNCHABLE_TOKEN))
+        && (inputs.test-task == 'check'
+          || inputs.test-task == 'test-all'
+          || inputs.test-task == 'test'
+          || contains(fromJSON(inputs.test-tasks), 'test-all')
+          || contains(fromJSON(inputs.test-tasks), 'test'))
+        }}
+
+    # Launchable CLI requires Python and Java.
+    # https://www.launchableinc.com/docs/resources/cli-reference/
+    - name: Set up Python
+      uses: actions/setup-python@a26af69be951a213d495a4c3e4e4022e16d87065 # v5.6.0
+      with:
+        python-version: "3.x"
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java
+      uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+      with:
+        distribution: 'temurin'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java ppc64le
+      uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+      with:
+        distribution: 'semeru'
+        architecture: 'ppc64le'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 'ppc64le') }}
+
+    - name: Set up Java s390x
+      uses: actions/setup-java@c1e323688fd81a25caa38c78aa6df2d33d3e20d9 # v4.8.0
+      with:
+        distribution: 'semeru'
+        architecture: 's390x'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 's390x') }}
+
+    - name: Set global vars
+      id: global
+      shell: bash
+      run: |
+        test_all_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-all' || contains(fromJSON(inputs.test-tasks), 'test-all') }}"
+        btest_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test' || contains(fromJSON(inputs.test-tasks), 'test') }}"
+        test_spec_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-spec' || contains(fromJSON(inputs.test-tasks), 'test-spec') }}"
+        echo test_all_enabled="${test_all_enabled}" >> $GITHUB_OUTPUT
+        echo btest_enabled="${btest_enabled}" >> $GITHUB_OUTPUT
+        echo test_spec_enabled="${test_spec_enabled}" >> $GITHUB_OUTPUT
+        echo test_all_report_file='launchable_test_all_report.json' >> $GITHUB_OUTPUT
+        echo btest_report_file='launchable_btest_report.json' >> $GITHUB_OUTPUT
+        echo test_spec_report_dir='launchable_test_spec_report' >> $GITHUB_OUTPUT
+        echo stdout_report_path="launchable_stdout.log" >> $GITHUB_OUTPUT
+        echo stderr_report_path="launchable_stderr.log" >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set environment variables for Launchable
+      shell: bash
+      run: | # zizmor: ignore[github-env]
+        : # GITHUB_PULL_REQUEST_URL are used for commenting test reports in Launchable Github App.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/link.py#L42
+        echo "GITHUB_PULL_REQUEST_URL=${INPUT_PR_HTML_URL}" >> $GITHUB_ENV
+        : # The following envs are necessary in Launchable tokenless authentication.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L20
+        echo "LAUNCHABLE_ORGANIZATION=${INPUT_REPOSITORY_OWNER}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_WORKSPACE=${INPUT_REPOSITORY_NAME}" >> $GITHUB_ENV
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L71
+        echo "GITHUB_PR_HEAD_SHA=${INPUT_PR_HEAD_SHA}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_TOKEN=${INPUT_LAUNCHABLE_TOKEN}" >> $GITHUB_ENV
+        : # To prevent a slowdown in CI, disable request retries when the Launchable server is unstable.
+        echo "LAUNCHABLE_SKIP_TIMEOUT_RETRY=1" >> $GITHUB_ENV
+        echo "LAUNCHABLE_COMMIT_TIMEOUT=1" >> $GITHUB_ENV
+      env:
+        INPUT_PR_HTML_URL: ${{ github.event.pull_request.html_url }}
+        INPUT_REPOSITORY_OWNER: ${{ github.repository_owner }}
+        INPUT_REPOSITORY_NAME: ${{ github.event.repository.name }}
+        INPUT_PR_HEAD_SHA: ${{ github.event.pull_request.head.sha || github.sha }}
+        INPUT_LAUNCHABLE_TOKEN: ${{ inputs.launchable-token }}
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set up path
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      # Since updated PATH variable will be available in only subsequent actions, we need to add the path beforehand.
+      # https://docs.github.com/en/actions/using-workflows/workflow-commands-for-github-actions#adding-a-system-path
+      run: echo "$(python -msite --user-base)/bin" >> $GITHUB_PATH # zizmor: ignore[github-env]
+      if: >-
+        ${{
+        steps.enable-launchable.outputs.enable-launchable
+        && (startsWith(inputs.os, 'macos')
+          || endsWith(inputs.os, 'ppc64le')
+          || endsWith(inputs.os, 's390x'))
+        }}
+
+    - name: Set up Launchable
+      id: setup-launchable
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: | # zizmor: ignore[github-env]
+        set -x
+        pip install --user launchable
+        : # The build name cannot include a slash, so we replace the string here.
+        github_ref="${INPUT_GITHUB_REF}"
+        github_ref="${github_ref//\//_}"
+        : # With the --name option, we need to configure a unique identifier for this build.
+        : # To avoid setting the same build name as the CI which runs on other branches, we use the branch name here.
+        build_name="${github_ref}_${GITHUB_PR_HEAD_SHA}"
+        test_opts="${INPUT_TEST_OPTS}"
+        test_opts="${test_opts// /}"
+        test_opts="${test_opts//=/:}"
+        test_all_test_suite='test-all'
+        btest_test_suite='btest'
+        test_spec_test_suite='test-spec'
+        if [ "${INPUT_IS_YJIT}" = "true" ]; then
+          test_all_test_suite="yjit-${test_all_test_suite}"
+          btest_test_suite="yjit-${btest_test_suite}"
+          test_spec_test_suite="yjit-${test_spec_test_suite}"
+        fi
+        if [ "${INPUT_IS_ZJIT}" = "true" ]; then
+          test_all_test_suite="zjit-${test_all_test_suite}"
+          btest_test_suite="zjit-${btest_test_suite}"
+          test_spec_test_suite="zjit-${test_spec_test_suite}"
+        fi
+        # launchable_setup target var -- refers ${target} prefixed variables
+        launchable_setup() {
+          local target=$1 session
+          eval [ "\${${target}_enabled}" = "true" ] || return
+          eval local suite=\${${target}_test_suite}
+          session=$(launchable record session \
+            --build "${build_name}" \
+            --observation \
+            --flavor os="${INPUT_OS}" \
+            --flavor test_task="${INPUT_TEST_TASK}" \
+            --flavor test_opts="${test_opts}" \
+            --flavor workflow="${INPUT_WORKFLOW}" \
+            --test-suite ${suite} \
+            )
+          echo "${target}_session=${session}" >> $GITHUB_OUTPUT
+        }
+
+        launchable record build --name "${build_name}"
+        if launchable_setup test_all; then
+          echo "TESTS=${TESTS:+$TESTS }--launchable-test-reports=${test_all_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup btest; then
+          echo "BTESTS=${BTESTS:+$BTESTS }--launchable-test-reports=${btest_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup test_spec; then
+          echo "SPECOPTS=${SPECOPTS:$SPECOPTS }--launchable-test-reports=${test_spec_report_dir}" >> $GITHUB_ENV
+          echo test_spec_enabled=true >> $GITHUB_OUTPUT
+        fi
+
+        echo launchable_setup_dir=$(pwd) >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+      env:
+        INPUT_GITHUB_REF: ${{ github.ref }}
+        INPUT_TEST_OPTS: ${{ inputs.test-opts }}
+        INPUT_IS_YJIT: ${{ inputs.is-yjit }}
+        INPUT_IS_ZJIT: ${{ inputs.is-zjit }}
+        INPUT_OS: ${{ inputs.os }}
+        INPUT_TEST_TASK: ${{ inputs.test-task }}
+        INPUT_WORKFLOW: ${{ github.workflow }}
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: make test-spec report directory in build directory
+      shell: bash
+      working-directory: ${{ inputs.builddir }}
+      run: mkdir "${test_spec_report_dir}"
+      if: ${{ steps.setup-launchable.outputs.test_spec_enabled == 'true' }}
+      env:
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Clean up test results in Launchable
+      uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          rm -f "${test_all_report_file}"
+          rm -f "${btest_report_file}"
+          rm -fr "${test_spec_report_dir}"
+          rm -f launchable_stdout.log
+          rm -f launchable_stderr.log
+      if: always() && steps.setup-launchable.outcome == 'success'
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Record test results in Launchable
+      uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          if [[ "${test_all_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_all_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_all_session}" \
+              raw "${test_all_report_file}" || true; \
+          fi
+
+          if [[ "${btest_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${btest_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${btest_session}" \
+              raw "${btest_report_file}" || true; \
+          fi
+
+          if [[ "${test_spec_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_spec_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_spec_session}" \
+              raw ${test_spec_report_dir}/* || true; \
+          fi
+      if: ${{ always() && steps.setup-launchable.outcome == 'success' }}
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_session: ${{ steps.setup-launchable.outputs.test_all_session }}
+        btest_session: ${{ steps.setup-launchable.outputs.btest_session }}
+        test_spec_session: ${{ steps.setup-launchable.outputs.test_spec_session }}
+        stdout_report_path: ${{ steps.global.outputs.stdout_report_path }}
+        stderr_report_path: ${{ steps.global.outputs.stderr_report_path }}
+        LAUNCHABLE_SETUP_DIR: ${{ steps.setup-launchable.outputs.launchable_setup_dir }}
diff --git a/.github/actions/make-snapshot/action.yml b/.github/actions/make-snapshot/action.yml
new file mode 100644
index 0000000000..4552f0e067
--- /dev/null
+++ b/.github/actions/make-snapshot/action.yml
@@ -0,0 +1,77 @@
+name: 'make-snapshot'
+description: 'Make snapshot tarballs'
+inputs:
+  archname:
+    description: 'archname passed to tool/make-snapshot (e.g. snapshot-master)'
+    required: true
+  version:
+    description: 'Target Version'
+    required: false
+  shallow-since:
+    description: 'git fetch --shallow-since'
+    required: true
+    default: '2018-12-25 00:00:00'
+  fetch-branch:
+    description: 'fetch branch'
+    required: false
+  srcdir:
+    description: 'srcdir for tool/make-snapshot. Empty = clone ruby/ruby into ./ruby.'
+    required: false
+    default: ''
+  upload-artifact:
+    description: 'Upload Packages and Info as workflow artifacts. Pass "false" when callers run in a matrix that would collide on artifact names.'
+    required: false
+    default: 'true'
+
+runs:
+  using: "composite"
+  steps:
+    - name: Install libraries
+      run: |
+        set -x
+        sudo apt-get update -q || :
+        sudo apt-get install --no-install-recommends -q -y build-essential git bison autoconf ruby p7zip-full curl
+      shell: bash
+    - name: Checkout ruby/ruby for tool/make-snapshot
+      if: inputs.srcdir == ''
+      run: git clone --single-branch --depth=1 https://github.com/ruby/ruby ruby
+      shell: bash
+    - name: Fetch branches and notes (clone mode)
+      if: inputs.srcdir == ''
+      env:
+        SHALLOW_SINCE: ${{ inputs.shallow-since }}
+        FETCH_BRANCH: ${{ inputs.fetch-branch }}
+      run: |
+        set -x
+        cd ruby
+        git fetch --shallow-since="$SHALLOW_SINCE"
+        [ -n "$FETCH_BRANCH" ] && git fetch origin "+$FETCH_BRANCH:$FETCH_BRANCH"
+        git fetch origin '+refs/notes/commits:refs/notes/commits'
+        git fetch origin '+refs/notes/log-fix:refs/notes/log-fix'
+      shell: bash
+    - name: Fetch notes (local srcdir mode)
+      if: inputs.srcdir != ''
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        git fetch origin '+refs/notes/commits:refs/notes/commits' || :
+        git fetch origin '+refs/notes/log-fix:refs/notes/log-fix' || :
+      shell: bash
+    - name: Make snapshot
+      env:
+        ARCHNAME: ${{ inputs.archname }}
+        SRCDIR: ${{ inputs.srcdir }}
+        VERSION: ${{ inputs.version }}
+      run: |
+        [ -z "$SRCDIR" ] && SRCDIR=ruby
+        ruby "$SRCDIR/tool/make-snapshot" "-archname=$ARCHNAME" -srcdir="$SRCDIR" -packages=gzip,xz,zip pkg $VERSION
+      shell: bash
+    - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+      with:
+        name: Packages
+        path: pkg
+      if: ${{ inputs.upload-artifact == 'true' }}
+    - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+      with:
+        name: Info
+        path: pkg/info
+      if: ${{ inputs.upload-artifact == 'true' }}
diff --git a/.github/actions/setup/baseruby/action.yml b/.github/actions/setup/baseruby/action.yml
new file mode 100644
index 0000000000..76fe068897
--- /dev/null
+++ b/.github/actions/setup/baseruby/action.yml
@@ -0,0 +1,73 @@
+name: Setup directories etc.
+description: >-
+  Build baseruby for cross-compiling
+
+inputs:
+  srcdir:
+    required: true
+    default: ${{ github.workspace }}
+    description: >-
+      Directory of source codes.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}/baseruby
+    description: >-
+      Where baseruby will be built.
+
+  installdir:
+    required: false
+    default: install
+    description: >-
+      The path where the baseruby will be installed to.
+      This is relative from the workspace.
+
+outputs:
+  ruby:
+    value: ${{ steps.build.outputs.installdir }}/bin/ruby
+    description: >-
+      The path of the executable baseruby.
+  dump_ast:
+    value: ${{ steps.build.outputs.installdir }}/bin/dump_ast
+    description: >-
+      The path of the executable dump_ast.
+
+runs:
+  using: composite
+
+  steps:
+    - name: Build baseruby
+      shell: bash
+      id: build
+      run: |
+        case "$installdir" in /*) ;; *) installdir="$PWD/$installdir";; esac
+        mkdir "$builddir"
+        ln -sr "$srcdir" "$builddir/.src"
+        pushd "$builddir"
+        .src/configure "--prefix=${installdir}" --disable-install-doc
+        CONFIGURE_ARGS=--with-out-ext=-test- make install
+        install dump_ast "${installdir}/bin"
+        {
+          echo "${installdir}/bin/dump_ast"
+          echo "${installdir}/.installed.list"
+          echo "${installdir}/"
+        } >> .installed.list
+        cp .installed.list "${installdir}/"
+        make distclean
+        rm .src
+        popd
+        rmdir "$builddir"
+        {
+          echo "installdir=${installdir}"
+        } | tee -a "$GITHUB_OUTPUT"
+      env:
+        srcdir: ${{ inputs.srcdir }}
+        builddir: ${{ inputs.builddir }}
+        installdir: ${{ inputs.installdir }}
+
+    - name: clean
+      uses: gacts/run-and-post-run@598d7a875d5620e0457490555b5e18e46082aa47 # v1.4.4
+      with:
+        working-directory: ${{ inputs.srcdir }}
+        post: |
+          ruby tool/rbuninstall.rb "${{ steps.build.outputs.installdir }}/.installed.list" > /dev/null
diff --git a/.github/actions/setup/directories/action.yml b/.github/actions/setup/directories/action.yml
new file mode 100644
index 0000000000..589049a4b8
--- /dev/null
+++ b/.github/actions/setup/directories/action.yml
@@ -0,0 +1,205 @@
+name: Setup directories etc.
+description: >-
+  Set up the source code and build directories (plus some
+  environmental tweaks)
+
+inputs:
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes.  This will be created
+      if absent.  If there is no `configure` file that is also
+      generated inside.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Where binaries and other generated contents go.  This will be
+      created if absent.
+
+  make-command:
+    required: false
+    type: string
+    default: 'make'
+    description: >-
+      The command of `make`.
+
+  makeup:
+    required: false
+    type: boolean
+    # Note that `default: false` evaluates to a string constant
+    # `'false'`, which is a truthy value :sigh:
+    # https://github.com/actions/runner/issues/2238
+    default: ''
+    description: >-
+      If set to true, additionally runs `make up`.
+
+  checkout:
+    required: false
+    type: boolean
+    default: true
+    description: >-
+      If set to '' (false), skip running actions/checkout. This is useful when
+      you don't want to overwrite a GitHub token that is already set up.
+
+  dummy-files:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, creates dummy files in build dir.
+
+  fetch-depth:
+    required: false
+    default: '1'
+    description: The depth of commit history fetched from the remote repository
+
+  clean:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, clean build directory.
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    # Note that `shell: bash` works on both Windows and Linux, but not
+    # `shell: sh`.  This is because GitHub hosted Windows runners have
+    # their bash manually installed.
+    - shell: bash
+      run: |
+        mkdir -p "${INPUT_SRCDIR}"
+        mkdir -p "${INPUT_BUILDDIR}"
+      env:
+        INPUT_SRCDIR: ${{ inputs.srcdir }}
+        INPUT_BUILDDIR: ${{ inputs.builddir }}
+
+    # Did you know that actions/checkout works without git(1)?  We are
+    # checking that here.
+    - id: which
+      shell: bash
+      run: |
+        echo "git=`command -v git`" >> "$GITHUB_OUTPUT"
+        echo "sudo=`sudo true && command -v sudo`" >> "$GITHUB_OUTPUT"
+        echo "autoreconf=`command -v autoreconf`" >> "$GITHUB_OUTPUT"
+
+    - if: steps.which.outputs.git
+      shell: bash
+      run: |
+        git config --global core.autocrlf false
+        git config --global core.eol lf
+        git config --global advice.detachedHead 0
+        git config --global init.defaultBranch garbage
+
+    - if: inputs.checkout
+      uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+      with:
+        path: ${{ inputs.srcdir }}
+        fetch-depth: ${{ inputs.fetch-depth }}
+        persist-credentials: false
+
+    - uses: actions/cache@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+      with:
+        path: ${{ inputs.srcdir }}/.downloaded-cache
+        key: ${{ runner.os }}-${{ runner.arch }}-downloaded-cache
+
+    - if: steps.which.outputs.autoreconf
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: ./autogen.sh --install
+
+    # This is for MinGW.
+    - if: runner.os == 'Windows'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV # zizmor: ignore[github-env]
+
+    - if: runner.os == 'Linux'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-sj$((1 + $(nproc)))" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+
+    # macOS' GNU make is so old that they doesn't understand `GNUMAKEFLAGS`.
+    - if: runner.os == 'macOS'
+      shell: bash
+      run: echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+
+    - if: inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        touch config.status .rbconfig.time
+        for mk in Makefile GNUmakefile; do
+          sed -f tool/prereq.status template/$mk.in > $mk
+        done
+        make up
+
+    # Cleanup, runs even on failure
+    - if: always() && inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        rm -f config.status .rbconfig.time \
+          Makefile GNUmakefile uncommon.mk enc.mk noarch-fake.rb
+        rm -f prism/.time prism/util/.time
+
+    - if: steps.which.outputs.sudo
+      shell: bash
+      run: |
+        sudo chmod -R go-w /usr/share
+        chmod -v go-w $HOME $HOME/.config || :
+        declare -a dirs # -A is not supported by old bash, e.g. macos
+        SAVE_IFS="$IFS" IFS=:; set $PATH
+        for d do
+          while [ -d "$d" ]; do
+            case "$IFS${dirs[*]}$IFS" in *"$IFS$d$IFS"*) ;; *) dirs+=("$d");; esac
+            d="${d%/*}"
+          done
+        done
+        IFS="$SAVE_IFS"
+        sudo chmod -v go-w "${dirs[@]}" || :
+
+    - if: inputs.dummy-files == 'true'
+      shell: bash
+      id: dummy-files
+      working-directory: ${{ inputs.builddir }}
+      run: |
+        : Create dummy files in build dir
+        set {{a..z},{A..Z},{0..9},foo,bar,test,zzz}.rb
+        for file; do \
+          echo > $file "raise 'do not load $file'"; \
+        done
+        # drop {a..z}.rb if case-insensitive filesystem
+        grep -F A.rb a.rb > /dev/null && set "${@:27}"
+        echo clean="cd ${INPUT_BUILDDIR} && rm $*" >> $GITHUB_OUTPUT
+      env:
+        INPUT_BUILDDIR: ${{ inputs.builddir }}
+
+    - if: inputs.clean == 'true'
+      shell: bash
+      id: clean
+      run: |
+        echo distclean="cd ${INPUT_BUILDDIR} && ${INPUT_MAKE_COMMAND} distclean" >> $GITHUB_OUTPUT
+        echo remained-files="find ${INPUT_BUILDDIR} -ls" >> $GITHUB_OUTPUT
+        [ "${INPUT_BUILDDIR}" = "${INPUT_SRCDIR}" ] ||
+        echo final="rmdir ${INPUT_BUILDDIR}" >> $GITHUB_OUTPUT
+      env:
+        INPUT_BUILDDIR: ${{ inputs.builddir }}
+        INPUT_SRCDIR: ${{ inputs.srcdir }}
+        INPUT_MAKE_COMMAND: ${{ inputs.make-command }}
+
+    - name: clean
+      uses: gacts/run-and-post-run@598d7a875d5620e0457490555b5e18e46082aa47 # v1.4.4
+      with:
+        working-directory:
+        post: |
+          ${{ steps.dummy-files.outputs.clean }}
+          ${{ steps.clean.outputs.distclean }}
+          ${{ steps.clean.outputs.remained-files }}
+          ${{ steps.clean.outputs.final }}
+      # rmdir randomly fails due to launchable files
+      continue-on-error: true
diff --git a/.github/actions/setup/macos/action.yml b/.github/actions/setup/macos/action.yml
new file mode 100644
index 0000000000..9cd37a9b12
--- /dev/null
+++ b/.github/actions/setup/macos/action.yml
@@ -0,0 +1,29 @@
+name: Setup macOS environment
+description: >-
+  Installs necessary packages via Homebrew.
+
+inputs: {} # nothing?
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - name: brew
+      shell: bash
+      run: |
+        brew install --quiet jemalloc gmp libffi openssl@3 zlib autoconf automake libtool
+
+    - name: Set ENV
+      shell: bash
+      run: | # zizmor: ignore[github-env]
+        dir_config() {
+          local args=() lib var="$1"; shift
+          for lib in "$@"; do
+            args+=("--with-${lib%@*}-dir=$(brew --prefix $lib)")
+          done
+          echo "$var=${args[*]}" >> $GITHUB_ENV
+        }
+        dir_config ruby_configure_args gmp
+        dir_config CONFIGURE_ARGS openssl@3
diff --git a/.github/actions/setup/ubuntu/action.yml b/.github/actions/setup/ubuntu/action.yml
new file mode 100644
index 0000000000..5209ccc03f
--- /dev/null
+++ b/.github/actions/setup/ubuntu/action.yml
@@ -0,0 +1,72 @@
+name: Setup ubuntu environment
+description: >-
+  At the beginning there was no way but to copy & paste `apt-get`
+  everywhere.  But now that we have composite actions, it seems better
+  merge them into one.
+
+inputs:
+  arch:
+    required: false
+    default: ''
+    description: >-
+      Architecture.  Because we run this on a GitHub-hosted runner
+      acceptable value for this input is very limited.
+
+outputs:
+  arch:
+    value: ${{ steps.uname.outputs.uname }}
+    description: >-
+      Actual architecture.  This could be different from the one
+      passed to the `inputs.arch`.  For instance giving `i386` to this
+      action yields `i686`.
+
+runs:
+  using: composite
+
+  steps:
+    - id: uname
+      name: uname
+      shell: bash
+      env:
+        arch: ${{ inputs.arch }}
+      run: |
+        setarch="${arch:+setarch $arch --}"
+        # normalize `uname`
+        if uname=$(${setarch} uname -m 2> /dev/null); then
+          # `setarch` works, `$arch` is a valid architecture name.
+          echo "setarch=${setarch}" >> "$GITHUB_OUTPUT"
+        else
+          # if `setarch` failed, take the given `arch` as-is.
+          uname="${arch}"
+          setarch=""
+        fi
+        echo "uname=$uname" >> "$GITHUB_OUTPUT"
+        echo "dpkg=${uname/686/386}" >> "$GITHUB_OUTPUT"
+
+    - name: set SETARCH
+      shell: bash
+      run: echo "SETARCH=${setarch}" >> "$GITHUB_ENV" # zizmor: ignore[github-env]
+      env:
+        setarch: ${{ steps.uname.outputs.setarch }} # validated
+
+    - name: dpkg setup
+      shell: bash
+      run: sudo dpkg --add-architecture "${dpkg}"
+      # `dpkg` is valid, also `uname`.
+      if: ${{ inputs.arch }}
+      env:
+        dpkg: ${{ steps.uname.outputs.dpkg }}
+
+    - name: apt-get
+      shell: bash
+      env:
+        arch: ${{ inputs.arch && format(':{0}', steps.uname.outputs.dpkg) || '' }}
+      run: |
+        set -x
+        sudo apt-get update -qq || :
+        sudo apt-get install --no-install-recommends -qq -y -o=Dpkg::Use-Pty=0 \
+        ${arch:+cross}build-essential${arch/:/-} \
+        libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+        zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+        autoconf ruby
+        sudo apt-get install -qq -y pkg-config${arch} || :
diff --git a/.github/actions/slack/action.yml b/.github/actions/slack/action.yml
new file mode 100644
index 0000000000..6f89bef11a
--- /dev/null
+++ b/.github/actions/slack/action.yml
@@ -0,0 +1,51 @@
+name: Post a message to slack
+description: >-
+  We have our ruby/action-slack webhook.  However its arguments are
+  bit verbose to be listed in every workflow files.  Better merge them
+  into one.
+
+inputs:
+  SLACK_WEBHOOK_URL:
+    required: true
+    description: >-
+      The URL to post the payload.  This is an input because it tends
+      to be stored in a secrets vault and a composite action cannot
+      look into one.
+
+  label:
+    required: false
+    description: >-
+      Human-readable description of the run, something like "DEBUG=1".
+      This need not be unique among runs.
+
+  event_name:
+    required: false
+    default: 'push'
+    description: >-
+      Target event to trigger notification. Notify only push by default.
+
+  extra_channel_id:
+    required: false
+    description: >-
+      Slack channel ID to notify besides #alerts and #alerts-emoji.
+
+outputs: {} # Nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+      with:
+        payload: |
+          {
+            "ci": "GitHub Actions",
+            "env": "${{ github.workflow }}${{ inputs.label && format(' / {0}', inputs.label) }}",
+            "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+            "commit": "${{ github.sha }}",
+            "branch": "${{ github.ref_name }}"
+            ${{ inputs.extra_channel_id && format(', "extra_channel_id": "{0}"', inputs.extra_channel_id) }}
+          }
+      env:
+        SLACK_WEBHOOK_URL: ${{ inputs.SLACK_WEBHOOK_URL }}
+      if: ${{ github.event_name == inputs.event_name && startsWith(github.repository, 'ruby/') }}
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
new file mode 100644
index 0000000000..9e20cb7459
--- /dev/null
+++ b/.github/auto_request_review.yml
@@ -0,0 +1,21 @@
+files:
+  'yjit*': [team:jit]
+  'yjit/**/*': [team:jit]
+  'yjit/src/cruby_bindings.inc.rs': []
+  'bootstraptest/test_yjit*': [team:jit]
+  'test/ruby/test_yjit*': [team:jit]
+  'zjit*': [team:jit]
+  'zjit/**/*': [team:jit]
+  'zjit/src/cruby_bindings.inc.rs': []
+  'test/ruby/test_zjit*': [team:jit]
+  'defs/jit.mk': [team:jit]
+  'tool/zjit_bisect.rb': [team:jit]
+  'doc/jit/*': [team:jit]
+  # Skip files updated by dependabot. It's noisy in notifications, and they're auto-merged anyway.
+  'yjit/Cargo.lock': []
+  'zjit/Cargo.lock': []
+  '.github/workflows/yjit-*.yml': []
+  '.github/workflows/zjit-*.yml': []
+options:
+  ignore_draft: true
+  last_files_match_only: true
diff --git a/.github/codeql/codeql-config.yml b/.github/codeql/codeql-config.yml
new file mode 100644
index 0000000000..f5d33545c1
--- /dev/null
+++ b/.github/codeql/codeql-config.yml
@@ -0,0 +1,22 @@
+paths-ignore:
+  - benchmark
+  - sample
+  - spec/ruby/command_line/fixtures
+  - spec/ruby/core/enumerable/shared/inject.rb
+  - spec/ruby/core/exception/fixtures
+  - spec/ruby/core/proc/parameters_spec.rb
+  - spec/ruby/core/proc/ruby2_keywords_spec.rb
+  - spec/ruby/core/range/reverse_each_spec.rb
+  - spec/ruby/language/fixtures
+  - spec/ruby/language/lambda_spec.rb
+  - spec/ruby/language/method_spec.rb
+  - spec/ruby/language/string_spec.rb
+  - test/error_highlight/test_error_highlight.rb
+  - test/prism/result/named_capture_test.rb
+  - test/ruby/test_call.rb
+  - test/ruby/test_signal.rb
+  - test/ruby/test_super.rb
+  - test/ruby/test_syntax.rb
+  - test/ruby/test_unicode_escape.rb
+  - test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspec
+  - trace_point.rb
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..57da742e5c
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,29 @@
+version: 2
+updates:
+  - package-ecosystem: 'github-actions'
+    directories:
+      - '/'
+      - '/.github/actions/slack'
+      - '/.github/actions/setup/directories'
+    schedule:
+      interval: 'daily'
+    groups:
+      github-actions:
+        patterns:
+          - "*"
+  - package-ecosystem: 'cargo'
+    directories:
+      - '/yjit'
+      - '/zjit'
+    exclude-paths:
+      - 'gc/mmtk/**'
+    schedule:
+      interval: 'monthly'
+    groups:
+      jit:
+        patterns:
+          - "*"
+  - package-ecosystem: 'vcpkg'
+    directory: '/'
+    schedule:
+      interval: 'daily'
diff --git a/.github/labeler.yml b/.github/labeler.yml
new file mode 100644
index 0000000000..f39fcec386
--- /dev/null
+++ b/.github/labeler.yml
@@ -0,0 +1,7 @@
+Documentation:
+- changed-files:
+  - all-globs-to-all-files: doc/**
+
+Backport:
+- base-branch: 'ruby_3_\d'
+- base-branch: 'ruby_4_\d'
diff --git a/.github/workflows/annocheck.yml b/.github/workflows/annocheck.yml
new file mode 100644
index 0000000000..1d23c38fcd
--- /dev/null
+++ b/.github/workflows/annocheck.yml
@@ -0,0 +1,111 @@
+name: Annocheck
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  compile:
+    name: test-annocheck
+
+    runs-on: ubuntu-latest
+
+    container:
+      image: ghcr.io/ruby/ruby-ci-image:gcc-11
+      options: --user root
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    env:
+      CONFIGURE_TTY: never
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci rgengc
+      RUBY_TESTOPTS: >-
+        -q
+        --color=always
+        --tty=no
+      # FIXME: Drop skipping options
+      # https://bugs.ruby-lang.org/issues/18061
+      # https://sourceware.org/annobin/annobin.html/Test-pie.html
+      TEST_ANNOCHECK_OPTS: '--skip-pie --skip-gaps'
+
+    steps:
+      - run: id
+        working-directory:
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      # Minimal flags to pass the check.
+      # -g0 disables backtraces when SEGV.  Do not set that.
+      - name: Run configure
+        run: >
+          ../src/configure -C
+          --enable-debug-env
+          --disable-install-doc
+          --with-ext=-test-/cxxanyargs,+
+          --without-valgrind
+          --without-jemalloc
+          --without-gmp
+          --with-gcc="gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes"
+          --enable-shared
+          debugflags=-ggdb3
+          optflags=-O2
+          LDFLAGS=-Wl,-z,now
+
+      - run: make showflags
+
+      - run: make
+
+      - run: make test-annocheck
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
new file mode 100644
index 0000000000..1be2b11b86
--- /dev/null
+++ b/.github/workflows/auto_request_review.yml
@@ -0,0 +1,20 @@
+name: Auto Request Review
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+
+permissions:
+  contents: read
+
+jobs:
+  auto-request-review:
+    name: Auto Request Review
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
+    steps:
+      - name: Request review based on files changes and/or groups the author belongs to
+        uses: necojackarc/auto-request-review@5d3060495e58e9cb41f51de50e808d3135d5374e # master
+        with:
+          # scope: public_repo
+          token: ${{ secrets.MATZBOT_AUTO_REQUEST_REVIEW_TOKEN }}
diff --git a/.github/workflows/auto_review_pr.yml b/.github/workflows/auto_review_pr.yml
new file mode 100644
index 0000000000..24859ad0b0
--- /dev/null
+++ b/.github/workflows/auto_review_pr.yml
@@ -0,0 +1,41 @@
+name: Auto Review PR
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+  workflow_dispatch:
+    inputs:
+      pr_number:
+        description: 'PR number to review'
+        required: true
+        type: number
+
+permissions:
+  contents: read
+
+jobs:
+  auto-review-pr:
+    name: Auto Review PR
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && (github.base_ref == 'master' || github.event_name == 'workflow_dispatch') }}
+
+    permissions:
+      pull-requests: write
+      contents: read
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Auto Review PR
+        run: ruby tool/auto_review_pr.rb "$GITHUB_PR_NUMBER"
+        env:
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GITHUB_PR_NUMBER: ${{ github.event.pull_request.number || github.event.inputs.pr_number }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..1acfbe19ac
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,76 @@
+name: BASERUBY Check
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  baseruby:
+    name: BASERUBY
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        ruby:
+          - ruby-3.1
+          - ruby-3.2
+          - ruby-3.3
+
+    steps:
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+
+      - run: ./configure --disable-install-doc
+
+      - run: make all
+
+      - run: make test
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
new file mode 100644
index 0000000000..d890ed2495
--- /dev/null
+++ b/.github/workflows/bundled_gems.yml
@@ -0,0 +1,186 @@
+name: bundled_gems
+
+env:
+  UPDATE_ENABLED: true
+
+on:
+  push:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  pull_request:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  merge_group:
+  schedule:
+    - cron: '45 6 * * *'
+  workflow_dispatch:
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  update:
+    permissions:
+      contents: write # for Git to git push
+
+    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+
+    name: update ${{ github.workflow }}
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: 4.0
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Set ENV
+        run: |
+          echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+      - name: Download previous gems list
+        run: |
+          mkdir -p .downloaded-cache
+          for data in bundled_gems.json default_gems.json; do
+            ln -s .downloaded-cache/$data .
+            curl --retry 5 --retry-connrefused --retry-delay 2 --retry-max-time 60 -O -R -z ./$data https://stdgems.org/$data
+          done
+
+      - name: Update bundled gems list
+        id: bundled_gems
+        run: |
+          ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems >> $GITHUB_OUTPUT
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb bundled
+          ruby tool/update-NEWS-github-release.rb --update
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          news= gems=
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- NEWS.md ||
+          news=true
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- gems/bundled_gems ||
+          gems=true
+          git add -- NEWS.md gems/bundled_gems
+          echo news=$news >> $GITHUB_OUTPUT
+          echo gems=$gems >> $GITHUB_OUTPUT
+          echo update=${news:-$gems} >> $GITHUB_OUTPUT
+
+      - name: Commit
+        id: commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          message="Update bundled gems list"
+          if [ -z "${gems}" ]; then
+            git commit --message="[DOC] ${message} at ${GITHUB_SHA:0:30}"
+          else
+            git commit --message="${message} as of ${TODAY}"
+          fi
+        env:
+          TODAY: ${{ steps.bundled_gems.outputs.latest_date || env.TODAY }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          gems: ${{ steps.diff.outputs.gems }}
+        if: ${{ steps.diff.outputs.update }}
+
+      - name: Development revision of bundled gems
+        run: |
+          #!ruby
+          file = "gems/bundled_gems"
+
+          SECONDS_IN_DAY = 86400
+          today = Time.new("#{ENV['TODAY']}Z")
+          if !(december = today.month == 12)
+            days = 30
+          elsif (days = 26 - today.day).positive?
+            days += 4
+          else
+            puts "::info:: just after released"
+            exit
+          end
+
+          since = "#{today.year-1}-12-26"
+          ref = ENV['GITHUB_REF']
+          puts "::group::\e[94mfetching \e[1m#{file}\e[22m since \e[1m#{since}\e[22m from \e[1m#{ref}\e[m"
+          system(*%W[git fetch --shallow-since=#{since} --no-tags origin #{ref}], exception: true)
+          puts "::endgroup::"
+
+          puts "\e[94mchecking development version bundled gems older than \e[1m#{days}\e[22m days\e[m"
+          limit = today.to_i - days * SECONDS_IN_DAY
+          old = 0
+          IO.popen(%W"git blame --line-porcelain -- #{file}") do |blame|
+            while head = blame.gets("\n\t") and s = blame.gets
+              next unless (gem = s.split(/\s+|#.*/)).size > 3
+              time = head[/^committer-time \K\d+/].to_i
+              next if (d = limit - time) <= 0
+              d /= SECONDS_IN_DAY
+              line = head[/\A\h+ \d+ \K\d+/].to_i
+              level = if d < days; 'warning'; else old += 1; 'error'; end
+              d += days
+              puts "::#{level} file=#{file},line=#{line},title=Older than #{d} days::#{gem[0]} #{gem[3]}"
+            end
+          end
+          abort "::error title=Too long-standing gems::The release comes soon." if december and old.nonzero?
+        shell: ruby {0}
+        env:
+          file: ${{ steps.logs.outputs.file }}
+          days: ${{ steps.logs.outputs.days }}
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Build
+        run: |
+          ./autogen.sh
+          ./configure -C --disable-install-doc
+          make
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Prepare bundled gems
+        run: |
+          make -s prepare-gems
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Test bundled gems
+        run: |
+          make -s test-bundled-gems
+        timeout-minutes: 30
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Push
+        run: |
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.commit.outcome == 'success'
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..ad399b264f
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,61 @@
+name: Check Dependencies
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update-deps:
+    name: Dependency checks
+
+    strategy:
+      matrix:
+        os: [ubuntu-latest]
+      fail-fast: true
+
+    runs-on: ${{ matrix.os }}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - uses: ./.github/actions/setup/directories
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - name: Run configure
+        run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+
+      - run: make fix-depends
+
+      - run: git diff --color --no-ext-diff --ignore-submodules --exit-code
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / Dependencies need to update
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_misc.yml b/.github/workflows/check_misc.yml
new file mode 100644
index 0000000000..f194d00779
--- /dev/null
+++ b/.github/workflows/check_misc.yml
@@ -0,0 +1,151 @@
+name: Misc
+on: [push, pull_request, merge_group]
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  checks:
+    name: Miscellaneous checks
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: head
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Re-generate Makefiles
+        run: |
+          # config.status needs to run as a shell script
+          { echo ':&&exit'; cat tool/prereq.status; } > config.status
+          : # same as actions/setup/directories/action.yml
+          for mk in Makefile GNUmakefile; do
+            sed -f tool/prereq.status template/$mk.in > $mk
+          done
+
+      - name: Check for code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA"
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.pull_request.base.sha }}
+          GITHUB_NEW_SHA: ${{ github.event.pull_request.merge_commit_sha }}
+        # Skip 'push' events because post_push.yml fixes them on push
+        if: ${{ github.repository == 'ruby/ruby' && startsWith(github.event_name, 'pull') }}
+
+      - name: Check if date in man pages is up-to-date
+        run: |
+          git fetch origin --depth=1 "${GITHUB_OLD_SHA}"
+          git diff --exit-code --name-only "${GITHUB_OLD_SHA}" HEAD -- man ||
+          make V=1 GIT=git BASERUBY=ruby update-man-date
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- man
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.pull_request.base.sha }}
+        if: ${{ startsWith(github.event_name, 'pull') }}
+
+      - name: Check for bash specific substitution in configure.ac
+        run: |
+          git grep -n '\${[A-Za-z_0-9]*/' -- configure.ac && exit 1 || :
+
+      - name: Check for header macros
+        run: |
+          fail=
+          for header in ruby/*.h; do
+            git grep -l -F -e $header -e HAVE_`echo $header | tr a-z./ A-Z__` -- . > /dev/null && continue
+            fail=1
+            echo $header
+          done
+          exit $fail
+        working-directory: include
+
+      - id: now
+        run: |
+          date +"mon=%-m"%n"day=%-d" >> $GITHUB_OUTPUT
+        env:
+          TZ: Asia/Tokyo
+
+      - id: deprecation
+        run: |
+          eval $(sed -n 's/^#define RUBY_API_VERSION_\(MAJOR\|MINOR\) /\1=/p' include/ruby/version.h)
+          if git --no-pager grep --color -o 'rb_warn_deprecated_to_remove_at('$MAJOR'\.'$MINOR',.*' -- '*.c' >&2; then
+              false
+          else
+              true
+          fi
+        continue-on-error: ${{ steps.now.outputs.mon < 12 }}
+
+      - name: Check if to generate documents
+        id: rdoc
+        run: |
+          set -- $(sed 's/#.*//;/^rdoc /!d' gems/bundled_gems)
+          { echo version=$2; echo ref=$4; } >> $GITHUB_OUTPUT
+
+      - name: Checkout rdoc
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          repository: ruby/rdoc
+          ref: ${{ steps.rdoc.outputs.ref }}
+          path: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+          persist-credentials: false
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Generate rdoc scripts
+        run: |
+          set -x
+          gempath=$(ruby -e 'print Gem.user_dir, "/bin"')
+          PATH=$gempath:$PATH
+          gem install --user bundler
+          bundle config --local path vendor/bundle
+          bundle install --jobs 4
+          bundle exec rake generate
+        working-directory: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Core docs coverage
+        run: |
+          make XRUBY=ruby RDOC_DEPENDS= RBCONFIG=update-rbconfig rdoc-coverage
+
+      - name: Generate docs
+        id: docs
+        run: |
+          make XRUBY=ruby RDOC_DEPENDS= RBCONFIG=update-rbconfig HTMLOUT=html html
+          echo htmlout=ruby-html-${GITHUB_SHA:0:10} >> $GITHUB_OUTPUT
+        # Generate only when document commit/PR
+        if: >-
+          ${{false
+          || contains(github.event.head_commit.message, '[ruby/rdoc]')
+          || contains(github.event.head_commit.message, '[DOC]')
+          || contains(github.event.pull_request.title, '[DOC]')
+          || contains(github.event.pull_request.labels.*.name, 'Documentation')
+          }}
+
+      - name: Upload docs
+        uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        with:
+          path: html
+          name: ${{ steps.docs.outputs.htmlout }}
+        if: ${{ steps.docs.outcome == 'success' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_sast.yml b/.github/workflows/check_sast.yml
new file mode 100644
index 0000000000..6fd1be6542
--- /dev/null
+++ b/.github/workflows/check_sast.yml
@@ -0,0 +1,133 @@
+name: 'Check SAST tool'
+
+on:
+  push:
+    branches: ['master']
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  schedule:
+    - cron: '0 12 * * *'
+  workflow_dispatch:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  zizmor:
+    name: zizmor
+
+    runs-on: ubuntu-latest
+
+    permissions:
+      contents: read
+      security-events: write
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Run zizmor
+        uses: zizmorcore/zizmor-action@5f14fd08f7cf1cb1609c1e344975f152c7ee938d # v0.5.6
+        continue-on-error: true
+
+  analyze:
+    name: Analyze
+    runs-on: ubuntu-latest
+    permissions:
+      actions: read # for github/codeql-action/init to get workflow details
+      contents: read # for actions/checkout to fetch code
+      security-events: write # for github/codeql-action/upload-sarif to send a status report
+    # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - language: cpp
+          - language: ruby
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Initialize CodeQL
+        uses: github/codeql-action/init@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          languages: ${{ matrix.language }}
+          build-mode: none
+          config-file: .github/codeql/codeql-config.yml
+
+      - name: Perform CodeQL Analysis
+        uses: github/codeql-action/analyze@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          category: '/language:${{ matrix.language }}'
+          upload: False
+          output: sarif-results
+
+      - name: filter-sarif
+        uses: advanced-security/filter-sarif@2da736ff05ef065cb2894ac6892e47b5eac2c3c0 # v1.1
+        with:
+          patterns: |
+            +**/*.rb
+            -lib/uri/mailto.rb:rb/overly-large-range
+            -lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/mailto.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -spec/ruby/core/regexp/timeout_spec.rb:rb/redos
+            -test/ruby/test_io.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_open-uri.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_ssl.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/binread_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/readlines_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/foreach_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/write_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/read_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/kernel/open_spec.rb:rb/non-constant-kernel-open
+          input: sarif-results/${{ matrix.language }}.sarif
+          output: sarif-results/${{ matrix.language }}.sarif
+        if: ${{ matrix.language == 'ruby' }}
+        continue-on-error: true
+
+      - name: filter-sarif
+        uses: advanced-security/filter-sarif@2da736ff05ef065cb2894ac6892e47b5eac2c3c0 # v1.1
+        with:
+          patterns: |
+            +**/*.c
+            +**/*.h
+          input: sarif-results/${{ matrix.language }}.sarif
+          output: sarif-results/${{ matrix.language }}.sarif
+        if: ${{ matrix.language == 'cpp' }}
+        continue-on-error: true
+
+      - name: Upload SARIF
+        uses: github/codeql-action/upload-sarif@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          sarif_file: sarif-results/${{ matrix.language }}.sarif
+        continue-on-error: true
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..147470f38a
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,333 @@
+# Some tests depending on this name 'Compilations' via $GITHUB_WORKFLOW. Make sure to update such tests when renaming this workflow.
+name: Compilations
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Each job is split so that they roughly take 30min to run through.
+jobs:
+  compile-if:
+    name: 'omnibus compilations, trigger'
+    runs-on: ubuntu-latest
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+    steps:
+      - run: true
+        working-directory:
+
+  compile1:
+    name: 'omnibus compilations, #1'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      # Set fetch-depth: 10 so that Launchable can receive commits information.
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'clang 22 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: clang-22
+          with_gcc: 'clang-22 -flto=auto'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 30
+      - { uses: './.github/actions/compilers', name: '-O0', with: { optflags: '-O0 -march=x86-64 -mtune=generic' }, timeout-minutes: 5 }
+      # - { uses: './.github/actions/compilers', name: '-O3', with: { optflags: '-O3 -march=x86-64 -mtune=generic', check: true } }
+
+  compile2:
+    name: 'omnibus compilations, #2'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'GCC 15 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: gcc-15
+          with_gcc: 'gcc-15 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 10
+      - { uses: './.github/actions/compilers', name: 'ext/Setup', with: { static_exts: 'etc json/* */escape' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 15', with: { tag: 'gcc-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 14', with: { tag: 'gcc-14' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 13', with: { tag: 'gcc-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 12', with: { tag: 'gcc-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 11', with: { tag: 'gcc-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 10', with: { tag: 'gcc-10' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 9',  with: { tag: 'gcc-9'  }, timeout-minutes: 5 }
+
+  compile3:
+    name: 'omnibus compilations, #3'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 20', with: { tag: 'clang-20' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 19', with: { tag: 'clang-19' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 18', with: { tag: 'clang-18' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 17', with: { tag: 'clang-17' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 16', with: { tag: 'clang-16' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 15', with: { tag: 'clang-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 14', with: { tag: 'clang-14' }, timeout-minutes: 5 }
+
+  compile4:
+    name: 'omnibus compilations, #4'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 13', with: { tag: 'clang-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 12', with: { tag: 'clang-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 11', with: { tag: 'clang-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 10', with: { tag: 'clang-10' }, timeout-minutes: 5 }
+        # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o and fail `make test-leaked-globals`.
+      - { uses: './.github/actions/compilers', name: 'clang 9',  with: { tag: 'clang-9',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 8',  with: { tag: 'clang-8',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 7',  with: { tag: 'clang-7',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 6',  with: { tag: 'clang-6.0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compile5:
+    name: 'omnibus compilations, #5'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      # -Wno-strict-prototypes is necessary with current clang-15 since
+      # older autoconf generate functions without prototype and -pedantic
+      # now implies strict-prototypes. Disabling the error but leaving the
+      # warning generates a lot of noise from use of ANYARGS in
+      # rb_define_method() and friends.
+      # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
+      - { uses: './.github/actions/compilers', name: 'C99',      with: { CFLAGS: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C11',   with: { CFLAGS:   '-std=c11   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C17',   with: { CFLAGS:   '-std=c17   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C23',   with: { CFLAGS:   '-std=c2x   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++98', with: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++11', with: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++14', with: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++17', with: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+
+  compile6:
+    name: 'omnibus compilations, #6'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'C++20', with: { CXXFLAGS: '-std=c++20 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++23', with: { CXXFLAGS: '-std=c++23 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++26', with: { CXXFLAGS: '-std=c++26 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'gmp',                 with: { append_configure: '--with-gmp', test_all: 'ruby/test_bignum.rb', test_spec: "/github/workspace/src/spec/ruby/core/integer" }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'jemalloc',            with: { append_configure: '--with-jemalloc' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'valgrind',            with: { append_configure: '--with-valgrind' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=ucontext',  with: { append_configure: '--with-coroutine=ucontext' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=pthread',   with: { append_configure: '--with-coroutine=pthread' }, timeout-minutes: 5 }
+
+  compile7:
+    name: 'omnibus compilations, #7'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'disable-jit',         with: { append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-yjit',        with: { append_configure: '--disable-yjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-zjit',        with: { append_configure: '--disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-dln',         with: { append_configure: '--disable-dln' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'enable-mkmf-verbose', with: { append_configure: '--enable-mkmf-verbose' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-rubygems',    with: { append_configure: '--disable-rubygems' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEVEL',          with: { append_configure: '--enable-devel' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=0',            with: { cppflags: '-DOPT_THREADED_CODE=0' }, timeout-minutes: 5 }
+
+  compile8:
+    name: 'omnibus compilations, #8'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'NDEBUG',                         with: { cppflags: '-DNDEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEBUG',                     with: { cppflags: '-DRUBY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ARRAY_DEBUG',                    with: { cppflags: '-DARRAY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CCAN_LIST_DEBUG',                with: { cppflags: '-DCCAN_LIST_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CPDEBUG=-1',                     with: { cppflags: '-DCPDEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ENC_DEBUG',                      with: { cppflags: '-DENC_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG',                       with: { cppflags: '-DGC_DEBUG' }, timeout-minutes: 5 }
+
+  compile9:
+    name: 'omnibus compilations, #9'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'HASH_DEBUG',                     with: { cppflags: '-DHASH_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ID_TABLE_DEBUG',                 with: { cppflags: '-DID_TABLE_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_DEBUG=-1',                with: { cppflags: '-DRGENGC_DEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SYMBOL_DEBUG',                   with: { cppflags: '-DSYMBOL_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_CHECK_MODE',              with: { cppflags: '-DRGENGC_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_CHECK_MODE',                  with: { cppflags: '-DVM_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_EMBED_CI=0',                 with: { cppflags: '-DUSE_EMBED_CI=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_FLONUM=0',                   with: { cppflags: '-DUSE_FLONUM=0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compileX:
+    name: 'omnibus compilations, #10'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'USE_LAZY_LOAD',                  with: { cppflags: '-DUSE_LAZY_LOAD' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_RUBY_DEBUG_LOG=1',           with: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_DEBUG_COUNTER',              with: { cppflags: '-DUSE_DEBUG_COUNTER=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SHARABLE_MIDDLE_SUBSTRING',      with: { cppflags: '-DSHARABLE_MIDDLE_SUBSTRING=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_FIND_TIME_NUMGUESS',       with: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_INTEGER_PACK',             with: { cppflags: '-DDEBUG_INTEGER_PACK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=1',            with: { cppflags: '-DOPT_THREADED_CODE=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=2',            with: { cppflags: '-DOPT_THREADED_CODE=2' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 21', with: { tag: 'clang-21' }, timeout-minutes: 5 }
+
+  compileB:
+    name: 'omnibus compilations, #11'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG_STRESS_TO_CLASS',       with: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_ENABLE_LAZY_SWEEP=0',         with: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_DETAIL_MEMORY',       with: { cppflags: '-DGC_PROFILE_DETAIL_MEMORY' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_MORE_DETAIL',         with: { cppflags: '-DGC_PROFILE_MORE_DETAIL' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'MALLOC_ALLOCATED_SIZE_CHECK',    with: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_ESTIMATE_OLDMALLOC',      with: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_PROFILE',                 with: { cppflags: '-DRGENGC_PROFILE' }, timeout-minutes: 5 }
+
+  compileC:
+    name: 'omnibus compilations, #12'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_BP_CHECK',              with: { cppflags: '-DVM_DEBUG_BP_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_VERIFY_METHOD_CACHE',   with: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'YJIT_FORCE_ENABLE',              with: { cppflags: '-DYJIT_FORCE_ENABLE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'UNIVERSAL_PARSER',               with: { cppflags: '-DUNIVERSAL_PARSER' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 23', with: { tag: 'clang-23' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 22', with: { tag: 'clang-22' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 8',  with: { tag: 'gcc-8'  }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 7',  with: { tag: 'gcc-7'  }, timeout-minutes: 5 }
+
+  compilemax:
+    name: 'omnibus compilations, result'
+    runs-on: ubuntu-latest
+    if: ${{ always() }}
+    needs:
+      - 'compile1'
+      - 'compile2'
+      - 'compile3'
+      - 'compile4'
+      - 'compile5'
+      - 'compile6'
+      - 'compile7'
+      - 'compile8'
+      - 'compile9'
+      - 'compileX'
+      - 'compileB'
+      - 'compileC'
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github, persist-credentials: false }
+      - uses: ./.github/actions/slack
+        with:
+          label: 'omnibus'
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+      - run: false
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/crosscompile.yml b/.github/workflows/crosscompile.yml
new file mode 100644
index 0000000000..4c28516e25
--- /dev/null
+++ b/.github/workflows/crosscompile.yml
@@ -0,0 +1,123 @@
+name: Cross compile
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    name: make (${{ matrix.host }} host on ${{ matrix.build }})
+    strategy:
+      matrix:
+        include:
+          - host: aarch64-linux-gnu
+            arch: arm64
+            build: x86_64-linux-gnu
+            runs-on: ubuntu-24.04
+            file_arch: ARM aarch64
+          - host: x86_64-linux-gnu
+            arch: amd64
+            build: aarch64-linux-gnu
+            runs-on: ubuntu-24.04-arm
+            file_arch: x86-64
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ${{ matrix.runs-on }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Setup cross-compilation toolchain sources
+        run: |
+          native_arch=$(dpkg --print-architecture)
+          # Restrict existing sources to native arch
+          sudo sed -i '/^Architectures:/d' /etc/apt/sources.list.d/ubuntu.sources
+          sudo sed -i "/^Types:/a Architectures: ${native_arch}" /etc/apt/sources.list.d/ubuntu.sources
+          # Add cross-arch sources
+          if [ "${{ matrix.arch }}" = "arm64" ]; then
+            cross_uri="http://ports.ubuntu.com/"
+          else
+            cross_uri="http://archive.ubuntu.com/ubuntu/"
+          fi
+          printf '%s\n' \
+            "Types: deb" \
+            "URIs: ${cross_uri}" \
+            "Suites: noble noble-updates noble-security" \
+            "Components: main universe" \
+            "Architectures: ${{ matrix.arch }}" \
+            | sudo tee /etc/apt/sources.list.d/cross-${{ matrix.arch }}.sources
+
+      - uses: ./.github/actions/setup/ubuntu
+        with:
+          arch: ${{ matrix.arch }}
+
+      - uses: ./.github/actions/setup/baseruby
+        id: baseruby
+        with:
+          srcdir: src
+
+      - name: Run configure
+        run: >-
+          ../src/configure -C --disable-install-doc
+          --prefix=/usr
+          --build=${{ matrix.build }}
+          --host=${{ matrix.host }}
+          --with-baseruby="$baseruby"
+        env:
+          baseruby: ${{ steps.baseruby.outputs.ruby }}
+
+      - run: make
+
+      - run: make install DESTDIR=$PWD/install
+
+      - name: Verify cross-compiled binary
+        run: |
+          file install/usr/bin/ruby
+          file install/usr/bin/ruby | grep -q '${{ matrix.file_arch }}'
+
+      - uses: ./.github/actions/slack
+        with:
+          label: cross ${{ matrix.host }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/cygwin.yml b/.github/workflows/cygwin.yml
new file mode 100644
index 0000000000..5ab86c7b19
--- /dev/null
+++ b/.github/workflows/cygwin.yml
@@ -0,0 +1,75 @@
+name: Cygwin
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    runs-on: windows-2022
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - run: git config --global core.autocrlf input
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Setup Cygwin
+        uses: cygwin/cygwin-install-action@711d29f3da23c9f4a1798e369a6f01198c13b11a # v6.1
+        with:
+          packages: ruby gcc-core make autoconf libtool libssl-devel libyaml-devel libffi-devel zlib-devel rubygems
+          site: |
+            https://cygwin.osuosl.org/
+
+      - name: configure
+        run: |
+          ./autogen.sh
+          ./configure --disable-install-doc
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: Extract bundled gems
+        run: |
+          make ruby -j5
+          make extract-gems
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4 V=1
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Cygwin
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/default_gems_list.yml b/.github/workflows/default_gems_list.yml
new file mode 100644
index 0000000000..f52b83103c
--- /dev/null
+++ b/.github/workflows/default_gems_list.yml
@@ -0,0 +1,99 @@
+name: Update default gems list
+on: [push, pull_request, merge_group]
+
+env:
+  UPDATE_NEWS_ENABLED: true
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update_default_gems_list:
+    name: Update default gems list
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - id: gems
+        run: true
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Download previous gems list
+        run: |
+          data=default_gems.json
+          mkdir -p .downloaded-cache
+          ln -s .downloaded-cache/$data .
+          curl --retry 5 --retry-connrefused --retry-delay 2 --retry-max-time 60 -O -R -z ./$data https://stdgems.org/$data
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Make default gems list
+        run: |
+          #!ruby
+          require 'rubygems'
+          $:.unshift "lib"
+          rgver = File.foreach("lib/rubygems.rb") do |line|
+            break $1 if /^\s*VERSION\s*=\s*"([^"]+)"/ =~ line
+          end
+          gems = Dir.glob("{ext,lib}/**/*.gemspec").map do |f|
+            spec = Gem::Specification.load(f)
+            "#{spec.name} #{spec.version}"
+          end.sort
+          File.open("gems/default_gems", "w") do |f|
+            f.puts "RubyGems #{rgver}"
+            f.puts gems
+          end
+        shell: ruby --disable=gems {0}
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb default
+        if: ${{ steps.gems.outcome == 'success' && env.UPDATE_NEWS_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          git diff --color --no-ext-diff --ignore-submodules --exit-code NEWS.md ||
+          echo update=true >> $GITHUB_OUTPUT
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          git commit --message="Update default gems list at ${GITHUB_SHA:0:30} [ci skip]" NEWS.md
+          git push origin ${GITHUB_REF#refs/heads/}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.diff.outputs.update
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/dependabot_automerge.yml b/.github/workflows/dependabot_automerge.yml
new file mode 100644
index 0000000000..2e4dc8d7a2
--- /dev/null
+++ b/.github/workflows/dependabot_automerge.yml
@@ -0,0 +1,32 @@
+# from https://github.com/gofiber/swagger/blob/main/.github/workflows/dependabot_automerge.yml
+name: Dependabot auto-merge
+on:
+  pull_request:
+
+permissions:
+  contents: write
+  pull-requests: write
+
+jobs:
+  automerge:
+    runs-on: ubuntu-latest
+    if: github.event.pull_request.user.login == 'dependabot[bot]' && github.repository == 'ruby/ruby'
+    steps:
+      - name: Dependabot metadata
+        uses: dependabot/fetch-metadata@25dd0e34f4fe68f24cc83900b1fe3fe149efef98 # v3.1.0
+        id: metadata
+
+      - name: Wait for status checks
+        uses: lewagon/wait-on-check-action@9312864dfbc9fd208e9c0417843430751c042800 # v1.7.0
+        with:
+          repo-token: ${{ secrets.GITHUB_TOKEN }}
+          ref: ${{ github.event.pull_request.head.sha || github.sha }}
+          check-regexp: 'make \(check, .*\)'
+          wait-interval: 30
+
+      - name: Auto-merge for Dependabot PRs
+        if: ${{ steps.metadata.outputs.update-type == 'version-update:semver-minor' || steps.metadata.outputs.update-type == 'version-update:semver-patch' }}
+        run: gh pr merge --auto --rebase "$PR_URL"
+        env:
+          PR_URL: ${{ github.event.pull_request.html_url }}
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_DEPENDABOT_MERGE_TOKEN }}
diff --git a/.github/workflows/labeler.yml b/.github/workflows/labeler.yml
new file mode 100644
index 0000000000..d0a8024b05
--- /dev/null
+++ b/.github/workflows/labeler.yml
@@ -0,0 +1,15 @@
+name: "Pull Request Labeler"
+on:
+- pull_request_target
+
+permissions:
+  contents: read
+
+jobs:
+  labeler:
+    permissions:
+      contents: read
+      pull-requests: write
+    runs-on: ubuntu-latest
+    steps:
+    - uses: actions/labeler@f27b608878404679385c85cfa523b85ccb86e213 # v6.1.0
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..501d35698b
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,191 @@
+name: macOS
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: macos-26
+          - test_task: check
+            os: macos-15
+            configure_args: '--with-gcc=gcc-14'
+          - test_task: check
+            os: macos-26
+            configure_args: '--with-jemalloc --with-opt-dir=$(brew --prefix jemalloc)'
+          - test_task: check
+            os: macos-26
+            configure_args: '--with-gmp'
+          - test_task: test-all
+            test_opts: --repeat-count=2
+            os: macos-26
+          - test_task: test-bundler-parallel
+            os: macos-26
+          - test_task: test-bundled-gems
+            os: macos-26
+          - test_task: check
+            os: macos-15
+          - test_task: check
+            os: macos-15-intel
+          - test_task: check
+            os: macos-14
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 0 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${ruby_configure_args} ${{ matrix.configure_args }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - run: make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os }}
+          test-opts: ${{ matrix.test_opts }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: Set extra test options
+        run: |
+          echo "TESTS=$TESTS ${{ matrix.test_opts }}" >> $GITHUB_ENV
+          echo "RUBY_TEST_TIMEOUT_SCALE=10" >> $GITHUB_ENV # With --repeat-count=2, flaky test by timeout occurs frequently for some reason
+        if: matrix.test_opts
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          ulimit -c unlimited
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..1efae8be59
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,246 @@
+name: MinGW
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+  make:
+    runs-on: windows-${{ matrix.os }}
+
+    name: ${{ github.workflow }} (${{ matrix.msystem }})
+
+    env:
+      MSYSTEM: ${{ matrix.msystem }}
+      MSYS2_ARCH: >-
+        ${{ case(
+        contains(matrix.msystem, 'arm64'), 'aarch64',
+        contains(matrix.msystem, '64'), 'x86_64',
+        'i686'
+        ) }}
+      MINGW_PACKAGE_PREFIX: >-
+        mingw-w${{
+        case(endsWith(matrix.msystem, '64'), '64', '32')
+        }}-${{ case(
+        startsWith(matrix.msystem, 'clang'), 'clang',
+        startsWith(matrix.msystem, 'ucrt'), 'ucrt',
+        'mingw'
+        ) }}-${{ case(
+        contains(matrix.msystem, 'arm64'), 'aarch64',
+        endsWith(matrix.msystem, '64'), 'x86_64',
+        'i686'
+        ) }}
+      CFLAGS: '-mtune=generic -O3 -pipe'
+      CXXFLAGS: '-mtune=generic -O3 -pipe'
+      CPPFLAGS: '-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048'
+      LDFLAGS: '-pipe'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    strategy:
+      matrix:
+        include:
+          # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
+          # Ruby 3.2 is the first Windows Ruby to use OpenSSL 3.x
+          - msystem: 'UCRT64'
+            os: 2022
+            test_task: 'check'
+            test-all-opts: '--name=!/TestObjSpace#test_reachable_objects_during_iteration/'
+          - msystem: 'CLANGARM64'
+            os: 11-arm
+            test_task: 'check'
+      fail-fast: false
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/vcpkg'))
+      )}}
+
+    steps:
+      - uses: msys2/setup-msys2@e9898307ac31d1a803454791be09ab9973336e1c # v2.31.1
+        id: msys2
+        with:
+          msystem: ${{ matrix.msystem }}
+          update: true
+          install: >-
+            git
+            make
+            ruby
+            autoconf
+            ${{ env.MINGW_PACKAGE_PREFIX }}-gcc
+            ${{ env.MINGW_PACKAGE_PREFIX }}-ragel
+            ${{ env.MINGW_PACKAGE_PREFIX }}-openssl
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libyaml
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libffi
+
+      - name: Set up env
+        id: setup-env
+        working-directory:
+        run: |
+          $msys2 = ${env:MSYS2_LOCATION}
+          $msystem = ${env:MSYSTEM}.ToLower()
+          echo $msys2\usr\bin $msys2\$msystem\bin |
+            Tee-Object ${env:GITHUB_PATH} -Append -Encoding utf-8
+
+          # Use the fast device for the temporary directory.
+          # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+          # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+          $tmp = ${env:RUNNER_TEMP}
+          echo HOME=$home TMP=$tmp TEMP=$tmp TMPDIR=$tmp |
+            Tee-Object ${env:GITHUB_ENV} -Append -Encoding utf-8
+        shell: pwsh             # cmd.exe does not strip spaces before `|`.
+        env:
+          MSYS2_LOCATION: ${{ steps.msys2.outputs.msys2-location }}
+          MSYSTEM: ${{ matrix.msystem }}
+
+      - name: Remove Strawberry Perl pkg-config
+        working-directory:
+        # `pkg-config.bat` included in Strawberry Perl is written in
+        # Perl and doesn't work when another msys2 `perl` precede its
+        # own `perl`.
+        #
+        # ```
+        # Can't find C:\Strawberry\perl\bin\pkg-config.bat on PATH, '.' not in PATH.
+        # ```
+        run: |
+          Get-Command pkg-config.bat | % { ren $_.path ($_.path + "~") }
+        shell: pwsh
+
+      - name: Misc system & package info
+        working-directory:
+        run: |
+          group() { echo ::group::$'\e[94;1m'"$*"$'\e[m'; }
+          endgroup() { echo ::endgroup::; }
+
+          group Path
+          cygpath -wa / . $(type -p cygpath bash sh)
+          endgroup
+
+          I() {
+              group $1
+              run Where type -pa $1 && { [ $# -eq 1 ] || run Version "$@"; } ||
+                  failed+=($1)
+              endgroup
+          }
+          run() { local w m=$1; shift; w="$("$@")" && show "$m" && indent "$w"; }
+          indent() { [ -z "$1" ] || echo "$1" | /bin/sed '/^$/!s/^/  /'; }
+          show() { echo $'\e[96m'"$*"$'\e[m'; }
+
+          failed=()
+
+          I gcc.exe --version
+          I ragel.exe --version
+          I make.exe --version
+          I openssl.exe version
+          I libcrypto-3-x64.dll
+          I libssl-3-x64.dll
+
+          group Packages
+          pacman -Qs $MINGW_PACKAGE_PREFIX-* | /bin/sed -n "s,local/$MINGW_PACKAGE_PREFIX-,,p"
+          endgroup
+
+          [ ${#failed[@]} -eq 0 ]
+        shell: sh
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: configure
+        run: >
+          ../src/configure --disable-install-doc --prefix=/.
+          --build=$CHOST --host=$CHOST --target=$CHOST
+        shell: sh
+        env:
+          CHOST: ${{ env.MSYS2_ARCH }}-w64-mingw32
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4
+
+      - name: make install
+        run: make DESTDIR=../install install-nodoc
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-2022
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-tasks: '["test", "test-all", "test-spec"]'
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: test
+        timeout-minutes: 30
+        run: make test test-tool
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test' }}
+
+      - name: test-all
+        timeout-minutes: 45
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
+        env:
+          RUBY_TESTOPTS: >-
+            --retry --job-status=normal --show-skip --timeout-scale=1.5 -j4
+            ${{ matrix.test-all-opts }}
+            ${{ env.TESTS }}
+          BUNDLER_VERSION:
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/') }}
+
+      - name: test-spec
+        timeout-minutes: 10
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/') }}
+
+      - uses: ./src/.github/actions/slack
+        with:
+          label: ${{ matrix.msystem }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/modgc.yml b/.github/workflows/modgc.yml
new file mode 100644
index 0000000000..bd3c6ab575
--- /dev/null
+++ b/.github/workflows/modgc.yml
@@ -0,0 +1,179 @@
+name: ModGC
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  check:
+    strategy:
+      matrix:
+        gc:
+          - name: default
+          - name: mmtk
+            mmtk_build: release
+        os: [macos-26, ubuntu-latest]
+        include:
+          - test_task: check
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries (macOS)
+        uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Install libraries (Ubuntu)
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: false
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Setup Ruby GC Directory
+        run: |
+          echo "MODULAR_GC_DIR=$HOME/ruby_gc" >> $GITHUB_ENV
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+        run: |
+          ${SETARCH} ../src/configure -C --disable-install-doc --with-modular-gc="${MODULAR_GC_DIR}" \
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - uses: actions-rust-lang/setup-rust-toolchain@46268bd060767258de96ed93c1251119784f2ab6 # v1.16.1
+        with:
+          cache-bin: false
+      - name: Set MMTk environment variables
+        run: |
+          echo 'EXCLUDES=../src/test/.excludes-mmtk' >> $GITHUB_ENV
+          echo 'MSPECOPT=-B../src/spec/mmtk.mspec' >> $GITHUB_ENV
+        if: ${{ matrix.gc.name == 'mmtk' }}
+
+      - run: ${SETARCH} make
+
+      - name: Build Modular  GC
+        run: |
+          echo "RUBY_GC_LIBRARY=${{ matrix.gc.name }}" >> $GITHUB_ENV
+          make install-modular-gc MODULAR_GC=${{ matrix.gc.name }} MMTK_BUILD=${{ matrix.gc.mmtk_build }}
+          make distclean-modular-gc MODULAR_GC=${{ matrix.gc.name }}
+
+      - run: ${SETARCH} make hello
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          ${SETARCH} make -s ${{ matrix.test_task }} \
+            ${TESTS:+TESTS="$TESTS"} \
+            ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.gc.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          ${SETARCH} make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/parse_y.yml b/.github/workflows/parse_y.yml
new file mode 100644
index 0000000000..a0082f71de
--- /dev/null
+++ b/.github/workflows/parse_y.yml
@@ -0,0 +1,101 @@
+name: parse.y
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+          - test_task: test-bundler-parallel
+          - test_task: test-bundled-gems
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc cppflags=-DRUBY_DEBUG --with-parser=parse.y
+
+      - run: make
+
+      - run: make TESTRUN_SCRIPT='-renvutil -v -e "exit EnvUtil.current_parser == %[parse.y]"' run
+        env:
+          RUNOPT0: -I$(tooldir)/lib
+
+      - name: make ${{ matrix.test_task }}
+        run: make -s ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" SPECOPTS="$SPECOPTS"
+        env:
+          RUBY_TESTOPTS: ${{ matrix.testopts }}
+          EXCLUDES: '../src/test/.excludes-parsey'
+          RUN_OPTS: ${{ matrix.run_opts || '--parser=parse.y' }}
+          SPECOPTS: ${{ matrix.specopts || '-T --parser=parse.y' }}
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.run_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/post_push.yml b/.github/workflows/post_push.yml
new file mode 100644
index 0000000000..237679ebb1
--- /dev/null
+++ b/.github/workflows/post_push.yml
@@ -0,0 +1,97 @@
+name: Post-push
+on:
+  push:
+    branches:
+      - master
+      - 'ruby_*_*'
+
+permissions:
+  contents: read
+
+jobs:
+  hooks:
+    name: Post-push hooks
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' }}
+    steps:
+      - name: Sync git.ruby-lang.org
+        id: sync-git
+        continue-on-error: true
+        run: |
+          mkdir -p ~/.ssh
+          (umask 066; printenv RUBY_GIT_SYNC_PRIVATE_KEY > ~/.ssh/id_ed25519)
+          ssh-keyscan -t ed25519 git.ruby-lang.org >> ~/.ssh/known_hosts
+          ssh -i ~/.ssh/id_ed25519 git-sync@git.ruby-lang.org "sudo -u git /home/git/git.ruby-lang.org/bin/update-ruby.sh $GITHUB_REF"
+        env:
+          GITHUB_REF: ${{ github.ref }}
+          RUBY_GIT_SYNC_PRIVATE_KEY: ${{ secrets.RUBY_GIT_SYNC_PRIVATE_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Fetch changesets on bugs.ruby-lang.org
+        run: |
+          curl "https://bugs.ruby-lang.org/sys/fetch_changesets?key=${REDMINE_SYS_API_KEY}" -s --fail-with-body -w '* status: %{http_code}\n'
+        env:
+          REDMINE_SYS_API_KEY: ${{ secrets.REDMINE_SYS_API_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        with:
+          fetch-depth: 500 # for notify-slack-commits
+          token: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Notify commit to Slack
+        run: ruby tool/notify-slack-commits.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          SLACK_WEBHOOK_URL_ALERTS: ${{ secrets.SLACK_WEBHOOK_URL_ALERTS }}
+          SLACK_WEBHOOK_URL_COMMITS: ${{ secrets.SLACK_WEBHOOK_URL_COMMITS }}
+          SLACK_WEBHOOK_URL_RUBY_JP: ${{ secrets.SLACK_WEBHOOK_URL_RUBY_JP }}
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Notify commit to ruby-cvs
+        run: |
+          SENDMAIL="ssh -i ${HOME}/.ssh/id_ed25519 git-sync@git.ruby-lang.org /usr/sbin/sendmail" \
+            ruby tool/commit-email.rb . ruby-cvs@g.ruby-lang.org \
+            "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" "$GITHUB_REF" \
+            --viewer-uri "https://github.com/ruby/ruby/commit/" \
+            --error-to cvs-admin@ruby-lang.org
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_REF: ${{ github.ref }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Auto-correct code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Push PR notes to GitHub
+        id: pr-notes
+        continue-on-error: true
+        run: ruby tool/notes-github-pr.rb "$(pwd)/.git" "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Check for failures
+        run: exit 1
+        if: ${{ steps.sync-git.outcome == 'failure' || steps.pr-notes.outcome == 'failure' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/pr-playground.yml b/.github/workflows/pr-playground.yml
new file mode 100644
index 0000000000..dc4f075a38
--- /dev/null
+++ b/.github/workflows/pr-playground.yml
@@ -0,0 +1,131 @@
+name: Post Playground link to PR
+on:
+  pull_request_target:
+    types: [labeled]
+  workflow_run:
+    workflows: ["WebAssembly"]
+    types: [completed]
+
+permissions:
+  contents: read
+  actions: read
+
+jobs:
+  post-summary:
+    name: Post Playground link
+    runs-on: ubuntu-latest
+    permissions:
+      pull-requests: write
+    # Post a comment only if the PR status check is passed and the PR is labeled with `Playground`.
+    # Triggered twice: when the PR is labeled and when PR build is passed.
+    if: >-
+      ${{ false
+      || (true
+        && github.event_name == 'pull_request_target'
+        && contains(github.event.pull_request.labels.*.name, 'Playground'))
+      || (true
+        && github.event_name == 'workflow_run'
+        && github.event.workflow_run.conclusion == 'success'
+        && github.event.workflow_run.event == 'pull_request')
+      }}
+    steps:
+      - uses: actions/github-script@3a2844b7e9c422d3c10d287c895573f7108da1b3 # v9.0.0
+        with:
+          github-token: ${{ secrets.GITHUB_TOKEN }}
+          script: |
+            const fs = require('fs/promises');
+
+            const buildWorkflowPath = '.github/workflows/wasm.yml';
+            const findSuccessfuBuildRun = async (pr) => {
+              const opts = github.rest.actions.listWorkflowRunsForRepo.endpoint.merge({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                status: 'success',
+                branch: pr.head.ref,
+              });
+              const runs = await github.paginate(opts);
+              const buildRun = runs.find(run => run.path == buildWorkflowPath);
+              return buildRun;
+            }
+
+            const postComment = async (body, pr) => {
+              const { data: comments } = await github.rest.issues.listComments({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                issue_number: pr.number,
+              });
+
+              const commentOpts = { owner: context.repo.owner, repo: context.repo.repo, body: comment };
+
+              const existingComment = comments.find(comment => comment.body.startsWith(magicComment));
+              if (existingComment) {
+                core.info(`Updating existing comment: ${existingComment.html_url}`);
+                await github.rest.issues.updateComment({
+                  ...commentOpts, comment_id: existingComment.id
+                });
+              } else {
+                await github.rest.issues.createComment({
+                  ...commentOpts, issue_number: pr.number
+                });
+              }
+            }
+
+            const derivePRNumber = async () => {
+              if (context.payload.pull_request) {
+                return context.payload.pull_request.number;
+              }
+              // Workaround for https://github.com/orgs/community/discussions/25220
+
+              const { data: { artifacts } } = await github.rest.actions.listWorkflowRunArtifacts({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                run_id: context.payload.workflow_run.id,
+              });
+              const artifact = artifacts.find(artifact => artifact.name == 'github-pr-info');
+              if (!artifact) {
+                throw new Error('Cannot find github-pr-info.txt artifact');
+              }
+
+              const { data } = await github.rest.actions.downloadArtifact({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                artifact_id: artifact.id,
+                archive_format: 'zip',
+              });
+
+              await fs.writeFile('pr-info.zip', Buffer.from(data));
+              await exec.exec('unzip', ['pr-info.zip']);
+              return await fs.readFile('github-pr-info.txt', 'utf8');
+            }
+
+            const prNumber = await derivePRNumber();
+
+            const { data: pr } = await github.rest.pulls.get({
+              owner: context.repo.owner,
+              repo: context.repo.repo,
+              pull_number: prNumber,
+            });
+
+            core.info(`Checking if the PR ${prNumber} is labeled with Playground...`);
+            if (!pr.labels.some(label => label.name == 'Playground')) {
+              core.info(`The PR is not labeled with Playground.`);
+              return;
+            }
+
+            core.info(`Checking if the build is successful for ${pr.head.ref} in ${pr.head.repo.owner.login}/${pr.head.repo.name}...`);
+            const buildRun = await findSuccessfuBuildRun(pr);
+            if (!buildRun) {
+              core.info(`No successful build run found for ${buildWorkflowPath} on ${pr.head.ref} yet.`);
+              return;
+            }
+            core.info(`Found a successful build run: ${buildRun.html_url}`);
+
+            const runLink = `${process.env.GITHUB_SERVER_URL}/${process.env.GITHUB_REPOSITORY}/actions/runs/${process.env.GITHUB_RUN_ID}`;
+            const magicComment = `<!-- AUTO-GENERATED-COMMENT-PR-PLAYGROUND -->`;
+            const comment = `${magicComment}
+            **Try on Playground**: https://ruby.github.io/play-ruby?run=${buildRun.id}
+            This is an automated comment by [\`pr-playground.yml\`](${runLink}) workflow.
+            `;
+            core.info(`Comment: ${comment}`);
+            await postComment(comment, pr);
+
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
new file mode 100644
index 0000000000..5d16915e10
--- /dev/null
+++ b/.github/workflows/publish.yml
@@ -0,0 +1,114 @@
+name: Publish Ruby packages
+
+on:
+  repository_dispatch:
+    types:
+      - release
+  workflow_dispatch:
+    inputs:
+      version:
+        description: 'Version of the Ruby package to release'
+        required: true
+        default: '4.0.0'
+
+permissions:
+  contents: read
+
+jobs:
+  release:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: 3.3.4
+
+      - name: Store Ruby version
+        env:
+          RUBY_VERSION: ${{ github.event.client_payload.version || github.event.inputs.version }}
+        run: |
+          echo "RUBY_VERSION=${RUBY_VERSION}" >> $GITHUB_ENV
+
+      - name: Store ABI version
+        run: echo "ABI_VERSION=$(echo ${RUBY_VERSION} | cut -d '.' -f 1-2)" >> $GITHUB_ENV
+
+      - name: Copy draft package `/tmp` to `/pub` directory
+        run: tool/release.sh ${RUBY_VERSION}
+        env:
+          AWS_ACCESS_KEY_ID: ${{ secrets.FTP_R_L_O_AWS_ACCESS_KEY_ID }}
+          AWS_SECRET_ACCESS_KEY: ${{ secrets.FTP_R_L_O_AWS_SECRET_ACCESS_KEY }}
+          AWS_DEFAULT_REGION: us-west-2
+
+      - name: Purge URLs of release package
+        run: |
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${ABI_VERSION}/ruby-${RUBY_VERSION}.tar.gz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${ABI_VERSION}/ruby-${RUBY_VERSION}.tar.xz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${ABI_VERSION}/ruby-${RUBY_VERSION}.zip
+
+      - name: Create a release on GitHub
+        run: |
+          RELEASE_TAG=$(ruby tool/ruby-version.rb tag "${RUBY_VERSION}")
+          echo $RELEASE_TAG
+          PREVIOUS_RELEASE_TAG=$(ruby tool/ruby-version.rb previous-tag "${RUBY_VERSION}")
+          echo $PREVIOUS_RELEASE_TAG
+          tool/gen-github-release.rb $PREVIOUS_RELEASE_TAG $RELEASE_TAG --no-dry-run
+        env:
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Update versions index
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d '{"event_type": "update_index"}'
+
+      - name: Build and push Docker images
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/docker-images/dispatches \
+            -d "{\"event_type\": \"build\", \"client_payload\": {\"ruby_version\": \"${RUBY_VERSION}\"}}"
+
+      - name: Build snapcraft packages
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/snap.ruby/dispatches \
+            -d "{\"event_type\": \"build\", \"client_payload\": {\"ruby_version\": \"${RUBY_VERSION}\"}}"
+
+      - name: Store the latest LTS version of OpenSSL
+        run: |
+          echo "OPENSSL_VERSION=`curl -s https://api.github.com/repos/openssl/openssl/releases | jq -r '.[].tag_name | select(startswith("openssl-3.0"))' | sort -Vr | head -n1 | cut -d'-' -f2`" >> $GITHUB_ENV
+
+      - name: Update ruby-build definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.RUBY_BUILD_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/rbenv/ruby-build/dispatches \
+            -d "{\"event_type\": \"update-ruby\", \"client_payload\": {\"ruby_version\": \"${RUBY_VERSION}\", \"openssl_version\": \"${OPENSSL_VERSION}\"}}"
+
+      - name: Update all-ruby definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/all-ruby/dispatches \
+            -d '{"event_type": "update"}'
diff --git a/.github/workflows/release.yml b/.github/workflows/release.yml
new file mode 100644
index 0000000000..a35bcff99a
--- /dev/null
+++ b/.github/workflows/release.yml
@@ -0,0 +1,21 @@
+name: Start release workflow
+on:
+  push:
+    tags:
+      - '*'
+
+permissions:
+  contents: read
+
+jobs:
+  notify:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Build release package
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d "{\"event_type\": \"$GITHUB_REF\"}"
diff --git a/.github/workflows/rust-warnings.yml b/.github/workflows/rust-warnings.yml
new file mode 100644
index 0000000000..23ed164405
--- /dev/null
+++ b/.github/workflows/rust-warnings.yml
@@ -0,0 +1,62 @@
+# Surface Rust warnings on PRs that touch any Rust code.
+# Not a required check so we never block people over new warnings
+# that might come from a new Rust version being released.
+name: Rust warnings
+on:
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    paths:
+      - '**.rs'
+      - '!**.inc.rs'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rust-warnings:
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: Install Rust
+        run: rustup default beta
+
+      - name: Rust warnings
+        shell: bash
+        run: |
+          set -eu
+          cargo check --quiet --all-features --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
+
+      - name: "📜 `rustdoc` warnings"
+        shell: bash
+        run: |
+          set -eu
+          cargo doc --document-private-items --all --no-deps --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
new file mode 100644
index 0000000000..74c13f98fa
--- /dev/null
+++ b/.github/workflows/scorecards.yml
@@ -0,0 +1,78 @@
+# This workflow uses actions that are not certified by GitHub. They are provided
+# by a third-party and are governed by separate terms of service, privacy
+# policy, and support documentation.
+
+name: Scorecard supply-chain security
+on:
+  # For Branch-Protection check. Only the default branch is supported. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
+  branch_protection_rule:
+  # To guarantee Maintained check is occasionally updated. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
+  schedule:
+    - cron: '39 3 * * 5'
+  # push:
+  #   branches: [ "master" ]
+
+# Declare default permissions as read only.
+permissions: read-all
+
+jobs:
+  analysis:
+    name: Scorecard analysis
+    runs-on: ubuntu-latest
+    # `publish_results: true` only works when run from the default branch. conditional can be removed if disabled.
+    if: github.event.repository.default_branch == github.ref_name || github.event_name == 'pull_request'
+    permissions:
+      # Needed to upload the results to code-scanning dashboard.
+      security-events: write
+      # Needed to publish results and get a badge (see publish_results below).
+      id-token: write
+      # Uncomment the permissions below if installing in a private repository.
+      # contents: read
+      # actions: read
+
+    steps:
+      - name: "Checkout code"
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - name: "Run analysis"
+        uses: ossf/scorecard-action@4eaacf0543bb3f2c246792bd56e8cdeffafb205a # v2.4.3
+        with:
+          results_file: results.sarif
+          results_format: sarif
+          # (Optional) "write" PAT token. Uncomment the `repo_token` line below if:
+          # - you want to enable the Branch-Protection check on a *public* repository, or
+          # - you are installing Scorecard on a *private* repository
+          # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action?tab=readme-ov-file#authentication-with-fine-grained-pat-optional.
+          # repo_token: ${{ secrets.SCORECARD_TOKEN }}
+
+          # Public repositories:
+          #   - Publish results to OpenSSF REST API for easy access by consumers
+          #   - Allows the repository to include the Scorecard badge.
+          #   - See https://github.com/ossf/scorecard-action#publishing-results.
+          # For private repositories:
+          #   - `publish_results` will always be set to `false`, regardless
+          #     of the value entered here.
+          publish_results: true
+
+          # (Optional) Uncomment file_mode if you have a .gitattributes with files marked export-ignore
+          # file_mode: git
+
+      # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
+      # format to the repository Actions tab.
+      - name: "Upload artifact"
+        uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        with:
+          name: SARIF file
+          path: results.sarif
+          retention-days: 5
+
+      # Upload the results to GitHub's code scanning dashboard (optional).
+      # Commenting out will disable upload of results to your repo's Code Scanning dashboard
+      - name: "Upload to code-scanning"
+        uses: github/codeql-action/upload-sarif@7211b7c8077ea37d8641b6271f6a365a22a5fbfa # v4.36.0
+        with:
+          sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..856b6e434e
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,68 @@
+name: Rubyspec Version Guards Check
+
+on:
+  push:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  pull_request:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rubyspec:
+    name: Rubyspec
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        # Specs from ruby/spec should still run on all supported Ruby versions.
+        # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+        ruby:
+          - ruby-3.3
+          - ruby-3.4
+          - ruby-4.0
+      fail-fast: false
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - run: gem install webrick
+
+      - run: ruby ../mspec/bin/mspec
+        working-directory: spec/ruby
+        env:
+          CHECK_LEAKS: true
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/sync_default_gems.yml b/.github/workflows/sync_default_gems.yml
new file mode 100644
index 0000000000..9fd1945449
--- /dev/null
+++ b/.github/workflows/sync_default_gems.yml
@@ -0,0 +1,80 @@
+name: Sync default gems
+
+env:
+  DEFAULT_GEM_SYNC_ENABLED: true
+
+on:
+  workflow_dispatch:
+    inputs:
+      gem:
+        required: true
+        description: 'Name of the gem to be synchronized'
+        type: string
+      before:
+        required: true
+        description: 'Gem commit SHA before sync'
+        type: string
+      after:
+        required: true
+        description: 'Gem commit SHA after sync'
+        type: string
+
+permissions:
+  contents: read
+
+jobs:
+  sync_default_gems:
+    name: Sync default gem ${{ github.event.inputs.gem }}
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2 # zizmor: ignore[artipacked]
+        name: Check out ruby/ruby
+        with:
+          token: ${{ github.repository == 'ruby/ruby' && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Run tool/sync_default_gems.rb
+        id: sync
+        run: |
+          ruby_before=$(git rev-parse HEAD)
+          set -x
+          ruby tool/sync_default_gems.rb "${gem_name}" "${gem_before}..${gem_after}"
+          if [[ "$(git rev-parse HEAD)" != "$ruby_before" ]]; then
+            echo update=true >> $GITHUB_OUTPUT
+          fi
+        env:
+          gem_name: ${{ github.event.inputs.gem }}
+          gem_before: ${{ github.event.inputs.before }}
+          gem_after: ${{ github.event.inputs.after }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - name: Push
+        run: |
+          git pull --rebase origin ${GITHUB_REF#refs/heads/}
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: ${{ steps.sync.outputs.update && env.DEFAULT_GEM_SYNC_ENABLED == 'true' }}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+          label: "${{ github.event.inputs.gem }} (<https://github.com/${{ github.event.inputs.gem == 'rubygems' && 'rubygems' || 'ruby' }}/${{ github.event.inputs.gem }}/compare/${{ github.event.inputs.before }}...${{ github.event.inputs.after }}|diff>)"
+          event_name: workflow_dispatch
+          extra_channel_id: C05FPKAU743 # alerts-sync
+        if: ${{ failure() }}
diff --git a/.github/workflows/tarball-macos.yml b/.github/workflows/tarball-macos.yml
new file mode 100644
index 0000000000..9bec94d528
--- /dev/null
+++ b/.github/workflows/tarball-macos.yml
@@ -0,0 +1,101 @@
+name: tarball-macos (reusable)
+
+on:
+  workflow_call:
+    inputs:
+      archname:
+        description: 'archname (e.g. snapshot-master, snapshot-ruby_3_3)'
+        required: true
+        type: string
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (schedule/release builds).'
+        required: false
+        type: boolean
+        default: false
+    secrets:
+      SIMPLER_ALERTS_URL:
+        required: false
+      SNAPSHOT_SLACK_WEBHOOK_URL:
+        required: false
+
+permissions:
+  contents: read
+
+jobs:
+  macos:
+    strategy:
+      matrix:
+        test_task: [check, test-bundled-gems, test-bundler-parallel]
+        os: [macos-26, macos-15, macos-14]
+        include:
+          - os: macos-15-intel
+            test_task: check
+      fail-fast: false
+    runs-on: ${{ matrix.os }}
+    env:
+      ARCHNAME: ${{ inputs.archname }}
+    steps:
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: tar xf pkg/*.tar.xz
+      - name: Install libraries
+        run: |
+          with_retry () {
+            "$@" || { sleep 5 && "$@"; } || { sleep 60 && "$@"; }
+          }
+          set -x
+          with_retry brew install gmp libffi openssl zlib autoconf automake libtool libyaml
+      - name: Set ENV
+        run: |
+          echo "JOBS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
+      - name: configure
+        run: cd "$ARCHNAME/" && ./configure --with-openssl-dir=$(brew --prefix openssl) --with-libyaml-dir=$(brew --prefix libyaml)
+      - name: make
+        run: cd "$ARCHNAME/" && make $JOBS
+      - name: Tests
+        run: cd "$ARCHNAME/" && make $JOBS -s ${{ matrix.test_task }}
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+          RUBY_DEBUG_TEST_NO_REMOTE: "1"
+      # leaked-globals since 2.7
+      - name: Leaked Globals
+        run: cd "$ARCHNAME/" && make -s leaked-globals
+        if: matrix.test_task == 'check'
+      - name: make install without root privilege
+        run: cd "$ARCHNAME/" && make $JOBS install DESTDIR="/tmp/destdir"
+        if: matrix.test_task == 'check'
+      - name: make install
+        run: cd "$ARCHNAME/" && sudo make $JOBS install
+        if: matrix.test_task == 'check'
+      - name: Verify installed binaries
+        run: |
+          /usr/local/bin/ruby -v
+          /usr/local/bin/gem -v
+          /usr/local/bin/bundle -v
+        if: matrix.test_task == 'check'
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout: .github/actions/slack
+          sparse-checkout-cone-mode: false
+          persist-credentials: false
+        if: ${{ failure() }}
+      - uses: ./.github/actions/slack
+        with:
+          label: "${{ matrix.os }} / ${{ matrix.test_task }}"
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+      - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+        with:
+          payload: |
+            {
+              "attachments": [{
+                "text": "${{ job.status }}: ${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}|${{ inputs.archname }}>",
+                "color": "danger"
+              }]
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+        if: failure() && inputs.notify-release-channel
diff --git a/.github/workflows/tarball-non-development.yml b/.github/workflows/tarball-non-development.yml
new file mode 100644
index 0000000000..db6230b301
--- /dev/null
+++ b/.github/workflows/tarball-non-development.yml
@@ -0,0 +1,87 @@
+name: tarball-non-development (reusable)
+
+on:
+  workflow_call: {}
+
+permissions:
+  contents: read
+
+jobs:
+  non_development:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - { variant: default,     remove_ruby: false, configure_extra: '' }
+          - { variant: no-ruby,     remove_ruby: true,  configure_extra: '' }
+          - { variant: baseruby-no, remove_ruby: false, configure_extra: '--with-baseruby=no' }
+    runs-on: ubuntu-24.04
+    env:
+      ruby_prefix: /tmp/ruby-snapshot
+    steps:
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: tar xf pkg/*.tar.xz
+      - name: Substitute patchlevel
+        run: |
+          set -x
+          cd snapshot-*/
+          sed -i.orig 's/^\( *# *define  *RUBY_PATCHLEVEL\)  *-.*/\1 0/' version.h
+          diff -u version.h.orig version.h || :
+          rm -f version.h.orig
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev zlib1g-dev libffi-dev libgmp-dev bison- autoconf-
+      - name: Remove host ruby
+        if: matrix.remove_ruby
+        run: |
+          set -x
+          sudo apt-get purge -y -q 'ruby*' || :
+          sudo rm -rf /opt/hostedtoolcache/Ruby
+          ! command -v ruby
+      - name: Set ENV
+        run: |
+          echo "JOBS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - name: configure
+        run: cd snapshot-*/ && ./configure --prefix="${ruby_prefix}" ${{ matrix.configure_extra }}
+      - name: make
+        run: cd snapshot-*/ && make $JOBS
+      - name: Leaked Globals
+        run: cd snapshot-*/ && make -s leaked-globals
+      - name: make install
+        run: cd snapshot-*/ && make $JOBS install
+      - name: Set PATH
+        run: echo "PATH=${ruby_prefix}/bin:$PATH" >> $GITHUB_ENV
+      - name: Check patchlevel
+        id: check-patchlevel
+        run: |
+          exec "${ruby_prefix}/bin/ruby" -vx "$0"
+          #!ruby
+          puts "RUBY_PATCHLEVEL=#{RUBY_PATCHLEVEL.inspect}"
+          abort unless RUBY_PATCHLEVEL >= 0
+        working-directory: ${{ env.ruby_prefix }}
+        continue-on-error: true
+      - name: Check LOADPATH
+        id: check-loadpath
+        run: |
+          exec ${ruby_prefix}/bin/ruby -vx "$0"
+          #!ruby
+          paths = $:.grep(/\+/)
+          pp paths
+          abort unless paths.empty?
+        working-directory: ${{ env.ruby_prefix }}
+        continue-on-error: true
+      - name: Check pathnames
+        id: check-pathnames
+        run: |
+          ! find -name '*+*' | grep +
+        working-directory: ${{ env.ruby_prefix }}
+        continue-on-error: true
+      - name: result
+        run: false
+        if: ${{ contains(steps.*.outcome, 'failure') }}
diff --git a/.github/workflows/tarball-test-schedule.yml b/.github/workflows/tarball-test-schedule.yml
new file mode 100644
index 0000000000..6684b09edb
--- /dev/null
+++ b/.github/workflows/tarball-test-schedule.yml
@@ -0,0 +1,26 @@
+name: tarball-test-schedule
+on:
+  schedule:
+    - cron: '30 18 * * *' # Daily at 18:30 UTC
+  workflow_dispatch:
+
+permissions: {}
+
+jobs:
+  dispatch:
+    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+    runs-on: ubuntu-latest
+    strategy:
+      fail-fast: false
+      matrix:
+        branch:
+          - master
+          - ruby_4_0
+          - ruby_3_4
+          - ruby_3_3
+    steps:
+      - name: Trigger tarball-test on ${{ matrix.branch }}
+        run: gh workflow run tarball-test.yml --ref "$BRANCH" --repo "$GITHUB_REPOSITORY" -f notify-release-channel=true
+        env:
+          BRANCH: ${{ matrix.branch }}
+          GH_TOKEN: ${{ secrets.MATZBOT_GITHUB_ACTION_TOKEN }}
diff --git a/.github/workflows/tarball-test.yml b/.github/workflows/tarball-test.yml
new file mode 100644
index 0000000000..52c4d31fc8
--- /dev/null
+++ b/.github/workflows/tarball-test.yml
@@ -0,0 +1,105 @@
+name: tarball-test
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+  workflow_dispatch:
+    inputs:
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (set by tarball-test-schedule).'
+        type: boolean
+        default: false
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  tarball:
+    runs-on: ubuntu-latest
+    # Cherry-pick to maintenance branches by changing only env.BRANCH below;
+    # archname / branch-label / Materialize all derive from it.
+    env:
+      BRANCH: master
+    outputs:
+      branch: ${{ env.BRANCH }}
+      skip: ${{ steps.skipping.outputs.skip }}
+    steps:
+      - id: skipping
+        run:
+          echo 'skip=true' >> $GITHUB_OUTPUT
+        if: >-
+          ${{(false
+          || contains(github.event.head_commit.message, '[DOC]')
+          || contains(github.event.pull_request.title, '[DOC]')
+          || contains(github.event.pull_request.labels.*.name, 'Documentation')
+          || (github.event.pull_request.user.login == 'dependabot[bot]')
+          )}}
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          fetch-depth: 1 # actions/checkout fetches all heads/tags unless > 0
+          persist-credentials: false
+      # tool/make-snapshot derives the branch name from HEAD and looks up
+      # the upstream during ChangeLog generation. Detached checkouts
+      # (pull_request, merge_group) lack a local branch with tracking, so
+      # pin one to HEAD and connect it to the matching origin ref.
+      - name: Materialize local branch
+        run: |
+          git fetch --no-tags --depth=1 origin "+refs/heads/$BASE:refs/remotes/origin/$BASE"
+          git checkout -B "$BRANCH" HEAD
+          git branch --set-upstream-to="origin/$BASE" "$BRANCH"
+        env:
+          BASE: ${{ github.base_ref || env.BRANCH }}
+      - uses: ./.github/actions/make-snapshot
+        with:
+          archname: snapshot-${{ env.BRANCH }}
+          srcdir: '.'
+
+  ubuntu:
+    needs: tarball
+    if: ${{ ! needs.tarball.outputs.skip }}
+    uses: ./.github/workflows/tarball-ubuntu.yml
+    with:
+      archname: snapshot-${{ needs.tarball.outputs.branch }}
+      notify-release-channel: ${{ github.event_name == 'workflow_dispatch' && inputs.notify-release-channel || false }}
+    secrets:
+      SIMPLER_ALERTS_URL: ${{ secrets.SIMPLER_ALERTS_URL }}
+      SNAPSHOT_SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+
+  macos:
+    needs: tarball
+    if: ${{ ! needs.tarball.outputs.skip }}
+    uses: ./.github/workflows/tarball-macos.yml
+    with:
+      archname: snapshot-${{ needs.tarball.outputs.branch }}
+      notify-release-channel: ${{ github.event_name == 'workflow_dispatch' && inputs.notify-release-channel || false }}
+    secrets:
+      SIMPLER_ALERTS_URL: ${{ secrets.SIMPLER_ALERTS_URL }}
+      SNAPSHOT_SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+
+  windows:
+    needs: tarball
+    if: ${{ ! needs.tarball.outputs.skip }}
+    uses: ./.github/workflows/tarball-windows.yml
+    with:
+      archname: snapshot-${{ needs.tarball.outputs.branch }}
+      notify-release-channel: ${{ github.event_name == 'workflow_dispatch' && inputs.notify-release-channel || false }}
+    secrets:
+      SIMPLER_ALERTS_URL: ${{ secrets.SIMPLER_ALERTS_URL }}
+      SNAPSHOT_SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+
+  non_development:
+    needs: tarball
+    uses: ./.github/workflows/tarball-non-development.yml
diff --git a/.github/workflows/tarball-ubuntu.yml b/.github/workflows/tarball-ubuntu.yml
new file mode 100644
index 0000000000..03f2f946b5
--- /dev/null
+++ b/.github/workflows/tarball-ubuntu.yml
@@ -0,0 +1,150 @@
+name: tarball-ubuntu (reusable)
+
+on:
+  workflow_call:
+    inputs:
+      archname:
+        description: 'archname (e.g. snapshot-master, snapshot-ruby_3_3)'
+        required: true
+        type: string
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (schedule/release builds).'
+        required: false
+        type: boolean
+        default: false
+    secrets:
+      SIMPLER_ALERTS_URL:
+        required: false
+      SNAPSHOT_SLACK_WEBHOOK_URL:
+        required: false
+
+permissions:
+  contents: read
+
+jobs:
+  ubuntu:
+    strategy:
+      matrix:
+        test_task: [check, test-bundler-parallel, test-bundled-gems]
+        os: [ubuntu-24.04, ubuntu-22.04]
+      fail-fast: false
+    runs-on: ${{ matrix.os }}
+    env:
+      ARCHNAME: ${{ inputs.archname }}
+    steps:
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: tar xf pkg/*.tar.xz
+      - name: Install libraries
+        run: |
+          set -x
+          sudo apt-get update -q
+          sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev zlib1g-dev libffi-dev libgmp-dev bison- autoconf-
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.2'
+        # test-bundled-gems requires executable host ruby
+        if: matrix.test_task == 'test-bundled-gems'
+      - name: Fixed world writable dirs
+        run: |
+          mkdir -p $HOME/.local/share
+          mkdir -p $HOME/.cache/gem/specs
+          mkdir -p $HOME/.bundle/cache
+          mkdir -p $HOME/.ssh
+          chmod a-w $HOME/.bundle
+          # chmod a-w $HOME
+          # allow to write $HOME and check stats of HOME around tests (see below)
+          chmod -v a-w $HOME/.config
+          sudo chmod -R a-w /usr/share
+          sudo bash -c 'IFS=:; for d in '"$PATH"'; do chmod -v a-w $d; done' || :
+      - name: Set ENV
+        run: |
+          echo "JOBS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
+      - name: configure
+        run: cd "$ARCHNAME/" && ./configure
+      - name: make
+        run: cd "$ARCHNAME/" && make $JOBS
+      - name: Save stats of HOME
+        run: |
+          set -euxo pipefail
+          cat >"$ARCHNAME/save-stats.rb" <<'EOF'
+          require 'pathname'
+          require 'digest'
+          out = []
+          [
+            Dir.home,
+          ].each do |dir|
+            Dir.each_child(dir) do |pn|
+              st = File.stat(pn)
+              if st.file?
+                content = Digest::SHA1.file(pn).hexdigest
+              elsif st.directory? && st.nlink <= 10
+                content = Dir.children(pn).sort
+              end
+              out << [pn, "%o"%st.mode, st.nlink, st.uid, st.gid, st.size, content].to_s
+            rescue
+              out << [pn, $!.inspect].to_s
+            end
+          end
+          File.open(ARGV.shift, "w") do |io|
+            io.puts out.sort
+          end
+          EOF
+          make -C "$ARCHNAME" TESTRUN_SCRIPT=save-stats.rb RUNOPT=/tmp/stat-before-tests.txt runruby
+      - name: Tests
+        run: cd "$ARCHNAME/" && make $JOBS -s ${{ matrix.test_task }}
+        env:
+          RUBY_TESTOPTS: "-q --tty=no"
+      # test_sync_default_gems triggers gpg, whose agent processes leave
+      # $HOME/.gnupg around even when GNUPGHOME points elsewhere.
+      - name: Forcibly remove ~/.gnupg
+        run: rm -rf $HOME/.gnupg
+      - name: Diff stats of HOME
+        run: |
+          make -C "$ARCHNAME" TESTRUN_SCRIPT=save-stats.rb RUNOPT=/tmp/stat-after-tests.txt runruby
+          rm -f "$ARCHNAME/save-stats.rb"
+          diff -u /tmp/stat-before-tests.txt /tmp/stat-after-tests.txt
+      # leaked-globals since 2.7
+      - name: Leaked Globals
+        run: cd "$ARCHNAME/" && make -s leaked-globals
+        if: matrix.test_task == 'check'
+      - name: make install without root privilege
+        run: cd "$ARCHNAME/" && make $JOBS install DESTDIR="/tmp/destdir"
+        if: matrix.test_task == 'check'
+      - name: make install
+        run: cd "$ARCHNAME/" && sudo make $JOBS install
+        if: matrix.test_task == 'check'
+      - name: Verify installed binaries
+        run: |
+          /usr/local/bin/ruby -v
+          /usr/local/bin/gem -v
+          /usr/local/bin/bundle -v
+        if: matrix.test_task == 'check'
+      - name: Show .local
+        run: find $HOME/.local -ls
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout: .github/actions/slack
+          sparse-checkout-cone-mode: false
+          persist-credentials: false
+        if: ${{ failure() }}
+      - uses: ./.github/actions/slack
+        with:
+          label: "${{ matrix.os }} / ${{ matrix.test_task }}"
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+      - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+        with:
+          payload: |
+            {
+              "attachments": [{
+                "text": "${{ job.status }}: ${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}|${{ inputs.archname }}>",
+                "color": "danger"
+              }]
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+        if: failure() && inputs.notify-release-channel
diff --git a/.github/workflows/tarball-windows.yml b/.github/workflows/tarball-windows.yml
new file mode 100644
index 0000000000..1ce95de6fc
--- /dev/null
+++ b/.github/workflows/tarball-windows.yml
@@ -0,0 +1,163 @@
+name: tarball-windows (reusable)
+
+on:
+  workflow_call:
+    inputs:
+      archname:
+        description: 'archname (e.g. snapshot-master)'
+        required: true
+        type: string
+      notify-release-channel:
+        description: 'Also send failure notifications to SNAPSHOT_SLACK_WEBHOOK_URL (schedule/release builds).'
+        required: false
+        type: boolean
+        default: false
+    secrets:
+      SIMPLER_ALERTS_URL:
+        required: false
+      SNAPSHOT_SLACK_WEBHOOK_URL:
+        required: false
+
+permissions:
+  contents: read
+
+jobs:
+  windows:
+    strategy:
+      matrix:
+        include:
+          - os: '2022'
+            test_task: check
+          - os: '2025-vs2026'
+            test_task: check
+      fail-fast: false
+    runs-on: windows-${{ matrix.os }}
+    defaults:
+      run:
+        shell: cmd
+        working-directory: build
+    name: Windows ${{ matrix.os }} (${{ matrix.test_task }})
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{github.ref}}
+      PATCH: C:\msys64\usr\bin\patch.exe
+      OS_VER: windows-${{ matrix.os }}
+      # see https://github.com/ruby/ruby/commit/9ff4399decef0036897d3cfb9ac2c710dea913ca
+      OPENSSL_MODULES: C:\vcpkg\installed\x64-windows\bin
+    steps:
+      - run: md build
+        working-directory:
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.2'
+          bundler: none
+          windows-toolchain: none
+
+      - uses: msys2/setup-msys2@e9898307ac31d1a803454791be09ab9973336e1c # v2.31.1
+        id: setup-msys2
+        with:
+          update: true
+          install: >-
+            patch
+      - name: patch path
+        shell: msys2 {0}
+        run: echo PATCH=$(cygpath -wa $(command -v patch)) >> $GITHUB_ENV
+        if: ${{ steps.setup-msys2.outcome == 'success' }}
+      - uses: actions/cache@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: C:\vcpkg\installed
+          key: ${{ runner.os }}-vcpkg-installed-${{ env.OS_VER }}-${{ github.sha }}
+          restore-keys: |
+            ${{ runner.os }}-vcpkg-installed-${{ env.OS_VER }}-
+            ${{ runner.os }}-vcpkg-installed-
+      - name: Install libraries with vcpkg
+        run: |
+          vcpkg --triplet x64-windows install gmp libffi libyaml openssl zlib
+
+      - uses: actions/download-artifact@3e5f45b2cfb9172054b4087a40e8e0b5a5461e7c # v8.0.1
+        with:
+          name: Packages
+          path: pkg
+      - name: Extract
+        run: 7z x pkg/*.zip
+        working-directory:
+
+      - uses: actions/cache@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: snapshot-*/.downloaded-cache
+          key: downloaded-cache
+
+      - name: setup env
+        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+        env:
+          ARCHNAME: ${{ inputs.archname }}
+        run: |
+          set > old.env
+          call ..\%ARCHNAME%\win32\vssetup.cmd
+          set TMP=%USERPROFILE%\AppData\Local\Temp
+          set TEMP=%USERPROFILE%\AppData\Local\Temp
+          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+          set > new.env
+
+      - name: update env
+        shell: pwsh
+        run: |
+          $old = (Get-Content old.env); $new = (Get-Content new.env)
+          del *.env
+          Compare-Object $old $new |
+            Where-Object { $_.SideIndicator -eq '=>' } |
+            Select-Object -ExpandProperty InputObject |
+            Add-Content -Path $env:GITHUB_ENV
+      - name: link libraries
+        run: |
+          for %%I in (C:\vcpkg\installed\x64-windows\bin\*.dll) do (
+            mklink %%~nxI %%I
+          )
+      - name: Configure
+        env:
+          ARCHNAME: ${{ inputs.archname }}
+        run: >-
+          ../%ARCHNAME%/win32/configure.bat --disable-install-doc
+          --with-opt-dir=C:/vcpkg/installed/x64-windows
+      - run: nmake incs
+      - run: nmake extract-extlibs
+      - run: nmake
+        env:
+          YACC: win_bison
+
+      - name: ruby -v
+        run: .\ruby -v
+
+      - run: nmake test
+        timeout-minutes: 5
+
+      - run: nmake ${{ matrix.test_task }}
+        env:
+          RUBY_TESTOPTS: -j${{env.TEST_JOBS}}
+        timeout-minutes: 70
+        continue-on-error: ${{ matrix.continue-on-error || false }}
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout: .github/actions/slack
+          sparse-checkout-cone-mode: false
+          persist-credentials: false
+        if: ${{ failure() }}
+      - uses: ./.github/actions/slack
+        with:
+          label: "${{ env.OS_VER }} / ${{ matrix.test_task }}"
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+      - uses: ruby/action-slack@d260b61aa817726d5bedd22dd6cc305787fa4cdd # v4.0.0
+        with:
+          payload: |
+            {
+              "attachments": [{
+                "text": "${{ job.status }}: ${{ env.OS_VER }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}|${{ inputs.archname }}>",
+                "color": "danger"
+              }]
+            }
+        env:
+          SLACK_WEBHOOK_URL: ${{ secrets.SNAPSHOT_SLACK_WEBHOOK_URL }}
+        if: failure() && inputs.notify-release-channel
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..09e96f764c
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,275 @@
+name: Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        # We enumerate every job in matrix.include to save build time
+        include:
+          - test_task: check
+            configure: 'cppflags=-DVM_CHECK_MODE'
+          - test_task: check
+            arch: i686
+          - test_task: check
+            configure: '--disable-yjit'
+          - test_task: check
+            configure: '--enable-shared --enable-load-relative'
+          - test_task: test-bundler-parallel
+            timeout: 50
+          - test_task: test-bundled-gems
+          - test_task: check
+            os: ubuntu-24.04
+            extra_checks: [capi]
+          # ubuntu-24.04-arm jobs don't start on ruby/ruby as of 2025-10-29
+          #- test_task: check
+          #  os: ubuntu-24.04-arm
+      fail-fast: false
+
+    env: &make-env
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: &make-steps
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+        with:
+          arch: ${{ matrix.arch }}
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: >-
+          ${{ !endsWith(matrix.os, 'arm')
+          && !endsWith(matrix.os, 'ppc64le') && !endsWith(matrix.os, 's390x') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+          configure: ${{ matrix.configure }}
+        run: >-
+          $SETARCH ../src/configure -C --disable-install-doc ${configure:- --enable-debug-env cppflags=-DRUBY_DEBUG}
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - run: $SETARCH make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: $SETARCH make
+
+      - run: $SETARCH make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | $SETARCH make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      # Avoid possible test failures with the zlib applying the following patch
+      # on s390x CPU architecture.
+      # https://github.com/madler/zlib/pull/410
+      - name: Disable DFLTCC
+        run: echo "DFLTCC=0" >> $GITHUB_ENV
+        if: ${{ endsWith(matrix.os, 's390x') }}
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          $SETARCH make -s ${{ matrix.test_task }} \
+          ${TESTS:+TESTS="$TESTS"} \
+          ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: test-pc
+        run: |
+          DESTDIR=${RUNNER_TEMP-${TMPDIR-/tmp}}/installed
+          $SETARCH make test-pc "DESTDIR=$DESTDIR"
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+          make: '$SETARCH make'
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}${{ matrix.os }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  make-ibm:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: ubuntu-24.04-ppc64le
+          - test_task: check
+            os: ubuntu-24.04-s390x
+      fail-fast: false
+
+    env: *make-env
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{github.repository == 'ruby/ruby'
+      && !(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: *make-steps
+
+  # Separated from `make` job to avoid making it a required status check
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Using the same setup as ZJIT jobs
+          - bench_opts: '--warmup=1 --bench=1 --excludes=shipit'
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install"
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          repository: ruby/ruby-bench
+          persist-credentials: false
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "ruby::../build/install/bin/ruby" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+        env:
+          BUNDLER_VERSION: 0
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
new file mode 100644
index 0000000000..edb2c76c48
--- /dev/null
+++ b/.github/workflows/wasm.yml
@@ -0,0 +1,195 @@
+name: WebAssembly
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        entry:
+#         # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
+#         - { name: O0-debuginfo, optflags: '-O0', debugflags: '-g', wasmoptflags: '-O1' }
+#         - { name: O1,           optflags: '-O1', debugflags: ''  , wasmoptflags: '-O1' }
+          - { name: O2, optflags: '-O2', debugflags: '', wasmoptflags: '-O2' }
+#         - { name: O3,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O3' }
+#         # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
+#         - { name: O4,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O4' }
+#         - { name: Oz,           optflags: '-Oz', debugflags: ''  , wasmoptflags: '-Oz' }
+      fail-fast: false
+
+    env:
+      RUBY_TESTOPTS: '-q --tty=no'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      WASI_SDK_VERSION_MAJOR: 25
+      WASI_SDK_VERSION_MINOR: 0
+      BINARYEN_VERSION: 113
+      WASMTIME_VERSION: v15.0.0
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Install libraries
+        run: |
+          set -ex
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y ruby make autoconf git wget
+
+          wasi_sdk_deb="wasi-sdk-${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}-x86_64-linux.deb"
+          wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
+          sudo dpkg -i "$wasi_sdk_deb"
+          rm -f "$wasi_sdk_deb"
+
+          mkdir build-sdk
+          pushd build-sdk
+
+          wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
+          wget -O - "$wasmtime_url" | tar xJf -
+          sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
+
+          binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
+          binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
+          wget -O - "$binaryen_url" | tar xfz -
+          sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
+        working-directory: src
+
+      - name: Set ENV
+        run: |
+          echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
+
+      - uses: ./.github/actions/setup/baseruby
+        id: baseruby
+        with:
+          srcdir: src
+
+      - name: Download config.guess with wasi version
+        run: |
+          rm tool/config.guess tool/config.sub
+          ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
+        working-directory: src
+
+      - name: Run configure
+        run: >-
+          ../src/configure
+          --host wasm32-unknown-wasi
+          --with-baseruby="${{ steps.baseruby.outputs.ruby }}"
+          --with-dump-ast="${{ steps.baseruby.outputs.dump_ast }}"
+          --with-static-linked-ext
+          --with-ext=${EXTS// /,}
+          LDFLAGS="
+          -Xlinker --stack-first
+          -Xlinker -z -Xlinker stack-size=16777216
+          "
+          optflags="${{ matrix.entry.optflags }}"
+          debugflags="${{ matrix.entry.debugflags }}"
+          wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
+        env:
+          EXTS:
+            cgi/escape
+            continuation
+            coverage
+            date
+            digest
+            digest/*
+            erb/escape
+            etc
+            fcntl
+            json
+            json/*
+            objspace
+            rbconfig/sizeof
+            ripper
+            stringio
+            strscan
+
+      # miniruby may not be built when cross-compling
+      - run: make mini ruby
+
+      - run: make install DESTDIR=$PWD/../install
+      - run: tar cfz ../install.tar.gz -C ../install .
+
+      - name: Upload artifacts
+        uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        with:
+          name: ruby-wasm-install
+          path: ${{ github.workspace }}/install.tar.gz
+      - name: Show Playground URL to try the build
+        run: |
+          echo "Try on Playground: https://ruby.github.io/play-ruby?run=$GITHUB_RUN_ID" >> $GITHUB_STEP_SUMMARY
+
+      - name: Run basictest
+        run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
+        working-directory: src
+
+      - name: Run bootstraptest (no thread)
+        run: |
+          NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
+          ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
+        working-directory: src
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.entry.name }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+      # Workaround for https://github.com/orgs/community/discussions/25220
+      - name: Save Pull Request number
+        if: ${{ github.event_name == 'pull_request' }}
+        run: echo "${{ github.event.pull_request.number }}" >> ${{ github.workspace }}/github-pr-info.txt
+      - uses: actions/upload-artifact@043fb46d1a93c77aae656e7c1c64a875d1fc6a0a # v7.0.1
+        if: ${{ github.event_name == 'pull_request' }}
+        with:
+          name: github-pr-info
+          path: ${{ github.workspace }}/github-pr-info.txt
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..13551427bb
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,209 @@
+name: Windows
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - os: 2022
+            test_task: check
+          - os: 2022
+            test_task: test-bundled-gems
+          - os: 2025-vs2026
+            test_task: check
+          - os: 2025-vs2026
+            test_task: test-bundled-gems
+          - os: 11-arm
+            test_task: 'btest test-basic test-tool' # check and test-spec are broken yet.
+            target: arm64
+      fail-fast: false
+
+    runs-on: windows-${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/vcpkg'))
+      )}}
+
+    name: Windows ${{ matrix.os }} (${{ matrix.test_task }})
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      VCPKG_DEFAULT_TRIPLET: ${{ matrix.target || 'x64' }}-windows
+
+    steps:
+      - run: md build
+        working-directory:
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          # windows-11-arm has only 3.4.1, 3.4.2, 3.4.3, head
+          ruby-version: ${{ !endsWith(matrix.os, 'arm') && '3.1' || '3.4' }}
+          bundler: none
+          windows-toolchain: none
+
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          make-command: nmake
+          clean: true
+
+      - name: Install tools with scoop
+        run: |
+          if ((vcpkg.exe help install) -match "manifest") { exit }
+          Set-ExecutionPolicy -ExecutionPolicy RemoteSigned -Scope CurrentUser
+          iwr -useb get.scoop.sh | iex
+          Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
+          scoop install vcpkg
+        shell: pwsh
+
+      - name: Restore vcpkg artifact
+        id: restore-vcpkg
+        uses: actions/cache/restore@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+
+      - name: Install libraries with vcpkg
+        run: |
+          vcpkg install
+        working-directory: src
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit }}
+
+      - name: Save vcpkg artifact
+        uses: actions/cache/save@27d5ce7f107fe9357f9df03efb73ab90386fccae # v5.0.5
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit && (github.ref_name == 'master' || startsWith(github.ref_name, 'ruby_')) }}
+
+      - name: setup env
+        # Available Ruby versions: https://github.com/actions/runner-images/blob/main/images/windows/Windows2019-Readme.md#ruby
+        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+        run: |
+          set > old.env
+          call ..\src\win32\vssetup.cmd ^
+            -arch=${{ matrix.target || 'amd64' }} ^
+            ${{ matrix.vcvars && '-vcvars_ver=' || '' }}${{ matrix.vcvars }}
+          nmake -f nul
+          set TMP=%RUNNER_TEMP%
+          set TEMP=%RUNNER_TEMP%
+          set MAKEFLAGS=l
+          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+          set RUBY_OPT_DIR=%GITHUB_WORKSPACE:\=/%/src/vcpkg_installed/%VCPKG_DEFAULT_TRIPLET%
+          set > new.env
+
+      - name: update env
+        shell: pwsh
+        run: |
+          $old = (Get-Content old.env); $new = (Get-Content new.env)
+          del *.env
+          Compare-Object $old $new |
+            Where-Object { $_.SideIndicator -eq '=>' } |
+            Select-Object -ExpandProperty InputObject |
+            Add-Content -Path $env:GITHUB_ENV
+
+      - name: baseruby version
+        run: ruby -v
+
+      - name: compiler version
+        run: cl
+
+      - name: volume info
+        run: Get-Volume
+        shell: pwsh
+
+      # TODO: We should use `../src` instead of `D:/a/ruby/ruby/src`
+      - name: Configure
+        run: >-
+          ../src/win32/configure.bat --disable-install-doc
+          --with-opt-dir=%RUBY_OPT_DIR%
+          --with-gmp
+
+      - run: nmake prepare-vcpkg
+
+      - run: nmake incs
+
+      - run: nmake extract-extlibs
+
+      # On all other platforms, test-spec depending on extract-gems (in common.mk) is enough.
+      # But not for this Visual Studio workflow. So here we extract gems before building.
+      - run: nmake extract-gems
+
+      # windows-11-arm runner cannot run `ruby tool/file2lastrev.rb --revision.h --output=revision.h`
+      - name: make revision.h
+        run: |
+          win32\lastrev.bat | win32\ifchange.bat --timestamp=.revision.time revision.h -
+          type revision.h
+        working-directory: src
+
+      - run: nmake
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-${{ matrix.os }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-task: ${{ matrix.test_task || 'check' }}
+        continue-on-error: true
+        if: ${{ matrix.test_task != 'test-bundled-gems' }}
+        timeout-minutes: 3
+
+      - run: nmake ${{ matrix.test_task || 'check' }}
+        env:
+          RUBY_TESTOPTS: -j${{ env.TEST_JOBS || 4 }}
+        timeout-minutes: 70
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Windows ${{ matrix.os }} / ${{ matrix.test_task || 'check' }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: windows-2025-vs2026
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/wsl.yml b/.github/workflows/wsl.yml
new file mode 100644
index 0000000000..470b68fe66
--- /dev/null
+++ b/.github/workflows/wsl.yml
@@ -0,0 +1,73 @@
+name: Ubuntu on WSL
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+permissions:
+  contents: read
+
+jobs:
+  wsl:
+    runs-on: windows-2025-vs2026
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - name: Install or update WSL
+        uses: Ubuntu/WSL/.github/actions/wsl-install@main
+        with:
+          distro: Ubuntu-24.04
+
+      - name: Install dependencies
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            DEBIAN_FRONTEND=noninteractive sudo apt update
+            DEBIAN_FRONTEND=noninteractive sudo apt install -y ruby build-essential autoconf libssl-dev libyaml-dev zlib1g-dev libgmp-dev libffi-dev
+
+      - name: Check out the repository
+        uses: Ubuntu/WSL/.github/actions/wsl-checkout@main
+        with:
+          distro: Ubuntu-24.04
+          working-dir: /tmp/github/
+          submodules: true
+
+      - name: Build
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./autogen.sh
+            ./configure --disable-install-doc
+            make ruby -j4
+            make extract-gems
+            make -j4
+
+      - name: Test
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./ruby -v
+            # make check TESTS="-j4" MSPECOPT="-j"
diff --git a/.github/workflows/yjit-macos.yml b/.github/workflows/yjit-macos.yml
new file mode 100644
index 0000000000..b52c6355ad
--- /dev/null
+++ b/.github/workflows/yjit-macos.yml
@@ -0,0 +1,201 @@
+name: YJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: 'check'
+            configure: '--enable-yjit'
+            yjit_opts: '--yjit'
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: macos-26
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }} ${{ matrix.yjit_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
new file mode 100644
index 0000000000..934c3f56d4
--- /dev/null
+++ b/.github/workflows/yjit-ubuntu.yml
@@ -0,0 +1,245 @@
+name: YJIT Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      # For now we can't run cargo test --offline because it complains about the
+      # capstone dependency, even though the dependency is optional
+      #- run: cargo test --offline
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  lint:
+    name: cargo clippy
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      # Check that we don't have linting errors in release mode, too
+      - run: cargo clippy --all-targets --all-features
+        working-directory: yjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'yjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--with-gcc=clang-14 --enable-yjit=dev --enable-zjit'
+            libclang_path: '/usr/lib/llvm-14/lib/libclang.so.1'
+
+          - test_task: 'check'
+            # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
+            #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
+            configure: "RUSTC='rustc +1.58.0'"
+            rust_version: '1.58.0'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-yjit=dev'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      RUBY_DEBUG: ci
+      RUST_BACKTRACE: 1
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: rustup install ${{ matrix.rust_version }} --profile minimal
+
+      - name: Remove cargo
+        # Since this tests a `rustc` build for release, remove `cargo` to ensure
+        # that only `rustc` is used.
+        if: ${{ contains(matrix.configure, 'rustc') }}
+        run: sudo rm $(which -a cargo | uniq)
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      # Check that the binary was built with YJIT
+      - name: Check YJIT enabled
+        run: ./miniruby --yjit -v | grep "+YJIT"
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ubuntu-22.04
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS" YJIT_BINDGEN_DIFF_OPTS="$YJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          YJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          LIBCLANG_PATH: ${{ matrix.libclang_path }}
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-macos.yml b/.github/workflows/zjit-macos.yml
new file mode 100644
index 0000000000..f9282d64e8
--- /dev/null
+++ b/.github/workflows/zjit-macos.yml
@@ -0,0 +1,239 @@
+name: ZJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit=dev --enable-zjit'
+            rust_version: "1.85.0"
+
+          - test_task: 'ruby'
+            hint: 'combo build test'
+            configure: '--enable-yjit --enable-zjit'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      RUST_BACKTRACE: 1
+      ZJIT_RB_BUG: 1
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - uses: taiki-e/install-action@13608cbb45b01feb47ef444ab1a42dc41ad56f1a # v2.79.11
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: macos-26
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-zjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '30'
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=shipit'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: macos-26
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      # setup/directories set MAKEFLAGS=-j4 for macOS, which randomly fails sqlite3.gem builds
+      - name: Unset MAKEFLAGS
+        run: echo "MAKEFLAGS=" >> "$GITHUB_ENV"
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+        env:
+          BUNDLER_VERSION: 0
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-ubuntu.yml b/.github/workflows/zjit-ubuntu.yml
new file mode 100644
index 0000000000..1e7bec3859
--- /dev/null
+++ b/.github/workflows/zjit-ubuntu.yml
@@ -0,0 +1,293 @@
+name: ZJIT Ubuntu
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  lint:
+    name: cargo clippy
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - run: cargo clippy --all-targets --all-features
+        working-directory: zjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+            # The optimizer benefits from at least 1 iteration of profiling. Also, many
+            # regression tests in bootstraptest/test_yjit.rb assume call-threshold=2.
+          - test_task: 'btest'
+            run_opts: '--zjit-call-threshold=2'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit --enable-zjit=dev'
+            rust_version: '1.85.0'
+
+          - test_task: 'zjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--enable-zjit=dev --enable-yjit --with-gcc=clang-16'
+            clang_path: '/usr/bin/clang-16'
+            runs-on: 'ubuntu-24.04' # for clang-16
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-zjit=dev'
+            run_opts: '--zjit-call-threshold=1'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      RUBY_DEBUG: ci
+      BUNDLE_JOBS: 8 # for yjit-bench
+      RUST_BACKTRACE: 1
+      ZJIT_RB_BUG: 1
+
+    runs-on: ${{ matrix.runs-on || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@afeafc3d1ab54a631816aba4c914a0081c12ff2f # v1.310.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: taiki-e/install-action@13608cbb45b01feb47ef444ab1a42dc41ad56f1a # v2.79.11
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - name: Install rustfmt
+        if: ${{ matrix.test_task == 'zjit-bindgen' }}
+        run: rustup component add rustfmt
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      # Check that the binary was built with ZJIT
+      - name: Check ZJIT enabled
+        run: ./miniruby --zjit -v | grep "+ZJIT"
+        if: ${{ matrix.configure != '--disable-zjit' }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.runs-on || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-zjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS" \
+            ZJIT_BINDGEN_DIFF_OPTS="$ZJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '30'
+          ZJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          CLANG_PATH: ${{ matrix.clang_path }}
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-22.04
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=shipit'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event.pull_request.user.login == 'dependabot[bot]' && !startsWith(github.head_ref, 'dependabot/cargo'))
+      )}}
+
+    steps:
+      - uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          persist-credentials: false
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@de0fac2e4500dabe0009e67214ff5f5447ce83dd # v6.0.2
+        with:
+          repository: ruby/ruby-bench
+          persist-credentials: false
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+        env:
+          BUNDLER_VERSION: 0
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/zizmor.yml b/.github/zizmor.yml
new file mode 100644
index 0000000000..65b67fb6c8
--- /dev/null
+++ b/.github/zizmor.yml
@@ -0,0 +1,26 @@
+# Ignore existing findings (baseline)
+# Composite action findings are suppressed inline with # zizmor: ignore
+rules:
+  dangerous-triggers:
+    ignore:
+      - auto_request_review.yml
+      - auto_review_pr.yml
+      - labeler.yml
+      - pr-playground.yml
+  dependabot-cooldown:
+    ignore:
+      - dependabot.yml
+  misfeature:
+    ignore:
+      - mingw.yml
+      - tarball-windows.yml
+      - windows.yml
+  unpinned-images:
+    ignore:
+      - compilers.yml
+  secrets-outside-env:
+    # All committers with write access are trusted; no need for environment-scoped secrets.
+    disable: true
+  unpinned-uses:
+    ignore:
+      - wsl.yml
diff --git a/.gitignore b/.gitignore
index efc7fd5864..7ead3a81f5 100644
--- a/.gitignore
+++ b/.gitignore
@@ -4,25 +4,33 @@
 *.a
 *.bak
 *.bc
+*.bundle
 *.dSYM
 *.dmyh
 *.dylib
 *.elc
 *.i
+*.ii
 *.inc
 *.log
 *.o
+*.o.tmp
 *.obj
 *.old
 *.orig
+*.pch
 *.pdb
+*.rbinc
+*.rbbin
 *.rej
 *.s
 *.sav
+*.sl
+*.so
+*.so.*
 *.swp
 *.yarb
 *~
-.*-*
 .*.list
 .*.time
 .DS_Store
@@ -32,6 +40,8 @@
 .pc
 .ppack
 .svn
+.time
+.ruby-version
 Makefile
 cygruby*.def
 extconf.h
@@ -40,6 +50,8 @@ y.tab.c
 *.gcda
 *.gcno
 *.gcov
+*.vscode
+!misc/.vscode
 lcov*.info
 
 # /
@@ -50,7 +62,11 @@ lcov*.info
 /*.pc
 /*.rc
 /*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
 /COPYING.LIB
+/ChangeLog
 /Doxyfile
 /GNUmakefile
 /README.atheos
@@ -60,6 +76,7 @@ lcov*.info
 /archive
 /autom4te*.cache
 /automake
+/benchmark/benchmark-driver
 /beos
 /bmlog-*
 /breakpoints.gdb
@@ -80,6 +97,7 @@ lcov*.info
 /enc.mk
 /encdb.h
 /exts.mk
+/gc/*/exts.mk
 /goruby
 /id.[ch]
 /largefile.h
@@ -107,23 +125,34 @@ lcov*.info
 /rename2.h
 /repack
 /revision.h
+/revision.tmp
+/ripper.tmp.y
 /riscos
 /rubicon
 /ruby
 /ruby-runner
 /ruby-runner.h
 /ruby-man.rd.gz
+/rubyspec_temp
 /run.gdb
 /sizes.c
+/static-ruby
 /test.rb
 /test-coverage.dat
 /tmp
+/vcpkg_installed
 /transdb.h
 /uncommon.mk
 /verconf.h
 /verconf.mk
 /web
-/yasmdata.rb
+
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+/bin/goruby
+/bin/ruby
 
 # /benchmark/
 /benchmark/bm_require.data
@@ -137,27 +166,36 @@ lcov*.info
 /enc/jis/props.h
 /enc/unicode/data
 
+# /coroutine/
+!/coroutine/**/*.s
+!/coroutine/**/*.S
+
 # /enc/trans/
 /enc/trans/*.c
 /enc/trans/*.def
 /enc/trans/*.exp
 /enc/trans/*.lib
-/enc/trans/.time
 
 # /exe/
+/exe/goruby
 /exe/ruby
-/exe/.time
 
 # /ext/
 /ext/extinit.c
 /ext/configure-ext.mk
 /ext/*/exts.mk
 
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
+
 # /ext/-test-/win32/dln/
 /ext/-test-/win32/dln/dlntest.dll
 /ext/-test-/win32/dln/dlntest.exp
 /ext/-test-/win32/dln/dlntest.lib
 
+# /ext/-test-/gems
+/ext/-test-/gems
+
 # /ext/etc/
 /ext/etc/constdefs.h
 
@@ -170,7 +208,10 @@ lcov*.info
 
 # /ext/ripper/
 /ext/ripper/eventids1.c
+/ext/ripper/eventids1.h
+/ext/ripper/.eventids2-check
 /ext/ripper/eventids2table.c
+/ext/ripper/ripper_init.c
 /ext/ripper/ripper.*
 /ext/ripper/ids1
 /ext/ripper/ids2
@@ -185,7 +226,14 @@ lcov*.info
 /gems/src
 /gems/*-*
 
-# /spec/bundler
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
+
+# /misc/
+/misc/**/__pycache__
+
+# for `make test-bundler`
 /.rspec_status
 
 # /tool/
@@ -194,4 +242,50 @@ lcov*.info
 
 # /win32/
 /win32/*.ico
-/win32/.time
+
+
+# YJIT
+/yjit-bench
+/yjit_exit_locations.dump
+
+# Rust
+/target
+
+# /wasm/
+/wasm/tests/*.wasm
+
+# prism
+/lib/prism/compiler.rb
+/lib/prism/dispatcher.rb
+/lib/prism/dot_visitor.rb
+/lib/prism/dsl.rb
+/lib/prism/inspect_visitor.rb
+/lib/prism/mutation_compiler.rb
+/lib/prism/node.rb
+/lib/prism/reflection.rb
+/lib/prism/serialize.rb
+/lib/prism/visitor.rb
+/prism/internal/diagnostic.h
+/prism/api_node.c
+/prism/ast.h
+/prism/diagnostic.c
+/prism/json.c
+/prism/node.c
+/prism/prettyprint.c
+/prism/serialize.c
+/prism/tokens.c
+/prism/srcs.mk
+/dump_ast
+
+# prism (old file)
+/prism/token_type.c
+
+# tool/update-NEWS-gemlist.rb
+/bundled_gems.json
+/default_gems.json
+/gems/default_gems
+
+# AI agents
+/.claude
+/AGENTS.md
+/CLAUDE.md
diff --git a/.indent.pro b/.indent.pro
index 6a207a0554..1d61cbcad1 100644
--- a/.indent.pro
+++ b/.indent.pro
@@ -2,12 +2,15 @@
 -nbbb
 -nbc
 -br
+-brs
 -nbs
 -ncdb
--ce
--cli0.5
+-nce
+-cdw
+-cli2
+-cbi2
 -ndj
--ei
+-ncs
 -nfc1
 -i4
 -l120
@@ -16,6 +19,14 @@
 -psl
 -sc
 -sob
+-sbi4
+-nut
+-par
 
 -TID
 -TVALUE
+-Tst_data_t
+-Tst_index_t
+-Tst_table
+-Trb_data_type_t
+-TFILE
diff --git a/.mailmap b/.mailmap
new file mode 100644
index 0000000000..213a0f4916
--- /dev/null
+++ b/.mailmap
@@ -0,0 +1,431 @@
+git[bot]                                <svn-admin@ruby-lang.org>
+git[bot]                                <svn-admin@ruby-lang.org> git <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+svn[bot]                                <svn-admin@ruby-lang.org> svn <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# a_matsuda
+Akira Matsuda                           <ronnie@dio.jp>
+Akira Matsuda                           <ronnie@dio.jp> <a_matsuda@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aamine
+Minero Aoki                             <aamine@loveruby.net>
+Minero Aoki                             <aamine@loveruby.net> <aamine@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akira
+akira yamada                            <akira@ruby-lang.org>
+## akira yamada                         <akira@ruby-lang.org> <akira@rice.p.arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akiyoshi
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com>
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com> <akiyoshi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akr
+Tanaka Akira                            <akr@fsij.org>
+Tanaka Akira                            <akr@fsij.org> <akr@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arai
+Koji Arai                               <jca02266@nifty.ne.jp>
+Koji Arai                               <jca02266@nifty.ne.jp> <arai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arton
+Akio Tajima                             <artonx@yahoo.co.jp>
+Akio Tajima                             <artonx@yahoo.co.jp> <arton@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aycabta
+aycabta                                 <aycabta@gmail.com>
+aycabta                                 <aycabta@gmail.com> <aycabta@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ayumin
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com>
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com> <ayumin@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# azav
+Alexander Zavorine                      <alexandre.zavorine@nokia.com>
+Alexander Zavorine                      <alexandre.zavorine@nokia.com> <azav@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# charliesome
+Charlie Somerville                      <charliesome@ruby-lang.org>
+Charlie Somerville                      <charliesome@ruby-lang.org> <charliesome@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dave
+Dave Thomas                             <dave@pragprog.com>
+Dave Thomas                             <dave@pragprog.com> <dave@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# davidflanagan
+David Flanagan                          <davidflanagan@ruby-lang.org>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@think32>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@davidflanagan.com>
+David Flanagan                          <davidflanagan@ruby-lang.org> <davidflanagan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dblack
+David A. Black                          <dblack@rubypal.com>
+David A. Black                          <dblack@rubypal.com> <dblack@wobblini.net>
+David A. Black                          <dblack@rubypal.com> <dblack@superlink.net>
+David A. Black                          <dblack@rubypal.com> <dblack@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# drbrain
+Eric Hodel                              <drbrain@segment7.net>
+Eric Hodel                              <drbrain@segment7.net> <drbrain@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# duerst
+Martin Dürst                            <duerst@it.aoyama.ac.jp>
+Martin Dürst                            <duerst@it.aoyama.ac.jp> <duerst@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eban
+WATANABE Hirofumi                       <eban@ruby-lang.org>
+WATANABE Hirofumi                       <eban@ruby-lang.org> <eban@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# emboss
+Martin Bosslet                          <Martin.Bosslet@gmail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <Martin.Bosslet@googlemail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <emboss@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eregon
+Benoit Daloze                           <eregontp@gmail.com>
+Benoit Daloze                           <eregontp@gmail.com> <eregon@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# evan
+Evan Phoenix                            <evan@ruby-lang.org>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@fallingsnow.net>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# glass
+Masaki Matsushita                       <glass.saga@gmail.com>
+Masaki Matsushita                       <glass.saga@gmail.com> <glass@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gogotanaka
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org>
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org> <gogotanaka@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoken
+Kentaro Goto                            <gotoken@gmail.com>
+Kentaro Goto                            <gotoken@gmail.com> <gotoken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoyuzo
+GOTOU Yuuzou                            <gotoyuzo@notwork.org>
+GOTOU Yuuzou                            <gotoyuzo@notwork.org> <gotoyuzo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gsinclair
+Gavin Sinclair                          <gsinclair@soyabean.com.au>
+Gavin Sinclair                          <gsinclair@soyabean.com.au> <gsinclair@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# H_Konishi
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp>
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp> <H_Konishi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# headius
+Charles Oliver Nutter                   <headius@headius.com>
+Charles Oliver Nutter                   <headius@headius.com> <headius@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hone
+Terence Lee                             <hone@heroku.com>
+Terence Lee                             <hone@heroku.com> <hone@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hsbt
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org>
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org> <hsbt@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# iwamatsu
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org>
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org> <iwamatsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jeg2
+James Edward Gray II                    <james@graysoftinc.com>
+James Edward Gray II                    <james@graysoftinc.com> <jeg2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jim
+Jim Weirich                             <jim@tardis.local>
+Jim Weirich                             <jim@tardis.local> <jim@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# k0kubun
+Takashi Kokubun                         <takashikkbn@gmail.com>
+Takashi Kokubun                         <takashikkbn@gmail.com> <k0kubun@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kanemoto
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org>
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org> <kanemoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# katsu
+UENO Katsuhiro                          <katsu@blue.sky.or.jp>
+UENO Katsuhiro                          <katsu@blue.sky.or.jp> <katsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kazu
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com>
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com> <kazu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# keiju
+Keiju Ishitsuka                         <keiju@ishitsuka.com>
+Keiju Ishitsuka                         <keiju@ishitsuka.com> <keiju@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# knu
+Akinori MUSHA                           <knu@iDaemons.org>
+Akinori MUSHA                           <knu@iDaemons.org> <knu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ko1
+Koichi Sasada                           <ko1@atdot.net>
+Koichi Sasada                           <ko1@atdot.net> <ko1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosaki
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com>
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com> <kosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosako
+K.Kosako                                <sndgk393@ybb.ne.jp>
+K.Kosako                                <sndgk393@ybb.ne.jp> <kosako@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kou
+Sutou Kouhei                            <kou@clear-code.com>
+Sutou Kouhei                            <kou@clear-code.com> <kou@cozmixng.org>
+Sutou Kouhei                            <kou@clear-code.com> <kou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kouji
+Kouji Takao                             <kouji.takao@gmail.com>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@takao7.net>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ksaito
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp>
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp> <ksaito@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ktsj
+Kazuki Tsujimoto                        <kazuki@callcc.net>
+Kazuki Tsujimoto                        <kazuki@callcc.net> <ktsj@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# luislavena
+Luis Lavena                             <luislavena@gmail.com>
+Luis Lavena                             <luislavena@gmail.com> <luislavena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mame
+Yusuke Endoh                            <mame@ruby-lang.org>
+## Yusuke Endoh                         <mame@ruby-lang.org> <mame@tsg.ne.jp>
+Yusuke Endoh                            <mame@ruby-lang.org> <mame@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# marcandre
+Marc-Andre Lafortune                    <github@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca> <marcandre@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# matz
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@ruby-lang.org>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# michal
+Michal Rokos                            <michal@ruby-lang.org>
+Michal Rokos                            <michal@ruby-lang.org> <michal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mneumann
+Michael Neumann                         <mneumann@ruby-lang.org>
+Michael Neumann                         <mneumann@ruby-lang.org> <mneumann@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mrkn
+Kenta Murata                            <mrkn@mrkn.jp>
+Kenta Murata                            <mrkn@mrkn.jp> <muraken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+Kenta Murata                            <mrkn@mrkn.jp> <3959+mrkn@users.noreply.github.com>
+Kenta Murata                            <mrkn@mrkn.jp> <mrkn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagachika
+nagachika                               <nagachika@ruby-lang.org>
+nagachika                               <nagachika@ruby-lang.org> <nagachika@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagai
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp>
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp> <nagai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nahi
+Hiroshi Nakamura                        <nahi@ruby-lang.org>
+Hiroshi Nakamura                        <nahi@ruby-lang.org> <nahi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nari
+Narihiro Nakamura                       <authornari@gmail.com>
+Narihiro Nakamura                       <authornari@gmail.com> <nari@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# naruse
+NARUSE, Yui                             <naruse@airemix.jp>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@ruby-lang.org>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ngoto
+Naohisa Goto                            <ngotogenome@gmail.com>
+Naohisa Goto                            <ngotogenome@gmail.com> <ngoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nobu
+Nobuyoshi Nakada                        <nobu@ruby-lang.org>
+Nobuyoshi Nakada                        <nobu@ruby-lang.org> <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# normal
+Eric Wong                               <normal@ruby-lang.org>
+Eric Wong                               <normal@ruby-lang.org> <e@80x24.org>
+Eric Wong                               <normal@ruby-lang.org> <normal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ntalbott
+Nathaniel Talbott                       <ntalbott@ruby-lang.org>
+Nathaniel Talbott                       <ntalbott@ruby-lang.org> <ntalbott@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ocean
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp>
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp> <ocean@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# odaira
+Rei Odaira                              <rodaira@us.ibm.com>
+Rei Odaira                              <rodaira@us.ibm.com> <Rei.Odaira@gmail.com>
+Rei Odaira                              <rodaira@us.ibm.com> <odaira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# okkez
+okkez                                   <okkez000@gmail.com>
+okkez                                   <okkez000@gmail.com> <okkez@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# rhe
+Kazuki Yamaguchi                        <k@rhe.jp>
+Kazuki Yamaguchi                        <k@rhe.jp> <rhe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ryan
+Ryan Davis                              <ryand-github@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryand-ruby@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# samuel
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz>
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz> <samuel@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# seki
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp>
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp> <seki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ser
+Sean Russell                            <ser@germane-software.com>
+Sean Russell                            <ser@germane-software.com> <ser@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shigek
+Shigeo Kobayashi                        <shigek@ruby-lang.org>
+Shigeo Kobayashi                        <shigek@ruby-lang.org> <shigek@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shirosaki
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com>
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com> <shirosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sho-h
+Sho Hashimoto                           <sho-h@ruby-lang.org>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@netlab.jp>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho.hsmt@gmail.com>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shugo
+Shugo Maeda                             <shugo@ruby-lang.org>
+Shugo Maeda                             <shugo@ruby-lang.org> <shugo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shyouhei
+卜部昌平                                    <shyouhei@ruby-lang.org>
+卜部昌平                                    <shyouhei@ruby-lang.org> <shyouhei@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# siena
+Siena.                                  <siena@faculty.chiba-u.jp>
+Siena.                                  <siena@faculty.chiba-u.jp> <siena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sonots
+sonots                                  <sonots@gmail.com>
+sonots                                  <sonots@gmail.com> <sonots@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sorah
+Sorah Fukumori                          <her@sorah.jp>
+Sorah Fukumori                          <her@sorah.jp> <sorah@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# stomar
+Marcus Stollsteimer                     <sto.mar@web.de>
+Marcus Stollsteimer                     <sto.mar@web.de> <stomar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# suke
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp>
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp> <suke@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadd
+Tadashi Saito                           <tad.a.digger@gmail.com>
+Tadashi Saito                           <tad.a.digger@gmail.com> <tadd@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadf
+Tadayoshi Funaba                        <tadf@dotrb.org>
+Tadayoshi Funaba                        <tadf@dotrb.org> <tadf@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# takano32
+TAKANO Mitsuhiro                        <takano32@gmail.com>
+TAKANO Mitsuhiro                        <takano32@gmail.com> <takano32@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tarui
+Masaya Tarui                            <tarui@ruby-lang.org>
+Masaya Tarui                            <tarui@ruby-lang.org> <tarui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# technorama
+Technorama Ltd.                         <oss-ruby@technorama.net>
+Technorama Ltd.                         <oss-ruby@technorama.net> <technorama@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tenderlove
+Aaron Patterson                         <tenderlove@ruby-lang.org>
+Aaron Patterson                         <tenderlove@ruby-lang.org> <tenderlove@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tmm1
+Aman Gupta                              <ruby@tmm1.net>
+Aman Gupta                              <ruby@tmm1.net> <tmm1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ts
+Guy Decoux                              <ts@moulon.inra.fr>
+Guy Decoux                              <ts@moulon.inra.fr> <ts@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ttate
+Takaaki Tateishi                        <ttate@ttsky.net>
+## Takaaki Tateishi                     <ttate@ttsky.net> <ttate@kt.jaist.ac.jp>
+Takaaki Tateishi                        <ttate@ttsky.net> <ttate@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# uema2
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp>
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp> <uema2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# usa
+U.Nakamura                              <usa@ruby-lang.org>
+U.Nakamura                              <usa@ruby-lang.org> <usa@garbagecollect.jp>
+U.Nakamura                              <usa@ruby-lang.org> <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wakou
+Wakou Aoyama                            <wakou@ruby-lang.org>
+Wakou Aoyama                            <wakou@ruby-lang.org> <wakou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wanabe
+wanabe                                  <s.wanabe@gmail.com>
+wanabe                                  <s.wanabe@gmail.com> <wanabe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# watson1978
+Watson                                  <watson1978@gmail.com>
+Watson                                  <watson1978@gmail.com> <watson1978@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wew
+William Webber                          <william@williamwebber.com>
+William Webber                          <william@williamwebber.com> <wew@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# why
+why the lucky stiff                     <why@ruby-lang.org>
+why the lucky stiff                     <why@ruby-lang.org> <why@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# xibbar
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org>
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org> <xibbar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yugui
+Yuki Yugui Sonoda                       <yugui@yugui.jp>
+Yuki Yugui Sonoda                       <yugui@yugui.jp> <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yui-knk
+yui-knk                                 <spiketeika@gmail.com>
+yui-knk                                 <spiketeika@gmail.com> <yui-knk@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yuki
+Yuki Nishijima                          <yuki24@hey.com>
+Yuki Nishijima                          <yuki24@hey.com> <mail@yukinishijima.net>
+Yuki Nishijima                          <yuki24@hey.com> <yuki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zsombor
+Dee Zsombor                             <zsombor@ruby-lang.org>
+Dee Zsombor                             <zsombor@ruby-lang.org> <zsombor@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zzak
+zzak                                    <zzakscott@gmail.com>
+zzak                                    <zzakscott@gmail.com> <zzak@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
diff --git a/.rdoc_options b/.rdoc_options
new file mode 100644
index 0000000000..5172911e16
--- /dev/null
+++ b/.rdoc_options
@@ -0,0 +1,37 @@
+---
+page_dir: doc
+main_page: index.md
+title: Documentation for Ruby development version
+visibility: :private
+rdoc_include:
+- doc
+
+exclude:
+- \.gemspec\z
+- lib/set/subclass_compatible.rb
+
+autolink_excluded_words:
+- Box
+- Class
+- Method
+- Module
+- Process
+- RDoc
+- Ruby
+- Set
+- ZJIT
+- YJIT
+
+canonical_root: https://docs.ruby-lang.org/en/master
+
+footer_content:
+  Ruby:
+    Documentation: index.html
+    Official Website: https://www.ruby-lang.org/
+    Playground: https://ruby.github.io/play-ruby/
+  Resources:
+    GitHub: https://github.com/ruby/ruby
+    Issue Tracker: https://bugs.ruby-lang.org/projects/ruby-master/issues
+    RubyGems: https://rubygems.org/
+  Community:
+    X: https://x.com/rubylangorg
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 4c7a2e9667..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,104 +0,0 @@
-# Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
-#
-# This file is  a part of the programming language  Ruby.  Permission is hereby
-# granted,  to either  redistribute  or  modify this  file,  provided that  the
-# conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
-# details.
-
-# This is  a Travis-CI  build configuration file.   The list  of configurations
-# available is located in
-#
-#     http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-#     http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-language: c
-dist: trusty
-
-sudo: false
-
-compiler:
-  - gcc
-
-os:
-  - linux
-
-before_install:
-  - "CONFIG_FLAG="
-  - "JOBS=-j`nproc`"
-
-before_script:
-  - "echo JOBS=$JOBS"
-  - "uname -a"
-  - "uname -r"
-  - "rm -fr .ext autom4te.cache"
-  - "echo $TERM"
-  - "> config.status"
-  - "sed -f tool/prereq.status Makefile.in common.mk > Makefile"
-  - "make update-config_files"
-  - "make touch-unicode-files"
-  - "make -s $JOBS srcs UNICODE_FILES=."
-  - "requests=; for req in ${RUBYSPEC_PULL_REQUEST//,/ }; do
-      requests=\"$requests +refs/pull/$req/merge:\";
-    done"
-  - "${requests:+git -C spec/ruby -c user.email=none -c user.name=none pull --no-edit origin $requests}"
-  - "${requests:+git -C spec/ruby log --oneline origin/master..@}"
-  - "rm config.status Makefile rbconfig.rb .rbconfig.time"
-  - "mkdir build config_1st config_2nd"
-  - "chmod -R a-w ."
-  - "chmod u+w build config_1st config_2nd"
-  - "cd build"
-  - "../configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
-  - "cp -pr config.cache config.status .ext/include ../config_1st"
-  - "make reconfig"
-  - "cp -pr config.cache config.status .ext/include ../config_2nd"
-  - "(cd .. && exec diff -ru config_1st config_2nd)"
-  - "make -s $JOBS"
-
-script:
-  - "make -s test TESTOPTS=--color=never"
-  - "make -s $JOBS test-all -o exts TESTOPTS='-q --color=never --job-status=normal'"
-  - "make -s $JOBS test-spec MSPECOPT=-j"
-
-# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
-branches:
-  only:
-    - trunk
-    - ruby_2_2
-    - ruby_2_3
-    - ruby_2_4
-    - /^feature\//
-    - /^bug\//
-
-# We want to be notified when something happens.
-notifications:
-  irc:
-    channels:
-      - "chat.freenode.net#ruby-core"
-      - "chat.freenode.net#ruby-ja"
-    on_success: change # [always|never|change] # default: always
-    on_failure: always # [always|never|change] # default: always
-    template:
-      - "%{message} by @%{author}: See %{build_url}"
-
-  slack:
-    secure: TNRGiWGytGSLDAjJLR0NVXKlHhba6Kf584wU7mXqiOCDNBQ0LHUsrIMaL38uvpnzQ6NeV5j5k575LAZyuGXKczSrOTeIBJaHfw6Wj/8WUnifnNcIFozZ5DH9/S2EuiVcslDmoRflOFSTkocpE0MElt2KU2kNCzeq3/iVatNT8Nw=
-    on_pull_requests: false
-    on_success: change
-    on_failure: always
-
-  email:
-    - ko1c-failure@atdot.net
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
diff --git a/BSDL b/BSDL
index a009caefea..66d93598aa 100644
--- a/BSDL
+++ b/BSDL
@@ -4,10 +4,10 @@ Redistribution and use in source and binary forms, with or without
 modification, are permitted provided that the following conditions
 are met:
 1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
+   notice, this list of conditions and the following disclaimer.
 2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
+   notice, this list of conditions and the following disclaimer in the
+   documentation and/or other materials provided with the distribution.
 
 THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
 ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index ffdf2dd4b8..35e79dd3b9 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -1,4 +1 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
diff --git a/COPYING b/COPYING
index f06056fb45..428ce03ed7 100644
--- a/COPYING
+++ b/COPYING
@@ -1,56 +1,58 @@
+{日本語}[rdoc-ref:COPYING.ja]
+
 Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
 You can redistribute it and/or modify it under either the terms of the
 2-clause BSDL (see the file BSDL), or the conditions below:
 
-  1. You may make and give away verbatim copies of the source form of the
-     software without restriction, provided that you duplicate all of the
-     original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+   software without restriction, provided that you duplicate all of the
+   original copyright notices and associated disclaimers.
 
-  2. You may modify your copy of the software in any way, provided that
-     you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+   you do at least ONE of the following:
 
-       a) place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-          modifications to Usenet or an equivalent medium, or by allowing
-          the author to include your modifications in the software.
+   a. place your modifications in the Public Domain or otherwise
+      make them Freely Available, such as by posting said
+      modifications to Usenet or an equivalent medium, or by allowing
+      the author to include your modifications in the software.
 
-       b) use the modified software only within your corporation or
-          organization.
+   b. use the modified software only within your corporation or
+      organization.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  3. You may distribute the software in object code or binary form,
-     provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+   provided that you do at least ONE of the following:
 
-       a) distribute the binaries and library files of the software,
-          together with instructions (in the manual page or equivalent)
-          on where to get the original distribution.
+   a. distribute the binaries and library files of the software,
+      together with instructions (in the manual page or equivalent)
+      on where to get the original distribution.
 
-       b) accompany the distribution with the machine-readable source of
-          the software.
+   b. accompany the distribution with the machine-readable source of
+      the software.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
 
-       d) make other distribution arrangements with the author.
+   d. make other distribution arrangements with the author.
 
-  4. You may modify and include the part of the software into any other
-     software (possibly commercial).  But some files in the distribution
-     are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+   software (possibly commercial).  But some files in the distribution
+   are not written by the author, so that they are not under these terms.
 
-     For the list of those files and their copying conditions, see the
-     file LEGAL.
+   For the list of those files and their copying conditions, see the
+   file LEGAL.
 
-  5. The scripts and library files supplied as input to or produced as
-     output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them,
-     and may be sold commercially, and may be aggregated with this
-     software.
+5. The scripts and library files supplied as input to or produced as
+   output from the software do not automatically fall under the
+   copyright of the software, but belong to whomever generated them,
+   and may be sold commercially, and may be aggregated with this
+   software.
 
-  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-     PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+   IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+   WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+   PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index e50d01c8d1..5de2dbcc8f 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,53 @@
+{English}[rdoc-ref:COPYING]
+
 本プログラムはフリーソフトウェアです．2-clause BSDL
 または以下に示す条件で本プログラムを再配布できます
 2-clause BSDLについてはBSDLファイルを参照して下さい．
 
-  1. 複製は制限なく自由です．
+1. 複製は制限なく自由です．
 
-  2. 以下の条件のいずれかを満たす時に本プログラムのソースを
-     自由に変更できます．
+2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+   自由に変更できます．
 
-     (a) ネットニューズにポストしたり，作者に変更を送付する
-         などの方法で，変更を公開する．
+   a.  ネットニューズにポストしたり，作者に変更を送付する
+       などの方法で，変更を公開する．
 
-     (b) 変更した本プログラムを自分の所属する組織内部だけで
-         使う．
+   b.  変更した本プログラムを自分の所属する組織内部だけで
+       使う．
 
-     (c) 変更点を明示したうえ，ソフトウェアの名前を変更する．
-         そのソフトウェアを配布する時には変更前の本プログラ
-         ムも同時に配布する．または変更前の本プログラムのソー
-         スの入手法を明示する．
+   c.  変更点を明示したうえ，ソフトウェアの名前を変更する．
+       そのソフトウェアを配布する時には変更前の本プログラ
+       ムも同時に配布する．または変更前の本プログラムのソー
+       スの入手法を明示する．
 
-     (d) その他の変更条件を作者と合意する．
+   d.  その他の変更条件を作者と合意する．
 
-  3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
-     ルしたオブジェクトコードや実行形式でも配布できます．
+3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+   ルしたオブジェクトコードや実行形式でも配布できます．
 
-     (a) バイナリを受け取った人がソースを入手できるように，
-         ソースの入手法を明示する．
+   a.  バイナリを受け取った人がソースを入手できるように，
+       ソースの入手法を明示する．
 
-     (b) 機械可読なソースコードを添付する．
+   b.  機械可読なソースコードを添付する．
 
-     (c) 変更を行ったバイナリは名前を変更したうえ，オリジナ
-         ルのソースコードの入手法を明示する．
+   c.  変更を行ったバイナリは名前を変更したうえ，オリジナ
+       ルのソースコードの入手法を明示する．
 
-     (d) その他の配布条件を作者と合意する．
+   d.  その他の配布条件を作者と合意する．
 
-  4. 他のプログラムへの引用はいかなる目的であれ自由です．た
-     だし，本プログラムに含まれる他の作者によるコードは，そ
-     れぞれの作者の意向による制限が加えられる場合があります．
+4. 他のプログラムへの引用はいかなる目的であれ自由です．た
+   だし，本プログラムに含まれる他の作者によるコードは，そ
+   れぞれの作者の意向による制限が加えられる場合があります．
 
-     それらファイルの一覧とそれぞれの配布条件などに付いては
-     LEGALファイルを参照してください．
+   それらファイルの一覧とそれぞれの配布条件などに付いては
+   LEGALファイルを参照してください．
 
-  5. 本プログラムへの入力となるスクリプトおよび，本プログラ
-     ムからの出力の権利は本プログラムの作者ではなく，それぞ
-     れの入出力を生成した人に属します．また，本プログラムに
-     組み込まれるための拡張ライブラリについても同様です．
+5. 本プログラムへの入力となるスクリプトおよび，本プログラ
+   ムからの出力の権利は本プログラムの作者ではなく，それぞ
+   れの入出力を生成した人に属します．また，本プログラムに
+   組み込まれるための拡張ライブラリについても同様です．
 
-  6. 本プログラムは無保証です．作者は本プログラムをサポート
-     する意志はありますが，プログラム自身のバグあるいは本プ
-     ログラムの実行などから発生するいかなる損害に対しても責
-     任を持ちません．
+6. 本プログラムは無保証です．作者は本プログラムをサポート
+   する意志はありますが，プログラム自身のバグあるいは本プ
+   ログラムの実行などから発生するいかなる損害に対しても責
+   任を持ちません．
diff --git a/Cargo.lock b/Cargo.lock
new file mode 100644
index 0000000000..2108276e72
--- /dev/null
+++ b/Cargo.lock
@@ -0,0 +1,766 @@
+# This file is automatically @generated by Cargo.
+# It is not intended for manual editing.
+version = 3
+
+[[package]]
+name = "anyhow"
+version = "1.0.100"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a23eb6b1614318a8071c9b2521f36b424b2c83db5eb3a0fead4a6c0809af6e61"
+
+[[package]]
+name = "autocfg"
+version = "1.5.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "c08606f8c3cbf4ce6ec8e28fb0014a2c086708fe954eaa885384a6165172e7e8"
+
+[[package]]
+name = "bitflags"
+version = "1.3.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "bef38d45163c2f1dde094a7dfd33ccf595c92905c8f8f4fdc18d06fb1037718a"
+
+[[package]]
+name = "bitflags"
+version = "2.11.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "843867be96c8daad0d758b57df9392b6d8d271134fce549de6ce169ff98a92af"
+
+[[package]]
+name = "capstone"
+version = "0.14.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f442ae0f2f3f1b923334b4a5386c95c69c1cfa072bafa23d6fae6d9682eb1dd4"
+dependencies = [
+ "capstone-sys",
+ "static_assertions",
+]
+
+[[package]]
+name = "capstone-sys"
+version = "0.18.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a4e8087cab6731295f5a2a2bd82989ba4f41d3a428aab2e7c98d8f4db38aac05"
+dependencies = [
+ "cc",
+]
+
+[[package]]
+name = "cc"
+version = "1.0.94"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "17f6e324229dc011159fcc089755d1e2e216a90d43a7dea6853ca740b84f35e7"
+
+[[package]]
+name = "cfg-if"
+version = "1.0.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9330f8b2ff13f34540b44e946ef35111825727b38d33286ef986142615121801"
+
+[[package]]
+name = "chacha20"
+version = "0.10.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "6f8d983286843e49675a4b7a2d174efe136dc93a18d69130dd18198a6c167601"
+dependencies = [
+ "cfg-if",
+ "cpufeatures",
+ "rand_core",
+]
+
+[[package]]
+name = "console"
+version = "0.16.3"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d64e8af5551369d19cf50138de61f1c42074ab970f74e99be916646777f8fc87"
+dependencies = [
+ "encode_unicode",
+ "libc",
+ "windows-sys 0.61.2",
+]
+
+[[package]]
+name = "cpufeatures"
+version = "0.3.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8b2a41393f66f16b0823bb79094d54ac5fbd34ab292ddafb9a0456ac9f87d201"
+dependencies = [
+ "libc",
+]
+
+[[package]]
+name = "encode_unicode"
+version = "1.0.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "34aa73646ffb006b8f5147f3dc182bd4bcb190227ce861fc4a4844bf8e3cb2c0"
+
+[[package]]
+name = "equivalent"
+version = "1.0.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "877a4ace8713b0bcf2a4e7eec82529c029f1d0619886d18145fea96c3ffe5c0f"
+
+[[package]]
+name = "errno"
+version = "0.3.14"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "39cab71617ae0d63f51a36d69f866391735b51691dbda63cf6f96d042b63efeb"
+dependencies = [
+ "libc",
+ "windows-sys 0.52.0",
+]
+
+[[package]]
+name = "fastrand"
+version = "1.9.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "e51093e27b0797c359783294ca4f0a911c270184cb10f85783b118614a1501be"
+dependencies = [
+ "instant",
+]
+
+[[package]]
+name = "foldhash"
+version = "0.1.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a0d2fde1f7b3d48b8395d5f2de76c18a528bd6a9cdde438df747bfcba3e05d6f"
+
+[[package]]
+name = "getrandom"
+version = "0.4.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0de51e6874e94e7bf76d726fc5d13ba782deca734ff60d5bb2fb2607c7406555"
+dependencies = [
+ "cfg-if",
+ "libc",
+ "r-efi",
+ "rand_core",
+ "wasip2",
+ "wasip3",
+]
+
+[[package]]
+name = "hashbrown"
+version = "0.15.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9229cfe53dfd69f0609a49f65461bd93001ea1ef889cd5529dd176593f5338a1"
+dependencies = [
+ "foldhash",
+]
+
+[[package]]
+name = "hashbrown"
+version = "0.16.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "841d1cc9bed7f9236f321df977030373f4a4163ae1a7dbfe1a51a2c1a51d9100"
+
+[[package]]
+name = "heck"
+version = "0.5.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "2304e00983f87ffb38b55b444b5e3b60a884b5d30c0fca7d82fe33449bbe55ea"
+
+[[package]]
+name = "hermit-abi"
+version = "0.3.9"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d231dfb89cfffdbc30e7fc41579ed6066ad03abda9e567ccafae602b97ec5024"
+
+[[package]]
+name = "id-arena"
+version = "2.3.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "3d3067d79b975e8844ca9eb072e16b31c3c1c36928edf9c6789548c524d0d954"
+
+[[package]]
+name = "indexmap"
+version = "2.13.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "7714e70437a7dc3ac8eb7e6f8df75fd8eb422675fc7678aff7364301092b1017"
+dependencies = [
+ "equivalent",
+ "hashbrown 0.16.1",
+ "serde",
+ "serde_core",
+]
+
+[[package]]
+name = "insta"
+version = "1.47.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "7b4a6248eb93a4401ed2f37dfe8ea592d3cf05b7cf4f8efa867b6895af7e094e"
+dependencies = [
+ "console",
+ "once_cell",
+ "similar",
+ "tempfile",
+]
+
+[[package]]
+name = "instant"
+version = "0.1.13"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "e0242819d153cba4b4b05a5a8f2a7e9bbf97b6055b2a002b395c96b5ff3c0222"
+dependencies = [
+ "cfg-if",
+]
+
+[[package]]
+name = "io-lifetimes"
+version = "1.0.11"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "eae7b9aee968036d54dce06cebaefd919e4472e753296daccd6d344e3e2df0c2"
+dependencies = [
+ "hermit-abi",
+ "libc",
+ "windows-sys 0.48.0",
+]
+
+[[package]]
+name = "itoa"
+version = "1.0.15"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "4a5f13b858c8d314ee3e8f639011f7ccefe71f97f96e50151fb991f267928e2c"
+
+[[package]]
+name = "jit"
+version = "0.1.0"
+
+[[package]]
+name = "leb128fmt"
+version = "0.1.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "09edd9e8b54e49e587e4f6295a7d29c3ea94d469cb40ab8ca70b288248a81db2"
+
+[[package]]
+name = "libc"
+version = "0.2.163"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "1fdaeca4cf44ed4ac623e86ef41f056e848dbeab7ec043ecb7326ba300b36fd0"
+
+[[package]]
+name = "linux-raw-sys"
+version = "0.3.8"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ef53942eb7bf7ff43a617b3e2c1c4a5ecf5944a7c1bc12d7ee39bbb15e5c1519"
+
+[[package]]
+name = "log"
+version = "0.4.18"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "518ef76f2f87365916b142844c16d8fefd85039bc5699050210a7778ee1cd1de"
+
+[[package]]
+name = "memchr"
+version = "2.6.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "76fc44e2588d5b436dbc3c6cf62aef290f90dab6235744a93dfe1cc18f451e2c"
+
+[[package]]
+name = "once_cell"
+version = "1.21.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9f7c3e4beb33f85d45ae3e3a1792185706c8e16d043238c593331cc7cd313b50"
+
+[[package]]
+name = "prettyplease"
+version = "0.2.37"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "479ca8adacdd7ce8f1fb39ce9ecccbfe93a3f1344b3d0d97f20bc0196208f62b"
+dependencies = [
+ "proc-macro2",
+ "syn",
+]
+
+[[package]]
+name = "proc-macro2"
+version = "1.0.101"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "89ae43fd86e4158d6db51ad8e2b80f313af9cc74f5c0e03ccb87de09998732de"
+dependencies = [
+ "unicode-ident",
+]
+
+[[package]]
+name = "quote"
+version = "1.0.40"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "1885c039570dc00dcb4ff087a89e185fd56bae234ddc7f056a945bf36467248d"
+dependencies = [
+ "proc-macro2",
+]
+
+[[package]]
+name = "r-efi"
+version = "6.0.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f8dcc9c7d52a811697d2151c701e0d08956f92b0e24136cf4cf27b57a6a0d9bf"
+
+[[package]]
+name = "rand"
+version = "0.10.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d2e8e8bcc7961af1fdac401278c6a831614941f6164ee3bf4ce61b7edb162207"
+dependencies = [
+ "chacha20",
+ "getrandom",
+ "rand_core",
+]
+
+[[package]]
+name = "rand_core"
+version = "0.10.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0c8d0fd677905edcbeedbf2edb6494d676f0e98d54d5cf9bda0b061cb8fb8aba"
+
+[[package]]
+name = "redox_syscall"
+version = "0.3.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "567664f262709473930a4bf9e51bf2ebf3348f2e748ccc50dea20646858f8f29"
+dependencies = [
+ "bitflags 1.3.2",
+]
+
+[[package]]
+name = "ruby"
+version = "0.0.0"
+dependencies = [
+ "yjit",
+ "zjit",
+]
+
+[[package]]
+name = "rustix"
+version = "0.37.28"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "519165d378b97752ca44bbe15047d5d3409e875f39327546b42ac81d7e18c1b6"
+dependencies = [
+ "bitflags 1.3.2",
+ "errno",
+ "io-lifetimes",
+ "libc",
+ "linux-raw-sys",
+ "windows-sys 0.48.0",
+]
+
+[[package]]
+name = "ryu"
+version = "1.0.20"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "28d3b2b1366ec20994f1fd18c3c594f05c5dd4bc44d8bb0c1c632c8d6829481f"
+
+[[package]]
+name = "semver"
+version = "1.0.26"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "56e6fa9c48d24d85fb3de5ad847117517440f6beceb7798af16b4a87d616b8d0"
+
+[[package]]
+name = "serde"
+version = "1.0.228"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9a8e94ea7f378bd32cbbd37198a4a91436180c5bb472411e48b5ec2e2124ae9e"
+dependencies = [
+ "serde_core",
+]
+
+[[package]]
+name = "serde_core"
+version = "1.0.228"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "41d385c7d4ca58e59fc732af25c3983b67ac852c1a25000afe1175de458b67ad"
+dependencies = [
+ "serde_derive",
+]
+
+[[package]]
+name = "serde_derive"
+version = "1.0.228"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d540f220d3187173da220f885ab66608367b6574e925011a9353e4badda91d79"
+dependencies = [
+ "proc-macro2",
+ "quote",
+ "syn",
+]
+
+[[package]]
+name = "serde_json"
+version = "1.0.143"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d401abef1d108fbd9cbaebc3e46611f4b1021f714a0597a71f41ee463f5f4a5a"
+dependencies = [
+ "itoa",
+ "memchr",
+ "ryu",
+ "serde",
+]
+
+[[package]]
+name = "similar"
+version = "2.4.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32fea41aca09ee824cc9724996433064c89f7777e60762749a4170a14abbfa21"
+
+[[package]]
+name = "static_assertions"
+version = "1.1.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a2eb9349b6444b326872e140eb1cf5e7c522154d69e7a0ffb0fb81c06b37543f"
+
+[[package]]
+name = "syn"
+version = "2.0.117"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "e665b8803e7b1d2a727f4023456bbbbe74da67099c585258af0ad9c5013b9b99"
+dependencies = [
+ "proc-macro2",
+ "quote",
+ "unicode-ident",
+]
+
+[[package]]
+name = "tempfile"
+version = "3.6.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "31c0432476357e58790aaa47a8efb0c5138f137343f3b5f23bd36a27e3b0a6d6"
+dependencies = [
+ "autocfg",
+ "cfg-if",
+ "fastrand",
+ "redox_syscall",
+ "rustix",
+ "windows-sys 0.48.0",
+]
+
+[[package]]
+name = "unicode-ident"
+version = "1.0.22"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9312f7c4f6ff9069b165498234ce8be658059c6728633667c526e27dc2cf1df5"
+
+[[package]]
+name = "unicode-xid"
+version = "0.2.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ebc1c04c71510c7f702b52b7c350734c9ff1295c464a03335b00bb84fc54f853"
+
+[[package]]
+name = "wasip2"
+version = "1.0.1+wasi-0.2.4"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0562428422c63773dad2c345a1882263bbf4d65cf3f42e90921f787ef5ad58e7"
+dependencies = [
+ "wit-bindgen 0.46.0",
+]
+
+[[package]]
+name = "wasip3"
+version = "0.4.0+wasi-0.3.0-rc-2026-01-06"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "5428f8bf88ea5ddc08faddef2ac4a67e390b88186c703ce6dbd955e1c145aca5"
+dependencies = [
+ "wit-bindgen 0.51.0",
+]
+
+[[package]]
+name = "wasm-encoder"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "990065f2fe63003fe337b932cfb5e3b80e0b4d0f5ff650e6985b1048f62c8319"
+dependencies = [
+ "leb128fmt",
+ "wasmparser",
+]
+
+[[package]]
+name = "wasm-metadata"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "bb0e353e6a2fbdc176932bbaab493762eb1255a7900fe0fea1a2f96c296cc909"
+dependencies = [
+ "anyhow",
+ "indexmap",
+ "wasm-encoder",
+ "wasmparser",
+]
+
+[[package]]
+name = "wasmparser"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "47b807c72e1bac69382b3a6fb3dbe8ea4c0ed87ff5629b8685ae6b9a611028fe"
+dependencies = [
+ "bitflags 2.11.0",
+ "hashbrown 0.15.5",
+ "indexmap",
+ "semver",
+]
+
+[[package]]
+name = "windows-link"
+version = "0.2.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f0805222e57f7521d6a62e36fa9163bc891acd422f971defe97d64e70d0a4fe5"
+
+[[package]]
+name = "windows-sys"
+version = "0.48.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "677d2418bec65e3338edb076e806bc1ec15693c5d0104683f2efe857f61056a9"
+dependencies = [
+ "windows-targets 0.48.5",
+]
+
+[[package]]
+name = "windows-sys"
+version = "0.52.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "282be5f36a8ce781fad8c8ae18fa3f9beff57ec1b52cb3de0789201425d9a33d"
+dependencies = [
+ "windows-targets 0.52.6",
+]
+
+[[package]]
+name = "windows-sys"
+version = "0.61.2"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ae137229bcbd6cdf0f7b80a31df61766145077ddf49416a728b02cb3921ff3fc"
+dependencies = [
+ "windows-link",
+]
+
+[[package]]
+name = "windows-targets"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9a2fa6e2155d7247be68c096456083145c183cbbbc2764150dda45a87197940c"
+dependencies = [
+ "windows_aarch64_gnullvm 0.48.5",
+ "windows_aarch64_msvc 0.48.5",
+ "windows_i686_gnu 0.48.5",
+ "windows_i686_msvc 0.48.5",
+ "windows_x86_64_gnu 0.48.5",
+ "windows_x86_64_gnullvm 0.48.5",
+ "windows_x86_64_msvc 0.48.5",
+]
+
+[[package]]
+name = "windows-targets"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9b724f72796e036ab90c1021d4780d4d3d648aca59e491e6b98e725b84e99973"
+dependencies = [
+ "windows_aarch64_gnullvm 0.52.6",
+ "windows_aarch64_msvc 0.52.6",
+ "windows_i686_gnu 0.52.6",
+ "windows_i686_gnullvm",
+ "windows_i686_msvc 0.52.6",
+ "windows_x86_64_gnu 0.52.6",
+ "windows_x86_64_gnullvm 0.52.6",
+ "windows_x86_64_msvc 0.52.6",
+]
+
+[[package]]
+name = "windows_aarch64_gnullvm"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "2b38e32f0abccf9987a4e3079dfb67dcd799fb61361e53e2882c3cbaf0d905d8"
+
+[[package]]
+name = "windows_aarch64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32a4622180e7a0ec044bb555404c800bc9fd9ec262ec147edd5989ccd0c02cd3"
+
+[[package]]
+name = "windows_aarch64_msvc"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "dc35310971f3b2dbbf3f0690a219f40e2d9afcf64f9ab7cc1be722937c26b4bc"
+
+[[package]]
+name = "windows_aarch64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "09ec2a7bb152e2252b53fa7803150007879548bc709c039df7627cabbd05d469"
+
+[[package]]
+name = "windows_i686_gnu"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a75915e7def60c94dcef72200b9a8e58e5091744960da64ec734a6c6e9b3743e"
+
+[[package]]
+name = "windows_i686_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8e9b5ad5ab802e97eb8e295ac6720e509ee4c243f69d781394014ebfe8bbfa0b"
+
+[[package]]
+name = "windows_i686_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0eee52d38c090b3caa76c563b86c3a4bd71ef1a819287c19d586d7334ae8ed66"
+
+[[package]]
+name = "windows_i686_msvc"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8f55c233f70c4b27f66c523580f78f1004e8b5a8b659e05a4eb49d4166cca406"
+
+[[package]]
+name = "windows_i686_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "240948bc05c5e7c6dabba28bf89d89ffce3e303022809e73deaefe4f6ec56c66"
+
+[[package]]
+name = "windows_x86_64_gnu"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "53d40abd2583d23e4718fddf1ebec84dbff8381c07cae67ff7768bbf19c6718e"
+
+[[package]]
+name = "windows_x86_64_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "147a5c80aabfbf0c7d901cb5895d1de30ef2907eb21fbbab29ca94c5b08b1a78"
+
+[[package]]
+name = "windows_x86_64_gnullvm"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0b7b52767868a23d5bab768e390dc5f5c55825b6d30b86c844ff2dc7414044cc"
+
+[[package]]
+name = "windows_x86_64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "24d5b23dc417412679681396f2b49f3de8c1473deb516bd34410872eff51ed0d"
+
+[[package]]
+name = "windows_x86_64_msvc"
+version = "0.48.5"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ed94fce61571a4006852b7389a063ab983c02eb1bb37b47f8272ce92d06d9538"
+
+[[package]]
+name = "windows_x86_64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "589f6da84c646204747d1270a2a5661ea66ed1cced2631d546fdfb155959f9ec"
+
+[[package]]
+name = "wit-bindgen"
+version = "0.46.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "f17a85883d4e6d00e8a97c586de764dabcc06133f7f1d55dce5cdc070ad7fe59"
+
+[[package]]
+name = "wit-bindgen"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "d7249219f66ced02969388cf2bb044a09756a083d0fab1e566056b04d9fbcaa5"
+dependencies = [
+ "wit-bindgen-rust-macro",
+]
+
+[[package]]
+name = "wit-bindgen-core"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ea61de684c3ea68cb082b7a88508a8b27fcc8b797d738bfc99a82facf1d752dc"
+dependencies = [
+ "anyhow",
+ "heck",
+ "wit-parser",
+]
+
+[[package]]
+name = "wit-bindgen-rust"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "b7c566e0f4b284dd6561c786d9cb0142da491f46a9fbed79ea69cdad5db17f21"
+dependencies = [
+ "anyhow",
+ "heck",
+ "indexmap",
+ "prettyplease",
+ "syn",
+ "wasm-metadata",
+ "wit-bindgen-core",
+ "wit-component",
+]
+
+[[package]]
+name = "wit-bindgen-rust-macro"
+version = "0.51.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0c0f9bfd77e6a48eccf51359e3ae77140a7f50b1e2ebfe62422d8afdaffab17a"
+dependencies = [
+ "anyhow",
+ "prettyplease",
+ "proc-macro2",
+ "quote",
+ "syn",
+ "wit-bindgen-core",
+ "wit-bindgen-rust",
+]
+
+[[package]]
+name = "wit-component"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9d66ea20e9553b30172b5e831994e35fbde2d165325bec84fc43dbf6f4eb9cb2"
+dependencies = [
+ "anyhow",
+ "bitflags 2.11.0",
+ "indexmap",
+ "log",
+ "serde",
+ "serde_derive",
+ "serde_json",
+ "wasm-encoder",
+ "wasm-metadata",
+ "wasmparser",
+ "wit-parser",
+]
+
+[[package]]
+name = "wit-parser"
+version = "0.244.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "ecc8ac4bc1dc3381b7f59c34f00b67e18f910c2c0f50015669dde7def656a736"
+dependencies = [
+ "anyhow",
+ "id-arena",
+ "indexmap",
+ "log",
+ "semver",
+ "serde",
+ "serde_derive",
+ "serde_json",
+ "unicode-xid",
+ "wasmparser",
+]
+
+[[package]]
+name = "yjit"
+version = "0.1.0"
+dependencies = [
+ "capstone",
+ "jit",
+]
+
+[[package]]
+name = "zjit"
+version = "0.0.1"
+dependencies = [
+ "capstone",
+ "insta",
+ "jit",
+ "rand",
+ "yjit",
+]
diff --git a/Cargo.toml b/Cargo.toml
new file mode 100644
index 0000000000..33010e65fb
--- /dev/null
+++ b/Cargo.toml
@@ -0,0 +1,64 @@
+# This is the root Cargo [workspace](https://doc.rust-lang.org/cargo/reference/workspaces.html)
+# and the root package for all the rust code that are statically linked into ruby. Rust tooling
+# limitations means all Rust code need to share a single archive library (staticlib) at the
+# integration point with non-rust code. (See rustlang/rust#44322 and #104707 for a taste of
+# the linking challenges.)
+#
+# Do not add required dependencies. This is a policy that helps downstream consumers and give
+# us tight control over what we ship. All of the optional dependencies are used exclusively
+# during development.
+#
+# Release builds avoid Cargo entirely because offline builds can fail even when none of the
+# optional dependencies are built (rust-lang/cargo#10352).
+
+[workspace]
+members = ["zjit", "yjit", "jit"]
+
+[package]
+name = "ruby"
+version = "0.0.0"
+edition = "2024"
+rust-version = "1.85.0"
+publish = false # Don't publish to crates.io
+
+[dependencies]
+yjit = { path = "yjit", optional = true }
+zjit = { path = "zjit", optional = true }
+
+[lib]
+crate-type = ["staticlib"]
+path = "ruby.rs"
+
+[features]
+disasm = ["yjit?/disasm", "zjit?/disasm"]
+runtime_checks = ["yjit?/runtime_checks", "zjit?/runtime_checks"]
+yjit = [ "dep:yjit" ]
+zjit = [ "dep:zjit" ]
+
+[profile.dev]
+opt-level = 1 # On 0, functions use so much stack space that we get stray `SystemStackError`s
+debug = true
+debug-assertions = true
+overflow-checks = true
+
+[profile.test]
+inherits = "dev"
+opt-level = 0
+
+[profile.dev_nodebug]
+inherits = "dev"
+
+[profile.stats]
+inherits = "release"
+
+[profile.release]
+# NOTE: --enable-yjit and zjit builds use `rustc` without going through Cargo. You
+# might want to update the `rustc` invocation if you change this profile.
+opt-level = 3
+# The extra robustness that comes from checking for arithmetic overflow is
+# worth the performance cost for the compiler.
+overflow-checks = true
+# Generate debug info
+debug = true
+# Use ThinLTO. Much smaller output for a small amount of build time increase.
+lto = "thin"
diff --git a/LEGAL b/LEGAL
index 84eecccad3..2777aa2c14 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,160 +1,248 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
 
 All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
+[addr2line.c]
+
+  A part of this file is from FreeBSD.
 
-  These files are licensed under the CC0.
+  >>>
+    Copyright (c) 1986, 1988, 1991, 1993::
+    The Regents of the University of California.  All rights reserved.
 
-    https://creativecommons.org/choose/zero/
+    (c) UNIX System Laboratories, Inc.
 
-ccan/list/list.h
+    All or some portions of this file are derived from material licensed
+    to the University of California by American Telephone and Telegraph
+    Co. or Unix System Laboratories, Inc. and are reproduced herein with
+    the permission of UNIX System Laboratories, Inc.
 
-  This file is licensed under the MIT License.
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    4. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
 
-    Permission is hereby granted, free of charge, to any person obtaining a copy
-    of this software and associated documentation files (the "Software"), to deal
-    in the Software without restriction, including without limitation the rights
-    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-    copies of the Software, and to permit persons to whom the Software is
-    furnished to do so, subject to the following conditions:
+	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+  These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+  This file is licensed under the {MIT License}[rdoc-ref:@MIT+License].
+
+[coroutine]
+
+  Unless otherwise specified, these files are licensed under the
+  {MIT License}[rdoc-ref:@MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+  Onigmo (Oniguruma-mod) LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    Copyright (c) 2011-2014::  K.Takata  <kentkt AT csc DOT jp>
+    All rights reserved.
 
-    The above copyright notice and this permission notice shall be included in
-    all copies or substantial portions of the Software.
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
 
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
-    THE SOFTWARE.
-
-include/ruby/onigmo.h:
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Onigmo (Oniguruma-mod) LICENSE
-------------------------------
-
-/*-
- * Copyright (c) 2002-2009  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
- * Copyright (c) 2011-2014  K.Takata  <kentkt AT csc DOT jp>
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- *
- * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- */
-
-
-Oniguruma LICENSE
------------------
-
-/*-
- * Copyright (c) 2002-2009  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- *
- * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- */
-
-https://github.com/k-takata/Onigmo/
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
-   When this software is partly used or it is distributed with Ruby,
-   this of Ruby follows the license of Ruby.
-
-enc/trans/GB/GB12345%UCS.src:
-enc/trans/GB/UCS%GB12345.src:
-enc/trans/GB/GB2312%UCS.src:
-enc/trans/GB/UCS%GB2312.src:
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  Oniguruma LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
 
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  * https://github.com/k-takata/Onigmo/
+  * https://github.com/kkos/oniguruma
+  * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+    When this software is partly used or it is distributed with Ruby,
+    this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
+
+  >>>
+    Copyright (c) 2006-2007::  Byte      <byte AT mail DOT kna DOT ru>
+                               K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
+
+  >>>
+    Copyright (c) 2002-2007::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+  These files have this explanatory texts.
+
+  >>>
     This mapping data was created from files provided by Unicode, Inc.
     (The Unicode Consortium). The files were used to create a product supporting
     Unicode, as explicitly permitted in the files' copyright notices.
@@ -162,56 +250,82 @@ enc/trans/GB/UCS%GB2312.src:
     files for any particular purpose, and has ceased to publish the files many
     years ago.
 
-enc/trans/JIS/JISX0201-KANA%UCS.src:
-enc/trans/JIS/JISX0208@1990%UCS.src:
-enc/trans/JIS/JISX0212%UCS.src:
-enc/trans/JIS/UCS%JISX0201-KANA.src:
-enc/trans/JIS/UCS%JISX0208@1990.src:
-enc/trans/JIS/UCS%JISX0212.src:
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
 
+  These files are copyrighted as the following.
+
+  >>>
     © 2015 Unicode®, Inc.
+
     For terms of use, see http://www.unicode.org/terms_of_use.html
 
-enc/trans/JIS/JISX0213-1%UCS@BMP.src:
-enc/trans/JIS/JISX0213-1%UCS@SIP.src:
-enc/trans/JIS/JISX0213-2%UCS@BMP.src:
-enc/trans/JIS/JISX0213-2%UCS@SIP.src:
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    Copyright (C) 2006:: Project X0213, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
+
+  >>>
+    Copyright (C) 2001-2005:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
 
- 	Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- 	Copyright (C) 2001 I'O, All Rights Reserved.
- 	Copyright (C) 2006 Project X0213, All Rights Reserved.
- 	You can use, modify, distribute this table freely.
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
 
-enc/trans/JIS/UCS@BMP%JISX0213-1.src:
-enc/trans/JIS/UCS@BMP%JISX0213-2.src:
-enc/trans/JIS/UCS@SIP%JISX0213-1.src:
-enc/trans/JIS/UCS@SIP%JISX0213-2.src:
+  >>>
+    Copyright (C) 2001-2002:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
 
- 	Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- 	Copyright (C) 2001 I'O, All Rights Reserved.
- 	You can use, modify, distribute this table freely.
 
-configure:
+[configure]
 
   This file is free software.
 
-    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+  >>>
+    Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
 
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-tool/config.guess:
-tool/config.sub:
+[tool/config.guess]
+[tool/config.sub]
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
 
-      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
-      Free Software Foundation, Inc.
+  >>>
+    Copyright 1992-2018:: Free Software Foundation, Inc.
 
     This file is free software; you can redistribute it and/or modify it
     under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 2 of the License, or
+    the Free Software Foundation; either version 3 of the License, or
     (at your option) any later version.
 
     This program is distributed in the hope that it will be useful, but
@@ -220,54 +334,85 @@ tool/config.sub:
     General Public License for more details.
 
     You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+    along with this program; if not, see <https://www.gnu.org/licenses/>.
 
     As a special exception to the GNU General Public License, if you
     distribute this file as part of a program that contains a
     configuration script generated by Autoconf, you may include it under
-    the same distribution terms that you use for the rest of that program.
+    the same distribution terms that you use for the rest of that
+    program.  This Exception is an additional permission under section 7
+    of the GNU General Public License, version 3 ("GPLv3").
 
-parse.c:
+[tool/lib/test/*]
+[tool/lib/core_assertions.rb]
 
-  This file is licensed under the GPL, but is incorporated into Ruby and
+  Some of methods on these files are based on MiniTest 4. MiniTest 4 is
+  distributed under the MIT License.
+
+  >>>
+    Copyright (c) Ryan Davis, seattle.rb
+
+    Permission is hereby granted, free of charge, to any person obtaining
+    a copy of this software and associated documentation files (the
+    'Software'), to deal in the Software without restriction, including
+    without limitation the rights to use, copy, modify, merge, publish,
+    distribute, sublicense, and/or sell copies of the Software, and to
+    permit persons to whom the Software is furnished to do so, subject to
+    the following conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+    MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+    IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+    CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+    TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+    SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+[parse.c]
+[parse.h]
+
+  These files are licensed under the GPL, but are incorporated into Ruby and
   redistributed under the terms of the Ruby license, as permitted by the
   exception to the GPL below.
 
-     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
-     Free Software Foundation, Inc.
+  >>>
+    Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
 
-     This program is free software; you can redistribute it and/or modify
-     it under the terms of the GNU General Public License as published by
-     the Free Software Foundation; either version 2, or (at your option)
-     any later version.
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
 
-     This program is distributed in the hope that it will be useful,
-     but WITHOUT ANY WARRANTY; without even the implied warranty of
-     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-     GNU General Public License for more details.
+    You should have received a copy of the GNU General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
 
-     You should have received a copy of the GNU General Public License
-     along with this program; if not, write to the Free Software
-     Foundation, Inc., 51 Franklin Street, Fifth Floor,
-     Boston, MA 02110-1301, USA.  */
+    As a special exception, you may create a larger work that contains
+    part or all of the Bison parser skeleton and distribute that work
+    under terms of your choice, so long as that work isn't itself a
+    parser generator using the skeleton or a modified version thereof
+    as a parser skeleton.  Alternatively, if you modify or redistribute
+    the parser skeleton itself, you may (at your option) remove this
+    special exception, which will cause the skeleton and the resulting
+    Bison output files to be licensed under the GNU General Public
+    License without this special exception.
 
-  /* As a special exception, you may create a larger work that contains
-     part or all of the Bison parser skeleton and distribute that work
-     under terms of your choice, so long as that work isn't itself a
-     parser generator using the skeleton or a modified version thereof
-     as a parser skeleton.  Alternatively, if you modify or redistribute
-     the parser skeleton itself, you may (at your option) remove this
-     special exception, which will cause the skeleton and the resulting
-     Bison output files to be licensed under the GNU General Public
-     License without this special exception.
+    This special exception was added by the Free Software Foundation in
+    version 2.2 of Bison.
 
-     This special exception was added by the Free Software Foundation in
-     version 2.2 of Bison.  */
+[missing/dtoa.c]
 
-util.c (partly):
+  This file is under these licenses.
 
-    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+  >>>
+    Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
 
     Permission to use, copy, modify, and distribute this software for any
     purpose without fee is hereby granted, provided that this entire notice
@@ -280,71 +425,74 @@ util.c (partly):
     REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
     OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
 
-win32/win32.[ch]:
+  >>>
+    Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+                              All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
 
   You can apply the Artistic License to these files. (or GPL,
   alternatively)
 
-    Copyright (c) 1993, Intergraph Corporation
+  >>>
+    Copyright (c) 1993:: Intergraph Corporation
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
-util.c (partly):
-
-   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
-   All rights reserved.
-
-   Redistribution and use in source and binary forms, with or without
-   modification, are permitted provided that the following conditions
-   are met:
-   1. Redistributions of source code must retain the above copyright
-      notice, this list of conditions and the following disclaimer.
-   2. Redistributions in binary form must reproduce the above copyright
-      notice, this list of conditions and the following disclaimer in the
-      documentation and/or other materials provided with the distribution.
-
-   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-   SUCH DAMAGE.
-
-random.c
+[missing/mt19937.c]
 
   This file is under the new-style BSD license.
 
-    A C-program for MT19937, with initialization improved 2002/2/10.
+  >>>
+    A C-program for MT19937, with initialization improved 2002/2/10.::
     Coded by Takuji Nishimura and Makoto Matsumoto.
+
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
     Before using, initialize the state by using init_genrand(seed)
     or init_by_array(init_key, key_length).
 
-    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
-    All rights reserved.
+    Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+                                All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
     are met:
 
-      1. Redistributions of source code must retain the above copyright
-	 notice, this list of conditions and the following disclaimer.
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
 
-      2. Redistributions in binary form must reproduce the above copyright
-	 notice, this list of conditions and the following disclaimer in the
-	 documentation and/or other materials provided with the distribution.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
 
-      3. The names of its contributors may not be used to endorse or promote
-	 products derived from this software without specific prior written
-	 permission.
+    3. The names of its contributors may not be used to endorse or promote
+       products derived from this software without specific prior written
+       permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
     "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -363,12 +511,15 @@ random.c
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
-vm_dump.c:procstat_vm
+  The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
+
+[missing/procstat_vm.c]
 
   This file is under the new-style BSD license.
 
-    Copyright (c) 2007 Robert N. M. Watson
-    All rights reserved.
+  >>>
+    Copyright (c) 2007:: Robert N. M. Watson
+                         All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -393,146 +544,65 @@ vm_dump.c:procstat_vm
 
     $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
 
-vsnprintf.c:
+[vsnprintf.c]
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
 
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
+  >>>
+    Copyright (c) 1990, 1993::
+    The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Chris Torek.
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
-
-st.c:
-strftime.c:
-include/ruby/st.h:
-missing/acosh.c:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/lgamma_r.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strerror.c:
-missing/strstr.c:
-missing/tgamma.c:
-ext/date/date_strftime.c:
-ext/digest/sha1/sha1.[ch]:
-ext/sdbm/_sdbm.c:
-ext/sdbm/sdbm.h:
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/erf.c]
+[missing/hypot.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
 
   These files are all under public domain.
 
-missing/crypt.c:
+[missing/crypt.c]
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
 
-    Copyright (c) 1989, 1993
-    	The Regents of the University of California.  All rights reserved.
+  >>>
+    Copyright (c) 1989, 1993::
+    The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Tom Truscott.
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+[missing/setproctitle.c]
 
-missing/setproctitle.c
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  >>>
+    Copyright 2003:: Damien Miller
+    Copyright (c) 1983, 1995-1997:: Eric P. Allman
+    Copyright (c) 1988, 1993::
+    The Regents of the University of California.  All rights reserved.
 
-    Copyright 2003 Damien Miller
-    Copyright (c) 1983, 1995-1997 Eric P. Allman
-    Copyright (c) 1988, 1993
-    	The Regents of the University of California.  All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-missing/strlcat.c
-missing/strlcpy.c
+[missing/strlcat.c]
+[missing/strlcpy.c]
 
   These files are under an ISC-style license.
 
-    Copyright (c) 1998, 2015 Todd C. Miller <Todd.Miller@courtesan.com>
+  >>>
+    Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
 
     Permission to use, copy, modify, and distribute this software for any
     purpose with or without fee is hereby granted, provided that the above
@@ -546,23 +616,26 @@ missing/strlcpy.c
     ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
     OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
 
-missing/langinfo.c
+[missing/langinfo.c]
 
   This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
   Ruby uses a modified version. The file contains the following
   author/copyright notice:
 
-  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
-  Permission to use, copy, modify, and distribute this software
-  for any purpose and without fee is hereby granted. The author
-  disclaims all warranties with regard to this software.
+  >>>
+    Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+    Permission to use, copy, modify, and distribute this software
+    for any purpose and without fee is hereby granted. The author
+    disclaims all warranties with regard to this software.
 
-ext/digest/md5/md5.[ch]:
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
 
   These files are under the following license.  Ruby uses modified
   versions of them.
 
-    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
+  >>>
+    Copyright (C) 1999, 2000:: Aladdin Enterprises.  All rights reserved.
 
     This software is provided 'as-is', without any express or implied
     warranty.  In no event will the authors be held liable for any damages
@@ -583,23 +656,27 @@ ext/digest/md5/md5.[ch]:
     L. Peter Deutsch
     ghost@aladdin.com
 
-ext/digest/rmd160/rmd160.[ch]:
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
 
   These files have the following copyright information, and by the
   author we are allowed to use it under the new-style BSD license.
 
-    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
+  >>>
+    AUTHOR::  Antoon Bosselaers, ESAT-COSIC
               (Arranged for libc by Todd C. Miller)
-    DATE:     1 March 1996
+    DATE::    1 March 1996
 
-    Copyright (c) Katholieke Universiteit Leuven
+    Copyright (c):: Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-ext/digest/sha2/sha2.[ch]:
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
 
   These files are under the new-style BSD license.
 
-    Copyright 2000 Aaron D. Gifford.  All rights reserved.
+  >>>
+    Copyright 2000:: Aaron D. Gifford.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -625,96 +702,71 @@ ext/digest/sha2/sha2.[ch]:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/json/generator/generator.c:
-
-    Copyright 2001-2004 Unicode, Inc.
-
-    Disclaimer
-
-    This source code is provided as is by Unicode, Inc. No claims are
-    made as to fitness for any particular purpose. No warranties of any
-    kind are expressed or implied. The recipient agrees to determine
-    applicability of information provided. If this file has been
-    purchased on magnetic or optical media from Unicode, Inc., the
-    sole remedy for any claim will be exchange of defective media
-    within 90 days of receipt.
-
-    Limitations on Rights to Redistribute This Code
-
-    Unicode, Inc. hereby grants the right to freely use the information
-    supplied in this file in the creation of products supporting the
-    Unicode Standard, and to make copies of this file in any form
-    for internal or external distribution as long as this notice
-    remains attached.
-
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
-
-  These files are under the following license.  So to speak, it is
-  copyrighted semi-public-domain software.
-
-    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
-       Everyone is permitted to do anything on this program
-       including copying, modifying, improving,
-       as long as you don't try to pretend that you wrote it.
-       i.e., the above copyright notice has to appear in all copies.
-       Binary distribution requires original version messages.
-       You don't have to ask before copying, redistribution or publishing.
-       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
-
-ext/psych:
-test/psych:
-
-  Copyright 2009 Aaron Patterson, et al.
-
-  Permission is hereby granted, free of charge, to any person obtaining a copy of
-  this software and associated documentation files (the 'Software'), to deal in
-  the Software without restriction, including without limitation the rights to
-  use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
-  of the Software, and to permit persons to whom the Software is furnished to do
-  so, subject to the following conditions:
-
-  The above copyright notice and this permission notice shall be included in all
-  copies or substantial portions of the Software.
-
-  THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-  IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-  FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-  AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-  LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-  OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-  SOFTWARE.
-
-ext/psych/yaml:
-
-  Copyright (c) 2006 Kirill Simonov
-
-  Permission is hereby granted, free of charge, to any person obtaining a copy of
-  this software and associated documentation files (the "Software"), to deal in
-  the Software without restriction, including without limitation the rights to
-  use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
-  of the Software, and to permit persons to whom the Software is furnished to do
-  so, subject to the following conditions:
-
-  The above copyright notice and this permission notice shall be included in all
-  copies or substantial portions of the Software.
-
-  THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-  IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-  FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-  AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-  LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-  OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-  SOFTWARE.
-
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+[ext/json/vendor/fpconv.c]
+
+  This file is under the {Boost Software License}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/json/vendor/jeaiii-ltoa.h]
+
+  >>>
+    Copyright (c) 2024,2025 Enrico Thierbach - https://github.com/radiospiel
+    Copyright (c) 2022 James Edward Anhalt III - https://github.com/jeaiii/itoa
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[ext/json/vendor/ryu.h]
+  This file is adapted from the Ryu algorithm by Ulf Adams https://github.com/ulfjack/ryu.
+  It is dual-licensed under {Apache License 2.0}[rdoc-ref:@Apache+License+2.0] OR
+  {Boost Software License 1.0}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/psych]
+[test/psych]
+
+  The files under these directories are under the following license.
+
+  >>>
+    Copyright 2009:: Aaron Patterson, et al.
+
+    Permission is hereby granted, free of charge, to any person obtaining a copy of
+    this software and associated documentation files (the 'Software'), to deal in
+    the Software without restriction, including without limitation the rights to
+    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+    of the Software, and to permit persons to whom the Software is furnished to do
+    so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in all
+    copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+    SOFTWARE.
+
+[ext/pty/pty.c]
+
+  >>>
+    C) Copyright 1998:: by Akinori Ito.
+
+    This software may be redistributed freely for this purpose, in full
+    or in part, provided that this entire copyright notice is included
+    on any copies of this software and applications and derivations thereof.
+
+    This software is provided on an "as is" basis, without warranty of any
+    kind, either expressed or implied, as to any matter including, but not
+    limited to warranty of fitness of purpose, or merchantability, or
+    results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
 
   These files are under the new-style BSD license.
 
-    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+  >>>
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
     All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
@@ -741,31 +793,35 @@ ext/socket/getnameinfo.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/win32ole/win32ole.c:
+[ext/win32ole/win32ole.c]
 
   You can apply the Artistic License to this file. (or GPL,
   alternatively)
 
-    (c) 1995 Microsoft Corporation. All rights reserved.
+  >>>
+    (c) 1995:: Microsoft Corporation. All rights reserved.
     Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
 
-    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+    Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the README file
     of the Perl distribution.
 
-lib/rdoc/generator/template/darkfish/css/fonts.css:
+  The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
 
-  This file is licensed under the SIL Open Font License.
+  This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
 
-    http://scripts.sil.org/OFL
+[spec/mspec]
+[spec/ruby]
 
-spec/mspec:
-spec/ruby:
+  The files under these directories are under the following license.
 
-    Copyright (c) 2008 Engine Yard, Inc. All rights reserved.
+  >>>
+    Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
 
     Permission is hereby granted, free of charge, to any person
     obtaining a copy of this software and associated documentation
@@ -788,89 +844,457 @@ spec/ruby:
     FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
     OTHER DEALINGS IN THE SOFTWARE.
 
-lib/rubygems.rb:
-lib/rubygems:
-test/rubygems:
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+  RubyGems is under the following license.
+
+  >>>
+    RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+    Weirich and others.  You can redistribute it and/or modify it under
+    either the terms of the {MIT license}[rdoc-ref:@MIT+License], or the conditions
+    below:
+
+    1. You may make and give away verbatim copies of the source form of the
+       software without restriction, provided that you duplicate all of the
+       original copyright notices and associated disclaimers.
+
+    2. You may modify your copy of the software in any way, provided that
+       you do at least ONE of the following:
+
+       a. place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+          modifications to Usenet or an equivalent medium, or by allowing
+          the author to include your modifications in the software.
+
+       b. use the modified software only within your corporation or
+          organization.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    3. You may distribute the software in object code or executable
+       form, provided that you do at least ONE of the following:
+
+       a. distribute the executables and library files of the software,
+          together with instructions (in the manual page or equivalent)
+          on where to get the original distribution.
+
+       b. accompany the distribution with the machine-readable source of
+          the software.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    4. You may modify and include the part of the software into any other
+       software (possibly commercial).
+
+    5. The scripts and library files supplied as input to or produced as
+       output from the software do not automatically fall under the
+       copyright of the software, but belong to whomever generated them,
+       and may be sold commercially, and may be aggregated with this
+       software.
+
+    6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+       IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+       WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+       PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[spec/bundler]
 
-  RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
-  Weirich and others.  You can redistribute it and/or modify it under
-  either the terms of the MIT license (see the file MIT.txt), or the
-  conditions below:
+  Bundler is under the following license.
 
-  1. You may make and give away verbatim copies of the source form of the
-     software without restriction, provided that you duplicate all of the
-     original copyright notices and associated disclaimers.
+  >>>
+    Portions copyright (c) 2010:: Andre Arko
+    Portions copyright (c) 2009:: Engine Yard
 
-  2. You may modify your copy of the software in any way, provided that
-     you do at least ONE of the following:
+    {MIT License}[rdoc-ref:@MIT+License]
 
-     a. place your modifications in the Public Domain or otherwise
-        make them Freely Available, such as by posting said
-        modifications to Usenet or an equivalent medium, or by allowing
-        the author to include your modifications in the software.
+[lib/bundler/vendor/thor]
 
-     b. use the modified software only within your corporation or
-        organization.
+  Thor is under the following license.
 
-     c. give non-standard executables non-standard names, with
-        instructions on where to get the original software distribution.
+  >>>
+    Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
 
-     d. make other distribution arrangements with the author.
+    {MIT License}[rdoc-ref:@MIT+License]
 
-  3. You may distribute the software in object code or executable
-     form, provided that you do at least ONE of the following:
+[lib/rubygems/vendor/molinillo]
 
-     a. distribute the executables and library files of the software,
-        together with instructions (in the manual page or equivalent)
-        on where to get the original distribution.
+  molinillo is under the following license.
 
-     b. accompany the distribution with the machine-readable source of
-        the software.
+  >>>
+    Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
 
-     c. give non-standard executables non-standard names, with
-        instructions on where to get the original software distribution.
+    {MIT License}[rdoc-ref:@MIT+License]
 
-     d . make other distribution arrangements with the author.
+[lib/bundler/vendor/pub_grub]
 
-  4. You may modify and include the part of the software into any other
-     software (possibly commercial).
+  pub_grub is under the following license.
 
-  5. The scripts and library files supplied as input to or produced as
-     output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them,
-     and may be sold commercially, and may be aggregated with this
-     software.
+  >>>
+    Copyright (c) 2018 John Hawthorn
 
-  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-     PURPOSE.
+    {MIT License}[rdoc-ref:@MIT+License]
 
-lib/bundler:
-lib/bundler.rb:
-lib/bundler.gemspec:
-spec/bundler:
+[lib/bundler/vendor/connection_pool]
 
-  Portions copyright (c) 2010 Andre Arko
-  Portions copyright (c) 2009 Engine Yard
+  connection_pool is under the following license.
 
-  MIT License
+  >>>
+    Copyright (c) 2011 Mike Perham
 
-  Permission is hereby granted, free of charge, to any person obtaining
-  a copy of this software and associated documentation files (the
-  "Software"), to deal in the Software without restriction, including
-  without limitation the rights to use, copy, modify, merge, publish,
-  distribute, sublicense, and/or sell copies of the Software, and to
-  permit persons to whom the Software is furnished to do so, subject to
-  the following conditions:
+    {MIT License}[rdoc-ref:@MIT+License]
 
-  The above copyright notice and this permission notice shall be
-  included in all copies or substantial portions of the Software.
+[lib/bundler/vendor/net-http-persistent]
 
-  THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-  EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-  MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-  NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
-  LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
-  OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
-  WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+  net-http-persistent is under the following license.
+
+  >>>
+    Copyright (c) Eric Hodel, Aaron Patterson
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+  did_you_mean is under the following license.
+
+  >>>
+    Copyright (c) 2014-2016 Yuki Nishijima
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/error_highlight]
+[lib/error_highlight.rb]
+[test/error_highlight]
+
+  error_highlight is under the following license.
+
+  >>>
+    Copyright (c) 2021 Yusuke Endoh
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+  These files are very old copy of then-called "The Great Computer Language
+  Shootout".  LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+  site has been lost.  Upstream diverged to delete several benchmarks listed
+  above.
+
+== MIT License
+>>>
+      Permission is hereby granted, free of charge, to any person obtaining
+      a copy of this software and associated documentation files (the
+      "Software"), to deal in the Software without restriction, including
+      without limitation the rights to use, copy, modify, merge, publish,
+      distribute, sublicense, and/or sell copies of the Software, and to
+      permit persons to whom the Software is furnished to do so, subject to
+      the following conditions:
+
+      The above copyright notice and this permission notice shall be
+      included in all copies or substantial portions of the Software.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+      EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+      MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+      NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+      LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+      OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+      WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+      Redistribution and use in source and binary forms, with or without
+      modification, are permitted provided that the following conditions
+      are met:
+      1. Redistributions of source code must retain the above copyright
+         notice, this list of conditions and the following disclaimer.
+      2. Redistributions in binary form must reproduce the above copyright
+         notice, this list of conditions and the following disclaimer in the
+         documentation and/or other materials provided with the distribution.
+      3. Neither the name of the University nor the names of its contributors
+         may be used to endorse or promote products derived from this software
+         without specific prior written permission.
+
+      THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+      ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+      IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+      ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+      FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+      DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+      OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+      HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+      LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+      OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+      SUCH DAMAGE.
+
+      IMPORTANT NOTE::
+
+      From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+      paragraph 3 above is now null and void.
+
+== Boost Software License 1.0
+
+>>>
+      Boost Software License - Version 1.0 - August 17th, 2003
+
+      Permission is hereby granted, free of charge, to any person or organization
+      obtaining a copy of the software and accompanying documentation covered by
+      this license (the "Software") to use, reproduce, display, distribute,
+      execute, and transmit the Software, and to prepare derivative works of the
+      Software, and to permit third-parties to whom the Software is furnished to
+      do so, all subject to the following:
+
+      The copyright notices in the Software and this entire statement, including
+      the above license grant, this restriction and the following disclaimer,
+      must be included in all copies of the Software, in whole or in part, and
+      all derivative works of the Software, unless such copies or derivative
+      works are solely in the form of machine-executable object code generated by
+      a source language processor.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+      IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+      FITNESS FOR A PARTICULAR PURPOSE, TITLE AND NON-INFRINGEMENT. IN NO EVENT
+      SHALL THE COPYRIGHT HOLDERS OR ANYONE DISTRIBUTING THE SOFTWARE BE LIABLE
+      FOR ANY DAMAGES OR OTHER LIABILITY, WHETHER IN CONTRACT, TORT OR OTHERWISE,
+      ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
+      DEALINGS IN THE SOFTWARE.
+
+== Apache License 2.0
+
+>>>
+      Apache License
+      Version 2.0, January 2004
+      http://www.apache.org/licenses/
+
+      TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
+
+      1. Definitions.
+
+         "License" shall mean the terms and conditions for use, reproduction,
+         and distribution as defined by Sections 1 through 9 of this document.
+
+         "Licensor" shall mean the copyright owner or entity authorized by
+         the copyright owner that is granting the License.
+
+         "Legal Entity" shall mean the union of the acting entity and all
+         other entities that control, are controlled by, or are under common
+         control with that entity. For the purposes of this definition,
+         "control" means (i) the power, direct or indirect, to cause the
+         direction or management of such entity, whether by contract or
+         otherwise, or (ii) ownership of fifty percent (50%) or more of the
+         outstanding shares, or (iii) beneficial ownership of such entity.
+
+         "You" (or "Your") shall mean an individual or Legal Entity
+         exercising permissions granted by this License.
+
+         "Source" form shall mean the preferred form for making modifications,
+         including but not limited to software source code, documentation
+         source, and configuration files.
+
+         "Object" form shall mean any form resulting from mechanical
+         transformation or translation of a Source form, including but
+         not limited to compiled object code, generated documentation,
+         and conversions to other media types.
+
+         "Work" shall mean the work of authorship, whether in Source or
+         Object form, made available under the License, as indicated by a
+         copyright notice that is included in or attached to the work
+         (an example is provided in the Appendix below).
+
+         "Derivative Works" shall mean any work, whether in Source or Object
+         form, that is based on (or derived from) the Work and for which the
+         editorial revisions, annotations, elaborations, or other modifications
+         represent, as a whole, an original work of authorship. For the purposes
+         of this License, Derivative Works shall not include works that remain
+         separable from, or merely link (or bind by name) to the interfaces of,
+         the Work and Derivative Works thereof.
+
+         "Contribution" shall mean any work of authorship, including
+         the original version of the Work and any modifications or additions
+         to that Work or Derivative Works thereof, that is intentionally
+         submitted to Licensor for inclusion in the Work by the copyright owner
+         or by an individual or Legal Entity authorized to submit on behalf of
+         the copyright owner. For the purposes of this definition, "submitted"
+         means any form of electronic, verbal, or written communication sent
+         to the Licensor or its representatives, including but not limited to
+         communication on electronic mailing lists, source code control systems,
+         and issue tracking systems that are managed by, or on behalf of, the
+         Licensor for the purpose of discussing and improving the Work, but
+         excluding communication that is conspicuously marked or otherwise
+         designated in writing by the copyright owner as "Not a Contribution."
+
+         "Contributor" shall mean Licensor and any individual or Legal Entity
+         on behalf of whom a Contribution has been received by Licensor and
+         subsequently incorporated within the Work.
+
+      2. Grant of Copyright License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         copyright license to reproduce, prepare Derivative Works of,
+         publicly display, publicly perform, sublicense, and distribute the
+         Work and such Derivative Works in Source or Object form.
+
+      3. Grant of Patent License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         (except as stated in this section) patent license to make, have made,
+         use, offer to sell, sell, import, and otherwise transfer the Work,
+         where such license applies only to those patent claims licensable
+         by such Contributor that are necessarily infringed by their
+         Contribution(s) alone or by combination of their Contribution(s)
+         with the Work to which such Contribution(s) was submitted. If You
+         institute patent litigation against any entity (including a
+         cross-claim or counterclaim in a lawsuit) alleging that the Work
+         or a Contribution incorporated within the Work constitutes direct
+         or contributory patent infringement, then any patent licenses
+         granted to You under this License for that Work shall terminate
+         as of the date such litigation is filed.
+
+      4. Redistribution. You may reproduce and distribute copies of the
+         Work or Derivative Works thereof in any medium, with or without
+         modifications, and in Source or Object form, provided that You
+         meet the following conditions:
+
+         a.  You must give any other recipients of the Work or
+             Derivative Works a copy of this License; and
+
+         b.  You must cause any modified files to carry prominent notices
+             stating that You changed the files; and
+
+         c.  You must retain, in the Source form of any Derivative Works
+             that You distribute, all copyright, patent, trademark, and
+             attribution notices from the Source form of the Work,
+             excluding those notices that do not pertain to any part of
+             the Derivative Works; and
+
+         d.  If the Work includes a "NOTICE" text file as part of its
+             distribution, then any Derivative Works that You distribute must
+             include a readable copy of the attribution notices contained
+             within such NOTICE file, excluding those notices that do not
+             pertain to any part of the Derivative Works, in at least one
+             of the following places: within a NOTICE text file distributed
+             as part of the Derivative Works; within the Source form or
+             documentation, if provided along with the Derivative Works; or,
+             within a display generated by the Derivative Works, if and
+             wherever such third-party notices normally appear. The contents
+             of the NOTICE file are for informational purposes only and
+             do not modify the License. You may add Your own attribution
+             notices within Derivative Works that You distribute, alongside
+             or as an addendum to the NOTICE text from the Work, provided
+             that such additional attribution notices cannot be construed
+             as modifying the License.
+
+         You may add Your own copyright statement to Your modifications and
+         may provide additional or different license terms and conditions
+         for use, reproduction, or distribution of Your modifications, or
+         for any such Derivative Works as a whole, provided Your use,
+         reproduction, and distribution of the Work otherwise complies with
+         the conditions stated in this License.
+
+      5. Submission of Contributions. Unless You explicitly state otherwise,
+         any Contribution intentionally submitted for inclusion in the Work
+         by You to the Licensor shall be under the terms and conditions of
+         this License, without any additional terms or conditions.
+         Notwithstanding the above, nothing herein shall supersede or modify
+         the terms of any separate license agreement you may have executed
+         with Licensor regarding such Contributions.
+
+      6. Trademarks. This License does not grant permission to use the trade
+         names, trademarks, service marks, or product names of the Licensor,
+         except as required for reasonable and customary use in describing the
+         origin of the Work and reproducing the content of the NOTICE file.
+
+      7. Disclaimer of Warranty. Unless required by applicable law or
+         agreed to in writing, Licensor provides the Work (and each
+         Contributor provides its Contributions) on an "AS IS" BASIS,
+         WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
+         implied, including, without limitation, any warranties or conditions
+         of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A
+         PARTICULAR PURPOSE. You are solely responsible for determining the
+         appropriateness of using or redistributing the Work and assume any
+         risks associated with Your exercise of permissions under this License.
+
+      8. Limitation of Liability. In no event and under no legal theory,
+         whether in tort (including negligence), contract, or otherwise,
+         unless required by applicable law (such as deliberate and grossly
+         negligent acts) or agreed to in writing, shall any Contributor be
+         liable to You for damages, including any direct, indirect, special,
+         incidental, or consequential damages of any character arising as a
+         result of this License or out of the use or inability to use the
+         Work (including but not limited to damages for loss of goodwill,
+         work stoppage, computer failure or malfunction, or any and all
+         other commercial damages or losses), even if such Contributor
+         has been advised of the possibility of such damages.
+
+      9. Accepting Warranty or Additional Liability. While redistributing
+         the Work or Derivative Works thereof, You may choose to offer,
+         and charge a fee for, acceptance of support, warranty, indemnity,
+         or other liability obligations and/or rights consistent with this
+         License. However, in accepting such obligations, You may act only
+         on Your own behalf and on Your sole responsibility, not on behalf
+         of any other Contributor, and only if You agree to indemnify,
+         defend, and hold each Contributor harmless for any liability
+         incurred by, or claims asserted against, such Contributor by reason
+         of your accepting any such warranty or additional liability.
+
+      END OF TERMS AND CONDITIONS
+
+      APPENDIX: How to apply the Apache License to your work.
+
+      >>>
+         To apply the Apache License to your work, attach the following
+         boilerplate notice, with the fields enclosed by brackets "[]"
+         replaced with your own identifying information. (Don't include
+         the brackets!)  The text should be enclosed in the appropriate
+         comment syntax for the file format. We also recommend that a
+         file or class name and description of purpose be included on the
+         same "printed page" as the copyright notice for easier
+         identification within third-party archives.
+
+      Copyright [yyyy] [name of copyright owner]
+
+      Licensed under the Apache License, Version 2.0 (the "License");
+      you may not use this file except in compliance with the License.
+      You may obtain a copy of the License at
+
+          http://www.apache.org/licenses/LICENSE-2.0
+
+      Unless required by applicable law or agreed to in writing, software
+      distributed under the License is distributed on an "AS IS" BASIS,
+      WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+      See the License for the specific language governing permissions and
+      limitations under the License.
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 0ae2abba3d..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,531 +0,0 @@
-SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
-
-CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
-PURIFY =
-AUTOCONF = autoconf
-ACLOCAL = aclocal
-CONFIGURE = @CONFIGURE@
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
-
-empty =
-CC_VERSION = @CC_VERSION@
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-ENABLE_SHARED = @ENABLE_SHARED@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
-SOLIBS = @SOLIBS@
-ENABLE_DEBUG_ENV = @ENABLE_DEBUG_ENV@
-MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
-RUBY_API_VERSION=@RUBY_API_VERSION@
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
-	$(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
-	$(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
-
-#### End of system configuration section. ####
-
-MAJOR=	@MAJOR@
-MINOR=	@MINOR@
-TEENY=	@TEENY@
-RUBY_PROGRAM_VERSION = @RUBY_PROGRAM_VERSION@
-
-LIBRUBY_A     = @LIBRUBY_A@
-LIBRUBY_SO    = @LIBRUBY_SO@
-LIBRUBY_SONAME= @LIBRUBY_SONAME@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY	      = @LIBRUBY@
-LIBRUBYARG    = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
-			eval.$(OBJEXT) \
-			gc.$(OBJEXT) \
-			hash.$(OBJEXT) \
-			load.$(OBJEXT) \
-			object.$(OBJEXT) \
-			parse.$(OBJEXT) \
-			string.$(OBJEXT) \
-			symbol.$(OBJEXT) \
-			vm.$(OBJEXT)
-
-THREAD_MODEL  = @THREAD_MODEL@
-
-PREP          = @PREP@
-ARCHFILE      = @ARCHFILE@
-SETUP         =
-EXTSTATIC     = @EXTSTATIC@
-ENCSTATIC     = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS      = @MKDIR_P@
-CP            = cp
-MV            = mv
-RM            = rm -f
-RMDIR         = @RMDIR@
-RMDIRS        = @RMDIRS@
-RMALL         = @RMALL@
-NM            = @NM@
-AR            = @AR@
-ARFLAGS       = @ARFLAGS@$(empty)
-RANLIB        = @RANLIB@
-AS            = @AS@
-ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE      = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP       = @OBJDUMP@
-OBJCOPY       = @OBJCOPY@
-HAVE_GIT      = @HAVE_GIT@
-GIT           = @GIT@
-VCS           = @VCS@
-VCSUP         = @VCSUP@
-DTRACE        = @DTRACE@ @DTRACE_OPT@
-DTRACE_EXT    = @DTRACE_EXT@
-DTRACE_OBJ    = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
-
-OBJEXT        = @OBJEXT@
-ASMEXT        = S
-SOEXT         = @SOEXT@
-DLEXT         = @DLEXT@
-MANTYPE	      = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C     = enc/trans/newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C     = prelude.c
-RBCONFIG      = .rbconfig.time
-
-MAINSRC = $(MAINOBJ:@OBJEXT@=c)
-
-SRC_FILE      = $<
-OS_SRC_FILE   = $<
-DEST_FILE     = $@
-OS_DEST_FILE  = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
-
-DESTDIR       = @DESTDIR@
-
-configure_args = @configure_args@
-#### End of variables
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-all:
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
-		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
-		$(Q) $(POSTLINK)
-
-$(PROGRAM):
-		@$(RM) $@
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
-		$(Q) $(POSTLINK)
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
-		@$(RM) $@
-		$(ECHO) linking static-library $@
-		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
-		@-$(RANLIB) $@ 2> /dev/null || true
-
-verify-static-library: $(LIBRUBY_A)
-		$(ECHO) verifying static-library $@
-		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
-		@$(RMALL) conftest$(EXEEXT) conftest.c conftest.dSYM
-
-$(LIBRUBY_SO):
-		@-$(PRE_LIBRUBY_UPDATE)
-		$(ECHO) linking shared-library $@
-		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
-		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
-			-L '$(SYMBOL_PREFIX)*_threadptr_*' -L '$(SYMBOL_PREFIX)*_ec_*' $@
-		$(Q) $(POSTLINK)
-		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
-						  File.symlink "$(LIBRUBY_SO)", link}' \
-				$(LIBRUBY_ALIASES) || true
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
-		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-ruby-runner.h: template/ruby-runner.h.in
-		@./config.status --file=$@:$(srcdir)/template/$(@F).in
-
-$(RBCONFIG): $(PREP)
-
-rbconfig.rb: $(RBCONFIG)
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
-	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
-	$(ECHO) installing cross-compiling stuff
-	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
-	$(Q) $(BASERUBY) -p \
-	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
-	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
-	rbconfig.rb > fake-rbconfig.rb
-	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
-	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
-	@$(RM) fake.rb fake-rbconfig.rb
-	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
-	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
-	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
-		@[ -f $@ ] && mv $@ $@.old
-		MAKE=$(MAKE) $(SHELL) ./config.status $@
-		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
-		{ \
-		    echo "all:; -@rm -f conftest.mk"; \
-		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
-		    echo ".force:"; \
-		} > conftest.mk || exit 1; \
-		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
-		{ echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
-		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
-			$(srcdir)/include/ruby/version.h
-	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
-	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/$(CONFIGURE): $(srcdir)/configure.ac $(srcdir)/aclocal.m4
-	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
-
-$(srcdir)/aclocal.m4:
-	$(CHDIR) $(srcdir) && \
-	type $(ACLOCAL) >/dev/null 2>&1 && exec $(ACLOCAL); \
-	touch $(@F)
-
-prereq: $(srcdir)/$(CONFIGURE)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
-	@\
-	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
-	  [ $(Q) ] && echo copying $@ || set -x; \
-	  $(CP) $(srcdir)/lex.c.blt $@; \
-	else \
-	  [ $(Q) ] && echo generating $@ || set -x; \
-	  gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
-	  | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
-	  > $@.tmp && \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(srcdir)/defs/lex.c.src && \
-	  $(CP) $@ $(srcdir)/lex.c.blt; \
-	fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-$(srcdir)/enc/jis/props.h: enc/jis/props.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  set -x; \
-	  gperf $(JIS_PROPS_OPTIONS) $? | \
-	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
-
-.c.@OBJEXT@:
-	@$(ECHO) compiling $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
-	@$(ECHO) assembling $<
-	$(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
-	@$(ECHO) translating $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
-	@$(ECHO) preprocessing $<
-	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
-	@$(ECHO) translating probes $<
-	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
-	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
-	$(Q) $(RM) $@.tmp
-
-.dmyh.h:
-	@$(ECHO) making dummy $(DEST_FILE)
-	$(Q)echo '#include "$(*F).dmyh"' > $@
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
-	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
-	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
-	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
-	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
-	fi
-	$(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
-	@$(ECHO) processing probes in object files
-	$(Q) $(RM) $@
-	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
-	@$(ECHO) generating a glommed object with DTrace probes for static library
-	$(Q) $(LD) -r -o $@ $(OBJS)
-
-clean-local::
-	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
-		enc/encinit.c enc/encinit.$(OBJEXT)
-	-$(Q)$(RM) $(pkgconfig_DATA)
-	-$(Q)$(RMALL) exe/ ruby-runner.h *.dSYM
-
-distclean-local::
-	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
-	-$(Q)$(RM) run.gdb
-	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
-	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-ext/clean.sub gems/clean.sub:: ext/clean.mk
-ext/distclean.sub gems/distclean.sub:: ext/distclean.mk
-ext/realclean.sub gems/realclean.sub:: ext/realclean.mk
-
-ext/clean.mk ext/distclean.mk ext/realclean.mk::
-	-$(Q) if [ -f $(EXTS_MK) ]; then exec $(MAKE) -f $(EXTS_MK) $(@F:.mk=); fi
-
-ext/clean:: ext/clean.sub
-ext/distclean:: ext/distclean.sub
-ext/realclean:: ext/realclean.sub
-gems/clean:: gems/clean.sub
-gems/distclean:: gems/distclean.sub
-gems/realclean:: gems/realclean.sub
-
-ext/clean.sub ext/distclean.sub ext/realclean.sub \
-gems/clean.sub gems/distclean.sub gems/realclean.sub::
-	$(Q) set dummy `echo "${EXTS}" | tr , ' '`; shift; \
-	test "$$#" = 0 && set .; \
-	set dummy `\
-	    cd $(@D) 2>/dev/null && \
-	    find "$$@" \( -name Makefile -o -name exts.mk \) -print | \
-	    sed -n 's:^\./::;s:^:$(@D)/:;s:/[^/][^/]*$$::p' | sort -u; \
-	`; shift; \
-	for dir do \
-	    $(RM) "$$dir/exts.mk"; \
-	    if [ -f "$$dir/Makefile" ]; then \
-		echo $(@F:.sub=)ing "$$dir"; \
-		(cd "$$dir" && exec $(MAKE) $(mflags) $(@F:.sub=)); \
-	    fi; \
-	done || true
-
-ext/distclean ext/realclean gems/distclean gems/realclean::
-	$(Q) set dummy `echo "${EXTS}" | tr , ' '`; shift; \
-	test "$$#" = 0 && set .; \
-	cd $(@D) 2>/dev/null && \
-	find "$$@" -type d -empty -exec $(RMDIRS) {} + 2> /dev/null || true
-	$(Q) $(RMDIRS) $(@D) 2> /dev/null || true
-
-clean-enc distclean-enc realclean-enc:
-	@test -f "$(ENC_MK)" || exit 0; \
-	echo $(@:-enc=ing) encodings; \
-	exec $(MAKE) $(MAKE_ENC) $(@:-enc=)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(ECHO) compiling $@
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-test-bundled-gems-run:
-	$(Q) set -e; while read gem _; do \
-	  echo testing $$gem gem && \
-	  $(XRUBY) -C $(srcdir)/gems/src/$$gem -Ilib ../../../.bundle/bin/rake; \
-	done < $(srcdir)/gems/bundled_gems
-
-update-src::
-	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-update-download:: update-config_files
-
-after-update:: prereq
-
-gcov:
-	$(Q) $(BASERUBY) $(srcdir)/tool/run-gcov.rb
-
-lcov:
-	$(Q) $(BASERUBY) $(srcdir)/tool/run-lcov.rb
-
-update-doclie:
-	$(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/coverage $(Q1:0=-q) \
-		--branch $(DOCLIE_GIT_REF) \
-		$(DOCLIE_GIT_URL) doclie $(GIT_OPTS)
-
-update-simplecov-html:
-	$(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/coverage $(Q1:0=-q) \
-		--branch $(SIMPLECOV_HTML_GIT_REF) \
-		$(SIMPLECOV_HTML_GIT_URL) simplecov-html $(GIT_OPTS)
-
-update-simplecov:
-	$(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/coverage $(Q1:0=-q) \
-		--branch $(SIMPLECOV_GIT_REF)  \
-		$(SIMPLECOV_GIT_URL) simplecov $(GIT_OPTS)
-
-update-coverage: update-simplecov update-simplecov-html update-doclie
-
-INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
-	  vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
-	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
-	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
-	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
-	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
-	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
-
-un-runnable:
-	$(ECHO) cannot make runnable, configure with --enable-load-relative.
-	$(Q) exit 1
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 9bb6b3bc98..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,312 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.5.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with.  For a full list of changes
-with all sufficient information, see the ChangeLog file or Redmine
-(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
-
-== Changes since the 2.4.0 release
-
-=== Language changes
-
-* Top-level constant look-up is removed.  [Feature #11547]
-
-* rescue/else/ensure are allowed inside do/end blocks.  [Feature #12906]
-
-* refinements take place in string interpolations.  [Feature #13812]
-
-=== Core classes updates (outstanding ones only)
-
-* Array
-
-  * Array#append  [Feature #12746]
-  * Array#prepend  [Feature #12746]
-
-* Data
-
-  * Now deprecated [Feature #3072]
-
-* Dir
-
-  * Dir.glob provides new optional keyword argument, :base.
-    [Feature #13056]
-  * Dir.children  [Feature #11302]
-  * Dir.each_child  [Feature #11302]
-
-* File
-
-  * :newline option to File.open implies text mode now.  [Bug #13350]
-  * File#path now raises an IOError for files opened with
-    File::Constants::TMPFILE option. [Feature #13568]
-  * File.stat, File.exist?, and other rb_stat()-using methods release GVL
-    [Bug #13941]
-  * File.rename releases GVL [Feature #13951]
-  * Add File.lutime  [Feature #4052]
-
-* Hash
-
-  * Hash#transform_keys  [Feature #13583]
-  * Hash#transform_keys!  [Feature #13583]
-  * Hash#slice  [Feature #8499]
-
-* IO
-
-  * IO#pread  [Feature #4532]
-  * IO#pwrite  [Feature #4532]
-  * IO#copy_stream tries copy offload with copy_file_range(2) [Feature #13867]
-  * IO#write accepts multiple arguments  [Feature #9323]
-
-* IOError
-
-  * exception message "stream closed" is changed  [Bug #13405]
-
-* Integer
-
-  * Integer.sqrt  [Feature #13219]
-  * Integer#step does no longer rescue exceptions when given
-    a step value which cannot be compared with #> to 0. [Feature #7688]
-  * Integer#{round,floor,ceil,truncate} now always return an Integer.
-    [Bug #13420]
-  * Integer#pow now has an optional modulo argument for calculating modular
-    exponentiation.  [Feature #12508] [Feature #11003]
-
-* Kernel
-
-  * Kernel#yield_self  [Feature #6721]
-  * Kernel#pp [Feature #14123]
-
-* Module
-  * Module#attr, attr_accessor, attr_reader, attr_writer are now public [#14132]
-  * Module#define_method, alias_method, undef_method, remove_method are now public [#14133]
-
-* Numeric
-
-  * Numerical comparison operators (<,<=,>=,>) no longer rescue exceptions
-    of #coerce. Return nil in #coerce if the coercion is impossible.
-    [Feature #7688]
-
-* Process
-
-  * Precision of Process.times is improved if getrusage(2) exists. [Feature #11952]
-
-* Range
-  * Range#initialize no longer rescue exceptions when comparing begin and
-    end with #<=> and raise a "bad value for range" ArgumentError
-    but instead let the exception from the #<=> call go through.
-    [Feature #7688]
-
-* Regexp
-  * Update to Onigmo 6.1.3-669ac9997619954c298da971fcfacccf36909d05.
-    * Support absent operator https://github.com/k-takata/Onigmo/issues/82
-
-* String
-
-  * String#-@ deduplicates unfrozen strings.  Already-frozen
-    strings remain unchanged for compatibility.  [Feature #13077]
-  * -"literal" (String#-@) optimized to return the same object
-    (same as "literal".freeze in Ruby 2.1+) [Feature #13295]
-  * String#{casecmp,casecmp?} now return nil for non-string arguments
-    instead of raising a TypeError. [Bug #13312]
-  * String#delete_prefix is added to remove prefix [Feature #12694]
-  * String#delete_prefix! is added to remove prefix destructively [Feature #12694]
-  * String#delete_suffix is added to remove suffix [Feature #13665]
-  * String#delete_suffix! is added to remove suffix destructively [Feature #13665]
-  * String#each_grapheme_cluster and String#grapheme_clusters is added to
-    enumerate grapheme clusters [Feature #13780]
-  * String#start_with? supports regexp [Feature #13712]
-
-* Regexp/String: Update Unicode version from 9.0.0 to 10.0.0 [Feature #13685]
-
-* Thread
-
-  * Thread#fetch  [Feature #13009]
-
-  * Description set by Thread#name= is now visible on Windows 10.
-
-* Time
-
-  * Time#at receives 3rd argument which specifies the unit of 2nd argument.
-    [Feature #13919]
-
-* KeyError
-
-  * KeyError#receiver [Feature #12063]
-  * KeyError#key      [Feature #12063]
-
-=== Stdlib updates (outstanding ones only)
-
-* Bundler
-
-  * Add Bundler to Standard Library. [Feature #12733]
-
-* DRb
-  * ACL::ACLEntry.new no longer suppresses IPAddr::InvalidPrefixError.
-
-* ERB
-  * Add ERB#result_with_hash to render a template with local variables passed
-    with a Hash object. [Feature #8631]
-  * Default template file encoding is changed from ASCII-8BIT to UTF-8 in erb
-    command. [Bug #14095]
-
-  * Carriage returns are changed to be trimmed properly if trim_mode is specified
-    and used. Duplicated newlines will be removed on Windows. [Bug #5339] [Bug #11464]
-
-* IPAddr
-  * New methods are added:
-    * IPAddr#prefix
-    * IPAddr#loopback?
-    * IPAddr#private? [Feature #11666]
-    * IPAddr#link_local? [Feature #10912]
-  * IPAddr now rejects invalid address mask. [Bug #13399]
-  * IPAddr#ipv4_compat and #ipv4_compat? are deprecated. [Bug #13769]
-
-* IRB
-  * `binding.irb` automatically requires irb and runs [Bug #13099] [experimental]
-  * Show source around `binding.irb` on session start [Feature #14124]
-
-* Net::HTTP
-  * Net::HTTP.new supports no_proxy parameter [Feature #11195]
-
-  * Net::HTTP#min_version/max_version [Feature #9450]
-
-  * Add more HTTP status classes
-
-  * Net::HTTP::STATUS_CODES is added as HTTP Status Code Repository [Misc #12935]
-
-  * Net::HTTP#proxy_user and Net::HTTP#proxy_pass now reflects http_proxy
-    environment variable if the system's environment variable is multiuser
-    safe. [Bug #12921]
-
-* Pathname
-  * New method:
-    * Pathname#glob [Feature #7360]
-
-* Psych
-
-  * Update to Psych 3.0.0.
-    * Add :symbolize_names option to Psych.load, Psych.safe_load like JSON.parse
-      https://github.com/ruby/psych/pull/333, https://github.com/ruby/psych/pull/337
-    * Add Psych::Handler#event_location
-      https://github.com/ruby/psych/pull/326
-    * Make frozen string literal = true
-      https://github.com/ruby/psych/pull/320
-    * Preserve time zone offset when deserializing times
-      https://github.com/ruby/psych/pull/316
-    * Removed deprecated method aliases for syck gem
-      https://github.com/ruby/psych/pull/312
-
-* RbConfig
-  * New constants:
-    * RbConfig::LIMITS is added to provide the limits of C types.
-      This is available when rbconfig/sizeof is required.
-
-* Ripper
-  * New method:
-    * Ripper#state is added to tell the state of scanner. [Feature #13686]
-
-  * New constants:
-    * Ripper::EXPR_BEG and so on for Ripper#state.
-
-* RDoc
-
-  * Update to RDoc 6.0.0.beta3.
-    * Replaced IRB based lexer with Ripper. It much improves the speed of generating document.
-    * https://github.com/ruby/rdoc/pull/512
-
-* Rubygems
-
-  * Update to Rubygems 2.7.0.
-    * http://blog.rubygems.org/2017/11/01/2.7.0-released.html
-    * http://blog.rubygems.org/2017/08/27/2.6.13-released.html
-    * http://blog.rubygems.org/2017/10/09/unsafe-object-deserialization-vulnerability.html
-
-* SecureRandom
-  * New methods:
-    * SecureRandom.alphanumeric
-
-* Set
-  * Add Set#to_s as alias to #inspect [Feature #13676]
-  * Add Set#=== as alias to #include? [Feature #13801]
-  * Add Set#reset [Feature #6589]
-
-* StringIO
-  * StringIO#write accepts multiple arguments
-
-* StringScanner
-  * Add StringScanner#size, StringScanner#captures, StringScanner#values_at  [Feature #836]
-
-* WEBrick
-
-  * Add Server Name Indication (SNI) support [Feature #13729]
-
-* Zlib
-  * Zlib::GzipWriter#write accepts multiple arguments
-
-=== Compatibility issues (excluding feature bug fixes)
-
-* BasicSocket#read_nonblock and BasicSocket#write_nonblock no
-  longer sets the O_NONBLOCK file description flag as side effect
-  (on Linux only) [Feature #13362]
-
-* Net::HTTP
-  * Net::HTTP#start now pass :ENV to p_addr by default. [Bug #13351]
-    To avoid this, pass nil explicitly.
-
-* Random.raw_seed renamed to become Random.urandom.  It is now
-  applicable to non-seeding purposes due to [Bug #9569].
-
-* Socket::Ifaddr#vhid is added [Feature #13803]
-
-* ConditionVariable, Queue and SizedQueue reimplemented for speed.
-  They no longer subclass Struct. [Feature #13552]
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* mathn.rb
-  Removed from stdlib. [Feature #10169]
-
-* Rubygems
-  * Removed "ubygems.rb" file from stdlib. It's needless since Ruby 1.9.
-
-=== C API updates
-
-=== Supported platform changes
-
-* Drop to support NaCl platform
-  * https://bugs.chromium.org/p/chromium/issues/detail?id=239656#c160
-
-=== Implementation improvements
-
-* (This might not be a "user visible feature change" but) Hash class's
-  hash function is now SipHash13. [Feature #13017]
-
-* SecureRandom now prefers OS-provided sources than OpenSSL. [Bug #9569]
-
-* Mutex rewritten to be smaller and faster [Feature #13517]
-
-* Performance of block passing using block parameters is improved by
-  lazy Proc allocation [Feature #14045]
-
-* Dynamic instrumentation for TracePoint hooks instead of using "trace"
-  instruction to avoid overhead [Feature #14104]
-
-=== Miscellaneous changes
-
-* Print backtrace and error message in reverse order if STDERR is unchanged and a tty.
-  [Feature #8661] [experimental]
-
-* Print error message in bold/underlined text if STDERR is unchanged and a tty.
-  [Feature #14140] [experimental]
-
-* configure option --with-ext now mandates its arguments.  So for
-  instance if you run ./configure --with-ext=openssl,+ then the
-  openssl library is guaranteed compiled, otherwise the build fails
-  abnormally.
-
-  Note however to always add the ",+" at the end of the argument.
-  Otherwise nothing but openssl are built.  [Feature #13302]
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..038f1a63c6
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,265 @@
+# NEWS for Ruby 4.1.0
+
+This document is a list of user-visible feature changes
+since the **4.0.0** release, except for bug fixes.
+
+Note that each entry is kept to a minimum, see links for details.
+
+## Language changes
+
+* `Module#clone` and `Module#dup` no longer rewrite the lexical scope of
+  copied methods. Constants and class variables resolve through the
+  original class, consistent with inheritance and mixins.
+  [[Feature #21981]]
+
+## Core classes updates
+
+Note: We're only listing outstanding class updates.
+
+* Array
+
+    * `Array#pack` accepts a new format `R` and `r` for unpacking unsigned
+      and signed LEB128 encoded integers. [[Feature #21785]]
+    * `Array#pack` accepts a new format `^` that returns the current offset.
+      Useful when combined with variable width formats like LEB128. [[Feature #21796]]
+
+* ENV
+
+    * `ENV.fetch_values` is added. It returns an array of values for the
+      given names, raising `KeyError` for missing names unless a block is
+      given. [[Feature #21781]]
+
+* Kernel
+
+    * `Kernel#autoload_relative` and `Module#autoload_relative` are added.
+      These methods work like `autoload`, but resolve the file path relative
+      to the file where the method is called, similar to `require_relative`.
+      This makes it easier to autoload constants from files in the same
+      directory without hardcoding absolute paths or manipulating `$LOAD_PATH`.
+      [[Feature #15330]]
+
+* MatchData
+
+    * `MatchData#integer_at` is added.  It converts the matched substring to
+      integer and return the result.  [[Feature #21932]]
+
+* Regexp
+
+    * All instances of `Regexp` are now frozen, not just literals.
+      Subclasses of `Regexp` are not frozen for compatibility.
+      [[Feature #8948]]
+
+* Set
+
+    * A deprecated behavior, `Set#to_set`, `Range#to_set`, and
+      `Enumerable#to_set` accepting arguments, was removed.  [[Feature #21390]]
+
+## Stdlib updates
+
+### The following bundled gems are added.
+
+
+We only list stdlib changes that are notable feature changes.
+
+Other changes are listed in the following sections. We also listed release
+history from the previous bundled version that is Ruby 3.4.0 if it has GitHub
+releases.
+
+### The following bundled gems are promoted from default gems.
+
+* tsort 0.2.0
+* win32-registry 0.1.2
+
+### The following default gem is added.
+
+### The following default gems are updated.
+
+* RubyGems 4.1.0.dev
+  * 4.0.3 to [v4.0.4][RubyGems-v4.0.4], [v4.0.5][RubyGems-v4.0.5], [v4.0.6][RubyGems-v4.0.6], [v4.0.7][RubyGems-v4.0.7], [v4.0.8][RubyGems-v4.0.8], [v4.0.9][RubyGems-v4.0.9], [v4.0.10][RubyGems-v4.0.10], [v4.0.11][RubyGems-v4.0.11], [v4.0.12][RubyGems-v4.0.12]
+* bundler 4.1.0.dev
+  * 4.0.3 to [v4.0.4][bundler-v4.0.4], [v4.0.5][bundler-v4.0.5], [v4.0.6][bundler-v4.0.6], [v4.0.7][bundler-v4.0.7], [v4.0.8][bundler-v4.0.8], [v4.0.9][bundler-v4.0.9], [v4.0.10][bundler-v4.0.10], [v4.0.11][bundler-v4.0.11], [v4.0.12][bundler-v4.0.12]
+* erb 6.0.4
+  * 6.0.1 to [v6.0.1.1][erb-v6.0.1.1], [v6.0.2][erb-v6.0.2], [v6.0.3][erb-v6.0.3], [v6.0.4][erb-v6.0.4]
+* ipaddr 1.2.9
+  * 1.2.8 to [v1.2.9][ipaddr-v1.2.9]
+* json 2.19.7
+  * 2.18.0 to [v2.18.1][json-v2.18.1], [v2.19.0][json-v2.19.0], [v2.19.1][json-v2.19.1], [v2.19.2][json-v2.19.2], [v2.19.3][json-v2.19.3], [v2.19.4][json-v2.19.4], [v2.19.5][json-v2.19.5], [v2.19.6][json-v2.19.6], [v2.19.7][json-v2.19.7]
+* openssl 4.0.2
+  * 4.0.0 to [v4.0.1][openssl-v4.0.1], [v4.0.2][openssl-v4.0.2]
+* prism 1.9.0
+  * 1.7.0 to [v1.8.0][prism-v1.8.0], [v1.8.1][prism-v1.8.1], [v1.9.0][prism-v1.9.0]
+* resolv 0.7.1
+  * 0.7.0 to [v0.7.1][resolv-v0.7.1]
+* stringio 3.2.1.dev
+* strscan 3.1.9.dev
+  * 3.1.6 to [v3.1.7][strscan-v3.1.7], [v3.1.8][strscan-v3.1.8]
+* syntax_suggest 3.0.0
+* timeout 0.6.1
+  * 0.6.0 to [v0.6.1][timeout-v0.6.1]
+* zlib 3.2.3
+  * 3.2.2 to [v3.2.3][zlib-v3.2.3]
+
+### The following bundled gems are updated.
+
+* minitest 6.0.6
+* rake 13.4.2
+  * 13.3.1 to [v13.4.0][rake-v13.4.0], [v13.4.1][rake-v13.4.1], [v13.4.2][rake-v13.4.2]
+* test-unit 3.7.7
+  * 3.7.5 to [3.7.6][test-unit-3.7.6], [3.7.7][test-unit-3.7.7]
+* net-imap 0.6.4
+  * 0.6.2 to [v0.6.3][net-imap-v0.6.3], [v0.6.4][net-imap-v0.6.4]
+* rbs 4.0.2
+  * 3.10.0 to [v3.10.1][rbs-v3.10.1], [v3.10.2][rbs-v3.10.2], [v3.10.3][rbs-v3.10.3], [v3.10.4][rbs-v3.10.4], [v4.0.0.dev.5][rbs-v4.0.0.dev.5], [v4.0.0][rbs-v4.0.0], [v4.0.2][rbs-v4.0.2]
+* typeprof 0.32.0
+* mutex_m 0.3.0
+* bigdecimal 4.1.2
+  * 4.0.1 to [v4.1.0][bigdecimal-v4.1.0], [v4.1.1][bigdecimal-v4.1.1], [v4.1.2][bigdecimal-v4.1.2]
+* resolv-replace 0.2.0
+  * 0.1.1 to [v0.2.0][resolv-replace-v0.2.0]
+* syslog 0.4.0
+  * 0.3.0 to [v0.4.0][syslog-v0.4.0]
+* repl_type_completor 0.1.15
+  * 0.1.12 to [v0.1.13][repl_type_completor-v0.1.13], [v0.1.14][repl_type_completor-v0.1.14], [v0.1.15][repl_type_completor-v0.1.15]
+* pstore 0.2.1
+  * 0.2.0 to [v0.2.1][pstore-v0.2.1]
+* rdoc 7.2.0
+  * 7.0.3 to [v7.0.4][rdoc-v7.0.4], [v7.1.0][rdoc-v7.1.0], [v7.2.0][rdoc-v7.2.0]
+* win32ole 1.9.3
+  * 1.9.2 to [v1.9.3][win32ole-v1.9.3]
+* irb 1.18.0
+  * 1.16.0 to [v1.17.0][irb-v1.17.0], [v1.18.0][irb-v1.18.0]
+
+### RubyGems and Bundler
+
+Ruby 4.0 bundled RubyGems and Bundler version 4. see the following links for details.
+
+## Supported platforms
+
+## Compatibility issues
+
+## Stdlib compatibility issues
+
+## C API updates
+
+### Embedded TypedData
+
+* The `RUBY_TYPED_EMBEDDABLE` flag is now public and documented and can be used by C extensions.
+  It allows allocating C structs directly into Ruby object slots, which reduces pointer chasing,
+  and in some case memory usage.
+  See the C extension documentation for details. [[Feature #21853]]
+
+* Added new C23 inspired allocator functions, that takes the previous memory size.
+  This allow the Ruby GC to better keep track of memory usage, improving its heuristics.
+  It also improves the performance of system allocators that support C23 `free_sized`.
+
+  However, it is important to note that passing an incorrect size to these function is undefined
+  behavior and may result in crashes or memory leaks.
+
+  - `ruby_xfree_sized(void *ptr, size_t size)`
+  - `ruby_xrealloc_sized(void *ptr, size_t newsiz, size_t oldsiz)`
+  - `ruby_xrealloc2_sized(void *ptr, size_t newelems, size_t newsiz, size_t oldelems)`
+
+  [[Feature #21861]]
+
+### Removed APIs
+
+The following APIs, which have been deprecated for many years, are removed.
+[[Feature #21768]]
+
+* old postponed job functions,
+* untyped data object type/functions,
+* old APIs to allocate a data object,
+* taintedness/trustedness enums/macros,
+* `rb_gc_force_recycle` function,
+* `rb_iterate` function,
+* and some functions and constants for internal use.
+
+## Implementation improvements
+
+### Ractor
+
+A lot of work has gone into making Ractors more stable, performant, and usable. These improvements bring Ractor implementation closer to leaving experimental status.
+
+## JIT
+
+[Feature #8948]: https://bugs.ruby-lang.org/issues/8948
+[Feature #15330]: https://bugs.ruby-lang.org/issues/15330
+[Feature #21390]: https://bugs.ruby-lang.org/issues/21390
+[Feature #21768]: https://bugs.ruby-lang.org/issues/21768
+[Feature #21785]: https://bugs.ruby-lang.org/issues/21785
+[Feature #21796]: https://bugs.ruby-lang.org/issues/21796
+[Feature #21853]: https://bugs.ruby-lang.org/issues/21853
+[Feature #21861]: https://bugs.ruby-lang.org/issues/21861
+[Feature #21932]: https://bugs.ruby-lang.org/issues/21932
+[Feature #21981]: https://bugs.ruby-lang.org/issues/21981
+[RubyGems-v4.0.4]: https://github.com/rubygems/rubygems/releases/tag/v4.0.4
+[RubyGems-v4.0.5]: https://github.com/rubygems/rubygems/releases/tag/v4.0.5
+[RubyGems-v4.0.6]: https://github.com/rubygems/rubygems/releases/tag/v4.0.6
+[RubyGems-v4.0.7]: https://github.com/rubygems/rubygems/releases/tag/v4.0.7
+[RubyGems-v4.0.8]: https://github.com/rubygems/rubygems/releases/tag/v4.0.8
+[RubyGems-v4.0.9]: https://github.com/rubygems/rubygems/releases/tag/v4.0.9
+[RubyGems-v4.0.10]: https://github.com/rubygems/rubygems/releases/tag/v4.0.10
+[RubyGems-v4.0.11]: https://github.com/rubygems/rubygems/releases/tag/v4.0.11
+[RubyGems-v4.0.12]: https://github.com/rubygems/rubygems/releases/tag/v4.0.12
+[bundler-v4.0.4]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.4
+[bundler-v4.0.5]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.5
+[bundler-v4.0.6]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.6
+[bundler-v4.0.7]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.7
+[bundler-v4.0.8]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.8
+[bundler-v4.0.9]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.9
+[bundler-v4.0.10]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.10
+[bundler-v4.0.11]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.11
+[bundler-v4.0.12]: https://github.com/rubygems/rubygems/releases/tag/bundler-v4.0.12
+[erb-v6.0.1.1]: https://github.com/ruby/erb/releases/tag/v6.0.1.1
+[erb-v6.0.2]: https://github.com/ruby/erb/releases/tag/v6.0.2
+[erb-v6.0.3]: https://github.com/ruby/erb/releases/tag/v6.0.3
+[erb-v6.0.4]: https://github.com/ruby/erb/releases/tag/v6.0.4
+[ipaddr-v1.2.9]: https://github.com/ruby/ipaddr/releases/tag/v1.2.9
+[json-v2.18.1]: https://github.com/ruby/json/releases/tag/v2.18.1
+[json-v2.19.0]: https://github.com/ruby/json/releases/tag/v2.19.0
+[json-v2.19.1]: https://github.com/ruby/json/releases/tag/v2.19.1
+[json-v2.19.2]: https://github.com/ruby/json/releases/tag/v2.19.2
+[json-v2.19.3]: https://github.com/ruby/json/releases/tag/v2.19.3
+[json-v2.19.4]: https://github.com/ruby/json/releases/tag/v2.19.4
+[json-v2.19.5]: https://github.com/ruby/json/releases/tag/v2.19.5
+[json-v2.19.6]: https://github.com/ruby/json/releases/tag/v2.19.6
+[json-v2.19.7]: https://github.com/ruby/json/releases/tag/v2.19.7
+[openssl-v4.0.1]: https://github.com/ruby/openssl/releases/tag/v4.0.1
+[openssl-v4.0.2]: https://github.com/ruby/openssl/releases/tag/v4.0.2
+[prism-v1.8.0]: https://github.com/ruby/prism/releases/tag/v1.8.0
+[prism-v1.8.1]: https://github.com/ruby/prism/releases/tag/v1.8.1
+[prism-v1.9.0]: https://github.com/ruby/prism/releases/tag/v1.9.0
+[resolv-v0.7.1]: https://github.com/ruby/resolv/releases/tag/v0.7.1
+[strscan-v3.1.7]: https://github.com/ruby/strscan/releases/tag/v3.1.7
+[strscan-v3.1.8]: https://github.com/ruby/strscan/releases/tag/v3.1.8
+[timeout-v0.6.1]: https://github.com/ruby/timeout/releases/tag/v0.6.1
+[zlib-v3.2.3]: https://github.com/ruby/zlib/releases/tag/v3.2.3
+[rake-v13.4.0]: https://github.com/ruby/rake/releases/tag/v13.4.0
+[rake-v13.4.1]: https://github.com/ruby/rake/releases/tag/v13.4.1
+[rake-v13.4.2]: https://github.com/ruby/rake/releases/tag/v13.4.2
+[test-unit-3.7.6]: https://github.com/test-unit/test-unit/releases/tag/3.7.6
+[test-unit-3.7.7]: https://github.com/test-unit/test-unit/releases/tag/3.7.7
+[net-imap-v0.6.3]: https://github.com/ruby/net-imap/releases/tag/v0.6.3
+[net-imap-v0.6.4]: https://github.com/ruby/net-imap/releases/tag/v0.6.4
+[rbs-v3.10.1]: https://github.com/ruby/rbs/releases/tag/v3.10.1
+[rbs-v3.10.2]: https://github.com/ruby/rbs/releases/tag/v3.10.2
+[rbs-v3.10.3]: https://github.com/ruby/rbs/releases/tag/v3.10.3
+[rbs-v3.10.4]: https://github.com/ruby/rbs/releases/tag/v3.10.4
+[rbs-v4.0.0.dev.5]: https://github.com/ruby/rbs/releases/tag/v4.0.0.dev.5
+[rbs-v4.0.0]: https://github.com/ruby/rbs/releases/tag/v4.0.0
+[rbs-v4.0.2]: https://github.com/ruby/rbs/releases/tag/v4.0.2
+[bigdecimal-v4.1.0]: https://github.com/ruby/bigdecimal/releases/tag/v4.1.0
+[bigdecimal-v4.1.1]: https://github.com/ruby/bigdecimal/releases/tag/v4.1.1
+[bigdecimal-v4.1.2]: https://github.com/ruby/bigdecimal/releases/tag/v4.1.2
+[resolv-replace-v0.2.0]: https://github.com/ruby/resolv-replace/releases/tag/v0.2.0
+[syslog-v0.4.0]: https://github.com/ruby/syslog/releases/tag/v0.4.0
+[repl_type_completor-v0.1.13]: https://github.com/ruby/repl_type_completor/releases/tag/v0.1.13
+[repl_type_completor-v0.1.14]: https://github.com/ruby/repl_type_completor/releases/tag/v0.1.14
+[repl_type_completor-v0.1.15]: https://github.com/ruby/repl_type_completor/releases/tag/v0.1.15
+[pstore-v0.2.1]: https://github.com/ruby/pstore/releases/tag/v0.2.1
+[rdoc-v7.0.4]: https://github.com/ruby/rdoc/releases/tag/v7.0.4
+[rdoc-v7.1.0]: https://github.com/ruby/rdoc/releases/tag/v7.1.0
+[rdoc-v7.2.0]: https://github.com/ruby/rdoc/releases/tag/v7.2.0
+[win32ole-v1.9.3]: https://github.com/ruby/win32ole/releases/tag/v1.9.3
+[irb-v1.17.0]: https://github.com/ruby/irb/releases/tag/v1.17.0
+[irb-v1.18.0]: https://github.com/ruby/irb/releases/tag/v1.18.0
diff --git a/README.EXT b/README.EXT
deleted file mode 100644
index 48b8d964c4..0000000000
--- a/README.EXT
+++ /dev/null
@@ -1 +0,0 @@
-Moved to doc/extension.rdoc
diff --git a/README.EXT.ja b/README.EXT.ja
deleted file mode 100644
index f884ecbb0e..0000000000
--- a/README.EXT.ja
+++ /dev/null
@@ -1 +0,0 @@
-doc/extension.ja.rdocに移動しました
diff --git a/README.ja.md b/README.ja.md
index 2902216f99..9bbc3a83a5 100644
--- a/README.ja.md
+++ b/README.ja.md
@@ -1,3 +1,11 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+[English](rdoc-ref:README.md)
+
 # Rubyとは
 
 Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
@@ -10,40 +18,41 @@ Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい
 
 *   シンプルな文法
 *   普通のオブジェクト指向機能(クラス，メソッドコールなど)
-*   特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
+*   特殊なオブジェクト指向機能(Mixin，特異メソッドなど)
 *   演算子オーバーロード
 *   例外処理機能
 *   イテレータとクロージャ
 *   ガーベージコレクタ
 *   ダイナミックローディング (アーキテクチャによる)
-*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， Mac OS
-    X，Haikuなどの上でも動く cf.
-    https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， macOS，
+    Haikuなどの上でも動く cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
 
 
 ## 入手法
 
-### FTPで
-
-以下の場所においてあります．
+サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
 
-ftp://ftp.ruby-lang.org/pub/ruby/
+https://www.ruby-lang.org/ja/downloads/
 
-### Subversionで
+を参照してください．
 
-開発先端のソースコードは次のコマンドで取得できます．
+### Git
 
-    $ svn co https://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+ミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
 
-他に開発中のブランチの一覧は次のコマンドで見られます．
+```console
+$ git clone https://github.com/ruby/ruby.git
+```
 
-    $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
+他のブランチの一覧は次のコマンドで見られます．
 
-### Gitで
+```console
+$ git ls-remote https://github.com/ruby/ruby.git
+```
 
-SubversionのミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
-
-    $ git clone git://github.com/ruby/ruby.git
+Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります．
+コミッタはこちらを使います．
 
 ## ホームページ
 
@@ -55,38 +64,33 @@ https://www.ruby-lang.org/
 
 ## メーリングリスト
 
-Rubyのメーリングリストがあります．参加希望の方は
-
-mailto:ruby-list-request@ruby-lang.org
+Rubyのメーリングリストがあります．参加希望の方は [ruby-list-request@ml.ruby-lang.org] まで件名に
 
-まで本文に
-
-    subscribe
+    join
 
 と書いて送って下さい．
 
-Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています． 参加希望の方は
-
-mailto:ruby-dev-request@ruby-lang.org
-
-までruby-listと同様の方法でメールしてください．
+Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています．
+参加希望の方は [ruby-dev-request@ml.ruby-lang.org] までruby-listと同様の方法でメールしてください．
 
 Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
 英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
 
+[ruby-list-request@ml.ruby-lang.org]: mailto:ruby-list-request@ml.ruby-lang.org?subject=join
+[ruby-dev-request@ml.ruby-lang.org]: mailto:ruby-dev-request@ml.ruby-lang.org?subject=join
+
 ## コンパイル・インストール
 
 以下の手順で行ってください．
 
-1.  もし `configure` ファイルが見つからない，もしくは `configure.ac` より古いようなら， `autoconf` を実行して
-    新しく `configure` を生成する
+1.  (Gitリポジトリから取得したソースをビルドする場合) `./autogen.sh` を実行して新しく `configure` を生成する
 
 2.  `configure` を実行して `Makefile` などを生成する
 
     環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
     `warnflags=..` 等で上書きできます．
 
-3.  (必要ならば)`defines.h` を編集する
+3.  (必要ならば)`include/ruby/defines.h` を編集する
 
     多分，必要無いと思います．
 
@@ -95,7 +99,8 @@ Ruby拡張モジュールについて話し合うruby-extメーリングリス�
     `ext/Setup` に記述したモジュールは静的にリンクされます．
 
     ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
-    メントを外す必要があります．また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
+    メントを外す必要があります．
+    また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
 
 5.  `make` を実行してコンパイルする
 
@@ -151,21 +156,21 @@ UNIXであれば `configure` がほとんどの差異を吸収してくれるは
 
 ## 配布条件
 
-[COPYING.ja](COPYING.ja) ファイルを参照してください．
+[COPYING.ja](https://docs.ruby-lang.org/en/master/COPYING_ja.html) ファイルを参照してください．
 
 ## フィードバック
 
-Rubyに関する質問は Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
-stackoverflow (https://ja.stackoverflow.com/) などのWebサイトに投稿してください．
+Rubyに関する質問は [Ruby-Talk]（英語）や [Ruby-List]（日本語）や，
+[stackoverflow] などのWebサイトに投稿してください．
 
 バグ報告は https://bugs.ruby-lang.org で受け付けています．
 
+[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
+[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
+[stackoverflow]: https://ja.stackoverflow.com/
 
 ## 著者
 
 Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
 
 <mailto:matz@ruby-lang.org>
-
----
-created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
index 688802633c..02435b419e 100644
--- a/README.md
+++ b/README.md
@@ -1,27 +1,30 @@
-[![Build Status](https://travis-ci.org/ruby/ruby.svg)](https://travis-ci.org/ruby/ruby)
-[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/trunk?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/trunk)
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
 
-# What's Ruby
+[日本語](rdoc-ref:README.ja.md)
 
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming. It has many features to process text files and to do system
-management tasks (as in Perl). It is simple, straight-forward, and
-extensible.
+# What is Ruby?
 
-## Features of Ruby
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
 
-*   Simple Syntax
-*   **Normal** Object-oriented Features (e.g. class, method calls)
-*   **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
-*   Operator Overloading
-*   Exception Handling
-*   Iterators and Closures
-*   Garbage Collection
-*   Dynamic Loading of Object Files (on some architectures)
-*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
-    well as Windows, macOS, Haiku, etc.) cf.
-    https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+## Features of Ruby
 
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+  well as Windows, macOS, etc.) cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
 
 ## How to get Ruby
 
@@ -30,146 +33,64 @@ like rvm, see:
 
 https://www.ruby-lang.org/en/downloads/
 
-The Ruby distribution files can be found on the following FTP site:
-
-ftp://ftp.ruby-lang.org/pub/ruby/
+You can download release packages and the snapshot of the repository. If you want to
+download whole versions of Ruby, please visit https://www.ruby-lang.org/en/downloads/releases/.
 
-The trunk of the Ruby source tree can be checked out with the following
-command:
+### Download with Git
 
-    $ svn co https://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+The mirror of the Ruby source tree can be checked out with the following command:
 
-Or if you are using git then use the following command:
-
-    $ git clone git://github.com/ruby/ruby.git
+    $ git clone https://github.com/ruby/ruby.git
 
 There are some other branches under development. Try the following command
 to see the list of branches:
 
-    $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
+    $ git ls-remote https://github.com/ruby/ruby.git
 
-Or if you are using git then use the following command:
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
 
-    $ git ls-remote git://github.com/ruby/ruby.git
+## How to build
 
-## Ruby home page
+See [Building Ruby](https://docs.ruby-lang.org/en/master/contributing/building_ruby_md.html)
 
-The URL of the Ruby home page is:
+## Ruby home page
 
 https://www.ruby-lang.org/
 
-## Mailing list
-
-There is a mailing list to talk about Ruby. To subscribe to this list, please
-send the following phrase:
-
-    subscribe
-
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
-
-## How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-1.  If you want to use Microsoft Visual C++ to compile Ruby, read
-    [win32/README.win32](win32/README.win32) instead of this document.
-
-2.  If `./configure` does not exist or is older than `configure.ac`, run
-    `autoconf` to (re)generate configure.
-
-3.  Run `./configure`, which will generate `config.h` and `Makefile`.
-
-    Some C compiler flags may be added by default depending on your
-    environment. Specify `optflags=..` and `warnflags=..` as necessary to
-    override them.
+## Documentation
 
-4.  Edit `defines.h` if you need. Usually this step will not be needed.
+- [English](https://docs.ruby-lang.org/en/master/index.html)
+- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
 
-5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
-    module names if not present), if you want to link modules statically.
-
-    If you don't want to compile non static extension modules (probably on
-    architectures which do not allow dynamic loading), remove comment mark
-    from the line "`#option nodynamic`" in `ext/Setup`.
-
-    Usually this step will not be needed.
-
-6.  Run `make`.
-
-    * On Mac, set RUBY\_CODESIGN environment variable with a signing identity.
-      It uses the identity to sign `ruby` binary. See also codesign(1).
-
-7.  Optionally, run '`make check`' to check whether the compiled Ruby
-    interpreter works well. If you see the message "`check succeeded`", your
-    Ruby works as it should (hopefully).
-
-8.  Optionally, run `make update-gems` and `make extract-gems`.
-
-    If you want to install bundled gems, run `make update-gems` and
-    `make extract-gems` before running `make install`.
-
-9.  Run '`make install`'.
-
-    This command will create the following directories and install files into
-    them.
-
-    *   `${DESTDIR}${prefix}/bin`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib`
-    *   `${DESTDIR}${prefix}/lib/ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/share/man/man1`
-    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
-    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
-    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
-    **NOTE**: teeny of the API version may be different from one of Ruby's
-    program version
+## Mailing list
 
-    You may have to be a super user to install Ruby.
+There is a mailing list to discuss Ruby. To subscribe to this list, please
+send the following phrase:
 
+    join
 
-If you fail to compile Ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
+in the mail subject (not body) to the address [ruby-talk-request@ml.ruby-lang.org].
 
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
+[ruby-talk-request@ml.ruby-lang.org]: mailto:ruby-talk-request@ml.ruby-lang.org?subject=join
 
 ## Copying
 
-See the file [COPYING](COPYING).
+See the file [COPYING](rdoc-ref:COPYING).
 
 ## Feedback
 
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(https://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(https://stackoverflow.com).
+Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
+or on websites like https://stackoverflow.com.
 
-Bug reports should be filed at https://bugs.ruby-lang.org. Read [HowToReport] for more information.
-
-[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
+Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
 
 ## Contributing
 
-See the file [CONTRIBUTING.md](CONTRIBUTING.md)
-
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
 
 ## The Author
 
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
 
-<mailto:matz@ruby-lang.org>
+<matz@ruby-lang.org>
diff --git a/acinclude.m4 b/acinclude.m4
deleted file mode 100644
index 99b24e6d93..0000000000
--- a/acinclude.m4
+++ /dev/null
@@ -1,46 +0,0 @@
-# -*- autoconf -*-
-
-AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
-    msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
-    AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
-	msg_begin="`tput smso 2>/dev/null`"
-	AS_CASE(["$msg_begin"], ['@<:@'*m],
-	    [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
-	    msg_checking="${msg_begin}33m"
-	    AS_IF([test ${TEST_COLORS:+set}], [
-		msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
-		msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
-		msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
-	    ])
-	    msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
-	    msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
-	    msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
-	    msg_reset="${msg_begin}m"
-	    ])
-	AS_UNSET(msg_begin)
-	])
-    AS_REQUIRE_SHELL_FN([colorize_result],
-	[AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
-        [AS_CASE(["$[]1"],
-            [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
-            [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
-            [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
-])
-
-AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-    AS_LITERAL_IF([$1],
-	[m4_case([$1],
-		[yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
-		[no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
-		[AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
-	[colorize_result "$1"]) dnl
-])
-
-AC_DEFUN([AC_CHECKING],[dnl
-AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
-
-AC_DEFUN([AC_MSG_RESULT], [dnl
-{ _AS_ECHO_LOG([result: $1])
-COLORIZE_RESULT([$1]); dnl
-}])
diff --git a/aclocal.m4 b/aclocal.m4
index 18ba297b05..e69de29bb2 100644
--- a/aclocal.m4
+++ b/aclocal.m4
@@ -1,15 +0,0 @@
-# generated automatically by aclocal 1.15.1 -*- Autoconf -*-
-
-# Copyright (C) 1996-2017 Free Software Foundation, Inc.
-
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
-m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
-m4_include([acinclude.m4])
diff --git a/addr2line.c b/addr2line.c
index 44ccff0d0d..19a6a425c1 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -8,15 +8,30 @@
 
 **********************************************************************/
 
-#include "ruby/config.h"
+#if defined(__clang__) && defined(__has_warning)
+#if __has_warning("-Wgnu-empty-initializer")
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#endif
+#if __has_warning("-Wgcc-compat")
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
 #include "ruby/missing.h"
 #include "addr2line.h"
 
 #include <stdio.h>
-#include <stdbool.h>
 #include <errno.h>
 
-#ifdef USE_ELF
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
 
 #include <fcntl.h>
 #include <limits.h>
@@ -29,12 +44,6 @@
 #include <sys/stat.h>
 #include <unistd.h>
 
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
 /* Make alloca work the best possible way.  */
 #ifdef __GNUC__
 # ifndef alloca
@@ -47,35 +56,44 @@
 #  ifdef _AIX
 #pragma alloca
 #  else
-#   ifndef alloca		/* predefined by HP cc +Olibcalls */
+#   ifndef alloca                /* predefined by HP cc +Olibcalls */
 void *alloca();
 #   endif
 #  endif /* AIX */
-# endif	/* HAVE_ALLOCA_H */
+# endif        /* HAVE_ALLOCA_H */
+# ifndef UNREACHABLE
+#  define UNREACHABLE __builtin_unreachable()
+# endif
+# ifndef UNREACHABLE_RETURN
+#  define UNREACHABLE_RETURN(_) __builtin_unreachable()
+# endif
 #endif /* __GNUC__ */
 
+#ifndef UNREACHABLE
+# define UNREACHABLE abort()
+#endif
+#ifndef UNREACHABLE_RETURN
+# define UNREACHABLE_RETURN(_) return (abort(), (_))
+#endif
+
 #ifdef HAVE_DLADDR
 # include <dlfcn.h>
 #endif
 
-#define DW_LNS_copy                     0x01
-#define DW_LNS_advance_pc               0x02
-#define DW_LNS_advance_line             0x03
-#define DW_LNS_set_file                 0x04
-#define DW_LNS_set_column               0x05
-#define DW_LNS_negate_stmt              0x06
-#define DW_LNS_set_basic_block          0x07
-#define DW_LNS_const_add_pc             0x08
-#define DW_LNS_fixed_advance_pc         0x09
-#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
-#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
 
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence             0x01
-#define DW_LNE_set_address              0x02
-#define DW_LNE_define_file              0x03
-#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+#  include <elf_abi.h>
+# else
+#  include <elf.h>
+# endif
 
 #ifndef ElfW
 # if SIZEOF_VOIDP == 8
@@ -91,17 +109,44 @@ void *alloca();
 #  define ELF_ST_TYPE ELF32_ST_TYPE
 # endif
 #endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+   /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+#  include <zlib.h>
+#  define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
 #ifndef PATH_MAX
 #define PATH_MAX 4096
 #endif
 
-#ifndef SHF_COMPRESSED /* compatibility with glibc < 2.22 */
-#define SHF_COMPRESSED 0
-#endif
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
 
-int kprintf(const char *fmt, ...);
+#define kprintf(...) fprintf(errout, "" __VA_ARGS__)
 
-typedef struct {
+typedef struct line_info {
     const char *dirname;
     const char *filename;
     const char *path; /* object path */
@@ -110,318 +155,418 @@ typedef struct {
     uintptr_t base_addr;
     uintptr_t saddr;
     const char *sname; /* function name */
+
+    struct line_info *next;
 } line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
+
+struct dwarf_section {
+    char *ptr;
+    size_t size;
+    uint64_t flags;
+};
+
+typedef struct obj_info {
     const char *path; /* object path */
-    int fd;
-    void *mapped;
+    char *mapped;
     size_t mapped_size;
+    void *uncompressed;
     uintptr_t base_addr;
-    obj_info_t *next;
+    uintptr_t vmaddr;
+    struct dwarf_section debug_abbrev;
+    struct dwarf_section debug_info;
+    struct dwarf_section debug_line;
+    struct dwarf_section debug_ranges;
+    struct dwarf_section debug_str_offsets;
+    struct dwarf_section debug_addr;
+    struct dwarf_section debug_rnglists;
+    struct dwarf_section debug_str;
+    struct dwarf_section debug_line_str;
+    struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 9
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+    struct dwarf_section *ary[] = {
+        &obj->debug_abbrev,
+        &obj->debug_info,
+        &obj->debug_line,
+        &obj->debug_ranges,
+        &obj->debug_str_offsets,
+        &obj->debug_addr,
+        &obj->debug_rnglists,
+        &obj->debug_str,
+        &obj->debug_line_str
+    };
+    if (n < 0 || DWARF_SECTION_COUNT <= n) {
+        UNREACHABLE_RETURN(0);
+    }
+    return ary[n];
+}
+
+struct debug_section_definition {
+    const char *name;
+    struct dwarf_section *dwarf;
 };
 
 /* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
+static char binary_filename[PATH_MAX + 1];
 
 static unsigned long
-uleb128(char **p)
+uleb128(const char **p)
 {
     unsigned long r = 0;
     int s = 0;
     for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    r += (unsigned long)b << s;
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            r += (unsigned long)b << s;
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
     }
     return r;
 }
 
 static long
-sleb128(char **p)
+sleb128(const char **p)
 {
     long r = 0;
     int s = 0;
     for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    if (b & 0x40) {
-		r -= (0x80 - b) << s;
-	    }
-	    else {
-		r += (b & 0x3f) << s;
-	    }
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            if (b & 0x40) {
+                r -= (0x80 - b) << s;
+            }
+            else {
+                r += (b & 0x3f) << s;
+            }
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
     }
     return r;
 }
 
 static const char *
-get_nth_dirname(unsigned long dir, char *p)
+get_nth_dirname(unsigned long dir, const char *p, FILE *errout)
 {
     if (!dir--) {
-	return "";
+        return "";
     }
     while (dir--) {
-	while (*p) p++;
-	p++;
-	if (!*p) {
-	    kprintf("Unexpected directory number %lu in %s\n",
-		    dir, binary_filename);
-	    return "";
-	}
+        while (*p) p++;
+        p++;
+        if (!*p) {
+            kprintf("Unexpected directory number %lu in %s\n",
+                    dir, binary_filename);
+            return "";
+        }
     }
     return p;
 }
 
+static const char *parse_ver5_debug_line_header(
+    const char *p, int idx, uint8_t format,
+    obj_info_t *obj, const char **out_path,
+    uint64_t *out_directory_index, FILE *errout);
+
 static void
-fill_filename(int file, char *include_directories, char *filenames,
-	      line_info_t *line)
+fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories,
+              const char *filenames, line_info_t *line, obj_info_t *obj, FILE *errout)
 {
     int i;
-    char *p = filenames;
-    char *filename;
+    const char *p = filenames;
+    const char *filename;
     unsigned long dir;
-    for (i = 1; i <= file; i++) {
-	filename = p;
-	if (!*p) {
-	    /* Need to output binary file name? */
-	    kprintf("Unexpected file number %d in %s\n",
-		    file, binary_filename);
-	    return;
-	}
-	while (*p) p++;
-	p++;
-	dir = uleb128(&p);
-	/* last modified. */
-	uleb128(&p);
-	/* size of the file. */
-	uleb128(&p);
-
-	if (i == file) {
-	    line->filename = filename;
-	    line->dirname = get_nth_dirname(dir, include_directories);
-	}
+    if (version >= 5) {
+        const char *path;
+        uint64_t directory_index = -1;
+        parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index, errout);
+        line->filename = path;
+        parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL, errout);
+        line->dirname = path;
+    }
+    else {
+        for (i = 1; i <= file; i++) {
+            filename = p;
+            if (!*p) {
+#ifndef __APPLE__
+                /* Need to output binary file name? */
+                kprintf("Unexpected file number %d in %s at %tx\n",
+                        file, binary_filename, filenames - obj->mapped);
+#endif
+                return;
+            }
+            while (*p) p++;
+            p++;
+            dir = uleb128(&p);
+            /* last modified. */
+            uleb128(&p);
+            /* size of the file. */
+            uleb128(&p);
+
+            if (i == file) {
+                line->filename = filename;
+                line->dirname = get_nth_dirname(dir, include_directories, errout);
+            }
+        }
     }
 }
 
 static void
 fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
-	  char *include_directories, char *filenames,
-	  obj_info_t *obj, line_info_t *lines, int offset)
+          uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
+          obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
 {
     int i;
-    addr += obj->base_addr;
+    addr += obj->base_addr - obj->vmaddr;
     for (i = offset; i < num_traces; i++) {
-	uintptr_t a = (uintptr_t)traces[i];
-	/* We assume one line code doesn't result >100 bytes of native code.
+        uintptr_t a = (uintptr_t)traces[i];
+        /* We assume one line code doesn't result >100 bytes of native code.
        We may want more reliable way eventually... */
-	if (addr < a && a < addr + 100) {
-	    fill_filename(file, include_directories, filenames, &lines[i]);
-	    lines[i].line = line;
-	}
+        if (addr < a && a < addr + 100) {
+            fill_filename(file, format, version, include_directories, filenames, &lines[i], obj, errout);
+            lines[i].line = line;
+        }
     }
 }
 
+struct LineNumberProgramHeader {
+    uint64_t unit_length;
+    uint16_t version;
+    uint8_t format; /* 4 or 8 */
+    uint64_t header_length;
+    uint8_t minimum_instruction_length;
+    uint8_t maximum_operations_per_instruction;
+    uint8_t default_is_stmt;
+    int8_t line_base;
+    uint8_t line_range;
+    uint8_t opcode_base;
+    /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+    const char *include_directories;
+    const char *filenames;
+    const char *cu_start;
+    const char *cu_end;
+};
+
 static int
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
-		obj_info_t *obj, line_info_t *lines, int offset)
+parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header, FILE *errout)
 {
-    char *p, *cu_end, *cu_start, *include_directories, *filenames;
-    unsigned long unit_length;
-    int default_is_stmt, line_base;
-    unsigned int header_length, minimum_instruction_length, line_range,
-		 opcode_base;
-    /* unsigned char *standard_opcode_lengths; */
-
-    /* The registers. */
-    unsigned long addr = 0;
-    unsigned int file = 1;
-    unsigned int line = 1;
-    /* unsigned int column = 0; */
-    int is_stmt;
-    /* int basic_block = 0; */
-    /* int end_sequence = 0; */
-    /* int prologue_end = 0; */
-    /* int epilogue_begin = 0; */
-    /* unsigned int isa = 0; */
-
-    p = *debug_line;
-
-    unit_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
-    if (unit_length == 0xffffffff) {
-	unit_length = *(unsigned long *)p;
-	p += sizeof(unsigned long);
+    const char *p = *pp;
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
     }
 
-    cu_end = p + unit_length;
-
-    /*dwarf_version = *(unsigned short *)p;*/
-    p += 2;
+    header->cu_end = p + header->unit_length;
 
-    header_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
+    header->version = *(uint16_t *)p;
+    p += sizeof(uint16_t);
+    if (header->version > 5) return -1;
 
-    cu_start = p + header_length;
+    if (header->version >= 5) {
+        /* address_size = *(uint8_t *)p++; */
+        /* segment_selector_size = *(uint8_t *)p++; */
+        p += 2;
+    }
 
-    minimum_instruction_length = *(unsigned char *)p;
-    p++;
+    header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+    p += header->format;
+    header->cu_start = p + header->header_length;
 
-    is_stmt = default_is_stmt = *(unsigned char *)p;
-    p++;
+    header->minimum_instruction_length = *(uint8_t *)p++;
 
-    line_base = *(signed char *)p;
-    p++;
+    if (header->version >= 4) {
+        /* maximum_operations_per_instruction = *(uint8_t *)p; */
+        if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+        p++;
+    }
 
-    line_range = *(unsigned char *)p;
-    p++;
+    header->default_is_stmt = *(uint8_t *)p++;
+    header->line_base = *(int8_t *)p++;
+    header->line_range = *(uint8_t *)p++;
+    header->opcode_base = *(uint8_t *)p++;
+    /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+    p += header->opcode_base - 1;
+
+    if (header->version >= 5) {
+        header->include_directories = p;
+        p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL, errout);
+        header->filenames = p;
+    }
+    else {
+        header->include_directories = p;
 
-    opcode_base = *(unsigned char *)p;
-    p++;
+        /* temporary measure for compress-debug-sections */
+        if (p >= header->cu_end) return -1;
 
-    /* standard_opcode_lengths = (unsigned char *)p - 1; */
-    p += opcode_base - 1;
+        /* skip include directories */
+        while (*p) {
+            p = memchr(p, '\0', header->cu_end - p);
+            if (!p) return -1;
+            p++;
+        }
+        p++;
 
-    include_directories = p;
+        header->filenames = p;
+    }
 
-    /* temporary measure for compress-debug-sections */
-    if (p >= cu_end) return -1;
+    *pp = header->cu_start;
 
-    /* skip include directories */
-    while (*p) {
-	p = memchr(p, '\0', cu_end - p);
-	if (!p) return -1;
-	p++;
-    }
-    p++;
+    return 0;
+}
 
-    filenames = p;
+static int
+parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
+                obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    const char *p = (const char *)*debug_line;
+    struct LineNumberProgramHeader header;
 
-    p = cu_start;
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
 
-#define FILL_LINE()						    \
-    do {							    \
-	fill_line(num_traces, traces, addr, file, line,		    \
-		  include_directories, filenames,		    \
-		  obj, lines, offset);				    \
-	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
+    if (parse_debug_line_header(obj, &p, &header, errout))
+        return -1;
+    is_stmt = header.default_is_stmt;
+
+#define FILL_LINE()                                                 \
+    do {                                                            \
+        fill_line(num_traces, traces, addr, file, line,             \
+                  header.format,                                    \
+                  header.version,                                   \
+                  header.include_directories,                       \
+                  header.filenames,                                 \
+                  obj, lines, offset, errout);                      \
+        /*basic_block = prologue_end = epilogue_begin = 0;*/        \
     } while (0)
 
-    while (p < cu_end) {
-	unsigned long a;
-	unsigned char op = *p++;
-	switch (op) {
-	case DW_LNS_copy:
-	    FILL_LINE();
-	    break;
-	case DW_LNS_advance_pc:
-	    a = uleb128(&p);
-	    addr += a;
-	    break;
-	case DW_LNS_advance_line: {
-	    long a = sleb128(&p);
-	    line += a;
-	    break;
-	}
-	case DW_LNS_set_file:
-	    file = (unsigned int)uleb128(&p);
-	    break;
-	case DW_LNS_set_column:
-	    /*column = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case DW_LNS_negate_stmt:
-	    is_stmt = !is_stmt;
-	    break;
-	case DW_LNS_set_basic_block:
-	    /*basic_block = 1; */
-	    break;
-	case DW_LNS_const_add_pc:
-	    a = ((255 - opcode_base) / line_range) *
-		minimum_instruction_length;
-	    addr += a;
-	    break;
-	case DW_LNS_fixed_advance_pc:
-	    a = *(unsigned char *)p++;
-	    addr += a;
-	    break;
-	case DW_LNS_set_prologue_end:
-	    /* prologue_end = 1; */
-	    break;
-	case DW_LNS_set_epilogue_begin:
-	    /* epilogue_begin = 1; */
-	    break;
-	case DW_LNS_set_isa:
-	    /* isa = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case 0:
-	    a = *(unsigned char *)p++;
-	    op = *p++;
-	    switch (op) {
-	    case DW_LNE_end_sequence:
-		/* end_sequence = 1; */
-		FILL_LINE();
-		addr = 0;
-		file = 1;
-		line = 1;
-		/* column = 0; */
-		is_stmt = default_is_stmt;
-		/* end_sequence = 0; */
-		/* isa = 0; */
-		break;
-	    case DW_LNE_set_address:
-		addr = *(unsigned long *)p;
-		p += sizeof(unsigned long);
-		break;
-	    case DW_LNE_define_file:
-		kprintf("Unsupported operation in %s\n",
-			binary_filename);
-		break;
-	    case DW_LNE_set_discriminator:
-		/* TODO:currently ignore */
-		uleb128(&p);
-		break;
-	    default:
-		kprintf("Unknown extended opcode: %d in %s\n",
-			op, binary_filename);
-	    }
-	    break;
-	default: {
-	    unsigned long addr_incr;
-	    unsigned long line_incr;
-	    a = op - opcode_base;
-	    addr_incr = (a / line_range) * minimum_instruction_length;
-	    line_incr = line_base + (a % line_range);
-	    addr += (unsigned int)addr_incr;
-	    line += (unsigned int)line_incr;
-	    FILL_LINE();
-	}
-	}
-    }
-    *debug_line = p;
+    while (p < header.cu_end) {
+        unsigned long a;
+        unsigned char op = *p++;
+        switch (op) {
+        case DW_LNS_copy:
+            FILL_LINE();
+            break;
+        case DW_LNS_advance_pc:
+            a = uleb128(&p) * header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_advance_line: {
+            long a = sleb128(&p);
+            line += a;
+            break;
+        }
+        case DW_LNS_set_file:
+            file = (unsigned int)uleb128(&p);
+            break;
+        case DW_LNS_set_column:
+            /*column = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case DW_LNS_negate_stmt:
+            is_stmt = !is_stmt;
+            break;
+        case DW_LNS_set_basic_block:
+            /*basic_block = 1; */
+            break;
+        case DW_LNS_const_add_pc:
+            a = ((255UL - header.opcode_base) / header.line_range) *
+                header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_fixed_advance_pc:
+            a = *(uint16_t *)p;
+            p += sizeof(uint16_t);
+            addr += a;
+            break;
+        case DW_LNS_set_prologue_end:
+            /* prologue_end = 1; */
+            break;
+        case DW_LNS_set_epilogue_begin:
+            /* epilogue_begin = 1; */
+            break;
+        case DW_LNS_set_isa:
+            /* isa = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case 0:
+            a = uleb128(&p);
+            op = *p++;
+            switch (op) {
+            case DW_LNE_end_sequence:
+                /* end_sequence = 1; */
+                FILL_LINE();
+                addr = 0;
+                file = 1;
+                line = 1;
+                /* column = 0; */
+                is_stmt = header.default_is_stmt;
+                /* end_sequence = 0; */
+                /* isa = 0; */
+                break;
+            case DW_LNE_set_address:
+                addr = *(unsigned long *)p;
+                p += sizeof(unsigned long);
+                break;
+            case DW_LNE_define_file:
+                kprintf("Unsupported operation in %s\n",
+                        binary_filename);
+                break;
+            case DW_LNE_set_discriminator:
+                /* TODO:currently ignore */
+                uleb128(&p);
+                break;
+            default:
+                kprintf("Unknown extended opcode: %d in %s\n",
+                        op, binary_filename);
+            }
+            break;
+        default: {
+            uint8_t adjusted_opcode = op - header.opcode_base;
+            uint8_t operation_advance = adjusted_opcode / header.line_range;
+            /* NOTE: this code doesn't support VLIW */
+            addr += operation_advance * header.minimum_instruction_length;
+            line += header.line_base + (adjusted_opcode % header.line_range);
+            FILL_LINE();
+        }
+        }
+    }
+    *debug_line = (char *)p;
     return 0;
 }
 
 static int
 parse_debug_line(int num_traces, void **traces,
-		 char *debug_line, unsigned long size,
-		 obj_info_t *obj, line_info_t *lines, int offset)
+                 const char *debug_line, unsigned long size,
+                 obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
 {
-    char *debug_line_end = debug_line + size;
+    const char *debug_line_end = debug_line + size;
     while (debug_line < debug_line_end) {
-	if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
-	    return -1;
+        if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset, errout))
+            return -1;
     }
     if (debug_line != debug_line_end) {
-	kprintf("Unexpected size of .debug_line in %s\n",
-		binary_filename);
+        kprintf("Unexpected size of .debug_line in %s\n",
+                binary_filename);
     }
     return 0;
 }
@@ -429,7 +574,7 @@ parse_debug_line(int num_traces, void **traces,
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset);
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout);
 
 static void
 append_obj(obj_info_t **objp)
@@ -439,13 +584,26 @@ append_obj(obj_info_t **objp)
     *objp = newobj;
 }
 
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ *   - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ *   - /usr/bin/ruby.debug
+ *   - /usr/bin/.debug/ruby.debug
+ *   - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
 static void
 follow_debuglink(const char *debuglink, int num_traces, void **traces,
-		 obj_info_t **objp, line_info_t *lines, int offset)
+                 obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
 {
-    /* Ideally we should check 4 paths to follow gnu_debuglink,
-       but we handle only one case for now as this format is used
-       by some linux distributions. See GDB's info for detail. */
     static const char global_debug_dir[] = "/usr/lib/debug";
     const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
     char *p;
@@ -454,13 +612,13 @@ follow_debuglink(const char *debuglink, int num_traces, void **traces,
 
     p = strrchr(binary_filename, '/');
     if (!p) {
-	return;
+        return;
     }
     p[1] = '\0';
 
     len = strlen(binary_filename);
     if (len >= PATH_MAX - global_debug_dir_len)
-	len = PATH_MAX - global_debug_dir_len - 1;
+        len = PATH_MAX - global_debug_dir_len - 1;
     memmove(binary_filename + global_debug_dir_len, binary_filename, len);
     memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
     len += global_debug_dir_len;
@@ -470,20 +628,1440 @@ follow_debuglink(const char *debuglink, int num_traces, void **traces,
     o2 = *objp;
     o2->base_addr = o1->base_addr;
     o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset);
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+                          obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+    static const char debug_suffix[] = ".debug";
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
+    obj_info_t *o1 = *objp, *o2;
+    size_t i;
+
+    if (PATH_MAX < global_debug_dir_len + build_id_size * 2 + sizeof(debug_suffix)) return;
+
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    p = binary_filename + global_debug_dir_len;
+    for (i = 0; i < build_id_size; i++) {
+        static const char tbl[] = "0123456789abcdef";
+        unsigned char n = build_id[i];
+        *p++ = tbl[n / 16];
+        *p++ = tbl[n % 16];
+        if (i == 0) *p++ = '/';
+    }
+    memcpy(p, debug_suffix, sizeof(debug_suffix));
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+#endif
+
+enum
+{
+    DW_TAG_compile_unit = 0x11,
+    DW_TAG_inlined_subroutine = 0x1d,
+    DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+    DW_AT_sibling = 0x01,
+    DW_AT_location = 0x02,
+    DW_AT_name = 0x03,
+    /* Reserved 0x04 */
+    /* Reserved 0x05 */
+    /* Reserved 0x06 */
+    /* Reserved 0x07 */
+    /* Reserved 0x08 */
+    DW_AT_ordering = 0x09,
+    /* Reserved 0x0a */
+    DW_AT_byte_size = 0x0b,
+    /* Reserved 0x0c */
+    DW_AT_bit_size = 0x0d,
+    /* Reserved 0x0e */
+    /* Reserved 0x0f */
+    DW_AT_stmt_list = 0x10,
+    DW_AT_low_pc = 0x11,
+    DW_AT_high_pc = 0x12,
+    DW_AT_language = 0x13,
+    /* Reserved 0x14 */
+    DW_AT_discr = 0x15,
+    DW_AT_discr_value = 0x16,
+    DW_AT_visibility = 0x17,
+    DW_AT_import = 0x18,
+    DW_AT_string_length = 0x19,
+    DW_AT_common_reference = 0x1a,
+    DW_AT_comp_dir = 0x1b,
+    DW_AT_const_value = 0x1c,
+    DW_AT_containing_type = 0x1d,
+    DW_AT_default_value = 0x1e,
+    /* Reserved 0x1f */
+    DW_AT_inline = 0x20,
+    DW_AT_is_optional = 0x21,
+    DW_AT_lower_bound = 0x22,
+    /* Reserved 0x23 */
+    /* Reserved 0x24 */
+    DW_AT_producer = 0x25,
+    /* Reserved 0x26 */
+    DW_AT_prototyped = 0x27,
+    /* Reserved 0x28 */
+    /* Reserved 0x29 */
+    DW_AT_return_addr = 0x2a,
+    /* Reserved 0x2b */
+    DW_AT_start_scope = 0x2c,
+    /* Reserved 0x2d */
+    DW_AT_bit_stride = 0x2e,
+    DW_AT_upper_bound = 0x2f,
+    /* Reserved 0x30 */
+    DW_AT_abstract_origin = 0x31,
+    DW_AT_accessibility = 0x32,
+    DW_AT_address_class = 0x33,
+    DW_AT_artificial = 0x34,
+    DW_AT_base_types = 0x35,
+    DW_AT_calling_convention = 0x36,
+    DW_AT_count = 0x37,
+    DW_AT_data_member_location = 0x38,
+    DW_AT_decl_column = 0x39,
+    DW_AT_decl_file = 0x3a,
+    DW_AT_decl_line = 0x3b,
+    DW_AT_declaration = 0x3c,
+    DW_AT_discr_list = 0x3d,
+    DW_AT_encoding = 0x3e,
+    DW_AT_external = 0x3f,
+    DW_AT_frame_base = 0x40,
+    DW_AT_friend = 0x41,
+    DW_AT_identifier_case = 0x42,
+    /* Reserved 0x43 */
+    DW_AT_namelist_item = 0x44,
+    DW_AT_priority = 0x45,
+    DW_AT_segment = 0x46,
+    DW_AT_specification = 0x47,
+    DW_AT_static_link = 0x48,
+    DW_AT_type = 0x49,
+    DW_AT_use_location = 0x4a,
+    DW_AT_variable_parameter = 0x4b,
+    DW_AT_virtuality = 0x4c,
+    DW_AT_vtable_elem_location = 0x4d,
+    DW_AT_allocated = 0x4e,
+    DW_AT_associated = 0x4f,
+    DW_AT_data_location = 0x50,
+    DW_AT_byte_stride = 0x51,
+    DW_AT_entry_pc = 0x52,
+    DW_AT_use_UTF8 = 0x53,
+    DW_AT_extension = 0x54,
+    DW_AT_ranges = 0x55,
+    DW_AT_trampoline = 0x56,
+    DW_AT_call_column = 0x57,
+    DW_AT_call_file = 0x58,
+    DW_AT_call_line = 0x59,
+    DW_AT_description = 0x5a,
+    DW_AT_binary_scale = 0x5b,
+    DW_AT_decimal_scale = 0x5c,
+    DW_AT_small = 0x5d,
+    DW_AT_decimal_sign = 0x5e,
+    DW_AT_digit_count = 0x5f,
+    DW_AT_picture_string = 0x60,
+    DW_AT_mutable = 0x61,
+    DW_AT_threads_scaled = 0x62,
+    DW_AT_explicit = 0x63,
+    DW_AT_object_pointer = 0x64,
+    DW_AT_endianity = 0x65,
+    DW_AT_elemental = 0x66,
+    DW_AT_pure = 0x67,
+    DW_AT_recursive = 0x68,
+    DW_AT_signature = 0x69,
+    DW_AT_main_subprogram = 0x6a,
+    DW_AT_data_bit_offset = 0x6b,
+    DW_AT_const_expr = 0x6c,
+    DW_AT_enum_class = 0x6d,
+    DW_AT_linkage_name = 0x6e,
+    DW_AT_string_length_bit_size = 0x6f,
+    DW_AT_string_length_byte_size = 0x70,
+    DW_AT_rank = 0x71,
+    DW_AT_str_offsets_base = 0x72,
+    DW_AT_addr_base = 0x73,
+    DW_AT_rnglists_base = 0x74,
+    /* Reserved 0x75 */
+    DW_AT_dwo_name = 0x76,
+    DW_AT_reference = 0x77,
+    DW_AT_rvalue_reference = 0x78,
+    DW_AT_macros = 0x79,
+    DW_AT_call_all_calls = 0x7a,
+    DW_AT_call_all_source_calls = 0x7b,
+    DW_AT_call_all_tail_calls = 0x7c,
+    DW_AT_call_return_pc = 0x7d,
+    DW_AT_call_value = 0x7e,
+    DW_AT_call_origin = 0x7f,
+    DW_AT_call_parameter = 0x80,
+    DW_AT_call_pc = 0x81,
+    DW_AT_call_tail_call = 0x82,
+    DW_AT_call_target = 0x83,
+    DW_AT_call_target_clobbered = 0x84,
+    DW_AT_call_data_location = 0x85,
+    DW_AT_call_data_value = 0x86,
+    DW_AT_noreturn = 0x87,
+    DW_AT_alignment = 0x88,
+    DW_AT_export_symbols = 0x89,
+    DW_AT_deleted = 0x8a,
+    DW_AT_defaulted = 0x8b,
+    DW_AT_loclists_base = 0x8c,
+    DW_AT_lo_user = 0x2000,
+    DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+    DW_FORM_addr = 0x01,
+    /* Reserved 0x02 */
+    DW_FORM_block2 = 0x03,
+    DW_FORM_block4 = 0x04,
+    DW_FORM_data2 = 0x05,
+    DW_FORM_data4 = 0x06,
+    DW_FORM_data8 = 0x07,
+    DW_FORM_string = 0x08,
+    DW_FORM_block = 0x09,
+    DW_FORM_block1 = 0x0a,
+    DW_FORM_data1 = 0x0b,
+    DW_FORM_flag = 0x0c,
+    DW_FORM_sdata = 0x0d,
+    DW_FORM_strp = 0x0e,
+    DW_FORM_udata = 0x0f,
+    DW_FORM_ref_addr = 0x10,
+    DW_FORM_ref1 = 0x11,
+    DW_FORM_ref2 = 0x12,
+    DW_FORM_ref4 = 0x13,
+    DW_FORM_ref8 = 0x14,
+    DW_FORM_ref_udata = 0x15,
+    DW_FORM_indirect = 0x16,
+    DW_FORM_sec_offset = 0x17,
+    DW_FORM_exprloc = 0x18,
+    DW_FORM_flag_present = 0x19,
+    DW_FORM_strx = 0x1a,
+    DW_FORM_addrx = 0x1b,
+    DW_FORM_ref_sup4 = 0x1c,
+    DW_FORM_strp_sup = 0x1d,
+    DW_FORM_data16 = 0x1e,
+    DW_FORM_line_strp = 0x1f,
+    DW_FORM_ref_sig8 = 0x20,
+    DW_FORM_implicit_const = 0x21,
+    DW_FORM_loclistx = 0x22,
+    DW_FORM_rnglistx = 0x23,
+    DW_FORM_ref_sup8 = 0x24,
+    DW_FORM_strx1 = 0x25,
+    DW_FORM_strx2 = 0x26,
+    DW_FORM_strx3 = 0x27,
+    DW_FORM_strx4 = 0x28,
+    DW_FORM_addrx1 = 0x29,
+    DW_FORM_addrx2 = 0x2a,
+    DW_FORM_addrx3 = 0x2b,
+    DW_FORM_addrx4 = 0x2c,
+
+    /* GNU extensions for referring to .gnu_debugaltlink dwz-compressed info */
+    DW_FORM_GNU_ref_alt = 0x1f20,
+    DW_FORM_GNU_strp_alt = 0x1f21
+};
+
+/* Range list entry encodings */
+enum {
+    DW_RLE_end_of_list = 0x00,
+    DW_RLE_base_addressx = 0x01,
+    DW_RLE_startx_endx = 0x02,
+    DW_RLE_startx_length = 0x03,
+    DW_RLE_offset_pair = 0x04,
+    DW_RLE_base_address = 0x05,
+    DW_RLE_start_end = 0x06,
+    DW_RLE_start_length = 0x07
+};
+
+enum {
+    VAL_none = 0,
+    VAL_cstr = 1,
+    VAL_data = 2,
+    VAL_uint = 3,
+    VAL_int = 4,
+    VAL_addr = 5
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+    obj_info_t *obj;
+    const char *file;
+    uint8_t current_version;
+    const char *current_cu;
+    uint64_t current_low_pc;
+    uint64_t current_str_offsets_base;
+    uint64_t current_addr_base;
+    uint64_t current_rnglists_base;
+    const char *debug_line_cu_end;
+    uint8_t debug_line_format;
+    uint16_t debug_line_version;
+    const char *debug_line_files;
+    const char *debug_line_directories;
+    const char *p;
+    const char *cu_end;
+    const char *pend;
+    const char *q0;
+    const char *q;
+    int format; // 4 or 8
+    uint8_t address_size;
+    int level;
+    const char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+    ptrdiff_t pos;
+    int tag;
+    int has_children;
+} DIE;
+
+typedef struct {
+    union {
+        const char *ptr;
+        uint64_t uint64;
+        int64_t int64;
+        uint64_t addr_idx;
+    } as;
+    uint64_t off;
+    uint64_t at;
+    uint64_t form;
+    size_t size;
+    int type;
+} DebugInfoValue;
+
+#if defined(WORDS_BIGENDIAN)
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
+#else
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+#endif
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+    return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+    return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+    return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 1);
+    return (uint8_t)*p;
+}
+
+static uint16_t
+read_uint16(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 2);
+    return get_uint16((const uint8_t *)p);
+}
+
+static uint32_t
+read_uint24(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 3);
+    return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
+}
+
+static uint32_t
+read_uint32(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 4);
+    return get_uint32((const uint8_t *)p);
+}
+
+static uint64_t
+read_uint64(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + 8);
+    return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+    return get_uint64(p);
+#else
+    return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+    if (reader->format == 4) {
+        return read_uint32(&reader->p);
+    } else { /* 64 bit */
+        return read_uint64(&reader->p);
+    }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+    return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+    return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+    reader->file = obj->mapped;
+    reader->obj = obj;
+    reader->p = obj->debug_info.ptr;
+    reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+    reader->debug_line_cu_end = obj->debug_line.ptr;
+    reader->current_low_pc = 0;
+    reader->current_str_offsets_base = 0;
+    reader->current_addr_base = 0;
+    reader->current_rnglists_base = 0;
+}
+
+static void
+di_skip_die_attributes(const char **p)
+{
+    for (;;) {
+        uint64_t at = uleb128(p);
+        uint64_t form = uleb128(p);
+        if (!at && !form) break;
+        switch (form) {
+          default:
+            break;
+          case DW_FORM_implicit_const:
+            sleb128(p);
+            break;
+        }
+    }
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+    uint64_t prev = 0;
+    const char *p = reader->q0;
+    for (;;) {
+        uint64_t abbrev_number = uleb128(&p);
+        if (abbrev_number <= prev) break;
+        if (abbrev_number < ABBREV_TABLE_SIZE) {
+            reader->abbrev_table[abbrev_number] = p;
+        }
+        prev = abbrev_number;
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader, FILE *errout)
+{
+    const char *p;
+    struct LineNumberProgramHeader header;
+
+    p = (const char *)reader->debug_line_cu_end;
+    if (parse_debug_line_header(reader->obj, &p, &header, errout))
+        return -1;
+
+    reader->debug_line_cu_end = (char *)header.cu_end;
+    reader->debug_line_format = header.format;
+    reader->debug_line_version = header.version;
+    reader->debug_line_directories = (char *)header.include_directories;
+    reader->debug_line_files = (char *)header.filenames;
+
+    return 0;
+}
+
+static void
+set_addr_idx_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.addr_idx = n;
+    v->type = VAL_addr;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.uint64 = n;
+    v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+    v->as.int64 = n;
+    v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->off = 0;
+    v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
+{
+    v->as.ptr = s;
+    v->off = off;
+    v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+    if (v->as.ptr) {
+        return v->as.ptr + v->off;
+    } else {
+        return NULL;
+    }
+}
+
+static const char *
+resolve_strx(DebugInfoReader *reader, uint64_t idx)
+{
+    const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
+    uint64_t off;
+    if (reader->format == 4) {
+        off = ((uint32_t *)p)[idx];
+    }
+    else {
+        off = ((uint64_t *)p)[idx];
+    }
+    return reader->obj->debug_str.ptr + off;
+}
+
+static bool
+debug_info_reader_read_addr_value_member(DebugInfoReader *reader, DebugInfoValue *v, int size)
+{
+    if (size == 4) {
+        set_uint_value(v, read_uint32(&reader->p));
+    } else if (size == 8) {
+        set_uint_value(v, read_uint64(&reader->p));
+    } else {
+        return false;
+    }
+    return true;
+}
+
+#define debug_info_reader_read_addr_value(reader, v, mem) \
+    if (!debug_info_reader_read_addr_value_member((reader), (v), (reader)->mem)) { \
+        kprintf("unknown " #mem ":%d", (reader)->mem); \
+        return false; \
+    }
+
+
+static bool
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v, FILE *errout)
+{
+    switch (form) {
+      case DW_FORM_addr:
+        debug_info_reader_read_addr_value(reader, v, address_size);
+        break;
+      case DW_FORM_block2:
+        v->size = read_uint16(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block4:
+        v->size = read_uint32(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_data4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_data8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_string:
+        v->size = strlen(reader->p);
+        set_cstr_value(v, reader->p);
+        reader->p += v->size + 1;
+        break;
+      case DW_FORM_block:
+        v->size = uleb128(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block1:
+        v->size = read_uint8(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_flag:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_sdata:
+        set_int_value(v, read_sleb128(reader));
+        break;
+      case DW_FORM_strp:
+        set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_udata:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_addr:
+        if (reader->current_version <= 2) {
+            // DWARF Version 2 specifies that references have
+            // the same size as an address on the target system
+            debug_info_reader_read_addr_value(reader, v, address_size);
+        } else {
+            debug_info_reader_read_addr_value(reader, v, format);
+        }
+        break;
+      case DW_FORM_ref1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_ref2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_ref4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_ref8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_ref_udata:
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_indirect:
+        /* TODO: read the referred value */
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_sec_offset:
+        set_uint_value(v, read_uint(reader)); /* offset */
+        /* addrptr: debug_addr */
+        /* lineptr: debug_line */
+        /* loclist: debug_loclists */
+        /* loclistptr: debug_loclists */
+        /* macptr: debug_macro */
+        /* rnglist: debug_rnglists */
+        /* rnglistptr: debug_rnglists */
+        /* stroffsetsptr: debug_str_offsets */
+        break;
+      case DW_FORM_exprloc:
+        v->size = (size_t)read_uleb128(reader);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_flag_present:
+        set_uint_value(v, 1);
+        break;
+      case DW_FORM_strx:
+        set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
+        break;
+      case DW_FORM_addrx:
+        set_addr_idx_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_ref_sup4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_strp_sup:
+        set_uint_value(v, read_uint(reader));
+        /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+        break;
+      case DW_FORM_data16:
+        v->size = 16;
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_line_strp:
+        set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_ref_sig8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_implicit_const:
+        set_int_value(v, sleb128(&reader->q));
+        break;
+      case DW_FORM_loclistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_rnglistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_sup8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_strx1:
+        set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
+        break;
+      case DW_FORM_strx2:
+        set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
+        break;
+      case DW_FORM_strx3:
+        set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
+        break;
+      case DW_FORM_strx4:
+        set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
+        break;
+      case DW_FORM_addrx1:
+        set_addr_idx_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_addrx2:
+        set_addr_idx_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_addrx3:
+        set_addr_idx_value(v, read_uint24(&reader->p));
+        break;
+      case DW_FORM_addrx4:
+        set_addr_idx_value(v, read_uint32(&reader->p));
+        break;
+      /* we have no support for actually reading the real values of these refs out
+       * of the .gnu_debugaltlink dwz-compressed debuginfo at the moment, but "read"
+       * them anyway so that we advance the reader by the right amount. */
+      case DW_FORM_GNU_ref_alt:
+      case DW_FORM_GNU_strp_alt:
+        read_uint(reader);
+        set_uint_value(v, 0);
+        break;
+      case 0:
+        goto fail;
+        break;
+    }
+    return true;
+
+  fail:
+    kprintf("%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+    return false;
+}
+
+/* find abbrev in current compilation unit */
+static const char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number, FILE *errout)
+{
+    const char *p;
+    if (abbrev_number < ABBREV_TABLE_SIZE) {
+        return reader->abbrev_table[abbrev_number];
+    }
+    p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+    /* skip 255th record */
+    uleb128(&p); /* tag */
+    p++; /* has_children */
+    di_skip_die_attributes(&p);
+    for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+        if (n == 0) {
+            kprintf("%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+            return NULL;
+        }
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+    return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n, FILE *errout)
+{
+    size_t i;
+    kprintf("     0  1  2  3  4  5  6  7  8  9  A  B  C  D  E  F\n");
+    for (i=0; i < n; i++){
+        switch (i & 15) {
+          case 0:
+            kprintf("%02" PRIdSIZE ": %02X ", i/16, p[i]);
+            break;
+          case 15:
+            kprintf("%02X\n", p[i]);
+            break;
+          default:
+            kprintf("%02X ", p[i]);
+            break;
+        }
+    }
+    if ((i & 15) != 15) {
+        kprintf("\n");
+    }
+}
+#define hexdump(p,n,e) hexdump0((const unsigned char *)p, n, e)
+
+static void
+div_inspect(DebugInfoValue *v, FILE *errout)
+{
+    switch (v->type) {
+      case VAL_uint:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
+        break;
+      case VAL_int:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+        break;
+      case VAL_cstr:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+        break;
+      case VAL_data:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
+        hexdump(v->as.ptr, 16, errout);
+        break;
+    }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die, FILE *errout)
+{
+    uint64_t abbrev_number = uleb128(&reader->p);
+    if (abbrev_number == 0) {
+        reader->level--;
+        return NULL;
+    }
+
+    if (!(reader->q = di_find_abbrev(reader, abbrev_number, errout))) return NULL;
+
+    die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+    die->tag = (int)uleb128(&reader->q); /* tag */
+    die->has_children = *reader->q++; /* has_children */
+    if (die->has_children) {
+        reader->level++;
+    }
+    return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp, FILE *errout)
+{
+    uint64_t at = uleb128(&reader->q);
+    uint64_t form = uleb128(&reader->q);
+    if (!at || !form) return NULL;
+    vp->at = at;
+    vp->form = form;
+    if (!debug_info_reader_read_value(reader, form, vp, errout)) return NULL;
+    return vp;
+}
+
+static bool
+di_skip_records(DebugInfoReader *reader, FILE *errout)
+{
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        uint64_t at = uleb128(&reader->q);
+        uint64_t form = uleb128(&reader->q);
+        if (!at || !form) return true;
+        if (!debug_info_reader_read_value(reader, form, &v, errout)) return false;
+    }
+}
+
+typedef struct addr_header {
+    const char *ptr;
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    /* uint8_t segment_selector_size; */
+} addr_header_t;
+
+static bool
+addr_header_init(obj_info_t *obj, addr_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_addr.ptr;
+
+    header->ptr = p;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    return true;
+}
+
+static uint64_t
+read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
+    if (header->address_size == 4) {
+        return ((uint32_t*)(header->ptr + addr_base))[idx];
+    }
+    else {
+        return ((uint64_t*)(header->ptr + addr_base))[idx];
+    }
+}
+
+typedef struct rnglists_header {
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    uint32_t offset_entry_count;
+} rnglists_header_t;
+
+static bool
+rnglists_header_init(obj_info_t *obj, rnglists_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_rnglists.ptr;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    header->offset_entry_count = *(uint32_t *)p;
+    return true;
+}
+
+typedef struct {
+    uint64_t low_pc;
+    uint64_t high_pc;
+    uint64_t ranges;
+    bool low_pc_set;
+    bool high_pc_set;
+    bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
+{
+    uint64_t n = 0;
+    if (v->type == VAL_uint) {
+        n = v->as.uint64;
+    }
+    else if (v->type == VAL_addr) {
+        n = read_addr(addr_header, addr_base, v->as.addr_idx);
+    }
+    switch (v->at) {
+      case DW_AT_low_pc:
+        ptr->low_pc = n;
+        ptr->low_pc_set = true;
+        break;
+      case DW_AT_high_pc:
+        if (v->form == DW_FORM_addr) {
+            ptr->high_pc = n;
+        }
+        else {
+            ptr->high_pc = ptr->low_pc + n;
+        }
+        ptr->high_pc_set = true;
+        break;
+      case DW_AT_ranges:
+        ptr->ranges = n;
+        ptr->ranges_set = true;
+        break;
+    }
+}
+
+static uint64_t
+read_dw_form_addr(DebugInfoReader *reader, const char **ptr, FILE *errout)
+{
+    const char *p = *ptr;
+    *ptr = p + reader->address_size;
+    if (reader->address_size == 4) {
+        return read_uint32(&p);
+    } else {
+        return read_uint64(&p);
+    }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            return UINTPTR_MAX;
+        }
+        if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    else if (ptr->ranges_set) {
+        /* TODO: support base address selection entry */
+        const char *p;
+        uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+        bool base_valid = true;
+        if (reader->current_version >= 5) {
+            if (rnglists_header->offset_entry_count == 0) {
+                // DW_FORM_sec_offset
+                p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
+            }
+            else {
+                // DW_FORM_rnglistx
+                const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
+                if (rnglists_header->format == 4) {
+                    p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
+                }
+                else {
+                    p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
+                }
+            }
+            for (;;) {
+                uint8_t rle = read_uint8(&p);
+                uintptr_t from = 0, to = 0;
+                if (rle == DW_RLE_end_of_list) break;
+                switch (rle) {
+                  case DW_RLE_base_addressx:
+                    uleb128(&p);
+                    base_valid = false; /* not supported yet */
+                    break;
+                  case DW_RLE_startx_endx:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_startx_length:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_offset_pair:
+                    if (!base_valid) break;
+                    from = (uintptr_t)base + uleb128(&p);
+                    to = (uintptr_t)base + uleb128(&p);
+                    break;
+                  case DW_RLE_base_address:
+                    base = read_dw_form_addr(reader, &p, errout);
+                    base_valid = true;
+                    break;
+                  case DW_RLE_start_end:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    break;
+                  case DW_RLE_start_length:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = from + uleb128(&p);
+                    break;
+                }
+                if (from <= addr && addr < to) {
+                    return from;
+                }
+            }
+            return 0;
+        }
+        p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            if (from == UINTPTR_MAX) {
+                /* base address selection entry */
+                base = to;
+            }
+            else if (base + from <= addr && addr < base + to) {
+                return (uintptr_t)base + from;
+            }
+        }
+    }
+    else if (ptr->low_pc_set) {
+        if (ptr->low_pc == addr) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    return 0;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            kprintf("low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+            return;
+        }
+        kprintf("low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+    }
+    else if (ptr->ranges_set) {
+        char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        kprintf("low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            kprintf("%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+        }
+        kprintf("\n");
+    }
+    else if (ptr->low_pc_set) {
+        kprintf("low_pc:%"PRIx64"\n",ptr->low_pc);
+    }
+    else {
+        kprintf("empty\n");
+    }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader, FILE *errout)
+{
+    uint64_t unit_length;
+    uint16_t version;
+    uint64_t debug_abbrev_offset;
+    reader->format = 4;
+    reader->current_cu = reader->p;
+    unit_length = read_uint32(&reader->p);
+    if (unit_length == 0xffffffff) {
+        unit_length = read_uint64(&reader->p);
+        reader->format = 8;
+    }
+    reader->cu_end = reader->p + unit_length;
+    version = read_uint16(&reader->p);
+    reader->current_version = version;
+    if (version > 5) {
+        return -1;
+    }
+    else if (version == 5) {
+        /* unit_type = */ read_uint8(&reader->p);
+        reader->address_size = read_uint8(&reader->p);
+        debug_abbrev_offset = read_uint(reader);
+    }
+    else {
+        debug_abbrev_offset = read_uint(reader);
+        reader->address_size = read_uint8(&reader->p);
+    }
+    if (reader->address_size != 4 && reader->address_size != 8) {
+        kprintf("unknown address_size:%d", reader->address_size);
+        return -1;
+    }
+    reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+    reader->level = 0;
+    di_read_debug_abbrev_cu(reader);
+    if (di_read_debug_line_cu(reader, errout)) return -1;
+
+    do {
+        DIE die;
+
+        if (!di_read_die(reader, &die, errout)) continue;
+
+        if (die.tag != DW_TAG_compile_unit) {
+            if (!di_skip_records(reader, errout)) return -1;
+            break;
+        }
+
+        reader->current_str_offsets_base = 0;
+        reader->current_addr_base = 0;
+        reader->current_rnglists_base = 0;
+
+        DebugInfoValue low_pc = {{0}};
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            if (!di_read_record(reader, &v, errout)) break;
+            switch (v.at) {
+              case DW_AT_low_pc:
+                // clang may output DW_AT_addr_base after DW_AT_low_pc.
+                // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
+                low_pc = v;
+                break;
+              case DW_AT_str_offsets_base:
+                reader->current_str_offsets_base = v.as.uint64;
+                break;
+              case DW_AT_addr_base:
+                reader->current_addr_base = v.as.uint64;
+                break;
+              case DW_AT_rnglists_base:
+                reader->current_rnglists_base = v.as.uint64;
+                break;
+            }
+        }
+        // Resolve the DW_FORM_addr of DW_AT_low_pc
+        switch (low_pc.type) {
+            case VAL_uint:
+                reader->current_low_pc = low_pc.as.uint64;
+                break;
+            case VAL_addr:
+                {
+                    addr_header_t header = {0};
+                    if (!addr_header_init(reader->obj, &header, errout)) return -1;
+                    reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
+                }
+                break;
+        }
+    } while (0);
+
+    return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line, FILE *errout)
+{
+    const char *p = reader->p;
+    const char *q = reader->q;
+    int level = reader->level;
+    DIE die;
+
+    switch (form) {
+      case DW_FORM_ref1:
+      case DW_FORM_ref2:
+      case DW_FORM_ref4:
+      case DW_FORM_ref8:
+      case DW_FORM_ref_udata:
+        reader->p = reader->current_cu + abstract_origin;
+        break;
+      case DW_FORM_ref_addr:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sig8:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sup4:
+      case DW_FORM_ref_sup8:
+        goto finish; /* not supported yet */
+      default:
+        goto finish;
+    }
+    if (!di_read_die(reader, &die, errout)) goto finish;
+
+    /* enumerate abbrev */
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        if (!di_read_record(reader, &v, errout)) break;
+        switch (v.at) {
+          case DW_AT_name:
+            line->sname = get_cstr_value(&v);
+            break;
+        }
+    }
+
+  finish:
+    reader->p = p;
+    reader->q = q;
+    reader->level = level;
+}
+
+static bool
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+                line_info_t *lines, int offset, FILE *errout)
+{
+
+    addr_header_t addr_header = {0};
+    if (!addr_header_init(reader->obj, &addr_header, errout)) return false;
+
+    rnglists_header_t rnglists_header = {0};
+    if (!rnglists_header_init(reader->obj, &rnglists_header, errout)) return false;
+
+    while (reader->p < reader->cu_end) {
+        DIE die;
+        ranges_t ranges = {0};
+        line_info_t line = {0};
+
+        if (!di_read_die(reader, &die, errout)) continue;
+        /* kprintf("%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+        if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+          skip_die:
+            if (!di_skip_records(reader, errout)) return false;
+            continue;
+        }
+
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            /* ptrdiff_t pos = reader->p - reader->p0; */
+            if (!di_read_record(reader, &v, errout)) break;
+            /* kprintf("\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+            /* div_inspect(&v, errout); */
+            switch (v.at) {
+              case DW_AT_name:
+                line.sname = get_cstr_value(&v);
+                break;
+              case DW_AT_call_file:
+                fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj, errout);
+                break;
+              case DW_AT_call_line:
+                line.line = (int)v.as.uint64;
+                break;
+              case DW_AT_low_pc:
+              case DW_AT_high_pc:
+              case DW_AT_ranges:
+                ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
+                break;
+              case DW_AT_declaration:
+                goto skip_die;
+              case DW_AT_inline:
+                /* 1 or 3 */
+                break; /* goto skip_die; */
+              case DW_AT_abstract_origin:
+                read_abstract_origin(reader, v.form, v.as.uint64, &line, errout);
+                break; /* goto skip_die; */
+            }
+        }
+        /* ranges_inspect(reader, &ranges, errout); */
+        /* kprintf("%d:%tx: %x ",__LINE__,diepos,die.tag); */
+        for (int i=offset; i < num_traces; i++) {
+            uintptr_t addr = (uintptr_t)traces[i];
+            uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+            uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header, errout);
+            if (saddr == UINTPTR_MAX) return false;
+            if (saddr) {
+                /* kprintf("%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+                if (lines[i].sname) {
+                    line_info_t *lp = malloc(sizeof(line_info_t));
+                    memcpy(lp, &lines[i], sizeof(line_info_t));
+                    lines[i].next = lp;
+                    lp->dirname = line.dirname;
+                    lp->filename = line.filename;
+                    lp->line = line.line;
+                    lp->saddr = 0;
+                }
+                lines[i].path = reader->obj->path;
+                lines[i].base_addr = line.base_addr;
+                lines[i].sname = line.sname;
+                lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+            }
+        }
+    }
+    return true;
+}
+
+// This function parses the following attributes of Line Number Program Header in DWARF 5:
+//
+// * directory_entry_format_count
+// * directory_entry_format
+// * directories_count
+// * directories
+//
+// or
+//
+// * file_name_entry_format_count
+// * file_name_entry_format
+// * file_names_count
+// * file_names
+//
+// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
+static const char *
+parse_ver5_debug_line_header(const char *p, int idx, uint8_t format,
+                             obj_info_t *obj, const char **out_path,
+                             uint64_t *out_directory_index, FILE *errout)
+{
+    int i, j;
+    int entry_format_count = *(uint8_t *)p++;
+    const char *entry_format = p;
+
+    /* skip the part of entry_format */
+    for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
+
+    int entry_count = (int)uleb128(&p);
+
+    DebugInfoReader reader = {0};
+    debug_info_reader_init(&reader, obj);
+    reader.format = format;
+    reader.p = p;
+    for (j = 0; j < entry_count; j++) {
+        const char *format = entry_format;
+        for (i = 0; i < entry_format_count; i++) {
+            DebugInfoValue v = {{0}};
+            unsigned long dw_lnct = uleb128(&format);
+            unsigned long dw_form = uleb128(&format);
+            if (!debug_info_reader_read_value(&reader, dw_form, &v, errout)) return 0;
+            if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
+                *out_path = v.as.ptr + v.off;
+            if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
+                *out_directory_index = v.as.uint64;
+        }
+        if (j == idx) return 0;
+    }
+
+    return reader.p;
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+    *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+    ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+    unsigned long destsize = chdr->ch_size;
+    int ret = 0;
+
+    if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+        /* unsupported compression type */
+        return 0;
+    }
+
+    *ptr = malloc(destsize);
+    if (!*ptr) return 0;
+    ret = uncompress((Bytef *)*ptr, &destsize,
+            (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+            shdr->sh_size - sizeof(ElfW(Chdr)));
+    if (ret != Z_OK) goto fail;
+    return destsize;
+
+fail:
+    free(*ptr);
+    *ptr = NULL;
+#endif
+    return 0;
 }
 
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset)
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
 {
     int i, j;
     char *shstr;
-    char *section_name;
     ElfW(Ehdr) *ehdr;
     ElfW(Shdr) *shdr, *shstr_shdr;
-    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *note_gnu_build_id = NULL;
     int fd;
     off_t filesize;
     char *file;
@@ -491,47 +2069,44 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
     ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
     obj_info_t *obj = *objp;
     uintptr_t dladdr_fbase = 0;
-    bool compressed_p = false;
 
     fd = open(binary_filename, O_RDONLY);
     if (fd < 0) {
-	goto fail;
+        goto fail;
     }
     filesize = lseek(fd, 0, SEEK_END);
     if (filesize < 0) {
-	int e = errno;
-	close(fd);
-	kprintf("lseek: %s\n", strerror(e));
-	goto fail;
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
     }
 #if SIZEOF_OFF_T > SIZEOF_SIZE_T
     if (filesize > (off_t)SIZE_MAX) {
-	close(fd);
-	kprintf("Too large file %s\n", binary_filename);
-	goto fail;
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
     }
 #endif
     lseek(fd, 0, SEEK_SET);
     /* async-signal unsafe */
     file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
     if (file == MAP_FAILED) {
-	int e = errno;
-	close(fd);
-	kprintf("mmap: %s\n", strerror(e));
-	goto fail;
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
     }
+    close(fd);
 
     ehdr = (ElfW(Ehdr) *)file;
     if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
-	/*
-	 * Huh? Maybe filename was overridden by setproctitle() and
-	 * it match non-elf file.
-	 */
-	close(fd);
-	goto fail;
+        /*
+         * Huh? Maybe filename was overridden by setproctitle() and
+         * it match non-elf file.
+         */
+        goto fail;
     }
-
-    obj->fd = fd;
     obj->mapped = file;
     obj->mapped_size = (size_t)filesize;
 
@@ -541,157 +2116,506 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
     shstr = file + shstr_shdr->sh_offset;
 
     for (i = 0; i < ehdr->e_shnum; i++) {
-	section_name = shstr + shdr[i].sh_name;
-	switch (shdr[i].sh_type) {
-	  case SHT_STRTAB:
-	    if (!strcmp(section_name, ".strtab")) {
-		strtab_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".dynstr")) {
-		dynstr_shdr = shdr + i;
-	    }
-	    break;
-	  case SHT_SYMTAB:
-	    /* if (!strcmp(section_name, ".symtab")) */
-	    symtab_shdr = shdr + i;
-	    break;
-	  case SHT_DYNSYM:
-	    /* if (!strcmp(section_name, ".dynsym")) */
-	    dynsym_shdr = shdr + i;
-	    break;
-	  case SHT_PROGBITS:
-	    if (!strcmp(section_name, ".debug_line")) {
-		if (shdr[i].sh_flags & SHF_COMPRESSED) {
-		    compressed_p = true;
-		}
-		debug_line_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".gnu_debuglink")) {
-		gnu_debuglink_shdr = shdr + i;
-	    }
-	    break;
-	}
-    }
-
-    if (offset == -1) {
-	/* main executable */
-	offset = 0;
-	if (dynsym_shdr && dynstr_shdr) {
-	    char *strtab = file + dynstr_shdr->sh_offset;
-	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
-	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
-	    for (j = 0; j < symtab_count; j++) {
-		ElfW(Sym) *sym = &symtab[j];
-		Dl_info info;
-		void *h, *s;
-		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
-		if (!h) continue;
-		s = dlsym(h, strtab + sym->st_name);
-		if (!s) continue;
-		if (dladdr(s, &info)) {
-		    dladdr_fbase = (uintptr_t)info.dli_fbase;
-		    break;
-		}
-	    }
-	    if (ehdr->e_type == ET_EXEC) {
-		obj->base_addr = 0;
-	    }
-	    else {
-		/* PIE (position-independent executable) */
-		obj->base_addr = dladdr_fbase;
-	    }
-	}
-    }
-
-    if (!symtab_shdr) {
-	symtab_shdr = dynsym_shdr;
-	strtab_shdr = dynstr_shdr;
-    }
-
-    if (symtab_shdr && strtab_shdr) {
-	char *strtab = file + strtab_shdr->sh_offset;
-	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
-	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
-	for (j = 0; j < symtab_count; j++) {
-	    ElfW(Sym) *sym = &symtab[j];
-	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
-	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-	    for (i = offset; i < num_traces; i++) {
-		uintptr_t d = (uintptr_t)traces[i] - saddr;
-		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
-		    continue;
-		/* fill symbol name and addr from .symtab */
-		lines[i].sname = strtab + sym->st_name;
-		lines[i].saddr = saddr;
-		lines[i].path  = obj->path;
-		lines[i].base_addr = obj->base_addr;
-	    }
-	}
-    }
-
-    if (!debug_line_shdr) {
-	/* This file doesn't have .debug_line section,
-	   let's check .gnu_debuglink section instead. */
-	if (gnu_debuglink_shdr && check_debuglink) {
-	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
-			     num_traces, traces,
-			     objp, lines, offset);
-	}
-	goto finish;
-    }
-
-    if (!compressed_p &&
-	    parse_debug_line(num_traces, traces,
-			 file + debug_line_shdr->sh_offset,
-			 debug_line_shdr->sh_size,
-			 obj, lines, offset))
-	goto fail;
+        char *section_name = shstr + shdr[i].sh_name;
+        switch (shdr[i].sh_type) {
+          case SHT_STRTAB:
+            if (!strcmp(section_name, ".strtab")) {
+                strtab_shdr = shdr + i;
+            }
+            else if (!strcmp(section_name, ".dynstr")) {
+                dynstr_shdr = shdr + i;
+            }
+            break;
+          case SHT_SYMTAB:
+            /* if (!strcmp(section_name, ".symtab")) */
+            symtab_shdr = shdr + i;
+            break;
+          case SHT_DYNSYM:
+            /* if (!strcmp(section_name, ".dynsym")) */
+            dynsym_shdr = shdr + i;
+            break;
+          case SHT_NOTE:
+            if (!strcmp(section_name, ".note.gnu.build-id")) {
+                note_gnu_build_id = shdr + i;
+            }
+            break;
+          case SHT_PROGBITS:
+            if (!strcmp(section_name, ".gnu_debuglink")) {
+                gnu_debuglink_shdr = shdr + i;
+            }
+            else {
+                const char *debug_section_names[] = {
+                    ".debug_abbrev",
+                    ".debug_info",
+                    ".debug_line",
+                    ".debug_ranges",
+                    ".debug_str_offsets",
+                    ".debug_addr",
+                    ".debug_rnglists",
+                    ".debug_str",
+                    ".debug_line_str"
+                };
+
+                for (j=0; j < DWARF_SECTION_COUNT; j++) {
+                    struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                    if (strcmp(section_name, debug_section_names[j]) != 0)
+                        continue;
+
+                    s->ptr = file + shdr[i].sh_offset;
+                    s->size = shdr[i].sh_size;
+                    s->flags = shdr[i].sh_flags;
+                    if (s->flags & SHF_COMPRESSED) {
+                        s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+                        if (!s->size) goto fail;
+                    }
+                    break;
+                }
+            }
+            break;
+        }
+    }
+
+    if (offset == 0) {
+        /* main executable */
+        if (dynsym_shdr && dynstr_shdr) {
+            char *strtab = file + dynstr_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+            int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+            void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+            if (handle) {
+                for (j = 0; j < symtab_count; j++) {
+                    ElfW(Sym) *sym = &symtab[j];
+                    Dl_info info;
+                    void *s;
+                    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+                    s = dlsym(handle, strtab + sym->st_name);
+                    if (s && dladdr(s, &info)) {
+                        obj->base_addr = dladdr_fbase;
+                        dladdr_fbase = (uintptr_t)info.dli_fbase;
+                        break;
+                    }
+                }
+                dlclose(handle);
+            }
+            if (ehdr->e_type == ET_EXEC) {
+                obj->base_addr = 0;
+            }
+            else {
+                /* PIE (position-independent executable) */
+                obj->base_addr = dladdr_fbase;
+            }
+        }
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        i = 0;
+        while (reader.p < reader.pend) {
+            /* kprintf("%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+            if (di_read_cu(&reader, errout)) goto use_symtab;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto use_symtab;
+        }
+    }
+    else {
+        /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+        if (!symtab_shdr) {
+            /* This file doesn't have symtab, use dynsym instead */
+            symtab_shdr = dynsym_shdr;
+            strtab_shdr = dynstr_shdr;
+        }
+
+        if (symtab_shdr && strtab_shdr) {
+            char *strtab = file + strtab_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+            int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+            for (j = 0; j < symtab_count; j++) {
+                ElfW(Sym) *sym = &symtab[j];
+                uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+                if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+                for (i = offset; i < num_traces; i++) {
+                    uintptr_t d = (uintptr_t)traces[i] - saddr;
+                    if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+                        continue;
+                    /* fill symbol name and addr from .symtab */
+                    if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+                    lines[i].saddr = saddr;
+                    lines[i].path  = obj->path;
+                    lines[i].base_addr = obj->base_addr;
+                }
+            }
+        }
+    }
+
+    if (!obj->debug_line.ptr) {
+        /* This file doesn't have .debug_line section,
+           let's check .gnu_debuglink section instead. */
+        if (gnu_debuglink_shdr && check_debuglink) {
+            follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+                             num_traces, traces,
+                             objp, lines, offset, errout);
+        }
+        if (note_gnu_build_id && check_debuglink) {
+            ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+            const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+            follow_debuglink_build_id(build_id, nhdr->n_descsz,
+                               num_traces, traces,
+                               objp, lines, offset, errout);
+        }
+        goto finish;
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
 finish:
     return dladdr_fbase;
 fail:
     return (uintptr_t)-1;
 }
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+        obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+# ifdef __LP64__
+#  define LP(x) x##_64
+# else
+#  define LP(x) x
+# endif
+    int fd;
+    off_t filesize;
+    char *file, *p = NULL;
+    obj_info_t *obj = *objp;
+    struct LP(mach_header) *header;
+    uintptr_t dladdr_fbase = 0;
+
+    {
+        char *s = binary_filename;
+        char *base = strrchr(binary_filename, '/')+1;
+        size_t max = PATH_MAX;
+        size_t size = strlen(binary_filename);
+        size_t basesize = size - (base - binary_filename);
+        s += size;
+        max -= size;
+        p = s;
+        size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+        if (size == 0) goto fail;
+        s += size;
+        max -= size;
+        if (max <= basesize) goto fail;
+        memcpy(s, base, basesize);
+        s[basesize] = 0;
+
+        fd = open(binary_filename, O_RDONLY);
+        if (fd < 0) {
+            *p = 0; /* binary_filename becomes original file name */
+            fd = open(binary_filename, O_RDONLY);
+            if (fd < 0) {
+                goto fail;
+            }
+        }
+    }
+
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
+    }
+    close(fd);
+
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    header = (struct LP(mach_header) *)file;
+    if (header->magic == LP(MH_MAGIC)) {
+        /* non universal binary */
+        p = file;
+    }
+    else if (header->magic == FAT_CIGAM) {
+        struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+        struct fat_header *fat = (struct fat_header *)file;
+        char *q = file + sizeof(*fat);
+        uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+        /* kprintf("%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+        for (uint32_t i = 0; i < nfat_arch; i++) {
+            struct fat_arch *arch = (struct fat_arch *)q;
+            cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+            cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+            uint32_t offset = __builtin_bswap32(arch->offset);
+            /* kprintf("%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+            if (mhp->cputype == cputype &&
+                    (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+                p = file + offset;
+                file = p;
+                header = (struct LP(mach_header) *)p;
+                if (header->magic == LP(MH_MAGIC)) {
+                    goto found_mach_header;
+                }
+                break;
+            }
+            q += sizeof(*arch);
+        }
+        kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+        close(fd);
+        goto fail;
+    }
+    else {
+# ifdef __LP64__
+#   define bitsize "64"
+# else
+#   define bitsize "32"
+# endif
+        kprintf("'%s' is not a " bitsize
+                "-bit Mach-O file!\n",binary_filename);
+# undef bitsize
+        close(fd);
+        goto fail;
+    }
+found_mach_header:
+    p += sizeof(*header);
+
+    for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+        struct load_command *lcmd = (struct load_command *)p;
+        switch (lcmd->cmd) {
+          case LP(LC_SEGMENT):
+            {
+                static const char *debug_section_names[] = {
+                    "__debug_abbrev",
+                    "__debug_info",
+                    "__debug_line",
+                    "__debug_ranges",
+                    "__debug_str_offsets",
+                    "__debug_addr",
+                    "__debug_rnglists",
+                    "__debug_str",
+                    "__debug_line_str",
+                };
+                struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+                if (strcmp(scmd->segname, "__TEXT") == 0) {
+                    obj->vmaddr = scmd->vmaddr;
+                }
+                else if (strcmp(scmd->segname, "__DWARF") == 0) {
+                    p += sizeof(struct LP(segment_command));
+                    for (uint64_t i = 0; i < scmd->nsects; i++) {
+                        struct LP(section) *sect = (struct LP(section) *)p;
+                        p += sizeof(struct LP(section));
+                        for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+                            struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                            if (strcmp(sect->sectname, debug_section_names[j]) != 0
+#ifdef __APPLE__
+                                    /* macOS clang 16 generates DWARF5, which have Mach-O
+                                     * section names that are limited to 16 characters,
+                                     * which causes sections with long names to be truncated
+                                     * and not match above.
+                                     * See: https://wiki.dwarfstd.org/Best_Practices.md#Mach-2d-O
+                                     */
+                                    && strncmp(sect->sectname, debug_section_names[j], 16) != 0
+#endif
+                                )
+                                continue;
+
+                            s->ptr = file + sect->offset;
+                            s->size = sect->size;
+                            s->flags = sect->flags;
+                            if (s->flags & SHF_COMPRESSED) {
+                                goto fail;
+                            }
+                            break;
+                        }
+                    }
+                }
+            }
+            break;
+
+          case LC_SYMTAB:
+            {
+                struct symtab_command *cmd = (struct symtab_command *)lcmd;
+                struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+                char *strtab = file + cmd->stroff, *sname = 0;
+                uint32_t j;
+                uintptr_t saddr = 0;
+                /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
+                for (j = 0; j < cmd->nsyms; j++) {
+                    uintptr_t symsize, d;
+                    struct LP(nlist) *e = &nl[j];
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                    if (e->n_type != N_FUN) continue;
+                    if (e->n_sect) {
+                        saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+                        sname = strtab + e->n_un.n_strx;
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                        continue;
+                    }
+                    for (int k = offset; k < num_traces; k++) {
+                        d = (uintptr_t)traces[k] - saddr;
+                        symsize = e->n_value;
+                        /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+                        if (lines[k].line > 0 || d > (uintptr_t)symsize)
+                            continue;
+                        /* fill symbol name and addr from .symtab */
+                        if (!lines[k].sname) lines[k].sname = sname;
+                        lines[k].saddr = saddr;
+                        lines[k].path  = obj->path;
+                        lines[k].base_addr = obj->base_addr;
+                    }
+                }
+            }
+        }
+        p += lcmd->cmdsize;
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        while (reader.p < reader.pend) {
+            if (di_read_cu(&reader, errout)) goto fail;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto fail;
+        }
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+#endif
 
 #define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
+#if defined(__FreeBSD__) || defined(__DragonFly__)
 # include <sys/sysctl.h>
 #endif
-/* ssize_t main_exe_path(void)
+/* ssize_t main_exe_path(FILE *errout)
  *
  * store the path of the main executable to `binary_filename`,
  * and returns strlen(binary_filename).
  * it is NUL terminated.
  */
-#if defined(__linux__)
+#if defined(__linux__) || defined(__NetBSD__)
 static ssize_t
-main_exe_path(void)
+main_exe_path(FILE *errout)
 {
-# define PROC_SELF_EXE "/proc/self/exe"
+# if defined(__linux__)
+#  define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+#  define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
     ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+    if (len < 0) return 0;
     binary_filename[len] = 0;
     return len;
 }
-#elif defined(__FreeBSD__)
+#elif defined(__FreeBSD__) || defined(__DragonFly__)
 static ssize_t
-main_exe_path(void)
+main_exe_path(FILE *errout)
 {
     int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
     size_t len = PATH_MAX;
     int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
     if (err) {
-	kprintf("Can't get the path of ruby");
-	return -1;
+        kprintf("Can't get the path of ruby");
+        return -1;
     }
     len--; /* sysctl sets strlen+1 */
     return len;
 }
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+    int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+    if (len == 0) return 0;
+    binary_filename[len] = 0;
+    return len;
+}
 #else
 #undef HAVE_MAIN_EXE_PATH
 #endif
 
+static void
+print_line0(line_info_t *line, void *address, FILE *errout)
+{
+    uintptr_t addr = (uintptr_t)address;
+    uintptr_t d = addr - line->saddr;
+    if (!address) {
+        /* inlined */
+        if (line->dirname && line->dirname[0]) {
+            kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+        }
+        else {
+            kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+        }
+    }
+    else if (!line->path) {
+        kprintf("[0x%"PRIxPTR"]\n", addr);
+    }
+    else if (!line->sname) {
+        kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+    }
+    else if (!line->saddr) {
+        kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
+    }
+    else if (line->line <= 0) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+                d, addr);
+    }
+    else if (!line->filename) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+                d, addr, line->line);
+    }
+    else if (line->dirname && line->dirname[0]) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+                d, addr, line->dirname, line->filename, line->line);
+    }
+    else {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+                d, addr, line->filename, line->line);
+    }
+}
+
+static void
+print_line(line_info_t *line, void *address, FILE *errout)
+{
+    print_line0(line, address, errout);
+    if (line->next) {
+        print_line(line->next, NULL, errout);
+    }
+}
+
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces)
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
 {
     int i;
     /* async-signal unsafe */
@@ -699,531 +2623,99 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces)
     obj_info_t *obj = NULL;
     /* 2 is NULL + main executable */
     void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+
 #ifdef HAVE_MAIN_EXE_PATH
     char *main_path = NULL; /* used on printing backtrace */
     ssize_t len;
-    if ((len = main_exe_path()) > 0) {
-	main_path = (char *)alloca(len + 1);
-	if (main_path) {
-	    uintptr_t addr;
-	    memcpy(main_path, binary_filename, len+1);
-	    append_obj(&obj);
-	    obj->path = main_path;
-	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
-	    if (addr != (uintptr_t)-1) {
-		dladdr_fbases[0] = (void *)addr;
-	    }
-	}
+    if ((len = main_exe_path(errout)) > 0) {
+        main_path = (char *)alloca(len + 1);
+        if (main_path) {
+            uintptr_t addr;
+            memcpy(main_path, binary_filename, len+1);
+            append_obj(&obj);
+            obj->path = main_path;
+            addr = fill_lines(num_traces, traces, 1, &obj, lines, 0, errout);
+            if (addr != (uintptr_t)-1) {
+                dladdr_fbases[0] = (void *)addr;
+            }
+        }
     }
 #endif
 
     /* fill source lines by reading dwarf */
     for (i = 0; i < num_traces; i++) {
-	Dl_info info;
-	if (lines[i].line) continue;
-	if (dladdr(traces[i], &info)) {
-	    const char *path;
-	    void **p;
-
-	    /* skip symbols which is in already checked objects */
-	    /* if the binary is strip-ed, this may effect */
-	    for (p=dladdr_fbases; *p; p++) {
-		if (*p == info.dli_fbase) {
-		    lines[i].path = info.dli_fname;
-		    lines[i].sname = info.dli_sname;
-		    goto next_line;
-		}
-	    }
-	    *p = info.dli_fbase;
-
-	    append_obj(&obj);
-	    obj->base_addr = (uintptr_t)info.dli_fbase;
-	    path = info.dli_fname;
-	    obj->path = path;
-	    lines[i].path = path;
-	    strlcpy(binary_filename, path, PATH_MAX);
-	    if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
-		break;
-	}
+        Dl_info info;
+        if (lines[i].line) continue;
+        if (dladdr(traces[i], &info)) {
+            const char *path;
+            void **p;
+
+            /* skip symbols which is in already checked objects */
+            /* if the binary is strip-ed, this may effect */
+            for (p=dladdr_fbases; *p; p++) {
+                if (*p == info.dli_fbase) {
+                    if (info.dli_fname) lines[i].path = info.dli_fname;
+                    if (info.dli_sname) lines[i].sname = info.dli_sname;
+                    goto next_line;
+                }
+            }
+            *p = info.dli_fbase;
+
+            append_obj(&obj);
+            obj->base_addr = (uintptr_t)info.dli_fbase;
+            path = info.dli_fname;
+            obj->path = path;
+            if (path) lines[i].path = path;
+            if (info.dli_sname) {
+                lines[i].sname = info.dli_sname;
+                lines[i].saddr = (uintptr_t)info.dli_saddr;
+            }
+            strlcpy(binary_filename, path, PATH_MAX);
+            if (fill_lines(num_traces, traces, 1, &obj, lines, i, errout) == (uintptr_t)-1)
+                break;
+        }
 next_line:
-	continue;
+        continue;
     }
 
     /* output */
     for (i = 0; i < num_traces; i++) {
-	line_info_t *line = &lines[i];
-	uintptr_t addr = (uintptr_t)traces[i];
-	uintptr_t d = addr - line->saddr;
-	if (!line->path) {
-	    kprintf("[0x%lx]\n", addr);
-	}
-	else if (!line->saddr || !line->sname) {
-	    kprintf("%s(0x%lx) [0x%lx]\n", line->path, addr-line->base_addr, addr);
-	}
-	else if (line->line <= 0) {
-	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
-		    d, addr);
-	}
-	else if (!line->filename) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
-		    d, addr, line->line);
-	}
-	else if (line->dirname && line->dirname[0]) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
-		    d, addr, line->dirname, line->filename, line->line);
-	}
-	else {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
-		    d, addr, line->filename, line->line);
-	}
-	/* FreeBSD's backtrace may show _start and so on */
-	if (line->sname && strcmp("main", line->sname) == 0)
-	    break;
+        print_line(&lines[i], traces[i], errout);
+
+        /* FreeBSD's backtrace may show _start and so on */
+        if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
+            break;
     }
 
     /* free */
     while (obj) {
-	obj_info_t *o = obj;
-	obj = o->next;
-	if (o->fd) {
-	    munmap(o->mapped, o->mapped_size);
-	    close(o->fd);
-	}
-	free(o);
+        obj_info_t *o = obj;
+        for (i=0; i < DWARF_SECTION_COUNT; i++) {
+            struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+            if (s->flags & SHF_COMPRESSED) {
+                free(s->ptr);
+            }
+        }
+        if (obj->mapped_size) {
+            munmap(obj->mapped, obj->mapped_size);
+        }
+        obj = o->next;
+        free(o);
+    }
+    for (i = 0; i < num_traces; i++) {
+        line_info_t *line = lines[i].next;
+        while (line) {
+            line_info_t *l = line;
+            line = line->next;
+            free(l);
+        }
     }
     free(lines);
     free(dladdr_fbases);
 }
 
-/* From FreeBSD's lib/libstand/printf.c */
-/*-
- * Copyright (c) 1986, 1988, 1991, 1993
- *	The Regents of the University of California.  All rights reserved.
- * (c) UNIX System Laboratories, Inc.
- * All or some portions of this file are derived from material licensed
- * to the University of California by American Telephone and Telegraph
- * Co. or Unix System Laboratories, Inc. and are reproduced herein with
- * the permission of UNIX System Laboratories, Inc.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- * 4. Neither the name of the University nor the names of its contributors
- *    may be used to endorse or promote products derived from this software
- *    without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
- */
-
-#include <stdarg.h>
-#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
-#define    hex2ascii(hex)  (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-static inline int imax(int a, int b) { return (a > b ? a : b); }
-static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
-
-static void putce(int c)
-{
-    char s[1];
-    ssize_t ret;
-
-    s[0] = (char)c;
-    ret = write(2, s, 1);
-    (void)ret;
-}
-
-int
-kprintf(const char *fmt, ...)
-{
-	va_list ap;
-	int retval;
-
-	va_start(ap, fmt);
-	retval = kvprintf(fmt, putce, NULL, 10, ap);
-	va_end(ap);
-	return retval;
-}
-
-/*
- * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
- * order; return an optional length and a pointer to the last character
- * written in the buffer (i.e., the first character of the string).
- * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
- */
-static char *
-ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
-{
-	char *p, c;
-
-	p = nbuf;
-	*p = '\0';
-	do {
-		c = hex2ascii(num % base);
-		*++p = upper ? toupper(c) : c;
-	} while (num /= base);
-	if (lenp)
-		*lenp = (int)(p - nbuf);
-	return (p);
-}
+#undef kprintf
 
-/*
- * Scaled down version of printf(3).
- *
- * Two additional formats:
- *
- * The format %b is supported to decode error registers.
- * Its usage is:
- *
- *	printf("reg=%b\n", regval, "<base><arg>*");
- *
- * where <base> is the output base expressed as a control character, e.g.
- * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
- * the first of which gives the bit number to be inspected (origin 1), and
- * the next characters (up to a control character, i.e. a character <= 32),
- * give the name of the register.  Thus:
- *
- *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
- *
- * would produce output:
- *
- *	reg=3<BITTWO,BITONE>
- *
- * XXX:  %D  -- Hexdump, takes pointer and separator string:
- *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
- *		("%*D", len, ptr, " " -> XX XX XX XX ...
- */
-static int
-kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
-{
-#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
-	char nbuf[MAXNBUF];
-	char *d;
-	const char *p, *percent, *q;
-	unsigned char *up;
-	int ch, n;
-	uintmax_t num;
-	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
-	int cflag, hflag, jflag, tflag, zflag;
-	int dwidth, upper;
-	char padc;
-	int stop = 0, retval = 0;
-
-	num = 0;
-	if (!func)
-		d = (char *) arg;
-	else
-		d = NULL;
-
-	if (fmt == NULL)
-		fmt = "(fmt null)\n";
-
-	if (radix < 2 || radix > 36)
-		radix = 10;
-
-	for (;;) {
-		padc = ' ';
-		width = 0;
-		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
-			if (ch == '\0')
-				return (retval);
-			PCHAR(ch);
-		}
-		percent = fmt - 1;
-		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
-		sign = 0; dot = 0; dwidth = 0; upper = 0;
-		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
-reswitch:	switch (ch = (unsigned char)*fmt++) {
-		case '.':
-			dot = 1;
-			goto reswitch;
-		case '#':
-			sharpflag = 1;
-			goto reswitch;
-		case '+':
-			sign = 1;
-			goto reswitch;
-		case '-':
-			ladjust = 1;
-			goto reswitch;
-		case '%':
-			PCHAR(ch);
-			break;
-		case '*':
-			if (!dot) {
-				width = va_arg(ap, int);
-				if (width < 0) {
-					ladjust = !ladjust;
-					width = -width;
-				}
-			} else {
-				dwidth = va_arg(ap, int);
-			}
-			goto reswitch;
-		case '0':
-			if (!dot) {
-				padc = '0';
-				goto reswitch;
-			}
-		case '1': case '2': case '3': case '4':
-		case '5': case '6': case '7': case '8': case '9':
-				for (n = 0;; ++fmt) {
-					n = n * 10 + ch - '0';
-					ch = *fmt;
-					if (ch < '0' || ch > '9')
-						break;
-				}
-			if (dot)
-				dwidth = n;
-			else
-				width = n;
-			goto reswitch;
-		case 'b':
-			num = (unsigned int)va_arg(ap, int);
-			p = va_arg(ap, char *);
-			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
-				PCHAR(*q--);
-
-			if (num == 0)
-				break;
-
-			for (tmp = 0; *p;) {
-				n = *p++;
-				if (num & (1 << (n - 1))) {
-					PCHAR(tmp ? ',' : '<');
-					for (; (n = *p) > ' '; ++p)
-						PCHAR(n);
-					tmp = 1;
-				} else
-					for (; *p > ' '; ++p)
-						continue;
-			}
-			if (tmp)
-				PCHAR('>');
-			break;
-		case 'c':
-			PCHAR(va_arg(ap, int));
-			break;
-		case 'D':
-			up = va_arg(ap, unsigned char *);
-			p = va_arg(ap, char *);
-			if (!width)
-				width = 16;
-			while(width--) {
-				PCHAR(hex2ascii(*up >> 4));
-				PCHAR(hex2ascii(*up & 0x0f));
-				up++;
-				if (width)
-					for (q=p;*q;q++)
-						PCHAR(*q);
-			}
-			break;
-		case 'd':
-		case 'i':
-			base = 10;
-			sign = 1;
-			goto handle_sign;
-		case 'h':
-			if (hflag) {
-				hflag = 0;
-				cflag = 1;
-			} else
-				hflag = 1;
-			goto reswitch;
-		case 'j':
-			jflag = 1;
-			goto reswitch;
-		case 'l':
-			if (lflag) {
-				lflag = 0;
-				qflag = 1;
-			} else
-				lflag = 1;
-			goto reswitch;
-		case 'n':
-			if (jflag)
-				*(va_arg(ap, intmax_t *)) = retval;
-			else if (qflag)
-				*(va_arg(ap, int64_t *)) = retval;
-			else if (lflag)
-				*(va_arg(ap, long *)) = retval;
-			else if (zflag)
-				*(va_arg(ap, size_t *)) = retval;
-			else if (hflag)
-				*(va_arg(ap, short *)) = retval;
-			else if (cflag)
-				*(va_arg(ap, char *)) = retval;
-			else
-				*(va_arg(ap, int *)) = retval;
-			break;
-		case 'o':
-			base = 8;
-			goto handle_nosign;
-		case 'p':
-			base = 16;
-			sharpflag = (width == 0);
-			sign = 0;
-			num = (uintptr_t)va_arg(ap, void *);
-			goto number;
-		case 'q':
-			qflag = 1;
-			goto reswitch;
-		case 'r':
-			base = radix;
-			if (sign)
-				goto handle_sign;
-			goto handle_nosign;
-		case 's':
-			p = va_arg(ap, char *);
-			if (p == NULL)
-				p = "(null)";
-			if (!dot)
-				n = (int)strlen (p);
-			else
-				for (n = 0; n < dwidth && p[n]; n++)
-					continue;
-
-			width -= n;
-
-			if (!ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			while (n--)
-				PCHAR(*p++);
-			if (ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			break;
-		case 't':
-			tflag = 1;
-			goto reswitch;
-		case 'u':
-			base = 10;
-			goto handle_nosign;
-		case 'X':
-			upper = 1;
-		case 'x':
-			base = 16;
-			goto handle_nosign;
-		case 'y':
-			base = 16;
-			sign = 1;
-			goto handle_sign;
-		case 'z':
-			zflag = 1;
-			goto reswitch;
-handle_nosign:
-			sign = 0;
-			if (jflag)
-				num = va_arg(ap, uintmax_t);
-			else if (qflag)
-				num = va_arg(ap, uint64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, unsigned long);
-			else if (zflag)
-				num = va_arg(ap, size_t);
-			else if (hflag)
-				num = (unsigned short)va_arg(ap, int);
-			else if (cflag)
-				num = (unsigned char)va_arg(ap, int);
-			else
-				num = va_arg(ap, unsigned int);
-			goto number;
-handle_sign:
-			if (jflag)
-				num = va_arg(ap, intmax_t);
-			else if (qflag)
-				num = va_arg(ap, int64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, long);
-			else if (zflag)
-				num = va_arg(ap, ssize_t);
-			else if (hflag)
-				num = (short)va_arg(ap, int);
-			else if (cflag)
-				num = (char)va_arg(ap, int);
-			else
-				num = va_arg(ap, int);
-number:
-			if (sign && (intmax_t)num < 0) {
-				neg = 1;
-				num = -(intmax_t)num;
-			}
-			p = ksprintn(nbuf, num, base, &n, upper);
-			tmp = 0;
-			if (sharpflag && num != 0) {
-				if (base == 8)
-					tmp++;
-				else if (base == 16)
-					tmp += 2;
-			}
-			if (neg)
-				tmp++;
-
-			if (!ladjust && padc == '0')
-				dwidth = width - tmp;
-			width -= tmp + imax(dwidth, n);
-			dwidth -= n;
-			if (!ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-			if (neg)
-				PCHAR('-');
-			if (sharpflag && num != 0) {
-				if (base == 8) {
-					PCHAR('0');
-				} else if (base == 16) {
-					PCHAR('0');
-					PCHAR('x');
-				}
-			}
-			while (dwidth-- > 0)
-				PCHAR('0');
-
-			while (*p)
-				PCHAR(*p--);
-
-			if (ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-
-			break;
-		default:
-			while (percent < fmt)
-				PCHAR(*percent++);
-			/*
-			 * Since we ignore an formatting argument it is no
-			 * longer safe to obey the remaining formatting
-			 * arguments as the arguments will no longer match
-			 * the format specs.
-			 */
-			stop = 1;
-			break;
-		}
-	}
-#undef PCHAR
-}
 #else /* defined(USE_ELF) */
 #error not supported
 #endif
diff --git a/addr2line.h b/addr2line.h
index d99f010934..ff8e476b92 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,3 +1,5 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
 /**********************************************************************
 
   addr2line.h -
@@ -8,13 +10,12 @@
 
 **********************************************************************/
 
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
 
-#ifdef USE_ELF
+#include <stdio.h>
 
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces);
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout);
 
 #endif /* USE_ELF */
 
diff --git a/appveyor.yml b/appveyor.yml
deleted file mode 100644
index 22c7bdce6a..0000000000
--- a/appveyor.yml
+++ /dev/null
@@ -1,55 +0,0 @@
----
-shallow_clone: true
-platform:
-  - x64
-environment:
-  ruby_version: "24-%Platform%"
-  zlib_version: "1.2.11"
-  matrix:
-    - vs: "120"
-install:
-  - chcp
-  - SET BITS=%Platform:x86=32%
-  - SET BITS=%BITS:x=%
-  - SET OPENSSL_DIR=c:\OpenSSL-Win%BITS%
-  - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
-  - SET vcvars
-  - '"%vcvars%" %Platform:x64=amd64%'
-  - SET ruby_path=C:\Ruby%ruby_version:-x86=%
-  - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
-  - ruby --version
-  - 'cl'
-  - SET
-  - echo> Makefile srcdir=.
-  - echo>> Makefile MSC_VER=0
-  - echo>> Makefile RT=none
-  - echo>> Makefile RT_VER=0
-  - echo>> Makefile BUILTIN_ENCOBJS=nul
-  - type win32\Makefile.sub >> Makefile
-  - nmake %mflags% touch-unicode-files
-  - nmake %mflags% up incs UNICODE_FILES=.
-  - del Makefile
-  - mkdir \usr\local\bin
-  - mkdir \usr\local\include
-  - mkdir \usr\local\lib
-  - appveyor DownloadFile https://zlib.net/zlib%zlib_version:.=%.zip
-  - 7z x -o%APPVEYOR_BUILD_FOLDER%\ext\zlib zlib%zlib_version:.=%.zip
-  - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
-  - mkdir %Platform%-mswin_%vs%
-  - ps: Get-ChildItem "win32" -Recurse | foreach {$_.Attributes = 'Readonly'}
-  - ps: Get-Item $env:Platform"-mswin_"$env:vs | foreach {$_.Attributes = 'Normal'}
-build_script:
-  - cd %APPVEYOR_BUILD_FOLDER%
-  - cd %Platform%-mswin_%vs%
-  - ..\win32\configure.bat --without-ext=+,dbm,gdbm,readline --with-opt-dir=/usr/local --with-openssl-dir=%OPENSSL_DIR:\=/%
-  - nmake -l
-  - nmake install-nodoc
-  - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
-test_script:
-  - set /a JOBS=%NUMBER_OF_PROCESSORS%
-  - nmake -l "TESTOPTS=-v -q" btest
-  - nmake -l "TESTOPTS=-v -q" test-basic
-  - nmake -l "TESTOPTS=-q -j%JOBS%" test-all
-  - nmake -l test-spec
-matrix:
-  fast_finish: true
diff --git a/array.c b/array.c
index 425e28aa69..08d8d17c90 100644
--- a/array.c
+++ b/array.c
@@ -11,19 +11,60 @@
 
 **********************************************************************/
 
+#include "debug_counter.h"
+#include "id.h"
 #include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
 #include "probes.h"
-#include "id.h"
-#include "debug_counter.h"
+#include "ruby/encoding.h"
+#include "ruby/st.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "ruby/ractor.h"
+#include "vm_core.h"
+#include "builtin.h"
 
-#ifndef ARRAY_DEBUG
+#if !ARRAY_DEBUG
+# undef NDEBUG
 # define NDEBUG
 #endif
 #include "ruby_assert.h"
 
 VALUE rb_cArray;
+VALUE rb_cArray_empty_frozen;
+
+/* Flags of RArray
+ *
+ * 0:   RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
+ *          The array is shared. The buffer this array points to is owned by
+ *          another array (the shared root).
+ * 1:   RARRAY_EMBED_FLAG
+ *          The array is embedded (its contents follow the header, rather than
+ *          being on a separately allocated buffer).
+ * 3-9: RARRAY_EMBED_LEN
+ *          The length of the array when RARRAY_EMBED_FLAG is set.
+ * 12:  RARRAY_SHARED_ROOT_FLAG
+ *          The array is a shared root that does reference counting. The buffer
+ *          this array points to is owned by this array but may be pointed to
+ *          by other arrays.
+ *          Note: Frozen arrays may be a shared root without this flag being
+ *                set. Frozen arrays do not have reference counting because
+ *                they cannot be modified. Not updating the reference count
+ *                improves copy-on-write performance. Their reference count is
+ *                assumed to be infinity.
+ * 14:  RARRAY_PTR_IN_USE_FLAG
+ *          The buffer of the array is in use. This is only used during
+ *          debugging.
+ */
 
 /* for OPTIMIZED_CMP: */
 #define id_cmp idCmp
@@ -32,48 +73,56 @@ VALUE rb_cArray;
 #define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
 #define SMALL_ARRAY_LEN 16
 
-# define ARY_SHARED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+    return RB_TYPE_P(ary, T_ARRAY);
+}
+
+#define ARY_HEAP_PTR(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(!ARY_SHARED_ROOT_P(a)), \
+                          RARRAY(a)->as.heap.aux.capa)
 
-#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_PTR(a) (RUBY_ASSERT(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
 #define ARY_EMBED_LEN(a) \
-    (assert(ARY_EMBED_P(a)), \
+    (RUBY_ASSERT(ARY_EMBED_P(a)), \
      (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
-	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+         (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (RUBY_ASSERT(should_be_T_ARRAY((VALUE)(a))), \
+                            !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
 
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
 #define FL_SET_EMBED(a) do { \
-    assert(!ARY_SHARED_P(a)); \
+    RUBY_ASSERT(!ARY_SHARED_P(a)); \
     FL_SET((a), RARRAY_EMBED_FLAG); \
+    ary_verify(a); \
 } while (0)
+
 #define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
 #define FL_SET_SHARED(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), ELTS_SHARED); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_FLAG); \
 } while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
 
+#define ARY_SET_PTR_FORCE(ary, p) \
+    (RARRAY(ary)->as.heap.ptr = (p))
 #define ARY_SET_PTR(ary, p) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.ptr = (p); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_PTR_FORCE(ary, p); \
 } while (0)
 #define ARY_SET_EMBED_LEN(ary, n) do { \
     long tmp_n = (n); \
-    assert(ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(ARY_EMBED_P(ary)); \
     RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
     RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
 } while (0)
 #define ARY_SET_HEAP_LEN(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
     RARRAY(ary)->as.heap.len = (n); \
 } while (0)
 #define ARY_SET_LEN(ary, n) do { \
@@ -83,15 +132,15 @@ VALUE rb_cArray;
     else { \
         ARY_SET_HEAP_LEN((ary), (n)); \
     } \
-    assert(RARRAY_LEN(ary) == (n)); \
+    RUBY_ASSERT(RARRAY_LEN(ary) == (n)); \
 } while (0)
 #define ARY_INCREASE_PTR(ary, n) do  { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.ptr += (n); \
 } while (0)
 #define ARY_INCREASE_LEN(ary, n) do  { \
-    assert(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
     if (ARY_EMBED_P(ary)) { \
         ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
     } \
@@ -100,45 +149,154 @@ VALUE rb_cArray;
     } \
 } while (0)
 
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
-		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
+                       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
+#define ARY_SET_CAPA_FORCE(ary, n) \
+    RARRAY(ary)->as.heap.aux.capa = (n);
 #define ARY_SET_CAPA(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!ARY_SHARED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.aux.capa = (n); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!ARY_SHARED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_CAPA_FORCE(ary, n); \
 } while (0)
 
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
-#define ARY_SET_SHARED(ary, value) do { \
-    const VALUE _ary_ = (ary); \
-    const VALUE _value_ = (value); \
-    assert(!ARY_EMBED_P(_ary_)); \
-    assert(ARY_SHARED_P(_ary_)); \
-    assert(ARY_SHARED_ROOT_P(_value_)); \
-    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
-} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
-    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
-    assert(ARY_SHARED_ROOT_P(ary)); \
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT((value) >= 0); \
     RARRAY(ary)->as.heap.aux.capa = (value); \
 } while (0)
 #define FL_SET_SHARED_ROOT(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
     FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
 } while (0)
 
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+    RUBY_ASSERT(!ARY_SHARED_P(a));
+    RUBY_ASSERT(!OBJ_FROZEN(a));
+
+    RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+static long
+ary_embed_capa(VALUE ary)
+{
+    size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
+    RUBY_ASSERT(size % sizeof(VALUE) == 0);
+    return size / sizeof(VALUE);
+}
+
+static size_t
+ary_embed_size(long capa)
+{
+    size_t size = offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
+    if (size < sizeof(struct RArray)) size = sizeof(struct RArray);
+    return size;
+}
+
+static bool
+ary_embeddable_p(long capa)
+{
+    return rb_gc_size_allocatable_p(ary_embed_size(capa));
+}
+
+bool
+rb_ary_embeddable_p(VALUE ary)
+{
+    /* An array cannot be turned embeddable when the array is:
+     *  - Shared root: other objects may point to the buffer of this array
+     *    so we cannot make it embedded.
+     *  - Frozen: this array may also be a shared root without the shared root
+     *    flag.
+     *  - Shared: we don't want to re-embed an array that points to a shared
+     *    root (to save memory).
+     */
+    return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
+}
+
+size_t
+rb_ary_size_as_embedded(VALUE ary)
+{
+    size_t real_size;
+
+    if (ARY_EMBED_P(ary)) {
+        real_size = ary_embed_size(ARY_EMBED_LEN(ary));
+    }
+    else if (rb_ary_embeddable_p(ary)) {
+        real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
+    }
+    else {
+        real_size = sizeof(struct RArray);
+    }
+    return real_size;
+}
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
+
+    if (ARY_SHARED_P(ary)) {
+        VALUE root = ARY_SHARED_ROOT(ary);
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        const VALUE *root_ptr = RARRAY_CONST_PTR(root);
+        long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+        RUBY_ASSERT(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
+        RUBY_ASSERT(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+        ary_verify(root);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        RUBY_ASSERT(!ARY_SHARED_P(ary));
+        RUBY_ASSERT(RARRAY_LEN(ary) <= ary_embed_capa(ary));
+    }
+    else {
+        const VALUE *ptr = RARRAY_CONST_PTR(ary);
+        long i, len = RARRAY_LEN(ary);
+        volatile VALUE v;
+        if (len > 1) len = 1; /* check only HEAD */
+        for (i=0; i<len; i++) {
+            v = ptr[i]; /* access check */
+        }
+        v = v;
+    }
+
+    return ary;
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+    return (VALUE *)RARRAY_CONST_PTR(ary);
+}
 
 void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
+
+void
+rb_mem_clear(VALUE *mem, long size)
 {
     while (size--) {
-	*mem++ = Qnil;
+        *mem++ = Qnil;
     }
 }
 
@@ -146,7 +304,7 @@ static void
 ary_mem_clear(VALUE ary, long beg, long size)
 {
     RARRAY_PTR_USE(ary, ptr, {
-	rb_mem_clear(ptr + beg, size);
+        rb_mem_clear(ptr + beg, size);
     });
 }
 
@@ -154,7 +312,7 @@ static inline void
 memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
-	*mem++ = val;
+        *mem++ = val;
     }
 }
 
@@ -162,36 +320,30 @@ static void
 ary_memfill(VALUE ary, long beg, long size, VALUE val)
 {
     RARRAY_PTR_USE(ary, ptr, {
-	memfill(ptr + beg, size, val);
-	RB_OBJ_WRITTEN(ary, Qundef, val);
+        memfill(ptr + beg, size, val);
+        RB_OBJ_WRITTEN(ary, Qundef, val);
     });
 }
 
 static void
 ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
 {
-#if 1
-    assert(!ARY_SHARED_P(buff_owner_ary));
+    RUBY_ASSERT(!ARY_SHARED_P(buff_owner_ary));
 
     if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
-	rb_gc_writebarrier_remember(buff_owner_ary);
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMCPY(ptr+beg, argv, VALUE, argc);
-	});
+        rb_gc_writebarrier_remember(buff_owner_ary);
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMCPY(ptr+beg, argv, VALUE, argc);
+        });
     }
     else {
-	int i;
-	RARRAY_PTR_USE(ary, ptr, {
-	    for (i=0; i<argc; i++) {
-		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
-	    }
-	});
+        int i;
+        RARRAY_PTR_USE(ary, ptr, {
+            for (i=0; i<argc; i++) {
+                RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+            }
+        });
     }
-#else
-    /* giveup write barrier (traditional way) */
-    RARRAY_PTR(buff_owner_ary);
-    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
 }
 
 static void
@@ -200,49 +352,106 @@ ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
     ary_memcpy0(ary, beg, argc, argv, ary);
 }
 
+static VALUE *
+ary_heap_alloc_buffer(size_t capa)
+{
+    return ALLOC_N(VALUE, capa);
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+    ruby_xfree_sized((void *)ptr, size);
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+    ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+}
+
+static size_t
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, ARY_HEAP_CAPA(ary));
+    ary_verify(ary);
+
+    return new_capa;
+}
+
+void
+rb_ary_make_embedded(VALUE ary)
+{
+    RUBY_ASSERT(rb_ary_embeddable_p(ary));
+    if (!ARY_EMBED_P(ary)) {
+        const VALUE *buf = ARY_HEAP_PTR(ary);
+        long len = ARY_HEAP_LEN(ary);
+        long capa = ARY_HEAP_CAPA(ary);
+
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, len);
+
+        MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
+
+        ary_heap_free_ptr(ary, buf, capa * sizeof(VALUE));
+    }
+}
+
 static void
 ary_resize_capa(VALUE ary, long capacity)
 {
-    assert(RARRAY_LEN(ary) <= capacity);
-    assert(!OBJ_FROZEN(ary));
-    assert(!ARY_SHARED_P(ary));
-    if (capacity > RARRAY_EMBED_LEN_MAX) {
+    RUBY_ASSERT(RARRAY_LEN(ary) <= capacity);
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+
+    if (capacity > ary_embed_capa(ary)) {
+        size_t new_capa = capacity;
         if (ARY_EMBED_P(ary)) {
             long len = ARY_EMBED_LEN(ary);
-            VALUE *ptr = ALLOC_N(VALUE, (capacity));
+            VALUE *ptr = ary_heap_alloc_buffer(capacity);
+
             MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
             FL_UNSET_EMBED(ary);
             ARY_SET_PTR(ary, ptr);
             ARY_SET_HEAP_LEN(ary, len);
         }
         else {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+            new_capa = ary_heap_realloc(ary, capacity);
         }
-        ARY_SET_CAPA(ary, (capacity));
+        ARY_SET_CAPA(ary, new_capa);
     }
     else {
         if (!ARY_EMBED_P(ary)) {
-            long len = RARRAY_LEN(ary);
-	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+            long len = ARY_HEAP_LEN(ary);
+            long old_capa = ARY_HEAP_CAPA(ary);
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
 
-	    if (len > capacity) len = capacity;
+            if (len > capacity) len = capacity;
             MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+            ary_heap_free_ptr(ary, ptr, old_capa * sizeof(VALUE));
+
             FL_SET_EMBED(ary);
             ARY_SET_LEN(ary, len);
-	    ruby_xfree((VALUE *)ptr);
         }
     }
+
+    ary_verify(ary);
 }
 
 static inline void
 ary_shrink_capa(VALUE ary)
 {
     long capacity = ARY_HEAP_LEN(ary);
-    long old_capa = RARRAY(ary)->as.heap.aux.capa;
-    assert(!ARY_SHARED_P(ary));
-    assert(old_capa >= capacity);
-    if (old_capa > capacity)
-	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
+    long old_capa = ARY_HEAP_CAPA(ary);
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    RUBY_ASSERT(old_capa >= capacity);
+    if (old_capa > capacity) {
+        size_t new_capa = ary_heap_realloc(ary, capacity);
+        ARY_SET_CAPA(ary, new_capa);
+    }
+
+    ary_verify(ary);
 }
 
 static void
@@ -251,106 +460,128 @@ ary_double_capa(VALUE ary, long min)
     long new_capa = ARY_CAPA(ary) / 2;
 
     if (new_capa < ARY_DEFAULT_SIZE) {
-	new_capa = ARY_DEFAULT_SIZE;
+        new_capa = ARY_DEFAULT_SIZE;
     }
     if (new_capa >= ARY_MAX_SIZE - min) {
-	new_capa = (ARY_MAX_SIZE - min) / 2;
+        new_capa = (ARY_MAX_SIZE - min) / 2;
     }
     new_capa += min;
     ary_resize_capa(ary, new_capa);
+
+    ary_verify(ary);
 }
 
 static void
-rb_ary_decrement_share(VALUE shared)
+rb_ary_decrement_share(VALUE shared_root)
 {
-    if (shared) {
-	long num = ARY_SHARED_NUM(shared) - 1;
-	if (num == 0) {
-	    rb_ary_free(shared);
-	    rb_gc_force_recycle(shared);
-	}
-	else if (num > 0) {
-	    ARY_SET_SHARED_NUM(shared, num);
-	}
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
     }
 }
 
 static void
 rb_ary_unshare(VALUE ary)
 {
-    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
-    rb_ary_decrement_share(shared);
+    VALUE shared_root = ARY_SHARED_ROOT(ary);
+    rb_ary_decrement_share(shared_root);
     FL_UNSET_SHARED(ary);
 }
 
-static inline void
-rb_ary_unshare_safe(VALUE ary)
+static void
+rb_ary_reset(VALUE ary)
 {
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
+    if (ARY_OWNS_HEAP_P(ary)) {
+        ary_heap_free(ary);
     }
+    else if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+    }
+
+    FL_SET_EMBED(ary);
+    ARY_SET_EMBED_LEN(ary, 0);
 }
 
 static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_increment_share(VALUE shared_root)
 {
-    long num = ARY_SHARED_NUM(shared);
-    if (num >= 0) {
-	ARY_SET_SHARED_NUM(shared, num + 1);
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        RUBY_ASSERT(num >= 0);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
     }
-    return shared;
+    return shared_root;
 }
 
 static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
 {
-    rb_ary_increment_share(shared);
+    RUBY_ASSERT(!ARY_EMBED_P(ary));
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(shared_root) || OBJ_FROZEN(shared_root));
+
+    rb_ary_increment_share(shared_root);
     FL_SET_SHARED(ary);
-    ARY_SET_SHARED(ary, shared);
+    RB_OBJ_WRITE(ary, &RARRAY(ary)->as.heap.aux.shared_root, shared_root);
+
+    RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
 }
 
 static inline void
 rb_ary_modify_check(VALUE ary)
 {
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
     rb_check_frozen(ary);
+    ary_verify(ary);
 }
 
 void
-rb_ary_modify(VALUE ary)
+rb_ary_cancel_sharing(VALUE ary)
 {
-    rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-	long shared_len, len = RARRAY_LEN(ary);
-	VALUE shared = ARY_SHARED(ary);
-        if (len <= RARRAY_EMBED_LEN_MAX) {
-	    const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long shared_len, len = RARRAY_LEN(ary);
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+        ary_verify(shared_root);
+
+        if (len <= ary_embed_capa(ary)) {
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
             FL_UNSET_SHARED(ary);
             FL_SET_EMBED(ary);
-	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
-            rb_ary_decrement_share(shared);
+            MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared_root);
             ARY_SET_EMBED_LEN(ary, len);
         }
-	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
-	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
-	    FL_UNSET_SHARED(ary);
-	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
-	    ARY_SET_CAPA(ary, shared_len);
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+shift, VALUE, len);
-	    });
-	    FL_SET_EMBED(shared);
-	    rb_ary_decrement_share(shared);
-	}
+        else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+            long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared_root);
+            FL_UNSET_SHARED(ary);
+            ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared_root));
+            ARY_SET_CAPA(ary, shared_len);
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr+shift, VALUE, len);
+            });
+            FL_SET_EMBED(shared_root);
+            rb_ary_decrement_share(shared_root);
+        }
         else {
-            VALUE *ptr = ALLOC_N(VALUE, len);
-            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+            VALUE *ptr = ary_heap_alloc_buffer(len);
+            MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
             rb_ary_unshare(ary);
-            ARY_SET_CAPA(ary, len);
-            ARY_SET_PTR(ary, ptr);
+            ARY_SET_CAPA_FORCE(ary, len);
+            ARY_SET_PTR_FORCE(ary, ptr);
         }
 
-	rb_gc_writebarrier_remember(ary);
+        rb_gc_writebarrier_remember(ary);
     }
+    ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    rb_ary_cancel_sharing(ary);
 }
 
 static VALUE
@@ -361,69 +592,75 @@ ary_ensure_room_for_push(VALUE ary, long add_len)
     long capa;
 
     if (old_len > ARY_MAX_SIZE - add_len) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
     }
     if (ARY_SHARED_P(ary)) {
-	if (new_len > RARRAY_EMBED_LEN_MAX) {
-	    VALUE shared = ARY_SHARED(ary);
-	    if (ARY_SHARED_OCCUPIED(shared)) {
-		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
-		    rb_ary_modify_check(ary);
-		    return shared;
-		}
-		else {
-		    /* if array is shared, then it is likely it participate in push/shift pattern */
-		    rb_ary_modify(ary);
-		    capa = ARY_CAPA(ary);
-		    if (new_len > capa - (capa >> 6)) {
-			ary_double_capa(ary, new_len);
-		    }
-		    return ary;
-		}
-	    }
-	}
-	rb_ary_modify(ary);
+        if (new_len > ary_embed_capa(ary)) {
+            VALUE shared_root = ARY_SHARED_ROOT(ary);
+            if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+                if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+                    rb_ary_modify_check(ary);
+
+                    ary_verify(ary);
+                    ary_verify(shared_root);
+                    return shared_root;
+                }
+                else {
+                    /* if array is shared, then it is likely it participate in push/shift pattern */
+                    rb_ary_modify(ary);
+                    capa = ARY_CAPA(ary);
+                    if (new_len > capa - (capa >> 6)) {
+                        ary_double_capa(ary, new_len);
+                    }
+                    ary_verify(ary);
+                    return ary;
+                }
+            }
+        }
+        ary_verify(ary);
+        rb_ary_modify(ary);
     }
     else {
-	rb_ary_modify_check(ary);
+        rb_ary_modify_check(ary);
     }
     capa = ARY_CAPA(ary);
     if (new_len > capa) {
-	ary_double_capa(ary, new_len);
+        ary_double_capa(ary, new_len);
     }
 
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *      ary.freeze -> ary
+ *    freeze -> self
+ *
+ *  Freezes +self+ (if not already frozen); returns +self+:
  *
- *  Calls Object#freeze on +ary+ to prevent any further
- *  modification. A RuntimeError will be raised if a modification
- *  attempt is made.
+ *    a = []
+ *    a.frozen? # => false
+ *    a.freeze
+ *    a.frozen? # => true
  *
+ *  No further changes may be made to +self+;
+ *  raises FrozenError if a change is attempted.
+ *
+ *  Related: Kernel#frozen?.
  */
 
 VALUE
 rb_ary_freeze(VALUE ary)
 {
-    return rb_obj_freeze(ary);
-}
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
 
-/*
- *  call-seq:
- *     ary.frozen?  -> true or false
- *
- *  Return +true+ if this array is frozen (or temporarily frozen
- *  while being sorted). See also Object#frozen?
- */
+    if (OBJ_FROZEN(ary)) return ary;
 
-static VALUE
-rb_ary_frozen_p(VALUE ary)
-{
-    if (OBJ_FROZEN(ary)) return Qtrue;
-    return Qfalse;
+    if (!ARY_EMBED_P(ary) && !ARY_SHARED_P(ary) && !ARY_SHARED_ROOT_P(ary)) {
+        ary_shrink_capa(ary);
+    }
+
+    return rb_obj_freeze(ary);
 }
 
 /* This can be used to take a snapshot of an array (with
@@ -437,22 +674,35 @@ VALUE
 rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
 {
     if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
-	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
-	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
-	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
-	return Qtrue;
+            !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+            ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
+            ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
+        return Qtrue;
     }
     return Qfalse;
 }
 
 static VALUE
-ary_alloc(VALUE klass)
+ary_alloc_embed(VALUE klass, long capa)
 {
-    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-    /* Created array is:
-     *   FL_SET_EMBED((VALUE)ary);
-     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
-     */
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+   /* Created array is:
+    *   FL_SET_EMBED((VALUE)ary);
+    *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+    */
+    return rb_newobj_of(klass, T_ARRAY | RARRAY_EMBED_FLAG, size);
+}
+
+static VALUE
+ary_alloc_heap(VALUE klass)
+{
+    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY, sizeof(struct RArray));
+
+    ary->as.heap.len = 0;
+    ary->as.heap.aux.capa = 0;
+    ary->as.heap.ptr = NULL;
+
     return (VALUE)ary;
 }
 
@@ -460,29 +710,34 @@ static VALUE
 empty_ary_alloc(VALUE klass)
 {
     RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
-    return ary_alloc(klass);
+    return ary_alloc_embed(klass, 0);
 }
 
 static VALUE
 ary_new(VALUE klass, long capa)
 {
-    VALUE ary,*ptr;
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
+    VALUE ary;
 
     if (capa < 0) {
-	rb_raise(rb_eArgError, "negative array size (or size too big)");
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
     if (capa > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
+        rb_raise(rb_eArgError, "array size too big");
     }
 
     RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
 
-    ary = ary_alloc(klass);
-    if (capa > RARRAY_EMBED_LEN_MAX) {
-	ptr = ALLOC_N(VALUE, capa);
-        FL_UNSET_EMBED(ary);
-        ARY_SET_PTR(ary, ptr);
+    if (ary_embeddable_p(capa)) {
+        ary = ary_alloc_embed(klass, capa);
+    }
+    else {
+        ary = ary_alloc_heap(klass);
         ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
         ARY_SET_HEAP_LEN(ary, 0);
     }
 
@@ -498,7 +753,7 @@ rb_ary_new_capa(long capa)
 VALUE
 rb_ary_new(void)
 {
-    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+    return rb_ary_new_capa(0);
 }
 
 VALUE
@@ -512,7 +767,7 @@ VALUE
 
     va_start(ar, n);
     for (i=0; i<n; i++) {
-	ARY_SET(ary, i, va_arg(ar, VALUE));
+        ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
@@ -527,8 +782,8 @@ rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
 
     ary = ary_new(klass, n);
     if (n > 0 && elts) {
-	ary_memcpy(ary, 0, n, elts);
-	ARY_SET_LEN(ary, n);
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
     }
 
     return ary;
@@ -540,16 +795,82 @@ rb_ary_new_from_values(long n, const VALUE *elts)
     return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
 }
 
+static VALUE
+ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+   /* Created array is:
+    *   FL_SET_EMBED((VALUE)ary);
+    *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+    */
+    return rb_ec_newobj_of(ec, klass, T_ARRAY | RARRAY_EMBED_FLAG, size);
+}
+
+static VALUE
+ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
+{
+    VALUE ary = rb_ec_newobj_of(ec, klass, T_ARRAY, sizeof(struct RArray));
+    RARRAY(ary)->as.heap.len = 0;
+    RARRAY(ary)->as.heap.aux.capa = 0;
+    RARRAY(ary)->as.heap.ptr = NULL;
+    return ary;
+}
+
+static VALUE
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    VALUE ary;
+
+    if (capa < 0) {
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
+    }
+
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    if (ary_embeddable_p(capa)) {
+        ary = ec_ary_alloc_embed(ec, klass, capa);
+    }
+    else {
+        ary = ec_ary_alloc_heap(ec, klass);
+        ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
+
+    return ary;
+}
+
 VALUE
-rb_ary_tmp_new(long capa)
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
 {
-    return ary_new(0, capa);
+    VALUE ary;
+
+    ary = ec_ary_new(ec, rb_cArray, n);
+    if (n > 0 && elts) {
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
+    }
+
+    return ary;
 }
 
 VALUE
-rb_ary_tmp_new_fill(long capa)
+rb_ary_hidden_new(long capa)
 {
     VALUE ary = ary_new(0, capa);
+    return ary;
+}
+
+VALUE
+rb_ary_hidden_new_fill(long capa)
+{
+    VALUE ary = rb_ary_hidden_new(capa);
     ary_memfill(ary, 0, capa, Qnil);
     ARY_SET_LEN(ary, capa);
     return ary;
@@ -559,63 +880,107 @@ void
 rb_ary_free(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-	RB_DEBUG_COUNTER_INC(obj_ary_ptr);
-	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+        if (USE_DEBUG_COUNTER &&
+            !ARY_SHARED_ROOT_P(ary) &&
+            ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+            RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+        }
+
+        RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+        ary_heap_free(ary);
     }
     else {
-	RB_DEBUG_COUNTER_INC(obj_ary_embed);
+        RB_DEBUG_COUNTER_INC(obj_ary_embed);
+    }
+
+    if (ARY_SHARED_P(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared);
     }
+    if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
+    }
+}
+
+static VALUE fake_ary_flags;
+
+static VALUE
+init_fake_ary_flags(void)
+{
+    struct RArray fake_ary = {0};
+    fake_ary.basic.flags = T_ARRAY;
+    VALUE ary = (VALUE)&fake_ary;
+    rb_ary_freeze(ary);
+    return fake_ary.basic.flags;
+}
+
+VALUE
+rb_setup_fake_ary(struct RArray *fake_ary, const VALUE *list, long len)
+{
+    fake_ary->basic.flags = fake_ary_flags;
+    RBASIC_CLEAR_CLASS((VALUE)fake_ary);
+
+    // bypass frozen checks
+    fake_ary->as.heap.ptr = list;
+    fake_ary->as.heap.len = len;
+    fake_ary->as.heap.aux.capa = len;
+    return (VALUE)fake_ary;
 }
 
-RUBY_FUNC_EXPORTED size_t
+size_t
 rb_ary_memsize(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-	return ARY_CAPA(ary) * sizeof(VALUE);
+        return ARY_CAPA(ary) * sizeof(VALUE);
     }
     else {
-	return 0;
+        return 0;
     }
 }
 
-static inline void
-ary_discard(VALUE ary)
-{
-    rb_ary_free(ary);
-    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
-    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
 static VALUE
 ary_make_shared(VALUE ary)
 {
-    assert(!ARY_EMBED_P(ary));
+    ary_verify(ary);
+
     if (ARY_SHARED_P(ary)) {
-	return ARY_SHARED(ary);
+        return ARY_SHARED_ROOT(ary);
     }
     else if (ARY_SHARED_ROOT_P(ary)) {
-	return ary;
+        return ary;
     }
     else if (OBJ_FROZEN(ary)) {
-	ary_shrink_capa(ary);
-	FL_SET_SHARED_ROOT(ary);
-	ARY_SET_SHARED_NUM(ary, 1);
-	return ary;
+        return ary;
     }
     else {
-	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
-	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-        FL_UNSET_EMBED(shared);
+        long capa = ARY_CAPA(ary);
+        long len = RARRAY_LEN(ary);
 
-	ARY_SET_LEN((VALUE)shared, capa);
-	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
-	ary_mem_clear((VALUE)shared, len, capa - len);
-	FL_SET_SHARED_ROOT(shared);
-	ARY_SET_SHARED_NUM((VALUE)shared, 1);
-	FL_SET_SHARED(ary);
-	ARY_SET_SHARED(ary, (VALUE)shared);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
+        /* Shared roots cannot be embedded because the reference count
+         * (refcnt) is stored in as.heap.aux.capa. */
+        VALUE shared = ary_alloc_heap(0);
+        FL_SET_SHARED_ROOT(shared);
+
+        if (ARY_EMBED_P(ary)) {
+            VALUE *ptr = ary_heap_alloc_buffer(capa);
+            ARY_SET_PTR(shared, ptr);
+            ary_memcpy(shared, 0, len, RARRAY_CONST_PTR(ary));
+
+            FL_UNSET_EMBED(ary);
+            ARY_SET_HEAP_LEN(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+        else {
+            ARY_SET_PTR(shared, RARRAY_CONST_PTR(ary));
+        }
+
+        ARY_SET_LEN(shared, capa);
+        ary_mem_clear(shared, len, capa - len);
+        rb_ary_set_shared(ary, shared);
+
+        ary_verify(shared);
+        ary_verify(ary);
+
+        return shared;
     }
 }
 
@@ -624,9 +989,11 @@ ary_make_substitution(VALUE ary)
 {
     long len = RARRAY_LEN(ary);
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE subst = rb_ary_new2(len);
-	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+    if (ary_embeddable_p(len)) {
+        VALUE subst = rb_ary_new_capa(len);
+        RUBY_ASSERT(ARY_EMBED_P(subst));
+
+        ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
         ARY_SET_EMBED_LEN(subst, len);
         return subst;
     }
@@ -654,23 +1021,34 @@ rb_check_array_type(VALUE ary)
     return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
 }
 
+VALUE
+rb_check_to_array(VALUE ary)
+{
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+VALUE
+rb_to_array(VALUE ary)
+{
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
 /*
  *  call-seq:
- *     Array.try_convert(obj) -> array or nil
+ *    Array.try_convert(object) -> object, new_array, or nil
+ *
+ *  Attempts to return an array, based on the given +object+.
  *
- *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
- *  converted array or +nil+ if +obj+ cannot be converted for any reason.
- *  This method can be used to check if an argument is an array.
+ *  If +object+ is an array, returns +object+.
  *
- *     Array.try_convert([1])   #=> [1]
- *     Array.try_convert("1")   #=> nil
+ *  Otherwise if +object+ responds to <tt>:to_ary</tt>.
+ *  calls <tt>object.to_ary</tt>:
+ *  if the return value is an array or +nil+, returns that value;
+ *  if not, raises TypeError.
  *
- *     if tmp = Array.try_convert(arg)
- *       # the argument is an array
- *     elsif tmp = String.try_convert(arg)
- *       # the argument is a string
- *     end
+ *  Otherwise returns +nil+.
  *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -679,60 +1057,79 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
     return rb_check_array_type(ary);
 }
 
+/* :nodoc: */
+static VALUE
+rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
+{
+    VALUE ary;
+
+    if (klass == rb_cArray) {
+        long size = 0;
+        if (argc > 0 && FIXNUM_P(argv[0])) {
+            size = FIX2LONG(argv[0]);
+            if (size < 0) size = 0;
+        }
+
+        ary = ary_new(klass, size);
+
+        rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
+    }
+    else {
+        ary = rb_class_new_instance_pass_kw(argc, argv, klass);
+    }
+
+    return ary;
+}
+
 /*
  *  call-seq:
- *     Array.new(size=0, default=nil)
- *     Array.new(array)
- *     Array.new(size) {|index| block }
+ *    Array.new -> new_empty_array
+ *    Array.new(array) -> new_array
+ *    Array.new(size, default_value = nil) -> new_array
+ *    Array.new(size = 0) {|index| ... } -> new_array
  *
  *  Returns a new array.
  *
- *  In the first form, if no arguments are sent, the new array will be empty.
- *  When a +size+ and an optional +default+ are sent, an array is created with
- *  +size+ copies of +default+.  Take notice that all elements will reference the
- *  same object +default+.
- *
- *  The second form creates a copy of the array passed as a parameter (the
- *  array is generated by calling to_ary on the parameter).
+ *  With no block and no argument given, returns a new empty array:
  *
- *    first_array = ["Matz", "Guido"]
+ *    Array.new # => []
  *
- *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *  With no block and array argument given, returns a new array with the same elements:
  *
- *    first_array.equal? second_array       #=> false
+ *    Array.new([:foo, 'bar', 2]) # => [:foo, "bar", 2]
  *
- *  In the last form, an array of the given size is created.  Each element in
- *  this array is created by passing the element's index to the given block
- *  and storing the return value.
+ *  With no block and integer argument given, returns a new array containing
+ *  that many instances of the given +default_value+:
  *
- *    Array.new(3){ |index| index ** 2 }
- *    # => [0, 1, 4]
+ *    Array.new(0)    # => []
+ *    Array.new(3)    # => [nil, nil, nil]
+ *    Array.new(2, 3) # => [3, 3]
  *
- *  == Common gotchas
+ *  With a block given, returns an array of the given +size+;
+ *  calls the block with each +index+ in the range <tt>(0...size)</tt>;
+ *  the element at that +index+ in the returned array is the blocks return value:
  *
- *  When sending the second parameter, the same object will be used as the
- *  value for all the array elements:
+ *    Array.new(3)  {|index| "Element #{index}" } # => ["Element 0", "Element 1", "Element 2"]
  *
- *     a = Array.new(2, Hash.new)
- *     # => [{}, {}]
+ *  A common pitfall for new Rubyists is providing an expression as +default_value+:
  *
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *    array = Array.new(2, {})
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {a: 1}], as array[0] and array[1] are same object
  *
- *     a[1]['cat'] = 'Felix'
- *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *  If you want the elements of the array to be distinct, you should pass a block:
  *
- *  Since all the Array elements store the same hash, changes to one of them
- *  will affect them all.
+ *    array = Array.new(2) { {} }
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {}], as array[0] and array[1] are different objects
  *
- *  If multiple copies are what you want, you should use the block
- *  version which uses the result of that block each time an element
- *  of the array needs to be initialized:
- *
- *     a = Array.new(2) { Hash.new }
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {}]
+ *  Raises TypeError if the first argument is not either an array
+ *  or an {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]).
+ *  Raises ArgumentError if the first argument is a negative integer.
  *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -743,61 +1140,60 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 
     rb_ary_modify(ary);
     if (argc == 0) {
-	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
-	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
-	}
-        rb_ary_unshare_safe(ary);
-        FL_SET_EMBED(ary);
-	ARY_SET_EMBED_LEN(ary, 0);
-	if (rb_block_given_p()) {
-	    rb_warning("given block not used");
-	}
-	return ary;
+        rb_ary_reset(ary);
+        RUBY_ASSERT(ARY_EMBED_P(ary));
+        RUBY_ASSERT(ARY_EMBED_LEN(ary) == 0);
+        if (rb_block_given_p()) {
+            rb_warning("given block not used");
+        }
+        return ary;
     }
     rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
-	val = rb_check_array_type(size);
-	if (!NIL_P(val)) {
-	    rb_ary_replace(ary, val);
-	    return ary;
-	}
+        val = rb_check_array_type(size);
+        if (!NIL_P(val)) {
+            rb_ary_replace(ary, val);
+            return ary;
+        }
     }
 
     len = NUM2LONG(size);
     /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+        rb_raise(rb_eArgError, "negative array size");
     }
     if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
+        rb_raise(rb_eArgError, "array size too big");
     }
     /* recheck after argument conversion */
     rb_ary_modify(ary);
     ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
-	long i;
+        long i;
 
-	if (argc == 2) {
-	    rb_warn("block supersedes default value argument");
-	}
-	for (i=0; i<len; i++) {
-	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    ARY_SET_LEN(ary, i + 1);
-	}
+        if (argc == 2) {
+            rb_warn("block supersedes default value argument");
+        }
+        for (i=0; i<len; i++) {
+            rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+            ARY_SET_LEN(ary, i + 1);
+        }
     }
     else {
-	ary_memfill(ary, 0, len, val);
-	ARY_SET_LEN(ary, len);
+        ary_memfill(ary, 0, len, val);
+        ARY_SET_LEN(ary, len);
     }
     return ary;
 }
 
 /*
- * Returns a new array populated with the given objects.
+ * Returns a new array, populated with the given objects:
+ *
+ *   Array[1, 'a', /^A/]    # => [1, "a", /^A/]
+ *   Array[]                # => []
+ *   Array.[](1, 'a', /^A/) # => [1, "a", /^A/]
  *
- *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
- *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
- *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
+ * Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -818,26 +1214,26 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
     long len = RARRAY_LEN(ary);
 
     if (idx < 0) {
-	idx += len;
-	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     idx - len, -len);
-	}
+        idx += len;
+        if (idx < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     idx - len, -len);
+        }
     }
     else if (idx >= ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", idx);
+        rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
     rb_ary_modify(ary);
     if (idx >= ARY_CAPA(ary)) {
-	ary_double_capa(ary, idx);
+        ary_double_capa(ary, idx);
     }
     if (idx > len) {
-	ary_mem_clear(ary, len, idx - len + 1);
+        ary_mem_clear(ary, len, idx - len + 1);
     }
 
     if (idx >= len) {
-	ARY_SET_LEN(ary, idx + 1);
+        ARY_SET_LEN(ary, idx + 1);
     }
     ARY_SET(ary, idx, val);
 }
@@ -845,35 +1241,98 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
 static VALUE
 ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
 {
-    assert(offset >= 0);
-    assert(len >= 0);
-    assert(offset+len <= RARRAY_LEN(ary));
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-        VALUE result = ary_alloc(klass);
-	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+    VALUE result = ary_alloc_heap(klass);
+    size_t embed_capa = ary_embed_capa(result);
+    if ((size_t)len <= embed_capa) {
+        FL_SET_EMBED(result);
+        ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
         ARY_SET_EMBED_LEN(result, len);
-        return result;
     }
     else {
-        VALUE shared, result = ary_alloc(klass);
+        VALUE shared = ary_make_shared(ary);
+
+        /* The ary_make_shared call may allocate, which can trigger a GC
+         * compaction. This can cause the array to be embedded because it has
+         * a length of 0. */
         FL_UNSET_EMBED(result);
 
-        shared = ary_make_shared(ary);
         ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
         ARY_SET_LEN(result, RARRAY_LEN(ary));
         rb_ary_set_shared(result, shared);
 
         ARY_INCREASE_PTR(result, offset);
         ARY_SET_LEN(result, len);
+
+        ary_verify(shared);
+    }
+
+    ary_verify(result);
+    return result;
+}
+
+static VALUE
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
+{
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
+    RUBY_ASSERT(step != 0);
+
+    const long orig_len = len;
+
+    if (step > 0 && step >= len) {
+        VALUE result = ary_new(klass, 1);
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RB_OBJ_WRITE(result, ptr, values[offset]);
+        ARY_SET_EMBED_LEN(result, 1);
         return result;
     }
+    else if (step < 0 && step < -len) {
+        step = -len;
+    }
+
+    long ustep = (step < 0) ? -step : step;
+    len = roomof(len, ustep);
+
+    long i;
+    long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+
+    VALUE result = ary_new(klass, len);
+    if (ARY_EMBED_P(result)) {
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        for (i = 0; i < len; ++i) {
+            RB_OBJ_WRITE(result, ptr+i, values[j]);
+            j += step;
+        }
+        ARY_SET_EMBED_LEN(result, len);
+    }
+    else {
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RARRAY_PTR_USE(result, ptr, {
+            for (i = 0; i < len; ++i) {
+                RB_OBJ_WRITE(result, ptr+i, values[j]);
+                j += step;
+            }
+        });
+        ARY_SET_LEN(result, len);
+    }
+
+    return result;
 }
 
 static VALUE
 ary_make_shared_copy(VALUE ary)
 {
-    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
 }
 
 enum ary_take_pos_flags
@@ -883,53 +1342,59 @@ enum ary_take_pos_flags
 };
 
 static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+ary_take_first_or_last_n(VALUE ary, long n, enum ary_take_pos_flags last)
 {
-    VALUE nv;
-    long n;
-    long len;
+    long len = RARRAY_LEN(ary);
     long offset = 0;
 
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
-    len = RARRAY_LEN(ary);
     if (n > len) {
-	n = len;
+        n = len;
     }
     else if (n < 0) {
-	rb_raise(rb_eArgError, "negative array size");
+        rb_raise(rb_eArgError, "negative array size");
     }
     if (last) {
-	offset = len - n;
+        offset = len - n;
     }
     return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    argc = rb_check_arity(argc, 0, 1);
+    /* the case optional argument is omitted should be handled in
+     * callers of this function.  if another arity case is added,
+     * this arity check needs to rewrite. */
+    RUBY_ASSERT_ALWAYS(argc == 1);
+    return ary_take_first_or_last_n(ary, NUM2LONG(argv[0]), last);
+}
+
 /*
  *  call-seq:
- *     ary << obj            -> ary
+ *    self << object -> self
  *
- *  Append---Pushes the given object on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together.
+ *  Appends +object+ as the last element in +self+; returns +self+:
  *
- *     a = [ 1, 2 ]
- *     a << "c" << "d" << [ 3, 4 ]
- *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
- *     a
- *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *    [:foo, 'bar', 2] << :baz # => [:foo, "bar", 2, :baz]
  *
+ *  Appends +object+ as a single element, even if it is another array:
+ *
+ *    [:foo, 'bar', 2] << [3, 4] # => [:foo, "bar", 2, [3, 4]]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
 rb_ary_push(VALUE ary, VALUE item)
 {
-    long idx = RARRAY_LEN(ary);
+    long idx = RARRAY_LEN((ary_verify(ary), ary));
     VALUE target_ary = ary_ensure_room_for_push(ary, 1);
     RARRAY_PTR_USE(ary, ptr, {
-	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+        RB_OBJ_WRITE(target_ary, &ptr[idx], item);
     });
     ARY_SET_LEN(ary, idx + 1);
+    ary_verify(ary);
     return ary;
 }
 
@@ -945,18 +1410,20 @@ rb_ary_cat(VALUE ary, const VALUE *argv, long len)
 
 /*
  *  call-seq:
- *     ary.push(obj, ... )   -> ary
- *
- *  Append --- Pushes the given object(s) on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together. See also Array#pop for the opposite
- *  effect.
- *
- *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")
- *             #=> ["a", "b", "c", "d", "e", "f"]
- *     [1, 2, 3].push(4).push(5)
- *             #=> [1, 2, 3, 4, 5]
+ *    push(*objects) -> self
+ *    append(*objects) -> self
+ *
+ *  Appends each argument in +objects+ to +self+; returns +self+:
+ *
+ *    a = [:foo, 'bar', 2] # => [:foo, "bar", 2]
+ *    a.push(:baz, :bat)   # => [:foo, "bar", 2, :baz, :bat]
+ *
+ *  Appends each argument as a single element, even if it is another array:
+ *
+ *    a = [:foo, 'bar', 2]               # => [:foo, "bar", 2]
+      a.push([:baz, :bat], [:bam, :bad]) # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -973,32 +1440,47 @@ rb_ary_pop(VALUE ary)
     n = RARRAY_LEN(ary);
     if (n == 0) return Qnil;
     if (ARY_OWNS_HEAP_P(ary) &&
-	n * 3 < ARY_CAPA(ary) &&
-	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+        n * 3 < ARY_CAPA(ary) &&
+        ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
     {
-	ary_resize_capa(ary, n * 2);
+        ary_resize_capa(ary, n * 2);
     }
-    --n;
-    ARY_SET_LEN(ary, n);
-    return RARRAY_AREF(ary, n);
+
+    VALUE obj = RARRAY_AREF(ary, n - 1);
+
+    ARY_SET_LEN(ary, n - 1);
+    ary_verify(ary);
+    return obj;
 }
 
 /*
  *  call-seq:
- *     ary.pop    -> obj or nil
- *     ary.pop(n) -> new_ary
+ *    pop -> object or nil
+ *    pop(count) -> new_array
+ *
+ *  Removes and returns trailing elements of +self+.
+ *
+ *  With no argument given, removes and returns the last element, if available;
+ *  otherwise returns +nil+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop  # => 2
+ *    a      # => [:foo, "bar"]
+ *    [].pop # => nil
  *
- *  Removes the last element from +self+ and returns it, or
- *  +nil+ if the array is empty.
+ *  With non-negative integer argument +count+ given,
+ *  returns a new array containing the trailing +count+ elements of +self+, as available:
  *
- *  If a number +n+ is given, returns an array of the last +n+ elements
- *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
- *  Array#push for the opposite effect.
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(2) # => ["bar", 2]
+ *    a        # => [:foo]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.pop     #=> "d"
- *     a.pop(2)  #=> ["b", "c"]
- *     a         #=> ["a"]
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(50) # => [:foo, "bar", 2]
+ *    a         # => []
+ *
+ *  Related: Array#push;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -1007,12 +1489,13 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
     VALUE result;
 
     if (argc == 0) {
-	return rb_ary_pop(ary);
+        return rb_ary_pop(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    ary_verify(ary);
     return result;
 }
 
@@ -1022,52 +1505,54 @@ rb_ary_shift(VALUE ary)
     VALUE top;
     long len = RARRAY_LEN(ary);
 
-    rb_ary_modify_check(ary);
-    if (len == 0) return Qnil;
+    if (len == 0) {
+        rb_ary_modify_check(ary);
+        return Qnil;
+    }
+
     top = RARRAY_AREF(ary, 0);
-    if (!ARY_SHARED_P(ary)) {
-	if (len < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+1, VALUE, len-1);
-	    }); /* WB: no new reference */
-            ARY_INCREASE_LEN(ary, -1);
-	    return top;
-	}
-        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
-
-	ARY_SET(ary, 0, Qnil);
-	ary_make_shared(ary);
-    }
-    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
-    }
-    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
-    ARY_INCREASE_LEN(ary, -1);
+
+    rb_ary_behead(ary, 1);
 
     return top;
 }
 
 /*
  *  call-seq:
- *     ary.shift    -> obj or nil
- *     ary.shift(n) -> new_ary
+ *    shift -> object or nil
+ *    shift(count) -> new_array or nil
+ *
+ *  Removes and returns leading elements from +self+.
+ *
+ *  With no argument, removes and returns one element, if available,
+ *  or +nil+ otherwise:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.shift  # => 0
+ *    a        # => [1, 2, 3]
+ *    [].shift # => nil
+ *
+ *  With non-negative numeric argument +count+ given,
+ *  removes and returns the first +count+ elements:
  *
- *  Removes the first element of +self+ and returns it (shifting all
- *  other elements down by one). Returns +nil+ if the array
- *  is empty.
+ *    a = [0, 1, 2, 3]
+ *    a.shift(2)   # => [0, 1]
+ *    a            # => [2, 3]
+ *    a.shift(1.1) # => [2]
+ *    a            # => [3]
+ *    a.shift(0)   # => []
+ *    a            # => [3]
  *
- *  If a number +n+ is given, returns an array of the first +n+ elements
- *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- *  containing only the remainder elements, not including what was shifted to
- *  +new_ary+. See also Array#unshift for the opposite effect.
+ *  If +count+ is large,
+ *  removes and returns all elements:
  *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift     #=> "-m"
- *     args           #=> ["-q", "filename"]
+ *    a = [0, 1, 2, 3]
+ *    a.shift(50) # => [0, 1, 2, 3]
+ *    a           # => []
  *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift(2)  #=> ["-m", "-q"]
- *     args           #=> ["filename"]
+ *  If +self+ is empty, returns a new empty array.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -1077,115 +1562,158 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
     long n;
 
     if (argc == 0) {
-	return rb_ary_shift(ary);
+        return rb_ary_shift(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     n = RARRAY_LEN(result);
-    if (ARY_SHARED_P(ary)) {
-	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	  setup_occupied_shared:
-	    ary_mem_clear(ary, 0, n);
-	}
-        ARY_INCREASE_PTR(ary, n);
+    rb_ary_behead(ary,n);
+
+    return result;
+}
+
+VALUE
+rb_ary_behead(VALUE ary, long n)
+{
+    if (n <= 0) {
+        return ary;
     }
-    else {
-	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
-	    }); /* WB: no new reference */
-	}
-	else {
-	    ary_make_shared(ary);
-	    goto setup_occupied_shared;
-	}
+
+    rb_ary_modify_check(ary);
+
+    if (!ARY_SHARED_P(ary)) {
+        if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
+            }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -n);
+            ary_verify(ary);
+            return ary;
+        }
+
+        ary_mem_clear(ary, 0, n);
+        ary_make_shared(ary);
     }
+    else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+        ary_mem_clear(ary, 0, n);
+    }
+
+    ARY_INCREASE_PTR(ary, n);
     ARY_INCREASE_LEN(ary, -n);
+    ary_verify(ary);
 
-    return result;
+    return ary;
 }
 
 static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
+{
+    if (head - sharedp < argc) {
+        long room = capa - len - argc;
+
+        room -= room >> 4;
+        MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+        head = sharedp + argc + room;
+    }
+    ARY_SET_PTR(ary, head - argc);
+    RUBY_ASSERT(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+    ary_verify(ary);
+    return ARY_SHARED_ROOT(ary);
+}
+
+static VALUE
+ary_modify_for_unshift(VALUE ary, int argc)
 {
     long len = RARRAY_LEN(ary);
     long new_len = len + argc;
     long capa;
     const VALUE *head, *sharedp;
 
-    if (len > ARY_MAX_SIZE - argc) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
-    }
-
-    if (ARY_SHARED_P(ary)) {
-	VALUE shared = ARY_SHARED(ary);
-	capa = RARRAY_LEN(shared);
-	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
-	    head = RARRAY_CONST_PTR(ary);
-	    sharedp = RARRAY_CONST_PTR(shared);
-	    goto makeroom_if_need;
-	}
-    }
-
     rb_ary_modify(ary);
     capa = ARY_CAPA(ary);
     if (capa - (capa >> 6) <= new_len) {
-	ary_double_capa(ary, new_len);
+        ary_double_capa(ary, new_len);
     }
 
     /* use shared array for big "queues" */
-    if (new_len > ARY_DEFAULT_SIZE * 4) {
-	/* make a room for unshifted items */
-	capa = ARY_CAPA(ary);
-	ary_make_shared(ary);
-
-	head = sharedp = RARRAY_CONST_PTR(ary);
-	goto makeroom;
-      makeroom_if_need:
-	if (head - sharedp < argc) {
-	    long room;
-	  makeroom:
-	    room = capa - new_len;
-	    room -= room >> 4;
-	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
-	    head = sharedp + argc + room;
-	}
-	ARY_SET_PTR(ary, head - argc);
-	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
-	return ARY_SHARED(ary);
+    if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
+        ary_verify(ary);
+
+        /* make a room for unshifted items */
+        capa = ARY_CAPA(ary);
+        ary_make_shared(ary);
+
+        head = sharedp = RARRAY_CONST_PTR(ary);
+        return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
+    }
+    else {
+        /* sliding items */
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMMOVE(ptr + argc, ptr, VALUE, len);
+        });
+
+        ary_verify(ary);
+        return ary;
+    }
+}
+
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+
+    if (len > ARY_MAX_SIZE - argc) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    else if (! ARY_SHARED_P(ary)) {
+        return ary_modify_for_unshift(ary, argc);
     }
     else {
-	/* sliding items */
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMMOVE(ptr + argc, ptr, VALUE, len);
-	});
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+        long capa = RARRAY_LEN(shared_root);
 
-	return ary;
+        if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else if (new_len > capa) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else {
+            const VALUE * head = RARRAY_CONST_PTR(ary);
+            void *sharedp = (void *)RARRAY_CONST_PTR(shared_root);
+
+            rb_ary_modify_check(ary);
+            return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+        }
     }
 }
 
 /*
  *  call-seq:
- *     ary.unshift(obj, ...)  -> ary
+ *    unshift(*objects) -> self
+ *    prepend(*objects) -> self
  *
- *  Prepends objects to the front of +self+, moving other elements upwards.
- *  See also Array#shift for the opposite effect.
+ *  Prepends the given +objects+ to +self+:
  *
- *     a = [ "b", "c", "d" ]
- *     a.unshift("a")   #=> ["a", "b", "c", "d"]
- *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
+ *    a = [:foo, 'bar', 2]
+ *    a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
+ *
+ *  Related: Array#shift;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
-static VALUE
+VALUE
 rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
     long len = RARRAY_LEN(ary);
     VALUE target_ary;
 
     if (argc == 0) {
-	rb_ary_modify_check(ary);
-	return ary;
+        rb_ary_modify_check(ary);
+        return ary;
     }
 
     target_ary = ary_ensure_room_for_unshift(ary, argc);
@@ -1197,7 +1725,7 @@ rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 VALUE
 rb_ary_unshift(VALUE ary, VALUE item)
 {
-    return rb_ary_unshift_m(1,&item,ary);
+    return rb_ary_unshift_m(1, &item, ary);
 }
 
 /* faster version - use this if you don't need to treat negative offset */
@@ -1207,7 +1735,7 @@ rb_ary_elt(VALUE ary, long offset)
     long len = RARRAY_LEN(ary);
     if (len == 0) return Qnil;
     if (offset < 0 || len <= offset) {
-	return Qnil;
+        return Qnil;
     }
     return RARRAY_AREF(ary, offset);
 }
@@ -1215,21 +1743,11 @@ rb_ary_elt(VALUE ary, long offset)
 VALUE
 rb_ary_entry(VALUE ary, long offset)
 {
-    long len = RARRAY_LEN(ary);
-    const VALUE *ptr = RARRAY_CONST_PTR(ary);
-    if (len == 0) return Qnil;
-    if (offset < 0) {
-        offset += len;
-        if (offset < 0) return Qnil;
-    }
-    else if (len <= offset) {
-        return Qnil;
-    }
-    return ptr[offset];
+    return rb_ary_entry_internal(ary, offset);
 }
 
 VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
 {
     VALUE klass;
     long alen = RARRAY_LEN(ary);
@@ -1238,48 +1756,142 @@ rb_ary_subseq(VALUE ary, long beg, long len)
     if (beg < 0 || len < 0) return Qnil;
 
     if (alen < len || alen < beg + len) {
-	len = alen - beg;
+        len = alen - beg;
     }
-    klass = rb_obj_class(ary);
+    klass = rb_cArray;
     if (len == 0) return ary_new(klass, 0);
+    if (step == 0)
+        rb_raise(rb_eArgError, "slice step cannot be zero");
+    if (step == 1)
+        return ary_make_partial(ary, klass, beg, len);
+    else
+        return ary_make_partial_step(ary, klass, beg, len, step);
+}
 
-    return ary_make_partial(ary, klass, beg, len);
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+    return rb_ary_subseq_step(ary, beg, len, 1);
 }
 
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
 /*
  *  call-seq:
- *     ary[index]                -> obj     or nil
- *     ary[start, length]        -> new_ary or nil
- *     ary[range]                -> new_ary or nil
- *     ary.slice(index)          -> obj     or nil
- *     ary.slice(start, length)  -> new_ary or nil
- *     ary.slice(range)          -> new_ary or nil
- *
- *  Element Reference --- Returns the element at +index+, or returns a
- *  subarray starting at the +start+ index and continuing for +length+
- *  elements, or returns a subarray specified by +range+ of indices.
- *
- *  Negative indices count backward from the end of the array (-1 is the last
- *  element).  For +start+ and +range+ cases the starting index is just before
- *  an element.  Additionally, an empty array is returned when the starting
- *  index for an element range is at the end of the array.
- *
- *  Returns +nil+ if the index (or starting index) are out of range.
- *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a[2] +  a[0] + a[1]    #=> "cab"
- *     a[6]                   #=> nil
- *     a[1, 2]                #=> [ "b", "c" ]
- *     a[1..3]                #=> [ "b", "c", "d" ]
- *     a[4..7]                #=> [ "e" ]
- *     a[6..10]               #=> nil
- *     a[-3, 3]               #=> [ "c", "d", "e" ]
- *     # special cases
- *     a[5]                   #=> nil
- *     a[6, 1]                #=> nil
- *     a[5, 1]                #=> []
- *     a[5..10]               #=> []
+ *    self[offset] -> object or nil
+ *    self[offset, size] -> object or nil
+ *    self[range] -> object or nil
+ *    self[aseq] -> object or nil
+ *
+ *  Returns elements from +self+; does not modify +self+.
+ *
+ *  In brief:
+ *
+ *    a = [:foo, 'bar', 2]
+ *
+ *    # Single argument offset: returns one element.
+ *    a[0]     # => :foo          # Zero-based index.
+ *    a[-1]    # => 2             # Negative index counts backwards from end.
+ *
+ *    # Arguments offset and size: returns an array.
+ *    a[1, 2]  # => ["bar", 2]
+ *    a[-2, 2] # => ["bar", 2]    # Negative offset counts backwards from end.
+ *
+ *    # Single argument range: returns an array.
+ *    a[0..1]  # => [:foo, "bar"]
+ *    a[0..-2] # => [:foo, "bar"] # Negative range-begin counts backwards from end.
+ *    a[-2..2] # => ["bar", 2]    # Negative range-end counts backwards from end.
+ *
+ *  When a single integer argument +offset+ is given, returns the element at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] # => :foo
+ *    a[2] # => 2
+ *    a # => [:foo, "bar", 2]
+ *
+ *  If +offset+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] # => 2
+ *    a[-2] # => "bar"
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  When two Integer arguments +offset+ and +size+ are given,
+ *  returns a new array of size +size+ containing successive elements beginning at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] # => [:foo, "bar"]
+ *    a[1, 2] # => ["bar", 2]
+ *
+ *  If <tt>offset + size</tt> is greater than <tt>self.size</tt>,
+ *  returns all elements from offset +offset+ to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 4] # => [:foo, "bar", 2]
+ *    a[1, 3] # => ["bar", 2]
+ *    a[2, 2] # => [2]
+ *
+ *  If <tt>offset == self.size</tt> and <tt>size >= 0</tt>,
+ *  returns a new empty array.
+ *
+ *  If +size+ is negative, returns +nil+.
+ *
+ *  When a single Range argument +range+ is given,
+ *  treats <tt>range.min</tt> as +offset+ above
+ *  and <tt>range.size</tt> as +size+ above:
  *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] # => [:foo, "bar"]
+ *    a[1..2] # => ["bar", 2]
+ *
+ *  Special case: If <tt>range.start == a.size</tt>, returns a new empty array.
+ *
+ *  If <tt>range.end</tt> is negative, calculates the end index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..-1] # => [:foo, "bar", 2]
+ *    a[0..-2] # => [:foo, "bar"]
+ *    a[0..-3] # => [:foo]
+ *
+ *  If <tt>range.start</tt> is negative, calculates the start index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1..2] # => [2]
+ *    a[-2..2] # => ["bar", 2]
+ *    a[-3..2] # => [:foo, "bar", 2]
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[4..1] # => nil
+ *    a[4..0] # => nil
+ *    a[4..-1] # => nil
+ *
+ *  When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ *  returns an array of elements corresponding to the indexes produced by
+ *  the sequence.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..).step(2)] # => ["data1", "data2", "data3"]
+ *
+ *  Unlike slicing with range, if the start or the end of the arithmetic sequence
+ *  is larger than array size, throws RangeError.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..11).step(2)]
+ *    # RangeError (((1..11).step(2)) out of range)
+ *    a[(7..).step(2)]
+ *    # RangeError (((7..).step(2)) out of range)
+ *
+ *  If given a single argument, and its type is not one of the listed, tries to
+ *  convert it to Integer, and raises if it is impossible:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    # Raises TypeError (no implicit conversion of Symbol into Integer):
+ *    a[:foo]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -1287,18 +1899,18 @@ rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
 {
     rb_check_arity(argc, 1, 2);
     if (argc == 2) {
-	return rb_ary_aref2(ary, argv[0], argv[1]);
+        return rb_ary_aref2(ary, argv[0], argv[1]);
     }
     return rb_ary_aref1(ary, argv[0]);
 }
 
-VALUE
+static VALUE
 rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
 {
     long beg = NUM2LONG(b);
     long len = NUM2LONG(e);
     if (beg < 0) {
-	beg += RARRAY_LEN(ary);
+        beg += RARRAY_LEN(ary);
     }
     return rb_ary_subseq(ary, beg, len);
 }
@@ -1306,35 +1918,47 @@ rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
 VALUE
 rb_ary_aref1(VALUE ary, VALUE arg)
 {
-    long beg, len;
+    long beg, len, step;
 
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
-	return rb_ary_entry(ary, FIX2LONG(arg));
+        return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+    /* check if idx is Range or ArithmeticSequence */
+    switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
       case Qfalse:
-	break;
+        break;
       case Qnil:
-	return Qnil;
+        return Qnil;
       default:
-	return rb_ary_subseq(ary, beg, len);
+        return rb_ary_subseq_step(ary, beg, len, step);
     }
+
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
 /*
  *  call-seq:
- *     ary.at(index)   ->   obj  or nil
+ *    at(index) -> object or nil
+ *
+ *  Returns the element of +self+ specified by the given +index+
+ *  or +nil+ if there is no such element;
+ *  +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
  *
- *  Returns the element at +index+. A negative index counts from the end of
- *  +self+. Returns +nil+ if the index is out of range. See also
- *  Array#[].
+ *  For non-negative +index+, returns the element of +self+ at offset +index+:
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.at(0)     #=> "a"
- *     a.at(-1)    #=> "e"
+ *    a = [:foo, 'bar', 2]
+ *    a.at(0)   # => :foo
+ *    a.at(2)   # => 2
+ *    a.at(2.0) # => 2
+ *
+ *  For negative +index+, counts backwards from the end of +self+:
+ *
+ *    a.at(-2) # => "bar"
+ *
+ *  Related: Array#[];
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -1343,83 +1967,82 @@ rb_ary_at(VALUE ary, VALUE pos)
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
-/*
- *  call-seq:
- *     ary.first     ->   obj or nil
- *     ary.first(n)  ->   new_ary
- *
- *  Returns the first element, or the first +n+ elements, of the array.
- *  If the array is empty, the first form returns +nil+, and the
- *  second form returns an empty array. See also Array#last for
- *  the opposite effect.
- *
- *     a = [ "q", "r", "s", "t" ]
- *     a.first     #=> "q"
- *     a.first(2)  #=> ["q", "r"]
- */
-
+#if 0
 static VALUE
 rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY_LEN(ary) == 0) return Qnil;
-	return RARRAY_AREF(ary, 0);
+        if (RARRAY_LEN(ary) == 0) return Qnil;
+        return RARRAY_AREF(ary, 0);
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
+#endif
 
-/*
- *  call-seq:
- *     ary.last     ->  obj or nil
- *     ary.last(n)  ->  new_ary
- *
- *  Returns the last element(s) of +self+. If the array is empty,
- *  the first form returns +nil+.
- *
- *  See also Array#first for the opposite effect.
- *
- *     a = [ "w", "x", "y", "z" ]
- *     a.last     #=> "z"
- *     a.last(2)  #=> ["y", "z"]
- */
+static VALUE
+ary_first(VALUE self)
+{
+    return (RARRAY_LEN(self) == 0) ? Qnil : RARRAY_AREF(self, 0);
+}
+
+static VALUE
+ary_last(VALUE self)
+{
+    long len = RARRAY_LEN(self);
+    return (len == 0) ? Qnil : RARRAY_AREF(self, len-1);
+}
 
 VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+rb_ary_last(int argc, const VALUE *argv, VALUE ary) // used by parse.y
 {
     if (argc == 0) {
-	long len = RARRAY_LEN(ary);
-	if (len == 0) return Qnil;
-	return RARRAY_AREF(ary, len-1);
+        return ary_last(ary);
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *     ary.fetch(index)                    -> obj
- *     ary.fetch(index, default)           -> obj
- *     ary.fetch(index) { |index| block }  -> obj
- *
- *  Tries to return the element at position +index+, but throws an IndexError
- *  exception if the referenced +index+ lies outside of the array bounds.  This
- *  error can be prevented by supplying a second argument, which will act as a
- *  +default+ value.
- *
- *  Alternatively, if a block is given it will only be executed when an
- *  invalid +index+ is referenced.
- *
- *  Negative values of +index+ count from the end of the array.
- *
- *     a = [ 11, 22, 33, 44 ]
- *     a.fetch(1)               #=> 22
- *     a.fetch(-1)              #=> 44
- *     a.fetch(4, 'cat')        #=> "cat"
- *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
- *                              #=> "100 is out of bounds"
+ *    fetch(index) -> element
+ *    fetch(index, default_value) -> element or default_value
+ *    fetch(index) {|index| ... } -> element or block_return_value
+ *
+ *  Returns the element of +self+ at offset +index+ if +index+ is in range; +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  With the single argument +index+ and no block,
+ *  returns the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1)   # => "bar"
+ *    a.fetch(1.1) # => "bar"
+ *
+ *  If +index+ is negative, counts from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(-1) # => 2
+ *    a.fetch(-2) # => "bar"
+ *
+ *  With arguments +index+ and +default_value+ (which may be any object) and no block,
+ *  returns +default_value+ if +index+ is out-of-range:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1, nil)  # => "bar"
+ *    a.fetch(3, :foo) # => :foo
+ *
+ *  With argument +index+ and a block,
+ *  returns the element at offset +index+ if index is in range
+ *  (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ *    a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -1432,48 +2055,145 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
     rb_scan_args(argc, argv, "11", &pos, &ifnone);
     block_given = rb_block_given_p();
     if (block_given && argc == 2) {
-	rb_warn("block supersedes default value argument");
+        rb_warn("block supersedes default value argument");
     }
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-	idx +=  RARRAY_LEN(ary);
+        idx +=  RARRAY_LEN(ary);
     }
     if (idx < 0 || RARRAY_LEN(ary) <= idx) {
-	if (block_given) return rb_yield(pos);
-	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
-			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
-	}
-	return ifnone;
+        if (block_given) return rb_yield(pos);
+        if (argc == 1) {
+            rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+                        idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+        }
+        return ifnone;
     }
     return RARRAY_AREF(ary, idx);
 }
 
 /*
+ * call-seq:
+ *   find(if_none_proc = nil) {|element| ... } -> object or nil
+ *   find(if_none_proc = nil) -> enumerator
+ *
+ * Returns the first element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array;
+ * returns the first element for which the block returns a truthy value:
+ *
+ *   [1, 3, 5].find {|element| element > 2}                # => 3
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 3, 5].find(proc {-1}) {|element| element > 12} # => -1
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
+static VALUE
+rb_ary_find(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE if_none;
+    long idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    for (idx = 0; idx < RARRAY_LEN(ary); idx++) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
+    }
+
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
+    }
+    return Qnil;
+}
+
+/*
+ * call-seq:
+ *   rfind(if_none_proc = nil) {|element| ... } -> object or nil
+ *   rfind(if_none_proc = nil) -> enumerator
+ *
+ * Returns the last element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array in
+ * reverse order; returns the first element for which the block returns a truthy
+ * value:
+ *
+ *   [1, 2, 3, 4, 5, 6].rfind {|element| element < 5}       # => 4
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 2, 3, 4].rfind(proc {0}) {|element| element < -2}  # => 0
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
+static VALUE
+rb_ary_rfind(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE if_none;
+    long len, idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    idx = RARRAY_LEN(ary);
+    while (idx--) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
+
+        len = RARRAY_LEN(ary);
+        idx = (idx >= len) ? len : idx;
+    }
+
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
+    }
+    return Qnil;
+}
+
+/*
  *  call-seq:
- *     ary.find_index(obj)             ->  int or nil
- *     ary.find_index { |item| block } ->  int or nil
- *     ary.find_index                  ->  Enumerator
- *     ary.index(obj)             ->  int or nil
- *     ary.index { |item| block } ->  int or nil
- *     ary.index                  ->  Enumerator
+ *    find_index(object) -> integer or nil
+ *    find_index {|element| ... } -> integer or nil
+ *    find_index -> new_enumerator
+ *    index(object) -> integer or nil
+ *    index {|element| ... } -> integer or nil
+ *    index -> new_enumerator
+ *
+ *  Returns the zero-based integer index of a specified element, or +nil+.
+ *
+ *  With only argument +object+ given,
+ *  returns the index of the first element +element+
+ *  for which <tt>object == element</tt>:
  *
- *  Returns the _index_ of the first object in +ary+ such that the object is
- *  <code>==</code> to +obj+.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index('bar') # => 1
  *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+.  Returns +nil+ if no
- *  match is found.
+ *  Returns +nil+ if no such element found.
  *
- *  See also Array#rindex.
+ *  With only a block given,
+ *  calls the block with each successive element;
+ *  returns the index of the first element for which the block returns a truthy value:
  *
- *  An Enumerator is returned if neither a block nor argument is given.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index {|element| element == 'bar' } # => 1
  *
- *     a = [ "a", "b", "c" ]
- *     a.index("b")              #=> 1
- *     a.index("z")              #=> nil
- *     a.index { |x| x == "b" }  #=> 1
+ *  Returns +nil+ if the block never returns a truthy value.
+ *
+ *  With neither an argument nor a block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -1483,49 +2203,53 @@ rb_ary_index(int argc, VALUE *argv, VALUE ary)
     long i;
 
     if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	for (i=0; i<RARRAY_LEN(ary); i++) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-		return LONG2NUM(i);
-	    }
-	}
-	return Qnil;
+        RETURN_ENUMERATOR(ary, 0, 0);
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                return LONG2NUM(i);
+            }
+        }
+        return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-	rb_warn("given block not used");
+        rb_warn("given block not used");
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE e = RARRAY_AREF(ary, i);
-	if (rb_equal(e, val)) {
-	    return LONG2NUM(i);
-	}
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rindex(obj)             ->  int or nil
- *     ary.rindex { |item| block } ->  int or nil
- *     ary.rindex                  ->  Enumerator
+ *    rindex(object) -> integer or nil
+ *    rindex {|element| ... } -> integer or nil
+ *    rindex -> new_enumerator
+ *
+ *  Returns the index of the last element for which <tt>object == element</tt>.
+ *
+ *  With argument +object+ given, returns the index of the last such element found:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex('bar') # => 3
  *
- *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ *  Returns +nil+ if no such object found.
  *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+, starting from the last
- *  object.
+ *  With a block given, calls the block with each successive element;
+ *  returns the index of the last element for which the block returns a truthy value:
  *
- *  Returns +nil+ if no match is found.
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex {|element| element == 'bar' } # => 3
  *
- *  See also Array#index.
+ *  Returns +nil+ if the block never returns a truthy value.
  *
- *  If neither block nor argument is given, an Enumerator is returned instead.
+ *  When neither an argument nor a block is given, returns a new Enumerator.
  *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")             #=> 3
- *     a.rindex("z")             #=> nil
- *     a.rindex { |x| x == "b" } #=> 3
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -1535,25 +2259,28 @@ rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
     long i = RARRAY_LEN(ary), len;
 
     if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	while (i--) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
-		return LONG2NUM(i);
-	    if (i > (len = RARRAY_LEN(ary))) {
-		i = len;
-	    }
-	}
-	return Qnil;
+        RETURN_ENUMERATOR(ary, 0, 0);
+        while (i--) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+                return LONG2NUM(i);
+            if (i > (len = RARRAY_LEN(ary))) {
+                i = len;
+            }
+        }
+        return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-	rb_warn("given block not used");
+        rb_warn("given block not used");
     while (i--) {
-	VALUE e = RARRAY_AREF(ary, i);
-	if (rb_equal(e, val)) {
-	    return LONG2NUM(i);
-	}
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
+        if (i > RARRAY_LEN(ary)) {
+            break;
+        }
     }
     return Qnil;
 }
@@ -1576,57 +2303,69 @@ rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
     olen = RARRAY_LEN(ary);
     if (beg < 0) {
-	beg += olen;
-	if (beg < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     beg - olen, -olen);
-	}
+        beg += olen;
+        if (beg < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     beg - olen, -olen);
+        }
     }
     if (olen < len || olen < beg + len) {
-	len = olen - beg;
+        len = olen - beg;
     }
 
     {
-	const VALUE *optr = RARRAY_CONST_PTR(ary);
-	rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+        const VALUE *optr = RARRAY_CONST_PTR(ary);
+        rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
     }
 
     if (beg >= olen) {
-	VALUE target_ary;
-	if (beg > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", beg);
-	}
-	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
-	len = beg + rlen;
-	ary_mem_clear(ary, olen, beg - olen);
-	if (rlen > 0) {
-	    if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
-	    ary_memcpy0(ary, beg, rlen, rptr, target_ary);
-	}
-	ARY_SET_LEN(ary, len);
+        VALUE target_ary;
+        if (beg > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", beg);
+        }
+        target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+        len = beg + rlen;
+        ary_mem_clear(ary, olen, beg - olen);
+        if (rlen > 0) {
+            if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
+            ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+        }
+        ARY_SET_LEN(ary, len);
     }
     else {
-	long alen;
-
-	if (olen - len > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
-	}
-	rb_ary_modify(ary);
-	alen = olen + rlen - len;
-	if (alen >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, alen);
-	}
-
-	if (len != rlen) {
-	    RARRAY_PTR_USE(ary, ptr,
-			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
-				   VALUE, olen - (beg + len)));
-	    ARY_SET_LEN(ary, alen);
-	}
-	if (rlen > 0) {
-	    if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
-	    MEMMOVE(RARRAY_PTR(ary) + beg, rptr, VALUE, rlen);
-	}
+        long alen;
+
+        if (olen - len > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+        }
+        rb_ary_modify(ary);
+        alen = olen + rlen - len;
+        if (alen >= ARY_CAPA(ary)) {
+            ary_double_capa(ary, alen);
+        }
+
+        if (len != rlen) {
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+                                             VALUE, olen - (beg + len)));
+            ARY_SET_LEN(ary, alen);
+        }
+        if (rlen > 0) {
+            if (rofs == -1) {
+                rb_gc_writebarrier_remember(ary);
+            }
+            else {
+                /* In this case, we're copying from a region in this array, so
+                 * we don't need to fire the write barrier. */
+                rptr = RARRAY_CONST_PTR(ary) + rofs;
+            }
+
+            /* do not use RARRAY_PTR() because it can causes GC.
+             * ary can contain T_NONE object because it is not cleared.
+             */
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg, rptr, VALUE, rlen));
+        }
     }
 }
 
@@ -1637,22 +2376,14 @@ rb_ary_set_len(VALUE ary, long len)
 
     rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-	rb_raise(rb_eRuntimeError, "can't set length of shared ");
+        rb_raise(rb_eRuntimeError, "can't set length of shared ");
     }
     if (len > (capa = (long)ARY_CAPA(ary))) {
-	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+        rb_bug("probable buffer overflow: %ld for %ld", len, capa);
     }
     ARY_SET_LEN(ary, len);
 }
 
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary  an array
- * \param len  new size
- * \return     \a ary
- * \post       the size of \a ary is \a len.
- */
 VALUE
 rb_ary_resize(VALUE ary, long len)
 {
@@ -1662,117 +2393,260 @@ rb_ary_resize(VALUE ary, long len)
     olen = RARRAY_LEN(ary);
     if (len == olen) return ary;
     if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", len);
+        rb_raise(rb_eIndexError, "index %ld too big", len);
     }
     if (len > olen) {
-	if (len >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, len);
-	}
-	ary_mem_clear(ary, olen, len - olen);
-	ARY_SET_LEN(ary, len);
+        if (len > ARY_CAPA(ary)) {
+            ary_double_capa(ary, len);
+        }
+        ary_mem_clear(ary, olen, len - olen);
+        ARY_SET_LEN(ary, len);
     }
     else if (ARY_EMBED_P(ary)) {
         ARY_SET_EMBED_LEN(ary, len);
     }
-    else if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE tmp[RARRAY_EMBED_LEN_MAX];
-	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
-	ary_discard(ary);
-	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+    else if (len <= ary_embed_capa(ary)) {
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long ptr_capa = ARY_HEAP_SIZE(ary);
+        bool is_malloc_ptr = !ARY_SHARED_P(ary);
+
+        FL_SET_EMBED(ary);
+
+        MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
         ARY_SET_EMBED_LEN(ary, len);
+
+        if (is_malloc_ptr) ruby_xfree_sized((void *)ptr, ptr_capa);
     }
     else {
-	if (olen > len + ARY_DEFAULT_SIZE) {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
-	    ARY_SET_CAPA(ary, len);
-	}
-	ARY_SET_HEAP_LEN(ary, len);
+        if (olen > len + ARY_DEFAULT_SIZE) {
+            size_t new_capa = ary_heap_realloc(ary, len);
+            ARY_SET_CAPA(ary, new_capa);
+        }
+        ARY_SET_HEAP_LEN(ary, len);
     }
+    ary_verify(ary);
     return ary;
 }
 
+static VALUE
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
+{
+    rb_ary_store(ary, key, val);
+    return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+    VALUE rpl = rb_ary_to_ary(val);
+    rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
+    RB_GC_GUARD(rpl);
+    return val;
+}
+
 /*
  *  call-seq:
- *     ary[index]         = obj                      ->  obj
- *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
- *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
- *
- *  Element Assignment --- Sets the element at +index+, or replaces a subarray
- *  from the +start+ index for +length+ elements, or replaces a subarray
- *  specified by the +range+ of indices.
- *
- *  If indices are greater than the current capacity of the array, the array
- *  grows automatically.  Elements are inserted into the array at +start+ if
- *  +length+ is zero.
- *
- *  Negative indices will count backward from the end of the array.  For
- *  +start+ and +range+ cases the starting index is just before an element.
- *
- *  An IndexError is raised if a negative index points past the beginning of
- *  the array.
- *
- *  See also Array#push, and Array#unshift.
- *
- *     a = Array.new
- *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
- *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
- *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
- *     a[0..2] = "A"               #=> ["A", "4"]
- *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A", nil]
- *     a[1..-1] = []               #=> ["A"]
- *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
- *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
+ *    self[index] = object -> object
+ *    self[start, length] = object -> object
+ *    self[range] = object -> object
+ *
+ *  Assigns elements in +self+, based on the given +object+; returns +object+.
+ *
+ *  In brief:
+ *
+ *      a_orig = [:foo, 'bar', 2]
+ *
+ *      # With argument index.
+ *      a = a_orig.dup
+ *      a[0] = 'foo' # => "foo"
+ *      a # => ["foo", "bar", 2]
+ *      a = a_orig.dup
+ *      a[7] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *      # With arguments start and length.
+ *      a = a_orig.dup
+ *      a[0, 2] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6, 50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *      # With argument range.
+ *      a = a_orig.dup
+ *      a[0..1] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6..50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  When Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ *  If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] = 'foo' # => "foo"
+ *    a # => ["foo", "bar", 2]
+ *
+ *  If +index+ is greater than <tt>self.length</tt>, extends the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[7] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *  If +index+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] = 'two' # => "two"
+ *    a # => [:foo, "bar", "two"]
+ *
+ *  When Integer arguments +start+ and +length+ are given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  If +start+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2, 2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ *  extends the array with +nil+, assigns +object+ at offset +start+,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6, 50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If +length+ is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If +length+ is too large for the existing array, does not extend the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  When Range argument +range+ is given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2..2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If the array length is less than <tt>range.begin</tt>,
+ *  extends the array with +nil+, assigns +object+ at offset <tt>range.begin</tt>,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6..50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ *  retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-1] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", 2]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-3] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *    a = [:foo, 'bar', 2]
+ *
+ *  If <tt>range.end</tt> is too large for the existing array,
+ *  replaces array elements, but does not extend the array with +nil+ values:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
 rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
-    VALUE rpl;
 
+    rb_check_arity(argc, 2, 3);
+    rb_ary_modify_check(ary);
     if (argc == 3) {
-	rb_ary_modify_check(ary);
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	goto range;
+        beg = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
     }
-    rb_check_arity(argc, 2, 2);
-    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
-	offset = FIX2LONG(argv[0]);
-	goto fixnum;
+        offset = FIX2LONG(argv[0]);
+        return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
     }
     if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
-	/* check if idx is Range */
-      range:
-	rpl = rb_ary_to_ary(argv[argc-1]);
-	rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
-	RB_GC_GUARD(rpl);
-	return argv[argc-1];
+        /* check if idx is Range */
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
     }
 
     offset = NUM2LONG(argv[0]);
-fixnum:
-    rb_ary_store(ary, offset, argv[1]);
-    return argv[1];
+    return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
 }
 
 /*
  *  call-seq:
- *     ary.insert(index, obj...)  -> ary
+ *    insert(index, *objects) -> self
+ *
+ *  Inserts the given +objects+ as elements of +self+;
+ *  returns +self+.
  *
- *  Inserts the given values before the element with the given +index+.
+ *  When +index+ is non-negative, inserts +objects+
+ *  _before_ the element at offset +index+:
  *
- *  Negative indices count backwards from the end of the array, where +-1+ is
- *  the last element. If a negative index is used, the given values will be
- *  inserted after that element, so using an index of +-1+ will insert the
- *  values at the end of the array.
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(1, :x, :y, :z) # => ["a", :x, :y, :z, "b", "c"]
  *
- *     a = %w{ a b c d }
- *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
- *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
+ *  Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
+ *
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(5, :x, :y, :z) # => ["a", "b", "c", nil, nil, :x, :y, :z]
+ *
+ *  When +index+ is negative, inserts +objects+
+ *  _after_ the element at offset <tt>index + self.size</tt>:
+ *
+ *    a = ['a', 'b', 'c']      # => ["a", "b", "c"]
+ *    a.insert(-2, :x, :y, :z) # => ["a", "b", :x, :y, :z, "c"]
+ *
+ *  With no +objects+ given, does nothing:
+ *
+ *    a = ['a', 'b', 'c'] # => ["a", "b", "c"]
+ *    a.insert(1)         # => ["a", "b", "c"]
+ *    a.insert(50)        # => ["a", "b", "c"]
+ *    a.insert(-50)       # => ["a", "b", "c"]
+ *
+ *  Raises IndexError if +objects+ are given and +index+ is negative and out of range.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -1785,15 +2659,15 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
     pos = NUM2LONG(argv[0]);
     if (argc == 1) return ary;
     if (pos == -1) {
-	pos = RARRAY_LEN(ary);
+        pos = RARRAY_LEN(ary);
     }
     else if (pos < 0) {
-	long minpos = -RARRAY_LEN(ary) - 1;
-	if (pos < minpos) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     pos, minpos);
-	}
-	pos++;
+        long minpos = -RARRAY_LEN(ary) - 1;
+        if (pos < minpos) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     pos, minpos);
+        }
+        pos++;
     }
     rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
     return ary;
@@ -1808,52 +2682,112 @@ ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
     return rb_ary_length(ary);
 }
 
+// Return true if the index is at or past the end of the array.
+VALUE
+rb_jit_ary_at_end(rb_execution_context_t *ec, VALUE self, VALUE index)
+{
+    return FIX2LONG(index) >= RARRAY_LEN(self) ? Qtrue : Qfalse;
+}
+
+// Return the element at the given fixnum index.
+VALUE
+rb_jit_ary_at(rb_execution_context_t *ec, VALUE self, VALUE index)
+{
+    return RARRAY_AREF(self, FIX2LONG(index));
+}
+
+// Increment a fixnum by 1.
+VALUE
+rb_jit_fixnum_inc(rb_execution_context_t *ec, VALUE self, VALUE num)
+{
+    return LONG2FIX(FIX2LONG(num) + 1);
+}
+
+// Push a value onto an array and return the value.
+VALUE
+rb_jit_ary_push(rb_execution_context_t *ec, VALUE self, VALUE ary, VALUE val)
+{
+    rb_ary_push(ary, val);
+    return val;
+}
+
 /*
  *  call-seq:
- *     ary.each { |item| block }  -> ary
- *     ary.each                   -> Enumerator
+ *    each {|element| ... } -> self
+ *    each -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each element to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element|  puts "#{element.class} #{element}" }
  *
- *  Calls the given block once for each element in +self+, passing that element
- *  as a parameter.  Returns the array itself.
+ *  Output:
  *
- *  If no block is given, an Enumerator is returned.
+ *    Symbol foo
+ *    String bar
+ *    Integer 2
  *
- *     a = [ "a", "b", "c" ]
- *     a.each {|x| print x, " -- " }
+ *  Allows the array to be modified during iteration:
  *
- *  produces:
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
  *
- *     a -- b -- c --
+ *  Output:
+ *
+ *    foo
+ *    bar
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 VALUE
 rb_ary_each(VALUE ary)
 {
     long i;
-
+    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(RARRAY_AREF(ary, i));
+        rb_yield(RARRAY_AREF(ary, i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.each_index { |index| block }  -> ary
- *     ary.each_index                    -> Enumerator
+ *    each_index {|index| ... } -> self
+ *    each_index -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each <i>array index</i> to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index|  puts "#{index} #{a[index]}" }
+ *
+ *  Output:
  *
- *  Same as Array#each, but passes the +index+ of the element instead of the
- *  element itself.
+ *    0 foo
+ *    1 bar
+ *    2 2
  *
- *  An Enumerator is returned if no block is given.
+ *  Allows the array to be modified during iteration:
  *
- *     a = [ "a", "b", "c" ]
- *     a.each_index {|x| print x, " -- " }
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index| puts index; a.clear if index > 0 }
+ *    a # => []
  *
- *  produces:
+ *  Output:
  *
- *     0 -- 1 -- 2 --
+ *    0
+ *    1
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -1863,24 +2797,33 @@ rb_ary_each_index(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(LONG2NUM(i));
+        rb_yield(LONG2NUM(i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.reverse_each { |item| block }  -> ary
- *     ary.reverse_each                   -> Enumerator
+ *    reverse_each {|element| ... } -> self
+ *    reverse_each -> Enumerator
+ *
+ *  When a block given, iterates backwards over the elements of +self+,
+ *  passing, in reverse order, each element to the block;
+ *  returns +self+:
+ *
+ *    a = []
+ *    [0, 1, 2].reverse_each {|element| a.push(element) }
+ *    a # => [2, 1, 0]
  *
- *  Same as Array#each, but traverses +self+ in reverse order.
+ *  Allows the array to be modified during iteration:
  *
- *     a = [ "a", "b", "c" ]
- *     a.reverse_each {|x| print x, " " }
+ *    a = ['a', 'b', 'c']
+ *    a.reverse_each {|element| a.clear if element.start_with?('b') }
+ *    a # => []
  *
- *  produces:
+ *  When no block given, returns a new Enumerator.
  *
- *     c b a
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -1891,24 +2834,27 @@ rb_ary_reverse_each(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     len = RARRAY_LEN(ary);
     while (len--) {
-	long nlen;
-	rb_yield(RARRAY_AREF(ary, len));
-	nlen = RARRAY_LEN(ary);
-	if (nlen < len) {
-	    len = nlen;
-	}
+        long nlen;
+        rb_yield(RARRAY_AREF(ary, len));
+        nlen = RARRAY_LEN(ary);
+        if (nlen < len) {
+            len = nlen;
+        }
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.length -> int
+ *    length -> integer
+ *    size -> integer
+ *
+ *  Returns the count of elements in +self+:
  *
- *  Returns the number of elements in +self+. May be zero.
+ *    [0, 1, 2].length # => 3
+ *    [].length        # => 0
  *
- *     [ 1, 2, 3, 4, 5 ].length   #=> 5
- *     [].length                  #=> 0
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -1920,19 +2866,18 @@ rb_ary_length(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.empty?   -> true or false
+ *    empty?  -> true or false
  *
- *  Returns +true+ if +self+ contains no elements.
+ *  Returns +true+ if the count of elements in +self+ is zero,
+ *  +false+ otherwise.
  *
- *     [].empty?   #=> true
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
 rb_ary_empty_p(VALUE ary)
 {
-    if (RARRAY_LEN(ary) == 0)
-	return Qtrue;
-    return Qfalse;
+    return RBOOL(RARRAY_LEN(ary) == 0);
 }
 
 VALUE
@@ -1942,13 +2887,16 @@ rb_ary_dup(VALUE ary)
     VALUE dup = rb_ary_new2(len);
     ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
     ARY_SET_LEN(dup, len);
+
+    ary_verify(ary);
+    ary_verify(dup);
     return dup;
 }
 
 VALUE
 rb_ary_resurrect(VALUE ary)
 {
-    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
 }
 
 extern VALUE rb_output_fs;
@@ -1965,15 +2913,15 @@ recursive_join(VALUE obj, VALUE argp, int recur)
     int *first = (int *)arg[3];
 
     if (recur) {
-	rb_raise(rb_eArgError, "recursive array join");
+        rb_raise(rb_eArgError, "recursive array join");
     }
     else {
-	ary_join_1(obj, ary, sep, 0, result, first);
+        ary_join_1(obj, ary, sep, 0, result, first);
     }
     return Qnil;
 }
 
-static void
+static long
 ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
     long i;
@@ -1981,11 +2929,40 @@ ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 
     if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
     for (i=0; i<max; i++) {
-	val = RARRAY_AREF(ary, i);
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, val);
-	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+        val = RARRAY_AREF(ary, i);
+        if (!RB_TYPE_P(val, T_STRING)) break;
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+        rb_str_buf_append(result, val);
+    }
+    return i;
+}
+
+static void
+ary_join_1_str(VALUE dst, VALUE src, int *first)
+{
+    rb_str_buf_append(dst, src);
+    if (*first) {
+        rb_enc_copy(dst, src);
+        *first = FALSE;
+    }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+    if (val == ary) {
+        rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+        VALUE args[4];
+
+        *first = FALSE;
+        args[0] = val;
+        args[1] = sep;
+        args[2] = result;
+        args[3] = (VALUE)first;
+        rb_exec_recursive(recursive_join, obj, (VALUE)args);
     }
 }
 
@@ -1995,50 +2972,25 @@ ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
     VALUE val, tmp;
 
     for (; i<RARRAY_LEN(ary); i++) {
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-
-	val = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(val, T_STRING)) {
-	  str_join:
-	    rb_str_buf_append(result, val);
-	    if (*first) {
-		rb_enc_copy(result, val);
-		*first = FALSE;
-	    }
-	}
-	else if (RB_TYPE_P(val, T_ARRAY)) {
-	    obj = val;
-	  ary_join:
-	    if (val == ary) {
-		rb_raise(rb_eArgError, "recursive array join");
-	    }
-	    else {
-		VALUE args[4];
-
-		*first = FALSE;
-		args[0] = val;
-		args[1] = sep;
-		args[2] = result;
-		args[3] = (VALUE)first;
-		rb_exec_recursive(recursive_join, obj, (VALUE)args);
-	    }
-	}
-	else {
-	    tmp = rb_check_string_type(val);
-	    if (!NIL_P(tmp)) {
-		val = tmp;
-		goto str_join;
-	    }
-	    tmp = rb_check_array_type(val);
-	    if (!NIL_P(tmp)) {
-		obj = val;
-		val = tmp;
-		goto ary_join;
-	    }
-	    val = rb_obj_as_string(val);
-	    goto str_join;
-	}
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+
+        val = RARRAY_AREF(ary, i);
+        if (RB_TYPE_P(val, T_STRING)) {
+            ary_join_1_str(result, val, first);
+        }
+        else if (RB_TYPE_P(val, T_ARRAY)) {
+            ary_join_1_ary(val, ary, sep, result, val, first);
+        }
+        else if (!NIL_P(tmp = rb_check_string_type(val))) {
+            ary_join_1_str(result, tmp, first);
+        }
+        else if (!NIL_P(tmp = rb_check_array_type(val))) {
+            ary_join_1_ary(val, ary, sep, result, tmp, first);
+        }
+        else {
+            ary_join_1_str(result, rb_obj_as_string(val), first);
+        }
     }
 }
 
@@ -2046,36 +2998,41 @@ VALUE
 rb_ary_join(VALUE ary, VALUE sep)
 {
     long len = 1, i;
-    int taint = FALSE;
     VALUE val, tmp, result;
 
     if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
-    if (OBJ_TAINTED(ary)) taint = TRUE;
 
     if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+        StringValue(sep);
+        len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    long len_memo = RARRAY_LEN(ary);
+    for (i=0; i < len_memo; i++) {
+        val = RARRAY_AREF(ary, i);
+        if (RB_UNLIKELY(!RB_TYPE_P(val, T_STRING))) {
+            tmp = rb_check_string_type(val);
+            if (NIL_P(tmp) || tmp != val) {
+                int first;
+                long n = RARRAY_LEN(ary);
+                if (i > n) i = n;
+                result = rb_str_buf_new(len + (n-i)*10);
+                rb_enc_associate(result, rb_usascii_encoding());
+                i = ary_join_0(ary, sep, i, result);
+                first = i == 0;
+                ary_join_1(ary, ary, sep, i, result, &first);
+                return result;
+            }
+            len += RSTRING_LEN(tmp);
+            len_memo = RARRAY_LEN(ary);
+        }
+        else {
+            len += RSTRING_LEN(val);
+        }
     }
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	val = RARRAY_AREF(ary, i);
-	tmp = rb_check_string_type(val);
 
-	if (NIL_P(tmp) || tmp != val) {
-	    int first;
-	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
-	    rb_enc_associate(result, rb_usascii_encoding());
-	    if (taint) OBJ_TAINT(result);
-	    ary_join_0(ary, sep, i, result);
-	    first = i == 0;
-	    ary_join_1(ary, ary, sep, i, result, &first);
-	    return result;
-	}
-
-	len += RSTRING_LEN(tmp);
-    }
+    result = rb_str_new(0, len);
+    rb_str_set_len(result, 0);
 
-    result = rb_str_buf_new(len);
-    if (taint) OBJ_TAINT(result);
     ary_join_0(ary, sep, RARRAY_LEN(ary), result);
 
     return result;
@@ -2083,29 +3040,44 @@ rb_ary_join(VALUE ary, VALUE sep)
 
 /*
  *  call-seq:
- *     ary.join(separator=$,)    -> str
+ *    join(separator = $,) -> new_string
+ *
+ *  Returns the new string formed by joining the converted elements of +self+;
+ *  for each element +element+:
+ *
+ *  - Converts recursively using <tt>element.join(separator)</tt>
+ *    if +element+ is a <tt>kind_of?(Array)</tt>.
+ *  - Otherwise, converts using <tt>element.to_s</tt>.
+ *
+ *  With no argument given, joins using the output field separator, <tt>$,</tt>:
  *
- *  Returns a string created by converting each element of the array to
- *  a string, separated by the given +separator+.
- *  If the +separator+ is +nil+, it uses current <code>$,</code>.
- *  If both the +separator+ and <code>$,</code> are +nil+,
- *  it uses an empty string.
+ *    a = [:foo, 'bar', 2]
+ *    $, # => nil
+ *    a.join # => "foobar2"
  *
- *     [ "a", "b", "c" ].join        #=> "abc"
- *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
+ *  With string argument +separator+ given, joins using that separator:
  *
- *  For nested arrays, join is applied recursively:
+ *    a = [:foo, 'bar', 2]
+ *    a.join("\n") # => "foo\nbar\n2"
  *
- *     [ "a", [1, 2, [:x, :y]], "b" ].join("-")   #=> "a-1-2-x-y-b"
+ *  Joins recursively for nested arrays:
+ *
+ *   a = [:foo, [:bar, [:baz, :bat]]]
+ *   a.join # => "foobarbazbat"
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
-
 static VALUE
 rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
-    rb_scan_args(argc, argv, "01", &sep);
-    if (NIL_P(sep)) sep = rb_output_fs;
+    if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+        sep = rb_output_fs;
+        if (!NIL_P(sep)) {
+            rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+        }
+    }
 
     return rb_ary_join(ary, sep);
 }
@@ -2113,32 +3085,33 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 static VALUE
 inspect_ary(VALUE ary, VALUE dummy, int recur)
 {
-    int tainted = OBJ_TAINTED(ary);
     long i;
     VALUE s, str;
 
     if (recur) return rb_usascii_str_new_cstr("[...]");
     str = rb_str_buf_new2("[");
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	s = rb_inspect(RARRAY_AREF(ary, i));
-	if (OBJ_TAINTED(s)) tainted = TRUE;
-	if (i > 0) rb_str_buf_cat2(str, ", ");
-	else rb_enc_copy(str, s);
-	rb_str_buf_append(str, s);
+        s = rb_inspect(RARRAY_AREF(ary, i));
+        if (i > 0) rb_str_buf_cat2(str, ", ");
+        else rb_enc_copy(str, s);
+        rb_str_buf_append(str, s);
     }
     rb_str_buf_cat2(str, "]");
-    if (tainted) OBJ_TAINT(str);
     return str;
 }
 
 /*
  *  call-seq:
- *     ary.inspect  -> string
- *     ary.to_s     -> string
+ *    inspect -> new_string
+ *    to_s -> new_string
+ *
+ *  Returns the new string formed by calling method <tt>#inspect</tt>
+ *  on each array element:
  *
- *  Creates a string representation of +self+.
+ *    a = [:foo, 'bar', 2]
+ *    a.inspect # => "[:foo, \"bar\", 2]"
  *
- *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -2156,33 +3129,55 @@ rb_ary_to_s(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.to_a     -> ary
+ *    to_a -> self or new_array
  *
- *  Returns +self+.
+ *  When +self+ is an instance of \Array, returns +self+.
+ *
+ *  Otherwise, returns a new array containing the elements of +self+:
  *
- *  If called on a subclass of Array, converts the receiver to an Array object.
+ *    class MyArray < Array; end
+ *    my_a = MyArray.new(['foo', 'bar', 'two'])
+ *    a = my_a.to_a
+ *    a # => ["foo", "bar", "two"]
+ *    a.class # => Array # Not MyArray.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
 rb_ary_to_a(VALUE ary)
 {
     if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
-	rb_ary_replace(dup, ary);
-	return dup;
+        VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+        rb_ary_replace(dup, ary);
+        return dup;
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.to_h     -> hash
+ *    to_h -> new_hash
+ *    to_h {|element| ... } -> new_hash
+ *
+ *  Returns a new hash formed from +self+.
+ *
+ *  With no block given, each element of +self+ must be a 2-element sub-array;
+ *  forms each sub-array into a key-value pair in the new hash:
+ *
+ *    a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ *    a.to_h # => {"foo" => "zero", "bar" => "one", "baz" => "two"}
+ *    [].to_h # => {}
+ *
+ *  With a block given, the block must return a 2-element array;
+ *  calls the block with each element of +self+;
+ *  forms each returned array into a key-value pair in the returned hash:
  *
- *  Returns the result of interpreting <i>ary</i> as an array of
- *  <tt>[key, value]</tt> pairs.
+ *    a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ *    a.to_h {|element| [element, element.class] }
+ *    # => {"foo" => String, bar: Symbol, 1 => Integer, [2, 3] => Array, {baz: 4} => Hash}
  *
- *     [[:foo, :bar], [1, 2]].to_h
- *       # => {:foo => :bar, 1 => 2}
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -2190,25 +3185,28 @@ rb_ary_to_h(VALUE ary)
 {
     long i;
     VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+    int block_given = rb_block_given_p();
+
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	const VALUE elt = rb_ary_elt(ary, i);
-	const VALUE key_value_pair = rb_check_array_type(elt);
-	if (NIL_P(key_value_pair)) {
-	    rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
-		     rb_obj_class(elt), i);
-	}
-	if (RARRAY_LEN(key_value_pair) != 2) {
-	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
-		i, RARRAY_LEN(key_value_pair));
-	}
-	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+        const VALUE e = rb_ary_elt(ary, i);
+        const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+        const VALUE key_value_pair = rb_check_array_type(elt);
+        if (NIL_P(key_value_pair)) {
+            rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+                     rb_obj_class(elt), i);
+        }
+        if (RARRAY_LEN(key_value_pair) != 2) {
+            rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+                i, RARRAY_LEN(key_value_pair));
+        }
+        rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
     return hash;
 }
 
 /*
  *  call-seq:
- *     ary.to_ary -> ary
+ *    to_ary -> self
  *
  *  Returns +self+.
  */
@@ -2223,9 +3221,9 @@ static void
 ary_reverse(VALUE *p1, VALUE *p2)
 {
     while (p1 < p2) {
-	VALUE tmp = *p1;
-	*p1++ = *p2;
-	*p2-- = tmp;
+        VALUE tmp = *p1;
+        *p1++ = *p2;
+        *p2-- = tmp;
     }
 }
 
@@ -2237,23 +3235,26 @@ rb_ary_reverse(VALUE ary)
 
     rb_ary_modify(ary);
     if (len > 1) {
-	RARRAY_PTR_USE(ary, p1, {
-	    p2 = p1 + len - 1;	/* points last item */
-	    ary_reverse(p1, p2);
-	}); /* WB: no new reference */
+        RARRAY_PTR_USE(ary, p1, {
+            p2 = p1 + len - 1;	/* points last item */
+            ary_reverse(p1, p2);
+        }); /* WB: no new reference */
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.reverse!   -> ary
+ *    reverse! -> self
+ *
+ *  Reverses the order of the elements of +self+;
+ *  returns +self+:
  *
- *  Reverses +self+ in place.
+ *    a = [0, 1, 2]
+ *    a.reverse! # => [2, 1, 0]
+ *    a          # => [2, 1, 0]
  *
- *     a = [ "a", "b", "c" ]
- *     a.reverse!       #=> ["c", "b", "a"]
- *     a                #=> ["c", "b", "a"]
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -2264,12 +3265,13 @@ rb_ary_reverse_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.reverse    -> new_ary
+ *    reverse -> new_array
  *
- *  Returns a new array containing +self+'s elements in reverse order.
+ *  Returns a new array containing the elements of +self+ in reverse order:
  *
- *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
- *     [ 1 ].reverse               #=> [1]
+ *    [0, 1, 2].reverse # => [2, 1, 0]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
@@ -2279,9 +3281,9 @@ rb_ary_reverse_m(VALUE ary)
     VALUE dup = rb_ary_new2(len);
 
     if (len > 0) {
-	const VALUE *p1 = RARRAY_CONST_PTR(ary);
-	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
-	do *p2-- = *p1++; while (--len > 0);
+        const VALUE *p1 = RARRAY_CONST_PTR(ary);
+        VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+        do *p2-- = *p1++; while (--len > 0);
     }
     ARY_SET_LEN(dup, RARRAY_LEN(ary));
     return dup;
@@ -2293,73 +3295,113 @@ rotate_count(long cnt, long len)
     return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
 }
 
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+{
+    if (cnt == 1) {
+        VALUE tmp = *ptr;
+        memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+        *(ptr + len - 1) = tmp;
+    }
+    else if (cnt == len - 1) {
+        VALUE tmp = *(ptr + len - 1);
+        memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+        *ptr = tmp;
+    }
+    else {
+        --len;
+        if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+        if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+        if (len > 0) ary_reverse(ptr, ptr + len);
+    }
+}
+
 VALUE
 rb_ary_rotate(VALUE ary, long cnt)
 {
     rb_ary_modify(ary);
 
     if (cnt != 0) {
-	VALUE *ptr = RARRAY_PTR(ary);
-	long len = RARRAY_LEN(ary);
-
-	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
-	    --len;
-	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
-	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
-	    if (len > 0) ary_reverse(ptr, ptr + len);
-	    return ary;
-	}
+        long len = RARRAY_LEN(ary);
+        if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+            RARRAY_PTR_USE(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+            return ary;
+        }
     }
-
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rotate!(count=1)   -> ary
+ *    rotate!(count = 1) -> self
  *
- *  Rotates +self+ in place so that the element at +count+ comes first, and
- *  returns +self+.
+ *  Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates +count+ elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate!(2)   # => [2, 3, 0, 1]
+      [0, 1, 2, 3].rotate!(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
  *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of the array where +-1+ is the last element.
+ *    [0, 1, 2, 3].rotate!(21) # => [1, 2, 3, 0]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate!        #=> ["b", "c", "d", "a"]
- *     a                #=> ["b", "c", "d", "a"]
- *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
- *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
+ *  If +count+ is zero, rotates no elements:
+ *
+ *    [0, 1, 2, 3].rotate!(0) # => [0, 1, 2, 3]
+ *
+ *  With a negative numeric +count+, rotates in the opposite direction,
+ *  from end to beginning:
+ *
+ *    [0, 1, 2, 3].rotate!(-1) # => [3, 0, 1, 2]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate!(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
 rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long n = 1;
-
-    switch (argc) {
-      case 1: n = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
+    long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
     rb_ary_rotate(ary, n);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.rotate(count=1)    -> new_ary
+ *    rotate(count = 1) -> new_array
+ *
+ *  Returns a new array formed from +self+ with elements
+ *  rotated from one end to the other.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate(2)   # => [2, 3, 0, 1]
+ *    [0, 1, 2, 3].rotate(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
  *
- *  Returns a new array by rotating +self+ so that the element at +count+ is
- *  the first element of the new array.
+ *    [0, 1, 2, 3].rotate(22) # => [2, 3, 0, 1]
  *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of +self+ where +-1+ is the last element.
+ *  With a +count+ of zero, rotates no elements:
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate         #=> ["b", "c", "d", "a"]
- *     a                #=> ["a", "b", "c", "d"]
- *     a.rotate(2)      #=> ["c", "d", "a", "b"]
- *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
+ *    [0, 1, 2, 3].rotate(0) # => [0, 1, 2, 3]
+ *
+ *  With negative numeric +count+, rotates in the opposite direction,
+ *  from the end to the beginning:
+ *
+ *    [0, 1, 2, 3].rotate(-1) # => [3, 0, 1, 2]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -2367,22 +3409,17 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE rotated;
     const VALUE *ptr;
-    long len, cnt = 1;
-
-    switch (argc) {
-      case 1: cnt = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
+    long len;
+    long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
 
     len = RARRAY_LEN(ary);
     rotated = rb_ary_new2(len);
     if (len > 0) {
-	cnt = rotate_count(cnt, len);
-	ptr = RARRAY_CONST_PTR(ary);
-	len -= cnt;
-	ary_memcpy(rotated, 0, len, ptr + cnt);
-	ary_memcpy(rotated, len, cnt, ptr);
+        cnt = rotate_count(cnt, len);
+        ptr = RARRAY_CONST_PTR(ary);
+        len -= cnt;
+        ary_memcpy(rotated, 0, len, ptr + cnt);
+        ary_memcpy(rotated, len, cnt, ptr);
     }
     ARY_SET_LEN(rotated, RARRAY_LEN(ary));
     return rotated;
@@ -2390,18 +3427,27 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 
 struct ary_sort_data {
     VALUE ary;
-    struct cmp_opt_data cmp_opt;
+    VALUE receiver;
 };
 
 static VALUE
 sort_reentered(VALUE ary)
 {
     if (RBASIC(ary)->klass) {
-	rb_raise(rb_eRuntimeError, "sort reentered");
+        rb_raise(rb_eRuntimeError, "sort reentered");
     }
     return Qnil;
 }
 
+static void
+sort_returned(struct ary_sort_data *data)
+{
+    if (rb_obj_frozen_p(data->receiver)) {
+        rb_raise(rb_eFrozenError, "array frozen during sort");
+    }
+    sort_reentered(data->ary);
+}
+
 static int
 sort_1(const void *ap, const void *bp, void *dummy)
 {
@@ -2415,7 +3461,7 @@ sort_1(const void *ap, const void *bp, void *dummy)
     args[1] = b;
     retval = rb_yield_values2(2, args);
     n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    sort_returned(data);
     return n;
 }
 
@@ -2427,74 +3473,61 @@ sort_2(const void *ap, const void *bp, void *dummy)
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Fixnum)) {
-	if ((long)a > (long)b) return 1;
-	if ((long)a < (long)b) return -1;
-	return 0;
+    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
+        if ((long)a > (long)b) return 1;
+        if ((long)a < (long)b) return -1;
+        return 0;
     }
-    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
-	return rb_str_cmp(a, b);
+    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
+        return rb_str_cmp(a, b);
     }
-    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(data->cmp_opt, Float)) {
-	return rb_float_cmp(a, b);
+    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
+        return rb_float_cmp(a, b);
     }
 
     retval = rb_funcallv(a, id_cmp, 1, &b);
     n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    sort_returned(data);
 
     return n;
 }
 
 /*
  *  call-seq:
- *     ary.sort!                   -> ary
- *     ary.sort! { |a, b| block }  -> ary
- *
- *  Sorts +self+ in place.
- *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
- *
- *  The block must implement a comparison between +a+ and +b+ and return
- *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *    sort! -> self
+ *    sort! {|a, b| ... } -> self
  *
- *  The result is not guaranteed to be stable.  When the comparison of two
- *  elements returns +0+, the order of the elements is unpredictable.
+ *  Like Array#sort, but returns +self+ with its elements sorted in place.
  *
- *     ary = [ "d", "a", "e", "c", "b" ]
- *     ary.sort!                     #=> ["a", "b", "c", "d", "e"]
- *     ary.sort! { |a, b| b <=> a }  #=> ["e", "d", "c", "b", "a"]
- *
- *  See also Enumerable#sort_by.
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
 rb_ary_sort_bang(VALUE ary)
 {
     rb_ary_modify(ary);
-    assert(!ARY_SHARED_P(ary));
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
     if (RARRAY_LEN(ary) > 1) {
-	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
-	struct ary_sort_data data;
-	long len = RARRAY_LEN(ary);
-
-	RBASIC_CLEAR_CLASS(tmp);
-	data.ary = tmp;
-	data.cmp_opt.opt_methods = 0;
-	data.cmp_opt.opt_inited = 0;
-	RARRAY_PTR_USE(tmp, ptr, {
-	    ruby_qsort(ptr, len, sizeof(VALUE),
-		       rb_block_given_p()?sort_1:sort_2, &data);
-	}); /* WB: no new reference */
-	rb_ary_modify(ary);
+        VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+        struct ary_sort_data data;
+        long len = RARRAY_LEN(ary);
+        RBASIC_CLEAR_CLASS(tmp);
+        data.ary = tmp;
+        data.receiver = ary;
+        RARRAY_PTR_USE(tmp, ptr, {
+            ruby_qsort(ptr, len, sizeof(VALUE),
+                       rb_block_given_p()?sort_1:sort_2, &data);
+        }); /* WB: no new reference */
+        rb_ary_modify(ary);
         if (ARY_EMBED_P(tmp)) {
             if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
                 rb_ary_unshare(ary);
-		FL_SET_EMBED(ary);
+                FL_SET_EMBED(ary);
+            }
+            if (ARY_EMBED_LEN(tmp) > ARY_CAPA(ary)) {
+                ary_resize_capa(ary, ARY_EMBED_LEN(tmp));
             }
-	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+            ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
             ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
         }
         else {
@@ -2503,7 +3536,7 @@ rb_ary_sort_bang(VALUE ary)
                 ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
             }
             else {
-                assert(!ARY_SHARED_P(tmp));
+                RUBY_ASSERT(!ARY_SHARED_P(tmp));
                 if (ARY_EMBED_P(ary)) {
                     FL_UNSET_EMBED(ary);
                 }
@@ -2512,46 +3545,56 @@ rb_ary_sort_bang(VALUE ary)
                     rb_ary_unshare(ary);
                 }
                 else {
-		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+                    ary_heap_free(ary);
                 }
-                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+                ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
                 ARY_SET_HEAP_LEN(ary, len);
-                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+                ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
             }
             /* tmp was lost ownership for the ptr */
-            FL_UNSET(tmp, FL_FREEZE);
             FL_SET_EMBED(tmp);
             ARY_SET_EMBED_LEN(tmp, 0);
-            FL_SET(tmp, FL_FREEZE);
-	}
+            OBJ_FREEZE(tmp);
+        }
         /* tmp will be GC'ed. */
         RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
     }
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.sort                   -> new_ary
- *     ary.sort { |a, b| block }  -> new_ary
+ *    sort -> new_array
+ *    sort {|a, b| ... } -> new_array
+ *
+ *  Returns a new array containing the elements of +self+, sorted.
+ *
+ *  With no block given, compares elements using operator <tt>#<=></tt>
+ *  (see Object#<=>):
+ *
+ *    [0, 2, 3, 1].sort # => [0, 1, 2, 3]
  *
- *  Returns a new array created by sorting +self+.
+ *  With a block given, calls the block with each combination of pairs of elements from +self+;
+ *  for each pair +a+ and +b+, the block should return a numeric:
  *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
+ *  - Negative when +b+ is to follow +a+.
+ *  - Zero when +a+ and +b+ are equivalent.
+ *  - Positive when +a+ is to follow +b+.
  *
- *  The block must implement a comparison between +a+ and +b+ and return
- *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *  Example:
  *
- *  The result is not guaranteed to be stable.  When the comparison of two
- *  elements returns +0+, the order of the elements is unpredictable.
+ *    a = [3, 2, 0, 1]
+ *    a.sort {|a, b| a <=> b } # => [0, 1, 2, 3]
+ *    a.sort {|a, b| b <=> a } # => [3, 2, 1, 0]
  *
- *     ary = [ "d", "a", "e", "c", "b" ]
- *     ary.sort                     #=> ["a", "b", "c", "d", "e"]
- *     ary.sort { |a, b| b <=> a }  #=> ["e", "d", "c", "b", "a"]
+ *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ *  and may be unstable.
  *
- *  See also Enumerable#sort_by.
+ *  See an example in Numeric#nonzero? for the idiom to sort more
+ *  complex structure.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -2566,55 +3609,15 @@ static VALUE rb_ary_bsearch_index(VALUE ary);
 
 /*
  *  call-seq:
- *     ary.bsearch {|x| block }  -> elem
- *
- *  By using binary search, finds a value from this array which meets
- *  the given condition in O(log n) where n is the size of the array.
- *
- *  You can use this method in two modes: a find-minimum mode and
- *  a find-any mode.  In either case, the elements of the array must be
- *  monotone (or sorted) with respect to the block.
- *
- *  In find-minimum mode (this is a good choice for typical use cases),
- *  the block must always return true or false, and there must be an index i
- *  (0 <= i <= ary.size) so that:
- *
- *  - the block returns false for any element whose index is less than
- *    i, and
- *  - the block returns true for any element whose index is greater
- *    than or equal to i.
- *
- *  This method returns the i-th element.  If i is equal to ary.size,
- *  it returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     ary.bsearch {|x| x >=   4 } #=> 4
- *     ary.bsearch {|x| x >=   6 } #=> 7
- *     ary.bsearch {|x| x >=  -1 } #=> 0
- *     ary.bsearch {|x| x >= 100 } #=> nil
- *
- *  In find-any mode (this behaves like libc's bsearch(3)), the block
- *  must always return a number, and there must be two indices i and j
- *  (0 <= i <= j <= ary.size) so that:
- *
- *  - the block returns a positive number for ary[k] if 0 <= k < i,
- *  - the block returns zero for ary[k] if i <= k < j, and
- *  - the block returns a negative number for ary[k] if
- *    j <= k < ary.size.
- *
- *  Under this condition, this method returns any element whose index
- *  is within i...j.  If i is equal to j (i.e., there is no element
- *  that satisfies the block), this method returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     # try to find v such that 4 <= v < 8
- *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- *     # try to find v such that 8 <= v < 10
- *     ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- *  You must not mix the two modes at a time; the block must always
- *  return either true/false, or always return a number.  It is
- *  undefined which value is actually picked up at each iteration.
+ *    bsearch {|element| ... } -> found_element or nil
+ *    bsearch -> new_enumerator
+ *
+ *  Returns the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
+ *
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -2623,22 +3626,22 @@ rb_ary_bsearch(VALUE ary)
     VALUE index_result = rb_ary_bsearch_index(ary);
 
     if (FIXNUM_P(index_result)) {
-	return rb_ary_entry(ary, FIX2LONG(index_result));
+        return rb_ary_entry(ary, FIX2LONG(index_result));
     }
     return index_result;
 }
 
 /*
  *  call-seq:
- *     ary.bsearch_index {|x| block }  -> int or nil
+ *    bsearch_index {|element| ... } -> integer or nil
+ *    bsearch_index -> new_enumerator
  *
- *  By using binary search, finds an index of a value from this array which
- *  meets the given condition in O(log n) where n is the size of the array.
+ *  Returns the integer index of the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
  *
- *  It supports two modes, depending on the nature of the block. They are
- *  exactly the same as in the case of the #bsearch method, with the only difference
- *  being that this method returns the index of the element instead of the
- *  element itself. For more details consult the documentation for #bsearch.
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -2650,39 +3653,39 @@ rb_ary_bsearch_index(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     while (low < high) {
-	mid = low + ((high - low) / 2);
-	val = rb_ary_entry(ary, mid);
-	v = rb_yield(val);
-	if (FIXNUM_P(v)) {
-	    if (v == INT2FIX(0)) return INT2FIX(mid);
-	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
-	}
-	else if (v == Qtrue) {
-	    satisfied = 1;
-	    smaller = 1;
-	}
-	else if (v == Qfalse || v == Qnil) {
-	    smaller = 0;
-	}
-	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
-	    const VALUE zero = INT2FIX(0);
-	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
-	      case 0: return INT2FIX(mid);
-	      case 1: smaller = 1; break;
-	      case -1: smaller = 0;
-	    }
-	}
-	else {
-	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
-		     " (must be numeric, true, false or nil)",
-		     rb_obj_class(v));
-	}
-	if (smaller) {
-	    high = mid;
-	}
-	else {
-	    low = mid + 1;
-	}
+        mid = low + ((high - low) / 2);
+        val = rb_ary_entry(ary, mid);
+        v = rb_yield(val);
+        if (FIXNUM_P(v)) {
+            if (v == INT2FIX(0)) return INT2FIX(mid);
+            smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+        }
+        else if (v == Qtrue) {
+            satisfied = 1;
+            smaller = 1;
+        }
+        else if (!RTEST(v)) {
+            smaller = 0;
+        }
+        else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+            const VALUE zero = INT2FIX(0);
+            switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+              case 0: return INT2FIX(mid);
+              case 1: smaller = 0; break;
+              case -1: smaller = 1;
+            }
+        }
+        else {
+            rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+                     " (must be numeric, true, false or nil)",
+                     rb_obj_class(v));
+        }
+        if (smaller) {
+            high = mid;
+        }
+        else {
+            low = mid + 1;
+        }
     }
     if (!satisfied) return Qnil;
     return INT2FIX(low);
@@ -2697,18 +3700,24 @@ sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
 
 /*
  *  call-seq:
- *     ary.sort_by! { |obj| block }    -> ary
- *     ary.sort_by!                    -> Enumerator
+ *    sort_by! {|element| ... } -> self
+ *    sort_by! -> new_enumerator
+ *
+ *  With a block given, sorts the elements of +self+ in place;
+ *  returns self.
+ *
+ *  Calls the block with each successive element;
+ *  sorts elements based on the values returned from the block:
  *
- *  Sorts +self+ in place using a set of keys generated by mapping the
- *  values in +self+ through the given block.
+ *    a = ['aaaa', 'bbb', 'cc', 'd']
+ *    a.sort_by! {|element| element.size }
+ *    a # => ["d", "cc", "bbb", "aaaa"]
  *
- *  The result is not guaranteed to be stable.  When two keys are equal,
- *  the order of the corresponding elements is unpredictable.
+ *  For duplicate values returned by the block, the ordering is indeterminate, and may be unstable.
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *  See also Enumerable#sort_by.
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -2718,31 +3727,32 @@ rb_ary_sort_by_bang(VALUE ary)
 
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
-    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
-    rb_ary_replace(ary, sorted);
+    if (RARRAY_LEN(ary) > 1) {
+        sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+        rb_ary_replace(ary, sorted);
+    }
     return ary;
 }
 
 
 /*
  *  call-seq:
- *     ary.collect { |item| block }  -> new_ary
- *     ary.map     { |item| block }  -> new_ary
- *     ary.collect                   -> Enumerator
- *     ary.map                       -> Enumerator
- *
- *  Invokes the given block once for each element of +self+.
+ *    collect {|element| ... } -> new_array
+ *    collect -> new_enumerator
+ *    map {|element| ... } -> new_array
+ *    map -> new_enumerator
  *
- *  Creates a new array containing the values returned by the block.
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array whose elements are the return values from the block:
  *
- *  See also Enumerable#collect.
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.map {|element| element.class }
+ *    a1 # => [Symbol, String, Integer]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.collect { |x| x + "!" }         #=> ["a!", "b!", "c!", "d!"]
- *     a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- *     a                                 #=> ["a", "b", "c", "d"]
+ *  Related: #collect!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -2754,7 +3764,7 @@ rb_ary_collect(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     collect = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+        rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
     }
     return collect;
 }
@@ -2762,23 +3772,22 @@ rb_ary_collect(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.collect! {|item| block }   -> ary
- *     ary.map!     {|item| block }   -> ary
- *     ary.collect!                   -> Enumerator
- *     ary.map!                       -> Enumerator
+ *    collect! {|element| ... } -> self
+ *    collect! -> new_enumerator
+ *    map! {|element| ... } -> self
+ *    map! -> new_enumerator
  *
- *  Invokes the given block once for each element of +self+, replacing the
- *  element with the value returned by the block.
+ *  With a block given, calls the block with each element of +self+
+ *  and replaces the element with the block's return value;
+ *  returns +self+:
  *
- *  See also Enumerable#collect.
+ *    a = [:foo, 'bar', 2]
+ *    a.map! { |element| element.class } # => [Symbol, String, Integer]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.map! {|x| x + "!" }
- *     a #=>  [ "a!", "b!", "c!", "d!" ]
- *     a.collect!.with_index {|x, i| x[0...i] }
- *     a #=>  ["", "b", "c!", "d!"]
+ *  Related: #collect;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -2789,7 +3798,7 @@ rb_ary_collect_bang(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+        rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
     }
     return ary;
 }
@@ -2801,66 +3810,190 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
     long beg, len, i, j;
 
     for (i=0; i<argc; i++) {
-	if (FIXNUM_P(argv[i])) {
-	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
-	    continue;
-	}
-	/* check if idx is Range */
-	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
-	    long end = olen < beg+len ? olen : beg+len;
-	    for (j = beg; j < end; j++) {
-		rb_ary_push(result, (*func)(obj, j));
-	    }
-	    if (beg + len > j)
-		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
-	    continue;
-	}
-	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+        if (FIXNUM_P(argv[i])) {
+            rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+            continue;
+        }
+        /* check if idx is Range */
+        if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+            long end = olen < beg+len ? olen : beg+len;
+            for (j = beg; j < end; j++) {
+                rb_ary_push(result, (*func)(obj, j));
+            }
+            if (beg + len > j)
+                rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+            continue;
+        }
+        rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
     }
     return result;
 }
 
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+    long beg, len;
+    if (FIXNUM_P(idx)) {
+        beg = FIX2LONG(idx);
+    }
+    /* check if idx is Range */
+    else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+        if (len > 0) {
+            const VALUE *const src = RARRAY_CONST_PTR(ary);
+            const long end = beg + len;
+            const long prevlen = RARRAY_LEN(result);
+            if (beg < olen) {
+                rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+            }
+            if (end > olen) {
+                rb_ary_store(result, prevlen + len - 1, Qnil);
+            }
+        }
+        return result;
+    }
+    else {
+        beg = NUM2LONG(idx);
+    }
+    return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
 /*
  *  call-seq:
- *     ary.values_at(selector, ...)  -> new_ary
+ *    values_at(*specifiers) -> new_array
+ *
+ *  Returns elements from +self+ in a new array; does not modify +self+.
+ *
+ *  The objects included in the returned array are the elements of +self+
+ *  selected by the given +specifiers+,
+ *  each of which must be a numeric index or a Range.
  *
- *  Returns an array containing the elements in +self+ corresponding to the
- *  given +selector+(s).
+ *  In brief:
  *
- *  The selectors may be either integer indices or ranges.
+ *    a = ['a', 'b', 'c', 'd']
  *
- *  See also Array#select.
+ *    # Index specifiers.
+ *    a.values_at(2, 0, 2, 0)     # => ["c", "a", "c", "a"] # May repeat.
+ *    a.values_at(-4, -3, -2, -1) # => ["a", "b", "c", "d"] # Counts backwards if negative.
+ *    a.values_at(-50, 50)        # => [nil, nil]           # Outside of self.
  *
- *     a = %w{ a b c d e f }
- *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
- *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
- *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
- *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
+ *    # Range specifiers.
+ *    a.values_at(1..3)       # => ["b", "c", "d"] # From range.begin to range.end.
+ *    a.values_at(1...3)      # => ["b", "c"]      # End excluded.
+ *    a.values_at(3..1)       # => []              # No such elements.
+ *
+ *    a.values_at(-3..3)  # => ["b", "c", "d"]     # Negative range.begin counts backwards.
+ *    a.values_at(-50..3)                          # Raises RangeError.
+ *
+ *    a.values_at(1..-2)  # => ["b", "c"]          # Negative range.end counts backwards.
+ *    a.values_at(1..-50) # => []                  # No such elements.
+ *
+ *    # Mixture of specifiers.
+ *    a.values_at(2..3, 3, 0..1, 0) # => ["c", "d", "d", "a", "b", "a"]
+ *
+ *  With no +specifiers+ given, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.values_at # => []
+ *
+ *  For each numeric specifier +index+, includes an element:
+ *
+ *  - For each non-negative numeric specifier +index+ that is in-range (less than <tt>self.size</tt>),
+ *    includes the element at offset +index+:
+ *
+ *      a.values_at(0, 2)     # => ["a", "c"]
+ *      a.values_at(0.1, 2.9) # => ["a", "c"]
+ *
+ *  - For each negative numeric +index+ that is in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-1, -4) # => ["d", "a"]
+ *
+ *  The given indexes may be in any order, and may repeat:
+ *
+ *    a.values_at(2, 0, 1, 0, 2) # => ["c", "a", "b", "a", "c"]
+ *
+ *  For each +index+ that is out-of-range, includes +nil+:
+ *
+ *    a.values_at(4, -5) # => [nil, nil]
+ *
+ *  For each Range specifier +range+, includes elements
+ *  according to <tt>range.begin</tt> and <tt>range.end</tt>:
+ *
+ *  - If both <tt>range.begin</tt> and <tt>range.end</tt>
+ *    are non-negative and in-range (less than <tt>self.size</tt>),
+ *    includes elements from index <tt>range.begin</tt>
+ *    through <tt>range.end - 1</tt> (if <tt>range.exclude_end?</tt>),
+ *    or through <tt>range.end</tt> (otherwise):
+ *
+ *      a.values_at(1..2)  # => ["b", "c"]
+ *      a.values_at(1...2) # => ["b"]
+ *
+ *  - If <tt>range.begin</tt> is negative and in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-2..3) # => ["c", "d"]
+ *
+ *  - If <tt>range.begin</tt> is negative and out-of-range, raises an exception:
+ *
+ *      a.values_at(-5..3) # Raises RangeError.
+ *
+ *  - If <tt>range.end</tt> is positive and out-of-range,
+ *    extends the returned array with +nil+ elements:
+ *
+ *      a.values_at(1..5) # => ["b", "c", "d", nil, nil]
+ *
+ *  - If <tt>range.end</tt> is negative and in-range,
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(1..-2) # => ["b", "c"]
+ *
+ *  - If <tt>range.end</tt> is negative and out-of-range,
+ *    returns an empty array:
+ *
+ *      a.values_at(1..-5) # => []
+ *
+ *  The given ranges may be in any order and may repeat:
+ *
+ *    a.values_at(2..3, 0..1, 2..3) # => ["c", "d", "a", "b", "c", "d"]
+ *
+ *  The given specifiers may be any mixture of indexes and ranges:
+ *
+ *    a.values_at(3, 1..2, 0, 2..3) # => ["d", "b", "c", "a", "c", "d"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
 rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+    long i, olen = RARRAY_LEN(ary);
+    VALUE result = rb_ary_new_capa(argc);
+    for (i = 0; i < argc; ++i) {
+        append_values_at_single(result, ary, olen, argv[i]);
+    }
+    RB_GC_GUARD(ary);
+    return result;
 }
 
 
 /*
  *  call-seq:
- *     ary.select { |item| block } -> new_ary
- *     ary.select                  -> Enumerator
- *
- *  Returns a new array containing all elements of +ary+
- *  for which the given +block+ returns a true value.
+ *    select {|element| ... } -> new_array
+ *    select -> new_enumerator
+ *    filter {|element| ... } -> new_array
+ *    filter -> new_enumerator
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array containing those elements of +self+
+ *  for which the block returns a truthy value:
  *
- *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select {|element| element.to_s.start_with?('b') }
+ *    # => ["bar", :bam]
  *
- *     a = %w{ a b c d e f }
- *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *  With no block given, returns a new Enumerator.
  *
- *  See also Enumerable#select.
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -2872,9 +4005,9 @@ rb_ary_select(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     result = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-	    rb_ary_push(result, rb_ary_elt(ary, i));
-	}
+        if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+            rb_ary_push(result, rb_ary_elt(ary, i));
+        }
     }
     return result;
 }
@@ -2892,12 +4025,12 @@ select_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (!RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (!RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -2911,34 +4044,39 @@ select_bang_ensure(VALUE a)
     long i1 = arg->len[0], i2 = arg->len[1];
 
     if (i2 < len && i2 < i1) {
-	long tail = 0;
-	if (i1 < len) {
-	    tail = len - i1;
-	    RARRAY_PTR_USE(ary, ptr, {
-		    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
-		});
-	}
-	ARY_SET_LEN(ary, i2 + tail);
+        long tail = 0;
+        rb_ary_modify(ary);
+        if (i1 < len) {
+            tail = len - i1;
+            RARRAY_PTR_USE(ary, ptr, {
+                    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+                });
+        }
+        ARY_SET_LEN(ary, i2 + tail);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.select!  {|item| block } -> ary or nil
- *     ary.select!                  -> Enumerator
+ *    select! {|element| ... } -> self or nil
+ *    select! -> new_enumerator
+ *    filter! {|element| ... } -> self or nil
+ *    filter! -> new_enumerator
  *
- *  Invokes the given block passing in successive elements from +self+,
- *  deleting elements for which the block returns a +false+ value.
+ *  With a block given, calls the block with each element of +self+;
+ *  removes from +self+ those elements for which the block returns +false+ or +nil+.
  *
- *  The array may not be changed instantly every time the block is called.
+ *  Returns +self+ if any elements were removed:
  *
- *  If changes were made, it will return +self+, otherwise it returns +nil+.
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
  *
- *  See also Array#keep_if
+ *  Returns +nil+ if no elements were removed.
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -2956,18 +4094,18 @@ rb_ary_select_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.keep_if { |item| block } -> ary
- *     ary.keep_if                  -> Enumerator
+ *    keep_if {|element| ... } -> self
+ *    keep_if -> new_enumerator
  *
- *  Deletes every element of +self+ for which the given block evaluates to
- *  +false+.
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element from +self+ if the block does not return a truthy value:
  *
- *  See also Array#select!
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     a = %w{ a b c d e f }
- *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -2983,32 +4121,49 @@ ary_resize_smaller(VALUE ary, long len)
 {
     rb_ary_modify(ary);
     if (RARRAY_LEN(ary) > len) {
-	ARY_SET_LEN(ary, len);
-	if (len * 2 < ARY_CAPA(ary) &&
-	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
-	    ary_resize_capa(ary, len * 2);
-	}
+        ARY_SET_LEN(ary, len);
+        if (len * 2 < ARY_CAPA(ary) &&
+            ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+            ary_resize_capa(ary, len * 2);
+        }
     }
 }
 
 /*
  *  call-seq:
- *     ary.delete(obj)            -> item or nil
- *     ary.delete(obj) { block }  -> item or result of block
+ *    delete(object) -> last_removed_object
+ *    delete(object) {|element| ... } -> last_removed_object or block_return
  *
- *  Deletes all items from +self+ that are equal to +obj+.
+ *  Removes zero or more elements from +self+.
  *
- *  Returns the last deleted item, or +nil+ if no matching item is found.
+ *  With no block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>;
+ *  returns the last removed element:
  *
- *  If the optional code block is given, the result of the block is returned if
- *  the item is not found.  (To remove +nil+ elements and get an informative
- *  return value, use Array#compact!)
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) # => 2.0
+ *    a           # => [0, 1]
  *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.delete("b")                   #=> "b"
- *     a                               #=> ["a", "c"]
- *     a.delete("z")                   #=> nil
- *     a.delete("z") { "not found" }   #=> "not found"
+ *  Returns +nil+ if no elements removed:
+ *
+ *    a.delete(2) # => nil
+ *
+ *  With a block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>.
+ *
+ *  If any such elements are found, ignores the block
+ *  and returns the last removed element:
+ *
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) {|element| fail 'Cannot happen' } # => 2.0
+ *    a                                             # => [0, 1]
+ *
+ *  If no such element is found, returns the block's return value:
+ *
+ *    a.delete(2) {|element| "Element #{element} not found." }
+ *    # => "Element 2 not found."
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 VALUE
@@ -3018,26 +4173,27 @@ rb_ary_delete(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+        VALUE e = RARRAY_AREF(ary, i1);
 
-	if (rb_equal(e, item)) {
-	    v = e;
-	    continue;
-	}
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
-	}
-	i2++;
+        if (rb_equal(e, item)) {
+            v = e;
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-	if (rb_block_given_p()) {
-	    return rb_yield(item);
-	}
-	return Qnil;
+        if (rb_block_given_p()) {
+            return rb_yield(item);
+        }
+        return Qnil;
     }
 
     ary_resize_smaller(ary, i2);
 
+    ary_verify(ary);
     return v;
 }
 
@@ -3047,18 +4203,18 @@ rb_ary_delete_same(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+        VALUE e = RARRAY_AREF(ary, i1);
 
-	if (e == item) {
-	    continue;
-	}
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
-	}
-	i2++;
+        if (e == item) {
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-	return;
+        return;
     }
 
     ary_resize_smaller(ary, i2);
@@ -3072,33 +4228,46 @@ rb_ary_delete_at(VALUE ary, long pos)
 
     if (pos >= len) return Qnil;
     if (pos < 0) {
-	pos += len;
-	if (pos < 0) return Qnil;
+        pos += len;
+        if (pos < 0) return Qnil;
     }
 
     rb_ary_modify(ary);
     del = RARRAY_AREF(ary, pos);
     RARRAY_PTR_USE(ary, ptr, {
-	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+        MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
     });
     ARY_INCREASE_LEN(ary, -1);
-
+    ary_verify(ary);
     return del;
 }
 
 /*
  *  call-seq:
- *     ary.delete_at(index)  -> obj or nil
+ *    delete_at(index) -> removed_object or nil
+ *
+ *  Removes the element of +self+ at the given +index+, which must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  When +index+ is non-negative, deletes the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(1) # => "bar"
+ *    a # => [:foo, 2]
  *
- *  Deletes the element at the specified +index+, returning that element, or
- *  +nil+ if the +index+ is out of range.
+ *  When +index+ is negative, counts backward from the end of the array:
  *
- *  See also Array#slice!
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(-2) # => "bar"
+ *    a # => [:foo, 2]
  *
- *     a = ["ant", "bat", "cat", "dog"]
- *     a.delete_at(2)    #=> "cat"
- *     a                 #=> ["ant", "bat", "dog"]
- *     a.delete_at(99)   #=> nil
+ *  When +index+ is out of range, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(3)  # => nil
+ *    a.delete_at(-4) # => nil
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -3107,73 +4276,156 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
+static VALUE
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
+{
+    const long orig_len = RARRAY_LEN(ary);
+
+    if (len < 0) {
+        return Qnil;
+    }
+    else if (pos < -orig_len) {
+        return Qnil;
+    }
+    else if (pos < 0) {
+        pos += orig_len;
+    }
+    else if (orig_len < pos) {
+        return Qnil;
+    }
+    if (orig_len < pos + len) {
+        len = orig_len - pos;
+    }
+    if (len == 0) {
+        return rb_ary_new2(0);
+    }
+    else {
+        VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+        rb_ary_splice(ary, pos, len, 0, 0);
+        return arg2;
+    }
+}
+
 /*
  *  call-seq:
- *     ary.slice!(index)         -> obj or nil
- *     ary.slice!(start, length) -> new_ary or nil
- *     ary.slice!(range)         -> new_ary or nil
- *
- *  Deletes the element(s) given by an +index+ (optionally up to +length+
- *  elements) or by a +range+.
- *
- *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- *  range.
- *
- *     a = [ "a", "b", "c" ]
- *     a.slice!(1)     #=> "b"
- *     a               #=> ["a", "c"]
- *     a.slice!(-1)    #=> "c"
- *     a               #=> ["a"]
- *     a.slice!(100)   #=> nil
- *     a               #=> ["a"]
+ *    slice!(index) -> object or nil
+ *    slice!(start, length) -> new_array or nil
+ *    slice!(range) -> new_array or nil
+ *
+ *  Removes and returns elements from +self+.
+ *
+ *  With numeric argument +index+ given,
+ *  removes and returns the element at offset +index+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2)   # => "c"
+ *    a             # => ["a", "b", "d"]
+ *    a.slice!(2.1) # => "d"
+ *    a             # => ["a", "b"]
+ *
+ *  If +index+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2) # => "c"
+ *    a            # => ["a", "b", "d"]
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  With numeric arguments +start+ and +length+ given,
+ *  removes +length+ elements from +self+ beginning at zero-based offset +start+;
+ *  returns the removed objects in a new array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1, 2)     # => ["b", "c"]
+ *    a                  # => ["a", "d"]
+ *    a.slice!(0.1, 1.1) # => ["a"]
+ *    a                  # => ["d"]
+ *
+ *  If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2, 1) # => ["c"]
+ *    a               # => ["a", "b", "d"]
+ *
+ *  If +start+ is out-of-range, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(5, 1)  # => nil
+ *    a.slice!(-5, 1) # => nil
+ *
+ *  If <tt>start + length</tt> exceeds the array size,
+ *  removes and returns all elements from offset +start+ to the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2, 50) # => ["c", "d"]
+ *    a               # => ["a", "b"]
+ *
+ *  If <tt>start == a.size</tt> and +length+ is non-negative,
+ *  returns a new empty array.
+ *
+ *  If +length+ is negative, returns +nil+.
+ *
+ *  With Range argument +range+ given,
+ *  treats <tt>range.min</tt> as +start+ (as above)
+ *  and <tt>range.size</tt> as +length+ (as above):
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1..2) # => ["b", "c"]
+ *    a              # => ["a", "d"]
+ *
+ *  If <tt>range.start == a.size</tt>, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(4..5) # => []
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+      a.slice!(5..6) # => nil
+ *
+ *  If <tt>range.start</tt> is negative,
+ *  calculates the start index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2..2) # => ["c"]
+ *
+ *  If <tt>range.end</tt> is negative,
+ *  calculates the end index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(0..-2) # => ["a", "b", "c"]
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
 rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1, arg2;
-    long pos, len, orig_len;
+    VALUE arg1;
+    long pos, len;
 
     rb_ary_modify_check(ary);
+    rb_check_arity(argc, 1, 2);
+    arg1 = argv[0];
+
     if (argc == 2) {
-	pos = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-      delete_pos_len:
-	if (len < 0) return Qnil;
-	orig_len = RARRAY_LEN(ary);
-	if (pos < 0) {
-	    pos += orig_len;
-	    if (pos < 0) return Qnil;
-	}
-	else if (orig_len < pos) return Qnil;
-	if (orig_len < pos + len) {
-	    len = orig_len - pos;
-	}
-	if (len == 0) return rb_ary_new2(0);
-	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
-	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
-	rb_ary_splice(ary, pos, len, 0, 0);
-	return arg2;
-    }
-
-    if (argc != 1) {
-	/* error report */
-	rb_scan_args(argc, argv, "11", NULL, NULL);
+        pos = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
     }
-    arg1 = argv[0];
 
     if (!FIXNUM_P(arg1)) {
-	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
-	  case Qtrue:
-	    /* valid range */
-	    goto delete_pos_len;
-	  case Qnil:
-	    /* invalid range */
-	    return Qnil;
-	  default:
-	    /* not a range */
-	    break;
-	}
+        switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+          case Qtrue:
+            /* valid range */
+            return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+          case Qnil:
+            /* invalid range */
+            return Qnil;
+          default:
+            /* not a range */
+            break;
+        }
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
@@ -3185,10 +4437,11 @@ ary_reject(VALUE orig, VALUE result)
     long i;
 
     for (i = 0; i < RARRAY_LEN(orig); i++) {
-	VALUE v = RARRAY_AREF(orig, i);
-	if (!RTEST(rb_yield(v))) {
-	    rb_ary_push(result, v);
-	}
+        VALUE v = RARRAY_AREF(orig, i);
+
+        if (!RTEST(rb_yield(v))) {
+            rb_ary_push(result, v);
+        }
     }
     return result;
 }
@@ -3201,12 +4454,12 @@ reject_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -3215,7 +4468,6 @@ static VALUE
 ary_reject_bang(VALUE ary)
 {
     struct select_bang_arg args;
-
     rb_ary_modify_check(ary);
     args.ary = ary;
     args.len[0] = args.len[1] = 0;
@@ -3224,37 +4476,47 @@ ary_reject_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.reject! { |item| block }  -> ary or nil
- *     ary.reject!                   -> Enumerator
+ *    reject! {|element| ... } -> self or nil
+ *    reject! -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes each element for which the block returns a truthy value.
  *
- *  Deletes every element of +self+ for which the block evaluates to +true+,
- *  if no changes were made returns +nil+.
+ *  Returns +self+ if any elements removed:
  *
- *  The array may not be changed instantly every time the block is called.
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
  *
- *  See also Enumerable#reject and Array#delete_if.
+ *  Returns +nil+ if no elements removed.
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
 rb_ary_reject_bang(VALUE ary)
 {
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
     return ary_reject_bang(ary);
 }
 
 /*
  *  call-seq:
- *     ary.reject  {|item| block }  -> new_ary
- *     ary.reject                   -> Enumerator
+ *    reject {|element| ... } -> new_array
+ *    reject -> new_enumerator
  *
- *  Returns a new array containing the items in +self+ for which the given
- *  block is not +true+. The ordering of non-rejected elements is maintained.
+ *  With a block given, returns a new array whose elements are all those from +self+
+ *  for which the block returns +false+ or +nil+:
  *
- *  See also Array#delete_if
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a1 = a.reject {|element| element.to_s.start_with?('b') }
+ *    a1 # => [:foo, 2]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -3270,25 +4532,25 @@ rb_ary_reject(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.delete_if { |item| block }  -> ary
- *     ary.delete_if                   -> Enumerator
- *
- *  Deletes every element of +self+ for which block evaluates to +true+.
+ *    delete_if {|element| ... } -> self
+ *    delete_if -> new_numerator
  *
- *  The array is changed instantly every time the block is called, not after
- *  the iteration is over.
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element if the block returns a truthy value;
+ *  returns +self+:
  *
- *  See also Array#reject!
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
  *
- *  If no block is given, an Enumerator is returned instead.
+ *  With no block given, returns a new Enumerator.
  *
- *     scores = [ 97, 42, 75 ]
- *     scores.delete_if {|score| score < 80 }   #=> [97]
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
 rb_ary_delete_if(VALUE ary)
 {
+    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     ary_reject_bang(ary);
     return ary;
@@ -3298,9 +4560,9 @@ static VALUE
 take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
 {
     VALUE *args = (VALUE *)cbarg;
-    if (args[1]-- == 0) rb_iter_break();
     if (argc > 1) val = rb_ary_new4(argc, argv);
     rb_ary_push(args[0], val);
+    if (--args[1] == 0) rb_iter_break();
     return Qnil;
 }
 
@@ -3310,38 +4572,108 @@ take_items(VALUE obj, long n)
     VALUE result = rb_check_array_type(obj);
     VALUE args[2];
 
+    if (n == 0) return result;
     if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
     result = rb_ary_new2(n);
     args[0] = result; args[1] = (VALUE)n;
-    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
-	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
-		 rb_obj_class(obj));
+    if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
+        rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+                 rb_obj_class(obj));
     return result;
 }
 
 
 /*
  *  call-seq:
- *     ary.zip(arg, ...)                  -> new_ary
- *     ary.zip(arg, ...) { |arr| block }  -> nil
- *
- *  Converts any arguments to arrays, then merges elements of +self+ with
- *  corresponding elements from each argument.
- *
- *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
- *  where _n_ is one more than the count of arguments.
- *
- *  If the size of any argument is less than the size of the initial array,
- *  +nil+ values are supplied.
- *
- *  If a block is given, it is invoked for each output +array+, otherwise an
- *  array of arrays is returned.
- *
- *     a = [ 4, 5, 6 ]
- *     b = [ 7, 8, 9 ]
- *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
- *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
+ *    zip(*other_arrays) -> new_array
+ *    zip(*other_arrays) {|sub_array| ... } -> nil
+ *
+ *  With no block given, combines +self+ with the collection of +other_arrays+;
+ *  returns a new array of sub-arrays:
+ *
+ *    [0, 1].zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *
+ *  Returned:
+ *
+ *  - The outer array is of size <tt>self.size</tt>.
+ *  - Each sub-array is of size <tt>other_arrays.size + 1</tt>.
+ *  - The _nth_ sub-array contains (in order):
+ *
+ *    - The _nth_ element of +self+.
+ *    - The _nth_ element of each of the other arrays, as available.
+ *
+ *  Example:
+ *
+ *    a = [0, 1]
+ *    zipped = a.zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *    zipped.size       # => 2 # Same size as a.
+ *    zipped.first.size # => 3 # Size of other arrays plus 1.
+ *
+ *  When the other arrays are all the same size as +self+,
+ *  the returned sub-arrays are a rearrangement containing exactly elements of all the arrays
+ *  (including +self+), with no omissions or additions:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  When one of the other arrays is smaller than +self+,
+ *  pads the corresponding sub-array with +nil+ elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2]
+ *    c = [:c0, :c1]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, nil],
+ *     [:a3, nil, nil]]
+ *
+ *  When one of the other arrays is larger than +self+,
+ *  _ignores_ its trailing elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3, :b4]
+ *    c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  With a block given, calls the block with each of the other arrays;
+ *  returns +nil+:
+ *
+ *    d = []
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    a.zip(b, c) {|sub_array| d.push(sub_array.reverse) } # => nil
+ *    pp d
+ *    # =>
+ *    [[:c0, :b0, :a0],
+ *     [:c1, :b1, :a1],
+ *     [:c2, :b2, :a2],
+ *     [:c3, :b3, :a3]]
+ *
+ *  For an *object* in *other_arrays* that is not actually an array,
+ *  forms the "other array" as <tt>object.to_ary</tt>, if defined,
+ *  or as <tt>object.each.to_a</tt> otherwise.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -3352,51 +4684,51 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
     VALUE result = Qnil;
 
     for (i=0; i<argc; i++) {
-	argv[i] = take_items(argv[i], len);
+        argv[i] = take_items(argv[i], len);
     }
 
     if (rb_block_given_p()) {
-	int arity = rb_block_arity();
-
-	if (arity > 1) {
-	    VALUE work, *tmp;
-
-	    tmp = ALLOCV_N(VALUE, work, argc+1);
-
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		tmp[0] = RARRAY_AREF(ary, i);
-		for (j=0; j<argc; j++) {
-		    tmp[j+1] = rb_ary_elt(argv[j], i);
-		}
-		rb_yield_values2(argc+1, tmp);
-	    }
-
-	    if (work) ALLOCV_END(work);
-	}
-	else {
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		VALUE tmp = rb_ary_new2(argc+1);
-
-		rb_ary_push(tmp, RARRAY_AREF(ary, i));
-		for (j=0; j<argc; j++) {
-		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-		}
-		rb_yield(tmp);
-	    }
-	}
+        int arity = rb_block_arity();
+
+        if (arity > 1) {
+            VALUE work, *tmp;
+
+            tmp = ALLOCV_N(VALUE, work, argc+1);
+
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                tmp[0] = RARRAY_AREF(ary, i);
+                for (j=0; j<argc; j++) {
+                    tmp[j+1] = rb_ary_elt(argv[j], i);
+                }
+                rb_yield_values2(argc+1, tmp);
+            }
+
+            if (work) ALLOCV_END(work);
+        }
+        else {
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                VALUE tmp = rb_ary_new2(argc+1);
+
+                rb_ary_push(tmp, RARRAY_AREF(ary, i));
+                for (j=0; j<argc; j++) {
+                    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+                }
+                rb_yield(tmp);
+            }
+        }
     }
     else {
-	result = rb_ary_new_capa(len);
+        result = rb_ary_new_capa(len);
 
-	for (i=0; i<len; i++) {
-	    VALUE tmp = rb_ary_new_capa(argc+1);
+        for (i=0; i<len; i++) {
+            VALUE tmp = rb_ary_new_capa(argc+1);
 
-	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
-	    for (j=0; j<argc; j++) {
-		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-	    }
-	    rb_ary_push(result, tmp);
-	}
+            rb_ary_push(tmp, RARRAY_AREF(ary, i));
+            for (j=0; j<argc; j++) {
+                rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+            }
+            rb_ary_push(result, tmp);
+        }
     }
 
     return result;
@@ -3404,15 +4736,17 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *     ary.transpose -> new_ary
+ *    transpose -> new_array
+ *
+ *  Returns a new array that is +self+
+ *  as a {transposed matrix}[https://en.wikipedia.org/wiki/Transpose]:
  *
- *  Assumes that +self+ is an array of arrays and transposes the rows and
- *  columns.
+ *    a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ *    a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
  *
- *     a = [[1,2], [3,4], [5,6]]
- *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
+ *  The elements of +self+ must all be the same size.
  *
- *  If the length of the subarrays don't match, an IndexError is raised.
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
@@ -3424,36 +4758,38 @@ rb_ary_transpose(VALUE ary)
     alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
-	tmp = to_ary(rb_ary_elt(ary, i));
-	if (elen < 0) {		/* first element */
-	    elen = RARRAY_LEN(tmp);
-	    result = rb_ary_new2(elen);
-	    for (j=0; j<elen; j++) {
-		rb_ary_store(result, j, rb_ary_new2(alen));
-	    }
-	}
-	else if (elen != RARRAY_LEN(tmp)) {
-	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
-		     RARRAY_LEN(tmp), elen);
-	}
-	for (j=0; j<elen; j++) {
-	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
-	}
+        tmp = to_ary(rb_ary_elt(ary, i));
+        if (elen < 0) {		/* first element */
+            elen = RARRAY_LEN(tmp);
+            result = rb_ary_new2(elen);
+            for (j=0; j<elen; j++) {
+                rb_ary_store(result, j, rb_ary_new2(alen));
+            }
+        }
+        else if (elen != RARRAY_LEN(tmp)) {
+            rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+                     RARRAY_LEN(tmp), elen);
+        }
+        for (j=0; j<elen; j++) {
+            rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+        }
     }
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.replace(other_ary)  -> ary
- *     ary.initialize_copy(other_ary)	-> ary
+ *    initialize_copy(other_array) -> self
+ *    replace(other_array) -> self
  *
- *  Replaces the contents of +self+ with the contents of +other_ary+,
- *  truncating or expanding if necessary.
+ *  Replaces the elements of +self+ with the elements of +other_array+, which must be an
+ *  {array-convertible object}[rdoc-ref:implicit_conversion.rdoc@Array-Convertible+Objects];
+ *  returns +self+:
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
- *     a                              #=> ["x", "y", "z"]
+ *    a = ['a', 'b', 'c']   # => ["a", "b", "c"]
+ *    a.replace(['d', 'e']) # => ["d", "e"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
@@ -3463,94 +4799,253 @@ rb_ary_replace(VALUE copy, VALUE orig)
     orig = to_ary(orig);
     if (copy == orig) return copy;
 
-    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
-        VALUE shared = 0;
+    rb_ary_reset(copy);
 
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-	}
-        else if (ARY_SHARED_P(copy)) {
-            shared = ARY_SHARED(copy);
-            FL_UNSET_SHARED(copy);
-        }
-        FL_SET_EMBED(copy);
-	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
-        if (shared) {
-            rb_ary_decrement_share(shared);
-        }
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+    /* orig has enough space to embed the contents of orig. */
+    if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
+        RUBY_ASSERT(ARY_EMBED_P(copy));
+        ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
     }
+    /* orig is embedded but copy does not have enough space to embed the
+     * contents of orig. */
+    else if (ARY_EMBED_P(orig)) {
+        long len = ARY_EMBED_LEN(orig);
+        VALUE *ptr = ary_heap_alloc_buffer(len);
+
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, ptr);
+        ARY_SET_LEN(copy, len);
+        ARY_SET_CAPA(copy, len);
+
+        // No allocation and exception expected that could leave `copy` in a
+        // bad state from the edits above.
+        ary_memcpy(copy, 0, len, RARRAY_CONST_PTR(orig));
+    }
+    /* Otherwise, orig is on heap and copy does not have enough space to embed
+     * the contents of orig. */
     else {
-        VALUE shared = ary_make_shared(orig);
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-        }
-        else {
-            rb_ary_unshare_safe(copy);
-        }
+        VALUE shared_root = ary_make_shared(orig);
         FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
-        rb_ary_set_shared(copy, shared);
+        ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+        ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+        rb_ary_set_shared(copy, shared_root);
+
+        RUBY_ASSERT(RB_OBJ_SHAREABLE_P(copy) ? RB_OBJ_SHAREABLE_P(shared_root) : 1);
     }
+    ary_verify(copy);
     return copy;
 }
 
 /*
  *  call-seq:
- *     ary.clear    -> ary
+ *    clear -> self
+ *
+ *  Removes all elements from +self+; returns +self+:
  *
- *  Removes all elements from +self+.
+ *    a = [:foo, 'bar', 2]
+ *    a.clear # => []
  *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.clear    #=> [ ]
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 VALUE
 rb_ary_clear(VALUE ary)
 {
     rb_ary_modify_check(ary);
-    ARY_SET_LEN(ary, 0);
     if (ARY_SHARED_P(ary)) {
-	if (!ARY_EMBED_P(ary)) {
-	    rb_ary_unshare(ary);
-	    FL_SET_EMBED(ary);
-	}
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, 0);
     }
-    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
-	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+    else {
+        ARY_SET_LEN(ary, 0);
+        if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+            ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+        }
     }
+    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.fill(obj)                                 -> ary
- *     ary.fill(obj, start [, length])               -> ary
- *     ary.fill(obj, range )                         -> ary
- *     ary.fill { |index| block }                    -> ary
- *     ary.fill(start [, length] ) { |index| block } -> ary
- *     ary.fill(range) { |index| block }             -> ary
+ *    fill(object, start = nil, count = nil) -> self
+ *    fill(object, range) -> self
+ *    fill(start = nil, count = nil) {|element| ... } -> self
+ *    fill(range) {|element| ... } -> self
  *
- *  The first three forms set the selected elements of +self+ (which
- *  may be the entire array) to +obj+.
+ *  Replaces selected elements in +self+;
+ *  may add elements to +self+;
+ *  always returns +self+ (never a new array).
  *
- *  A +start+ of +nil+ is equivalent to zero.
+ *  In brief:
  *
- *  A +length+ of +nil+ is equivalent to the length of the array.
+ *    # Non-negative start.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1, 2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
  *
- *  The last three forms fill the array with the value of the given block,
- *  which is passed the absolute index of each element to be filled.
+ *    # Extends with specified values if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 3, 2)          # => ["a", "b", "c", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
  *
- *  Negative values of +start+ count from the end of the array, where +-1+ is
- *  the last element.
+ *    # Fills with nils if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 6, 2)          # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
  *
- *     a = [ "a", "b", "c", "d" ]
- *     a.fill("x")              #=> ["x", "x", "x", "x"]
- *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
- *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
- *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
- *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
+ *    # For negative start, counts backwards from the end.
+ *    ['a', 'b', 'c', 'd'].fill('-', -3, 3)          # => ["a", "-", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    # Range.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  When arguments +start+ and +count+ are given,
+ *  they select the elements of +self+ to be replaced;
+ *  each must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  (or +nil+):
+ *
+ *  - +start+ specifies the zero-based offset of the first element to be replaced;
+ *    +nil+ means zero.
+ *  - +count+ is the number of consecutive elements to be replaced;
+ *    +nil+ means "all the rest."
+ *
+ *  With argument +object+ given,
+ *  that one object is used for all replacements:
+ *
+ *    o = Object.new           # => #<Object:0x0000014e7bff7600>
+ *    a = ['a', 'b', 'c', 'd'] # => ["a", "b", "c", "d"]
+ *    a.fill(o, 1, 2)
+ *    # => ["a", #<Object:0x0000014e7bff7600>, #<Object:0x0000014e7bff7600>, "d"]
+ *
+ *  With a block given, the block is called once for each element to be replaced;
+ *  the value passed to the block is the _index_ of the element to be replaced
+ *  (not the element itself);
+ *  the block's return value replaces the element:
+ *
+ *    a = ['a', 'b', 'c', 'd']               # => ["a", "b", "c", "d"]
+ *    a.fill(1, 2) {|element| element.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  For arguments +start+ and +count+:
+ *
+ *  - If +start+ is non-negative,
+ *    replaces +count+ elements beginning at offset +start+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 0, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1, 2) # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 2) # => ["a", "b", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(0, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, 2) {|e| e.to_s } # => ["a", "b", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 3, 2) # => ["a", "b", "c", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 4, 2) # => ["a", "b", "c", "d", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(4, 2) {|e| e.to_s } # => ["a", "b", "c", "d", "4", "5"]
+ *
+ *    Fills with +nil+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 5, 2) # => ["a", "b", "c", "d", nil, "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, 2) # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(5, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, "5", "6"]
+ *      ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 0)    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, -100) # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, -100) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(2, 0) {|e| fail 'Cannot happen' }    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(6, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  - If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -4, 3) # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3, 3) # => ["a", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-4, 3) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 3) # => ["a", "b", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -1, 3) # => ["a", "b", "c", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 3) {|e| e.to_s } # => ["a", "b", "2", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(-1, 3) {|e| e.to_s } # => ["a", "b", "c", "3", "4", "5"]
+ *
+ *    Starts at the beginning of +self+ if +start+ is negative and out-of-range:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -5, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -6, 2) # => ["-", "-", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-5, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-6, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 0)  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, -1) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 0) {|e| fail 'Cannot happen' }  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-2, -1) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  When argument +range+ is given,
+ *  it must be a Range object whose members are numeric;
+ *  its +begin+ and +end+ values determine the elements of +self+
+ *  to be replaced:
+ *
+ *  - If both +begin+ and +end+ are positive, they specify the first and last elements
+ *    to be replaced:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *    If +end+ is smaller than +begin+, replaces no elements:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2..1)          # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2..1) {|e| e.to_s } # => ["a", "b", "c", "d"]
+ *
+ *  - If either is negative (or both are negative), counts backwards from the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..-2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..-2) # => ["a", "-", "-", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-3..2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..-2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3..-2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  - If the +end+ value is excluded (see Range#exclude_end?), omits the last replacement:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...2)  # => ["a", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...-2) # => ["a", "-", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(1...2) {|e| e.to_s }  # => ["a", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1...-2) {|e| e.to_s } # => ["a", "1", "c", "d"]
+ *
+ *  - If the range is endless (see {Endless Ranges}[rdoc-ref:Range@Endless+Ranges]),
+ *    replaces elements to the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..)          # => ["a", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill(1..) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *  - If the range is beginless (see {Beginless Ranges}[rdoc-ref:Range@Beginless+Ranges]),
+ *    replaces elements from the beginning of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', ..2)          # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(..2) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -3560,84 +5055,74 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
     long beg = 0, end = 0, len = 0;
 
     if (rb_block_given_p()) {
-	rb_scan_args(argc, argv, "02", &arg1, &arg2);
-	argc += 1;		/* hackish */
+        rb_scan_args(argc, argv, "02", &arg1, &arg2);
+        argc += 1;		/* hackish */
     }
     else {
-	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+        rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
     }
     switch (argc) {
       case 1:
-	beg = 0;
-	len = RARRAY_LEN(ary);
-	break;
+        beg = 0;
+        len = RARRAY_LEN(ary);
+        break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
-	    break;
-	}
-	/* fall through */
+        if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+            break;
+        }
+        /* fall through */
       case 3:
-	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
-	if (beg < 0) {
-	    beg = RARRAY_LEN(ary) + beg;
-	    if (beg < 0) beg = 0;
-	}
-	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
-	break;
+        beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+        if (beg < 0) {
+            beg = RARRAY_LEN(ary) + beg;
+            if (beg < 0) beg = 0;
+        }
+        len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+        break;
     }
     rb_ary_modify(ary);
     if (len < 0) {
         return ary;
     }
     if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
-	rb_raise(rb_eArgError, "argument too big");
+        rb_raise(rb_eArgError, "argument too big");
     }
     end = beg + len;
     if (RARRAY_LEN(ary) < end) {
-	if (end >= ARY_CAPA(ary)) {
-	    ary_resize_capa(ary, end);
-	}
-	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
-	ARY_SET_LEN(ary, end);
+        if (end >= ARY_CAPA(ary)) {
+            ary_resize_capa(ary, end);
+        }
+        ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+        ARY_SET_LEN(ary, end);
     }
 
-    if (item == Qundef) {
-	VALUE v;
-	long i;
+    if (UNDEF_P(item)) {
+        VALUE v;
+        long i;
 
-	for (i=beg; i<end; i++) {
-	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY_LEN(ary)) break;
-	    ARY_SET(ary, i, v);
-	}
+        for (i=beg; i<end; i++) {
+            v = rb_yield(LONG2NUM(i));
+            if (i>=RARRAY_LEN(ary)) break;
+            ARY_SET(ary, i, v);
+        }
     }
     else {
-	ary_memfill(ary, beg, len, item);
+        ary_memfill(ary, beg, len, item);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary + other_ary   -> new_ary
- *
- *  Concatenation --- Returns a new array built by concatenating the
- *  two arrays together to produce a third array.
+ *    self + other_array -> new_array
  *
- *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
- *     a = [ "a", "b", "c" ]
- *     c = a + [ "d", "e", "f" ]
- *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
- *     a                         #=> [ "a", "b", "c" ]
+ *  Returns a new array containing all elements of +self+
+ *  followed by all elements of +other_array+:
  *
- *  Note that
- *     x += y
- *  is the same as
- *     x = x + y
- *  This means that it produces a new array. As a consequence,
- *  repeated use of <code>+=</code> on arrays can be quite inefficient.
+ *    a = [0, 1] + [2, 3]
+ *    a # => [0, 1, 2, 3]
  *
- *  See also Array#concat.
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 VALUE
@@ -3663,29 +5148,23 @@ ary_append(VALUE x, VALUE y)
 {
     long n = RARRAY_LEN(y);
     if (n > 0) {
-	rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
+        rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
     }
+    RB_GC_GUARD(y);
     return x;
 }
 
 /*
  *  call-seq:
- *     ary.concat(other_ary1, other_ary2,...)   -> ary
+ *    concat(*other_arrays) -> self
  *
- *  Appends the elements of +other_ary+s to +self+.
+ *  Adds to +self+ all elements from each array in +other_arrays+; returns +self+:
  *
- *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- *     [ "a" ].concat( ["b"], ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- *     [ "a" ].concat #=> [ "a" ]
+ *    a = [0, 1]
+ *    a.concat(['two', 'three'], [:four, :five], a)
+ *    # => [0, 1, "two", "three", :four, :five, 0, 1]
  *
- *     a = [ 1, 2, 3 ]
- *     a.concat( [ 4, 5 ] )
- *     a                                 #=> [ 1, 2, 3, 4, 5 ]
- *
- *     a = [ 1, 2 ]
- *     a.concat(a, a)                    #=> [1, 2, 1, 2, 1, 2]
- *
- *  See also Array#+.
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -3694,17 +5173,18 @@ rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
     rb_ary_modify_check(ary);
 
     if (argc == 1) {
-	rb_ary_concat(ary, argv[0]);
+        rb_ary_concat(ary, argv[0]);
     }
     else if (argc > 1) {
-	int i;
-	VALUE args = rb_ary_tmp_new(argc);
-	for (i = 0; i < argc; i++) {
-	    rb_ary_concat(args, argv[i]);
-	}
-	ary_append(ary, args);
+        int i;
+        VALUE args = rb_ary_hidden_new(argc);
+        for (i = 0; i < argc; i++) {
+            rb_ary_concat(args, argv[i]);
+        }
+        ary_append(ary, args);
     }
 
+    ary_verify(ary);
     return ary;
 }
 
@@ -3716,18 +5196,19 @@ rb_ary_concat(VALUE x, VALUE y)
 
 /*
  *  call-seq:
- *     ary * int     -> new_ary
- *     ary * str     -> new_string
+ *    self * n -> new_array
+ *    self * string_separator -> new_string
  *
- *  Repetition --- With a String argument, equivalent to
- *  <code>ary.join(str)</code>.
+ *  When non-negative integer argument +n+ is given,
+ *  returns a new array built by concatenating +n+ copies of +self+:
  *
- *  Otherwise, returns a new array built by concatenating the +int+ copies of
- *  +self+.
+ *    a = ['x', 'y']
+ *    a * 3 # => ["x", "y", "x", "y", "x", "y"]
  *
+ *  When string argument +string_separator+ is given,
+ *  equivalent to <tt>self.join(string_separator)</tt>:
  *
- *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
+ *    [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {foo: 0}"
  *
  */
 
@@ -3740,61 +5221,55 @@ rb_ary_times(VALUE ary, VALUE times)
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
-	return rb_ary_join(ary, tmp);
+        return rb_ary_join(ary, tmp);
     }
 
     len = NUM2LONG(times);
     if (len == 0) {
-	ary2 = ary_new(rb_obj_class(ary), 0);
-	goto out;
+        ary2 = ary_new(rb_cArray, 0);
+        goto out;
     }
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative argument");
+        rb_raise(rb_eArgError, "negative argument");
     }
     if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
-	rb_raise(rb_eArgError, "argument too big");
+        rb_raise(rb_eArgError, "argument too big");
     }
     len *= RARRAY_LEN(ary);
 
-    ary2 = ary_new(rb_obj_class(ary), len);
+    ary2 = ary_new(rb_cArray, len);
     ARY_SET_LEN(ary2, len);
 
     ptr = RARRAY_CONST_PTR(ary);
     t = RARRAY_LEN(ary);
     if (0 < t) {
-	ary_memcpy(ary2, 0, t, ptr);
-	while (t <= len/2) {
-	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+        ary_memcpy(ary2, 0, t, ptr);
+        while (t <= len/2) {
+            ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
             t *= 2;
         }
         if (t < len) {
-	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+            ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
         }
     }
   out:
-    OBJ_INFECT(ary2, ary);
-
     return ary2;
 }
 
 /*
  *  call-seq:
- *     ary.assoc(obj)   -> element_ary  or  nil
+ *    assoc(object) -> found_array or nil
  *
- *  Searches through an array whose elements are also arrays comparing +obj+
- *  with the first element of each contained array using <code>obj.==</code>.
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[0] == object</tt>:
  *
- *  Returns the first contained array that matches (that is, the first
- *  associated array), or +nil+ if no match is found.
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.assoc(4) # => [4, 5, 6]
  *
- *  See also Array#rassoc
+ *  Returns +nil+ if no such element is found.
  *
- *     s1 = [ "colors", "red", "blue", "green" ]
- *     s2 = [ "letters", "a", "b", "c" ]
- *     s3 = "foo"
- *     a  = [ s1, s2, s3 ]
- *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
- *     a.assoc("foo")      #=> nil
+ *  Related: Array#rassoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -3804,30 +5279,29 @@ rb_ary_assoc(VALUE ary, VALUE key)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = rb_check_array_type(RARRAY_AREF(ary, i));
-	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
-	    rb_equal(RARRAY_AREF(v, 0), key))
-	    return v;
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+            rb_equal(RARRAY_AREF(v, 0), key))
+            return v;
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rassoc(obj) -> element_ary or nil
+ *    rassoc(object) -> found_array or nil
  *
- *  Searches through the array whose elements are also arrays.
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[1] == object</tt>:
  *
- *  Compares +obj+ with the second element of each contained array using
- *  <code>obj.==</code>.
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.rassoc(4) # => [2, 4]
+ *    a.rassoc(5) # => [4, 5, 6]
  *
- *  Returns the first contained array that matches +obj+.
+ *  Returns +nil+ if no such element is found.
  *
- *  See also Array#assoc.
- *
- *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- *     a.rassoc("two")    #=> [2, "two"]
- *     a.rassoc("four")   #=> nil
+ *  Related: Array#assoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
@@ -3837,11 +5311,11 @@ rb_ary_rassoc(VALUE ary, VALUE value)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(v, T_ARRAY) &&
-	    RARRAY_LEN(v) > 1 &&
-	    rb_equal(RARRAY_AREF(v, 1), value))
-	    return v;
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (RB_TYPE_P(v, T_ARRAY) &&
+            RARRAY_LEN(v) > 1 &&
+            rb_equal(RARRAY_AREF(v, 1), value))
+            return v;
     }
     return Qnil;
 }
@@ -3854,43 +5328,54 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
 
+    /* rb_equal() can evacuate ptrs */
     p1 = RARRAY_CONST_PTR(ary1);
     p2 = RARRAY_CONST_PTR(ary2);
     len1 = RARRAY_LEN(ary1);
 
     for (i = 0; i < len1; i++) {
-	if (*p1 != *p2) {
-	    if (rb_equal(*p1, *p2)) {
-		len1 = RARRAY_LEN(ary1);
-		if (len1 != RARRAY_LEN(ary2))
-		    return Qfalse;
-		if (len1 < i)
-		    return Qtrue;
-		p1 = RARRAY_CONST_PTR(ary1) + i;
-		p2 = RARRAY_CONST_PTR(ary2) + i;
-	    }
-	    else {
-		return Qfalse;
-	    }
-	}
-	p1++;
-	p2++;
+        if (*p1 != *p2) {
+            if (rb_equal(*p1, *p2)) {
+                len1 = RARRAY_LEN(ary1);
+                if (len1 != RARRAY_LEN(ary2))
+                    return Qfalse;
+                if (len1 < i)
+                    return Qtrue;
+                p1 = RARRAY_CONST_PTR(ary1) + i;
+                p2 = RARRAY_CONST_PTR(ary2) + i;
+            }
+            else {
+                return Qfalse;
+            }
+        }
+        p1++;
+        p2++;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     ary == other_ary   ->   bool
+ *    self == other_array -> true or false
+ *
+ *  Returns whether both:
+ *
+ *  - +self+ and +other_array+ are the same size.
+ *  - Their corresponding elements are the same;
+ *    that is, for each index +i+ in <tt>(0...self.size)</tt>,
+ *    <tt>self[i] == other_array[i]</tt>.
  *
- *  Equality --- Two arrays are equal if they contain the same number of
- *  elements and if each element is equal to (according to Object#==) the
- *  corresponding element in +other_ary+.
+ *  Examples:
  *
- *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
- *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
- *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2]   # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2.0] # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar']      # => false # Different sizes.
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 3]   # => false # Different elements.
  *
+ *  This method is different from method Array#eql?,
+ *  which compares elements using <tt>Object#eql?</tt>.
+ *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 static VALUE
@@ -3898,10 +5383,10 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
 {
     if (ary1 == ary2) return Qtrue;
     if (!RB_TYPE_P(ary2, T_ARRAY)) {
-	if (!rb_respond_to(ary2, idTo_ary)) {
-	    return Qfalse;
-	}
-	return rb_equal(ary2, ary1);
+        if (!rb_respond_to(ary2, idTo_ary)) {
+            return Qfalse;
+        }
+        return rb_equal(ary2, ary1);
     }
     if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
     if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
@@ -3915,18 +5400,29 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-	    return Qfalse;
+        if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+            return Qfalse;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *     ary.eql?(other)  -> true or false
+ *    eql?(other_array) -> true or false
+ *
+ *  Returns +true+ if +self+ and +other_array+ are the same size,
+ *  and if, for each index +i+ in +self+, <tt>self[i].eql?(other_array[i])</tt>:
  *
- *  Returns +true+ if +self+ and +other+ are the same object,
- *  or are both arrays with the same content (according to Object#eql?).
+ *    a0 = [:foo, 'bar', 2]
+ *    a1 = [:foo, 'bar', 2]
+ *    a1.eql?(a0) # => true
+ *
+ *  Otherwise, returns +false+.
+ *
+ *  This method is different from method Array#==,
+ *  which compares using method <tt>Object#==</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -3939,45 +5435,67 @@ rb_ary_eql(VALUE ary1, VALUE ary2)
     return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
+static VALUE
+ary_hash_values(long len, const VALUE *elements, const VALUE ary)
+{
+    long i;
+    st_index_t h;
+    VALUE n;
+
+    h = rb_hash_start(len);
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash_values);
+    for (i=0; i<len; i++) {
+        n = rb_hash(elements[i]);
+        h = rb_hash_uint(h, NUM2LONG(n));
+        if (ary) {
+            len = RARRAY_LEN(ary);
+            elements = RARRAY_CONST_PTR(ary);
+        }
+    }
+    h = rb_hash_end(h);
+    return ST2FIX(h);
+}
+
+VALUE
+rb_ary_hash_values(long len, const VALUE *elements)
+{
+    return ary_hash_values(len, elements, 0);
+}
+
 /*
  *  call-seq:
- *     ary.hash   -> integer
+ *    hash -> integer
  *
- *  Compute a hash-code for this array.
+ *  Returns the integer hash value for +self+.
  *
- *  Two arrays with the same content will have the same hash code (and will
- *  compare using #eql?).
+ *  Two arrays with the same content will have the same hash value
+ *  (and will compare using eql?):
+ *
+ *    ['a', 'b'].hash == ['a', 'b'].hash # => true
+ *    ['a', 'b'].hash == ['a', 'c'].hash # => false
+ *    ['a', 'b'].hash == ['a'].hash      # => false
  *
- *  See also Object#hash.
  */
 
 static VALUE
 rb_ary_hash(VALUE ary)
 {
-    long i;
-    st_index_t h;
-    VALUE n;
-
-    h = rb_hash_start(RARRAY_LEN(ary));
-    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	n = rb_hash(RARRAY_AREF(ary, i));
-	h = rb_hash_uint(h, NUM2LONG(n));
-    }
-    h = rb_hash_end(h);
-    return ST2FIX(h);
+    RBIMPL_ASSERT_OR_ASSUME(ary);
+    return ary_hash_values(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary), ary);
 }
 
 /*
  *  call-seq:
- *     ary.include?(object)   -> true or false
+ *    include?(object) -> true or false
+ *
+ *  Returns whether for some element +element+ in +self+,
+ *  <tt>object == element</tt>:
  *
- *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
- *  element <code>==</code> +object+), otherwise returns +false+.
+ *    [0, 1, 2].include?(2)   # => true
+ *    [0, 1, 2].include?(2.0) # => true
+ *    [0, 1, 2].include?(2.1) # => false
  *
- *     a = [ "a", "b", "c" ]
- *     a.include?("b")   #=> true
- *     a.include?("z")   #=> false
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 VALUE
@@ -3987,10 +5505,10 @@ rb_ary_includes(VALUE ary, VALUE item)
     VALUE e;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	e = RARRAY_AREF(ary, i);
-	if (rb_equal(e, item)) {
-	    return Qtrue;
-	}
+        e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, item)) {
+            return Qtrue;
+        }
     }
     return Qfalse;
 }
@@ -4002,10 +5520,10 @@ rb_ary_includes_by_eql(VALUE ary, VALUE item)
     VALUE e;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	e = RARRAY_AREF(ary, i);
-	if (rb_eql(item, e)) {
-	    return Qtrue;
-	}
+        e = RARRAY_AREF(ary, i);
+        if (rb_eql(item, e)) {
+            return Qtrue;
+        }
     }
     return Qfalse;
 }
@@ -4018,46 +5536,54 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
     if (recur) return Qundef;	/* Subtle! */
     len = RARRAY_LEN(ary1);
     if (len > RARRAY_LEN(ary2)) {
-	len = RARRAY_LEN(ary2);
+        len = RARRAY_LEN(ary2);
     }
     for (i=0; i<len; i++) {
-	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
-	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
-	if (v != INT2FIX(0)) {
-	    return v;
-	}
+        VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+        VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+        if (v != INT2FIX(0)) {
+            return v;
+        }
     }
     return Qundef;
 }
 
 /*
  *  call-seq:
- *     ary <=> other_ary   ->  -1, 0, +1 or nil
+ *    self <=> other_array -> -1, 0, or 1
+ *
+ *  Returns -1, 0, or 1 as +self+ is determined
+ *  to be less than, equal to, or greater than +other_array+.
+ *
+ *  Iterates over each index +i+ in <tt>(0...self.size)</tt>:
+ *
+ *  - Computes <tt>result[i]</tt> as <tt>self[i] <=> other_array[i]</tt>.
+ *  - Immediately returns 1 if <tt>result[i]</tt> is 1:
+ *
+ *      [0, 1, 2] <=> [0, 0, 2] # => 1
  *
- *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- *  array is less than, equal to, or greater than +other_ary+.
+ *  - Immediately returns -1 if <tt>result[i]</tt> is -1:
  *
- *  Each object in each array is compared (using the <=> operator).
+ *      [0, 1, 2] <=> [0, 2, 2] # => -1
  *
- *  Arrays are compared in an "element-wise" manner; the first element of +ary+
- *  is compared with the first one of +other_ary+ using the <=> operator, then
- *  each of the second elements, etc...
- *  As soon as the result of any such comparison is non zero (i.e. the two
- *  corresponding elements are not equal), that result is returned for the
- *  whole array comparison.
+ *  - Continues if <tt>result[i]</tt> is 0.
  *
- *  If all the elements are equal, then the result is based on a comparison of
- *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- *  and only if, they have the same length and the value of each element is
- *  equal to the value of the corresponding element in the other array.
+ *  When every +result+ is 0,
+ *  returns <tt>self.size <=> other_array.size</tt>
+ *  (see Integer#<=>):
  *
- *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
- *  of two elements returned +nil+.
+ *    [0, 1, 2] <=> [0, 1]        # => 1
+ *    [0, 1, 2] <=> [0, 1, 2]     # => 0
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
  *
- *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
- *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
- *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
+ *  Note that when +other_array+ is larger than +self+,
+ *  its trailing elements do not affect the result:
  *
+ *    [0, 1, 2] <=> [0, 1, 2, -3] # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 0]  # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
+ *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 VALUE
@@ -4070,7 +5596,7 @@ rb_ary_cmp(VALUE ary1, VALUE ary2)
     if (NIL_P(ary2)) return Qnil;
     if (ary1 == ary2) return INT2FIX(0);
     v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
-    if (v != Qundef) return v;
+    if (!UNDEF_P(v)) return v;
     len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
@@ -4083,8 +5609,8 @@ ary_add_hash(VALUE hash, VALUE ary)
     long i;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE elt = RARRAY_AREF(ary, i);
-	rb_hash_add_new_element(hash, elt, elt);
+        VALUE elt = RARRAY_AREF(ary, i);
+        rb_hash_add_new_element(hash, elt, elt);
     }
     return hash;
 }
@@ -4112,8 +5638,8 @@ ary_add_hash_by(VALUE hash, VALUE ary)
     long i;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
-	rb_hash_add_new_element(hash, k, v);
+        VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+        rb_hash_add_new_element(hash, k, v);
     }
     return hash;
 }
@@ -4125,35 +5651,25 @@ ary_make_hash_by(VALUE ary)
     return ary_add_hash_by(hash, ary);
 }
 
-static inline void
-ary_recycle_hash(VALUE hash)
-{
-    assert(RBASIC_CLASS(hash) == 0);
-    if (RHASH(hash)->ntbl) {
-	st_table *tbl = RHASH(hash)->ntbl;
-	st_free_table(tbl);
-    }
-    rb_gc_force_recycle(hash);
-}
-
 /*
  *  call-seq:
- *     ary - other_ary    -> new_ary
- *
- *  Array Difference
+ *    self - other_array -> new_array
  *
- *  Returns a new array that is a copy of the original array, removing any
- *  items that also appear in +other_ary+. The order is preserved from the
- *  original array.
+ *  Returns a new array containing only those elements of +self+
+ *  that are not found in +other_array+;
+ *  the order from +self+ is preserved:
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1]             # => [0, 2, 3]
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [3, 2, 0, :foo] # => [1, 1, 1, 1, 1, 1]
+ *    [0, 1, 2] - [:foo]                            # => [0, 1, 2]
  *
- *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
+ *  Element are compared using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
  *
- *  If you need set-like behavior, see the library class Set.
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
-static VALUE
+VALUE
 rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
@@ -4161,39 +5677,104 @@ rb_ary_diff(VALUE ary1, VALUE ary2)
     long i;
 
     ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
     ary3 = rb_ary_new();
 
-    if (RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-	for (i=0; i<RARRAY_LEN(ary1); i++) {
-	    VALUE elt = rb_ary_elt(ary1, i);
-	    if (rb_ary_includes_by_eql(ary2, elt)) continue;
-	    rb_ary_push(ary3, elt);
-	}
-	return ary3;
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            VALUE elt = rb_ary_elt(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, elt)) continue;
+            rb_ary_push(ary3, elt);
+        }
+        return ary3;
     }
 
     hash = ary_make_hash(ary2);
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
-	rb_ary_push(ary3, rb_ary_elt(ary1, i));
+        if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
+        rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
-    ary_recycle_hash(hash);
+
     return ary3;
 }
 
 /*
  *  call-seq:
- *     ary & other_ary      -> new_ary
+ *    difference(*other_arrays = []) -> new_array
  *
- *  Set Intersection --- Returns a new array containing unique elements common to the
- *  two arrays. The order is preserved from the original array.
+ *  Returns a new array containing only those elements from +self+
+ *  that are not found in any of the given +other_arrays+;
+ *  items are compared using <tt>eql?</tt>;  order from +self+ is preserved:
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ *    [0, 1, 2, 3].difference([3, 0], [1, 3])     # => [2]
+ *    [0, 1, 2].difference([4])                   # => [0, 1, 2]
+ *    [0, 1, 2].difference                        # => [0, 1, 2]
  *
- *     [ 1, 1, 3, 5 ] & [ 3, 2, 1 ]                 #=> [ 1, 3 ]
- *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
+ *  Returns a copy of +self+ if no arguments are given.
  *
- *  See also Array#uniq.
+ *  Related: Array#-;
+ *  see also {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE ary_diff;
+    long i, length;
+    volatile VALUE t0;
+    bool *is_hash = ALLOCV_N(bool, t0, argc);
+    ary_diff = rb_ary_new();
+    length = RARRAY_LEN(ary);
+
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+        if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        int j;
+        VALUE elt = rb_ary_elt(ary, i);
+        for (j = 0; j < argc; j++) {
+            if (is_hash[j]) {
+                if (rb_hash_stlike_lookup(argv[j], elt, NULL))
+                    break;
+            }
+            else {
+                if (rb_ary_includes_by_eql(argv[j], elt)) break;
+            }
+        }
+        if (j == argc) rb_ary_push(ary_diff, elt);
+    }
+
+    ALLOCV_END(t0);
+
+    return ary_diff;
+}
+
+
+/*
+ *  call-seq:
+ *    self & other_array -> new_array
+ *
+ *  Returns a new array containing the _intersection_ of +self+ and +other_array+;
+ *  that is, containing those elements found in both +self+ and +other_array+:
+ *
+ *    [0, 1, 2, 3] & [1, 2] # => [1, 2]
+ *
+ *  Omits duplicates:
+ *
+ *    [0, 1, 1, 0] & [0, 1] # => [0, 1]
+ *
+ *  Preserves order from +self+:
+ *
+ *    [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
+ *
+ *  Identifies common elements using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 
@@ -4201,39 +5782,70 @@ static VALUE
 rb_ary_and(VALUE ary1, VALUE ary2)
 {
     VALUE hash, ary3, v;
-    st_table *table;
     st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
     ary3 = rb_ary_new();
-    if (RARRAY_LEN(ary2) == 0) return ary3;
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
 
     if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-	for (i=0; i<RARRAY_LEN(ary1); i++) {
-	    v = RARRAY_AREF(ary1, i);
-	    if (!rb_ary_includes_by_eql(ary2, v)) continue;
-	    if (rb_ary_includes_by_eql(ary3, v)) continue;
-	    rb_ary_push(ary3, v);
-	}
-	return ary3;
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (!rb_ary_includes_by_eql(ary2, v)) continue;
+            if (rb_ary_includes_by_eql(ary3, v)) continue;
+            rb_ary_push(ary3, v);
+        }
+        return ary3;
     }
 
     hash = ary_make_hash(ary2);
-    table = rb_hash_tbl_raw(hash);
 
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-	v = RARRAY_AREF(ary1, i);
-	vv = (st_data_t)v;
-	if (st_delete(table, &vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
+        v = RARRAY_AREF(ary1, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_delete(hash, &vv, 0)) {
+            rb_ary_push(ary3, v);
+        }
     }
-    ary_recycle_hash(hash);
 
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *    intersection(*other_arrays) -> new_array
+ *
+ *  Returns a new array containing each element in +self+ that is +#eql?+
+ *  to at least one element in each of the given +other_arrays+;
+ *  duplicates are omitted:
+ *
+ *    [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Order from +self+ is preserved:
+ *
+ *    [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments are given.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = rb_ary_dup(ary);
+    int i;
+
+    for (i = 0; i < argc; i++) {
+        result = rb_ary_and(result, argv[i]);
+    }
+
+    return result;
+}
+
 static int
 ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
 {
@@ -4242,165 +5854,553 @@ ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
     return ST_CONTINUE;
 }
 
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE elt = rb_ary_elt(ary, i);
+        if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+        rb_ary_push(ary_union, elt);
+    }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary2); i++) {
+        VALUE elt = RARRAY_AREF(ary2, i);
+        if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+            RB_OBJ_WRITTEN(hash, Qundef, elt);
+        }
+    }
+}
+
 /*
  *  call-seq:
- *     ary | other_ary     -> new_ary
+ *    self | other_array -> new_array
  *
- *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- *  excluding any duplicates and preserving the order from the given arrays.
+ *  Returns the union of +self+ and +other_array+;
+ *  duplicates are removed; order is preserved;
+ *  items are compared using <tt>eql?</tt> and <tt>hash</tt>:
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *    [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
  *
- *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
- *     [ "c", "d", "a" ] | [ "a", "b", "c" ]    #=> [ "c", "d", "a", "b" ]
- *
- *  See also Array#uniq.
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
 rb_ary_or(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, ary3;
-    long i;
+    VALUE hash;
 
     ary2 = to_ary(ary2);
     if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-	ary3 = rb_ary_new();
-	for (i=0; i<RARRAY_LEN(ary1); i++) {
-	    VALUE elt = rb_ary_elt(ary1, i);
-	    if (rb_ary_includes_by_eql(ary3, elt)) continue;
-	    rb_ary_push(ary3, elt);
-	}
-	for (i=0; i<RARRAY_LEN(ary2); i++) {
-	    VALUE elt = rb_ary_elt(ary2, i);
-	    if (rb_ary_includes_by_eql(ary3, elt)) continue;
-	    rb_ary_push(ary3, elt);
-	}
-	return ary3;
+        VALUE ary3 = rb_ary_new();
+        rb_ary_union(ary3, ary1);
+        rb_ary_union(ary3, ary2);
+        return ary3;
     }
 
     hash = ary_make_hash(ary1);
-    for (i=0; i<RARRAY_LEN(ary2); i++) {
-	VALUE elt = RARRAY_AREF(ary2, i);
-	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
-	    RB_OBJ_WRITTEN(hash, Qundef, elt);
-	}
-    }
-    ary3 = rb_hash_values(hash);
-    ary_recycle_hash(hash);
-    return ary3;
+    rb_ary_union_hash(hash, ary2);
+
+    return rb_hash_values(hash);
 }
 
 /*
  *  call-seq:
- *     ary.max                     -> obj
- *     ary.max { |a, b| block }    -> obj
- *     ary.max(n)                  -> array
- *     ary.max(n) { |a, b| block } -> array
+ *    union(*other_arrays) -> new_array
+ *
+ *  Returns a new array that is the union of the elements of +self+
+ *  and all given arrays +other_arrays+;
+ *  items are compared using <tt>eql?</tt> and <tt>hash</tt>:
  *
- *  Returns the object in _ary_ with the maximum value. The
- *  first form assumes all objects implement <code>Comparable</code>;
- *  the second uses the block to return <em>a <=> b</em>.
+ *    [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
  *
- *     ary = %w(albatross dog horse)
- *     ary.max                                   #=> "horse"
- *     ary.max { |a, b| a.length <=> b.length }  #=> "albatross"
+ *  Removes duplicates (preserving the first found):
  *
- *  If the +n+ argument is given, maximum +n+ elements are returned
- *  as an array.
+ *    [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
  *
- *     ary = %w[albatross dog horse]
- *     ary.max(2)                                  #=> ["horse", "dog"]
- *     ary.max(2) {|a, b| a.length <=> b.length }  #=> ["albatross", "horse"]
+ *  Preserves order (preserving the position of the first found):
+ *
+ *    [3, 2, 1, 0].union([5, 3], [4, 2]) # => [3, 2, 1, 0, 5, 4]
+ *
+ *  With no arguments given, returns a copy of +self+.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+    int i;
+    long sum;
+    VALUE hash;
+
+    sum = RARRAY_LEN(ary);
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        sum += RARRAY_LEN(argv[i]);
+    }
+
+    if (sum <= SMALL_ARRAY_LEN) {
+        VALUE ary_union = rb_ary_new();
+
+        rb_ary_union(ary_union, ary);
+        for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+        return ary_union;
+    }
+
+    hash = ary_make_hash(ary);
+    for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+    return rb_hash_values(hash);
+}
+
+/*
+ *  call-seq:
+ *    intersect?(other_array) -> true or false
+ *
+ *  Returns whether +other_array+ has at least one element that is +#eql?+ to some element of +self+:
+ *
+ *    [1, 2, 3].intersect?([3, 4, 5]) # => true
+ *    [1, 2, 3].intersect?([4, 5, 6]) # => false
+ *
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_intersect_p(VALUE ary1, VALUE ary2)
+{
+    VALUE hash, v, result, shorter, longer;
+    st_data_t vv;
+    long i;
+
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
+        }
+        return Qfalse;
+    }
+
+    shorter = ary1;
+    longer = ary2;
+    if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
+        longer = ary1;
+        shorter = ary2;
+    }
+
+    hash = ary_make_hash(shorter);
+    result = Qfalse;
+
+    for (i=0; i<RARRAY_LEN(longer); i++) {
+        v = RARRAY_AREF(longer, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_lookup(hash, vv, 0)) {
+            result = Qtrue;
+            break;
+        }
+    }
+
+    return result;
+}
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+            vmax = v;
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(v)) {
+            if ((long)vmax < (long)v) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(v)) {
+            if (rb_float_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (STRING_P(v)) {
+            if (rb_str_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+/*
+ *  call-seq:
+ *    max -> element
+ *    max(count) -> new_array
+ *    max {|a, b| ... } -> element
+ *    max(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The maximum-valued element from +self+.
+ *  - A new array of maximum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
+ *
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the maximum value per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].max # => 3
+ *
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].max(3)   # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(3.0) # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(9)   # => [3, 2, 1, 0]
+ *    [1, 0, 3, 2].max(0)   # => []
+ *
+ *  With a block given, the block must return a numeric.
+ *
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the maximum value per the block:
+ *
+ *    ['0', '', '000', '00'].max {|a, b| a.size <=> b.size }
+ *    # => "000"
+ *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per the block:
+ *
+ *    ['0', '', '000', '00'].max(2) {|a, b| a.size <=> b.size }
+ *    # => ["000", "00"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 static VALUE
 rb_ary_max(int argc, VALUE *argv, VALUE ary)
 {
-    struct cmp_opt_data cmp_opt = { 0, 0 };
     VALUE result = Qundef, v;
     VALUE num;
     long i;
 
-    rb_scan_args(argc, argv, "01", &num);
-
-    if (!NIL_P(num))
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
        return rb_nmin_run(ary, num, 0, 1, 1);
 
+    const long n = RARRAY_LEN(ary);
     if (rb_block_given_p()) {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
-	       result = v;
-	   }
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+               result = v;
+           }
+        }
     }
-    else {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) > 0) {
-	       result = v;
-	   }
-	}
-    }
-    if (result == Qundef) return Qnil;
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_max_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_max_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_max_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_max_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
     return result;
 }
 
+static VALUE
+ary_min_generic(VALUE ary, long i, VALUE vmin)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+            vmin = v;
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(a)) {
+            if ((long)vmin > (long)a) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(a)) {
+            if (rb_float_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (STRING_P(a)) {
+            if (rb_str_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
 /*
  *  call-seq:
- *     ary.min                     -> obj
- *     ary.min {| a,b | block }    -> obj
- *     ary.min(n)                  -> array
- *     ary.min(n) {| a,b | block } -> array
+ *    min -> element
+ *    min(count) -> new_array
+ *    min {|a, b| ... } -> element
+ *    min(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The minimum-valued element from +self+.
+ *  - A new array of minimum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
+ *
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
  *
- *  Returns the object in _ary_ with the minimum value. The
- *  first form assumes all objects implement <code>Comparable</code>;
- *  the second uses the block to return <em>a <=> b</em>.
+ *  With no argument and no block, returns the element in +self+
+ *  having the minimum value per method <tt>#<=></tt>:
  *
- *     ary = %w(albatross dog horse)
- *     ary.min                                   #=> "albatross"
- *     ary.min { |a, b| a.length <=> b.length }  #=> "dog"
+ *    [1, 0, 3, 2].min # => 0
  *
- *  If the +n+ argument is given, minimum +n+ elements are returned
- *  as an array.
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per method <tt>#<=></tt>:
  *
- *     ary = %w[albatross dog horse]
- *     ary.min(2)                                  #=> ["albatross", "dog"]
- *     ary.min(2) {|a, b| a.length <=> b.length }  #=> ["dog", "horse"]
+ *    [1, 0, 3, 2].min(3)   # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(3.0) # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(9)   # => [0, 1, 2, 3]
+ *    [1, 0, 3, 2].min(0)   # => []
+ *
+ *  With a block given, the block must return a numeric.
+ *
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the minimum value per the block:
+ *
+ *    ['0', '', '000', '00'].min {|a, b| a.size <=> b.size }
+ *    # => ""
+ *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per the block:
+ *
+ *    ['0', '', '000', '00'].min(2) {|a, b| a.size <=> b.size }
+ *    # => ["", "0"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 static VALUE
 rb_ary_min(int argc, VALUE *argv, VALUE ary)
 {
-    struct cmp_opt_data cmp_opt = { 0, 0 };
     VALUE result = Qundef, v;
     VALUE num;
     long i;
 
-    rb_scan_args(argc, argv, "01", &num);
-
-    if (!NIL_P(num))
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
        return rb_nmin_run(ary, num, 0, 0, 1);
 
+    const long n = RARRAY_LEN(ary);
     if (rb_block_given_p()) {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
-	       result = v;
-	   }
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+               result = v;
+           }
+        }
     }
-    else {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) < 0) {
-	       result = v;
-	   }
-	}
-    }
-    if (result == Qundef) return Qnil;
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_min_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_min_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_min_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_min_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
     return result;
 }
 
+/*
+ *  call-seq:
+ *    minmax -> array
+ *    minmax {|a, b| ... } -> array
+ *
+ *  Returns a 2-element array containing the minimum-valued and maximum-valued
+ *  elements from +self+;
+ *  does not modify +self+.
+ *
+ *  With no block given, the minimum and maximum values are determined using method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].minmax # => [0, 3]
+ *
+ *  With a block given, the block must return a numeric;
+ *  the block is called <tt>self.size - 1</tt> times to compare elements;
+ *  returns the elements having the minimum and maximum values per the block:
+ *
+ *    ['0', '', '000', '00'].minmax {|a, b| a.size <=> b.size }
+ *    # => ["", "000"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+    if (rb_block_given_p()) {
+        return rb_call_super(0, NULL);
+    }
+    return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
 static int
 push_value(st_data_t key, st_data_t val, st_data_t ary)
 {
@@ -4410,31 +6410,31 @@ push_value(st_data_t key, st_data_t val, st_data_t ary)
 
 /*
  *  call-seq:
- *     ary.uniq!                -> ary or nil
- *     ary.uniq! { |item| ... } -> ary or nil
- *
- *  Removes duplicate elements from +self+.
- *
- *  If a block is given, it will use the return value of the block for
- *  comparison.
- *
- *  It compares values using their #hash and #eql? methods for efficiency.
+ *    uniq! -> self or nil
+ *    uniq! {|element| ... } -> self or nil
  *
- *  +self+ is traversed in order, and the first occurrence is kept.
+ *  Removes duplicate elements from +self+, the first occurrence always being retained;
+ *  returns +self+ if any elements removed, +nil+ otherwise.
  *
- *  Returns +nil+ if no changes are made (that is, no duplicates are found).
+ *  With no block given, identifies and removes elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare elements:
  *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   # => ["a", "b", "c"]
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq! # => [0, 1, 2]
+ *    a.uniq! # => nil
  *
- *     b = [ "a", "b", "c" ]
- *     b.uniq!   # => nil
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
  *
- *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq! {|element| element.size } # => ["a", "aa", "aaa"]
+ *    a.uniq! {|element| element.size } # => nil
  *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
-
 static VALUE
 rb_ary_uniq_bang(VALUE ary)
 {
@@ -4445,46 +6445,50 @@ rb_ary_uniq_bang(VALUE ary)
     if (RARRAY_LEN(ary) <= 1)
         return Qnil;
     if (rb_block_given_p())
-	hash = ary_make_hash_by(ary);
+        hash = ary_make_hash_by(ary);
     else
-	hash = ary_make_hash(ary);
+        hash = ary_make_hash(ary);
 
     hash_size = RHASH_SIZE(hash);
     if (RARRAY_LEN(ary) == hash_size) {
-	return Qnil;
+        return Qnil;
     }
     rb_ary_modify_check(ary);
     ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
-	FL_SET_EMBED(ary);
+    if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
     }
     ary_resize_capa(ary, hash_size);
-    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
-    ary_recycle_hash(hash);
+    rb_hash_foreach(hash, push_value, ary);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.uniq                -> new_ary
- *     ary.uniq { |item| ... } -> new_ary
- *
- *  Returns a new array by removing duplicate values in +self+.
+ *    uniq -> new_array
+ *    uniq {|element| ... } -> new_array
  *
- *  If a block is given, it will use the return value of the block for comparison.
+ *  Returns a new array containing those elements from +self+ that are not duplicates,
+ *  the first occurrence always being retained.
  *
- *  It compares values using their #hash and #eql? methods for efficiency.
+ *  With no block given, identifies and omits duplicate elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare elements:
  *
- *  +self+ is traversed in order, and the first occurrence is kept.
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq # => [0, 1, 2]
  *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   # => ["a", "b", "c"]
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  and <tt>hash</tt> to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
  *
- *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
  *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -4492,35 +6496,39 @@ rb_ary_uniq(VALUE ary)
 {
     VALUE hash, uniq;
 
-    if (RARRAY_LEN(ary) <= 1)
-        return rb_ary_dup(ary);
-    if (rb_block_given_p()) {
-	hash = ary_make_hash_by(ary);
-	uniq = rb_hash_values(hash);
+    if (RARRAY_LEN(ary) <= 1) {
+        hash = 0;
+        uniq = rb_ary_dup(ary);
+    }
+    else if (rb_block_given_p()) {
+        hash = ary_make_hash_by(ary);
+        uniq = rb_hash_values(hash);
     }
     else {
-	hash = ary_make_hash(ary);
-	uniq = rb_hash_values(hash);
+        hash = ary_make_hash(ary);
+        uniq = rb_hash_values(hash);
     }
-    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
-    ary_recycle_hash(hash);
 
     return uniq;
 }
 
 /*
  *  call-seq:
- *     ary.compact!    -> ary  or  nil
+ *    compact! -> self or nil
  *
- *  Removes +nil+ elements from the array.
+ *  Removes all +nil+ elements from +self+;
+ *  Returns +self+ if any elements are removed, +nil+ otherwise:
  *
- *  Returns +nil+ if no changes were made, otherwise returns the array.
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact! # => [0, false, "", [], {}]
+ *    a          # => [0, false, "", [], {}]
+ *    a.compact! # => nil
  *
- *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- *     [ "a", "b", "c" ].compact!           #=> nil
+ *  Related: Array#compact;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
-static VALUE
+VALUE
 rb_ary_compact_bang(VALUE ary)
 {
     VALUE *p, *t, *end;
@@ -4531,12 +6539,12 @@ rb_ary_compact_bang(VALUE ary)
     end = p + RARRAY_LEN(ary);
 
     while (t < end) {
-	if (NIL_P(*t)) t++;
-	else *p++ = *t++;
+        if (NIL_P(*t)) t++;
+        else *p++ = *t++;
     }
     n = p - RARRAY_CONST_PTR(ary);
     if (RARRAY_LEN(ary) == n) {
-	return Qnil;
+        return Qnil;
     }
     ary_resize_smaller(ary, n);
 
@@ -4545,12 +6553,16 @@ rb_ary_compact_bang(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.compact     -> new_ary
+ *    compact -> new_array
+ *
+ *  Returns a new array containing only the non-+nil+ elements from +self+;
+ *  element order is preserved:
  *
- *  Returns a copy of +self+ with all +nil+ elements removed.
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact # => [0, false, "", [], {}]
  *
- *     [ "a", nil, "b", nil, "c", nil ].compact
- *                       #=> [ "a", "b", "c" ]
+ *  Related: Array#compact!;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -4563,23 +6575,29 @@ rb_ary_compact(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.count                   -> int
- *     ary.count(obj)              -> int
- *     ary.count { |item| block }  -> int
+ *    count -> integer
+ *    count(object) -> integer
+ *    count {|element| ... } -> integer
+ *
+ *  Returns a count of specified elements.
  *
- *  Returns the number of elements.
+ *  With no argument and no block, returns the count of all elements:
  *
- *  If an argument is given, counts the number of elements which equal +obj+
- *  using <code>==</code>.
+ *    [0, :one, 'two', 3, 3.0].count # => 5
  *
- *  If a block is given, counts the number of elements for which the block
- *  returns a true value.
+ *  With argument +object+ given, returns the count of elements <tt>==</tt> to +object+:
  *
- *     ary = [1, 2, 4, 2]
- *     ary.count                  #=> 4
- *     ary.count(2)               #=> 2
- *     ary.count { |x| x%2 == 0 } #=> 3
+ *    [0, :one, 'two', 3, 3.0].count(3) # => 2
  *
+ *  With no argument and a block given, calls the block with each element;
+ *  returns the count of elements for which the block returns a truthy value:
+ *
+ *    [0, 1, 2, 3].count {|element| element > 1 } # => 2
+ *
+ *  With argument +object+ and a block given, issues a warning, ignores the block,
+ *  and returns the count of elements <tt>==</tt> to +object+.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -4587,108 +6605,149 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
     long i, n = 0;
 
-    if (argc == 0) {
-	VALUE v;
+    if (rb_check_arity(argc, 0, 1) == 0) {
+        VALUE v;
 
-	if (!rb_block_given_p())
-	    return LONG2NUM(RARRAY_LEN(ary));
+        if (!rb_block_given_p())
+            return LONG2NUM(RARRAY_LEN(ary));
 
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    v = RARRAY_AREF(ary, i);
-	    if (RTEST(rb_yield(v))) n++;
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            v = RARRAY_AREF(ary, i);
+            if (RTEST(rb_yield(v))) n++;
+        }
     }
     else {
-	VALUE obj;
+        VALUE obj = argv[0];
 
-	rb_scan_args(argc, argv, "1", &obj);
-	if (rb_block_given_p()) {
-	    rb_warn("given block not used");
-	}
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
-	}
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+        }
     }
 
     return LONG2NUM(n);
 }
 
 static VALUE
-flatten(VALUE ary, int level, int *modified)
+flatten(VALUE ary, int level)
 {
-    long i = 0;
-    VALUE stack, result, tmp, elt;
-    st_table *memo;
-    st_data_t id;
+    long i;
+    VALUE stack, result, tmp = 0, elt;
+    VALUE memo = Qfalse;
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        elt = RARRAY_AREF(ary, i);
+        tmp = rb_check_array_type(elt);
+        if (!NIL_P(tmp)) {
+            break;
+        }
+    }
+    if (i == RARRAY_LEN(ary)) {
+        return ary;
+    }
 
-    stack = ary_new(0, ARY_DEFAULT_SIZE);
     result = ary_new(0, RARRAY_LEN(ary));
-    memo = st_init_numtable();
-    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
-    *modified = 0;
+    ary_memcpy(result, 0, i, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(result, i);
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    rb_ary_push(stack, ary);
+    rb_ary_push(stack, LONG2NUM(i + 1));
+
+    if (level < 0) {
+        memo = rb_obj_hide(rb_ident_hash_new());
+        rb_hash_aset(memo, ary, Qtrue);
+        rb_hash_aset(memo, tmp, Qtrue);
+    }
+
+    ary = tmp;
+    i = 0;
 
     while (1) {
-	while (i < RARRAY_LEN(ary)) {
-	    elt = RARRAY_AREF(ary, i++);
-	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
-		rb_ary_push(result, elt);
-		continue;
-	    }
-	    tmp = rb_check_array_type(elt);
-	    if (RBASIC(result)->klass) {
-		rb_raise(rb_eRuntimeError, "flatten reentered");
-	    }
-	    if (NIL_P(tmp)) {
-		rb_ary_push(result, elt);
-	    }
-	    else {
-		*modified = 1;
-		id = (st_data_t)tmp;
-		if (st_lookup(memo, id, 0)) {
-		    st_free_table(memo);
-		    rb_raise(rb_eArgError, "tried to flatten recursive array");
-		}
-		st_insert(memo, id, (st_data_t)Qtrue);
-		rb_ary_push(stack, ary);
-		rb_ary_push(stack, LONG2NUM(i));
-		ary = tmp;
-		i = 0;
-	    }
-	}
-	if (RARRAY_LEN(stack) == 0) {
-	    break;
-	}
-	id = (st_data_t)ary;
-	st_delete(memo, &id, 0);
-	tmp = rb_ary_pop(stack);
-	i = NUM2LONG(tmp);
-	ary = rb_ary_pop(stack);
-    }
-
-    st_free_table(memo);
-
-    RBASIC_SET_CLASS(result, rb_obj_class(ary));
+        while (i < RARRAY_LEN(ary)) {
+            elt = RARRAY_AREF(ary, i++);
+            if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+                rb_ary_push(result, elt);
+                continue;
+            }
+            tmp = rb_check_array_type(elt);
+            if (RBASIC(result)->klass) {
+                if (RTEST(memo)) {
+                    rb_hash_clear(memo);
+                }
+                rb_raise(rb_eRuntimeError, "flatten reentered");
+            }
+            if (NIL_P(tmp)) {
+                rb_ary_push(result, elt);
+            }
+            else {
+                if (memo) {
+                    if (rb_hash_aref(memo, tmp) == Qtrue) {
+                        rb_hash_clear(memo);
+                        rb_raise(rb_eArgError, "tried to flatten recursive array");
+                    }
+                    rb_hash_aset(memo, tmp, Qtrue);
+                }
+                rb_ary_push(stack, ary);
+                rb_ary_push(stack, LONG2NUM(i));
+                ary = tmp;
+                i = 0;
+            }
+        }
+        if (RARRAY_LEN(stack) == 0) {
+            break;
+        }
+        if (memo) {
+            rb_hash_delete(memo, ary);
+        }
+        tmp = rb_ary_pop(stack);
+        i = NUM2LONG(tmp);
+        ary = rb_ary_pop(stack);
+    }
+
+    if (memo) {
+        rb_hash_clear(memo);
+    }
+
+    RBASIC_SET_CLASS(result, rb_cArray);
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.flatten!        -> ary or nil
- *     ary.flatten!(level) -> ary or nil
+ *    flatten!(depth = nil) -> self or nil
+ *
+ *  Returns +self+ as a recursively flattening of +self+ to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
+ *  At each level of recursion:
+ *
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
+ *
+ *  Returns +nil+ if no elements were flattened.
  *
- *  Flattens +self+ in place.
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
  *
- *  Returns +nil+ if no modifications were made (i.e., the array contains no
- *  subarrays.)
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a                   # => [0, [1, [2, 3], 4], 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1)   # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1.1) # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(2)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(3)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
  *
- *  The optional +level+ argument determines the level of recursion to flatten.
+ *  With +nil+ or negative argument +depth+, flattens all levels:
  *
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!   #=> [1, 2, 3, 4, 5]
- *     a.flatten!   #=> nil
- *     a            #=> [1, 2, 3, 4, 5]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
+ *    a.dup.flatten!     # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(-1) # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *
+ *  Related: Array#flatten;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -4697,17 +6756,16 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
     int mod = 0, level = -1;
     VALUE result, lv;
 
-    rb_scan_args(argc, argv, "01", &lv);
+    lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
     rb_ary_modify_check(ary);
     if (!NIL_P(lv)) level = NUM2INT(lv);
     if (level == 0) return Qnil;
 
-    result = flatten(ary, level, &mod);
-    if (mod == 0) {
-	ary_discard(result);
-	return Qnil;
+    result = flatten(ary, level);
+    if (result == ary) {
+        return Qnil;
     }
-    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+    if (!(mod = ARY_EMBED_P(result))) rb_ary_freeze(result);
     rb_ary_replace(ary, result);
     if (mod) ARY_SET_EMBED_LEN(result, 0);
 
@@ -4716,284 +6774,221 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *     ary.flatten -> new_ary
- *     ary.flatten(level) -> new_ary
+ *    flatten(depth = nil) -> new_array
+ *
+ *  Returns a new array that is a recursive flattening of +self+
+ *  to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  or +nil+.
+ *  At each level of recursion:
  *
- *  Returns a new array that is a one-dimensional flattening of +self+
- *  (recursively).
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
  *
- *  That is, for every element that is an array, extract its elements into
- *  the new array.
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
  *
- *  The optional +level+ argument determines the level of recursion to
- *  flatten.
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a              # => [0, [1, [2, 3], 4], 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(0)   # => [0, [1, [2, 3], 4], 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(1  ) # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(1.1) # => [0, 1, [2, 3], 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(2)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(3)   # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
  *
- *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
- *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
+ *  With +nil+ or negative +depth+, flattens all levels.
+ *
+ *    a.flatten     # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *    a.flatten(-1) # => [0, 1, 2, 3, 4, 5, {foo: 0}, #<Set: {6, 7}>]
+ *
+ *  Related: Array#flatten!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
  */
 
 static VALUE
 rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
 {
-    int mod = 0, level = -1;
-    VALUE result, lv;
+    int level = -1;
+    VALUE result;
 
-    rb_scan_args(argc, argv, "01", &lv);
-    if (!NIL_P(lv)) level = NUM2INT(lv);
-    if (level == 0) return ary_make_shared_copy(ary);
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+        level = NUM2INT(argv[0]);
+        if (level == 0) return ary_make_shared_copy(ary);
+    }
 
-    result = flatten(ary, level, &mod);
-    OBJ_INFECT(result, ary);
+    result = flatten(ary, level);
+    if (result == ary) {
+        result = ary_make_shared_copy(ary);
+    }
 
     return result;
 }
 
-#define OPTHASH_GIVEN_P(opts) \
-    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
 #define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
 
-/*
- *  call-seq:
- *     ary.shuffle!              -> ary
- *     ary.shuffle!(random: rng) -> ary
- *
- *  Shuffles elements in +self+ in place.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle!                #=> [2, 3, 1]
- *     a                         #=> [2, 3, 1]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
- */
-
 static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
 {
-    VALUE opts, randgen = rb_cRandom;
     long i, len;
 
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
-    rb_check_arity(argc, 0, 0);
     rb_ary_modify(ary);
     i = len = RARRAY_LEN(ary);
     RARRAY_PTR_USE(ary, ptr, {
-	while (i) {
-	    long j = RAND_UPTO(i);
-	    VALUE tmp;
-	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
-		rb_raise(rb_eRuntimeError, "modified during shuffle");
-	    }
-	    tmp = ptr[--i];
-	    ptr[i] = ptr[j];
-	    ptr[j] = tmp;
-	}
+        while (i > 1) {
+            long j = RAND_UPTO(i);
+            VALUE tmp;
+            if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+                rb_raise(rb_eRuntimeError, "modified during shuffle");
+            }
+            tmp = ptr[--i];
+            ptr[i] = ptr[j];
+            ptr[j] = tmp;
+        }
     }); /* WB: no new reference */
     return ary;
 }
 
-
-/*
- *  call-seq:
- *     ary.shuffle              -> new_ary
- *     ary.shuffle(random: rng) -> new_ary
- *
- *  Returns a new array with elements of +self+ shuffled.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle                 #=> [2, 3, 1]
- *     a                         #=> [1, 2, 3]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
- */
-
 static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
 {
     ary = rb_ary_dup(ary);
-    rb_ary_shuffle_bang(argc, argv, ary);
+    rb_ary_shuffle_bang(ec, ary, randgen);
     return ary;
 }
 
-
-/*
- *  call-seq:
- *     ary.sample                  -> obj
- *     ary.sample(random: rng)     -> obj
- *     ary.sample(n)               -> new_ary
- *     ary.sample(n, random: rng)  -> new_ary
- *
- *  Choose a random element or +n+ random elements from the array.
- *
- *  The elements are chosen by using random and unique indices into the array
- *  in order to ensure that an element doesn't repeat itself unless the array
- *  already contained duplicate elements.
- *
- *  If the array is empty the first form returns +nil+ and the second form
- *  returns an empty array.
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- *     a.sample         #=> 7
- *     a.sample(4)      #=> [6, 4, 2, 5]
- */
-
+static const rb_data_type_t ary_sample_memo_type = {
+    .wrap_struct_name = "ary_sample_memo",
+    .function = {
+        .dfree = (RUBY_DATA_FUNC)st_free_table,
+    },
+    .flags = RUBY_TYPED_WB_PROTECTED | RUBY_TYPED_FREE_IMMEDIATELY
+};
 
 static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
 {
-    VALUE nv, result;
-    VALUE opts, randgen = rb_cRandom;
+    VALUE result;
     long n, len, i, j, k, idx[10];
     long rnds[numberof(idx)];
     long memo_threshold;
 
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
     len = RARRAY_LEN(ary);
-    if (argc == 0) {
-	if (len < 2)
-	    i = 0;
-	else
-	    i = RAND_UPTO(len);
+    if (!to_array) {
+        if (len < 2)
+            i = 0;
+        else
+            i = RAND_UPTO(len);
 
-	return rb_ary_elt(ary, i);
+        return rb_ary_elt(ary, i);
     }
-    rb_scan_args(argc, argv, "1", &nv);
     n = NUM2LONG(nv);
     if (n < 0) rb_raise(rb_eArgError, "negative sample number");
     if (n > len) n = len;
     if (n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    rnds[i] = RAND_UPTO(len - i);
-	}
+        for (i = 0; i < n; ++i) {
+            rnds[i] = RAND_UPTO(len - i);
+        }
     }
     k = len;
     len = RARRAY_LEN(ary);
     if (len < k && n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    if (rnds[i] >= len) return rb_ary_new_capa(0);
-	}
+        for (i = 0; i < n; ++i) {
+            if (rnds[i] >= len) return rb_ary_new_capa(0);
+        }
     }
     if (n > len) n = len;
     switch (n) {
       case 0:
-	return rb_ary_new_capa(0);
+        return rb_ary_new_capa(0);
       case 1:
-	i = rnds[0];
-	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+        i = rnds[0];
+        return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
       case 2:
-	i = rnds[0];
-	j = rnds[1];
-	if (j >= i) j++;
-	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+        i = rnds[0];
+        j = rnds[1];
+        if (j >= i) j++;
+        return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
       case 3:
-	i = rnds[0];
-	j = rnds[1];
-	k = rnds[2];
-	{
-	    long l = j, g = i;
-	    if (j >= i) l = i, g = ++j;
-	    if (k >= l && (++k >= g)) ++k;
-	}
-	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+        i = rnds[0];
+        j = rnds[1];
+        k = rnds[2];
+        {
+            long l = j, g = i;
+            if (j >= i) l = i, g = ++j;
+            if (k >= l && (++k >= g)) ++k;
+        }
+        return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
     }
     memo_threshold =
-	len < 2560 ? len / 128 :
-	len < 5120 ? len / 64 :
-	len < 10240 ? len / 32 :
-	len / 16;
+        len < 2560 ? len / 128 :
+        len < 5120 ? len / 64 :
+        len < 10240 ? len / 32 :
+        len / 16;
     if (n <= numberof(idx)) {
-	long sorted[numberof(idx)];
-	sorted[0] = idx[0] = rnds[0];
-	for (i=1; i<n; i++) {
-	    k = rnds[i];
-	    for (j = 0; j < i; ++j) {
-		if (k < sorted[j]) break;
-		++k;
-	    }
-	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
-	    sorted[j] = idx[i] = k;
-	}
-	result = rb_ary_new_capa(n);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
-	    }
-	});
+        long sorted[numberof(idx)];
+        sorted[0] = idx[0] = rnds[0];
+        for (i=1; i<n; i++) {
+            k = rnds[i];
+            for (j = 0; j < i; ++j) {
+                if (k < sorted[j]) break;
+                ++k;
+            }
+            memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+            sorted[j] = idx[i] = k;
+        }
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+            }
+        });
     }
     else if (n <= memo_threshold / 2) {
-	long max_idx = 0;
-#undef RUBY_UNTYPED_DATA_WARNING
-#define RUBY_UNTYPED_DATA_WARNING 0
-	VALUE vmemo = Data_Wrap_Struct(0, 0, 0, st_free_table);
-	st_table *memo = st_init_numtable_with_size(n);
-	DATA_PTR(vmemo) = memo;
-	result = rb_ary_new_capa(n);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		long r = RAND_UPTO(len-i) + i;
-		ptr_result[i] = r;
-		if (r > max_idx) max_idx = r;
-	    }
-	    len = RARRAY_LEN(ary);
-	    if (len <= max_idx) n = 0;
-	    else if (n > len) n = len;
-	    RARRAY_PTR_USE(ary, ptr_ary, {
-		for (i=0; i<n; i++) {
-		    long j2 = j = ptr_result[i];
-		    long i2 = i;
-		    st_data_t value;
-		    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
-		    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
-		    st_insert(memo, (st_data_t)j, (st_data_t)i2);
-		    ptr_result[i] = ptr_ary[j2];
-		}
-	    });
-	});
-	DATA_PTR(vmemo) = 0;
-	st_free_table(memo);
+        long max_idx = 0;
+        VALUE vmemo = TypedData_Wrap_Struct(0, &ary_sample_memo_type, 0);
+        st_table *memo = st_init_numtable_with_size(n);
+        RTYPEDDATA_DATA(vmemo) = memo;
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                long r = RAND_UPTO(len-i) + i;
+                ptr_result[i] = r;
+                if (r > max_idx) max_idx = r;
+            }
+            len = RARRAY_LEN(ary);
+            if (len <= max_idx) n = 0;
+            else if (n > len) n = len;
+            RARRAY_PTR_USE(ary, ptr_ary, {
+                for (i=0; i<n; i++) {
+                    long j2 = j = ptr_result[i];
+                    long i2 = i;
+                    st_data_t value;
+                    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+                    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+                    st_insert(memo, (st_data_t)j, (st_data_t)i2);
+                    ptr_result[i] = ptr_ary[j2];
+                }
+            });
+        });
+        RTYPEDDATA_DATA(vmemo) = 0;
+        st_free_table(memo);
+        RB_GC_GUARD(vmemo);
     }
     else {
-	result = rb_ary_dup(ary);
-	RBASIC_CLEAR_CLASS(result);
-	RB_GC_GUARD(ary);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		j = RAND_UPTO(len-i) + i;
-		nv = ptr_result[j];
-		ptr_result[j] = ptr_result[i];
-		ptr_result[i] = nv;
-	    }
-	});
-	RBASIC_SET_CLASS_RAW(result, rb_cArray);
+        result = rb_ary_dup(ary);
+        RBASIC_CLEAR_CLASS(result);
+        RB_GC_GUARD(ary);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                j = RAND_UPTO(len-i) + i;
+                nv = ptr_result[j];
+                ptr_result[j] = ptr_result[i];
+                ptr_result[i] = nv;
+            }
+        });
+        RBASIC_SET_CLASS_RAW(result, rb_cArray);
     }
     ARY_SET_LEN(result, n);
 
@@ -5001,15 +6996,27 @@ rb_ary_sample(int argc, VALUE *argv, VALUE ary)
 }
 
 static VALUE
+ary_sized_alloc(rb_execution_context_t *ec, VALUE self)
+{
+    return rb_ary_new2(RARRAY_LEN(self));
+}
+
+static VALUE
+ary_sample0(rb_execution_context_t *ec, VALUE ary)
+{
+    return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
+}
+
+static VALUE
 rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
 {
     long mul;
     VALUE n = Qnil;
     if (args && (RARRAY_LEN(args) > 0)) {
-	n = RARRAY_AREF(args, 0);
+        n = RARRAY_AREF(args, 0);
     }
     if (RARRAY_LEN(self) == 0) return INT2FIX(0);
-    if (n == Qnil) return DBL2NUM(INFINITY);
+    if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
     mul = NUM2LONG(n);
     if (mul <= 0) return INT2FIX(0);
     n = LONG2FIX(mul);
@@ -5018,38 +7025,50 @@ rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.cycle(n=nil) { |obj| block }  -> nil
- *     ary.cycle(n=nil)                  -> Enumerator
+ *    cycle(count = nil) {|element| ... } -> nil
+ *    cycle(count = nil) -> new_enumerator
+ *
+ *  With a block given, may call the block, depending on the value of argument +count+;
+ *  +count+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
+ *
+ *  When +count+ is positive,
+ *  calls the block with each element, then does so repeatedly,
+ *  until it has done so +count+ times; returns +nil+:
+ *
+ *    output = []
+ *    [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ *    output # => [0, 1, 0, 1]
  *
- *  Calls the given block for each element +n+ times or forever if +nil+ is
- *  given.
+ *  When +count+ is zero or negative, does not call the block:
  *
- *  Does nothing if a non-positive number is given or the array is empty.
+ *    [0, 1].cycle(0) {|element| fail 'Cannot happen' }  # => nil
+ *    [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
  *
- *  Returns +nil+ if the loop has finished without getting interrupted.
+ *  When +count+ is +nil+, cycles forever:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    # Prints 0 and 1 forever.
+ *    [0, 1].cycle {|element| puts element }
+ *    [0, 1].cycle(nil) {|element| puts element }
  *
- *     a = ["a", "b", "c"]
- *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
- *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
+ *  With no block given, returns a new Enumerator.
  *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
-
 static VALUE
 rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
 {
     long n, i;
-    VALUE nv = Qnil;
 
-    rb_scan_args(argc, argv, "01", &nv);
+    rb_check_arity(argc, 0, 1);
 
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
-    if (NIL_P(nv)) {
+    if (argc == 0 || NIL_P(argv[0])) {
         n = -1;
     }
     else {
-        n = NUM2LONG(nv);
+        n = NUM2LONG(argv[0]);
         if (n <= 0) return Qnil;
     }
 
@@ -5061,11 +7080,6 @@ rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
     return Qnil;
 }
 
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
 /*
  * Build a ruby array of the corresponding values and yield it to the
  * associated block.
@@ -5075,11 +7089,9 @@ static int
 yield_indexed_values(const VALUE values, const long r, const long *const p)
 {
     const VALUE result = rb_ary_new2(r);
-    VALUE *const result_array = RARRAY_PTR(result);
-    const VALUE *const values_array = RARRAY_CONST_PTR(values);
     long i;
 
-    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+    for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
     ARY_SET_LEN(result, r);
     rb_yield(result);
     return !RBASIC(values)->klass;
@@ -5103,52 +7115,52 @@ permute0(const long n, const long r, long *const p, char *const used, const VALU
     long i = 0, index = 0;
 
     for (;;) {
-	const char *const unused = memchr(&used[i], 0, n-i);
-	if (!unused) {
-	    if (!index) break;
-	    i = p[--index];                /* pop index */
-	    used[i++] = 0;                 /* index unused */
-	}
-	else {
-	    i = unused - used;
-	    p[index] = i;
-	    used[i] = 1;                   /* mark index used */
-	    ++index;
-	    if (index < r-1) {             /* if not done yet */
-		p[index] = i = 0;
-		continue;
-	    }
-	    for (i = 0; i < n; ++i) {
-		if (used[i]) continue;
-		p[index] = i;
-		if (!yield_indexed_values(values, r, p)) {
-		    rb_raise(rb_eRuntimeError, "permute reentered");
-		}
-	    }
-	    i = p[--index];                /* pop index */
-	    used[i] = 0;                   /* index unused */
-	    p[index] = ++i;
-	}
+        const char *const unused = memchr(&used[i], 0, n-i);
+        if (!unused) {
+            if (!index) break;
+            i = p[--index];                /* pop index */
+            used[i++] = 0;                 /* index unused */
+        }
+        else {
+            i = unused - used;
+            p[index] = i;
+            used[i] = 1;                   /* mark index used */
+            ++index;
+            if (index < r-1) {             /* if not done yet */
+                p[index] = i = 0;
+                continue;
+            }
+            for (i = 0; i < n; ++i) {
+                if (used[i]) continue;
+                p[index] = i;
+                if (!yield_indexed_values(values, r, p)) {
+                    rb_raise(rb_eRuntimeError, "permute reentered");
+                }
+            }
+            i = p[--index];                /* pop index */
+            used[i] = 0;                   /* index unused */
+            p[index] = ++i;
+        }
     }
 }
 
 /*
  * Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
  */
 static VALUE
 descending_factorial(long from, long how_many)
 {
     VALUE cnt;
     if (how_many > 0) {
-	cnt = LONG2FIX(from);
-	while (--how_many > 0) {
-	    long v = --from;
-	    cnt = rb_int_mul(cnt, LONG2FIX(v));
-	}
+        cnt = LONG2FIX(from);
+        while (--how_many > 0) {
+            long v = --from;
+            cnt = rb_int_mul(cnt, LONG2FIX(v));
+        }
     }
     else {
-	cnt = LONG2FIX(how_many == 0);
+        cnt = LONG2FIX(how_many == 0);
     }
     return cnt;
 }
@@ -5159,18 +7171,18 @@ binomial_coefficient(long comb, long size)
     VALUE r;
     long i;
     if (comb > size-comb) {
-	comb = size-comb;
+        comb = size-comb;
     }
     if (comb < 0) {
-	return LONG2FIX(0);
+        return LONG2FIX(0);
     }
     else if (comb == 0) {
-	return LONG2FIX(1);
+        return LONG2FIX(1);
     }
     r = LONG2FIX(size);
     for (i = 1; i < comb; ++i) {
-	r = rb_int_mul(r, LONG2FIX(size - i));
-	r = rb_int_idiv(r, LONG2FIX(i + 1));
+        r = rb_int_mul(r, LONG2FIX(size - i));
+        r = rb_int_idiv(r, LONG2FIX(i + 1));
     }
     return r;
 }
@@ -5186,66 +7198,80 @@ rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.permutation { |p| block }          -> ary
- *     ary.permutation                        -> Enumerator
- *     ary.permutation(n) { |p| block }       -> ary
- *     ary.permutation(n)                     -> Enumerator
+ *    permutation(count = self.size) {|permutation| ... } -> self
+ *    permutation(count = self.size) -> new_enumerator
+ *
+ *  Iterates over permutations of the elements of +self+;
+ *  the order of permutations is indeterminate.
+ *
+ *  With a block and an in-range positive integer argument +count+ (<tt>0 < count <= self.size</tt>) given,
+ *  calls the block with each permutation of +self+ of size +count+;
+ *  returns +self+:
+ *
+ *    a = [0, 1, 2]
+ *    perms = []
+ *    a.permutation(1) {|perm| perms.push(perm) }
+ *    perms # => [[0], [1], [2]]
  *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
+ *    perms = []
+ *    a.permutation(2) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1], [0, 2], [1, 0], [1, 2], [2, 0], [2, 1]]
  *
- * If +n+ is not specified, yield all permutations of all elements.
+ *    perms = []
+ *    a.permutation(3) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1, 2], [0, 2, 1], [1, 0, 2], [1, 2, 0], [2, 0, 1], [2, 1, 0]]
  *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
+ *  When +count+ is zero, calls the block once with a new empty array:
  *
- * If no block is given, an Enumerator is returned instead.
+ *    perms = []
+ *    a.permutation(0) {|perm| perms.push(perm) }
+ *    perms # => [[]]
  *
- * Examples:
+ *  When +count+ is out of range (negative or larger than <tt>self.size</tt>),
+ *  does not call the block:
  *
- *   a = [1, 2, 3]
- *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(1).to_a #=> [[1],[2],[3]]
- *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
- *   a.permutation(4).to_a #=> []   # no permutations of length 4
+ *    a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ *    a.permutation(4) {|permutation| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
 rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE num;
     long r, n, i;
 
     n = RARRAY_LEN(ary);                  /* Array length */
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
-    rb_scan_args(argc, argv, "01", &num);
-    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+    r = n;
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+        r = NUM2LONG(argv[0]);            /* Permutation size from argument */
 
     if (r < 0 || n < r) {
-	/* no permutations: yield nothing */
+        /* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
-	char *used = (char*)(p + r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+        char *used = (char*)(p + r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	MEMZERO(used, char, n); /* initialize array */
+        MEMZERO(used, char, n); /* initialize array */
 
-	permute0(n, r, p, used, ary0); /* compute and yield permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        permute0(n, r, p, used, ary0); /* compute and yield permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5258,16 +7284,16 @@ combinate0(const long len, const long n, long *const stack, const VALUE values)
     MEMZERO(stack+1, long, n);
     stack[0] = -1;
     for (;;) {
-	for (lev++; lev < n; lev++) {
-	    stack[lev+1] = stack[lev]+1;
-	}
-	if (!yield_indexed_values(values, n, stack+1)) {
-	    rb_raise(rb_eRuntimeError, "combination reentered");
-	}
-	do {
-	    if (lev == 0) return;
-	    stack[lev--]++;
-	} while (stack[lev+1]+n == len+lev+1);
+        for (lev++; lev < n; lev++) {
+            stack[lev+1] = stack[lev]+1;
+        }
+        if (!yield_indexed_values(values, n, stack+1)) {
+            rb_raise(rb_eRuntimeError, "combination reentered");
+        }
+        do {
+            if (lev == 0) return;
+            stack[lev--]++;
+        } while (stack[lev+1]+n == len+lev+1);
     }
 }
 
@@ -5282,27 +7308,46 @@ rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *     ary.combination(n) { |c| block }    -> ary
- *     ary.combination(n)                  -> Enumerator
+ *    combination(count) {|element| ... } -> self
+ *    combination(count) -> new_enumerator
  *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
+ *  When a block and a positive
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  argument +count+ (<tt>0 < count <= self.size</tt>)
+ *  are given, calls the block with each combination of +self+ of size +count+;
+ *  returns +self+:
  *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
+ *    a = %w[a b c]                                   # => ["a", "b", "c"]
+ *    a.combination(2) {|combination| p combination } # => ["a", "b", "c"]
  *
- * If no block is given, an Enumerator is returned instead.
+ *  Output:
  *
- * Examples:
+ *    ["a", "b"]
+ *    ["a", "c"]
+ *    ["b", "c"]
  *
- *     a = [1, 2, 3, 4]
- *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
- *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- *     a.combination(4).to_a  #=> [[1,2,3,4]]
- *     a.combination(0).to_a  #=> [[]] # one combination of length 0
- *     a.combination(5).to_a  #=> []   # no combinations of length 5
+ *  The order of the yielded combinations is not guaranteed.
  *
+ *  When +count+ is zero, calls the block once with a new empty array:
+ *
+ *    a.combination(0) {|combination| p combination }
+ *    [].combination(0) {|combination| p combination }
+ *
+ *  Output:
+ *
+ *    []
+ *    []
+ *
+ *  When +count+ is negative or larger than +self.size+ and +self+ is non-empty,
+ *  does not call the block:
+ *
+ *    a.combination(-1) {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *    a.combination(4)  {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: Array#permutation;
+ *  see also {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -5314,25 +7359,25 @@ rb_ary_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
     len = RARRAY_LEN(ary);
     if (n < 0 || len < n) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	volatile VALUE t0;
-	long *stack = ALLOCV_N(long, t0, n+1);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        volatile VALUE t0;
+        long *stack = ALLOCV_N(long, t0, n+1);
 
-	RBASIC_CLEAR_CLASS(ary0);
-	combinate0(len, n, stack, ary0);
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        RBASIC_CLEAR_CLASS(ary0);
+        combinate0(len, n, stack, ary0);
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5356,19 +7401,19 @@ rpermute0(const long n, const long r, long *const p, const VALUE values)
 
     p[index] = i;
     for (;;) {
-	if (++index < r-1) {
-	    p[index] = i = 0;
-	    continue;
-	}
-	for (i = 0; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated permute reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
+        if (++index < r-1) {
+            p[index] = i = 0;
+            continue;
+        }
+        for (i = 0; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated permute reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -5379,37 +7424,52 @@ rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
     long k = NUM2LONG(RARRAY_AREF(args, 0));
 
     if (k < 0) {
-	return LONG2FIX(0);
+        return LONG2FIX(0);
     }
     if (n <= 0) {
-	return LONG2FIX(!k);
+        return LONG2FIX(!k);
     }
     return rb_int_positive_pow(n, (unsigned long)k);
 }
 
 /*
  *  call-seq:
- *     ary.repeated_permutation(n) { |p| block } -> ary
- *     ary.repeated_permutation(n)               -> Enumerator
+ *    repeated_permutation(size) {|permutation| ... } -> self
+ *    repeated_permutation(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated permutation of length +size+
+ *  of the elements of +self+;
+ *  each permutation is an array;
+ *  returns +self+. The order of the permutations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated permutation of the elements of +self+.
+ *  The number of permutations is <tt>self.size**size</tt>.
+ *
+ *  Examples:
  *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
+ *  - +size+ is 1:
  *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(1) {|permutation| p.push(permutation) }
+ *      p # => [[0], [1], [2]]
  *
- * If no block is given, an Enumerator is returned instead.
+ *  - +size+ is 2:
  *
- * Examples:
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(2) {|permutation| p.push(permutation) }
+ *      p # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
  *
- *     a = [1, 2]
- *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
- *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
- *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
+ *  If +size+ is zero, calls the block once with an empty array.
+ *
+ *  If +size+ is negative, does not call the block:
+ *
+ *    [0, 1, 2].repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
-
 static VALUE
 rb_ary_repeated_permutation(VALUE ary, VALUE num)
 {
@@ -5420,25 +7480,25 @@ rb_ary_repeated_permutation(VALUE ary, VALUE num)
     r = NUM2LONG(num);                    /* Permutation size from argument */
 
     if (r < 0) {
-	/* no permutations: yield nothing */
+        /* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -5450,19 +7510,19 @@ rcombinate0(const long n, const long r, long *const p, const long rest, const VA
 
     p[index] = i;
     for (;;) {
-	if (++index < r-1) {
-	    p[index] = i;
-	    continue;
-	}
-	for (; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated combination reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
+        if (++index < r-1) {
+            p[index] = i;
+            continue;
+        }
+        for (; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated combination reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -5472,36 +7532,48 @@ rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
     if (k == 0) {
-	return LONG2FIX(1);
+        return LONG2FIX(1);
     }
     return binomial_coefficient(k, n + k - 1);
 }
 
 /*
  *  call-seq:
- *     ary.repeated_combination(n) { |c| block } -> ary
- *     ary.repeated_combination(n)               -> Enumerator
+ *    repeated_combination(size) {|combination| ... } -> self
+ *    repeated_combination(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated combination of length +size+
+ *  of the elements of +self+;
+ *  each combination is an array;
+ *  returns +self+. The order of the combinations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated combination of the elements of +self+.
+ *  The number of combinations is <tt>(size+1)(size+2)/2</tt>.
+ *
+ *  Examples:
+ *
+ *  - +size+ is 1:
  *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
+ *      c = []
+ *      [0, 1, 2].repeated_combination(1) {|combination| c.push(combination) }
+ *      c # => [[0], [1], [2]]
  *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
+ *  - +size+ is 2:
  *
- * If no block is given, an Enumerator is returned instead.
+ *      c = []
+ *      [0, 1, 2].repeated_combination(2) {|combination| c.push(combination) }
+ *      c # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
  *
- * Examples:
+ *  If +size+ is zero, calls the block once with an empty array.
  *
- *   a = [1, 2, 3]
- *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
- *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
+ *  If +size+ is negative, does not call the block:
  *
+ *    [0, 1, 2].repeated_combination(-1) {|combination| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
@@ -5513,67 +7585,98 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
     len = RARRAY_LEN(ary);
     if (n < 0) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
+        rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
     }
     else if (len == 0) {
-	/* yield nothing */
+        /* yield nothing */
     }
     else {
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, n);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, n);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
 
-	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+        rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.product(other_ary, ...)                -> new_ary
- *     ary.product(other_ary, ...) { |p| block }  -> ary
+ *    product(*other_arrays) -> new_array
+ *    product(*other_arrays) {|combination| ... } -> self
+ *
+ *  Computes all combinations of elements from all the arrays,
+ *  including both +self+ and +other_arrays+:
+ *
+ *  - The number of combinations is the product of the sizes of all the arrays,
+ *    including both +self+ and +other_arrays+.
+ *  - The order of the returned combinations is indeterminate.
+ *
+ *  With no block given, returns the combinations as an array of arrays:
+ *
+ *    p = [0, 1].product([2, 3])
+ *    # => [[0, 2], [0, 3], [1, 2], [1, 3]]
+ *    p.size # => 4
+ *    p = [0, 1].product([2, 3], [4, 5])
+ *    # => [[0, 2, 4], [0, 2, 5], [0, 3, 4], [0, 3, 5], [1, 2, 4], [1, 2, 5], [1, 3, 4], [1, 3,...
+ *    p.size # => 8
+ *
+ *  If +self+ or any argument is empty, returns an empty array:
+ *
+ *    [].product([2, 3], [4, 5]) # => []
+ *    [0, 1].product([2, 3], []) # => []
+ *
+ *  If no argument is given, returns an array of 1-element arrays,
+ *  each containing an element of +self+:
+ *
+ *    a.product # => [[0], [1], [2]]
+ *
+ *  With a block given, calls the block with each combination; returns +self+:
+ *
+ *    p = []
+ *    [0, 1].product([2, 3]) {|combination| p.push(combination) }
+ *    p # => [[0, 2], [0, 3], [1, 2], [1, 3]]
  *
- *  Returns an array of all combinations of elements from all arrays.
+ *  If +self+ or any argument is empty, does not call the block:
  *
- *  The length of the returned array is the product of the length of +self+ and
- *  the argument arrays.
+ *    [].product([2, 3], [4, 5]) {|combination| fail 'Cannot happen' }
+ *    # => []
+ *    [0, 1].product([2, 3], []) {|combination| fail 'Cannot happen' }
+ *    # => [0, 1]
  *
- *  If given a block, #product will yield all combinations and return +self+
- *  instead.
+ *  If no argument is given, calls the block with each element of +self+ as a 1-element array:
  *
- *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
- *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- *     [1,2].product()            #=> [[1],[2]]
- *     [1,2].product([])          #=> []
+ *    p = []
+ *    [0, 1].product {|combination| p.push(combination) }
+ *    p # => [[0], [1]]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
 rb_ary_product(int argc, VALUE *argv, VALUE ary)
 {
     int n = argc+1;    /* How many arrays we're operating on */
-    volatile VALUE t0 = tmpary(n);
-    volatile VALUE t1 = tmpbuf(n, sizeof(int));
+    volatile VALUE t0 = rb_ary_hidden_new(n);
+    volatile VALUE t1 = Qundef;
     VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
-    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+    int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
     VALUE result = Qnil;      /* The array we'll be returning, when no block given */
     long i,j;
     long resultlen = 1;
 
     RBASIC_CLEAR_CLASS(t0);
-    RBASIC_CLEAR_CLASS(t1);
 
     /* initialize the arrays of arrays */
     ARY_SET_LEN(t0, n);
@@ -5586,82 +7689,85 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
 
     /* Otherwise, allocate and fill in an array of results */
     if (rb_block_given_p()) {
-	/* Make defensive copies of arrays; exit if any is empty */
-	for (i = 0; i < n; i++) {
-	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
-	    arrays[i] = ary_make_shared_copy(arrays[i]);
-	}
+        /* Make defensive copies of arrays; exit if any is empty */
+        for (i = 0; i < n; i++) {
+            if (RARRAY_LEN(arrays[i]) == 0) goto done;
+            arrays[i] = ary_make_shared_copy(arrays[i]);
+        }
     }
     else {
-	/* Compute the length of the result array; return [] if any is empty */
-	for (i = 0; i < n; i++) {
-	    long k = RARRAY_LEN(arrays[i]);
-	    if (k == 0) {
-		result = rb_ary_new2(0);
-		goto done;
-	    }
+        /* Compute the length of the result array; return [] if any is empty */
+        for (i = 0; i < n; i++) {
+            long k = RARRAY_LEN(arrays[i]);
+            if (k == 0) {
+                result = rb_ary_new2(0);
+                goto done;
+            }
             if (MUL_OVERFLOW_LONG_P(resultlen, k))
-		rb_raise(rb_eRangeError, "too big to product");
-	    resultlen *= k;
-	}
-	result = rb_ary_new2(resultlen);
+                rb_raise(rb_eRangeError, "too big to product");
+            resultlen *= k;
+        }
+        result = rb_ary_new2(resultlen);
     }
     for (;;) {
-	int m;
-	/* fill in one subarray */
-	VALUE subarray = rb_ary_new2(n);
-	for (j = 0; j < n; j++) {
-	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
-	}
-
-	/* put it on the result array */
-	if (NIL_P(result)) {
-	    FL_SET(t0, FL_USER5);
-	    rb_yield(subarray);
-	    if (! FL_TEST(t0, FL_USER5)) {
-		rb_raise(rb_eRuntimeError, "product reentered");
-	    }
-	    else {
-		FL_UNSET(t0, FL_USER5);
-	    }
-	}
-	else {
-	    rb_ary_push(result, subarray);
-	}
-
-	/*
-	 * Increment the last counter.  If it overflows, reset to 0
-	 * and increment the one before it.
-	 */
-	m = n-1;
-	counters[m]++;
-	while (counters[m] == RARRAY_LEN(arrays[m])) {
-	    counters[m] = 0;
-	    /* If the first counter overflows, we are done */
-	    if (--m < 0) goto done;
-	    counters[m]++;
-	}
+        int m;
+        /* fill in one subarray */
+        VALUE subarray = rb_ary_new2(n);
+        for (j = 0; j < n; j++) {
+            rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+        }
+
+        /* put it on the result array */
+        if (NIL_P(result)) {
+            FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
+            rb_yield(subarray);
+            if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
+                rb_raise(rb_eRuntimeError, "product reentered");
+            }
+            else {
+                FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
+            }
+        }
+        else {
+            rb_ary_push(result, subarray);
+        }
+
+        /*
+         * Increment the last counter.  If it overflows, reset to 0
+         * and increment the one before it.
+         */
+        m = n-1;
+        counters[m]++;
+        while (counters[m] == RARRAY_LEN(arrays[m])) {
+            counters[m] = 0;
+            /* If the first counter overflows, we are done */
+            if (--m < 0) goto done;
+            counters[m]++;
+        }
     }
+
 done:
-    tmpary_discard(t0);
-    tmpbuf_discard(t1);
+    ALLOCV_END(t1);
 
     return NIL_P(result) ? ary : result;
 }
 
 /*
  *  call-seq:
- *     ary.take(n)               -> new_ary
+ *    take(count) -> new_array
  *
- *  Returns first +n+ elements from the array.
+ *  Returns a new array containing the first +count+ element of +self+
+ *  (as available);
+ *  +count+ must be a non-negative numeric;
+ *  does not modify +self+:
  *
- *  If a negative number is given, raises an ArgumentError.
- *
- *  See also Array#drop
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take(3)             #=> [1, 2, 3]
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.take(2)   # => ["a", "b"]
+ *    a.take(2.1) # => ["a", "b"]
+ *    a.take(50)  # => ["a", "b", "c", "d"]
+ *    a.take(0)   # => []
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5669,26 +7775,30 @@ rb_ary_take(VALUE obj, VALUE n)
 {
     long len = NUM2LONG(n);
     if (len < 0) {
-	rb_raise(rb_eArgError, "attempt to take negative size");
+        rb_raise(rb_eArgError, "attempt to take negative size");
     }
     return rb_ary_subseq(obj, 0, len);
 }
 
 /*
  *  call-seq:
- *     ary.take_while { |obj| block }  -> new_ary
- *     ary.take_while                  -> Enumerator
+ *    take_while {|element| ... } -> new_array
+ *    take_while -> new_enumerator
  *
- *  Passes elements to the block until the block returns +nil+ or +false+, then
- *  stops iterating and returns an array of all prior elements.
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops iterating if the block returns +false+ or +nil+;
+ *  returns a new array containing those elements for which the block returned a truthy value:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| element < 3 } # => [0, 1, 2]
+ *    a.take_while {|element| true }        # => [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| false }       # => []
  *
- *  See also Array#drop_while
+ *  With no block given, returns a new Enumerator.
  *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take_while { |i| i < 3 }  #=> [1, 2]
+ *  Does not modify +self+.
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5698,25 +7808,28 @@ rb_ary_take_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_take(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *     ary.drop(n)               -> new_ary
- *
- *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
- *  an array.
+ *    drop(count) -> new_array
  *
- *  If a negative number is given, raises an ArgumentError.
+ *  Returns a new array containing all but the first +count+ element of +self+,
+ *  where +count+ is a non-negative integer;
+ *  does not modify +self+.
  *
- *  See also Array#take
+ *  Examples:
  *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop(3)             #=> [4, 5, 0]
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ *    a.drop(1) # => [1, 2, 3, 4, 5]
+ *    a.drop(2) # => [2, 3, 4, 5]
+ *    a.drop(9) # => []
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5725,30 +7838,30 @@ rb_ary_drop(VALUE ary, VALUE n)
     VALUE result;
     long pos = NUM2LONG(n);
     if (pos < 0) {
-	rb_raise(rb_eArgError, "attempt to drop negative size");
+        rb_raise(rb_eArgError, "attempt to drop negative size");
     }
 
     result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
-    if (result == Qnil) result = rb_ary_new();
+    if (NIL_P(result)) result = rb_ary_new();
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.drop_while { |obj| block }   -> new_ary
- *     ary.drop_while                  -> Enumerator
+ *    drop_while {|element| ... } -> new_array
+ *    drop_while -> new_enumerator
  *
- *  Drops elements up to, but not including, the first element for which the
- *  block returns +nil+ or +false+ and returns an array containing the
- *  remaining elements.
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops if the block returns +false+ or +nil+;
+ *  returns a new array _omitting_ those elements for which the block returned a truthy value;
+ *  does not modify +self+:
  *
- *  If no block is given, an Enumerator is returned instead.
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop_while {|element| element < 3 } # => [3, 4, 5]
  *
- *  See also Array#take_while
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
+ *  With no block given, returns a new Enumerator.
  *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -5758,53 +7871,301 @@ rb_ary_drop_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_drop(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *     ary.any? [{ |obj| block }]   -> true or false
+ *    any? -> true or false
+ *    any?(object) -> true or false
+ *    any? {|element| ... } -> true or false
+ *
+ *  Returns whether for any element of +self+, a given criterion is satisfied.
+ *
+ *  With no block and no argument, returns whether any element of +self+ is truthy:
+ *
+ *    [nil, false, []].any? # => true  # Array object is truthy.
+ *    [nil, false, {}].any? # => true  # Hash object is truthy.
+ *    [nil, false, ''].any? # => true  # String object is truthy.
+ *    [nil, false].any?     # => false # Nil and false are not truthy.
+ *
+ *  With argument +object+ given,
+ *  returns whether <tt>object === ele</tt> for any element +ele+ in +self+:
+ *
+ *    [nil, false, 0].any?(0)          # => true
+ *    [nil, false, 1].any?(0)          # => false
+ *    [nil, false, 'food'].any?(/foo/) # => true
+ *    [nil, false, 'food'].any?(/bar/) # => false
+ *
+ *  With a block given,
+ *  calls the block with each element in +self+;
+ *  returns whether the block returns any truthy value:
  *
- *  See also Enumerable#any?
+ *    [0, 1, 2].any? {|ele| ele < 1 } # => true
+ *    [0, 1, 2].any? {|ele| ele < 0 } # => false
+ *
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +false+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
-rb_ary_any_p(VALUE ary)
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
 {
     long i, len = RARRAY_LEN(ary);
-    const VALUE *ptr = RARRAY_CONST_PTR(ary);
 
+    rb_check_arity(argc, 0, 1);
     if (!len) return Qfalse;
-    if (!rb_block_given_p()) {
-	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+        }
     }
     else {
-	for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
-	}
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+        }
     }
     return Qfalse;
 }
 
 /*
- * call-seq:
- *   ary.dig(idx, ...)                 -> object
+ *  call-seq:
+ *    all? -> true or false
+ *    all?(object) -> true or false
+ *    all? {|element| ... } -> true or false
+ *
+ *  Returns whether for every element of +self+,
+ *  a given criterion is satisfied.
+ *
+ *  With no block and no argument,
+ *  returns whether every element of +self+ is truthy:
  *
- * Extracts the nested value specified by the sequence of <i>idx</i>
- * objects by calling +dig+ at each step, returning +nil+ if any
- * intermediate step is +nil+.
+ *    [[], {}, '', 0, 0.0, Object.new].all? # => true  # All truthy objects.
+ *    [[], {}, '', 0, 0.0, nil].all?        # => false # nil is not truthy.
+ *    [[], {}, '', 0, 0.0, false].all?      # => false # false is not truthy.
  *
- *   a = [[1, [2, 3]]]
+ *  With argument +object+ given, returns whether <tt>object === ele</tt>
+ *  for every element +ele+ in +self+:
  *
- *   a.dig(0, 1, 1)                    #=> 3
- *   a.dig(1, 2, 3)                    #=> nil
- *   a.dig(0, 0, 0)                    #=> TypeError: Integer does not have #dig method
- *   [42, {foo: :bar}].dig(1, :foo)    #=> :bar
+ *    [0, 0, 0].all?(0)                    # => true
+ *    [0, 1, 2].all?(1)                    # => false
+ *    ['food', 'fool', 'foot'].all?(/foo/) # => true
+ *    ['food', 'drink'].all?(/foo/)        # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns whether the block returns only truthy values:
+ *
+ *    [0, 1, 2].all? { |ele| ele < 3 } # => true
+ *    [0, 1, 2].all? { |ele| ele < 2 } # => false
+ *
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +true+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
-VALUE
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    none? -> true or false
+ *    none?(object) -> true or false
+ *    none? {|element| ... } -> true or false
+ *
+ *  Returns +true+ if no element of +self+ meets a given criterion, +false+ otherwise.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ *  +false+ otherwise:
+ *
+ *    [nil, false].none?    # => true
+ *    [nil, 0, false].none? # => false
+ *    [].none?              # => true
+ *
+ *  With argument +object+ given, returns +false+ if for any element +element+,
+ *  <tt>object === element</tt>; +true+ otherwise:
+ *
+ *    ['food', 'drink'].none?(/bar/) # => true
+ *    ['food', 'drink'].none?(/foo/) # => false
+ *    [].none?(/foo/)                # => true
+ *    [0, 1, 2].none?(3)             # => true
+ *    [0, 1, 2].none?(1)             # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block returns no truthy value, +false+ otherwise:
+ *
+ *    [0, 1, 2].none? {|element| element > 3 } # => true
+ *    [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    one? -> true or false
+ *    one? {|element| ... } -> true or false
+ *    one?(object) -> true or false
+ *
+ *  Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ *  +false+ otherwise:
+ *
+ *    [nil, 0].one? # => true
+ *    [0, 0].one? # => false
+ *    [nil, nil].one? # => false
+ *    [].one? # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ *
+ *    [0, 1, 2].one? {|element| element > 0 } # => false
+ *    [0, 1, 2].one? {|element| element > 1 } # => true
+ *    [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ *  With argument +object+ given, returns +true+ if for exactly one element +element+, <tt>object === element</tt>;
+ *  +false+ otherwise:
+ *
+ *    [0, 1, 2].one?(0) # => true
+ *    [0, 0, 1].one?(0) # => false
+ *    [1, 1, 2].one?(0) # => false
+ *    ['food', 'drink'].one?(/bar/) # => false
+ *    ['food', 'drink'].one?(/foo/) # => true
+ *    [].one?(/foo/) # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+    VALUE result = Qfalse;
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qfalse;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    dig(index, *identifiers) -> object
+ *
+ *  Finds and returns the object in nested object
+ *  specified by +index+ and +identifiers+;
+ *  the nested objects may be instances of various classes.
+ *  See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ *
+ *  Examples:
+ *
+ *    a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ *    a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ *    a.dig(1, 2) # => [:bat, :bam]
+ *    a.dig(1, 2, 0) # => :bat
+ *    a.dig(1, 2, 3) # => nil
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
 rb_ary_dig(int argc, VALUE *argv, VALUE self)
 {
     rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
@@ -5819,14 +8180,8 @@ finish_exact_sum(long n, VALUE r, VALUE v, int z)
 {
     if (n != 0)
         v = rb_fix_plus(LONG2FIX(n), v);
-    if (r != Qundef) {
-	/* r can be an Integer when mathn is loaded */
-	if (FIXNUM_P(r))
-	    v = rb_fix_plus(r, v);
-	else if (RB_TYPE_P(r, T_BIGNUM))
-	    v = rb_big_plus(r, v);
-	else
-	    v = rb_rational_plus(r, v);
+    if (!UNDEF_P(r)) {
+        v = rb_rational_plus(r, v);
     }
     else if (!n && z) {
         v = rb_fix_plus(LONG2FIX(0), v);
@@ -5836,43 +8191,42 @@ finish_exact_sum(long n, VALUE r, VALUE v, int z)
 
 /*
  * call-seq:
- *   ary.sum(init=0)                    -> number
- *   ary.sum(init=0) {|e| expr }        -> number
- *
- * Returns the sum of elements.
- * For example, [e1, e2, e3].sum returns init + e1 + e2 + e3.
+ *   sum(init = 0) -> object
+ *   sum(init = 0) {|element| ... } -> object
  *
- * If a block is given, the block is applied to each element
- * before addition.
+ *  With no block given, returns the sum of +init+ and all elements of +self+;
+ *  for array +array+ and value +init+, equivalent to:
  *
- * If <i>ary</i> is empty, it returns <i>init</i>.
+ *    sum = init
+ *    array.each {|element| sum += element }
+ *    sum
  *
- *   [].sum                             #=> 0
- *   [].sum(0.0)                        #=> 0.0
- *   [1, 2, 3].sum                      #=> 6
- *   [3, 5.5].sum                       #=> 8.5
- *   [2.5, 3.0].sum(0.0) {|e| e * e }   #=> 15.25
- *   [Object.new].sum                   #=> TypeError
+ *  For example, <tt>[e0, e1, e2].sum</tt> returns <tt>init + e0 + e1 + e2</tt>.
  *
- * The (arithmetic) mean value of an array can be obtained as follows.
+ *  Examples:
  *
- *   mean = ary.sum(0.0) / ary.length
+ *    [0, 1, 2, 3].sum                 # => 6
+ *    [0, 1, 2, 3].sum(100)            # => 106
+ *    ['abc', 'def', 'ghi'].sum('jkl') # => "jklabcdefghi"
+ *    [[:foo, :bar], ['foo', 'bar']].sum([2, 3])
+ *    # => [2, 3, :foo, :bar, "foo", "bar"]
  *
- * This method can be used for non-numeric objects by
- * explicit <i>init</i> argument.
+ *  The +init+ value and elements need not be numeric, but must all be <tt>+</tt>-compatible:
  *
- *   ["a", "b", "c"].sum("")            #=> "abc"
- *   [[1], [[2]], [3]].sum([])          #=> [1, [2], 3]
+ *    # Raises TypeError: Array can't be coerced into Integer.
+ *    [[:foo, :bar], ['foo', 'bar']].sum(2)
  *
- * However, Array#join and Array#flatten is faster than Array#sum for
- * array of strings and array of arrays.
+ *  With a block given, calls the block with each element of +self+;
+ *  the block's return value (instead of the element itself) is used as the addend:
  *
- *   ["a", "b", "c"].join               #=> "abc"
- *   [[1], [[2]], [3]].flatten(1)       #=> [1, [2], 3]
+ *    ['zero', 1, :two].sum('Coerced and concatenated: ') {|element| element.to_s }
+ *    # => "Coerced and concatenated: zero1two"
  *
+ *  Notes:
  *
- * Array#sum method may not respect method redefinition of "+" methods
- * such as Integer#+.
+ *  - Array#join and Array#flatten may be faster than Array#sum
+ *    for an array of strings or an array of arrays.
+ *  - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
  *
  */
 
@@ -5883,8 +8237,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     long i, n;
     int block_given;
 
-    if (rb_scan_args(argc, argv, "01", &v) == 0)
-        v = LONG2FIX(0);
+    v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
 
     block_given = rb_block_given_p();
 
@@ -5893,6 +8246,12 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
 
     n = 0;
     r = Qundef;
+
+    if (!FIXNUM_P(v) && !RB_BIGNUM_TYPE_P(v) && !RB_TYPE_P(v, T_RATIONAL)) {
+        i = 0;
+        goto init_is_a_value;
+    }
+
     for (i = 0; i < RARRAY_LEN(ary); i++) {
         e = RARRAY_AREF(ary, i);
         if (block_given)
@@ -5904,10 +8263,10 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
                 n = 0;
             }
         }
-        else if (RB_TYPE_P(e, T_BIGNUM))
+        else if (RB_BIGNUM_TYPE_P(e))
             v = rb_big_plus(e, v);
         else if (RB_TYPE_P(e, T_RATIONAL)) {
-            if (r == Qundef)
+            if (UNDEF_P(r))
                 r = e;
             else
                 r = rb_rational_plus(r, e);
@@ -5924,15 +8283,15 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     if (RB_FLOAT_TYPE_P(e)) {
         /*
          * Kahan-Babuska balancing compensated summation algorithm
-         * See http://link.springer.com/article/10.1007/s00607-005-0139-x
+         * See https://link.springer.com/article/10.1007/s00607-005-0139-x
          */
         double f, c;
+        double x, t;
 
         f = NUM2DBL(v);
         c = 0.0;
         goto has_float_value;
         for (; i < RARRAY_LEN(ary); i++) {
-            double x, t;
             e = RARRAY_AREF(ary, i);
             if (block_given)
                 e = rb_yield(e);
@@ -5941,13 +8300,27 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
                 x = RFLOAT_VALUE(e);
             else if (FIXNUM_P(e))
                 x = FIX2LONG(e);
-            else if (RB_TYPE_P(e, T_BIGNUM))
+            else if (RB_BIGNUM_TYPE_P(e))
                 x = rb_big2dbl(e);
             else if (RB_TYPE_P(e, T_RATIONAL))
                 x = rb_num2dbl(e);
             else
                 goto not_float;
 
+            if (isnan(f)) continue;
+            if (isnan(x)) {
+                f = x;
+                continue;
+            }
+            if (isinf(x)) {
+                if (isinf(f) && signbit(x) != signbit(f))
+                    f = NAN;
+                else
+                    f = x;
+                continue;
+            }
+            if (isinf(f)) continue;
+
             t = f + x;
             if (fabs(f) >= fabs(x))
                 c += ((f - t) + x);
@@ -5963,6 +8336,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     }
 
     goto has_some_value;
+    init_is_a_value:
     for (; i < RARRAY_LEN(ary); i++) {
         e = RARRAY_AREF(ary, i);
         if (block_given)
@@ -5973,56 +8347,162 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
     return v;
 }
 
+/* :nodoc: */
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+    return ary;
+}
+
 /*
- *  Arrays are ordered, integer-indexed collections of any object.
+ *  An \Array object is an ordered, integer-indexed collection of objects,
+ *  called _elements_;
+ *  the object represents
+ *  an {array data structure}[https://en.wikipedia.org/wiki/Array_(data_structure)].
+ *
+ *  An element may be any object (even another array);
+ *  elements may be any mixture of objects of different types.
+ *
+ *  Important data structures that use arrays include:
  *
- *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
- *  to be relative to the end of the array---that is, an index of -1 indicates
- *  the last element of the array, -2 is the next to last element in the
- *  array, and so on.
+ *  - {Coordinate vector}[https://en.wikipedia.org/wiki/Coordinate_vector].
+ *  - {Matrix}[https://en.wikipedia.org/wiki/Matrix_(mathematics)].
+ *  - {Heap}[https://en.wikipedia.org/wiki/Heap_(data_structure)].
+ *  - {Hash table}[https://en.wikipedia.org/wiki/Hash_table].
+ *  - {Deque (double-ended queue)}[https://en.wikipedia.org/wiki/Double-ended_queue].
+ *  - {Queue}[https://en.wikipedia.org/wiki/Queue_(abstract_data_type)].
+ *  - {Stack}[https://en.wikipedia.org/wiki/Stack_(abstract_data_type)].
+ *
+ *  There are also array-like data structures:
+ *
+ *  - {Associative array}[https://en.wikipedia.org/wiki/Associative_array] (see Hash).
+ *  - {Directory}[https://en.wikipedia.org/wiki/Directory_(computing)] (see Dir).
+ *  - {Environment}[https://en.wikipedia.org/wiki/Environment_variable] (see ENV).
+ *  - {Set}[https://en.wikipedia.org/wiki/Set_(abstract_data_type)] (see Set).
+ *  - {String}[https://en.wikipedia.org/wiki/String_(computer_science)] (see String).
+ *
+ *  == \Array Indexes
+ *
+ *  \Array indexing starts at 0, as in C or Java.
+ *
+ *  A non-negative index is an offset from the first element:
+ *
+ *  - Index 0 indicates the first element.
+ *  - Index 1 indicates the second element.
+ *  - ...
+ *
+ *  A negative index is an offset, backwards, from the end of the array:
+ *
+ *  - Index -1 indicates the last element.
+ *  - Index -2 indicates the next-to-last element.
+ *  - ...
+ *
+ *
+ *  === In-Range and Out-of-Range Indexes
+ *
+ *  A non-negative index is <i>in range</i> if and only if it is smaller than
+ *  the size of the array.  For a 3-element array:
+ *
+ *  - Indexes 0 through 2 are in range.
+ *  - Index 3 is out of range.
+ *
+ *  A negative index is <i>in range</i> if and only if its absolute value is
+ *  not larger than the size of the array.  For a 3-element array:
+ *
+ *  - Indexes -1 through -3 are in range.
+ *  - Index -4 is out of range.
+ *
+ *  === Effective Index
+ *
+ *  Although the effective index into an array is always an integer,
+ *  some methods (both within class \Array and elsewhere)
+ *  accept one or more non-integer arguments that are
+ *  {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
  *
  *  == Creating Arrays
  *
- *  A new array can be created by using the literal constructor
- *  <code>[]</code>.  Arrays can contain different types of objects.  For
- *  example, the array below contains an Integer, a String and a Float:
+ *  You can create an \Array object explicitly with:
+ *
+ *  - An {array literal}[rdoc-ref:syntax/literals.rdoc@Array+Literals]:
+ *
+ *      [1, 'one', :one, [2, 'two', :two]]
+ *
+ *  - A {%w or %W string-array Literal}[rdoc-ref:syntax/literals.rdoc@w-and-w-String-Array-Literals]:
+ *
+ *      %w[foo bar baz] # => ["foo", "bar", "baz"]
+ *      %w[1 % *]       # => ["1", "%", "*"]
  *
- *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ *  - A {%i or %I symbol-array Literal}[rdoc-ref:syntax/literals.rdoc@i+and-I-Symbol-Array+Literals]:
  *
- *  An array can also be created by explicitly calling Array.new with zero, one
- *  (the initial size of the Array) or two arguments (the initial size and a
- *  default object).
+ *      %i[foo bar baz] # => [:foo, :bar, :baz]
+ *      %i[1 % *]       # => [:"1", :%, :*]
  *
- *     ary = Array.new    #=> []
- *     Array.new(3)       #=> [nil, nil, nil]
- *     Array.new(3, true) #=> [true, true, true]
+ *  - Method Kernel#Array:
  *
- *  Note that the second argument populates the array with references to the
- *  same object.  Therefore, it is only recommended in cases when you need to
- *  instantiate arrays with natively immutable objects such as Symbols,
- *  numbers, true or false.
+ *      Array(["a", "b"])             # => ["a", "b"]
+ *      Array(1..5)                   # => [1, 2, 3, 4, 5]
+ *      Array(key: :value)            # => [[:key, :value]]
+ *      Array(nil)                    # => []
+ *      Array(1)                      # => [1]
+ *      Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
  *
- *  To create an array with separate objects a block can be passed instead.
- *  This method is safe to use with mutable objects such as hashes, strings or
- *  other arrays:
+ *  - Method Array.new:
  *
- *     Array.new(4) { Hash.new }  #=> [{}, {}, {}, {}]
- *     Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
+ *      Array.new               # => []
+ *      Array.new(3)            # => [nil, nil, nil]
+ *      Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
+ *      Array.new(3, true)      # => [true, true, true]
  *
- *  This is also a quick way to build up multi-dimensional arrays:
+ *    Note that the last example above populates the array
+ *    with references to the same object.
+ *    This is recommended only in cases where that object is a natively immutable object
+ *    such as a symbol, a numeric, +nil+, +true+, or +false+.
  *
- *     empty_table = Array.new(3) { Array.new(3) }
- *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *    Another way to create an array with various objects, using a block;
+ *    this usage is safe for mutable objects such as hashes, strings or
+ *    other arrays:
  *
- *  An array can also be created by using the Array() method, provided by
- *  Kernel, which tries to call #to_ary, then #to_a on its argument.
+ *      Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
  *
- *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ *    Here is a way to create a multi-dimensional array:
+ *
+ *      Array.new(3) {Array.new(3)}
+ *      # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ *  A number of Ruby methods, both in the core and in the standard library,
+ *  provide instance method +to_a+, which converts an object to an array.
+ *
+ *  - ARGF#to_a
+ *  - Array#to_a
+ *  - Enumerable#to_a
+ *  - Hash#to_a
+ *  - MatchData#to_a
+ *  - NilClass#to_a
+ *  - OptionParser#to_a
+ *  - Range#to_a
+ *  - Set#to_a
+ *  - Struct#to_a
+ *  - Time#to_a
+ *  - Benchmark::Tms#to_a
+ *  - CSV::Table#to_a
+ *  - Enumerator::Lazy#to_a
+ *  - Gem::List#to_a
+ *  - Gem::NameTuple#to_a
+ *  - Gem::Platform#to_a
+ *  - Gem::RequestSet::Lockfile::Tokenizer#to_a
+ *  - Gem::SourceList#to_a
+ *  - OpenSSL::X509::Extension#to_a
+ *  - OpenSSL::X509::Name#to_a
+ *  - Racc::ISet#to_a
+ *  - Rinda::RingFinger#to_a
+ *  - Ripper::Lexer::Elem#to_a
+ *  - RubyVM::InstructionSequence#to_a
+ *  - YAML::DBM#to_a
  *
  *  == Example Usage
  *
- *  In addition to the methods it mixes in through the Enumerable module, the
- *  Array class has proprietary methods for accessing, searching and otherwise
+ *  In addition to the methods it mixes in through the Enumerable module,
+ *  class \Array has proprietary methods for accessing, searching and otherwise
  *  manipulating arrays.
  *
  *  Some of the more common ones are illustrated below.
@@ -6070,9 +8550,9 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
  *
  *     arr.drop(3) #=> [4, 5, 6]
  *
- *  == Obtaining Information about an Array
+ *  == Obtaining Information about an \Array
  *
- *  Arrays keep track of their own length at all times.  To query an array
+ *  An array keeps track of its own length at all times.  To query an array
  *  about the number of elements it contains, use #length, #count or #size.
  *
  *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
@@ -6087,7 +8567,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
  *
  *    browsers.include?('Konqueror') #=> false
  *
- *  == Adding Items to Arrays
+ *  == Adding Items to an \Array
  *
  *  Items can be added to the end of an array by using either #push or #<<
  *
@@ -6108,7 +8588,7 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
  *     arr.insert(3, 'orange', 'pear', 'grapefruit')
  *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
  *
- *  == Removing Items from an Array
+ *  == Removing Items from an \Array
  *
  *  The method #pop removes the last element in an array and returns it:
  *
@@ -6148,17 +8628,17 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
  *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
  *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
  *
- *  == Iterating over Arrays
+ *  == Iterating over an \Array
  *
- *  Like all classes that include the Enumerable module, Array has an each
+ *  Like all classes that include the Enumerable module, class \Array has an each
  *  method, which defines what elements should be iterated over and how.  In
- *  case of Array's #each, all elements in the Array instance are yielded to
+ *  case of Array#each, all elements in +self+ are yielded to
  *  the supplied block in sequence.
  *
  *  Note that this operation leaves the array unchanged.
  *
  *     arr = [1, 2, 3, 4, 5]
- *     arr.each { |a| print a -= 10, " " }
+ *     arr.each {|a| print a -= 10, " "}
  *     # prints: -9 -8 -7 -6 -5
  *     #=> [1, 2, 3, 4, 5]
  *
@@ -6167,18 +8647,19 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
  *
  *     words = %w[first second third fourth fifth sixth]
  *     str = ""
- *     words.reverse_each { |word| str += "#{word} " }
+ *     words.reverse_each {|word| str += "#{word} "}
  *     p str #=> "sixth fifth fourth third second first "
  *
  *  The #map method can be used to create a new array based on the original
  *  array, but with the values modified by the supplied block:
  *
- *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
+ *     arr.map {|a| 2*a}     #=> [2, 4, 6, 8, 10]
  *     arr                   #=> [1, 2, 3, 4, 5]
- *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ *     arr.map! {|a| a**2}   #=> [1, 4, 9, 16, 25]
  *     arr                   #=> [1, 4, 9, 16, 25]
  *
- *  == Selecting Items from an Array
+ *
+ *  == Selecting Items from an \Array
  *
  *  Elements can be selected from an array according to criteria defined in a
  *  block.  The selection can happen in a destructive or a non-destructive
@@ -6189,9 +8670,9 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
  *  === Non-destructive Selection
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
- *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
- *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ *     arr.select {|a| a > 3}       #=> [4, 5, 6]
+ *     arr.reject {|a| a < 3}       #=> [3, 4, 5, 6]
+ *     arr.drop_while {|a| a < 4}   #=> [4, 5, 6]
  *     arr                          #=> [1, 2, 3, 4, 5, 6]
  *
  *  === Destructive Selection
@@ -6202,25 +8683,190 @@ rb_ary_sum(int argc, VALUE *argv, VALUE ary)
  *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
  *  opposite result when supplied with the same block:
  *
- *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ *     arr.delete_if {|a| a < 4}   #=> [4, 5, 6]
  *     arr                         #=> [4, 5, 6]
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ *     arr.keep_if {|a| a < 4}   #=> [1, 2, 3]
  *     arr                       #=> [1, 2, 3]
  *
+ *  == What's Here
+ *
+ *  First, what's elsewhere. Class \Array:
+ *
+ *  - Inherits from {class Object}[rdoc-ref:Object@Whats-Here].
+ *  - Includes {module Enumerable}[rdoc-ref:Enumerable@Whats-Here],
+ *    which provides dozens of additional methods.
+ *
+ *  Here, class \Array provides methods that are useful for:
+ *
+ *  - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
+ *  - {Querying}[rdoc-ref:Array@Methods+for+Querying]
+ *  - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
+ *  - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
+ *  - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
+ *  - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
+ *  - {Combining}[rdoc-ref:Array@Methods+for+Combining]
+ *  - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
+ *  - {Converting}[rdoc-ref:Array@Methods+for+Converting]
+ *  - {And more....}[rdoc-ref:Array@Other+Methods]
+ *
+ *  === Methods for Creating an \Array
+ *
+ *  - ::[]: Returns a new array populated with given objects.
+ *  - ::new: Returns a new array.
+ *  - ::try_convert: Returns a new array created from a given object.
+ *
+ *  See also {Creating Arrays}[rdoc-ref:Array@Creating+Arrays].
+ *
+ *  === Methods for Querying
+ *
+ *  - #all?: Returns whether all elements meet a given criterion.
+ *  - #any?: Returns whether any element meets a given criterion.
+ *  - #count: Returns the count of elements that meet a given criterion.
+ *  - #empty?: Returns whether there are no elements.
+ *  - #find_index (aliased as #index): Returns the index of the first element that meets a given criterion.
+ *  - #hash: Returns the integer hash code.
+ *  - #include?: Returns whether any element <tt>==</tt> a given object.
+ *  - #length (aliased as #size): Returns the count of elements.
+ *  - #none?: Returns whether no element <tt>==</tt> a given object.
+ *  - #one?: Returns whether exactly one element <tt>==</tt> a given object.
+ *  - #rindex: Returns the index of the last element that meets a given criterion.
+ *
+ *  === Methods for Comparing
+ *
+ *  - #<=>: Returns -1, 0, or 1, as +self+ is less than, equal to, or greater than a given object.
+ *  - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element in a given object.
+ *  - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding element in a given object.
+
+ *  === Methods for Fetching
+ *
+ *  These methods do not modify +self+.
+ *
+ *  - #[] (aliased as #slice): Returns consecutive elements as determined by a given argument.
+ *  - #assoc: Returns the first element that is an array whose first element <tt>==</tt> a given object.
+ *  - #at: Returns the element at a given offset.
+ *  - #bsearch: Returns an element selected via a binary search as determined by a given block.
+ *  - #bsearch_index: Returns the index of an element selected via a binary search as determined by a given block.
+ *  - #compact: Returns an array containing all non-+nil+ elements.
+ *  - #dig: Returns the object in nested objects that is specified by a given index and additional arguments.
+ *  - #drop: Returns trailing elements as determined by a given index.
+ *  - #drop_while: Returns trailing elements as determined by a given block.
+ *  - #fetch: Returns the element at a given offset.
+ *  - #fetch_values: Returns elements at given offsets.
+ *  - #first: Returns one or more leading elements.
+ *  - #last: Returns one or more trailing elements.
+ *  - #max: Returns one or more maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #min: Returns one or more minimum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #minmax: Returns the minimum-valued and maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #rassoc: Returns the first element that is an array whose second element <tt>==</tt> a given object.
+ *  - #reject: Returns an array containing elements not rejected by a given block.
+ *  - #reverse: Returns all elements in reverse order.
+ *  - #rotate: Returns all elements with some rotated from one end to the other.
+ *  - #sample: Returns one or more random elements.
+ *  - #select (aliased as #filter): Returns an array containing elements selected by a given block.
+ *  - #shuffle: Returns elements in a random order.
+ *  - #sort: Returns all elements in an order determined by <tt>#<=></tt> or a given block.
+ *  - #take: Returns leading elements as determined by a given index.
+ *  - #take_while: Returns leading elements as determined by a given block.
+ *  - #uniq: Returns an array containing non-duplicate elements.
+ *  - #values_at: Returns the elements at given offsets.
+ *
+ *  === Methods for Assigning
+ *
+ *  These methods add, replace, or reorder elements in +self+.
+ *
+ *  - #<<: Appends an element.
+ *  - #[]=: Assigns specified elements with a given object.
+ *  - #concat: Appends all elements from given arrays.
+ *  - #fill: Replaces specified elements with specified objects.
+ *  - #flatten!: Replaces each nested array in +self+ with the elements from that array.
+ *  - #initialize_copy (aliased as #replace): Replaces the content of +self+ with the content of a given array.
+ *  - #insert: Inserts given objects at a given offset; does not replace elements.
+ *  - #push (aliased as #append): Appends elements.
+ *  - #reverse!: Replaces +self+ with its elements reversed.
+ *  - #rotate!: Replaces +self+ with its elements rotated.
+ *  - #shuffle!: Replaces +self+ with its elements in random order.
+ *  - #sort!: Replaces +self+ with its elements sorted, as determined by <tt>#<=></tt> or a given block.
+ *  - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
+ *  - #unshift (aliased as #prepend): Prepends leading elements.
+ *
+ *  === Methods for Deleting
+ *
+ *  Each of these methods removes elements from +self+:
+ *
+ *  - #clear: Removes all elements.
+ *  - #compact!: Removes all +nil+ elements.
+ *  - #delete: Removes elements equal to a given object.
+ *  - #delete_at: Removes the element at a given offset.
+ *  - #delete_if: Removes elements specified by a given block.
+ *  - #keep_if: Removes elements not specified by a given block.
+ *  - #pop: Removes and returns the last element.
+ *  - #reject!: Removes elements specified by a given block.
+ *  - #select! (aliased as #filter!): Removes elements not specified by a given block.
+ *  - #shift:  Removes and returns the first element.
+ *  - #slice!: Removes and returns a sequence of elements.
+ *  - #uniq!: Removes duplicates.
+ *
+ *  === Methods for Combining
+ *
+ *  - #&: Returns an array containing elements found both in +self+ and a given array.
+ *  - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
+ *  - #-: Returns an array containing all elements of +self+ that are not found in a given array.
+ *  - #|: Returns an array containing all element of +self+ and all elements of a given array, duplicates removed.
+ *  - #difference: Returns an array containing all elements of +self+ that are not found in any of the given arrays..
+ *  - #intersection: Returns an array containing elements found both in +self+ and in each given array.
+ *  - #product: Returns or yields all combinations of elements from +self+ and given arrays.
+ *  - #reverse: Returns an array containing all elements of +self+ in reverse order.
+ *  - #union: Returns an array containing all elements of +self+ and all elements of given arrays, duplicates removed.
+ *
+ *  === Methods for Iterating
+ *
+ *  - #combination: Calls a given block with combinations of elements of +self+; a combination does not use the same element more than once.
+ *  - #cycle: Calls a given block with each element, then does so again, for a specified number of times, or forever.
+ *  - #each: Passes each element to a given block.
+ *  - #each_index: Passes each element index to a given block.
+ *  - #permutation: Calls a given block with permutations of elements of +self+; a permutation does not use the same element more than once.
+ *  - #repeated_combination: Calls a given block with combinations of elements of +self+; a combination may use the same element more than once.
+ *  - #repeated_permutation: Calls a given block with permutations of elements of +self+; a permutation may use the same element more than once.
+ *  - #reverse_each:  Passes each element, in reverse order, to a given block.
+ *
+ *  === Methods for Converting
+ *
+ *  - #collect (aliased as #map): Returns an array containing the block return-value for each element.
+ *  - #collect! (aliased as #map!): Replaces each element with a block return-value.
+ *  - #flatten: Returns an array that is a recursive flattening of +self+.
+ *  - #inspect (aliased as #to_s): Returns a new String containing the elements.
+ *  - #join: Returns a new String containing the elements joined by the field separator.
+ *  - #to_a: Returns +self+ or a new array containing all elements.
+ *  - #to_ary: Returns +self+.
+ *  - #to_h: Returns a new hash formed from the elements.
+ *  - #transpose: Transposes +self+, which must be an array of arrays.
+ *  - #zip: Returns a new array of arrays containing +self+ and given arrays.
+ *
+ *  === Other Methods
+ *
+ *  - #*: Returns one of the following:
+ *
+ *    - With integer argument +n+, a new array that is the concatenation
+ *      of +n+ copies of +self+.
+ *    - With string argument +field_separator+, a new string that is equivalent to
+ *      <tt>join(field_separator)</tt>.
+ *
+ *  - #pack: Packs the elements into a binary sequence.
+ *  - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
  */
 
 void
 Init_Array(void)
 {
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
+    fake_ary_flags = init_fake_ary_flags();
 
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
     rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
     rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
@@ -6231,7 +8877,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
     rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
-    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
     rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
     rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -6241,9 +8886,11 @@ Init_Array(void)
     rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
     rb_define_method(rb_cArray, "at", rb_ary_at, 1);
     rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
-    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
-    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
     rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+    rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+    rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+    rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+    rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
     rb_define_alias(rb_cArray,  "append", "push");
@@ -6256,8 +8903,11 @@ Init_Array(void)
     rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
     rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
-    rb_define_alias(rb_cArray,  "size", "length");
+    rb_define_method(rb_cArray, "size", rb_ary_length, 0);
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
+    rb_define_method(rb_cArray, "find", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "detect", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "rfind", rb_ary_rfind, -1);
     rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
@@ -6275,6 +8925,8 @@ Init_Array(void)
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
     rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
     rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -6305,6 +8957,7 @@ Init_Array(void)
 
     rb_define_method(rb_cArray, "max", rb_ary_max, -1);
     rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+    rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
 
     rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
@@ -6313,9 +8966,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
     rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
     rb_define_method(rb_cArray, "count", rb_ary_count, -1);
-    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
-    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
-    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
     rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
     rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
     rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -6329,9 +8979,18 @@ Init_Array(void)
     rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
     rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
     rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
-    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+    rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+    rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+    rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
     rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
     rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
+    rb_define_method(rb_cArray, "freeze", rb_ary_freeze, 0);
+
+    rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
 
-    id_random = rb_intern("random");
+    rb_cArray_empty_frozen = RB_OBJ_SET_SHAREABLE(rb_ary_freeze(rb_ary_new()));
+    rb_vm_register_global_object(rb_cArray_empty_frozen);
 }
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..7ee4e09a4c
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,307 @@
+class Array
+  # call-seq:
+  #   shuffle!(random: Random) -> self
+  #
+  # Shuffles all elements in +self+ into a random order,
+  # as selected by the object given by the keyword argument +random+.
+  # Returns +self+:
+  #
+  #   a =             [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle! # => [5, 3, 8, 7, 6, 1, 9, 4, 2, 0]
+  #   a.shuffle! # => [9, 4, 0, 6, 2, 8, 1, 5, 3, 7]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =             [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle! # => [1, 0, 0, 1, 1, 0, 1, 0, 0, 1]
+  #   a.shuffle! # => [0, 1, 0, 1, 1, 0, 1, 0, 1, 0]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+  def shuffle!(random: Random)
+    Primitive.rb_ary_shuffle_bang(random)
+  end
+
+  # call-seq:
+  #   shuffle(random: Random) -> new_array
+  #
+  # Returns a new array containing all elements from +self+ in a random order,
+  # as selected by the object given by the keyword argument +random+:
+  #
+  #   a =            [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle # => [0, 8, 1, 9, 6, 3, 4, 7, 2, 5]
+  #   a.shuffle # => [8, 9, 0, 5, 1, 2, 6, 4, 7, 3]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =            [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle # => [1, 0, 1, 1, 0, 0, 1, 0, 0, 1]
+  #   a.shuffle # => [1, 1, 0, 0, 0, 1, 1, 0, 0, 1]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def shuffle(random: Random)
+    Primitive.rb_ary_shuffle(random)
+  end
+
+  # call-seq:
+  #   sample(random: Random) -> object
+  #   sample(count, random: Random) -> new_ary
+  #
+  # Returns random elements from +self+,
+  # as selected by the object given by the keyword argument +random+.
+  #
+  # With no argument +count+ given, returns one random element from +self+:
+  #
+  #   a = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.sample # => 3
+  #   a.sample # => 8
+  #
+  # Returns +nil+ if +self+ is empty:
+  #
+  #   [].sample # => nil
+  #
+  # With a non-negative numeric argument +count+ given,
+  # returns a new array containing +count+ random elements from +self+:
+  #
+  #   a.sample(3) # => [8, 9, 2]
+  #   a.sample(6) # => [9, 6, 0, 3, 1, 4]
+  #
+  # The order of the result array is unrelated to the order of +self+.
+  #
+  # Returns a new empty array if +self+ is empty:
+  #
+  #   [].sample(4) # => []
+  #
+  # May return duplicates in +self+:
+  #
+  #   a = [1, 1, 1, 2, 2, 3]
+  #   a.sample(a.size) # => [1, 1, 3, 2, 1, 2]
+  #
+  # Returns no more than <tt>a.size</tt> elements
+  # (because no new duplicates are introduced):
+  #
+  #   a.sample(50) # => [6, 4, 1, 8, 5, 9, 0, 2, 3, 7]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator:
+  #
+  #   a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+  #   a.sample(random: Random.new(1))     # => 6
+  #   a.sample(4, random: Random.new(1))  # => [6, 10, 9, 2]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def sample(n = (ary = false), random: Random)
+    if Primitive.mandatory_only?
+      # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
+      Primitive.ary_sample0
+    else
+      # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
+      Primitive.ary_sample(random, n, ary)
+    end
+  end
+
+  # call-seq:
+  #   first -> object or nil
+  #   first(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; does not modify +self+.
+  #
+  # With no argument given, returns the first element (if available):
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.first # => :foo
+  #   a # => [:foo, "bar", 2]
+  #
+  # If +self+ is empty, returns +nil+.
+  #
+  #   [].first # => nil
+  #
+  # With a non-negative integer argument +count+ given,
+  # returns the first +count+ elements (as available) in a new array:
+  #
+  #   a.first(0)  # => []
+  #   a.first(2)  # => [:foo, "bar"]
+  #   a.first(50) # => [:foo, "bar", 2]
+  #
+  # Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+  def first n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_first(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_first(self) }
+      else
+        Primitive.cexpr! %q{  ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_FIRST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #  last  -> last_object or nil
+  #  last(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; +self+ is not modified.
+  #
+  # With no argument given, returns the last element, or +nil+ if +self+ is empty:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last # => 2
+  #   a # => [:foo, "bar", 2]
+  #   [].last # => nil
+  #
+  #
+  # With non-negative integer argument +count+ given,
+  # returns a new array containing the trailing +count+ elements of +self+, as available:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last(2)  # => ["bar", 2]
+  #   a.last(50) # => [:foo, "bar", 2]
+  #   a.last(0)  # => []
+  #   [].last(3) # => []
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def last n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_last(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_last(self) }
+      else
+        Primitive.cexpr! %q{ ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_LAST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #   fetch_values(*indexes) -> new_array
+  #   fetch_values(*indexes) { |index| ... } -> new_array
+  #
+  # With no block given, returns a new array containing the elements of +self+
+  # at the offsets specified by +indexes+. Each of the +indexes+ must be an
+  # {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]:
+  #
+  #    a = [:foo, :bar, :baz]
+  #    a.fetch_values(2, 0)   # => [:baz, :foo]
+  #    a.fetch_values(2.1, 0) # => [:baz, :foo]
+  #    a.fetch_values         # => []
+  #
+  # For a negative index, counts backwards from the end of the array:
+  #
+  #    a.fetch_values(-2, -1) # [:bar, :baz]
+  #
+  # When no block is given, raises an exception if any index is out of range.
+  #
+  # With a block given, for each index:
+  #
+  # - If the index is in range, uses an element of +self+ (as above).
+  # - Otherwise, calls the block with the index and uses the block's return value.
+  #
+  # Example:
+  #
+  #   a = [:foo, :bar, :baz]
+  #   a.fetch_values(1, 0, 42, 777) { |index| index.to_s }
+  #   # => [:bar, :foo, "42", "777"]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def fetch_values(*indexes, &block)
+    indexes.map! { |i| fetch(i, &block) }
+    indexes
+  end
+
+  with_jit do
+    if Primitive.rb_builtin_basic_definition_p(:each)
+      undef :each
+
+      def each # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+        i = 0
+        until Primitive.rb_jit_ary_at_end(i)
+          yield Primitive.rb_jit_ary_at(i)
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        self
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:map)
+      undef :map
+
+      def map # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        i = 0
+        result = Primitive.ary_sized_alloc
+        until Primitive.rb_jit_ary_at_end(i)
+          value = yield(Primitive.rb_jit_ary_at(i))
+          Primitive.rb_jit_ary_push(result, value)
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:collect)
+        undef :collect
+        alias collect map
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:select)
+      undef :select
+
+      def select # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        i = 0
+        result = Primitive.ary_sized_alloc
+        until Primitive.rb_jit_ary_at_end(i)
+          value = Primitive.rb_jit_ary_at(i)
+          if yield value
+            Primitive.rb_jit_ary_push(result, value)
+          end
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:filter)
+        undef :filter
+        alias filter select
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:find)
+      undef :find
+
+      def find(if_none_proc = nil) # :nodoc:
+        Primitive.attr! :inline_block, :c_trace, :without_interrupts
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+        i = 0
+        until Primitive.rb_jit_ary_at_end(i)
+          value = Primitive.rb_jit_ary_at(i)
+          return value if yield(value)
+          i = Primitive.rb_jit_fixnum_inc(i)
+        end
+        if_none_proc&.call
+      end
+    end
+  end
+end
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..1ddc2b5791
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,1178 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/ruby_parser.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+static VALUE rb_cLocation;
+
+struct ASTNodeData {
+    VALUE ast_value;
+    const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    rb_gc_mark(data->ast_value);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    size_t size = sizeof(struct ASTNodeData);
+    if (data->ast_value) {
+        rb_ast_t *ast = rb_ruby_ast_data_get(data->ast_value);
+        size += rb_ast_memsize(ast);
+    }
+
+    return size;
+}
+
+static const rb_data_type_t rb_node_type = {
+    "AST/node",
+    {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+struct ASTLocationData {
+    int first_lineno;
+    int first_column;
+    int last_lineno;
+    int last_column;
+};
+
+static void
+location_gc_mark(void *ptr)
+{
+}
+
+static size_t
+location_memsize(const void *ptr)
+{
+    return sizeof(struct ASTLocationData);
+}
+
+static const rb_data_type_t rb_location_type = {
+    "AST/location",
+    {location_gc_mark, RUBY_TYPED_DEFAULT_FREE, location_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, VALUE ast_value, const NODE *node)
+{
+    struct ASTNodeData *data;
+
+    TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+    data->ast_value = ast_value;
+    data->node = node;
+}
+
+static VALUE
+ast_new_internal(VALUE ast_value, const NODE *node)
+{
+    VALUE obj;
+
+    obj = rb_ast_node_alloc(rb_cNode);
+    setup_node(obj, ast_value, node);
+
+    return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+
+static VALUE
+ast_parse_new(void)
+{
+    return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(VALUE ast_value)
+{
+    rb_ast_t *ast = rb_ruby_ast_data_get(ast_value);
+
+    if (!ast->body.root) {
+        rb_ast_dispose(ast);
+        rb_exc_raise(GET_EC()->errinfo);
+    }
+
+    return ast_new_internal(ast_value, (NODE *)ast->body.root);
+}
+
+static VALUE
+setup_vparser(VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE vparser = ast_parse_new();
+    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
+    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+    return vparser;
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+    StringValue(str);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_string_path(vparser, Qnil, str, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE f;
+    VALUE ast_value = Qnil;
+    rb_encoding *enc = rb_utf8_encoding();
+
+    f = rb_file_open_str(path, "r");
+    rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_file_path(vparser, Qnil, f, 1);
+    rb_io_close(f);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+
+    array = rb_check_array_type(array);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_array(vparser, Qnil, array, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE node_children(VALUE, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+    VALUE ary;
+    long i;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    if (nd_node_id(data->node) == node_id) return self;
+
+    ary = node_children(data->ast_value, data->node);
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE child = RARRAY_AREF(ary, i);
+
+        if (CLASS_OF(child) == rb_cNode) {
+            VALUE result = node_find(child, node_id);
+            if (RTEST(result)) return result;
+        }
+    }
+
+    return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
+{
+    int node_id;
+
+    if (!rb_frame_info_p(location)) {
+        rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
+    }
+
+    node_id = rb_get_node_id_from_frame_info(location);
+    if (node_id == -1) {
+        return Qnil;
+    }
+
+    return INT2NUM(node_id);
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE node, lines = Qnil;
+    const rb_iseq_t *iseq;
+    int node_id;
+
+    if (rb_frame_info_p(body)) {
+        iseq = rb_get_iseq_from_frame_info(body);
+        node_id = rb_get_node_id_from_frame_info(body);
+    }
+    else {
+        iseq = NULL;
+
+        if (rb_obj_is_proc(body)) {
+            iseq = vm_proc_iseq(body);
+
+            if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
+        }
+        else {
+            iseq = rb_method_iseq(body);
+        }
+        if (iseq) {
+            node_id = ISEQ_BODY(iseq)->location.node_id;
+        }
+    }
+
+    if (!iseq) {
+        return Qnil;
+    }
+
+    if (ISEQ_BODY(iseq)->prism) {
+        rb_raise(rb_eRuntimeError, "cannot get AST for ISEQ compiled by prism");
+    }
+
+    lines = ISEQ_BODY(iseq)->variable.script_lines;
+
+    VALUE path = rb_iseq_path(iseq);
+    int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
+
+    if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
+        rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
+    }
+
+    if (!NIL_P(lines)) {
+        node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else if (e_option) {
+        node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else {
+        node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+    }
+
+    return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+    struct ASTNodeData *data;
+    VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+    return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+    return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+static VALUE
+ast_node_node_id(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2FIX(nd_node_id(data->node));
+}
+
+#define NEW_CHILD(ast_value, node) (node ? ast_new_internal(ast_value, node) : Qnil)
+
+static VALUE
+rb_ary_new_from_node_args(VALUE ast_value, long n, ...)
+{
+    va_list ar;
+    VALUE ary;
+    long i;
+
+    ary = rb_ary_new2(n);
+
+    va_start(ar, n);
+    for (i=0; i<n; i++) {
+        NODE *node;
+        node = va_arg(ar, NODE *);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node));
+    }
+    va_end(ar);
+    return ary;
+}
+
+static VALUE
+dump_block(VALUE ast_value, const struct RNode_BLOCK *node)
+{
+    VALUE ary = rb_ary_new();
+    do {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    } while (node->nd_next &&
+        nd_type_p(node->nd_next, NODE_BLOCK) &&
+        (node = RNODE_BLOCK(node->nd_next), 1));
+    if (node->nd_next) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+    }
+
+    return ary;
+}
+
+static VALUE
+dump_array(VALUE ast_value, const struct RNode_LIST *node)
+{
+    VALUE ary = rb_ary_new();
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+
+    while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
+        node = RNODE_LIST(node->nd_next);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    }
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+
+    return ary;
+}
+
+static VALUE
+dump_parser_array(VALUE ast_value, rb_parser_ary_t *p_ary)
+{
+    VALUE ary;
+
+    if (p_ary->data_type != PARSER_ARY_DATA_NODE) {
+        rb_bug("unexpected rb_parser_ary_data_type: %d", p_ary->data_type);
+    }
+
+    ary = rb_ary_new();
+
+    for (long i = 0; i < p_ary->len; i++) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, p_ary->data[i]));
+    }
+
+    return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+    if (!id) return Qnil;
+    if (!rb_id2str(id)) return Qnil;
+    return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+    ID rest;
+    CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+    return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(VALUE ast_value, const NODE *rest_arg)
+{
+    return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast_value, rest_arg) : no_name_rest();
+}
+
+static ID
+node_colon_name(const NODE *node)
+{
+    switch (nd_type(node)) {
+      case NODE_COLON2:
+        return RNODE_COLON2(node)->nd_mid;
+      case NODE_COLON3:
+        return RNODE_COLON3(node)->nd_mid;
+      default:
+        rb_bug("unexpected node: %s", ruby_node_name(nd_type(node)));
+    }
+}
+
+static VALUE
+node_children(VALUE ast_value, const NODE *node)
+{
+    char name[sizeof("$") + DECIMAL_SIZE_OF(long)];
+
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_BLOCK:
+        return dump_block(ast_value, RNODE_BLOCK(node));
+      case NODE_IF:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IF(node)->nd_cond, RNODE_IF(node)->nd_body, RNODE_IF(node)->nd_else);
+      case NODE_UNLESS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_UNLESS(node)->nd_cond, RNODE_UNLESS(node)->nd_body, RNODE_UNLESS(node)->nd_else);
+      case NODE_CASE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE(node)->nd_head, RNODE_CASE(node)->nd_body);
+      case NODE_CASE2:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE2(node)->nd_head, RNODE_CASE2(node)->nd_body);
+      case NODE_CASE3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE3(node)->nd_head, RNODE_CASE3(node)->nd_body);
+      case NODE_WHEN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_WHEN(node)->nd_head, RNODE_WHEN(node)->nd_body, RNODE_WHEN(node)->nd_next);
+      case NODE_IN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IN(node)->nd_head, RNODE_IN(node)->nd_body, RNODE_IN(node)->nd_next);
+      case NODE_WHILE:
+      case NODE_UNTIL:
+        return rb_ary_push(rb_ary_new_from_node_args(ast_value, 2, RNODE_WHILE(node)->nd_cond, RNODE_WHILE(node)->nd_body),
+                           RBOOL(RNODE_WHILE(node)->nd_state));
+      case NODE_ITER:
+      case NODE_FOR:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ITER(node)->nd_iter, RNODE_ITER(node)->nd_body);
+      case NODE_FOR_MASGN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_FOR_MASGN(node)->nd_var);
+      case NODE_BREAK:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BREAK(node)->nd_stts);
+      case NODE_NEXT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_NEXT(node)->nd_stts);
+      case NODE_RETURN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_RETURN(node)->nd_stts);
+      case NODE_REDO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_RETRY:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_BEGIN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BEGIN(node)->nd_body);
+      case NODE_RESCUE:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_RESCUE(node)->nd_head, RNODE_RESCUE(node)->nd_resq, RNODE_RESCUE(node)->nd_else);
+      case NODE_RESBODY:
+        return rb_ary_new_from_node_args(ast_value, 4, RNODE_RESBODY(node)->nd_args, RNODE_RESBODY(node)->nd_exc_var, RNODE_RESBODY(node)->nd_body, RNODE_RESBODY(node)->nd_next);
+      case NODE_ENSURE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ENSURE(node)->nd_head, RNODE_ENSURE(node)->nd_ensr);
+      case NODE_AND:
+      case NODE_OR:
+        {
+            VALUE ary = rb_ary_new();
+
+            while (1) {
+                rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_1st));
+                if (!RNODE_AND(node)->nd_2nd || !nd_type_p(RNODE_AND(node)->nd_2nd, type))
+                    break;
+                node = RNODE_AND(node)->nd_2nd;
+            }
+            rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_2nd));
+            return ary;
+        }
+      case NODE_MASGN:
+        if (NODE_NAMED_REST_P(RNODE_MASGN(node)->nd_args)) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MASGN(node)->nd_value, RNODE_MASGN(node)->nd_head, RNODE_MASGN(node)->nd_args);
+        }
+        else {
+            return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_value),
+                                        NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_head),
+                                        no_name_rest());
+        }
+      case NODE_LASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_LASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_LASGN(node)->nd_value));
+      case NODE_DASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_DASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_DASGN(node)->nd_value));
+      case NODE_IASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_IASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_IASGN(node)->nd_value));
+      case NODE_CVASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_CVASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CVASGN(node)->nd_value));
+      case NODE_GASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_GASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_GASGN(node)->nd_value));
+      case NODE_CDECL:
+        if (RNODE_CDECL(node)->nd_vid) {
+            return rb_ary_new_from_args(2, ID2SYM(RNODE_CDECL(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+        }
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_else), ID2SYM(node_colon_name(RNODE_CDECL(node)->nd_else)), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(4, NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_recv),
+                                    ID2SYM(RNODE_OP_ASGN1(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_index),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_rvalue));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(5, NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_recv),
+                                    RBOOL(RNODE_OP_ASGN2(node)->nd_aid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_vid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_value));
+      case NODE_OP_ASGN_AND:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_head), ID2SYM(idANDOP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_value));
+      case NODE_OP_ASGN_OR:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_head), ID2SYM(idOROP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_value));
+      case NODE_OP_CDECL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_head),
+                                    ID2SYM(RNODE_OP_CDECL(node)->nd_aid),
+                                    NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_value));
+      case NODE_CALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CALL(node)->nd_recv),
+                                    ID2SYM(RNODE_CALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_CALL(node)->nd_args));
+      case NODE_OPCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_OPCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_args));
+      case NODE_QCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_QCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_args));
+      case NODE_FCALL:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_FCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_FCALL(node)->nd_args));
+      case NODE_VCALL:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_VCALL(node)->nd_mid));
+      case NODE_SUPER:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SUPER(node)->nd_args);
+      case NODE_ZSUPER:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_LIST:
+        return dump_array(ast_value, RNODE_LIST(node));
+      case NODE_ZLIST:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_HASH:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_HASH(node)->nd_head);
+      case NODE_YIELD:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_YIELD(node)->nd_head);
+      case NODE_LVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_LVAR(node)->nd_vid));
+      case NODE_DVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_DVAR(node)->nd_vid));
+      case NODE_IVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_IVAR(node)->nd_vid));
+      case NODE_CONST:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CONST(node)->nd_vid));
+      case NODE_CVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CVAR(node)->nd_vid));
+      case NODE_GVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_GVAR(node)->nd_vid));
+      case NODE_NTH_REF:
+        snprintf(name, sizeof(name), "$%ld", RNODE_NTH_REF(node)->nd_nth);
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_BACK_REF:
+        name[0] = '$';
+        name[1] = (char)RNODE_BACK_REF(node)->nd_nth;
+        name[2] = '\0';
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_MATCH:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_MATCH2:
+        if (RNODE_MATCH2(node)->nd_args) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value, RNODE_MATCH2(node)->nd_args);
+        }
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value);
+      case NODE_MATCH3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH3(node)->nd_recv, RNODE_MATCH3(node)->nd_value);
+      case NODE_STR:
+      case NODE_XSTR:
+        return rb_ary_new_from_args(1, rb_node_str_string_val(node));
+      case NODE_INTEGER:
+        return rb_ary_new_from_args(1, rb_node_integer_literal_val(node));
+      case NODE_FLOAT:
+        return rb_ary_new_from_args(1, rb_node_float_literal_val(node));
+      case NODE_RATIONAL:
+        return rb_ary_new_from_args(1, rb_node_rational_literal_val(node));
+      case NODE_IMAGINARY:
+        return rb_ary_new_from_args(1, rb_node_imaginary_literal_val(node));
+      case NODE_REGX:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_ONCE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_ONCE(node)->nd_body);
+      case NODE_DSTR:
+      case NODE_DXSTR:
+      case NODE_DREGX:
+      case NODE_DSYM:
+        {
+            struct RNode_LIST *n = RNODE_DSTR(node)->nd_next;
+            VALUE head = Qnil, next = Qnil;
+            if (n) {
+                head = NEW_CHILD(ast_value, n->nd_head);
+                next = NEW_CHILD(ast_value, n->nd_next);
+            }
+            return rb_ary_new_from_args(3, rb_node_dstr_string_val(node), head, next);
+        }
+      case NODE_SYM:
+        return rb_ary_new_from_args(1, rb_node_sym_string_val(node));
+      case NODE_EVSTR:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_EVSTR(node)->nd_body);
+      case NODE_ARGSCAT:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSCAT(node)->nd_head, RNODE_ARGSCAT(node)->nd_body);
+      case NODE_ARGSPUSH:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSPUSH(node)->nd_head, RNODE_ARGSPUSH(node)->nd_body);
+      case NODE_SPLAT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SPLAT(node)->nd_head);
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_BLOCK_PASS(node)->nd_head, RNODE_BLOCK_PASS(node)->nd_body);
+      case NODE_DEFN:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_DEFN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFN(node)->nd_defn));
+      case NODE_DEFS:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_recv), ID2SYM(RNODE_DEFS(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_defn));
+      case NODE_ALIAS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ALIAS(node)->nd_1st, RNODE_ALIAS(node)->nd_2nd);
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_VALIAS(node)->nd_alias), ID2SYM(RNODE_VALIAS(node)->nd_orig));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(1, dump_parser_array(ast_value, RNODE_UNDEF(node)->nd_undefs));
+      case NODE_CLASS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_CLASS(node)->nd_cpath, RNODE_CLASS(node)->nd_super, RNODE_CLASS(node)->nd_body);
+      case NODE_MODULE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MODULE(node)->nd_cpath, RNODE_MODULE(node)->nd_body);
+      case NODE_SCLASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_SCLASS(node)->nd_recv, RNODE_SCLASS(node)->nd_body);
+      case NODE_COLON2:
+        return rb_ary_new_from_args(2, NEW_CHILD(ast_value, RNODE_COLON2(node)->nd_head), ID2SYM(RNODE_COLON2(node)->nd_mid));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_COLON3(node)->nd_mid));
+      case NODE_DOT2:
+      case NODE_DOT3:
+      case NODE_FLIP2:
+      case NODE_FLIP3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_DOT2(node)->nd_beg, RNODE_DOT2(node)->nd_end);
+      case NODE_SELF:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_NIL:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_TRUE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_FALSE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ERRINFO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_DEFINED:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_DEFINED(node)->nd_head);
+      case NODE_POSTEXE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_POSTEXE(node)->nd_body);
+      case NODE_ATTRASGN:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_recv), ID2SYM(RNODE_ATTRASGN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_args));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_LAMBDA(node)->nd_body);
+      case NODE_OPT_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_OPT_ARG(node)->nd_body, RNODE_OPT_ARG(node)->nd_next);
+      case NODE_KW_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_KW_ARG(node)->nd_body, RNODE_KW_ARG(node)->nd_next);
+      case NODE_POSTARG:
+        if (NODE_NAMED_REST_P(RNODE_POSTARG(node)->nd_1st)) {
+            return rb_ary_new_from_node_args(ast_value, 2, RNODE_POSTARG(node)->nd_1st, RNODE_POSTARG(node)->nd_2nd);
+        }
+        return rb_ary_new_from_args(2, no_name_rest(),
+                                    NEW_CHILD(ast_value, RNODE_POSTARG(node)->nd_2nd));
+      case NODE_ARGS:
+        {
+            struct rb_args_info *ainfo = &RNODE_ARGS(node)->nd_ainfo;
+            return rb_ary_new_from_args(10,
+                                        INT2NUM(ainfo->pre_args_num),
+                                        NEW_CHILD(ast_value, ainfo->pre_init),
+                                        NEW_CHILD(ast_value, (NODE *)ainfo->opt_args),
+                                        var_name(ainfo->first_post_arg),
+                                        INT2NUM(ainfo->post_args_num),
+                                        NEW_CHILD(ast_value, ainfo->post_init),
+                                        (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+                                            ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+                                            : var_name(ainfo->rest_arg)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, (NODE *)ainfo->kw_args)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, ainfo->kw_rest_arg)),
+                                        (ainfo->no_blockarg ? Qfalse : var_name(ainfo->block_arg)));
+        }
+      case NODE_SCOPE:
+        {
+            rb_ast_id_table_t *tbl = RNODE_SCOPE(node)->nd_tbl;
+            int i, size = tbl ? tbl->size : 0;
+            VALUE locals = rb_ary_new_capa(size);
+            for (i = 0; i < size; i++) {
+                rb_ary_push(locals, var_name(tbl->ids[i]));
+            }
+            return rb_ary_new_from_args(3, locals, NEW_CHILD(ast_value, (NODE *)RNODE_SCOPE(node)->nd_args), NEW_CHILD(ast_value, RNODE_SCOPE(node)->nd_body));
+        }
+      case NODE_ARYPTN:
+        {
+            VALUE rest = rest_arg(ast_value, RNODE_ARYPTN(node)->rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->pre_args),
+                                        rest,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->post_args));
+        }
+      case NODE_FNDPTN:
+        {
+            VALUE pre_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->pre_rest_arg);
+            VALUE post_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->post_rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->nd_pconst),
+                                        pre_rest,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->args),
+                                        post_rest);
+        }
+      case NODE_HSHPTN:
+        {
+            VALUE kwrest = RNODE_HSHPTN(node)->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+                                                                                 NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwrestarg);
+
+            return rb_ary_new_from_args(3,
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwargs),
+                                        kwrest);
+        }
+      case NODE_LINE:
+        return rb_ary_new_from_args(1, rb_node_line_lineno_val(node));
+      case NODE_FILE:
+        return rb_ary_new_from_args(1, rb_node_file_path_val(node));
+      case NODE_ENCODING:
+        return rb_ary_new_from_args(1, rb_node_encoding_val(node));
+      case NODE_ERROR:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+    }
+
+    rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_children(data->ast_value, data->node);
+}
+
+static int
+null_loc_p(rb_code_location_t *loc)
+{
+    return (loc->beg_pos.lineno == 0 && loc->beg_pos.column == -1 && loc->end_pos.lineno == 0 && loc->end_pos.column == -1);
+}
+
+static VALUE
+location_new(rb_code_location_t *loc)
+{
+    VALUE obj;
+    struct ASTLocationData *data;
+
+    if (null_loc_p(loc)) return Qnil;
+
+    obj = TypedData_Make_Struct(rb_cLocation, struct ASTLocationData, &rb_location_type, data);
+    data->first_lineno = loc->beg_pos.lineno;
+    data->first_column = loc->beg_pos.column;
+    data->last_lineno = loc->end_pos.lineno;
+    data->last_column = loc->end_pos.column;
+
+    return obj;
+}
+
+static VALUE
+node_locations(VALUE ast_value, const NODE *node)
+{
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_ALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_ALIAS(node)->keyword_loc));
+      case NODE_AND:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_AND(node)->operator_loc));
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BLOCK_PASS(node)->operator_loc));
+      case NODE_BREAK:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BREAK(node)->keyword_loc));
+      case NODE_CASE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE(node)->end_keyword_loc));
+      case NODE_CASE2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE2(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE2(node)->end_keyword_loc));
+      case NODE_CASE3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE3(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE3(node)->end_keyword_loc));
+      case NODE_CLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_CLASS(node)->inheritance_operator_loc),
+                                    location_new(&RNODE_CLASS(node)->end_keyword_loc));
+      case NODE_COLON2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON2(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON2(node)->name_loc));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON3(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON3(node)->name_loc));
+      case NODE_DEFINED:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DEFINED(node)->keyword_loc));
+      case NODE_DOT2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT2(node)->operator_loc));
+      case NODE_DOT3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT3(node)->operator_loc));
+      case NODE_EVSTR:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_EVSTR(node)->opening_loc),
+                                    location_new(&RNODE_EVSTR(node)->closing_loc));
+      case NODE_FLIP2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP2(node)->operator_loc));
+      case NODE_FLIP3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP3(node)->operator_loc));
+      case NODE_FOR:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FOR(node)->for_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->in_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->do_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->end_keyword_loc));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_LAMBDA(node)->operator_loc),
+                                    location_new(&RNODE_LAMBDA(node)->opening_loc),
+                                    location_new(&RNODE_LAMBDA(node)->closing_loc));
+      case NODE_IF:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IF(node)->if_keyword_loc),
+                                    location_new(&RNODE_IF(node)->then_keyword_loc),
+                                    location_new(&RNODE_IF(node)->end_keyword_loc));
+      case NODE_IN:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IN(node)->in_keyword_loc),
+                                    location_new(&RNODE_IN(node)->then_keyword_loc),
+                                    location_new(&RNODE_IN(node)->operator_loc));
+      case NODE_MODULE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_MODULE(node)->module_keyword_loc),
+                                    location_new(&RNODE_MODULE(node)->end_keyword_loc));
+      case NODE_NEXT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_NEXT(node)->keyword_loc));
+      case NODE_OR:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OR(node)->operator_loc));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN1(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->opening_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->closing_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->binary_operator_loc));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN2(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->message_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->binary_operator_loc));
+      case NODE_POSTEXE:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_POSTEXE(node)->keyword_loc),
+                                    location_new(&RNODE_POSTEXE(node)->opening_loc),
+                                    location_new(&RNODE_POSTEXE(node)->closing_loc));
+      case NODE_REDO:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REDO(node)->keyword_loc));
+      case NODE_REGX:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REGX(node)->opening_loc),
+                                    location_new(&RNODE_REGX(node)->content_loc),
+                                    location_new(&RNODE_REGX(node)->closing_loc));
+      case NODE_RETURN:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_RETURN(node)->keyword_loc));
+
+      case NODE_SCLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SCLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_SCLASS(node)->operator_loc),
+                                    location_new(&RNODE_SCLASS(node)->end_keyword_loc));
+
+      case NODE_SPLAT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SPLAT(node)->operator_loc));
+      case NODE_SUPER:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SUPER(node)->keyword_loc),
+                                    location_new(&RNODE_SUPER(node)->lparen_loc),
+                                    location_new(&RNODE_SUPER(node)->rparen_loc));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNDEF(node)->keyword_loc));
+      case NODE_UNLESS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNLESS(node)->keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->then_keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->end_keyword_loc));
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_VALIAS(node)->keyword_loc));
+      case NODE_WHEN:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHEN(node)->keyword_loc),
+                                    location_new(&RNODE_WHEN(node)->then_keyword_loc));
+      case NODE_WHILE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHILE(node)->keyword_loc),
+                                    location_new(&RNODE_WHILE(node)->closing_loc));
+      case NODE_UNTIL:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNTIL(node)->keyword_loc),
+                                    location_new(&RNODE_UNTIL(node)->closing_loc));
+      case NODE_YIELD:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_YIELD(node)->keyword_loc),
+                                    location_new(&RNODE_YIELD(node)->lparen_loc),
+                                    location_new(&RNODE_YIELD(node)->rparen_loc));
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+      default:
+        return rb_ary_new_from_args(1, location_new(nd_code_loc(node)));
+    }
+
+    rb_bug("node_locations: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_locations(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_locations(data->ast_value, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
+{
+    long i;
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    rb_parser_ary_t *parser_tokens;
+    rb_parser_ast_token_t *parser_token;
+    VALUE str, loc, token, all_tokens;
+
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+
+    parser_tokens = ast->node_buffer->tokens;
+    if (parser_tokens == NULL) {
+        return Qnil;
+    }
+
+    all_tokens = rb_ary_new2(parser_tokens->len);
+    for (i = 0; i < parser_tokens->len; i++) {
+        parser_token = parser_tokens->data[i];
+        str = rb_str_new(parser_token->str->ptr, parser_token->str->len);
+        loc = rb_ary_new_from_args(4,
+            INT2FIX(parser_token->loc.beg_pos.lineno),
+            INT2FIX(parser_token->loc.beg_pos.column),
+            INT2FIX(parser_token->loc.end_pos.lineno),
+            INT2FIX(parser_token->loc.end_pos.column)
+        );
+        token = rb_ary_new_from_args(4, INT2FIX(parser_token->id), ID2SYM(rb_intern(parser_token->type_name)), str, loc);
+        rb_ary_push(all_tokens, token);
+    }
+    rb_ary_freeze(all_tokens);
+
+    return all_tokens;
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+                node_type_to_str(data->node),
+                nd_first_lineno(data->node), nd_first_column(data->node),
+                nd_last_lineno(data->node), nd_last_column(data->node));
+
+    return str;
+}
+
+static VALUE
+ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+    rb_parser_ary_t *ret = ast->body.script_lines;
+    return rb_parser_build_script_lines_from(ret);
+}
+
+static VALUE
+ast_location_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_lineno);
+}
+
+static VALUE
+ast_location_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_column);
+}
+
+static VALUE
+ast_location_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_lineno);
+}
+
+static VALUE
+ast_location_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_column);
+}
+
+static VALUE
+ast_location_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":@%d:%d-%d:%d>",
+                data->first_lineno, data->first_column,
+                data->last_lineno, data->last_column);
+
+    return str;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+    rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+    rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+    rb_cLocation = rb_define_class_under(rb_mAST, "Location", rb_cObject);
+    rb_undef_alloc_func(rb_cNode);
+    rb_undef_alloc_func(rb_cLocation);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..6380621780
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,332 @@
+# for ast.c
+
+# AbstractSyntaxTree provides methods to parse Ruby code into
+# abstract syntax trees. The nodes in the tree
+# are instances of RubyVM::AbstractSyntaxTree::Node.
+#
+# This module is MRI specific as it exposes implementation details
+# of the MRI abstract syntax tree.
+#
+# This module is experimental and its API is not stable, therefore it might
+# change without notice. As examples, the order of children nodes is not
+# guaranteed, the number of children nodes might change, there is no way to
+# access children nodes by name, etc.
+#
+# If you are looking for a stable API or an API working under multiple Ruby
+# implementations, consider using the _prism_ gem, which is the official
+# Ruby API to parse Ruby code.
+#
+module RubyVM::AbstractSyntaxTree
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #  Parses the given _string_ into an abstract syntax tree,
+  #  returning the root node of that tree.
+  #
+  #    RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+  #    # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+  #
+  #  If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
+  #  source is associated with nodes and is available via Node#script_lines.
+  #
+  #  If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
+  #
+  #  SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
+  #  behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
+  #  will produce a tree where expressions with syntax errors would be represented by
+  #  Node with <tt>type=:ERROR</tt>.
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
+  #     # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
+  #     # x = 1; p(x; y=2
+  #     #           ^
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
+  #     # (SCOPE@1:0-1:15
+  #     #  tbl: [:x, :y]
+  #     #  args: nil
+  #     #  body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
+  #     root.children.last.children
+  #     # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
+  #     #  (ERROR@1:7-1:11),
+  #     #  (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
+  #
+  #  Note that parsing continues even after the errored expression.
+  #
+  def self.parse string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Reads the file from _pathname_, then parses it like ::parse,
+  #   returning the root node of the abstract syntax tree.
+  #
+  #   SyntaxError is raised if _pathname_'s contents are not
+  #   valid Ruby syntax.
+  #
+  #     RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.parse_file pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false)   -> RubyVM::AbstractSyntaxTree::Node
+  #     RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Returns AST nodes of the given _proc_ or _method_.
+  #
+  #     RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+  #
+  #     def hello
+  #       puts "hello, world"
+  #     end
+  #
+  #     RubyVM::AbstractSyntaxTree.of(method(:hello))
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.of body, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location)   -> integer
+  #
+  #   Returns the node id for the given backtrace location.
+  #
+  #     begin
+  #       raise
+  #     rescue =>  e
+  #       loc = e.backtrace_locations.first
+  #       RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
+  #     end # => 0
+  def self.node_id_for_backtrace_location backtrace_location
+    Primitive.node_id_for_backtrace_location backtrace_location
+  end
+
+  # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+  # RubyVM::AbstractSyntaxTree.
+  #
+  # This class is MRI specific.
+  #
+  class Node
+
+    #  call-seq:
+    #     node.type -> symbol
+    #
+    #  Returns the type of this node as a symbol.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+    #    root.type # => :SCOPE
+    #    lasgn = root.children[2]
+    #    lasgn.type # => :LASGN
+    #    call = lasgn.children[1]
+    #    call.type # => :OPCALL
+    def type
+      Primitive.ast_node_type
+    end
+
+    #  call-seq:
+    #     node.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_node_first_lineno
+    end
+
+    #  call-seq:
+    #     node.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_node_first_column
+    end
+
+    #  call-seq:
+    #     node.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_node_last_lineno
+    end
+
+    #  call-seq:
+    #     node.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_node_last_column
+    end
+
+    #  call-seq:
+    #     node.tokens -> array
+    #
+    #  Returns tokens corresponding to the location of the node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+    #
+    #  Token is an array of:
+    #
+    #  - id
+    #  - token type
+    #  - source code text
+    #  - location [ first_lineno, first_column, last_lineno, last_column ]
+    def tokens
+      return nil unless all_tokens
+
+      all_tokens.each_with_object([]) do |token, a|
+        loc = token.last
+        if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
+           ([last_lineno, last_column]   <=> [loc[2], loc[3]]) >= 0
+           a << token
+        end
+      end
+    end
+
+    #  call-seq:
+    #     node.all_tokens -> array
+    #
+    #  Returns all tokens for the input script regardless the receiver node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    def all_tokens
+      Primitive.ast_node_all_tokens
+    end
+
+    #  call-seq:
+    #     node.children -> array
+    #
+    #  Returns AST nodes under this one.  Each kind of node
+    #  has different children, depending on what kind of node it is.
+    #
+    #  The returned array may contain other nodes or <code>nil</code>.
+    def children
+      Primitive.ast_node_children
+    end
+
+    #  call-seq:
+    #     node.inspect -> string
+    #
+    #  Returns debugging information about this node as a string.
+    def inspect
+      Primitive.ast_node_inspect
+    end
+
+    #  call-seq:
+    #     node.node_id -> integer
+    #
+    #  Returns an internal node_id number.
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def node_id
+      Primitive.ast_node_node_id
+    end
+
+    #  call-seq:
+    #     node.script_lines -> array
+    #
+    #  Returns the original source code as an array of lines.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def script_lines
+      Primitive.ast_node_script_lines
+    end
+
+    #  call-seq:
+    #     node.source -> string
+    #
+    #  Returns the code fragment that corresponds to this AST.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    #
+    #  Also note that this API may return an incomplete code fragment
+    #  that does not parse; for example, a here document following
+    #  an expression may be dropped.
+    def source
+      lines = script_lines
+      if lines
+        lines = lines[first_lineno - 1 .. last_lineno - 1]
+        lines[-1] = lines[-1].byteslice(0...last_column)
+        lines[0] = lines[0].byteslice(first_column..-1)
+        lines.join
+      else
+        nil
+      end
+    end
+
+    #  call-seq:
+    #     node.locations -> array
+    #
+    #  Returns location objects associated with the AST node.
+    #  The returned array contains RubyVM::AbstractSyntaxTree::Location.
+    def locations
+      Primitive.ast_node_locations
+    end
+  end
+
+  # RubyVM::AbstractSyntaxTree::Location instances are created by
+  # RubyVM::AbstractSyntaxTree::Node#locations.
+  #
+  # This class is MRI specific.
+  #
+  class Location
+
+    #  call-seq:
+    #     location.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_location_first_lineno
+    end
+
+    #  call-seq:
+    #     location.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_location_first_column
+    end
+
+    #  call-seq:
+    #     location.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_location_last_lineno
+    end
+
+    #  call-seq:
+    #     location.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_location_last_column
+    end
+
+    #  call-seq:
+    #     location.inspect -> string
+    #
+    #  Returns debugging information about this location as a string.
+    def inspect
+      Primitive.ast_location_inspect
+    end
+  end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..6cbc5dddab
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,22 @@
+#!/bin/sh
+
+# Clear PWD to force commands to recompute working directory
+PWD=
+
+# Figure out the source directory for this script
+# configure.ac should be in the same place
+case "$0" in
+    */* )  srcdir=`dirname "$0"` ;; # Called with path
+    *   )  srcdir="";; # Otherwise
+esac
+
+# If install-only is explicitly requested, disable symlink flags
+case " $* " in
+    *" -i "* | *" --install"* ) symlink_flags="" ;;
+    *                         ) symlink_flags="--install --symlink" ;;
+esac
+
+exec ${AUTORECONF:-autoreconf} \
+     $symlink_flags \
+     "$@" \
+     $srcdir
diff --git a/basictest/test.rb b/basictest/test.rb
index 25d52ca1ef..711e4f4ab3 100755
--- a/basictest/test.rb
+++ b/basictest/test.rb
@@ -35,7 +35,7 @@ class Progress
       # dircolors-like style
       colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
       begin
-        File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+        File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
           colors[n] ||= c
         end
       rescue
@@ -879,7 +879,7 @@ $x.sort!{|a,b| b-a}		# reverse sort
 test_ok($x == [7,5,3,2,1])
 
 # split test
-$x = "The Book of Mormon"
+$x = +"The Book of Mormon"
 test_ok($x.split(//).reverse!.join == $x.reverse)
 test_ok($x.reverse == $x.reverse!)
 test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
@@ -984,13 +984,6 @@ test_ok($z == 0)
 
 test_check "iterator"
 
-test_ok(!iterator?)
-
-def ttt
-  test_ok(iterator?)
-end
-ttt{}
-
 # yield at top level
 test_ok(!defined?(yield))
 
@@ -1432,9 +1425,6 @@ marity_test(:test_ok)
 marity_test(:marity_test)
 marity_test(:p)
 
-lambda(&method(:test_ok)).call(true)
-lambda(&block_get{|a,n| test_ok(a,n)}).call(true, 2)
-
 class ITER_TEST1
    def a
      block_given?
@@ -1653,7 +1643,7 @@ test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
 test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
 test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
 
-$x = <<END;
+$x = +<<END;
 ABCD
 ABCD
 END
@@ -1692,12 +1682,12 @@ test_ok(?a == ?a)
 test_ok(?\C-a == "\1")
 test_ok(?\M-a == "\341")
 test_ok(?\M-\C-a == "\201")
-test_ok("a".upcase![0] == ?A)
-test_ok("A".downcase![0] == ?a)
-test_ok("abc".tr!("a-z", "A-Z") == "ABC")
-test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
-test_ok("abcc".squeeze!("a-z") == "abc")
-test_ok("abcd".delete!("bc") == "ad")
+test_ok("a".dup.upcase![0] == ?A)
+test_ok("A".dup.downcase![0] == ?a)
+test_ok("abc".dup.tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".dup.tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".dup.squeeze!("a-z") == "abc")
+test_ok("abcd".dup.delete!("bc") == "ad")
 
 $x = "abcdef"
 $y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
@@ -1710,7 +1700,7 @@ $x.each_byte {|i|
 }
 test_ok(!$bad)
 
-s = "a string"
+s = +"a string"
 s[0..s.size]="another string"
 test_ok(s == "another string")
 
@@ -1739,7 +1729,7 @@ a = nil
 test_ok(defined?(a))
 test_ok(a == nil)
 
-# multiple asignment
+# multiple assignment
 a, b = 1, 2
 test_ok(a == 1 && b == 2)
 
@@ -1970,6 +1960,8 @@ test_ok(p1.call == 5)
 test_ok(i7 == nil)
 end
 
+# WASI doesn't support spawning a new process for now.
+unless /wasi/ =~ RUBY_PLATFORM
 test_check "system"
 test_ok(`echo foobar` == "foobar\n")
 test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
@@ -2020,6 +2012,7 @@ test_ok(done)
 
 File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
 File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+end # not /wasi/ =~ RUBY_PLATFORM
 
 test_check "const"
 TEST1 = 1
@@ -2147,7 +2140,7 @@ $_ = foobar
 test_ok($_ == foobar)
 
 class Gods
-  @@rule = "Uranus"		# private to Gods
+  @@rule = "Uranus"
   def ruler0
     @@rule
   end
@@ -2170,7 +2163,7 @@ module Olympians
 end
 
 class Titans < Gods
-  @@rule = "Cronus"		# do not affect @@rule in Gods
+  @@rule = "Cronus"		# modifies @@rule in Gods
   include Olympians
   def ruler4
     @@rule
@@ -2185,7 +2178,14 @@ test_ok(Titans.ruler2 == "Cronus")
 atlas = Titans.new
 test_ok(atlas.ruler0 == "Cronus")
 test_ok(atlas.ruler3 == "Zeus")
-test_ok(atlas.ruler4 == "Cronus")
+begin
+  atlas.ruler4
+rescue RuntimeError => e
+  test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+  test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
 
 test_check "trace"
 $x = 1234
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..9f9192685e
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,75 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+benchmark-driver --help
+Usage: benchmark-driver [options] RUBY|YAML...
+    -r, --runner TYPE                Specify runner type: ips, time, memory, once, block (default: ips)
+    -o, --output TYPE                Specify output type: compare, simple, markdown, record, all (default: compare)
+    -e, --executables EXECS          Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+        --rbenv VERSIONS             Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+        --repeat-count NUM           Try benchmark NUM times and use the fastest result or the worst memory usage
+        --repeat-result TYPE         Yield "best", "average" or "worst" result with --repeat-count (default: best)
+        --alternate                  Alternate executables instead of running the same executable in a row with --repeat-count
+        --bundler                    Install and use gems specified in Gemfile
+        --filter REGEXP              Filter out benchmarks with given regexp
+        --run-duration SECONDS       Warmup estimates loop_count to run for this duration (default: 3)
+        --timeout SECONDS            Timeout ruby command execution with timeout(1)
+    -v, --verbose                    Verbose mode. Multiple -v options increase visibility (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+#   -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/bm_app_answer.rb b/benchmark/app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/bm_app_answer.rb
+++ b/benchmark/app_answer.rb
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..c1546e08ab
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def orthoBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    orthoBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+  # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  # $fp = fp
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n")
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+benchmark:
+  app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/bm_app_factorial.rb
+++ b/benchmark/app_factorial.rb
diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb
new file mode 100644
index 0000000000..e61bc8aa32
--- /dev/null
+++ b/benchmark/app_fib.rb
@@ -0,0 +1,10 @@
+def fib(n)
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ b/benchmark/app_lc_fizzbuzz.rb
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/bm_app_mandelbrot.rb
+++ b/benchmark/app_mandelbrot.rb
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/bm_app_raise.rb
+++ b/benchmark/app_raise.rb
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/bm_app_strconcat.rb
+++ b/benchmark/app_strconcat.rb
diff --git a/benchmark/bm_app_tak.rb b/benchmark/app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/bm_app_tak.rb
+++ b/benchmark/app_tak.rb
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/bm_app_tarai.rb
+++ b/benchmark/app_tarai.rb
diff --git a/benchmark/bm_app_uri.rb b/benchmark/app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/bm_app_uri.rb
+++ b/benchmark/app_uri.rb
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+  small_flat_ary = 5.times.to_a
+  large_flat_ary = 100.times.to_a
+  small_pairs_ary = [[1, 2]] * 5
+  large_pairs_ary = [[1, 2]] * 100
+  mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+  small_flat_ary.flatten: small_flat_ary.flatten
+  small_flat_ary.flatten!: small_flat_ary.flatten!
+  large_flat_ary.flatten: large_flat_ary.flatten
+  large_flat_ary.flatten!: large_flat_ary.flatten!
+  small_pairs_ary.flatten: small_pairs_ary.flatten
+  small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+  large_pairs_ary.flatten: large_pairs_ary.flatten
+  large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+  mostly_flat_ary.flatten: mostly_flat_ary.flatten
+  mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+  small1 = [1, 2, 3]
+  small2 = [1, 2, 3, 4, 5]
+  small3 = [2, 3, 4, 5]
+  small4 = [2]
+  big1 = [1, 2, 3, 4] * 64
+  big2 = [1, 2, 3] * 64
+  big3 = [1, 2] * 64
+
+benchmark:
+  small-&: small1 & small2 & small3 & small4
+  small-intersection: small1.intersection(small2, small3, small4)
+  big-&: big1 & big2 & big3
+  big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_large_literal.yml b/benchmark/array_large_literal.yml
new file mode 100644
index 0000000000..423d68391f
--- /dev/null
+++ b/benchmark/array_large_literal.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def def_array(size)
+    Object.class_eval(<<-END)
+      def array_#{size}
+        x = 1
+        [#{(['x'] * size).join(',')}]
+      end
+    END
+  end
+  def_array(100)
+  def_array(1000)
+  def_array(10000)
+  def_array(100000)
+benchmark:
+  array_100: array_100
+  array_1000: array_1000
+  array_10000: array_10000
+  array_100000: array_100000
+
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_f).shuffle
+  ary10 = 10.times.map(&:to_f).shuffle
+  ary100 = 100.times.map(&:to_f).shuffle
+  ary500 = 500.times.map(&:to_f).shuffle
+  ary1000 = 1000.times.map(&:to_f).shuffle
+  ary2000 = 2500.times.map(&:to_f).shuffle
+  ary3000 = 2500.times.map(&:to_f).shuffle
+  ary5000 = 5000.times.map(&:to_f).shuffle
+  ary10000 = 10000.times.map(&:to_f).shuffle
+  ary20000 = 20000.times.map(&:to_f).shuffle
+  ary50000 = 50000.times.map(&:to_f).shuffle
+  ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+  ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_s).shuffle
+  ary10 = 10.times.map(&:to_s).shuffle
+  ary100 = 100.times.map(&:to_s).shuffle
+  ary500 = 500.times.map(&:to_s).shuffle
+  ary1000 = 1000.times.map(&:to_s).shuffle
+  ary2000 = 2500.times.map(&:to_s).shuffle
+  ary3000 = 2500.times.map(&:to_s).shuffle
+  ary5000 = 5000.times.map(&:to_s).shuffle
+  ary10000 = 10000.times.map(&:to_s).shuffle
+  ary20000 = 20000.times.map(&:to_s).shuffle
+  ary50000 = 50000.times.map(&:to_s).shuffle
+  ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.min: ary2.min
+  ary10.min: ary10.min
+  ary100.min: ary100.min
+  ary500.min: ary500.min
+  ary1000.min: ary1000.min
+  ary2000.min: ary2000.min
+  ary3000.min: ary3000.min
+  ary5000.min: ary5000.min
+  ary10000.min: ary10000.min
+  ary20000.min: ary20000.min
+  ary50000.min: ary50000.min
+  ary100000.min: ary100000.min
+  ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+  - ary.sample
+  - ary.sample(2)
diff --git a/benchmark/bm_array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
index 5f41ecc32b..5f41ecc32b 100644
--- a/benchmark/bm_array_sample_100k_10.rb
+++ b/benchmark/array_sample_100k_10.rb
diff --git a/benchmark/bm_array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
index 18b1715319..18b1715319 100644
--- a/benchmark/bm_array_sample_100k_11.rb
+++ b/benchmark/array_sample_100k_11.rb
diff --git a/benchmark/bm_array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
index 22863afe89..22863afe89 100644
--- a/benchmark/bm_array_sample_100k__100.rb
+++ b/benchmark/array_sample_100k__100.rb
diff --git a/benchmark/bm_array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
index 4cd79e6c67..4cd79e6c67 100644
--- a/benchmark/bm_array_sample_100k__1k.rb
+++ b/benchmark/array_sample_100k__1k.rb
diff --git a/benchmark/bm_array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
index b3d264249e..b3d264249e 100644
--- a/benchmark/bm_array_sample_100k__6k.rb
+++ b/benchmark/array_sample_100k__6k.rb
diff --git a/benchmark/bm_array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
index 5dd55ec058..5dd55ec058 100644
--- a/benchmark/bm_array_sample_100k___10k.rb
+++ b/benchmark/array_sample_100k___10k.rb
diff --git a/benchmark/bm_array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
index 1506732c3c..1506732c3c 100644
--- a/benchmark/bm_array_sample_100k___50k.rb
+++ b/benchmark/array_sample_100k___50k.rb
diff --git a/benchmark/bm_array_shift.rb b/benchmark/array_shift.rb
index 798bb9e3f4..798bb9e3f4 100644
--- a/benchmark/bm_array_shift.rb
+++ b/benchmark/array_shift.rb
diff --git a/benchmark/bm_array_small_and.rb b/benchmark/array_small_and.rb
index e53a6edae6..e53a6edae6 100644
--- a/benchmark/bm_array_small_and.rb
+++ b/benchmark/array_small_and.rb
diff --git a/benchmark/bm_array_small_diff.rb b/benchmark/array_small_diff.rb
index 9661ee48db..9661ee48db 100644
--- a/benchmark/bm_array_small_diff.rb
+++ b/benchmark/array_small_diff.rb
diff --git a/benchmark/bm_array_small_or.rb b/benchmark/array_small_or.rb
index c58b5fd1ff..c58b5fd1ff 100644
--- a/benchmark/bm_array_small_or.rb
+++ b/benchmark/array_small_or.rb
diff --git a/benchmark/bm_array_sort_block.rb b/benchmark/array_sort_block.rb
index 3579786056..3579786056 100644
--- a/benchmark/bm_array_sort_block.rb
+++ b/benchmark/array_sort_block.rb
diff --git a/benchmark/bm_array_sort_float.rb b/benchmark/array_sort_float.rb
index 9a6e2f8bd2..9a6e2f8bd2 100644
--- a/benchmark/bm_array_sort_float.rb
+++ b/benchmark/array_sort_float.rb
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+  ary2.sort: ary2.sort
+  ary10.sort: ary10.sort
+  ary100.sort: ary100.sort
+  ary1000.sort: ary1000.sort
+  ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+  class C
+    attr_accessor :x
+    def initialize
+      @x = nil
+    end
+    class_eval <<-END
+      def ar
+        #{'x;'*256}
+      end
+      def aw
+        #{'self.x = nil;'*256}
+      end
+      def arm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def awm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+    END
+  end
+  obj = C.new
+benchmark:
+  attr_reader: "obj.ar"
+  attr_writer: "obj.aw"
+  attr_reader_method: "obj.arm"
+  attr_writer_method: "obj.awm"
diff --git a/benchmark/bm_bighash.rb b/benchmark/bighash.rb
index e2ad5a5c94..e2ad5a5c94 100644
--- a/benchmark/bm_bighash.rb
+++ b/benchmark/bighash.rb
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index 2bd6acfaf8..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-#      https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
-  def initialize(x, y, z)
-    @x = x
-    @y = y
-    @z = z
-  end
-
-  attr_accessor :x, :y, :z
-
-  def vadd(b)
-    Vec.new(@x + b.x, @y + b.y, @z + b.z)
-  end
-
-  def vsub(b)
-    Vec.new(@x - b.x, @y - b.y, @z - b.z)
-  end
-
-  def vcross(b)
-    Vec.new(@y * b.z - @z * b.y,
-            @z * b.x - @x * b.z,
-            @x * b.y - @y * b.x)
-  end
-
-  def vdot(b)
-    @x * b.x + @y * b.y + @z * b.z
-  end
-
-  def vlength
-    Math.sqrt(@x * @x + @y * @y + @z * @z)
-  end
-
-  def vnormalize
-    len = vlength
-    v = Vec.new(@x, @y, @z)
-    if len > 1.0e-17 then
-      v.x = v.x / len
-      v.y = v.y / len
-      v.z = v.z / len
-    end
-    v
-  end
-end
-
-
-class Sphere
-  def initialize(center, radius)
-    @center = center
-    @radius = radius
-  end
-
-  attr_reader :center, :radius
-
-  def intersect(ray, isect)
-    rs = ray.org.vsub(@center)
-    b = rs.vdot(ray.dir)
-    c = rs.vdot(rs) - (@radius * @radius)
-    d = b * b - c
-    if d > 0.0 then
-      t = - b - Math.sqrt(d)
-
-      if t > 0.0 and t < isect.t then
-        isect.t = t
-        isect.hit = true
-        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
-                          ray.org.y + ray.dir.y * t,
-                          ray.org.z + ray.dir.z * t)
-        n = isect.pl.vsub(@center)
-        isect.n = n.vnormalize
-      else
-        0.0
-      end
-    end
-    nil
-  end
-end
-
-class Plane
-  def initialize(p, n)
-    @p = p
-    @n = n
-  end
-
-  def intersect(ray, isect)
-    d = -@p.vdot(@n)
-    v = ray.dir.vdot(@n)
-    v0 = v
-    if v < 0.0 then
-      v0 = -v
-    end
-    if v0 < 1.0e-17 then
-      return
-    end
-
-    t = -(ray.org.vdot(@n) + d) / v
-
-    if t > 0.0 and t < isect.t then
-      isect.hit = true
-      isect.t = t
-      isect.n = @n
-      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
-                        ray.org.y + t * ray.dir.y,
-                        ray.org.z + t * ray.dir.z)
-    end
-    nil
-  end
-end
-
-class Ray
-  def initialize(org, dir)
-    @org = org
-    @dir = dir
-  end
-
-  attr_accessor :org, :dir
-end
-
-class Isect
-  def initialize
-    @t = 10000000.0
-    @hit = false
-    @pl = Vec.new(0.0, 0.0, 0.0)
-    @n = Vec.new(0.0, 0.0, 0.0)
-  end
-
-  attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
-  i = f * 255.5
-  if i > 255.0 then
-    i = 255.0
-  end
-  if i < 0.0 then
-    i = 0.0
-  end
-  i.to_i
-end
-
-def otherBasis(basis, n)
-  basis[2] = Vec.new(n.x, n.y, n.z)
-  basis[1] = Vec.new(0.0, 0.0, 0.0)
-
-  if n.x < 0.6 and n.x > -0.6 then
-    basis[1].x = 1.0
-  elsif n.y < 0.6 and n.y > -0.6 then
-    basis[1].y = 1.0
-  elsif n.z < 0.6 and n.z > -0.6 then
-    basis[1].z = 1.0
-  else
-    basis[1].x = 1.0
-  end
-
-  basis[0] = basis[1].vcross(basis[2])
-  basis[0] = basis[0].vnormalize
-
-  basis[1] = basis[2].vcross(basis[0])
-  basis[1] = basis[1].vnormalize
-end
-
-class Scene
-  def initialize
-    @spheres = Array.new
-    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
-    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
-    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
-    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
-  end
-
-  def ambient_occlusion(isect)
-    basis = Array.new
-    otherBasis(basis, isect.n)
-
-    ntheta    = NAO_SAMPLES
-    nphi      = NAO_SAMPLES
-    eps       = 0.0001
-    occlusion = 0.0
-
-    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
-                isect.pl.y + eps * isect.n.y,
-                isect.pl.z + eps * isect.n.z)
-    nphi.times do |j|
-      ntheta.times do |i|
-        r = rand
-        phi = 2.0 * 3.14159265 * rand
-        x = Math.cos(phi) * Math.sqrt(1.0 - r)
-        y = Math.sin(phi) * Math.sqrt(1.0 - r)
-        z = Math.sqrt(r)
-
-        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
-        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
-        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
-        raydir = Vec.new(rx, ry, rz)
-        ray = Ray.new(p0, raydir)
-
-        occisect = Isect.new
-        @spheres[0].intersect(ray, occisect)
-        @spheres[1].intersect(ray, occisect)
-        @spheres[2].intersect(ray, occisect)
-        @plane.intersect(ray, occisect)
-        if occisect.hit then
-          occlusion = occlusion + 1.0
-        else
-          0.0
-        end
-      end
-    end
-
-    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
-    Vec.new(occlusion, occlusion, occlusion)
-  end
-
-  def render(w, h, nsubsamples)
-    cnt = 0
-    nsf = nsubsamples.to_f
-    h.times do |y|
-      w.times do |x|
-        rad = Vec.new(0.0, 0.0, 0.0)
-
-        # Subsampling
-        nsubsamples.times do |v|
-          nsubsamples.times do |u|
-
-            cnt = cnt + 1
-            wf = w.to_f
-            hf = h.to_f
-            xf = x.to_f
-            yf = y.to_f
-            uf = u.to_f
-            vf = v.to_f
-
-            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
-            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
-            eye = Vec.new(px, py, -1.0).vnormalize
-
-            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
-            isect = Isect.new
-            @spheres[0].intersect(ray, isect)
-            @spheres[1].intersect(ray, isect)
-            @spheres[2].intersect(ray, isect)
-            @plane.intersect(ray, isect)
-            if isect.hit then
-              col = ambient_occlusion(isect)
-              rad.x = rad.x + col.x
-              rad.y = rad.y + col.y
-              rad.z = rad.z + col.z
-            end
-          end
-        end
-
-        r = rad.x / (nsf * nsf)
-        g = rad.y / (nsf * nsf)
-        b = rad.z / (nsf * nsf)
-        printf("%c", clamp(r))
-        printf("%c", clamp(g))
-        printf("%c", clamp(b))
-      end
-      nil
-    end
-
-    nil
-  end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
-  printf("P6\n")
-  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
-  ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
-  <head> <%= title %> </head>
-  <body>
-    <h1> <%= title %> </h1>
-    <p>
-      <%= content %>
-    </p>
-  </body>
-</html>
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
deleted file mode 100644
index 34a7b2e725..0000000000
--- a/benchmark/bm_app_fib.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def fib n
-  if n < 3
-    1
-  else
-    fib(n-1) + fib(n-2)
-  end
-end
-
-fib(34)
-
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
-  nb.each{|x|
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      [-ROW, -1, 1, ROW].each{|d|
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      }
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  }
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  (0...ROW*COL).each{|i|
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  }
-end
-
-def pboard
-  return # skip print
-  print "No. #$no\n"
-  (0...COL).each{|i|
-    print "|"
-    (0...ROW-NP).each{|j|
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    }
-    print "\n"
-  }
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      x.each{|s|
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      }
-      if f == 0 then
-        x.each{|s|
-          $b[pos+s] = i
-        }
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        x.each{|s|
-          $b[pos+s] = -1
-        }
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
-  for x in nb
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      for d in [-ROW, -1, 1, ROW]
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      end
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  end
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  for i in 0...ROW*COL
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  end
-end
-
-def pboard
-  print "No. #$no\n"
-  for i in 0...COL
-    print "|"
-    for j in 0...ROW-NP
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    end
-    print "\n"
-  end
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      for s in x do
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      end
-      if f == 0 then
-        for s in x do
-          $b[pos+s] = i
-        end
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        for s in x do
-          $b[pos+s] = -1
-        end
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_erb_render.rb b/benchmark/bm_erb_render.rb
deleted file mode 100644
index d2929b0553..0000000000
--- a/benchmark/bm_erb_render.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-require 'erb'
-
-data = DATA.read
-max = 1_500_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-src = "def self.render(title, content); #{ERB.new(data).src}; end"
-mod = Module.new
-mod.instance_eval(src, "(ERB)")
-
-max.times do
-  mod.render(title, content)
-end
-
-__END__
-
-<html>
-  <head> <%= title %> </head>
-  <body>
-    <h1> <%= title %> </h1>
-    <p>
-      <%= content %>
-    </p>
-  </body>
-</html>
diff --git a/benchmark/bm_file_rename.rb b/benchmark/bm_file_rename.rb
deleted file mode 100644
index 3bf6a5ef35..0000000000
--- a/benchmark/bm_file_rename.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-# rename file
-require 'tempfile'
-
-max = 100_000
-tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
-a, b = tmp.map { |x| x.path }
-max.times do
-  File.rename(a, b)
-  File.rename(b, a)
-end
-tmp.each { |t| t.close! }
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
deleted file mode 100644
index d3375c744c..0000000000
--- a/benchmark/bm_loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 600000
-
-if defined? Fiber
-  gen = (1..max).each
-  loop do
-    gen.next
-  end
-else
-  require 'generator'
-  gen = Generator.new((0..max))
-  while gen.next?
-    gen.next
-  end
-end
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
deleted file mode 100644
index b8abc88f41..0000000000
--- a/benchmark/bm_require.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-1.upto(10000) do |i|
-  require "c#{i}"
-end
-
-$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
deleted file mode 100644
index e54db6c6e5..0000000000
--- a/benchmark/bm_require_thread.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-i=0
-t = Thread.new do
-  while true
-    i = i+1 # dummy loop
-  end
-end
-
-1.upto(100) do |i|
-  require "c#{i}"
-end
-
-$:.pop
-t.kill
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
-  x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
-  (n-1).step(0,-1) do |bi|
-    y[bi] += x.at(bi)
-  end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
-  i += 1
-  hello = ''
-  4_000_000.times do |e|
-    hello << STUFF
-  end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
-  tmp = input.read(4096) or break
-  data = tmp << (input.gets || "")
-  nc += data.length
-  nl += data.count("\n")
-  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
-  nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-class Hi_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-def some_function(num)
-  begin
-    hi_function(num)
-  rescue
-    print "We shouldn't get here, exception is: #{$!.type}\n"
-  end
-end
-
-def hi_function(num)
-  begin
-    lo_function(num)
-  rescue Hi_Exception
-    $HI = $HI + 1
-  end
-end
-
-def lo_function(num)
-  begin
-    blowup(num)
-  rescue Lo_Exception
-    $LO = $LO + 1
-  end
-end
-
-def blowup(num)
-  if num % 2 == 0
-    raise Lo_Exception.new(num)
-  else
-    raise Hi_Exception.new(num)
-  end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
-  i += 1
-  some_function(i+1)
-end
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
-    n, table = seq.length - length + 1, Hash.new(0)
-    f, i = nil, nil
-    (0 ... length).each do |f|
-        (f ... n).step(length) do |i|
-            table[seq[i,length]] += 1
-        end
-    end
-    [n,table]
-
-end
-
-def sort_by_freq( seq,length )
-    n,table = frecuency( seq,length )
-    a, b, v = nil, nil, nil
-    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-    end
-    puts
-end
-
-def find_seq( seq,s )
-    n,table = frecuency( seq,s.length )
-    puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
-    seq << line.chomp
-    line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
-    count = 1
-    mx = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            row[j] = count
-            count += 1
-        end
-        mx[bi] = row
-    end
-    mx
-end
-
-def mmult(rows, cols, m1, m2)
-    m3 = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            val = 0
-            (0 .. (cols - 1)).each do |k|
-                val += m1.at(bi).at(k) * m2.at(k).at(j)
-            end
-            row[j] = val
-        end
-        m3[bi] = row
-    end
-    m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
-    mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100755
index 8c136baa6c..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,563 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-#   http://shootout.alioth.debian.org
-#   contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM:  the main body is at the bottom.
-#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-#   2) see how I represent a board as a bitmask by reading the blank_board comments
-#   3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
-  # an array (by location) containing a bit mask for how the piece maps at the given location.
-  # if the rotation is invalid at that location the mask will contain false
-  attr_reader :start_masks
-
-  # maps a direction to a relative location.  these differ depending on whether it is an even or
-  # odd row being mapped from
-  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
-  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
-  def initialize( directions )
-    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
-    @even_mask = mask_for_offsets( @even_offsets)
-    @odd_mask = mask_for_offsets( @odd_offsets)
-
-    @start_masks = Array.new(60)
-
-    # create the rotational masks by placing the base mask at the location and seeing if
-    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
-    # is true the piece cannot be placed
-    0.upto(59) do | offset |
-      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
-      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
-        imask = compute_required( mask, offset)
-        @start_masks[offset] = [ mask, imask, imask | mask ]
-      else
-        @start_masks[offset] = false
-      end
-    end
-  end
-
-  def compute_required( mask, offset )
-    board = blank_board
-    0.upto(offset) { | i | board |= 1 << i }
-    board |= mask
-    return 0 if (!prunable(board | mask, offset))
-    board = flood_fill(board,58)
-    count = 0
-    imask = 0
-    0.upto(59) do | i |
-      if (board[i] == 0) then
-        imask |= (1 << i)
-        count += 1
-      end
-    end
-    (count > 0 && count < 5) ? imask : 0
-  end
-
-  def flood_fill( board, location)
-    return board if (board[location] == 1)
-    board |= 1 << location
-    row, col = location.divmod(6)
-    board = flood_fill( board, location - 1) if (col > 0)
-    board = flood_fill( board, location + 1) if (col < 4)
-    if (row % 2 == 0) then
-      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
-    else
-      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
-    end
-    board
-  end
-
-  # given a location, produces a list of relative locations covered by the piece at this rotation
-  def offsets( location)
-    if is_even( location) then
-      @even_offsets.collect { | value | value + location }
-    else
-      @odd_offsets.collect { | value | value + location }
-    end
-  end
-
-  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
-  # this is hard to explain. imagine we have this partial board:
-  #   0 0 0 0 0 x        [positions 0-5]
-  #    0 0 1 1 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 1 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # The top-left of the piece is at position 8, the
-  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
-  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
-  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
-  #   0 0 0 1 1 x        [positions 0-5]
-  #    0 0 1 0 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 0 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
-  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
-  # this function would return
-  def normalize_offsets( values)
-    min = values.min
-    even_min = is_even(min)
-    other_min = even_min ? min + 6 : min + 7
-    other_values = values.collect do | value |
-      if is_even(value) then
-        value + 6 - other_min
-      else
-        value + 7 - other_min
-      end
-    end
-    values.collect! { | value | value - min }
-
-    if even_min then
-      [values, other_values]
-    else
-      [other_values, values]
-    end
-  end
-
-  # produce a bitmask representation of an array of offset locations
-  def mask_for_offsets( offsets )
-    mask = 0
-    offsets.each { | value | mask = mask + ( 1 << value ) }
-    mask
-  end
-
-  # finds a "safe" position that a position as described by a list of directions can be placed
-  # without falling off any edge of the board.  the values returned a location to place the first piece
-  # at so it will fit after making the described moves
-  def start_adjust( directions )
-    south = east = 0;
-    directions.each do | direction |
-      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
-      south += 1 if ( direction == :nw || direction == :ne )
-    end
-    south * 6 + east
-  end
-
-  # given a set of directions places the piece (as defined by a set of directions) on the board at
-  # a location that will not take it off the edge
-  def get_values( directions )
-    start = start_adjust(directions)
-    values = [ start ]
-    directions.each do | direction |
-      if (start % 12 >= 6) then
-        start += @@rotation_odd_adder[direction]
-      else
-        start += @@rotation_even_adder[direction]
-      end
-      values += [ start ]
-    end
-
-    # some moves take you back to an existing location, we'll strip duplicates
-    values.uniq
-  end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-#   rotations -- all the rotations of the piece
-#   type -- a numeic "name" of the piece
-#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
-#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
-  attr_reader :rotations, :type, :masks
-  attr_accessor :placed
-
-  # transform hashes that change one direction into another when you either flip or rotate a set of directions
-  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
-  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
-  def initialize( directions, type )
-    @type = type
-    @rotations = Array.new();
-    @map = {}
-
-    generate_rotations( directions )
-    directions.collect! { | value | @@flip_converter[value] }
-    generate_rotations( directions )
-
-    # creates the masks AND a map that returns [location, rotation] for any given mask
-    # this is used when a board is found and we want to draw it, otherwise the map is unused
-    @masks = Array.new();
-    0.upto(59) do | i |
-      even = true
-      @masks[i] = @rotations.collect do | rotation |
-        mask = rotation.start_masks[i]
-        @map[mask[0]] = [ i, rotation ] if (mask)
-        mask || nil
-      end
-      @masks[i].compact!
-    end
-  end
-
-  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
-  def generate_rotations( directions )
-    6.times do
-      rotations.push( Rotation.new(directions))
-      directions.collect! { | value | @@rotate_converter[value] }
-    end
-  end
-
-  # given a board string, adds this piece to the board at whatever location/rotation
-  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
-  def fill_string( board_string)
-    location, rotation = @map[@placed]
-    rotation.offsets(location).each do | offset |
-      row, col = offset.divmod(6)
-      board_string[ row*5 + col, 1 ] = @type.to_s
-    end
-  end
-end
-
-# a blank bit board having this form:
-#
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
-  0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
-  0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
-  (location % 12) < 6
-end
-
-# support function that create three utility maps:
-#  $converter -- for each row an array that maps a five bit row (via array mapping)
-#                to the a five bit representation of the bits below it
-#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-#                   a region array has three values the first is a mask of bits in the region,
-#                   the second is the count of those bits and the third is identical to the first
-#                   examples:
-#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-#                           0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
-  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
-  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
-  all_odds = Array.new(0b100000)
-  all_evens = Array.new(0b100000)
-  bit_counts = Array.new(0b100000)
-  new_regions = Array.new(0b100000)
-  0.upto(0b11111) do | i |
-    bit_count = odd = even = 0
-    0.upto(4) do | bit |
-      if (i[bit] == 1) then
-        bit_count += 1
-        odd |= odd_map[bit]
-        even |= even_map[bit]
-      end
-    end
-    all_odds[i] = odd
-    all_evens[i] = even
-    bit_counts[i] = bit_count
-    new_regions[i] = create_regions( i)
-  end
-
-  $converter = []
-  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
-  $bit_counts = bit_counts
-  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five.  The following board is an example of a prunable board:
-#    0 0 1 0 0
-#     0 1 0 0 0
-#    1 1 0 0 0
-#     0 1 0 0 0
-#    0 0 0 0 0
-#       ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
-#   location -- starting location, everything above and to the left is already full
-#   slotting -- set to true only when testing initial pieces, when filling normally
-#               additional assumptions are possible
-#
-# Algorithm:
-#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
-#    maintainng counts of active open areas (kept in the collector array) each collector contains
-#    three values at the start of an iteration:
-#          0: mask of bits that would be adjacent to the collector in this row
-#          1: the number of bits collected so far
-#          2: a scratch space starting as zero, but used during the computation to represent
-#             the empty bits in the new row that are adjacent (position 0)
-#  The exact procedure is described in-code
-def prunable( board, location, slotting = false)
-  collectors = []
-  # loop across the rows
-  (location / 6).to_i.upto(9) do | row_on |
-    # obtain a set of regions representing the bits of the current row.
-    regions = $regions[(board >> (row_on * 6)) & 0b11111]
-    converter = $converter[row_on]
-
-    # track the number of collectors at the start of the cycle so that
-    # we don't compute against newly created collectors, only existing collectors
-    initial_collector_count = collectors.length
-
-    # loop against the regions.  For each region of the row
-    # we will see if it connects to one or more existing collectors.
-    # if it connects to 1 collector, the bits from the region are added to the
-    # bits of the collector and the mask is placed in collector[2]
-    # If the region overlaps more than one collector then all the collectors
-    # it overlaps with are merged into the first one (the others are set to nil in the array)
-    # if NO collectors are found then the region is copied as a new collector
-    regions.each do | region |
-      collector_found = nil
-      region_mask = region[2]
-      initial_collector_count.times do | collector_num |
-        collector = collectors[collector_num]
-        if (collector) then
-          collector_mask = collector[0]
-          if (collector_mask & region_mask != 0) then
-            if (collector_found) then
-              collector_found[0] |= collector_mask
-              collector_found[1] += collector[1]
-              collector_found[2] |= collector[2]
-              collectors[collector_num] = nil
-            else
-              collector_found = collector
-              collector[1] += region[1]
-              collector[2] |= region_mask
-            end
-          end
-        end
-      end
-      if (collector_found == nil) then
-        collectors.push(Array.new(region))
-      end
-    end
-
-    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
-    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
-    # the board is prunable.  if it is a multiple of five it is removed.
-    # Collector that are still active have a new adjacent value [0] set based n the matched bits
-    # and have [2] cleared out for the next cycle.
-    collectors.length.times do | collector_num |
-      collector = collectors[collector_num]
-      if (collector) then
-        if (collector[2] == 0) then
-          return true if (collector[1] % 5 != 0)
-          collectors[collector_num] = nil
-        else
-          # if a collector matches all bits in the row then we can return unprunable early for the
-          # following reasons:
-          #    1) there can be no more unavailable bits bince we fill from the top left downward
-          #    2) all previous regions have been closed or joined so only this region can fail
-          #    3) this region must be good since there can never be only 1 region that is nuot
-          #       a multiple of five
-          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
-          # in pieces to see what configurations work for them (the only other time this algorithm is used).
-          return false if (collector[2] == 0b11111 && !slotting)
-          collector[0] = converter[collector[2]]
-          collector[2] = 0
-        end
-      end
-    end
-
-    # get rid of all the empty converters for the next round
-    collectors.compact!
-  end
-  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
-  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask.  see prunable for what a "region" is
-def create_regions( value )
-  regions = []
-  cur_region = 0
-  5.times do | bit |
-    if (value[bit] == 0) then
-      cur_region |= 1 << bit
-    else
-      if (cur_region != 0 ) then
-        regions.push( cur_region)
-        cur_region = 0;
-      end
-    end
-  end
-  regions.push(cur_region) if (cur_region != 0)
-  regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
-  find_top( 1)
-  find_top( 0)
-  print_results
-end
-
-# show the board
-def print_results
-  print "#{@boards_found} solutions found\n\n"
-  print_full_board( @min_board)
-  print "\n"
-  print_full_board( @max_board)
-  print "\n"
-end
-
-# finds solutions.  This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece.  It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
-#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
-#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
-#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
-#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-#   maximum number
-def find_top( rotation_skip)
-  board = blank_board
-  (@pieces.length-1).times do
-    piece = @pieces.shift
-    piece.masks[0].each do | mask, imask, cmask |
-      if ((rotation_skip += 1) % 2 == 0) then
-        piece.placed = mask
-        find( 1, 1, board | mask)
-      end
-    end
-    @pieces.push(piece)
-  end
-  piece = @pieces.shift
-  @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-#  start_location -- where to start looking for place for the next piece at
-#  placed -- number of pieces placed
-#  board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
-  # find the next location to place a piece by looking for an empty bit
-  while board[start_location] == 1
-    start_location += 1
-  end
-
-  @pieces.length.times do
-    piece = @pieces.shift
-    piece.masks[start_location].each do | mask, imask, cmask |
-      if ( board & cmask == imask) then
-        piece.placed = mask
-        if (placed == 9) then
-          add_board
-        else
-          find( start_location + 1, placed + 1, board | mask)
-        end
-      end
-    end
-    @pieces.push(piece)
-  end
-end
-
-# print the board
-def print_full_board( board_string)
-  10.times do | row |
-    print " " if (row % 2 == 1)
-    5.times do | col |
-      print "#{board_string[row*5 + col,1]} "
-    end
-    print "\n"
-  end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
-  board_string = "99999999999999999999999999999999999999999999999999"
-  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
-  save( board_string)
-  save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
-  if (@all_boards[board_string] == nil) then
-    @min_board = board_string if (board_string < @min_board)
-    @max_board = board_string if (board_string > @max_board)
-    @all_boards.store(board_string,true)
-    @boards_found += 1
-
-    # the exit motif is a time saver.  Ideally the function should return, but those tests
-    # take noticeable time (performance).
-    if (@boards_found == @stop_count) then
-      print_results
-      exit(0)
-    end
-  end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
-  Piece.new( [ :nw, :ne, :east, :east ], 2),
-  Piece.new( [ :ne, :se, :east, :ne ], 7),
-  Piece.new( [ :ne, :east, :ne, :nw ], 1),
-  Piece.new( [ :east, :sw, :sw, :se ], 6),
-  Piece.new( [ :east, :ne, :se, :ne ], 5),
-  Piece.new( [ :east, :east, :east, :se ], 0),
-  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
-  Piece.new( [ :se, :se, :se, :west ], 9),
-  Piece.new( [ :se, :se, :east, :se ], 8),
-  Piece.new( [ :east, :east, :sw, :se ], 3)
-  ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
-  @x, @y, @z = x, y, z
-  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-  @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
-  while i < nbodies
-   b2 = bodies[i]
-   dx = @x - b2.x
-   dy = @y - b2.y
-   dz = @z - b2.z
-
-   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-   mag = dt / (distance * distance * distance)
-   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-   @vx -= dx * b2_mass_mag
-   @vy -= dy * b2_mass_mag
-   @vz -= dz * b2_mass_mag
-   b2.vx += dx * b_mass_mag
-   b2.vy += dy * b_mass_mag
-   b2.vz += dz * b_mass_mag
-   i += 1
-  end
-
-  @x += dt * @vx
-  @y += dt * @vy
-  @z += dt * @vz
- end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
-    n.times do
-        n.times do
-            n.times do
-                n.times do
-                    n.times do
-                        x += 1
-                    end
-                end
-            end
-        end
-    end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
-    def initialize(start_state)
-        @bool = start_state
-    end
-
-    def value
-        @bool
-    end
-
-    def activate
-        @bool = !@bool
-        self
-    end
-end
-
-class NthToggle < Toggle
-    def initialize(start_state, max_counter)
-        super start_state
-        @count_max = max_counter
-        @counter = 0
-    end
-
-    def activate
-        @counter += 1
-        if @counter >= @count_max
-            @bool = !@bool
-            @counter = 0
-        end
-        self
-    end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
-    toggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
-    ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
-  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
-  stringlen=seq.length
-  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
-  if $_ =~ />/
-    if seq.length != 0
-      revcomp(seq.join)
-      seq=Array.new
-    end
-    puts $_
-  else
-    $_.sub(/\n/,'')
-    seq.push $_
-  end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_reader :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = obj.a
-  k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_accessor :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  obj.a = 1
-  obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m{
-  }
-end
diff --git a/benchmark/bm_vm1_blockparam.rb b/benchmark/bm_vm1_blockparam.rb
deleted file mode 100755
index 11680a2e61..0000000000
--- a/benchmark/bm_vm1_blockparam.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m &b
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m{}
-end
-
diff --git a/benchmark/bm_vm1_blockparam_call.rb b/benchmark/bm_vm1_blockparam_call.rb
deleted file mode 100755
index f6102a2b5a..0000000000
--- a/benchmark/bm_vm1_blockparam_call.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m &b
-  b.call
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m{}
-end
diff --git a/benchmark/bm_vm1_blockparam_pass.rb b/benchmark/bm_vm1_blockparam_pass.rb
deleted file mode 100755
index 10029a257a..0000000000
--- a/benchmark/bm_vm1_blockparam_pass.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-def bp_yield
-  yield
-end
-
-def bp_pass &b
-  bp_yield &b
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  bp_pass{}
-end
diff --git a/benchmark/bm_vm1_blockparam_yield.rb b/benchmark/bm_vm1_blockparam_yield.rb
deleted file mode 100755
index 6dc01ced7c..0000000000
--- a/benchmark/bm_vm1_blockparam_yield.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def bp_yield &b
-  yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  bp_yield{}
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = Const
-  k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
-  i += 1
-  begin
-    begin
-    ensure
-    end
-  ensure
-  end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
-  i += 1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
-  if n == 0
-    ''
-  else
-    10.times{
-      h[Object.new] = nested_hash(h, n-1)
-    }
-  end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 1b030386cf..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_ary[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index ebc369a60f..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index 96f4261915..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
-  attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_obj.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index 674c413992..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
-  attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = @a
-  k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  @a = 1
-  @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a.length
-  b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
-  unless v
-    # unreachable code
-    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
-    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
-    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
-    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
-    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
-  end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
-  i += 1
-  m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  begin
-  rescue
-  end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  i = 0
-  while i<30_000_000 # while loop 1
-    i += 1
-    yield
-  end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-  ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
-  i += 1
-  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
-  case :foo
-  when :bar
-    raise
-  when :baz
-    raise
-  when :boo
-    raise
-  when :foo
-    i += 1
-  end
-end
-
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
deleted file mode 100644
index c62b294e0e..0000000000
--- a/benchmark/bm_vm2_case_lit.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-i = 0
-@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
-def foo(i)
-  @ret[i % @ret.size]
-end
-
-while i<6_000_000 # while loop 2
-  case foo(i)
-  when "foo" then :foo
-  when true then true
-  when false then false
-  when :sym then :sym
-  when 6 then :fix
-  when nil then nil
-  when 0.1 then :float
-  when 0xffffffffffffffff then :big
-  end
-  i += 1
-end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
-  define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
deleted file mode 100644
index 58c0f7bbc3..0000000000
--- a/benchmark/bm_vm2_dstr.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-x = y = 'z'
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  str = "foo#{x}bar#{y}baz"
-end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 307cfc28ef..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  eval("1")
-end
-
diff --git a/benchmark/bm_vm2_fiber_switch.rb b/benchmark/bm_vm2_fiber_switch.rb
deleted file mode 100644
index c6f615d71d..0000000000
--- a/benchmark/bm_vm2_fiber_switch.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
-fib = Fiber.new do
-  loop { Fiber.yield }
-end
-i = 0
-while i< 6_000_000 # benchmark loop 2
-  i += 1
-  fib.resume
-end
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index a8ccff7138..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def method_missing mid
-  end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_module_ann_const_set.rb b/benchmark/bm_vm2_module_ann_const_set.rb
deleted file mode 100644
index 12ccfd2ff3..0000000000
--- a/benchmark/bm_vm2_module_ann_const_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  Module.new.const_set(:X, Module.new)
-end
diff --git a/benchmark/bm_vm2_module_const_set.rb b/benchmark/bm_vm2_module_const_set.rb
deleted file mode 100644
index f4d4c1b2e7..0000000000
--- a/benchmark/bm_vm2_module_const_set.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-module M
-end
-$VERBOSE = nil
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  M.const_set(:X, Module.new)
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 5d16480c6b..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Thread::Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
deleted file mode 100644
index 6422c9b0d0..0000000000
--- a/benchmark/bm_vm2_newlambda.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  lambda {}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_poly_singleton.rb b/benchmark/bm_vm2_poly_singleton.rb
deleted file mode 100644
index 0dba4320c4..0000000000
--- a/benchmark/bm_vm2_poly_singleton.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C1
-  def m; 1; end
-end
-
-o1 = C1.new
-o2 = C1.new
-o2.singleton_class
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
-  b
-end
-
-pr = m{
-  a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 1
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 10
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
-  /hoge/ =~ str
-  i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def m
-  end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
deleted file mode 100644
index 1d73036849..0000000000
--- a/benchmark/bm_vm2_string_literal.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
deleted file mode 100644
index fff940a80a..0000000000
--- a/benchmark/bm_vm2_struct_big_href_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:z]
-end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
deleted file mode 100644
index 5e4085d59d..0000000000
--- a/benchmark/bm_vm2_struct_big_href_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k]
-end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
deleted file mode 100644
index 9c0cee4141..0000000000
--- a/benchmark/bm_vm2_struct_big_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a = i
-end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
deleted file mode 100644
index 2c88fee6bf..0000000000
--- a/benchmark/bm_vm2_struct_small_href.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a]
-end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
deleted file mode 100644
index 33c36d20f1..0000000000
--- a/benchmark/bm_vm2_struct_small_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a] = 1
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
-  def m
-    1
-  end
-end
-
-class CC < C
-  def m
-    super()
-  end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  obj.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
-  def m a
-    1
-  end
-end
-
-class CC < C
-  def m a
-    super
-  end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
-  obj.m 10
-  i += 1
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644
index c993accdda..0000000000
--- a/benchmark/bm_vm_thread_alive_check1.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5_000.times{
-  t = Thread.new{}
-  while t.alive?
-    Thread.pass
-  end
-}
diff --git a/benchmark/bm_vm_thread_condvar1.rb b/benchmark/bm_vm_thread_condvar1.rb
deleted file mode 100644
index cf5706b23e..0000000000
--- a/benchmark/bm_vm_thread_condvar1.rb
+++ /dev/null
@@ -1,28 +0,0 @@
-# two threads, two mutex, two condvar ping-pong
-require 'thread'
-m1 = Mutex.new
-m2 = Mutex.new
-cv1 = ConditionVariable.new
-cv2 = ConditionVariable.new
-max = 100000
-i = 0
-wait = nil
-m2.synchronize do
-  wait = Thread.new do
-    m1.synchronize do
-      m2.synchronize { cv2.signal }
-      while (i += 1) < max
-        cv1.wait(m1)
-        cv2.signal
-      end
-    end
-  end
-  cv2.wait(m2)
-end
-m1.synchronize do
-  while i < max
-    cv1.signal
-    cv2.wait(m1)
-  end
-end
-wait.join
diff --git a/benchmark/bm_vm_thread_condvar2.rb b/benchmark/bm_vm_thread_condvar2.rb
deleted file mode 100644
index 7c8dc19481..0000000000
--- a/benchmark/bm_vm_thread_condvar2.rb
+++ /dev/null
@@ -1,35 +0,0 @@
-# many threads, one mutex, many condvars
-require 'thread'
-m = Mutex.new
-cv1 = ConditionVariable.new
-cv2 = ConditionVariable.new
-max = 1000
-n = 100
-waiting = 0
-scvs = []
-waiters = n.times.map do |i|
-  start_cv = ConditionVariable.new
-  scvs << start_cv
-  start_mtx = Mutex.new
-  start_mtx.synchronize do
-    th = Thread.new(start_mtx, start_cv) do |sm, scv|
-      m.synchronize do
-        sm.synchronize { scv.signal }
-        max.times do
-          cv2.signal if (waiting += 1) == n
-          cv1.wait(m)
-        end
-      end
-    end
-    start_cv.wait(start_mtx)
-    th
-  end
-end
-m.synchronize do
-  max.times do
-    cv2.wait(m) until waiting == n
-    waiting = 0
-    cv1.broadcast
-  end
-end
-waiters.each(&:join)
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
deleted file mode 100644
index b5b3c0bc85..0000000000
--- a/benchmark/bm_vm_thread_pass.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# Plenty Thtread.pass
-# A performance may depend on GVL implementation.
-
-tmax = (ARGV.shift || 2).to_i
-lmax = 200_000 / tmax
-
-(1..tmax).map{
-  Thread.new{
-    lmax.times{
-      Thread.pass
-    }
-  }
-}.each{|t| t.join}
-
-
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
deleted file mode 100644
index a660aafc18..0000000000
--- a/benchmark/bm_vm_thread_pass_flood.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-# n.b. this is a good test for GVL when pinned to a single CPU
-
-1000.times{
-  Thread.new{loop{Thread.pass}}
-}
-
-i = 0
-while i<10000
-  i += 1
-end
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
deleted file mode 100644
index 274ceda366..0000000000
--- a/benchmark/bm_vm_thread_queue.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-require 'thread'
-
-n = 1_000_000
-q = Thread::Queue.new
-consumer = Thread.new{
-  while q.pop
-    # consuming
-  end
-}
-
-producer = Thread.new{
-  n.times{
-    q.push true
-  }
-  q.push nil
-}
-
-consumer.join
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  array = string.bytes
+  buffer = IO::Buffer.for(string)
+benchmark:
+  string.each_byte: |
+    upcased = String.new
+    string.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
+  array.each: |
+    upcased = String.new
+    array.each do |byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each: |
+    upcased = String.new
+    buffer.each(:U8) do |offset, byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each_byte: |
+    upcased = String.new
+    buffer.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  buffer = IO::Buffer.for(string)
+  format = [:U32, :U32, :U32, :U32]
+benchmark:
+  string.unpack1: |
+    [
+      string.unpack1("N"),
+      string.unpack1("N", offset: 4),
+      string.unpack1("N", offset: 8),
+      string.unpack1("N", offset: 12),
+    ]
+  buffer.get_value: |
+    [
+      buffer.get_value(:U32, 0),
+      buffer.get_value(:U32, 4),
+      buffer.get_value(:U32, 8),
+      buffer.get_value(:U32, 12),
+    ]
+  buffer.get_values: |
+    buffer.get_values(format, 0)
+  string.unpack: |
+    string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'cgi/escape'
+benchmark:
+  - script: CGI.escapeHTML("")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcde")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcd<")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: CGI.escapeHTML(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: CGI.escapeHTML(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: CGI.escapeHTML(example_html)
+    loop_count: 1000000
diff --git a/benchmark/class_superclass.yml b/benchmark/class_superclass.yml
new file mode 100644
index 0000000000..847ff811f1
--- /dev/null
+++ b/benchmark/class_superclass.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class SimpleClass; end
+  class OneModuleClass
+    1.times { include Module.new }
+  end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+benchmark:
+  object_class_superclass: |
+    Object.superclass
+  simple_class_superclass: |
+    SimpleClass.superclass
+  one_module_class: |
+    OneModuleClass.superclass
+  medium_class_superclass: |
+    MediumClass.superclass
+  large_class_superclass: |
+    LargeClass.superclass
+loop_count: 20000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+  [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+  constants
+
+  # With previous behavior, this would cause all of the constant caches
+  # associated with the constant lookups listed above to invalidate, meaning
+  # they would all have to be fetched again. With current behavior, it only
+  # invalidates when a name matches, so the following constant set shouldn't
+  # impact the constant lookups listed above.
+  INVALIDATE = true
+end
diff --git a/benchmark/bm_dir_empty_p.rb b/benchmark/dir_empty_p.rb
index 8329c757cf..8329c757cf 100644
--- a/benchmark/bm_dir_empty_p.rb
+++ b/benchmark/dir_empty_p.rb
diff --git a/benchmark/dir_pwd.yml b/benchmark/dir_pwd.yml
new file mode 100644
index 0000000000..c435d3ac5e
--- /dev/null
+++ b/benchmark/dir_pwd.yml
@@ -0,0 +1,2 @@
+benchmark:
+  pwd: Dir.pwd
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100755
index 469fc99f40..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,441 +0,0 @@
-#!/usr/bin/env ruby
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
-  require 'optparse'
-rescue LoadError
-  if first
-    first = false
-    $:.unshift File.join(File.dirname(__FILE__), '../lib')
-    retry
-  else
-    raise
-  end
-end
-
-require 'benchmark'
-require 'pp'
-require 'tempfile'
-
-class BenchmarkDriver
-  def self.benchmark(opt)
-    driver = self.new(opt[:execs], opt[:dir], opt)
-    begin
-      driver.run
-    ensure
-      driver.show_results
-    end
-  end
-
-  def self.load(input, type, opt)
-    case type
-    when 'yaml'
-      require 'yaml'
-      h = YAML.load(input)
-    when 'json'
-      require 'json'
-      h = JSON.load(input)
-    else
-      h = eval(input.read)
-    end
-    results = h[:results] || h["results"]
-    obj = allocate
-    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
-    obj.instance_variable_set("@results", results)
-    obj.instance_variable_set("@opt", opt)
-    [1, 2].each do |i|
-      loop = results.assoc((n = "loop_whileloop#{i}").intern) || results.assoc(n)
-      obj.instance_variable_set("@loop_wl#{i}", loop ? loop[1].map {|t,*|t} : nil)
-    end
-    obj.instance_variable_set("@measure_target", opt[:measure_target] || opt["measure_target"])
-    obj
-  end
-
-  def output *args
-    puts(*args)
-    @output and @output.puts(*args)
-  end
-
-  def message *args
-    output(*args) if @verbose
-  end
-
-  def message_print *args
-    if @verbose
-      print(*args)
-      STDOUT.flush
-      @output and @output.print(*args)
-    end
-  end
-
-  def progress_message *args
-    unless STDOUT.tty?
-      STDERR.print(*args)
-      STDERR.flush
-    end
-  end
-
-  def initialize execs, dir, opt = {}
-    @execs = execs.map{|e|
-      e.strip!
-      next if e.empty?
-
-      if /(.+)::(.+)/ =~ e
-        # ex) ruby-a::/path/to/ruby-a
-        label = $1.strip
-        path = $2
-        version = `#{path} -v`.chomp
-      else
-        path = e
-        version = label = `#{path} -v`.chomp
-      end
-      [path, label, version]
-    }.compact
-
-    @dir = dir
-    @repeat = opt[:repeat] || 1
-    @repeat = 1 if @repeat < 1
-    @pattern = opt[:pattern] || nil
-    @exclude = opt[:exclude] || nil
-    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
-    @output = opt[:output] ? open(opt[:output], 'w') : nil
-    @loop_wl1 = @loop_wl2 = nil
-    @ruby_arg = opt[:ruby_arg] || nil
-    @measure_target = opt[:measure_target]
-    @opt = opt
-
-    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
-    @results = []
-
-    if @verbose
-      @start_time = Time.now
-      message @start_time
-      @execs.each_with_index{|(path, label, version), i|
-        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
-      }
-      message "measure target: #{@measure_target}"
-    end
-  end
-
-  def adjusted_results name, results
-    s = nil
-    results.each_with_index{|e, i|
-      r = e.min
-      case name
-      when /^vm1_/
-        if @loop_wl1
-          r -= @loop_wl1[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      when /^vm2_/
-        if @loop_wl2
-          r -= @loop_wl2[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      end
-      yield r
-    }
-    s
-  end
-
-  def show_results
-    case @opt[:format]
-    when :tsv
-      strformat = "\t%1$s"
-      numformat = "\t%1$*2$.3f"
-      minwidth = 0
-      name_width = 0
-    when :markdown
-      markdown = true
-      strformat = "|%1$-*2$s"
-      numformat = "|%1$*2$.3f"
-    when :plain
-      strformat = " %1$-*2$s"
-      numformat = " %1$*2$.3f"
-    end
-
-    name_width ||= @results.map {|v, result|
-      v.size + (case v; when /^vm1_/; @loop_wl1; when /^vm2_/; @loop_wl2; end ? 1 : 0)
-    }.max
-    minwidth ||= 7
-    width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
-    output
-
-    if @verbose
-      message '-----------------------------------------------------------'
-      message 'raw data:'
-      message
-      message PP.pp(@results, "", 79)
-      message
-      message "Elapsed time: #{Time.now - @start_time} (sec)"
-    end
-
-    if rawdata_output = @opt[:rawdata_output]
-      h = {}
-      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
-      h[:executables] = @execs
-      h[:results] = @results
-      if (type = File.extname(rawdata_output)).empty?
-        type = rawdata_output
-        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
-      end
-      case type
-      when 'yaml'
-        require 'yaml'
-        h = YAML.dump(h)
-      when 'json'
-        require 'json'
-        h = JSON.pretty_generate(h)
-      else
-        require 'pp'
-        h = h.pretty_inspect
-      end
-      open(rawdata_output, 'w') {|f| f.puts h}
-    end
-
-    output '-----------------------------------------------------------'
-    output 'benchmark results:'
-
-    if @verbose and @repeat > 1
-      output "minimum results in each #{@repeat} measurements."
-    end
-
-    output({
-      real: "Execution time (sec)",
-      peak: "Memory usage (peak) (B)",
-      size: "Memory usage (last size) (B)",
-    }[@measure_target])
-    output if markdown
-    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
-    @results.each{|v, result|
-      rets = []
-      s = adjusted_results(v, result){|r|
-        rets << sprintf(numformat, r, width[rets.size])
-      }
-      v += s if s
-      output [v.ljust(name_width), rets].join("")
-    }
-
-    if @execs.size > 1
-      output
-      output({
-        real: "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)",
-        peak: "Memory consuming ratio (peak) with the result of `#{@execs[0][1]}' (greater is better)",
-        size: "Memory consuming ratio (size) with the result of `#{@execs[0][1]}' (greater is better)",
-      }[@measure_target])
-      output if markdown
-      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
-      @results.each{|v, result|
-        rets = []
-        first_value = nil
-        s = adjusted_results(v, result){|r|
-          if first_value
-            if r == 0
-              rets << "Error"
-            else
-              rets << sprintf(numformat, first_value/Float(r), width[rets.size+1])
-            end
-          else
-            first_value = r
-          end
-        }
-        v += s if s
-        output [v.ljust(name_width), rets].join("")
-      }
-    end
-
-    if @opt[:output]
-      output
-      output "Log file: #{@opt[:output]}"
-    end
-  end
-
-  def files
-    flag = {}
-    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
-      next if @pattern && /#{@pattern}/ !~ File.basename(file)
-      next if @exclude && /#{@exclude}/ =~ File.basename(file)
-      case file
-      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
-        flag[$1] = true
-      end
-      file
-    }.compact
-
-    if flag['vm1'] && !flag['whileloop']
-      @files << File.join(@dir, 'bm_loop_whileloop.rb')
-    elsif flag['vm2'] && !flag['whileloop2']
-      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
-    end
-
-    @files.sort!
-    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
-    @files
-  end
-
-  def run
-    files.each_with_index{|file, i|
-      @i = i
-      r = measure_file(file)
-
-      if /bm_loop_whileloop.rb/ =~ file
-        @loop_wl1 = r[1].map{|e| e.min}
-      elsif /bm_loop_whileloop2.rb/ =~ file
-        @loop_wl2 = r[1].map{|e| e.min}
-      end
-    }
-  end
-
-  def measure_file file
-    name = File.basename(file, '.rb').sub(/^bm_/, '')
-    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
-    load prepare_file if FileTest.exist?(prepare_file)
-
-    if @verbose
-      output
-      output '-----------------------------------------------------------'
-      output name
-      output
-      output File.read(file)
-      output
-    end
-
-    result = [name]
-    result << @execs.map{|(e, v)|
-      (0...@repeat).map{
-        message_print "#{v}\t"
-        progress_message '.'
-
-        m = measure(e, file)
-        message "#{m}"
-        m
-      }
-    }
-    @results << result
-    result
-  end
-
-  unless defined?(File::NULL)
-    if File.exist?('/dev/null')
-      File::NULL = '/dev/null'
-    end
-  end
-
-  def measure executable, file
-    case @measure_target
-    when :real
-      cmd = "#{executable} #{@ruby_arg} #{file}"
-      m = Benchmark.measure{
-        system(cmd, out: File::NULL)
-      }
-      result = m.real
-    when :peak, :size
-      tmp = Tempfile.new("benchmark-memory-wrapper-data")
-      wrapper = "#{File.join(__dir__, 'memory_wrapper.rb')} #{tmp.path} #{@measure_target}"
-      cmd = "#{executable} #{@ruby_arg} #{wrapper} #{file}"
-      system(cmd, out: File::NULL)
-      result = tmp.read.to_i
-      tmp.close
-    else
-      raise "unknown measure target"
-    end
-
-    if $? != 0
-      raise $?.inspect if $? && $?.signaled?
-      output "\`#{cmd}\' exited with abnormal status (#{$?})"
-      0
-    else
-      result
-    end
-  end
-end
-
-if __FILE__ == $0
-  opt = {
-    :execs => [],
-    :dir => File.dirname(__FILE__),
-    :repeat => 1,
-    :measure_target => :real,
-    :output => nil,
-    :raw_output => nil,
-    :format => :tsv,
-  }
-  formats = {
-    :tsv => ".tsv",
-    :markdown => ".md",
-    :plain => ".txt",
-  }
-
-  parser = OptionParser.new{|o|
-    o.on('-e', '--executables [EXECS]',
-      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
-       e.split(/;/).each{|path|
-         opt[:execs] << path
-       }
-    }
-    o.on('--rbenv [VERSIONS]', 'Specify benchmark targets with rbenv version (vX.X.X;vX.X.X;...)'){|v|
-      v.split(/;/).each{|version|
-        opt[:execs] << "#{version}::#{`RBENV_VERSION='#{version}' rbenv which ruby`.rstrip}"
-      }
-    }
-    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
-      opt[:dir] = d
-    }
-    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
-      opt[:pattern] = p
-    }
-    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
-      opt[:exclude] = e
-    }
-    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
-      opt[:repeat] = n.to_i
-    }
-    o.on('-o', '--output-file [FILE]', "Output file"){|f|
-      opt[:output] = f
-    }
-    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
-      opt[:ruby_arg] = a
-    }
-    o.on('--measure-target [TARGET]', 'real (execution time), peak, size (memory)'){|mt|
-      opt[:measure_target] = mt.to_sym
-    }
-    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
-      opt[:rawdata_output] = r
-    }
-    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
-      opt[:rawdata_input] = r
-    }
-    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
-      opt[:format] = r
-    }
-    o.on('-v', '--verbose'){|v|
-      opt[:verbose] = v
-    }
-    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
-      opt[:quiet] = q
-      opt[:verbose] = false
-    }
-  }
-
-  parser.parse!(ARGV)
-
-  if input = opt[:rawdata_input]
-    b = open(input) {|f|
-      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
-    }
-    b.show_results
-  else
-    opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
-    BenchmarkDriver.benchmark(opt)
-  end
-end
-
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+  num = (1..).lazy.take(100)
+  ary2 = [[1,2]].cycle.lazy.take(10)
+  ary10 = [[*1..10]].cycle.lazy.take(10)
+  ary20 = [[*1..20]].cycle.lazy.take(10)
+  ary50 = [[*1..50]].cycle.lazy.take(10)
+  ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+  num3: num.flat_map {|x| x}.take(3).to_a
+  num10: num.flat_map {|x| x}.take(3).to_a
+  ary2:  ary2.flat_map {|x| x}.take(3).to_a
+  ary10: ary10.flat_map {|x| x}.take(3).to_a
+  ary20: ary20.flat_map {|x| x}.take(3).to_a
+  ary50: ary50.flat_map {|x| x}.take(3).to_a
+  ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+  a = (1..3).lazy
+  b = a.map {|x| x}
+
+benchmark:
+  first_ary: a.zip(["a", "b", "c"]).first
+  first_nonary: a.zip("a".."c").first
+  first_noarg: a.zip.first
+
+  take3_ary: a.zip(["a", "b", "c"]).take(3).force
+  take3_nonary: a.zip("a".."c").take(3).force
+  take3_noarg: a.zip.take(3).force
+
+  chain-first_ary: b.zip(["a", "b", "c"]).first
+  chain-first_nonary: b.zip("a".."c").first
+  chain-first_noarg: b.zip.first
+
+  chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+  chain-take3_nonary: b.zip("a".."c").take(3).force
+  chain-take3_noarg: b.zip.take(3).force
+
+  block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.min: set2.min
+  set10.min: set10.min
+  set100.min: set100.min
+  set1000.min: set1000.min
+  set10000.min: set10000.min
+  set2.max: set2.max
+  set10.max: set10.max
+  set100.max: set100.max
+  set1000.max: set1000.max
+  set10000.max: set10000.max
+  set2.minmax: set2.minmax
+  set10.minmax: set10.minmax
+  set100.minmax: set100.minmax
+  set1000.minmax: set1000.minmax
+  set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.sort_by: set2.sort_by { 0 }
+  set10.sort_by: set10.sort_by { 0 }
+  set100.sort_by: set100.sort_by { 0 }
+  set1000.sort_by: set1000.sort_by { 0 }
+  set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_sort_by.yml b/benchmark/enum_sort_by.yml
new file mode 100644
index 0000000000..d386353888
--- /dev/null
+++ b/benchmark/enum_sort_by.yml
@@ -0,0 +1,53 @@
+prelude: |
+  array_length = 2
+  fixnum_array2 = array_length.times.to_a.map {rand(10000)}
+  float_array2 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array2 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array2 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array2 =array_length.times.to_a.map {0}
+
+  array_length = 10
+  fixnum_array10 = array_length.times.to_a.map {rand(10000)}
+  float_array10 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array10 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array10 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array10 =array_length.times.to_a.map {0}
+
+  array_length = 1000
+  fixnum_array1000 = array_length.times.to_a.map {rand(10000)}
+  float_array1000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array1000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array1000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array1000 =array_length.times.to_a.map {0}
+
+  array_length = 100000
+  fixnum_array100000 = array_length.times.to_a.map {rand(10000)}
+  float_array100000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array100000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array100000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array100000 =array_length.times.to_a.map {0}
+
+benchmark:
+  fixnum_array2.sort_by: fixnum_array2.sort_by {|a| a}
+  float_array2.sort_by:  float_array2.sort_by {|a| a}
+  string_length2.sort_by: string_array2.sort_by {|a| a.length}
+  mix_array2.sort_by:  mix_array2.sort_by {|a| a}
+  all_zero2.sort_by: all_zero_array2.sort_by{|a| a}
+
+  fixnum_array10.sort_by: fixnum_array10.sort_by {|a| a}
+  float_array10.sort_by:  float_array10.sort_by {|a| a}
+  string_length10.sort_by: string_array10.sort_by {|a| a.length}
+  mix_array10.sort_by:  mix_array10.sort_by {|a| a}
+  all_zero10.sort_by: all_zero_array10.sort_by{|a| a}
+
+  fixnum_array1000.sort_by: fixnum_array1000.sort_by {|a| a}
+  float_array1000.sort_by:  float_array1000.sort_by {|a| a}
+  string_length1000.sort_by: string_array1000.sort_by {|a| a.length}
+  mix_array1000.sort_by:  mix_array1000.sort_by {|a| a}
+  all_zero1000.sort_by: all_zero_array1000.sort_by{|a| a}
+
+  fixnum_array100000.sort_by: fixnum_array100000.sort_by {|a| a}
+  float_array100000.sort_by:  float_array100000.sort_by {|a| a}
+  string_length100000.sort_by: string_array100000.sort_by {|a| a.length}
+  mix_array100000.sort_by:  mix_array100000.sort_by {|a| a}
+  all_zero100000.sort_by: all_zero_array100000.sort_by{|a| a}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+  list = ("aaa".."zzz").to_a*10
+benchmark:
+  tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'erb'
+benchmark:
+  - script: ERB::Util.html_escape("")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcde")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcd<")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: ERB::Util.html_escape(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: ERB::Util.html_escape(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: ERB::Util.html_escape(example_html)
+    loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+
+  src = "def self.render(title, content); #{ERB.new(data).src}; end"
+  mod = Module.new
+  mod.instance_eval(src, "(ERB)")
+benchmark:
+  erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+  def make_link(previous)
+    Fiber.new do
+      while message = previous.resume
+        Fiber.yield(message)
+      end
+    end
+  end
+
+  def make_chain(length = 1000, &block)
+    chain = Fiber.new(&block)
+
+    (length - 1).times do
+      chain = make_link(chain)
+    end
+
+    return chain
+  end
+
+  message = "Hello World!"
+
+  chain = make_chain do
+    while true
+      Fiber.yield(message)
+    end
+  end
+benchmark:
+  make_chain: |
+    make_chain(100) do
+      while true
+        Fiber.yield(message)
+      end
+    end
+  resume_chain: |
+    chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+  th = Thread.current
+  th[:key] = :val
+benchmark:
+  key?: th.key?(:key)
+  []: th[:key]
+  keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_basename.yml b/benchmark/file_basename.yml
new file mode 100644
index 0000000000..fbd78785aa
--- /dev/null
+++ b/benchmark/file_basename.yml
@@ -0,0 +1,6 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  long: File.basename("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+  long_name: File.basename("Users_george_src_github.com_ruby_ruby_benchmark_file_dirname.yml")
+  withext: File.basename("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml", ".yml")
diff --git a/benchmark/bm_file_chmod.rb b/benchmark/file_chmod.rb
index 1cd4760c9d..1cd4760c9d 100644
--- a/benchmark/bm_file_chmod.rb
+++ b/benchmark/file_chmod.rb
diff --git a/benchmark/file_dirname.yml b/benchmark/file_dirname.yml
new file mode 100644
index 0000000000..43a81c9371
--- /dev/null
+++ b/benchmark/file_dirname.yml
@@ -0,0 +1,6 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  long: File.dirname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+  short: File.dirname("foo/bar")
+  n_4: File.dirname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml", 4)
diff --git a/benchmark/file_expand_path.yml b/benchmark/file_expand_path.yml
new file mode 100644
index 0000000000..9e503ab003
--- /dev/null
+++ b/benchmark/file_expand_path.yml
@@ -0,0 +1,4 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  expand_path: File.expand_path("../../foo.txt", __FILE__)
diff --git a/benchmark/file_extname.yml b/benchmark/file_extname.yml
new file mode 100644
index 0000000000..fb16e55840
--- /dev/null
+++ b/benchmark/file_extname.yml
@@ -0,0 +1,6 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  long: File.extname("/Users/george/src/github.com/ruby/ruby/benchmark/file_dirname.yml")
+  long_name: File.extname("Users_george_src_github.com_ruby_ruby_benchmark_file_dirname.yml")
+  short: File.extname("foo/bar")
diff --git a/benchmark/file_join.yml b/benchmark/file_join.yml
new file mode 100644
index 0000000000..845257cf1e
--- /dev/null
+++ b/benchmark/file_join.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  two_strings: File.join(__FILE__, "path")
+  many_strings: File.join(__FILE__, "path", "a", "b", "c", "d")
+  array: File.join([__FILE__, "path", "a", "b", "c", "d"])
+  mixed: File.join(__FILE__, "path", "a", "b", ["c", "d"])
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+  File.rename(a, b)
+  File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  to_f: |
+    flo.to_f
+  abs: |
+    flo.abs
+  magnitude: |
+    flo.magnitude
+  -@: |
+    -flo
+  zero?: |
+    flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  negative?: |
+    flo.negative?
+  positive?: |
+    flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_predicate.yml b/benchmark/float_predicate.yml
new file mode 100644
index 0000000000..b946937666
--- /dev/null
+++ b/benchmark/float_predicate.yml
@@ -0,0 +1,12 @@
+prelude: |
+  floats = [1.0, -1.0, 0.0, Float::NAN, Float::INFINITY, -Float::INFINITY]
+
+benchmark:
+  float_nan?: floats.each { |f| f.nan? }
+  float_finite?: floats.each { |f| f.finite? }
+  float_infinite?: floats.each { |f| f.infinite? }
+  float_zero?: floats.each { |f| f.zero? }
+  float_positive?: floats.each { |f| f.positive? }
+  float_negative?: floats.each { |f| f.negative? }
+
+loop_count: 1000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+  floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+  to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
index 2eed7abc83..275f58b924 100644
--- a/benchmark/gc/aobench.rb
+++ b/benchmark/gc/aobench.rb
@@ -1 +1 @@
-require_relative '../bm_app_aobench.rb'
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
index af8ea722aa..83347cdd20 100644
--- a/benchmark/gc/binary_trees.rb
+++ b/benchmark/gc/binary_trees.rb
@@ -1 +1 @@
-require_relative '../bm_so_binary_trees.rb'
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
index 09a404466a..23d0b91c6c 100644
--- a/benchmark/gc/gcbench.rb
+++ b/benchmark/gc/gcbench.rb
@@ -3,11 +3,12 @@ require 'pp'
 require 'optparse'
 
 $list = true
-$gcprof = true
+$gcprof = false
 
 opt = OptionParser.new
 opt.on('-q'){$list = false}
 opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
 opt.parse!(ARGV)
 
 script = File.join(File.dirname(__FILE__), ARGV.shift)
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
index 94ba74be89..8ebdff7d1d 100644
--- a/benchmark/gc/pentomino.rb
+++ b/benchmark/gc/pentomino.rb
@@ -1 +1 @@
-require_relative '../bm_app_pentomino.rb'
+require_relative '../app_pentomino'
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
index af4f8c36d4..af4f8c36d4 100644
--- a/benchmark/bm_hash_aref_dsym.rb
+++ b/benchmark/hash_aref_dsym.rb
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
index 9d7759379e..9d7759379e 100644
--- a/benchmark/bm_hash_aref_dsym_long.rb
+++ b/benchmark/hash_aref_dsym_long.rb
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
index 1346890582..1346890582 100644
--- a/benchmark/bm_hash_aref_fix.rb
+++ b/benchmark/hash_aref_fix.rb
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
index 2217274c82..2217274c82 100644
--- a/benchmark/bm_hash_aref_flo.rb
+++ b/benchmark/hash_aref_flo.rb
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
index b0913dd4bb..b0913dd4bb 100644
--- a/benchmark/bm_hash_aref_miss.rb
+++ b/benchmark/hash_aref_miss.rb
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/hash_aref_str.rb
index 19439b061b..19439b061b 100644
--- a/benchmark/bm_hash_aref_str.rb
+++ b/benchmark/hash_aref_str.rb
diff --git a/benchmark/hash_aref_str_lit.yml b/benchmark/hash_aref_str_lit.yml
new file mode 100644
index 0000000000..ed8142bcf1
--- /dev/null
+++ b/benchmark/hash_aref_str_lit.yml
@@ -0,0 +1,20 @@
+prelude: |
+  # frozen_string_literal: true
+  hash = 10.times.to_h do |i|
+    [i, i]
+  end
+  dyn_sym = "dynamic_symbol".to_sym
+  binary = RubyVM::InstructionSequence.compile("# frozen_string_literal: true\n'iseq_load'").to_binary
+  iseq_literal_string = RubyVM::InstructionSequence.load_from_binary(binary).eval
+
+  hash[:some_symbol] = 1
+  hash[dyn_sym] = 2
+  hash["small"] = 3
+  hash["frozen_string_literal"] = 4
+  hash[iseq_literal_string] = 5
+benchmark:
+  symbol: hash[:some_symbol]
+  dyn_symbol: hash[dyn_sym]
+  small_lit: hash["small"]
+  frozen_lit: hash["frozen_string_literal"]
+  iseq_lit: hash[iseq_literal_string]
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
index f75d163fe6..f75d163fe6 100644
--- a/benchmark/bm_hash_aref_sym.rb
+++ b/benchmark/hash_aref_sym.rb
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
index 9dab8df7be..9dab8df7be 100644
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ b/benchmark/hash_aref_sym_long.rb
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+  h = Hash.new { :foo }
+benchmark:
+  default_aref: h[1]
+  default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+  small_hash = { a: 1 }
+  larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+  dup_small: small_hash.dup
+  dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+  hash1 = 1_000_000.times.to_h { [rand, true]}
+  hash2 = hash1.dup
+  hash2.keys[1..100_000].each { hash2.delete _1 }
+  hash2.delete hash2.first[0]
+
+benchmark:
+  hash1: hash1.first
+  hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/hash_flatten.rb
index e944aae9f2..e944aae9f2 100644
--- a/benchmark/bm_hash_flatten.rb
+++ b/benchmark/hash_flatten.rb
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
index 0c7edfed3e..0c7edfed3e 100644
--- a/benchmark/bm_hash_ident_flo.rb
+++ b/benchmark/hash_ident_flo.rb
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/hash_ident_num.rb
index b226736c6f..b226736c6f 100644
--- a/benchmark/bm_hash_ident_num.rb
+++ b/benchmark/hash_ident_num.rb
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
index 4b3b58edec..4b3b58edec 100644
--- a/benchmark/bm_hash_ident_obj.rb
+++ b/benchmark/hash_ident_obj.rb
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/hash_ident_str.rb
index 8582b38e31..8582b38e31 100644
--- a/benchmark/bm_hash_ident_str.rb
+++ b/benchmark/hash_ident_str.rb
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
index 4c81e3d28e..4c81e3d28e 100644
--- a/benchmark/bm_hash_ident_sym.rb
+++ b/benchmark/hash_ident_sym.rb
diff --git a/benchmark/hash_key.yml b/benchmark/hash_key.yml
new file mode 100644
index 0000000000..cab4cf9ca4
--- /dev/null
+++ b/benchmark/hash_key.yml
@@ -0,0 +1,5 @@
+prelude: |
+  obj = Object.new
+  hash = { obj => true }
+benchmark: hash.key?(obj)
+loop_count: 30000000
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/hash_keys.rb
index 6863cd01f9..6863cd01f9 100644
--- a/benchmark/bm_hash_keys.rb
+++ b/benchmark/hash_keys.rb
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" }  }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/bm_hash_long.rb b/benchmark/hash_long.rb
index 03d9109602..03d9109602 100644
--- a/benchmark/bm_hash_long.rb
+++ b/benchmark/hash_long.rb
diff --git a/benchmark/hash_new.yml b/benchmark/hash_new.yml
new file mode 100644
index 0000000000..9d8e34187f
--- /dev/null
+++ b/benchmark/hash_new.yml
@@ -0,0 +1,16 @@
+prelude: |
+  has_hash_with_capa = Hash.instance_method(:initialize).parameters.include?([:key, :capacity])
+  strings_1k = 1_000.times.map { |i| -i.to_s.freeze }
+  strings_100k = 100_000.times.map { |i| -i.to_s.freeze }
+benchmark:
+  new: Hash.new
+  new_with_capa_1k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_1k.size) : {}
+    strings_1k.each do |x|
+      h[x] = true
+    end
+  new_with_capa_100k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_100k.size) : {}
+    strings_100k.each do |x|
+      h[x] = true
+    end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/hash_shift.rb
index a645671a5b..a645671a5b 100644
--- a/benchmark/bm_hash_shift.rb
+++ b/benchmark/hash_shift.rb
diff --git a/benchmark/bm_hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
index ec800d0342..ec800d0342 100644
--- a/benchmark/bm_hash_shift_u16.rb
+++ b/benchmark/hash_shift_u16.rb
diff --git a/benchmark/bm_hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
index de4e0fa696..de4e0fa696 100644
--- a/benchmark/bm_hash_shift_u24.rb
+++ b/benchmark/hash_shift_u24.rb
diff --git a/benchmark/bm_hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
index 656aa55583..656aa55583 100644
--- a/benchmark/bm_hash_shift_u32.rb
+++ b/benchmark/hash_shift_u32.rb
diff --git a/benchmark/bm_hash_small2.rb b/benchmark/hash_small2.rb
index 45485d9c71..45485d9c71 100644
--- a/benchmark/bm_hash_small2.rb
+++ b/benchmark/hash_small2.rb
diff --git a/benchmark/bm_hash_small4.rb b/benchmark/hash_small4.rb
index acd4084334..acd4084334 100644
--- a/benchmark/bm_hash_small4.rb
+++ b/benchmark/hash_small4.rb
diff --git a/benchmark/bm_hash_small8.rb b/benchmark/hash_small8.rb
index 9cffcc91b6..9cffcc91b6 100644
--- a/benchmark/bm_hash_small8.rb
+++ b/benchmark/hash_small8.rb
diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/hash_to_proc.rb
index 2b675bf509..2b675bf509 100644
--- a/benchmark/bm_hash_to_proc.rb
+++ b/benchmark/hash_to_proc.rb
diff --git a/benchmark/bm_hash_values.rb b/benchmark/hash_values.rb
index 069441302f..069441302f 100644
--- a/benchmark/bm_hash_values.rb
+++ b/benchmark/hash_values.rb
diff --git a/benchmark/bm_int_quo.rb b/benchmark/int_quo.rb
index e22a3f8c30..e22a3f8c30 100644
--- a/benchmark/bm_int_quo.rb
+++ b/benchmark/int_quo.rb
diff --git a/benchmark/int_to_s.yml b/benchmark/int_to_s.yml
new file mode 100644
index 0000000000..000dae9612
--- /dev/null
+++ b/benchmark/int_to_s.yml
@@ -0,0 +1,25 @@
+prelude: |
+  # frozen_string_literal: true
+  N1   = 5
+  N2   = 42
+  N3   = 400
+  N5   = 12345
+  N10  = 1_234_567_890
+  N19  = 4_611_686_018_427_387_903
+  NEG  = -1_234_567_890
+  BIG20  = 10 ** 19 + 12_345_678_901_234_567
+  BIG40  = 10 ** 39 + 123_456_789_012_345
+  BIG100 = 10 ** 99 + 42
+benchmark:
+  fix_1digit:   "N1.to_s"
+  fix_2digit:   "N2.to_s"
+  fix_3digit:   "N3.to_s"
+  fix_5digit:   "N5.to_s"
+  fix_10digit:  "N10.to_s"
+  fix_19digit:  "N19.to_s"
+  fix_negative: "NEG.to_s"
+  big_20digit:  "BIG20.to_s"
+  big_40digit:  "BIG40.to_s"
+  big_100digit: "BIG100.to_s"
+  interp_id:    '"id=#{N10}"'
+  interp_mixed: '"a=#{N2},b=#{N5},c=#{N10}"'
diff --git a/benchmark/integer_predicate.yml b/benchmark/integer_predicate.yml
new file mode 100644
index 0000000000..7c05ff2587
--- /dev/null
+++ b/benchmark/integer_predicate.yml
@@ -0,0 +1,9 @@
+prelude: |
+  nums = (0..9).to_a
+
+benchmark:
+  integer_zero?: nums.each { |n| n.zero? }
+  integer_even?: nums.each { |n| n.even? }
+  integer_odd?: nums.each { |n| n.odd? }
+
+loop_count: 1000000
diff --git a/benchmark/io_close.yml b/benchmark/io_close.yml
new file mode 100644
index 0000000000..a552872884
--- /dev/null
+++ b/benchmark/io_close.yml
@@ -0,0 +1,13 @@
+prelude: |
+  ios = 1000.times.map do
+    100.times.map{IO.pipe}
+  end
+benchmark:
+  # Close IO
+  io_close: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 100
diff --git a/benchmark/io_close_contended.yml b/benchmark/io_close_contended.yml
new file mode 100644
index 0000000000..1d9e4e0d0f
--- /dev/null
+++ b/benchmark/io_close_contended.yml
@@ -0,0 +1,21 @@
+prelude: |
+  ios = 100.times.map do
+    10.times.map do
+      pipe = IO.pipe.tap do |r, w|
+        Thread.new do
+          r.read
+        rescue IOError
+          # Ignore
+        end
+      end
+    end
+  end
+benchmark:
+  # Close IO
+  io_close_contended: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 10
diff --git a/benchmark/bm_io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
index 3fd87250a4..3fd87250a4 100644
--- a/benchmark/bm_io_copy_stream_write.rb
+++ b/benchmark/io_copy_stream_write.rb
diff --git a/benchmark/bm_io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
index 11f369bd0d..11f369bd0d 100644
--- a/benchmark/bm_io_copy_stream_write_socket.rb
+++ b/benchmark/io_copy_stream_write_socket.rb
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/io_file_create.rb
index 2f205c1333..2f205c1333 100644
--- a/benchmark/bm_io_file_create.rb
+++ b/benchmark/io_file_create.rb
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/io_file_read.rb
index b9e796ed30..b9e796ed30 100644
--- a/benchmark/bm_io_file_read.rb
+++ b/benchmark/io_file_read.rb
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/io_file_write.rb
index aa1be0e5fe..aa1be0e5fe 100644
--- a/benchmark/bm_io_file_write.rb
+++ b/benchmark/io_file_write.rb
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
index da9357fdc6..da9357fdc6 100644
--- a/benchmark/bm_io_nonblock_noex.rb
+++ b/benchmark/io_nonblock_noex.rb
diff --git a/benchmark/bm_io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
index 56819d049b..56819d049b 100644
--- a/benchmark/bm_io_nonblock_noex2.rb
+++ b/benchmark/io_nonblock_noex2.rb
diff --git a/benchmark/bm_io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
index 6862a8ae61..6862a8ae61 100644
--- a/benchmark/bm_io_pipe_rw.rb
+++ b/benchmark/io_pipe_rw.rb
diff --git a/benchmark/bm_io_select.rb b/benchmark/io_select.rb
index 19248daeb1..19248daeb1 100644
--- a/benchmark/bm_io_select.rb
+++ b/benchmark/io_select.rb
diff --git a/benchmark/bm_io_select2.rb b/benchmark/io_select2.rb
index 10e37d71b2..10e37d71b2 100644
--- a/benchmark/bm_io_select2.rb
+++ b/benchmark/io_select2.rb
diff --git a/benchmark/bm_io_select3.rb b/benchmark/io_select3.rb
index 7d0ba1f092..7d0ba1f092 100644
--- a/benchmark/bm_io_select3.rb
+++ b/benchmark/io_select3.rb
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+  while i.read(1024)
+  end
+end
+
+100.times do
+  o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'irb/color'
+  code = <<~'CODE'
+    def self.foo # bar
+      :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+    end
+  CODE
+benchmark:
+  irb_color_complete: |
+    IRB::Color.colorize_code(code, complete: true)
+  irb_color_incomplete: |
+    IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'rbconfig'
+  irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+  irb_exec: |
+    IO.popen(irb_f, 'w') do |io|
+      io.write('exit')
+    end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+  symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+  define_method = RubyVM::InstructionSequence.compile(%{
+    def foo; end
+    def bar; end
+    def baz; end
+    def egg; end
+    def spam; end
+  }).to_binary
+
+  all = RubyVM::InstructionSequence.compile(%{
+    module Foo; def foo; :foo; end; end
+    module Bar; def bar; :bar; end; end
+    module Baz; def baz; :baz; end; end
+    class Egg; def egg; :egg; end; end
+    class Spaml; def spam; :spam; end; end
+  }).to_binary
+
+benchmark:
+  symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+  define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+  all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class Embedded
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+    end
+  end
+
+  class Extended
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+      @d = 1
+      @e = 1
+      @f = 1
+    end
+  end
+benchmark:
+  embedded: Embedded.new
+  extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+  clone: "object.clone"
+  clone_true: "object.clone(freeze: true)"
+  clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+  float: "Float(42)"
+  float_true: "Float(42, exception: true)"
+  float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+  x = nil
+benchmark:
+  kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+  kernel_then: 1.then { |i| i + 1 }
+  kernel_then_enum: 1.then
+  kernel_yield_self: 1.yield_self { |i| i + 1 }
+  kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+  h = {a: 1}
+  def kw(a: 1) a end
+  def kws(**kw) kw end
+benchmark:
+  kw_to_kw: "kw(a: 1)"
+  kw_splat_to_kw: "kw(**h)"
+  kw_to_kw_splat: "kws(a: 1)"
+  kw_splat_to_kw_splat: "kws(**h)"
+  kw_and_splat_to_kw: "kw(a: 1, **h)"
+  kw_splats_to_kw: "kw(**h, **h)"
+  kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+  kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+  def initialize(*)
+    super
+    @stdout = $stdout
+    @strio  = StringIO.new
+    $stdout = IOMultiplexer.new(@stdout, @strio)
+  end
+
+  def with_benchmark(*)
+    super
+  ensure
+    logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+    puts "\nLog file: #{logfile}"
+
+    $stdout = @stdout
+    File.write(logfile, @strio.tap(&:rewind).read)
+  end
+
+  class IOMultiplexer
+    def initialize(io1, io2)
+      @io1 = io1
+      @io2 = io2
+    end
+
+    [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+      define_method(method) do |*args|
+        @io1.send(method, *args)
+        @io2.send(method, *args)
+      end
+    end
+  end
+  private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cstime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cutime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      jobs = jobs.map do |job|
+        job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+      end
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => value }, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render) do |path|
+        output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+        if $?.success?
+          Integer(f.read)
+        else
+          $stdout.print(output)
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def target
+    'peak'
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def metric
+    METRIC
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    def render
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+  key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+  key = ms.respond_to?(:rss) ? :rss : :size
+else
+  raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      end
+
+      if times > 1
+        <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+        RUBY
+      else
+        content
+      end
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..fd9c2dd4db
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob) do
+    attr_accessor :ractor
+  end
+
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+    def parse(ractor: 1, **kwargs)
+      super(**kwargs).each do |job|
+        job.ractor = ractor
+      end
+    end
+  })
+
+  private
+
+  unless private_instance_methods.include?(:run_benchmark)
+    raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+  end
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    results = job.ractor.times.map do
+      Tempfile.open('benchmark_driver_result')
+    end
+    duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+      success = execute(*context.executable.command, path, exception: false)
+      if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+        value
+      else
+        BenchmarkDriver::Result::ERROR
+      end
+    end
+    results.each(&:close)
+
+    value_duration(
+      loop_count: job.loop_count,
+      duration: duration,
+    )
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(results:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+  __bmdv_loop_before = 0
+  __bmdv_loop_after = 0
+else
+  __bmdv_loop_before = Time.new
+  #{while_loop('', loop_count, id: 0)}
+  __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+  __bmdv_time = Time
+  __bmdv_script_before = __bmdv_time.new
+  #{while_loop(script, loop_count, id: 1)}
+  __bmdv_script_after = __bmdv_time.new
+
+  (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:value)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+      RUBY
+    end
+
+    private
+
+    # id is to prevent:
+    # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+    def while_loop(content, times, id:)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+  #{content}
+  __bmdv_i#{id} += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Peak#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Peak#target
+  def target
+    'size'
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :stime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      raise 'missing loop_count is not supported in Ruby repository'
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render(result: f.path, target: target)) do |path|
+        IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+        if $?.success?
+          Float(f.read)
+        else
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # This method is overridden by some subclasses
+  def metric
+    METRIC
+  end
+
+  # This method is overridden by some subclasses
+  def target
+    :total
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(result:, target:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+  #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :utime
+  end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+#   1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+  x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+  x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+  x.report %q{
+    h = {a: 1, b: 2, c: 3, d: 4}
+  }
+}
+=end
+#
+#  2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/loop_each.yml b/benchmark/loop_each.yml
new file mode 100644
index 0000000000..1c757185a8
--- /dev/null
+++ b/benchmark/loop_each.yml
@@ -0,0 +1,4 @@
+prelude: |
+  arr = [nil] * 30_000_000
+benchmark:
+  loop_each: arr.each{|e|}
diff --git a/benchmark/bm_loop_for.rb b/benchmark/loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/bm_loop_for.rb
+++ b/benchmark/loop_for.rb
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
new file mode 100644
index 0000000000..6a3194b670
--- /dev/null
+++ b/benchmark/loop_generator.rb
@@ -0,0 +1,14 @@
+max = 6000000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/bm_loop_times.rb
+++ b/benchmark/loop_times.rb
diff --git a/benchmark/loop_times_megamorphic.yml b/benchmark/loop_times_megamorphic.yml
new file mode 100644
index 0000000000..f9343ba897
--- /dev/null
+++ b/benchmark/loop_times_megamorphic.yml
@@ -0,0 +1,7 @@
+prelude: |
+  eval(<<~EOS)
+    def loop_times_megamorphic
+      #{"1.times {|i|};" * 1000}
+    end
+  EOS
+benchmark: loop_times_megamorphic
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/loop_whileloop.rb
index 0072822c06..0072822c06 100644
--- a/benchmark/bm_loop_whileloop.rb
+++ b/benchmark/loop_whileloop.rb
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
index 47d02dffc4..47d02dffc4 100644
--- a/benchmark/bm_loop_whileloop2.rb
+++ b/benchmark/loop_whileloop2.rb
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
-  filebase = File.join(File.dirname($0), 'fasta.output')
-  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-  file = "#{filebase}.#{n}"
-
-  unless FileTest.exist?(file)
-    STDERR.puts "preparing #{file}"
-
-    open(file, 'w'){|f|
-      ARGV[0] = n
-      $stdout = f
-      load script
-      $stdout = STDOUT
-    }
-  end
-end
-
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
index 9b8d0c6afb..9b8d0c6afb 100644
--- a/benchmark/bm_marshal_dump_flo.rb
+++ b/benchmark/marshal_dump_flo.rb
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
index 8252ad90fa..8252ad90fa 100644
--- a/benchmark/bm_marshal_dump_load_geniv.rb
+++ b/benchmark/marshal_dump_load_geniv.rb
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+  smallint_array = 1000.times.map { |x| x }
+  bigint32_array = 1000.times.map { |x| x + 2**32 }
+  bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+  smallint_dump = Marshal.dump(smallint_array)
+  bigint32_dump = Marshal.dump(bigint32_array)
+  bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+  marshal_dump_integer_small: |
+    Marshal.dump(smallint_array)
+  marshal_dump_integer_over_32_bit: |
+    Marshal.dump(bigint32_array)
+  marshal_dump_integer_over_64_bit: |
+    Marshal.dump(bigint64_array)
+  marshal_load_integer_small: |
+    Marshal.load(smallint_dump)
+  marshal_load_integer_over_32_bit: |
+    Marshal.load(bigint32_dump)
+  marshal_load_integer_over_64_bit: |
+    Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
index e29743b791..e29743b791 100644
--- a/benchmark/bm_marshal_dump_load_time.rb
+++ b/benchmark/marshal_dump_load_time.rb
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+  a = [nil] * 3
+  b = Class.new{attr_writer :a, :b, :c}.new
+  c = d = e = f = g = h = i = nil
+benchmark:
+  array2_2: "c = (a[0], a[1] = 1, 2)"
+  array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+  array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+  array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+  attr2_2: "c = (b.a, b.b = 1, 2)"
+  attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+  attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+  attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+  lvar2_2: "c = (d, e = 1, 2)"
+  lvar2_3: "c = (d, e = 1, 2, 3)"
+  lvar3_2: "c = (d, e, f = 1, 2)"
+  lvar3_3: "c = (d, e, f = 1, 2, 3)"
+  array2_2p: "(a[0], a[1] = 1, 2; nil)"
+  array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+  array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+  array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+  attr2_2p: "(b.a, b.b = 1, 2; nil)"
+  attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+  attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+  attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+  lvar2_2p: "(d, e = 1, 2; nil)"
+  lvar2_3p: "(d, e = 1, 2, 3; nil)"
+  lvar3_2p: "(d, e, f = 1, 2; nil)"
+  lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+  array2_2lv: "c = (a[0], a[1] = g, h)"
+  array2_ilv: "c = (a[0], a[1] = g, h, i)"
+  arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+  arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+  attr2_2lv: "c = (b.a, b.b = g, h)"
+  attr2_ilv: "c = (b.a, b.b = g, h, i)"
+  attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+  attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+  lvar2_2lv: "c = (d, e = g, h)"
+  lvar2_ilv: "c = (d, e = g, h, i)"
+  lvari_2lv: "c = (d, e, f = g, h)"
+  lvari_ilv: "c = (d, e, f = g, h, i)"
+  array2_2plv: "(a[0], a[1] = g, h; nil)"
+  array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+  arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+  arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+  attr2_2plv: "(b.a, b.b = g, h; nil)"
+  attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+  attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+  attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+  lvar2_2plv: "(d, e = g, h; nil)"
+  lvar2_iplv: "(d, e = g, h, i; nil)"
+  lvari_2plv: "(d, e, f = g, h; nil)"
+  lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/memory_wrapper.rb b/benchmark/memory_wrapper.rb
deleted file mode 100644
index 3f4451a037..0000000000
--- a/benchmark/memory_wrapper.rb
+++ /dev/null
@@ -1,16 +0,0 @@
-
-write_file, target, script_file = ARGV
-
-load(script_file)
-require_relative '../test/lib/memory_status'
-open(write_file, 'wb'){|f|
-  ms = Memory::Status.new
-  case target.to_sym
-  when :peak
-    key = ms.respond_to?(:hwm) ? :hwm : :peak
-  when :size
-    key = ms.respond_to?(:rss) ? :rss : :size
-  end
-
-  f.puts ms[key]
-}
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+  named_module = Kernel
+
+  module FakeName
+    def self.name
+      "NotMyame".freeze
+    end
+  end
+
+  MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+  fastpath: MOD_NAME.bind_call(Kernel)
+  slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..2f9c490d92
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,32 @@
+prelude: |
+  module SomeModule; end
+  class SimpleClass; end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+  class HugeClass
+    300.times { include Module.new }
+  end
+  SimpleObj = SimpleClass.new
+  MediumObj = MediumClass.new
+  LargeObj = LargeClass.new
+  HugeObj = HugeClass.new
+benchmark:
+  simple_class_eqq_simple_obj: |
+    SimpleClass === SimpleObj
+  medium_class_eqq_simple_obj: |
+    MediumClass === SimpleObj
+  simple_class_eqq_medium_obj: |
+    SimpleClass === MediumObj
+  simple_class_eqq_large_obj: |
+    SimpleClass === LargeObj
+  simple_class_eqq_huge_obj: |
+    SimpleClass === HugeObj
+  simple_class_eqq_module: |
+    SimpleClass === HugeObj
+  module_eqq_module: |
+    SomeModule === HugeObj
+loop_count: 10000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+  class Niller; def nil?; true; end; end
+  xnil, notnil = nil, Object.new
+  niller = Niller.new
+benchmark:
+  - xnil.nil?
+  - notnil.nil?
+  - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..66234c4cdf
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def a = nil
+benchmark:
+  rationalize:
+    nil.rationalize
+  to_c: |
+    nil.to_c
+  to_i: |
+    nil.to_i
+  to_f: |
+    nil.to_f
+  to_r: |
+    nil.to_r
+  splat: |
+    a(*nil)
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+  - 0.zero?
+  - 1.zero?
+  - 0r.zero?
+  - 1r.zero?
+  - 0i.zero?
+  - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+  int = 42
+  flo = 4.2
+benchmark:
+  real?: |
+    int.real?
+  integer?: |
+    flo.integer?
+  finite?: |
+    int.finite?
+  infinite?: |
+    int.infinite?
+  integer_real: |
+    int.real
+  float_real: |
+    flo.real
+  integr_imag: |
+    int.imag
+  float_imag: |
+    flo.imag
+  integer_conj: |
+    int.conj
+  float_conj: |
+    flo.conj
+  integer_numerator: |
+    int.numerator
+  integer_denominator: |
+    int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..c6269923f0
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,49 @@
+prelude: |
+  class Eight
+    8.times { include(Module.new) }
+  end
+  class ThirtyTwo
+    32.times { include(Module.new) }
+  end
+  class SixtyFour
+    64.times { include(Module.new) }
+  end
+  class OneTwentyEight
+    128.times { include(Module.new) }
+  end
+  class OnePositional
+    def initialize a; end
+  end
+  class TwoPositional
+    def initialize a, b; end
+  end
+  class ThreePositional
+    def initialize a, b, c; end
+  end
+  class FourPositional
+    def initialize a, b, c, d; end
+  end
+  class KWArg
+    def initialize a:, b:, c:, d:
+    end
+  end
+  class Mixed
+    def initialize a, b, c:, d:
+    end
+  end
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  allocate_8_deep: Eight.new
+  allocate_32_deep: ThirtyTwo.new
+  allocate_64_deep: SixtyFour.new
+  allocate_128_deep: OneTwentyEight.new
+  allocate_1_positional_params: OnePositional.new(1)
+  allocate_2_positional_params: TwoPositional.new(1, 2)
+  allocate_3_positional_params: ThreePositional.new(1, 2, 3)
+  allocate_4_positional_params: FourPositional.new(1, 2, 3, 4)
+  allocate_kwarg_params: "KWArg.new(a: 1, b: 2, c: 3, d: 4)"
+  allocate_mixed_params: "Mixed.new(1, 2, c: 3, d: 4)"
+  allocate_no_params: "Object.new"
+  allocate_allocate: "Object.allocate"
+loop_count: 100000
diff --git a/benchmark/object_class.yml b/benchmark/object_class.yml
new file mode 100644
index 0000000000..1e5409d1e2
--- /dev/null
+++ b/benchmark/object_class.yml
@@ -0,0 +1,40 @@
+prelude: |
+  def get_class(obj)
+    i = 10_000
+    while i > 0
+      i -= 1
+      # 100 times per loop
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+    end
+  end
+
+  class Obj
+  end
+  obj = Obj.new
+
+  singleton = Obj.new
+  def singleton.bar
+  end
+
+  extended = Obj.new
+  2.times do
+    extended.extend Module.new
+  end
+
+  immediate = 1.4
+benchmark:
+  obj: get_class(obj)
+  extended: get_class(extended)
+  singleton: get_class(singleton)
+  immediate: get_class(immediate)
+loop_count: 1000
diff --git a/benchmark/object_id.yml b/benchmark/object_id.yml
new file mode 100644
index 0000000000..2bd52b923f
--- /dev/null
+++ b/benchmark/object_id.yml
@@ -0,0 +1,4 @@
+benchmark:
+  baseline: "Object.new"
+  object_id: "Object.new.object_id"
+# loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'objspace'
+  require 'tempfile'
+  $objs = 1_000.times.map { Object.new }
+  $strings = 1_000.times.map { |i| "string #{i}" }
+  $file = Tempfile.new('heap')
+  $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+  dump_all_string: "ObjectSpace.dump_all(output: :string)"
+  dump_all_file: "ObjectSpace.dump_all(output: $file)"
+  dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 01593965d9..1ce9f76275 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
 
 def factL(n):
 	r = 1
-	for x in range(2, n):
+	for x in range(2, n+1):
 		r *= x
 	return r
 
diff --git a/benchmark/pathname.yml b/benchmark/pathname.yml
new file mode 100644
index 0000000000..bcf3011eab
--- /dev/null
+++ b/benchmark/pathname.yml
@@ -0,0 +1,15 @@
+prelude: |
+  abs = Pathname("/a")
+  rel = Pathname("a")
+  p1 = Pathname.new('foo/././././bar')
+  p2 = Pathname.new('foo/bar/./../..')
+  p3 = Pathname.new('foo/bar/zot')
+benchmark:
+  p1+p2: p1+p2
+  abs.root?: abs.root?
+  rel.root?: rel.root?
+  abs.absolute?: abs.absolute?
+  rel.absolute?: rel.absolute?
+  p1.cleanpath: p1.cleanpath
+  p2.cleanpath: p2.cleanpath
+  relative_path_from: p3.relative_path_from('foo/bar/qux/quax')
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def call(*val)
+    case val
+      in [String => body]
+        [200, {}, [body]]
+      in [Integer => status]
+        [status, {}, [""]]
+      in [Integer, String] => response
+        [response[0], {}, [response[1]]]
+      in [Integer, Hash, String] => response
+        [response[0], response[1], [response[2]]]
+    end
+  end
+
+benchmark:
+  first_match: call("ok")
+  second_match: call(401)
+  third_match: call(200, "ok")
+  fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
deleted file mode 100644
index c4786f04ad..0000000000
--- a/benchmark/prepare_require.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require "fileutils"
-
-def prepare
-  num_files = 10000
-
-  basename = File.dirname($0)
-  data_dir = File.join(basename, "bm_require.data")
-
-  # skip if all of files exists
-  if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
-    return
-  end
-
-  FileUtils.mkdir_p(data_dir)
-
-  1.upto(num_files) do |i|
-    f = File.open("#{data_dir}/c#{i}.rb", "w")
-    f.puts <<-END
-      class C#{i}
-      end
-    END
-  end
-end
-
-prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
deleted file mode 100644
index 339ecb8b39..0000000000
--- a/benchmark/prepare_require_thread.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-load File.join(File.dirname(__FILE__), "prepare_require.rb")
-
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+  FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+  ractor_float_to_s: |
+    FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/ractor_string_fstring.yml b/benchmark/ractor_string_fstring.yml
new file mode 100644
index 0000000000..14b92d8fd8
--- /dev/null
+++ b/benchmark/ractor_string_fstring.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  ractor_fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -str
+      i += 1
+    end
+loop_count: 1
+ractor: 4
diff --git a/benchmark/range_bsearch_bignum.yml b/benchmark/range_bsearch_bignum.yml
new file mode 100644
index 0000000000..5730c93fcf
--- /dev/null
+++ b/benchmark/range_bsearch_bignum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 2**100
+  last = 2**1000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_bsearch_endpointless.yml b/benchmark/range_bsearch_endpointless.yml
new file mode 100644
index 0000000000..8d7bedb662
--- /dev/null
+++ b/benchmark/range_bsearch_endpointless.yml
@@ -0,0 +1,21 @@
+prelude: |
+  re = (1..)
+  rb = (..0)
+
+benchmark:
+  'endless 10**0': re.bsearch { |x| x >= 1 }
+  'endless 10**1': re.bsearch { |x| x >= 10 }
+  'endless 10**2': re.bsearch { |x| x >= 100 }
+  'endless 10**3': re.bsearch { |x| x >= 1000 }
+  'endless 10**4': re.bsearch { |x| x >= 10000 }
+  'endless 10**5': re.bsearch { |x| x >= 100000 }
+  'endless 10**10': re.bsearch { |x| x >= 10000000000 }
+  'endless 10**100': re.bsearch { |x| x >= 10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
+  'beginless -10**0': rb.bsearch { |x| x >= -1 }
+  'beginless -10**1': rb.bsearch { |x| x >= -10 }
+  'beginless -10**2': rb.bsearch { |x| x >= -100 }
+  'beginless -10**3': rb.bsearch { |x| x >= -1000 }
+  'beginless -10**4': rb.bsearch { |x| x >= -10000 }
+  'beginless -10**5': rb.bsearch { |x| x >= -100000 }
+  'beginless -10**10': rb.bsearch { |x| x >= -10000000000 }
+  'beginless -10**100': rb.bsearch { |x| x >= -10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
diff --git a/benchmark/range_bsearch_fixnum.yml b/benchmark/range_bsearch_fixnum.yml
new file mode 100644
index 0000000000..59416531b9
--- /dev/null
+++ b/benchmark/range_bsearch_fixnum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 1
+  last = 10000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_count.yml b/benchmark/range_count.yml
new file mode 100644
index 0000000000..58f53a0236
--- /dev/null
+++ b/benchmark/range_count.yml
@@ -0,0 +1,11 @@
+prelude: |
+  r_1 = 1..1
+  r_1k = 1..1000
+  r_1m = 1..1000000
+  r_str = 'a'..'z'
+
+benchmark:
+  'int 1': r_1.count
+  'int 1K': r_1k.count
+  'int 1M': r_1m.count
+  string: r_str.count
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - (1..1_000_000).last(100)
+  - (1..1_000_000).last(1000)
+  - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+  - (1..10).min
diff --git a/benchmark/range_overlap.yml b/benchmark/range_overlap.yml
new file mode 100644
index 0000000000..700a00053c
--- /dev/null
+++ b/benchmark/range_overlap.yml
@@ -0,0 +1,19 @@
+prelude: |
+  class Range
+    unless method_defined?(:overlap?)
+      def overlap?(other)
+        other.begin == self.begin || cover?(other.begin) || other.cover?(self.begin)
+      end
+    end
+  end
+
+benchmark:
+  - (2..3).overlap?(1..1)
+  - (2..3).overlap?(2..4)
+  - (2..3).overlap?(4..5)
+  - (2..3).overlap?(2..1)
+  - (2..3).overlap?(0..1)
+  - (2..3).overlap?(...1)
+  - (2...3).overlap?(..2)
+  - (2...3).overlap?(3...)
+  - (2..3).overlap?('a'..'d')
diff --git a/benchmark/range_reverse_each.yml b/benchmark/range_reverse_each.yml
new file mode 100644
index 0000000000..a32efeccc6
--- /dev/null
+++ b/benchmark/range_reverse_each.yml
@@ -0,0 +1,16 @@
+prelude: |
+  rf_1 = 0..1
+  rf_1k = 0..1000
+  rf_1m = 0..1000000
+  big = 2**1000
+  rb_1 = big..big+1
+  rb_1k = big..big+1000
+  rb_1m = big..big+1000000
+
+benchmark:
+  "Fixnum 1": rf_1.reverse_each { _1 }
+  "Fixnum 1K": rf_1k.reverse_each { _1 }
+  "Fixnum 1M": rf_1m.reverse_each { _1 }
+  "Bignum 1": rb_1.reverse_each { _1 }
+  "Bignum 1K": rb_1k.reverse_each { _1 }
+  "Bignum 1M": rb_1m.reverse_each { _1 }
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..6b6a4836b0
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,33 @@
+prelude: |
+  f = File
+  pwd = Dir.pwd
+  Dir.mkdir('b') unless f.directory?('b')
+  f.write('b/a', '') unless f.file?('b/a')
+
+  relative = 'b/a'
+  absolute = File.join(pwd, relative)
+  dir = 'b'
+  file = 'a'
+
+  relative_dir = 'b/c'
+  absolute_dir = File.join(pwd, relative_dir)
+  file_dir = 'c'
+teardown: |
+  require 'fileutils'
+  FileUtils.rm_rf('b')
+benchmark:
+  relative_nil: "f.realpath(relative, nil)"
+  absolute_nil: "f.realpath(absolute, nil)"
+  relative_relative: "f.realpath(file, dir)"
+  absolute_relative: "f.realpath(absolute, dir)"
+  relative_absolute: "f.realpath(relative, pwd)"
+  relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+  absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+  relative_relative_dir: "f.realdirpath(file_dir, dir)"
+  absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+  relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+  relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+  absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+  relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+  absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+  relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/regexp_dup.yml b/benchmark/regexp_dup.yml
new file mode 100644
index 0000000000..52f89991cd
--- /dev/null
+++ b/benchmark/regexp_dup.yml
@@ -0,0 +1,6 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  dup: re.dup
diff --git a/benchmark/regexp_new.yml b/benchmark/regexp_new.yml
new file mode 100644
index 0000000000..bc9ab3ca21
--- /dev/null
+++ b/benchmark/regexp_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  string: Regexp.new(str)
+  regexp: Regexp.new(re)
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index d2dc56b1e1..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
-  <<-EOP
-  $DRIVER_PATH = '#{File.dirname($0)}'
-  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
-  require 'benchmark'
-  require 'yarvutil'
-#  print '#{type}'
-  begin
-    puts Benchmark.measure{
-      #{w}('#{file}')
-    }.utime
-  rescue Exception => exec_command_error_variable
-    puts "\t" + exec_command_error_variable.message
-  end
-  EOP
-end
-
-def benchmark cmd
-  rubybin = ENV['RUBY'] || RbConfig.ruby
-
-  IO.popen(rubybin, 'r+'){|io|
-    io.write cmd
-    io.close_write
-    return io.gets
-  }
-end
-
-def ruby_exec file
-  prog = exec_command 'ruby', file, 'load'
-  benchmark prog
-end
-
-def yarv_exec file
-  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
-  benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
-  file = File.dirname($0) + "/bm_#{bench}.rb"
-  r = ruby_exec(file).to_f
-  y = yarv_exec(file).to_f
-  puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
-  r = ruby_exec.to_f
-  y = yarv_exec.to_f
-  puts r/y
-end
-
-if $0 == __FILE__
-  %w{
-    whileloop
-    whileloop2
-    times
-    const
-    method
-    poly_method
-    block
-    rescue
-    rescue2
-  }.each{|bench|
-    measure bench
-  }
-end
-
-
-
-
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    1.upto(10000) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require_thread: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    i=0
+    t = Thread.new do
+      while true
+        i = i+1 # dummy loop
+      end
+    end
+
+    1.upto(100) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+    t.kill
+loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 0cd2363849..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results  = []
-
-# prepare 'wc.input'
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
-
-def bm file
-  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
-  return if prog.empty?
-
-  /[a-z]+_(.+)\.rb/ =~ file
-  bm_name = $1
-  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
-  puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
-  begin
-    result = [bm_name]
-    result << matzruby_exec(file) unless $rubyonly
-    result << ruby_exec(file) unless $matzrubyonly
-    $results << result
-
-  rescue Exception => e
-    puts
-    puts "** benchmark failure: #{e}"
-    puts e.backtrace
-  end
-end
-
-def benchmark file, bin
-  m = Benchmark.measure{
-    `#{bin} #{$opts} #{file}`
-  }
-  sec = '%.3f' % m.real
-  puts " #{sec}"
-  sec
-end
-
-def ruby_exec file
-  print 'ruby'
-  benchmark file, $ruby_program
-end
-
-def matzruby_exec file
-  print 'matz'
-  rubylib = ENV['RUBYLIB']
-  ENV['RUBYLIB'] = ''
-  r = benchmark file, $matzruby_program
-  ENV['RUBYLIB'] = rubylib
-  r
-end
-
-if $0 == __FILE__
-  ARGV.each{|arg|
-    case arg
-    when /\A--ruby=(.+)/
-      $ruby_program = $1
-    when /\A--matzruby=(.+)/
-      $matzruby_program = $1
-    when /\A--opts=(.+)/
-      $opts = $1
-    when /\A(-r|--only-ruby)\z/
-      $rubyonly = true
-    when /\A(-m|--only-matzruby)\z/
-      $matzrubyonly = true
-    end
-  }
-  ARGV.delete_if{|arg|
-    /\A-/ =~ arg
-  }
-
-  puts "MatzRuby:"
-  system("#{$matzruby_program} -v")
-  puts "Ruby:"
-  system("#{$ruby_program} -v")
-  puts
-
-  if ARGV.empty?
-    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
-      bm file
-    }
-  else
-    ARGV.each{|file|
-      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
-        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
-        bm ef
-      }
-    }
-  end
-
-  puts
-  puts "-- benchmark summary ---------------------------"
-  $results.each{|res|
-    print res.shift, "\t"
-    (res||[]).each{|result|
-      /([\d\.]+)/ =~ result
-      print $1 + "\t" if $1
-    }
-    puts
-  }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
-  puts file
-  file = File.join(File.dirname($0), 'contrib', file)
-  Benchmark.bm{|x|
-    x.report('ruby'){
-      system("#{$rubybin} #{file}")
-    }
-    x.report('yarv'){
-      system("#{$rubybin} -rite -I.. #{file}")
-    }
-  }
-end
-
-ARGV.each{|file|
-  runfile file
-}
-
-
diff --git a/benchmark/scan.yaml b/benchmark/scan.yaml
new file mode 100644
index 0000000000..62ad1d6862
--- /dev/null
+++ b/benchmark/scan.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "test"
+  reg = /test/
+benchmark:
+  check(reg): |
+    scanner.check(reg)
+  check(str): |
+    scanner.check(str)
+  match?(reg): |
+    scanner.match?(reg)
+  match?(str): |
+    scanner.match?(str)
diff --git a/benchmark/search.yaml b/benchmark/search.yaml
new file mode 100644
index 0000000000..42a50c90e6
--- /dev/null
+++ b/benchmark/search.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "string"
+  reg = /string/
+benchmark:
+  check_until(reg): |
+    scanner.check_until(reg)
+  check_until(str): |
+    scanner.check_until(str)
+  exist?(reg): |
+    scanner.exist?(reg)
+  exist?(str): |
+    scanner.exist?(str)
diff --git a/benchmark/bm_securerandom.rb b/benchmark/securerandom.rb
index a082ea6d5b..a082ea6d5b 100644
--- a/benchmark/bm_securerandom.rb
+++ b/benchmark/securerandom.rb
diff --git a/benchmark/set.yml b/benchmark/set.yml
new file mode 100644
index 0000000000..061509cb1f
--- /dev/null
+++ b/benchmark/set.yml
@@ -0,0 +1,261 @@
+prelude: |
+  # First 1000 digits of pi
+  pi = <<~END.gsub(/\D/, '')
+    31415926535897932384626433832795028841971693993751058209749445923078164062862089
+    98628034825342117067982148086513282306647093844609550582231725359408128481117450
+    28410270193852110555964462294895493038196442881097566593344612847564823378678316
+    52712019091456485669234603486104543266482133936072602491412737245870066063155881
+    74881520920962829254091715364367892590360011330530548820466521384146951941511609
+    43305727036575959195309218611738193261179310511854807446237996274956735188575272
+    48912279381830119491298336733624406566430860213949463952247371907021798609437027
+    70539217176293176752384674818467669405132000568127145263560827785771342757789609
+    17363717872146844090122495343014654958537105079227968925892354201995611212902196
+    08640344181598136297747713099605187072113499999983729780499510597317328160963185
+    95024459455346908302642522308253344685035261931188171010003137838752886587533208
+    38142061717766914730359825349042875546873115956286388235378759375195778185778053
+    21712268066130019278766111959092164201989380952572010654505906988788448549
+  END
+  array1 = 10.times.flat_map do |i|
+    pi[i...].chars.each_slice(10).map(&:join)
+  end
+  array2 = array1.map(&:reverse)
+  array1.map!(&:to_i)
+  array2.map!(&:to_i)
+  a1 = array1[...10]
+  a2 = array1[...100]
+  a3 = array1
+  oa1 = array2[...10]
+  oa2 = array2[...100]
+  oa3 = array2
+  s0 = Set.new
+  s0 = Set.new
+  s1 = Set.new(a1)
+  s2 = Set.new(a2)
+  s3 = Set.new(a3)
+  o0 = Set.new
+  o1 = Set.new(array2[...10])
+  o2 = Set.new(array2[...100])
+  o3 = Set.new(array2)
+  d0 = s0.dup
+  d1 = s1.dup
+  d2 = s2.dup
+  d3 = s3.dup
+  ss1 = s1 - a1[-1..-1]
+  ss2 = s2 - a2[-1..-1]
+  ss3 = s3 - a3[-1..-1]
+  os1 = o1 - oa1[-1..-1]
+  os2 = o2 - oa2[-1..-1]
+  os3 = o3 - oa3[-1..-1]
+  member = a1.first
+  cbi = s0.dup.compare_by_identity
+  ns = Set[s3, o3, d3]
+  set_subclass = Class.new(Set)
+
+benchmark:
+  new_0: Set.new
+  new_10: Set.new(a1)
+  new_100: Set.new(a2)
+  new_1000: Set.new(a3)
+  aref_0: Set[]
+  aref_10: Set[*a1]
+  aref_100: Set[*a2]
+  aref_1000: Set[*a3]
+  amp_0: s0 & o0
+  amp_10: s1 & o1
+  amp_100: s2 & o2
+  amp_1000: s3 & o3
+  amp_same_0: s0 & d0
+  amp_same_10: s1 & d1
+  amp_same_100: s2 & d2
+  amp_same_1000: s3 & d3
+  minus_0: s0 - o0
+  minus_10: s1 - o1
+  minus_100: s2 - o2
+  minus_1000: s3 - o3
+  minus_same_0: s0 - d0
+  minus_same_10: s1 - d1
+  minus_same_100: s2 - d2
+  minus_same_1000: s3 - d3
+  spaceship_0: s0 <=> o0
+  spaceship_diff_10: s1 <=> o1
+  spaceship_diff_100: s2 <=> o2
+  spaceship_diff_1000: s2 <=> o3
+  spaceship_sub_10: s1 <=> ss1
+  spaceship_sub_100: s2 <=> ss2
+  spaceship_sub_1000: s2 <=> ss3
+  spaceship_sup_10: ss1 <=> s1
+  spaceship_sup_100: ss2 <=> s2
+  spaceship_sup_1000: ss2 <=> s3
+  eq_0: s0 == o0
+  eq_10: s1 == o1
+  eq_100: s2 == o2
+  eq_1000: s3 == o3
+  eq_same_0: s0 == d0
+  eq_same_10: s1 == d1
+  eq_same_100: s2 == d2
+  eq_same_1000: s3 == d3
+  xor_0: s0 ^ o0
+  xor_10: s1 ^ o1
+  xor_100: s2 ^ o2
+  xor_1000: s3 ^ o3
+  xor_same_0: s0 ^ d0
+  xor_same_10: s1 ^ d1
+  xor_same_100: s2 ^ d2
+  xor_same_1000: s3 ^ d3
+  pipe_0: s0 | o0
+  pipe_10: s1 | o1
+  pipe_100: s2 | o2
+  pipe_1000: s3 | o3
+  pipe_same_0: s0 | d0
+  pipe_same_10: s1 | d1
+  pipe_same_100: s2 | d2
+  pipe_same_1000: s3 | d3
+  add: a3.each { s0.add(it) }
+  add_exist: a3.each { s3.add(it) }
+  addq: a3.each { s0.add?(it) }
+  addq_exist: a3.each { s3.add?(it) }
+  classify_0: s0.classify { it }
+  classify_10: s1.classify { it & 2 }
+  classify_100: s2.classify { it & 8 }
+  classify_1000: s3.classify { it & 32 }
+  clear: s0.clear
+  collect_0: s0.collect! { it }
+  collect_10: s1.collect! { it }
+  collect_100: s2.collect! { it }
+  collect_1000: s3.collect! { it }
+  compare_by_identity_0: s0.dup.compare_by_identity
+  compare_by_identity_10: s1.dup.compare_by_identity
+  compare_by_identity_100: s2.dup.compare_by_identity
+  compare_by_identity_1000: s3.dup.compare_by_identity
+  compare_by_identityq_false: s0.compare_by_identity?
+  compare_by_identityq_true: cbi.compare_by_identity?
+  clone_0: s0.clone
+  clone_10: s1.clone
+  clone_100: s2.clone
+  clone_1000: s3.clone
+  delete: a3.each { s3.delete(it) }
+  delete_not_exist: a3.each { o3.delete(it) }
+  deleteq: a3.each { s3.delete?(it) }
+  deleteq_not_exist: a3.each { o3.delete?(it) }
+  delete_if_0: s0.delete_if { it }
+  delete_if_10: s1.delete_if { it & 2 == 0 }
+  delete_if_100: s2.delete_if { it & 2 == 0 }
+  delete_if_1000: s3.delete_if { it & 2 == 0 }
+  disjoint_0: s0.disjoint? o0
+  disjoint_10: s1.disjoint? o1
+  disjoint_100: s2.disjoint? o2
+  disjoint_1000: s3.disjoint? o3
+  disjoint_same_0: s0.disjoint? d0
+  disjoint_same_10: s1.disjoint? d1
+  disjoint_same_100: s2.disjoint? d2
+  disjoint_same_1000: s3.disjoint? d3
+  divide_1arity_0: s0.divide { true }
+  divide_1arity_10: s1.divide { it & 2 }
+  divide_1arity_100: s2.divide { it & 8 }
+  divide_1arity_1000: s3.divide { it & 32 }
+  divide_2arity_0: s0.divide { true }
+  divide_2arity_10: s1.divide { (_1 & 2) == (_2 & 2) }
+  divide_2arity_100: s2.divide { (_1 & 8) == (_2 & 8) }
+  divide_2arity_1000: s3.divide { (_1 & 32) == (_2 & 32) }
+  dup_0: s0.dup
+  dup_10: s1.dup
+  dup_100: s2.dup
+  dup_1000: s3.dup
+  each_0: s0.each { it }
+  each_10: s1.each { it }
+  each_100: s2.each { it }
+  each_1000: s3.each { it }
+  empty_true: s0.empty?
+  empty_false: s3.empty?
+  flatten: ns.flatten
+  flattenb: ns.flatten!
+  include_true_0: s0.include? member
+  include_true_10: s1.include? member
+  include_true_100: s2.include? member
+  include_true_1000: s3.include? member
+  include_false_0: s0.include?(-1)
+  include_false_10: s1.include?(-1)
+  include_false_100: s2.include?(-1)
+  include_false_1000: s3.include?(-1)
+  intersect_0: s0.intersect? o0
+  intersect_10: s1.intersect? o1
+  intersect_100: s2.intersect? o2
+  intersect_1000: s3.intersect? o3
+  intersect_same_0: s0.intersect? d0
+  intersect_same_10: s1.intersect? d1
+  intersect_same_100: s2.intersect? d2
+  intersect_same_1000: s3.intersect? d3
+  join_0: s0.join
+  join_10: s1.join
+  join_100: s2.join
+  join_1000: s3.join
+  join_arg_0: s0.join ""
+  join_arg_10: s1.join ""
+  join_arg_100: s2.join ""
+  join_arg_1000: s3.join ""
+  keep_if_0: s0.keep_if { it }
+  keep_if_10: s1.keep_if { it & 2 == 0 }
+  keep_if_100: s2.keep_if { it & 2 == 0 }
+  keep_if_1000: s3.keep_if { it & 2 == 0 }
+  merge_set: s0.dup.merge(s3, o3)
+  merge_enum: s0.dup.merge(array1, array2)
+  proper_subset_0: s0.proper_subset? s0
+  proper_subset_10: s1.proper_subset? ss1
+  proper_subset_100: s2.proper_subset? ss2
+  proper_subset_1000: s3.proper_subset? ss3
+  proper_subset_false_10: s1.proper_subset? os1
+  proper_subset_false_100: s2.proper_subset? os2
+  proper_subset_false_1000: s3.proper_subset? os3
+  proper_superset_0: s0.proper_superset? s0
+  proper_superset_10: ss1.proper_superset? s1
+  proper_superset_100: ss2.proper_superset? s2
+  proper_superset_1000: ss3.proper_superset? s3
+  proper_superset_false_10: os1.proper_superset? s1
+  proper_superset_false_100: os2.proper_superset? s2
+  proper_superset_false_1000: os3.proper_superset? s3
+  reject_0: s0.reject! { it }
+  reject_10: s1.reject! { it & 2 == 0 }
+  reject_100: s2.reject! { it & 2 == 0 }
+  reject_1000: s3.reject! { it & 2 == 0 }
+  replace_0: s = Set.new; array1.each { s.replace(s0) }
+  replace_10: s = Set.new; array1.each { s.replace(s1) }
+  replace_100: s = Set.new; array1.each { s.replace(s2) }
+  replace_1000: s = Set.new; array1.each { s.replace(s3) }
+  reset_0: s0.reset
+  reset_10: s1.reset
+  reset_100: s2.reset
+  reset_1000: s3.reset
+  select_0: s0.select! { it }
+  select_10: s1.select! { it & 2 == 0 }
+  select_100: s2.select! { it & 2 == 0 }
+  select_1000: s3.select! { it & 2 == 0 }
+  size_0: s0.size
+  size_10: s1.size
+  size_100: s2.size
+  size_1000: s3.size
+  subtract_set: s3.dup.subtract(os3)
+  subtract_enum: s3.dup.subtract(oa3)
+  subtract_same_set: s3.dup.subtract(s3)
+  subtract_same_enum: s3.dup.subtract(a3)
+  subset_0: s0.subset? s0
+  subset_10: s1.subset? ss1
+  subset_100: s2.subset? ss2
+  subset_1000: s3.subset? ss3
+  subset_false_10: s1.subset? os1
+  subset_false_100: s2.subset? os2
+  subset_false_1000: s3.subset? os3
+  superset_0: s0.superset? s0
+  superset_10: ss1.superset? s1
+  superset_100: ss2.superset? s2
+  superset_1000: ss3.superset? s3
+  superset_false_10: os1.superset? s1
+  superset_false_100: os2.superset? s2
+  superset_false_1000: os3.superset? s3
+  to_a_0: s0.to_a
+  to_a_10: s1.to_a
+  to_a_100: s2.to_a
+  to_a_1000: s3.to_a
+  to_set_0: s0.to_set
+  to_set_10: s1.to_set
+  to_set_100: s2.to_set
+  to_set_1000: s3.to_set
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/so_binary_trees.rb
index b1693e4109..b1693e4109 100644
--- a/benchmark/bm_so_binary_trees.rb
+++ b/benchmark/so_binary_trees.rb
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..f7322a8541
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,66 @@
+prelude: |
+  #!/usr/bin/ruby
+
+  wc_input_base = <<EOS
+  Subject:      Re: Who was Izchak Miller?
+  From:         "Jane D. Anonymous" <nobody@yale.edu>
+  Date:         1996/04/28
+  Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+  References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+  To:           75176.2330@compuserve.com
+  Content-Type: text/plain; charset=us-ascii
+  Organization: Yale University
+  X-Url:        news:4lk6vl$gde@ns.oar.net
+  Mime-Version: 1.0
+  Newsgroups:   rec.games.roguelike.nethack
+  X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+  Hello there,  Izchak Miller was my  father.  When I was  younger I spent
+  many  a night,  hunched over  the keyboard  with a  cup of  tea, playing
+  nethack with him and my brother.  my dad was a philosopher with a strong
+  weakness for fantasy/sci fi.  I remember when he started to get involved
+  with the  Nethack team- my  brother's Dungeons and Dragons  monster book
+  found a regular place beside my dad's  desk. it's nice to see him living
+  on in the game he loved so much :-).
+                                                                    Tamar Miller
+
+  The following is a really long word of 5000 characters:
+
+  wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+  EOS
+
+  # prepare 'wc.input'
+
+  def prepare_wc_input(wcbase)
+    wcinput = File.join(File.dirname($0), 'wc.input')
+    unless FileTest.exist?(wcinput)
+      data = wcbase.dup
+      13.times{
+        data << data
+      }
+      File.write(wcinput, data)
+    end
+    at_exit {File.unlink(wcinput) rescue nil}
+  end
+
+  prepare_wc_input(wc_input_base)
+
+benchmark:
+  so_count_words: |
+    # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+    # http://www.bagley.org/~doug/shootout/
+    # with help from Paul Brannan
+
+    nl = nw = nc = 0
+    File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|
+      while tmp = input.read(4096)
+        data = tmp << (input.gets || "")
+        nc += data.length
+        nl += data.count("\n")
+        ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+        nw += data.count(" ") + 1
+      end
+    end
+    # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/so_fannkuch.rb
index bac5ecd44c..bac5ecd44c 100644
--- a/benchmark/bm_so_fannkuch.rb
+++ b/benchmark/so_fannkuch.rb
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/so_fasta.rb
index dcc6b39507..dcc6b39507 100644
--- a/benchmark/bm_so_fasta.rb
+++ b/benchmark/so_fasta.rb
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_k_nucleotide
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(100_000)
+    script: |
+      # The Computer Language Shootout
+      # http://shootout.alioth.debian.org
+      #
+      # contributed by jose fco. gonzalez
+      # modified by Sokolov Yura
+
+      seq = String.new
+
+      def frecuency( seq,length )
+          n, table = seq.length - length + 1, Hash.new(0)
+          f, i = nil, nil
+          (0 ... length).each do |f|
+              (f ... n).step(length) do |i|
+                  table[seq[i,length]] += 1
+              end
+          end
+          [n,table]
+
+      end
+
+      def sort_by_freq( seq,length )
+          n,table = frecuency( seq,length )
+          a, b, v = nil, nil, nil
+          table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+              puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+          end
+          puts
+      end
+
+      def find_seq( seq,s )
+          n,table = frecuency( seq,s.length )
+          puts "#{table[s].to_s}\t#{s.upcase}"
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+      line = input.gets while line !~ /^>THREE/
+      line = input.gets
+
+      while (line !~ /^>/) & line do
+          seq << line.chomp
+          line = input.gets
+      end
+
+      [1,2].each {|i| sort_by_freq( seq,i ) }
+
+      %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+    loop_count: 1
diff --git a/benchmark/bm_so_lists.rb b/benchmark/so_lists.rb
index e8f4a2a5f7..e8f4a2a5f7 100644
--- a/benchmark/bm_so_lists.rb
+++ b/benchmark/so_lists.rb
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/bm_so_mandelbrot.rb
+++ b/benchmark/so_mandelbrot.rb
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..d8c8e3ab9c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminish over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..9884fc4edc
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+  attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+  def initialize(x, y, z, vx, vy, vz, mass)
+    @x, @y, @z = x, y, z
+    @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+    @mass = mass * SOLAR_MASS
+  end
+
+  def move_from_i(bodies, nbodies, dt, i)
+    while i < nbodies
+      b2 = bodies[i]
+      dx = @x - b2.x
+      dy = @y - b2.y
+      dz = @z - b2.z
+
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      mag = dt / (distance * distance * distance)
+      b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+      @vx -= dx * b2_mass_mag
+      @vy -= dy * b2_mass_mag
+      @vz -= dz * b2_mass_mag
+      b2.vx += dx * b_mass_mag
+      b2.vy += dy * b_mass_mag
+      b2.vz += dz * b_mass_mag
+      i += 1
+    end
+
+    @x += dt * @vx
+    @y += dt * @vy
+    @z += dt * @vz
+  end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/bm_so_nsieve.rb
+++ b/benchmark/so_nsieve.rb
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
index 6f958ee44e..6f958ee44e 100644
--- a/benchmark/bm_so_nsieve_bits.rb
+++ b/benchmark/so_nsieve_bits.rb
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/bm_so_partial_sums.rb
+++ b/benchmark/so_partial_sums.rb
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/so_pidigits.rb
index 9a537b2d1c..9a537b2d1c 100644
--- a/benchmark/bm_so_pidigits.rb
+++ b/benchmark/so_pidigits.rb
diff --git a/benchmark/bm_so_random.rb b/benchmark/so_random.rb
index a66b9e8e63..a66b9e8e63 100644
--- a/benchmark/bm_so_random.rb
+++ b/benchmark/so_random.rb
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_reverse_complement
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(2_500_000)
+    script: |
+      # The Great Computer Language Shootout
+      # http://shootout.alioth.debian.org/
+      #
+      # Contributed by Peter Bjarke Olsen
+      # Modified by Doug King
+
+      seq=Array.new
+
+      def revcomp(seq)
+        seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+        stringlen=seq.length
+        0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+      while input.gets
+        if $_ =~ />/
+          if seq.length != 0
+            revcomp(seq.join)
+            seq=Array.new
+          end
+          puts $_
+        else
+          $_.sub(/\n/,'')
+          seq.push $_
+        end
+      end
+      revcomp(seq.join)
+    loop_count: 1
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/so_sieve.rb
index 43dc302648..43dc302648 100644
--- a/benchmark/bm_so_sieve.rb
+++ b/benchmark/so_sieve.rb
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/bm_so_spectralnorm.rb
+++ b/benchmark/so_spectralnorm.rb
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+  str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  capitalize-1: str1.capitalize
+  capitalize-10: str10.capitalize
+  capitalize-100: str100.capitalize
+  capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..88a3555c8a
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,28 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp-1: lstr1.casecmp(ustr1)
+  casecmp-10: lstr10.casecmp(ustr10)
+  casecmp-100: lstr100.casecmp(ustr100)
+  casecmp-1000: lstr1000.casecmp(ustr1000)
+  casecmp-1000vs10: lstr1000.casecmp(ustr10)
+  casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+  casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+  casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+  casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
+  casecmp-nonascii1000vs10: lnonascii1000.casecmp(unonascii10)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp_p-1: lstr1.casecmp?(ustr1)
+  casecmp_p-10: lstr10.casecmp?(ustr10)
+  casecmp_p-100: lstr100.casecmp?(ustr100)
+  casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+  casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+  casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+  casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+  casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_codepoints.yml b/benchmark/string_codepoints.yml
new file mode 100644
index 0000000000..6a07db7ce1
--- /dev/null
+++ b/benchmark/string_codepoints.yml
@@ -0,0 +1,9 @@
+prelude: |
+  mixed_ascii64 = ("a" * 63 + "\u{100}") * 2048
+  mixed_ascii256 = ("a" * 255 + "\u{100}") * 512
+  utf8_2byte = "\u{100}" * 65536
+
+benchmark:
+  codepoints_mixed_ascii64: mixed_ascii64.codepoints
+  codepoints_mixed_ascii256: mixed_ascii256.codepoints
+  codepoints_utf8_2byte: utf8_2byte.codepoints
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
new file mode 100644
index 0000000000..c07fd21013
--- /dev/null
+++ b/benchmark/string_concat.yml
@@ -0,0 +1,51 @@
+prelude: |
+  CHUNK = "a" * 64
+  UCHUNK = "é" * 32
+  SHORT = "a" * (GC.stat_heap(0, :slot_size) / 2)
+  LONG = "a" * (GC.stat_heap(0, :slot_size) * 2)
+  GC.disable # GC causes a lot of variance
+benchmark:
+  binary_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_UTF8: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+  interpolation: |
+    buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
+  interpolation_same_heap: |
+    buffer = "#{SHORT}#{SHORT}"
+  interpolation_switching_heaps: |
+    buffer = "#{SHORT}#{LONG}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  downcase-1: str1.upcase
+  downcase-10: str10.upcase
+  downcase-100: str100.upcase
+  downcase-1000: str1000.upcase
+  downcase-nonascii1: nonascii1.downcase
+  downcase-nonascii10: nonascii10.downcase
+  downcase-nonascii100: nonascii100.downcase
+  downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_dup.yml b/benchmark/string_dup.yml
new file mode 100644
index 0000000000..90793f9f2a
--- /dev/null
+++ b/benchmark/string_dup.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  uplus: |
+    +"A"
+  dup: |
+    "A".dup
diff --git a/benchmark/string_fstring.yml b/benchmark/string_fstring.yml
new file mode 100644
index 0000000000..cafef1f3fe
--- /dev/null
+++ b/benchmark/string_fstring.yml
@@ -0,0 +1,16 @@
+benchmark:
+  fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 5_000_000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 10_000_000
+      -str
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/string_gsub.yml b/benchmark/string_gsub.yml
new file mode 100644
index 0000000000..c26e1a6498
--- /dev/null
+++ b/benchmark/string_gsub.yml
@@ -0,0 +1,54 @@
+prelude: |
+  # frozen_string_literal: true
+  STR = ((("a" * 31) + "<") * 1000).freeze
+  STR_UNICODE = ((("a" * 30) + "\u2028") * 1000).freeze
+  ESCAPED_CHARS_BINARY = {
+    "\u2028".b => '\u2028'.b,
+    "\u2029".b => '\u2029'.b,
+    ">".b => '\u003e'.b.freeze,
+    "<".b => '\u003c'.b.freeze,
+    "&".b => '\u0026'.b.freeze,
+  }
+  BINARY_PATTERN = Regexp.union(ESCAPED_CHARS_BINARY.keys)
+
+  ESCAPED_CHARS = {
+    "\u2028" => '\u2028',
+    "\u2029" => '\u2029',
+    ">" => '\u003e',
+    "<" => '\u003c',
+    "&" => '\u0026',
+  }
+  ESCAPE_PATTERN = Regexp.union(ESCAPED_CHARS.keys)
+
+  NO_MATCH_SHARED_STRING = ("a" * 100_000).freeze
+
+benchmark:
+  gsub_no_match_shared: |
+    str = NO_MATCH_SHARED_STRING.dup
+    str.gsub!("z", "x")
+    str
+
+  sub_no_match_shared: |
+    str = NO_MATCH_SHARED_STRING.dup
+    str.sub!("z", "x")
+    str
+
+  escape: |
+    str = STR.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_bin: |
+    str = STR.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
+
+  escape_utf8: |
+    str = STR_UNICODE.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_utf8_bin: |
+    str = STR_UNICODE.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
diff --git a/benchmark/bm_string_index.rb b/benchmark/string_index.rb
index 7783111082..7783111082 100644
--- a/benchmark/bm_string_index.rb
+++ b/benchmark/string_index.rb
diff --git a/benchmark/string_memsearch.yml b/benchmark/string_memsearch.yml
new file mode 100644
index 0000000000..cde363289a
--- /dev/null
+++ b/benchmark/string_memsearch.yml
@@ -0,0 +1,75 @@
+prelude: |
+  # Haystacks of various sizes
+  small_hay  = "a" * 256
+  medium_hay = "a" * 4096
+  large_hay  = "a" * 65536
+
+  # Short needles (2-8 bytes) that exercise rb_memsearch_ss
+  needle_2 = "xy"
+  needle_4 = "xyzw"
+  needle_8 = "xyzwabcd"
+
+  # Needle whose first byte is absent from the haystack (memchr fast-path)
+  # vs needle whose first byte is common (rolling hash comparison)
+  first_byte_absent  = "x" + "a" * 3
+  first_byte_common  = "a" + "x" * 3
+
+  # Haystack with match at the end
+  hay_match_end = "a" * 4095 + "xy"
+
+  # Haystack with match at the start
+  hay_match_start = "xy" + "a" * 4094
+
+  # Mixed content haystack (more realistic)
+  mixed_hay = (("abcdefghij" * 100) + "z") * 10
+
+benchmark:
+  # === First byte absent from haystack (biggest win for rolling hash) ===
+  index_first_byte_absent_small: |
+    small_hay.index(first_byte_absent)
+  index_first_byte_absent_medium: |
+    medium_hay.index(first_byte_absent)
+  index_first_byte_absent_large: |
+    large_hay.index(first_byte_absent)
+
+  # === First byte common in haystack (stresses comparison loop) ===
+  index_first_byte_common_small: |
+    small_hay.index(first_byte_common)
+  index_first_byte_common_medium: |
+    medium_hay.index(first_byte_common)
+  index_first_byte_common_large: |
+    large_hay.index(first_byte_common)
+
+  # === Needle length variations (all absent) ===
+  index_needle_2_absent: |
+    medium_hay.index(needle_2)
+  index_needle_4_absent: |
+    medium_hay.index(needle_4)
+  index_needle_8_absent: |
+    medium_hay.index(needle_8)
+
+  # === Match at end of haystack ===
+  index_match_at_end: |
+    hay_match_end.index(needle_2)
+
+  # === Match at start of haystack ===
+  index_match_at_start: |
+    hay_match_start.index(needle_2)
+
+  # === include? (same code path) ===
+  include_first_byte_absent: |
+    medium_hay.include?(first_byte_absent)
+  include_first_byte_common: |
+    medium_hay.include?(first_byte_common)
+
+  # === byteindex ===
+  byteindex_first_byte_absent: |
+    medium_hay.byteindex(first_byte_absent)
+  byteindex_first_byte_common: |
+    medium_hay.byteindex(first_byte_common)
+
+  # === Mixed/realistic haystack ===
+  index_mixed_absent: |
+    mixed_hay.index(needle_4)
+  index_mixed_present: |
+    mixed_hay.index("ijab")
diff --git a/benchmark/string_rpartition.yml b/benchmark/string_rpartition.yml
new file mode 100644
index 0000000000..37e9d1b071
--- /dev/null
+++ b/benchmark/string_rpartition.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10 + ":"
+  str100 = str1 * 100 + ":"
+  str1000 = str1 * 1000 + ":"
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10 + ":"
+  nonascii100 = nonascii1 * 100 + ":"
+  nonascii1000 = nonascii1 * 1000 + ":"
+benchmark:
+  rpartition-1: str1.rpartition(":")
+  rpartition-10: str10.rpartition(":")
+  rpartition-100: str100.rpartition(":")
+  rpartition-1000: str1000.rpartition(":")
+  rpartition-nonascii1: nonascii1.rpartition(":")
+  rpartition-nonascii10: nonascii10.rpartition(":")
+  rpartition-nonascii100: nonascii100.rpartition(":")
+  rpartition-nonascii1000: nonascii1000.rpartition(":")
diff --git a/benchmark/bm_string_scan_re.rb b/benchmark/string_scan_re.rb
index b0d60201a9..b0d60201a9 100644
--- a/benchmark/bm_string_scan_re.rb
+++ b/benchmark/string_scan_re.rb
diff --git a/benchmark/bm_string_scan_str.rb b/benchmark/string_scan_str.rb
index 42440bd948..42440bd948 100644
--- a/benchmark/bm_string_scan_str.rb
+++ b/benchmark/string_scan_str.rb
diff --git a/benchmark/string_scrub.yml b/benchmark/string_scrub.yml
new file mode 100644
index 0000000000..4b5faaad8e
--- /dev/null
+++ b/benchmark/string_scrub.yml
@@ -0,0 +1,48 @@
+prelude: |
+
+  STRING_SIZE = 1024
+  def duplicate_to_length(str, target_length)
+    return "" if target_length <= 0
+    return str[0, target_length] if str.length >= target_length
+
+    (str * ((target_length / str.length) + 1))[0, target_length]
+  end
+  base = "Hello \u{1f600} world! \u{00e9}\u{00f1}"
+  padding = duplicate_to_length(base, STRING_SIZE)
+
+  valid_utf8 = (padding.b + "OK".b).force_encoding("UTF-8")
+  valid_utf8.valid_encoding?
+  unknown_but_valid_utf8 = valid_utf8.dup.b.force_encoding("UTF-8")
+  invalid_utf8 = (padding.b + "\x80\xFF".b).force_encoding("UTF-8")
+  invalid_utf8.valid_encoding?
+  unknown_but_invalid_utf8 = (padding.b + "\x80\xFF".b).force_encoding("UTF-8")
+
+  worst_case_utf8 = duplicate_to_length("\u{1f600}\u{00e9}\u{00f1}", STRING_SIZE).b.force_encoding("UTF-8")
+
+  unknown_but_valid_utf8_worst_case = worst_case_utf8.dup.b.force_encoding("UTF-8")
+  unknown_but_invalid_utf8_worst_case = (worst_case_utf8.b + "\x80\xFF".b).force_encoding("UTF-8")
+
+benchmark:
+  scrub_known_valid: |
+    string = valid_utf8.dup
+    string.scrub!
+
+  scrub_known_invalid: |
+    string = invalid_utf8.dup
+    string.scrub!
+
+  scrub_unknown_but_valid_coderange: |
+    string = unknown_but_valid_utf8.dup
+    string.scrub!
+
+  scrub_unknown_and_invalid_coderange: |
+    string = unknown_but_invalid_utf8.dup
+    string.scrub!
+
+  scrub_unknown_but_valid_coderange_worst_case: |
+    string = unknown_but_valid_utf8_worst_case.dup
+    string.scrub!
+
+  scrub_unknown_and_invalid_coderange_worst_case: |
+    string = unknown_but_invalid_utf8_worst_case.dup
+    string.scrub!
\ No newline at end of file
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+  long_string = "x"*1000+"-hår"
+benchmark:
+  regexp-short: |
+    "x-hår".slice!(/-(.)(.)(.)/, 3)
+  regexp-long: |
+    long_string.dup.slice!(/-(.)(.)(.)/, 3)
+  string-short: |
+    "x-hår".slice!("r")
+  string-long: |
+    long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+  str1 = [*0..5].join(" ") + " "
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  to_chars-1: str1.split('')
+  to_chars-10: str10.split('')
+  to_chars-100: str100.split('')
+  to_chars-1000: str1000.split('')
+  to_words-1: str1.split(' ')
+  to_words-10: str10.split(' ')
+  to_words-100: str100.split(' ')
+  to_words-1000: str1000.split(' ')
+  re_chars-1: str1.split(//)
+  re_chars-10: str10.split(//)
+  re_chars-100: str100.split(//)
+  re_chars-1000: str1000.split(//)
+  re_space-1: str1.split(/ /)
+  re_space-10: str10.split(/ /)
+  re_space-100: str100.split(/ /)
+  re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  swapcase-1: str1.swapcase
+  swapcase-10: str10.swapcase
+  swapcase-100: str100.swapcase
+  swapcase-1000: str1000.swapcase
+  swapcase-nonascii1: nonascii1.swapcase
+  swapcase-nonascii10: nonascii10.swapcase
+  swapcase-nonascii100: nonascii100.swapcase
+  swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  upcase-1: str1.upcase
+  upcase-10: str10.upcase
+  upcase-100: str100.upcase
+  upcase-1000: str1000.upcase
+  upcase-nonascii1: nonascii1.upcase
+  upcase-nonascii10: nonascii10.upcase
+  upcase-nonascii100: nonascii100.upcase
+  upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/struct_accessor.yml b/benchmark/struct_accessor.yml
new file mode 100644
index 0000000000..d95240e2dd
--- /dev/null
+++ b/benchmark/struct_accessor.yml
@@ -0,0 +1,37 @@
+prelude: |
+  C = Struct.new(:x) do
+    def initialize(...)
+      super
+      @ivar = 42
+    end
+
+    attr_accessor :ivar
+
+    class_eval <<-END
+      def r
+        #{'x;'*256}
+      end
+      def w
+        #{'self.x = nil;'*256}
+      end
+      def rm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def wm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+      def r_ivar
+        #{'ivar;'*256}
+      end
+    END
+  end
+  C.new(nil) # ensure common shape is known
+  obj = C.new(nil)
+benchmark:
+  member_reader: "obj.r"
+  member_writer: "obj.w"
+  member_reader_method: "obj.rm"
+  member_writer_method: "obj.wm"
+  ivar_reader: "obj.r_ivar"
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  - 'Time.at(0)'
+  - 'Time.at(0, 500)'
+  - 'Time.at(0, in: "+09:00")'
+  - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.new(2021)'
+  - 'Time.new(2021, 8, 22)'
+  - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_now.yml b/benchmark/time_now.yml
new file mode 100644
index 0000000000..9336877cd4
--- /dev/null
+++ b/benchmark/time_now.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.now'
+  - 'Time.now(in: "+09:00")'
+  - 'Time.now.year'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..6060b58bc6
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,10 @@
+prelude: |
+  require 'time'
+  inspect = "2021-08-23 09:57:02 +0900"
+  iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+  - Time.iso8601(iso8601)
+  - Time.parse(iso8601)
+  - Time.parse(inspect)
+  - Time.new(iso8601) rescue Time.iso8601(iso8601)
+  - Time.new(inspect) rescue Time.parse(inspect)
diff --git a/benchmark/time_strftime.yml b/benchmark/time_strftime.yml
new file mode 100644
index 0000000000..28f62aec87
--- /dev/null
+++ b/benchmark/time_strftime.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+  time = Time.now
+benchmark:
+  - time.strftime("%FT%T")     # 19B
+  - time.strftime("%FT%T.%3N") # 23B
+  - time.strftime("%FT%T.%6N") # 26B
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'time'
+benchmark:
+  - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+  - Time.strptime("1", "%s")
+  - Time.strptime("0 +0100", "%s %z")
+  - Time.strptime("0 UTC", "%s %z")
+  - Time.strptime("1.5", "%s.%N")
+  - Time.strptime("1.000000000001", "%s.%N")
+  - Time.strptime("20010203 -0200", "%Y%m%d %z")
+  - Time.strptime("20010203 UTC", "%Y%m%d %z")
+  - Time.strptime("2018-365", "%Y-%j")
+  - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/bm_time_subsec.rb b/benchmark/time_subsec.rb
index 505021c701..505021c701 100644
--- a/benchmark/bm_time_subsec.rb
+++ b/benchmark/time_subsec.rb
diff --git a/benchmark/time_xmlschema.yml b/benchmark/time_xmlschema.yml
new file mode 100644
index 0000000000..654e5cfcbc
--- /dev/null
+++ b/benchmark/time_xmlschema.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal
+  unless Time.method_defined?(:xmlschema)
+    class Time
+      def xmlschema(fraction_digits=0)
+        fraction_digits = fraction_digits.to_i
+        s = strftime("%FT%T")
+        if fraction_digits > 0
+          s << strftime(".%#{fraction_digits}N")
+        end
+        s << (utc? ? 'Z' : strftime("%:z"))
+      end
+    end
+  end
+  time = Time.now
+  utc_time = Time.now.utc
+  fraction_sec = Time.at(123456789.quo(9999999999)).getlocal("+09:00")
+  future_time = Time.utc(10000)
+benchmark:
+  - time.xmlschema
+  - utc_time.xmlschema
+  - time.xmlschema(6)
+  - utc_time.xmlschema(6)
+  - time.xmlschema(9)
+  - utc_time.xmlschema(9)
+  - fraction_sec.xmlschema(10)
+  - future_time.xmlschema
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_array: |
+    a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_reader :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar: |
+    j = obj.a
+    k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_accessor :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar_set: |
+    obj.a = 1
+    obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/vm_backtrace.rb
index 0fbf73e1ca..0fbf73e1ca 100644
--- a/benchmark/bm_vm3_backtrace.rb
+++ b/benchmark/vm_backtrace.rb
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+  vm_bigarray: |
+    a = [
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+    ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_bighash: |
+    a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+  def m
+    yield
+  end
+benchmark:
+  vm_block: |
+    m{
+    }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+  p = proc{_1}
+  o = Object.new
+  def o.each
+    i = 0
+    while i < 3_000_000 do
+      yield i
+      i += 1
+    end
+  end
+
+benchmark:
+  - name: block_handler_type_iseq
+    script: |
+      o.each{_1}
+
+  - name: block_handler_type_symbol
+    script: |
+      o.each(&:itself)
+
+  - name: block_handler_type_proc
+    script: |
+      o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m &b
+  end
+benchmark:
+  vm_blockparam: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644
index 0000000000..a7d8d366ea
--- /dev/null
+++ b/benchmark/vm_blockparam_call.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m &b
+    b.call
+  end
+benchmark:
+  vm_blockparam_call: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_pass.yml b/benchmark/vm_blockparam_pass.yml
new file mode 100644
index 0000000000..841f5e7a63
--- /dev/null
+++ b/benchmark/vm_blockparam_pass.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def bp_yield
+    yield
+  end
+
+  def bp_pass &b
+    bp_yield &b
+  end
+benchmark:
+  vm_blockparam_pass: |
+    bp_pass{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_yield.yml b/benchmark/vm_blockparam_yield.yml
new file mode 100644
index 0000000000..8ea9b46ed2
--- /dev/null
+++ b/benchmark/vm_blockparam_yield.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def bp_yield &b
+    yield
+  end
+benchmark:
+  vm_blockparam_yield: |
+    bp_yield{}
+loop_count: 30000000
diff --git a/benchmark/vm_call_bmethod.yml b/benchmark/vm_call_bmethod.yml
new file mode 100644
index 0000000000..40136e5aa4
--- /dev/null
+++ b/benchmark/vm_call_bmethod.yml
@@ -0,0 +1,37 @@
+prelude: |
+  define_method(:a0){}
+  define_method(:a1){|a| a}
+  define_method(:s){|*a| a}
+  define_method(:b){|kw: 1| kw}
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t100 = 100.times.to_a
+  kw = {kw: 2}
+benchmark:
+  bmethod_simple_0: |
+    a0
+  bmethod_simple_1: |
+    a1(1)
+  bmethod_simple_0_splat: |
+    a0(*t0)
+  bmethod_simple_1_splat: |
+    a1(*t1)
+  bmethod_no_splat: |
+    s
+  bmethod_0_splat: |
+    s(*t0)
+  bmethod_1_splat: |
+    s(*t1)
+  bmethod_10_splat: |
+    s(*t10)
+  bmethod_100_splat: |
+    s(*t100)
+  bmethod_kw: |
+    b(kw: 1)
+  bmethod_no_kw: |
+    b
+  bmethod_kw_splat: |
+    b(**kw)
+loop_count: 6000000
diff --git a/benchmark/vm_call_kw_and_kw_splat.yml b/benchmark/vm_call_kw_and_kw_splat.yml
new file mode 100644
index 0000000000..aa6e549e0c
--- /dev/null
+++ b/benchmark/vm_call_kw_and_kw_splat.yml
@@ -0,0 +1,25 @@
+prelude: |
+  h1, h10, h100, h1000 = [1, 10, 100, 1000].map do |n|
+    h = {kw: 1}
+    n.times{|i| h[i.to_s.to_sym] = i}
+    h
+  end
+  eh = {}
+  def kw(kw: nil, **kws) end
+benchmark:
+  1: |
+    kw(**h1)
+  1_mutable: |
+    kw(**eh, **h1)
+  10: |
+    kw(**h10)
+  10_mutable: |
+    kw(**eh, **h10)
+  100: |
+    kw(**h100)
+  100_mutable: |
+    kw(**eh, **h100)
+  1000: |
+    kw(**h1000)
+  1000_mutable: |
+    kw(**eh, **h1000)
diff --git a/benchmark/vm_call_method_missing.yml b/benchmark/vm_call_method_missing.yml
new file mode 100644
index 0000000000..f890796f11
--- /dev/null
+++ b/benchmark/vm_call_method_missing.yml
@@ -0,0 +1,62 @@
+prelude: |
+  class A0
+    def method_missing(m); m end
+  end
+  class A1
+    def method_missing(m, a) a; end
+  end
+  class S
+    def method_missing(m, *a) a; end
+  end
+  class B
+    def method_missing(m, kw: 1) kw end
+  end
+  class SB
+    def method_missing(m, *a, kw: 1) kw end
+  end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+  kw = {kw: 2}
+
+  a0 = A0.new
+  a1 = A1.new
+  s = S.new
+  b = B.new
+  sb = SB.new
+benchmark:
+  method_missing_simple_0: |
+    a0.()
+  method_missing_simple_1: |
+    a1.x(1)
+  method_missing_simple_0_splat: |
+    a0.(*t0)
+  method_missing_simple_1_splat: |
+    a1.(*t1)
+  method_missing_no_splat: |
+    s.()
+  method_missing_0_splat: |
+    s.(*t0)
+  method_missing_1_splat: |
+    s.(*t1)
+  method_missing_10_splat: |
+    s.(*t10)
+  method_missing_200_splat: |
+    s.(*t200)
+  method_missing_kw: |
+    b.(kw: 1)
+  method_missing_no_kw: |
+    b.()
+  method_missing_kw_splat: |
+    b.(**kw)
+  method_missing_0_splat_kw: |
+    sb.(*t0, **kw)
+  method_missing_1_splat_kw: |
+    sb.(*t1, **kw)
+  method_missing_10_splat_kw: |
+    sb.(*t10, **kw)
+  method_missing_200_splat_kw: |
+    sb.(*t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_call_send_iseq.yml b/benchmark/vm_call_send_iseq.yml
new file mode 100644
index 0000000000..60ff23c475
--- /dev/null
+++ b/benchmark/vm_call_send_iseq.yml
@@ -0,0 +1,77 @@
+prelude: |
+  def a0; end
+  def a1(a) a; end
+  def s(*a) a; end
+  def b(kw: 1) kw end
+  def sb(*a, kw: 1) kw end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+
+  a0_t0 = [:a0, *t0]
+  a1_t1 = [:a1, *t1]
+  s_t0 = [:s, *t0]
+  s_t1 = [:s, *t1]
+  s_t10 = [:s, *t10]
+  s_t200 = [:s, *t200]
+  sb_t0 = [:sb, *t0]
+  sb_t1 = [:sb, *t1]
+  sb_t10 = [:sb, *t10]
+  sb_t200 = [:sb, *t200]
+  kw = {kw: 2}
+benchmark:
+  send_simple_0: |
+    send(:a0)
+  send_simple_1: |
+    send(:a1, 1)
+  send_simple_0_splat: |
+    send(:a0, *t0)
+  send_simple_1_splat: |
+    send(:a1, *t1)
+  send_simple_0_splat_comb: |
+    send(*a0_t0)
+  send_simple_1_splat_comb: |
+    send(*a1_t1)
+  send_no_splat: |
+    send(:s)
+  send_0_splat: |
+    send(:s, *t0)
+  send_1_splat: |
+    send(:s, *t1)
+  send_10_splat: |
+    send(:s, *t10)
+  send_200_splat: |
+    send(:s, *t200)
+  send_0_splat_comb: |
+    send(*s_t0)
+  send_1_splat_comb: |
+    send(*s_t1)
+  send_10_splat_comb: |
+    send(*s_t10)
+  send_200_splat_comb: |
+    send(*s_t200)
+  send_kw: |
+    send(:b, kw: 1)
+  send_no_kw: |
+    send(:b)
+  send_kw_splat: |
+    send(:b, **kw)
+  send_0_splat_kw: |
+    send(:sb, *t0, **kw)
+  send_1_splat_kw: |
+    send(:sb, *t1, **kw)
+  send_10_splat_kw: |
+    send(:sb, *t10, **kw)
+  send_200_splat_kw: |
+    send(:sb, *t200, **kw)
+  send_0_splat_comb_kw: |
+    send(*sb_t0, **kw)
+  send_1_splat_comb_kw: |
+    send(*sb_t1, **kw)
+  send_10_splat_comb_kw: |
+    send(*sb_t10, **kw)
+  send_200_splat_comb_kw: |
+    send(*sb_t200, **kw)
+loop_count: 3000000
diff --git a/benchmark/vm_call_symproc.yml b/benchmark/vm_call_symproc.yml
new file mode 100644
index 0000000000..16e0ac579e
--- /dev/null
+++ b/benchmark/vm_call_symproc.yml
@@ -0,0 +1,83 @@
+prelude: |
+  def self.a0; end
+  def self.a1(a) a; end
+  def self.s(*a) a; end
+  def self.b(kw: 1) kw end
+  def self.sb(*a, kw: 1) kw end
+
+  t0 = 0.times.to_a
+  t1 = 1.times.to_a
+  t10 = 10.times.to_a
+  t200 = 200.times.to_a
+
+  a0_t0 = [self, *t0]
+  a1_t1 = [self, *t1]
+  s_t0 = [self, *t0]
+  s_t1 = [self, *t1]
+  s_t10 = [self, *t10]
+  s_t200 = [self, *t200]
+  sb_t0 = [self, *t0]
+  sb_t1 = [self, *t1]
+  sb_t10 = [self, *t10]
+  sb_t200 = [self, *t200]
+  kw = {kw: 2}
+
+  a0 = :a0.to_proc
+  a1 = :a1.to_proc
+  s = :s.to_proc
+  b = :b.to_proc
+  sb = :sb.to_proc
+benchmark:
+  symproc_simple_0: |
+    a0.(self)
+  symproc_simple_1: |
+    a1.(self, 1)
+  symproc_simple_0_splat: |
+    a0.(self, *t0)
+  symproc_simple_1_splat: |
+    a1.(self, *t1)
+  symproc_simple_0_splat_comb: |
+    a0.(*a0_t0)
+  symproc_simple_1_splat_comb: |
+    a1.(*a1_t1)
+  symproc_no_splat: |
+    s.(self)
+  symproc_0_splat: |
+    s.(self, *t0)
+  symproc_1_splat: |
+    s.(self, *t1)
+  symproc_10_splat: |
+    s.(self, *t10)
+  symproc_200_splat: |
+    s.(self, *t200)
+  symproc_0_splat_comb: |
+    s.(*s_t0)
+  symproc_1_splat_comb: |
+    s.(*s_t1)
+  symproc_10_splat_comb: |
+    s.(*s_t10)
+  symproc_200_splat_comb: |
+    s.(*s_t200)
+  symproc_kw: |
+    b.(self, kw: 1)
+  symproc_no_kw: |
+    b.(self)
+  symproc_kw_splat: |
+    b.(self, **kw)
+  symproc_0_splat_kw: |
+    sb.(self, *t0, **kw)
+  symproc_1_splat_kw: |
+    sb.(self, *t1, **kw)
+  symproc_10_splat_kw: |
+    sb.(self, *t10, **kw)
+  symproc_200_splat_kw: |
+    sb.(self, *t200, **kw)
+  symproc_0_splat_comb_kw: |
+    sb.(*sb_t0, **kw)
+  symproc_1_splat_comb_kw: |
+    sb.(*sb_t1, **kw)
+  symproc_10_splat_comb_kw: |
+    sb.(*sb_t10, **kw)
+  symproc_200_splat_comb_kw: |
+    sb.(*sb_t200, **kw)
+loop_count: 1000000
diff --git a/benchmark/vm_case.yml b/benchmark/vm_case.yml
new file mode 100644
index 0000000000..b26a491a15
--- /dev/null
+++ b/benchmark/vm_case.yml
@@ -0,0 +1,13 @@
+benchmark:
+  vm_case: |
+    case :foo
+    when :bar
+      raise
+    when :baz
+      raise
+    when :boo
+      raise
+    when :foo
+      # noop
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_classes.yml b/benchmark/vm_case_classes.yml
new file mode 100644
index 0000000000..cacc4f0464
--- /dev/null
+++ b/benchmark/vm_case_classes.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_case_classes: |
+    case :foo
+    when Hash
+      raise
+    when Array
+      raise
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_case_lit.yml b/benchmark/vm_case_lit.yml
new file mode 100644
index 0000000000..9f91801544
--- /dev/null
+++ b/benchmark/vm_case_lit.yml
@@ -0,0 +1,23 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_case_lit: |
+    i = 0
+    @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+    def foo(i)
+      @ret[i % @ret.size]
+    end
+
+    while i<6_000_000
+      case foo(i)
+      when "foo" then :foo
+      when true then true
+      when false then false
+      when :sym then :sym
+      when 6 then :fix
+      when nil then nil
+      when 0.1 then :float
+      when 0xffffffffffffffff then :big
+      end
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/vm_clearmethodcache.rb
index 9661323cd2..9661323cd2 100644
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ b/benchmark/vm_clearmethodcache.rb
diff --git a/benchmark/vm_const.yml b/benchmark/vm_const.yml
new file mode 100644
index 0000000000..8939ca0cd3
--- /dev/null
+++ b/benchmark/vm_const.yml
@@ -0,0 +1,13 @@
+prelude: |
+  Const = 1
+  A = B = C = D = E = F = G = H = I = J = K = L = M = N = O = P = Q = R = S = T = U = V = W = X = Y = Z = 1
+  def foo
+    A; B; C; D; E; F; G; H; I; J; K; L; M; N; O; P; Q; R; S; T; U; V; W; X; Y; Z
+  end
+benchmark:
+  vm_const: |
+    j = Const
+    k = Const
+  vm_const_many: |
+    foo
+loop_count: 30000000
diff --git a/benchmark/vm_cvar.yml b/benchmark/vm_cvar.yml
new file mode 100644
index 0000000000..1d0e161829
--- /dev/null
+++ b/benchmark/vm_cvar.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    @@foo = 1
+
+    def self.foo
+      @@foo
+    end
+
+    ("A".."Z").each do |module_name|
+      eval <<-EOM
+        module #{module_name}
+        end
+
+        include #{module_name}
+      EOM
+    end
+  end
+benchmark:
+  vm_cvar: A.foo
+loop_count: 600000
diff --git a/benchmark/vm_defined_method.yml b/benchmark/vm_defined_method.yml
new file mode 100644
index 0000000000..347e0cfd33
--- /dev/null
+++ b/benchmark/vm_defined_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  class Object
+    define_method(:m){}
+  end
+benchmark:
+  vm_defined_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_dstr.yml b/benchmark/vm_dstr.yml
new file mode 100644
index 0000000000..30c7a3193c
--- /dev/null
+++ b/benchmark/vm_dstr.yml
@@ -0,0 +1,6 @@
+prelude: |
+  x = y = 'z'
+benchmark:
+  vm_dstr: |
+    str = "foo#{x}bar#{y}baz"
+loop_count: 6000000
diff --git a/benchmark/vm_dstr_ary.rb b/benchmark/vm_dstr_ary.rb
new file mode 100644
index 0000000000..1d3aa3b97b
--- /dev/null
+++ b/benchmark/vm_dstr_ary.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = []
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_bool.rb b/benchmark/vm_dstr_bool.rb
new file mode 100644
index 0000000000..631ca54755
--- /dev/null
+++ b/benchmark/vm_dstr_bool.rb
@@ -0,0 +1,7 @@
+i = 0
+x = true
+y = false
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_class_module.rb b/benchmark/vm_dstr_class_module.rb
new file mode 100644
index 0000000000..becf0861c7
--- /dev/null
+++ b/benchmark/vm_dstr_class_module.rb
@@ -0,0 +1,10 @@
+i = 0
+class A; end unless defined?(A)
+module B; end unless defined?(B)
+x = A
+y = B
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
+
diff --git a/benchmark/vm_dstr_digit.rb b/benchmark/vm_dstr_digit.rb
new file mode 100644
index 0000000000..caaa395192
--- /dev/null
+++ b/benchmark/vm_dstr_digit.rb
@@ -0,0 +1,7 @@
+i = 0
+x = 0
+y = 9
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_int.rb b/benchmark/vm_dstr_int.rb
new file mode 100644
index 0000000000..ed380d7595
--- /dev/null
+++ b/benchmark/vm_dstr_int.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{i}bar#{i}baz"
+end
diff --git a/benchmark/vm_dstr_nil.rb b/benchmark/vm_dstr_nil.rb
new file mode 100644
index 0000000000..ec4f5d6c67
--- /dev/null
+++ b/benchmark/vm_dstr_nil.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = nil
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj.rb b/benchmark/vm_dstr_obj.rb
new file mode 100644
index 0000000000..fb78637ead
--- /dev/null
+++ b/benchmark/vm_dstr_obj.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = Object.new
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_obj_def.rb b/benchmark/vm_dstr_obj_def.rb
new file mode 100644
index 0000000000..99ff7b98fb
--- /dev/null
+++ b/benchmark/vm_dstr_obj_def.rb
@@ -0,0 +1,8 @@
+i = 0
+o = Object.new
+def o.to_s; -""; end
+x = y = o
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_str.rb b/benchmark/vm_dstr_str.rb
new file mode 100644
index 0000000000..45fc107892
--- /dev/null
+++ b/benchmark/vm_dstr_str.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = ""
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_dstr_sym.rb b/benchmark/vm_dstr_sym.rb
new file mode 100644
index 0000000000..484b8f8150
--- /dev/null
+++ b/benchmark/vm_dstr_sym.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = :z
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/vm_ensure.yml b/benchmark/vm_ensure.yml
new file mode 100644
index 0000000000..4ea62f30de
--- /dev/null
+++ b/benchmark/vm_ensure.yml
@@ -0,0 +1,14 @@
+# Not utilizing loop_count since using it for this is too unstable for now
+benchmark:
+  vm_ensure: |
+    i = 0
+    while i<30_000_000
+      i += 1
+      begin
+        begin
+        ensure
+        end
+      ensure
+      end
+    end
+loop_count: 1
diff --git a/benchmark/vm_eval.yml b/benchmark/vm_eval.yml
new file mode 100644
index 0000000000..7ba1a8d1de
--- /dev/null
+++ b/benchmark/vm_eval.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_eval: |
+    eval("1")
+loop_count: 6000000
diff --git a/benchmark/vm_fiber_allocate.yml b/benchmark/vm_fiber_allocate.yml
new file mode 100644
index 0000000000..b5a54e1ddf
--- /dev/null
+++ b/benchmark/vm_fiber_allocate.yml
@@ -0,0 +1,8 @@
+prelude: |
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  vm_fiber_allocate: |
+    fiber = Fiber.new{Fiber.yield}
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_count.yml b/benchmark/vm_fiber_count.yml
new file mode 100644
index 0000000000..b83d3152d4
--- /dev/null
+++ b/benchmark/vm_fiber_count.yml
@@ -0,0 +1,10 @@
+# On Linux, you will need to increase the maximum number of memory maps:
+# sudo sysctl -w vm.max_map_count=200000
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_count: |
+    fiber = Fiber.new{Fiber.yield}
+    fibers << fiber
+    fiber.resume
+loop_count: 100000
diff --git a/benchmark/vm_fiber_reuse.yml b/benchmark/vm_fiber_reuse.yml
new file mode 100644
index 0000000000..4ca41085b1
--- /dev/null
+++ b/benchmark/vm_fiber_reuse.yml
@@ -0,0 +1,14 @@
+prelude: |
+  GC.disable
+  fibers = []
+benchmark:
+  vm_fiber_reuse: |
+    1024.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+
+    fibers.clear
+    GC.start
+loop_count: 200
diff --git a/benchmark/vm_fiber_reuse_gc.yml b/benchmark/vm_fiber_reuse_gc.yml
new file mode 100644
index 0000000000..892622f121
--- /dev/null
+++ b/benchmark/vm_fiber_reuse_gc.yml
@@ -0,0 +1,12 @@
+# https://bugs.ruby-lang.org/issues/16009
+prelude: |
+  fibers = []
+benchmark:
+  vm_fiber_reuse_gc: |
+    2000.times do
+      fiber = Fiber.new{Fiber.yield}
+      fibers << fiber
+      fiber.resume
+    end
+    fibers.clear
+loop_count: 100
diff --git a/benchmark/vm_fiber_switch.yml b/benchmark/vm_fiber_switch.yml
new file mode 100644
index 0000000000..3de36b66eb
--- /dev/null
+++ b/benchmark/vm_fiber_switch.yml
@@ -0,0 +1,9 @@
+prelude: |
+  # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
+  fib = Fiber.new do
+    loop { Fiber.yield }
+  end
+benchmark:
+  vm_fiber_switch: |
+    fib.resume
+loop_count: 20000000
diff --git a/benchmark/vm_float_simple.yml b/benchmark/vm_float_simple.yml
new file mode 100644
index 0000000000..92f5fd52ab
--- /dev/null
+++ b/benchmark/vm_float_simple.yml
@@ -0,0 +1,8 @@
+prelude: |
+  f = 0.0
+benchmark:
+  vm_float_simple: |
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+    f += 0.1; f -= 0.1
+loop_count: 30000000
diff --git a/benchmark/vm_freezeobj.yml b/benchmark/vm_freezeobj.yml
new file mode 100644
index 0000000000..69a795a354
--- /dev/null
+++ b/benchmark/vm_freezeobj.yml
@@ -0,0 +1,6 @@
+prelude: |
+ objs = 100000.times.map { Object.new }
+benchmark:
+  vm_freeze_obj: |
+    objs.map(&:freeze)
+loop_count: 600
diff --git a/benchmark/vm_freezestring.yml b/benchmark/vm_freezestring.yml
new file mode 100644
index 0000000000..facc9aa043
--- /dev/null
+++ b/benchmark/vm_freezestring.yml
@@ -0,0 +1,10 @@
+prelude: |
+  class String
+    def freeze
+      -self
+    end
+  end
+benchmark:
+  vm_freezestring: |
+    "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
+loop_count: 6000000
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/vm_gc.rb
index e668026915..e668026915 100644
--- a/benchmark/bm_vm3_gc.rb
+++ b/benchmark/vm_gc.rb
diff --git a/benchmark/bm_vm3_gc_old_full.rb b/benchmark/vm_gc_old_full.rb
index cfdfc8c5a5..cfdfc8c5a5 100644
--- a/benchmark/bm_vm3_gc_old_full.rb
+++ b/benchmark/vm_gc_old_full.rb
diff --git a/benchmark/bm_vm3_gc_old_immediate.rb b/benchmark/vm_gc_old_immediate.rb
index ad22feb655..ad22feb655 100644
--- a/benchmark/bm_vm3_gc_old_immediate.rb
+++ b/benchmark/vm_gc_old_immediate.rb
diff --git a/benchmark/bm_vm3_gc_old_lazy.rb b/benchmark/vm_gc_old_lazy.rb
index b74d44baf1..b74d44baf1 100644
--- a/benchmark/bm_vm3_gc_old_lazy.rb
+++ b/benchmark/vm_gc_old_lazy.rb
diff --git a/benchmark/vm_gc_short_lived.yml b/benchmark/vm_gc_short_lived.yml
new file mode 100644
index 0000000000..29c803fee3
--- /dev/null
+++ b/benchmark/vm_gc_short_lived.yml
@@ -0,0 +1,9 @@
+benchmark:
+  vm_gc_short_lived: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_complex_long.yml b/benchmark/vm_gc_short_with_complex_long.yml
new file mode 100644
index 0000000000..4b6c3ed7b9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_complex_long.yml
@@ -0,0 +1,25 @@
+prelude: |
+  def nested_hash h, n
+    if n == 0
+      ''
+    else
+      10.times{
+        h[Object.new] = nested_hash(h, n-1)
+      }
+    end
+  end
+
+  long_lived = Hash.new
+  nested_hash long_lived, 6
+
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_complex_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_long.yml b/benchmark/vm_gc_short_with_long.yml
new file mode 100644
index 0000000000..03ba0f95a9
--- /dev/null
+++ b/benchmark/vm_gc_short_with_long.yml
@@ -0,0 +1,13 @@
+prelude: |
+  long_lived = Array.new(1_000_000){|i| "#{i}"}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_long: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_short_with_symbol.yml b/benchmark/vm_gc_short_with_symbol.yml
new file mode 100644
index 0000000000..129b8bf4ed
--- /dev/null
+++ b/benchmark/vm_gc_short_with_symbol.yml
@@ -0,0 +1,13 @@
+prelude: |
+  50_000.times{|i| sym = "sym#{i}".to_sym}
+  GC.start
+  GC.start
+benchmark:
+  vm_gc_short_with_symbol: |
+    a = '' # short-lived String
+    b = ''
+    c = ''
+    d = ''
+    e = ''
+    f = ''
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary.yml b/benchmark/vm_gc_wb_ary.yml
new file mode 100644
index 0000000000..e3293e72d0
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary.yml
@@ -0,0 +1,12 @@
+prelude: |
+  short_lived_ary = []
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_ary: |
+    short_lived_ary[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_ary_promoted.yml b/benchmark/vm_gc_wb_ary_promoted.yml
new file mode 100644
index 0000000000..003995945b
--- /dev/null
+++ b/benchmark/vm_gc_wb_ary_promoted.yml
@@ -0,0 +1,15 @@
+prelude: |
+  long_lived = []
+
+  if RUBY_VERSION > "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+
+benchmark:
+  vm_gc_wb_ary_promoted: |
+    long_lived[0] = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj.yml b/benchmark/vm_gc_wb_obj.yml
new file mode 100644
index 0000000000..a2a2ce2d18
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj.yml
@@ -0,0 +1,15 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  short_lived_obj = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj: |
+    short_lived_obj.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_gc_wb_obj_promoted.yml b/benchmark/vm_gc_wb_obj_promoted.yml
new file mode 100644
index 0000000000..00a454ba72
--- /dev/null
+++ b/benchmark/vm_gc_wb_obj_promoted.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    attr_accessor :foo
+  end
+  long_lived = C.new
+
+  if RUBY_VERSION >= "2.2.0"
+    3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
+  elsif
+    GC.start
+  end
+
+  short_lived = ''
+benchmark:
+  vm_gc_wb_obj_promoted: |
+    long_lived.foo = short_lived # write barrier
+loop_count: 30000000
diff --git a/benchmark/vm_iclass_super.yml b/benchmark/vm_iclass_super.yml
new file mode 100644
index 0000000000..21bb7db247
--- /dev/null
+++ b/benchmark/vm_iclass_super.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+
+    ("A".."M").each do |module_name|
+      eval <<-EOM
+          module #{module_name}
+            def m; super; end
+          end
+          prepend #{module_name}
+      EOM
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_iclass_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_ivar.yml b/benchmark/vm_ivar.yml
new file mode 100644
index 0000000000..119531d5ef
--- /dev/null
+++ b/benchmark/vm_ivar.yml
@@ -0,0 +1,6 @@
+prelude: "@a = 1\n"
+benchmark:
+  vm_ivar: |
+    j = @a
+    k = @a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_embedded_obj_init.yml b/benchmark/vm_ivar_embedded_obj_init.yml
new file mode 100644
index 0000000000..74fe20a630
--- /dev/null
+++ b/benchmark/vm_ivar_embedded_obj_init.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_embedded_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_extended_obj_init.yml b/benchmark/vm_ivar_extended_obj_init.yml
new file mode 100644
index 0000000000..f054bab282
--- /dev/null
+++ b/benchmark/vm_ivar_extended_obj_init.yml
@@ -0,0 +1,16 @@
+prelude: |
+  class C
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_extended_obj_init: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_get.yml b/benchmark/vm_ivar_generic_get.yml
new file mode 100644
index 0000000000..dae2d37671
--- /dev/null
+++ b/benchmark/vm_ivar_generic_get.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C < Array
+    attr_reader :a, :b, :c
+    def initialize
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_get: |
+    c.a
+    c.b
+    c.c
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_generic_set.yml b/benchmark/vm_ivar_generic_set.yml
new file mode 100644
index 0000000000..102a6577fb
--- /dev/null
+++ b/benchmark/vm_ivar_generic_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C < Array
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+    end
+  end
+
+  c = C.new
+benchmark:
+  vm_ivar_generic_set: |
+    c.set_ivars
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_get.yml b/benchmark/vm_ivar_get.yml
new file mode 100644
index 0000000000..1e0dad665f
--- /dev/null
+++ b/benchmark/vm_ivar_get.yml
@@ -0,0 +1,100 @@
+prelude: |
+  class Example
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+
+    @levar = 1
+    @v0 = 1
+    @v1 = 2
+    @v3 = 3
+
+    def self.get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+  end
+
+  class GenExample < Time
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def get_value_loop
+      sum = 0
+
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        sum += @levar
+        i += 1
+      end
+
+      return sum
+    end
+  end
+
+  obj = Example.new
+  gen = GenExample.new
+benchmark:
+  vm_ivar_get_on_obj: |
+    obj.get_value_loop
+  vm_ivar_get_on_class: |
+    Example.get_value_loop
+  vm_ivar_get_on_generic: |
+    gen.get_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_get_unintialized.yml b/benchmark/vm_ivar_get_unintialized.yml
new file mode 100644
index 0000000000..a1ccfb06ce
--- /dev/null
+++ b/benchmark/vm_ivar_get_unintialized.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def read
+      @uninitialized
+    end
+  end
+
+  obj = Example.new
+benchmark:
+  vm_ivar_get_uninitialized: |
+    obj.read
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_ic_miss.yml b/benchmark/vm_ivar_ic_miss.yml
new file mode 100644
index 0000000000..944fb1a9e6
--- /dev/null
+++ b/benchmark/vm_ivar_ic_miss.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class Foo
+    def initialize diverge
+      if diverge
+        @a = 1
+      end
+
+      @a0 = @a1 = @a2 = @a3 = @a4 = @a5 = @a6 = @a7 = @a8 = @a9 = @a10 = @a11 = @a12 = @a13 = @a14 = @a15 = @a16 = @a17 = @a18 = @a19 = @a20 = @a21 = @a22 = @a23 = @a24 = @a25 = @a26 = @a27 = @a28 = @a29 = @a30 = @a31 = @a32 = @a33 = @a34 = @a35 = @a36 = @a37 = @a38 = @a39 = @a40 = @a41 = @a42 = @a43 = @a44 = @a45 = @a46 = @a47 = @a48 = @a49 = @a50 = @a51 = @a52 = @a53 = @a54 = @a55 = @a56 = @a57 = @a58 = @a59 = @a60 = @a61 = @a62 = @a63 = @a64 = @a65 = @a66 = @a67 = @a68 = @a69 = @a70 = @a71 = @a72 = @a73 = @a74 = @b = 1
+    end
+
+    def b; @b; end
+  end
+
+  a = Foo.new false
+  b = Foo.new true
+benchmark:
+  vm_ivar_ic_miss: |
+    a.b
+    b.b
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_lazy_set.yml b/benchmark/vm_ivar_lazy_set.yml
new file mode 100644
index 0000000000..7372ffcfbc
--- /dev/null
+++ b/benchmark/vm_ivar_lazy_set.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class Example
+    def lazy_set
+      @uninitialized ||= 123
+    end
+  end
+
+  objs = 10000000.times.map { Example.new }
+benchmark:
+  vm_ivar_lazy_set: |
+    objs.each(&:lazy_set)
+loop_count: 1
diff --git a/benchmark/vm_ivar_memoize.yml b/benchmark/vm_ivar_memoize.yml
new file mode 100644
index 0000000000..90f6b07f05
--- /dev/null
+++ b/benchmark/vm_ivar_memoize.yml
@@ -0,0 +1,85 @@
+prelude: |
+  IVARS = 60
+  class Record
+    def initialize(offset = false)
+      @offset = 1 if offset
+      @first = 0
+      IVARS.times do |i|
+        instance_variable_set("@ivar_#{i}", i)
+      end
+    end
+
+    def first
+      @first
+    end
+
+    def lazy_set
+      @lazy_set ||= 123
+    end
+
+    def undef
+      @undef
+    end
+  end
+
+  Record.new # Need one alloc to right size
+
+  BASE = Record.new
+  LAZY = Record.new
+  LAZY.lazy_set
+
+  class Miss < Record
+    @first = 0
+    IVARS.times do |i|
+      instance_variable_set("@i_#{i}", i)
+    end
+  end
+
+  Miss.new # Need one alloc to right size
+  MISS = Miss.new
+
+  DIVERGENT = Record.new(true)
+
+benchmark:
+  vm_ivar_stable_shape: |
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+    BASE.first
+  vm_ivar_memoize_unstable_shape: |
+    BASE.first
+    LAZY.first
+    BASE.first
+    LAZY.first
+    BASE.first
+    LAZY.first
+  vm_ivar_memoize_unstable_shape_miss: |
+    BASE.first
+    MISS.first
+    BASE.first
+    MISS.first
+    BASE.first
+    MISS.first
+  vm_ivar_unstable_undef: |
+    BASE.undef
+    LAZY.undef
+    BASE.undef
+    LAZY.undef
+    BASE.undef
+    LAZY.undef
+  vm_ivar_divergent_shape: |
+    BASE.first
+    DIVERGENT.first
+    BASE.first
+    DIVERGENT.first
+    BASE.first
+    DIVERGENT.first
+  vm_ivar_divergent_shape_imbalanced: |
+    BASE.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
+    DIVERGENT.first
diff --git a/benchmark/vm_ivar_of_class.yml b/benchmark/vm_ivar_of_class.yml
new file mode 100644
index 0000000000..172e28b2fd
--- /dev/null
+++ b/benchmark/vm_ivar_of_class.yml
@@ -0,0 +1,12 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+      _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;
+    end
+  end
+benchmark:
+  vm_ivar_of_class: |
+    a = C.a
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_of_class_set.yml b/benchmark/vm_ivar_of_class_set.yml
new file mode 100644
index 0000000000..2ea5199423
--- /dev/null
+++ b/benchmark/vm_ivar_of_class_set.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    @a = 1
+    def self.a o
+      @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;
+    end
+  end
+benchmark:
+  vm_ivar_of_class_set: |
+    a = C.a(nil)
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set.yml b/benchmark/vm_ivar_set.yml
new file mode 100644
index 0000000000..8bbb60043b
--- /dev/null
+++ b/benchmark/vm_ivar_set.yml
@@ -0,0 +1,5 @@
+benchmark:
+  vm_ivar_set: |
+    @a = 1
+    @b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_ivar_set_on_instance.yml b/benchmark/vm_ivar_set_on_instance.yml
new file mode 100644
index 0000000000..6ce53a86ec
--- /dev/null
+++ b/benchmark/vm_ivar_set_on_instance.yml
@@ -0,0 +1,94 @@
+prelude: |
+  class TheClass
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+  class Generic < Time
+    def initialize
+      @levar = 1
+      @v0 = 1
+      @v1 = 2
+      @v3 = 3
+    end
+
+    def set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+  obj = TheClass.new
+  gen_obj = Generic.new
+
+  class SomeClass
+    @levar = 1
+    @v0 = 1
+    @v1 = 2
+    @v3 = 3
+
+    def self.set_value_loop
+      # 100k
+      i = 0
+      while i < 100_000
+        # 10 times to de-emphasize loop overhead
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        @levar = i
+        i += 1
+      end
+    end
+  end
+
+benchmark:
+  vm_ivar_set_on_instance: |
+    obj.set_value_loop
+  vm_ivar_set_on_generic: |
+    gen_obj.set_value_loop
+  vm_ivar_set_on_class: |
+    SomeClass.set_value_loop
+loop_count: 100
diff --git a/benchmark/vm_ivar_set_subclass.yml b/benchmark/vm_ivar_set_subclass.yml
new file mode 100644
index 0000000000..bc8bf5bf6b
--- /dev/null
+++ b/benchmark/vm_ivar_set_subclass.yml
@@ -0,0 +1,20 @@
+prelude: |
+  class A
+    def set_ivars
+      @a = nil
+      @b = nil
+      @c = nil
+      @d = nil
+      @e = nil
+    end
+  end
+  class B < A; end
+  class C < A; end
+
+  b = B.new
+  c = C.new
+benchmark:
+  vm_ivar_init_subclass: |
+    b.set_ivars
+    c.set_ivars
+loop_count: 3000000
diff --git a/benchmark/vm_length.yml b/benchmark/vm_length.yml
new file mode 100644
index 0000000000..5fd94e7d86
--- /dev/null
+++ b/benchmark/vm_length.yml
@@ -0,0 +1,8 @@
+prelude: |
+  a = 'abc'
+  b = [1, 2, 3]
+benchmark:
+  vm_length: |
+    a.length
+    b.length
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_cond_set.yml b/benchmark/vm_lvar_cond_set.yml
new file mode 100644
index 0000000000..1845f9d12e
--- /dev/null
+++ b/benchmark/vm_lvar_cond_set.yml
@@ -0,0 +1,8 @@
+benchmark:
+  vm_lvar_cond_set: |
+    a ||= 1
+    b ||= 1
+    c ||= 1
+    d ||= 1
+    nil
+loop_count: 30000000
diff --git a/benchmark/vm_lvar_init.yml b/benchmark/vm_lvar_init.yml
new file mode 100644
index 0000000000..70a9b1c0ca
--- /dev/null
+++ b/benchmark/vm_lvar_init.yml
@@ -0,0 +1,21 @@
+# while loop cost is not removed because `i` is used in the script
+benchmark:
+  vm_lvar_init: |
+    def m v
+      unless v
+        # unreachable code
+        v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+        v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+        v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+        v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+        v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+      end
+    end
+
+    i = 0
+
+    while i<30_000_000
+      i += 1
+      m i
+    end
+loop_count: 1
diff --git a/benchmark/vm_lvar_set.yml b/benchmark/vm_lvar_set.yml
new file mode 100644
index 0000000000..f29f763d81
--- /dev/null
+++ b/benchmark/vm_lvar_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_lvar_set: |
+    a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+loop_count: 30000000
diff --git a/benchmark/vm_method.yml b/benchmark/vm_method.yml
new file mode 100644
index 0000000000..d45e4ec572
--- /dev/null
+++ b/benchmark/vm_method.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method: |
+    m; m; m; m; m; m; m; m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_missing.yml b/benchmark/vm_method_missing.yml
new file mode 100644
index 0000000000..3da456c0bb
--- /dev/null
+++ b/benchmark/vm_method_missing.yml
@@ -0,0 +1,11 @@
+prelude: |
+  class C
+    def method_missing mid
+    end
+  end
+
+  obj = C.new
+benchmark:
+  vm_method_missing: |
+    obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+loop_count: 6000000
diff --git a/benchmark/vm_method_splat_calls.yml b/benchmark/vm_method_splat_calls.yml
new file mode 100644
index 0000000000..f2f366e99c
--- /dev/null
+++ b/benchmark/vm_method_splat_calls.yml
@@ -0,0 +1,13 @@
+prelude: |
+  def f(x=0, y: 0) end
+  a = [1]
+  ea = []
+  kw = {y: 1}
+  b = lambda{}
+benchmark:
+  arg_splat: "f(1, *ea)"
+  arg_splat_block: "f(1, *ea, &b)"
+  splat_kw_splat: "f(*a, **kw)"
+  splat_kw_splat_block: "f(*a, **kw, &b)"
+  splat_kw: "f(*a, y: 1)"
+  splat_kw_block: "f(*a, y: 1, &b)"
diff --git a/benchmark/vm_method_splat_calls2.yml b/benchmark/vm_method_splat_calls2.yml
new file mode 100644
index 0000000000..d33dcd7e8b
--- /dev/null
+++ b/benchmark/vm_method_splat_calls2.yml
@@ -0,0 +1,27 @@
+prelude: |
+  def named_arg_splat(*a) end
+  def named_arg_kw_splat(*a, **kw) end
+  def anon_arg_splat(*) end
+  def anon_kw_splat(**) end
+  def anon_arg_kw_splat(*, **) end
+  def anon_fw_to_named(*, **) named_arg_kw_splat(*, **) end
+  def fw_to_named(...) named_arg_kw_splat(...) end
+  def fw_to_anon_to_named(...) anon_fw_to_named(...) end
+  def fw_no_kw(...) named_arg_splat(...) end
+  a = [1]
+  kw = {y: 1}
+benchmark:
+  named_multi_arg_splat: "named_arg_splat(*a, *a)"
+  named_post_splat: "named_arg_splat(*a, a)"
+  anon_arg_splat: "anon_arg_splat(*a)"
+  anon_arg_kw_splat: "anon_arg_kw_splat(*a, **kw)"
+  anon_multi_arg_splat: "anon_arg_splat(*a, *a)"
+  anon_post_splat: "anon_arg_splat(*a, a)"
+  anon_kw_splat: "anon_kw_splat(**kw)"
+  anon_fw_to_named_splat: "anon_fw_to_named(*a, **kw)"
+  anon_fw_to_named_no_splat: "anon_fw_to_named(1, y: 1)"
+  fw_to_named_splat: "fw_to_named(*a, **kw)"
+  fw_to_named_no_splat: "fw_to_named(1, y: 1)"
+  fw_to_anon_to_named_splat: "fw_to_anon_to_named(*a, **kw)"
+  fw_to_anon_to_named_no_splat: "fw_to_anon_to_named(1, y: 1)"
+  fw_no_kw: "fw_no_kw(1, 2)"
diff --git a/benchmark/vm_method_with_block.yml b/benchmark/vm_method_with_block.yml
new file mode 100644
index 0000000000..281a481394
--- /dev/null
+++ b/benchmark/vm_method_with_block.yml
@@ -0,0 +1,8 @@
+prelude: |
+  def m
+    nil
+  end
+benchmark:
+  vm_method_with_block: |
+    m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+loop_count: 6000000
diff --git a/benchmark/vm_module_ann_const_set.yml b/benchmark/vm_module_ann_const_set.yml
new file mode 100644
index 0000000000..243229ba4a
--- /dev/null
+++ b/benchmark/vm_module_ann_const_set.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_module_ann_const_set: |
+    Module.new.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_module_const_set.yml b/benchmark/vm_module_const_set.yml
new file mode 100644
index 0000000000..e5a24181a9
--- /dev/null
+++ b/benchmark/vm_module_const_set.yml
@@ -0,0 +1,8 @@
+prelude: |
+  module M
+  end
+  $VERBOSE = nil
+benchmark:
+  vm_module_const_set: |
+    M.const_set(:X, Module.new)
+loop_count: 6000000
diff --git a/benchmark/vm_mutex.yml b/benchmark/vm_mutex.yml
new file mode 100644
index 0000000000..abcf1e28ce
--- /dev/null
+++ b/benchmark/vm_mutex.yml
@@ -0,0 +1,8 @@
+prelude: |
+  require 'thread'
+
+  m = Thread::Mutex.new
+benchmark:
+  vm_mutex: |
+    m.synchronize{}
+loop_count: 6000000
diff --git a/benchmark/vm_neq.yml b/benchmark/vm_neq.yml
new file mode 100644
index 0000000000..fb04d15ae8
--- /dev/null
+++ b/benchmark/vm_neq.yml
@@ -0,0 +1,7 @@
+prelude: |
+  obj1 = Object.new
+  obj2 = Object.new
+benchmark:
+  vm_neq: |
+    obj1 != obj2
+loop_count: 30000000
diff --git a/benchmark/vm_newlambda.yml b/benchmark/vm_newlambda.yml
new file mode 100644
index 0000000000..0b9787d91a
--- /dev/null
+++ b/benchmark/vm_newlambda.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_newlambda: |
+    lambda {}
+loop_count: 6000000
diff --git a/benchmark/vm_not.yml b/benchmark/vm_not.yml
new file mode 100644
index 0000000000..c68dde3c50
--- /dev/null
+++ b/benchmark/vm_not.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+benchmark:
+  vm_not: |
+    !obj
+loop_count: 30000000
diff --git a/benchmark/vm_poly_method.yml b/benchmark/vm_poly_method.yml
new file mode 100644
index 0000000000..dd2f4e71de
--- /dev/null
+++ b/benchmark/vm_poly_method.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_method_ov.yml b/benchmark/vm_poly_method_ov.yml
new file mode 100644
index 0000000000..bca1b62729
--- /dev/null
+++ b/benchmark/vm_poly_method_ov.yml
@@ -0,0 +1,24 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_method_ov: |
+    class C1
+      def m
+        1
+      end
+    end
+    class C2
+      def m
+        2
+      end
+    end
+
+    o1 = C1.new
+    o2 = C2.new
+
+    i = 0
+    while i<6_000_000
+      o = (i % 2 == 0) ? o1 : o2
+    #  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_poly_same_method.yml b/benchmark/vm_poly_same_method.yml
new file mode 100644
index 0000000000..6c5404ac84
--- /dev/null
+++ b/benchmark/vm_poly_same_method.yml
@@ -0,0 +1,25 @@
+prelude: |
+  module AR; end
+  class AR::Base
+    def create_or_update
+      nil
+    end
+    def save
+      create_or_update
+    end
+  end
+  class Foo < AR::Base; end
+  class Bar < AR::Base; end
+  o1 = Foo.new
+  o2 = Bar.new
+benchmark:
+  vm_poly_same_method: |
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+    o1.save; o2.save;
+loop_count: 6000000
diff --git a/benchmark/vm_poly_singleton.yml b/benchmark/vm_poly_singleton.yml
new file mode 100644
index 0000000000..c7923160fb
--- /dev/null
+++ b/benchmark/vm_poly_singleton.yml
@@ -0,0 +1,18 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_poly_singleton: |
+    class C1
+      def m; 1; end
+    end
+
+    o1 = C1.new
+    o2 = C1.new
+    o2.singleton_class
+
+    i = 0
+    while i<6_000_000 # benchmark loop 2
+      o = (i % 2 == 0) ? o1 : o2
+      o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/vm_proc.yml b/benchmark/vm_proc.yml
new file mode 100644
index 0000000000..2f8de6c272
--- /dev/null
+++ b/benchmark/vm_proc.yml
@@ -0,0 +1,12 @@
+prelude: |
+  def m &b
+    b
+  end
+
+  pr = m{
+    a = 1
+  }
+benchmark:
+  vm_proc: |
+    pr.call
+loop_count: 6000000
diff --git a/benchmark/vm_raise1.yml b/benchmark/vm_raise1.yml
new file mode 100644
index 0000000000..247d9f70ee
--- /dev/null
+++ b/benchmark/vm_raise1.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise1: |
+    begin
+      rec 1
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_raise2.yml b/benchmark/vm_raise2.yml
new file mode 100644
index 0000000000..f0fa047b3c
--- /dev/null
+++ b/benchmark/vm_raise2.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def rec n
+    if n > 0
+      rec n-1
+    else
+      raise
+    end
+  end
+benchmark:
+  vm_raise2: |
+    begin
+      rec 10
+    rescue
+      # ignore
+    end
+loop_count: 6000000
diff --git a/benchmark/vm_regexp.yml b/benchmark/vm_regexp.yml
new file mode 100644
index 0000000000..80541332b1
--- /dev/null
+++ b/benchmark/vm_regexp.yml
@@ -0,0 +1,14 @@
+prelude: |
+  str = 'xxxhogexxx'
+benchmark:
+  vm_regexp: |
+    /hoge/ =~ str
+  vm_regexp_alternating: |
+    /hoge/ =~ str
+    /huge/ =~ str
+  vm_regexp_invert: |
+    str =~ /hoge/
+  vm_regexp_invert_alternating: |
+    str =~ /hoge/
+    str =~ /huge/
+loop_count: 6000000
diff --git a/benchmark/vm_rescue.yml b/benchmark/vm_rescue.yml
new file mode 100644
index 0000000000..b4a0af521f
--- /dev/null
+++ b/benchmark/vm_rescue.yml
@@ -0,0 +1,6 @@
+benchmark:
+  vm_rescue: |
+    begin
+    rescue
+    end
+loop_count: 30000000
diff --git a/benchmark/vm_send.yml b/benchmark/vm_send.yml
new file mode 100644
index 0000000000..f31bc7ac89
--- /dev/null
+++ b/benchmark/vm_send.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    def m
+    end
+  end
+
+  o = C.new
+  m = :m
+benchmark:
+  vm_send: |
+    o.__send__ :m
+  vm_send_var: |
+    o.__send__ m
+loop_count: 6000000
diff --git a/benchmark/vm_send_cfunc.yml b/benchmark/vm_send_cfunc.yml
new file mode 100644
index 0000000000..6f12b65176
--- /dev/null
+++ b/benchmark/vm_send_cfunc.yml
@@ -0,0 +1,14 @@
+prelude: |
+  ary = []
+  kw = {a: 1}
+  empty_kw = {}
+  kw_ary = [Hash.ruby2_keywords_hash(a: 1)]
+  empty_kw_ary = [Hash.ruby2_keywords_hash({})]
+benchmark:
+  vm_send_cfunc: itself
+  vm_send_cfunc_splat: itself(*ary)
+  vm_send_cfunc_splat_kw_hash: equal?(*kw_ary)
+  vm_send_cfunc_splat_empty_kw_hash: itself(*empty_kw_ary)
+  vm_send_cfunc_splat_kw: equal?(*ary, **kw)
+  vm_send_cfunc_splat_empty_kw: itself(*ary, **empty_kw)
+loop_count: 20000000
diff --git a/benchmark/vm_simplereturn.yml b/benchmark/vm_simplereturn.yml
new file mode 100644
index 0000000000..c9829cff0b
--- /dev/null
+++ b/benchmark/vm_simplereturn.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m
+    return 1
+  end
+benchmark:
+  vm_simplereturn: m
+loop_count: 30000000
diff --git a/benchmark/vm_string_literal.yml b/benchmark/vm_string_literal.yml
new file mode 100644
index 0000000000..64439c7980
--- /dev/null
+++ b/benchmark/vm_string_literal.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_string_literal: |
+    x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_hi.yml b/benchmark/vm_struct_big_aref_hi.yml
new file mode 100644
index 0000000000..4cf78970cb
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_hi: |
+    x.z # x[25]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aref_lo.yml b/benchmark/vm_struct_big_aref_lo.yml
new file mode 100644
index 0000000000..c91af27fa5
--- /dev/null
+++ b/benchmark/vm_struct_big_aref_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_aref_lo: |
+    x.k # x[10]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_aset.yml b/benchmark/vm_struct_big_aset.yml
new file mode 100644
index 0000000000..69550d14ea
--- /dev/null
+++ b/benchmark/vm_struct_big_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_aset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.k = i # x[10] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_big_href_hi.yml b/benchmark/vm_struct_big_href_hi.yml
new file mode 100644
index 0000000000..09b764dd13
--- /dev/null
+++ b/benchmark/vm_struct_big_href_hi.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_hi: |
+    x[:z]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_href_lo.yml b/benchmark/vm_struct_big_href_lo.yml
new file mode 100644
index 0000000000..d2f00b220f
--- /dev/null
+++ b/benchmark/vm_struct_big_href_lo.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+  x = s.new
+benchmark:
+  vm_struct_big_href_lo: |
+    x[:k]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_big_hset.yml b/benchmark/vm_struct_big_hset.yml
new file mode 100644
index 0000000000..fc45cbee9c
--- /dev/null
+++ b/benchmark/vm_struct_big_hset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_big_hset: |
+    s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x[:k] = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_aref.yml b/benchmark/vm_struct_small_aref.yml
new file mode 100644
index 0000000000..5a83251d1e
--- /dev/null
+++ b/benchmark/vm_struct_small_aref.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_aref: |
+    x.a
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_aset.yml b/benchmark/vm_struct_small_aset.yml
new file mode 100644
index 0000000000..74f435f126
--- /dev/null
+++ b/benchmark/vm_struct_small_aset.yml
@@ -0,0 +1,11 @@
+# loop_count is not utilized since `i` is involved in the script
+benchmark:
+  vm_struct_small_aset: |
+    s = Struct.new(:a, :b, :c)
+    x = s.new
+    i = 0
+    while i<6_000_000
+      i += 1
+      x.a = i
+    end
+loop_count: 1
diff --git a/benchmark/vm_struct_small_href.yml b/benchmark/vm_struct_small_href.yml
new file mode 100644
index 0000000000..6b7d7f39e7
--- /dev/null
+++ b/benchmark/vm_struct_small_href.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_href: |
+    x[:a]
+loop_count: 6000000
diff --git a/benchmark/vm_struct_small_hset.yml b/benchmark/vm_struct_small_hset.yml
new file mode 100644
index 0000000000..5d43b150de
--- /dev/null
+++ b/benchmark/vm_struct_small_hset.yml
@@ -0,0 +1,7 @@
+prelude: |
+  s = Struct.new(:a, :b, :c)
+  x = s.new
+benchmark:
+  vm_struct_small_hset: |
+    x[:a] = 1
+loop_count: 6000000
diff --git a/benchmark/vm_super.yml b/benchmark/vm_super.yml
new file mode 100644
index 0000000000..0d1e965c6e
--- /dev/null
+++ b/benchmark/vm_super.yml
@@ -0,0 +1,17 @@
+prelude: |
+  class C
+    def m
+      1
+    end
+  end
+
+  class CC < C
+    def m
+      super()
+    end
+  end
+
+  obj = CC.new
+benchmark:
+  vm_super: obj.m
+loop_count: 6000000
diff --git a/benchmark/vm_super_splat_calls.yml b/benchmark/vm_super_splat_calls.yml
new file mode 100644
index 0000000000..795e44e4da
--- /dev/null
+++ b/benchmark/vm_super_splat_calls.yml
@@ -0,0 +1,25 @@
+prelude: |
+  @a = [1].freeze
+  @ea = [].freeze
+  @kw = {y: 1}.freeze
+  @b = lambda{}
+  extend(Module.new{def arg_splat(x=0, y: 0) end})
+  extend(Module.new{def arg_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_block(x=0, y: 0) end})
+
+  extend(Module.new{def arg_splat; super(1, *@ea) end})
+  extend(Module.new{def arg_splat_block; super(1, *@ea, &@b) end})
+  extend(Module.new{def splat_kw_splat; super(*@a, **@kw) end})
+  extend(Module.new{def splat_kw_splat_block; super(*@a, **@kw, &@b) end})
+  extend(Module.new{def splat_kw; super(*@a, y: 1) end})
+  extend(Module.new{def splat_kw_block; super(*@a, y: 1, &@b) end})
+benchmark:
+  arg_splat: "arg_splat"
+  arg_splat_block: "arg_splat_block"
+  splat_kw_splat: "splat_kw_splat"
+  splat_kw_splat_block: "splat_kw_splat_block"
+  splat_kw: "splat_kw"
+  splat_kw_block: "splat_kw_block"
diff --git a/benchmark/vm_swap.yml b/benchmark/vm_swap.yml
new file mode 100644
index 0000000000..e824a65e0a
--- /dev/null
+++ b/benchmark/vm_swap.yml
@@ -0,0 +1,7 @@
+prelude: |
+  a = 1
+  b = 2
+benchmark:
+  vm_swap: |
+    a, b = b, a
+loop_count: 30000000
diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/vm_symbol_block_pass.rb
index 1d433353e1..1d433353e1 100644
--- a/benchmark/bm_vm_symbol_block_pass.rb
+++ b/benchmark/vm_symbol_block_pass.rb
diff --git a/benchmark/vm_thread_alive_check.yml b/benchmark/vm_thread_alive_check.yml
new file mode 100644
index 0000000000..d21737d3e8
--- /dev/null
+++ b/benchmark/vm_thread_alive_check.yml
@@ -0,0 +1,8 @@
+benchmark:
+  vm_thread_alive_check: |
+    t = Thread.new{}
+    while t.alive?
+      Thread.pass
+    end
+loop_count: 50_000
+
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/vm_thread_close.rb
index 3e9a265ce8..3e9a265ce8 100644
--- a/benchmark/bm_vm_thread_close.rb
+++ b/benchmark/vm_thread_close.rb
diff --git a/benchmark/vm_thread_condvar1.rb b/benchmark/vm_thread_condvar1.rb
new file mode 100644
index 0000000000..feed27c3ad
--- /dev/null
+++ b/benchmark/vm_thread_condvar1.rb
@@ -0,0 +1,28 @@
+# two threads, two mutex, two condvar ping-pong
+require 'thread'
+m1 = Thread::Mutex.new
+m2 = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 100000
+i = 0
+wait = nil
+m2.synchronize do
+  wait = Thread.new do
+    m1.synchronize do
+      m2.synchronize { cv2.signal }
+      while (i += 1) < max
+        cv1.wait(m1)
+        cv2.signal
+      end
+    end
+  end
+  cv2.wait(m2)
+end
+m1.synchronize do
+  while i < max
+    cv1.signal
+    cv2.wait(m1)
+  end
+end
+wait.join
diff --git a/benchmark/vm_thread_condvar2.rb b/benchmark/vm_thread_condvar2.rb
new file mode 100644
index 0000000000..6590c4134b
--- /dev/null
+++ b/benchmark/vm_thread_condvar2.rb
@@ -0,0 +1,35 @@
+# many threads, one mutex, many condvars
+require 'thread'
+m = Thread::Mutex.new
+cv1 = Thread::ConditionVariable.new
+cv2 = Thread::ConditionVariable.new
+max = 1000
+n = 100
+waiting = 0
+scvs = []
+waiters = n.times.map do |i|
+  start_cv = Thread::ConditionVariable.new
+  scvs << start_cv
+  start_mtx = Thread::Mutex.new
+  start_mtx.synchronize do
+    th = Thread.new(start_mtx, start_cv) do |sm, scv|
+      m.synchronize do
+        sm.synchronize { scv.signal }
+        max.times do
+          cv2.signal if (waiting += 1) == n
+          cv1.wait(m)
+        end
+      end
+    end
+    start_cv.wait(start_mtx)
+    th
+  end
+end
+m.synchronize do
+  max.times do
+    cv2.wait(m) until waiting == n
+    waiting = 0
+    cv1.broadcast
+  end
+end
+waiters.each(&:join)
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/vm_thread_create_join.rb
index 393cd45df9..393cd45df9 100644
--- a/benchmark/bm_vm_thread_create_join.rb
+++ b/benchmark/vm_thread_create_join.rb
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/vm_thread_mutex1.rb
index 66e42c85e1..66e42c85e1 100644
--- a/benchmark/bm_vm_thread_mutex1.rb
+++ b/benchmark/vm_thread_mutex1.rb
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/vm_thread_mutex2.rb
index 6e6c804c31..6e6c804c31 100644
--- a/benchmark/bm_vm_thread_mutex2.rb
+++ b/benchmark/vm_thread_mutex2.rb
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/vm_thread_mutex3.rb
index c750dc542a..c750dc542a 100644
--- a/benchmark/bm_vm_thread_mutex3.rb
+++ b/benchmark/vm_thread_mutex3.rb
diff --git a/benchmark/vm_thread_pass.rb b/benchmark/vm_thread_pass.rb
new file mode 100644
index 0000000000..438bd08d45
--- /dev/null
+++ b/benchmark/vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 8).to_i
+lmax = 400_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/vm_thread_pass_flood.rb b/benchmark/vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..65df8e6154
--- /dev/null
+++ b/benchmark/vm_thread_pass_flood.rb
@@ -0,0 +1,10 @@
+# n.b. this is a good test for GVL when pinned to a single CPU
+
+5_000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10_000
+  i += 1
+end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/vm_thread_pipe.rb
index 112a621905..112a621905 100644
--- a/benchmark/bm_vm_thread_pipe.rb
+++ b/benchmark/vm_thread_pipe.rb
diff --git a/benchmark/vm_thread_queue.rb b/benchmark/vm_thread_queue.rb
new file mode 100644
index 0000000000..1dd3696a3c
--- /dev/null
+++ b/benchmark/vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 10_000_000
+q = Thread::Queue.new
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  n.times{
+    q.push true
+  }
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/bm_vm_thread_sized_queue.rb b/benchmark/vm_thread_sized_queue.rb
index 7b9af5482b..7b9af5482b 100644
--- a/benchmark/bm_vm_thread_sized_queue.rb
+++ b/benchmark/vm_thread_sized_queue.rb
diff --git a/benchmark/bm_vm_thread_sized_queue2.rb b/benchmark/vm_thread_sized_queue2.rb
index de9f55e978..de9f55e978 100644
--- a/benchmark/bm_vm_thread_sized_queue2.rb
+++ b/benchmark/vm_thread_sized_queue2.rb
diff --git a/benchmark/bm_vm_thread_sized_queue3.rb b/benchmark/vm_thread_sized_queue3.rb
index ce5f1796d8..ce5f1796d8 100644
--- a/benchmark/bm_vm_thread_sized_queue3.rb
+++ b/benchmark/vm_thread_sized_queue3.rb
diff --git a/benchmark/bm_vm_thread_sized_queue4.rb b/benchmark/vm_thread_sized_queue4.rb
index a9b7d80ec0..a9b7d80ec0 100644
--- a/benchmark/bm_vm_thread_sized_queue4.rb
+++ b/benchmark/vm_thread_sized_queue4.rb
diff --git a/benchmark/vm_thread_sleep.yml b/benchmark/vm_thread_sleep.yml
new file mode 100644
index 0000000000..96901d8466
--- /dev/null
+++ b/benchmark/vm_thread_sleep.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_thread_sleep: |
+    Thread.new { sleep }
+loop_count: 10_000
diff --git a/benchmark/vm_unif1.yml b/benchmark/vm_unif1.yml
new file mode 100644
index 0000000000..04187bb0e2
--- /dev/null
+++ b/benchmark/vm_unif1.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m a, b
+  end
+benchmark:
+  vm_unif1: |
+    m 100, 200
+loop_count: 6000000
diff --git a/benchmark/vm_yield.yml b/benchmark/vm_yield.yml
new file mode 100644
index 0000000000..230be3d84f
--- /dev/null
+++ b/benchmark/vm_yield.yml
@@ -0,0 +1,13 @@
+# while loop cost is not removed due to benchmark_driver.gem's limitation
+benchmark:
+  vm_yield: |
+    def m
+      i = 0
+      while i<30_000_000
+        i += 1
+        yield
+      end
+    end
+
+    m{}
+loop_count: 1
diff --git a/benchmark/vm_zsuper.yml b/benchmark/vm_zsuper.yml
new file mode 100644
index 0000000000..bfb5837578
--- /dev/null
+++ b/benchmark/vm_zsuper.yml
@@ -0,0 +1,18 @@
+prelude: |
+  class C
+    def m a
+      1
+    end
+  end
+
+  class CC < C
+    def m a
+      super
+    end
+  end
+
+  obj = CC.new
+benchmark:
+  vm_zsuper: |
+    obj.m 10
+loop_count: 6000000
diff --git a/benchmark/vm_zsuper_splat_calls.yml b/benchmark/vm_zsuper_splat_calls.yml
new file mode 100644
index 0000000000..82dc22349d
--- /dev/null
+++ b/benchmark/vm_zsuper_splat_calls.yml
@@ -0,0 +1,28 @@
+prelude: |
+  a = [1].freeze
+  ea = [].freeze
+  kw = {y: 1}.freeze
+  b = lambda{}
+  extend(Module.new{def arg_splat(x=0, y: 0) end})
+  extend(Module.new{def arg_splat_block(x=0, y: 0) end})
+  extend(Module.new{def arg_splat_post(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_splat_block(x=0, y: 0) end})
+  extend(Module.new{def splat_kw(x=0, y: 0) end})
+  extend(Module.new{def splat_kw_block(x=0, y: 0) end})
+
+  extend(Module.new{def arg_splat(x, *a) super end})
+  extend(Module.new{def arg_splat_block(x, *a, &b) super end})
+  extend(Module.new{def arg_splat_post(*a, x) super end})
+  extend(Module.new{def splat_kw_splat(*a, **kw) super end})
+  extend(Module.new{def splat_kw_splat_block(*a, **kw, &b) super end})
+  extend(Module.new{def splat_kw(*a, y: 1) super end})
+  extend(Module.new{def splat_kw_block(*a, y: 1, &b) super end})
+benchmark:
+  arg_splat: "arg_splat(1, *ea)"
+  arg_splat_block: "arg_splat_block(1, *ea, &b)"
+  arg_splat_post: "arg_splat_post(1, *ea, &b)"
+  splat_kw_splat: "splat_kw_splat(*a, **kw)"
+  splat_kw_splat_block: "splat_kw_splat_block(*a, **kw, &b)"
+  splat_kw: "splat_kw(*a, y: 1)"
+  splat_kw_block: "splat_kw_block(*a, y: 1, &b)"
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
deleted file mode 100644
index 41143fbac0..0000000000
--- a/benchmark/wc.input.base
+++ /dev/null
@@ -1,25 +0,0 @@
-Subject:      Re: Who was Izchak Miller?
-From:         "Jane D. Anonymous" <nobody@yale.edu>
-Date:         1996/04/28
-Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
-References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-To:           75176.2330@compuserve.com
-Content-Type: text/plain; charset=us-ascii
-Organization: Yale University
-X-Url:        news:4lk6vl$gde@ns.oar.net
-Mime-Version: 1.0
-Newsgroups:   rec.games.roguelike.nethack
-X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
-
-Hello there, Izchak Miller was my father.  When I was younger I spent 
-many a night, hunched over the keyboard with a cup of tea, playing 
-nethack with him and my brother.  my dad was a philosopher with a strong 
-weakness for fantasy/sci fi.  I remember when he started to get involved 
-with the Nethack team- my brother's Dungeons and Dragons monster book 
-found a regular place beside my dad's desk. it's nice to see him living 
-on in the game he loved so much :-).  
-                                                                  Tamar Miller
-
-The following is a really long word of 5000 characters:
-
-wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index 94d0d50c8f..28924b4eb9 100644
--- a/bignum.c
+++ b/bignum.c
@@ -9,34 +9,76 @@
 
 **********************************************************************/
 
-#include "internal.h"
-#include "ruby/thread.h"
-#include "ruby/util.h"
-#include "id.h"
+#include "ruby/internal/config.h"
+
+#include <ctype.h>
+#include <float.h>
+#include <math.h>
 
 #ifdef HAVE_STRINGS_H
-#include <strings.h>
+# include <strings.h>
 #endif
-#include <math.h>
-#include <float.h>
-#include <ctype.h>
+
 #ifdef HAVE_IEEEFP_H
-#include <ieeefp.h>
+# include <ieeefp.h>
 #endif
-#include "ruby_assert.h"
 
+#if !defined(USE_GMP)
 #if defined(HAVE_LIBGMP) && defined(HAVE_GMP_H)
-#define USE_GMP
-#include <gmp.h>
+# define USE_GMP 1
+#else
+# define USE_GMP 0
+#endif
 #endif
 
-#define RB_BIGNUM_TYPE_P(x) RB_TYPE_P((x), T_BIGNUM)
+#include "id.h"
+#include "internal.h"
+#include "internal/bignum.h"
+#include "internal/complex.h"
+#include "internal/gc.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/sanitizers.h"
+#include "internal/variable.h"
+#include "internal/warnings.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "ruby_assert.h"
 
-#ifndef RUBY_INTEGER_UNIFICATION
-VALUE rb_cBignum;
+#if USE_GMP
+RBIMPL_WARNING_PUSH()
+# ifdef _MSC_VER
+RBIMPL_WARNING_IGNORED(4146) /* for mpn_neg() */
+# endif
+# include <gmp.h>
+RBIMPL_WARNING_POP()
 #endif
+
+static const bool debug_integer_pack = (
+#ifdef DEBUG_INTEGER_PACK
+    DEBUG_INTEGER_PACK+0
+#else
+    RUBY_DEBUG
+#endif
+    ) != 0;
+
 const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
 
+/* Two-digit decimal lookup table.  Offset 2*n holds the ASCII pair for
+ * n in the range 0..99.  Used by both rb_fix2str in numeric.c and
+ * big2str_2bdigits below to emit two base-10 digits per iteration. */
+const char ruby_decimal_digit_pairs[201] =
+    "00010203040506070809"
+    "10111213141516171819"
+    "20212223242526272829"
+    "30313233343536373839"
+    "40414243444546474849"
+    "50515253545556575859"
+    "60616263646566676869"
+    "70717273747576777879"
+    "80818283848586878889"
+    "90919293949596979899";
+
 #ifndef SIZEOF_BDIGIT_DBL
 # if SIZEOF_INT*2 <= SIZEOF_LONG_LONG
 #  define SIZEOF_BDIGIT_DBL SIZEOF_LONG_LONG
@@ -52,7 +94,6 @@ STATIC_ASSERT(sizeof_bdigit_and_dbl, SIZEOF_BDIGIT*2 <= SIZEOF_BDIGIT_DBL);
 STATIC_ASSERT(bdigit_signedness, 0 < (BDIGIT)-1);
 STATIC_ASSERT(bdigit_dbl_signedness, 0 < (BDIGIT_DBL)-1);
 STATIC_ASSERT(bdigit_dbl_signed_signedness, 0 > (BDIGIT_DBL_SIGNED)-1);
-STATIC_ASSERT(rbignum_embed_len_max, BIGNUM_EMBED_LEN_MAX <= (BIGNUM_EMBED_LEN_MASK >> BIGNUM_EMBED_LEN_SHIFT));
 
 #if SIZEOF_BDIGIT < SIZEOF_LONG
 STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_LONG % SIZEOF_BDIGIT == 0);
@@ -65,8 +106,7 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #else
 #   define HOST_BIGENDIAN_P 0
 #endif
-#define ALIGNOF(type) ((int)offsetof(struct { char f1; type f2; }, f2))
-/* (!LSHIFTABLE(d, n) ? 0 : (n)) is same as n but suppress a warning, C4293, by Visual Studio.  */
+/* (!LSHIFTABLE(d, n) ? 0 : (n)) is the same as n but suppress a warning, C4293, by Visual Studio.  */
 #define LSHIFTABLE(d, n) ((n) < sizeof(d) * CHAR_BIT)
 #define LSHIFTX(d, n) (!LSHIFTABLE(d, n) ? 0 : ((d) << (!LSHIFTABLE(d, n) ? 0 : (n))))
 #define CLEAR_LOWBITS(d, numbits) ((d) & LSHIFTX(~((d)*0), (numbits)))
@@ -93,8 +133,8 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #endif
 
 #define BIGZEROP(x) (BIGNUM_LEN(x) == 0 || \
-		     (BDIGITS(x)[0] == 0 && \
-		      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
+                     (BDIGITS(x)[0] == 0 && \
+                      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
 #define BIGSIZE(x) (BIGNUM_LEN(x) == 0 ? (size_t)0 : \
     BDIGITS(x)[BIGNUM_LEN(x)-1] ? \
         (size_t)(BIGNUM_LEN(x)*SIZEOF_BDIGIT - nlz(BDIGITS(x)[BIGNUM_LEN(x)-1])/CHAR_BIT) : \
@@ -139,7 +179,7 @@ STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
 #define GMP_DIV_DIGITS 20
 #define GMP_BIG2STR_DIGITS 20
 #define GMP_STR2BIG_DIGITS 20
-#ifdef USE_GMP
+#if USE_GMP
 # define NAIVE_MUL_DIGITS GMP_MUL_DIGITS
 #else
 # define NAIVE_MUL_DIGITS KARATSUBA_MUL_DIGITS
@@ -150,15 +190,11 @@ typedef void (mulfunc_t)(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, c
 static mulfunc_t bary_mul_toom3_start;
 static mulfunc_t bary_mul_karatsuba_start;
 static BDIGIT bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y);
-static void bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn);
 
-static VALUE bigmul0(VALUE x, VALUE y);
-static void bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
 static VALUE bignew_1(VALUE klass, size_t len, int sign);
 static inline VALUE bigtrunc(VALUE x);
 
 static VALUE bigsq(VALUE x);
-static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
 static inline VALUE power_cache_get_power(int base, int power_level, size_t *numdigits_ret);
 
 #if SIZEOF_BDIGIT <= SIZEOF_INT
@@ -333,7 +369,7 @@ maxpow_in_bdigit_dbl(int base, int *exp_ret)
     BDIGIT_DBL maxpow;
     int exponent;
 
-    assert(2 <= base && base <= 36);
+    RUBY_ASSERT(2 <= base && base <= 36);
 
     {
 #if SIZEOF_BDIGIT_DBL == 2
@@ -365,7 +401,7 @@ maxpow_in_bdigit_dbl(int base, int *exp_ret)
 static inline BDIGIT_DBL
 bary2bdigitdbl(const BDIGIT *ds, size_t n)
 {
-    assert(n <= 2);
+    RUBY_ASSERT(n <= 2);
 
     if (n == 2)
         return ds[0] | BIGUP(ds[1]);
@@ -377,7 +413,7 @@ bary2bdigitdbl(const BDIGIT *ds, size_t n)
 static inline void
 bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
 {
-    assert(n == 2);
+    RUBY_ASSERT(n == 2);
 
     ds[0] = BIGLO(num);
     ds[1] = (BDIGIT)BIGDN(num);
@@ -386,6 +422,7 @@ bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
 static int
 bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
+    size_t i;
     BARY_TRUNC(xds, xn);
     BARY_TRUNC(yds, yn);
 
@@ -394,11 +431,12 @@ bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
     if (xn > yn)
         return 1;
 
-    while (xn-- && xds[xn] == yds[xn])
-        ;
-    if (xn == (size_t)-1)
+    for (i = 0; i < xn; i++)
+        if (xds[xn - i - 1] != yds[yn - i - 1])
+            break;
+    if (i == xn)
         return 0;
-    return xds[xn] < yds[xn] ? -1 : 1;
+    return xds[xn - i - 1] < yds[yn - i - 1] ? -1 : 1;
 }
 
 static BDIGIT
@@ -406,12 +444,12 @@ bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
 {
     size_t i;
     BDIGIT_DBL num = 0;
-    assert(0 <= shift && shift < BITSPERDIG);
+    RUBY_ASSERT(0 <= shift && shift < BITSPERDIG);
 
     for (i=0; i<n; i++) {
-	num = num | (BDIGIT_DBL)*xds++ << shift;
-	*zds++ = BIGLO(num);
-	num = BIGDN(num);
+        num = num | (BDIGIT_DBL)*xds++ << shift;
+        *zds++ = BIGLO(num);
+        num = BIGDN(num);
     }
     return BIGLO(num);
 }
@@ -419,16 +457,17 @@ bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
 static void
 bary_small_rshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift, BDIGIT higher_bdigit)
 {
+    size_t i;
     BDIGIT_DBL num = 0;
 
-    assert(0 <= shift && shift < BITSPERDIG);
+    RUBY_ASSERT(0 <= shift && shift < BITSPERDIG);
 
     num = BIGUP(higher_bdigit);
-    while (n--) {
-	BDIGIT x = xds[n];
-	num = (num | x) >> shift;
-	zds[n] = BIGLO(num);
-	num = BIGUP(x);
+    for (i = 0; i < n; i++) {
+        BDIGIT x = xds[n - i - 1];
+        num = (num | x) >> shift;
+        zds[n - i - 1] = BIGLO(num);
+        num = BIGUP(x);
     }
 }
 
@@ -438,7 +477,7 @@ bary_zero_p(const BDIGIT *xds, size_t xn)
     if (xn == 0)
         return 1;
     do {
-	if (xds[--xn]) return 0;
+        if (xds[--xn]) return 0;
     } while (xn);
     return 1;
 }
@@ -446,15 +485,15 @@ bary_zero_p(const BDIGIT *xds, size_t xn)
 static void
 bary_neg(BDIGIT *ds, size_t n)
 {
-    while (n--)
-        ds[n] = BIGLO(~ds[n]);
+    size_t i;
+    for (i = 0; i < n; i++)
+        ds[n - i - 1] = BIGLO(~ds[n - i - 1]);
 }
 
 static int
 bary_2comp(BDIGIT *ds, size_t n)
 {
     size_t i;
-    i = 0;
     for (i = 0; i < n; i++) {
         if (ds[i] != 0) {
             goto non_zero;
@@ -617,8 +656,12 @@ static int
 bytes_2comp(unsigned char *buf, size_t len)
 {
     size_t i;
-    for (i = 0; i < len; i++)
-        buf[i] = ~buf[i];
+    for (i = 0; i < len; i++) {
+        signed char c = buf[i];
+        signed int d = ~c;
+        unsigned int e = d & 0xFF;
+        buf[i] = e;
+    }
     for (i = 0; i < len; i++) {
         buf[i]++;
         if (buf[i] != 0)
@@ -668,7 +711,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                     return ((1 < de - dp || CLEAR_LOWBITS(d, 8) != 0) ? 2 : 1) * sign;
                 }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
                     uint16_t u = (uint16_t)(d = dp[0]);
                     if (need_swap) u = swap16(u);
                     *((uint16_t *)words) = u;
@@ -676,7 +719,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
                     uint32_t u = (uint32_t)(d = dp[0]);
                     if (need_swap) u = swap32(u);
                     *((uint32_t *)words) = u;
@@ -684,7 +727,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
                     uint64_t u = (uint64_t)(d = dp[0]);
                     if (need_swap) u = swap64(u);
                     *((uint64_t *)words) = u;
@@ -699,7 +742,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                     return (1 < de - dp || FILL_LOWBITS(d, 8) != -1) ? -2 : -1;
                 }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
                     uint16_t u = (uint16_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap16(u);
                     *((uint16_t *)words) = u;
@@ -708,7 +751,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
                     uint32_t u = (uint32_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap32(u);
                     *((uint32_t *)words) = u;
@@ -717,7 +760,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
                 }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
                     uint64_t u = (uint64_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
                     if (need_swap) u = swap64(u);
                     *((uint64_t *)words) = u;
@@ -760,7 +803,7 @@ bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords
         }
 #endif
         if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
-            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % ALIGNOF(BDIGIT) == 0) {
+            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % RUBY_ALIGNOF(BDIGIT) == 0) {
             size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
             size_t src_num_bdigits = de - dp;
             size_t dst_num_bdigits = numwords * bdigits_per_word;
@@ -962,7 +1005,7 @@ integer_unpack_num_bdigits_small(size_t numwords, size_t wordsize, size_t nails,
 {
     /* nlp_bits stands for number of leading padding bits */
     size_t num_bits = (wordsize * CHAR_BIT - nails) * numwords;
-    size_t num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG;
+    size_t num_bdigits = roomof(num_bits, BITSPERDIG);
     *nlp_bits_ret = (int)(num_bdigits * BITSPERDIG - num_bits);
     return num_bdigits;
 }
@@ -972,7 +1015,7 @@ integer_unpack_num_bdigits_generic(size_t numwords, size_t wordsize, size_t nail
 {
     /* BITSPERDIG = SIZEOF_BDIGIT * CHAR_BIT */
     /* num_bits = (wordsize * CHAR_BIT - nails) * numwords */
-    /* num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG */
+    /* num_bdigits = roomof(num_bits, BITSPERDIG) */
 
     /* num_bits = CHAR_BIT * (wordsize * numwords) - nails * numwords = CHAR_BIT * num_bytes1 - nails * numwords */
     size_t num_bytes1 = wordsize * numwords;
@@ -1034,14 +1077,13 @@ integer_unpack_num_bdigits(size_t numwords, size_t wordsize, size_t nails, int *
 
     if (numwords <= (SIZE_MAX - (BITSPERDIG-1)) / CHAR_BIT / wordsize) {
         num_bdigits = integer_unpack_num_bdigits_small(numwords, wordsize, nails, nlp_bits_ret);
-#ifdef DEBUG_INTEGER_PACK
-        {
+        if (debug_integer_pack) {
             int nlp_bits1;
             size_t num_bdigits1 = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, &nlp_bits1);
-            assert(num_bdigits == num_bdigits1);
-            assert(*nlp_bits_ret == nlp_bits1);
+            RUBY_ASSERT(num_bdigits == num_bdigits1);
+            RUBY_ASSERT(*nlp_bits_ret == nlp_bits1);
+            (void)num_bdigits1;
         }
-#endif
     }
     else {
         num_bdigits = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, nlp_bits_ret);
@@ -1080,6 +1122,13 @@ integer_unpack_single_bdigit(BDIGIT u, size_t size, int flags, BDIGIT *dp)
     return sign;
 }
 
+#ifdef HAVE_BUILTIN___BUILTIN_ASSUME_ALIGNED
+#define reinterpret_cast(type, value) (type) \
+    __builtin_assume_aligned((value), sizeof(*(type)NULL));
+#else
+#define reinterpret_cast(type, value) (type)value
+#endif
+
 static int
 bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags, int nlp_bits)
 {
@@ -1100,23 +1149,24 @@ bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, siz
                 return integer_unpack_single_bdigit(*(uint8_t *)buf, sizeof(uint8_t), flags, dp);
             }
 #if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-            if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
-                uint16_t u = *(uint16_t *)buf;
+            if (wordsize == 2 && (uintptr_t)words % RUBY_ALIGNOF(uint16_t) == 0) {
+                uint16_t u = *reinterpret_cast(const uint16_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap16(u) : u, sizeof(uint16_t), flags, dp);
             }
 #endif
 #if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-            if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
-                uint32_t u = *(uint32_t *)buf;
+            if (wordsize == 4 && (uintptr_t)words % RUBY_ALIGNOF(uint32_t) == 0) {
+                uint32_t u = *reinterpret_cast(const uint32_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap32(u) : u, sizeof(uint32_t), flags, dp);
             }
 #endif
 #if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-            if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
-                uint64_t u = *(uint64_t *)buf;
+            if (wordsize == 8 && (uintptr_t)words % RUBY_ALIGNOF(uint64_t) == 0) {
+                uint64_t u = *reinterpret_cast(const uint64_t *, buf);
                 return integer_unpack_single_bdigit(need_swap ? swap64(u) : u, sizeof(uint64_t), flags, dp);
             }
 #endif
+#undef reinterpret_cast
         }
 #if !defined(WORDS_BIGENDIAN)
         if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
@@ -1241,7 +1291,7 @@ bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, siz
         }
         if (dd)
             *dp++ = (BDIGIT)dd;
-        assert(dp <= de);
+        RUBY_ASSERT(dp <= de);
         while (dp < de)
             *dp++ = 0;
 #undef PUSH_BITS
@@ -1300,7 +1350,7 @@ bary_unpack(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwo
 
     num_bdigits0 = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
 
-    assert(num_bdigits0 <= num_bdigits);
+    RUBY_ASSERT(num_bdigits0 <= num_bdigits);
 
     sign = bary_unpack_internal(bdigits, num_bdigits0, words, numwords, wordsize, nails, flags, nlp_bits);
 
@@ -1319,16 +1369,16 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     size_t i;
     size_t sn;
 
-    assert(xn <= zn);
-    assert(yn <= zn);
+    RUBY_ASSERT(xn <= zn);
+    RUBY_ASSERT(yn <= zn);
 
     sn = xn < yn ? xn : yn;
 
     num = borrow ? -1 : 0;
     for (i = 0; i < sn; i++) {
-	num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     if (yn <= xn) {
         for (; i < xn; i++) {
@@ -1347,7 +1397,7 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     }
     if (num == 0) goto num_is_zero;
     for (; i < zn; i++) {
-	zds[i] = BDIGMAX;
+        zds[i] = BDIGMAX;
     }
     return 1;
 
@@ -1355,10 +1405,10 @@ bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     if (xds == zds && xn == zn)
         return 0;
     for (; i < xn; i++) {
-	zds[i] = xds[i];
+        zds[i] = xds[i];
     }
     for (; i < zn; i++) {
-	zds[i] = 0;
+        zds[i] = 0;
     }
     return 0;
 }
@@ -1381,31 +1431,31 @@ bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     BDIGIT_DBL num;
     size_t i;
 
-    assert(xn <= zn);
-    assert(yn <= zn);
+    RUBY_ASSERT(xn <= zn);
+    RUBY_ASSERT(yn <= zn);
 
     if (xn > yn) {
-	const BDIGIT *tds;
-	tds = xds; xds = yds; yds = tds;
-	i = xn; xn = yn; yn = i;
+        const BDIGIT *tds;
+        tds = xds; xds = yds; yds = tds;
+        i = xn; xn = yn; yn = i;
     }
 
     num = carry ? 1 : 0;
     for (i = 0; i < xn; i++) {
-	num += (BDIGIT_DBL)xds[i] + yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += (BDIGIT_DBL)xds[i] + yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < yn; i++) {
         if (num == 0) goto num_is_zero;
-	num += yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        num += yds[i];
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     for (; i < zn; i++) {
         if (num == 0) goto num_is_zero;
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
     }
     return num != 0;
 
@@ -1413,10 +1463,10 @@ bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yd
     if (yds == zds && yn == zn)
         return 0;
     for (; i < yn; i++) {
-	zds[i] = yds[i];
+        zds[i] = yds[i];
     }
     for (; i < zn; i++) {
-	zds[i] = 0;
+        zds[i] = 0;
     }
     return 0;
 }
@@ -1432,7 +1482,9 @@ bary_add_one(BDIGIT *ds, size_t n)
 {
     size_t i;
     for (i = 0; i < n; i++) {
-	ds[i] = BIGLO(ds[i]+1);
+        BDIGIT_DBL n = ds[i];
+        n += 1;
+        ds[i] = BIGLO(n);
         if (ds[i] != 0)
             return 0;
     }
@@ -1444,7 +1496,7 @@ bary_mul_single(BDIGIT *zds, size_t zn, BDIGIT x, BDIGIT y)
 {
     BDIGIT_DBL n;
 
-    assert(2 <= zn);
+    RUBY_ASSERT(2 <= zn);
 
     n = (BDIGIT_DBL)x * y;
     bdigitdbl2bary(zds, 2, n);
@@ -1458,7 +1510,7 @@ bary_muladd_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
     BDIGIT_DBL dd;
     size_t j;
 
-    assert(zn > yn);
+    RUBY_ASSERT(zn > yn);
 
     if (x == 0)
         return 0;
@@ -1493,22 +1545,23 @@ bigdivrem_mulsub(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
     BDIGIT_DBL t2;
     BDIGIT_DBL_SIGNED num;
 
-    assert(zn == yn + 1);
+    RUBY_ASSERT(zn == yn + 1);
 
     num = 0;
     t2 = 0;
     i = 0;
 
     do {
-        BDIGIT_DBL ee;
+        BDIGIT_DBL_SIGNED ee;
         t2 += (BDIGIT_DBL)yds[i] * x;
         ee = num - BIGLO(t2);
-        num = (BDIGIT_DBL)zds[i] + ee;
+        num = (BDIGIT_DBL_SIGNED)zds[i] + ee;
         if (ee) zds[i] = BIGLO(num);
         num = BIGDN(num);
         t2 = BIGDN(t2);
     } while (++i < yn);
-    num += zds[i] - t2; /* borrow from high digit; don't update */
+    num -= (BDIGIT_DBL_SIGNED)t2;
+    num += (BDIGIT_DBL_SIGNED)zds[yn]; /* borrow from high digit; don't update */
     return num;
 }
 
@@ -1517,7 +1570,7 @@ bary_mulsub_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
 {
     BDIGIT_DBL_SIGNED num;
 
-    assert(zn == yn + 1);
+    RUBY_ASSERT(zn == yn + 1);
 
     num = bigdivrem_mulsub(zds, zn, x, yds, yn);
     zds[yn] = BIGLO(num);
@@ -1531,7 +1584,7 @@ bary_mul_normal(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIG
 {
     size_t i;
 
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     BDIGITS_ZERO(zds, zn);
     for (i = 0; i < xn; i++) {
@@ -1552,7 +1605,7 @@ rb_big_mul_normal(VALUE x, VALUE y)
 
 /* efficient squaring (2 times faster than normal multiplication)
  * ref: Handbook of Applied Cryptography, Algorithm 14.16
- *      http://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
+ *      https://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
  */
 static void
 bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
@@ -1562,7 +1615,7 @@ bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
     BDIGIT vl;
     int vh;
 
-    assert(xn * 2 <= zn);
+    RUBY_ASSERT(xn * 2 <= zn);
 
     BDIGITS_ZERO(zds, zn);
 
@@ -1570,30 +1623,30 @@ bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
         return;
 
     for (i = 0; i < xn-1; i++) {
-	v = (BDIGIT_DBL)xds[i];
-	if (!v)
+        v = (BDIGIT_DBL)xds[i];
+        if (!v)
             continue;
-	c = (BDIGIT_DBL)zds[i + i] + v * v;
-	zds[i + i] = BIGLO(c);
-	c = BIGDN(c);
-	v *= 2;
+        c = (BDIGIT_DBL)zds[i + i] + v * v;
+        zds[i + i] = BIGLO(c);
+        c = BIGDN(c);
+        v *= 2;
         vl = BIGLO(v);
         vh = (int)BIGDN(v);
-	for (j = i + 1; j < xn; j++) {
-	    w = (BDIGIT_DBL)xds[j];
-	    c += (BDIGIT_DBL)zds[i + j] + vl * w;
-	    zds[i + j] = BIGLO(c);
-	    c = BIGDN(c);
-	    if (vh)
+        for (j = i + 1; j < xn; j++) {
+            w = (BDIGIT_DBL)xds[j];
+            c += (BDIGIT_DBL)zds[i + j] + vl * w;
+            zds[i + j] = BIGLO(c);
+            c = BIGDN(c);
+            if (vh)
                 c += w;
-	}
-	if (c) {
-	    c += (BDIGIT_DBL)zds[i + xn];
-	    zds[i + xn] = BIGLO(c);
-	    c = BIGDN(c);
+        }
+        if (c) {
+            c += (BDIGIT_DBL)zds[i + xn];
+            zds[i + xn] = BIGLO(c);
+            c = BIGDN(c);
             if (c)
                 zds[i + xn + 1] += (BDIGIT)c;
-	}
+        }
     }
 
     /* i == xn-1 */
@@ -1618,28 +1671,48 @@ rb_big_sq_fast(VALUE x)
     return z;
 }
 
+static inline size_t
+max_size(size_t a, size_t b)
+{
+    return (a > b ? a : b);
+}
+
 /* balancing multiplication by slicing larger argument */
 static void
-bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn, mulfunc_t *mulfunc)
+bary_mul_balance_with_mulfunc(BDIGIT *const zds, const size_t zn,
+                              const BDIGIT *const xds, const size_t xn,
+                              const BDIGIT *const yds, const size_t yn,
+                              BDIGIT *wds, size_t wn, mulfunc_t *const mulfunc)
 {
     VALUE work = 0;
-    size_t yn0 = yn;
-    size_t r, n;
+    size_t n;
 
-    assert(xn + yn <= zn);
-    assert(xn <= yn);
-    assert(!KARATSUBA_BALANCED(xn, yn) || !TOOM3_BALANCED(xn, yn));
+    RUBY_ASSERT(xn + yn <= zn);
+    RUBY_ASSERT(xn <= yn);
+    RUBY_ASSERT(!KARATSUBA_BALANCED(xn, yn) || !TOOM3_BALANCED(xn, yn));
 
     BDIGITS_ZERO(zds, xn);
 
+    if (wn < xn) {
+        /* The condition when a new buffer is needed:
+         * 1. (2(xn+r) > zn-(yn-r)) => (2xn+r > zn-yn), at the last
+         *    iteration (or r == 0)
+         * 2. (2(xn+xn) > zn-(yn-r-xn)) => (3xn-r > zn-yn), at the
+         *    previous iteration.
+         */
+        const size_t r = yn % xn;
+        if (2*xn + yn + max_size(xn-r, r) > zn) {
+            wn = xn;
+            wds = ALLOCV_N(BDIGIT, work, wn);
+        }
+    }
+
     n = 0;
-    while (yn > 0) {
-        BDIGIT *tds;
-        size_t tn;
-	r = xn > yn ? yn : xn;
-        tn = xn + r;
+    while (yn > n) {
+        const size_t r = (xn > (yn - n) ? (yn - n) : xn);
+        const size_t tn = (xn + r);
         if (2 * (xn + r) <= zn - n) {
-            tds = zds + n + xn + r;
+            BDIGIT *const tds = zds + n + xn + r;
             mulfunc(tds, tn, xds, xn, yds + n, r, wds, wn);
             BDIGITS_ZERO(zds + n + xn, r);
             bary_add(zds + n, tn,
@@ -1647,21 +1720,25 @@ bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t
                      tds, tn);
         }
         else {
+            BDIGIT *const tds = zds + n;
             if (wn < xn) {
+                /* xn is invariant, only once here */
+#if 0
                 wn = xn;
                 wds = ALLOCV_N(BDIGIT, work, wn);
+#else
+                rb_bug("wds is not enough: %" PRIdSIZE " for %" PRIdSIZE, wn, xn);
+#endif
             }
-            tds = zds + n;
             MEMCPY(wds, zds + n, BDIGIT, xn);
             mulfunc(tds, tn, xds, xn, yds + n, r, wds+xn, wn-xn);
             bary_add(zds + n, tn,
                      zds + n, tn,
                      wds, xn);
         }
-	yn -= r;
-	n += r;
+        n += r;
     }
-    BDIGITS_ZERO(zds+xn+yn0, zn - (xn+yn0));
+    BDIGITS_ZERO(zds+xn+yn, zn - (xn+yn));
 
     if (work)
         ALLOCV_END(work);
@@ -1694,9 +1771,9 @@ bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const B
     const BDIGIT *xds0, *xds1, *yds0, *yds1;
     BDIGIT *zds0, *zds1, *zds2, *zds3;
 
-    assert(xn + yn <= zn);
-    assert(xn <= yn);
-    assert(yn < 2 * xn);
+    RUBY_ASSERT(xn + yn <= zn);
+    RUBY_ASSERT(xn <= yn);
+    RUBY_ASSERT(yn < 2 * xn);
 
     sq = xds == yds && xn == yn;
 
@@ -1711,7 +1788,7 @@ bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const B
 
     n = yn / 2;
 
-    assert(n < xn);
+    RUBY_ASSERT(n < xn);
 
     if (wn < n) {
         /* This function itself needs only n BDIGITs for work area.
@@ -1832,7 +1909,7 @@ bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const B
         for (x = 0, i = xn-1; 0 <= i; i--) { x <<= SIZEOF_BDIGIT*CHAR_BIT; x |= xds[i]; }
         for (y = 0, i = yn-1; 0 <= i; i--) { y <<= SIZEOF_BDIGIT*CHAR_BIT; y |= yds[i]; }
         for (z = 0, i = zn-1; 0 <= i; i--) { z <<= SIZEOF_BDIGIT*CHAR_BIT; z |= zds[i]; }
-        assert(z == x * y);
+        RUBY_ASSERT(z == x * y);
     }
     */
 
@@ -1900,11 +1977,11 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
 
     int sq = xds == yds && xn == yn;
 
-    assert(xn <= yn);  /* assume y >= x */
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn <= yn);  /* assume y >= x */
+    RUBY_ASSERT(xn + yn <= zn);
 
     n = (yn + 2) / 3;
-    assert(2*n < xn);
+    RUBY_ASSERT(2*n < xn);
 
     wnc = 0;
 
@@ -1978,7 +2055,7 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
     }
 
     /*
-     * ref. http://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
+     * ref. https://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
      *
      * x(b) = x0 * b^0 + x1 * b^1 + x2 * b^2
      * y(b) = y0 * b^0 + y1 * b^1 + y2 * b^2
@@ -2051,21 +2128,21 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
         v3n = u3n; v3ds = u3ds; v3p = u3p;
     }
     else {
-	/* v1 <- y0 + y2 */
+        /* v1 <- y0 + y2 */
         bary_add(v1ds, v1n, y0ds, y0n, y2ds, y2n);
         v1p = 1;
 
-	/* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
+        /* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
         v2p = 1;
         if (bary_sub(v2ds, v2n, v1ds, v1n, y1ds, y1n)) {
             bary_2comp(v2ds, v2n);
             v2p = 0;
         }
 
-	/* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
+        /* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
         bary_add(v1ds, v1n, v1ds, v1n, y1ds, y1n);
 
-	/* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
+        /* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
         v3p = 1;
         if (v2p) {
             bary_add(v3ds, v3n, v2ds, v2n, y2ds, y2n);
@@ -2091,19 +2168,19 @@ bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGI
     /* z(1) : t1 <- u1 * v1 */
     bary_mul_toom3_start(t1ds, t1n, u1ds, u1n, v1ds, v1n, wds, wn);
     t1p = u1p == v1p;
-    assert(t1ds[t1n-1] == 0);
+    RUBY_ASSERT(t1ds[t1n-1] == 0);
     t1n--;
 
     /* z(-1) : t2 <- u2 * v2 */
     bary_mul_toom3_start(t2ds, t2n, u2ds, u2n, v2ds, v2n, wds, wn);
     t2p = u2p == v2p;
-    assert(t2ds[t2n-1] == 0);
+    RUBY_ASSERT(t2ds[t2n-1] == 0);
     t2n--;
 
     /* z(-2) : t3 <- u3 * v3 */
     bary_mul_toom3_start(t3ds, t3n, u3ds, u3n, v3ds, v3n, wds, wn);
     t3p = u3p == v3p;
-    assert(t3ds[t3n-1] == 0);
+    RUBY_ASSERT(t3ds[t3n-1] == 0);
     t3n--;
 
     /* z(inf) : t4 <- x2 * y2 */
@@ -2258,28 +2335,41 @@ rb_big_mul_toom3(VALUE x, VALUE y)
     return z;
 }
 
-#ifdef USE_GMP
+#if USE_GMP
+static inline void
+bdigits_to_mpz(mpz_t mp, const BDIGIT *digits, size_t len)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_import(mp, len, -1, sizeof(BDIGIT), 0, nails, digits);
+}
+
+static inline void
+bdigits_from_mpz(mpz_t mp, BDIGIT *digits, size_t *len)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_export(digits, len, -1, sizeof(BDIGIT), 0, nails, mp);
+}
+
 static void
 bary_mul_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t x, y, z;
     size_t count;
 
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     mpz_init(x);
     mpz_init(y);
     mpz_init(z);
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+    bdigits_to_mpz(x, xds, xn);
     if (xds == yds && xn == yn) {
         mpz_mul(z, x, x);
     }
     else {
-        mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+        bdigits_to_mpz(y, yds, yn);
         mpz_mul(z, x, y);
     }
-    mpz_export(zds, &count, -1, sizeof(BDIGIT), 0, nails, z);
+    bdigits_from_mpz(z, zds, &count);
     BDIGITS_ZERO(zds+count, zn-count);
     mpz_clear(x);
     mpz_clear(y);
@@ -2301,7 +2391,7 @@ rb_big_mul_gmp(VALUE x, VALUE y)
 static void
 bary_short_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     if (xn == 1 && yn == 1) {
         bary_mul_single(zds, zn, xds[0], yds[0]);
@@ -2318,9 +2408,9 @@ bary_sparse_p(const BDIGIT *ds, size_t n)
 {
     long c = 0;
 
-    if (          ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+    if (          ds[2 * n / 5]) c++;
+    if (c <= 1 && ds[    n / 2]) c++;
+    if (c <= 1 && ds[3 * n / 5]) c++;
 
     return (c <= 1) ? 1 : 0;
 }
@@ -2337,7 +2427,7 @@ bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp,
     const BDIGIT *yds = *ydsp;
     size_t yn = *ynp;
 
-    assert(xn + yn <= zn);
+    RUBY_ASSERT(xn + yn <= zn);
 
     nlsz = 0;
 
@@ -2383,10 +2473,10 @@ bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp,
     if (xn > yn) {
         const BDIGIT *tds;
         size_t tn;
-	tds = xds; xds = yds; yds = tds;
-	tn = xn; xn = yn; yn = tn;
+        tds = xds; xds = yds; yds = tds;
+        tn = xn; xn = yn; yn = tn;
     }
-    assert(xn <= yn);
+    RUBY_ASSERT(xn <= yn);
 
     if (xn <= 1) {
         if (xn == 0) {
@@ -2428,12 +2518,7 @@ bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn,
 {
     /* normal multiplication when x is small */
     if (xn < KARATSUBA_MUL_DIGITS) {
-      normal:
-        if (xds == yds && xn == yn)
-            bary_sq_fast(zds, zn, xds, xn);
-        else
-            bary_short_mul(zds, zn, xds, xn, yds, yn);
-        return;
+        goto normal;
     }
 
     /* normal multiplication when x or y is a sparse bignum */
@@ -2451,6 +2536,15 @@ bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn,
 
     /* multiplication by karatsuba method */
     bary_mul_karatsuba(zds, zn, xds, xn, yds, yn, wds, wn);
+    return;
+
+  normal:
+    if (xds == yds && xn == yn) {
+        bary_sq_fast(zds, zn, xds, xn);
+    }
+    else {
+        bary_short_mul(zds, zn, xds, xn, yds, yn);
+    }
 }
 
 static void
@@ -2506,7 +2600,7 @@ bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds
         }
     }
 
-#ifdef USE_GMP
+#if USE_GMP
     bary_mul_gmp(zds, zn, xds, xn, yds, yn);
 #else
     bary_mul_toom3_start(zds, zn, xds, xn, yds, yn, NULL, 0);
@@ -2530,30 +2624,31 @@ bigdivrem1(void *ptr)
     BDIGIT q;
 
     do {
-	if (bds->stop) {
-	    bds->zn = zn;
-	    return 0;
+        if (bds->stop) {
+            bds->zn = zn;
+            return 0;
         }
-	if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
-	else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
-	if (q) {
+        if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
+        else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
+        if (q) {
             num = bigdivrem_mulsub(zds+zn-(yn+1), yn+1,
                                    q,
                                    yds, yn);
-	    while (num) { /* "add back" required */
-		q--;
+            while (num) { /* "add back" required */
+                q--;
                 num = bary_add(zds+zn-(yn+1), yn,
                                zds+zn-(yn+1), yn,
                                yds, yn);
                 num--;
-	    }
-	}
+            }
+        }
         zn--;
-	zds[zn] = q;
+        zds[zn] = q;
     } while (zn > yn);
     return 0;
 }
 
+/* async-signal-safe */
 static void
 rb_big_stop(void *ptr)
 {
@@ -2564,8 +2659,8 @@ rb_big_stop(void *ptr)
 static BDIGIT
 bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdigit, BDIGIT y)
 {
-    assert(0 < xn);
-    assert(x_higher_bdigit < y);
+    RUBY_ASSERT(0 < xn);
+    RUBY_ASSERT(x_higher_bdigit < y);
     if (POW2_P(y)) {
         BDIGIT r;
         r = xds[0] & (y-1);
@@ -2576,10 +2671,9 @@ bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdi
         size_t i;
         BDIGIT_DBL t2;
         t2 = x_higher_bdigit;
-        i = xn;
-        while (i--) {
-            t2 = BIGUP(t2) + xds[i];
-            qds[i] = (BDIGIT)(t2 / y);
+        for (i = 0; i < xn; i++) {
+            t2 = BIGUP(t2) + xds[xn - i - 1];
+            qds[xn - i - 1] = (BDIGIT)(t2 / y);
             t2 %= y;
         }
         return (BDIGIT)t2;
@@ -2598,9 +2692,9 @@ bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
     struct big_div_struct bds;
     size_t ynzero;
 
-    assert(yn < zn);
-    assert(BDIGIT_MSB(yds[yn-1]));
-    assert(zds[zn-1] < yds[yn-1]);
+    RUBY_ASSERT(yn < zn);
+    RUBY_ASSERT(BDIGIT_MSB(yds[yn-1]));
+    RUBY_ASSERT(zds[zn-1] < yds[yn-1]);
 
     for (ynzero = 0; !yds[ynzero]; ynzero++);
 
@@ -2618,16 +2712,16 @@ bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
     bds.zn = zn - ynzero;
     if (bds.zn > 10000 || bds.yn > 10000) {
       retry:
-	bds.stop = Qfalse;
-	rb_thread_call_without_gvl(bigdivrem1, &bds, rb_big_stop, &bds);
+        bds.stop = Qfalse;
+        rb_nogvl(bigdivrem1, &bds, rb_big_stop, &bds, RB_NOGVL_UBF_ASYNC_SAFE | RB_NOGVL_OFFLOAD_SAFE);
 
-	if (bds.stop == Qtrue) {
-	    /* execute trap handler, but exception was not raised. */
-	    goto retry;
-	}
+        if (bds.stop == Qtrue) {
+            /* execute trap handler, but exception was not raised. */
+            goto retry;
+        }
     }
     else {
-	bigdivrem1(&bds);
+        bigdivrem1(&bds);
     }
 }
 
@@ -2639,9 +2733,9 @@ bary_divmod_normal(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT
     size_t zn;
     VALUE tmpyz = 0;
 
-    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
-    assert(qds ? (xn - yn + 1) <= qn : 1);
-    assert(rds ? yn <= rn : 1);
+    RUBY_ASSERT(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+    RUBY_ASSERT(qds ? (xn - yn + 1) <= qn : 1);
+    RUBY_ASSERT(rds ? yn <= rn : 1);
 
     zn = xn + BIGDIVREM_EXTRA_WORDS;
 
@@ -2726,26 +2820,25 @@ rb_big_divrem_normal(VALUE x, VALUE y)
     return rb_assoc_new(q, r);
 }
 
-#ifdef USE_GMP
+#if USE_GMP
 static void
 bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
     mpz_t x, y, q, r;
     size_t count;
 
-    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
-    assert(qds ? (xn - yn + 1) <= qn : 1);
-    assert(rds ? yn <= rn : 1);
-    assert(qds || rds);
+    RUBY_ASSERT(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+    RUBY_ASSERT(qds ? (xn - yn + 1) <= qn : 1);
+    RUBY_ASSERT(rds ? yn <= rn : 1);
+    RUBY_ASSERT(qds || rds);
 
     mpz_init(x);
     mpz_init(y);
     if (qds) mpz_init(q);
     if (rds) mpz_init(r);
 
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
-    mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+    bdigits_to_mpz(x, xds, xn);
+    bdigits_to_mpz(y, yds, yn);
 
     if (!rds) {
         mpz_fdiv_q(q, x, y);
@@ -2761,13 +2854,13 @@ bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xd
     mpz_clear(y);
 
     if (qds) {
-        mpz_export(qds, &count, -1, sizeof(BDIGIT), 0, nails, q);
+        bdigits_from_mpz(q, qds, &count);
         BDIGITS_ZERO(qds+count, qn-count);
         mpz_clear(q);
     }
 
     if (rds) {
-        mpz_export(rds, &count, -1, sizeof(BDIGIT), 0, nails, r);
+        bdigits_from_mpz(r, rds, &count);
         BDIGITS_ZERO(rds+count, rn-count);
         mpz_clear(r);
     }
@@ -2811,7 +2904,7 @@ rb_big_divrem_gmp(VALUE x, VALUE y)
 static void
 bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-#ifdef USE_GMP
+#if USE_GMP
     if (GMP_DIV_DIGITS < xn) {
         bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
         return;
@@ -2823,8 +2916,8 @@ bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT
 static void
 bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    assert(xn <= qn);
-    assert(yn <= rn);
+    RUBY_ASSERT(xn <= qn);
+    RUBY_ASSERT(yn <= rn);
 
     BARY_TRUNC(yds, yn);
     if (yn == 0)
@@ -2865,32 +2958,6 @@ bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, s
     }
 }
 
-
-#define BIGNUM_DEBUG 0
-#if BIGNUM_DEBUG
-#define ON_DEBUG(x) do { x; } while (0)
-static void
-dump_bignum(VALUE x)
-{
-    long i;
-    printf("%c0x0", BIGNUM_SIGN(x) ? '+' : '-');
-    for (i = BIGNUM_LEN(x); i--; ) {
-        printf("_%0*"PRIxBDIGIT, SIZEOF_BDIGIT*2, BDIGITS(x)[i]);
-    }
-    printf(", len=%"PRIuSIZE, BIGNUM_LEN(x));
-    puts("");
-}
-
-static VALUE
-rb_big_dump(VALUE x)
-{
-    dump_bignum(x);
-    return x;
-}
-#else
-#define ON_DEBUG(x)
-#endif
-
 static int
 bigzero_p(VALUE x)
 {
@@ -2907,7 +2974,7 @@ int
 rb_cmpint(VALUE val, VALUE a, VALUE b)
 {
     if (NIL_P(val)) {
-	rb_cmperr(a, b);
+        rb_cmperr_reason(a, b, "comparator returned nil");
     }
     if (FIXNUM_P(val)) {
         long l = FIX2LONG(val);
@@ -2916,9 +2983,9 @@ rb_cmpint(VALUE val, VALUE a, VALUE b)
         return 0;
     }
     if (RB_BIGNUM_TYPE_P(val)) {
-	if (BIGZEROP(val)) return 0;
-	if (BIGNUM_SIGN(val)) return 1;
-	return -1;
+        if (BIGZEROP(val)) return 0;
+        if (BIGNUM_SIGN(val)) return 1;
+        return -1;
     }
     if (RTEST(rb_funcall(val, '>', 1, INT2FIX(0)))) return 1;
     if (RTEST(rb_funcall(val, '<', 1, INT2FIX(0)))) return -1;
@@ -2926,44 +2993,76 @@ rb_cmpint(VALUE val, VALUE a, VALUE b)
 }
 
 #define BIGNUM_SET_LEN(b,l) \
-    ((RBASIC(b)->flags & BIGNUM_EMBED_FLAG) ? \
+    (BIGNUM_EMBED_P(b) ? \
      (void)(RBASIC(b)->flags = \
-	    (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
-	    ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
+            (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
+            ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
      (void)(RBIGNUM(b)->as.heap.len = (l)))
 
+static size_t
+big_embed_capa(VALUE big)
+{
+    size_t size = rb_gc_obj_slot_size(big) - offsetof(struct RBignum, as.ary);
+    RUBY_ASSERT(size % sizeof(BDIGIT) == 0);
+    size_t capa = size / sizeof(BDIGIT);
+    RUBY_ASSERT(capa <= BIGNUM_EMBED_LEN_MAX);
+    return capa;

path: root/spec/ruby/core/objectspace/undefine_finalizer_spec.rb

require_relative '../../spec_helper'

describe "ObjectSpace.undefine_finalizer" do
  it "needs to be reviewed for spec completeness"
end