11426 files changed, 2733592 insertions, 32162 deletions

diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..8f4b96445c
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,39 @@
+;; Copyright (c) 2018 Urabe, Shyouhei.  All rights reserved.
+;;
+;; This file is a part of  the programming language Ruby.  Permission is hereby
+;; granted, to either  redistribute and/or modify this file,  provided that the
+;; conditions mentioned  in the  file COPYING  are met.   Consult the  file for
+;; details.
+
+((nil .
+     ((indent-tabs-mode . nil)
+      (require-final-newline . t)
+      (tab-width . 8)
+      (show-trailing-whitespace . t)
+      (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (c++-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+     ((buffer-file-coding-system . us-ascii)
+      (indent-tabs-mode . t)
+      (change-log-indent-text . 2)
+      (add-log-time-format . (lambda (&optional x y)
+        (let* ((time (or x (current-time)))
+	       (system-time-locale "C")
+	       (diff (+ (cadr time) 32400))
+	       (lo (% diff 65536))
+	       (hi (+ (car time) (/ diff 65536))))
+        (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
new file mode 100644
index 0000000000..82ca602bfb
--- /dev/null
+++ b/.document
@@ -0,0 +1,56 @@
+# This file determines which files in the
+# Ruby hierarchy will be processed by the RDoc
+# tool when it is given the top-level directory
+# as an argument
+
+# Process all the C source files
+*.c
+*.y
+
+# prelude
+prelude.rb
+rbconfig.rb
+
+array.rb
+ast.rb
+dir.rb
+gc.rb
+hash.rb
+io.rb
+kernel.rb
+marshal.rb
+numeric.rb
+nilclass.rb
+pack.rb
+pathname_builtin.rb
+ractor.rb
+string.rb
+symbol.rb
+timev.rb
+thread_sync.rb
+trace_point.rb
+warning.rb
+yjit.rb
+zjit.rb
+
+# Errno::*
+known_errors.inc
+
+# the lib/ directory (which has its own .document file)
+lib
+
+# and some of the ext/ directory (which has its own .document file)
+ext
+
+# rdoc files
+NEWS.md
+
+README.md
+README.ja.md
+
+COPYING
+COPYING.ja
+
+LEGAL
+
+doc
diff --git a/.editorconfig b/.editorconfig
new file mode 100644
index 0000000000..4633a7acae
--- /dev/null
+++ b/.editorconfig
@@ -0,0 +1,30 @@
+root = true
+
+[*]
+end_of_line = lf
+indent_size = 4
+indent_style = space
+insert_final_newline = true
+tab_width = 8
+trim_trailing_whitespace = true
+
+[*.bat]
+end_of_line = crlf
+
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..bda544c641
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,1336 @@
+define ruby_gdb_init
+  init-if-undefined $color_type = "\033[31m"
+  init-if-undefined $color_highlite = "\033[36m"
+  init-if-undefined $color_end = "\033[m"
+end
+
+# set prompt \033[36m(gdb)\033[m\040
+
+define rp
+  ruby_gdb_init
+  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+  else
+  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+    printf "%sSYMBOL%s: ", $color_type, $color_end
+    rp_id $id
+  else
+  if ($arg0) == RUBY_Qfalse
+    echo false\n
+  else
+  if ($arg0) == RUBY_Qtrue
+    echo true\n
+  else
+  if ($arg0) == RUBY_Qnil
+    echo nil\n
+  else
+  if ($arg0) == RUBY_Qundef
+    echo undef\n
+  else
+  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+    if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
+      printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
+    else
+      echo immediate\n
+    end
+  else
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
+    printf "[PROMOTED] "
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+    printf "%sT_NONE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+    printf "%sT_NIL%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+    printf "%sT_OBJECT%s: ", $color_type, $color_end
+    print ((struct RObject *)($arg0))->basic
+    if ($flags & ROBJECT_EMBED)
+      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (RSHAPE_CAPACITY(rb_obj_shape_id($arg0)))
+    else
+      print (((struct RObject *)($arg0))->as.heap)
+      if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+        print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+      end
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+    printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+    printf "%sT_ICLASS%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+    printf "%sT_MODULE%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+    printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
+    print (struct RFloat *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    printf "%sT_STRING%s: ", $color_type, $color_end
+    rp_string $arg0 $flags
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+    set $regsrc = ((struct RRegexp*)($arg0))->src
+    set $rsflags = ((struct RBasic*)$regsrc)->flags
+    printf "%sT_REGEXP%s: ", $color_type, $color_end
+    set $len = ((struct RString*)($arg0))->len
+    set print address off
+    output *(char *)(($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.ptr : \
+            ((struct RString*)$regsrc)->as.embed.ary) @ $len
+    set print address on
+    printf " len:%ld ", $len
+    if $flags & RUBY_FL_USER6
+      printf "(none) "
+    end
+    if $flags & RUBY_FL_USER5
+      printf "(literal) "
+    end
+    if $flags & RUBY_FL_USER4
+      printf "(fixed) "
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    print (struct RRegexp *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if ($flags & RUBY_FL_USER1)
+      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      printf "(embed) "
+      if ($len == 0)
+        printf "{(empty)} "
+      else
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+        printf " "
+      end
+    else
+      set $len = ((struct RArray*)($arg0))->as.heap.len
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      if ($flags & RUBY_FL_USER2)
+        printf "(shared) shared="
+        output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
+        printf " "
+      else
+        printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+      end
+      if ($len == 0)
+        printf "{(empty)} "
+      else
+        print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+        printf " "
+      end
+    end
+    print (struct RArray *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+    printf "%sT_FIXNUM%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+    printf "%sT_HASH%s: ", $color_type, $color_end,
+    if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
+      set $st = (struct st_table *)((uintptr_t)($arg0) + sizeof(struct RHash))
+      printf "st len=%ld ", $st->num_entries
+      print $st
+    else
+      printf "li len=%ld bound=%ld ", \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
+	print (struct ar_table_struct *)((uintptr_t)($arg0) + sizeof(struct RHash))
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+    set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+       ((struct RStruct *)($arg0))->as.heap.len)
+    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
+    print (struct RStruct *)($arg0)
+    output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+              ((struct RStruct *)($arg0))->as.ary : \
+              ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+    rp_bignum $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+    printf "%sT_RATIONAL%s: ", $color_type, $color_end
+    print (struct RRational *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+    printf "%sT_COMPLEX%s: ", $color_type, $color_end
+    print (struct RComplex *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+    printf "%sT_FILE%s: ", $color_type, $color_end
+    print (struct RFile *)($arg0)
+    output *((struct RFile *)($arg0))->fptr
+    printf "\n"
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+    printf "%sT_TRUE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+    printf "%sT_FALSE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+    if ($flags & RUBY_TYPED_FL_IS_TYPED_DATA)
+      set $data = (struct RTypedData *)($arg0)
+      set $type = (const rb_data_type_t *)($data->type & ~1)
+      printf "%sT_DATA%s(%s): ", $color_type, $color_end, $type->wrap_struct_name
+      print *$type
+      if ($data->type & 1)
+        print (void *)&$data->data
+      else
+        print $data
+      end
+    else
+      printf "%sT_DATA%s: ", $color_type, $color_end
+      print *(struct RData *)($arg0)
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+    printf "%sT_MATCH%s: ", $color_type, $color_end
+    print (struct RMatch *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+    printf "%sT_SYMBOL%s: ", $color_type, $color_end
+    print (struct RSymbol *)($arg0)
+    set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
+    if $id_type == RUBY_ID_LOCAL
+      printf "l"
+    else
+    if $id_type == RUBY_ID_INSTANCE
+      printf "i"
+    else
+    if $id_type == RUBY_ID_GLOBAL
+      printf "G"
+    else
+    if $id_type == RUBY_ID_ATTRSET
+      printf "a"
+    else
+    if $id_type == RUBY_ID_CONST
+      printf "C"
+    else
+    if $id_type == RUBY_ID_CLASS
+      printf "c"
+    else
+      printf "j"
+    end
+    end
+    end
+    end
+    end
+    end
+    set $id_fstr = ((struct RSymbol *)($arg0))->fstr
+    rp_string $id_fstr
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+    printf "%sT_UNDEF%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
+    printf "%sT_IMEMO%s(", $color_type, $color_end
+    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
+    printf "): "
+    rp_imemo $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+    printf "%sT_NODE%s(", $color_type, $color_end
+    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+    printf "): "
+    print *(NODE *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+    printf "%sT_ZOMBIE%s: ", $color_type, $color_end
+    print (struct RData *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
+    printf "%sT_MOVED%s: ", $color_type, $color_end
+    print *(struct RMoved *)$arg0
+  else
+    printf "%sunknown%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp
+  Print a Ruby's VALUE.
+end
+
+define rp_id
+  set $id = (ID)$arg0
+  if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+    printf "(:%c)\n", $id
+  else
+  if $id == idDot2
+    printf "(:..)\n"
+  else
+  if $id == idDot3
+    printf "(:...)\n"
+  else
+  if $id == idUPlus
+    printf "(:+@)\n"
+  else
+  if $id == idUMinus
+    printf "(:-@)\n"
+  else
+  if $id == idPow
+    printf "(:**)\n"
+  else
+  if $id == idCmp
+    printf "(:<=>)\n"
+  else
+  if $id == idLTLT
+    printf "(:<<)\n"
+  else
+  if $id == idGTGT
+    printf "(:>>)\n"
+  else
+  if $id == idLE
+    printf "(:<=)\n"
+  else
+  if $id == idGE
+    printf "(:>=)\n"
+  else
+  if $id == idEq
+    printf "(:==)\n"
+  else
+  if $id == idEqq
+    printf "(:===)\n"
+  else
+  if $id == idNeq
+    printf "(:!=)\n"
+  else
+  if $id == idEqTilde
+    printf "(:=~)\n"
+  else
+  if $id == idNeqTilde
+    printf "(:!~)\n"
+  else
+  if $id == idAREF
+    printf "(:[])\n"
+  else
+  if $id == idASET
+    printf "(:[]=)\n"
+  else
+  if $id == idCOLON2
+    printf "(:'::')\n"
+  else
+  if $id == idANDOP
+    printf "(:&&)\n"
+  else
+  if $id == idOROP
+    printf "(:||)\n"
+  else
+  if $id == idANDDOT
+    printf "(:&.)\n"
+  else
+    if $id <= tLAST_OP_ID
+      printf "O"
+    else
+      set $id_type = $id & RUBY_ID_SCOPE_MASK
+      if $id_type == RUBY_ID_LOCAL
+        printf "l"
+      else
+      if $id_type == RUBY_ID_INSTANCE
+        printf "i"
+      else
+      if $id_type == RUBY_ID_GLOBAL
+        printf "G"
+      else
+      if $id_type == RUBY_ID_ATTRSET
+        printf "a"
+      else
+      if $id_type == RUBY_ID_CONST
+        printf "C"
+      else
+      if $id_type == RUBY_ID_CLASS
+        printf "c"
+      else
+        printf "j"
+      end
+      end
+      end
+      end
+      end
+      end
+    end
+    printf "(%ld): ", $id
+    print_id $id
+    echo \n
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp_id
+  Print an ID.
+end
+
+define output_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set $len = ((struct RString*)($arg0))->len
+  if $len > 0
+    output *(char *)(($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
+  else
+    output ""
+  end
+end
+
+define print_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set $len = ((struct RString*)($arg0))->len
+  if $len > 0
+    printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.ptr : \
+            ((struct RString*)($arg0))->as.embed.ary) @ $len
+  end
+end
+
+define rp_string
+  output_string $arg0
+  printf " bytesize:%ld ", $len
+  if !($flags & RUBY_FL_USER1)
+    printf "(embed) "
+  else
+    if ($flags & RUBY_FL_USER2)
+      printf "(shared) "
+    end
+    if ($flags & RUBY_FL_USER3)
+      printf "(assoc) "
+    end
+  end
+  printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+    printf "coderange:unknown "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+    printf "coderange:7bit "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+    printf "coderange:valid "
+  else
+    printf "coderange:broken "
+  end
+  end
+  end
+  print (struct RString *)($arg0)
+end
+document rp_string
+  Print the content of a String.
+end
+
+define rp_bignum
+  set $flags = ((struct RBignum*)($arg0))->basic.flags
+  set $len = (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+  printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+         (($flags & RUBY_FL_USER1) != 0), $len
+  if $flags & RUBY_FL_USER2
+    printf "(embed) "
+  end
+  print (struct RBignum *)($arg0)
+  set $ptr = (($flags & RUBY_FL_USER2) ? \
+              ((struct RBignum*)($arg0))->as.ary : \
+              ((struct RBignum*)($arg0))->as.heap.digits)
+  set $len = $len-1
+  printf "0x%x", $ptr[$len]
+  while $len > 0
+    set $len = $len-1
+    set $val = $ptr[$len]
+    set $w = sizeof($ptr[0])
+    printf "_"
+    if $w > 8
+      printf "%.32x", $val
+    else
+    if $w > 4
+      printf "%.16x", $val
+    else
+    if $w > 2
+      printf "%.8x", $val
+    else
+    if $w > 1
+      printf "%.4x", $val
+    else
+      printf "%.2x", $val
+    end
+    end
+    end
+    end
+  end
+  printf "\n"
+end
+document rp_bignum
+  Print the content of a Bignum.
+end
+
+define rp_class
+  set $class_and_classext = (struct RClass_and_rb_classext_t *)($arg0)
+  printf "(struct RClass *) %p", (void*)$arg0
+  if $class_and_classext->classext->origin_ != (VALUE)$arg0
+    printf " -> %p", $class_and_classext->classext->origin_
+  end
+  printf "\n"
+  rb_classname $arg0
+  print/x *$class_and_classext
+end
+document rp_class
+  Print the content of a Class/Module.
+end
+
+define rp_imemo
+  set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
+  if $flags == imemo_cref
+    printf "(rb_cref_t *) %p\n", (void*)$arg0
+    print *(rb_cref_t *)$arg0
+  else
+  if $flags == imemo_svar
+    printf "(struct vm_svar *) %p\n", (void*)$arg0
+    print *(struct vm_svar *)$arg0
+  else
+  if $flags == imemo_throw_data
+    printf "(struct vm_throw_data *) %p\n", (void*)$arg0
+    print *(struct vm_throw_data *)$arg0
+  else
+  if $flags == imemo_ifunc
+    printf "(struct vm_ifunc *) %p\n", (void*)$arg0
+    print *(struct vm_ifunc *)$arg0
+  else
+  if $flags == imemo_memo
+    printf "(struct MEMO *) %p\n", (void*)$arg0
+    print *(struct MEMO *)$arg0
+  else
+  if $flags == imemo_ment
+    printf "(rb_method_entry_t *) %p\n", (void*)$arg0
+    print *(rb_method_entry_t *)$arg0
+  else
+  if $flags == imemo_iseq
+    printf "(rb_iseq_t *) %p\n", (void*)$arg0
+    print *(rb_iseq_t *)$arg0
+  else
+    printf "(struct RIMemo *) %p\n", (void*)$arg0
+    print *(struct RIMemo *)$arg0
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp_imemo
+  Print the content of a memo
+end
+
+define nd_type
+  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+  Print a Ruby' node type.
+end
+
+define nd_file
+  print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+  Print the source file name of a node.
+end
+
+define nd_line
+  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+  Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_alen
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_next
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_cond
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_body
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_else
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_orig
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+
+define nd_resq
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_ensr
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_1st
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_2nd
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+
+define nd_stts
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_vid
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_cflag
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_cval
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+define nd_tbl
+  printf "%su1.tbl%s: ", $color_highlite, $color_end
+  p ($arg0).u1.tbl
+end
+
+
+define nd_var
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_ibdy
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_iter
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_value
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_aid
+  printf "%su3.id%s: ", $color_highlite, $color_end
+  p ($arg0).u3.id
+end
+
+
+define nd_lit
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+define nd_rest
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_opt
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_recv
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_mid
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_args
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+define nd_defn
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_old
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_new
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+
+define nd_cname
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_super
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_modl
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_clss
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+
+define nd_beg
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_end
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_state
+  printf "%su3.state%s: ", $color_highlite, $color_end
+  p ($arg0).u3.state
+end
+
+define nd_rval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+
+define nd_nth
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
+define nd_tag
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_tval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+define nd_tree
+  set $buf = (struct RString *)rb_str_buf_new(0)
+  call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
+  printf "%s\n", $buf->as.heap.ptr
+end
+
+define rb_p
+  call rb_p($arg0)
+end
+
+define rb_numtable_entry
+  set $rb_numtable_tbl = $arg0
+  set $rb_numtable_id = (st_data_t)$arg1
+  set $rb_numtable_key = 0
+  set $rb_numtable_rec = 0
+  if $rb_numtable_tbl->entries_packed
+    set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
+    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
+      if $rb_numtable_p.k == $rb_numtable_id
+        set $rb_numtable_key = $rb_numtable_p.k
+        set $rb_numtable_rec = $rb_numtable_p.v
+        set $rb_numtable_p = 0
+      else
+        set $rb_numtable_p = $rb_numtable_p + 1
+      end
+    end
+  else
+    set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
+    while $rb_numtable_p
+      if $rb_numtable_p->key == $rb_numtable_id
+        set $rb_numtable_key = $rb_numtable_p->key
+        set $rb_numtable_rec = $rb_numtable_p->record
+        set $rb_numtable_p = 0
+      else
+        set $rb_numtable_p = $rb_numtable_p->next
+      end
+    end
+  end
+end
+
+define rb_id2name
+  ruby_gdb_init
+  printf "%sID%s: ", $color_type, $color_end
+  rp_id $arg0
+end
+document rb_id2name
+  Print the name of id
+end
+
+define rb_method_entry
+  set $rb_method_entry_klass = (struct RClass *)$arg0
+  set $rb_method_entry_id = (ID)$arg1
+  set $rb_method_entry_me = (rb_method_entry_t *)0
+  while !$rb_method_entry_me && $rb_method_entry_klass
+    rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
+    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+    if !$rb_method_entry_me
+      set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
+    end
+  end
+  if $rb_method_entry_me
+    print *$rb_method_entry_klass
+    print *$rb_method_entry_me
+  else
+    echo method not found\n
+  end
+end
+document rb_method_entry
+  Search method entry by class and id
+end
+
+define rb_classname
+  set $rb_classname = ((struct RClass_and_rb_classext_t*)$arg0)->classext->classpath
+  if $rb_classname != RUBY_Qfalse
+    print_string $rb_classname
+    printf "\n"
+  else
+    echo anonymous class/module\n
+  end
+end
+
+define rb_ancestors
+  set $rb_ancestors_module = $arg0
+  while $rb_ancestors_module
+    rp_class $rb_ancestors_module
+    set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
+  end
+end
+document rb_ancestors
+  Print ancestors.
+end
+
+define rb_backtrace
+  call rb_backtrace()
+end
+
+define iseq
+  if ruby_dummy_gdb_enums.special_consts
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_NONE
+    echo [none]\n
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_LABEL
+    print *(LABEL*)($arg0)
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_INSN
+    print *(INSN*)($arg0)
+    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+      set $i = 0
+      set $operand_size = ((INSN*)($arg0))->operand_size
+      set $operands = ((INSN*)($arg0))->operands
+      while $i < $operand_size
+        rp $operands[$i++]
+      end
+    end
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+    print *(ADJUST*)($arg0)
+  end
+end
+
+define rb_ps
+  rb_ps_vm ruby_current_vm_ptr
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+  print $ps_vm = (rb_vm_t*)$arg0
+  set $ps_thread_ln      = $ps_vm->ractor.main_ractor.threads.set.n.next
+  set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
+  while 1
+    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+    set $ps_thread = (VALUE)($ps_thread_th->self)
+    rb_ps_thread $ps_thread
+    if $ps_thread_ln == $ps_thread_ln_last
+      loop_break
+    end
+    set $ps_thread_ln = $ps_thread_ln->next
+  end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define print_lineno
+  set $cfp = $arg0
+  set $iseq = $cfp->iseq
+  set $pos = $cfp->pc - $iseq->body->iseq_encoded
+  if $pos != 0
+    set $pos = $pos - 1
+  end
+
+  set $index = 0
+  set $size = $iseq->body->insns_info.size
+  set $table = $iseq->body->insns_info.body
+  set $positions = $iseq->body->insns_info.positions
+  #printf "size: %d\n", $size
+  if $size == 0
+  else
+  if $size == 1
+    printf "%d", $table[0].line_no
+  else
+    if $positions
+      # get_insn_info_linear_search
+      set $index = 1
+      while $index < $size
+        #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+        if $positions[$index] > $pos
+          loop_break
+        end
+        set $index = $index + 1
+        if $positions[$index] == $pos
+          loop_break
+        end
+      end
+    else
+      # get_insn_info_succinct_bitvector
+      set $sd = $iseq->body->insns_info.succ_index_table
+      set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+      if $pos < $immediate_table_size
+        set $i = $pos / 9
+        set $j = $pos % 9
+        set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+      else
+        set $block_index = ($pos - $immediate_table_size) / 512
+        set $block = &$sd->succ_part[$block_index]
+        set $block_bit_index = ($pos - $immediate_table_size) % 512
+        set $small_block_index = $block_bit_index / 64
+        set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+        set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+        set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+        set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+        set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+        set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+        set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+        set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+        set $index = $block->rank + $small_block_popcount + $popcnt
+      end
+    end
+    printf "%d", $table[$index-1].line_no
+  end
+  end
+end
+
+define check_method_entry
+  set $imemo = (struct RBasic *)$arg0
+  if $imemo != RUBY_Qfalse
+    set $type = ($imemo->flags >> 12) & 0x07
+    if $type == imemo_ment
+      set $me = (rb_callable_method_entry_t *)$imemo
+    else
+    if $type == imemo_svar
+      set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+      check_method_entry $imemo
+    end
+    end
+  end
+end
+
+define print_id
+  set $id = $arg0
+  # rb_id_to_serial
+  if $id > tLAST_OP_ID
+    set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
+  else
+    set $serial = (rb_id_serial_t)$id
+  end
+  if $serial && $serial <= ruby_global_symbols.last_id
+    set $idx = $serial / ID_ENTRY_UNIT
+    set $ids = (struct RArray *)ruby_global_symbols.ids
+    set $flags = $ids->basic.flags
+    if ($flags & RUBY_FL_USER1)
+      set $idsptr = $ids->as.ary
+      set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+    else
+      set $idsptr = $ids->as.heap.ptr
+      set $idslen = $ids->as.heap.len
+    end
+    if $idx < $idslen
+      set $t = 0
+      set $ary = (struct RArray *)$idsptr[$idx]
+      if $ary != RUBY_Qnil
+        set $flags = $ary->basic.flags
+        if ($flags & RUBY_FL_USER1)
+          set $aryptr = $ary->as.ary
+          set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+        else
+          set $aryptr = $ary->as.heap.ptr
+          set $arylen = $ary->as.heap.len
+        end
+        set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
+        if $result != RUBY_Qnil
+          print_string $result
+        else
+          echo undef
+        end
+      end
+    end
+  end
+end
+
+define print_pathobj
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    print_string $arg0
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if $flags & RUBY_FL_USER1
+      set $str = ((struct RArray*)($arg0))->as.ary[0]
+    else
+      set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+    end
+    print_string $str
+  end
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+    $ps_thread, $ps_thread_th, $ps_thread_th->nt
+  set $cfp = $ps_thread_th->ec->cfp
+  set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
+  while $cfp < $cfpend
+    if $cfp->iseq
+      if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+        printf "%d:ifunc ", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $cfp->iseq.body
+        set print symbol-filename off
+        printf "\n"
+      else
+      if $cfp->pc
+        set $location = $cfp->iseq->body->location
+        printf "%d:", $cfpend-$cfp
+        print_pathobj $location.pathobj
+        printf ":"
+        print_lineno $cfp
+        printf ":in `"
+        print_string $location.label
+        printf "'\n"
+      else
+        printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+      end
+      end
+    else
+      # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
+      set $ep = $cfp->ep
+      if ($ep[0] & 0xffff0001) == 0x55550001
+        #define VM_ENV_FLAG_LOCAL 0x02
+        #define VM_ENV_PREV_EP(ep)   GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
+        set $me = 0
+        set $env_specval = $ep[-1]
+        set $env_me_cref = $ep[-2]
+        while ($env_specval & 0x02) != 0
+          check_method_entry $env_me_cref
+          if $me != 0
+            loop_break
+          end
+          set $ep = $ep[0]
+          set $env_specval = $ep[-1]
+          set $env_me_cref = $ep[-2]
+        end
+        if $me == 0
+          check_method_entry $env_me_cref
+        end
+        printf "%d:", $cfpend-$cfp
+        set print symbol-filename on
+        output/a $me->def->body.cfunc.func
+        set print symbol-filename off
+        set $mid = $me->def->original_id
+        printf ":in `"
+        print_id $mid
+        printf "'\n"
+      else
+        printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
+      end
+    end
+    set $cfp = $cfp + 1
+  end
+end
+
+define rb_count_objects
+  set $objspace = ruby_current_vm_ptr->objspace
+  set $counts_00 = 0
+  set $counts_01 = 0
+  set $counts_02 = 0
+  set $counts_03 = 0
+  set $counts_04 = 0
+  set $counts_05 = 0
+  set $counts_06 = 0
+  set $counts_07 = 0
+  set $counts_08 = 0
+  set $counts_09 = 0
+  set $counts_0a = 0
+  set $counts_0b = 0
+  set $counts_0c = 0
+  set $counts_0d = 0
+  set $counts_0e = 0
+  set $counts_0f = 0
+  set $counts_10 = 0
+  set $counts_11 = 0
+  set $counts_12 = 0
+  set $counts_13 = 0
+  set $counts_14 = 0
+  set $counts_15 = 0
+  set $counts_16 = 0
+  set $counts_17 = 0
+  set $counts_18 = 0
+  set $counts_19 = 0
+  set $counts_1a = 0
+  set $counts_1b = 0
+  set $counts_1c = 0
+  set $counts_1d = 0
+  set $counts_1e = 0
+  set $counts_1f = 0
+  set $total = 0
+  set $i = 0
+  while $i < $objspace->heap_pages.allocated_pages
+    printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
+    set $page = $objspace->heap_pages.sorted[$i]
+    set $p = $page->start
+    set $pend = $p + $page->total_slots
+    while $p < $pend
+      set $flags = $p->as.basic.flags & 0x1f
+      eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
+      set $p = $p + 1
+    end
+    set $total = $total + $page->total_slots
+    set $i = $i + 1
+  end
+  printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
+  printf "T_OBJECT: %d\n", $counts_01
+  printf "T_CLASS: %d\n", $counts_02
+  printf "T_MODULE: %d\n", $counts_03
+  printf "T_FLOAT: %d\n", $counts_04
+  printf "T_STRING: %d\n", $counts_05
+  printf "T_REGEXP: %d\n", $counts_06
+  printf "T_ARRAY: %d\n", $counts_07
+  printf "T_HASH: %d\n", $counts_08
+  printf "T_STRUCT: %d\n", $counts_09
+  printf "T_BIGNUM: %d\n", $counts_0a
+  printf "T_FILE: %d\n", $counts_0b
+  printf "T_DATA: %d\n", $counts_0c
+  printf "T_MATCH: %d\n", $counts_0d
+  printf "T_COMPLEX: %d\n", $counts_0e
+  printf "T_RATIONAL: %d\n", $counts_0f
+  #printf "UNKNOWN_10: %d\n", $counts_10
+  printf "T_NIL: %d\n", $counts_11
+  printf "T_TRUE: %d\n", $counts_12
+  printf "T_FALSE: %d\n", $counts_13
+  printf "T_SYMBOL: %d\n", $counts_14
+  printf "T_FIXNUM: %d\n", $counts_15
+  printf "T_UNDEF: %d\n", $counts_16
+  #printf "UNKNOWN_17: %d\n", $counts_17
+  #printf "UNKNOWN_18: %d\n", $counts_18
+  #printf "UNKNOWN_19: %d\n", $counts_19
+  printf "T_IMEMO: %d\n", $counts_1a
+  printf "T_NODE: %d\n", $counts_1b
+  printf "T_ICLASS: %d\n", $counts_1c
+  printf "T_ZOMBIE: %d\n", $counts_1d
+  #printf "UNKNOWN_1E: %d\n", $counts_1e
+  printf "T_MASK: %d\n", $counts_1f
+end
+document rb_count_objects
+  Counts all objects grouped by type.
+end
+
+# Details: https://github.com/ruby/ruby/wiki/Machine-Instructions-Trace-with-GDB
+define trace_machine_instructions
+  set logging enabled
+  set height 0
+  set width 0
+  display/i $pc
+  while !$exit_code
+    info line *$pc
+    si
+  end
+end
+
+define SDR
+  call rb_vmdebug_stack_dump_raw_current()
+end
+
+define rbi
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+    p *(LABEL*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+    p *(INSN*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+    p *(ADJUST*)$arg0
+  else
+    print *$arg0
+  end
+  end
+  end
+end
+
+define dump_node
+  set $str = rb_parser_dump_tree($arg0, 0)
+  set $flags = ((struct RBasic*)($str))->flags
+  printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+                        ((struct RString*)$str)->as.heap.ptr : \
+                        ((struct RString*)$str)->as.embed.ary)
+end
+
+define print_flags
+  printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+  printf "RUBY_FL_PROMOTED    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED ? "1" : "0"
+  printf "RUBY_FL_FINALIZE    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+  printf "RUBY_FL_SHAREABLE   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
+  printf "RUBY_FL_EXIVAR      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+  printf "RUBY_FL_FREEZE      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+  printf "RUBY_FL_USER0       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+  printf "RUBY_FL_USER1       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+  printf "RUBY_FL_USER2       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+  printf "RUBY_FL_USER3       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+  printf "RUBY_FL_USER4       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+  printf "RUBY_FL_USER5       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+  printf "RUBY_FL_USER6       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+  printf "RUBY_FL_USER7       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+  printf "RUBY_FL_USER8       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+  printf "RUBY_FL_USER9       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+  printf "RUBY_FL_USER10      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+  printf "RUBY_FL_USER11      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+  printf "RUBY_FL_USER12      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+  printf "RUBY_FL_USER13      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+  printf "RUBY_FL_USER14      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+  printf "RUBY_FL_USER15      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+  printf "RUBY_FL_USER16      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+  printf "RUBY_FL_USER17      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+  printf "RUBY_FL_USER18      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
+
+source -s misc/gdb.py
+
+# Moved from beginning, since it fails on older gdbs
+set startup-with-shell off
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
new file mode 100644
index 0000000000..d98646febf
--- /dev/null
+++ b/.git-blame-ignore-revs
@@ -0,0 +1,41 @@
+# This is a file used by GitHub to ignore the following commits on `git blame`.
+#
+# You can also do the same thing in your local repository with:
+# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
+
+# Expand tabs
+5b21e94bebed90180d8ff63dad03b8b948361089
+c5e9af9c9d890578182a21e7b71b50334cd5579e
+e63a2115f64433b21cb5dd67c5bf8b30f87ef293
+712ac99e4d0384a941c80a9f48f62943ba7d97c0
+d1474affa8e105bece209cc9d594bb0a989859e1
+2da92388b948821269b18d6b178a680f17e41750
+5062c0c621d887367af8a054e5e5d83d7ec57dd3
+
+# Enable Style/StringLiterals cop for RubyGems/Bundler
+d7ffd3fea402239b16833cc434404a7af82d44f3
+
+# [ruby/digest] Revert tab-expansion in external files
+48b09aae7ec5632209229dcc294dd0d75a93a17f
+8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
+39dc9f9093901d40d2998653948d5da38b18ee2c
+
+# [ruby/io-nonblock] Revert tab expansion
+f28287d34c03f472ffe90ea262bdde9affd4b965
+0d842fecb4f75ab3b1d4097ebdb8e88f51558041
+4ba2c66761d6a293abdfba409241d31063cefd62
+
+# Make benchmark indentation consistent
+fc4acf8cae82e5196186d3278d831f2438479d91
+
+# Make prism_compile.c indentation consistent
+40b2c8e5e7e6e5f83cee9276dc9c1922a69292d6
+d2c5867357ed88eccc28c2b3bd4a46e206e7ff85
+
+# Miss-and-revived commits
+a0f7de814ae5c299d6ce99bed5fb308a05d50ba0
+d4e24021d39e1f80f0055b55d91f8d5f22e15084
+7a56c316418980b8a41fcbdc94067b2bda2ad112
+e90282be7ba1bc8e3119f6e1a2c80356ceb3f80a
+26a9e0b4e31f7b5a9cbd755e0a15823a8fa51bae
+2f53985da9ee593fe524d408256835667938c7d7
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..6ac6e6fcc3
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,9 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+*.inc.rs linguist-generated=true
+bin svn-properties=svn:ignore=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/actions/capiext/action.yml b/.github/actions/capiext/action.yml
new file mode 100644
index 0000000000..49562725f4
--- /dev/null
+++ b/.github/actions/capiext/action.yml
@@ -0,0 +1,86 @@
+name: rubyspec C-API extensions
+
+inputs:
+  builddir:
+    required: false
+    default: '.'
+  make:
+    required: false
+    default: 'make -s'
+
+outputs:
+  key:
+    value: >-
+      ${{
+      !steps.restore.outputs.cache-hit &&
+      github.ref == 'refs/heads/master' &&
+      steps.config.outputs.key
+      }}
+
+runs:
+  using: composite
+
+  steps:
+    - id: config
+      shell: bash
+      run: |
+        eval $(grep -e '^arch *=' -e '^ruby_version *=' -e '^DLEXT *=' Makefile |
+            sed 's/ *= */=/')
+        case "${ruby_version}" in
+        *+*) key=capiexts-${arch}-${ruby_version}-${{ hashFiles('src/spec/ruby/optional/capi/ext/*.[ch]') }};;
+        *)   key=;;
+        esac
+        echo version=$ruby_version >> $GITHUB_OUTPUT
+        echo key="$key" >> $GITHUB_OUTPUT
+        echo DLEXT=$DLEXT >> $GITHUB_OUTPUT
+      working-directory: ${{ inputs.builddir }}
+
+    - name: Restore previous CAPI extensions
+      uses: actions/cache/restore@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      id: cache
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.config.outputs.key }}
+
+    - name: Run test-spec with previous CAPI extension binaries
+      id: check
+      shell: bash
+      run: |
+        touch spec/ruby/optional/capi/ext/*.$DLEXT
+        [ ! -f spec/ruby/optional/capi/ext/\*.$DLEXT ]
+        ${{ inputs.make }} SPECOPTS=optional/capi test-spec
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: ${{ steps.cache.outputs.cache-hit }}
+
+    - name: Strip CAPI extensions
+      id: strip
+      shell: bash
+      run: |
+        rm -f spec/ruby/optional/capi/ext/*.c
+        [ "$DLEXT" = bundle ] || # separated to .dSYM directories
+        strip spec/ruby/optional/capi/ext/*.$DLEXT
+      env:
+        DLEXT: ${{ steps.config.outputs.DLEXT }}
+      working-directory: ${{ inputs.builddir }}
+      if: >-
+        ${{true
+        && ! steps.cache.outputs.cache-hit
+        && github.ref_name == 'master'
+        }}
+
+    - name: Save CAPI extensions
+      uses: actions/cache/save@0400d5f644dc74513175e3cd8d07132dd4860809 # v4.2.4
+      with:
+        path: ${{ inputs.builddir }}/spec/ruby/optional/capi/ext/
+        key: ${{ steps.config.outputs.key }}
+      if: ${{ steps.strip.outcome == 'success' }}
+
+    - shell: bash
+      run: |
+        echo "::error::Change from ${prev} detected; bump up ABI version"
+      env:
+        prev: ${{ steps.config.outputs.version }}
+      if: ${{ always() && steps.check.outcome == 'failure' }}
diff --git a/.github/actions/compilers/action.yml b/.github/actions/compilers/action.yml
new file mode 100644
index 0000000000..ab5b56a889
--- /dev/null
+++ b/.github/actions/compilers/action.yml
@@ -0,0 +1,133 @@
+name: Compiles ruby in a container
+description: >-
+  Makes ruby using a dedicated container
+
+inputs:
+  tag:
+    required: false
+    default: clang-20
+    description: >-
+      container image tag to use in this run.
+
+  with_gcc:
+    required: false
+    description: >-
+      override compiler path & flags.
+
+  CFLAGS:
+    required: false
+    description: >-
+      C compiler flags to override.
+
+  CXXFLAGS:
+    required: false
+    description: >-
+      C++ compiler flags to override.
+
+  optflags:
+    required: false
+    # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
+    # to optimize binaries.  Also GitHub Actions run on relatively modern CPUs
+    # compared to, say, GCC 4 or Clang 3.  We don't specify `-march=native`
+    # because compilers tend not understand what the CPU is.
+    default: '-O1'
+    description: >-
+      Compiler flags for optimisations.
+
+  cppflags:
+    required: false
+    description: >-
+      Additional preprocessor flags.
+
+  append_configure:
+    required: false
+    default: >-
+      --without-valgrind
+      --without-jemalloc
+      --without-gmp
+    description: >-
+      flags to append to configure.
+
+  enable_shared:
+    required: false
+    default: true
+    description: >-
+      Whether to build libruby.so.
+
+  check:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make check`
+
+  test_all:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-all` with options for test-all.
+
+  test_spec:
+    required: false
+    default: ''
+    description: >-
+      Whether to run `make test-spec` with options for mspec.
+
+  static_exts:
+    required: false
+    description: >-
+      whitespace separated list of extensions that need be linked statically.
+
+runs:
+  using: composite
+  steps:
+    - shell: bash
+      run: docker pull --quiet 'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
+
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        github.repository == 'ruby/ruby' ||
+        (github.repository != 'ruby/ruby' && env.LAUNCHABLE_TOKEN)
+        }}
+
+    - name: compile
+      shell: bash
+      run: >-
+        docker run
+        --rm
+        --user=root
+        --volume '${{ github.workspace }}:/github/workspace:ro'
+        --workdir=/github/workspace
+        --entrypoint=/github/workspace/.github/actions/compilers/entrypoint.sh
+        --env CI
+        --env GITHUB_ACTION
+        --env INPUT_WITH_GCC='${{ inputs.with_gcc || inputs.tag }}'
+        --env INPUT_CFLAGS='${{ inputs.CFLAGS }}'
+        --env INPUT_CXXFLAGS='${{ inputs.CXXFLAGS }}'
+        --env INPUT_OPTFLAGS='${{ inputs.OPTFLAGS }}'
+        --env INPUT_CPPFLAGS='${{ inputs.cppflags }}'
+        --env INPUT_APPEND_CONFIGURE='${{ inputs.append_configure }}'
+        --env INPUT_CHECK='${{ inputs.check }}'
+        --env INPUT_TEST_ALL='${{ inputs.test_all }}'
+        --env INPUT_TEST_SPEC='${{ inputs.test_spec }}'
+        --env INPUT_ENABLE_SHARED='${{ inputs.enable_shared }}'
+        --env INPUT_STATIC_EXTS='${{ inputs.static_exts }}'
+        --env LAUNCHABLE_ORGANIZATION='${{ github.repository_owner }}'
+        --env LAUNCHABLE_WORKSPACE='${{ github.event.repository.name }}'
+        --env LAUNCHABLE_ENABLED='${{ steps.enable-launchable.outputs.enable-launchable || false }}'
+        --env GITHUB_PR_HEAD_SHA='${{ github.event.pull_request.head.sha || github.sha }}'
+        --env GITHUB_PULL_REQUEST_URL='${{ github.event.pull_request.html_url }}'
+        --env GITHUB_REF='${{ github.ref }}'
+        --env GITHUB_ACTIONS
+        --env GITHUB_RUN_ID
+        --env GITHUB_REPOSITORY
+        --env GITHUB_WORKFLOW
+        --env GITHUB_RUN_NUMBER
+        --env GITHUB_EVENT_NAME
+        --env GITHUB_SHA
+        --env GITHUB_HEAD_REF
+        --env GITHUB_SERVER_URL
+        'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
diff --git a/.github/actions/compilers/entrypoint.sh b/.github/actions/compilers/entrypoint.sh
new file mode 100755
index 0000000000..b554151091
--- /dev/null
+++ b/.github/actions/compilers/entrypoint.sh
@@ -0,0 +1,90 @@
+#! /bin/bash
+
+# Copyright (c) 2024 Ruby developers.  All rights reserved.
+#
+# This file is  a part of the programming language  Ruby.  Permission is hereby
+# granted, to  either redistribute and/or  modify this file, provided  that the
+# conditions  mentioned in  the file  COPYING are  met.  Consult  the file  for
+# details.
+
+grouped()
+{
+    echo "::group::${@}"
+    "${@}"
+    echo "::endgroup::"
+}
+
+set -e
+set -u
+set -o pipefail
+
+srcdir="/github/workspace/src"
+builddir="$(mktemp -dt)"
+
+export GITHUB_WORKFLOW='Compilations'
+export CONFIGURE_TTY='never'
+export RUBY_DEBUG='ci rgengc'
+export RUBY_TESTOPTS='-q --color=always --tty=no'
+export RUBY_DEBUG_COUNTER_DISABLE='1'
+export GNUMAKEFLAGS="-j$((1 + $(nproc)))"
+
+case "x${INPUT_ENABLE_SHARED}" in
+x | xno | xfalse )
+    enable_shared='--disable-shared'
+    ;;
+*)
+    enable_shared='--enable-shared'
+    ;;
+esac
+
+pushd ${builddir}
+
+grouped git config --global --add safe.directory ${srcdir}
+
+grouped ${srcdir}/configure        \
+    -C                             \
+    --with-gcc="${INPUT_WITH_GCC}" \
+    --enable-debug-env             \
+    --disable-install-doc          \
+    --with-ext=-test-/cxxanyargs,+ \
+    --without-git                  \
+    ${enable_shared}               \
+    ${INPUT_APPEND_CONFIGURE}      \
+    CFLAGS="${INPUT_CFLAGS}"       \
+    CXXFLAGS="${INPUT_CXXFLAGS}"   \
+    optflags="${INPUT_OPTFLAGS}"   \
+    cppflags="${INPUT_CPPFLAGS}"   \
+    debugflags='-ggdb3' # -g0 disables backtraces when SEGV.  Do not set that.
+
+popd
+
+if [[ -n "${INPUT_STATIC_EXTS}" ]]; then
+    echo "::group::ext/Setup"
+    set -x
+    mkdir ${builddir}/ext
+    (
+        for ext in ${INPUT_STATIC_EXTS}; do
+            echo "${ext}"
+        done
+    ) >> ${builddir}/ext/Setup
+    set +x
+    echo "::endgroup::"
+fi
+
+if [ -n "$INPUT_TEST_ALL" ]; then
+  tests=" -- $INPUT_TEST_ALL"
+else
+  tests=" -- ruby -ext-"
+fi
+
+pushd ${builddir}
+
+grouped make showflags
+grouped make all
+# grouped make install
+
+# Run only `make test` by default. Run other tests if specified.
+grouped make test
+if [[ -n "$INPUT_CHECK" ]]; then grouped make test-tool; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_ALL" ]]; then grouped make test-all TESTS="$tests"; fi
+if [[ -n "$INPUT_CHECK" || -n "$INPUT_TEST_SPEC" ]]; then grouped env CHECK_LEAKS=true make test-spec MSPECOPT="$INPUT_TEST_SPEC"; fi
diff --git a/.github/actions/launchable/setup/action.yml b/.github/actions/launchable/setup/action.yml
new file mode 100644
index 0000000000..16af8fc3fd
--- /dev/null
+++ b/.github/actions/launchable/setup/action.yml
@@ -0,0 +1,313 @@
+name: Set up Launchable
+description: >-
+  Install the required dependencies and execute the necessary Launchable commands for test recording
+
+inputs:
+  os:
+    required: true
+    description: The operating system that CI runs on. This value is used in Launchable flavor.
+
+  test-opts:
+    default: none
+    required: false
+    description: >-
+      Test options that determine how tests are run.
+      This value is used in the Launchable flavor.
+
+  launchable-token:
+    required: false
+    description: >-
+      Launchable token is needed if you want to run Launchable on your forked repository.
+      See https://github.com/ruby/ruby/wiki/CI-Servers#launchable-ci for details.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to create Launchable report file.
+
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes. Launchable retrieves the commit information
+      from the directory.
+
+  test-task:
+    required: false
+    default: ${{ matrix.test_task }}
+    description: >-
+      Specifies a single test task to be executed.
+      This value is used in the Launchable flavor.
+      Either 'test-task' or 'multi-test-tasks' must be configured.
+
+  test-tasks:
+    required: false
+    default: '[]'
+    description: >-
+      Specifies an array of multiple test tasks to be executed.
+      For example: '["test", "test-all"]'.
+      If you want to run a single test task, use the 'test-task' input instead.
+
+  is-yjit:
+    required: false
+    default: 'false'
+    description: >-
+      Whether this workflow is executed on YJIT.
+
+outputs:
+  stdout_report_path:
+    value: ${{ steps.global.outputs.stdout_report_path }}
+    description: >-
+      Report file path for standard output.
+
+  stderr_report_path:
+    value: ${{ steps.global.outputs.stderr_report_path }}
+    description: >-
+      Report file path for standard error.
+
+runs:
+  using: composite
+
+  steps:
+    - name: Enable Launchable conditionally
+      id: enable-launchable
+      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
+      shell: bash
+      if: >-
+        ${{
+        (github.repository == 'ruby/ruby'
+          || (github.repository != 'ruby/ruby'
+          && env.LAUNCHABLE_TOKEN))
+        && (inputs.test-task == 'check'
+          || inputs.test-task == 'test-all'
+          || inputs.test-task == 'test'
+          || contains(fromJSON(inputs.test-tasks), 'test-all')
+          || contains(fromJSON(inputs.test-tasks), 'test'))
+        }}
+
+    # Launchable CLI requires Python and Java.
+    # https://www.launchableinc.com/docs/resources/cli-reference/
+    - name: Set up Python
+      uses: actions/setup-python@871daa956ca9ea99f3c3e30acb424b7960676734 # v5.0.0
+      with:
+        python-version: "3.x"
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java
+      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
+      with:
+        distribution: 'temurin'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && !endsWith(inputs.os, 'ppc64le') && !endsWith(inputs.os, 's390x') }}
+
+    - name: Set up Java ppc64le
+      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
+      with:
+        distribution: 'semeru'
+        architecture: 'ppc64le'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 'ppc64le') }}
+
+    - name: Set up Java s390x
+      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
+      with:
+        distribution: 'semeru'
+        architecture: 's390x'
+        java-version: '17'
+      if: >-
+        ${{ steps.enable-launchable.outputs.enable-launchable
+        && endsWith(inputs.os, 's390x') }}
+
+    - name: Set global vars
+      id: global
+      shell: bash
+      run: |
+        test_all_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-all' || contains(fromJSON(inputs.test-tasks), 'test-all') }}"
+        btest_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test' || contains(fromJSON(inputs.test-tasks), 'test') }}"
+        test_spec_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-spec' || contains(fromJSON(inputs.test-tasks), 'test-spec') }}"
+        echo test_all_enabled="${test_all_enabled}" >> $GITHUB_OUTPUT
+        echo btest_enabled="${btest_enabled}" >> $GITHUB_OUTPUT
+        echo test_spec_enabled="${test_spec_enabled}" >> $GITHUB_OUTPUT
+        echo test_all_report_file='launchable_test_all_report.json' >> $GITHUB_OUTPUT
+        echo btest_report_file='launchable_btest_report.json' >> $GITHUB_OUTPUT
+        echo test_spec_report_dir='launchable_test_spec_report' >> $GITHUB_OUTPUT
+        echo stdout_report_path="launchable_stdout.log" >> $GITHUB_OUTPUT
+        echo stderr_report_path="launchable_stderr.log" >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set environment variables for Launchable
+      shell: bash
+      run: |
+        : # GITHUB_PULL_REQUEST_URL are used for commenting test reports in Launchable Github App.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/link.py#L42
+        echo "GITHUB_PULL_REQUEST_URL=${{ github.event.pull_request.html_url }}" >> $GITHUB_ENV
+        : # The following envs are necessary in Launchable tokenless authentication.
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L20
+        echo "LAUNCHABLE_ORGANIZATION=${{ github.repository_owner }}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_WORKSPACE=${{ github.event.repository.name }}" >> $GITHUB_ENV
+        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L71
+        echo "GITHUB_PR_HEAD_SHA=${{ github.event.pull_request.head.sha || github.sha }}" >> $GITHUB_ENV
+        echo "LAUNCHABLE_TOKEN=${{ inputs.launchable-token }}" >> $GITHUB_ENV
+        : # To prevent a slowdown in CI, disable request retries when the Launchable server is unstable.
+        echo "LAUNCHABLE_SKIP_TIMEOUT_RETRY=1" >> $GITHUB_ENV
+        echo "LAUNCHABLE_COMMIT_TIMEOUT=1" >> $GITHUB_ENV
+      if: steps.enable-launchable.outputs.enable-launchable
+
+    - name: Set up path
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      # Since updated PATH variable will be available in only subsequent actions, we need to add the path beforehand.
+      # https://docs.github.com/en/actions/using-workflows/workflow-commands-for-github-actions#adding-a-system-path
+      run: echo "$(python -msite --user-base)/bin" >> $GITHUB_PATH
+      if: >-
+        ${{
+        steps.enable-launchable.outputs.enable-launchable
+        && (startsWith(inputs.os, 'macos')
+          || endsWith(inputs.os, 'ppc64le')
+          || endsWith(inputs.os, 's390x'))
+        }}
+
+    - name: Set up Launchable
+      id: setup-launchable
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        set -x
+        pip install --user launchable
+        : # The build name cannot include a slash, so we replace the string here.
+        github_ref="${{ github.ref }}"
+        github_ref="${github_ref//\//_}"
+        : # With the --name option, we need to configure a unique identifier for this build.
+        : # To avoid setting the same build name as the CI which runs on other branches, we use the branch name here.
+        build_name="${github_ref}_${GITHUB_PR_HEAD_SHA}"
+        test_opts="${{ inputs.test-opts }}"
+        test_opts="${test_opts// /}"
+        test_opts="${test_opts//=/:}"
+        test_all_test_suite='test-all'
+        btest_test_suite='btest'
+        test_spec_test_suite='test-spec'
+        if [ "${{ inputs.is-yjit }}" = "true" ]; then
+          test_all_test_suite="yjit-${test_all_test_suite}"
+          btest_test_suite="yjit-${btest_test_suite}"
+          test_spec_test_suite="yjit-${test_spec_test_suite}"
+        fi
+        # launchable_setup target var -- refers ${target} prefixed variables
+        launchable_setup() {
+          local target=$1 session
+          eval [ "\${${target}_enabled}" = "true" ] || return
+          eval local suite=\${${target}_test_suite}
+          session=$(launchable record session \
+            --build "${build_name}" \
+            --observation \
+            --flavor os="${{ inputs.os }}" \
+            --flavor test_task="${{ inputs.test-task }}" \
+            --flavor test_opts="${test_opts}" \
+            --flavor workflow="${{ github.workflow }}" \
+            --test-suite ${suite} \
+            )
+          echo "${target}_session=${session}" >> $GITHUB_OUTPUT
+        }
+
+        launchable record build --name "${build_name}"
+        if launchable_setup test_all; then
+          echo "TESTS=${TESTS:+$TESTS }--launchable-test-reports=${test_all_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup btest; then
+          echo "BTESTS=${BTESTS:+$BTESTS }--launchable-test-reports=${btest_report_file}" >> $GITHUB_ENV
+        fi
+        if launchable_setup test_spec; then
+          echo "SPECOPTS=${SPECOPTS:$SPECOPTS }--launchable-test-reports=${test_spec_report_dir}" >> $GITHUB_ENV
+          echo test_spec_enabled=true >> $GITHUB_OUTPUT
+        fi
+
+        echo launchable_setup_dir=$(pwd) >> $GITHUB_OUTPUT
+      if: steps.enable-launchable.outputs.enable-launchable
+      env:
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: make test-spec report directory in build directory
+      shell: bash
+      working-directory: ${{ inputs.builddir }}
+      run: mkdir "${test_spec_report_dir}"
+      if: ${{ steps.setup-launchable.outputs.test_spec_enabled == 'true' }}
+      env:
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Clean up test results in Launchable
+      uses: gacts/run-and-post-run@674528335da98a7afc80915ff2b4b860a0b3553a # v1.4.0
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          rm -f "${test_all_report_file}"
+          rm -f "${btest_report_file}"
+          rm -fr "${test_spec_report_dir}"
+          rm -f launchable_stdout.log
+          rm -f launchable_stderr.log
+      if: always() && steps.setup-launchable.outcome == 'success'
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+
+    - name: Record test results in Launchable
+      uses: gacts/run-and-post-run@674528335da98a7afc80915ff2b4b860a0b3553a # v1.4.0
+      with:
+        shell: bash
+        working-directory: ${{ inputs.builddir }}
+        post: |
+          if [[ "${test_all_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_all_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_all_session}" \
+              raw "${test_all_report_file}" || true; \
+          fi
+
+          if [[ "${btest_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${btest_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${btest_session}" \
+              raw "${btest_report_file}" || true; \
+          fi
+
+          if [[ "${test_spec_enabled}" = "true" ]]; then \
+            launchable record attachment \
+              --session "${test_spec_session}" \
+              "${stdout_report_path}" \
+              "${stderr_report_path}"; \
+            launchable record tests \
+              --session "${test_spec_session}" \
+              raw ${test_spec_report_dir}/* || true; \
+          fi
+      if: ${{ always() && steps.setup-launchable.outcome == 'success' }}
+      env:
+        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
+        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
+        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
+        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
+        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
+        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
+        test_all_session: ${{ steps.setup-launchable.outputs.test_all_session }}
+        btest_session: ${{ steps.setup-launchable.outputs.btest_session }}
+        test_spec_session: ${{ steps.setup-launchable.outputs.test_spec_session }}
+        stdout_report_path: ${{ steps.global.outputs.stdout_report_path }}
+        stderr_report_path: ${{ steps.global.outputs.stderr_report_path }}
+        LAUNCHABLE_SETUP_DIR: ${{ steps.setup-launchable.outputs.launchable_setup_dir }}
diff --git a/.github/actions/setup/directories/action.yml b/.github/actions/setup/directories/action.yml
new file mode 100644
index 0000000000..0e8ffd59ef
--- /dev/null
+++ b/.github/actions/setup/directories/action.yml
@@ -0,0 +1,194 @@
+name: Setup directories etc.
+description: >-
+  Set up the source code and build directories (plus some
+  environmental tweaks)
+
+inputs:
+  srcdir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Directory to (re-)checkout source codes.  This will be created
+      if absent.  If there is no `configure` file that is also
+      generated inside.
+
+  builddir:
+    required: false
+    default: ${{ github.workspace }}
+    description: >-
+      Where binaries and other generated contents go.  This will be
+      created if absent.
+
+  make-command:
+    required: false
+    type: string
+    default: 'make'
+    description: >-
+      The command of `make`.
+
+  makeup:
+    required: false
+    type: boolean
+    # Note that `default: false` evaluates to a string constant
+    # `'false'`, which is a truthy value :sigh:
+    # https://github.com/actions/runner/issues/2238
+    default: ''
+    description: >-
+      If set to true, additionally runs `make up`.
+
+  checkout:
+    required: false
+    type: boolean
+    default: true
+    description: >-
+      If set to '' (false), skip running actions/checkout. This is useful when
+      you don't want to overwrite a GitHub token that is already set up.
+
+  dummy-files:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, creates dummy files in build dir.
+
+  fetch-depth:
+    required: false
+    default: '1'
+    description: The depth of commit history fetched from the remote repository
+
+  clean:
+    required: false
+    type: boolean
+    default: ''
+    description: >-
+      If set to true, clean build directory.
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    # Note that `shell: bash` works on both Windows and Linux, but not
+    # `shell: sh`.  This is because GitHub hosted Windows runners have
+    # their bash manually installed.
+    - shell: bash
+      run: |
+        mkdir -p ${{ inputs.srcdir }}
+        mkdir -p ${{ inputs.builddir }}
+
+    # Did you know that actions/checkout works without git(1)?  We are
+    # checking that here.
+    - id: which
+      shell: bash
+      run: |
+        echo "git=`command -v git`" >> "$GITHUB_OUTPUT"
+        echo "sudo=`sudo true && command -v sudo`" >> "$GITHUB_OUTPUT"
+        echo "autoreconf=`command -v autoreconf`" >> "$GITHUB_OUTPUT"
+
+    - if: steps.which.outputs.git
+      shell: bash
+      run: |
+        git config --global core.autocrlf false
+        git config --global core.eol lf
+        git config --global advice.detachedHead 0
+        git config --global init.defaultBranch garbage
+
+    - if: inputs.checkout
+      uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+      with:
+        path: ${{ inputs.srcdir }}
+        fetch-depth: ${{ inputs.fetch-depth }}
+
+    - uses: actions/cache@8b402f58fbc84540c8b491a91e594a4576fec3d7 # v5.0.2
+      with:
+        path: ${{ inputs.srcdir }}/.downloaded-cache
+        key: ${{ runner.os }}-${{ runner.arch }}-downloaded-cache
+
+    - if: steps.which.outputs.autoreconf
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: ./autogen.sh --install
+
+    # This is for MinGW.
+    - if: runner.os == 'Windows'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV
+
+    - if: runner.os == 'Linux'
+      shell: bash
+      run: echo "GNUMAKEFLAGS=-sj$((1 + $(nproc)))" >> "$GITHUB_ENV"
+
+    # macOS' GNU make is so old that they doesn't understand `GNUMAKEFLAGS`.
+    - if: runner.os == 'macOS'
+      shell: bash
+      run: echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> "$GITHUB_ENV"
+
+    - if: inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        touch config.status .rbconfig.time
+        for mk in Makefile GNUmakefile; do
+          sed -f tool/prereq.status template/$mk.in > $mk
+        done
+        make up
+
+    # Cleanup, runs even on failure
+    - if: always() && inputs.makeup
+      shell: bash
+      working-directory: ${{ inputs.srcdir }}
+      run: |
+        rm -f config.status .rbconfig.time \
+          Makefile GNUmakefile uncommon.mk enc.mk noarch-fake.rb
+
+    - if: steps.which.outputs.sudo
+      shell: bash
+      run: |
+        sudo chmod -R go-w /usr/share
+        chmod -v go-w $HOME $HOME/.config || :
+        declare -a dirs # -A is not supported by old bash, e.g. macos
+        SAVE_IFS="$IFS" IFS=:; set $PATH
+        for d do
+          while [ -d "$d" ]; do
+            case "$IFS${dirs[*]}$IFS" in *"$IFS$d$IFS"*) ;; *) dirs+=("$d");; esac
+            d="${d%/*}"
+          done
+        done
+        IFS="$SAVE_IFS"
+        sudo chmod -v go-w "${dirs[@]}" || :
+
+    - if: inputs.dummy-files == 'true'
+      shell: bash
+      id: dummy-files
+      working-directory: ${{ inputs.builddir }}
+      run: |
+        : Create dummy files in build dir
+        set {{a..z},{A..Z},{0..9},foo,bar,test,zzz}.rb
+        for file; do \
+          echo > $file "raise 'do not load $file'"; \
+        done
+        # drop {a..z}.rb if case-insensitive filesystem
+        grep -F A.rb a.rb > /dev/null && set "${@:27}"
+        echo clean="cd ${{ inputs.builddir }} && rm $*" >> $GITHUB_OUTPUT
+
+    - if: inputs.clean == 'true'
+      shell: bash
+      id: clean
+      run: |
+        echo distclean='cd ${{ inputs.builddir }} && ${{ inputs.make-command }} distclean' >> $GITHUB_OUTPUT
+        echo remained-files='find ${{ inputs.builddir }} -ls' >> $GITHUB_OUTPUT
+        [ "${{ inputs.builddir }}" = "${{ inputs.srcdir }}" ] ||
+        echo final='rmdir ${{ inputs.builddir }}' >> $GITHUB_OUTPUT
+
+    - name: clean
+      uses: gacts/run-and-post-run@81b6ce503cde93862cec047c54652e45c5dca991 # v1.4.3
+      with:
+        working-directory:
+        post: |
+          ${{ steps.dummy-files.outputs.clean }}
+          ${{ steps.clean.outputs.distclean }}
+          ${{ steps.clean.outputs.remained-files }}
+          ${{ steps.clean.outputs.final }}
+      # rmdir randomly fails due to launchable files
+      continue-on-error: true
diff --git a/.github/actions/setup/macos/action.yml b/.github/actions/setup/macos/action.yml
new file mode 100644
index 0000000000..d0072ff828
--- /dev/null
+++ b/.github/actions/setup/macos/action.yml
@@ -0,0 +1,29 @@
+name: Setup macOS environment
+description: >-
+  Installs necessary packages via Homebrew.
+
+inputs: {} # nothing?
+
+outputs: {} # nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - name: brew
+      shell: bash
+      run: |
+        brew install --quiet jemalloc gmp libffi openssl@3 zlib autoconf automake libtool
+
+    - name: Set ENV
+      shell: bash
+      run: |
+        dir_config() {
+          local args=() lib var="$1"; shift
+          for lib in "$@"; do
+            args+=("--with-${lib%@*}-dir=$(brew --prefix $lib)")
+          done
+          echo "$var=${args[*]}" >> $GITHUB_ENV
+        }
+        dir_config ruby_configure_args gmp
+        dir_config CONFIGURE_ARGS openssl@3
diff --git a/.github/actions/setup/ubuntu/action.yml b/.github/actions/setup/ubuntu/action.yml
new file mode 100644
index 0000000000..a9e5b41951
--- /dev/null
+++ b/.github/actions/setup/ubuntu/action.yml
@@ -0,0 +1,53 @@
+name: Setup ubuntu environment
+description: >-
+  At the beginning there was no way but to copy & paste `apt-get`
+  everywhere.  But now that we have composite actions, it seems better
+  merge them into one.
+
+inputs:
+  arch:
+    required: false
+    default: ''
+    description: >-
+      Architecture.  Because we run this on a GitHub-hosted runner
+      acceptable value for this input is very limited.
+
+outputs:
+  arch:
+    value: ${{ steps.uname.outputs.uname }}
+    description: >-
+      Actual architecture.  This could be different from the one
+      passed to the `inputs.arch`.  For instance giving `i386` to this
+      action yields `i686`.
+
+runs:
+  using: composite
+
+  steps:
+    - name: set SETARCH
+      shell: bash
+      run: echo "SETARCH=${setarch}" >> "$GITHUB_ENV"
+      env:
+        setarch: ${{ inputs.arch && format('setarch {0} --', inputs.arch) }}
+
+    - id: uname
+      name: uname
+      shell: bash
+      run: |
+        echo uname=`${SETARCH} uname -m` >> "$GITHUB_OUTPUT"
+        echo dpkg=`${SETARCH} uname -m | sed s/686/386/` >> "$GITHUB_OUTPUT"
+
+    - name: apt-get
+      shell: bash
+      env:
+        arch: ${{ inputs.arch && format(':{0}', steps.uname.outputs.dpkg) || '' }}
+      run: |
+        set -x
+        ${arch:+sudo dpkg --add-architecture ${arch#:}}
+        sudo apt-get update -qq || :
+        sudo apt-get install --no-install-recommends -qq -y -o=Dpkg::Use-Pty=0 \
+        ${arch:+cross}build-essential${arch/:/-} \
+        libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
+        zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
+        autoconf ruby
+        sudo apt-get install -qq -y pkg-config${arch} || :
diff --git a/.github/actions/slack/action.yml b/.github/actions/slack/action.yml
new file mode 100644
index 0000000000..4a398da1d1
--- /dev/null
+++ b/.github/actions/slack/action.yml
@@ -0,0 +1,51 @@
+name: Post a message to slack
+description: >-
+  We have our ruby/action-slack webhook.  However its arguments are
+  bit verbose to be listed in every workflow files.  Better merge them
+  into one.
+
+inputs:
+  SLACK_WEBHOOK_URL:
+    required: true
+    description: >-
+      The URL to post the payload.  This is an input because it tends
+      to be stored in a secrets vault and a composite action cannot
+      look into one.
+
+  label:
+    required: false
+    description: >-
+      Human-readable description of the run, something like "DEBUG=1".
+      This need not be unique among runs.
+
+  event_name:
+    required: false
+    default: 'push'
+    description: >-
+      Target event to trigger notification. Notify only push by default.
+
+  extra_channel_id:
+    required: false
+    description: >-
+      Slack channel ID to notify besides #alerts and #alerts-emoji.
+
+outputs: {} # Nothing?
+
+runs:
+  using: composite
+
+  steps:
+    - uses: ruby/action-slack@54175162371f1f7c8eb94d7c8644ee2479fcd375 # v3.2.2
+      with:
+        payload: |
+          {
+            "ci": "GitHub Actions",
+            "env": "${{ github.workflow }}${{ inputs.label && format(' / {0}', inputs.label) }}",
+            "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
+            "commit": "${{ github.sha }}",
+            "branch": "${{ github.ref_name }}"
+            ${{ inputs.extra_channel_id && format(', "extra_channel_id": "{0}"', inputs.extra_channel_id) }}
+          }
+      env:
+        SLACK_WEBHOOK_URL: ${{ inputs.SLACK_WEBHOOK_URL }}
+      if: ${{ github.event_name == inputs.event_name && startsWith(github.repository, 'ruby/') }}
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
new file mode 100644
index 0000000000..38496d5ceb
--- /dev/null
+++ b/.github/auto_request_review.yml
@@ -0,0 +1,20 @@
+files:
+  'yjit*': [team:jit]
+  'yjit/**/*': [team:jit]
+  'yjit/src/cruby_bindings.inc.rs': []
+  'bootstraptest/test_yjit*': [team:jit]
+  'test/ruby/test_yjit*': [team:jit]
+  'zjit*': [team:jit]
+  'zjit/**/*': [team:jit]
+  'zjit/src/cruby_bindings.inc.rs': []
+  'test/ruby/test_zjit*': [team:jit]
+  'defs/jit.mk': [team:jit]
+  'tool/zjit_bisect.rb': [team:jit]
+  'doc/jit/*': [team:jit]
+  # Skip github workflow files because the team don't necessarily need to review dependabot updates for GitHub Actions. It's noisy in notifications, and they're auto-merged anyway.
+options:
+  ignore_draft: true
+  # This currently doesn't work as intended. We want to skip reviews when only
+  # cruby_bingings.inc.rs is modified, but this skips reviews even when other
+  # files are modified as well. To be enabled after fixing the behavior.
+  #last_files_match_only: true
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
new file mode 100644
index 0000000000..2c2982d1d4
--- /dev/null
+++ b/.github/dependabot.yml
@@ -0,0 +1,22 @@
+version: 2
+updates:
+  - package-ecosystem: 'github-actions'
+    directory: '/'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'github-actions'
+    directory: '/.github/actions/slack'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'github-actions'
+    directory: '/.github/actions/setup/directories'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'cargo'
+    directory: '/yjit'
+    schedule:
+      interval: 'daily'
+  - package-ecosystem: 'vcpkg'
+    directory: '/'
+    schedule:
+      interval: 'daily'
diff --git a/.github/labeler.yml b/.github/labeler.yml
new file mode 100644
index 0000000000..e81aed8e98
--- /dev/null
+++ b/.github/labeler.yml
@@ -0,0 +1,6 @@
+Documentation:
+- changed-files:
+  - all-globs-to-all-files: doc/**
+
+Backport:
+- base-branch: 'ruby_3_\d'
diff --git a/.github/workflows/annocheck.yml b/.github/workflows/annocheck.yml
new file mode 100644
index 0000000000..899d601aef
--- /dev/null
+++ b/.github/workflows/annocheck.yml
@@ -0,0 +1,110 @@
+name: Annocheck
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  compile:
+    name: test-annocheck
+
+    runs-on: ubuntu-latest
+
+    container:
+      image: ghcr.io/ruby/ruby-ci-image:gcc-11
+      options: --user root
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    env:
+      CONFIGURE_TTY: never
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci rgengc
+      RUBY_TESTOPTS: >-
+        -q
+        --color=always
+        --tty=no
+      # FIXME: Drop skipping options
+      # https://bugs.ruby-lang.org/issues/18061
+      # https://sourceware.org/annobin/annobin.html/Test-pie.html
+      TEST_ANNOCHECK_OPTS: '--skip-pie --skip-gaps'
+
+    steps:
+      - run: id
+        working-directory:
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      # Minimal flags to pass the check.
+      # -g0 disables backtraces when SEGV.  Do not set that.
+      - name: Run configure
+        run: >
+          ../src/configure -C
+          --enable-debug-env
+          --disable-install-doc
+          --with-ext=-test-/cxxanyargs,+
+          --without-valgrind
+          --without-jemalloc
+          --without-gmp
+          --with-gcc="gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes"
+          --enable-shared
+          debugflags=-ggdb3
+          optflags=-O2
+          LDFLAGS=-Wl,-z,now
+
+      - run: make showflags
+
+      - run: make
+
+      - run: make test-annocheck
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
new file mode 100644
index 0000000000..207315a084
--- /dev/null
+++ b/.github/workflows/auto_request_review.yml
@@ -0,0 +1,20 @@
+name: Auto Request Review
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+
+permissions:
+  contents: read
+
+jobs:
+  auto-request-review:
+    name: Auto Request Review
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
+    steps:
+      - name: Request review based on files changes and/or groups the author belongs to
+        uses: necojackarc/auto-request-review@e89da1a8cd7c8c16d9de9c6e763290b6b0e3d424 # v0.13.0
+        with:
+          # scope: public_repo
+          token: ${{ secrets.MATZBOT_AUTO_REQUEST_REVIEW_TOKEN }}
diff --git a/.github/workflows/auto_review_pr.yml b/.github/workflows/auto_review_pr.yml
new file mode 100644
index 0000000000..ad0e63ba12
--- /dev/null
+++ b/.github/workflows/auto_review_pr.yml
@@ -0,0 +1,33 @@
+name: Auto Review PR
+on:
+  pull_request_target:
+    types: [opened, ready_for_review, reopened]
+    branches: [master]
+
+permissions:
+  contents: read
+
+jobs:
+  auto-review-pr:
+    name: Auto Review PR
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
+
+    permissions:
+      pull-requests: write
+      contents: read
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@v6.0.1
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Auto Review PR
+        run: ruby tool/auto_review_pr.rb "$GITHUB_PR_NUMBER"
+        env:
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GITHUB_PR_NUMBER: ${{ github.event.pull_request.number }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
new file mode 100644
index 0000000000..d3e734f885
--- /dev/null
+++ b/.github/workflows/baseruby.yml
@@ -0,0 +1,74 @@
+name: BASERUBY Check
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  baseruby:
+    name: BASERUBY
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        ruby:
+          - ruby-3.1
+          - ruby-3.2
+          - ruby-3.3
+
+    steps:
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+
+      - run: ./configure --disable-install-doc
+
+      - run: make all
+
+      - run: make test
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
new file mode 100644
index 0000000000..59f64e8312
--- /dev/null
+++ b/.github/workflows/bundled_gems.yml
@@ -0,0 +1,190 @@
+name: bundled_gems
+
+env:
+  UPDATE_ENABLED: true
+
+on:
+  push:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  pull_request:
+    branches: ['master']
+    paths:
+      - '.github/workflows/bundled_gems.yml'
+      - 'gems/bundled_gems'
+  merge_group:
+  schedule:
+    - cron: '45 6 * * *'
+  workflow_dispatch:
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  update:
+    permissions:
+      contents: write # for Git to git push
+
+    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
+
+    name: update ${{ github.workflow }}
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Set ENV
+        run: |
+          echo "TODAY=$(date +%F)" >> $GITHUB_ENV
+
+      - name: Download previous gems list
+        run: |
+          mkdir -p .downloaded-cache
+          for data in bundled_gems.json default_gems.json; do
+            ln -s .downloaded-cache/$data .
+            curl -O -R -z ./$data https://stdgems.org/$data
+          done
+
+      - name: Update bundled gems list
+        id: bundled_gems
+        run: |
+          ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems >> $GITHUB_OUTPUT
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Update spec/bundler/support/builders.rb
+        run: |
+          #!ruby
+          rake_version = File.read("gems/bundled_gems")[/^rake\s+(\S+)/, 1]
+          print ARGF.read.sub(/^ *def rake_version\s*\K".*?"/) {rake_version.dump}
+        shell: ruby -i~ {0} spec/bundler/support/builders.rb
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb bundled
+        if: ${{ env.UPDATE_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          news= gems=
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- NEWS.md ||
+          news=true
+          git diff --color --no-ext-diff --ignore-submodules --exit-code -- gems/bundled_gems ||
+          gems=true
+          git add -- NEWS.md gems/bundled_gems
+          git add -- spec/bundler/support/builders.rb
+          echo news=$news >> $GITHUB_OUTPUT
+          echo gems=$gems >> $GITHUB_OUTPUT
+          echo update=${news:-$gems} >> $GITHUB_OUTPUT
+
+      - name: Commit
+        id: commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          message="Update bundled gems list"
+          if [ -z "${gems}" ]; then
+            git commit --message="[DOC] ${message} at ${GITHUB_SHA:0:30}"
+          else
+            git commit --message="${message} as of ${TODAY}"
+          fi
+        env:
+          TODAY: ${{ steps.bundled_gems.outputs.latest_date || env.TODAY }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          gems: ${{ steps.diff.outputs.gems }}
+        if: ${{ steps.diff.outputs.update }}
+
+      - name: Development revision of bundled gems
+        run: |
+          #!ruby
+          file = "gems/bundled_gems"
+
+          SECONDS_IN_DAY = 86400
+          today = Time.new("#{ENV['TODAY']}Z")
+          if !(december = today.month == 12)
+            days = 30
+          elsif (days = 26 - today.day).positive?
+            days += 4
+          else
+            puts "::info:: just after released"
+            exit
+          end
+
+          since = "#{today.year-1}-12-26"
+          ref = ENV['GITHUB_REF']
+          puts "::group::\e[94mfetching \e[1m#{file}\e[22m since \e[1m#{since}\e[22m from \e[1m#{ref}\e[m"
+          system(*%W[git fetch --shallow-since=#{since} --no-tags origin #{ref}], exception: true)
+          puts "::endgroup::"
+
+          puts "\e[94mchecking development version bundled gems older than \e[1m#{days}\e[22m days\e[m"
+          limit = today.to_i - days * SECONDS_IN_DAY
+          old = 0
+          IO.popen(%W"git blame --line-porcelain -- #{file}") do |blame|
+            while head = blame.gets("\n\t") and s = blame.gets
+              next unless (gem = s.split(/\s+|#.*/)).size > 3
+              time = head[/^committer-time \K\d+/].to_i
+              next if (d = limit - time) <= 0
+              d /= SECONDS_IN_DAY
+              line = head[/\A\h+ \d+ \K\d+/].to_i
+              level = if d < days; 'warning'; else old += 1; 'error'; end
+              d += days
+              puts "::#{level} file=#{file},line=#{line},title=Older than #{d} days::#{gem[0]} #{gem[3]}"
+            end
+          end
+          abort "::error title=Too long-standing gems::The release comes soon." if december and old.nonzero?
+        shell: ruby {0}
+        env:
+          file: ${{ steps.logs.outputs.file }}
+          days: ${{ steps.logs.outputs.days }}
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Build
+        run: |
+          ./autogen.sh
+          ./configure -C --disable-install-doc
+          make
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Prepare bundled gems
+        run: |
+          make -s prepare-gems
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Test bundled gems
+        run: |
+          make -s test-bundled-gems
+        timeout-minutes: 30
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+        if: ${{ steps.diff.outputs.gems }}
+
+      - name: Push
+        run: |
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.commit.outcome == 'success'
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
new file mode 100644
index 0000000000..c5dec65e48
--- /dev/null
+++ b/.github/workflows/check_dependencies.yml
@@ -0,0 +1,59 @@
+name: Check Dependencies
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update-deps:
+    name: Dependency checks
+
+    strategy:
+      matrix:
+        os: [ubuntu-latest]
+      fail-fast: true
+
+    runs-on: ${{ matrix.os }}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - uses: ./.github/actions/setup/directories
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - name: Run configure
+        run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+
+      - run: make fix-depends
+
+      - run: git diff --no-ext-diff --ignore-submodules --exit-code
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / Dependencies need to update
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/check_misc.yml b/.github/workflows/check_misc.yml
new file mode 100644
index 0000000000..2a2bd1df53
--- /dev/null
+++ b/.github/workflows/check_misc.yml
@@ -0,0 +1,127 @@
+name: Misc
+on: [push, pull_request, merge_group]
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  checks:
+    name: Miscellaneous checks
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+
+      - name: Check for code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA"
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.pull_request.base.sha }}
+          GITHUB_NEW_SHA: ${{ github.event.pull_request.merge_commit_sha }}
+        # Skip 'push' events because post_push.yml fixes them on push
+        if: ${{ github.repository == 'ruby/ruby' && startsWith(github.event_name, 'pull') }}
+
+      - name: Check for bash specific substitution in configure.ac
+        run: |
+          git grep -n '\${[A-Za-z_0-9]*/' -- configure.ac && exit 1 || :
+
+      - name: Check for header macros
+        run: |
+          fail=
+          for header in ruby/*.h; do
+            git grep -l -F -e $header -e HAVE_`echo $header | tr a-z./ A-Z__` -- . > /dev/null && continue
+            fail=1
+            echo $header
+          done
+          exit $fail
+        working-directory: include
+
+      - id: now
+        run: |
+          date +"mon=%-m"%n"day=%-d" >> $GITHUB_OUTPUT
+        env:
+          TZ: Tokyo/Asia
+
+      - id: deprecation
+        run: |
+          eval $(sed -n 's/^#define RUBY_API_VERSION_\(MAJOR\|MINOR\) /\1=/p' include/ruby/version.h)
+          if git --no-pager grep --color -o 'rb_warn_deprecated_to_remove_at('$MAJOR'\.'$MINOR',.*' -- '*.c' >&2; then
+              false
+          else
+              true
+          fi
+        continue-on-error: ${{ steps.now.outputs.mon < 12 }}
+
+      - name: Check if to generate documents
+        id: rdoc
+        run: |
+          set -- $(sed 's/#.*//;/^rdoc /!d' gems/bundled_gems)
+          { echo version=$2; echo ref=$4; } >> $GITHUB_OUTPUT
+          echo RDOC='ruby -W0 --disable-gems tool/rdoc-srcdir -q' >> $GITHUB_ENV
+
+      - name: Checkout rdoc
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/rdoc
+          ref: ${{ steps.rdoc.outputs.ref }}
+          path: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Generate rdoc
+        run: |
+          set -x
+          gempath=$(ruby -e 'print Gem.user_dir, "/bin"')
+          PATH=$gempath:$PATH
+          gem install --user bundler
+          bundle config --local path vendor/bundle
+          bundle install --jobs 4
+          bundle exec rake generate
+        working-directory: .bundle/gems/rdoc-${{ steps.rdoc.outputs.version }}
+        if: ${{ steps.rdoc.outputs.ref != '' }}
+
+      - name: Core docs coverage
+        run: |
+          $RDOC -C -x ^ext -x ^lib .
+
+      - name: Generate docs
+        id: docs
+        run: |
+          $RDOC --op html .
+          echo htmlout=ruby-html-${GITHUB_SHA:0:10} >> $GITHUB_OUTPUT
+        # Generate only when document commit/PR
+        if: >-
+          ${{false
+          || contains(github.event.head_commit.message, '[ruby/rdoc]')
+          || contains(github.event.head_commit.message, '[DOC]')
+          || contains(github.event.pull_request.title, '[DOC]')
+          || contains(github.event.pull_request.labels.*.name, 'Documentation')
+          }}
+
+      - name: Upload docs
+        uses: actions/upload-artifact@v6.0.0
+        with:
+          path: html
+          name: ${{ steps.docs.outputs.htmlout }}
+        if: ${{ steps.docs.outcome == 'success' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
new file mode 100644
index 0000000000..a92c93b476
--- /dev/null
+++ b/.github/workflows/codeql-analysis.yml
@@ -0,0 +1,121 @@
+name: 'CodeQL'
+
+on:
+  push:
+    branches: ['master']
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  schedule:
+    - cron: '0 12 * * *'
+  workflow_dispatch:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  analyze:
+    name: Analyze
+    runs-on: ubuntu-latest
+    permissions:
+      actions: read # for github/codeql-action/init to get workflow details
+      contents: read # for actions/checkout to fetch code
+      security-events: write # for github/codeql-action/autobuild to send a status report
+    # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    env:
+      enable_install_doc: no
+
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - language: cpp
+          - language: ruby
+
+    steps:
+      - name: Checkout repository
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - name: Install libraries
+        if: ${{ contains(matrix.os, 'macos') }}
+        uses: ./.github/actions/setup/macos
+
+      - name: Install libraries
+        if : ${{ matrix.os == 'ubuntu-latest' }}
+        uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+
+      - name: Remove an obsolete rubygems vendored file
+        if: ${{ matrix.os == 'ubuntu-latest' }}
+        run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
+
+      - name: Initialize CodeQL
+        uses: github/codeql-action/init@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+        with:
+          languages: ${{ matrix.language }}
+          trap-caching: false
+          debug: true
+
+      - name: Autobuild
+        uses: github/codeql-action/autobuild@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+
+      - name: Perform CodeQL Analysis
+        uses: github/codeql-action/analyze@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+        with:
+          category: '/language:${{ matrix.language }}'
+          upload: False
+          output: sarif-results
+
+      - name: filter-sarif
+        uses: advanced-security/filter-sarif@f3b8118a9349d88f7b1c0c488476411145b6270d # v1.0.1
+        with:
+          patterns: |
+            +**/*.rb
+            -lib/uri/mailto.rb:rb/overly-large-range
+            -lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/mailto.rb:rb/overly-large-range
+            -lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb:rb/overly-large-range
+            -test/ruby/test_io.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_open-uri.rb:rb/non-constant-kernel-open
+            -test/open-uri/test_ssl.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/binread_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/readlines_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/foreach_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/write_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/io/read_spec.rb:rb/non-constant-kernel-open
+            -spec/ruby/core/kernel/open_spec.rb:rb/non-constant-kernel-open
+          input: sarif-results/${{ matrix.language }}.sarif
+          output: sarif-results/${{ matrix.language }}.sarif
+        if: ${{ matrix.language == 'ruby' }}
+        continue-on-error: true
+
+      - name: Upload SARIF
+        uses: github/codeql-action/upload-sarif@e296a935590eb16afc0c0108289f68c87e2a89a5 # v4.30.7
+        with:
+          sarif_file: sarif-results/${{ matrix.language }}.sarif
+        continue-on-error: true
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
new file mode 100644
index 0000000000..8c0ca54e0b
--- /dev/null
+++ b/.github/workflows/compilers.yml
@@ -0,0 +1,335 @@
+# Some tests depending on this name 'Compilations' via $GITHUB_WORKFLOW. Make sure to update such tests when renaming this workflow.
+name: Compilations
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Each job is split so that they roughly take 30min to run through.
+jobs:
+  compile-if:
+    name: 'omnibus compilations, trigger'
+    runs-on: ubuntu-latest
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+    steps:
+      - run: true
+        working-directory:
+
+  compile1:
+    name: 'omnibus compilations, #1'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      # Set fetch-depth: 10 so that Launchable can receive commits information.
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'clang 18 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: clang-18
+          with_gcc: 'clang-18 -flto=auto'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 30
+      - { uses: './.github/actions/compilers', name: '-O0', with: { optflags: '-O0 -march=x86-64 -mtune=generic' }, timeout-minutes: 5 }
+      # - { uses: './.github/actions/compilers', name: '-O3', with: { optflags: '-O3 -march=x86-64 -mtune=generic', check: true } }
+
+  compile2:
+    name: 'omnibus compilations, #2'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - name: 'GCC 15 LTO'
+        uses: './.github/actions/compilers'
+        with:
+          tag: gcc-15
+          with_gcc: 'gcc-15 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
+          optflags: '-O2'
+          enable_shared: false
+        timeout-minutes: 10
+      - { uses: './.github/actions/compilers', name: 'ext/Setup', with: { static_exts: 'etc json/* */escape' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 15', with: { tag: 'gcc-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 14', with: { tag: 'gcc-14' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 13', with: { tag: 'gcc-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 12', with: { tag: 'gcc-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 11', with: { tag: 'gcc-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 10', with: { tag: 'gcc-10' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 9',  with: { tag: 'gcc-9'  }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 8',  with: { tag: 'gcc-8'  }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GCC 7',  with: { tag: 'gcc-7'  }, timeout-minutes: 5 }
+
+  compile3:
+    name: 'omnibus compilations, #3'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 22', with: { tag: 'clang-22' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 21', with: { tag: 'clang-21' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 20', with: { tag: 'clang-20' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 19', with: { tag: 'clang-19' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 18', with: { tag: 'clang-18' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 17', with: { tag: 'clang-17' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 16', with: { tag: 'clang-16' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 15', with: { tag: 'clang-15' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 14', with: { tag: 'clang-14' }, timeout-minutes: 5 }
+
+  compile4:
+    name: 'omnibus compilations, #4'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'clang 13', with: { tag: 'clang-13' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 12', with: { tag: 'clang-12' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 11', with: { tag: 'clang-11' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 10', with: { tag: 'clang-10' }, timeout-minutes: 5 }
+        # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o and fail `make test-leaked-globals`.
+      - { uses: './.github/actions/compilers', name: 'clang 9',  with: { tag: 'clang-9',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 8',  with: { tag: 'clang-8',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 7',  with: { tag: 'clang-7',   append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'clang 6',  with: { tag: 'clang-6.0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compile5:
+    name: 'omnibus compilations, #5'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      # -Wno-strict-prototypes is necessary with current clang-15 since
+      # older autoconf generate functions without prototype and -pedantic
+      # now implies strict-prototypes. Disabling the error but leaving the
+      # warning generates a lot of noise from use of ANYARGS in
+      # rb_define_method() and friends.
+      # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
+      - { uses: './.github/actions/compilers', name: 'C99',      with: { CFLAGS: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C11',   with: { CFLAGS:   '-std=c11   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C17',   with: { CFLAGS:   '-std=c17   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C23',   with: { CFLAGS:   '-std=c2x   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++98', with: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++11', with: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++14', with: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++17', with: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+
+  compile6:
+    name: 'omnibus compilations, #6'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'C++20', with: { CXXFLAGS: '-std=c++20 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++23', with: { CXXFLAGS: '-std=c++23 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'C++26', with: { CXXFLAGS: '-std=c++26 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'gmp',                 with: { append_configure: '--with-gmp', test_all: 'ruby/test_bignum.rb', test_spec: "/github/workspace/src/spec/ruby/core/integer" }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'jemalloc',            with: { append_configure: '--with-jemalloc' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'valgrind',            with: { append_configure: '--with-valgrind' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=ucontext',  with: { append_configure: '--with-coroutine=ucontext' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'coroutine=pthread',   with: { append_configure: '--with-coroutine=pthread' }, timeout-minutes: 5 }
+
+  compile7:
+    name: 'omnibus compilations, #7'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'disable-jit',         with: { append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-yjit',        with: { append_configure: '--disable-yjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-zjit',        with: { append_configure: '--disable-zjit' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-dln',         with: { append_configure: '--disable-dln' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'enable-mkmf-verbose', with: { append_configure: '--enable-mkmf-verbose' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'disable-rubygems',    with: { append_configure: '--disable-rubygems' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEVEL',          with: { append_configure: '--enable-devel' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=0',            with: { cppflags: '-DOPT_THREADED_CODE=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=1',            with: { cppflags: '-DOPT_THREADED_CODE=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=2',            with: { cppflags: '-DOPT_THREADED_CODE=2' }, timeout-minutes: 5 }
+
+  compile8:
+    name: 'omnibus compilations, #8'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'NDEBUG',                         with: { cppflags: '-DNDEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RUBY_DEBUG',                     with: { cppflags: '-DRUBY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ARRAY_DEBUG',                    with: { cppflags: '-DARRAY_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'BIGNUM_DEBUG',                   with: { cppflags: '-DBIGNUM_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CCAN_LIST_DEBUG',                with: { cppflags: '-DCCAN_LIST_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'CPDEBUG=-1',                     with: { cppflags: '-DCPDEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ENC_DEBUG',                      with: { cppflags: '-DENC_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG',                       with: { cppflags: '-DGC_DEBUG' }, timeout-minutes: 5 }
+
+  compile9:
+    name: 'omnibus compilations, #9'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'HASH_DEBUG',                     with: { cppflags: '-DHASH_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'ID_TABLE_DEBUG',                 with: { cppflags: '-DID_TABLE_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_DEBUG=-1',                with: { cppflags: '-DRGENGC_DEBUG=-1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SYMBOL_DEBUG',                   with: { cppflags: '-DSYMBOL_DEBUG' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_CHECK_MODE',              with: { cppflags: '-DRGENGC_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_CHECK_MODE',                  with: { cppflags: '-DVM_CHECK_MODE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_EMBED_CI=0',                 with: { cppflags: '-DUSE_EMBED_CI=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_FLONUM=0',                   with: { cppflags: '-DUSE_FLONUM=0', append_configure: '--disable-yjit --disable-zjit' }, timeout-minutes: 5 }
+
+  compileX:
+    name: 'omnibus compilations, #10'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'USE_LAZY_LOAD',                  with: { cppflags: '-DUSE_LAZY_LOAD' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_SYMBOL_GC=0',                with: { cppflags: '-DUSE_SYMBOL_GC=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_THREAD_CACHE=0',             with: { cppflags: '-DUSE_THREAD_CACHE=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_RUBY_DEBUG_LOG=1',           with: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'USE_DEBUG_COUNTER',              with: { cppflags: '-DUSE_DEBUG_COUNTER=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'SHARABLE_MIDDLE_SUBSTRING',      with: { cppflags: '-DSHARABLE_MIDDLE_SUBSTRING=1' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_FIND_TIME_NUMGUESS',       with: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'DEBUG_INTEGER_PACK',             with: { cppflags: '-DDEBUG_INTEGER_PACK' }, timeout-minutes: 5 }
+
+  compileB:
+    name: 'omnibus compilations, #11'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'GC_DEBUG_STRESS_TO_CLASS',       with: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_ENABLE_LAZY_SWEEP=0',         with: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_DETAIL_MEMORY',       with: { cppflags: '-DGC_PROFILE_DETAIL_MEMORY' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_MORE_DETAIL',         with: { cppflags: '-DGC_PROFILE_MORE_DETAIL' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'MALLOC_ALLOCATED_SIZE_CHECK',    with: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_ESTIMATE_OLDMALLOC',      with: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'RGENGC_PROFILE',                 with: { cppflags: '-DRGENGC_PROFILE' }, timeout-minutes: 5 }
+
+  compileC:
+    name: 'omnibus compilations, #12'
+    runs-on: ubuntu-latest
+    needs: compile-if
+    if: ${{ needs.compile-if.result == 'success' }}
+    timeout-minutes: 60
+    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_BP_CHECK',              with: { cppflags: '-DVM_DEBUG_BP_CHECK' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_VERIFY_METHOD_CACHE',   with: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'YJIT_FORCE_ENABLE',              with: { cppflags: '-DYJIT_FORCE_ENABLE' }, timeout-minutes: 5 }
+      - { uses: './.github/actions/compilers', name: 'UNIVERSAL_PARSER',               with: { cppflags: '-DUNIVERSAL_PARSER' }, timeout-minutes: 5 }
+
+  compilemax:
+    name: 'omnibus compilations, result'
+    runs-on: ubuntu-latest
+    if: ${{ always() }}
+    needs:
+      - 'compile1'
+      - 'compile2'
+      - 'compile3'
+      - 'compile4'
+      - 'compile5'
+      - 'compile6'
+      - 'compile7'
+      - 'compile8'
+      - 'compile9'
+      - 'compileX'
+      - 'compileB'
+      - 'compileC'
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
+      - uses: ./.github/actions/slack
+        with:
+          label: 'omnibus'
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+      - run: false
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/cygwin.yml b/.github/workflows/cygwin.yml
new file mode 100644
index 0000000000..ac73991fe8
--- /dev/null
+++ b/.github/workflows/cygwin.yml
@@ -0,0 +1,71 @@
+name: Cygwin
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    runs-on: windows-2022
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - run: git config --global core.autocrlf input
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - name: Setup Cygwin
+        uses: cygwin/cygwin-install-action@master
+        with:
+          packages: ruby gcc-core make autoconf libtool libssl-devel libyaml-devel libffi-devel zlib-devel rubygems
+
+      - name: configure
+        run: |
+          ./autogen.sh
+          ./configure --disable-install-doc
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: Extract bundled gems
+        run: |
+          make ruby -j5
+          make extract-gems
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4 V=1
+        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Cygwin
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/default_gems_list.yml b/.github/workflows/default_gems_list.yml
new file mode 100644
index 0000000000..1c7e2195c8
--- /dev/null
+++ b/.github/workflows/default_gems_list.yml
@@ -0,0 +1,99 @@
+name: Update default gems list
+on: [push, pull_request, merge_group]
+
+env:
+  UPDATE_NEWS_ENABLED: true
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  update_default_gems_list:
+    name: Update default gems list
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - id: gems
+        run: true
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          makeup: true
+          # Skip overwriting MATZBOT_AUTO_UPDATE_TOKEN
+          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Download previous gems list
+        run: |
+          data=default_gems.json
+          mkdir -p .downloaded-cache
+          ln -s .downloaded-cache/$data .
+          curl -O -R -z ./$data https://stdgems.org/$data
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Make default gems list
+        run: |
+          #!ruby
+          require 'rubygems'
+          $:.unshift "lib"
+          rgver = File.foreach("lib/rubygems.rb") do |line|
+            break $1 if /^\s*VERSION\s*=\s*"([^"]+)"/ =~ line
+          end
+          gems = Dir.glob("{ext,lib}/**/*.gemspec").map do |f|
+            spec = Gem::Specification.load(f)
+            "#{spec.name} #{spec.version}"
+          end.sort
+          File.open("gems/default_gems", "w") do |f|
+            f.puts "RubyGems #{rgver}"
+            f.puts gems
+          end
+        shell: ruby --disable=gems {0}
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Maintain updated gems list in NEWS
+        run: |
+          ruby tool/update-NEWS-gemlist.rb default
+        if: ${{ steps.gems.outcome == 'success' && env.UPDATE_NEWS_ENABLED == 'true' }}
+
+      - name: Check diffs
+        id: diff
+        run: |
+          git diff --color --no-ext-diff --ignore-submodules --exit-code NEWS.md ||
+          echo update=true >> $GITHUB_OUTPUT
+        if: ${{ steps.gems.outcome == 'success' }}
+
+      - name: Commit
+        run: |
+          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
+          git commit --message="Update default gems list at ${GITHUB_SHA:0:30} [ci skip]" NEWS.md
+          git push origin ${GITHUB_REF#refs/heads/}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+        if: >-
+          ${{
+          github.repository == 'ruby/ruby' &&
+          !startsWith(github.event_name, 'pull') &&
+          steps.diff.outputs.update
+          }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/dependabot_automerge.yml b/.github/workflows/dependabot_automerge.yml
new file mode 100644
index 0000000000..a95c7005c4
--- /dev/null
+++ b/.github/workflows/dependabot_automerge.yml
@@ -0,0 +1,32 @@
+# from https://github.com/gofiber/swagger/blob/main/.github/workflows/dependabot_automerge.yml
+name: Dependabot auto-merge
+on:
+  pull_request:
+
+permissions:
+  contents: write
+  pull-requests: write
+
+jobs:
+  automerge:
+    runs-on: ubuntu-latest
+    if: github.event.pull_request.user.login == 'dependabot[bot]' && github.repository == 'ruby/ruby'
+    steps:
+      - name: Dependabot metadata
+        uses: dependabot/fetch-metadata@21025c705c08248db411dc16f3619e6b5f9ea21a # v2.5.0
+        id: metadata
+
+      - name: Wait for status checks
+        uses: lewagon/wait-on-check-action@3603e826ee561ea102b58accb5ea55a1a7482343 # v1.4.1
+        with:
+          repo-token: ${{ secrets.GITHUB_TOKEN }}
+          ref: ${{ github.event.pull_request.head.sha || github.sha }}
+          check-regexp: 'make \(check, .*\)'
+          wait-interval: 30
+
+      - name: Auto-merge for Dependabot PRs
+        if: ${{ steps.metadata.outputs.update-type == 'version-update:semver-minor' || steps.metadata.outputs.update-type == 'version-update:semver-patch' }}
+        run: gh pr merge --auto --rebase "$PR_URL"
+        env:
+          PR_URL: ${{ github.event.pull_request.html_url }}
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_DEPENDABOT_MERGE_TOKEN }}
diff --git a/.github/workflows/labeler.yml b/.github/workflows/labeler.yml
new file mode 100644
index 0000000000..16dbac1afa
--- /dev/null
+++ b/.github/workflows/labeler.yml
@@ -0,0 +1,12 @@
+name: "Pull Request Labeler"
+on:
+- pull_request_target
+
+jobs:
+  labeler:
+    permissions:
+      contents: read
+      pull-requests: write
+    runs-on: ubuntu-latest
+    steps:
+    - uses: actions/labeler@v6
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..29adcab39a
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,202 @@
+name: macOS
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: macos-14
+          - test_task: check
+            os: macos-14
+            configure_args: '--with-gcc=gcc-14'
+          - test_task: check
+            os: macos-14
+            configure_args: '--with-jemalloc --with-opt-dir=$(brew --prefix jemalloc)'
+          - test_task: check
+            os: macos-14
+            configure_args: '--with-gmp'
+          - test_task: test-all
+            test_opts: --repeat-count=2
+            os: macos-14
+          - test_task: test-bundler-parallel
+            os: macos-14
+          - test_task: test-bundled-gems
+            os: macos-14
+          - test_task: check
+            os: macos-15
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 0 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${ruby_configure_args} ${{ matrix.configure_args }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - run: make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os }}
+          test-opts: ${{ matrix.test_opts }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: Set extra test options
+        run: |
+          echo "TESTS=$TESTS ${{ matrix.test_opts }}" >> $GITHUB_ENV
+          echo "RUBY_TEST_TIMEOUT_SCALE=10" >> $GITHUB_ENV # With --repeat-count=2, flaky test by timeout occurs frequently for some reason
+        if: matrix.test_opts
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          ulimit -c unlimited
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.os }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+      - name: Resolve job ID
+        id: job_id
+        uses: actions/github-script@main
+        env:
+          matrix: ${{ toJson(matrix) }}
+        with:
+          script: |
+            const { data: workflow_run } = await github.rest.actions.listJobsForWorkflowRun({
+              owner: context.repo.owner,
+              repo: context.repo.repo,
+              run_id: context.runId
+            });
+            const matrix = JSON.parse(process.env.matrix);
+            const job_name = `${context.job}${matrix ? ` (${Object.values(matrix).join(", ")})` : ""}`;
+            return workflow_run.jobs.find((job) => job.name === job_name).id;
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: macos-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
new file mode 100644
index 0000000000..5c639ad48b
--- /dev/null
+++ b/.github/workflows/mingw.yml
@@ -0,0 +1,243 @@
+name: MinGW
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+# Notes:
+# Actions console encoding causes issues, see test-all & test-spec steps
+#
+jobs:
+  make:
+    runs-on: windows-${{ matrix.os }}
+
+    name: ${{ github.workflow }} (${{ matrix.msystem }})
+
+    env:
+      MSYSTEM: ${{ matrix.msystem }}
+      MSYS2_ARCH: >-
+        ${{
+        contains(matrix.msystem, 'arm64') && 'aarch64' ||
+        contains(matrix.msystem, '64') && 'x86_64' || 'i686'
+        }}
+      MINGW_PACKAGE_PREFIX: >-
+        mingw-w${{
+        endsWith(matrix.msystem, '64') && '64' || '32'
+        }}-${{
+        startsWith(matrix.msystem, 'clang') && 'clang' ||
+        startsWith(matrix.msystem, 'ucrt') && 'ucrt' ||
+        'mingw'
+        }}-${{
+        contains(matrix.msystem, 'arm64') && 'aarch64' ||
+        endsWith(matrix.msystem, '64') && 'x86_64' || 'i686'
+        }}
+      CFLAGS: '-mtune=generic -O3 -pipe'
+      CXXFLAGS: '-mtune=generic -O3 -pipe'
+      CPPFLAGS: '-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048'
+      LDFLAGS: '-pipe'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    strategy:
+      matrix:
+        include:
+          # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
+          # Ruby 3.2 is the first Windows Ruby to use OpenSSL 3.x
+          - msystem: 'UCRT64'
+            os: 2022
+            test_task: 'check'
+            test-all-opts: '--name=!/TestObjSpace#test_reachable_objects_during_iteration/'
+          - msystem: 'CLANGARM64'
+            os: 11-arm
+            test_task: 'check'
+      fail-fast: false
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: msys2/setup-msys2@4f806de0a5a7294ffabaff804b38a9b435a73bda # v2.30.0
+        id: msys2
+        with:
+          msystem: ${{ matrix.msystem }}
+          update: true
+          install: >-
+            git
+            make
+            ruby
+            autoconf
+            ${{ env.MINGW_PACKAGE_PREFIX }}-gcc
+            ${{ env.MINGW_PACKAGE_PREFIX }}-ragel
+            ${{ env.MINGW_PACKAGE_PREFIX }}-openssl
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libyaml
+            ${{ env.MINGW_PACKAGE_PREFIX }}-libffi
+
+      - name: Set up env
+        id: setup-env
+        working-directory:
+        run: |
+          $msys2 = ${env:MSYS2_LOCATION}
+          $msystem = ${env:MSYSTEM}.ToLower()
+          echo $msys2\usr\bin $msys2\$msystem\bin |
+            Tee-Object ${env:GITHUB_PATH} -Append -Encoding utf-8
+
+          # Use the fast device for the temporary directory.
+          # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+          # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+          $tmp = ${env:RUNNER_TEMP}
+          echo HOME=$home TMP=$tmp TEMP=$tmp TMPDIR=$tmp |
+            Tee-Object ${env:GITHUB_ENV} -Append -Encoding utf-8
+        shell: pwsh             # cmd.exe does not strip spaces before `|`.
+        env:
+          MSYS2_LOCATION: ${{ steps.msys2.outputs.msys2-location }}
+          MSYSTEM: ${{ matrix.msystem }}
+
+      - name: Remove Strawberry Perl pkg-config
+        working-directory:
+        # `pkg-config.bat` included in Strawberry Perl is written in
+        # Perl and doesn't work when another msys2 `perl` precede its
+        # own `perl`.
+        #
+        # ```
+        # Can't find C:\Strawberry\perl\bin\pkg-config.bat on PATH, '.' not in PATH.
+        # ```
+        run: |
+          Get-Command pkg-config.bat | % { ren $_.path ($_.path + "~") }
+        shell: pwsh
+
+      - name: Misc system & package info
+        working-directory:
+        run: |
+          group() { echo ::group::$'\e[94;1m'"$*"$'\e[m'; }
+          endgroup() { echo ::endgroup::; }
+
+          group Path
+          cygpath -wa / . $(type -p cygpath bash sh)
+          endgroup
+
+          I() {
+              group $1
+              run Where type -pa $1 && { [ $# -eq 1 ] || run Version "$@"; } ||
+                  failed+=($1)
+              endgroup
+          }
+          run() { local w m=$1; shift; w="$("$@")" && show "$m" && indent "$w"; }
+          indent() { [ -z "$1" ] || echo "$1" | /bin/sed '/^$/!s/^/  /'; }
+          show() { echo $'\e[96m'"$*"$'\e[m'; }
+
+          failed=()
+
+          I gcc.exe --version
+          I ragel.exe --version
+          I make.exe --version
+          I openssl.exe version
+          I libcrypto-3-x64.dll
+          I libssl-3-x64.dll
+
+          group Packages
+          pacman -Qs $MINGW_PACKAGE_PREFIX-* | /bin/sed -n "s,local/$MINGW_PACKAGE_PREFIX-,,p"
+          endgroup
+
+          [ ${#failed[@]} -eq 0 ]
+        shell: sh
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: configure
+        run: >
+          ../src/configure --disable-install-doc --prefix=/.
+          --build=$CHOST --host=$CHOST --target=$CHOST
+        shell: sh
+        env:
+          CHOST: ${{ env.MSYS2_ARCH }}-w64-mingw32
+
+      - name: make all
+        timeout-minutes: 30
+        run: make -j4
+
+      - name: make install
+        run: make DESTDIR=../install install-nodoc
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-2022
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-tasks: '["test", "test-all", "test-spec"]'
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: test
+        timeout-minutes: 30
+        run: make test test-tool
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test' }}
+
+      - name: test-all
+        timeout-minutes: 45
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
+        env:
+          RUBY_TESTOPTS: >-
+            --retry --job-status=normal --show-skip --timeout-scale=1.5 -j4
+            ${{ matrix.test-all-opts }}
+            ${{ env.TESTS }}
+          BUNDLER_VERSION:
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/') }}
+
+      - name: test-spec
+        timeout-minutes: 10
+        run: |
+          make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
+        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/') }}
+
+      - uses: ./src/.github/actions/slack
+        with:
+          label: ${{ matrix.msystem }} / ${{ matrix.test_task }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/modgc.yml b/.github/workflows/modgc.yml
new file mode 100644
index 0000000000..1d14934df8
--- /dev/null
+++ b/.github/workflows/modgc.yml
@@ -0,0 +1,176 @@
+name: ModGC
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  check:
+    strategy:
+      matrix:
+        gc:
+          - name: default
+          - name: mmtk
+            mmtk_build: release
+        os: [macos-latest, ubuntu-latest]
+        include:
+          - test_task: check
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries (macOS)
+        uses: ./.github/actions/setup/macos
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Install libraries (Ubuntu)
+        uses: ./.github/actions/setup/ubuntu
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: ${{ contains(matrix.os, 'ubuntu') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: false
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: make sure that kern.coredump=1
+        run: |
+          sysctl -n kern.coredump
+          sudo sysctl -w kern.coredump=1
+          sudo chmod -R +rwx /cores/
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Delete unused SDKs
+        # To free up disk space to not run out during the run
+        run: |
+          sudo rm -rf ~/.dotnet
+          sudo rm -rf /Library/Android
+          sudo rm -rf /Library/Developer/CoreSimulator
+        continue-on-error: true
+        if: ${{ contains(matrix.os, 'macos') }}
+
+      - name: Setup Ruby GC Directory
+        run: |
+          echo "MODULAR_GC_DIR=$HOME/ruby_gc" >> $GITHUB_ENV
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+        run: >-
+          $SETARCH ../src/configure -C --disable-install-doc --with-modular-gc=${{ env.MODULAR_GC_DIR }}
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - uses: actions-rust-lang/setup-rust-toolchain@v1
+      - name: Set MMTk environment variables
+        run: |
+          echo 'EXCLUDES=../src/test/.excludes-mmtk' >> $GITHUB_ENV
+          echo 'MSPECOPT=-B../src/spec/mmtk.mspec' >> $GITHUB_ENV
+        if: ${{ matrix.gc.name == 'mmtk' }}
+
+      - run: $SETARCH make
+
+      - name: Build Modular  GC
+        run: |
+          echo "RUBY_GC_LIBRARY=${{ matrix.gc.name }}" >> $GITHUB_ENV
+          make install-modular-gc MODULAR_GC=${{ matrix.gc.name }} MMTK_BUILD=${{ matrix.gc.mmtk_build }}
+          make distclean-modular-gc MODULAR_GC=${{ matrix.gc.name }}
+
+      - run: $SETARCH make hello
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          $SETARCH make -s ${{ matrix.test_task }} \
+            ${TESTS:+TESTS="$TESTS"} \
+            ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.gc.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/parse_y.yml b/.github/workflows/parse_y.yml
new file mode 100644
index 0000000000..87facc8a55
--- /dev/null
+++ b/.github/workflows/parse_y.yml
@@ -0,0 +1,100 @@
+name: parse.y
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+          - test_task: test-bundler-parallel
+          - test_task: test-bundled-gems
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc cppflags=-DRUBY_DEBUG --with-parser=parse.y
+
+      - run: make
+
+      - run: make TESTRUN_SCRIPT='-renvutil -v -e "exit EnvUtil.current_parser == %[parse.y]"' run
+        env:
+          RUNOPT0: -I$(tooldir)/lib
+
+      - name: make ${{ matrix.test_task }}
+        run: make -s ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" SPECOPTS="$SPECOPTS"
+        env:
+          RUBY_TESTOPTS: ${{ matrix.testopts }}
+          EXCLUDES: '../src/test/.excludes-parsey'
+          RUN_OPTS: ${{ matrix.run_opts || '--parser=parse.y' }}
+          SPECOPTS: ${{ matrix.specopts || '-T --parser=parse.y' }}
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.run_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/post_push.yml b/.github/workflows/post_push.yml
new file mode 100644
index 0000000000..318444c0a2
--- /dev/null
+++ b/.github/workflows/post_push.yml
@@ -0,0 +1,85 @@
+name: Post-push
+on:
+  push:
+    branches:
+      - master
+      - 'ruby_*_*'
+jobs:
+  hooks:
+    name: Post-push hooks
+    runs-on: ubuntu-latest
+    if: ${{ github.repository == 'ruby/ruby' }}
+    steps:
+      - name: Sync git.ruby-lang.org
+        run: |
+          mkdir -p ~/.ssh
+          (umask 066; printenv RUBY_GIT_SYNC_PRIVATE_KEY > ~/.ssh/id_ed25519)
+          ssh-keyscan -t ed25519 git.ruby-lang.org >> ~/.ssh/known_hosts
+          ssh -i ~/.ssh/id_ed25519 git-sync@git.ruby-lang.org "sudo -u git /home/git/git.ruby-lang.org/bin/update-ruby.sh $GITHUB_REF"
+        env:
+          GITHUB_REF: ${{ github.ref }}
+          RUBY_GIT_SYNC_PRIVATE_KEY: ${{ secrets.RUBY_GIT_SYNC_PRIVATE_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Fetch changesets on bugs.ruby-lang.org
+        run: |
+          curl "https://bugs.ruby-lang.org/sys/fetch_changesets?key=${REDMINE_SYS_API_KEY}" -s --fail-with-body -w '* status: %{http_code}\n'
+        env:
+          REDMINE_SYS_API_KEY: ${{ secrets.REDMINE_SYS_API_KEY }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          fetch-depth: 500 # for notify-slack-commits
+          token: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Notify commit to Slack
+        run: ruby tool/notify-slack-commits.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          SLACK_WEBHOOK_URL_ALERTS: ${{ secrets.SLACK_WEBHOOK_URL_ALERTS }}
+          SLACK_WEBHOOK_URL_COMMITS: ${{ secrets.SLACK_WEBHOOK_URL_COMMITS }}
+          SLACK_WEBHOOK_URL_RUBY_JP: ${{ secrets.SLACK_WEBHOOK_URL_RUBY_JP }}
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Notify commit to ruby-cvs
+        run: |
+          SENDMAIL="ssh -i ${HOME}/.ssh/id_ed25519 git-sync@git.ruby-lang.org /usr/sbin/sendmail" \
+            ruby tool/commit-email.rb . ruby-cvs@g.ruby-lang.org \
+            "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" "$GITHUB_REF" \
+            --viewer-uri "https://github.com/ruby/ruby/commit/" \
+            --error-to cvs-admin@ruby-lang.org
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_REF: ${{ github.ref }}
+        if: ${{ github.ref == 'refs/heads/master' || startsWith(github.ref, 'refs/heads/ruby_') }}
+
+      - name: Auto-correct code styles
+        run: |
+          set -x
+          ruby tool/auto-style.rb "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - name: Push PR notes to GitHub
+        run: ruby tool/notes-github-pr.rb "$(pwd)/.git" "$GITHUB_OLD_SHA" "$GITHUB_NEW_SHA" refs/heads/master
+        env:
+          GITHUB_OLD_SHA: ${{ github.event.before }}
+          GITHUB_NEW_SHA: ${{ github.event.after }}
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+          EMAIL: svn-admin@ruby-lang.org
+        if: ${{ github.ref == 'refs/heads/master' }}
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/pr-playground.yml b/.github/workflows/pr-playground.yml
new file mode 100644
index 0000000000..f3c0556429
--- /dev/null
+++ b/.github/workflows/pr-playground.yml
@@ -0,0 +1,127 @@
+name: Post Playground link to PR
+on:
+  pull_request_target:
+    types: [labeled]
+  workflow_run:
+    workflows: ["WebAssembly"]
+    types: [completed]
+
+jobs:
+  post-summary:
+    name: Post Playground link
+    runs-on: ubuntu-latest
+    permissions:
+      pull-requests: write
+    # Post a comment only if the PR status check is passed and the PR is labeled with `Playground`.
+    # Triggered twice: when the PR is labeled and when PR build is passed.
+    if: >-
+      ${{ false
+      || (true
+        && github.event_name == 'pull_request_target'
+        && contains(github.event.pull_request.labels.*.name, 'Playground'))
+      || (true
+        && github.event_name == 'workflow_run'
+        && github.event.workflow_run.conclusion == 'success'
+        && github.event.workflow_run.event == 'pull_request')
+      }}
+    steps:
+      - uses: actions/github-script@ed597411d8f924073f98dfc5c65a23a2325f34cd # v8.0.0
+        with:
+          github-token: ${{ secrets.GITHUB_TOKEN }}
+          script: |
+            const fs = require('fs/promises');
+
+            const buildWorkflowPath = '.github/workflows/wasm.yml';
+            const findSuccessfuBuildRun = async (pr) => {
+              const opts = github.rest.actions.listWorkflowRunsForRepo.endpoint.merge({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                status: 'success',
+                branch: pr.head.ref,
+              });
+              const runs = await github.paginate(opts);
+              const buildRun = runs.find(run => run.path == buildWorkflowPath);
+              return buildRun;
+            }
+
+            const postComment = async (body, pr) => {
+              const { data: comments } = await github.rest.issues.listComments({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                issue_number: pr.number,
+              });
+
+              const commentOpts = { owner: context.repo.owner, repo: context.repo.repo, body: comment };
+
+              const existingComment = comments.find(comment => comment.body.startsWith(magicComment));
+              if (existingComment) {
+                core.info(`Updating existing comment: ${existingComment.html_url}`);
+                await github.rest.issues.updateComment({
+                  ...commentOpts, comment_id: existingComment.id
+                });
+              } else {
+                await github.rest.issues.createComment({
+                  ...commentOpts, issue_number: pr.number
+                });
+              }
+            }
+
+            const derivePRNumber = async () => {
+              if (context.payload.pull_request) {
+                return context.payload.pull_request.number;
+              }
+              // Workaround for https://github.com/orgs/community/discussions/25220
+
+              const { data: { artifacts } } = await github.rest.actions.listWorkflowRunArtifacts({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                run_id: context.payload.workflow_run.id,
+              });
+              const artifact = artifacts.find(artifact => artifact.name == 'github-pr-info');
+              if (!artifact) {
+                throw new Error('Cannot find github-pr-info.txt artifact');
+              }
+
+              const { data } = await github.rest.actions.downloadArtifact({
+                owner: context.repo.owner,
+                repo: context.repo.repo,
+                artifact_id: artifact.id,
+                archive_format: 'zip',
+              });
+
+              await fs.writeFile('pr-info.zip', Buffer.from(data));
+              await exec.exec('unzip', ['pr-info.zip']);
+              return await fs.readFile('github-pr-info.txt', 'utf8');
+            }
+
+            const prNumber = await derivePRNumber();
+
+            const { data: pr } = await github.rest.pulls.get({
+              owner: context.repo.owner,
+              repo: context.repo.repo,
+              pull_number: prNumber,
+            });
+
+            core.info(`Checking if the PR ${prNumber} is labeled with Playground...`);
+            if (!pr.labels.some(label => label.name == 'Playground')) {
+              core.info(`The PR is not labeled with Playground.`);
+              return;
+            }
+
+            core.info(`Checking if the build is successful for ${pr.head.ref} in ${pr.head.repo.owner.login}/${pr.head.repo.name}...`);
+            const buildRun = await findSuccessfuBuildRun(pr);
+            if (!buildRun) {
+              core.info(`No successful build run found for ${buildWorkflowPath} on ${pr.head.ref} yet.`);
+              return;
+            }
+            core.info(`Found a successful build run: ${buildRun.html_url}`);
+
+            const runLink = `${process.env.GITHUB_SERVER_URL}/${process.env.GITHUB_REPOSITORY}/actions/runs/${process.env.GITHUB_RUN_ID}`;
+            const magicComment = `<!-- AUTO-GENERATED-COMMENT-PR-PLAYGROUND -->`;
+            const comment = `${magicComment}
+            **Try on Playground**: https://ruby.github.io/play-ruby?run=${buildRun.id}
+            This is an automated comment by [\`pr-playground.yml\`](${runLink}) workflow.
+            `;
+            core.info(`Comment: ${comment}`);
+            await postComment(comment, pr);
+
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
new file mode 100644
index 0000000000..3caeee9a3b
--- /dev/null
+++ b/.github/workflows/publish.yml
@@ -0,0 +1,107 @@
+name: Publish Ruby packages
+
+on:
+  repository_dispatch:
+    types:
+      - release
+  workflow_dispatch:
+    inputs:
+      version:
+        description: 'Version of the Ruby package to release'
+        required: true
+        default: '3.3.4'
+
+jobs:
+  release:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: actions/checkout@v6.0.1
+
+      - uses: ruby/setup-ruby@v1
+        with:
+          ruby-version: 3.3.4
+
+      - name: Store Ruby version
+        run: |
+          echo "RUBY_VERSION=${{ github.event.client_payload.version || github.event.inputs.version }}" >> $GITHUB_ENV
+
+      - name: Store ABI version
+        run: echo "ABI_VERSION=$(echo ${{ env.RUBY_VERSION }} | cut -d '.' -f 1-2)" >> $GITHUB_ENV
+
+      - name: Copy draft package `/tmp` to `/pub` directory
+        run: tool/release.sh ${{ env.RUBY_VERSION }}
+        env:
+          AWS_ACCESS_KEY_ID: ${{ secrets.FTP_R_L_O_AWS_ACCESS_KEY_ID }}
+          AWS_SECRET_ACCESS_KEY: ${{ secrets.FTP_R_L_O_AWS_SECRET_ACCESS_KEY }}
+          AWS_DEFAULT_REGION: us-west-2
+
+      - name: Purge URLs of release package
+        run: |
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.gz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.xz
+          curl -X POST \
+            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
+            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.zip
+
+      - name: Create a release on GitHub
+        run: |
+          RELEASE_TAG=$(ruby tool/ruby-version.rb tag "${{ env.RUBY_VERSION }}")
+          echo $RELEASE_TAG
+          PREVIOUS_RELEASE_TAG=$(ruby tool/ruby-version.rb previous-tag "${{ env.RUBY_VERSION }}")
+          echo $PREVIOUS_RELEASE_TAG
+          tool/gen-github-release.rb $PREVIOUS_RELEASE_TAG $RELEASE_TAG --no-dry-run
+        env:
+          GITHUB_TOKEN: ${{ secrets.MATZBOT_AUTO_UPDATE_TOKEN }}
+
+      - name: Update versions index
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d '{"event_type": "update_index"}'
+
+      - name: Build and push Docker images
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/docker-images/actions/workflows/build.yml/dispatches \
+            -d '{"ref": "master", "inputs": {"ruby_version": "${{ env.RUBY_VERSION }}"}}'
+
+      - name: Build snapcraft packages
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/snap.ruby/dispatches \
+            -d '{"event_type": "build", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}"}}'
+
+      - name: Store the latest LTS version of OpenSSL
+        run: |
+          echo "OPENSSL_VERSION=`curl -s https://api.github.com/repos/openssl/openssl/releases | jq -r '.[].tag_name | select(startswith("openssl-3.0"))' | sort -Vr | head -n1 | cut -d'-' -f2`" >> $GITHUB_ENV
+
+      - name: Update ruby-build definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.RUBY_BUILD_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/rbenv/ruby-build/dispatches \
+            -d '{"event_type": "update-ruby", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}", "openssl_version": "${{ env.OPENSSL_VERSION }}"}}'
+
+      - name: Update all-ruby definition
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/all-ruby/dispatches \
+            -d '{"event_type": "update"}'
diff --git a/.github/workflows/release.yml b/.github/workflows/release.yml
new file mode 100644
index 0000000000..5d4474d978
--- /dev/null
+++ b/.github/workflows/release.yml
@@ -0,0 +1,18 @@
+name: Start release workflow
+on:
+  push:
+    tags:
+      - '*'
+
+jobs:
+  notify:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Build release package
+        run: |
+          curl -L -X POST \
+            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
+            -H "Accept: application/vnd.github+json" \
+            -H "X-GitHub-Api-Version: 2022-11-28" \
+            https://api.github.com/repos/ruby/actions/dispatches \
+            -d '{"event_type": "${{ github.ref }}"}'
diff --git a/.github/workflows/rust-warnings.yml b/.github/workflows/rust-warnings.yml
new file mode 100644
index 0000000000..a2e3208e52
--- /dev/null
+++ b/.github/workflows/rust-warnings.yml
@@ -0,0 +1,60 @@
+# Surface Rust warnings on PRs that touch any Rust code.
+# Not a required check so we never block people over new warnings
+# that might come from a new Rust version being released.
+name: Rust warnings
+on:
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    paths:
+      - '**.rs'
+      - '!**.inc.rs'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rust-warnings:
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - name: Install Rust
+        run: rustup default beta
+
+      - name: Rust warnings
+        shell: bash
+        run: |
+          set -eu
+          cargo check --quiet --all-features --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
+
+      - name: "📜 `rustdoc` warnings"
+        shell: bash
+        run: |
+          set -eu
+          cargo doc --document-private-items --all --no-deps --message-format=json \
+            | jq -r 'select(.message.level | IN("warning", "error")) | .message.rendered' \
+            | tee messages.txt
+          (exit "${PIPESTATUS[0]}") && ! grep --quiet '[^[:space:]]' messages.txt
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
new file mode 100644
index 0000000000..c607098997
--- /dev/null
+++ b/.github/workflows/scorecards.yml
@@ -0,0 +1,78 @@
+# This workflow uses actions that are not certified by GitHub. They are provided
+# by a third-party and are governed by separate terms of service, privacy
+# policy, and support documentation.
+
+name: Scorecard supply-chain security
+on:
+  # For Branch-Protection check. Only the default branch is supported. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
+  branch_protection_rule:
+  # To guarantee Maintained check is occasionally updated. See
+  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
+  schedule:
+    - cron: '39 3 * * 5'
+  # push:
+  #   branches: [ "master" ]
+
+# Declare default permissions as read only.
+permissions: read-all
+
+jobs:
+  analysis:
+    name: Scorecard analysis
+    runs-on: ubuntu-latest
+    # `publish_results: true` only works when run from the default branch. conditional can be removed if disabled.
+    if: github.event.repository.default_branch == github.ref_name || github.event_name == 'pull_request'
+    permissions:
+      # Needed to upload the results to code-scanning dashboard.
+      security-events: write
+      # Needed to publish results and get a badge (see publish_results below).
+      id-token: write
+      # Uncomment the permissions below if installing in a private repository.
+      # contents: read
+      # actions: read
+
+    steps:
+      - name: "Checkout code"
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          persist-credentials: false
+
+      - name: "Run analysis"
+        uses: ossf/scorecard-action@4eaacf0543bb3f2c246792bd56e8cdeffafb205a # v2.4.3
+        with:
+          results_file: results.sarif
+          results_format: sarif
+          # (Optional) "write" PAT token. Uncomment the `repo_token` line below if:
+          # - you want to enable the Branch-Protection check on a *public* repository, or
+          # - you are installing Scorecard on a *private* repository
+          # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action?tab=readme-ov-file#authentication-with-fine-grained-pat-optional.
+          # repo_token: ${{ secrets.SCORECARD_TOKEN }}
+
+          # Public repositories:
+          #   - Publish results to OpenSSF REST API for easy access by consumers
+          #   - Allows the repository to include the Scorecard badge.
+          #   - See https://github.com/ossf/scorecard-action#publishing-results.
+          # For private repositories:
+          #   - `publish_results` will always be set to `false`, regardless
+          #     of the value entered here.
+          publish_results: true
+
+          # (Optional) Uncomment file_mode if you have a .gitattributes with files marked export-ignore
+          # file_mode: git
+
+      # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
+      # format to the repository Actions tab.
+      - name: "Upload artifact"
+        uses: actions/upload-artifact@b7c566a772e6b6bfb58ed0dc250532a479d7789f # v6.0.0
+        with:
+          name: SARIF file
+          path: results.sarif
+          retention-days: 5
+
+      # Upload the results to GitHub's code scanning dashboard (optional).
+      # Commenting out will disable upload of results to your repo's Code Scanning dashboard
+      - name: "Upload to code-scanning"
+        uses: github/codeql-action/upload-sarif@v4
+        with:
+          sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
new file mode 100644
index 0000000000..cf4661555c
--- /dev/null
+++ b/.github/workflows/spec_guards.yml
@@ -0,0 +1,67 @@
+name: Rubyspec Version Guards Check
+
+on:
+  push:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  pull_request:
+    paths:
+      - '.github/workflows/spec_guards.yml'
+      - 'spec/**'
+      - '!spec/*.md'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  rubyspec:
+    name: Rubyspec
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    strategy:
+      matrix:
+        # Specs from ruby/spec should still run on all supported Ruby versions.
+        # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
+        ruby:
+          - ruby-3.2
+          - ruby-3.3
+          - ruby-3.4
+          - ruby-4.0
+      fail-fast: false
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: ${{ matrix.ruby }}
+          bundler: none
+
+      - run: gem install webrick
+
+      - run: ruby ../mspec/bin/mspec
+        working-directory: spec/ruby
+        env:
+          CHECK_LEAKS: true
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.ruby }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
diff --git a/.github/workflows/sync_default_gems.yml b/.github/workflows/sync_default_gems.yml
new file mode 100644
index 0000000000..9ff97d5a4e
--- /dev/null
+++ b/.github/workflows/sync_default_gems.yml
@@ -0,0 +1,77 @@
+name: Sync default gems
+
+env:
+  DEFAULT_GEM_SYNC_ENABLED: true
+
+on:
+  workflow_dispatch:
+    inputs:
+      gem:
+        required: true
+        description: 'Name of the gem to be synchronized'
+        type: string
+      before:
+        required: true
+        description: 'Gem commit SHA before sync'
+        type: string
+      after:
+        required: true
+        description: 'Gem commit SHA after sync'
+        type: string
+
+jobs:
+  sync_default_gems:
+    name: Sync default gem ${{ github.event.inputs.gem }}
+
+    permissions:
+      contents: write # for Git to git push
+
+    runs-on: ubuntu-latest
+
+    if: ${{ github.repository == 'ruby/ruby' }}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        name: Check out ruby/ruby
+        with:
+          token: ${{ github.repository == 'ruby/ruby' && secrets.MATZBOT_AUTO_UPDATE_TOKEN || secrets.GITHUB_TOKEN }}
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.4'
+          bundler: none
+
+      - name: Run tool/sync_default_gems.rb
+        id: sync
+        run: |
+          ruby_before=$(git rev-parse HEAD)
+          set -x
+          ruby tool/sync_default_gems.rb "${gem_name}" "${gem_before}..${gem_after}"
+          if [[ "$(git rev-parse HEAD)" != "$ruby_before" ]]; then
+            echo update=true >> $GITHUB_OUTPUT
+          fi
+        env:
+          gem_name: ${{ github.event.inputs.gem }}
+          gem_before: ${{ github.event.inputs.before }}
+          gem_after: ${{ github.event.inputs.after }}
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - name: Push
+        run: |
+          git pull --rebase origin ${GITHUB_REF#refs/heads/}
+          git push origin ${GITHUB_REF#refs/heads/}
+        if: ${{ steps.sync.outputs.update && env.DEFAULT_GEM_SYNC_ENABLED == 'true' }}
+        env:
+          EMAIL: svn-admin@ruby-lang.org
+          GIT_AUTHOR_NAME: git
+          GIT_COMMITTER_NAME: git
+
+      - uses: ./.github/actions/slack
+        with:
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+          label: "${{ github.event.inputs.gem }} (<https://github.com/${{ github.event.inputs.gem == 'rubygems' && 'rubygems' || 'ruby' }}/${{ github.event.inputs.gem }}/compare/${{ github.event.inputs.before }}...${{ github.event.inputs.after }}|diff>)"
+          event_name: workflow_dispatch
+          extra_channel_id: C05FPKAU743 # alerts-sync
+        if: ${{ failure() }}
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..88c19b6fe6
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,269 @@
+name: Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        # We enumerate every job in matrix.include to save build time
+        include:
+          - test_task: check
+            configure: 'cppflags=-DVM_CHECK_MODE'
+          - test_task: check
+            arch: i686
+          - test_task: check
+            configure: '--disable-yjit'
+          - test_task: check
+            configure: '--enable-shared --enable-load-relative'
+          - test_task: test-bundler-parallel
+            timeout: 50
+          - test_task: test-bundled-gems
+          - test_task: check
+            os: ubuntu-24.04
+            extra_checks: [capi]
+          # ubuntu-24.04-arm jobs don't start on ruby/ruby as of 2025-10-29
+          #- test_task: check
+          #  os: ubuntu-24.04-arm
+      fail-fast: false
+
+    env: &make-env
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUBY_DEBUG: ci
+
+    runs-on: ${{ matrix.os || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: &make-steps
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+        with:
+          arch: ${{ matrix.arch }}
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+        if: >-
+          ${{ !endsWith(matrix.os, 'arm')
+          && !endsWith(matrix.os, 'ppc64le') && !endsWith(matrix.os, 's390x') }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          clean: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        env:
+          arch: ${{ matrix.arch }}
+          configure: ${{ matrix.configure }}
+        run: >-
+          $SETARCH ../src/configure -C --disable-install-doc ${configure:-cppflags=-DRUBY_DEBUG}
+          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
+
+      - run: $SETARCH make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: $SETARCH make
+
+      - run: $SETARCH make hello
+
+      - name: runirb
+        run: |
+          echo IRB::VERSION | $SETARCH make runirb RUNOPT="-- -f"
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ${{ matrix.os || 'ubuntu-22.04' }}
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+        continue-on-error: true
+        timeout-minutes: 3
+
+      # Avoid possible test failures with the zlib applying the following patch
+      # on s390x CPU architecture.
+      # https://github.com/madler/zlib/pull/410
+      - name: Disable DFLTCC
+        run: echo "DFLTCC=0" >> $GITHUB_ENV
+        if: ${{ endsWith(matrix.os, 's390x') }}
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          $SETARCH make -s ${{ matrix.test_task }} \
+          ${TESTS:+TESTS="$TESTS"} \
+          ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
+        timeout-minutes: ${{ matrix.timeout || 40 }}
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+
+      - name: make skipped tests
+        run: |
+          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: test-pc
+        run: |
+          DESTDIR=${RUNNER_TEMP-${TMPDIR-/tmp}}/installed
+          $SETARCH make test-pc "DESTDIR=$DESTDIR"
+
+      - name: CAPI extensions
+        uses: ./.github/actions/capiext
+        with:
+          builddir: build
+          make: '$SETARCH make'
+        env:
+          RUBY_TESTOPTS: '-v --tty=no'
+        if: ${{ contains(matrix.extra_checks, 'capi') }}
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}${{ matrix.os }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  make-ibm:
+    strategy:
+      matrix:
+        include:
+          - test_task: check
+            os: ubuntu-24.04-ppc64le
+          - test_task: check
+            os: ubuntu-24.04-s390x
+      fail-fast: false
+
+    env: *make-env
+
+    runs-on: ${{ matrix.os }}
+
+    if: >-
+      ${{github.repository == 'ruby/ruby'
+      && !(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps: *make-steps
+
+  # Separated from `make` job to avoid making it a required status check
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Using the same setup as ZJIT jobs
+          - bench_opts: '--warmup=1 --bench=1 --excludes=lobsters'
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install"
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "ruby::../build/install/bin/ruby" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
new file mode 100644
index 0000000000..0d2a6f0545
--- /dev/null
+++ b/.github/workflows/wasm.yml
@@ -0,0 +1,179 @@
+name: WebAssembly
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions: # added using https://github.com/step-security/secure-workflows
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        entry:
+#         # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
+#         - { name: O0-debuginfo, optflags: '-O0', debugflags: '-g', wasmoptflags: '-O1' }
+#         - { name: O1,           optflags: '-O1', debugflags: ''  , wasmoptflags: '-O1' }
+          - { name: O2, optflags: '-O2', debugflags: '', wasmoptflags: '-O2' }
+#         - { name: O3,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O3' }
+#         # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
+#         - { name: O4,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O4' }
+#         - { name: Oz,           optflags: '-Oz', debugflags: ''  , wasmoptflags: '-Oz' }
+      fail-fast: false
+
+    env:
+      RUBY_TESTOPTS: '-q --tty=no'
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      WASI_SDK_VERSION_MAJOR: 25
+      WASI_SDK_VERSION_MINOR: 0
+      BINARYEN_VERSION: 113
+      WASMTIME_VERSION: v15.0.0
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Install libraries
+        run: |
+          set -ex
+          sudo apt-get update -q || :
+          sudo apt-get install --no-install-recommends -q -y ruby make autoconf git wget
+
+          wasi_sdk_deb="wasi-sdk-${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}-x86_64-linux.deb"
+          wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
+          sudo dpkg -i "$wasi_sdk_deb"
+          rm -f "$wasi_sdk_deb"
+
+          mkdir build-sdk
+          pushd build-sdk
+
+          wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
+          wget -O - "$wasmtime_url" | tar xJf -
+          sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
+
+          binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
+          binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
+          wget -O - "$binaryen_url" | tar xfz -
+          sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
+        working-directory: src
+
+      - name: Set ENV
+        run: |
+          echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - name: Build baseruby
+        run: |
+          set -ex
+          mkdir ../baseruby
+          pushd ../baseruby
+          ../src/configure --prefix=$PWD/install
+          make
+          make install
+
+      - name: Download config.guess with wasi version
+        run: |
+          rm tool/config.guess tool/config.sub
+          ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
+        working-directory: src
+
+      - name: Run configure
+        run: |
+          ../src/configure \
+            --host wasm32-unknown-wasi \
+            --with-baseruby=$PWD/../baseruby/install/bin/ruby \
+            --with-static-linked-ext \
+            --with-ext=cgi/escape,continuation,coverage,date,digest/bubblebabble,digest,digest/md5,digest/rmd160,digest/sha1,digest/sha2,etc,fcntl,json,json/generator,json/parser,objspace,pathname,rbconfig/sizeof,ripper,stringio,strscan,monitor \
+            LDFLAGS=" \
+              -Xlinker --stack-first \
+              -Xlinker -z -Xlinker stack-size=16777216 \
+            " \
+            optflags="${{ matrix.entry.optflags }}" \
+            debugflags="${{ matrix.entry.debugflags }}" \
+            wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
+
+      # miniruby may not be built when cross-compling
+      - run: make mini ruby
+
+      - run: make install DESTDIR=$PWD/../install
+      - run: tar cfz ../install.tar.gz -C ../install .
+
+      - name: Upload artifacts
+        uses: actions/upload-artifact@b7c566a772e6b6bfb58ed0dc250532a479d7789f # v6.0.0
+        with:
+          name: ruby-wasm-install
+          path: ${{ github.workspace }}/install.tar.gz
+      - name: Show Playground URL to try the build
+        run: |
+          echo "Try on Playground: https://ruby.github.io/play-ruby?run=$GITHUB_RUN_ID" >> $GITHUB_STEP_SUMMARY
+
+      - name: Run basictest
+        run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
+        working-directory: src
+
+      - name: Run bootstraptest (no thread)
+        run: |
+          NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
+          ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
+        working-directory: src
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.entry.name }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+      # Workaround for https://github.com/orgs/community/discussions/25220
+      - name: Save Pull Request number
+        if: ${{ github.event_name == 'pull_request' }}
+        run: echo "${{ github.event.pull_request.number }}" >> ${{ github.workspace }}/github-pr-info.txt
+      - uses: actions/upload-artifact@b7c566a772e6b6bfb58ed0dc250532a479d7789f # v6.0.0
+        if: ${{ github.event_name == 'pull_request' }}
+        with:
+          name: github-pr-info
+          path: ${{ github.workspace }}/github-pr-info.txt
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..1d44a5482c
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,201 @@
+name: Windows
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      matrix:
+        include:
+          - os: 2022
+            vc: 2022
+            test_task: check
+          - os: 2025
+            vc: 2022
+            test_task: check
+          - os: 11-arm
+            test_task: 'btest test-basic test-tool' # check and test-spec are broken yet.
+            target: arm64
+          - os: 2025
+            vc: 2022
+            test_task: test-bundled-gems
+      fail-fast: false
+
+    runs-on: windows-${{ matrix.os }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    name: Windows ${{ matrix.os }}/Visual C++ ${{ matrix.vc }} (${{ matrix.test_task }})
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      VCPKG_DEFAULT_TRIPLET: ${{ matrix.target || 'x64' }}-windows
+
+    steps:
+      - run: md build
+        working-directory:
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          # windows-11-arm has only 3.4.1, 3.4.2, 3.4.3, head
+          ruby-version: ${{ !endsWith(matrix.os, 'arm') && '3.1' || '3.4' }}
+          bundler: none
+          windows-toolchain: none
+
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          make-command: nmake
+          clean: true
+
+      - name: Install tools with scoop
+        run: |
+          Set-ExecutionPolicy -ExecutionPolicy RemoteSigned -Scope CurrentUser
+          iwr -useb get.scoop.sh | iex
+          Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
+          scoop install vcpkg uutils-coreutils
+        shell: pwsh
+
+      - name: Restore vcpkg artifact
+        id: restore-vcpkg
+        uses: actions/cache/restore@8b402f58fbc84540c8b491a91e594a4576fec3d7 # v5.0.2
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+
+      - name: Install libraries with vcpkg
+        run: |
+          vcpkg install --vcpkg-root=%USERPROFILE%\scoop\apps\vcpkg\current
+        working-directory: src
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit }}
+
+      - name: Save vcpkg artifact
+        uses: actions/cache/save@8b402f58fbc84540c8b491a91e594a4576fec3d7 # v5.0.2
+        with:
+          path: src\vcpkg_installed
+          key: windows-${{ matrix.os }}-vcpkg-${{ hashFiles('src/vcpkg.json') }}
+        if: ${{ ! steps.restore-vcpkg.outputs.cache-hit && (github.ref_name == 'master' || startsWith(github.ref_name, 'ruby_')) }}
+
+      - name: setup env
+        # Available Ruby versions: https://github.com/actions/runner-images/blob/main/images/windows/Windows2019-Readme.md#ruby
+        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
+        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
+        run: |
+          ::- Set up VC ${{ matrix.vc }}
+          set | sort > old.env
+          call ..\src\win32\vssetup.cmd ^
+            -arch=${{ matrix.target || 'amd64' }} ^
+            ${{ matrix.vcvars && '-vcvars_ver=' || '' }}${{ matrix.vcvars }}
+          nmake -f nul
+          set TMP=%RUNNER_TEMP%
+          set TEMP=%RUNNER_TEMP%
+          set MAKEFLAGS=l
+          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
+          set RUBY_OPT_DIR=%GITHUB_WORKSPACE:\=/%/src/vcpkg_installed/%VCPKG_DEFAULT_TRIPLET%
+          set | sort > new.env
+          comm -13 old.env new.env >> %GITHUB_ENV%
+          del *.env
+
+      - name: baseruby version
+        run: ruby -v
+
+      - name: compiler version
+        run: cl
+
+      - name: volume info
+        run: Get-Volume
+        shell: pwsh
+
+      # TODO: We should use `../src` instead of `D:/a/ruby/ruby/src`
+      - name: Configure
+        run: >-
+          ../src/win32/configure.bat --disable-install-doc
+          --with-opt-dir=%RUBY_OPT_DIR%
+          --with-gmp
+
+      - run: nmake prepare-vcpkg
+
+      - run: nmake incs
+
+      - run: nmake extract-extlibs
+
+      # On all other platforms, test-spec depending on extract-gems (in common.mk) is enough.
+      # But not for this Visual Studio workflow. So here we extract gems before building.
+      - run: nmake extract-gems
+
+      # windows-11-arm runner cannot run `ruby tool/file2lastrev.rb --revision.h --output=revision.h`
+      - name: make revision.h
+        run: |
+          win32\lastrev.bat | win32\ifchange.bat --timestamp=.revision.time revision.h -
+          type revision.h
+        working-directory: src
+
+      - run: nmake
+
+      - name: Set up Launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: windows-${{ matrix.os }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          test-task: ${{ matrix.test_task || 'check' }}
+        continue-on-error: true
+        if: ${{ matrix.test_task != 'test-bundled-gems' }}
+        timeout-minutes: 3
+
+      - run: nmake ${{ matrix.test_task || 'check' }}
+        env:
+          RUBY_TESTOPTS: -j${{ env.TEST_JOBS || 4 }}
+        timeout-minutes: 70
+
+      - uses: ./.github/actions/slack
+        with:
+          label: Windows ${{ matrix.os }} / VC ${{ matrix.vc }} / ${{ matrix.test_task || 'check' }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: windows-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
+    shell: cmd
diff --git a/.github/workflows/wsl.yml b/.github/workflows/wsl.yml
new file mode 100644
index 0000000000..640f18ce42
--- /dev/null
+++ b/.github/workflows/wsl.yml
@@ -0,0 +1,70 @@
+name: Ubuntu on WSL
+
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+jobs:
+  wsl:
+    runs-on: windows-2025
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - name: Install or update WSL
+        uses: Ubuntu/WSL/.github/actions/wsl-install@main
+        with:
+          distro: Ubuntu-24.04
+
+      - name: Install dependencies
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            DEBIAN_FRONTEND=noninteractive sudo apt update
+            DEBIAN_FRONTEND=noninteractive sudo apt install -y ruby build-essential autoconf libssl-dev libyaml-dev zlib1g-dev libgmp-dev libffi-dev
+
+      - name: Check out the repository
+        uses: Ubuntu/WSL/.github/actions/wsl-checkout@main
+        with:
+          distro: Ubuntu-24.04
+          working-dir: /tmp/github/
+          submodules: true
+
+      - name: Build
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./autogen.sh
+            ./configure --disable-install-doc
+            make ruby -j4
+            make extract-gems
+            make -j4
+
+      - name: Test
+        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
+        with:
+         distro: Ubuntu-24.04
+         working-dir: /tmp/github/
+         exec: |
+            ./ruby -v
+            # make check TESTS="-j4" MSPECOPT="-j"
diff --git a/.github/workflows/yjit-macos.yml b/.github/workflows/yjit-macos.yml
new file mode 100644
index 0000000000..a59b4d6508
--- /dev/null
+++ b/.github/workflows/yjit-macos.yml
@@ -0,0 +1,198 @@
+name: YJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  make:
+    strategy:
+      matrix:
+        include:
+          - test_task: 'check'
+            configure: '--enable-yjit'
+            yjit_opts: '--yjit'
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+      fail-fast: false
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: Set test options for skipped tests
+        run: |
+          set -x
+          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
+          echo "TESTS=${TESTS}" >> $GITHUB_ENV
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: macos-14
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          PRECHECK_BUNDLED_GEMS: 'no'
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: make skipped tests
+        run: |
+          make -s test-all TESTS="${TESTS//-n!\//-n/}"
+        env:
+          GNUMAKEFLAGS: ''
+          RUBY_TESTOPTS: '-v --tty=no'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
+        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }} ${{ matrix.yjit_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: macos-14
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
new file mode 100644
index 0000000000..150f0b3275
--- /dev/null
+++ b/.github/workflows/yjit-ubuntu.yml
@@ -0,0 +1,240 @@
+name: YJIT Ubuntu
+on:
+  push:
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  cargo:
+    name: cargo test
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      # For now we can't run cargo test --offline because it complains about the
+      # capstone dependency, even though the dependency is optional
+      #- run: cargo test --offline
+
+      - run: RUST_BACKTRACE=1 cargo test
+        working-directory: yjit
+
+      # Also compile and test with all features enabled
+      - run: RUST_BACKTRACE=1 cargo test --all-features
+        working-directory: yjit
+
+      # Check that we can build in release mode too
+      - run: cargo build --release
+        working-directory: yjit
+
+  lint:
+    name: cargo clippy
+
+    # GitHub Action's image seems to already contain a Rust 1.58.0.
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      # Check that we don't have linting errors in release mode, too
+      - run: cargo clippy --all-targets --all-features
+        working-directory: yjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'yjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--with-gcc=clang-14 --enable-yjit=dev --enable-zjit'
+            libclang_path: '/usr/lib/llvm-14/lib/libclang.so.1'
+
+          - test_task: 'check'
+            # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
+            #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
+            configure: "RUSTC='rustc +1.58.0'"
+            rust_version: '1.58.0'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+
+          - test_task: 'check'
+            configure: '--enable-yjit=dev'
+            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
+            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-yjit=dev'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.yjit_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      RUBY_DEBUG: ci
+      RUST_BACKTRACE: 1
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: rustup install ${{ matrix.rust_version }} --profile minimal
+
+      - name: Remove cargo
+        # Since this tests a `rustc` build for release, remove `cargo` to ensure
+        # that only `rustc` is used.
+        if: ${{ contains(matrix.configure, 'rustc') }}
+        run: sudo rm $(which -a cargo | uniq)
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --yjit-dump-disasm works
+        run: |
+          ./miniruby --yjit-call-threshold=1 --yjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for YJIT
+        run: |
+          echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      # Check that the binary was built with YJIT
+      - name: Check YJIT enabled
+        run: ./miniruby --yjit -v | grep "+YJIT"
+
+      - name: Set up Launchable
+        id: launchable
+        uses: ./.github/actions/launchable/setup
+        with:
+          os: ubuntu-22.04
+          test-opts: ${{ matrix.configure }}
+          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
+          builddir: build
+          srcdir: src
+          is-yjit: true
+        continue-on-error: true
+        timeout-minutes: 3
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          test -n "${LAUNCHABLE_STDOUT}" && exec 1> >(tee "${LAUNCHABLE_STDOUT}")
+          test -n "${LAUNCHABLE_STDERR}" && exec 2> >(tee "${LAUNCHABLE_STDERR}")
+
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS" YJIT_BINDGEN_DIFF_OPTS="$YJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          YJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          LIBCLANG_PATH: ${{ matrix.libclang_path }}
+          LAUNCHABLE_STDOUT: ${{ steps.launchable.outputs.stdout_report_path }}
+          LAUNCHABLE_STDERR: ${{ steps.launchable.outputs.stderr_report_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-latest
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-macos.yml b/.github/workflows/zjit-macos.yml
new file mode 100644
index 0000000000..a638907811
--- /dev/null
+++ b/.github/workflows/zjit-macos.yml
@@ -0,0 +1,214 @@
+name: ZJIT macOS
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit=dev --enable-zjit'
+            rust_version: "1.85.0"
+
+          - test_task: 'ruby'
+            hint: 'combo build test'
+            configure: '--enable-yjit --enable-zjit'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      ZJIT_RB_BUG: 1
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - name: Install libraries
+        uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - uses: taiki-e/install-action@v2
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" \
+            SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS"
+        timeout-minutes: 60
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          PRECHECK_BUNDLED_GEMS: 'no'
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: macos-14
+    needs: [make]
+    steps:
+      - run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=lobsters'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: macos-14
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/macos
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      # setup/directories set MAKEFLAGS=-j4 for macOS, which randomly fails sqlite3.gem builds
+      - name: Unset MAKEFLAGS
+        run: echo "MAKEFLAGS=" >> "$GITHUB_ENV"
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.github/workflows/zjit-ubuntu.yml b/.github/workflows/zjit-ubuntu.yml
new file mode 100644
index 0000000000..28bfec963e
--- /dev/null
+++ b/.github/workflows/zjit-ubuntu.yml
@@ -0,0 +1,267 @@
+name: ZJIT Ubuntu
+on:
+  push:
+    branches:
+      - master
+    paths-ignore:
+      - 'doc/**'
+      - '**/man/*'
+      - '**.md'
+      - '**.rdoc'
+      - '**/.document'
+      - '.*.yml'
+  pull_request:
+    types:
+      - opened
+      - synchronize
+      - reopened
+    # Do not use paths-ignore for required status checks
+    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
+  merge_group:
+
+concurrency:
+  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
+  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
+
+permissions:
+  contents: read
+
+jobs:
+  lint:
+    name: cargo clippy
+
+    runs-on: ubuntu-22.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - run: cargo clippy --all-targets --all-features
+        working-directory: zjit
+
+  make:
+    strategy:
+      fail-fast: false
+      matrix:
+        include:
+          - test_task: 'check'
+            run_opts: '--zjit-call-threshold=1'
+            specopts: '-T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'check'
+            run_opts: '--zjit-disable-hir-opt --zjit-call-threshold=1'
+            specopts: '-T --zjit-disable-hir-opt -T --zjit-call-threshold=1'
+            configure: '--enable-zjit=dev'
+
+            # The optimizer benefits from at least 1 iteration of profiling. Also, many
+            # regression tests in bootstraptest/test_yjit.rb assume call-threshold=2.
+          - test_task: 'btest'
+            run_opts: '--zjit-call-threshold=2'
+            configure: '--enable-zjit=dev'
+
+          - test_task: 'zjit-check' # zjit-test + quick feedback of test_zjit.rb
+            configure: '--enable-yjit --enable-zjit=dev'
+            rust_version: '1.85.0'
+
+          - test_task: 'zjit-bindgen'
+            hint: 'To fix: use patch in logs'
+            # Build with YJIT+ZJIT for output that works in the most number of configurations
+            configure: '--enable-zjit=dev --enable-yjit --with-gcc=clang-16'
+            clang_path: '/usr/bin/clang-16'
+            runs-on: 'ubuntu-24.04' # for clang-16
+
+          - test_task: 'test-bundled-gems'
+            configure: '--enable-zjit=dev'
+            run_opts: '--zjit-call-threshold=1'
+
+    env:
+      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
+      RUN_OPTS: ${{ matrix.run_opts }}
+      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
+      SPECOPTS: ${{ matrix.specopts }}
+      TESTOPTS: ${{ matrix.testopts }}
+      RUBY_DEBUG: ci
+      BUNDLE_JOBS: 8 # for yjit-bench
+      RUST_BACKTRACE: 1
+      ZJIT_RB_BUG: 1
+
+    runs-on: ${{ matrix.runs-on || 'ubuntu-22.04' }}
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          sparse-checkout-cone-mode: false
+          sparse-checkout: /.github
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ruby/setup-ruby@b90be12699fdfcbee4440c2bba85f6f460446bb0 # v1.279.0
+        with:
+          ruby-version: '3.1'
+          bundler: none
+
+      - uses: taiki-e/install-action@v2
+        with:
+          tool: nextest@0.9
+        if: ${{ matrix.test_task == 'zjit-check' }}
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+          dummy-files: ${{ matrix.test_task == 'check' }}
+          # Set fetch-depth: 10 so that Launchable can receive commits information.
+          fetch-depth: 10
+
+      - name: Install Rust
+        if: ${{ matrix.rust_version }}
+        run: |
+          rustup install ${{ matrix.rust_version }} --profile minimal
+          rustup default ${{ matrix.rust_version }}
+
+      - name: Install rustfmt
+        if: ${{ matrix.test_task == 'zjit-bindgen' }}
+        run: rustup component add rustfmt
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
+
+      - run: make incs
+
+      - run: make prepare-gems
+        if: ${{ matrix.test_task == 'test-bundled-gems' }}
+
+      - run: make
+
+      - name: Verify that --zjit-dump-disasm works
+        run: |
+          ./miniruby --zjit-call-threshold=1 --zjit-dump-disasm -e0 | \
+          wc -l | \
+          ruby -ne 'raise "Disassembly seems broken in dev build (output has too few lines)" unless $_.to_i > 10'
+        if: ${{ contains(matrix.configure, 'jit=dev') }}
+
+      # Check that the binary was built with ZJIT
+      - name: Check ZJIT enabled
+        run: ./miniruby --zjit -v | grep "+ZJIT"
+        if: ${{ matrix.configure != '--disable-zjit' }}
+
+      - name: Set ENV for ZJIT
+        run: |
+          echo "RUBY_CRASH_REPORT=$(pwd)/rb_crash_%p.txt" >> $GITHUB_ENV
+
+      - name: make ${{ matrix.test_task }}
+        run: |
+          set -x
+          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
+            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
+            TESTOPTS="$TESTOPTS" \
+            ZJIT_BINDGEN_DIFF_OPTS="$ZJIT_BINDGEN_DIFF_OPTS"
+        timeout-minutes: 90
+        env:
+          RUBY_TESTOPTS: '-q --tty=no'
+          EXCLUDES: '../src/test/.excludes-zjit'
+          TEST_BUNDLED_GEMS_ALLOW_FAILURES: ''
+          PRECHECK_BUNDLED_GEMS: 'no'
+          SYNTAX_SUGGEST_TIMEOUT: '5'
+          ZJIT_BINDGEN_DIFF_OPTS: '--exit-code'
+          CLANG_PATH: ${{ matrix.clang_path }}
+        continue-on-error: ${{ matrix.continue-on-test_task || false }}
+
+      - name: Dump crash logs
+        if: ${{ failure() }}
+        continue-on-error: true
+        run: |
+          tail --verbose --lines=+1 rb_crash_*.txt
+          exit 1
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ${{ matrix.test_task }} ${{ matrix.configure }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+  result:
+    if: ${{ always() }}
+    name: ${{ github.workflow }} result
+    runs-on: ubuntu-22.04
+    needs: [make]
+    steps:
+      - name: ${{ github.workflow }} jobs have failed
+        run: exit 1
+        working-directory:
+        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
+
+  # Separated from `make` job to avoid making it a required status check for now
+  ruby-bench:
+    strategy:
+      matrix:
+        include:
+          # Test --call-threshold=2 with 2 iterations in total
+          - ruby_opts: '--zjit-call-threshold=2'
+            bench_opts: '--warmup=1 --bench=1 --excludes=lobsters'
+            configure: '--enable-zjit=dev_nodebug' # --enable-zjit=dev is too slow
+
+    runs-on: ubuntu-24.04
+
+    if: >-
+      ${{!(false
+      || contains(github.event.head_commit.message, '[DOC]')
+      || contains(github.event.pull_request.title, '[DOC]')
+      || contains(github.event.pull_request.labels.*.name, 'Documentation')
+      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
+      )}}
+
+    steps:
+      - uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+
+      - uses: ./.github/actions/setup/ubuntu
+
+      - uses: ./.github/actions/setup/directories
+        with:
+          srcdir: src
+          builddir: build
+          makeup: true
+
+      - name: Run configure
+        run: ../src/configure -C --disable-install-doc --prefix="$(pwd)/install" ${{ matrix.configure }}
+
+      - run: make install
+
+      - name: Checkout ruby-bench
+        uses: actions/checkout@8e8c483db84b4bee98b60c0593521ed34d9990e8 # v6.0.1
+        with:
+          repository: ruby/ruby-bench
+          path: ruby-bench
+
+      # If you want to skip failing benchmark, consider using `--excludes`.
+      # e.g. `bench_opts: '--warmup=1 --bench=1 --excludes=railsbench,lobsters'`
+      - name: Run ruby-bench
+        run: ruby run_benchmarks.rb -e "zjit::../build/install/bin/ruby ${{ matrix.ruby_opts }}" ${{ matrix.bench_opts }}
+        working-directory: ruby-bench
+
+      - uses: ./.github/actions/slack
+        with:
+          label: ruby-bench ${{ matrix.bench_opts }} ${{ matrix.ruby_opts }}
+          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
+        if: ${{ failure() }}
+
+defaults:
+  run:
+    working-directory: build
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..6cf5fb5f32
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,280 @@
+*-*-*.def
+*-*-*.exp
+*-*-*.lib
+*.a
+*.bak
+*.bc
+*.bundle
+*.dSYM
+*.dmyh
+*.dylib
+*.elc
+*.i
+*.ii
+*.inc
+*.log
+*.o
+*.o.tmp
+*.obj
+*.old
+*.orig
+*.pch
+*.pdb
+*.rbinc
+*.rbbin
+*.rej
+*.s
+*.sav
+*.sl
+*.so
+*.so.*
+*.swp
+*.yarb
+*~
+.*.list
+.*.time
+.DS_Store
+.bundle
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+.time
+.ruby-version
+Makefile
+cygruby*.def
+extconf.h
+y.output
+y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+!misc/.vscode
+lcov*.info
+
+# /
+/*-fake.rb
+/*.dll
+/*.exe
+/*.res
+/*.pc
+/*.rc
+/*_prelude.c
+/.downloaded-cache
+/.top-enc.mk
+/build*/
+/COPYING.LIB
+/ChangeLog
+/Doxyfile
+/GNUmakefile
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/benchmark/benchmark-driver
+/beos
+/bmlog-*
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
+/coverage/.last_run.json
+/coverage/.resultset.json*
+/coverage/assets
+/coverage/index.html
+/doc/capi
+/enc.mk
+/encdb.h
+/exts.mk
+/goruby
+/id.[ch]
+/largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/probes.dmyh
+/probes.h
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/revision.tmp
+/ripper.tmp.y
+/riscos
+/rubicon
+/ruby
+/ruby-runner
+/ruby-runner.h
+/ruby-man.rd.gz
+/rubyspec_temp
+/run.gdb
+/sizes.c
+/static-ruby
+/test.rb
+/test-coverage.dat
+/tmp
+/vcpkg_installed
+/transdb.h
+/uncommon.mk
+/verconf.h
+/verconf.mk
+/web
+
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+/bin/goruby
+/bin/ruby
+
+# /benchmark/
+/benchmark/bm_require.data
+/benchmark/bmx_*.rb
+/benchmark/fasta.output.*
+/benchmark/wc.input
+
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/jis/props.h
+/enc/unicode/data
+
+# /coroutine/
+!/coroutine/**/*.s
+!/coroutine/**/*.S
+
+# /enc/trans/
+/enc/trans/*.c
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+
+# /exe/
+/exe/goruby
+/exe/ruby
+
+# /ext/
+/ext/extinit.c
+/ext/configure-ext.mk
+/ext/*/exts.mk
+
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
+
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
+
+# /ext/-test-/gems
+/ext/-test-/gems
+
+# /ext/etc/
+/ext/etc/constdefs.h
+
+# /ext/fiddle/
+/ext/fiddle/libffi-*
+
+# /ext/rbconfig/
+/ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids1.h
+/ext/ripper/.eventids2-check
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper_init.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /gems
+/gems/*.gem
+/gems/src
+/gems/*-*
+
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
+
+# /misc/
+/misc/**/__pycache__
+
+# for `make test-bundler`
+/.rspec_status
+
+# /tool/
+/tool/config.guess
+/tool/config.sub
+
+# /win32/
+/win32/*.ico
+
+
+# YJIT
+/yjit-bench
+/yjit_exit_locations.dump
+
+# Rust
+/target
+
+# /wasm/
+/wasm/tests/*.wasm
+
+# prism
+/lib/prism/compiler.rb
+/lib/prism/dispatcher.rb
+/lib/prism/dot_visitor.rb
+/lib/prism/dsl.rb
+/lib/prism/inspect_visitor.rb
+/lib/prism/mutation_compiler.rb
+/lib/prism/node.rb
+/lib/prism/reflection.rb
+/lib/prism/serialize.rb
+/lib/prism/visitor.rb
+/prism/api_node.c
+/prism/ast.h
+/prism/diagnostic.c
+/prism/diagnostic.h
+/prism/node.c
+/prism/prettyprint.c
+/prism/serialize.c
+/prism/token_type.c
+/prism/srcs.mk
+
+# tool/update-NEWS-gemlist.rb
+/bundled_gems.json
+/default_gems.json
+/gems/default_gems
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..1d61cbcad1
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,32 @@
+-bap
+-nbbb
+-nbc
+-br
+-brs
+-nbs
+-ncdb
+-nce
+-cdw
+-cli2
+-cbi2
+-ndj
+-ncs
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+-sbi4
+-nut
+-par
+
+-TID
+-TVALUE
+-Tst_data_t
+-Tst_index_t
+-Tst_table
+-Trb_data_type_t
+-TFILE
diff --git a/.mailmap b/.mailmap
new file mode 100644
index 0000000000..213a0f4916
--- /dev/null
+++ b/.mailmap
@@ -0,0 +1,431 @@
+git[bot]                                <svn-admin@ruby-lang.org>
+git[bot]                                <svn-admin@ruby-lang.org> git <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+svn[bot]                                <svn-admin@ruby-lang.org> svn <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# a_matsuda
+Akira Matsuda                           <ronnie@dio.jp>
+Akira Matsuda                           <ronnie@dio.jp> <a_matsuda@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aamine
+Minero Aoki                             <aamine@loveruby.net>
+Minero Aoki                             <aamine@loveruby.net> <aamine@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akira
+akira yamada                            <akira@ruby-lang.org>
+## akira yamada                         <akira@ruby-lang.org> <akira@rice.p.arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@arika.org>
+akira yamada                            <akira@ruby-lang.org> <akira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akiyoshi
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com>
+AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com> <akiyoshi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# akr
+Tanaka Akira                            <akr@fsij.org>
+Tanaka Akira                            <akr@fsij.org> <akr@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arai
+Koji Arai                               <jca02266@nifty.ne.jp>
+Koji Arai                               <jca02266@nifty.ne.jp> <arai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# arton
+Akio Tajima                             <artonx@yahoo.co.jp>
+Akio Tajima                             <artonx@yahoo.co.jp> <arton@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# aycabta
+aycabta                                 <aycabta@gmail.com>
+aycabta                                 <aycabta@gmail.com> <aycabta@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ayumin
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com>
+Ayumu AIZAWA                            <ayumu.aizawa@gmail.com> <ayumin@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# azav
+Alexander Zavorine                      <alexandre.zavorine@nokia.com>
+Alexander Zavorine                      <alexandre.zavorine@nokia.com> <azav@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# charliesome
+Charlie Somerville                      <charliesome@ruby-lang.org>
+Charlie Somerville                      <charliesome@ruby-lang.org> <charliesome@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dave
+Dave Thomas                             <dave@pragprog.com>
+Dave Thomas                             <dave@pragprog.com> <dave@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# davidflanagan
+David Flanagan                          <davidflanagan@ruby-lang.org>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@think32>
+David Flanagan                          <davidflanagan@ruby-lang.org> <david@davidflanagan.com>
+David Flanagan                          <davidflanagan@ruby-lang.org> <davidflanagan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# dblack
+David A. Black                          <dblack@rubypal.com>
+David A. Black                          <dblack@rubypal.com> <dblack@wobblini.net>
+David A. Black                          <dblack@rubypal.com> <dblack@superlink.net>
+David A. Black                          <dblack@rubypal.com> <dblack@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# drbrain
+Eric Hodel                              <drbrain@segment7.net>
+Eric Hodel                              <drbrain@segment7.net> <drbrain@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# duerst
+Martin Dürst                            <duerst@it.aoyama.ac.jp>
+Martin Dürst                            <duerst@it.aoyama.ac.jp> <duerst@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eban
+WATANABE Hirofumi                       <eban@ruby-lang.org>
+WATANABE Hirofumi                       <eban@ruby-lang.org> <eban@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# emboss
+Martin Bosslet                          <Martin.Bosslet@gmail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <Martin.Bosslet@googlemail.com>
+Martin Bosslet                          <Martin.Bosslet@gmail.com> <emboss@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# eregon
+Benoit Daloze                           <eregontp@gmail.com>
+Benoit Daloze                           <eregontp@gmail.com> <eregon@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# evan
+Evan Phoenix                            <evan@ruby-lang.org>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@fallingsnow.net>
+Evan Phoenix                            <evan@ruby-lang.org> <evan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# glass
+Masaki Matsushita                       <glass.saga@gmail.com>
+Masaki Matsushita                       <glass.saga@gmail.com> <glass@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gogotanaka
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org>
+Kazuki Tanaka                           <gogotanaka@ruby-lang.org> <gogotanaka@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoken
+Kentaro Goto                            <gotoken@gmail.com>
+Kentaro Goto                            <gotoken@gmail.com> <gotoken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gotoyuzo
+GOTOU Yuuzou                            <gotoyuzo@notwork.org>
+GOTOU Yuuzou                            <gotoyuzo@notwork.org> <gotoyuzo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# gsinclair
+Gavin Sinclair                          <gsinclair@soyabean.com.au>
+Gavin Sinclair                          <gsinclair@soyabean.com.au> <gsinclair@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# H_Konishi
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp>
+KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp> <H_Konishi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# headius
+Charles Oliver Nutter                   <headius@headius.com>
+Charles Oliver Nutter                   <headius@headius.com> <headius@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hone
+Terence Lee                             <hone@heroku.com>
+Terence Lee                             <hone@heroku.com> <hone@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# hsbt
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org>
+Hiroshi SHIBATA                         <hsbt@ruby-lang.org> <hsbt@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# iwamatsu
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org>
+Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org> <iwamatsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jeg2
+James Edward Gray II                    <james@graysoftinc.com>
+James Edward Gray II                    <james@graysoftinc.com> <jeg2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# jim
+Jim Weirich                             <jim@tardis.local>
+Jim Weirich                             <jim@tardis.local> <jim@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# k0kubun
+Takashi Kokubun                         <takashikkbn@gmail.com>
+Takashi Kokubun                         <takashikkbn@gmail.com> <k0kubun@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kanemoto
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org>
+Yutaka Kanemoto                         <kanemoto@ruby-lang.org> <kanemoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# katsu
+UENO Katsuhiro                          <katsu@blue.sky.or.jp>
+UENO Katsuhiro                          <katsu@blue.sky.or.jp> <katsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kazu
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com>
+Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com> <kazu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# keiju
+Keiju Ishitsuka                         <keiju@ishitsuka.com>
+Keiju Ishitsuka                         <keiju@ishitsuka.com> <keiju@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# knu
+Akinori MUSHA                           <knu@iDaemons.org>
+Akinori MUSHA                           <knu@iDaemons.org> <knu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ko1
+Koichi Sasada                           <ko1@atdot.net>
+Koichi Sasada                           <ko1@atdot.net> <ko1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosaki
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com>
+KOSAKI Motohiro                         <kosaki.motohiro@gmail.com> <kosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kosako
+K.Kosako                                <sndgk393@ybb.ne.jp>
+K.Kosako                                <sndgk393@ybb.ne.jp> <kosako@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kou
+Sutou Kouhei                            <kou@clear-code.com>
+Sutou Kouhei                            <kou@clear-code.com> <kou@cozmixng.org>
+Sutou Kouhei                            <kou@clear-code.com> <kou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# kouji
+Kouji Takao                             <kouji.takao@gmail.com>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@takao7.net>
+Kouji Takao                             <kouji.takao@gmail.com> <kouji@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ksaito
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp>
+Kazuo Saito                             <ksaito@uranus.dti.ne.jp> <ksaito@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ktsj
+Kazuki Tsujimoto                        <kazuki@callcc.net>
+Kazuki Tsujimoto                        <kazuki@callcc.net> <ktsj@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# luislavena
+Luis Lavena                             <luislavena@gmail.com>
+Luis Lavena                             <luislavena@gmail.com> <luislavena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mame
+Yusuke Endoh                            <mame@ruby-lang.org>
+## Yusuke Endoh                         <mame@ruby-lang.org> <mame@tsg.ne.jp>
+Yusuke Endoh                            <mame@ruby-lang.org> <mame@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# marcandre
+Marc-Andre Lafortune                    <github@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca>
+Marc-Andre Lafortune                    <ruby-core@marc-andre.ca> <marcandre@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# matz
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@ruby-lang.org>
+Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# michal
+Michal Rokos                            <michal@ruby-lang.org>
+Michal Rokos                            <michal@ruby-lang.org> <michal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mneumann
+Michael Neumann                         <mneumann@ruby-lang.org>
+Michael Neumann                         <mneumann@ruby-lang.org> <mneumann@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# mrkn
+Kenta Murata                            <mrkn@mrkn.jp>
+Kenta Murata                            <mrkn@mrkn.jp> <muraken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+Kenta Murata                            <mrkn@mrkn.jp> <3959+mrkn@users.noreply.github.com>
+Kenta Murata                            <mrkn@mrkn.jp> <mrkn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagachika
+nagachika                               <nagachika@ruby-lang.org>
+nagachika                               <nagachika@ruby-lang.org> <nagachika@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nagai
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp>
+Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp> <nagai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nahi
+Hiroshi Nakamura                        <nahi@ruby-lang.org>
+Hiroshi Nakamura                        <nahi@ruby-lang.org> <nahi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nari
+Narihiro Nakamura                       <authornari@gmail.com>
+Narihiro Nakamura                       <authornari@gmail.com> <nari@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# naruse
+NARUSE, Yui                             <naruse@airemix.jp>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@ruby-lang.org>
+NARUSE, Yui                             <naruse@airemix.jp> <naruse@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ngoto
+Naohisa Goto                            <ngotogenome@gmail.com>
+Naohisa Goto                            <ngotogenome@gmail.com> <ngoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# nobu
+Nobuyoshi Nakada                        <nobu@ruby-lang.org>
+Nobuyoshi Nakada                        <nobu@ruby-lang.org> <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# normal
+Eric Wong                               <normal@ruby-lang.org>
+Eric Wong                               <normal@ruby-lang.org> <e@80x24.org>
+Eric Wong                               <normal@ruby-lang.org> <normal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ntalbott
+Nathaniel Talbott                       <ntalbott@ruby-lang.org>
+Nathaniel Talbott                       <ntalbott@ruby-lang.org> <ntalbott@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ocean
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp>
+Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp> <ocean@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# odaira
+Rei Odaira                              <rodaira@us.ibm.com>
+Rei Odaira                              <rodaira@us.ibm.com> <Rei.Odaira@gmail.com>
+Rei Odaira                              <rodaira@us.ibm.com> <odaira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# okkez
+okkez                                   <okkez000@gmail.com>
+okkez                                   <okkez000@gmail.com> <okkez@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# rhe
+Kazuki Yamaguchi                        <k@rhe.jp>
+Kazuki Yamaguchi                        <k@rhe.jp> <rhe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ryan
+Ryan Davis                              <ryand-github@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryand-ruby@zenspider.com>
+Ryan Davis                              <ryand-github@zenspider.com> <ryan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# samuel
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz>
+Samuel Williams                         <samuel.williams@oriontransfer.co.nz> <samuel@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# seki
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp>
+Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp> <seki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ser
+Sean Russell                            <ser@germane-software.com>
+Sean Russell                            <ser@germane-software.com> <ser@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shigek
+Shigeo Kobayashi                        <shigek@ruby-lang.org>
+Shigeo Kobayashi                        <shigek@ruby-lang.org> <shigek@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shirosaki
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com>
+Hiroshi Shirosaki                       <h.shirosaki@gmail.com> <shirosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sho-h
+Sho Hashimoto                           <sho-h@ruby-lang.org>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@netlab.jp>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho.hsmt@gmail.com>
+Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shugo
+Shugo Maeda                             <shugo@ruby-lang.org>
+Shugo Maeda                             <shugo@ruby-lang.org> <shugo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# shyouhei
+卜部昌平                                    <shyouhei@ruby-lang.org>
+卜部昌平                                    <shyouhei@ruby-lang.org> <shyouhei@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# siena
+Siena.                                  <siena@faculty.chiba-u.jp>
+Siena.                                  <siena@faculty.chiba-u.jp> <siena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sonots
+sonots                                  <sonots@gmail.com>
+sonots                                  <sonots@gmail.com> <sonots@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# sorah
+Sorah Fukumori                          <her@sorah.jp>
+Sorah Fukumori                          <her@sorah.jp> <sorah@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# stomar
+Marcus Stollsteimer                     <sto.mar@web.de>
+Marcus Stollsteimer                     <sto.mar@web.de> <stomar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# suke
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp>
+Masaki Suketa                           <masaki.suketa@nifty.ne.jp> <suke@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadd
+Tadashi Saito                           <tad.a.digger@gmail.com>
+Tadashi Saito                           <tad.a.digger@gmail.com> <tadd@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tadf
+Tadayoshi Funaba                        <tadf@dotrb.org>
+Tadayoshi Funaba                        <tadf@dotrb.org> <tadf@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# takano32
+TAKANO Mitsuhiro                        <takano32@gmail.com>
+TAKANO Mitsuhiro                        <takano32@gmail.com> <takano32@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tarui
+Masaya Tarui                            <tarui@ruby-lang.org>
+Masaya Tarui                            <tarui@ruby-lang.org> <tarui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# technorama
+Technorama Ltd.                         <oss-ruby@technorama.net>
+Technorama Ltd.                         <oss-ruby@technorama.net> <technorama@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tenderlove
+Aaron Patterson                         <tenderlove@ruby-lang.org>
+Aaron Patterson                         <tenderlove@ruby-lang.org> <tenderlove@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# tmm1
+Aman Gupta                              <ruby@tmm1.net>
+Aman Gupta                              <ruby@tmm1.net> <tmm1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ts
+Guy Decoux                              <ts@moulon.inra.fr>
+Guy Decoux                              <ts@moulon.inra.fr> <ts@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# ttate
+Takaaki Tateishi                        <ttate@ttsky.net>
+## Takaaki Tateishi                     <ttate@ttsky.net> <ttate@kt.jaist.ac.jp>
+Takaaki Tateishi                        <ttate@ttsky.net> <ttate@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# uema2
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp>
+Takaaki Uematsu                         <uema2x@jcom.home.ne.jp> <uema2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# usa
+U.Nakamura                              <usa@ruby-lang.org>
+U.Nakamura                              <usa@ruby-lang.org> <usa@garbagecollect.jp>
+U.Nakamura                              <usa@ruby-lang.org> <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wakou
+Wakou Aoyama                            <wakou@ruby-lang.org>
+Wakou Aoyama                            <wakou@ruby-lang.org> <wakou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wanabe
+wanabe                                  <s.wanabe@gmail.com>
+wanabe                                  <s.wanabe@gmail.com> <wanabe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# watson1978
+Watson                                  <watson1978@gmail.com>
+Watson                                  <watson1978@gmail.com> <watson1978@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# wew
+William Webber                          <william@williamwebber.com>
+William Webber                          <william@williamwebber.com> <wew@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# why
+why the lucky stiff                     <why@ruby-lang.org>
+why the lucky stiff                     <why@ruby-lang.org> <why@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# xibbar
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org>
+Takeyuki FUJIOKA                        <xibbar@ruby-lang.org> <xibbar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yugui
+Yuki Yugui Sonoda                       <yugui@yugui.jp>
+Yuki Yugui Sonoda                       <yugui@yugui.jp> <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yui-knk
+yui-knk                                 <spiketeika@gmail.com>
+yui-knk                                 <spiketeika@gmail.com> <yui-knk@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# yuki
+Yuki Nishijima                          <yuki24@hey.com>
+Yuki Nishijima                          <yuki24@hey.com> <mail@yukinishijima.net>
+Yuki Nishijima                          <yuki24@hey.com> <yuki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zsombor
+Dee Zsombor                             <zsombor@ruby-lang.org>
+Dee Zsombor                             <zsombor@ruby-lang.org> <zsombor@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
+
+# zzak
+zzak                                    <zzakscott@gmail.com>
+zzak                                    <zzakscott@gmail.com> <zzak@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
diff --git a/.rdoc_options b/.rdoc_options
new file mode 100644
index 0000000000..89265cafd4
--- /dev/null
+++ b/.rdoc_options
@@ -0,0 +1,39 @@
+---
+page_dir: doc
+charset: UTF-8
+encoding: UTF-8
+main_page: index.md
+title: Documentation for Ruby development version
+visibility: :private
+rdoc_include:
+- doc
+
+exclude:
+- \.gemspec\z
+- lib/set/subclass_compatible.rb
+
+autolink_excluded_words:
+- Box
+- Class
+- Method
+- Module
+- Process
+- RDoc
+- Ruby
+- Set
+- ZJIT
+- YJIT
+
+canonical_root: https://docs.ruby-lang.org/en/master
+
+footer_content:
+  Ruby:
+    Documentation: index.html
+    Official Website: https://www.ruby-lang.org/
+    Playground: https://ruby.github.io/play-ruby/
+  Resources:
+    GitHub: https://github.com/ruby/ruby
+    Issue Tracker: https://bugs.ruby-lang.org/projects/ruby-master/issues
+    RubyGems: https://rubygems.org/
+  Community:
+    X: https://x.com/rubylangorg
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..66d93598aa
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+   notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+   notice, this list of conditions and the following disclaimer in the
+   documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/C-IF b/C-IF
deleted file mode 100644
index 5c66a20ddc..0000000000
--- a/C-IF
+++ /dev/null
@@ -1,204 +0,0 @@
-.\" C-IF -  -*- Text -*- created at: Tue Oct 12 14:15:00 JST 1993
-
-Ruby-C ���󥿡��ե�����
-
-��
-
- VALUE
-
-   Ruby���֥������Ȥ�ɽ�����뷿. ɬ�פ˱����ƥ��㥹�Ȥ����Ѥ���. �Ȥ�
-   ���߷���ɽ������C�η���ruby.h�˵��Ҥ��Ƥ���R�ǻϤޤ빽¤�ΤǤ���.
-   VALUE���򤳤��˥��㥹�Ȥ��뤿���R�ǻϤޤ빽¤��̾��������ʸ����
-   ����̾���Υޥ������Ѱդ���Ƥ���.
-
-�ѿ������
-
- Qnil
-
-   ���: nil���֥�������
-
- Qself
-
-   �ѿ�: ���ߤ�self���֥������Ȥ���. ���̤˥᥽�åɤˤ�self��ؤ�����
-   ��Ϳ������Τ�, �����ѿ��˥�����������ɬ�פϤʤ�. �����ѿ����ͤ�
-   �ѹ�������ϰʸ��self���ͤ��Τ�Τ��Ѥ�äƤ��ޤ��Τ�, ���̤ʻ���
-   ���ʤ��¤��������ƤϤʤ�ʤ�.
-
- TRUE
-
-   ���: t���֥�������(���Υǥե������)
-
- FALSE
-
-   ���: nil���֥�������
-
-���饹���⥸�塼�����
-
- VALUE rb_define_class(char *name, VALUE super)
-
-   super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹���������.
-
- VALUE rb_define_module(char *name)
-
-   ������Ruby�⥸�塼����������.
-
- void rb_include_module(VALUE class, VALUE module)
-
-   �⥸�塼��򥤥󥯥롼�ɤ���. class�����Ǥ�module�򥤥󥯥롼�ɤ���
-   ������ˤϲ��⤷�ʤ�(¿�ť��󥯥롼�ɤζػ�).
-
-����ѿ�
-
- void rb_define_variable(char *name, VALUE *var,
-			 VALUE (*get_hook), VALUE (*set_hook)(), void *data)
-
-   Ruby��C�ȤǶ�ͭ���륰�����Х��ѿ����������. get_hook��Qnil�Ǥʤ���, 
-   �ѿ����Ȥκݤ�get_hook�˥��åȤ��줿�ؿ����ƤФ��. set_hook��Qnil 
-   �Ǥʤ����ˤ������λ���set_hook���ƤФ��. hook�ؿ��ˤ��ѿ�̾�򼨤� 
-   ID��(set hook�ξ�翷�����ͤ�)�ȤȤ��data��Ϳ�����ǡ����������Ȥ�
-   ���Ϥ����.
-
-   �ѿ�̾��`$'�ǻϤޤ�ʤ����ˤϼ�ưŪ���ɲä����. �ѿ�̾�Ȥ���ruby��
-   ���̻ҤȤ��Ƶ�����ʤ�ʸ��(�㤨��` ')��ޤ���ˤ�ruby�ץ�����फ
-   �饢�������Ǥ��ʤ��ʤ�.
-
- void rb_global_variable(VALUE *var)
-
-   GC�Τ��ᡤRuby�ץ�����फ��ϥ�����������ʤ���, Ruby���֥�������
-   ��ޤ�����ѿ���ޡ�������.
-
- void rb_read_only_hook()
-
-   �ɤ߽Ф����Ѥ��ѿ��Τ����set_hook�ؿ�. �ͤ����ꤷ�褦�Ȥ�����㳰
-   ��ȯ��������.
-
-���饹���
-
- void rb_define_const(VALUE class, char *name, VALUE val)
-
-   ���饹������������.
-
-�᥽�å����
-
- rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-   �᥽�åɤ��������. argc��self����������ο�. argc��-1�λ�, �ؿ���
-   �ϰ����ο�(self��ޤޤʤ�)����1����, �������������2�����Ȥ������
-   ��Ϳ������(��3������self). argc��-2�λ�, ������self, args(args��
-   ������ޤ�ruby������)�Ȥ���������Ϳ������.
-
- rb_define_single_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-   �ðۥ᥽�åɤ��������. ������rb_define_method()��Ʊ��.
-
- rb_scan_args(int atgc, VALUE *argv, char *fmt, ...)
-
-   argc,argv������Ϳ����줿������ʬ�򤹤�. fmt��ɬ�ܰ����ο�, �ղð�
-   ���ο�, �Ĥ�ΰ��������뤫����ꤹ��ʸ�����, "��������*"�Ȥ�������
-   �Ǥ���.  2 ���ܤο�����"*"�Ϥ��줾���ά��ǽ�Ǥ���. ɬ�ܰ��������
-   ��ʤ�����0����ꤹ�롥��3�����ʹߤ��ѿ��ؤΥݥ��󥿤�, ��������
-   ���Ǥ������ѿ��˳�Ǽ�����. �ղð������б����������Ϳ�����Ƥ���
-   �������ѿ���Qnil�����������.
-
-Ruby�᥽�åɸƤӽФ�
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-   �᥽�åɸƤӽФ�. ʸ���󤫤�mid�����뤿��ˤ�rb_intern()��Ȥ�.
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-   �᥽�åɸƤӽФ�. ������argc,argv�������Ϥ���
-
- VALUE rb_eval_string(char *str)
-
-   ʸ�����ruby�ȥ�����ץȤ��ƥ���ѥ��롦�¹Ԥ��롥
-
- ID rb_intern(char *name)
-
-   ʸ������б�����ID���֤�.
-
- char *rb_id2name(ID id)
-
-   ID���б�����ʸ������֤�(�ǥХå���).
-
- char *rb_class2name(VALUE class)
-
-   class��̾�����֤�(�ǥХå���). class��̾��������ʤ����ˤ�, ���ֶ�
-   ��̾������ĥ��饹��̾�����֤�.
-
-���󥹥����ѿ�
-
- VALUE rb_iv_get(VALUE obj, char *name)
-
-   obj�Υ��󥹥����ѿ����ͤ�����. `@'�ǻϤޤ�ʤ����󥹥����ѿ��� 
-   Ruby�ץ�����फ�饢�������Ǥ��ʤ�.
-
- VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
-
-   obj�Υ��󥹥����ѿ���val�˥��åȤ���.
-
-���湽¤
-
- VALUE rb_iterate(VALUE (*func1)(), char *arg1, VALUE (*func2)(), char *arg2)
-
-   func2��֥��å��Ȥ������ꤷ, func1�򥤥ƥ졼���Ȥ��ƸƤ�.  func1��
-   �� arg1�������Ȥ����Ϥ���, func2�ˤ���1�����˥��ƥ졼������Ϳ�����
-   ����, ��2������arg2���Ϥ����.
- 
- VALUE rb_yield(VALUE val)
-
-   val���ͤȤ��ƥ��ƥ졼���֥��å���ƤӽФ�.
-
- VALUE rb_resque(VALUE (*func1)(), char *arg1, VALUE (*func2)(), char *arg2)
-
-   �ؿ�func1��arg1������˸ƤӽФ�. func1�μ¹�����㳰��ȯ����������
-   �� func2��arg2������Ȥ��ƸƤ�. ����ͤ��㳰��ȯ�����ʤ��ä�����
-   func1�������, �㳰��ȯ���������ˤ�func2������ͤǤ���.
-
- VALUE rb_ensure(VALUE (*func1)(), char *arg1, VALUE (*func2)(), char *arg2)
-
-   �ؿ�func1��arg1������Ȥ��Ƽ¹Ԥ�, �¹Խ�λ��(���Ȥ��㳰��ȯ������
-   ��) func2��arg2������Ȥ��Ƽ¹Ԥ���. ����ͤ�func1������ͤǤ���(��
-   ����ȯ�������������ʤ�).
-
-�㳰�����顼
-
- void Warning(char *fmt, ...)
-
-   ɸ�२�顼���Ϥ˷ٹ�����ɽ������. ������printf()��Ʊ��.
-
- void Fail(char *fmt, ...)
-
-   �㳰��ȯ��������. ������printf()��Ʊ��.
-
- void Fatal(char *fmt, ...)
-
-   ��̿Ū�㳰��ȯ��������. �̾���㳰�����ϹԤʤ�줺, ���󥿡��ץ꥿
-   ����λ����(������ensure�ǻ��ꤵ�줿�����ɤϽ�λ���˼¹Ԥ����).
-
- void Bug(char *fmt, ...)
-
-   ���󥿡��ץ꥿�ʤɥץ������ΥХ��Ǥ���ȯ������Ϥ��Τʤ������λ�
-   �Ƥ�. ���󥿡��ץ꥿�ϥ�������פ�ľ���˽�λ����. �㳰�����ϰ��ڹ�
-   �ʤ��ʤ�.
-
-ruby�ν�������¹�
-
- void ruby_init(int argc, char **argv, char **envp)
-
-  ruby���󥿥ץ꥿�ν������Ԥʤ�.
-
- void ruby_run()
-
-  ruby���󥿥ץ꥿��¹Ԥ���.
-
- void ruby_script(char *name)
-
-  ruby�Υ�����ץ�̾($0)�����ꤹ��.
-
-/*
- * Local variables:
- * fill-column: 70
- * end:
- */
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
new file mode 100644
index 0000000000..35e79dd3b9
--- /dev/null
+++ b/CONTRIBUTING.md
@@ -0,0 +1 @@
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
diff --git a/COPYING b/COPYING
new file mode 100644
index 0000000000..428ce03ed7
--- /dev/null
+++ b/COPYING
@@ -0,0 +1,58 @@
+{日本語}[rdoc-ref:COPYING.ja]
+
+Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
+
+1. You may make and give away verbatim copies of the source form of the
+   software without restriction, provided that you duplicate all of the
+   original copyright notices and associated disclaimers.
+
+2. You may modify your copy of the software in any way, provided that
+   you do at least ONE of the following:
+
+   a. place your modifications in the Public Domain or otherwise
+      make them Freely Available, such as by posting said
+      modifications to Usenet or an equivalent medium, or by allowing
+      the author to include your modifications in the software.
+
+   b. use the modified software only within your corporation or
+      organization.
+
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
+
+   d. make other distribution arrangements with the author.
+
+3. You may distribute the software in object code or binary form,
+   provided that you do at least ONE of the following:
+
+   a. distribute the binaries and library files of the software,
+      together with instructions (in the manual page or equivalent)
+      on where to get the original distribution.
+
+   b. accompany the distribution with the machine-readable source of
+      the software.
+
+   c. give non-standard binaries non-standard names, with
+      instructions on where to get the original software distribution.
+
+   d. make other distribution arrangements with the author.
+
+4. You may modify and include the part of the software into any other
+   software (possibly commercial).  But some files in the distribution
+   are not written by the author, so that they are not under these terms.
+
+   For the list of those files and their copying conditions, see the
+   file LEGAL.
+
+5. The scripts and library files supplied as input to or produced as
+   output from the software do not automatically fall under the
+   copyright of the software, but belong to whomever generated them,
+   and may be sold commercially, and may be aggregated with this
+   software.
+
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+   IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+   WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+   PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
new file mode 100644
index 0000000000..5de2dbcc8f
--- /dev/null
+++ b/COPYING.ja
@@ -0,0 +1,53 @@
+{English}[rdoc-ref:COPYING]
+
+本プログラムはフリーソフトウェアです．2-clause BSDL
+または以下に示す条件で本プログラムを再配布できます
+2-clause BSDLについてはBSDLファイルを参照して下さい．
+
+1. 複製は制限なく自由です．
+
+2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+   自由に変更できます．
+
+   a.  ネットニューズにポストしたり，作者に変更を送付する
+       などの方法で，変更を公開する．
+
+   b.  変更した本プログラムを自分の所属する組織内部だけで
+       使う．
+
+   c.  変更点を明示したうえ，ソフトウェアの名前を変更する．
+       そのソフトウェアを配布する時には変更前の本プログラ
+       ムも同時に配布する．または変更前の本プログラムのソー
+       スの入手法を明示する．
+
+   d.  その他の変更条件を作者と合意する．
+
+3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+   ルしたオブジェクトコードや実行形式でも配布できます．
+
+   a.  バイナリを受け取った人がソースを入手できるように，
+       ソースの入手法を明示する．
+
+   b.  機械可読なソースコードを添付する．
+
+   c.  変更を行ったバイナリは名前を変更したうえ，オリジナ
+       ルのソースコードの入手法を明示する．
+
+   d.  その他の配布条件を作者と合意する．
+
+4. 他のプログラムへの引用はいかなる目的であれ自由です．た
+   だし，本プログラムに含まれる他の作者によるコードは，そ
+   れぞれの作者の意向による制限が加えられる場合があります．
+
+   それらファイルの一覧とそれぞれの配布条件などに付いては
+   LEGALファイルを参照してください．
+
+5. 本プログラムへの入力となるスクリプトおよび，本プログラ
+   ムからの出力の権利は本プログラムの作者ではなく，それぞ
+   れの入出力を生成した人に属します．また，本プログラムに
+   組み込まれるための拡張ライブラリについても同様です．
+
+6. 本プログラムは無保証です．作者は本プログラムをサポート
+   する意志はありますが，プログラム自身のバグあるいは本プ
+   ログラムの実行などから発生するいかなる損害に対しても責
+   任を持ちません．
diff --git a/Cargo.lock b/Cargo.lock
new file mode 100644
index 0000000000..9a4b2ebbba
--- /dev/null
+++ b/Cargo.lock
@@ -0,0 +1,193 @@
+# This file is automatically @generated by Cargo.
+# It is not intended for manual editing.
+version = 3
+
+[[package]]
+name = "capstone"
+version = "0.13.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "015ef5d5ca1743e3f94af9509ba6bd2886523cfee46e48d15c2ef5216fd4ac9a"
+dependencies = [
+ "capstone-sys",
+ "libc",
+]
+
+[[package]]
+name = "capstone-sys"
+version = "0.17.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "2267cb8d16a1e4197863ec4284ffd1aec26fe7e57c58af46b02590a0235809a0"
+dependencies = [
+ "cc",
+ "libc",
+]
+
+[[package]]
+name = "cc"
+version = "1.2.18"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "525046617d8376e3db1deffb079e91cef90a89fc3ca5c185bbf8c9ecdd15cd5c"
+dependencies = [
+ "shlex",
+]
+
+[[package]]
+name = "console"
+version = "0.15.8"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0e1f83fc076bd6dd27517eacdf25fef6c4dfe5f1d7448bafaaf3a26f13b5e4eb"
+dependencies = [
+ "encode_unicode",
+ "lazy_static",
+ "libc",
+ "windows-sys",
+]
+
+[[package]]
+name = "encode_unicode"
+version = "0.3.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "a357d28ed41a50f9c765dbfe56cbc04a64e53e5fc58ba79fbc34c10ef3df831f"
+
+[[package]]
+name = "insta"
+version = "1.43.1"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "154934ea70c58054b556dd430b99a98c2a7ff5309ac9891597e339b5c28f4371"
+dependencies = [
+ "console",
+ "once_cell",
+ "similar",
+]
+
+[[package]]
+name = "jit"
+version = "0.1.0"
+
+[[package]]
+name = "lazy_static"
+version = "1.5.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "bbd2bcb4c963f2ddae06a2efc7e9f3591312473c50c6685e1f298068316e66fe"
+
+[[package]]
+name = "libc"
+version = "0.2.171"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "c19937216e9d3aa9956d9bb8dfc0b0c8beb6058fc4f7a4dc4d850edf86a237d6"
+
+[[package]]
+name = "once_cell"
+version = "1.21.3"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "42f5e15c9953c5e4ccceeb2e7382a716482c34515315f7b03532b8b4e8393d2d"
+
+[[package]]
+name = "ruby"
+version = "0.0.0"
+dependencies = [
+ "yjit",
+ "zjit",
+]
+
+[[package]]
+name = "shlex"
+version = "1.3.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0fda2ff0d084019ba4d7c6f371c95d8fd75ce3524c3cb8fb653a3023f6323e64"
+
+[[package]]
+name = "similar"
+version = "2.4.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32fea41aca09ee824cc9724996433064c89f7777e60762749a4170a14abbfa21"
+
+[[package]]
+name = "windows-sys"
+version = "0.52.0"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "282be5f36a8ce781fad8c8ae18fa3f9beff57ec1b52cb3de0789201425d9a33d"
+dependencies = [
+ "windows-targets",
+]
+
+[[package]]
+name = "windows-targets"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "9b724f72796e036ab90c1021d4780d4d3d648aca59e491e6b98e725b84e99973"
+dependencies = [
+ "windows_aarch64_gnullvm",
+ "windows_aarch64_msvc",
+ "windows_i686_gnu",
+ "windows_i686_gnullvm",
+ "windows_i686_msvc",
+ "windows_x86_64_gnu",
+ "windows_x86_64_gnullvm",
+ "windows_x86_64_msvc",
+]
+
+[[package]]
+name = "windows_aarch64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "32a4622180e7a0ec044bb555404c800bc9fd9ec262ec147edd5989ccd0c02cd3"
+
+[[package]]
+name = "windows_aarch64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "09ec2a7bb152e2252b53fa7803150007879548bc709c039df7627cabbd05d469"
+
+[[package]]
+name = "windows_i686_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "8e9b5ad5ab802e97eb8e295ac6720e509ee4c243f69d781394014ebfe8bbfa0b"
+
+[[package]]
+name = "windows_i686_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "0eee52d38c090b3caa76c563b86c3a4bd71ef1a819287c19d586d7334ae8ed66"
+
+[[package]]
+name = "windows_i686_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "240948bc05c5e7c6dabba28bf89d89ffce3e303022809e73deaefe4f6ec56c66"
+
+[[package]]
+name = "windows_x86_64_gnu"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "147a5c80aabfbf0c7d901cb5895d1de30ef2907eb21fbbab29ca94c5b08b1a78"
+
+[[package]]
+name = "windows_x86_64_gnullvm"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "24d5b23dc417412679681396f2b49f3de8c1473deb516bd34410872eff51ed0d"
+
+[[package]]
+name = "windows_x86_64_msvc"
+version = "0.52.6"
+source = "registry+https://github.com/rust-lang/crates.io-index"
+checksum = "589f6da84c646204747d1270a2a5661ea66ed1cced2631d546fdfb155959f9ec"
+
+[[package]]
+name = "yjit"
+version = "0.1.0"
+dependencies = [
+ "capstone",
+ "jit",
+]
+
+[[package]]
+name = "zjit"
+version = "0.0.1"
+dependencies = [
+ "capstone",
+ "insta",
+ "jit",
+]
diff --git a/Cargo.toml b/Cargo.toml
new file mode 100644
index 0000000000..521129d92d
--- /dev/null
+++ b/Cargo.toml
@@ -0,0 +1,60 @@
+# This is the root Cargo [workspace](https://doc.rust-lang.org/cargo/reference/workspaces.html)
+# and the root package for all the rust code that are statically linked into ruby. Rust tooling
+# limitations means all Rust code need to share a single archive library (staticlib) at the
+# integration point with non-rust code. (See rustlang/rust#44322 and #104707 for a taste of
+# the linking challenges.)
+#
+# Do not add required dependencies. This is a policy that helps downstream consumers and give
+# us tight control over what we ship. All of the optional dependencies are used exclusively
+# during development.
+#
+# Release builds avoid Cargo entirely because offline builds can fail even when none of the
+# optional dependencies are built (rust-lang/cargo#10352).
+
+[workspace]
+members = ["zjit", "yjit", "jit"]
+
+[package]
+name = "ruby"
+version = "0.0.0"
+edition = "2024"
+rust-version = "1.85.0"
+publish = false # Don't publish to crates.io
+
+[dependencies]
+yjit = { path = "yjit", optional = true }
+zjit = { path = "zjit", optional = true }
+
+[lib]
+crate-type = ["staticlib"]
+path = "ruby.rs"
+
+[features]
+disasm = ["yjit?/disasm", "zjit?/disasm"]
+runtime_checks = ["yjit?/runtime_checks", "zjit?/runtime_checks"]
+yjit = [ "dep:yjit" ]
+zjit = [ "dep:zjit" ]
+
+[profile.dev]
+opt-level = 0
+debug = true
+debug-assertions = true
+overflow-checks = true
+
+[profile.dev_nodebug]
+inherits = "dev"
+
+[profile.stats]
+inherits = "release"
+
+[profile.release]
+# NOTE: --enable-yjit and zjit builds use `rustc` without going through Cargo. You
+# might want to update the `rustc` invocation if you change this profile.
+opt-level = 3
+# The extra robustness that comes from checking for arithmetic overflow is
+# worth the performance cost for the compiler.
+overflow-checks = true
+# Generate debug info
+debug = true
+# Use ThinLTO. Much smaller output for a small amount of build time increase.
+lto = "thin"
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index 78d6488e6d..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,306 +0,0 @@
-Fri Feb 24 13:15:43 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* version 0.68
-
-Thu Feb 23 11:19:19 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* eval.c: resque���self���ͤ��ְ�äƤ�����
-
-	* eval.c(rb_clear_cache): ����å���Υ��ꥢ��˺�줬���ä���
-
-	* eval.c: ����Υ������פ򥯥饹�����Ū�������פ��ѹ������������
-	  ��äơ��ðۥ᥽�åɤ���ϻ��Ȥ��������ϡ��쥷���ФΥ��饹�Ǥ�
-	  �ʤ���������줿�������פΥ��饹������Ȥʤ롥
-
-Wed Feb 22 00:51:38 1995  Yukihiro Matsumoto  (matz@dyna)
-
-	* regex.c: ignorecase������ɽ���Υ���ѥ������˻��ꤷ�ʤ���������
-	  ư��ʤ���������
-
-	* string.c(toupper,tolower): bug fix.
-
-	* ENV,VERSION: readonly�ѿ���������ء�
-
-Tue Feb 21 18:56:56 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* io.c(STDIN, STDOUT, STDERR): ����Ȥ�����������ޤǤ�$stdin�ʤ�
-	  �Ͼ���ʤ��ʤ뤫���Τ�ʤ���
-
-	* io.c(select): bug fix.
-
-	* version 0.67
-
-Mon Feb 20 16:10:14 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y(yylex): �����`%���̻�'���顤��1ʸ������ʸ���μ��̻Ҥ���
-	  ��������ˤȤ�ʤ����饹������Ȥʤä���
-
-	* eval.c: ���饹������self�����饹���������the_class���ä���
-
-	* variable.c(rb_name_class): ���饹̾�򥤥󥹥����ѿ��˳�Ǽ���롥
-
-Thu Feb 16 15:36:17 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: BLOCK��brace��ɽ������ʸˡ���ѹ�������Τ��äƤߤ롥
-	  ML���󼨤��Ƥߤ뤬ȿ�����ʤ���
-
-	* object.c(do,forever): �ʤ�������
-
-Wed Feb 15 13:20:49 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* re.c(new): ��2������Ϳ�����ơ�����nil�Ǥʤ��Ȥ��������ꤹ���
-	  ����(������nil�λ��ˤ������ԤʤäƤ���)��
-
-	* parse.y(parse_regexp): ����ɽ����ƥ�����ʸ����ʸ����̵�뤹��
-	  ���ɤ�������Ǥ���褦�ˡ�
-
-Tue Feb 14 00:55:33 1995  Yukihiro Matsumoto  (matz@dyna)
-
-	* parse.y: (compexpr) -> (expr).
-
-Fri Feb 10 16:30:00 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* ruby.c(load_file): script���ɤ߹��������"#!"�β��Ϥ�Ԥ��褦�ˡ�
-
-	* ruby.c(readin): �ե������ɤ߹��߻�����Ƭ��"#!"�����ꡤruby�˰���
-	  ��Ϳ�����Ƥ���С����ΰ�����ͭ���ˤʤ롥
-
-	* parse.y(yylex): �����ȹԤν��꤬`\'�Ǥ��ä��������ιԤ˷�³��
-	  �Ƥ���Ȥߤʤ��褦�ˤ�����
-
-Thu Feb  9 16:18:37 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* version 0.66
-
-	* parse.y: protect��begin���ѹ���begin..end���㳰���������Ǥʤ���
-	  ʸ��̤Ȥ��Ƥ�Ư�����Ȥˤʤä���
-
-Wed Feb  1 19:48:24 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* version 0.65
-
-	* string.c(str_replace): �֤�������ʸ�����Ĺ���������������ꥳ
-	  �ԡ��򤷤ʤ���
-
-	* string.c(rindex): ��������
-
-Mon Jan 30 11:23:05 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y(value_expr): if�Υ����å����ɲá�
-
-	* gc.c(gc_mark): free cell�ΰ����˥Х���
-
-	* parse.y: ʸˡ���ѹ�(��ꥷ��ץ��)���㳰�򸺤餷����
-
-Thu Jan 26 00:52:55 1995  Yukihiro Matsumoto  (matz@dyna)
-
-	* parse.y: �����Ȥ���Ϣ��������֤����Ȥ��Ǥ���褦�ˡ����ξ�硤
-	  Ϣ�������ƥ�뤬�ǽ������Ȥʤ롥
-
-	* parse.y: ���󻲾Ȥ�`[]'�⤬���Ǥ�褤���Ȥˤ�����
-
-Tue Jan 24 14:45:15 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* class.c(rb_include_module): `-v'����ꤷ�����ˤ�include�����⥸�塼
-	  ��ȥ��饹��������ͤ��Ƥ��ʤ��������å����롥
-
-Mon Jan 23 10:42:09 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y(rb_class2name): �᥿���饹�˴ؤ���bug fix.
-
-	* dict.c: Dict[..]�Ǽ���������������褦�ˡ�
-
-	* array.c: Array[..]������������������褦�ˡ�
-
-	* parse.y: �����ɽ���Ȥ���{a,b,..}�Ȥ�������������褦�ˡ�
-
-Fri Jan 20 10:28:38 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* re.c(Regexp.quote): ����ɽ���򥨥������פ���᥽�åɡ�
-
-	* ̵�̤�rb_intern()�򸺤餷����
-
-	* parse.y: `!', `!=', `!~'���ü�黻�Ҥˤ��롥��äƤ����Ϻ����
-	  �Ǥ��ʤ��ʤä���
-
-Wed Jan 18 13:20:41 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: ʸˡ������(unless,until��ʤ�����)��
-
-Tue Jan 17 11:11:27 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* eval.c: def�ǥ᥽�åɺ�������ˤϥ����ѡ����饹�Υ᥽�åɤβĻ�
-	  ����Ѿ����롥�ǽ������λ��Ϻ��ޤǤ�Ʊ���ǥե����(�ȥåץ��
-	  ��Ǵؿ�Ū�����饹�������̾�᥽�å�)��
-
-	* object.c(Class::new): ���֥������Ȥ��������˴ؿ�Ū��
-	  ���å�init_object��ɬ���ƤФ��褦���ѹ���
-
-	* eval.c: ̤����Υ᥽�åɤ��Ф���unknown�᥽�åɤ��ƤФ��褦��
-	  �ʤä������顼ɽ�������ޤǤ�Ʊ���ˤʤ�褦��env��Ĵ�ᤷ�Ƥ��롥
-
-Fri Jan 13 14:40:30 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* gc.c: gc��㴳�񤭴����������������������ޤ��Ѳ��Ϥʤ��ä��褦����
-
-	* parse.y(yylex): symbol��\sym����:sym���ѹ�������
-
-Thu Jan 12 01:39:28 1995  Yukihiro Matsumoto  (matz@dyna)
-
-	* eval.c: �����ؿ� rb_eval_string()��
-
-	* gc.c: gc_mark()�������Ƶ�����
-
-	* variable.c(rb_ivar_{get,set}): ���󥹥����ѿ��Υ������������
-	  �����å���­��ʤ��ä���
-
-	* variable.c: ���饹����ȥ��󥹥����ѿ��ǥϥå���ơ��֥��ͭ
-	  ����褦�ˤ�����
-
-	* ruby.h: iv_tbl��RBasic����RObject��RClass�ذ�ư����������ˤ�ꡤ
-	  Object��Class,Module�������󥹥����ѿ�����Ƥʤ��ʤ롥�������
-	  ���Ψ�ϼ㴳���夹�롥
-
-Tue Jan 10 00:58:20 1995  Yukihiro Matsumoto  (matz@dyna)
-
-	* 0.64 released
-
-	* eval.c: �쥷���ФȰ����Ͼ��iter�ǤϤʤ���
-
-	* cons.c(aref,aset): negative offset���
-
-Mon Jan  9 14:40:39 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: foo{..}�η����ˤ����ơ�foo����������ѿ��䥯�饹̾�Ǥ�
-	  �ʤ��������ʤ��δؿ����᥽�åɸƤӽФ��Ȥߤʤ��褦�ˤ�����
-
-	* list.c -> cons.c: ̾���ѹ�(���饹̾��)��
-
-	* list.c: a::b::c::nil��ꥹ��(a b c)�Ȥߤʤ�lisp�������顤a::b::c
-	  ��ꥹ��(a b c)�Ȥߤʤ�ruby�������ѹ���[], []=, each�⤽��˲��
-	  �������ͤȤ��롥
-
-	* list.c: cons�ڥ��Ȥ��Ƥε�ǽ��Ĵ�������ѹ���
-
-Sat Jan  7 01:26:26 1995  Yukihiro Matsumoto  (matz@dyna)
-
-	* eval.c: �����������Զ�罤����
-
-	* eval.c(masign): ¿�������������ꥹ�Ȥ�Ȥ��褦�ˤ�����
-
-	* list.c: assoc��2���Ǥ����󤫤�List(CONS�ڥ�)���ѹ�������
-
-Fri Jan  6 13:42:12 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: a[b]+=c��a.b+=c�ʤɤμ������������ǡ�a��b��2��ɾ������
-	  ���ʤä���
-
-	* eval.c: iterator����ΥХ��ե��å�����
-
-	* list.c: List���饹���ߡ�
-
-Thu Jan  5 13:55:00 1995  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: SCOPE�Υ���꡼����ʤ�������
-
-	* eval.c: built-in�᥽�åɤؤΰ����ΰ����Ϥ������ѹ����ơ��������
-	  �����򸺤餷����
-
-	* re.c: match-data������������뤳�Ȥ��᤿��`$~'�򥢥�����������
-	  ��on-demand���������롥
-
-	* string.c etc: ��ɬ�פ�memmove��memcpy���ִ���
-
-	* parse.y: =~, !~�������Ѥ�����Τǥ���ѥ������Ÿ���Ǥ��ʤ���
-
-Tue Jan  3 02:04:36 1995  Yukihiro Matsumoto  (matz@dyna)
-
-	* eval.c: rest������bug fix.
-
-	* eval.c,gc.c: scope�򥪥֥������Ȥˤ�����
-
-	* eval.c: env��scope�ΰ������ѹ�������
-
-Wed Dec 28 09:46:57 1994  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: eval�ǥ��������ѿ����ɲä��줿�����б�������
-
-	* parse.y: �黻�Ҥ�ޤ�alias��bug fix.
-
-Tue Dec 27 16:45:20 1994  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: def A B��alias A B���ѹ���
-
-	* eval.c: alias�ط���bug������node�򥪥֥������Ȳ���������enbug��
-	  ���褦����
-
-	* signal.c: �����ƥॳ����κ������ߤ᤿��
-
-	* io.c(select): write/except�Υե饰����˥Х���
-
-	* Makefile.in: static link�ѥ��ץ�����Make�ѿ��Ȥ�����Ω��������
-
-Tue Dec 20 00:46:19 1994  Yukihiro Matsumoto  (matz@dyna)
-
-	* 0.63 released
-
-	* eval.c(rb_call): super�θƤӽФ�������롥argc, argv�������˺��
-	  �Ƥ�����
-
-	* parse.y(read_escape): Ÿ�����顼��
-
-	* variable.c: ����Ѥߤ��ѿ���hook���ѹ����ʤ��褦�ˡ�
-
-Mon Dec 19 12:01:10 1994  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y(cond): ��Ｐ�����������֤��줿��硤`-v'���ץ����Ƿ�
-	  �𤬽Ф�褦�ˡ�
-
-	* parse.y(**): �Ѿ�黻��`**'��ͥ���̤�ñ��黻�Ҥ��⤯������
-
-	* parse.y(and,or): ͥ���̤��㤤�黻��`and', `or'.
-
-	* 0.62 released.
-
-	* eval.c: ��ɬ�פˤʤä�PUSH_ENV, POP_ENV�򸺤餷����
-
-	* env.h: ENVION����self��Ϥ�������PUSH_ENV��super�ν����Τ������
-	  ���Ѥ��뤳�Ȥˤ�����
-
-	* eval.c: �����Υ��֥������Ȳ����٤��ʤä��¹�®�٤��Ȥ��ᤷ����
-
-Mon Dec 17 23:01:10 1994  Yukihiro Matsumoto  (matz@ix-02)
-
-	* eval.c: env.{argv,argc}��scope.local_vars�Υ��֥������Ȳ���
-
-	* eval.c: 1�����������ʣ��Block�����������Ȥ��ΥХ�������
-
-Fri Dec 16 15:52:06 1994  Yukihiro Matsumoto  (matz@ix-02)
-
-	* parse.y: `&&'��`||'��ξ�դϤ��ĤǤ��Ｐ�Ȥ�����
-
-Thu Dec 15 00:16:04 1994  Yukihiro Matsumoto  (matz@dyna)
-
-	* eval.c(Block): Block���֥������Ȥ�¸���
-
-	* node.h: NODE_QLIST�Ϥʤ��ʤä���
-
-	* eval.c(rb_call): �����ؤ�������̾���ǰ�Ĥ�����������Τ���ơ�
-	  ���٤˥��ԡ�����褦�ˤ�����
-
-	* eval.c(rb_call): ruby�ǵ��Ҥ��줿�᥽�åɤؤΰ����Ϥ���inline����
-
-	* eval.c: ���ƥ졼��Ƚ����������̽񤭴�������Ŭ�ڤʥ��ƥ졼���Ƥ�
-	  �Ф���ʤ��������㤨�С�[foo(),bar()]{i|baz(i)}�פ�foo��bar�⥤
-	  �ƥ졼���Ȥ��ƸƤӽФ���*�ʤ�*��
-
-	* eval.c(rb_call): SCOPE������inline�����᥽�åɸƤӽФ��μ㴳�ι�
-	  ®����
-
-Wed Dec 14 18:09:33 1994  Yukihiro Matsumoto  (matz@ix-02)
-
-	* node.h: node�⥪�֥������Ȥˤ��롥��ä�GC�Dz������롥
-
-Thu Dec  8 14:17:29 1994  Yukihiro Matsumoto  (matz@ix-02)
-
-	* 0.60 released - alpha test baseline.
diff --git a/FAQ b/FAQ
deleted file mode 100644
index eaa9c86056..0000000000
--- a/FAQ
+++ /dev/null
@@ -1,65 +0,0 @@
-.\" FAQ -  -*- Indented-Text -*- created at: Tue Jan  4 12:48:12 JST 1994
-�����Ruby�˴ؤ���FAQ(Frequently Asked Question)��ޤȤ᤿��ΤǤ�.
-Emacs�Ǥ��Υե�����򸫤Ƥ�����ˤ�M-2 C-x $�Ǽ������ʬ�������ɤळ
-�Ȥ��Ǥ��ޤ�. C-x $�����Ƥ��ɤ���֤��᤻�ޤ�.
-------------------------------
-1) Ruby��̾�Τ�ͳ���
-    
-    Ruby�ϲ�����ά�ΤǤϤʤ�, �֤����Ф�̾����Ȥä�̾�դ����ޤ���. 
-    perl(pearl��6���������)�μ����ܻؤ�(Ruby��7���������)�Ȥ�����̣
-    ������ޤ�. �������������ͤ����ΤǤ��ä��ߤ����Ȥ����ꤤ��ޤޤ�
-    �Ƥ��ޤ�.
-------------------------------
-2) Ruby���ƶ�������������?
-   
-    Ruby�θ�����ͤ�C, Perl, Eiffel�γƸ���ˤ��ν�˱ƶ�������Ƥ���
-    ��. ����¾�˱ƶ������������Ȥ��Ƥ�tcl, AWK, bourne shell, CLU,
-    Icon, Sather, Smalltalk, Emacs Lisp�ʤɤ�����ޤ�.
-------------------------------
-3) Ruby����ħ��?
-    
-    �ʲ��˲վ��ˤ��ޤ�.
-    
-      + ���󥿥ץ꥿�Ǥ���, ��ڤ˥ץ������Ǥ���.
-      + �ѿ�������פ�ʤ�.
-      + �ե�����䥹�ȥ꡼��ʤɤؤ�UNIXŪ������ñ�ˤǤ���.
-      + �Х��ʥ�ե�����ⰷ����.
-      + ������Ȥ������֥������Ȼظ�����Ǥ���.
-      + �ðۥ᥽�åɤε�ǽ���󶡤���Ƥ���.
-      + �⥸�塼��ˤ�뵡ǽ�ζ�ͭ���Ǥ���.
-      + �㳰������ǽ������.
-      + GC������Τǥ�������򵤤ˤ��ʤ��ƺѤ�.
-      + ���������������.
-      + ʣ���ʥǡ�����¤�ⰷ����.
-      + �����ʥߥå������ɤ򥵥ݡ��Ȥ���(�����ƥ�ˤ��).
-    
-    �դ˷�����
-    
-      - ȯŸ�Ӿ�ǵ�ǽ�����ʤ�.
-      - �ǥХå���(�ޤ�)�ʤ�.
-      - �٤�.
-      
-    ���ȤǤ��礦��.
-------------------------------
-4) Ruby���ѿ�������ʤ����ȤΥ��åȤ�?
-    
-    �����ѿ����ɤΥ������פ�°���뤫�����ܤ�ʬ����Τ�, �ץ��������ɤ�
-    �פ�, ���򤷰פ����������Ȥ�����Υ��åȤǤ�. �ޤ��ȡ�����Υ�����
-    �̤�����Τǽ񤭰פ�, ��ڤ��ˤ�׸����ޤ�.
-------------------------------
-5) Ruby��Perl�ΰ㤤��?
-    
-    Ruby��Perl�ϥƥ���������ͥ�줿������ץȸ���Ǥ���Ȥ�������, ��
-    �С������ϰϤ��᤯, �츫����ȥ饤�Х�˸����ޤ�. �Τ���Ruby���߷�
-    �ˤ����ơ�Perl�ˤǤ��뤳�ȤϤǤ���褦�ˡפȤ������Ȥ�, ��Ĥν���
-    ����ɸ�Ǥ���. ������, Ruby�ο�����Ū�Ϥ����ޤǤ�ּ�ڤʥ��֥�����
-    �Ȼظ�����פǤ���, �ޤ�, Ruby�߷פ�3����ɸ�Ǥ���, ��ǽ�����������
-    ��ĥ���η�̤Ȥ���, Ruby��Perl�Ȥϰۤʤ����ˤʤ�ޤ���.
-    
-    Ruby��Perl�ۤɡֲ��Ǥ⤢��פǤϤ���ޤ���, �ۤȤ�ɤξ��Perl��
-    �����®�٤��٤��Ǥ�. ������, Ruby�Υ��֥������Ȼظ���ǽ��Perl�Ǥ�
-    ��­�Ǥ��ʤ��ͤ����˥��ԡ��뤹��Ȼפ��ޤ�.
-------------------------------
-Local variables:
-fill-column: 70
-end:
diff --git a/GPL b/GPL
new file mode 100644
index 0000000000..d159169d10
--- /dev/null
+++ b/GPL
@@ -0,0 +1,339 @@
+                    GNU GENERAL PUBLIC LICENSE
+                       Version 2, June 1991
+
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+                            Preamble
+
+  The licenses for most software are designed to take away your
+freedom to share and change it.  By contrast, the GNU General Public
+License is intended to guarantee your freedom to share and change free
+software--to make sure the software is free for all its users.  This
+General Public License applies to most of the Free Software
+Foundation's software and to any other program whose authors commit to
+using it.  (Some other Free Software Foundation software is covered by
+the GNU Lesser General Public License instead.)  You can apply it to
+your programs, too.
+
+  When we speak of free software, we are referring to freedom, not
+price.  Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+this service if you wish), that you receive source code or can get it
+if you want it, that you can change the software or use pieces of it
+in new free programs; and that you know you can do these things.
+
+  To protect your rights, we need to make restrictions that forbid
+anyone to deny you these rights or to ask you to surrender the rights.
+These restrictions translate to certain responsibilities for you if you
+distribute copies of the software, or if you modify it.
+
+  For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must give the recipients all the rights that
+you have.  You must make sure that they, too, receive or can get the
+source code.  And you must show them these terms so they know their
+rights.
+
+  We protect your rights with two steps: (1) copyright the software, and
+(2) offer you this license which gives you legal permission to copy,
+distribute and/or modify the software.
+
+  Also, for each author's protection and ours, we want to make certain
+that everyone understands that there is no warranty for this free
+software.  If the software is modified by someone else and passed on, we
+want its recipients to know that what they have is not the original, so
+that any problems introduced by others will not reflect on the original
+authors' reputations.
+
+  Finally, any free program is threatened constantly by software
+patents.  We wish to avoid the danger that redistributors of a free
+program will individually obtain patent licenses, in effect making the
+program proprietary.  To prevent this, we have made it clear that any
+patent must be licensed for everyone's free use or not licensed at all.
+
+  The precise terms and conditions for copying, distribution and
+modification follow.
+
+                    GNU GENERAL PUBLIC LICENSE
+   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+  0. This License applies to any program or other work which contains
+a notice placed by the copyright holder saying it may be distributed
+under the terms of this General Public License.  The "Program", below,
+refers to any such program or work, and a "work based on the Program"
+means either the Program or any derivative work under copyright law:
+that is to say, a work containing the Program or a portion of it,
+either verbatim or with modifications and/or translated into another
+language.  (Hereinafter, translation is included without limitation in
+the term "modification".)  Each licensee is addressed as "you".
+
+Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope.  The act of
+running the Program is not restricted, and the output from the Program
+is covered only if its contents constitute a work based on the
+Program (independent of having been made by running the Program).
+Whether that is true depends on what the Program does.
+
+  1. You may copy and distribute verbatim copies of the Program's
+source code as you receive it, in any medium, provided that you
+conspicuously and appropriately publish on each copy an appropriate
+copyright notice and disclaimer of warranty; keep intact all the
+notices that refer to this License and to the absence of any warranty;
+and give any other recipients of the Program a copy of this License
+along with the Program.
+
+You may charge a fee for the physical act of transferring a copy, and
+you may at your option offer warranty protection in exchange for a fee.
+
+  2. You may modify your copy or copies of the Program or any portion
+of it, thus forming a work based on the Program, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+    a) You must cause the modified files to carry prominent notices
+    stating that you changed the files and the date of any change.
+
+    b) You must cause any work that you distribute or publish, that in
+    whole or in part contains or is derived from the Program or any
+    part thereof, to be licensed as a whole at no charge to all third
+    parties under the terms of this License.
+
+    c) If the modified program normally reads commands interactively
+    when run, you must cause it, when started running for such
+    interactive use in the most ordinary way, to print or display an
+    announcement including an appropriate copyright notice and a
+    notice that there is no warranty (or else, saying that you provide
+    a warranty) and that users may redistribute the program under
+    these conditions, and telling the user how to view a copy of this
+    License.  (Exception: if the Program itself is interactive but
+    does not normally print such an announcement, your work based on
+    the Program is not required to print an announcement.)
+
+These requirements apply to the modified work as a whole.  If
+identifiable sections of that work are not derived from the Program,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works.  But when you
+distribute the same sections as part of a whole which is a work based
+on the Program, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Program.
+
+In addition, mere aggregation of another work not based on the Program
+with the Program (or with a work based on the Program) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+  3. You may copy and distribute the Program (or a work based on it,
+under Section 2) in object code or executable form under the terms of
+Sections 1 and 2 above provided that you also do one of the following:
+
+    a) Accompany it with the complete corresponding machine-readable
+    source code, which must be distributed under the terms of Sections
+    1 and 2 above on a medium customarily used for software interchange; or,
+
+    b) Accompany it with a written offer, valid for at least three
+    years, to give any third party, for a charge no more than your
+    cost of physically performing source distribution, a complete
+    machine-readable copy of the corresponding source code, to be
+    distributed under the terms of Sections 1 and 2 above on a medium
+    customarily used for software interchange; or,
+
+    c) Accompany it with the information you received as to the offer
+    to distribute corresponding source code.  (This alternative is
+    allowed only for noncommercial distribution and only if you
+    received the program in object code or executable form with such
+    an offer, in accord with Subsection b above.)
+
+The source code for a work means the preferred form of the work for
+making modifications to it.  For an executable work, complete source
+code means all the source code for all modules it contains, plus any
+associated interface definition files, plus the scripts used to
+control compilation and installation of the executable.  However, as a
+special exception, the source code distributed need not include
+anything that is normally distributed (in either source or binary
+form) with the major components (compiler, kernel, and so on) of the
+operating system on which the executable runs, unless that component
+itself accompanies the executable.
+
+If distribution of executable or object code is made by offering
+access to copy from a designated place, then offering equivalent
+access to copy the source code from the same place counts as
+distribution of the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+  4. You may not copy, modify, sublicense, or distribute the Program
+except as expressly provided under this License.  Any attempt
+otherwise to copy, modify, sublicense or distribute the Program is
+void, and will automatically terminate your rights under this License.
+However, parties who have received copies, or rights, from you under
+this License will not have their licenses terminated so long as such
+parties remain in full compliance.
+
+  5. You are not required to accept this License, since you have not
+signed it.  However, nothing else grants you permission to modify or
+distribute the Program or its derivative works.  These actions are
+prohibited by law if you do not accept this License.  Therefore, by
+modifying or distributing the Program (or any work based on the
+Program), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Program or works based on it.
+
+  6. Each time you redistribute the Program (or any work based on the
+Program), the recipient automatically receives a license from the
+original licensor to copy, distribute or modify the Program subject to
+these terms and conditions.  You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties to
+this License.
+
+  7. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License.  If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Program at all.  For example, if a patent
+license would not permit royalty-free redistribution of the Program by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Program.
+
+If any portion of this section is held invalid or unenforceable under
+any particular circumstance, the balance of the section is intended to
+apply and the section as a whole is intended to apply in other
+circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system, which is
+implemented by public license practices.  Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+  8. If the distribution and/or use of the Program is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Program under this License
+may add an explicit geographical distribution limitation excluding
+those countries, so that distribution is permitted only in or among
+countries not thus excluded.  In such case, this License incorporates
+the limitation as if written in the body of this License.
+
+  9. The Free Software Foundation may publish revised and/or new versions
+of the General Public License from time to time.  Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+Each version is given a distinguishing version number.  If the Program
+specifies a version number of this License which applies to it and "any
+later version", you have the option of following the terms and conditions
+either of that version or of any later version published by the Free
+Software Foundation.  If the Program does not specify a version number of
+this License, you may choose any version ever published by the Free Software
+Foundation.
+
+  10. If you wish to incorporate parts of the Program into other free
+programs whose distribution conditions are different, write to the author
+to ask for permission.  For software which is copyrighted by the Free
+Software Foundation, write to the Free Software Foundation; we sometimes
+make exceptions for this.  Our decision will be guided by the two goals
+of preserving the free status of all derivatives of our free software and
+of promoting the sharing and reuse of software generally.
+
+                            NO WARRANTY
+
+  11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
+FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
+OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
+PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
+OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE RISK AS
+TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.  SHOULD THE
+PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
+REPAIR OR CORRECTION.
+
+  12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
+REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
+OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
+TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
+YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+                     END OF TERMS AND CONDITIONS
+
+            How to Apply These Terms to Your New Programs
+
+  If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+  To do so, attach the following notices to the program.  It is safest
+to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+    <one line to give the program's name and a brief idea of what it does.>
+    Copyright (C) <year>  <name of author>
+
+    This program is free software; you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 2 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License along
+    with this program; if not, write to the Free Software Foundation, Inc.,
+    51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
+
+Also add information on how to contact you by electronic and paper mail.
+
+If the program is interactive, make it output a short notice like this
+when it starts in an interactive mode:
+
+    Gnomovision version 69, Copyright (C) year name of author
+    Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+    This is free software, and you are welcome to redistribute it
+    under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License.  Of course, the commands you use may
+be called something other than `show w' and `show c'; they could even be
+mouse-clicks or menu items--whatever suits your program.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the program, if
+necessary.  Here is a sample; alter the names:
+
+  Yoyodyne, Inc., hereby disclaims all copyright interest in the program
+  `Gnomovision' (which makes passes at compilers) written by James Hacker.
+
+  <signature of Ty Coon>, 1 April 1989
+  Ty Coon, President of Vice
+
+This General Public License does not permit incorporating your program into
+proprietary programs.  If your program is a subroutine library, you may
+consider it more useful to permit linking proprietary applications with the
+library.  If this is what you want to do, use the GNU Lesser General
+Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..35a8e75876
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,7 @@
+#
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
+# So all tests will cause failure.
+#
diff --git a/LEGAL b/LEGAL
new file mode 100644
index 0000000000..2777aa2c14
--- /dev/null
+++ b/LEGAL
@@ -0,0 +1,1300 @@
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
+
+All the files in this distribution are covered under either the Ruby's
+license (see the file COPYING) or public-domain except some files
+mentioned below.
+
+[addr2line.c]
+
+  A part of this file is from FreeBSD.
+
+  >>>
+    Copyright (c) 1986, 1988, 1991, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    (c) UNIX System Laboratories, Inc.
+
+    All or some portions of this file are derived from material licensed
+    to the University of California by American Telephone and Telegraph
+    Co. or Unix System Laboratories, Inc. and are reproduced herein with
+    the permission of UNIX System Laboratories, Inc.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    4. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+
+
+[ccan/build_assert/build_assert.h]
+[ccan/check_type/check_type.h]
+[ccan/container_of/container_of.h]
+[ccan/str/str.h]
+
+  These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
+
+[ccan/list/list.h]
+
+  This file is licensed under the {MIT License}[rdoc-ref:@MIT+License].
+
+[coroutine]
+
+  Unless otherwise specified, these files are licensed under the
+  {MIT License}[rdoc-ref:@MIT+License].
+
+[include/ruby/onigmo.h]
+[include/ruby/oniguruma.h]
+[regcomp.c]
+[regenc.c]
+[regenc.h]
+[regerror.c]
+[regexec.c]
+[regint.h]
+[regparse.c]
+[regparse.h]
+[enc/ascii.c]
+[enc/big5.c]
+[enc/cp949.c]
+[enc/emacs_mule.c]
+[enc/encdb.c]
+[enc/euc_jp.c]
+[enc/euc_kr.c]
+[enc/euc_tw.c]
+[enc/gb18030.c]
+[enc/gb2312.c]
+[enc/gbk.c]
+[enc/iso_8859_1.c]
+[enc/iso_8859_10.c]
+[enc/iso_8859_11.c]
+[enc/iso_8859_13.c]
+[enc/iso_8859_14.c]
+[enc/iso_8859_15.c]
+[enc/iso_8859_16.c]
+[enc/iso_8859_2.c]
+[enc/iso_8859_3.c]
+[enc/iso_8859_4.c]
+[enc/iso_8859_5.c]
+[enc/iso_8859_6.c]
+[enc/iso_8859_7.c]
+[enc/iso_8859_8.c]
+[enc/iso_8859_9.c]
+[enc/koi8_r.c]
+[enc/koi8_u.c]
+[enc/shift_jis.c]
+[enc/unicode.c]
+[enc/us_ascii.c]
+[enc/utf_16be.c]
+[enc/utf_16le.c]
+[enc/utf_32be.c]
+[enc/utf_32le.c]
+[enc/utf_8.c]
+[enc/windows_1251.c]
+[enc/windows_31j.c]
+
+  Onigmo (Oniguruma-mod) LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    Copyright (c) 2011-2014::  K.Takata  <kentkt AT csc DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  Oniguruma LICENSE
+
+  >>>
+    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+  * https://github.com/k-takata/Onigmo/
+  * https://github.com/kkos/oniguruma
+  * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+    When this software is partly used or it is distributed with Ruby,
+    this of Ruby follows the license of Ruby.
+
+[enc/windows_1250.c]
+[enc/windows_1252.c]
+
+  >>>
+    Copyright (c) 2006-2007::  Byte      <byte AT mail DOT kna DOT ru>
+                               K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/cesu_8.c]
+[enc/windows_1253.c]
+[enc/windows_1254.c]
+[enc/windows_1257.c]
+
+  >>>
+    Copyright (c) 2002-2007::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[enc/trans/GB/GB12345%UCS.src]
+[enc/trans/GB/UCS%GB12345.src]
+[enc/trans/GB/GB2312%UCS.src]
+[enc/trans/GB/UCS%GB2312.src]
+
+  These files have this explanatory texts.
+
+  >>>
+    This mapping data was created from files provided by Unicode, Inc.
+    (The Unicode Consortium). The files were used to create a product supporting
+    Unicode, as explicitly permitted in the files' copyright notices.
+    Please note that Unicode, Inc. never made any claims as to fitness of these
+    files for any particular purpose, and has ceased to publish the files many
+    years ago.
+
+[enc/trans/JIS/JISX0201-KANA%UCS.src]
+[enc/trans/JIS/JISX0208\@1990%UCS.src]
+[enc/trans/JIS/JISX0212%UCS.src]
+[enc/trans/JIS/UCS%JISX0201-KANA.src]
+[enc/trans/JIS/UCS%JISX0208@1990.src]
+[enc/trans/JIS/UCS%JISX0212.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    © 2015 Unicode®, Inc.
+
+    For terms of use, see http://www.unicode.org/terms_of_use.html
+
+[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
+[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
+[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    Copyright (C) 2006:: Project X0213, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
+[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
+[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
+
+  These files are copyrighted as the following.
+
+  >>>
+    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
+    Copyright (C) 2001:: I'O, All Rights Reserved.
+    You can use, modify, distribute this table freely.
+
+[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
+[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
+
+  >>>
+    Copyright (C) 2001-2005:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+[enc/trans/ucm/windows-950-2000.ucm]
+[enc/trans/ucm/windows-950_hkscs-2001.ucm]
+
+  >>>
+    Copyright (C) 2001-2002:: International Business Machines
+                              Corporation and others.  All Rights Reserved.
+
+
+[configure]
+
+  This file is free software.
+
+  >>>
+    Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
+
+    This configure script is free software; the Free Software Foundation
+    gives unlimited permission to copy, distribute and modify it.
+
+[tool/config.guess]
+[tool/config.sub]
+
+  As long as you distribute these files with the file configure, they
+  are covered under the Ruby's license.
+
+  >>>
+    Copyright 1992-2018:: Free Software Foundation, Inc.
+
+    This file is free software; you can redistribute it and/or modify it
+    under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 3 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful, but
+    WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+    General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program; if not, see <https://www.gnu.org/licenses/>.
+
+    As a special exception to the GNU General Public License, if you
+    distribute this file as part of a program that contains a
+    configuration script generated by Autoconf, you may include it under
+    the same distribution terms that you use for the rest of that
+    program.  This Exception is an additional permission under section 7
+    of the GNU General Public License, version 3 ("GPLv3").
+
+[tool/lib/test/*]
+[tool/lib/core_assertions.rb]
+
+  Some of methods on these files are based on MiniTest 4. MiniTest 4 is
+  distributed under the MIT License.
+
+  >>>
+    Copyright (c) Ryan Davis, seattle.rb
+
+    Permission is hereby granted, free of charge, to any person obtaining
+    a copy of this software and associated documentation files (the
+    'Software'), to deal in the Software without restriction, including
+    without limitation the rights to use, copy, modify, merge, publish,
+    distribute, sublicense, and/or sell copies of the Software, and to
+    permit persons to whom the Software is furnished to do so, subject to
+    the following conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+    MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+    IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+    CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+    TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+    SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+[parse.c]
+[parse.h]
+
+  These files are licensed under the GPL, but are incorporated into Ruby and
+  redistributed under the terms of the Ruby license, as permitted by the
+  exception to the GPL below.
+
+  >>>
+    Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+    As a special exception, you may create a larger work that contains
+    part or all of the Bison parser skeleton and distribute that work
+    under terms of your choice, so long as that work isn't itself a
+    parser generator using the skeleton or a modified version thereof
+    as a parser skeleton.  Alternatively, if you modify or redistribute
+    the parser skeleton itself, you may (at your option) remove this
+    special exception, which will cause the skeleton and the resulting
+    Bison output files to be licensed under the GNU General Public
+    License without this special exception.
+
+    This special exception was added by the Free Software Foundation in
+    version 2.2 of Bison.
+
+[missing/dtoa.c]
+
+  This file is under these licenses.
+
+  >>>
+    Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose without fee is hereby granted, provided that this entire notice
+    is included in all copies of any software which is or includes a copy
+    or modification of this software and in all copies of the supporting
+    documentation for such software.
+
+    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
+  >>>
+    Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
+                              All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[win32/win32.c]
+[include/ruby/win32.h]
+
+  You can apply the Artistic License to these files. (or GPL,
+  alternatively)
+
+  >>>
+    Copyright (c) 1993:: Intergraph Corporation
+
+    You may distribute under the terms of either the GNU General Public
+    License or the Artistic License, as specified in the perl README file.
+
+[missing/mt19937.c]
+
+  This file is under the new-style BSD license.
+
+  >>>
+    A C-program for MT19937, with initialization improved 2002/2/10.::
+    Coded by Takuji Nishimura and Makoto Matsumoto.
+
+    This is a faster version by taking Shawn Cokus's optimization,
+    Matthe Bellew's simplification, Isaku Wada's real version.
+
+    Before using, initialize the state by using init_genrand(seed)
+    or init_by_array(init_key, key_length).
+
+    Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
+                                All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    3. The names of its contributors may not be used to endorse or promote
+       products derived from this software without specific prior written
+       permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
+    "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+    LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+    A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL THE COPYRIGHT OWNER OR
+    CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+    PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF
+    LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
+    NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
+    SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+
+    Any feedback is very welcome.
+    http://www.math.keio.ac.jp/matumoto/emt.html
+    email: matumoto@math.keio.ac.jp
+
+  The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
+
+[missing/procstat_vm.c]
+
+  This file is under the new-style BSD license.
+
+  >>>
+    Copyright (c) 2007:: Robert N. M. Watson
+                         All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+[vsnprintf.c]
+
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+
+  >>>
+    Copyright (c) 1990, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+[st.c]
+[strftime.c]
+[include/ruby/st.h]
+[missing/acosh.c]
+[missing/alloca.c]
+[missing/erf.c]
+[missing/hypot.c]
+[missing/lgamma_r.c]
+[missing/memcmp.c]
+[missing/memmove.c]
+[missing/strchr.c]
+[missing/strerror.c]
+[missing/strstr.c]
+[missing/tgamma.c]
+[ext/date/date_strftime.c]
+[ext/digest/sha1/sha1.c]
+[ext/digest/sha1/sha1.h]
+
+  These files are all under public domain.
+
+[missing/crypt.c]
+
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+
+  >>>
+    Copyright (c) 1989, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Tom Truscott.
+
+[missing/setproctitle.c]
+
+  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+
+  >>>
+    Copyright 2003:: Damien Miller
+    Copyright (c) 1983, 1995-1997:: Eric P. Allman
+    Copyright (c) 1988, 1993::
+    The Regents of the University of California.  All rights reserved.
+
+[missing/strlcat.c]
+[missing/strlcpy.c]
+
+  These files are under an ISC-style license.
+
+  >>>
+    Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose with or without fee is hereby granted, provided that the above
+    copyright notice and this permission notice appear in all copies.
+
+    THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+    WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+    MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+    ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+    WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+    ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+    OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+
+[missing/langinfo.c]
+
+  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+  Ruby uses a modified version. The file contains the following
+  author/copyright notice:
+
+  >>>
+    Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
+    Permission to use, copy, modify, and distribute this software
+    for any purpose and without fee is hereby granted. The author
+    disclaims all warranties with regard to this software.
+
+[ext/digest/md5/md5.c]
+[ext/digest/md5/md5.h]
+
+  These files are under the following license.  Ruby uses modified
+  versions of them.
+
+  >>>
+    Copyright (C) 1999, 2000:: Aladdin Enterprises.  All rights reserved.
+
+    This software is provided 'as-is', without any express or implied
+    warranty.  In no event will the authors be held liable for any damages
+    arising from the use of this software.
+
+    Permission is granted to anyone to use this software for any purpose,
+    including commercial applications, and to alter it and redistribute it
+    freely, subject to the following restrictions:
+
+    1. The origin of this software must not be misrepresented; you must not
+       claim that you wrote the original software. If you use this software
+       in a product, an acknowledgment in the product documentation would be
+       appreciated but is not required.
+    2. Altered source versions must be plainly marked as such, and must not be
+       misrepresented as being the original software.
+    3. This notice may not be removed or altered from any source distribution.
+
+    L. Peter Deutsch
+    ghost@aladdin.com
+
+[ext/digest/rmd160/rmd160.c]
+[ext/digest/rmd160/rmd160.h]
+
+  These files have the following copyright information, and by the
+  author we are allowed to use it under the new-style BSD license.
+
+  >>>
+    AUTHOR::  Antoon Bosselaers, ESAT-COSIC
+              (Arranged for libc by Todd C. Miller)
+    DATE::    1 March 1996
+
+    Copyright (c):: Katholieke Universiteit Leuven
+    1996, All Rights Reserved
+
+[ext/digest/sha2/sha2.c]
+[ext/digest/sha2/sha2.h]
+
+  These files are under the new-style BSD license.
+
+  >>>
+    Copyright 2000:: Aaron D. Gifford.  All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the copyright holder nor the names of contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR(S) AND CONTRIBUTOR(S) ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR(S) OR CONTRIBUTOR(S) BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[ext/json/vendor/fpconv.c]
+
+  This file is under the {Boost Software License}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/json/vendor/jeaiii-ltoa.h]
+
+  >>>
+    Copyright (c) 2024,2025 Enrico Thierbach - https://github.com/radiospiel
+    Copyright (c) 2022 James Edward Anhalt III - https://github.com/jeaiii/itoa
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[ext/json/vendor/ryu.h]
+  This file is adapted from the Ryu algorithm by Ulf Adams https://github.com/ulfjack/ryu.
+  It is dual-licensed under {Apache License 2.0}[rdoc-ref:@Apache+License+2.0] OR
+  {Boost Software License 1.0}[rdoc-ref:@Boost+Software+License+1.0].
+
+[ext/psych]
+[test/psych]
+
+  The files under these directories are under the following license.
+
+  >>>
+    Copyright 2009:: Aaron Patterson, et al.
+
+    Permission is hereby granted, free of charge, to any person obtaining a copy of
+    this software and associated documentation files (the 'Software'), to deal in
+    the Software without restriction, including without limitation the rights to
+    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+    of the Software, and to permit persons to whom the Software is furnished to do
+    so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in all
+    copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+    SOFTWARE.
+
+[ext/pty/pty.c]
+
+  >>>
+    C) Copyright 1998:: by Akinori Ito.
+
+    This software may be redistributed freely for this purpose, in full
+    or in part, provided that this entire copyright notice is included
+    on any copies of this software and applications and derivations thereof.
+
+    This software is provided on an "as is" basis, without warranty of any
+    kind, either expressed or implied, as to any matter including, but not
+    limited to warranty of fitness of purpose, or merchantability, or
+    results obtained from use of this software.
+
+[ext/socket/addrinfo.h]
+[ext/socket/getaddrinfo.c]
+[ext/socket/getnameinfo.c]
+
+  These files are under the new-style BSD license.
+
+  >>>
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the project nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+[ext/win32ole/win32ole.c]
+
+  You can apply the Artistic License to this file. (or GPL,
+  alternatively)
+
+  >>>
+    (c) 1995:: Microsoft Corporation. All rights reserved.
+    Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
+
+    Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
+    <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
+
+    You may distribute under the terms of either the GNU General Public
+    License or the Artistic License, as specified in the README file
+    of the Perl distribution.
+
+  The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+[lib/rdoc/generator/template/darkfish/css/fonts.css]
+
+  This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
+
+[spec/mspec]
+[spec/ruby]
+
+  The files under these directories are under the following license.
+
+  >>>
+    Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
+
+    Permission is hereby granted, free of charge, to any person
+    obtaining a copy of this software and associated documentation
+    files (the "Software"), to deal in the Software without
+    restriction, including without limitation the rights to use,
+    copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the
+    Software is furnished to do so, subject to the following
+    conditions:
+
+    The above copyright notice and this permission notice shall be
+    included in all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+    OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+    NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+    HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+    WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+    FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+    OTHER DEALINGS IN THE SOFTWARE.
+
+[lib/rubygems.rb]
+[lib/rubygems]
+[test/rubygems]
+
+  RubyGems is under the following license.
+
+  >>>
+    RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+    Weirich and others.  You can redistribute it and/or modify it under
+    either the terms of the {MIT license}[rdoc-ref:@MIT+License], or the conditions
+    below:
+
+    1. You may make and give away verbatim copies of the source form of the
+       software without restriction, provided that you duplicate all of the
+       original copyright notices and associated disclaimers.
+
+    2. You may modify your copy of the software in any way, provided that
+       you do at least ONE of the following:
+
+       a. place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+          modifications to Usenet or an equivalent medium, or by allowing
+          the author to include your modifications in the software.
+
+       b. use the modified software only within your corporation or
+          organization.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    3. You may distribute the software in object code or executable
+       form, provided that you do at least ONE of the following:
+
+       a. distribute the executables and library files of the software,
+          together with instructions (in the manual page or equivalent)
+          on where to get the original distribution.
+
+       b. accompany the distribution with the machine-readable source of
+          the software.
+
+       c. give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d. make other distribution arrangements with the author.
+
+    4. You may modify and include the part of the software into any other
+       software (possibly commercial).
+
+    5. The scripts and library files supplied as input to or produced as
+       output from the software do not automatically fall under the
+       copyright of the software, but belong to whomever generated them,
+       and may be sold commercially, and may be aggregated with this
+       software.
+
+    6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+       IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+       WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+       PURPOSE.
+
+[lib/bundler]
+[lib/bundler.rb]
+[spec/bundler]
+
+  Bundler is under the following license.
+
+  >>>
+    Portions copyright (c) 2010:: Andre Arko
+    Portions copyright (c) 2009:: Engine Yard
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/thor]
+
+  Thor is under the following license.
+
+  >>>
+    Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/rubygems/vendor/molinillo]
+
+  molinillo is under the following license.
+
+  >>>
+    Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/pub_grub]
+
+  pub_grub is under the following license.
+
+  >>>
+    Copyright (c) 2018 John Hawthorn
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/connection_pool]
+
+  connection_pool is under the following license.
+
+  >>>
+    Copyright (c) 2011 Mike Perham
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/bundler/vendor/net-http-persistent]
+
+  net-http-persistent is under the following license.
+
+  >>>
+    Copyright (c) Eric Hodel, Aaron Patterson
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/did_you_mean]
+[lib/did_you_mean.rb]
+[test/did_you_mean]
+
+  did_you_mean is under the following license.
+
+  >>>
+    Copyright (c) 2014-2016 Yuki Nishijima
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[lib/error_highlight]
+[lib/error_highlight.rb]
+[test/error_highlight]
+
+  error_highlight is under the following license.
+
+  >>>
+    Copyright (c) 2021 Yusuke Endoh
+
+    {MIT License}[rdoc-ref:@MIT+License]
+
+[benchmark/so_ackermann.rb]
+[benchmark/so_array.rb]
+[benchmark/so_binary_trees.rb]
+[benchmark/so_concatenate.rb]
+[benchmark/so_count_words.yml]
+[benchmark/so_exception.rb]
+[benchmark/so_fannkuch.rb]
+[benchmark/so_fasta.rb]
+[benchmark/so_k_nucleotide.yml]
+[benchmark/so_lists.rb]
+[benchmark/so_mandelbrot.rb]
+[benchmark/so_matrix.rb]
+[benchmark/so_meteor_contest.rb]
+[benchmark/so_nbody.rb]
+[benchmark/so_nested_loop.rb]
+[benchmark/so_nsieve.rb]
+[benchmark/so_nsieve_bits.rb]
+[benchmark/so_object.rb]
+[benchmark/so_partial_sums.rb]
+[benchmark/so_pidigits.rb]
+[benchmark/so_random.rb]
+[benchmark/so_reverse_complement.yml]
+[benchmark/so_sieve.rb]
+[benchmark/so_spectralnorm.rb]
+
+  These files are very old copy of then-called "The Great Computer Language
+  Shootout".  LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
+  site has been lost.  Upstream diverged to delete several benchmarks listed
+  above.
+
+== MIT License
+>>>
+      Permission is hereby granted, free of charge, to any person obtaining
+      a copy of this software and associated documentation files (the
+      "Software"), to deal in the Software without restriction, including
+      without limitation the rights to use, copy, modify, merge, publish,
+      distribute, sublicense, and/or sell copies of the Software, and to
+      permit persons to whom the Software is furnished to do so, subject to
+      the following conditions:
+
+      The above copyright notice and this permission notice shall be
+      included in all copies or substantial portions of the Software.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+      EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+      MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+      NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+      LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+      OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+      WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+
+== Old-style BSD license
+>>>
+      Redistribution and use in source and binary forms, with or without
+      modification, are permitted provided that the following conditions
+      are met:
+      1. Redistributions of source code must retain the above copyright
+         notice, this list of conditions and the following disclaimer.
+      2. Redistributions in binary form must reproduce the above copyright
+         notice, this list of conditions and the following disclaimer in the
+         documentation and/or other materials provided with the distribution.
+      3. Neither the name of the University nor the names of its contributors
+         may be used to endorse or promote products derived from this software
+         without specific prior written permission.
+
+      THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+      ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+      IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+      ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+      FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+      DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+      OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+      HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+      LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+      OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+      SUCH DAMAGE.
+
+      IMPORTANT NOTE::
+
+      From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+      paragraph 3 above is now null and void.
+
+== Boost Software License 1.0
+
+>>>
+      Boost Software License - Version 1.0 - August 17th, 2003
+
+      Permission is hereby granted, free of charge, to any person or organization
+      obtaining a copy of the software and accompanying documentation covered by
+      this license (the "Software") to use, reproduce, display, distribute,
+      execute, and transmit the Software, and to prepare derivative works of the
+      Software, and to permit third-parties to whom the Software is furnished to
+      do so, all subject to the following:
+
+      The copyright notices in the Software and this entire statement, including
+      the above license grant, this restriction and the following disclaimer,
+      must be included in all copies of the Software, in whole or in part, and
+      all derivative works of the Software, unless such copies or derivative
+      works are solely in the form of machine-executable object code generated by
+      a source language processor.
+
+      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+      IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+      FITNESS FOR A PARTICULAR PURPOSE, TITLE AND NON-INFRINGEMENT. IN NO EVENT
+      SHALL THE COPYRIGHT HOLDERS OR ANYONE DISTRIBUTING THE SOFTWARE BE LIABLE
+      FOR ANY DAMAGES OR OTHER LIABILITY, WHETHER IN CONTRACT, TORT OR OTHERWISE,
+      ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
+      DEALINGS IN THE SOFTWARE.
+
+== Apache License 2.0
+
+>>>
+      Apache License
+      Version 2.0, January 2004
+      http://www.apache.org/licenses/
+
+      TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
+
+      1. Definitions.
+
+         "License" shall mean the terms and conditions for use, reproduction,
+         and distribution as defined by Sections 1 through 9 of this document.
+
+         "Licensor" shall mean the copyright owner or entity authorized by
+         the copyright owner that is granting the License.
+
+         "Legal Entity" shall mean the union of the acting entity and all
+         other entities that control, are controlled by, or are under common
+         control with that entity. For the purposes of this definition,
+         "control" means (i) the power, direct or indirect, to cause the
+         direction or management of such entity, whether by contract or
+         otherwise, or (ii) ownership of fifty percent (50%) or more of the
+         outstanding shares, or (iii) beneficial ownership of such entity.
+
+         "You" (or "Your") shall mean an individual or Legal Entity
+         exercising permissions granted by this License.
+
+         "Source" form shall mean the preferred form for making modifications,
+         including but not limited to software source code, documentation
+         source, and configuration files.
+
+         "Object" form shall mean any form resulting from mechanical
+         transformation or translation of a Source form, including but
+         not limited to compiled object code, generated documentation,
+         and conversions to other media types.
+
+         "Work" shall mean the work of authorship, whether in Source or
+         Object form, made available under the License, as indicated by a
+         copyright notice that is included in or attached to the work
+         (an example is provided in the Appendix below).
+
+         "Derivative Works" shall mean any work, whether in Source or Object
+         form, that is based on (or derived from) the Work and for which the
+         editorial revisions, annotations, elaborations, or other modifications
+         represent, as a whole, an original work of authorship. For the purposes
+         of this License, Derivative Works shall not include works that remain
+         separable from, or merely link (or bind by name) to the interfaces of,
+         the Work and Derivative Works thereof.
+
+         "Contribution" shall mean any work of authorship, including
+         the original version of the Work and any modifications or additions
+         to that Work or Derivative Works thereof, that is intentionally
+         submitted to Licensor for inclusion in the Work by the copyright owner
+         or by an individual or Legal Entity authorized to submit on behalf of
+         the copyright owner. For the purposes of this definition, "submitted"
+         means any form of electronic, verbal, or written communication sent
+         to the Licensor or its representatives, including but not limited to
+         communication on electronic mailing lists, source code control systems,
+         and issue tracking systems that are managed by, or on behalf of, the
+         Licensor for the purpose of discussing and improving the Work, but
+         excluding communication that is conspicuously marked or otherwise
+         designated in writing by the copyright owner as "Not a Contribution."
+
+         "Contributor" shall mean Licensor and any individual or Legal Entity
+         on behalf of whom a Contribution has been received by Licensor and
+         subsequently incorporated within the Work.
+
+      2. Grant of Copyright License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         copyright license to reproduce, prepare Derivative Works of,
+         publicly display, publicly perform, sublicense, and distribute the
+         Work and such Derivative Works in Source or Object form.
+
+      3. Grant of Patent License. Subject to the terms and conditions of
+         this License, each Contributor hereby grants to You a perpetual,
+         worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+         (except as stated in this section) patent license to make, have made,
+         use, offer to sell, sell, import, and otherwise transfer the Work,
+         where such license applies only to those patent claims licensable
+         by such Contributor that are necessarily infringed by their
+         Contribution(s) alone or by combination of their Contribution(s)
+         with the Work to which such Contribution(s) was submitted. If You
+         institute patent litigation against any entity (including a
+         cross-claim or counterclaim in a lawsuit) alleging that the Work
+         or a Contribution incorporated within the Work constitutes direct
+         or contributory patent infringement, then any patent licenses
+         granted to You under this License for that Work shall terminate
+         as of the date such litigation is filed.
+
+      4. Redistribution. You may reproduce and distribute copies of the
+         Work or Derivative Works thereof in any medium, with or without
+         modifications, and in Source or Object form, provided that You
+         meet the following conditions:
+
+         a.  You must give any other recipients of the Work or
+             Derivative Works a copy of this License; and
+
+         b.  You must cause any modified files to carry prominent notices
+             stating that You changed the files; and
+
+         c.  You must retain, in the Source form of any Derivative Works
+             that You distribute, all copyright, patent, trademark, and
+             attribution notices from the Source form of the Work,
+             excluding those notices that do not pertain to any part of
+             the Derivative Works; and
+
+         d.  If the Work includes a "NOTICE" text file as part of its
+             distribution, then any Derivative Works that You distribute must
+             include a readable copy of the attribution notices contained
+             within such NOTICE file, excluding those notices that do not
+             pertain to any part of the Derivative Works, in at least one
+             of the following places: within a NOTICE text file distributed
+             as part of the Derivative Works; within the Source form or
+             documentation, if provided along with the Derivative Works; or,
+             within a display generated by the Derivative Works, if and
+             wherever such third-party notices normally appear. The contents
+             of the NOTICE file are for informational purposes only and
+             do not modify the License. You may add Your own attribution
+             notices within Derivative Works that You distribute, alongside
+             or as an addendum to the NOTICE text from the Work, provided
+             that such additional attribution notices cannot be construed
+             as modifying the License.
+
+         You may add Your own copyright statement to Your modifications and
+         may provide additional or different license terms and conditions
+         for use, reproduction, or distribution of Your modifications, or
+         for any such Derivative Works as a whole, provided Your use,
+         reproduction, and distribution of the Work otherwise complies with
+         the conditions stated in this License.
+
+      5. Submission of Contributions. Unless You explicitly state otherwise,
+         any Contribution intentionally submitted for inclusion in the Work
+         by You to the Licensor shall be under the terms and conditions of
+         this License, without any additional terms or conditions.
+         Notwithstanding the above, nothing herein shall supersede or modify
+         the terms of any separate license agreement you may have executed
+         with Licensor regarding such Contributions.
+
+      6. Trademarks. This License does not grant permission to use the trade
+         names, trademarks, service marks, or product names of the Licensor,
+         except as required for reasonable and customary use in describing the
+         origin of the Work and reproducing the content of the NOTICE file.
+
+      7. Disclaimer of Warranty. Unless required by applicable law or
+         agreed to in writing, Licensor provides the Work (and each
+         Contributor provides its Contributions) on an "AS IS" BASIS,
+         WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
+         implied, including, without limitation, any warranties or conditions
+         of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A
+         PARTICULAR PURPOSE. You are solely responsible for determining the
+         appropriateness of using or redistributing the Work and assume any
+         risks associated with Your exercise of permissions under this License.
+
+      8. Limitation of Liability. In no event and under no legal theory,
+         whether in tort (including negligence), contract, or otherwise,
+         unless required by applicable law (such as deliberate and grossly
+         negligent acts) or agreed to in writing, shall any Contributor be
+         liable to You for damages, including any direct, indirect, special,
+         incidental, or consequential damages of any character arising as a
+         result of this License or out of the use or inability to use the
+         Work (including but not limited to damages for loss of goodwill,
+         work stoppage, computer failure or malfunction, or any and all
+         other commercial damages or losses), even if such Contributor
+         has been advised of the possibility of such damages.
+
+      9. Accepting Warranty or Additional Liability. While redistributing
+         the Work or Derivative Works thereof, You may choose to offer,
+         and charge a fee for, acceptance of support, warranty, indemnity,
+         or other liability obligations and/or rights consistent with this
+         License. However, in accepting such obligations, You may act only
+         on Your own behalf and on Your sole responsibility, not on behalf
+         of any other Contributor, and only if You agree to indemnify,
+         defend, and hold each Contributor harmless for any liability
+         incurred by, or claims asserted against, such Contributor by reason
+         of your accepting any such warranty or additional liability.
+
+      END OF TERMS AND CONDITIONS
+
+      APPENDIX: How to apply the Apache License to your work.
+
+      >>>
+         To apply the Apache License to your work, attach the following
+         boilerplate notice, with the fields enclosed by brackets "[]"
+         replaced with your own identifying information. (Don't include
+         the brackets!)  The text should be enclosed in the appropriate
+         comment syntax for the file format. We also recommend that a
+         file or class name and description of purpose be included on the
+         same "printed page" as the copyright notice for easier
+         identification within third-party archives.
+
+      Copyright [yyyy] [name of copyright owner]
+
+      Licensed under the Apache License, Version 2.0 (the "License");
+      you may not use this file except in compliance with the License.
+      You may obtain a copy of the License at
+
+          http://www.apache.org/licenses/LICENSE-2.0
+
+      Unless required by applicable law or agreed to in writing, software
+      distributed under the License is distributed on an "AS IS" BASIS,
+      WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+      See the License for the specific language governing permissions and
+      limitations under the License.
diff --git a/MANIFEST b/MANIFEST
deleted file mode 100644
index 429e921074..0000000000
--- a/MANIFEST
+++ /dev/null
@@ -1,67 +0,0 @@
-C-IF
-ChangeLog
-FAQ
-MANIFEST
-Makefile.in
-README
-ToDo
-array.c
-bignum.c
-class.c
-compar.c
-configure
-configure.in
-cons.c
-dbm.c
-defines.h
-dict.c
-dir.c
-dln.c
-dln.h
-enum.c
-env.h
-error.c
-etc.c
-eval.c
-file.c
-fnmatch.c
-fnmatch.h
-gc.c
-getopt.c
-getopt.h
-getopt1.c
-glob.c
-gnuglob.c
-ident.h
-inits.c
-io.c
-io.h
-main.c
-math.c
-node.h
-numeric.c
-object.c
-pack.c
-parse.y
-process.c
-random.c
-range.c
-re.c
-re.h
-regex.c
-regex.h
-ruby.1
-ruby.c
-ruby.h
-signal.c
-socket.c
-spec
-sprintf.c
-st.c
-st.h
-string.c
-struct.c
-time.c
-variable.c
-version.c
-version.h
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index b0c6eb5ea9..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,178 +0,0 @@
-SHELL = /bin/sh
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-VPATH = @srcdir@
-
-CC = @CC@
-DBMCC = cc
-YACC = @YACC@
-INSTALL = @INSTALL@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_DATA = @INSTALL_DATA@
-PURIFY=
-
-CFLAGS = -g
-STATIC = @STATIC@
-LDFLAGS = $(CFLAGS)
-LIBS = @LIBS@
-MISSING = @LIBOBJS@ @ALLOCA@
-
-prefix = /usr/local
-binprefix = 
-exec_prefix = $(prefix)
-bindir = $(exec_prefix)/bin
-
-#### End of system configuration section. ####
-
-HDRS          = defines.h \
-		dln.h \
-		getopt.h \
-		ident.h \
-		io.h \
-		node.h \
-		re.h \
-		regex.h \
-		ruby.h \
-		st.h \
-		version.h
-
-OBJS	      = array.o \
-		bignum.o \
-		class.o \
-		compar.o \
-		cons.o \
-		dbm.o \
-		dict.o \
-		dir.o \
-		dln.o \
-		enum.o \
-		error.o \
-		etc.o \
-		eval.o \
-		file.o \
-		fnmatch.o \
-		gc.o \
-		getopt.o \
-		getopt1.o \
-		glob.o \
-		gnuglob.o \
-		inits.o \
-		io.o \
-		main.o \
-		math.o \
-		numeric.o \
-		object.o \
-		pack.o \
-		parse.o \
-		process.o \
-		random.o \
-		range.o \
-		re.o \
-		regex.o \
-		ruby.o \
-		signal.o \
-		socket.o \
-		sprintf.o \
-		st.o \
-		string.o \
-		struct.o \
-		time.o \
-		variable.o \
-		version.o \
-		$(MISSING)
-
-PROGRAM	      = ruby
-
-all:		$(PROGRAM)
-
-$(PROGRAM):     $(OBJS)
-		@rm -f $(PROGRAM)
-		$(PURIFY) $(CC) $(STATIC) $(LDFLAGS) $(OBJS) $(LIBS) -o $(PROGRAM)
-
-$(bindir)/$(PROGRAM): $(PROGRAM)
-	$(INSTALL_PROGRAM) $(PROGRAM) $(bindir)/$(PROGRAM)
-
-install: $(bindir)/$(PROGRAM)
-
-clean:;		@rm -f $(OBJS)
-
-realclean:;	@rm -f $(OBJS)
-		@rm -f core ruby *~ config.status Makefile
-.c.o:
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
-
-dbm.o:dbm.c
-	$(DBMCC) $(CFLAGS) $(CPPFLAGS) -c dbm.c
-
-alloca.o: missing/alloca.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c missing/alloca.c
-
-memmove.o: missing/memmove.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/memmove.c
-
-mkdir.o: missing/mkdir.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/mkdir.c
-
-strerror.o: missing/strerror.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strerror.c
-
-strdup.o: missing/strdup.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strdup.c
-
-strftime.o: missing/strftime.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c missing/strftime.c
-
-strstr.o: missing/strstr.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strstr.c
-
-strtol.o: missing/strtol.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strtol.c
-
-strtoul.o: missing/strtoul.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strtoul.c
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-###
-parse.o : parse.y ruby.h defines.h config.h env.h node.h st.h ident.h regex.h 
-###
-array.o: array.c ruby.h config.h defines.h
-bignum.o: bignum.c ruby.h config.h defines.h
-class.o: class.c ruby.h config.h defines.h env.h node.h st.h
-compar.o: compar.c ruby.h config.h defines.h
-dbm.o: dbm.c ruby.h config.h defines.h
-dict.o: dict.c ruby.h config.h defines.h st.h
-dir.o: dir.c ruby.h config.h defines.h
-dln.o: dln.c defines.h dln.h
-enum.o: enum.c ruby.h config.h defines.h
-error.o: error.c ruby.h config.h defines.h env.h
-etc.o: etc.c ruby.h config.h defines.h
-eval.o: eval.c ruby.h config.h defines.h ident.h env.h node.h st.h
-file.o: file.c ruby.h config.h defines.h io.h
-fnmatch.o: fnmatch.c fnmatch.h
-gc.o: gc.c ruby.h config.h defines.h env.h st.h
-glob.o: glob.c ruby.h config.h defines.h fnmatch.h
-gnuglob.o: gnuglob.c fnmatch.h
-inits.o: inits.c ruby.h config.h defines.h
-io.o: io.c ruby.h config.h defines.h io.h
-main.o: main.c
-math.o: math.c ruby.h config.h defines.h
-numeric.o: numeric.c ruby.h config.h defines.h env.h
-object.o: object.c ruby.h config.h defines.h env.h st.h
-pack.o: pack.c ruby.h config.h defines.h
-process.o: process.c ruby.h config.h defines.h st.h
-random.o: random.c ruby.h config.h defines.h
-range.o: range.c ruby.h config.h defines.h
-re.o: re.c ruby.h config.h defines.h re.h regex.h
-regex.o: regex.c defines.h regex.h
-ruby.o: ruby.c ruby.h config.h defines.h re.h regex.h getopt.h
-socket.o: socket.c ruby.h config.h defines.h io.h
-sprintf.o: sprintf.c ruby.h config.h defines.h
-st.o: st.c st.h
-string.o: string.c ruby.h config.h defines.h re.h regex.h
-struct.o: struct.c ruby.h config.h defines.h env.h
-time.o: time.c ruby.h config.h defines.h
-variable.o: variable.c ruby.h config.h defines.h env.h ident.h st.h
-version.o: version.c ruby.h config.h defines.h version.h
diff --git a/NEWS.md b/NEWS.md
new file mode 100644
index 0000000000..2b021e7cdd
--- /dev/null
+++ b/NEWS.md
@@ -0,0 +1,87 @@
+# NEWS for Ruby 4.1.0
+
+This document is a list of user-visible feature changes
+since the **4.0.0** release, except for bug fixes.
+
+Note that each entry is kept to a minimum, see links for details.
+
+## Language changes
+
+## Core classes updates
+
+Note: We're only listing outstanding class updates.
+
+* Method
+
+    * `Method#source_location`, `Proc#source_location`, and
+      `UnboundMethod#source_location` now return extended location
+      information with 5 elements: `[path, start_line, start_column,
+      end_line, end_column]`. The previous 2-element format `[path,
+      line]` can still be obtained by calling `.take(2)` on the result.
+      [[Feature #6012]]
+
+* Set
+
+    * A deprecated behavior, `Set#to_set`, `Range#to_set`, and
+      `Enumerable#to_set` accepting arguments, was removed.  [[Feature #21390]]
+
+## Stdlib updates
+
+### The following bundled gems are added.
+
+
+We only list stdlib changes that are notable feature changes.
+
+Other changes are listed in the following sections. We also listed release
+history from the previous bundled version that is Ruby 3.4.0 if it has GitHub
+releases.
+
+### The following bundled gem is promoted from default gems.
+
+* tsort 0.2.0
+
+### The following default gem is added.
+
+### The following default gems are updated.
+
+* RubyGems 4.1.0.dev
+* bundler 4.1.0.dev
+* prism 1.8.0
+* stringio 3.2.1.dev
+* strscan 3.1.7.dev
+
+### The following bundled gems are updated.
+
+* minitest 6.0.1
+* test-unit 3.7.7
+* rss 0.3.2
+* net-imap 0.6.2
+* rbs 3.10.2
+* typeprof 0.31.1
+* debug 1.11.1
+* mutex_m 0.3.0
+* resolv-replace 0.2.0
+* rdoc 7.1.0
+
+### RubyGems and Bundler
+
+Ruby 4.0 bundled RubyGems and Bundler version 4. see the following links for details.
+
+## Supported platforms
+
+## Compatibility issues
+
+## Stdlib compatibility issues
+
+## C API updates
+
+## Implementation improvements
+
+### Ractor
+
+A lot of work has gone into making Ractors more stable, performant, and usable. These improvements bring Ractor implementation closer to leaving experimental status.
+
+## JIT
+
+[Feature #6012]: https://bugs.ruby-lang.org/issues/6012
+[Feature #21390]: https://bugs.ruby-lang.org/issues/21390
diff --git a/README b/README
deleted file mode 100644
index 9dc79e8e26..0000000000
--- a/README
+++ /dev/null
@@ -1,73 +0,0 @@
-.\" README -  -*- Text -*- created at: Wed Aug  3 11:57:36 JST 1994
-
-����ѥ��롦���󥹥ȡ���
-
-  1. configure��¹Ԥ���Makefile����������.
-  2. (ɬ�פʤ��)defines.h���Խ�����.
-  3. make��¹Ԥ��ƥ���ѥ��뤹��
-  4. make install
-
-  �⤷, ����ѥ�����˥��顼��ȯ���������ˤϥ��顼�Υ����ȥ�
-  ����, OS�μ����ޤ�Ǥ�������ܤ�����ݡ��Ȥ��Ԥ����äƤ�
-  ����������.
-
-��ǽ�ɲ�
-
-  C�����ɤ�񤯤��Ȥˤ�ä�, ��ñ��ruby�˵�ǽ���ɲäǤ���. 
-  ���Τ����ޤ��ʼ��ϰʲ����̤�Ǥ���.
-
-  * �ؿ�Ū�᥽�åɤ��ɲä�����
-
-    (1) C�Ǵؿ����
-    (2) rb_define_method()�ǥ����ͥ륯�饹�Υ᥽�åɤȤ��ƴ�
-	����ruby����Ͽ����ؿ����
-    (3) init.c���Խ�����, ��Ͽ����ؿ���ƤӽФ�
-
-  * ���饹���ɲä�����
-
-    (1) ���饹���߷פ���
-    (2) �᥽�åɤ�C�ǵ��Ҥ���
-    (3) rb_define_class()�ǥ��饹���������륳���ɤ��
-    (4) rb_define_method()�ǥ᥽�åɤ���Ͽ���륳���ɤ��
-    (5) init.c���Խ�����, ���������ؿ���ƤӽФ�
-
-  �ܤ�����C-IF�򻲾�.
-
-�ܿ�
-
-  UNIX�Ǥ����configure���ۤȤ�ɤκ��ۤ�ۼ����Ƥ����Ϥ�
-  ����, �פ�̸���Ȥ������ä����(����˰㤤�ʤ�), ��Ԥ˥�
-  �ݡ��Ȥ����, ���Ǥ��뤫���Τ�ʤ�.
-
-  �������ƥ�����ˤ�äȤ��¸����Τ�GC���Ǥ���. ruby��GC��
-  �оݤΥ������ƥ����㤬setjmp()�ˤ�ä�, ���ƤΥ쥸������ 
-  jmp_buf�˳�Ǽ���뤳�Ȥ�, jmp_buf�ȥ����å���32bit���饤��
-  ���Ȥ���Ƥ��뤳�Ȥ��ꤷ�Ƥ���. ���Ԥ����¤Ǥʤ�����
-  �ܿ��Ϻ����ˤ�������. ��Ԥϳ�ȴ�ñ�˲��Ǥ���. gc.c
-  �Υ����å���ޡ���������ʬ�˥��饤����ȤΥХ��ȿ�������
-  �餷�ƥޡ������륳���ɤ��ɲä�������ǺѤ�.
-
-  sparc�ʳ��Υ쥸����������ɥ������CPU�Ǥ�, �쥸����������
-  �ɥ���ե�å��夹�륳���ɤ��ɲä���ɬ�פ����뤫���Τ�ʤ�.
-
-���۾��
-
-  Ruby�Ϻǽ�Ū�ˤ�GNU Public License�ˤ������ä��������ۤ�
-  ���ͽ�����, �������Ǥϰʲ��ξ������ۤ���.
-
-  * ����
-
-    �����ʤ���Ū�Ǥ��켫ͳ�Ǥ���. ������, �Х������Ϻ�Ԥؤ�
-    �ե����ɥХå�����Ԥ���(�����ǤϤʤ�)
-
-  * ¾�Υץ������ؤΰ���
-
-    �����ʤ���Ū�Ǥ��켫ͳ�Ǥ���. ������, ���ۤ��������ɤ˴�
-    �ޤ��¾�κ�Ԥˤ�륳���ɤ�, ���줾��κ�Ԥΰո��ˤ��
-    ���¤��ä�����.
-
-  * ������
-
-    �ػߤ���. ���ꤷ�����ͤϺ�Ԥ�ľ��Ϣ����Ȥ뤳��. �����
-    Ruby�θ�����ͤ��԰���ʾ��֤Τޤ޹���ή�ۤ���Τ����¤�
-    �뤿��Ǥ���, ������ͤ����ꤷ�������Ǻ����ۼ�ͳ�Ȥ���.
diff --git a/README.EXT b/README.EXT
new file mode 100644
index 0000000000..48b8d964c4
--- /dev/null
+++ b/README.EXT
@@ -0,0 +1 @@
+Moved to doc/extension.rdoc
diff --git a/README.EXT.ja b/README.EXT.ja
new file mode 100644
index 0000000000..f884ecbb0e
--- /dev/null
+++ b/README.EXT.ja
@@ -0,0 +1 @@
+doc/extension.ja.rdocに移動しました
diff --git a/README.ja.md b/README.ja.md
new file mode 100644
index 0000000000..9bbc3a83a5
--- /dev/null
+++ b/README.ja.md
@@ -0,0 +1,176 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+[English](rdoc-ref:README.md)
+
+# Rubyとは
+
+Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
+オブジェクト指向プログラミングを手軽に行う事が出来ます．もちろん普通の手続き型のプログラミングも可能です．
+
+Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい強力です．さらにシンプルな文法と，
+例外処理やイテレータなどの機構によって，より分かりやすいプログラミングが出来ます．
+
+## Rubyの特長
+
+*   シンプルな文法
+*   普通のオブジェクト指向機能(クラス，メソッドコールなど)
+*   特殊なオブジェクト指向機能(Mixin，特異メソッドなど)
+*   演算子オーバーロード
+*   例外処理機能
+*   イテレータとクロージャ
+*   ガーベージコレクタ
+*   ダイナミックローディング (アーキテクチャによる)
+*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， macOS，
+    Haikuなどの上でも動く cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+
+
+## 入手法
+
+サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
+
+https://www.ruby-lang.org/ja/downloads/
+
+を参照してください．
+
+### Git
+
+ミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
+
+```console
+$ git clone https://github.com/ruby/ruby.git
+```
+
+他のブランチの一覧は次のコマンドで見られます．
+
+```console
+$ git ls-remote https://github.com/ruby/ruby.git
+```
+
+Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります．
+コミッタはこちらを使います．
+
+## ホームページ
+
+RubyのホームページのURLは
+
+https://www.ruby-lang.org/
+
+です．
+
+## メーリングリスト
+
+Rubyのメーリングリストがあります．参加希望の方は [ruby-list-request@ml.ruby-lang.org] まで件名に
+
+    join
+
+と書いて送って下さい．
+
+Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています．
+参加希望の方は [ruby-dev-request@ml.ruby-lang.org] までruby-listと同様の方法でメールしてください．
+
+Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
+英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
+
+[ruby-list-request@ml.ruby-lang.org]: mailto:ruby-list-request@ml.ruby-lang.org?subject=join
+[ruby-dev-request@ml.ruby-lang.org]: mailto:ruby-dev-request@ml.ruby-lang.org?subject=join
+
+## コンパイル・インストール
+
+以下の手順で行ってください．
+
+1.  (Gitリポジトリから取得したソースをビルドする場合) `./autogen.sh` を実行して新しく `configure` を生成する
+
+2.  `configure` を実行して `Makefile` などを生成する
+
+    環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
+    `warnflags=..` 等で上書きできます．
+
+3.  (必要ならば)`include/ruby/defines.h` を編集する
+
+    多分，必要無いと思います．
+
+4.  (必要ならば)`ext/Setup` に静的にリンクする拡張モジュールを指定する
+
+    `ext/Setup` に記述したモジュールは静的にリンクされます．
+
+    ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
+    メントを外す必要があります．
+    また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
+
+5.  `make` を実行してコンパイルする
+
+6.  `make check`でテストを行う．
+
+    「`check succeeded`」と表示されれば成功です．ただしテストに成功しても完璧だと保証されている訳ではありません．
+
+7.  `make install`
+
+    以下のディレクトリを作って，そこにファイルをインストー ルします．
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    RubyのAPIバージョンが'*x.y.z*'であれば，`${MAJOR}`は
+    '*x*'で，`${MINOR}`は'*y*'，`${TEENY}`は'*z*'です．
+
+    **注意**: APIバージョンの `teeny` は，Rubyプログラムのバージョンとは異なることがあります．
+
+    `root` で作業する必要があるかもしれません．
+
+
+もし，コンパイル時にエラーが発生した場合にはエラーのログとマシン，OSの種類を含むできるだけ詳しいレポートを作者に送って下さると他の方のためにもなります．
+
+## 移植
+
+UNIXであれば `configure` がほとんどの差異を吸収してくれるはずですが，思わぬ見落としがあった場合(ある事が多い)，作者にその
+ことを報告すれば，解決できる可能性があります．
+
+アーキテクチャにもっとも依存するのはGC部です．RubyのGCは対象
+のアーキテクチャが`setjmp()`または`getcontext()`によって全てのレジスタを `jmp_buf` や `ucontext_t`
+に格納することと， `jmp_buf` や `ucontext_t` とスタックが32bitアラインメントされていることを仮定
+しています．特に前者が成立しない場合の対応は非常に困難でしょう． 後者の解決は比較的簡単で， `gc.c` でスタックをマークしている
+部分にアラインメントのバイト数だけずらしてマークするコードを追加するだけで済みます．`defined(__mc68000__)`で括られてい
+る部分を参考にしてください．
+
+レジスタウィンドウを持つCPUでは，レジスタウィンドウをスタックにフラッシュするアセンブラコードを追加する必要があるかもしれません．
+
+## 配布条件
+
+[COPYING.ja](https://docs.ruby-lang.org/en/master/COPYING_ja.html) ファイルを参照してください．
+
+## フィードバック
+
+Rubyに関する質問は [Ruby-Talk]（英語）や [Ruby-List]（日本語）や，
+[stackoverflow] などのWebサイトに投稿してください．
+
+バグ報告は https://bugs.ruby-lang.org で受け付けています．
+
+[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
+[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
+[stackoverflow]: https://ja.stackoverflow.com/
+
+## 著者
+
+Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
+
+<mailto:matz@ruby-lang.org>
diff --git a/README.md b/README.md
new file mode 100644
index 0000000000..02435b419e
--- /dev/null
+++ b/README.md
@@ -0,0 +1,96 @@
+[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
+[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
+[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
+[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+
+[日本語](rdoc-ref:README.ja.md)
+
+# What is Ruby?
+
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
+
+## Features of Ruby
+
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+  well as Windows, macOS, etc.) cf.
+    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+
+## How to get Ruby
+
+For a complete list of ways to install Ruby, including using third-party tools
+like rvm, see:
+
+https://www.ruby-lang.org/en/downloads/
+
+You can download release packages and the snapshot of the repository. If you want to
+download whole versions of Ruby, please visit https://www.ruby-lang.org/en/downloads/releases/.
+
+### Download with Git
+
+The mirror of the Ruby source tree can be checked out with the following command:
+
+    $ git clone https://github.com/ruby/ruby.git
+
+There are some other branches under development. Try the following command
+to see the list of branches:
+
+    $ git ls-remote https://github.com/ruby/ruby.git
+
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
+
+## How to build
+
+See [Building Ruby](https://docs.ruby-lang.org/en/master/contributing/building_ruby_md.html)
+
+## Ruby home page
+
+https://www.ruby-lang.org/
+
+## Documentation
+
+- [English](https://docs.ruby-lang.org/en/master/index.html)
+- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
+
+## Mailing list
+
+There is a mailing list to discuss Ruby. To subscribe to this list, please
+send the following phrase:
+
+    join
+
+in the mail subject (not body) to the address [ruby-talk-request@ml.ruby-lang.org].
+
+[ruby-talk-request@ml.ruby-lang.org]: mailto:ruby-talk-request@ml.ruby-lang.org?subject=join
+
+## Copying
+
+See the file [COPYING](rdoc-ref:COPYING).
+
+## Feedback
+
+Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
+or on websites like https://stackoverflow.com.
+
+Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
+
+## Contributing
+
+See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
+
+## The Author
+
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
+
+<matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
deleted file mode 100644
index 5dcb005f52..0000000000
--- a/ToDo
+++ /dev/null
@@ -1,12 +0,0 @@
-* Process Class
-* ���饹�饤�֥��θ�ľ��(UNIX��¸�򸺤餹)
-* format��ǽ
-* here document
-* perl�Τ褦��setuid check
-* tr����BSD�����ɤ������(�ޤ���copyright��Ϥä��ꤵ����)
-* Ŭ�ڤ�signal handling
-* dln��COFF�б�(�ޤ���dlopen�б�)
-* ruby����������ѿ�hook�μ¸�
-* write debugger for ruby
-* re-write regex code for speed
-* byte code interpretor
diff --git a/sample/Artistic b/aclocal.m4
index e69de29bb2..e69de29bb2 100644
--- a/sample/Artistic
+++ b/aclocal.m4
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..19a6a425c1
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,2721 @@
+/**********************************************************************
+
+  addr2line.c -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#if defined(__clang__) && defined(__has_warning)
+#if __has_warning("-Wgnu-empty-initializer")
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#endif
+#if __has_warning("-Wgcc-compat")
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+#endif
+
+#include "ruby/internal/config.h"
+#include "ruby/defines.h"
+#include "ruby/missing.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#include "ruby/internal/stdbool.h"
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
+
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdint.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+/* Make alloca work the best possible way.  */
+#ifdef __GNUC__
+# ifndef alloca
+#  define alloca __builtin_alloca
+# endif
+#else
+# ifdef HAVE_ALLOCA_H
+#  include <alloca.h>
+# else
+#  ifdef _AIX
+#pragma alloca
+#  else
+#   ifndef alloca                /* predefined by HP cc +Olibcalls */
+void *alloca();
+#   endif
+#  endif /* AIX */
+# endif        /* HAVE_ALLOCA_H */
+# ifndef UNREACHABLE
+#  define UNREACHABLE __builtin_unreachable()
+# endif
+# ifndef UNREACHABLE_RETURN
+#  define UNREACHABLE_RETURN(_) __builtin_unreachable()
+# endif
+#endif /* __GNUC__ */
+
+#ifndef UNREACHABLE
+# define UNREACHABLE abort()
+#endif
+#ifndef UNREACHABLE_RETURN
+# define UNREACHABLE_RETURN(_) return (abort(), (_))
+#endif
+
+#ifdef HAVE_DLADDR
+# include <dlfcn.h>
+#endif
+
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
+
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+#  include <elf_abi.h>
+# else
+#  include <elf.h>
+# endif
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+#  define ElfW(x) Elf64##_##x
+# else
+#  define ElfW(x) Elf32##_##x
+# endif
+#endif
+#ifndef ELF_ST_TYPE
+# if SIZEOF_VOIDP == 8
+#  define ELF_ST_TYPE ELF64_ST_TYPE
+# else
+#  define ELF_ST_TYPE ELF32_ST_TYPE
+# endif
+#endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+   /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+#  include <zlib.h>
+#  define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
+#ifndef PATH_MAX
+#define PATH_MAX 4096
+#endif
+
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+
+#define kprintf(...) fprintf(errout, "" __VA_ARGS__)
+
+typedef struct line_info {
+    const char *dirname;
+    const char *filename;
+    const char *path; /* object path */
+    int line;
+
+    uintptr_t base_addr;
+    uintptr_t saddr;
+    const char *sname; /* function name */
+
+    struct line_info *next;
+} line_info_t;
+
+struct dwarf_section {
+    char *ptr;
+    size_t size;
+    uint64_t flags;
+};
+
+typedef struct obj_info {
+    const char *path; /* object path */
+    char *mapped;
+    size_t mapped_size;
+    void *uncompressed;
+    uintptr_t base_addr;
+    uintptr_t vmaddr;
+    struct dwarf_section debug_abbrev;
+    struct dwarf_section debug_info;
+    struct dwarf_section debug_line;
+    struct dwarf_section debug_ranges;
+    struct dwarf_section debug_str_offsets;
+    struct dwarf_section debug_addr;
+    struct dwarf_section debug_rnglists;
+    struct dwarf_section debug_str;
+    struct dwarf_section debug_line_str;
+    struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 9
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+    struct dwarf_section *ary[] = {
+        &obj->debug_abbrev,
+        &obj->debug_info,
+        &obj->debug_line,
+        &obj->debug_ranges,
+        &obj->debug_str_offsets,
+        &obj->debug_addr,
+        &obj->debug_rnglists,
+        &obj->debug_str,
+        &obj->debug_line_str
+    };
+    if (n < 0 || DWARF_SECTION_COUNT <= n) {
+        UNREACHABLE_RETURN(0);
+    }
+    return ary[n];
+}
+
+struct debug_section_definition {
+    const char *name;
+    struct dwarf_section *dwarf;
+};
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX + 1];
+
+static unsigned long
+uleb128(const char **p)
+{
+    unsigned long r = 0;
+    int s = 0;
+    for (;;) {
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            r += (unsigned long)b << s;
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
+    }
+    return r;
+}
+
+static long
+sleb128(const char **p)
+{
+    long r = 0;
+    int s = 0;
+    for (;;) {
+        unsigned char b = (unsigned char)*(*p)++;
+        if (b < 0x80) {
+            if (b & 0x40) {
+                r -= (0x80 - b) << s;
+            }
+            else {
+                r += (b & 0x3f) << s;
+            }
+            break;
+        }
+        r += (b & 0x7f) << s;
+        s += 7;
+    }
+    return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, const char *p, FILE *errout)
+{
+    if (!dir--) {
+        return "";
+    }
+    while (dir--) {
+        while (*p) p++;
+        p++;
+        if (!*p) {
+            kprintf("Unexpected directory number %lu in %s\n",
+                    dir, binary_filename);
+            return "";
+        }
+    }
+    return p;
+}
+
+static const char *parse_ver5_debug_line_header(
+    const char *p, int idx, uint8_t format,
+    obj_info_t *obj, const char **out_path,
+    uint64_t *out_directory_index, FILE *errout);
+
+static void
+fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories,
+              const char *filenames, line_info_t *line, obj_info_t *obj, FILE *errout)
+{
+    int i;
+    const char *p = filenames;
+    const char *filename;
+    unsigned long dir;
+    if (version >= 5) {
+        const char *path;
+        uint64_t directory_index = -1;
+        parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index, errout);
+        line->filename = path;
+        parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL, errout);
+        line->dirname = path;
+    }
+    else {
+        for (i = 1; i <= file; i++) {
+            filename = p;
+            if (!*p) {
+#ifndef __APPLE__
+                /* Need to output binary file name? */
+                kprintf("Unexpected file number %d in %s at %tx\n",
+                        file, binary_filename, filenames - obj->mapped);
+#endif
+                return;
+            }
+            while (*p) p++;
+            p++;
+            dir = uleb128(&p);
+            /* last modified. */
+            uleb128(&p);
+            /* size of the file. */
+            uleb128(&p);
+
+            if (i == file) {
+                line->filename = filename;
+                line->dirname = get_nth_dirname(dir, include_directories, errout);
+            }
+        }
+    }
+}
+
+static void
+fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
+          uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
+          obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    int i;
+    addr += obj->base_addr - obj->vmaddr;
+    for (i = offset; i < num_traces; i++) {
+        uintptr_t a = (uintptr_t)traces[i];
+        /* We assume one line code doesn't result >100 bytes of native code.
+       We may want more reliable way eventually... */
+        if (addr < a && a < addr + 100) {
+            fill_filename(file, format, version, include_directories, filenames, &lines[i], obj, errout);
+            lines[i].line = line;
+        }
+    }
+}
+
+struct LineNumberProgramHeader {
+    uint64_t unit_length;
+    uint16_t version;
+    uint8_t format; /* 4 or 8 */
+    uint64_t header_length;
+    uint8_t minimum_instruction_length;
+    uint8_t maximum_operations_per_instruction;
+    uint8_t default_is_stmt;
+    int8_t line_base;
+    uint8_t line_range;
+    uint8_t opcode_base;
+    /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+    const char *include_directories;
+    const char *filenames;
+    const char *cu_start;
+    const char *cu_end;
+};
+
+static int
+parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header, FILE *errout)
+{
+    const char *p = *pp;
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    header->cu_end = p + header->unit_length;
+
+    header->version = *(uint16_t *)p;
+    p += sizeof(uint16_t);
+    if (header->version > 5) return -1;
+
+    if (header->version >= 5) {
+        /* address_size = *(uint8_t *)p++; */
+        /* segment_selector_size = *(uint8_t *)p++; */
+        p += 2;
+    }
+
+    header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+    p += header->format;
+    header->cu_start = p + header->header_length;
+
+    header->minimum_instruction_length = *(uint8_t *)p++;
+
+    if (header->version >= 4) {
+        /* maximum_operations_per_instruction = *(uint8_t *)p; */
+        if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+        p++;
+    }
+
+    header->default_is_stmt = *(uint8_t *)p++;
+    header->line_base = *(int8_t *)p++;
+    header->line_range = *(uint8_t *)p++;
+    header->opcode_base = *(uint8_t *)p++;
+    /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+    p += header->opcode_base - 1;
+
+    if (header->version >= 5) {
+        header->include_directories = p;
+        p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL, errout);
+        header->filenames = p;
+    }
+    else {
+        header->include_directories = p;
+
+        /* temporary measure for compress-debug-sections */
+        if (p >= header->cu_end) return -1;
+
+        /* skip include directories */
+        while (*p) {
+            p = memchr(p, '\0', header->cu_end - p);
+            if (!p) return -1;
+            p++;
+        }
+        p++;
+
+        header->filenames = p;
+    }
+
+    *pp = header->cu_start;
+
+    return 0;
+}
+
+static int
+parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
+                obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    const char *p = (const char *)*debug_line;
+    struct LineNumberProgramHeader header;
+
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
+
+    if (parse_debug_line_header(obj, &p, &header, errout))
+        return -1;
+    is_stmt = header.default_is_stmt;
+
+#define FILL_LINE()                                                 \
+    do {                                                            \
+        fill_line(num_traces, traces, addr, file, line,             \
+                  header.format,                                    \
+                  header.version,                                   \
+                  header.include_directories,                       \
+                  header.filenames,                                 \
+                  obj, lines, offset, errout);                      \
+        /*basic_block = prologue_end = epilogue_begin = 0;*/        \
+    } while (0)
+
+    while (p < header.cu_end) {
+        unsigned long a;
+        unsigned char op = *p++;
+        switch (op) {
+        case DW_LNS_copy:
+            FILL_LINE();
+            break;
+        case DW_LNS_advance_pc:
+            a = uleb128(&p) * header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_advance_line: {
+            long a = sleb128(&p);
+            line += a;
+            break;
+        }
+        case DW_LNS_set_file:
+            file = (unsigned int)uleb128(&p);
+            break;
+        case DW_LNS_set_column:
+            /*column = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case DW_LNS_negate_stmt:
+            is_stmt = !is_stmt;
+            break;
+        case DW_LNS_set_basic_block:
+            /*basic_block = 1; */
+            break;
+        case DW_LNS_const_add_pc:
+            a = ((255UL - header.opcode_base) / header.line_range) *
+                header.minimum_instruction_length;
+            addr += a;
+            break;
+        case DW_LNS_fixed_advance_pc:
+            a = *(uint16_t *)p;
+            p += sizeof(uint16_t);
+            addr += a;
+            break;
+        case DW_LNS_set_prologue_end:
+            /* prologue_end = 1; */
+            break;
+        case DW_LNS_set_epilogue_begin:
+            /* epilogue_begin = 1; */
+            break;
+        case DW_LNS_set_isa:
+            /* isa = (unsigned int)*/(void)uleb128(&p);
+            break;
+        case 0:
+            a = uleb128(&p);
+            op = *p++;
+            switch (op) {
+            case DW_LNE_end_sequence:
+                /* end_sequence = 1; */
+                FILL_LINE();
+                addr = 0;
+                file = 1;
+                line = 1;
+                /* column = 0; */
+                is_stmt = header.default_is_stmt;
+                /* end_sequence = 0; */
+                /* isa = 0; */
+                break;
+            case DW_LNE_set_address:
+                addr = *(unsigned long *)p;
+                p += sizeof(unsigned long);
+                break;
+            case DW_LNE_define_file:
+                kprintf("Unsupported operation in %s\n",
+                        binary_filename);
+                break;
+            case DW_LNE_set_discriminator:
+                /* TODO:currently ignore */
+                uleb128(&p);
+                break;
+            default:
+                kprintf("Unknown extended opcode: %d in %s\n",
+                        op, binary_filename);
+            }
+            break;
+        default: {
+            uint8_t adjusted_opcode = op - header.opcode_base;
+            uint8_t operation_advance = adjusted_opcode / header.line_range;
+            /* NOTE: this code doesn't support VLIW */
+            addr += operation_advance * header.minimum_instruction_length;
+            line += header.line_base + (adjusted_opcode % header.line_range);
+            FILL_LINE();
+        }
+        }
+    }
+    *debug_line = (char *)p;
+    return 0;
+}
+
+static int
+parse_debug_line(int num_traces, void **traces,
+                 const char *debug_line, unsigned long size,
+                 obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+{
+    const char *debug_line_end = debug_line + size;
+    while (debug_line < debug_line_end) {
+        if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset, errout))
+            return -1;
+    }
+    if (debug_line != debug_line_end) {
+        kprintf("Unexpected size of .debug_line in %s\n",
+                binary_filename);
+    }
+    return 0;
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout);
+
+static void
+append_obj(obj_info_t **objp)
+{
+    obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
+    if (*objp) (*objp)->next = newobj;
+    *objp = newobj;
+}
+
+#ifdef USE_ELF
+/* Ideally we should check 4 paths to follow gnu_debuglink:
+ *
+ *   - /usr/lib/debug/.build-id/ab/cdef1234.debug
+ *   - /usr/bin/ruby.debug
+ *   - /usr/bin/.debug/ruby.debug
+ *   - /usr/lib/debug/usr/bin/ruby.debug.
+ *
+ * but we handle only two cases for now as the two formats are
+ * used by some linux distributions.
+ *
+ * See GDB's info for detail.
+ * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
+ */
+
+// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
+static void
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
+                 obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    static const char global_debug_dir[] = "/usr/lib/debug";
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
+    obj_info_t *o1 = *objp, *o2;
+    size_t len;
+
+    p = strrchr(binary_filename, '/');
+    if (!p) {
+        return;
+    }
+    p[1] = '\0';
+
+    len = strlen(binary_filename);
+    if (len >= PATH_MAX - global_debug_dir_len)
+        len = PATH_MAX - global_debug_dir_len - 1;
+    memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    len += global_debug_dir_len;
+    strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+
+// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
+static void
+follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
+                          obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
+    static const char debug_suffix[] = ".debug";
+    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+    char *p;
+    obj_info_t *o1 = *objp, *o2;
+    size_t i;
+
+    if (PATH_MAX < global_debug_dir_len + build_id_size * 2 + sizeof(debug_suffix)) return;
+
+    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+    p = binary_filename + global_debug_dir_len;
+    for (i = 0; i < build_id_size; i++) {
+        static const char tbl[] = "0123456789abcdef";
+        unsigned char n = build_id[i];
+        *p++ = tbl[n / 16];
+        *p++ = tbl[n % 16];
+        if (i == 0) *p++ = '/';
+    }
+    memcpy(p, debug_suffix, sizeof(debug_suffix));
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
+}
+#endif
+
+enum
+{
+    DW_TAG_compile_unit = 0x11,
+    DW_TAG_inlined_subroutine = 0x1d,
+    DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+    DW_AT_sibling = 0x01,
+    DW_AT_location = 0x02,
+    DW_AT_name = 0x03,
+    /* Reserved 0x04 */
+    /* Reserved 0x05 */
+    /* Reserved 0x06 */
+    /* Reserved 0x07 */
+    /* Reserved 0x08 */
+    DW_AT_ordering = 0x09,
+    /* Reserved 0x0a */
+    DW_AT_byte_size = 0x0b,
+    /* Reserved 0x0c */
+    DW_AT_bit_size = 0x0d,
+    /* Reserved 0x0e */
+    /* Reserved 0x0f */
+    DW_AT_stmt_list = 0x10,
+    DW_AT_low_pc = 0x11,
+    DW_AT_high_pc = 0x12,
+    DW_AT_language = 0x13,
+    /* Reserved 0x14 */
+    DW_AT_discr = 0x15,
+    DW_AT_discr_value = 0x16,
+    DW_AT_visibility = 0x17,
+    DW_AT_import = 0x18,
+    DW_AT_string_length = 0x19,
+    DW_AT_common_reference = 0x1a,
+    DW_AT_comp_dir = 0x1b,
+    DW_AT_const_value = 0x1c,
+    DW_AT_containing_type = 0x1d,
+    DW_AT_default_value = 0x1e,
+    /* Reserved 0x1f */
+    DW_AT_inline = 0x20,
+    DW_AT_is_optional = 0x21,
+    DW_AT_lower_bound = 0x22,
+    /* Reserved 0x23 */
+    /* Reserved 0x24 */
+    DW_AT_producer = 0x25,
+    /* Reserved 0x26 */
+    DW_AT_prototyped = 0x27,
+    /* Reserved 0x28 */
+    /* Reserved 0x29 */
+    DW_AT_return_addr = 0x2a,
+    /* Reserved 0x2b */
+    DW_AT_start_scope = 0x2c,
+    /* Reserved 0x2d */
+    DW_AT_bit_stride = 0x2e,
+    DW_AT_upper_bound = 0x2f,
+    /* Reserved 0x30 */
+    DW_AT_abstract_origin = 0x31,
+    DW_AT_accessibility = 0x32,
+    DW_AT_address_class = 0x33,
+    DW_AT_artificial = 0x34,
+    DW_AT_base_types = 0x35,
+    DW_AT_calling_convention = 0x36,
+    DW_AT_count = 0x37,
+    DW_AT_data_member_location = 0x38,
+    DW_AT_decl_column = 0x39,
+    DW_AT_decl_file = 0x3a,
+    DW_AT_decl_line = 0x3b,
+    DW_AT_declaration = 0x3c,
+    DW_AT_discr_list = 0x3d,
+    DW_AT_encoding = 0x3e,
+    DW_AT_external = 0x3f,
+    DW_AT_frame_base = 0x40,
+    DW_AT_friend = 0x41,
+    DW_AT_identifier_case = 0x42,
+    /* Reserved 0x43 */
+    DW_AT_namelist_item = 0x44,
+    DW_AT_priority = 0x45,
+    DW_AT_segment = 0x46,
+    DW_AT_specification = 0x47,
+    DW_AT_static_link = 0x48,
+    DW_AT_type = 0x49,
+    DW_AT_use_location = 0x4a,
+    DW_AT_variable_parameter = 0x4b,
+    DW_AT_virtuality = 0x4c,
+    DW_AT_vtable_elem_location = 0x4d,
+    DW_AT_allocated = 0x4e,
+    DW_AT_associated = 0x4f,
+    DW_AT_data_location = 0x50,
+    DW_AT_byte_stride = 0x51,
+    DW_AT_entry_pc = 0x52,
+    DW_AT_use_UTF8 = 0x53,
+    DW_AT_extension = 0x54,
+    DW_AT_ranges = 0x55,
+    DW_AT_trampoline = 0x56,
+    DW_AT_call_column = 0x57,
+    DW_AT_call_file = 0x58,
+    DW_AT_call_line = 0x59,
+    DW_AT_description = 0x5a,
+    DW_AT_binary_scale = 0x5b,
+    DW_AT_decimal_scale = 0x5c,
+    DW_AT_small = 0x5d,
+    DW_AT_decimal_sign = 0x5e,
+    DW_AT_digit_count = 0x5f,
+    DW_AT_picture_string = 0x60,
+    DW_AT_mutable = 0x61,
+    DW_AT_threads_scaled = 0x62,
+    DW_AT_explicit = 0x63,
+    DW_AT_object_pointer = 0x64,
+    DW_AT_endianity = 0x65,
+    DW_AT_elemental = 0x66,
+    DW_AT_pure = 0x67,
+    DW_AT_recursive = 0x68,
+    DW_AT_signature = 0x69,
+    DW_AT_main_subprogram = 0x6a,
+    DW_AT_data_bit_offset = 0x6b,
+    DW_AT_const_expr = 0x6c,
+    DW_AT_enum_class = 0x6d,
+    DW_AT_linkage_name = 0x6e,
+    DW_AT_string_length_bit_size = 0x6f,
+    DW_AT_string_length_byte_size = 0x70,
+    DW_AT_rank = 0x71,
+    DW_AT_str_offsets_base = 0x72,
+    DW_AT_addr_base = 0x73,
+    DW_AT_rnglists_base = 0x74,
+    /* Reserved 0x75 */
+    DW_AT_dwo_name = 0x76,
+    DW_AT_reference = 0x77,
+    DW_AT_rvalue_reference = 0x78,
+    DW_AT_macros = 0x79,
+    DW_AT_call_all_calls = 0x7a,
+    DW_AT_call_all_source_calls = 0x7b,
+    DW_AT_call_all_tail_calls = 0x7c,
+    DW_AT_call_return_pc = 0x7d,
+    DW_AT_call_value = 0x7e,
+    DW_AT_call_origin = 0x7f,
+    DW_AT_call_parameter = 0x80,
+    DW_AT_call_pc = 0x81,
+    DW_AT_call_tail_call = 0x82,
+    DW_AT_call_target = 0x83,
+    DW_AT_call_target_clobbered = 0x84,
+    DW_AT_call_data_location = 0x85,
+    DW_AT_call_data_value = 0x86,
+    DW_AT_noreturn = 0x87,
+    DW_AT_alignment = 0x88,
+    DW_AT_export_symbols = 0x89,
+    DW_AT_deleted = 0x8a,
+    DW_AT_defaulted = 0x8b,
+    DW_AT_loclists_base = 0x8c,
+    DW_AT_lo_user = 0x2000,
+    DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+    DW_FORM_addr = 0x01,
+    /* Reserved 0x02 */
+    DW_FORM_block2 = 0x03,
+    DW_FORM_block4 = 0x04,
+    DW_FORM_data2 = 0x05,
+    DW_FORM_data4 = 0x06,
+    DW_FORM_data8 = 0x07,
+    DW_FORM_string = 0x08,
+    DW_FORM_block = 0x09,
+    DW_FORM_block1 = 0x0a,
+    DW_FORM_data1 = 0x0b,
+    DW_FORM_flag = 0x0c,
+    DW_FORM_sdata = 0x0d,
+    DW_FORM_strp = 0x0e,
+    DW_FORM_udata = 0x0f,
+    DW_FORM_ref_addr = 0x10,
+    DW_FORM_ref1 = 0x11,
+    DW_FORM_ref2 = 0x12,
+    DW_FORM_ref4 = 0x13,
+    DW_FORM_ref8 = 0x14,
+    DW_FORM_ref_udata = 0x15,
+    DW_FORM_indirect = 0x16,
+    DW_FORM_sec_offset = 0x17,
+    DW_FORM_exprloc = 0x18,
+    DW_FORM_flag_present = 0x19,
+    DW_FORM_strx = 0x1a,
+    DW_FORM_addrx = 0x1b,
+    DW_FORM_ref_sup4 = 0x1c,
+    DW_FORM_strp_sup = 0x1d,
+    DW_FORM_data16 = 0x1e,
+    DW_FORM_line_strp = 0x1f,
+    DW_FORM_ref_sig8 = 0x20,
+    DW_FORM_implicit_const = 0x21,
+    DW_FORM_loclistx = 0x22,
+    DW_FORM_rnglistx = 0x23,
+    DW_FORM_ref_sup8 = 0x24,
+    DW_FORM_strx1 = 0x25,
+    DW_FORM_strx2 = 0x26,
+    DW_FORM_strx3 = 0x27,
+    DW_FORM_strx4 = 0x28,
+    DW_FORM_addrx1 = 0x29,
+    DW_FORM_addrx2 = 0x2a,
+    DW_FORM_addrx3 = 0x2b,
+    DW_FORM_addrx4 = 0x2c,
+
+    /* GNU extensions for referring to .gnu_debugaltlink dwz-compressed info */
+    DW_FORM_GNU_ref_alt = 0x1f20,
+    DW_FORM_GNU_strp_alt = 0x1f21
+};
+
+/* Range list entry encodings */
+enum {
+    DW_RLE_end_of_list = 0x00,
+    DW_RLE_base_addressx = 0x01,
+    DW_RLE_startx_endx = 0x02,
+    DW_RLE_startx_length = 0x03,
+    DW_RLE_offset_pair = 0x04,
+    DW_RLE_base_address = 0x05,
+    DW_RLE_start_end = 0x06,
+    DW_RLE_start_length = 0x07
+};
+
+enum {
+    VAL_none = 0,
+    VAL_cstr = 1,
+    VAL_data = 2,
+    VAL_uint = 3,
+    VAL_int = 4,
+    VAL_addr = 5
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+    obj_info_t *obj;
+    const char *file;
+    uint8_t current_version;
+    const char *current_cu;
+    uint64_t current_low_pc;
+    uint64_t current_str_offsets_base;
+    uint64_t current_addr_base;
+    uint64_t current_rnglists_base;
+    const char *debug_line_cu_end;
+    uint8_t debug_line_format;
+    uint16_t debug_line_version;
+    const char *debug_line_files;
+    const char *debug_line_directories;
+    const char *p;
+    const char *cu_end;
+    const char *pend;
+    const char *q0;
+    const char *q;
+    int format; // 4 or 8
+    uint8_t address_size;
+    int level;
+    const char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+    ptrdiff_t pos;
+    int tag;
+    int has_children;
+} DIE;
+
+typedef struct {
+    union {
+        const char *ptr;
+        uint64_t uint64;
+        int64_t int64;
+        uint64_t addr_idx;
+    } as;
+    uint64_t off;
+    uint64_t at;
+    uint64_t form;
+    size_t size;
+    int type;
+} DebugInfoValue;
+
+#if defined(WORDS_BIGENDIAN)
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
+#else
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+#endif
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+    return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+    return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+    return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 1);
+    return (uint8_t)*p;
+}
+
+static uint16_t
+read_uint16(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 2);
+    return get_uint16((const uint8_t *)p);
+}
+
+static uint32_t
+read_uint24(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 3);
+    return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
+}
+
+static uint32_t
+read_uint32(const char **ptr)
+{
+    const char *p = *ptr;
+    *ptr = (p + 4);
+    return get_uint32((const uint8_t *)p);
+}
+
+static uint64_t
+read_uint64(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + 8);
+    return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(const char **ptr)
+{
+    const unsigned char *p = (const unsigned char *)*ptr;
+    *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+    return get_uint64(p);
+#else
+    return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+    if (reader->format == 4) {
+        return read_uint32(&reader->p);
+    } else { /* 64 bit */
+        return read_uint64(&reader->p);
+    }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+    return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+    return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+    reader->file = obj->mapped;
+    reader->obj = obj;
+    reader->p = obj->debug_info.ptr;
+    reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+    reader->debug_line_cu_end = obj->debug_line.ptr;
+    reader->current_low_pc = 0;
+    reader->current_str_offsets_base = 0;
+    reader->current_addr_base = 0;
+    reader->current_rnglists_base = 0;
+}
+
+static void
+di_skip_die_attributes(const char **p)
+{
+    for (;;) {
+        uint64_t at = uleb128(p);
+        uint64_t form = uleb128(p);
+        if (!at && !form) break;
+        switch (form) {
+          default:
+            break;
+          case DW_FORM_implicit_const:
+            sleb128(p);
+            break;
+        }
+    }
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+    uint64_t prev = 0;
+    const char *p = reader->q0;
+    for (;;) {
+        uint64_t abbrev_number = uleb128(&p);
+        if (abbrev_number <= prev) break;
+        if (abbrev_number < ABBREV_TABLE_SIZE) {
+            reader->abbrev_table[abbrev_number] = p;
+        }
+        prev = abbrev_number;
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader, FILE *errout)
+{
+    const char *p;
+    struct LineNumberProgramHeader header;
+
+    p = (const char *)reader->debug_line_cu_end;
+    if (parse_debug_line_header(reader->obj, &p, &header, errout))
+        return -1;
+
+    reader->debug_line_cu_end = (char *)header.cu_end;
+    reader->debug_line_format = header.format;
+    reader->debug_line_version = header.version;
+    reader->debug_line_directories = (char *)header.include_directories;
+    reader->debug_line_files = (char *)header.filenames;
+
+    return 0;
+}
+
+static void
+set_addr_idx_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.addr_idx = n;
+    v->type = VAL_addr;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+    v->as.uint64 = n;
+    v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+    v->as.int64 = n;
+    v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->off = 0;
+    v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
+{
+    v->as.ptr = s;
+    v->off = off;
+    v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, const char *s)
+{
+    v->as.ptr = s;
+    v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+    if (v->as.ptr) {
+        return v->as.ptr + v->off;
+    } else {
+        return NULL;
+    }
+}
+
+static const char *
+resolve_strx(DebugInfoReader *reader, uint64_t idx)
+{
+    const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
+    uint64_t off;
+    if (reader->format == 4) {
+        off = ((uint32_t *)p)[idx];
+    }
+    else {
+        off = ((uint64_t *)p)[idx];
+    }
+    return reader->obj->debug_str.ptr + off;
+}
+
+static bool
+debug_info_reader_read_addr_value_member(DebugInfoReader *reader, DebugInfoValue *v, int size)
+{
+    if (size == 4) {
+        set_uint_value(v, read_uint32(&reader->p));
+    } else if (size == 8) {
+        set_uint_value(v, read_uint64(&reader->p));
+    } else {
+        return false;
+    }
+    return true;
+}
+
+#define debug_info_reader_read_addr_value(reader, v, mem) \
+    if (!debug_info_reader_read_addr_value_member((reader), (v), (reader)->mem)) { \
+        kprintf("unknown " #mem ":%d", (reader)->mem); \
+        return false; \
+    }
+
+
+static bool
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v, FILE *errout)
+{
+    switch (form) {
+      case DW_FORM_addr:
+        debug_info_reader_read_addr_value(reader, v, address_size);
+        break;
+      case DW_FORM_block2:
+        v->size = read_uint16(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block4:
+        v->size = read_uint32(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_data4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_data8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_string:
+        v->size = strlen(reader->p);
+        set_cstr_value(v, reader->p);
+        reader->p += v->size + 1;
+        break;
+      case DW_FORM_block:
+        v->size = uleb128(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_block1:
+        v->size = read_uint8(&reader->p);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_data1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_flag:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_sdata:
+        set_int_value(v, read_sleb128(reader));
+        break;
+      case DW_FORM_strp:
+        set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_udata:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_addr:
+        if (reader->current_version <= 2) {
+            // DWARF Version 2 specifies that references have
+            // the same size as an address on the target system
+            debug_info_reader_read_addr_value(reader, v, address_size);
+        } else {
+            debug_info_reader_read_addr_value(reader, v, format);
+        }
+        break;
+      case DW_FORM_ref1:
+        set_uint_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_ref2:
+        set_uint_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_ref4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_ref8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_ref_udata:
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_indirect:
+        /* TODO: read the referred value */
+        set_uint_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_sec_offset:
+        set_uint_value(v, read_uint(reader)); /* offset */
+        /* addrptr: debug_addr */
+        /* lineptr: debug_line */
+        /* loclist: debug_loclists */
+        /* loclistptr: debug_loclists */
+        /* macptr: debug_macro */
+        /* rnglist: debug_rnglists */
+        /* rnglistptr: debug_rnglists */
+        /* stroffsetsptr: debug_str_offsets */
+        break;
+      case DW_FORM_exprloc:
+        v->size = (size_t)read_uleb128(reader);
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_flag_present:
+        set_uint_value(v, 1);
+        break;
+      case DW_FORM_strx:
+        set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
+        break;
+      case DW_FORM_addrx:
+        set_addr_idx_value(v, uleb128(&reader->p));
+        break;
+      case DW_FORM_ref_sup4:
+        set_uint_value(v, read_uint32(&reader->p));
+        break;
+      case DW_FORM_strp_sup:
+        set_uint_value(v, read_uint(reader));
+        /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+        break;
+      case DW_FORM_data16:
+        v->size = 16;
+        set_data_value(v, reader->p);
+        reader->p += v->size;
+        break;
+      case DW_FORM_line_strp:
+        set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
+        break;
+      case DW_FORM_ref_sig8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_implicit_const:
+        set_int_value(v, sleb128(&reader->q));
+        break;
+      case DW_FORM_loclistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_rnglistx:
+        set_uint_value(v, read_uleb128(reader));
+        break;
+      case DW_FORM_ref_sup8:
+        set_uint_value(v, read_uint64(&reader->p));
+        break;
+      case DW_FORM_strx1:
+        set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
+        break;
+      case DW_FORM_strx2:
+        set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
+        break;
+      case DW_FORM_strx3:
+        set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
+        break;
+      case DW_FORM_strx4:
+        set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
+        break;
+      case DW_FORM_addrx1:
+        set_addr_idx_value(v, read_uint8(&reader->p));
+        break;
+      case DW_FORM_addrx2:
+        set_addr_idx_value(v, read_uint16(&reader->p));
+        break;
+      case DW_FORM_addrx3:
+        set_addr_idx_value(v, read_uint24(&reader->p));
+        break;
+      case DW_FORM_addrx4:
+        set_addr_idx_value(v, read_uint32(&reader->p));
+        break;
+      /* we have no support for actually reading the real values of these refs out
+       * of the .gnu_debugaltlink dwz-compressed debuginfo at the moment, but "read"
+       * them anyway so that we advance the reader by the right amount. */
+      case DW_FORM_GNU_ref_alt:
+      case DW_FORM_GNU_strp_alt:
+        read_uint(reader);
+        set_uint_value(v, 0);
+        break;
+      case 0:
+        goto fail;
+        break;
+    }
+    return true;
+
+  fail:
+    kprintf("%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+    return false;
+}
+
+/* find abbrev in current compilation unit */
+static const char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number, FILE *errout)
+{
+    const char *p;
+    if (abbrev_number < ABBREV_TABLE_SIZE) {
+        return reader->abbrev_table[abbrev_number];
+    }
+    p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+    /* skip 255th record */
+    uleb128(&p); /* tag */
+    p++; /* has_children */
+    di_skip_die_attributes(&p);
+    for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+        if (n == 0) {
+            kprintf("%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+            return NULL;
+        }
+        uleb128(&p); /* tag */
+        p++; /* has_children */
+        di_skip_die_attributes(&p);
+    }
+    return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n, FILE *errout)
+{
+    size_t i;
+    kprintf("     0  1  2  3  4  5  6  7  8  9  A  B  C  D  E  F\n");
+    for (i=0; i < n; i++){
+        switch (i & 15) {
+          case 0:
+            kprintf("%02" PRIdSIZE ": %02X ", i/16, p[i]);
+            break;
+          case 15:
+            kprintf("%02X\n", p[i]);
+            break;
+          default:
+            kprintf("%02X ", p[i]);
+            break;
+        }
+    }
+    if ((i & 15) != 15) {
+        kprintf("\n");
+    }
+}
+#define hexdump(p,n,e) hexdump0((const unsigned char *)p, n, e)
+
+static void
+div_inspect(DebugInfoValue *v, FILE *errout)
+{
+    switch (v->type) {
+      case VAL_uint:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
+        break;
+      case VAL_int:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+        break;
+      case VAL_cstr:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+        break;
+      case VAL_data:
+        kprintf("%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
+        hexdump(v->as.ptr, 16, errout);
+        break;
+    }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die, FILE *errout)
+{
+    uint64_t abbrev_number = uleb128(&reader->p);
+    if (abbrev_number == 0) {
+        reader->level--;
+        return NULL;
+    }
+
+    if (!(reader->q = di_find_abbrev(reader, abbrev_number, errout))) return NULL;
+
+    die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+    die->tag = (int)uleb128(&reader->q); /* tag */
+    die->has_children = *reader->q++; /* has_children */
+    if (die->has_children) {
+        reader->level++;
+    }
+    return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp, FILE *errout)
+{
+    uint64_t at = uleb128(&reader->q);
+    uint64_t form = uleb128(&reader->q);
+    if (!at || !form) return NULL;
+    vp->at = at;
+    vp->form = form;
+    if (!debug_info_reader_read_value(reader, form, vp, errout)) return NULL;
+    return vp;
+}
+
+static bool
+di_skip_records(DebugInfoReader *reader, FILE *errout)
+{
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        uint64_t at = uleb128(&reader->q);
+        uint64_t form = uleb128(&reader->q);
+        if (!at || !form) return true;
+        if (!debug_info_reader_read_value(reader, form, &v, errout)) return false;
+    }
+}
+
+typedef struct addr_header {
+    const char *ptr;
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    /* uint8_t segment_selector_size; */
+} addr_header_t;
+
+static bool
+addr_header_init(obj_info_t *obj, addr_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_addr.ptr;
+
+    header->ptr = p;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    return true;
+}
+
+static uint64_t
+read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
+    if (header->address_size == 4) {
+        return ((uint32_t*)(header->ptr + addr_base))[idx];
+    }
+    else {
+        return ((uint64_t*)(header->ptr + addr_base))[idx];
+    }
+}
+
+typedef struct rnglists_header {
+    uint64_t unit_length;
+    uint8_t format;
+    uint8_t address_size;
+    uint32_t offset_entry_count;
+} rnglists_header_t;
+
+static bool
+rnglists_header_init(obj_info_t *obj, rnglists_header_t *header, FILE *errout)
+{
+    const char *p = obj->debug_rnglists.ptr;
+
+    if (!p) return true;
+
+    header->unit_length = *(uint32_t *)p;
+    p += sizeof(uint32_t);
+
+    header->format = 4;
+    if (header->unit_length == 0xffffffff) {
+        header->unit_length = *(uint64_t *)p;
+        p += sizeof(uint64_t);
+        header->format = 8;
+    }
+
+    p += 2; /* version */
+    header->address_size = *p++;
+    if (header->address_size != 4 && header->address_size != 8) {
+        kprintf("unknown address_size:%d", header->address_size);
+        return false;
+    }
+    p++; /* segment_selector_size */
+    header->offset_entry_count = *(uint32_t *)p;
+    return true;
+}
+
+typedef struct {
+    uint64_t low_pc;
+    uint64_t high_pc;
+    uint64_t ranges;
+    bool low_pc_set;
+    bool high_pc_set;
+    bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
+{
+    uint64_t n = 0;
+    if (v->type == VAL_uint) {
+        n = v->as.uint64;
+    }
+    else if (v->type == VAL_addr) {
+        n = read_addr(addr_header, addr_base, v->as.addr_idx);
+    }
+    switch (v->at) {
+      case DW_AT_low_pc:
+        ptr->low_pc = n;
+        ptr->low_pc_set = true;
+        break;
+      case DW_AT_high_pc:
+        if (v->form == DW_FORM_addr) {
+            ptr->high_pc = n;
+        }
+        else {
+            ptr->high_pc = ptr->low_pc + n;
+        }
+        ptr->high_pc_set = true;
+        break;
+      case DW_AT_ranges:
+        ptr->ranges = n;
+        ptr->ranges_set = true;
+        break;
+    }
+}
+
+static uint64_t
+read_dw_form_addr(DebugInfoReader *reader, const char **ptr, FILE *errout)
+{
+    const char *p = *ptr;
+    *ptr = p + reader->address_size;
+    if (reader->address_size == 4) {
+        return read_uint32(&p);
+    } else {
+        return read_uint64(&p);
+    }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            return UINTPTR_MAX;
+        }
+        if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    else if (ptr->ranges_set) {
+        /* TODO: support base address selection entry */
+        const char *p;
+        uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+        bool base_valid = true;
+        if (reader->current_version >= 5) {
+            if (rnglists_header->offset_entry_count == 0) {
+                // DW_FORM_sec_offset
+                p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
+            }
+            else {
+                // DW_FORM_rnglistx
+                const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
+                if (rnglists_header->format == 4) {
+                    p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
+                }
+                else {
+                    p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
+                }
+            }
+            for (;;) {
+                uint8_t rle = read_uint8(&p);
+                uintptr_t from = 0, to = 0;
+                if (rle == DW_RLE_end_of_list) break;
+                switch (rle) {
+                  case DW_RLE_base_addressx:
+                    uleb128(&p);
+                    base_valid = false; /* not supported yet */
+                    break;
+                  case DW_RLE_startx_endx:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_startx_length:
+                    uleb128(&p);
+                    uleb128(&p);
+                    break;
+                  case DW_RLE_offset_pair:
+                    if (!base_valid) break;
+                    from = (uintptr_t)base + uleb128(&p);
+                    to = (uintptr_t)base + uleb128(&p);
+                    break;
+                  case DW_RLE_base_address:
+                    base = read_dw_form_addr(reader, &p, errout);
+                    base_valid = true;
+                    break;
+                  case DW_RLE_start_end:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    break;
+                  case DW_RLE_start_length:
+                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
+                    to = from + uleb128(&p);
+                    break;
+                }
+                if (from <= addr && addr < to) {
+                    return from;
+                }
+            }
+            return 0;
+        }
+        p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            if (from == UINTPTR_MAX) {
+                /* base address selection entry */
+                base = to;
+            }
+            else if (base + from <= addr && addr < base + to) {
+                return (uintptr_t)base + from;
+            }
+        }
+    }
+    else if (ptr->low_pc_set) {
+        if (ptr->low_pc == addr) {
+            return (uintptr_t)ptr->low_pc;
+        }
+    }
+    return 0;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr, FILE *errout)
+{
+    if (ptr->high_pc_set) {
+        if (ptr->ranges_set || !ptr->low_pc_set) {
+            kprintf("low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+            return;
+        }
+        kprintf("low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+    }
+    else if (ptr->ranges_set) {
+        char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+        kprintf("low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+        for (;;) {
+            uintptr_t from = read_uintptr(&p);
+            uintptr_t to = read_uintptr(&p);
+            if (!from && !to) break;
+            kprintf("%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+        }
+        kprintf("\n");
+    }
+    else if (ptr->low_pc_set) {
+        kprintf("low_pc:%"PRIx64"\n",ptr->low_pc);
+    }
+    else {
+        kprintf("empty\n");
+    }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader, FILE *errout)
+{
+    uint64_t unit_length;
+    uint16_t version;
+    uint64_t debug_abbrev_offset;
+    reader->format = 4;
+    reader->current_cu = reader->p;
+    unit_length = read_uint32(&reader->p);
+    if (unit_length == 0xffffffff) {
+        unit_length = read_uint64(&reader->p);
+        reader->format = 8;
+    }
+    reader->cu_end = reader->p + unit_length;
+    version = read_uint16(&reader->p);
+    reader->current_version = version;
+    if (version > 5) {
+        return -1;
+    }
+    else if (version == 5) {
+        /* unit_type = */ read_uint8(&reader->p);
+        reader->address_size = read_uint8(&reader->p);
+        debug_abbrev_offset = read_uint(reader);
+    }
+    else {
+        debug_abbrev_offset = read_uint(reader);
+        reader->address_size = read_uint8(&reader->p);
+    }
+    if (reader->address_size != 4 && reader->address_size != 8) {
+        kprintf("unknown address_size:%d", reader->address_size);
+        return -1;
+    }
+    reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+    reader->level = 0;
+    di_read_debug_abbrev_cu(reader);
+    if (di_read_debug_line_cu(reader, errout)) return -1;
+
+    do {
+        DIE die;
+
+        if (!di_read_die(reader, &die, errout)) continue;
+
+        if (die.tag != DW_TAG_compile_unit) {
+            if (!di_skip_records(reader, errout)) return -1;
+            break;
+        }
+
+        reader->current_str_offsets_base = 0;
+        reader->current_addr_base = 0;
+        reader->current_rnglists_base = 0;
+
+        DebugInfoValue low_pc = {{0}};
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            if (!di_read_record(reader, &v, errout)) break;
+            switch (v.at) {
+              case DW_AT_low_pc:
+                // clang may output DW_AT_addr_base after DW_AT_low_pc.
+                // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
+                low_pc = v;
+                break;
+              case DW_AT_str_offsets_base:
+                reader->current_str_offsets_base = v.as.uint64;
+                break;
+              case DW_AT_addr_base:
+                reader->current_addr_base = v.as.uint64;
+                break;
+              case DW_AT_rnglists_base:
+                reader->current_rnglists_base = v.as.uint64;
+                break;
+            }
+        }
+        // Resolve the DW_FORM_addr of DW_AT_low_pc
+        switch (low_pc.type) {
+            case VAL_uint:
+                reader->current_low_pc = low_pc.as.uint64;
+                break;
+            case VAL_addr:
+                {
+                    addr_header_t header = {0};
+                    if (!addr_header_init(reader->obj, &header, errout)) return -1;
+                    reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
+                }
+                break;
+        }
+    } while (0);
+
+    return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line, FILE *errout)
+{
+    const char *p = reader->p;
+    const char *q = reader->q;
+    int level = reader->level;
+    DIE die;
+
+    switch (form) {
+      case DW_FORM_ref1:
+      case DW_FORM_ref2:
+      case DW_FORM_ref4:
+      case DW_FORM_ref8:
+      case DW_FORM_ref_udata:
+        reader->p = reader->current_cu + abstract_origin;
+        break;
+      case DW_FORM_ref_addr:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sig8:
+        goto finish; /* not supported yet */
+      case DW_FORM_ref_sup4:
+      case DW_FORM_ref_sup8:
+        goto finish; /* not supported yet */
+      default:
+        goto finish;
+    }
+    if (!di_read_die(reader, &die, errout)) goto finish;
+
+    /* enumerate abbrev */
+    for (;;) {
+        DebugInfoValue v = {{0}};
+        if (!di_read_record(reader, &v, errout)) break;
+        switch (v.at) {
+          case DW_AT_name:
+            line->sname = get_cstr_value(&v);
+            break;
+        }
+    }
+
+  finish:
+    reader->p = p;
+    reader->q = q;
+    reader->level = level;
+}
+
+static bool
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+                line_info_t *lines, int offset, FILE *errout)
+{
+
+    addr_header_t addr_header = {0};
+    if (!addr_header_init(reader->obj, &addr_header, errout)) return false;
+
+    rnglists_header_t rnglists_header = {0};
+    if (!rnglists_header_init(reader->obj, &rnglists_header, errout)) return false;
+
+    while (reader->p < reader->cu_end) {
+        DIE die;
+        ranges_t ranges = {0};
+        line_info_t line = {0};
+
+        if (!di_read_die(reader, &die, errout)) continue;
+        /* kprintf("%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+        if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+          skip_die:
+            if (!di_skip_records(reader, errout)) return false;
+            continue;
+        }
+
+        /* enumerate abbrev */
+        for (;;) {
+            DebugInfoValue v = {{0}};
+            /* ptrdiff_t pos = reader->p - reader->p0; */
+            if (!di_read_record(reader, &v, errout)) break;
+            /* kprintf("\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+            /* div_inspect(&v, errout); */
+            switch (v.at) {
+              case DW_AT_name:
+                line.sname = get_cstr_value(&v);
+                break;
+              case DW_AT_call_file:
+                fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj, errout);
+                break;
+              case DW_AT_call_line:
+                line.line = (int)v.as.uint64;
+                break;
+              case DW_AT_low_pc:
+              case DW_AT_high_pc:
+              case DW_AT_ranges:
+                ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
+                break;
+              case DW_AT_declaration:
+                goto skip_die;
+              case DW_AT_inline:
+                /* 1 or 3 */
+                break; /* goto skip_die; */
+              case DW_AT_abstract_origin:
+                read_abstract_origin(reader, v.form, v.as.uint64, &line, errout);
+                break; /* goto skip_die; */
+            }
+        }
+        /* ranges_inspect(reader, &ranges, errout); */
+        /* kprintf("%d:%tx: %x ",__LINE__,diepos,die.tag); */
+        for (int i=offset; i < num_traces; i++) {
+            uintptr_t addr = (uintptr_t)traces[i];
+            uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+            uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header, errout);
+            if (saddr == UINTPTR_MAX) return false;
+            if (saddr) {
+                /* kprintf("%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+                if (lines[i].sname) {
+                    line_info_t *lp = malloc(sizeof(line_info_t));
+                    memcpy(lp, &lines[i], sizeof(line_info_t));
+                    lines[i].next = lp;
+                    lp->dirname = line.dirname;
+                    lp->filename = line.filename;
+                    lp->line = line.line;
+                    lp->saddr = 0;
+                }
+                lines[i].path = reader->obj->path;
+                lines[i].base_addr = line.base_addr;
+                lines[i].sname = line.sname;
+                lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+            }
+        }
+    }
+    return true;
+}
+
+// This function parses the following attributes of Line Number Program Header in DWARF 5:
+//
+// * directory_entry_format_count
+// * directory_entry_format
+// * directories_count
+// * directories
+//
+// or
+//
+// * file_name_entry_format_count
+// * file_name_entry_format
+// * file_names_count
+// * file_names
+//
+// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
+static const char *
+parse_ver5_debug_line_header(const char *p, int idx, uint8_t format,
+                             obj_info_t *obj, const char **out_path,
+                             uint64_t *out_directory_index, FILE *errout)
+{
+    int i, j;
+    int entry_format_count = *(uint8_t *)p++;
+    const char *entry_format = p;
+
+    /* skip the part of entry_format */
+    for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
+
+    int entry_count = (int)uleb128(&p);
+
+    DebugInfoReader reader = {0};
+    debug_info_reader_init(&reader, obj);
+    reader.format = format;
+    reader.p = p;
+    for (j = 0; j < entry_count; j++) {
+        const char *format = entry_format;
+        for (i = 0; i < entry_format_count; i++) {
+            DebugInfoValue v = {{0}};
+            unsigned long dw_lnct = uleb128(&format);
+            unsigned long dw_form = uleb128(&format);
+            if (!debug_info_reader_read_value(&reader, dw_form, &v, errout)) return 0;
+            if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
+                *out_path = v.as.ptr + v.off;
+            if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
+                *out_directory_index = v.as.uint64;
+        }
+        if (j == idx) return 0;
+    }
+
+    return reader.p;
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+    *ptr = NULL;
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+    ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+    unsigned long destsize = chdr->ch_size;
+    int ret = 0;
+
+    if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+        /* unsupported compression type */
+        return 0;
+    }
+
+    *ptr = malloc(destsize);
+    if (!*ptr) return 0;
+    ret = uncompress((Bytef *)*ptr, &destsize,
+            (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+            shdr->sh_size - sizeof(ElfW(Chdr)));
+    if (ret != Z_OK) goto fail;
+    return destsize;
+
+fail:
+    free(*ptr);
+    *ptr = NULL;
+#endif
+    return 0;
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+    int i, j;
+    char *shstr;
+    ElfW(Ehdr) *ehdr;
+    ElfW(Shdr) *shdr, *shstr_shdr;
+    ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+    ElfW(Shdr) *note_gnu_build_id = NULL;
+    int fd;
+    off_t filesize;
+    char *file;
+    ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
+    ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
+    obj_info_t *obj = *objp;
+    uintptr_t dladdr_fbase = 0;
+
+    fd = open(binary_filename, O_RDONLY);
+    if (fd < 0) {
+        goto fail;
+    }
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
+    }
+    close(fd);
+
+    ehdr = (ElfW(Ehdr) *)file;
+    if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
+        /*
+         * Huh? Maybe filename was overridden by setproctitle() and
+         * it match non-elf file.
+         */
+        goto fail;
+    }
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+    shstr_shdr = shdr + ehdr->e_shstrndx;
+    shstr = file + shstr_shdr->sh_offset;
+
+    for (i = 0; i < ehdr->e_shnum; i++) {
+        char *section_name = shstr + shdr[i].sh_name;
+        switch (shdr[i].sh_type) {
+          case SHT_STRTAB:
+            if (!strcmp(section_name, ".strtab")) {
+                strtab_shdr = shdr + i;
+            }
+            else if (!strcmp(section_name, ".dynstr")) {
+                dynstr_shdr = shdr + i;
+            }
+            break;
+          case SHT_SYMTAB:
+            /* if (!strcmp(section_name, ".symtab")) */
+            symtab_shdr = shdr + i;
+            break;
+          case SHT_DYNSYM:
+            /* if (!strcmp(section_name, ".dynsym")) */
+            dynsym_shdr = shdr + i;
+            break;
+          case SHT_NOTE:
+            if (!strcmp(section_name, ".note.gnu.build-id")) {
+                note_gnu_build_id = shdr + i;
+            }
+            break;
+          case SHT_PROGBITS:
+            if (!strcmp(section_name, ".gnu_debuglink")) {
+                gnu_debuglink_shdr = shdr + i;
+            }
+            else {
+                const char *debug_section_names[] = {
+                    ".debug_abbrev",
+                    ".debug_info",
+                    ".debug_line",
+                    ".debug_ranges",
+                    ".debug_str_offsets",
+                    ".debug_addr",
+                    ".debug_rnglists",
+                    ".debug_str",
+                    ".debug_line_str"
+                };
+
+                for (j=0; j < DWARF_SECTION_COUNT; j++) {
+                    struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                    if (strcmp(section_name, debug_section_names[j]) != 0)
+                        continue;
+
+                    s->ptr = file + shdr[i].sh_offset;
+                    s->size = shdr[i].sh_size;
+                    s->flags = shdr[i].sh_flags;
+                    if (s->flags & SHF_COMPRESSED) {
+                        s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+                        if (!s->size) goto fail;
+                    }
+                    break;
+                }
+            }
+            break;
+        }
+    }
+
+    if (offset == 0) {
+        /* main executable */
+        if (dynsym_shdr && dynstr_shdr) {
+            char *strtab = file + dynstr_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+            int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+            void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+            if (handle) {
+                for (j = 0; j < symtab_count; j++) {
+                    ElfW(Sym) *sym = &symtab[j];
+                    Dl_info info;
+                    void *s;
+                    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+                    s = dlsym(handle, strtab + sym->st_name);
+                    if (s && dladdr(s, &info)) {
+                        obj->base_addr = dladdr_fbase;
+                        dladdr_fbase = (uintptr_t)info.dli_fbase;
+                        break;
+                    }
+                }
+                dlclose(handle);
+            }
+            if (ehdr->e_type == ET_EXEC) {
+                obj->base_addr = 0;
+            }
+            else {
+                /* PIE (position-independent executable) */
+                obj->base_addr = dladdr_fbase;
+            }
+        }
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        i = 0;
+        while (reader.p < reader.pend) {
+            /* kprintf("%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+            if (di_read_cu(&reader, errout)) goto use_symtab;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto use_symtab;
+        }
+    }
+    else {
+        /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+        if (!symtab_shdr) {
+            /* This file doesn't have symtab, use dynsym instead */
+            symtab_shdr = dynsym_shdr;
+            strtab_shdr = dynstr_shdr;
+        }
+
+        if (symtab_shdr && strtab_shdr) {
+            char *strtab = file + strtab_shdr->sh_offset;
+            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+            int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+            for (j = 0; j < symtab_count; j++) {
+                ElfW(Sym) *sym = &symtab[j];
+                uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+                if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+                for (i = offset; i < num_traces; i++) {
+                    uintptr_t d = (uintptr_t)traces[i] - saddr;
+                    if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+                        continue;
+                    /* fill symbol name and addr from .symtab */
+                    if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+                    lines[i].saddr = saddr;
+                    lines[i].path  = obj->path;
+                    lines[i].base_addr = obj->base_addr;
+                }
+            }
+        }
+    }
+
+    if (!obj->debug_line.ptr) {
+        /* This file doesn't have .debug_line section,
+           let's check .gnu_debuglink section instead. */
+        if (gnu_debuglink_shdr && check_debuglink) {
+            follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+                             num_traces, traces,
+                             objp, lines, offset, errout);
+        }
+        if (note_gnu_build_id && check_debuglink) {
+            ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
+            const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
+            follow_debuglink_build_id(build_id, nhdr->n_descsz,
+                               num_traces, traces,
+                               objp, lines, offset, errout);
+        }
+        goto finish;
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
+finish:
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+        obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+{
+# ifdef __LP64__
+#  define LP(x) x##_64
+# else
+#  define LP(x) x
+# endif
+    int fd;
+    off_t filesize;
+    char *file, *p = NULL;
+    obj_info_t *obj = *objp;
+    struct LP(mach_header) *header;
+    uintptr_t dladdr_fbase = 0;
+
+    {
+        char *s = binary_filename;
+        char *base = strrchr(binary_filename, '/')+1;
+        size_t max = PATH_MAX;
+        size_t size = strlen(binary_filename);
+        size_t basesize = size - (base - binary_filename);
+        s += size;
+        max -= size;
+        p = s;
+        size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+        if (size == 0) goto fail;
+        s += size;
+        max -= size;
+        if (max <= basesize) goto fail;
+        memcpy(s, base, basesize);
+        s[basesize] = 0;
+
+        fd = open(binary_filename, O_RDONLY);
+        if (fd < 0) {
+            *p = 0; /* binary_filename becomes original file name */
+            fd = open(binary_filename, O_RDONLY);
+            if (fd < 0) {
+                goto fail;
+            }
+        }
+    }
+
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+        int e = errno;
+        close(fd);
+        kprintf("lseek: %s\n", strerror(e));
+        goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+        close(fd);
+        kprintf("Too large file %s\n", binary_filename);
+        goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+        int e = errno;
+        close(fd);
+        kprintf("mmap: %s\n", strerror(e));
+        goto fail;
+    }
+    close(fd);
+
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    header = (struct LP(mach_header) *)file;
+    if (header->magic == LP(MH_MAGIC)) {
+        /* non universal binary */
+        p = file;
+    }
+    else if (header->magic == FAT_CIGAM) {
+        struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+        struct fat_header *fat = (struct fat_header *)file;
+        char *q = file + sizeof(*fat);
+        uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+        /* kprintf("%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+        for (uint32_t i = 0; i < nfat_arch; i++) {
+            struct fat_arch *arch = (struct fat_arch *)q;
+            cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+            cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+            uint32_t offset = __builtin_bswap32(arch->offset);
+            /* kprintf("%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+            if (mhp->cputype == cputype &&
+                    (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+                p = file + offset;
+                file = p;
+                header = (struct LP(mach_header) *)p;
+                if (header->magic == LP(MH_MAGIC)) {
+                    goto found_mach_header;
+                }
+                break;
+            }
+            q += sizeof(*arch);
+        }
+        kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+        close(fd);
+        goto fail;
+    }
+    else {
+# ifdef __LP64__
+#   define bitsize "64"
+# else
+#   define bitsize "32"
+# endif
+        kprintf("'%s' is not a " bitsize
+                "-bit Mach-O file!\n",binary_filename);
+# undef bitsize
+        close(fd);
+        goto fail;
+    }
+found_mach_header:
+    p += sizeof(*header);
+
+    for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+        struct load_command *lcmd = (struct load_command *)p;
+        switch (lcmd->cmd) {
+          case LP(LC_SEGMENT):
+            {
+                static const char *debug_section_names[] = {
+                    "__debug_abbrev",
+                    "__debug_info",
+                    "__debug_line",
+                    "__debug_ranges",
+                    "__debug_str_offsets",
+                    "__debug_addr",
+                    "__debug_rnglists",
+                    "__debug_str",
+                    "__debug_line_str",
+                };
+                struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+                if (strcmp(scmd->segname, "__TEXT") == 0) {
+                    obj->vmaddr = scmd->vmaddr;
+                }
+                else if (strcmp(scmd->segname, "__DWARF") == 0) {
+                    p += sizeof(struct LP(segment_command));
+                    for (uint64_t i = 0; i < scmd->nsects; i++) {
+                        struct LP(section) *sect = (struct LP(section) *)p;
+                        p += sizeof(struct LP(section));
+                        for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+                            struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+                            if (strcmp(sect->sectname, debug_section_names[j]) != 0
+#ifdef __APPLE__
+                                    /* macOS clang 16 generates DWARF5, which have Mach-O
+                                     * section names that are limited to 16 characters,
+                                     * which causes sections with long names to be truncated
+                                     * and not match above.
+                                     * See: https://wiki.dwarfstd.org/Best_Practices.md#Mach-2d-O
+                                     */
+                                    && strncmp(sect->sectname, debug_section_names[j], 16) != 0
+#endif
+                                )
+                                continue;
+
+                            s->ptr = file + sect->offset;
+                            s->size = sect->size;
+                            s->flags = sect->flags;
+                            if (s->flags & SHF_COMPRESSED) {
+                                goto fail;
+                            }
+                            break;
+                        }
+                    }
+                }
+            }
+            break;
+
+          case LC_SYMTAB:
+            {
+                struct symtab_command *cmd = (struct symtab_command *)lcmd;
+                struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+                char *strtab = file + cmd->stroff, *sname = 0;
+                uint32_t j;
+                uintptr_t saddr = 0;
+                /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
+                for (j = 0; j < cmd->nsyms; j++) {
+                    uintptr_t symsize, d;
+                    struct LP(nlist) *e = &nl[j];
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                    if (e->n_type != N_FUN) continue;
+                    if (e->n_sect) {
+                        saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+                        sname = strtab + e->n_un.n_strx;
+                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+                        continue;
+                    }
+                    for (int k = offset; k < num_traces; k++) {
+                        d = (uintptr_t)traces[k] - saddr;
+                        symsize = e->n_value;
+                        /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+                        if (lines[k].line > 0 || d > (uintptr_t)symsize)
+                            continue;
+                        /* fill symbol name and addr from .symtab */
+                        if (!lines[k].sname) lines[k].sname = sname;
+                        lines[k].saddr = saddr;
+                        lines[k].path  = obj->path;
+                        lines[k].base_addr = obj->base_addr;
+                    }
+                }
+            }
+        }
+        p += lcmd->cmdsize;
+    }
+
+    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+        DebugInfoReader reader;
+        debug_info_reader_init(&reader, obj);
+        while (reader.p < reader.pend) {
+            if (di_read_cu(&reader, errout)) goto fail;
+            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
+                goto fail;
+        }
+    }
+
+    if (parse_debug_line(num_traces, traces,
+            obj->debug_line.ptr,
+            obj->debug_line.size,
+            obj, lines, offset, errout) == -1)
+        goto fail;
+
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+#endif
+
+#define HAVE_MAIN_EXE_PATH
+#if defined(__FreeBSD__) || defined(__DragonFly__)
+# include <sys/sysctl.h>
+#endif
+/* ssize_t main_exe_path(FILE *errout)
+ *
+ * store the path of the main executable to `binary_filename`,
+ * and returns strlen(binary_filename).
+ * it is NUL terminated.
+ */
+#if defined(__linux__) || defined(__NetBSD__)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+# if defined(__linux__)
+#  define PROC_SELF_EXE "/proc/self/exe"
+# elif defined(__NetBSD__)
+#  define PROC_SELF_EXE "/proc/curproc/exe"
+# endif
+    ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+    if (len < 0) return 0;
+    binary_filename[len] = 0;
+    return len;
+}
+#elif defined(__FreeBSD__) || defined(__DragonFly__)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+    int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
+    size_t len = PATH_MAX;
+    int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
+    if (err) {
+        kprintf("Can't get the path of ruby");
+        return -1;
+    }
+    len--; /* sysctl sets strlen+1 */
+    return len;
+}
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(FILE *errout)
+{
+    int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+    if (len == 0) return 0;
+    binary_filename[len] = 0;
+    return len;
+}
+#else
+#undef HAVE_MAIN_EXE_PATH
+#endif
+
+static void
+print_line0(line_info_t *line, void *address, FILE *errout)
+{
+    uintptr_t addr = (uintptr_t)address;
+    uintptr_t d = addr - line->saddr;
+    if (!address) {
+        /* inlined */
+        if (line->dirname && line->dirname[0]) {
+            kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+        }
+        else {
+            kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+        }
+    }
+    else if (!line->path) {
+        kprintf("[0x%"PRIxPTR"]\n", addr);
+    }
+    else if (!line->sname) {
+        kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+    }
+    else if (!line->saddr) {
+        kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
+    }
+    else if (line->line <= 0) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+                d, addr);
+    }
+    else if (!line->filename) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+                d, addr, line->line);
+    }
+    else if (line->dirname && line->dirname[0]) {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+                d, addr, line->dirname, line->filename, line->line);
+    }
+    else {
+        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+                d, addr, line->filename, line->line);
+    }
+}
+
+static void
+print_line(line_info_t *line, void *address, FILE *errout)
+{
+    print_line0(line, address, errout);
+    if (line->next) {
+        print_line(line->next, NULL, errout);
+    }
+}
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
+{
+    int i;
+    /* async-signal unsafe */
+    line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
+    obj_info_t *obj = NULL;
+    /* 2 is NULL + main executable */
+    void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+
+#ifdef HAVE_MAIN_EXE_PATH
+    char *main_path = NULL; /* used on printing backtrace */
+    ssize_t len;
+    if ((len = main_exe_path(errout)) > 0) {
+        main_path = (char *)alloca(len + 1);
+        if (main_path) {
+            uintptr_t addr;
+            memcpy(main_path, binary_filename, len+1);
+            append_obj(&obj);
+            obj->path = main_path;
+            addr = fill_lines(num_traces, traces, 1, &obj, lines, 0, errout);
+            if (addr != (uintptr_t)-1) {
+                dladdr_fbases[0] = (void *)addr;
+            }
+        }
+    }
+#endif
+
+    /* fill source lines by reading dwarf */
+    for (i = 0; i < num_traces; i++) {
+        Dl_info info;
+        if (lines[i].line) continue;
+        if (dladdr(traces[i], &info)) {
+            const char *path;
+            void **p;
+
+            /* skip symbols which is in already checked objects */
+            /* if the binary is strip-ed, this may effect */
+            for (p=dladdr_fbases; *p; p++) {
+                if (*p == info.dli_fbase) {
+                    if (info.dli_fname) lines[i].path = info.dli_fname;
+                    if (info.dli_sname) lines[i].sname = info.dli_sname;
+                    goto next_line;
+                }
+            }
+            *p = info.dli_fbase;
+
+            append_obj(&obj);
+            obj->base_addr = (uintptr_t)info.dli_fbase;
+            path = info.dli_fname;
+            obj->path = path;
+            if (path) lines[i].path = path;
+            if (info.dli_sname) {
+                lines[i].sname = info.dli_sname;
+                lines[i].saddr = (uintptr_t)info.dli_saddr;
+            }
+            strlcpy(binary_filename, path, PATH_MAX);
+            if (fill_lines(num_traces, traces, 1, &obj, lines, i, errout) == (uintptr_t)-1)
+                break;
+        }
+next_line:
+        continue;
+    }
+
+    /* output */
+    for (i = 0; i < num_traces; i++) {
+        print_line(&lines[i], traces[i], errout);
+
+        /* FreeBSD's backtrace may show _start and so on */
+        if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
+            break;
+    }
+
+    /* free */
+    while (obj) {
+        obj_info_t *o = obj;
+        for (i=0; i < DWARF_SECTION_COUNT; i++) {
+            struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+            if (s->flags & SHF_COMPRESSED) {
+                free(s->ptr);
+            }
+        }
+        if (obj->mapped_size) {
+            munmap(obj->mapped, obj->mapped_size);
+        }
+        obj = o->next;
+        free(o);
+    }
+    for (i = 0; i < num_traces; i++) {
+        line_info_t *line = lines[i].next;
+        while (line) {
+            line_info_t *l = line;
+            line = line->next;
+            free(l);
+        }
+    }
+    free(lines);
+    free(dladdr_fbases);
+}
+
+#undef kprintf
+
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..ff8e476b92
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,22 @@
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
+
+#include <stdio.h>
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 120fd13019..b471823876 100644
--- a/array.c
+++ b/array.c
@@ -1,982 +1,8992 @@
-/************************************************
+/**********************************************************************
 
   array.c -
 
-  $Author: matz $
-  $Date: 1995/01/10 10:42:18 $
+  $Author$
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1995 Yukihiro Matsumoto
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
+  Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
+  Copyright (C) 2000  Information-technology Promotion Agency, Japan
+
+**********************************************************************/
+
+#include "debug_counter.h"
+#include "id.h"
+#include "internal.h"
+#include "internal/array.h"
+#include "internal/compar.h"
+#include "internal/enum.h"
+#include "internal/gc.h"
+#include "internal/hash.h"
+#include "internal/numeric.h"
+#include "internal/object.h"
+#include "internal/proc.h"
+#include "internal/rational.h"
+#include "internal/vm.h"
+#include "probes.h"
+#include "ruby/encoding.h"
+#include "ruby/st.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+#include "ruby/ractor.h"
+#include "vm_core.h"
+#include "builtin.h"
+
+#if !ARRAY_DEBUG
+# undef NDEBUG
+# define NDEBUG
+#endif
+#include "ruby_assert.h"
+
+VALUE rb_cArray;
+VALUE rb_cArray_empty_frozen;
+
+/* Flags of RArray
+ *
+ * 0:   RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
+ *          The array is shared. The buffer this array points to is owned by
+ *          another array (the shared root).
+ * 1:   RARRAY_EMBED_FLAG
+ *          The array is embedded (its contents follow the header, rather than
+ *          being on a separately allocated buffer).
+ * 3-9: RARRAY_EMBED_LEN
+ *          The length of the array when RARRAY_EMBED_FLAG is set.
+ * 12:  RARRAY_SHARED_ROOT_FLAG
+ *          The array is a shared root that does reference counting. The buffer
+ *          this array points to is owned by this array but may be pointed to
+ *          by other arrays.
+ *          Note: Frozen arrays may be a shared root without this flag being
+ *                set. Frozen arrays do not have reference counting because
+ *                they cannot be modified. Not updating the reference count
+ *                improves copy-on-write performance. Their reference count is
+ *                assumed to be infinity.
+ * 14:  RARRAY_PTR_IN_USE_FLAG
+ *          The buffer of the array is in use. This is only used during
+ *          debugging.
+ */
+
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
 
-************************************************/
+#define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
 
-#include "ruby.h"
+RBIMPL_ATTR_MAYBE_UNUSED()
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+    return RB_TYPE_P(ary, T_ARRAY);
+}
 
-VALUE C_Array;
+#define ARY_HEAP_PTR(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(!ARY_SHARED_ROOT_P(a)), \
+                          RARRAY(a)->as.heap.aux.capa)
+
+#define ARY_EMBED_PTR(a) (RUBY_ASSERT(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+    (RUBY_ASSERT(ARY_EMBED_P(a)), \
+     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+         (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (RUBY_ASSERT(should_be_T_ARRAY((VALUE)(a))), \
+                            !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
+
+#define FL_SET_EMBED(a) do { \
+    RUBY_ASSERT(!ARY_SHARED_P(a)); \
+    FL_SET((a), RARRAY_EMBED_FLAG); \
+    ary_verify(a); \
+} while (0)
+
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_FLAG); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
+
+#define ARY_SET_PTR_FORCE(ary, p) \
+    (RARRAY(ary)->as.heap.ptr = (p))
+#define ARY_SET_PTR(ary, p) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_PTR_FORCE(ary, p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+    long tmp_n = (n); \
+    RUBY_ASSERT(ARY_EMBED_P(ary)); \
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), (n)); \
+    } \
+    else { \
+        ARY_SET_HEAP_LEN((ary), (n)); \
+    } \
+    RUBY_ASSERT(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do  { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do  { \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+    } \
+    else { \
+        RARRAY(ary)->as.heap.len += (n); \
+    } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
+                       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
+#define ARY_SET_CAPA_FORCE(ary, n) \
+    RARRAY(ary)->as.heap.aux.capa = (n);
+#define ARY_SET_CAPA(ary, n) do { \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    RUBY_ASSERT(!ARY_SHARED_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    ARY_SET_CAPA_FORCE(ary, n); \
+} while (0)
+
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(ary)); \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT((value) >= 0); \
+    RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+    RUBY_ASSERT(!ARY_SHARED_P(a));
+    RUBY_ASSERT(!OBJ_FROZEN(a));
 
-VALUE rb_to_a();
+    RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
 
-#define ARY_DEFAULT_SIZE 16
+static long
+ary_embed_capa(VALUE ary)
+{
+    size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
+    RUBY_ASSERT(size % sizeof(VALUE) == 0);
+    return size / sizeof(VALUE);
+}
+
+static size_t
+ary_embed_size(long capa)
+{
+    size_t size = offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
+    if (size < sizeof(struct RArray)) size = sizeof(struct RArray);
+    return size;
+}
+
+static bool
+ary_embeddable_p(long capa)
+{
+    return rb_gc_size_allocatable_p(ary_embed_size(capa));
+}
+
+bool
+rb_ary_embeddable_p(VALUE ary)
+{
+    /* An array cannot be turned embeddable when the array is:
+     *  - Shared root: other objects may point to the buffer of this array
+     *    so we cannot make it embedded.
+     *  - Frozen: this array may also be a shared root without the shared root
+     *    flag.
+     *  - Shared: we don't want to re-embed an array that points to a shared
+     *    root (to save memory).
+     */
+    return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
+}
+
+size_t
+rb_ary_size_as_embedded(VALUE ary)
+{
+    size_t real_size;
+
+    if (ARY_EMBED_P(ary)) {
+        real_size = ary_embed_size(ARY_EMBED_LEN(ary));
+    }
+    else if (rb_ary_embeddable_p(ary)) {
+        real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
+    }
+    else {
+        real_size = sizeof(struct RArray);
+    }
+    return real_size;
+}
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
+
+    if (ARY_SHARED_P(ary)) {
+        VALUE root = ARY_SHARED_ROOT(ary);
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        const VALUE *root_ptr = RARRAY_CONST_PTR(root);
+        long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+        RUBY_ASSERT(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
+        RUBY_ASSERT(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+        ary_verify(root);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        RUBY_ASSERT(!ARY_SHARED_P(ary));
+        RUBY_ASSERT(RARRAY_LEN(ary) <= ary_embed_capa(ary));
+    }
+    else {
+        const VALUE *ptr = RARRAY_CONST_PTR(ary);
+        long i, len = RARRAY_LEN(ary);
+        volatile VALUE v;
+        if (len > 1) len = 1; /* check only HEAD */
+        for (i=0; i<len; i++) {
+            v = ptr[i]; /* access check */
+        }
+        v = v;
+    }
+
+    return ary;
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+    return (VALUE *)RARRAY_CONST_PTR(ary);
+}
+
+void
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+    FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
+
+void
+rb_mem_clear(VALUE *mem, long size)
+{
+    while (size--) {
+        *mem++ = Qnil;
+    }
+}
+
+static void
+ary_mem_clear(VALUE ary, long beg, long size)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+        rb_mem_clear(ptr + beg, size);
+    });
+}
+
+static inline void
+memfill(register VALUE *mem, register long size, register VALUE val)
+{
+    while (size--) {
+        *mem++ = val;
+    }
+}
+
+static void
+ary_memfill(VALUE ary, long beg, long size, VALUE val)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+        memfill(ptr + beg, size, val);
+        RB_OBJ_WRITTEN(ary, Qundef, val);
+    });
+}
+
+static void
+ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
+{
+    RUBY_ASSERT(!ARY_SHARED_P(buff_owner_ary));
+
+    if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
+        rb_gc_writebarrier_remember(buff_owner_ary);
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMCPY(ptr+beg, argv, VALUE, argc);
+        });
+    }
+    else {
+        int i;
+        RARRAY_PTR_USE(ary, ptr, {
+            for (i=0; i<argc; i++) {
+                RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+            }
+        });
+    }
+}
+
+static void
+ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
+{
+    ary_memcpy0(ary, beg, argc, argv, ary);
+}
+
+static VALUE *
+ary_heap_alloc_buffer(size_t capa)
+{
+    return ALLOC_N(VALUE, capa);
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+    ruby_sized_xfree((void *)ptr, size);
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+    ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+}
+
+static size_t
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, ARY_HEAP_CAPA(ary));
+    ary_verify(ary);
+
+    return new_capa;
+}
+
+void
+rb_ary_make_embedded(VALUE ary)
+{
+    RUBY_ASSERT(rb_ary_embeddable_p(ary));
+    if (!ARY_EMBED_P(ary)) {
+        const VALUE *buf = ARY_HEAP_PTR(ary);
+        long len = ARY_HEAP_LEN(ary);
+
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, len);
+
+        MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
+
+        ary_heap_free_ptr(ary, buf, len * sizeof(VALUE));
+    }
+}
+
+static void
+ary_resize_capa(VALUE ary, long capacity)
+{
+    RUBY_ASSERT(RARRAY_LEN(ary) <= capacity);
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+
+    if (capacity > ary_embed_capa(ary)) {
+        size_t new_capa = capacity;
+        if (ARY_EMBED_P(ary)) {
+            long len = ARY_EMBED_LEN(ary);
+            VALUE *ptr = ary_heap_alloc_buffer(capacity);
+
+            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+            FL_UNSET_EMBED(ary);
+            ARY_SET_PTR(ary, ptr);
+            ARY_SET_HEAP_LEN(ary, len);
+        }
+        else {
+            new_capa = ary_heap_realloc(ary, capacity);
+        }
+        ARY_SET_CAPA(ary, new_capa);
+    }
+    else {
+        if (!ARY_EMBED_P(ary)) {
+            long len = ARY_HEAP_LEN(ary);
+            long old_capa = ARY_HEAP_CAPA(ary);
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
+
+            if (len > capacity) len = capacity;
+            MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+            ary_heap_free_ptr(ary, ptr, old_capa);
+
+            FL_SET_EMBED(ary);
+            ARY_SET_LEN(ary, len);
+        }
+    }
+
+    ary_verify(ary);
+}
+
+static inline void
+ary_shrink_capa(VALUE ary)
+{
+    long capacity = ARY_HEAP_LEN(ary);
+    long old_capa = ARY_HEAP_CAPA(ary);
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    RUBY_ASSERT(old_capa >= capacity);
+    if (old_capa > capacity) {
+        size_t new_capa = ary_heap_realloc(ary, capacity);
+        ARY_SET_CAPA(ary, new_capa);
+    }
+
+    ary_verify(ary);
+}
+
+static void
+ary_double_capa(VALUE ary, long min)
+{
+    long new_capa = ARY_CAPA(ary) / 2;
+
+    if (new_capa < ARY_DEFAULT_SIZE) {
+        new_capa = ARY_DEFAULT_SIZE;
+    }
+    if (new_capa >= ARY_MAX_SIZE - min) {
+        new_capa = (ARY_MAX_SIZE - min) / 2;
+    }
+    new_capa += min;
+    ary_resize_capa(ary, new_capa);
+
+    ary_verify(ary);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared_root)
+{
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
+    }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+    VALUE shared_root = ARY_SHARED_ROOT(ary);
+    rb_ary_decrement_share(shared_root);
+    FL_UNSET_SHARED(ary);
+}
+
+static void
+rb_ary_reset(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+        ary_heap_free(ary);
+    }
+    else if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+    }
+
+    FL_SET_EMBED(ary);
+    ARY_SET_EMBED_LEN(ary, 0);
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared_root)
+{
+    if (!OBJ_FROZEN(shared_root)) {
+        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+        RUBY_ASSERT(num >= 0);
+        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
+    }
+    return shared_root;
+}
+
+static void
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
+{
+    RUBY_ASSERT(!ARY_EMBED_P(ary));
+    RUBY_ASSERT(!OBJ_FROZEN(ary));
+    RUBY_ASSERT(ARY_SHARED_ROOT_P(shared_root) || OBJ_FROZEN(shared_root));
+
+    rb_ary_increment_share(shared_root);
+    FL_SET_SHARED(ary);
+    RB_OBJ_WRITE(ary, &RARRAY(ary)->as.heap.aux.shared_root, shared_root);
+
+    RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+}
+
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
+    rb_check_frozen(ary);
+    ary_verify(ary);
+}
+
+void
+rb_ary_cancel_sharing(VALUE ary)
+{
+    if (ARY_SHARED_P(ary)) {
+        long shared_len, len = RARRAY_LEN(ary);
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+        ary_verify(shared_root);
+
+        if (len <= ary_embed_capa(ary)) {
+            const VALUE *ptr = ARY_HEAP_PTR(ary);
+            FL_UNSET_SHARED(ary);
+            FL_SET_EMBED(ary);
+            MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared_root);
+            ARY_SET_EMBED_LEN(ary, len);
+        }
+        else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+            long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared_root);
+            FL_UNSET_SHARED(ary);
+            ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared_root));
+            ARY_SET_CAPA(ary, shared_len);
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr+shift, VALUE, len);
+            });
+            FL_SET_EMBED(shared_root);
+            rb_ary_decrement_share(shared_root);
+        }
+        else {
+            VALUE *ptr = ary_heap_alloc_buffer(len);
+            MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
+            rb_ary_unshare(ary);
+            ARY_SET_CAPA_FORCE(ary, len);
+            ARY_SET_PTR_FORCE(ary, ptr);
+        }
+
+        rb_gc_writebarrier_remember(ary);
+    }
+    ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    rb_ary_cancel_sharing(ary);
+}
+
+static VALUE
+ary_ensure_room_for_push(VALUE ary, long add_len)
+{
+    long old_len = RARRAY_LEN(ary);
+    long new_len = old_len + add_len;
+    long capa;
+
+    if (old_len > ARY_MAX_SIZE - add_len) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    if (ARY_SHARED_P(ary)) {
+        if (new_len > ary_embed_capa(ary)) {
+            VALUE shared_root = ARY_SHARED_ROOT(ary);
+            if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+                if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+                    rb_ary_modify_check(ary);
+
+                    ary_verify(ary);
+                    ary_verify(shared_root);
+                    return shared_root;
+                }
+                else {
+                    /* if array is shared, then it is likely it participate in push/shift pattern */
+                    rb_ary_modify(ary);
+                    capa = ARY_CAPA(ary);
+                    if (new_len > capa - (capa >> 6)) {
+                        ary_double_capa(ary, new_len);
+                    }
+                    ary_verify(ary);
+                    return ary;
+                }
+            }
+        }
+        ary_verify(ary);
+        rb_ary_modify(ary);
+    }
+    else {
+        rb_ary_modify_check(ary);
+    }
+    capa = ARY_CAPA(ary);
+    if (new_len > capa) {
+        ary_double_capa(ary, new_len);
+    }
+
+    ary_verify(ary);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    freeze -> self
+ *
+ *  Freezes +self+ (if not already frozen); returns +self+:
+ *
+ *    a = []
+ *    a.frozen? # => false
+ *    a.freeze
+ *    a.frozen? # => true
+ *
+ *  No further changes may be made to +self+;
+ *  raises FrozenError if a change is attempted.
+ *
+ *  Related: Kernel#frozen?.
+ */
 
 VALUE
-ary_new2(len)
+rb_ary_freeze(VALUE ary)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, C_Array, T_ARRAY);
+    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
+
+    if (OBJ_FROZEN(ary)) return ary;
 
-    ary->len = 0;
-    ary->capa = len;
-    ary->ptr = ALLOC_N(VALUE, len);
+    if (!ARY_EMBED_P(ary) && !ARY_SHARED_P(ary) && !ARY_SHARED_ROOT_P(ary)) {
+        ary_shrink_capa(ary);
+    }
+
+    return rb_obj_freeze(ary);
+}
 
+/* This can be used to take a snapshot of an array (with
+   e.g. rb_ary_replace) and check later whether the array has been
+   modified from the snapshot.  The snapshot is cheap, though if
+   something does modify the array it will pay the cost of copying
+   it.  If Array#pop or Array#shift has been called, the array will
+   be still shared with the snapshot, but the array length will
+   differ. */
+VALUE
+rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
+{
+    if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
+            !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+            ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
+            ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
+        return Qtrue;
+    }
+    return Qfalse;
+}
+
+static VALUE
+ary_alloc_embed(VALUE klass, long capa)
+{
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+    NEWOBJ_OF(ary, struct RArray, klass,
+                     T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                     size, 0);
+    /* Created array is:
+     *   FL_SET_EMBED((VALUE)ary);
+     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+     */
     return (VALUE)ary;
 }
 
+static VALUE
+ary_alloc_heap(VALUE klass)
+{
+    NEWOBJ_OF(ary, struct RArray, klass,
+                     T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+                     sizeof(struct RArray), 0);
+
+    ary->as.heap.len = 0;
+    ary->as.heap.aux.capa = 0;
+    ary->as.heap.ptr = NULL;
+
+    return (VALUE)ary;
+}
+
+static VALUE
+empty_ary_alloc(VALUE klass)
+{
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+    return ary_alloc_embed(klass, 0);
+}
+
+static VALUE
+ary_new(VALUE klass, long capa)
+{
+    RUBY_ASSERT(ruby_thread_has_gvl_p());
+
+    VALUE ary;
+
+    if (capa < 0) {
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
+    }
+
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    if (ary_embeddable_p(capa)) {
+        ary = ary_alloc_embed(klass, capa);
+    }
+    else {
+        ary = ary_alloc_heap(klass);
+        ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
+
+    return ary;
+}
+
 VALUE
-ary_new()
+rb_ary_new_capa(long capa)
 {
-    return ary_new2(ARY_DEFAULT_SIZE);
+    return ary_new(rb_cArray, capa);
 }
 
-#include <varargs.h>
+VALUE
+rb_ary_new(void)
+{
+    return rb_ary_new_capa(0);
+}
 
 VALUE
-ary_new3(n, va_alist)
-    int n;
-    va_dcl
+(rb_ary_new_from_args)(long n, ...)
 {
     va_list ar;
-    struct RArray* ary;
-    int len, i;
+    VALUE ary;
+    long i;
 
-    if (n < 0) {
-	Fail("Negative number of items(%d)", n);
-    }
-    ary = (struct RArray*)ary_new2(n<ARY_DEFAULT_SIZE?ARY_DEFAULT_SIZE:n);
+    ary = rb_ary_new2(n);
 
-    va_start(ar);
+    va_start(ar, n);
     for (i=0; i<n; i++) {
-	ary->ptr[i] = va_arg(ar, VALUE);
+        ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
-    ary->len = n;
-    return (VALUE)ary;
+    ARY_SET_LEN(ary, n);
+    return ary;
 }
 
 VALUE
-ary_new4(n, elts)
-    int n;
-    VALUE *elts;
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
 {
-    struct RArray* ary;
+    VALUE ary;
+
+    ary = ary_new(klass, n);
+    if (n > 0 && elts) {
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
+    }
 
-    ary = (struct RArray*)ary_new2(n);
-    MEMCPY(ary->ptr, elts, VALUE, n);
-    ary->len = n;
+    return ary;
+}
 
+VALUE
+rb_ary_new_from_values(long n, const VALUE *elts)
+{
+    return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
+
+static VALUE
+ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
+{
+    size_t size = ary_embed_size(capa);
+    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
+    NEWOBJ_OF(ary, struct RArray, klass,
+            T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+            size, ec);
+    /* Created array is:
+     *   FL_SET_EMBED((VALUE)ary);
+     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+     */
     return (VALUE)ary;
 }
 
 static VALUE
-Sary_new(class)
-    VALUE class;
+ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, class, T_ARRAY);
+    NEWOBJ_OF(ary, struct RArray, klass,
+            T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
+            sizeof(struct RArray), ec);
 
-    ary->len = 0;
-    ary->capa = ARY_DEFAULT_SIZE;
-    ary->ptr = ALLOC_N(VALUE, ARY_DEFAULT_SIZE);
+    ary->as.heap.len = 0;
+    ary->as.heap.aux.capa = 0;
+    ary->as.heap.ptr = NULL;
 
     return (VALUE)ary;
 }
 
 static VALUE
-Sary_create(argc, argv, class)
-    int argc;
-    VALUE *argv;
-    VALUE class;
+ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, class, T_ARRAY);
+    VALUE ary;
+
+    if (capa < 0) {
+        rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
+    }
 
-    ary->len = argc;
-    ary->capa = argc;
-    ary->ptr = ALLOC_N(VALUE, argc);
-    MEMCPY(ary->ptr, argv, VALUE, argc);
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
 
-    return (VALUE)ary;
+    if (ary_embeddable_p(capa)) {
+        ary = ec_ary_alloc_embed(ec, klass, capa);
+    }
+    else {
+        ary = ec_ary_alloc_heap(ec, klass);
+        ARY_SET_CAPA(ary, capa);
+        RUBY_ASSERT(!ARY_EMBED_P(ary));
+
+        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
+
+    return ary;
 }
 
-static void
-astore(ary, idx, val)
-    struct RArray *ary;
-    int idx;
-    VALUE val;
+VALUE
+rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
+{
+    VALUE ary;
+
+    ary = ec_ary_new(ec, rb_cArray, n);
+    if (n > 0 && elts) {
+        ary_memcpy(ary, 0, n, elts);
+        ARY_SET_LEN(ary, n);
+    }
+
+    return ary;
+}
+
+VALUE
+rb_ary_hidden_new(long capa)
+{
+    VALUE ary = ary_new(0, capa);
+    return ary;
+}
+
+VALUE
+rb_ary_hidden_new_fill(long capa)
+{
+    VALUE ary = rb_ary_hidden_new(capa);
+    ary_memfill(ary, 0, capa, Qnil);
+    ARY_SET_LEN(ary, capa);
+    return ary;
+}
+
+void
+rb_ary_free(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+        if (USE_DEBUG_COUNTER &&
+            !ARY_SHARED_ROOT_P(ary) &&
+            ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+            RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+        }
+
+        RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+        ary_heap_free(ary);
+    }
+    else {
+        RB_DEBUG_COUNTER_INC(obj_ary_embed);
+    }
+
+    if (ARY_SHARED_P(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared);
+    }
+    if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+        RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
+    }
+}
+
+static VALUE fake_ary_flags;
+
+static VALUE
+init_fake_ary_flags(void)
+{
+    struct RArray fake_ary = {0};
+    fake_ary.basic.flags = T_ARRAY;
+    VALUE ary = (VALUE)&fake_ary;
+    rb_ary_freeze(ary);
+    return fake_ary.basic.flags;
+}
+
+VALUE
+rb_setup_fake_ary(struct RArray *fake_ary, const VALUE *list, long len)
+{
+    fake_ary->basic.flags = fake_ary_flags;
+    RBASIC_CLEAR_CLASS((VALUE)fake_ary);
+
+    // bypass frozen checks
+    fake_ary->as.heap.ptr = list;
+    fake_ary->as.heap.len = len;
+    fake_ary->as.heap.aux.capa = len;
+    return (VALUE)fake_ary;
+}
+
+size_t
+rb_ary_memsize(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+        return ARY_CAPA(ary) * sizeof(VALUE);
+    }
+    else {
+        return 0;
+    }
+}
+
+static VALUE
+ary_make_shared(VALUE ary)
+{
+    ary_verify(ary);
+
+    if (ARY_SHARED_P(ary)) {
+        return ARY_SHARED_ROOT(ary);
+    }
+    else if (ARY_SHARED_ROOT_P(ary)) {
+        return ary;
+    }
+    else if (OBJ_FROZEN(ary)) {
+        return ary;
+    }
+    else {
+        long capa = ARY_CAPA(ary);
+        long len = RARRAY_LEN(ary);
+
+        /* Shared roots cannot be embedded because the reference count
+         * (refcnt) is stored in as.heap.aux.capa. */
+        VALUE shared = ary_alloc_heap(0);
+        FL_SET_SHARED_ROOT(shared);
+
+        if (ARY_EMBED_P(ary)) {
+            VALUE *ptr = ary_heap_alloc_buffer(capa);
+            ARY_SET_PTR(shared, ptr);
+            ary_memcpy(shared, 0, len, RARRAY_CONST_PTR(ary));
+
+            FL_UNSET_EMBED(ary);
+            ARY_SET_HEAP_LEN(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+        else {
+            ARY_SET_PTR(shared, RARRAY_CONST_PTR(ary));
+        }
+
+        ARY_SET_LEN(shared, capa);
+        ary_mem_clear(shared, len, capa - len);
+        rb_ary_set_shared(ary, shared);
+
+        ary_verify(shared);
+        ary_verify(ary);
+
+        return shared;
+    }
+}
+
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+
+    if (ary_embeddable_p(len)) {
+        VALUE subst = rb_ary_new_capa(len);
+        RUBY_ASSERT(ARY_EMBED_P(subst));
+
+        ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+        ARY_SET_EMBED_LEN(subst, len);
+        return subst;
+    }
+    else {
+        return rb_ary_increment_share(ary_make_shared(ary));
+    }
+}
+
+VALUE
+rb_assoc_new(VALUE car, VALUE cdr)
+{
+    return rb_ary_new3(2, car, cdr);
+}
+
+VALUE
+rb_to_array_type(VALUE ary)
+{
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+#define to_ary rb_to_array_type
+
+VALUE
+rb_check_array_type(VALUE ary)
+{
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+
+VALUE
+rb_check_to_array(VALUE ary)
+{
+    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+VALUE
+rb_to_array(VALUE ary)
+{
+    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+/*
+ *  call-seq:
+ *    Array.try_convert(object) -> object, new_array, or nil
+ *
+ *  Attempts to return an array, based on the given +object+.
+ *
+ *  If +object+ is an array, returns +object+.
+ *
+ *  Otherwise if +object+ responds to <tt>:to_ary</tt>.
+ *  calls <tt>object.to_ary</tt>:
+ *  if the return value is an array or +nil+, returns that value;
+ *  if not, raises TypeError.
+ *
+ *  Otherwise returns +nil+.
+ *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+    return rb_check_array_type(ary);
+}
+
+/* :nodoc: */
+static VALUE
+rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
+{
+    VALUE ary;
+
+    if (klass == rb_cArray) {
+        long size = 0;
+        if (argc > 0 && FIXNUM_P(argv[0])) {
+            size = FIX2LONG(argv[0]);
+            if (size < 0) size = 0;
+        }
+
+        ary = ary_new(klass, size);
+
+        rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
+    }
+    else {
+        ary = rb_class_new_instance_pass_kw(argc, argv, klass);
+    }
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    Array.new -> new_empty_array
+ *    Array.new(array) -> new_array
+ *    Array.new(size, default_value = nil) -> new_array
+ *    Array.new(size = 0) {|index| ... } -> new_array
+ *
+ *  Returns a new array.
+ *
+ *  With no block and no argument given, returns a new empty array:
+ *
+ *    Array.new # => []
+ *
+ *  With no block and array argument given, returns a new array with the same elements:
+ *
+ *    Array.new([:foo, 'bar', 2]) # => [:foo, "bar", 2]
+ *
+ *  With no block and integer argument given, returns a new array containing
+ *  that many instances of the given +default_value+:
+ *
+ *    Array.new(0)    # => []
+ *    Array.new(3)    # => [nil, nil, nil]
+ *    Array.new(2, 3) # => [3, 3]
+ *
+ *  With a block given, returns an array of the given +size+;
+ *  calls the block with each +index+ in the range <tt>(0...size)</tt>;
+ *  the element at that +index+ in the returned array is the blocks return value:
+ *
+ *    Array.new(3)  {|index| "Element #{index}" } # => ["Element 0", "Element 1", "Element 2"]
+ *
+ *  A common pitfall for new Rubyists is providing an expression as +default_value+:
+ *
+ *    array = Array.new(2, {})
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {a: 1}], as array[0] and array[1] are same object
+ *
+ *  If you want the elements of the array to be distinct, you should pass a block:
+ *
+ *    array = Array.new(2) { {} }
+ *    array # => [{}, {}]
+ *    array[0][:a] = 1
+ *    array # => [{a: 1}, {}], as array[0] and array[1] are different objects
+ *
+ *  Raises TypeError if the first argument is not either an array
+ *  or an {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]).
+ *  Raises ArgumentError if the first argument is a negative integer.
+ *
+ *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ */
+
+static VALUE
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
+{
+    long len;
+    VALUE size, val;
+
+    rb_ary_modify(ary);
+    if (argc == 0) {
+        rb_ary_reset(ary);
+        RUBY_ASSERT(ARY_EMBED_P(ary));
+        RUBY_ASSERT(ARY_EMBED_LEN(ary) == 0);
+        if (rb_block_given_p()) {
+            rb_warning("given block not used");
+        }
+        return ary;
+    }
+    rb_scan_args(argc, argv, "02", &size, &val);
+    if (argc == 1 && !FIXNUM_P(size)) {
+        val = rb_check_array_type(size);
+        if (!NIL_P(val)) {
+            rb_ary_replace(ary, val);
+            return ary;
+        }
+    }
+
+    len = NUM2LONG(size);
+    /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
+    if (len < 0) {
+        rb_raise(rb_eArgError, "negative array size");
+    }
+    if (len > ARY_MAX_SIZE) {
+        rb_raise(rb_eArgError, "array size too big");
+    }
+    /* recheck after argument conversion */
+    rb_ary_modify(ary);
+    ary_resize_capa(ary, len);
+    if (rb_block_given_p()) {
+        long i;
+
+        if (argc == 2) {
+            rb_warn("block supersedes default value argument");
+        }
+        for (i=0; i<len; i++) {
+            rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+            ARY_SET_LEN(ary, i + 1);
+        }
+    }
+    else {
+        ary_memfill(ary, 0, len, val);
+        ARY_SET_LEN(ary, len);
+    }
+    return ary;
+}
+
+/*
+ * Returns a new array, populated with the given objects:
+ *
+ *   Array[1, 'a', /^A/]    # => [1, "a", /^A/]
+ *   Array[]                # => []
+ *   Array.[](1, 'a', /^A/) # => [1, "a", /^A/]
+ *
+ * Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ */
+
+static VALUE
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+{
+    VALUE ary = ary_new(klass, argc);
+    if (argc > 0 && argv) {
+        ary_memcpy(ary, 0, argc, argv);
+        ARY_SET_LEN(ary, argc);
+    }
+
+    return ary;
+}
+
+void
+rb_ary_store(VALUE ary, long idx, VALUE val)
 {
+    long len = RARRAY_LEN(ary);
+
     if (idx < 0) {
-	Fail("negative index for array");
+        idx += len;
+        if (idx < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     idx - len, -len);
+        }
+    }
+    else if (idx >= ARY_MAX_SIZE) {
+        rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
-    if (idx >= ary->capa) {
-	ary->capa = idx + ary->capa/5;
-	REALLOC_N(ary->ptr, VALUE, ary->capa);
+    rb_ary_modify(ary);
+    if (idx >= ARY_CAPA(ary)) {
+        ary_double_capa(ary, idx);
+    }
+    if (idx > len) {
+        ary_mem_clear(ary, len, idx - len + 1);
+    }
+
+    if (idx >= len) {
+        ARY_SET_LEN(ary, idx + 1);
+    }
+    ARY_SET(ary, idx, val);
+}
+
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
+{
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
+
+    VALUE result = ary_alloc_heap(klass);
+    size_t embed_capa = ary_embed_capa(result);
+    if ((size_t)len <= embed_capa) {
+        FL_SET_EMBED(result);
+        ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+        ARY_SET_EMBED_LEN(result, len);
     }
-    if (idx > ary->len) {
-	MEMZERO(ary->ptr+ary->len, VALUE, idx-ary->len+1);
+    else {
+        VALUE shared = ary_make_shared(ary);
+
+        /* The ary_make_shared call may allocate, which can trigger a GC
+         * compaction. This can cause the array to be embedded because it has
+         * a length of 0. */
+        FL_UNSET_EMBED(result);
+
+        ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+        ARY_SET_LEN(result, RARRAY_LEN(ary));
+        rb_ary_set_shared(result, shared);
+
+        ARY_INCREASE_PTR(result, offset);
+        ARY_SET_LEN(result, len);
+
+        ary_verify(shared);
     }
 
-    if (idx >= ary->len) {
-	ary->len = idx + 1;
+    ary_verify(result);
+    return result;
+}
+
+static VALUE
+ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
+{
+    RUBY_ASSERT(offset >= 0);
+    RUBY_ASSERT(len >= 0);
+    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
+    RUBY_ASSERT(step != 0);
+
+    const long orig_len = len;
+
+    if (step > 0 && step >= len) {
+        VALUE result = ary_new(klass, 1);
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RB_OBJ_WRITE(result, ptr, values[offset]);
+        ARY_SET_EMBED_LEN(result, 1);
+        return result;
+    }
+    else if (step < 0 && step < -len) {
+        step = -len;
+    }
+
+    long ustep = (step < 0) ? -step : step;
+    len = roomof(len, ustep);
+
+    long i;
+    long j = offset + ((step > 0) ? 0 : (orig_len - 1));
+
+    VALUE result = ary_new(klass, len);
+    if (ARY_EMBED_P(result)) {
+        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        for (i = 0; i < len; ++i) {
+            RB_OBJ_WRITE(result, ptr+i, values[j]);
+            j += step;
+        }
+        ARY_SET_EMBED_LEN(result, len);
+    }
+    else {
+        const VALUE *values = RARRAY_CONST_PTR(ary);
+
+        RARRAY_PTR_USE(result, ptr, {
+            for (i = 0; i < len; ++i) {
+                RB_OBJ_WRITE(result, ptr+i, values[j]);
+                j += step;
+            }
+        });
+        ARY_SET_LEN(result, len);
+    }
+
+    return result;
+}
+
+static VALUE
+ary_make_shared_copy(VALUE ary)
+{
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+}
+
+enum ary_take_pos_flags
+{
+    ARY_TAKE_FIRST = 0,
+    ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last_n(VALUE ary, long n, enum ary_take_pos_flags last)
+{
+    long len = RARRAY_LEN(ary);
+    long offset = 0;
+
+    if (n > len) {
+        n = len;
+    }
+    else if (n < 0) {
+        rb_raise(rb_eArgError, "negative array size");
+    }
+    if (last) {
+        offset = len - n;
     }
-    ary->ptr[idx] = val;
+    return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    argc = rb_check_arity(argc, 0, 1);
+    /* the case optional argument is omitted should be handled in
+     * callers of this function.  if another arity case is added,
+     * this arity check needs to rewrite. */
+    RUBY_ASSERT_ALWAYS(argc == 1);
+    return ary_take_first_or_last_n(ary, NUM2LONG(argv[0]), last);
+}
+
+/*
+ *  call-seq:
+ *    self << object -> self
+ *
+ *  Appends +object+ as the last element in +self+; returns +self+:
+ *
+ *    [:foo, 'bar', 2] << :baz # => [:foo, "bar", 2, :baz]
+ *
+ *  Appends +object+ as a single element, even if it is another array:
+ *
+ *    [:foo, 'bar', 2] << [3, 4] # => [:foo, "bar", 2, [3, 4]]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
 VALUE
-ary_push(ary, item)
-    struct RArray *ary;
-    VALUE item;
+rb_ary_push(VALUE ary, VALUE item)
 {
-    astore(ary, ary->len, item);
-    return (VALUE)ary;
+    long idx = RARRAY_LEN((ary_verify(ary), ary));
+    VALUE target_ary = ary_ensure_room_for_push(ary, 1);
+    RARRAY_PTR_USE(ary, ptr, {
+        RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+    });
+    ARY_SET_LEN(ary, idx + 1);
+    ary_verify(ary);
+    return ary;
 }
 
+VALUE
+rb_ary_cat(VALUE ary, const VALUE *argv, long len)
+{
+    long oldlen = RARRAY_LEN(ary);
+    VALUE target_ary = ary_ensure_room_for_push(ary, len);
+    ary_memcpy0(ary, oldlen, len, argv, target_ary);
+    ARY_SET_LEN(ary, oldlen + len);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    push(*objects) -> self
+ *    append(*objects) -> self
+ *
+ *  Appends each argument in +objects+ to +self+; returns +self+:
+ *
+ *    a = [:foo, 'bar', 2] # => [:foo, "bar", 2]
+ *    a.push(:baz, :bat)   # => [:foo, "bar", 2, :baz, :bat]
+ *
+ *  Appends each argument as a single element, even if it is another array:
+ *
+ *    a = [:foo, 'bar', 2]               # => [:foo, "bar", 2]
+      a.push([:baz, :bat], [:bam, :bad]) # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
 static VALUE
-Fary_append(ary, item)
-    struct RArray *ary;
-    VALUE item;
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
 {
-    astore(ary, ary->len, item);
-    return (VALUE)ary;
+    return rb_ary_cat(ary, argv, argc);
 }
 
 VALUE
-ary_pop(ary)
-    struct RArray *ary;
+rb_ary_pop(VALUE ary)
 {
-    if (ary->len == 0) return Qnil;
-    return ary->ptr[--ary->len];
+    long n;
+    rb_ary_modify_check(ary);
+    n = RARRAY_LEN(ary);
+    if (n == 0) return Qnil;
+    if (ARY_OWNS_HEAP_P(ary) &&
+        n * 3 < ARY_CAPA(ary) &&
+        ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+    {
+        ary_resize_capa(ary, n * 2);
+    }
+
+    VALUE obj = RARRAY_AREF(ary, n - 1);
+
+    ARY_SET_LEN(ary, n - 1);
+    ary_verify(ary);
+    return obj;
+}
+
+/*
+ *  call-seq:
+ *    pop -> object or nil
+ *    pop(count) -> new_array
+ *
+ *  Removes and returns trailing elements of +self+.
+ *
+ *  With no argument given, removes and returns the last element, if available;
+ *  otherwise returns +nil+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop  # => 2
+ *    a      # => [:foo, "bar"]
+ *    [].pop # => nil
+ *
+ *  With non-negative integer argument +count+ given,
+ *  returns a new array containing the trailing +count+ elements of +self+, as available:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(2) # => ["bar", 2]
+ *    a        # => [:foo]
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.pop(50) # => [:foo, "bar", 2]
+ *    a         # => []
+ *
+ *  Related: Array#push;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result;
+
+    if (argc == 0) {
+        return rb_ary_pop(ary);
+    }
+
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    ary_verify(ary);
+    return result;
 }
 
 VALUE
-ary_shift(ary)
-    struct RArray *ary;
+rb_ary_shift(VALUE ary)
 {
     VALUE top;
+    long len = RARRAY_LEN(ary);
 
-    if (ary->len == 0) return Qnil;
+    if (len == 0) {
+        rb_ary_modify_check(ary);
+        return Qnil;
+    }
 
-    top = ary->ptr[0];
-    ary->len--;
+    top = RARRAY_AREF(ary, 0);
 
-    /* sliding items */
-    memmove(ary->ptr, ary->ptr+1, sizeof(VALUE)*(ary->len));
+    rb_ary_behead(ary, 1);
 
     return top;
 }
 
-VALUE
-ary_unshift(ary, item)
-    struct RArray *ary;
+/*
+ *  call-seq:
+ *    shift -> object or nil
+ *    shift(count) -> new_array or nil
+ *
+ *  Removes and returns leading elements from +self+.
+ *
+ *  With no argument, removes and returns one element, if available,
+ *  or +nil+ otherwise:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.shift  # => 0
+ *    a        # => [1, 2, 3]
+ *    [].shift # => nil
+ *
+ *  With non-negative numeric argument +count+ given,
+ *  removes and returns the first +count+ elements:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.shift(2)   # => [0, 1]
+ *    a            # => [2, 3]
+ *    a.shift(1.1) # => [2]
+ *    a            # => [3]
+ *    a.shift(0)   # => []
+ *    a            # => [3]
+ *
+ *  If +count+ is large,
+ *  removes and returns all elements:
+ *
+ *    a = [0, 1, 2, 3]
+ *    a.shift(50) # => [0, 1, 2, 3]
+ *    a           # => []
+ *
+ *  If +self+ is empty, returns a new empty array.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE top;
+    VALUE result;
+    long n;
 
-    if (ary->len >= ary->capa) {
-	ary->capa+=ARY_DEFAULT_SIZE;
-	REALLOC_N(ary->ptr, VALUE, ary->capa);
+    if (argc == 0) {
+        return rb_ary_shift(ary);
     }
 
-    /* sliding items */
-    memmove(ary->ptr+1, ary->ptr, sizeof(VALUE)*(ary->len));
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    n = RARRAY_LEN(result);
+    rb_ary_behead(ary,n);
 
-    ary->len++;
-    return ary->ptr[0] = item;
+    return result;
 }
 
 VALUE
-ary_entry(ary, offset)
-    struct RArray *ary;
-    int offset;
+rb_ary_behead(VALUE ary, long n)
 {
-    if (ary->len == 0) return Qnil;
+    if (n <= 0) {
+        return ary;
+    }
+
+    rb_ary_modify_check(ary);
 
-    if (offset < 0) {
-	offset = ary->len + offset;
+    if (!ARY_SHARED_P(ary)) {
+        if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+            RARRAY_PTR_USE(ary, ptr, {
+                MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
+            }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -n);
+            ary_verify(ary);
+            return ary;
+        }
+
+        ary_mem_clear(ary, 0, n);
+        ary_make_shared(ary);
     }
-    if (offset < 0 || ary->len <= offset) {
-	return Qnil;
+    else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+        ary_mem_clear(ary, 0, n);
     }
 
-    return ary->ptr[offset];
+    ARY_INCREASE_PTR(ary, n);
+    ARY_INCREASE_LEN(ary, -n);
+    ary_verify(ary);
+
+    return ary;
 }
 
 static VALUE
-ary_subseq(ary, beg, len)
-    struct RArray *ary;
-    int beg, len;
+make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
 {
-    struct RArray *ary2;
-    VALUE *ptr;
+    if (head - sharedp < argc) {
+        long room = capa - len - argc;
 
-    if (beg < 0) {
-	beg = ary->len + beg;
-	if (beg < 0) beg = 0;
+        room -= room >> 4;
+        MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+        head = sharedp + argc + room;
     }
-    if (len < 0) {
-	Fail("negative length for sub-array(size: %d)", ary->len);
+    ARY_SET_PTR(ary, head - argc);
+    RUBY_ASSERT(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+    ary_verify(ary);
+    return ARY_SHARED_ROOT(ary);
+}
+
+static VALUE
+ary_modify_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+    long capa;
+    const VALUE *head, *sharedp;
+
+    rb_ary_modify(ary);
+    capa = ARY_CAPA(ary);
+    if (capa - (capa >> 6) <= new_len) {
+        ary_double_capa(ary, new_len);
     }
-    if (len == 0) {
-	return ary_new();
+
+    /* use shared array for big "queues" */
+    if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
+        ary_verify(ary);
+
+        /* make a room for unshifted items */
+        capa = ARY_CAPA(ary);
+        ary_make_shared(ary);
+
+        head = sharedp = RARRAY_CONST_PTR(ary);
+        return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
     }
-    if (beg + len > ary->len) {
-	len = ary->len - beg;
+    else {
+        /* sliding items */
+        RARRAY_PTR_USE(ary, ptr, {
+            MEMMOVE(ptr + argc, ptr, VALUE, len);
+        });
+
+        ary_verify(ary);
+        return ary;
     }
+}
 
-    ary2 = (struct RArray*)ary_new2(len);
-    MEMCPY(ary2->ptr, ary->ptr+beg, VALUE, len);
-    ary2->len = len;
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
 
-    return (VALUE)ary2;
+    if (len > ARY_MAX_SIZE - argc) {
+        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    else if (! ARY_SHARED_P(ary)) {
+        return ary_modify_for_unshift(ary, argc);
+    }
+    else {
+        VALUE shared_root = ARY_SHARED_ROOT(ary);
+        long capa = RARRAY_LEN(shared_root);
+
+        if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else if (new_len > capa) {
+            return ary_modify_for_unshift(ary, argc);
+        }
+        else {
+            const VALUE * head = RARRAY_CONST_PTR(ary);
+            void *sharedp = (void *)RARRAY_CONST_PTR(shared_root);
+
+            rb_ary_modify_check(ary);
+            return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
+        }
+    }
 }
 
-extern VALUE C_Range;
+/*
+ *  call-seq:
+ *    unshift(*objects) -> self
+ *    prepend(*objects) -> self
+ *
+ *  Prepends the given +objects+ to +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
+ *
+ *  Related: Array#shift;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
 
-static void
-range_beg_end(range, begp, lenp, len)
-    VALUE range;
-    int *begp, *lenp;
-    int len;
+VALUE
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
-    int beg, end;
+    long len = RARRAY_LEN(ary);
+    VALUE target_ary;
 
-    beg = rb_iv_get(range, "start"); beg = NUM2INT(beg);
-    end = rb_iv_get(range, "end");   end = NUM2INT(end);
-    if (beg < 0) {
-	beg = len + beg;
-	if (beg < 0) beg = 0;
+    if (argc == 0) {
+        rb_ary_modify_check(ary);
+        return ary;
     }
-    if (end < 0) {
-	end = len + end;
-	if (end < 0) end = 0;
+
+    target_ary = ary_ensure_room_for_unshift(ary, argc);
+    ary_memcpy0(ary, 0, argc, argv, target_ary);
+    ARY_SET_LEN(ary, len + argc);
+    return ary;
+}
+
+VALUE
+rb_ary_unshift(VALUE ary, VALUE item)
+{
+    return rb_ary_unshift_m(1, &item, ary);
+}
+
+/* faster version - use this if you don't need to treat negative offset */
+static inline VALUE
+rb_ary_elt(VALUE ary, long offset)
+{
+    long len = RARRAY_LEN(ary);
+    if (len == 0) return Qnil;
+    if (offset < 0 || len <= offset) {
+        return Qnil;
     }
-    if (beg > end) {
-	int tmp;
+    return RARRAY_AREF(ary, offset);
+}
 
-	Warning("start %d is bigger than end %d", beg, end);
-	tmp = beg; beg = end; end = tmp;
+VALUE
+rb_ary_entry(VALUE ary, long offset)
+{
+    return rb_ary_entry_internal(ary, offset);
+}
+
+VALUE
+rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
+{
+    VALUE klass;
+    long alen = RARRAY_LEN(ary);
+
+    if (beg > alen) return Qnil;
+    if (beg < 0 || len < 0) return Qnil;
+
+    if (alen < len || alen < beg + len) {
+        len = alen - beg;
     }
-    *begp = beg; *lenp = end - beg + 1;
+    klass = rb_cArray;
+    if (len == 0) return ary_new(klass, 0);
+    if (step == 0)
+        rb_raise(rb_eArgError, "slice step cannot be zero");
+    if (step == 1)
+        return ary_make_partial(ary, klass, beg, len);
+    else
+        return ary_make_partial_step(ary, klass, beg, len, step);
 }
 
-static VALUE
-Fary_aref(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
 {
-    VALUE arg1, arg2;
+    return rb_ary_subseq_step(ary, beg, len, 1);
+}
 
-    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
-	int beg, len;
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
+/*
+ *  call-seq:
+ *    self[offset] -> object or nil
+ *    self[offset, size] -> object or nil
+ *    self[range] -> object or nil
+ *    self[aseq] -> object or nil
+ *
+ *  Returns elements from +self+; does not modify +self+.
+ *
+ *  In brief:
+ *
+ *    a = [:foo, 'bar', 2]
+ *
+ *    # Single argument offset: returns one element.
+ *    a[0]     # => :foo          # Zero-based index.
+ *    a[-1]    # => 2             # Negative index counts backwards from end.
+ *
+ *    # Arguments offset and size: returns an array.
+ *    a[1, 2]  # => ["bar", 2]
+ *    a[-2, 2] # => ["bar", 2]    # Negative offset counts backwards from end.
+ *
+ *    # Single argument range: returns an array.
+ *    a[0..1]  # => [:foo, "bar"]
+ *    a[0..-2] # => [:foo, "bar"] # Negative range-begin counts backwards from end.
+ *    a[-2..2] # => ["bar", 2]    # Negative range-end counts backwards from end.
+ *
+ *  When a single integer argument +offset+ is given, returns the element at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] # => :foo
+ *    a[2] # => 2
+ *    a # => [:foo, "bar", 2]
+ *
+ *  If +offset+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] # => 2
+ *    a[-2] # => "bar"
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  When two Integer arguments +offset+ and +size+ are given,
+ *  returns a new array of size +size+ containing successive elements beginning at offset +offset+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] # => [:foo, "bar"]
+ *    a[1, 2] # => ["bar", 2]
+ *
+ *  If <tt>offset + size</tt> is greater than <tt>self.size</tt>,
+ *  returns all elements from offset +offset+ to the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 4] # => [:foo, "bar", 2]
+ *    a[1, 3] # => ["bar", 2]
+ *    a[2, 2] # => [2]
+ *
+ *  If <tt>offset == self.size</tt> and <tt>size >= 0</tt>,
+ *  returns a new empty array.
+ *
+ *  If +size+ is negative, returns +nil+.
+ *
+ *  When a single Range argument +range+ is given,
+ *  treats <tt>range.min</tt> as +offset+ above
+ *  and <tt>range.size</tt> as +size+ above:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] # => [:foo, "bar"]
+ *    a[1..2] # => ["bar", 2]
+ *
+ *  Special case: If <tt>range.start == a.size</tt>, returns a new empty array.
+ *
+ *  If <tt>range.end</tt> is negative, calculates the end index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..-1] # => [:foo, "bar", 2]
+ *    a[0..-2] # => [:foo, "bar"]
+ *    a[0..-3] # => [:foo]
+ *
+ *  If <tt>range.start</tt> is negative, calculates the start index from the end:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1..2] # => [2]
+ *    a[-2..2] # => ["bar", 2]
+ *    a[-3..2] # => [:foo, "bar", 2]
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[4..1] # => nil
+ *    a[4..0] # => nil
+ *    a[4..-1] # => nil
+ *
+ *  When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
+ *  returns an array of elements corresponding to the indexes produced by
+ *  the sequence.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..).step(2)] # => ["data1", "data2", "data3"]
+ *
+ *  Unlike slicing with range, if the start or the end of the arithmetic sequence
+ *  is larger than array size, throws RangeError.
+ *
+ *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
+ *    a[(1..11).step(2)]
+ *    # RangeError (((1..11).step(2)) out of range)
+ *    a[(7..).step(2)]
+ *    # RangeError (((7..).step(2)) out of range)
+ *
+ *  If given a single argument, and its type is not one of the listed, tries to
+ *  convert it to Integer, and raises if it is impossible:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    # Raises TypeError (no implicit conversion of Symbol into Integer):
+ *    a[:foo]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
 
-	beg = NUM2INT(arg1);
-	len = NUM2INT(arg2);
-	if (len <= 0) {
-	    return ary_new();
-	}
-	return ary_subseq(ary, beg, len);
+VALUE
+rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
+{
+    rb_check_arity(argc, 1, 2);
+    if (argc == 2) {
+        return rb_ary_aref2(ary, argv[0], argv[1]);
     }
+    return rb_ary_aref1(ary, argv[0]);
+}
+
+static VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+    long beg = NUM2LONG(b);
+    long len = NUM2LONG(e);
+    if (beg < 0) {
+        beg += RARRAY_LEN(ary);
+    }
+    return rb_ary_subseq(ary, beg, len);
+}
+
+VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+    long beg, len, step;
 
     /* special case - speeding up */
-    if (FIXNUM_P(arg1)) {
-	return ary_entry(ary, NUM2INT(arg1));
+    if (FIXNUM_P(arg)) {
+        return rb_ary_entry(ary, FIX2LONG(arg));
+    }
+    /* check if idx is Range or ArithmeticSequence */
+    switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
+      case Qfalse:
+        break;
+      case Qnil:
+        return Qnil;
+      default:
+        return rb_ary_subseq_step(ary, beg, len, step);
     }
 
-    /* check if idx is Range */
-    if (obj_is_kind_of(arg1, C_Range)) {
-	int beg, len;
+    return rb_ary_entry(ary, NUM2LONG(arg));
+}
 
-	range_beg_end(arg1, &beg, &len, ary->len);
-	return ary_subseq(ary, beg, len);
+/*
+ *  call-seq:
+ *    at(index) -> object or nil
+ *
+ *  Returns the element of +self+ specified by the given +index+
+ *  or +nil+ if there is no such element;
+ *  +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  For non-negative +index+, returns the element of +self+ at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.at(0)   # => :foo
+ *    a.at(2)   # => 2
+ *    a.at(2.0) # => 2
+ *
+ *  For negative +index+, counts backwards from the end of +self+:
+ *
+ *    a.at(-2) # => "bar"
+ *
+ *  Related: Array#[];
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+VALUE
+rb_ary_at(VALUE ary, VALUE pos)
+{
+    return rb_ary_entry(ary, NUM2LONG(pos));
+}
+
+#if 0
+static VALUE
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
+{
+    if (argc == 0) {
+        if (RARRAY_LEN(ary) == 0) return Qnil;
+        return RARRAY_AREF(ary, 0);
     }
+    else {
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    }
+}
+#endif
 
-    return ary_entry(ary, NUM2INT(arg1));
+static VALUE
+ary_first(VALUE self)
+{
+    return (RARRAY_LEN(self) == 0) ? Qnil : RARRAY_AREF(self, 0);
 }
 
 static VALUE
-Fary_index(ary, val)
-    struct RArray *ary;
-    VALUE val;
+ary_last(VALUE self)
 {
-    int i;
+    long len = RARRAY_LEN(self);
+    return (len == 0) ? Qnil : RARRAY_AREF(self, len-1);
+}
+
+VALUE
+rb_ary_last(int argc, const VALUE *argv, VALUE ary) // used by parse.y
+{
+    if (argc == 0) {
+        return ary_last(ary);
+    }
+    else {
+        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    }
+}
+
+/*
+ *  call-seq:
+ *    fetch(index) -> element
+ *    fetch(index, default_value) -> element or default_value
+ *    fetch(index) {|index| ... } -> element or block_return_value
+ *
+ *  Returns the element of +self+ at offset +index+ if +index+ is in range; +index+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  With the single argument +index+ and no block,
+ *  returns the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1)   # => "bar"
+ *    a.fetch(1.1) # => "bar"
+ *
+ *  If +index+ is negative, counts from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(-1) # => 2
+ *    a.fetch(-2) # => "bar"
+ *
+ *  With arguments +index+ and +default_value+ (which may be any object) and no block,
+ *  returns +default_value+ if +index+ is out-of-range:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1, nil)  # => "bar"
+ *    a.fetch(3, :foo) # => :foo
+ *
+ *  With argument +index+ and a block,
+ *  returns the element at offset +index+ if index is in range
+ *  (and the block is not called); otherwise calls the block with index and returns its return value:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
+ *    a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
 
-    for (i=0; i<ary->len; i++) {
-	if (rb_equal(ary->ptr[i], val))
-	    return INT2FIX(i);
+static VALUE
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE pos, ifnone;
+    long block_given;
+    long idx;
+
+    rb_scan_args(argc, argv, "11", &pos, &ifnone);
+    block_given = rb_block_given_p();
+    if (block_given && argc == 2) {
+        rb_warn("block supersedes default value argument");
+    }
+    idx = NUM2LONG(pos);
+
+    if (idx < 0) {
+        idx +=  RARRAY_LEN(ary);
+    }
+    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+        if (block_given) return rb_yield(pos);
+        if (argc == 1) {
+            rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+                        idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+        }
+        return ifnone;
+    }
+    return RARRAY_AREF(ary, idx);
+}
+
+/*
+ * call-seq:
+ *   find(if_none_proc = nil) {|element| ... } -> object or nil
+ *   find(if_none_proc = nil) -> enumerator
+ *
+ * Returns the first element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array;
+ * returns the first element for which the block returns a truthy value:
+ *
+ *   [1, 3, 5].find {|element| element > 2}                # => 3
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 3, 5].find(proc {-1}) {|element| element > 12} # => -1
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
+static VALUE
+rb_ary_find(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE if_none;
+    long idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    for (idx = 0; idx < RARRAY_LEN(ary); idx++) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
+    }
+
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
     }
     return Qnil;
 }
 
+/*
+ * call-seq:
+ *   rfind(if_none_proc = nil) {|element| ... } -> object or nil
+ *   rfind(if_none_proc = nil) -> enumerator
+ *
+ * Returns the last element for which the block returns a truthy value.
+ *
+ * With a block given, calls the block with successive elements of the array in
+ * reverse order; returns the first element for which the block returns a truthy
+ * value:
+ *
+ *   [1, 2, 3, 4, 5, 6].rfind {|element| element < 5}       # => 4
+ *
+ * If no such element is found, calls +if_none_proc+ and returns its return value.
+ *
+ *   [1, 2, 3, 4].rfind(proc {0}) {|element| element < -2}  # => 0
+ *
+ * With no block given, returns an Enumerator.
+ *
+ */
+
 static VALUE
-Fary_indexes(ary, args)
-    struct RArray *ary, *args;
+rb_ary_rfind(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE *p, *pend;
-    VALUE new;
-    int i = 0;
+    VALUE if_none;
+    long len, idx;
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if_none = rb_check_arity(argc, 0, 1) ? argv[0] : Qnil;
+
+    idx = RARRAY_LEN(ary);
+    while (idx--) {
+        VALUE elem = RARRAY_AREF(ary, idx);
+        if (RTEST(rb_yield(elem))) {
+            return elem;
+        }
 
-    if (!args || args->len == 1) {
-	args = (struct RArray*)rb_to_a(args->ptr[0]);
+        len = RARRAY_LEN(ary);
+        idx = (idx >= len) ? len : idx;
     }
 
-    new = ary_new2(args->len);
+    if (!NIL_P(if_none)) {
+        return rb_funcallv(if_none, idCall, 0, 0);
+    }
+    return Qnil;
+}
 
-    p = args->ptr; pend = p + args->len;
-    while (p < pend) {
-	astore(new, i++, ary_entry(ary, NUM2INT(*p)));
-	p++;
+/*
+ *  call-seq:
+ *    find_index(object) -> integer or nil
+ *    find_index {|element| ... } -> integer or nil
+ *    find_index -> new_enumerator
+ *    index(object) -> integer or nil
+ *    index {|element| ... } -> integer or nil
+ *    index -> new_enumerator
+ *
+ *  Returns the zero-based integer index of a specified element, or +nil+.
+ *
+ *  With only argument +object+ given,
+ *  returns the index of the first element +element+
+ *  for which <tt>object == element</tt>:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index('bar') # => 1
+ *
+ *  Returns +nil+ if no such element found.
+ *
+ *  With only a block given,
+ *  calls the block with each successive element;
+ *  returns the index of the first element for which the block returns a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.index {|element| element == 'bar' } # => 1
+ *
+ *  Returns +nil+ if the block never returns a truthy value.
+ *
+ *  With neither an argument nor a block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE val;
+    long i;
+
+    if (argc == 0) {
+        RETURN_ENUMERATOR(ary, 0, 0);
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                return LONG2NUM(i);
+            }
+        }
+        return Qnil;
+    }
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+        rb_warn("given block not used");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
     }
-    return new;
+    return Qnil;
 }
 
+/*
+ *  call-seq:
+ *    rindex(object) -> integer or nil
+ *    rindex {|element| ... } -> integer or nil
+ *    rindex -> new_enumerator
+ *
+ *  Returns the index of the last element for which <tt>object == element</tt>.
+ *
+ *  With argument +object+ given, returns the index of the last such element found:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex('bar') # => 3
+ *
+ *  Returns +nil+ if no such object found.
+ *
+ *  With a block given, calls the block with each successive element;
+ *  returns the index of the last element for which the block returns a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, 'bar']
+ *    a.rindex {|element| element == 'bar' } # => 3
+ *
+ *  Returns +nil+ if the block never returns a truthy value.
+ *
+ *  When neither an argument nor a block is given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
 static VALUE
-Fary_aset(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE val;
+    long i = RARRAY_LEN(ary), len;
+
+    if (argc == 0) {
+        RETURN_ENUMERATOR(ary, 0, 0);
+        while (i--) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+                return LONG2NUM(i);
+            if (i > (len = RARRAY_LEN(ary))) {
+                i = len;
+            }
+        }
+        return Qnil;
+    }
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+        rb_warn("given block not used");
+    while (i--) {
+        VALUE e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, val)) {
+            return LONG2NUM(i);
+        }
+        if (i > RARRAY_LEN(ary)) {
+            break;
+        }
+    }
+    return Qnil;
+}
+
+VALUE
+rb_ary_to_ary(VALUE obj)
 {
-    VALUE arg1, arg2;
-    struct RArray *arg3;
-    int offset;
+    VALUE tmp = rb_check_array_type(obj);
 
-    if (rb_scan_args(argc, argv, "21", &arg1, &arg2, &arg3) == 3) {
-	int beg, len;
+    if (!NIL_P(tmp)) return tmp;
+    return rb_ary_new3(1, obj);
+}
+
+static void
+rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
+{
+    long olen;
+    long rofs;
+
+    if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
+    olen = RARRAY_LEN(ary);
+    if (beg < 0) {
+        beg += olen;
+        if (beg < 0) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     beg - olen, -olen);
+        }
+    }
+    if (olen < len || olen < beg + len) {
+        len = olen - beg;
+    }
 
-	beg = NUM2INT(arg1);
-	if (TYPE(arg3) != T_ARRAY) {
-	    arg3 = (struct RArray*)rb_to_a(arg3);
-	}
-	if (beg < 0) {
-	    beg = ary->len + beg;
-	    if (beg < 0) {
-		Fail("negative index for array(size: %d)", ary->len);
-	    }
-	}
-	if (beg >= ary->len) {
-	    len = beg + arg3->len;
-	    if (len >= ary->capa) {
-		ary->capa=len;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
-	    }
-	    MEMZERO(ary->ptr+ary->len, VALUE, beg-ary->len);
-	    MEMCPY(ary->ptr+beg, arg3->ptr, VALUE, arg3->len);
-	    ary->len = len;
-	}
-	else {
-	    int alen;
+    {
+        const VALUE *optr = RARRAY_CONST_PTR(ary);
+        rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+    }
 
-	    len = NUM2INT(arg2);
-	    if (beg + len > ary->len) {
-		len = ary->len - beg;
-	    }
-	    if (len < 0) {
-		Fail("negative length for sub-array(size: %d)", ary->len);
-	    }
+    if (beg >= olen) {
+        VALUE target_ary;
+        if (beg > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", beg);
+        }
+        target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+        len = beg + rlen;
+        ary_mem_clear(ary, olen, beg - olen);
+        if (rlen > 0) {
+            if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
+            ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+        }
+        ARY_SET_LEN(ary, len);
+    }
+    else {
+        long alen;
+
+        if (olen - len > ARY_MAX_SIZE - rlen) {
+            rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+        }
+        rb_ary_modify(ary);
+        alen = olen + rlen - len;
+        if (alen >= ARY_CAPA(ary)) {
+            ary_double_capa(ary, alen);
+        }
+
+        if (len != rlen) {
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+                                             VALUE, olen - (beg + len)));
+            ARY_SET_LEN(ary, alen);
+        }
+        if (rlen > 0) {
+            if (rofs == -1) {
+                rb_gc_writebarrier_remember(ary);
+            }
+            else {
+                /* In this case, we're copying from a region in this array, so
+                 * we don't need to fire the write barrier. */
+                rptr = RARRAY_CONST_PTR(ary) + rofs;
+            }
+
+            /* do not use RARRAY_PTR() because it can causes GC.
+             * ary can contain T_NONE object because it is not cleared.
+             */
+            RARRAY_PTR_USE(ary, ptr,
+                                     MEMMOVE(ptr + beg, rptr, VALUE, rlen));
+        }
+    }
+}
 
-	    alen = ary->len + arg3->len - len;
-	    if (alen >= ary->capa) {
-		ary->capa=alen;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
-	    }
+void
+rb_ary_set_len(VALUE ary, long len)
+{
+    long capa;
 
-	    memmove(ary->ptr+beg+arg3->len, ary->ptr+beg+len,
-		    sizeof(VALUE)*(ary->len-(beg+len)));
-	    memcpy(ary->ptr+beg, arg3->ptr, sizeof(VALUE)*arg3->len);
-	    ary->len = alen;
-	}
-	return (VALUE)arg3;
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+        rb_raise(rb_eRuntimeError, "can't set length of shared ");
     }
+    if (len > (capa = (long)ARY_CAPA(ary))) {
+        rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+    }
+    ARY_SET_LEN(ary, len);
+}
 
-    /* check if idx is Range */
-    if (obj_is_kind_of(arg1, C_Range)) {
-	int beg, len;
-
-	Check_Type(arg2, T_ARRAY);
-	range_beg_end(arg1, &beg, &len, ary->len);
-	if (ary->len < beg) {
-	    len = beg + RARRAY(arg2)->len;
-	    if (len >= ary->capa) {
-		ary->capa=len;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
-	    }
-	    MEMZERO(ary->ptr+ary->len, VALUE, beg-ary->len);
-	    MEMCPY(ary->ptr+beg, RARRAY(arg2)->ptr, VALUE, RARRAY(arg2)->len);
-	    ary->len = len;
-	}
-	else {
-	    int alen;
-
-	    alen = ary->len + RARRAY(arg2)->len - len;
-	    if (alen >= ary->capa) {
-		ary->capa=alen;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
-	    }
-
-	    memmove(ary->ptr+beg+RARRAY(arg2)->len, ary->ptr+beg+len,
-		    sizeof(VALUE)*(ary->len-(beg+len)));
-	    memcpy(ary->ptr+beg, RARRAY(arg2)->ptr,
-		    sizeof(VALUE)*RARRAY(arg2)->len);
-	    ary->len = alen;
-	}
-	return arg2;
-    }
-
-    offset = NUM2INT(arg1);
-    if (offset < 0) {
-	offset = ary->len + offset;
-    }
-    astore(ary, offset, arg2);
-    return arg2;
-}
-
-static VALUE
-Fary_each(ary)
-    struct RArray *ary;
+VALUE
+rb_ary_resize(VALUE ary, long len)
 {
-    int i;
+    long olen;
 
-    if (iterator_p()) {
-	for (i=0; i<ary->len; i++) {
-	    rb_yield(ary->ptr[i]);
-	}
+    rb_ary_modify(ary);
+    olen = RARRAY_LEN(ary);
+    if (len == olen) return ary;
+    if (len > ARY_MAX_SIZE) {
+        rb_raise(rb_eIndexError, "index %ld too big", len);
+    }
+    if (len > olen) {
+        if (len > ARY_CAPA(ary)) {
+            ary_double_capa(ary, len);
+        }
+        ary_mem_clear(ary, olen, len - olen);
+        ARY_SET_LEN(ary, len);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        ARY_SET_EMBED_LEN(ary, len);
+    }
+    else if (len <= ary_embed_capa(ary)) {
+        const VALUE *ptr = ARY_HEAP_PTR(ary);
+        long ptr_capa = ARY_HEAP_SIZE(ary);
+        bool is_malloc_ptr = !ARY_SHARED_P(ary);
+
+        FL_SET_EMBED(ary);
+
+        MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
+        ARY_SET_EMBED_LEN(ary, len);
+
+        if (is_malloc_ptr) ruby_sized_xfree((void *)ptr, ptr_capa);
     }
     else {
-	return (VALUE)ary;
+        if (olen > len + ARY_DEFAULT_SIZE) {
+            size_t new_capa = ary_heap_realloc(ary, len);
+            ARY_SET_CAPA(ary, new_capa);
+        }
+        ARY_SET_HEAP_LEN(ary, len);
     }
+    ary_verify(ary);
+    return ary;
 }
 
 static VALUE
-Fary_each_index(ary)
-    struct RArray *ary;
+ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
 {
-    int i;
+    rb_ary_store(ary, key, val);
+    return val;
+}
+
+static VALUE
+ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
+{
+    VALUE rpl = rb_ary_to_ary(val);
+    rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
+    RB_GC_GUARD(rpl);
+    return val;
+}
+
+/*
+ *  call-seq:
+ *    self[index] = object -> object
+ *    self[start, length] = object -> object
+ *    self[range] = object -> object
+ *
+ *  Assigns elements in +self+, based on the given +object+; returns +object+.
+ *
+ *  In brief:
+ *
+ *      a_orig = [:foo, 'bar', 2]
+ *
+ *      # With argument index.
+ *      a = a_orig.dup
+ *      a[0] = 'foo' # => "foo"
+ *      a # => ["foo", "bar", 2]
+ *      a = a_orig.dup
+ *      a[7] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *      # With arguments start and length.
+ *      a = a_orig.dup
+ *      a[0, 2] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6, 50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *      # With argument range.
+ *      a = a_orig.dup
+ *      a[0..1] = 'foo' # => "foo"
+ *      a # => ["foo", 2]
+ *      a = a_orig.dup
+ *      a[6..50] = 'foo' # => "foo"
+ *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  When Integer argument +index+ is given, assigns +object+ to an element in +self+.
+ *
+ *  If +index+ is non-negative, assigns +object+ the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0] = 'foo' # => "foo"
+ *    a # => ["foo", "bar", 2]
+ *
+ *  If +index+ is greater than <tt>self.length</tt>, extends the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[7] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
+ *
+ *  If +index+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-1] = 'two' # => "two"
+ *    a # => [:foo, "bar", "two"]
+ *
+ *  When Integer arguments +start+ and +length+ are given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0, 2] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  If +start+ is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2, 2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
+ *  extends the array with +nil+, assigns +object+ at offset +start+,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6, 50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If +length+ is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If +length+ is too large for the existing array, does not extend the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1, 5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  When Range argument +range+ is given and +object+ is not an array,
+ *  removes <tt>length - 1</tt> elements beginning at offset +start+,
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[0..1] = 'foo' # => "foo"
+ *    a # => ["foo", 2]
+ *
+ *  if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[-2..2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  If the array length is less than <tt>range.begin</tt>,
+ *  extends the array with +nil+, assigns +object+ at offset <tt>range.begin</tt>,
+ *  and ignores +length+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[6..50] = 'foo' # => "foo"
+ *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
+ *
+ *  If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
+ *  and assigns +object+ at offset +start+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..0] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *
+ *  If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
+ *  retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-1] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-2] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", 2]
+ *    a = [:foo, 'bar', 2]
+ *    a[1..-3] = 'foo' # => "foo"
+ *    a # => [:foo, "foo", "bar", 2]
+ *    a = [:foo, 'bar', 2]
+ *
+ *  If <tt>range.end</tt> is too large for the existing array,
+ *  replaces array elements, but does not extend the array with +nil+ values:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a[1..5] = 'foo' # => "foo"
+ *    a # => [:foo, "foo"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
 
-    for (i=0; i<ary->len; i++) {
-	rb_yield(INT2FIX(i));
+static VALUE
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+{
+    long offset, beg, len;
+
+    rb_check_arity(argc, 2, 3);
+    rb_ary_modify_check(ary);
+    if (argc == 3) {
+        beg = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
+    }
+    if (FIXNUM_P(argv[0])) {
+        offset = FIX2LONG(argv[0]);
+        return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
     }
+    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+        /* check if idx is Range */
+        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
+    }
+
+    offset = NUM2LONG(argv[0]);
+    return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
 }
 
+/*
+ *  call-seq:
+ *    insert(index, *objects) -> self
+ *
+ *  Inserts the given +objects+ as elements of +self+;
+ *  returns +self+.
+ *
+ *  When +index+ is non-negative, inserts +objects+
+ *  _before_ the element at offset +index+:
+ *
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(1, :x, :y, :z) # => ["a", :x, :y, :z, "b", "c"]
+ *
+ *  Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
+ *
+ *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
+ *    a.insert(5, :x, :y, :z) # => ["a", "b", "c", nil, nil, :x, :y, :z]
+ *
+ *  When +index+ is negative, inserts +objects+
+ *  _after_ the element at offset <tt>index + self.size</tt>:
+ *
+ *    a = ['a', 'b', 'c']      # => ["a", "b", "c"]
+ *    a.insert(-2, :x, :y, :z) # => ["a", "b", :x, :y, :z, "c"]
+ *
+ *  With no +objects+ given, does nothing:
+ *
+ *    a = ['a', 'b', 'c'] # => ["a", "b", "c"]
+ *    a.insert(1)         # => ["a", "b", "c"]
+ *    a.insert(50)        # => ["a", "b", "c"]
+ *    a.insert(-50)       # => ["a", "b", "c"]
+ *
+ *  Raises IndexError if +objects+ are given and +index+ is negative and out of range.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
 static VALUE
-Fary_length(ary)
-    struct RArray *ary;
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
 {
-    return INT2FIX(ary->len);
+    long pos;
+
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    rb_ary_modify_check(ary);
+    pos = NUM2LONG(argv[0]);
+    if (argc == 1) return ary;
+    if (pos == -1) {
+        pos = RARRAY_LEN(ary);
+    }
+    else if (pos < 0) {
+        long minpos = -RARRAY_LEN(ary) - 1;
+        if (pos < minpos) {
+            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+                     pos, minpos);
+        }
+        pos++;
+    }
+    rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
+    return ary;
 }
 
 static VALUE
-ary_clone(ary)
-    struct RArray *ary;
+rb_ary_length(VALUE ary);
+
+static VALUE
+ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
 {
-    VALUE ary2 = ary_new2(ary->len);
+    return rb_ary_length(ary);
+}
 
-    CLONESETUP(ary2, ary);
-    MEMCPY(RARRAY(ary2)->ptr, ary->ptr, VALUE, ary->len);
-    RARRAY(ary2)->len = ary->len;
-    return ary2;
+// Primitive to avoid a race condition in Array#each.
+// Return `true` and write `value` and `index` if the element exists.
+static VALUE
+ary_fetch_next(VALUE self, VALUE *index, VALUE *value)
+{
+    long i = NUM2LONG(*index);
+    if (i >= RARRAY_LEN(self)) {
+        return Qfalse;
+    }
+    *value = RARRAY_AREF(self, i);
+    *index = LONG2NUM(i + 1);
+    return Qtrue;
 }
 
-extern VALUE OFS;
+/*
+ *  call-seq:
+ *    each {|element| ... } -> self
+ *    each -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each element to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element|  puts "#{element.class} #{element}" }
+ *
+ *  Output:
+ *
+ *    Symbol foo
+ *    String bar
+ *    Integer 2
+ *
+ *  Allows the array to be modified during iteration:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
+ *
+ *  Output:
+ *
+ *    foo
+ *    bar
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ */
 
 VALUE
-ary_join(ary, sep)
-    struct RArray *ary;
-    struct RString *sep;
+rb_ary_each(VALUE ary)
 {
-    int i;
-    VALUE result, tmp;
-    if (ary->len == 0) return str_new(0, 0);
+    long i;
+    ary_verify(ary);
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        rb_yield(RARRAY_AREF(ary, i));
+    }
+    return ary;
+}
 
-    if (TYPE(ary->ptr[0]) == T_STRING)
-	result = str_clone(ary->ptr[0]);
-    else
-	result = obj_as_string(ary->ptr[0]);
-
-    for (i=1; i<ary->len; i++) {
-	tmp = ary->ptr[i];
-	switch (TYPE(tmp)) {
-	  case T_STRING:
-	    break;
-	  case T_ARRAY:
-	    tmp = ary_join(tmp, sep);
-	    break;
-	  default:
-	    tmp = obj_as_string(tmp);
-	}
-	if (sep) str_cat(result, sep->ptr, sep->len);
-	str_cat(result, RSTRING(tmp)->ptr, RSTRING(tmp)->len);
+/*
+ *  call-seq:
+ *    each_index {|index| ... } -> self
+ *    each_index -> new_enumerator
+ *
+ *  With a block given, iterates over the elements of +self+,
+ *  passing each <i>array index</i> to the block;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index|  puts "#{index} #{a[index]}" }
+ *
+ *  Output:
+ *
+ *    0 foo
+ *    1 bar
+ *    2 2
+ *
+ *  Allows the array to be modified during iteration:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.each_index {|index| puts index; a.clear if index > 0 }
+ *    a # => []
+ *
+ *  Output:
+ *
+ *    0
+ *    1
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ */
+
+static VALUE
+rb_ary_each_index(VALUE ary)
+{
+    long i;
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        rb_yield(LONG2NUM(i));
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    reverse_each {|element| ... } -> self
+ *    reverse_each -> Enumerator
+ *
+ *  When a block given, iterates backwards over the elements of +self+,
+ *  passing, in reverse order, each element to the block;
+ *  returns +self+:
+ *
+ *    a = []
+ *    [0, 1, 2].reverse_each {|element| a.push(element) }
+ *    a # => [2, 1, 0]
+ *
+ *  Allows the array to be modified during iteration:
+ *
+ *    a = ['a', 'b', 'c']
+ *    a.reverse_each {|element| a.clear if element.start_with?('b') }
+ *    a # => []
+ *
+ *  When no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ */
+
+static VALUE
+rb_ary_reverse_each(VALUE ary)
+{
+    long len;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    len = RARRAY_LEN(ary);
+    while (len--) {
+        long nlen;
+        rb_yield(RARRAY_AREF(ary, len));
+        nlen = RARRAY_LEN(ary);
+        if (nlen < len) {
+            len = nlen;
+        }
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    length -> integer
+ *    size -> integer
+ *
+ *  Returns the count of elements in +self+:
+ *
+ *    [0, 1, 2].length # => 3
+ *    [].length        # => 0
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_length(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    return LONG2NUM(len);
+}
+
+/*
+ *  call-seq:
+ *    empty?  -> true or false
+ *
+ *  Returns +true+ if the count of elements in +self+ is zero,
+ *  +false+ otherwise.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_empty_p(VALUE ary)
+{
+    return RBOOL(RARRAY_LEN(ary) == 0);
+}
+
+VALUE
+rb_ary_dup(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(dup, len);
+
+    ary_verify(ary);
+    ary_verify(dup);
+    return dup;
+}
+
+VALUE
+rb_ary_resurrect(VALUE ary)
+{
+    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+}
+
+extern VALUE rb_output_fs;
+
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
+static VALUE
+recursive_join(VALUE obj, VALUE argp, int recur)
+{
+    VALUE *arg = (VALUE *)argp;
+    VALUE ary = arg[0];
+    VALUE sep = arg[1];
+    VALUE result = arg[2];
+    int *first = (int *)arg[3];
+
+    if (recur) {
+        rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+        ary_join_1(obj, ary, sep, 0, result, first);
+    }
+    return Qnil;
+}
+
+static long
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+{
+    long i;
+    VALUE val;
+
+    if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
+    for (i=0; i<max; i++) {
+        val = RARRAY_AREF(ary, i);
+        if (!RB_TYPE_P(val, T_STRING)) break;
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+        rb_str_buf_append(result, val);
+    }
+    return i;
+}
+
+static void
+ary_join_1_str(VALUE dst, VALUE src, int *first)
+{
+    rb_str_buf_append(dst, src);
+    if (*first) {
+        rb_enc_copy(dst, src);
+        *first = FALSE;
+    }
+}
+
+static void
+ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
+{
+    if (val == ary) {
+        rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+        VALUE args[4];
+
+        *first = FALSE;
+        args[0] = val;
+        args[1] = sep;
+        args[2] = result;
+        args[3] = (VALUE)first;
+        rb_exec_recursive(recursive_join, obj, (VALUE)args);
     }
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+{
+    VALUE val, tmp;
+
+    for (; i<RARRAY_LEN(ary); i++) {
+        if (i > 0 && !NIL_P(sep))
+            rb_str_buf_append(result, sep);
+
+        val = RARRAY_AREF(ary, i);
+        if (RB_TYPE_P(val, T_STRING)) {
+            ary_join_1_str(result, val, first);
+        }
+        else if (RB_TYPE_P(val, T_ARRAY)) {
+            ary_join_1_ary(val, ary, sep, result, val, first);
+        }
+        else if (!NIL_P(tmp = rb_check_string_type(val))) {
+            ary_join_1_str(result, tmp, first);
+        }
+        else if (!NIL_P(tmp = rb_check_array_type(val))) {
+            ary_join_1_ary(val, ary, sep, result, tmp, first);
+        }
+        else {
+            ary_join_1_str(result, rb_obj_as_string(val), first);
+        }
+    }
+}
+
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+    long len = 1, i;
+    VALUE val, tmp, result;
+
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+
+    if (!NIL_P(sep)) {
+        StringValue(sep);
+        len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    long len_memo = RARRAY_LEN(ary);
+    for (i=0; i < len_memo; i++) {
+        val = RARRAY_AREF(ary, i);
+        if (RB_UNLIKELY(!RB_TYPE_P(val, T_STRING))) {
+            tmp = rb_check_string_type(val);
+            if (NIL_P(tmp) || tmp != val) {
+                int first;
+                long n = RARRAY_LEN(ary);
+                if (i > n) i = n;
+                result = rb_str_buf_new(len + (n-i)*10);
+                rb_enc_associate(result, rb_usascii_encoding());
+                i = ary_join_0(ary, sep, i, result);
+                first = i == 0;
+                ary_join_1(ary, ary, sep, i, result, &first);
+                return result;
+            }
+            len += RSTRING_LEN(tmp);
+            len_memo = RARRAY_LEN(ary);
+        }
+        else {
+            len += RSTRING_LEN(val);
+        }
+    }
+
+    result = rb_str_new(0, len);
+    rb_str_set_len(result, 0);
+
+    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
 
     return result;
 }
 
+/*
+ *  call-seq:
+ *    join(separator = $,) -> new_string
+ *
+ *  Returns the new string formed by joining the converted elements of +self+;
+ *  for each element +element+:
+ *
+ *  - Converts recursively using <tt>element.join(separator)</tt>
+ *    if +element+ is a <tt>kind_of?(Array)</tt>.
+ *  - Otherwise, converts using <tt>element.to_s</tt>.
+ *
+ *  With no argument given, joins using the output field separator, <tt>$,</tt>:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    $, # => nil
+ *    a.join # => "foobar2"
+ *
+ *  With string argument +separator+ given, joins using that separator:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.join("\n") # => "foo\nbar\n2"
+ *
+ *  Joins recursively for nested arrays:
+ *
+ *   a = [:foo, [:bar, [:baz, :bat]]]
+ *   a.join # => "foobarbazbat"
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
 static VALUE
-Fary_join(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
-    rb_scan_args(argc, argv, "01", &sep);
-    if (sep == Qnil) sep = OFS;
+    if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+        sep = rb_output_fs;
+        if (!NIL_P(sep)) {
+            rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
+        }
+    }
+
+    return rb_ary_join(ary, sep);
+}
+
+static VALUE
+inspect_ary(VALUE ary, VALUE dummy, int recur)
+{
+    long i;
+    VALUE s, str;
+
+    if (recur) return rb_usascii_str_new_cstr("[...]");
+    str = rb_str_buf_new2("[");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        s = rb_inspect(RARRAY_AREF(ary, i));
+        if (i > 0) rb_str_buf_cat2(str, ", ");
+        else rb_enc_copy(str, s);
+        rb_str_buf_append(str, s);
+    }
+    rb_str_buf_cat2(str, "]");
+    return str;
+}
+
+/*
+ *  call-seq:
+ *    inspect -> new_string
+ *    to_s -> new_string
+ *
+ *  Returns the new string formed by calling method <tt>#inspect</tt>
+ *  on each array element:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.inspect # => "[:foo, \"bar\", 2]"
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
+static VALUE
+rb_ary_inspect(VALUE ary)
+{
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+    return rb_exec_recursive(inspect_ary, ary, 0);
+}
+
+VALUE
+rb_ary_to_s(VALUE ary)
+{
+    return rb_ary_inspect(ary);
+}
+
+/*
+ *  call-seq:
+ *    to_a -> self or new_array
+ *
+ *  When +self+ is an instance of \Array, returns +self+.
+ *
+ *  Otherwise, returns a new array containing the elements of +self+:
+ *
+ *    class MyArray < Array; end
+ *    my_a = MyArray.new(['foo', 'bar', 'two'])
+ *    a = my_a.to_a
+ *    a # => ["foo", "bar", "two"]
+ *    a.class # => Array # Not MyArray.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
+static VALUE
+rb_ary_to_a(VALUE ary)
+{
+    if (rb_obj_class(ary) != rb_cArray) {
+        VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+        rb_ary_replace(dup, ary);
+        return dup;
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    to_h -> new_hash
+ *    to_h {|element| ... } -> new_hash
+ *
+ *  Returns a new hash formed from +self+.
+ *
+ *  With no block given, each element of +self+ must be a 2-element sub-array;
+ *  forms each sub-array into a key-value pair in the new hash:
+ *
+ *    a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
+ *    a.to_h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
+ *    [].to_h # => {}
+ *
+ *  With a block given, the block must return a 2-element array;
+ *  calls the block with each element of +self+;
+ *  forms each returned array into a key-value pair in the returned hash:
+ *
+ *    a = ['foo', :bar, 1, [2, 3], {baz: 4}]
+ *    a.to_h {|element| [element, element.class] }
+ *    # => {"foo"=>String, :bar=>Symbol, 1=>Integer, [2, 3]=>Array, {:baz=>4}=>Hash}
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
 
-    if (sep != Qnil)
-	Check_Type(sep, T_STRING);
+static VALUE
+rb_ary_to_h(VALUE ary)
+{
+    long i;
+    VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+    int block_given = rb_block_given_p();
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        const VALUE e = rb_ary_elt(ary, i);
+        const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+        const VALUE key_value_pair = rb_check_array_type(elt);
+        if (NIL_P(key_value_pair)) {
+            rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+                     rb_obj_class(elt), i);
+        }
+        if (RARRAY_LEN(key_value_pair) != 2) {
+            rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+                i, RARRAY_LEN(key_value_pair));
+        }
+        rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+    }
+    return hash;
+}
+
+/*
+ *  call-seq:
+ *    to_ary -> self
+ *
+ *  Returns +self+.
+ */
+
+static VALUE
+rb_ary_to_ary_m(VALUE ary)
+{
+    return ary;
+}
 
-    return ary_join(ary, sep);
+static void
+ary_reverse(VALUE *p1, VALUE *p2)
+{
+    while (p1 < p2) {
+        VALUE tmp = *p1;
+        *p1++ = *p2;
+        *p2-- = tmp;
+    }
 }
 
 VALUE
-Fary_to_s(ary)
+rb_ary_reverse(VALUE ary)
+{
+    VALUE *p2;
+    long len = RARRAY_LEN(ary);
+
+    rb_ary_modify(ary);
+    if (len > 1) {
+        RARRAY_PTR_USE(ary, p1, {
+            p2 = p1 + len - 1;	/* points last item */
+            ary_reverse(p1, p2);
+        }); /* WB: no new reference */
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    reverse! -> self
+ *
+ *  Reverses the order of the elements of +self+;
+ *  returns +self+:
+ *
+ *    a = [0, 1, 2]
+ *    a.reverse! # => [2, 1, 0]
+ *    a          # => [2, 1, 0]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
+static VALUE
+rb_ary_reverse_bang(VALUE ary)
+{
+    return rb_ary_reverse(ary);
+}
+
+/*
+ *  call-seq:
+ *    reverse -> new_array
+ *
+ *  Returns a new array containing the elements of +self+ in reverse order:
+ *
+ *    [0, 1, 2].reverse # => [2, 1, 0]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_reverse_m(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+
+    if (len > 0) {
+        const VALUE *p1 = RARRAY_CONST_PTR(ary);
+        VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+        do *p2-- = *p1++; while (--len > 0);
+    }
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
+    return dup;
+}
+
+static inline long
+rotate_count(long cnt, long len)
+{
+    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+}
+
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+{
+    if (cnt == 1) {
+        VALUE tmp = *ptr;
+        memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
+        *(ptr + len - 1) = tmp;
+    }
+    else if (cnt == len - 1) {
+        VALUE tmp = *(ptr + len - 1);
+        memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
+        *ptr = tmp;
+    }
+    else {
+        --len;
+        if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+        if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+        if (len > 0) ary_reverse(ptr, ptr + len);
+    }
+}
+
+VALUE
+rb_ary_rotate(VALUE ary, long cnt)
+{
+    rb_ary_modify(ary);
+
+    if (cnt != 0) {
+        long len = RARRAY_LEN(ary);
+        if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
+            RARRAY_PTR_USE(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+            return ary;
+        }
+    }
+    return Qnil;
+}
+
+/*
+ *  call-seq:
+ *    rotate!(count = 1) -> self
+ *
+ *  Rotates +self+ in place by moving elements from one end to the other; returns +self+.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates +count+ elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate!(2)   # => [2, 3, 0, 1]
+      [0, 1, 2, 3].rotate!(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate!(21) # => [1, 2, 3, 0]
+ *
+ *  If +count+ is zero, rotates no elements:
+ *
+ *    [0, 1, 2, 3].rotate!(0) # => [0, 1, 2, 3]
+ *
+ *  With a negative numeric +count+, rotates in the opposite direction,
+ *  from end to beginning:
+ *
+ *    [0, 1, 2, 3].rotate!(-1) # => [3, 0, 1, 2]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate!(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
+static VALUE
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
+{
+    long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+    rb_ary_rotate(ary, n);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    rotate(count = 1) -> new_array
+ *
+ *  Returns a new array formed from +self+ with elements
+ *  rotated from one end to the other.
+ *
+ *  With non-negative numeric +count+,
+ *  rotates elements from the beginning to the end:
+ *
+ *    [0, 1, 2, 3].rotate(2)   # => [2, 3, 0, 1]
+ *    [0, 1, 2, 3].rotate(2.1) # => [2, 3, 0, 1]
+ *
+ *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate(22) # => [2, 3, 0, 1]
+ *
+ *  With a +count+ of zero, rotates no elements:
+ *
+ *    [0, 1, 2, 3].rotate(0) # => [0, 1, 2, 3]
+ *
+ *  With negative numeric +count+, rotates in the opposite direction,
+ *  from the end to the beginning:
+ *
+ *    [0, 1, 2, 3].rotate(-1) # => [3, 0, 1, 2]
+ *
+ *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *
+ *    [0, 1, 2, 3].rotate(-21) # => [3, 0, 1, 2]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE rotated;
+    const VALUE *ptr;
+    long len;
+    long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+
+    len = RARRAY_LEN(ary);
+    rotated = rb_ary_new2(len);
+    if (len > 0) {
+        cnt = rotate_count(cnt, len);
+        ptr = RARRAY_CONST_PTR(ary);
+        len -= cnt;
+        ary_memcpy(rotated, 0, len, ptr + cnt);
+        ary_memcpy(rotated, len, cnt, ptr);
+    }
+    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+    return rotated;
+}
+
+struct ary_sort_data {
     VALUE ary;
+    VALUE receiver;
+};
+
+static VALUE
+sort_reentered(VALUE ary)
 {
-    VALUE str = ary_join(ary, OFS);
-    if (str == Qnil) return str_new(0, 0);
-    return str;
+    if (RBASIC(ary)->klass) {
+        rb_raise(rb_eRuntimeError, "sort reentered");
+    }
+    return Qnil;
 }
 
+static void
+sort_returned(struct ary_sort_data *data)
+{
+    if (rb_obj_frozen_p(data->receiver)) {
+        rb_raise(rb_eFrozenError, "array frozen during sort");
+    }
+    sort_reentered(data->ary);
+}
+
+static int
+sort_1(const void *ap, const void *bp, void *dummy)
+{
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    VALUE args[2];
+    int n;
+
+    args[0] = a;
+    args[1] = b;
+    retval = rb_yield_values2(2, args);
+    n = rb_cmpint(retval, a, b);
+    sort_returned(data);
+    return n;
+}
+
+static int
+sort_2(const void *ap, const void *bp, void *dummy)
+{
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    int n;
+
+    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
+        if ((long)a > (long)b) return 1;
+        if ((long)a < (long)b) return -1;
+        return 0;
+    }
+    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
+        return rb_str_cmp(a, b);
+    }
+    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
+        return rb_float_cmp(a, b);
+    }
+
+    retval = rb_funcallv(a, id_cmp, 1, &b);
+    n = rb_cmpint(retval, a, b);
+    sort_returned(data);
+
+    return n;
+}
+
+/*
+ *  call-seq:
+ *    sort! -> self
+ *    sort! {|a, b| ... } -> self
+ *
+ *  Like Array#sort, but returns +self+ with its elements sorted in place.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
 VALUE
-Fary_print_on(ary, port)
-    struct RArray *ary;
-    VALUE port;
+rb_ary_sort_bang(VALUE ary)
 {
-    int i;
+    rb_ary_modify(ary);
+    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    if (RARRAY_LEN(ary) > 1) {
+        VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+        struct ary_sort_data data;
+        long len = RARRAY_LEN(ary);
+        RBASIC_CLEAR_CLASS(tmp);
+        data.ary = tmp;
+        data.receiver = ary;
+        RARRAY_PTR_USE(tmp, ptr, {
+            ruby_qsort(ptr, len, sizeof(VALUE),
+                       rb_block_given_p()?sort_1:sort_2, &data);
+        }); /* WB: no new reference */
+        rb_ary_modify(ary);
+        if (ARY_EMBED_P(tmp)) {
+            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+                rb_ary_unshare(ary);
+                FL_SET_EMBED(ary);
+            }
+            if (ARY_EMBED_LEN(tmp) > ARY_CAPA(ary)) {
+                ary_resize_capa(ary, ARY_EMBED_LEN(tmp));
+            }
+            ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+        }
+        else {
+            if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+                FL_UNSET_SHARED(ary);
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+            }
+            else {
+                RUBY_ASSERT(!ARY_SHARED_P(tmp));
+                if (ARY_EMBED_P(ary)) {
+                    FL_UNSET_EMBED(ary);
+                }
+                else if (ARY_SHARED_P(ary)) {
+                    /* ary might be destructively operated in the given block */
+                    rb_ary_unshare(ary);
+                }
+                else {
+                    ary_heap_free(ary);
+                }
+                ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
+                ARY_SET_HEAP_LEN(ary, len);
+                ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
+            }
+            /* tmp was lost ownership for the ptr */
+            FL_SET_EMBED(tmp);
+            ARY_SET_EMBED_LEN(tmp, 0);
+            OBJ_FREEZE(tmp);
+        }
+        /* tmp will be GC'ed. */
+        RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
+    }
+    ary_verify(ary);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    sort -> new_array
+ *    sort {|a, b| ... } -> new_array
+ *
+ *  Returns a new array containing the elements of +self+, sorted.
+ *
+ *  With no block given, compares elements using operator <tt>#<=></tt>
+ *  (see Object#<=>):
+ *
+ *    [0, 2, 3, 1].sort # => [0, 1, 2, 3]
+ *
+ *  With a block given, calls the block with each combination of pairs of elements from +self+;
+ *  for each pair +a+ and +b+, the block should return a numeric:
+ *
+ *  - Negative when +b+ is to follow +a+.
+ *  - Zero when +a+ and +b+ are equivalent.
+ *  - Positive when +a+ is to follow +b+.
+ *
+ *  Example:
+ *
+ *    a = [3, 2, 0, 1]
+ *    a.sort {|a, b| a <=> b } # => [0, 1, 2, 3]
+ *    a.sort {|a, b| b <=> a } # => [3, 2, 1, 0]
+ *
+ *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
+ *  and may be unstable.
+ *
+ *  See an example in Numeric#nonzero? for the idiom to sort more
+ *  complex structure.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
 
-    for (i=0; i<ary->len; i++) {
-	if (OFS && i>1) {
-	    io_write(port, OFS);
-	}
-	io_write(port, ary->ptr[i]);
+VALUE
+rb_ary_sort(VALUE ary)
+{
+    ary = rb_ary_dup(ary);
+    rb_ary_sort_bang(ary);
+    return ary;
+}
+
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
+/*
+ *  call-seq:
+ *    bsearch {|element| ... } -> found_element or nil
+ *    bsearch -> new_enumerator
+ *
+ *  Returns the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
+ *
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_bsearch(VALUE ary)
+{
+    VALUE index_result = rb_ary_bsearch_index(ary);
+
+    if (FIXNUM_P(index_result)) {
+        return rb_ary_entry(ary, FIX2LONG(index_result));
     }
-    return port;
+    return index_result;
 }
 
-#define INSPECT_MAX 10
+/*
+ *  call-seq:
+ *    bsearch_index {|element| ... } -> integer or nil
+ *    bsearch_index -> new_enumerator
+ *
+ *  Returns the integer index of the element from +self+ found by a binary search,
+ *  or +nil+ if the search found no suitable element.
+ *
+ *  See {Binary Searching}[rdoc-ref:language/bsearch.rdoc].
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
 
 static VALUE
-Fary_inspect(ary)
-    struct RArray *ary;
+rb_ary_bsearch_index(VALUE ary)
 {
-    int i, len;
-    VALUE str;
-    char *p;
+    long low = 0, high = RARRAY_LEN(ary), mid;
+    int smaller = 0, satisfied = 0;
+    VALUE v, val;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    while (low < high) {
+        mid = low + ((high - low) / 2);
+        val = rb_ary_entry(ary, mid);
+        v = rb_yield(val);
+        if (FIXNUM_P(v)) {
+            if (v == INT2FIX(0)) return INT2FIX(mid);
+            smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+        }
+        else if (v == Qtrue) {
+            satisfied = 1;
+            smaller = 1;
+        }
+        else if (!RTEST(v)) {
+            smaller = 0;
+        }
+        else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+            const VALUE zero = INT2FIX(0);
+            switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+              case 0: return INT2FIX(mid);
+              case 1: smaller = 0; break;
+              case -1: smaller = 1;
+            }
+        }
+        else {
+            rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+                     " (must be numeric, true, false or nil)",
+                     rb_obj_class(v));
+        }
+        if (smaller) {
+            high = mid;
+        }
+        else {
+            low = mid + 1;
+        }
+    }
+    if (!satisfied) return Qnil;
+    return INT2FIX(low);
+}
 
-    ary = (struct RArray*)ary_clone(ary);
 
-    len = ary->len;
-    for (i=0; i<len; i++) {
-	if (i > INSPECT_MAX) break;
-	ary->ptr[i] = rb_funcall(ary->ptr[i], rb_intern("_inspect"), 0, Qnil);
+static VALUE
+sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
+{
+    return rb_yield(i);
+}
+
+/*
+ *  call-seq:
+ *    sort_by! {|element| ... } -> self
+ *    sort_by! -> new_enumerator
+ *
+ *  With a block given, sorts the elements of +self+ in place;
+ *  returns self.
+ *
+ *  Calls the block with each successive element;
+ *  sorts elements based on the values returned from the block:
+ *
+ *    a = ['aaaa', 'bbb', 'cc', 'd']
+ *    a.sort_by! {|element| element.size }
+ *    a # => ["d", "cc", "bbb", "aaaa"]
+ *
+ *  For duplicate values returned by the block, the ordering is indeterminate, and may be unstable.
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
+{
+    VALUE sorted;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > 1) {
+        sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+        rb_ary_replace(ary, sorted);
     }
+    return ary;
+}
 
-    str = str_new2(", ");
-    str = ary_join(ary, str);
-    if (str == Qnil) return str_new2("[]");
-    len = RSTRING(str)->len;
-    if (ary->len > INSPECT_MAX)
-	str_grow(str, len+5);
-    else
-	str_grow(str, len+2);
 
-    p = RSTRING(str)->ptr;
-    memmove(p+1, p, len);
-    p[0] = '[';
-    if (ary->len > INSPECT_MAX)
-	strcpy(p+len, "...]");
-    else
-	p[len+1] = ']';
+/*
+ *  call-seq:
+ *    collect {|element| ... } -> new_array
+ *    collect -> new_enumerator
+ *    map {|element| ... } -> new_array
+ *    map -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array whose elements are the return values from the block:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a1 = a.map {|element| element.class }
+ *    a1 # => [Symbol, String, Integer]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: #collect!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
 
-    return str;
+static VALUE
+rb_ary_collect(VALUE ary)
+{
+    long i;
+    VALUE collect;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    collect = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+    }
+    return collect;
 }
 
+
+/*
+ *  call-seq:
+ *    collect! {|element| ... } -> self
+ *    collect! -> new_enumerator
+ *    map! {|element| ... } -> self
+ *    map! -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+
+ *  and replaces the element with the block's return value;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.map! { |element| element.class } # => [Symbol, String, Integer]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: #collect;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
 static VALUE
-Fary_to_a(ary)
-    VALUE ary;
+rb_ary_collect_bang(VALUE ary)
 {
+    long i;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+    }
     return ary;
 }
 
 VALUE
-rb_to_a(obj)
-    VALUE obj;
+rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
 {
-    if (TYPE(obj) == T_ARRAY) return obj;
-    obj = rb_funcall(obj, rb_intern("to_a"), 0);
-    if (TYPE(obj) != T_ARRAY) {
-	Bug("`to_a' did not return Array");
+    VALUE result = rb_ary_new2(argc);
+    long beg, len, i, j;
+
+    for (i=0; i<argc; i++) {
+        if (FIXNUM_P(argv[i])) {
+            rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+            continue;
+        }
+        /* check if idx is Range */
+        if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+            long end = olen < beg+len ? olen : beg+len;
+            for (j = beg; j < end; j++) {
+                rb_ary_push(result, (*func)(obj, j));
+            }
+            if (beg + len > j)
+                rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+            continue;
+        }
+        rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
     }
-    return obj;
+    return result;
 }
 
 static VALUE
-Fary_reverse(ary)
-    struct RArray *ary;
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
 {
-    VALUE ary2 = ary_new2(ary->len);
-    int i, j;
+    long beg, len;
+    if (FIXNUM_P(idx)) {
+        beg = FIX2LONG(idx);
+    }
+    /* check if idx is Range */
+    else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+        if (len > 0) {
+            const VALUE *const src = RARRAY_CONST_PTR(ary);
+            const long end = beg + len;
+            const long prevlen = RARRAY_LEN(result);
+            if (beg < olen) {
+                rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+            }
+            if (end > olen) {
+                rb_ary_store(result, prevlen + len - 1, Qnil);
+            }
+        }
+        return result;
+    }
+    else {
+        beg = NUM2LONG(idx);
+    }
+    return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
 
-    for (i=ary->len-1, j=0; i >=0; i--, j++) {
-	RARRAY(ary2)->ptr[j] = ary->ptr[i];
+/*
+ *  call-seq:
+ *    values_at(*specifiers) -> new_array
+ *
+ *  Returns elements from +self+ in a new array; does not modify +self+.
+ *
+ *  The objects included in the returned array are the elements of +self+
+ *  selected by the given +specifiers+,
+ *  each of which must be a numeric index or a Range.
+ *
+ *  In brief:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *
+ *    # Index specifiers.
+ *    a.values_at(2, 0, 2, 0)     # => ["c", "a", "c", "a"] # May repeat.
+ *    a.values_at(-4, -3, -2, -1) # => ["a", "b", "c", "d"] # Counts backwards if negative.
+ *    a.values_at(-50, 50)        # => [nil, nil]           # Outside of self.
+ *
+ *    # Range specifiers.
+ *    a.values_at(1..3)       # => ["b", "c", "d"] # From range.begin to range.end.
+ *    a.values_at(1...3)      # => ["b", "c"]      # End excluded.
+ *    a.values_at(3..1)       # => []              # No such elements.
+ *
+ *    a.values_at(-3..3)  # => ["b", "c", "d"]     # Negative range.begin counts backwards.
+ *    a.values_at(-50..3)                          # Raises RangeError.
+ *
+ *    a.values_at(1..-2)  # => ["b", "c"]          # Negative range.end counts backwards.
+ *    a.values_at(1..-50) # => []                  # No such elements.
+ *
+ *    # Mixture of specifiers.
+ *    a.values_at(2..3, 3, 0..1, 0) # => ["c", "d", "d", "a", "b", "a"]
+ *
+ *  With no +specifiers+ given, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.values_at # => []
+ *
+ *  For each numeric specifier +index+, includes an element:
+ *
+ *  - For each non-negative numeric specifier +index+ that is in-range (less than <tt>self.size</tt>),
+ *    includes the element at offset +index+:
+ *
+ *      a.values_at(0, 2)     # => ["a", "c"]
+ *      a.values_at(0.1, 2.9) # => ["a", "c"]
+ *
+ *  - For each negative numeric +index+ that is in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-1, -4) # => ["d", "a"]
+ *
+ *  The given indexes may be in any order, and may repeat:
+ *
+ *    a.values_at(2, 0, 1, 0, 2) # => ["c", "a", "b", "a", "c"]
+ *
+ *  For each +index+ that is out-of-range, includes +nil+:
+ *
+ *    a.values_at(4, -5) # => [nil, nil]
+ *
+ *  For each Range specifier +range+, includes elements
+ *  according to <tt>range.begin</tt> and <tt>range.end</tt>:
+ *
+ *  - If both <tt>range.begin</tt> and <tt>range.end</tt>
+ *    are non-negative and in-range (less than <tt>self.size</tt>),
+ *    includes elements from index <tt>range.begin</tt>
+ *    through <tt>range.end - 1</tt> (if <tt>range.exclude_end?</tt>),
+ *    or through <tt>range.end</tt> (otherwise):
+ *
+ *      a.values_at(1..2)  # => ["b", "c"]
+ *      a.values_at(1...2) # => ["b"]
+ *
+ *  - If <tt>range.begin</tt> is negative and in-range (greater than or equal to <tt>- self.size</tt>),
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(-2..3) # => ["c", "d"]
+ *
+ *  - If <tt>range.begin</tt> is negative and out-of-range, raises an exception:
+ *
+ *      a.values_at(-5..3) # Raises RangeError.
+ *
+ *  - If <tt>range.end</tt> is positive and out-of-range,
+ *    extends the returned array with +nil+ elements:
+ *
+ *      a.values_at(1..5) # => ["b", "c", "d", nil, nil]
+ *
+ *  - If <tt>range.end</tt> is negative and in-range,
+ *    counts backwards from the end of +self+:
+ *
+ *      a.values_at(1..-2) # => ["b", "c"]
+ *
+ *  - If <tt>range.end</tt> is negative and out-of-range,
+ *    returns an empty array:
+ *
+ *      a.values_at(1..-5) # => []
+ *
+ *  The given ranges may be in any order and may repeat:
+ *
+ *    a.values_at(2..3, 0..1, 2..3) # => ["c", "d", "a", "b", "c", "d"]
+ *
+ *  The given specifiers may be any mixture of indexes and ranges:
+ *
+ *    a.values_at(3, 1..2, 0, 2..3) # => ["d", "b", "c", "a", "c", "d"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
+{
+    long i, olen = RARRAY_LEN(ary);
+    VALUE result = rb_ary_new_capa(argc);
+    for (i = 0; i < argc; ++i) {
+        append_values_at_single(result, ary, olen, argv[i]);
     }
-    RARRAY(ary2)->len = ary->len;
+    RB_GC_GUARD(ary);
+    return result;
+}
 
-    return ary2;
+
+/*
+ *  call-seq:
+ *    select {|element| ... } -> new_array
+ *    select -> new_enumerator
+ *    filter {|element| ... } -> new_array
+ *    filter -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  returns a new array containing those elements of +self+
+ *  for which the block returns a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select {|element| element.to_s.start_with?('b') }
+ *    # => ["bar", :bam]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_select(VALUE ary)
+{
+    VALUE result;
+    long i;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    result = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+            rb_ary_push(result, rb_ary_elt(ary, i));
+        }
+    }
+    return result;
 }
 
-static ID cmp;
+struct select_bang_arg {
+    VALUE ary;
+    long len[2];
+};
 
-static int
-sort_1(a, b)
-    VALUE *a, *b;
+static VALUE
+select_bang_i(VALUE a)
 {
-    VALUE retval = rb_yield(assoc_new(*a, *b));
-    return NUM2INT(retval);
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (!RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
+    }
+    return (i1 == i2) ? Qnil : ary;
 }
 
-static int
-sort_2(a, b)
-    VALUE *a, *b;
+static VALUE
+select_bang_ensure(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long len = RARRAY_LEN(ary);
+    long i1 = arg->len[0], i2 = arg->len[1];
+
+    if (i2 < len && i2 < i1) {
+        long tail = 0;
+        rb_ary_modify(ary);
+        if (i1 < len) {
+            tail = len - i1;
+            RARRAY_PTR_USE(ary, ptr, {
+                    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+                });
+        }
+        ARY_SET_LEN(ary, i2 + tail);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    select! {|element| ... } -> self or nil
+ *    select! -> new_enumerator
+ *    filter! {|element| ... } -> self or nil
+ *    filter! -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes from +self+ those elements for which the block returns +false+ or +nil+.
+ *
+ *  Returns +self+ if any elements were removed:
+ *
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *
+ *  Returns +nil+ if no elements were removed.
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
+{
+    struct select_bang_arg args;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
+/*
+ *  call-seq:
+ *    keep_if {|element| ... } -> self
+ *    keep_if -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element from +self+ if the block does not return a truthy value:
+ *
+ *    a = [:foo, 'bar', 2, :bam]
+ *    a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
 {
-    VALUE retval;
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_select_bang(ary);
+    return ary;
+}
 
-    if (!cmp) cmp = rb_intern("<=>");
-    retval = rb_funcall(*a, cmp, 1, *b);
-    return NUM2INT(retval);
+static void
+ary_resize_smaller(VALUE ary, long len)
+{
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > len) {
+        ARY_SET_LEN(ary, len);
+        if (len * 2 < ARY_CAPA(ary) &&
+            ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+            ary_resize_capa(ary, len * 2);
+        }
+    }
 }
 
+/*
+ *  call-seq:
+ *    delete(object) -> last_removed_object
+ *    delete(object) {|element| ... } -> last_removed_object or block_return
+ *
+ *  Removes zero or more elements from +self+.
+ *
+ *  With no block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>;
+ *  returns the last removed element:
+ *
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) # => 2.0
+ *    a           # => [0, 1]
+ *
+ *  Returns +nil+ if no elements removed:
+ *
+ *    a.delete(2) # => nil
+ *
+ *  With a block given,
+ *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>.
+ *
+ *  If any such elements are found, ignores the block
+ *  and returns the last removed element:
+ *
+ *    a = [0, 1, 2, 2.0]
+ *    a.delete(2) {|element| fail 'Cannot happen' } # => 2.0
+ *    a                                             # => [0, 1]
+ *
+ *  If no such element is found, returns the block's return value:
+ *
+ *    a.delete(2) {|element| "Element #{element} not found." }
+ *    # => "Element 2 not found."
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
 VALUE
-Fary_sort(ary)
-    struct RArray *ary;
+rb_ary_delete(VALUE ary, VALUE item)
 {
-    qsort(ary->ptr, ary->len, sizeof(VALUE), iterator_p()?sort_1:sort_2);
-    return (VALUE)ary;
+    VALUE v = item;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+        VALUE e = RARRAY_AREF(ary, i1);
+
+        if (rb_equal(e, item)) {
+            v = e;
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
+    }
+    if (RARRAY_LEN(ary) == i2) {
+        if (rb_block_given_p()) {
+            return rb_yield(item);
+        }
+        return Qnil;
+    }
+
+    ary_resize_smaller(ary, i2);
+
+    ary_verify(ary);
+    return v;
+}
+
+void
+rb_ary_delete_same(VALUE ary, VALUE item)
+{
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+        VALUE e = RARRAY_AREF(ary, i1);
+
+        if (e == item) {
+            continue;
+        }
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, e);
+        }
+        i2++;
+    }
+    if (RARRAY_LEN(ary) == i2) {
+        return;
+    }
+
+    ary_resize_smaller(ary, i2);
+}
+
+VALUE
+rb_ary_delete_at(VALUE ary, long pos)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE del;
+
+    if (pos >= len) return Qnil;
+    if (pos < 0) {
+        pos += len;
+        if (pos < 0) return Qnil;
+    }
+
+    rb_ary_modify(ary);
+    del = RARRAY_AREF(ary, pos);
+    RARRAY_PTR_USE(ary, ptr, {
+        MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+    });
+    ARY_INCREASE_LEN(ary, -1);
+    ary_verify(ary);
+    return del;
+}
+
+/*
+ *  call-seq:
+ *    delete_at(index) -> removed_object or nil
+ *
+ *  Removes the element of +self+ at the given +index+, which must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  When +index+ is non-negative, deletes the element at offset +index+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(1) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  When +index+ is negative, counts backward from the end of the array:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(-2) # => "bar"
+ *    a # => [:foo, 2]
+ *
+ *  When +index+ is out of range, returns +nil+.
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.delete_at(3)  # => nil
+ *    a.delete_at(-4) # => nil
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
+{
+    return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
 static VALUE
-Fary_delete(ary, item)
-    struct RArray *ary;
-    VALUE item;
+ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
 {
-    int i1, i2;
+    const long orig_len = RARRAY_LEN(ary);
 
-    for (i1 = i2 = 0; i1 < ary->len; i1++) {
-	if (rb_equal(ary->ptr[i1], item)) continue;
-	if (i1 != i2) {
-	    ary->ptr[i2] = ary->ptr[i1];
-	}
-	i2++;
+    if (len < 0) {
+        return Qnil;
+    }
+    else if (pos < -orig_len) {
+        return Qnil;
+    }
+    else if (pos < 0) {
+        pos += orig_len;
     }
-    ary->len = i2;
+    else if (orig_len < pos) {
+        return Qnil;
+    }
+    if (orig_len < pos + len) {
+        len = orig_len - pos;
+    }
+    if (len == 0) {
+        return rb_ary_new2(0);
+    }
+    else {
+        VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+        rb_ary_splice(ary, pos, len, 0, 0);
+        return arg2;
+    }
+}
 
-    return (VALUE)ary;
+/*
+ *  call-seq:
+ *    slice!(index) -> object or nil
+ *    slice!(start, length) -> new_array or nil
+ *    slice!(range) -> new_array or nil
+ *
+ *  Removes and returns elements from +self+.
+ *
+ *  With numeric argument +index+ given,
+ *  removes and returns the element at offset +index+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2)   # => "c"
+ *    a             # => ["a", "b", "d"]
+ *    a.slice!(2.1) # => "d"
+ *    a             # => ["a", "b"]
+ *
+ *  If +index+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2) # => "c"
+ *    a            # => ["a", "b", "d"]
+ *
+ *  If +index+ is out of range, returns +nil+.
+ *
+ *  With numeric arguments +start+ and +length+ given,
+ *  removes +length+ elements from +self+ beginning at zero-based offset +start+;
+ *  returns the removed objects in a new array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1, 2)     # => ["b", "c"]
+ *    a                  # => ["a", "d"]
+ *    a.slice!(0.1, 1.1) # => ["a"]
+ *    a                  # => ["d"]
+ *
+ *  If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2, 1) # => ["c"]
+ *    a               # => ["a", "b", "d"]
+ *
+ *  If +start+ is out-of-range, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(5, 1)  # => nil
+ *    a.slice!(-5, 1) # => nil
+ *
+ *  If <tt>start + length</tt> exceeds the array size,
+ *  removes and returns all elements from offset +start+ to the end:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(2, 50) # => ["c", "d"]
+ *    a               # => ["a", "b"]
+ *
+ *  If <tt>start == a.size</tt> and +length+ is non-negative,
+ *  returns a new empty array.
+ *
+ *  If +length+ is negative, returns +nil+.
+ *
+ *  With Range argument +range+ given,
+ *  treats <tt>range.min</tt> as +start+ (as above)
+ *  and <tt>range.size</tt> as +length+ (as above):
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(1..2) # => ["b", "c"]
+ *    a              # => ["a", "d"]
+ *
+ *  If <tt>range.start == a.size</tt>, returns a new empty array:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(4..5) # => []
+ *
+ *  If <tt>range.start</tt> is larger than the array size, returns +nil+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+      a.slice!(5..6) # => nil
+ *
+ *  If <tt>range.start</tt> is negative,
+ *  calculates the start index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(-2..2) # => ["c"]
+ *
+ *  If <tt>range.end</tt> is negative,
+ *  calculates the end index by counting backwards from the end of +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.slice!(0..-2) # => ["a", "b", "c"]
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE arg1;
+    long pos, len;
+
+    rb_ary_modify_check(ary);
+    rb_check_arity(argc, 1, 2);
+    arg1 = argv[0];
+
+    if (argc == 2) {
+        pos = NUM2LONG(argv[0]);
+        len = NUM2LONG(argv[1]);
+        return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+    }
+
+    if (!FIXNUM_P(arg1)) {
+        switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+          case Qtrue:
+            /* valid range */
+            return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+          case Qnil:
+            /* invalid range */
+            return Qnil;
+          default:
+            /* not a range */
+            break;
+        }
+    }
+
+    return rb_ary_delete_at(ary, NUM2LONG(arg1));
 }
 
 static VALUE
-Fary_delete_if(ary)
-    struct RArray *ary;
+ary_reject(VALUE orig, VALUE result)
 {
-    int i1, i2;
+    long i;
 
-    for (i1 = i2 = 0; i1 < ary->len; i1++) {
-	if (rb_yield(ary->ptr[i1])) continue;
-	if (i1 != i2) {
-	    ary->ptr[i2] = ary->ptr[i1];
-	}
-	i2++;
+    for (i = 0; i < RARRAY_LEN(orig); i++) {
+        VALUE v = RARRAY_AREF(orig, i);
+
+        if (!RTEST(rb_yield(v))) {
+            rb_ary_push(result, v);
+        }
     }
-    ary->len = i2;
+    return result;
+}
 
-    return (VALUE)ary;
+static VALUE
+reject_bang_i(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+        VALUE v = RARRAY_AREF(ary, i1);
+        if (RTEST(rb_yield(v))) continue;
+        if (i1 != i2) {
+            rb_ary_store(ary, i2, v);
+        }
+        arg->len[1] = ++i2;
+    }
+    return (i1 == i2) ? Qnil : ary;
 }
 
 static VALUE
-Fary_clear(ary)
-    struct RArray *ary;
+ary_reject_bang(VALUE ary)
 {
-    ary->len = 0;
-    return (VALUE)ary;
+    struct select_bang_arg args;
+    rb_ary_modify_check(ary);
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
+/*
+ *  call-seq:
+ *    reject! {|element| ... } -> self or nil
+ *    reject! -> new_enumerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes each element for which the block returns a truthy value.
+ *
+ *  Returns +self+ if any elements removed:
+ *
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *
+ *  Returns +nil+ if no elements removed.
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_reject_bang(VALUE ary)
+{
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+    return ary_reject_bang(ary);
+}
+
+/*
+ *  call-seq:
+ *    reject {|element| ... } -> new_array
+ *    reject -> new_enumerator
+ *
+ *  With a block given, returns a new array whose elements are all those from +self+
+ *  for which the block returns +false+ or +nil+:
+ *
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a1 = a.reject {|element| element.to_s.start_with?('b') }
+ *    a1 # => [:foo, 2]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_reject(VALUE ary)
+{
+    VALUE rejected_ary;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rejected_ary = rb_ary_new();
+    ary_reject(ary, rejected_ary);
+    return rejected_ary;
+}
+
+/*
+ *  call-seq:
+ *    delete_if {|element| ... } -> self
+ *    delete_if -> new_numerator
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  removes the element if the block returns a truthy value;
+ *  returns +self+:
+ *
+ *    a = [:foo, 'bar', 2, 'bat']
+ *    a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_delete_if(VALUE ary)
+{
+    ary_verify(ary);
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    ary_reject_bang(ary);
+    return ary;
+}
+
+static VALUE
+take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
+{
+    VALUE *args = (VALUE *)cbarg;
+    if (argc > 1) val = rb_ary_new4(argc, argv);
+    rb_ary_push(args[0], val);
+    if (--args[1] == 0) rb_iter_break();
+    return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
+{
+    VALUE result = rb_check_array_type(obj);
+    VALUE args[2];
+
+    if (n == 0) return result;
+    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+    result = rb_ary_new2(n);
+    args[0] = result; args[1] = (VALUE)n;
+    if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
+        rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+                 rb_obj_class(obj));
+    return result;
 }
 
+
+/*
+ *  call-seq:
+ *    zip(*other_arrays) -> new_array
+ *    zip(*other_arrays) {|sub_array| ... } -> nil
+ *
+ *  With no block given, combines +self+ with the collection of +other_arrays+;
+ *  returns a new array of sub-arrays:
+ *
+ *    [0, 1].zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *
+ *  Returned:
+ *
+ *  - The outer array is of size <tt>self.size</tt>.
+ *  - Each sub-array is of size <tt>other_arrays.size + 1</tt>.
+ *  - The _nth_ sub-array contains (in order):
+ *
+ *    - The _nth_ element of +self+.
+ *    - The _nth_ element of each of the other arrays, as available.
+ *
+ *  Example:
+ *
+ *    a = [0, 1]
+ *    zipped = a.zip(['zero', 'one'], [:zero, :one])
+ *    # => [[0, "zero", :zero], [1, "one", :one]]
+ *    zipped.size       # => 2 # Same size as a.
+ *    zipped.first.size # => 3 # Size of other arrays plus 1.
+ *
+ *  When the other arrays are all the same size as +self+,
+ *  the returned sub-arrays are a rearrangement containing exactly elements of all the arrays
+ *  (including +self+), with no omissions or additions:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  When one of the other arrays is smaller than +self+,
+ *  pads the corresponding sub-array with +nil+ elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2]
+ *    c = [:c0, :c1]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, nil],
+ *     [:a3, nil, nil]]
+ *
+ *  When one of the other arrays is larger than +self+,
+ *  _ignores_ its trailing elements:
+ *
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3, :b4]
+ *    c = [:c0, :c1, :c2, :c3, :c4, :c5]
+ *    d = a.zip(b, c)
+ *    pp d
+ *    # =>
+ *    [[:a0, :b0, :c0],
+ *     [:a1, :b1, :c1],
+ *     [:a2, :b2, :c2],
+ *     [:a3, :b3, :c3]]
+ *
+ *  With a block given, calls the block with each of the other arrays;
+ *  returns +nil+:
+ *
+ *    d = []
+ *    a = [:a0, :a1, :a2, :a3]
+ *    b = [:b0, :b1, :b2, :b3]
+ *    c = [:c0, :c1, :c2, :c3]
+ *    a.zip(b, c) {|sub_array| d.push(sub_array.reverse) } # => nil
+ *    pp d
+ *    # =>
+ *    [[:c0, :b0, :a0],
+ *     [:c1, :b1, :a1],
+ *     [:c2, :b2, :a2],
+ *     [:c3, :b3, :a3]]
+ *
+ *  For an *object* in *other_arrays* that is not actually an array,
+ *  forms the "other array" as <tt>object.to_ary</tt>, if defined,
+ *  or as <tt>object.each.to_a</tt> otherwise.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
 static VALUE
-Fary_fill(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE item, arg1, arg2;
-    int beg, len, end;
-    VALUE *p, *pend;
+    int i, j;
+    long len = RARRAY_LEN(ary);
+    VALUE result = Qnil;
 
-    rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
-    if (arg2 == Qnil && obj_is_kind_of(arg1, C_Range)) {
-	range_beg_end(arg1, &beg, &len, ary->len);
+    for (i=0; i<argc; i++) {
+        argv[i] = take_items(argv[i], len);
+    }
+
+    if (rb_block_given_p()) {
+        int arity = rb_block_arity();
+
+        if (arity > 1) {
+            VALUE work, *tmp;
+
+            tmp = ALLOCV_N(VALUE, work, argc+1);
+
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                tmp[0] = RARRAY_AREF(ary, i);
+                for (j=0; j<argc; j++) {
+                    tmp[j+1] = rb_ary_elt(argv[j], i);
+                }
+                rb_yield_values2(argc+1, tmp);
+            }
+
+            if (work) ALLOCV_END(work);
+        }
+        else {
+            for (i=0; i<RARRAY_LEN(ary); i++) {
+                VALUE tmp = rb_ary_new2(argc+1);
+
+                rb_ary_push(tmp, RARRAY_AREF(ary, i));
+                for (j=0; j<argc; j++) {
+                    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+                }
+                rb_yield(tmp);
+            }
+        }
     }
     else {
-	beg = NUM2INT(arg1);
-	if (beg < 0) {
-	    beg = ary->len + beg;
-	    if (beg < 0) beg = 0;
-	}
-	if (arg2) {
-	    len = NUM2INT(arg2);
-	}
-	else {
-	    len = ary->len - beg;
-	}
+        result = rb_ary_new_capa(len);
+
+        for (i=0; i<len; i++) {
+            VALUE tmp = rb_ary_new_capa(argc+1);
+
+            rb_ary_push(tmp, RARRAY_AREF(ary, i));
+            for (j=0; j<argc; j++) {
+                rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+            }
+            rb_ary_push(result, tmp);
+        }
     }
-    end = beg + len;
-    if (end > ary->len) {
-	if (end >= ary->capa) {
-	    ary->capa=end;
-	    REALLOC_N(ary->ptr, VALUE, ary->capa);
-	}
-	if (beg > ary->len) {
-	    MEMZERO(ary->ptr+ary->len, VALUE, end-ary->len);
-	}
-	ary->len = end;
+
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    transpose -> new_array
+ *
+ *  Returns a new array that is +self+
+ *  as a {transposed matrix}[https://en.wikipedia.org/wiki/Transpose]:
+ *
+ *    a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
+ *    a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
+ *
+ *  The elements of +self+ must all be the same size.
+ *
+ *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
+static VALUE
+rb_ary_transpose(VALUE ary)
+{
+    long elen = -1, alen, i, j;
+    VALUE tmp, result = 0;
+
+    alen = RARRAY_LEN(ary);
+    if (alen == 0) return rb_ary_dup(ary);
+    for (i=0; i<alen; i++) {
+        tmp = to_ary(rb_ary_elt(ary, i));
+        if (elen < 0) {		/* first element */
+            elen = RARRAY_LEN(tmp);
+            result = rb_ary_new2(elen);
+            for (j=0; j<elen; j++) {
+                rb_ary_store(result, j, rb_ary_new2(alen));
+            }
+        }
+        else if (elen != RARRAY_LEN(tmp)) {
+            rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+                     RARRAY_LEN(tmp), elen);
+        }
+        for (j=0; j<elen; j++) {
+            rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+        }
     }
-    p = ary->ptr + beg; pend = p + len;
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    initialize_copy(other_array) -> self
+ *    replace(other_array) -> self
+ *
+ *  Replaces the elements of +self+ with the elements of +other_array+, which must be an
+ *  {array-convertible object}[rdoc-ref:implicit_conversion.rdoc@Array-Convertible+Objects];
+ *  returns +self+:
+ *
+ *    a = ['a', 'b', 'c']   # => ["a", "b", "c"]
+ *    a.replace(['d', 'e']) # => ["d", "e"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
 
-    while (p < pend) {
-	*p++ = item;
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
+{
+    rb_ary_modify_check(copy);
+    orig = to_ary(orig);
+    if (copy == orig) return copy;
+
+    rb_ary_reset(copy);
+
+    /* orig has enough space to embed the contents of orig. */
+    if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
+        RUBY_ASSERT(ARY_EMBED_P(copy));
+        ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
     }
-    return (VALUE)ary;
+    /* orig is embedded but copy does not have enough space to embed the
+     * contents of orig. */
+    else if (ARY_EMBED_P(orig)) {
+        long len = ARY_EMBED_LEN(orig);
+        VALUE *ptr = ary_heap_alloc_buffer(len);
+
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, ptr);
+        ARY_SET_LEN(copy, len);
+        ARY_SET_CAPA(copy, len);
+
+        // No allocation and exception expected that could leave `copy` in a
+        // bad state from the edits above.
+        ary_memcpy(copy, 0, len, RARRAY_CONST_PTR(orig));
+    }
+    /* Otherwise, orig is on heap and copy does not have enough space to embed
+     * the contents of orig. */
+    else {
+        VALUE shared_root = ary_make_shared(orig);
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+        ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+        rb_ary_set_shared(copy, shared_root);
+
+        RUBY_ASSERT(RB_OBJ_SHAREABLE_P(copy) ? RB_OBJ_SHAREABLE_P(shared_root) : 1);
+    }
+    ary_verify(copy);
+    return copy;
 }
 
+/*
+ *  call-seq:
+ *    clear -> self
+ *
+ *  Removes all elements from +self+; returns +self+:
+ *
+ *    a = [:foo, 'bar', 2]
+ *    a.clear # => []
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+VALUE
+rb_ary_clear(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
+        ARY_SET_EMBED_LEN(ary, 0);
+    }
+    else {
+        ARY_SET_LEN(ary, 0);
+        if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+            ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+        }
+    }
+    ary_verify(ary);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    fill(object, start = nil, count = nil) -> self
+ *    fill(object, range) -> self
+ *    fill(start = nil, count = nil) {|element| ... } -> self
+ *    fill(range) {|element| ... } -> self
+ *
+ *  Replaces selected elements in +self+;
+ *  may add elements to +self+;
+ *  always returns +self+ (never a new array).
+ *
+ *  In brief:
+ *
+ *    # Non-negative start.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1, 2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *    # Extends with specified values if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 3, 2)          # => ["a", "b", "c", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
+ *
+ *    # Fills with nils if necessary.
+ *    ['a', 'b', 'c', 'd'].fill('-', 6, 2)          # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
+ *
+ *    # For negative start, counts backwards from the end.
+ *    ['a', 'b', 'c', 'd'].fill('-', -3, 3)          # => ["a", "-", "-", "-"]
+ *    ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    # Range.
+ *    ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *    ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  When arguments +start+ and +count+ are given,
+ *  they select the elements of +self+ to be replaced;
+ *  each must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  (or +nil+):
+ *
+ *  - +start+ specifies the zero-based offset of the first element to be replaced;
+ *    +nil+ means zero.
+ *  - +count+ is the number of consecutive elements to be replaced;
+ *    +nil+ means "all the rest."
+ *
+ *  With argument +object+ given,
+ *  that one object is used for all replacements:
+ *
+ *    o = Object.new           # => #<Object:0x0000014e7bff7600>
+ *    a = ['a', 'b', 'c', 'd'] # => ["a", "b", "c", "d"]
+ *    a.fill(o, 1, 2)
+ *    # => ["a", #<Object:0x0000014e7bff7600>, #<Object:0x0000014e7bff7600>, "d"]
+ *
+ *  With a block given, the block is called once for each element to be replaced;
+ *  the value passed to the block is the _index_ of the element to be replaced
+ *  (not the element itself);
+ *  the block's return value replaces the element:
+ *
+ *    a = ['a', 'b', 'c', 'd']               # => ["a", "b", "c", "d"]
+ *    a.fill(1, 2) {|element| element.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  For arguments +start+ and +count+:
+ *
+ *  - If +start+ is non-negative,
+ *    replaces +count+ elements beginning at offset +start+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 0, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1, 2) # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 2) # => ["a", "b", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(0, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, 2) {|e| e.to_s } # => ["a", "b", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 3, 2) # => ["a", "b", "c", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 4, 2) # => ["a", "b", "c", "d", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(4, 2) {|e| e.to_s } # => ["a", "b", "c", "d", "4", "5"]
+ *
+ *    Fills with +nil+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 5, 2) # => ["a", "b", "c", "d", nil, "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, 2) # => ["a", "b", "c", "d", nil, nil, "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(5, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, "5", "6"]
+ *      ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, 0)    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 2, -100) # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 6, -100) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(2, 0) {|e| fail 'Cannot happen' }    # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(6, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  - If +start+ is negative, counts backwards from the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -4, 3) # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3, 3) # => ["a", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-4, 3) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *    Extends +self+ if necessary:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 3) # => ["a", "b", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -1, 3) # => ["a", "b", "c", "-", "-", "-"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 3) {|e| e.to_s } # => ["a", "b", "2", "3", "4"]
+ *      ['a', 'b', 'c', 'd'].fill(-1, 3) {|e| e.to_s } # => ["a", "b", "c", "3", "4", "5"]
+ *
+ *    Starts at the beginning of +self+ if +start+ is negative and out-of-range:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -5, 2) # => ["-", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -6, 2) # => ["-", "-", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-5, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-6, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
+ *
+ *    Does nothing if +count+ is non-positive:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, 0)  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -2, -1) # => ["a", "b", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-2, 0) {|e| fail 'Cannot happen' }  # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-2, -1) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
+ *
+ *  When argument +range+ is given,
+ *  it must be a Range object whose members are numeric;
+ *  its +begin+ and +end+ values determine the elements of +self+
+ *  to be replaced:
+ *
+ *  - If both +begin+ and +end+ are positive, they specify the first and last elements
+ *    to be replaced:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *    If +end+ is smaller than +begin+, replaces no elements:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 2..1)          # => ["a", "b", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(2..1) {|e| e.to_s } # => ["a", "b", "c", "d"]
+ *
+ *  - If either is negative (or both are negative), counts backwards from the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..-2)  # => ["a", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', -3..-2) # => ["a", "-", "-", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(-3..2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1..-2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(-3..-2) {|e| e.to_s } # => ["a", "1", "2", "d"]
+ *
+ *  - If the +end+ value is excluded (see Range#exclude_end?), omits the last replacement:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...2)  # => ["a", "-", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill('-', 1...-2) # => ["a", "-", "c", "d"]
+ *
+ *      ['a', 'b', 'c', 'd'].fill(1...2) {|e| e.to_s }  # => ["a", "1", "c", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(1...-2) {|e| e.to_s } # => ["a", "1", "c", "d"]
+ *
+ *  - If the range is endless (see {Endless Ranges}[rdoc-ref:Range@Endless+Ranges]),
+ *    replaces elements to the end of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', 1..)          # => ["a", "-", "-", "-"]
+ *      ['a', 'b', 'c', 'd'].fill(1..) {|e| e.to_s } # => ["a", "1", "2", "3"]
+ *
+ *  - If the range is beginless (see {Beginless Ranges}[rdoc-ref:Range@Beginless+Ranges]),
+ *    replaces elements from the beginning of +self+:
+ *
+ *      ['a', 'b', 'c', 'd'].fill('-', ..2)          # => ["-", "-", "-", "d"]
+ *      ['a', 'b', 'c', 'd'].fill(..2) {|e| e.to_s } # => ["0", "1", "2", "d"]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
 static VALUE
-Fary_plus(x, y)
-    struct RArray *x, *y;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
-    struct RArray *z;
+    VALUE item = Qundef, arg1, arg2;
+    long beg = 0, end = 0, len = 0;
 
-    switch (TYPE(y)) {
-      case T_ARRAY:
-	z = (struct RArray*)ary_new2(x->len + y->len);
-	MEMCPY(z->ptr, x->ptr, VALUE, x->len);
-	MEMCPY(z->ptr+x->len, y->ptr, VALUE, y->len);
-	z->len = x->len + RARRAY(y)->len;
-	break;
+    if (rb_block_given_p()) {
+        rb_scan_args(argc, argv, "02", &arg1, &arg2);
+        argc += 1;		/* hackish */
+    }
+    else {
+        rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+    }
+    switch (argc) {
+      case 1:
+        beg = 0;
+        len = RARRAY_LEN(ary);
+        break;
+      case 2:
+        if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+            break;
+        }
+        /* fall through */
+      case 3:
+        beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+        if (beg < 0) {
+            beg = RARRAY_LEN(ary) + beg;
+            if (beg < 0) beg = 0;
+        }
+        len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+        break;
+    }
+    rb_ary_modify(ary);
+    if (len < 0) {
+        return ary;
+    }
+    if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+        rb_raise(rb_eArgError, "argument too big");
+    }
+    end = beg + len;
+    if (RARRAY_LEN(ary) < end) {
+        if (end >= ARY_CAPA(ary)) {
+            ary_resize_capa(ary, end);
+        }
+        ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+        ARY_SET_LEN(ary, end);
+    }
 
-      default:
-	z = (struct RArray*)ary_clone(x);
-	ary_push(z, y);
-	break;
+    if (UNDEF_P(item)) {
+        VALUE v;
+        long i;
+
+        for (i=beg; i<end; i++) {
+            v = rb_yield(LONG2NUM(i));
+            if (i>=RARRAY_LEN(ary)) break;
+            ARY_SET(ary, i, v);
+        }
+    }
+    else {
+        ary_memfill(ary, beg, len, item);
     }
-    return (VALUE)z;
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    self + other_array -> new_array
+ *
+ *  Returns a new array containing all elements of +self+
+ *  followed by all elements of +other_array+:
+ *
+ *    a = [0, 1] + [2, 3]
+ *    a # => [0, 1, 2, 3]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+VALUE
+rb_ary_plus(VALUE x, VALUE y)
+{
+    VALUE z;
+    long len, xlen, ylen;
+
+    y = to_ary(y);
+    xlen = RARRAY_LEN(x);
+    ylen = RARRAY_LEN(y);
+    len = xlen + ylen;
+    z = rb_ary_new2(len);
+
+    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
+    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+    ARY_SET_LEN(z, len);
+    return z;
 }
 
 static VALUE
-Fary_times(ary, times)
-    struct RArray *ary;
-    VALUE times;
+ary_append(VALUE x, VALUE y)
 {
-    struct RArray *ary2;
-    int i, len;
+    long n = RARRAY_LEN(y);
+    if (n > 0) {
+        rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
+    }
+    RB_GC_GUARD(y);
+    return x;
+}
+
+/*
+ *  call-seq:
+ *    concat(*other_arrays) -> self
+ *
+ *  Adds to +self+ all elements from each array in +other_arrays+; returns +self+:
+ *
+ *    a = [0, 1]
+ *    a.concat(['two', 'three'], [:four, :five], a)
+ *    # => [0, 1, "two", "three", :four, :five, 0, 1]
+ *
+ *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
 
-    len = NUM2INT(times) * ary->len;
-    ary2 = (struct RArray*)ary_new2(len);
-    ary2->len = len;
+static VALUE
+rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
+{
+    rb_ary_modify_check(ary);
 
-    for (i=0; i<len; i+=ary->len) {
-	MEMCPY(ary2->ptr+i, ary->ptr, VALUE, ary->len);
+    if (argc == 1) {
+        rb_ary_concat(ary, argv[0]);
+    }
+    else if (argc > 1) {
+        int i;
+        VALUE args = rb_ary_hidden_new(argc);
+        for (i = 0; i < argc; i++) {
+            rb_ary_concat(args, argv[i]);
+        }
+        ary_append(ary, args);
     }
 
-    return (VALUE)ary2;
+    ary_verify(ary);
+    return ary;
 }
 
 VALUE
-Fary_assoc(ary, key)
-    struct RArray *ary;
-    VALUE key;
+rb_ary_concat(VALUE x, VALUE y)
 {
-    VALUE *p, *pend;
+    return ary_append(x, to_ary(y));
+}
+
+/*
+ *  call-seq:
+ *    self * n -> new_array
+ *    self * string_separator -> new_string
+ *
+ *  When non-negative integer argument +n+ is given,
+ *  returns a new array built by concatenating +n+ copies of +self+:
+ *
+ *    a = ['x', 'y']
+ *    a * 3 # => ["x", "y", "x", "y", "x", "y"]
+ *
+ *  When string argument +string_separator+ is given,
+ *  equivalent to <tt>self.join(string_separator)</tt>:
+ *
+ *    [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {foo: 0}"
+ *
+ */
 
-    p = ary->ptr; pend = p + ary->len;
-    while (p < pend) {
-	if (TYPE(*p) == T_CONS
-	    && rb_equal(RCONS(*p)->car, key))
-	    return *p;
+static VALUE
+rb_ary_times(VALUE ary, VALUE times)
+{
+    VALUE ary2, tmp;
+    const VALUE *ptr;
+    long t, len;
+
+    tmp = rb_check_string_type(times);
+    if (!NIL_P(tmp)) {
+        return rb_ary_join(ary, tmp);
     }
-    return Qnil;
+
+    len = NUM2LONG(times);
+    if (len == 0) {
+        ary2 = ary_new(rb_cArray, 0);
+        goto out;
+    }
+    if (len < 0) {
+        rb_raise(rb_eArgError, "negative argument");
+    }
+    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+        rb_raise(rb_eArgError, "argument too big");
+    }
+    len *= RARRAY_LEN(ary);
+
+    ary2 = ary_new(rb_cArray, len);
+    ARY_SET_LEN(ary2, len);
+
+    ptr = RARRAY_CONST_PTR(ary);
+    t = RARRAY_LEN(ary);
+    if (0 < t) {
+        ary_memcpy(ary2, 0, t, ptr);
+        while (t <= len/2) {
+            ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+            t *= 2;
+        }
+        if (t < len) {
+            ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+        }
+    }
+  out:
+    return ary2;
 }
 
+/*
+ *  call-seq:
+ *    assoc(object) -> found_array or nil
+ *
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[0] == object</tt>:
+ *
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.assoc(4) # => [4, 5, 6]
+ *
+ *  Returns +nil+ if no such element is found.
+ *
+ *  Related: Array#rassoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
 VALUE
-Fary_rassoc(ary, value)
-    struct RArray *ary;
-    VALUE value;
+rb_ary_assoc(VALUE ary, VALUE key)
 {
-    VALUE *p, *pend;
+    long i;
+    VALUE v;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+            rb_equal(RARRAY_AREF(v, 0), key))
+            return v;
+    }
+    return Qnil;
+}
+
+/*
+ *  call-seq:
+ *    rassoc(object) -> found_array or nil
+ *
+ *  Returns the first element +ele+ in +self+ such that +ele+ is an array
+ *  and <tt>ele[1] == object</tt>:
+ *
+ *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
+ *    a.rassoc(4) # => [2, 4]
+ *    a.rassoc(5) # => [4, 5, 6]
+ *
+ *  Returns +nil+ if no such element is found.
+ *
+ *  Related: Array#assoc;
+ *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
 
-    p = ary->ptr; pend = p + ary->len;
-    while (p < pend) {
-	if (TYPE(*p) == T_CONS
-	    && rb_equal(RCONS(*p)->cdr, value))
-	    return *p;
+VALUE
+rb_ary_rassoc(VALUE ary, VALUE value)
+{
+    long i;
+    VALUE v;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+        v = rb_check_array_type(RARRAY_AREF(ary, i));
+        if (RB_TYPE_P(v, T_ARRAY) &&
+            RARRAY_LEN(v) > 1 &&
+            rb_equal(RARRAY_AREF(v, 1), value))
+            return v;
     }
     return Qnil;
 }
 
 static VALUE
-Fary_equal(ary1, ary2)
-    struct RArray *ary1, *ary2;
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
 {
-    int i;
+    long i, len1;
+    const VALUE *p1, *p2;
+
+    if (recur) return Qtrue; /* Subtle! */
+
+    /* rb_equal() can evacuate ptrs */
+    p1 = RARRAY_CONST_PTR(ary1);
+    p2 = RARRAY_CONST_PTR(ary2);
+    len1 = RARRAY_LEN(ary1);
+
+    for (i = 0; i < len1; i++) {
+        if (*p1 != *p2) {
+            if (rb_equal(*p1, *p2)) {
+                len1 = RARRAY_LEN(ary1);
+                if (len1 != RARRAY_LEN(ary2))
+                    return Qfalse;
+                if (len1 < i)
+                    return Qtrue;
+                p1 = RARRAY_CONST_PTR(ary1) + i;
+                p2 = RARRAY_CONST_PTR(ary2) + i;
+            }
+            else {
+                return Qfalse;
+            }
+        }
+        p1++;
+        p2++;
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    self == other_array -> true or false
+ *
+ *  Returns whether both:
+ *
+ *  - +self+ and +other_array+ are the same size.
+ *  - Their corresponding elements are the same;
+ *    that is, for each index +i+ in <tt>(0...self.size)</tt>,
+ *    <tt>self[i] == other_array[i]</tt>.
+ *
+ *  Examples:
+ *
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2]   # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 2.0] # => true
+ *    [:foo, 'bar', 2] == [:foo, 'bar']      # => false # Different sizes.
+ *    [:foo, 'bar', 2] == [:foo, 'bar', 3]   # => false # Different elements.
+ *
+ *  This method is different from method Array#eql?,
+ *  which compares elements using <tt>Object#eql?</tt>.
+ *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
+ */
 
-    if (TYPE(ary2) != T_ARRAY) return FALSE;
-    if (ary1->len != ary2->len) return FALSE;
-    for (i=0; i<ary1->len; i++) {
-	if (!rb_equal(ary1->ptr[i], ary2->ptr[i]))
-	    return FALSE;
+static VALUE
+rb_ary_equal(VALUE ary1, VALUE ary2)
+{
+    if (ary1 == ary2) return Qtrue;
+    if (!RB_TYPE_P(ary2, T_ARRAY)) {
+        if (!rb_respond_to(ary2, idTo_ary)) {
+            return Qfalse;
+        }
+        return rb_equal(ary2, ary1);
     }
-    return TRUE;
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
 }
 
 static VALUE
-Fary_hash(ary)
-    struct RArray *ary;
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
 {
-    int i, h;
-    ID hash = rb_intern("hash");
+    long i;
 
-    h = 0;
-    for (i=0; i<ary->len; i++) {
-	h += rb_funcall(ary->ptr[i], hash, 0);
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+        if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+            return Qfalse;
     }
-    h += ary->len;
-    return INT2FIX(h);
+    return Qtrue;
 }
 
+/*
+ *  call-seq:
+ *    eql?(other_array) -> true or false
+ *
+ *  Returns +true+ if +self+ and +other_array+ are the same size,
+ *  and if, for each index +i+ in +self+, <tt>self[i].eql?(other_array[i])</tt>:
+ *
+ *    a0 = [:foo, 'bar', 2]
+ *    a1 = [:foo, 'bar', 2]
+ *    a1.eql?(a0) # => true
+ *
+ *  Otherwise, returns +false+.
+ *
+ *  This method is different from method Array#==,
+ *  which compares using method <tt>Object#==</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
 static VALUE
-Fary_includes(ary, item)
-    struct RArray *ary;
-    VALUE item;
+rb_ary_eql(VALUE ary1, VALUE ary2)
 {
-    int i;
-    for (i=0; i<ary->len; i++) {
-	if (rb_equal(ary->ptr[i], item)) {
-	    return TRUE;
-	}
+    if (ary1 == ary2) return Qtrue;
+    if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
+}
+
+static VALUE
+ary_hash_values(long len, const VALUE *elements, const VALUE ary)
+{
+    long i;
+    st_index_t h;
+    VALUE n;
+
+    h = rb_hash_start(len);
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash_values);
+    for (i=0; i<len; i++) {
+        n = rb_hash(elements[i]);
+        h = rb_hash_uint(h, NUM2LONG(n));
+        if (ary) {
+            len = RARRAY_LEN(ary);
+            elements = RARRAY_CONST_PTR(ary);
+        }
+    }
+    h = rb_hash_end(h);
+    return ST2FIX(h);
+}
+
+VALUE
+rb_ary_hash_values(long len, const VALUE *elements)
+{
+    return ary_hash_values(len, elements, 0);
+}
+
+/*
+ *  call-seq:
+ *    hash -> integer
+ *
+ *  Returns the integer hash value for +self+.
+ *
+ *  Two arrays with the same content will have the same hash value
+ *  (and will compare using eql?):
+ *
+ *    ['a', 'b'].hash == ['a', 'b'].hash # => true
+ *    ['a', 'b'].hash == ['a', 'c'].hash # => false
+ *    ['a', 'b'].hash == ['a'].hash      # => false
+ *
+ */
+
+static VALUE
+rb_ary_hash(VALUE ary)
+{
+    RBIMPL_ASSERT_OR_ASSUME(ary);
+    return ary_hash_values(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary), ary);
+}
+
+/*
+ *  call-seq:
+ *    include?(object) -> true or false
+ *
+ *  Returns whether for some element +element+ in +self+,
+ *  <tt>object == element</tt>:
+ *
+ *    [0, 1, 2].include?(2)   # => true
+ *    [0, 1, 2].include?(2.0) # => true
+ *    [0, 1, 2].include?(2.1) # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+VALUE
+rb_ary_includes(VALUE ary, VALUE item)
+{
+    long i;
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (rb_equal(e, item)) {
+            return Qtrue;
+        }
+    }
+    return Qfalse;
+}
+
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
+{
+    long i;
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (rb_eql(item, e)) {
+            return Qtrue;
+        }
     }
-    return FALSE;
+    return Qfalse;
 }
 
 static VALUE
-Fary_diff(ary1, ary2)
-    struct RArray *ary1, *ary2;
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
+{
+    long i, len;
+
+    if (recur) return Qundef;	/* Subtle! */
+    len = RARRAY_LEN(ary1);
+    if (len > RARRAY_LEN(ary2)) {
+        len = RARRAY_LEN(ary2);
+    }
+    for (i=0; i<len; i++) {
+        VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+        VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+        if (v != INT2FIX(0)) {
+            return v;
+        }
+    }
+    return Qundef;
+}
+
+/*
+ *  call-seq:
+ *    self <=> other_array -> -1, 0, or 1
+ *
+ *  Returns -1, 0, or 1 as +self+ is determined
+ *  to be less than, equal to, or greater than +other_array+.
+ *
+ *  Iterates over each index +i+ in <tt>(0...self.size)</tt>:
+ *
+ *  - Computes <tt>result[i]</tt> as <tt>self[i] <=> other_array[i]</tt>.
+ *  - Immediately returns 1 if <tt>result[i]</tt> is 1:
+ *
+ *      [0, 1, 2] <=> [0, 0, 2] # => 1
+ *
+ *  - Immediately returns -1 if <tt>result[i]</tt> is -1:
+ *
+ *      [0, 1, 2] <=> [0, 2, 2] # => -1
+ *
+ *  - Continues if <tt>result[i]</tt> is 0.
+ *
+ *  When every +result+ is 0,
+ *  returns <tt>self.size <=> other_array.size</tt>
+ *  (see Integer#<=>):
+ *
+ *    [0, 1, 2] <=> [0, 1]        # => 1
+ *    [0, 1, 2] <=> [0, 1, 2]     # => 0
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
+ *
+ *  Note that when +other_array+ is larger than +self+,
+ *  its trailing elements do not affect the result:
+ *
+ *    [0, 1, 2] <=> [0, 1, 2, -3] # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 0]  # => -1
+ *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
+ *
+ *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
+ */
+
+VALUE
+rb_ary_cmp(VALUE ary1, VALUE ary2)
+{
+    long len;
+    VALUE v;
+
+    ary2 = rb_check_array_type(ary2);
+    if (NIL_P(ary2)) return Qnil;
+    if (ary1 == ary2) return INT2FIX(0);
+    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+    if (!UNDEF_P(v)) return v;
+    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
+    if (len == 0) return INT2FIX(0);
+    if (len > 0) return INT2FIX(1);
+    return INT2FIX(-1);
+}
+
+static VALUE
+ary_add_hash(VALUE hash, VALUE ary)
+{
+    long i;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+        VALUE elt = RARRAY_AREF(ary, i);
+        rb_hash_add_new_element(hash, elt, elt);
+    }
+    return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(VALUE ary)
+{
+    long size = RARRAY_LEN(ary);
+    VALUE hash = rb_hash_new_with_size(size);
+
+    RBASIC_CLEAR_CLASS(hash);
+    return hash;
+}
+
+static VALUE
+ary_make_hash(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new(ary);
+    return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+        VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+        rb_hash_add_new_element(hash, k, v);
+    }
+    return hash;
+}
+
+static VALUE
+ary_make_hash_by(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new(ary);
+    return ary_add_hash_by(hash, ary);
+}
+
+/*
+ *  call-seq:
+ *    self - other_array -> new_array
+ *
+ *  Returns a new array containing only those elements of +self+
+ *  that are not found in +other_array+;
+ *  the order from +self+ is preserved:
+ *
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1]             # => [0, 2, 3]
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [3, 2, 0, :foo] # => [1, 1, 1, 1, 1, 1]
+ *    [0, 1, 2] - [:foo]                            # => [0, 1, 2]
+ *
+ *  Element are compared using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+VALUE
+rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
-    int i, j;
+    VALUE hash;
+    long i;
+
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
+    ary3 = rb_ary_new();
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            VALUE elt = rb_ary_elt(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, elt)) continue;
+            rb_ary_push(ary3, elt);
+        }
+        return ary3;
+    }
 
-    Check_Type(ary2, T_ARRAY);
-    ary3 = ary_new();
-    for (i=0; i<ary1->len; i++) {
-	if (Fary_includes(ary2, ary1->ptr[i])) continue;
-	if (Fary_includes(ary3, ary1->ptr[i])) continue;
-	ary_push(ary3, ary1->ptr[i]);
+    hash = ary_make_hash(ary2);
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+        if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
+        rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
+
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *    difference(*other_arrays = []) -> new_array
+ *
+ *  Returns a new array containing only those elements from +self+
+ *  that are not found in any of the given +other_arrays+;
+ *  items are compared using <tt>eql?</tt>;  order from +self+ is preserved:
+ *
+ *    [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
+ *    [0, 1, 2, 3].difference([3, 0], [1, 3])     # => [2]
+ *    [0, 1, 2].difference([4])                   # => [0, 1, 2]
+ *    [0, 1, 2].difference                        # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments are given.
+ *
+ *  Related: Array#-;
+ *  see also {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
 static VALUE
-Fary_and(ary1, ary2)
-    struct RArray *ary1, *ary2;
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE ary3;
-    int i, j;
+    VALUE ary_diff;
+    long i, length;
+    volatile VALUE t0;
+    bool *is_hash = ALLOCV_N(bool, t0, argc);
+    ary_diff = rb_ary_new();
+    length = RARRAY_LEN(ary);
+
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+        if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        int j;
+        VALUE elt = rb_ary_elt(ary, i);
+        for (j = 0; j < argc; j++) {
+            if (is_hash[j]) {
+                if (rb_hash_stlike_lookup(argv[j], elt, NULL))
+                    break;
+            }
+            else {
+                if (rb_ary_includes_by_eql(argv[j], elt)) break;
+            }
+        }
+        if (j == argc) rb_ary_push(ary_diff, elt);
+    }
 
-    Check_Type(ary2, T_ARRAY);
-    ary3 = ary_new();
-    for (i=0; i<ary1->len; i++) {
-	if (Fary_includes(ary2, ary1->ptr[i])
-	    && !Fary_includes(ary3, ary1->ptr[i])) {
-	    ary_push(ary3, ary1->ptr[i]);
-	}
+    ALLOCV_END(t0);
+
+    return ary_diff;
+}
+
+
+/*
+ *  call-seq:
+ *    self & other_array -> new_array
+ *
+ *  Returns a new array containing the _intersection_ of +self+ and +other_array+;
+ *  that is, containing those elements found in both +self+ and +other_array+:
+ *
+ *    [0, 1, 2, 3] & [1, 2] # => [1, 2]
+ *
+ *  Omits duplicates:
+ *
+ *    [0, 1, 1, 0] & [0, 1] # => [0, 1]
+ *
+ *  Preserves order from +self+:
+ *
+ *    [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
+ *
+ *  Identifies common elements using method <tt>#eql?</tt>
+ *  (as defined in each element of +self+).
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+
+static VALUE
+rb_ary_and(VALUE ary1, VALUE ary2)
+{
+    VALUE hash, ary3, v;
+    st_data_t vv;
+    long i;
+
+    ary2 = to_ary(ary2);
+    ary3 = rb_ary_new();
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (!rb_ary_includes_by_eql(ary2, v)) continue;
+            if (rb_ary_includes_by_eql(ary3, v)) continue;
+            rb_ary_push(ary3, v);
+        }
+        return ary3;
+    }
+
+    hash = ary_make_hash(ary2);
+
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+        v = RARRAY_AREF(ary1, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_delete(hash, &vv, 0)) {
+            rb_ary_push(ary3, v);
+        }
     }
+
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *    intersection(*other_arrays) -> new_array
+ *
+ *  Returns a new array containing each element in +self+ that is +#eql?+
+ *  to at least one element in each of the given +other_arrays+;
+ *  duplicates are omitted:
+ *
+ *    [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
+ *
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Order from +self+ is preserved:
+ *
+ *    [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
+ *
+ *  Returns a copy of +self+ if no arguments are given.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
 static VALUE
-Fary_or(ary1, ary2)
-    struct RArray *ary1, *ary2;
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE ary3;
+    VALUE result = rb_ary_dup(ary);
     int i;
 
-    if (TYPE(ary2) != T_ARRAY) {
-	if (Fary_includes(ary1, ary2)) return (VALUE)ary1;
-	else return Fary_plus(ary1, ary2);
+    for (i = 0; i < argc; i++) {
+        result = rb_ary_and(result, argv[i]);
     }
 
-    ary3 = ary_new();
-    for (i=0; i<ary1->len; i++) {
-	if (!Fary_includes(ary3, ary1->ptr[i]))
-		ary_push(ary3, ary1->ptr[i]);
+    return result;
+}
+
+static int
+ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
+{
+    if (existing) return ST_STOP;
+    *key = *value = (VALUE)arg;
+    return ST_CONTINUE;
+}
+
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE elt = rb_ary_elt(ary, i);
+        if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+        rb_ary_push(ary_union, elt);
     }
-    for (i=0; i<ary2->len; i++) {
-	if (!Fary_includes(ary3, ary2->ptr[i]))
-		ary_push(ary3, ary2->ptr[i]);
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+    long i;
+    for (i = 0; i < RARRAY_LEN(ary2); i++) {
+        VALUE elt = RARRAY_AREF(ary2, i);
+        if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+            RB_OBJ_WRITTEN(hash, Qundef, elt);
+        }
     }
-    return ary3;
 }
 
-extern VALUE C_Kernel;
-extern VALUE M_Enumerable;
-
-Init_Array()
-{
-    C_Array  = rb_define_class("Array", C_Object);
-    rb_include_module(C_Array, M_Enumerable);
-
-    rb_define_single_method(C_Array, "new", Sary_new, 0);
-    rb_define_single_method(C_Array, "[]", Sary_create, -1);
-    rb_define_method(C_Array, "to_s", Fary_to_s, 0);
-    rb_define_method(C_Array, "_inspect", Fary_inspect, 0);
-    rb_define_method(C_Array, "to_a", Fary_to_a, 0);
-
-    rb_define_method(C_Array, "print_on", Fary_print_on, 1);
-
-    rb_define_method(C_Array, "==", Fary_equal, 1);
-    rb_define_method(C_Array, "hash", Fary_hash, 0);
-    rb_define_method(C_Array, "[]", Fary_aref, -1);
-    rb_define_method(C_Array, "[]=", Fary_aset, -1);
-    rb_define_method(C_Array, "<<", Fary_append, 1);
-    rb_define_method(C_Array, "push", ary_push, 1);
-    rb_define_method(C_Array, "pop", ary_pop, 0);
-    rb_define_method(C_Array, "shift", ary_shift, 0);
-    rb_define_method(C_Array, "unshift", ary_unshift, 1);
-    rb_define_method(C_Array, "each", Fary_each, 0);
-    rb_define_method(C_Array, "each_index", Fary_each_index, 0);
-    rb_define_method(C_Array, "length", Fary_length, 0);
-    rb_define_alias(C_Array,  "size", "length");
-    rb_define_method(C_Array, "index", Fary_index, 1);
-    rb_define_method(C_Array, "indexes", Fary_indexes, -2);
-    rb_define_method(C_Array, "clone", ary_clone, 0);
-    rb_define_method(C_Array, "join", Fary_join, -1);
-    rb_define_method(C_Array, "reverse", Fary_reverse, 0);
-    rb_define_method(C_Array, "sort", Fary_sort, 0);
-    rb_define_method(C_Array, "delete", Fary_delete, 1);
-    rb_define_method(C_Array, "delete_if", Fary_delete_if, 0);
-    rb_define_method(C_Array, "clear", Fary_clear, 0);
-    rb_define_method(C_Array, "fill", Fary_fill, -1);
-    rb_define_method(C_Array, "includes", Fary_includes, 1);
-
-    rb_define_method(C_Array, "assoc", Fary_assoc, 1);
-    rb_define_method(C_Array, "rassoc", Fary_rassoc, 1);
-
-    rb_define_method(C_Array, "+", Fary_plus, 1);
-    rb_define_method(C_Array, "*", Fary_times, 1);
-
-    rb_define_method(C_Array, "-", Fary_diff, 1);
-    rb_define_method(C_Array, "&", Fary_and, 1);
-    rb_define_method(C_Array, "|", Fary_or, 1);
+/*
+ *  call-seq:
+ *    self | other_array -> new_array
+ *
+ *  Returns the union of +self+ and +other_array+;
+ *  duplicates are removed; order is preserved;
+ *  items are compared using <tt>eql?</tt>:
+ *
+ *    [0, 1] | [2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
+ *    [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_or(VALUE ary1, VALUE ary2)
+{
+    VALUE hash;
+
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        VALUE ary3 = rb_ary_new();
+        rb_ary_union(ary3, ary1);
+        rb_ary_union(ary3, ary2);
+        return ary3;
+    }
+
+    hash = ary_make_hash(ary1);
+    rb_ary_union_hash(hash, ary2);
+
+    return rb_hash_values(hash);
+}
+
+/*
+ *  call-seq:
+ *    union(*other_arrays) -> new_array
+ *
+ *  Returns a new array that is the union of the elements of +self+
+ *  and all given arrays +other_arrays+;
+ *  items are compared using <tt>eql?</tt>:
+ *
+ *    [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ *
+ *  Removes duplicates (preserving the first found):
+ *
+ *    [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ *
+ *  Preserves order (preserving the position of the first found):
+ *
+ *    [3, 2, 1, 0].union([5, 3], [4, 2]) # => [3, 2, 1, 0, 5, 4]
+ *
+ *  With no arguments given, returns a copy of +self+.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+    int i;
+    long sum;
+    VALUE hash;
+
+    sum = RARRAY_LEN(ary);
+    for (i = 0; i < argc; i++) {
+        argv[i] = to_ary(argv[i]);
+        sum += RARRAY_LEN(argv[i]);
+    }
+
+    if (sum <= SMALL_ARRAY_LEN) {
+        VALUE ary_union = rb_ary_new();
+
+        rb_ary_union(ary_union, ary);
+        for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+        return ary_union;
+    }
+
+    hash = ary_make_hash(ary);
+    for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+    return rb_hash_values(hash);
+}
+
+/*
+ *  call-seq:
+ *    intersect?(other_array) -> true or false
+ *
+ *  Returns whether +other_array+ has at least one element that is +#eql?+ to some element of +self+:
+ *
+ *    [1, 2, 3].intersect?([3, 4, 5]) # => true
+ *    [1, 2, 3].intersect?([4, 5, 6]) # => false
+ *
+ *  Each element must correctly implement method <tt>#hash</tt>.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_intersect_p(VALUE ary1, VALUE ary2)
+{
+    VALUE hash, v, result, shorter, longer;
+    st_data_t vv;
+    long i;
+
+    ary2 = to_ary(ary2);
+    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
+
+    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+        for (i=0; i<RARRAY_LEN(ary1); i++) {
+            v = RARRAY_AREF(ary1, i);
+            if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
+        }
+        return Qfalse;
+    }
+
+    shorter = ary1;
+    longer = ary2;
+    if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
+        longer = ary1;
+        shorter = ary2;
+    }
+
+    hash = ary_make_hash(shorter);
+    result = Qfalse;
+
+    for (i=0; i<RARRAY_LEN(longer); i++) {
+        v = RARRAY_AREF(longer, i);
+        vv = (st_data_t)v;
+        if (rb_hash_stlike_lookup(hash, vv, 0)) {
+            result = Qtrue;
+            break;
+        }
+    }
+
+    return result;
 }
+
+static VALUE
+ary_max_generic(VALUE ary, long i, VALUE vmax)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
+            vmax = v;
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(v)) {
+            if ((long)vmax < (long)v) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_float(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(v)) {
+            if (rb_float_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+static VALUE
+ary_max_opt_string(VALUE ary, long i, VALUE vmax)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmax));
+
+    VALUE v;
+    for (; i < n; ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (STRING_P(v)) {
+            if (rb_str_cmp(vmax, v) < 0) {
+                vmax = v;
+            }
+        }
+        else {
+            return ary_max_generic(ary, i, vmax);
+        }
+    }
+
+    return vmax;
+}
+
+/*
+ *  call-seq:
+ *    max -> element
+ *    max(count) -> new_array
+ *    max {|a, b| ... } -> element
+ *    max(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The maximum-valued element from +self+.
+ *  - A new array of maximum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
+ *
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the maximum value per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].max # => 3
+ *
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].max(3)   # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(3.0) # => [3, 2, 1]
+ *    [1, 0, 3, 2].max(9)   # => [3, 2, 1, 0]
+ *    [1, 0, 3, 2].max(0)   # => []
+ *
+ *  With a block given, the block must return a numeric.
+ *
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the maximum value per the block:
+ *
+ *    ['0', '', '000', '00'].max {|a, b| a.size <=> b.size }
+ *    # => "000"
+ *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in descending order, per the block:
+ *
+ *    ['0', '', '000', '00'].max(2) {|a, b| a.size <=> b.size }
+ *    # => ["000", "00"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_max(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 1, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_max_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_max_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_max_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_max_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
+
+static VALUE
+ary_min_generic(VALUE ary, long i, VALUE vmin)
+{
+    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
+
+    VALUE v;
+    for (; i < RARRAY_LEN(ary); ++i) {
+        v = RARRAY_AREF(ary, i);
+
+        if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
+            vmin = v;
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(FIXNUM_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (FIXNUM_P(a)) {
+            if ((long)vmin > (long)a) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_float(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (RB_FLOAT_TYPE_P(a)) {
+            if (rb_float_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+static VALUE
+ary_min_opt_string(VALUE ary, long i, VALUE vmin)
+{
+    const long n = RARRAY_LEN(ary);
+    RUBY_ASSERT(i > 0 && i < n);
+    RUBY_ASSERT(STRING_P(vmin));
+
+    VALUE a;
+    for (; i < n; ++i) {
+        a = RARRAY_AREF(ary, i);
+
+        if (STRING_P(a)) {
+            if (rb_str_cmp(vmin, a) > 0) {
+                vmin = a;
+            }
+        }
+        else {
+            return ary_min_generic(ary, i, vmin);
+        }
+    }
+
+    return vmin;
+}
+
+/*
+ *  call-seq:
+ *    min -> element
+ *    min(count) -> new_array
+ *    min {|a, b| ... } -> element
+ *    min(count) {|a, b| ... } -> new_array
+ *
+ *  Returns one of the following:
+ *
+ *  - The minimum-valued element from +self+.
+ *  - A new array of minimum-valued elements from +self+.
+ *
+ *  Does not modify +self+.
+ *
+ *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
+ *  with a numeric.
+ *
+ *  With no argument and no block, returns the element in +self+
+ *  having the minimum value per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].min # => 0
+ *
+ *  With non-negative numeric argument +count+ and no block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].min(3)   # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(3.0) # => [0, 1, 2]
+ *    [1, 0, 3, 2].min(9)   # => [0, 1, 2, 3]
+ *    [1, 0, 3, 2].min(0)   # => []
+ *
+ *  With a block given, the block must return a numeric.
+ *
+ *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
+ *  returns the element having the minimum value per the block:
+ *
+ *    ['0', '', '000', '00'].min {|a, b| a.size <=> b.size }
+ *    # => ""
+ *
+ *  With non-negative numeric argument +count+ and a block,
+ *  returns a new array with at most +count+ elements,
+ *  in ascending order, per the block:
+ *
+ *    ['0', '', '000', '00'].min(2) {|a, b| a.size <=> b.size }
+ *    # => ["", "0"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_min(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result = Qundef, v;
+    VALUE num;
+    long i;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+       return rb_nmin_run(ary, num, 0, 0, 1);
+
+    const long n = RARRAY_LEN(ary);
+    if (rb_block_given_p()) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+           v = RARRAY_AREF(ary, i);
+           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+               result = v;
+           }
+        }
+    }
+    else if (n > 0) {
+        result = RARRAY_AREF(ary, 0);
+        if (n > 1) {
+            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
+                return ary_min_opt_fixnum(ary, 1, result);
+            }
+            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
+                return ary_min_opt_string(ary, 1, result);
+            }
+            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
+                return ary_min_opt_float(ary, 1, result);
+            }
+            else {
+                return ary_min_generic(ary, 1, result);
+            }
+        }
+    }
+    if (UNDEF_P(result)) return Qnil;
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    minmax -> array
+ *    minmax {|a, b| ... } -> array
+ *
+ *  Returns a 2-element array containing the minimum-valued and maximum-valued
+ *  elements from +self+;
+ *  does not modify +self+.
+ *
+ *  With no block given, the minimum and maximum values are determined using method <tt>#<=></tt>:
+ *
+ *    [1, 0, 3, 2].minmax # => [0, 3]
+ *
+ *  With a block given, the block must return a numeric;
+ *  the block is called <tt>self.size - 1</tt> times to compare elements;
+ *  returns the elements having the minimum and maximum values per the block:
+ *
+ *    ['0', '', '000', '00'].minmax {|a, b| a.size <=> b.size }
+ *    # => ["", "000"]
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+    if (rb_block_given_p()) {
+        return rb_call_super(0, NULL);
+    }
+    return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+    rb_ary_push((VALUE)ary, (VALUE)val);
+    return ST_CONTINUE;
+}
+
+/*
+ *  call-seq:
+ *    uniq! -> self or nil
+ *    uniq! {|element| ... } -> self or nil
+ *
+ *  Removes duplicate elements from +self+, the first occurrence always being retained;
+ *  returns +self+ if any elements removed, +nil+ otherwise.
+ *
+ *  With no block given, identifies and removes elements using method <tt>eql?</tt>
+ *  to compare elements:
+ *
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq! # => [0, 1, 2]
+ *    a.uniq! # => nil
+ *
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
+ *
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq! {|element| element.size } # => ["a", "aa", "aaa"]
+ *    a.uniq! {|element| element.size } # => nil
+ *
+ *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+static VALUE
+rb_ary_uniq_bang(VALUE ary)
+{
+    VALUE hash;
+    long hash_size;
+
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) <= 1)
+        return Qnil;
+    if (rb_block_given_p())
+        hash = ary_make_hash_by(ary);
+    else
+        hash = ary_make_hash(ary);
+
+    hash_size = RHASH_SIZE(hash);
+    if (RARRAY_LEN(ary) == hash_size) {
+        return Qnil;
+    }
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary)) {
+        rb_ary_unshare(ary);
+        FL_SET_EMBED(ary);
+    }
+    ary_resize_capa(ary, hash_size);
+    rb_hash_foreach(hash, push_value, ary);
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    uniq -> new_array
+ *    uniq {|element| ... } -> new_array
+ *
+ *  Returns a new array containing those elements from +self+ that are not duplicates,
+ *  the first occurrence always being retained.
+ *
+ *  With no block given, identifies and omits duplicate elements using method <tt>eql?</tt>
+ *  to compare elements:
+ *
+ *    a = [0, 0, 1, 1, 2, 2]
+ *    a.uniq # => [0, 1, 2]
+ *
+ *  With a block given, calls the block for each element;
+ *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
+ *  to compare <i>block return values</i>;
+ *  that is, an element is a duplicate if its block return value
+ *  is the same as that of a previous element:
+ *
+ *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
+ *    a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
+ *
+ *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_uniq(VALUE ary)
+{
+    VALUE hash, uniq;
+
+    if (RARRAY_LEN(ary) <= 1) {
+        hash = 0;
+        uniq = rb_ary_dup(ary);
+    }
+    else if (rb_block_given_p()) {
+        hash = ary_make_hash_by(ary);
+        uniq = rb_hash_values(hash);
+    }
+    else {
+        hash = ary_make_hash(ary);
+        uniq = rb_hash_values(hash);
+    }
+
+    return uniq;
+}
+
+/*
+ *  call-seq:
+ *    compact! -> self or nil
+ *
+ *  Removes all +nil+ elements from +self+;
+ *  Returns +self+ if any elements are removed, +nil+ otherwise:
+ *
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact! # => [0, false, "", [], {}]
+ *    a          # => [0, false, "", [], {}]
+ *    a.compact! # => nil
+ *
+ *  Related: Array#compact;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_compact_bang(VALUE ary)
+{
+    VALUE *p, *t, *end;
+    long n;
+
+    rb_ary_modify(ary);
+    p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+    end = p + RARRAY_LEN(ary);
+
+    while (t < end) {
+        if (NIL_P(*t)) t++;
+        else *p++ = *t++;
+    }
+    n = p - RARRAY_CONST_PTR(ary);
+    if (RARRAY_LEN(ary) == n) {
+        return Qnil;
+    }
+    ary_resize_smaller(ary, n);
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    compact -> new_array
+ *
+ *  Returns a new array containing only the non-+nil+ elements from +self+;
+ *  element order is preserved:
+ *
+ *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
+ *    a.compact # => [0, false, "", [], {}]
+ *
+ *  Related: Array#compact!;
+ *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ */
+
+static VALUE
+rb_ary_compact(VALUE ary)
+{
+    ary = rb_ary_dup(ary);
+    rb_ary_compact_bang(ary);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    count -> integer
+ *    count(object) -> integer
+ *    count {|element| ... } -> integer
+ *
+ *  Returns a count of specified elements.
+ *
+ *  With no argument and no block, returns the count of all elements:
+ *
+ *    [0, :one, 'two', 3, 3.0].count # => 5
+ *
+ *  With argument +object+ given, returns the count of elements <tt>==</tt> to +object+:
+ *
+ *    [0, :one, 'two', 3, 3.0].count(3) # => 2
+ *
+ *  With no argument and a block given, calls the block with each element;
+ *  returns the count of elements for which the block returns a truthy value:
+ *
+ *    [0, 1, 2, 3].count {|element| element > 1 } # => 2
+ *
+ *  With argument +object+ and a block given, issues a warning, ignores the block,
+ *  and returns the count of elements <tt>==</tt> to +object+.
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
+{
+    long i, n = 0;
+
+    if (rb_check_arity(argc, 0, 1) == 0) {
+        VALUE v;
+
+        if (!rb_block_given_p())
+            return LONG2NUM(RARRAY_LEN(ary));
+
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            v = RARRAY_AREF(ary, i);
+            if (RTEST(rb_yield(v))) n++;
+        }
+    }
+    else {
+        VALUE obj = argv[0];
+
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+        }
+    }
+
+    return LONG2NUM(n);
+}
+
+static VALUE
+flatten(VALUE ary, int level)
+{
+    long i;
+    VALUE stack, result, tmp = 0, elt;
+    VALUE memo = Qfalse;
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        elt = RARRAY_AREF(ary, i);
+        tmp = rb_check_array_type(elt);
+        if (!NIL_P(tmp)) {
+            break;
+        }
+    }
+    if (i == RARRAY_LEN(ary)) {
+        return ary;
+    }
+
+    result = ary_new(0, RARRAY_LEN(ary));
+    ary_memcpy(result, 0, i, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(result, i);
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    rb_ary_push(stack, ary);
+    rb_ary_push(stack, LONG2NUM(i + 1));
+
+    if (level < 0) {
+        memo = rb_obj_hide(rb_ident_hash_new());
+        rb_hash_aset(memo, ary, Qtrue);
+        rb_hash_aset(memo, tmp, Qtrue);
+    }
+
+    ary = tmp;
+    i = 0;
+
+    while (1) {
+        while (i < RARRAY_LEN(ary)) {
+            elt = RARRAY_AREF(ary, i++);
+            if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+                rb_ary_push(result, elt);
+                continue;
+            }
+            tmp = rb_check_array_type(elt);
+            if (RBASIC(result)->klass) {
+                if (RTEST(memo)) {
+                    rb_hash_clear(memo);
+                }
+                rb_raise(rb_eRuntimeError, "flatten reentered");
+            }
+            if (NIL_P(tmp)) {
+                rb_ary_push(result, elt);
+            }
+            else {
+                if (memo) {
+                    if (rb_hash_aref(memo, tmp) == Qtrue) {
+                        rb_hash_clear(memo);
+                        rb_raise(rb_eArgError, "tried to flatten recursive array");
+                    }
+                    rb_hash_aset(memo, tmp, Qtrue);
+                }
+                rb_ary_push(stack, ary);
+                rb_ary_push(stack, LONG2NUM(i));
+                ary = tmp;
+                i = 0;
+            }
+        }
+        if (RARRAY_LEN(stack) == 0) {
+            break;
+        }
+        if (memo) {
+            rb_hash_delete(memo, ary);
+        }
+        tmp = rb_ary_pop(stack);
+        i = NUM2LONG(tmp);
+        ary = rb_ary_pop(stack);
+    }
+
+    if (memo) {
+        rb_hash_clear(memo);
+    }
+
+    RBASIC_SET_CLASS(result, rb_cArray);
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    flatten!(depth = nil) -> self or nil
+ *
+ *  Returns +self+ as a recursively flattening of +self+ to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
+ *  At each level of recursion:
+ *
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
+ *
+ *  Returns +nil+ if no elements were flattened.
+ *
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
+ *
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a                   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1)   # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *
+ *  With +nil+ or negative argument +depth+, flattens all levels:
+ *
+ *    a.dup.flatten!     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.dup.flatten!(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *
+ *  Related: Array#flatten;
+ *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ */
+
+static VALUE
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
+{
+    int mod = 0, level = -1;
+    VALUE result, lv;
+
+    lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
+    rb_ary_modify_check(ary);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return Qnil;
+
+    result = flatten(ary, level);
+    if (result == ary) {
+        return Qnil;
+    }
+    if (!(mod = ARY_EMBED_P(result))) rb_ary_freeze(result);
+    rb_ary_replace(ary, result);
+    if (mod) ARY_SET_EMBED_LEN(result, 0);
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    flatten(depth = nil) -> new_array
+ *
+ *  Returns a new array that is a recursive flattening of +self+
+ *  to +depth+ levels of recursion;
+ *  +depth+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  or +nil+.
+ *  At each level of recursion:
+ *
+ *  - Each element that is an array is "flattened"
+ *    (that is, replaced by its individual array elements).
+ *  - Each element that is not an array is unchanged
+ *    (even if the element is an object that has instance method +flatten+).
+ *
+ *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
+ *
+ *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
+ *    a              # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(0)   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(1  ) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *
+ *  With +nil+ or negative +depth+, flattens all levels.
+ *
+ *    a.flatten     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *    a.flatten(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *
+ *  Related: Array#flatten!;
+ *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ */
+
+static VALUE
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+    int level = -1;
+    VALUE result;
+
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+        level = NUM2INT(argv[0]);
+        if (level == 0) return ary_make_shared_copy(ary);
+    }
+
+    result = flatten(ary, level);
+    if (result == ary) {
+        result = ary_make_shared_copy(ary);
+    }
+
+    return result;
+}
+
+#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
+
+static VALUE
+rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+{
+    long i, len;
+
+    rb_ary_modify(ary);
+    i = len = RARRAY_LEN(ary);
+    RARRAY_PTR_USE(ary, ptr, {
+        while (i > 1) {
+            long j = RAND_UPTO(i);
+            VALUE tmp;
+            if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+                rb_raise(rb_eRuntimeError, "modified during shuffle");
+            }
+            tmp = ptr[--i];
+            ptr[i] = ptr[j];
+            ptr[j] = tmp;
+        }
+    }); /* WB: no new reference */
+    return ary;
+}
+
+static VALUE
+rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+{
+    ary = rb_ary_dup(ary);
+    rb_ary_shuffle_bang(ec, ary, randgen);
+    return ary;
+}
+
+static const rb_data_type_t ary_sample_memo_type = {
+    .wrap_struct_name = "ary_sample_memo",
+    .function = {
+        .dfree = (RUBY_DATA_FUNC)st_free_table,
+    },
+    .flags = RUBY_TYPED_WB_PROTECTED | RUBY_TYPED_FREE_IMMEDIATELY
+};
+
+static VALUE
+ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
+{
+    VALUE result;
+    long n, len, i, j, k, idx[10];
+    long rnds[numberof(idx)];
+    long memo_threshold;
+
+    len = RARRAY_LEN(ary);
+    if (!to_array) {
+        if (len < 2)
+            i = 0;
+        else
+            i = RAND_UPTO(len);
+
+        return rb_ary_elt(ary, i);
+    }
+    n = NUM2LONG(nv);
+    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+    if (n > len) n = len;
+    if (n <= numberof(idx)) {
+        for (i = 0; i < n; ++i) {
+            rnds[i] = RAND_UPTO(len - i);
+        }
+    }
+    k = len;
+    len = RARRAY_LEN(ary);
+    if (len < k && n <= numberof(idx)) {
+        for (i = 0; i < n; ++i) {
+            if (rnds[i] >= len) return rb_ary_new_capa(0);
+        }
+    }
+    if (n > len) n = len;
+    switch (n) {
+      case 0:
+        return rb_ary_new_capa(0);
+      case 1:
+        i = rnds[0];
+        return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
+      case 2:
+        i = rnds[0];
+        j = rnds[1];
+        if (j >= i) j++;
+        return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+      case 3:
+        i = rnds[0];
+        j = rnds[1];
+        k = rnds[2];
+        {
+            long l = j, g = i;
+            if (j >= i) l = i, g = ++j;
+            if (k >= l && (++k >= g)) ++k;
+        }
+        return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+    }
+    memo_threshold =
+        len < 2560 ? len / 128 :
+        len < 5120 ? len / 64 :
+        len < 10240 ? len / 32 :
+        len / 16;
+    if (n <= numberof(idx)) {
+        long sorted[numberof(idx)];
+        sorted[0] = idx[0] = rnds[0];
+        for (i=1; i<n; i++) {
+            k = rnds[i];
+            for (j = 0; j < i; ++j) {
+                if (k < sorted[j]) break;
+                ++k;
+            }
+            memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+            sorted[j] = idx[i] = k;
+        }
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+            }
+        });
+    }
+    else if (n <= memo_threshold / 2) {
+        long max_idx = 0;
+        VALUE vmemo = TypedData_Wrap_Struct(0, &ary_sample_memo_type, 0);
+        st_table *memo = st_init_numtable_with_size(n);
+        RTYPEDDATA_DATA(vmemo) = memo;
+        result = rb_ary_new_capa(n);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                long r = RAND_UPTO(len-i) + i;
+                ptr_result[i] = r;
+                if (r > max_idx) max_idx = r;
+            }
+            len = RARRAY_LEN(ary);
+            if (len <= max_idx) n = 0;
+            else if (n > len) n = len;
+            RARRAY_PTR_USE(ary, ptr_ary, {
+                for (i=0; i<n; i++) {
+                    long j2 = j = ptr_result[i];
+                    long i2 = i;
+                    st_data_t value;
+                    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+                    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+                    st_insert(memo, (st_data_t)j, (st_data_t)i2);
+                    ptr_result[i] = ptr_ary[j2];
+                }
+            });
+        });
+        RTYPEDDATA_DATA(vmemo) = 0;
+        st_free_table(memo);
+        RB_GC_GUARD(vmemo);
+    }
+    else {
+        result = rb_ary_dup(ary);
+        RBASIC_CLEAR_CLASS(result);
+        RB_GC_GUARD(ary);
+        RARRAY_PTR_USE(result, ptr_result, {
+            for (i=0; i<n; i++) {
+                j = RAND_UPTO(len-i) + i;
+                nv = ptr_result[j];
+                ptr_result[j] = ptr_result[i];
+                ptr_result[i] = nv;
+            }
+        });
+        RBASIC_SET_CLASS_RAW(result, rb_cArray);
+    }
+    ARY_SET_LEN(result, n);
+
+    return result;
+}
+
+static VALUE
+ary_sized_alloc(rb_execution_context_t *ec, VALUE self)
+{
+    return rb_ary_new2(RARRAY_LEN(self));
+}
+
+static VALUE
+ary_sample0(rb_execution_context_t *ec, VALUE ary)
+{
+    return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
+}
+
+static VALUE
+rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
+{
+    long mul;
+    VALUE n = Qnil;
+    if (args && (RARRAY_LEN(args) > 0)) {
+        n = RARRAY_AREF(args, 0);
+    }
+    if (RARRAY_LEN(self) == 0) return INT2FIX(0);
+    if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
+    mul = NUM2LONG(n);
+    if (mul <= 0) return INT2FIX(0);
+    n = LONG2FIX(mul);
+    return rb_fix_mul_fix(rb_ary_length(self), n);
+}
+
+/*
+ *  call-seq:
+ *    cycle(count = nil) {|element| ... } -> nil
+ *    cycle(count = nil) -> new_enumerator
+ *
+ *  With a block given, may call the block, depending on the value of argument +count+;
+ *  +count+ must be an
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
+ *  or +nil+.
+ *
+ *  When +count+ is positive,
+ *  calls the block with each element, then does so repeatedly,
+ *  until it has done so +count+ times; returns +nil+:
+ *
+ *    output = []
+ *    [0, 1].cycle(2) {|element| output.push(element) } # => nil
+ *    output # => [0, 1, 0, 1]
+ *
+ *  When +count+ is zero or negative, does not call the block:
+ *
+ *    [0, 1].cycle(0) {|element| fail 'Cannot happen' }  # => nil
+ *    [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
+ *
+ *  When +count+ is +nil+, cycles forever:
+ *
+ *    # Prints 0 and 1 forever.
+ *    [0, 1].cycle {|element| puts element }
+ *    [0, 1].cycle(nil) {|element| puts element }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ */
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+    long n, i;
+
+    rb_check_arity(argc, 0, 1);
+
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
+    if (argc == 0 || NIL_P(argv[0])) {
+        n = -1;
+    }
+    else {
+        n = NUM2LONG(argv[0]);
+        if (n <= 0) return Qnil;
+    }
+
+    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            rb_yield(RARRAY_AREF(ary, i));
+        }
+    }
+    return Qnil;
+}
+
+/*
+ * Build a ruby array of the corresponding values and yield it to the
+ * associated block.
+ * Return the class of +values+ for reentry check.
+ */
+static int
+yield_indexed_values(const VALUE values, const long r, const long *const p)
+{
+    const VALUE result = rb_ary_new2(r);
+    long i;
+
+    for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
+    ARY_SET_LEN(result, r);
+    rb_yield(result);
+    return !RBASIC(values)->klass;
+}
+
+/*
+ * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
+ *
+ * When we have a complete permutation of array indices, copy the values
+ * at those indices into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    for (;;) {
+        const char *const unused = memchr(&used[i], 0, n-i);
+        if (!unused) {
+            if (!index) break;
+            i = p[--index];                /* pop index */
+            used[i++] = 0;                 /* index unused */
+        }
+        else {
+            i = unused - used;
+            p[index] = i;
+            used[i] = 1;                   /* mark index used */
+            ++index;
+            if (index < r-1) {             /* if not done yet */
+                p[index] = i = 0;
+                continue;
+            }
+            for (i = 0; i < n; ++i) {
+                if (used[i]) continue;
+                p[index] = i;
+                if (!yield_indexed_values(values, r, p)) {
+                    rb_raise(rb_eRuntimeError, "permute reentered");
+                }
+            }
+            i = p[--index];                /* pop index */
+            used[i] = 0;                   /* index unused */
+            p[index] = ++i;
+        }
+    }
+}
+
+/*
+ * Returns the product of from, from-1, ..., from - how_many + 1.
+ * https://en.wikipedia.org/wiki/Pochhammer_symbol
+ */
+static VALUE
+descending_factorial(long from, long how_many)
+{
+    VALUE cnt;
+    if (how_many > 0) {
+        cnt = LONG2FIX(from);
+        while (--how_many > 0) {
+            long v = --from;
+            cnt = rb_int_mul(cnt, LONG2FIX(v));
+        }
+    }
+    else {
+        cnt = LONG2FIX(how_many == 0);
+    }
+    return cnt;
+}
+
+static VALUE
+binomial_coefficient(long comb, long size)
+{
+    VALUE r;
+    long i;
+    if (comb > size-comb) {
+        comb = size-comb;
+    }
+    if (comb < 0) {
+        return LONG2FIX(0);
+    }
+    else if (comb == 0) {
+        return LONG2FIX(1);
+    }
+    r = LONG2FIX(size);
+    for (i = 1; i < comb; ++i) {
+        r = rb_int_mul(r, LONG2FIX(size - i));
+        r = rb_int_idiv(r, LONG2FIX(i + 1));
+    }
+    return r;
+}
+
+static VALUE
+rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
+
+    return descending_factorial(n, k);
+}
+
+/*
+ *  call-seq:
+ *    permutation(count = self.size) {|permutation| ... } -> self
+ *    permutation(count = self.size) -> new_enumerator
+ *
+ *  Iterates over permutations of the elements of +self+;
+ *  the order of permutations is indeterminate.
+ *
+ *  With a block and an in-range positive integer argument +count+ (<tt>0 < count <= self.size</tt>) given,
+ *  calls the block with each permutation of +self+ of size +count+;
+ *  returns +self+:
+ *
+ *    a = [0, 1, 2]
+ *    perms = []
+ *    a.permutation(1) {|perm| perms.push(perm) }
+ *    perms # => [[0], [1], [2]]
+ *
+ *    perms = []
+ *    a.permutation(2) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1], [0, 2], [1, 0], [1, 2], [2, 0], [2, 1]]
+ *
+ *    perms = []
+ *    a.permutation(3) {|perm| perms.push(perm) }
+ *    perms # => [[0, 1, 2], [0, 2, 1], [1, 0, 2], [1, 2, 0], [2, 0, 1], [2, 1, 0]]
+ *
+ *  When +count+ is zero, calls the block once with a new empty array:
+ *
+ *    perms = []
+ *    a.permutation(0) {|perm| perms.push(perm) }
+ *    perms # => [[]]
+ *
+ *  When +count+ is out of range (negative or larger than <tt>self.size</tt>),
+ *  does not call the block:
+ *
+ *    a.permutation(-1) {|permutation| fail 'Cannot happen' }
+ *    a.permutation(4) {|permutation| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
+    r = n;
+    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+        r = NUM2LONG(argv[0]);            /* Permutation size from argument */
+
+    if (r < 0 || n < r) {
+        /* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else {             /* this is the general case */
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+        char *used = (char*)(p + r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
+
+        MEMZERO(used, char, n); /* initialize array */
+
+        permute0(n, r, p, used, ary0); /* compute and yield permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+static void
+combinate0(const long len, const long n, long *const stack, const VALUE values)
+{
+    long lev = 0;
+
+    MEMZERO(stack+1, long, n);
+    stack[0] = -1;
+    for (;;) {
+        for (lev++; lev < n; lev++) {
+            stack[lev+1] = stack[lev]+1;
+        }
+        if (!yield_indexed_values(values, n, stack+1)) {
+            rb_raise(rb_eRuntimeError, "combination reentered");
+        }
+        do {
+            if (lev == 0) return;
+            stack[lev--]++;
+        } while (stack[lev+1]+n == len+lev+1);
+    }
+}
+
+static VALUE
+rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+    return binomial_coefficient(k, n);
+}
+
+/*
+ *  call-seq:
+ *    combination(count) {|element| ... } -> self
+ *    combination(count) -> new_enumerator
+ *
+ *  When a block and a positive
+ *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
+ *  argument +count+ (<tt>0 < count <= self.size</tt>)
+ *  are given, calls the block with each combination of +self+ of size +count+;
+ *  returns +self+:
+ *
+ *    a = %w[a b c]                                   # => ["a", "b", "c"]
+ *    a.combination(2) {|combination| p combination } # => ["a", "b", "c"]
+ *
+ *  Output:
+ *
+ *    ["a", "b"]
+ *    ["a", "c"]
+ *    ["b", "c"]
+ *
+ *  The order of the yielded combinations is not guaranteed.
+ *
+ *  When +count+ is zero, calls the block once with a new empty array:
+ *
+ *    a.combination(0) {|combination| p combination }
+ *    [].combination(0) {|combination| p combination }
+ *
+ *  Output:
+ *
+ *    []
+ *    []
+ *
+ *  When +count+ is negative or larger than +self.size+ and +self+ is non-empty,
+ *  does not call the block:
+ *
+ *    a.combination(-1) {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *    a.combination(4)  {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: Array#permutation;
+ *  see also {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ */
+
+static VALUE
+rb_ary_combination(VALUE ary, VALUE num)
+{
+    long i, n, len;
+
+    n = NUM2LONG(num);
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
+    len = RARRAY_LEN(ary);
+    if (n < 0 || len < n) {
+        /* yield nothing */
+    }
+    else if (n == 0) {
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else {
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        volatile VALUE t0;
+        long *stack = ALLOCV_N(long, t0, n+1);
+
+        RBASIC_CLEAR_CLASS(ary0);
+        combinate0(len, n, stack, ary0);
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+/*
+ * Compute repeated permutations of +r+ elements of the set
+ * <code>[0..n-1]</code>.
+ *
+ * When we have a complete repeated permutation of array indices, copy the
+ * values at those indices into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(const long n, const long r, long *const p, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+        if (++index < r-1) {
+            p[index] = i = 0;
+            continue;
+        }
+        for (i = 0; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated permute reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
+    }
+}
+
+static VALUE
+rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+    if (k < 0) {
+        return LONG2FIX(0);
+    }
+    if (n <= 0) {
+        return LONG2FIX(!k);
+    }
+    return rb_int_positive_pow(n, (unsigned long)k);
+}
+
+/*
+ *  call-seq:
+ *    repeated_permutation(size) {|permutation| ... } -> self
+ *    repeated_permutation(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated permutation of length +size+
+ *  of the elements of +self+;
+ *  each permutation is an array;
+ *  returns +self+. The order of the permutations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated permutation of the elements of +self+.
+ *  The number of permutations is <tt>self.size**size</tt>.
+ *
+ *  Examples:
+ *
+ *  - +size+ is 1:
+ *
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(1) {|permutation| p.push(permutation) }
+ *      p # => [[0], [1], [2]]
+ *
+ *  - +size+ is 2:
+ *
+ *      p = []
+ *      [0, 1, 2].repeated_permutation(2) {|permutation| p.push(permutation) }
+ *      p # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
+ *
+ *  If +size+ is zero, calls the block once with an empty array.
+ *
+ *  If +size+ is negative, does not call the block:
+ *
+ *    [0, 1, 2].repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size);      /* Return Enumerator if no block */
+    r = NUM2LONG(num);                    /* Permutation size from argument */
+
+    if (r < 0) {
+        /* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else {             /* this is the general case */
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, r);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
+
+        rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+static void
+rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+        if (++index < r-1) {
+            p[index] = i;
+            continue;
+        }
+        for (; i < n; ++i) {
+            p[index] = i;
+            if (!yield_indexed_values(values, r, p)) {
+                rb_raise(rb_eRuntimeError, "repeated combination reentered");
+            }
+        }
+        do {
+            if (index <= 0) return;
+        } while ((i = ++p[--index]) >= n);
+    }
+}
+
+static VALUE
+rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+    if (k == 0) {
+        return LONG2FIX(1);
+    }
+    return binomial_coefficient(k, n + k - 1);
+}
+
+/*
+ *  call-seq:
+ *    repeated_combination(size) {|combination| ... } -> self
+ *    repeated_combination(size) -> new_enumerator
+ *
+ *  With a block given, calls the block with each repeated combination of length +size+
+ *  of the elements of +self+;
+ *  each combination is an array;
+ *  returns +self+. The order of the combinations is indeterminate.
+ *
+ *  If a positive integer argument +size+ is given,
+ *  calls the block with each +size+-tuple repeated combination of the elements of +self+.
+ *  The number of combinations is <tt>(size+1)(size+2)/2</tt>.
+ *
+ *  Examples:
+ *
+ *  - +size+ is 1:
+ *
+ *      c = []
+ *      [0, 1, 2].repeated_combination(1) {|combination| c.push(combination) }
+ *      c # => [[0], [1], [2]]
+ *
+ *  - +size+ is 2:
+ *
+ *      c = []
+ *      [0, 1, 2].repeated_combination(2) {|combination| c.push(combination) }
+ *      c # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
+ *
+ *  If +size+ is zero, calls the block once with an empty array.
+ *
+ *  If +size+ is negative, does not call the block:
+ *
+ *    [0, 1, 2].repeated_combination(-1) {|combination| fail 'Cannot happen' }
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);                 /* Combination size from argument */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
+    len = RARRAY_LEN(ary);
+    if (n < 0) {
+        /* yield nothing */
+    }
+    else if (n == 0) {
+        rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+        for (i = 0; i < RARRAY_LEN(ary); i++) {
+            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+        }
+    }
+    else if (len == 0) {
+        /* yield nothing */
+    }
+    else {
+        volatile VALUE t0;
+        long *p = ALLOCV_N(long, t0, n);
+        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+        RBASIC_CLEAR_CLASS(ary0);
+
+        rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+        ALLOCV_END(t0);
+        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *    product(*other_arrays) -> new_array
+ *    product(*other_arrays) {|combination| ... } -> self
+ *
+ *  Computes all combinations of elements from all the arrays,
+ *  including both +self+ and +other_arrays+:
+ *
+ *  - The number of combinations is the product of the sizes of all the arrays,
+ *    including both +self+ and +other_arrays+.
+ *  - The order of the returned combinations is indeterminate.
+ *
+ *  With no block given, returns the combinations as an array of arrays:
+ *
+ *    p = [0, 1].product([2, 3])
+ *    # => [[0, 2], [0, 3], [1, 2], [1, 3]]
+ *    p.size # => 4
+ *    p = [0, 1].product([2, 3], [4, 5])
+ *    # => [[0, 2, 4], [0, 2, 5], [0, 3, 4], [0, 3, 5], [1, 2, 4], [1, 2, 5], [1, 3, 4], [1, 3,...
+ *    p.size # => 8
+ *
+ *  If +self+ or any argument is empty, returns an empty array:
+ *
+ *    [].product([2, 3], [4, 5]) # => []
+ *    [0, 1].product([2, 3], []) # => []
+ *
+ *  If no argument is given, returns an array of 1-element arrays,
+ *  each containing an element of +self+:
+ *
+ *    a.product # => [[0], [1], [2]]
+ *
+ *  With a block given, calls the block with each combination; returns +self+:
+ *
+ *    p = []
+ *    [0, 1].product([2, 3]) {|combination| p.push(combination) }
+ *    p # => [[0, 2], [0, 3], [1, 2], [1, 3]]
+ *
+ *  If +self+ or any argument is empty, does not call the block:
+ *
+ *    [].product([2, 3], [4, 5]) {|combination| fail 'Cannot happen' }
+ *    # => []
+ *    [0, 1].product([2, 3], []) {|combination| fail 'Cannot happen' }
+ *    # => [0, 1]
+ *
+ *  If no argument is given, calls the block with each element of +self+ as a 1-element array:
+ *
+ *    p = []
+ *    [0, 1].product {|combination| p.push(combination) }
+ *    p # => [[0], [1]]
+ *
+ *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+    int n = argc+1;    /* How many arrays we're operating on */
+    volatile VALUE t0 = rb_ary_hidden_new(n);
+    volatile VALUE t1 = Qundef;
+    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+    int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
+    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
+    long i,j;
+    long resultlen = 1;
+
+    RBASIC_CLEAR_CLASS(t0);
+
+    /* initialize the arrays of arrays */
+    ARY_SET_LEN(t0, n);
+    arrays[0] = ary;
+    for (i = 1; i < n; i++) arrays[i] = Qnil;
+    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+    /* initialize the counters for the arrays */
+    for (i = 0; i < n; i++) counters[i] = 0;
+
+    /* Otherwise, allocate and fill in an array of results */
+    if (rb_block_given_p()) {
+        /* Make defensive copies of arrays; exit if any is empty */
+        for (i = 0; i < n; i++) {
+            if (RARRAY_LEN(arrays[i]) == 0) goto done;
+            arrays[i] = ary_make_shared_copy(arrays[i]);
+        }
+    }
+    else {
+        /* Compute the length of the result array; return [] if any is empty */
+        for (i = 0; i < n; i++) {
+            long k = RARRAY_LEN(arrays[i]);
+            if (k == 0) {
+                result = rb_ary_new2(0);
+                goto done;
+            }
+            if (MUL_OVERFLOW_LONG_P(resultlen, k))
+                rb_raise(rb_eRangeError, "too big to product");
+            resultlen *= k;
+        }
+        result = rb_ary_new2(resultlen);
+    }
+    for (;;) {
+        int m;
+        /* fill in one subarray */
+        VALUE subarray = rb_ary_new2(n);
+        for (j = 0; j < n; j++) {
+            rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+        }
+
+        /* put it on the result array */
+        if (NIL_P(result)) {
+            FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
+            rb_yield(subarray);
+            if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
+                rb_raise(rb_eRuntimeError, "product reentered");
+            }
+            else {
+                FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
+            }
+        }
+        else {
+            rb_ary_push(result, subarray);
+        }
+
+        /*
+         * Increment the last counter.  If it overflows, reset to 0
+         * and increment the one before it.
+         */
+        m = n-1;
+        counters[m]++;
+        while (counters[m] == RARRAY_LEN(arrays[m])) {
+            counters[m] = 0;
+            /* If the first counter overflows, we are done */
+            if (--m < 0) goto done;
+            counters[m]++;
+        }
+    }
+
+done:
+    ALLOCV_END(t1);
+
+    return NIL_P(result) ? ary : result;
+}
+
+/*
+ *  call-seq:
+ *    take(count) -> new_array
+ *
+ *  Returns a new array containing the first +count+ element of +self+
+ *  (as available);
+ *  +count+ must be a non-negative numeric;
+ *  does not modify +self+:
+ *
+ *    a = ['a', 'b', 'c', 'd']
+ *    a.take(2)   # => ["a", "b"]
+ *    a.take(2.1) # => ["a", "b"]
+ *    a.take(50)  # => ["a", "b", "c", "d"]
+ *    a.take(0)   # => []
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+    long len = NUM2LONG(n);
+    if (len < 0) {
+        rb_raise(rb_eArgError, "attempt to take negative size");
+    }
+    return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ *  call-seq:
+ *    take_while {|element| ... } -> new_array
+ *    take_while -> new_enumerator
+ *
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops iterating if the block returns +false+ or +nil+;
+ *  returns a new array containing those elements for which the block returned a truthy value:
+ *
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| element < 3 } # => [0, 1, 2]
+ *    a.take_while {|element| true }        # => [0, 1, 2, 3, 4, 5]
+ *    a.take_while {|element| false }       # => []
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Does not modify +self+.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *    drop(count) -> new_array
+ *
+ *  Returns a new array containing all but the first +count+ element of +self+,
+ *  where +count+ is a non-negative integer;
+ *  does not modify +self+.
+ *
+ *  Examples:
+ *
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop(0) # => [0, 1, 2, 3, 4, 5]
+ *    a.drop(1) # => [1, 2, 3, 4, 5]
+ *    a.drop(2) # => [2, 3, 4, 5]
+ *    a.drop(9) # => []
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+    VALUE result;
+    long pos = NUM2LONG(n);
+    if (pos < 0) {
+        rb_raise(rb_eArgError, "attempt to drop negative size");
+    }
+
+    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+    if (NIL_P(result)) result = rb_ary_new();
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    drop_while {|element| ... } -> new_array
+ *    drop_while -> new_enumerator
+ *
+ *  With a block given, calls the block with each successive element of +self+;
+ *  stops if the block returns +false+ or +nil+;
+ *  returns a new array _omitting_ those elements for which the block returned a truthy value;
+ *  does not modify +self+:
+ *
+ *    a = [0, 1, 2, 3, 4, 5]
+ *    a.drop_while {|element| element < 3 } # => [3, 4, 5]
+ *
+ *  With no block given, returns a new Enumerator.
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *    any? -> true or false
+ *    any?(object) -> true or false
+ *    any? {|element| ... } -> true or false
+ *
+ *  Returns whether for any element of +self+, a given criterion is satisfied.
+ *
+ *  With no block and no argument, returns whether any element of +self+ is truthy:
+ *
+ *    [nil, false, []].any? # => true  # Array object is truthy.
+ *    [nil, false, {}].any? # => true  # Hash object is truthy.
+ *    [nil, false, ''].any? # => true  # String object is truthy.
+ *    [nil, false].any?     # => false # Nil and false are not truthy.
+ *
+ *  With argument +object+ given,
+ *  returns whether <tt>object === ele</tt> for any element +ele+ in +self+:
+ *
+ *    [nil, false, 0].any?(0)          # => true
+ *    [nil, false, 1].any?(0)          # => false
+ *    [nil, false, 'food'].any?(/foo/) # => true
+ *    [nil, false, 'food'].any?(/bar/) # => false
+ *
+ *  With a block given,
+ *  calls the block with each element in +self+;
+ *  returns whether the block returns any truthy value:
+ *
+ *    [0, 1, 2].any? {|ele| ele < 1 } # => true
+ *    [0, 1, 2].any? {|ele| ele < 0 } # => false
+ *
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +false+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qfalse;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+        }
+    }
+    return Qfalse;
+}
+
+/*
+ *  call-seq:
+ *    all? -> true or false
+ *    all?(object) -> true or false
+ *    all? {|element| ... } -> true or false
+ *
+ *  Returns whether for every element of +self+,
+ *  a given criterion is satisfied.
+ *
+ *  With no block and no argument,
+ *  returns whether every element of +self+ is truthy:
+ *
+ *    [[], {}, '', 0, 0.0, Object.new].all? # => true  # All truthy objects.
+ *    [[], {}, '', 0, 0.0, nil].all?        # => false # nil is not truthy.
+ *    [[], {}, '', 0, 0.0, false].all?      # => false # false is not truthy.
+ *
+ *  With argument +object+ given, returns whether <tt>object === ele</tt>
+ *  for every element +ele+ in +self+:
+ *
+ *    [0, 0, 0].all?(0)                    # => true
+ *    [0, 1, 2].all?(1)                    # => false
+ *    ['food', 'fool', 'foot'].all?(/foo/) # => true
+ *    ['food', 'drink'].all?(/foo/)        # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns whether the block returns only truthy values:
+ *
+ *    [0, 1, 2].all? { |ele| ele < 3 } # => true
+ *    [0, 1, 2].all? { |ele| ele < 2 } # => false
+ *
+ *  With both a block and argument +object+ given,
+ *  ignores the block and uses +object+ as above.
+ *
+ *  <b>Special case</b>: returns +true+ if +self+ is empty
+ *  (regardless of any given argument or block).
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    none? -> true or false
+ *    none?(object) -> true or false
+ *    none? {|element| ... } -> true or false
+ *
+ *  Returns +true+ if no element of +self+ meets a given criterion, +false+ otherwise.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has no truthy elements,
+ *  +false+ otherwise:
+ *
+ *    [nil, false].none?    # => true
+ *    [nil, 0, false].none? # => false
+ *    [].none?              # => true
+ *
+ *  With argument +object+ given, returns +false+ if for any element +element+,
+ *  <tt>object === element</tt>; +true+ otherwise:
+ *
+ *    ['food', 'drink'].none?(/bar/) # => true
+ *    ['food', 'drink'].none?(/foo/) # => false
+ *    [].none?(/foo/)                # => true
+ *    [0, 1, 2].none?(3)             # => true
+ *    [0, 1, 2].none?(1)             # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block returns no truthy value, +false+ otherwise:
+ *
+ *    [0, 1, 2].none? {|element| element > 3 } # => true
+ *    [0, 1, 2].none? {|element| element > 1 } # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qtrue;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+        }
+    }
+    return Qtrue;
+}
+
+/*
+ *  call-seq:
+ *    one? -> true or false
+ *    one? {|element| ... } -> true or false
+ *    one?(object) -> true or false
+ *
+ *  Returns +true+ if exactly one element of +self+ meets a given criterion.
+ *
+ *  With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
+ *  +false+ otherwise:
+ *
+ *    [nil, 0].one? # => true
+ *    [0, 0].one? # => false
+ *    [nil, nil].one? # => false
+ *    [].one? # => false
+ *
+ *  With a block given, calls the block with each element in +self+;
+ *  returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
+ *
+ *    [0, 1, 2].one? {|element| element > 0 } # => false
+ *    [0, 1, 2].one? {|element| element > 1 } # => true
+ *    [0, 1, 2].one? {|element| element > 2 } # => false
+ *
+ *  With argument +object+ given, returns +true+ if for exactly one element +element+, <tt>object === element</tt>;
+ *  +false+ otherwise:
+ *
+ *    [0, 1, 2].one?(0) # => true
+ *    [0, 0, 1].one?(0) # => false
+ *    [1, 1, 2].one?(0) # => false
+ *    ['food', 'drink'].one?(/bar/) # => false
+ *    ['food', 'drink'].one?(/foo/) # => true
+ *    [].one?(/foo/) # => false
+ *
+ *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+    VALUE result = Qfalse;
+
+    rb_check_arity(argc, 0, 1);
+    if (!len) return Qfalse;
+    if (argc) {
+        if (rb_block_given_p()) {
+            rb_warn("given block not used");
+        }
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else if (!rb_block_given_p()) {
+        for (i = 0; i < len; ++i) {
+            if (RTEST(RARRAY_AREF(ary, i))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    else {
+        for (i = 0; i < RARRAY_LEN(ary); ++i) {
+            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+                if (result) return Qfalse;
+                result = Qtrue;
+            }
+        }
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *    dig(index, *identifiers) -> object
+ *
+ *  Finds and returns the object in nested object
+ *  specified by +index+ and +identifiers+;
+ *  the nested objects may be instances of various classes.
+ *  See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ *
+ *  Examples:
+ *
+ *    a = [:foo, [:bar, :baz, [:bat, :bam]]]
+ *    a.dig(1) # => [:bar, :baz, [:bat, :bam]]
+ *    a.dig(1, 2) # => [:bat, :bam]
+ *    a.dig(1, 2, 0) # => :bat
+ *    a.dig(1, 2, 3) # => nil
+ *
+ *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ */
+
+static VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    self = rb_ary_at(self, *argv);
+    if (!--argc) return self;
+    ++argv;
+    return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+    if (n != 0)
+        v = rb_fix_plus(LONG2FIX(n), v);
+    if (!UNDEF_P(r)) {
+        v = rb_rational_plus(r, v);
+    }
+    else if (!n && z) {
+        v = rb_fix_plus(LONG2FIX(0), v);
+    }
+    return v;
+}
+
+/*
+ * call-seq:
+ *   sum(init = 0) -> object
+ *   sum(init = 0) {|element| ... } -> object
+ *
+ *  With no block given, returns the sum of +init+ and all elements of +self+;
+ *  for array +array+ and value +init+, equivalent to:
+ *
+ *    sum = init
+ *    array.each {|element| sum += element }
+ *    sum
+ *
+ *  For example, <tt>[e0, e1, e2].sum</tt> returns <tt>init + e0 + e1 + e2</tt>.
+ *
+ *  Examples:
+ *
+ *    [0, 1, 2, 3].sum                 # => 6
+ *    [0, 1, 2, 3].sum(100)            # => 106
+ *    ['abc', 'def', 'ghi'].sum('jkl') # => "jklabcdefghi"
+ *    [[:foo, :bar], ['foo', 'bar']].sum([2, 3])
+ *    # => [2, 3, :foo, :bar, "foo", "bar"]
+ *
+ *  The +init+ value and elements need not be numeric, but must all be <tt>+</tt>-compatible:
+ *
+ *    # Raises TypeError: Array can't be coerced into Integer.
+ *    [[:foo, :bar], ['foo', 'bar']].sum(2)
+ *
+ *  With a block given, calls the block with each element of +self+;
+ *  the block's return value (instead of the element itself) is used as the addend:
+ *
+ *    ['zero', 1, :two].sum('Coerced and concatenated: ') {|element| element.to_s }
+ *    # => "Coerced and concatenated: zero1two"
+ *
+ *  Notes:
+ *
+ *  - Array#join and Array#flatten may be faster than Array#sum
+ *    for an array of strings or an array of arrays.
+ *  - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
+ *
+ */
+
+static VALUE
+rb_ary_sum(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE e, v, r;
+    long i, n;
+    int block_given;
+
+    v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+
+    block_given = rb_block_given_p();
+
+    if (RARRAY_LEN(ary) == 0)
+        return v;
+
+    n = 0;
+    r = Qundef;
+
+    if (!FIXNUM_P(v) && !RB_BIGNUM_TYPE_P(v) && !RB_TYPE_P(v, T_RATIONAL)) {
+        i = 0;
+        goto init_is_a_value;
+    }
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+        if (FIXNUM_P(e)) {
+            n += FIX2LONG(e); /* should not overflow long type */
+            if (!FIXABLE(n)) {
+                v = rb_big_plus(LONG2NUM(n), v);
+                n = 0;
+            }
+        }
+        else if (RB_BIGNUM_TYPE_P(e))
+            v = rb_big_plus(e, v);
+        else if (RB_TYPE_P(e, T_RATIONAL)) {
+            if (UNDEF_P(r))
+                r = e;
+            else
+                r = rb_rational_plus(r, e);
+        }
+        else
+            goto not_exact;
+    }
+    v = finish_exact_sum(n, r, v, argc!=0);
+    return v;
+
+  not_exact:
+    v = finish_exact_sum(n, r, v, i!=0);
+
+    if (RB_FLOAT_TYPE_P(e)) {
+        /*
+         * Kahan-Babuska balancing compensated summation algorithm
+         * See https://link.springer.com/article/10.1007/s00607-005-0139-x
+         */
+        double f, c;
+        double x, t;
+
+        f = NUM2DBL(v);
+        c = 0.0;
+        goto has_float_value;
+        for (; i < RARRAY_LEN(ary); i++) {
+            e = RARRAY_AREF(ary, i);
+            if (block_given)
+                e = rb_yield(e);
+            if (RB_FLOAT_TYPE_P(e))
+              has_float_value:
+                x = RFLOAT_VALUE(e);
+            else if (FIXNUM_P(e))
+                x = FIX2LONG(e);
+            else if (RB_BIGNUM_TYPE_P(e))
+                x = rb_big2dbl(e);
+            else if (RB_TYPE_P(e, T_RATIONAL))
+                x = rb_num2dbl(e);
+            else
+                goto not_float;
+
+            if (isnan(f)) continue;
+            if (isnan(x)) {
+                f = x;
+                continue;
+            }
+            if (isinf(x)) {
+                if (isinf(f) && signbit(x) != signbit(f))
+                    f = NAN;
+                else
+                    f = x;
+                continue;
+            }
+            if (isinf(f)) continue;
+
+            t = f + x;
+            if (fabs(f) >= fabs(x))
+                c += ((f - t) + x);
+            else
+                c += ((x - t) + f);
+            f = t;
+        }
+        f += c;
+        return DBL2NUM(f);
+
+      not_float:
+        v = DBL2NUM(f);
+    }
+
+    goto has_some_value;
+    init_is_a_value:
+    for (; i < RARRAY_LEN(ary); i++) {
+        e = RARRAY_AREF(ary, i);
+        if (block_given)
+            e = rb_yield(e);
+      has_some_value:
+        v = rb_funcall(v, idPLUS, 1, e);
+    }
+    return v;
+}
+
+/* :nodoc: */
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+    return ary;
+}
+
+/*
+ *  An \Array object is an ordered, integer-indexed collection of objects,
+ *  called _elements_;
+ *  the object represents
+ *  an {array data structure}[https://en.wikipedia.org/wiki/Array_(data_structure)].
+ *
+ *  An element may be any object (even another array);
+ *  elements may be any mixture of objects of different types.
+ *
+ *  Important data structures that use arrays include:
+ *
+ *  - {Coordinate vector}[https://en.wikipedia.org/wiki/Coordinate_vector].
+ *  - {Matrix}[https://en.wikipedia.org/wiki/Matrix_(mathematics)].
+ *  - {Heap}[https://en.wikipedia.org/wiki/Heap_(data_structure)].
+ *  - {Hash table}[https://en.wikipedia.org/wiki/Hash_table].
+ *  - {Deque (double-ended queue)}[https://en.wikipedia.org/wiki/Double-ended_queue].
+ *  - {Queue}[https://en.wikipedia.org/wiki/Queue_(abstract_data_type)].
+ *  - {Stack}[https://en.wikipedia.org/wiki/Stack_(abstract_data_type)].
+ *
+ *  There are also array-like data structures:
+ *
+ *  - {Associative array}[https://en.wikipedia.org/wiki/Associative_array] (see Hash).
+ *  - {Directory}[https://en.wikipedia.org/wiki/Directory_(computing)] (see Dir).
+ *  - {Environment}[https://en.wikipedia.org/wiki/Environment_variable] (see ENV).
+ *  - {Set}[https://en.wikipedia.org/wiki/Set_(abstract_data_type)] (see Set).
+ *  - {String}[https://en.wikipedia.org/wiki/String_(computer_science)] (see String).
+ *
+ *  == \Array Indexes
+ *
+ *  \Array indexing starts at 0, as in C or Java.
+ *
+ *  A non-negative index is an offset from the first element:
+ *
+ *  - Index 0 indicates the first element.
+ *  - Index 1 indicates the second element.
+ *  - ...
+ *
+ *  A negative index is an offset, backwards, from the end of the array:
+ *
+ *  - Index -1 indicates the last element.
+ *  - Index -2 indicates the next-to-last element.
+ *  - ...
+ *
+ *
+ *  === In-Range and Out-of-Range Indexes
+ *
+ *  A non-negative index is <i>in range</i> if and only if it is smaller than
+ *  the size of the array.  For a 3-element array:
+ *
+ *  - Indexes 0 through 2 are in range.
+ *  - Index 3 is out of range.
+ *
+ *  A negative index is <i>in range</i> if and only if its absolute value is
+ *  not larger than the size of the array.  For a 3-element array:
+ *
+ *  - Indexes -1 through -3 are in range.
+ *  - Index -4 is out of range.
+ *
+ *  === Effective Index
+ *
+ *  Although the effective index into an array is always an integer,
+ *  some methods (both within class \Array and elsewhere)
+ *  accept one or more non-integer arguments that are
+ *  {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *
+ *  == Creating Arrays
+ *
+ *  You can create an \Array object explicitly with:
+ *
+ *  - An {array literal}[rdoc-ref:syntax/literals.rdoc@Array+Literals]:
+ *
+ *      [1, 'one', :one, [2, 'two', :two]]
+ *
+ *  - A {%w or %W string-array Literal}[rdoc-ref:syntax/literals.rdoc@25w+and+-25W-3A+String-Array+Literals]:
+ *
+ *      %w[foo bar baz] # => ["foo", "bar", "baz"]
+ *      %w[1 % *]       # => ["1", "%", "*"]
+ *
+ *  - A {%i or %I symbol-array Literal}[rdoc-ref:syntax/literals.rdoc@25i+and+-25I-3A+Symbol-Array+Literals]:
+ *
+ *      %i[foo bar baz] # => [:foo, :bar, :baz]
+ *      %i[1 % *]       # => [:"1", :%, :*]
+ *
+ *  - Method Kernel#Array:
+ *
+ *      Array(["a", "b"])             # => ["a", "b"]
+ *      Array(1..5)                   # => [1, 2, 3, 4, 5]
+ *      Array(key: :value)            # => [[:key, :value]]
+ *      Array(nil)                    # => []
+ *      Array(1)                      # => [1]
+ *      Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
+ *
+ *  - Method Array.new:
+ *
+ *      Array.new               # => []
+ *      Array.new(3)            # => [nil, nil, nil]
+ *      Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
+ *      Array.new(3, true)      # => [true, true, true]
+ *
+ *    Note that the last example above populates the array
+ *    with references to the same object.
+ *    This is recommended only in cases where that object is a natively immutable object
+ *    such as a symbol, a numeric, +nil+, +true+, or +false+.
+ *
+ *    Another way to create an array with various objects, using a block;
+ *    this usage is safe for mutable objects such as hashes, strings or
+ *    other arrays:
+ *
+ *      Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
+ *
+ *    Here is a way to create a multi-dimensional array:
+ *
+ *      Array.new(3) {Array.new(3)}
+ *      # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ *  A number of Ruby methods, both in the core and in the standard library,
+ *  provide instance method +to_a+, which converts an object to an array.
+ *
+ *  - ARGF#to_a
+ *  - Array#to_a
+ *  - Enumerable#to_a
+ *  - Hash#to_a
+ *  - MatchData#to_a
+ *  - NilClass#to_a
+ *  - OptionParser#to_a
+ *  - Range#to_a
+ *  - Set#to_a
+ *  - Struct#to_a
+ *  - Time#to_a
+ *  - Benchmark::Tms#to_a
+ *  - CSV::Table#to_a
+ *  - Enumerator::Lazy#to_a
+ *  - Gem::List#to_a
+ *  - Gem::NameTuple#to_a
+ *  - Gem::Platform#to_a
+ *  - Gem::RequestSet::Lockfile::Tokenizer#to_a
+ *  - Gem::SourceList#to_a
+ *  - OpenSSL::X509::Extension#to_a
+ *  - OpenSSL::X509::Name#to_a
+ *  - Racc::ISet#to_a
+ *  - Rinda::RingFinger#to_a
+ *  - Ripper::Lexer::Elem#to_a
+ *  - RubyVM::InstructionSequence#to_a
+ *  - YAML::DBM#to_a
+ *
+ *  == Example Usage
+ *
+ *  In addition to the methods it mixes in through the Enumerable module,
+ *  class \Array has proprietary methods for accessing, searching and otherwise
+ *  manipulating arrays.
+ *
+ *  Some of the more common ones are illustrated below.
+ *
+ *  == Accessing Elements
+ *
+ *  Elements in an array can be retrieved using the Array#[] method.  It can
+ *  take a single integer argument (a numeric index), a pair of arguments
+ *  (start and length) or a range. Negative indices start counting from the end,
+ *  with -1 being the last element.
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr[2]    #=> 3
+ *     arr[100]  #=> nil
+ *     arr[-3]   #=> 4
+ *     arr[2, 3] #=> [3, 4, 5]
+ *     arr[1..4] #=> [2, 3, 4, 5]
+ *     arr[1..-3] #=> [2, 3, 4]
+ *
+ *  Another way to access a particular array element is by using the #at method
+ *
+ *     arr.at(0) #=> 1
+ *
+ *  The #slice method works in an identical manner to Array#[].
+ *
+ *  To raise an error for indices outside of the array bounds or else to
+ *  provide a default value when that happens, you can use #fetch.
+ *
+ *     arr = ['a', 'b', 'c', 'd', 'e', 'f']
+ *     arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
+ *     arr.fetch(100, "oops") #=> "oops"
+ *
+ *  The special methods #first and #last will return the first and last
+ *  elements of an array, respectively.
+ *
+ *     arr.first #=> 1
+ *     arr.last  #=> 6
+ *
+ *  To return the first +n+ elements of an array, use #take
+ *
+ *     arr.take(3) #=> [1, 2, 3]
+ *
+ *  #drop does the opposite of #take, by returning the elements after +n+
+ *  elements have been dropped:
+ *
+ *     arr.drop(3) #=> [4, 5, 6]
+ *
+ *  == Obtaining Information about an \Array
+ *
+ *  An array keeps track of its own length at all times.  To query an array
+ *  about the number of elements it contains, use #length, #count or #size.
+ *
+ *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
+ *    browsers.length #=> 5
+ *    browsers.count #=> 5
+ *
+ *  To check whether an array contains any elements at all
+ *
+ *    browsers.empty? #=> false
+ *
+ *  To check whether a particular item is included in the array
+ *
+ *    browsers.include?('Konqueror') #=> false
+ *
+ *  == Adding Items to an \Array
+ *
+ *  Items can be added to the end of an array by using either #push or #<<
+ *
+ *    arr = [1, 2, 3, 4]
+ *    arr.push(5) #=> [1, 2, 3, 4, 5]
+ *    arr << 6    #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  #unshift will add a new item to the beginning of an array.
+ *
+ *     arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
+ *
+ *  With #insert you can add a new element to an array at any position.
+ *
+ *     arr.insert(3, 'apple')  #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
+ *
+ *  Using the #insert method, you can also insert multiple values at once:
+ *
+ *     arr.insert(3, 'orange', 'pear', 'grapefruit')
+ *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
+ *
+ *  == Removing Items from an \Array
+ *
+ *  The method #pop removes the last element in an array and returns it:
+ *
+ *     arr =  [1, 2, 3, 4, 5, 6]
+ *     arr.pop #=> 6
+ *     arr #=> [1, 2, 3, 4, 5]
+ *
+ *  To retrieve and at the same time remove the first item, use #shift:
+ *
+ *     arr.shift #=> 1
+ *     arr #=> [2, 3, 4, 5]
+ *
+ *  To delete an element at a particular index:
+ *
+ *     arr.delete_at(2) #=> 4
+ *     arr #=> [2, 3, 5]
+ *
+ *  To delete a particular element anywhere in an array, use #delete:
+ *
+ *     arr = [1, 2, 2, 3]
+ *     arr.delete(2) #=> 2
+ *     arr #=> [1,3]
+ *
+ *  A useful method if you need to remove +nil+ values from an array is
+ *  #compact:
+ *
+ *     arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact  #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, 'bar', 7, 'baz']
+ *
+ *  Another common need is to remove duplicate elements from an array.
+ *
+ *  It has the non-destructive #uniq, and destructive method #uniq!
+ *
+ *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
+ *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
+ *
+ *  == Iterating over an \Array
+ *
+ *  Like all classes that include the Enumerable module, class \Array has an each
+ *  method, which defines what elements should be iterated over and how.  In
+ *  case of Array#each, all elements in +self+ are yielded to
+ *  the supplied block in sequence.
+ *
+ *  Note that this operation leaves the array unchanged.
+ *
+ *     arr = [1, 2, 3, 4, 5]
+ *     arr.each {|a| print a -= 10, " "}
+ *     # prints: -9 -8 -7 -6 -5
+ *     #=> [1, 2, 3, 4, 5]
+ *
+ *  Another sometimes useful iterator is #reverse_each which will iterate over
+ *  the elements in the array in reverse order.
+ *
+ *     words = %w[first second third fourth fifth sixth]
+ *     str = ""
+ *     words.reverse_each {|word| str += "#{word} "}
+ *     p str #=> "sixth fifth fourth third second first "
+ *
+ *  The #map method can be used to create a new array based on the original
+ *  array, but with the values modified by the supplied block:
+ *
+ *     arr.map {|a| 2*a}     #=> [2, 4, 6, 8, 10]
+ *     arr                   #=> [1, 2, 3, 4, 5]
+ *     arr.map! {|a| a**2}   #=> [1, 4, 9, 16, 25]
+ *     arr                   #=> [1, 4, 9, 16, 25]
+ *
+ *
+ *  == Selecting Items from an \Array
+ *
+ *  Elements can be selected from an array according to criteria defined in a
+ *  block.  The selection can happen in a destructive or a non-destructive
+ *  manner.  While the destructive operations will modify the array they were
+ *  called on, the non-destructive methods usually return a new array with the
+ *  selected elements, but leave the original array unchanged.
+ *
+ *  === Non-destructive Selection
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.select {|a| a > 3}       #=> [4, 5, 6]
+ *     arr.reject {|a| a < 3}       #=> [3, 4, 5, 6]
+ *     arr.drop_while {|a| a < 4}   #=> [4, 5, 6]
+ *     arr                          #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  === Destructive Selection
+ *
+ *  #select! and #reject! are the corresponding destructive methods to #select
+ *  and #reject
+ *
+ *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
+ *  opposite result when supplied with the same block:
+ *
+ *     arr.delete_if {|a| a < 4}   #=> [4, 5, 6]
+ *     arr                         #=> [4, 5, 6]
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.keep_if {|a| a < 4}   #=> [1, 2, 3]
+ *     arr                       #=> [1, 2, 3]
+ *
+ *  == What's Here
+ *
+ *  First, what's elsewhere. Class \Array:
+ *
+ *  - Inherits from {class Object}[rdoc-ref:Object@What-27s+Here].
+ *  - Includes {module Enumerable}[rdoc-ref:Enumerable@What-27s+Here],
+ *    which provides dozens of additional methods.
+ *
+ *  Here, class \Array provides methods that are useful for:
+ *
+ *  - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
+ *  - {Querying}[rdoc-ref:Array@Methods+for+Querying]
+ *  - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
+ *  - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
+ *  - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
+ *  - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
+ *  - {Combining}[rdoc-ref:Array@Methods+for+Combining]
+ *  - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
+ *  - {Converting}[rdoc-ref:Array@Methods+for+Converting]
+ *  - {And more....}[rdoc-ref:Array@Other+Methods]
+ *
+ *  === Methods for Creating an \Array
+ *
+ *  - ::[]: Returns a new array populated with given objects.
+ *  - ::new: Returns a new array.
+ *  - ::try_convert: Returns a new array created from a given object.
+ *
+ *  See also {Creating Arrays}[rdoc-ref:Array@Creating+Arrays].
+ *
+ *  === Methods for Querying
+ *
+ *  - #all?: Returns whether all elements meet a given criterion.
+ *  - #any?: Returns whether any element meets a given criterion.
+ *  - #count: Returns the count of elements that meet a given criterion.
+ *  - #empty?: Returns whether there are no elements.
+ *  - #find_index (aliased as #index): Returns the index of the first element that meets a given criterion.
+ *  - #hash: Returns the integer hash code.
+ *  - #include?: Returns whether any element <tt>==</tt> a given object.
+ *  - #length (aliased as #size): Returns the count of elements.
+ *  - #none?: Returns whether no element <tt>==</tt> a given object.
+ *  - #one?: Returns whether exactly one element <tt>==</tt> a given object.
+ *  - #rindex: Returns the index of the last element that meets a given criterion.
+ *
+ *  === Methods for Comparing
+ *
+ *  - #<=>: Returns -1, 0, or 1, as +self+ is less than, equal to, or greater than a given object.
+ *  - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element in a given object.
+ *  - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding element in a given object.
+
+ *  === Methods for Fetching
+ *
+ *  These methods do not modify +self+.
+ *
+ *  - #[] (aliased as #slice): Returns consecutive elements as determined by a given argument.
+ *  - #assoc: Returns the first element that is an array whose first element <tt>==</tt> a given object.
+ *  - #at: Returns the element at a given offset.
+ *  - #bsearch: Returns an element selected via a binary search as determined by a given block.
+ *  - #bsearch_index: Returns the index of an element selected via a binary search as determined by a given block.
+ *  - #compact: Returns an array containing all non-+nil+ elements.
+ *  - #dig: Returns the object in nested objects that is specified by a given index and additional arguments.
+ *  - #drop: Returns trailing elements as determined by a given index.
+ *  - #drop_while: Returns trailing elements as determined by a given block.
+ *  - #fetch: Returns the element at a given offset.
+ *  - #fetch_values: Returns elements at given offsets.
+ *  - #first: Returns one or more leading elements.
+ *  - #last: Returns one or more trailing elements.
+ *  - #max: Returns one or more maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #min: Returns one or more minimum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #minmax: Returns the minimum-valued and maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
+ *  - #rassoc: Returns the first element that is an array whose second element <tt>==</tt> a given object.
+ *  - #reject: Returns an array containing elements not rejected by a given block.
+ *  - #reverse: Returns all elements in reverse order.
+ *  - #rotate: Returns all elements with some rotated from one end to the other.
+ *  - #sample: Returns one or more random elements.
+ *  - #select (aliased as #filter): Returns an array containing elements selected by a given block.
+ *  - #shuffle: Returns elements in a random order.
+ *  - #sort: Returns all elements in an order determined by <tt>#<=></tt> or a given block.
+ *  - #take: Returns leading elements as determined by a given index.
+ *  - #take_while: Returns leading elements as determined by a given block.
+ *  - #uniq: Returns an array containing non-duplicate elements.
+ *  - #values_at: Returns the elements at given offsets.
+ *
+ *  === Methods for Assigning
+ *
+ *  These methods add, replace, or reorder elements in +self+.
+ *
+ *  - #<<: Appends an element.
+ *  - #[]=: Assigns specified elements with a given object.
+ *  - #concat: Appends all elements from given arrays.
+ *  - #fill: Replaces specified elements with specified objects.
+ *  - #flatten!: Replaces each nested array in +self+ with the elements from that array.
+ *  - #initialize_copy (aliased as #replace): Replaces the content of +self+ with the content of a given array.
+ *  - #insert: Inserts given objects at a given offset; does not replace elements.
+ *  - #push (aliased as #append): Appends elements.
+ *  - #reverse!: Replaces +self+ with its elements reversed.
+ *  - #rotate!: Replaces +self+ with its elements rotated.
+ *  - #shuffle!: Replaces +self+ with its elements in random order.
+ *  - #sort!: Replaces +self+ with its elements sorted, as determined by <tt>#<=></tt> or a given block.
+ *  - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
+ *  - #unshift (aliased as #prepend): Prepends leading elements.
+ *
+ *  === Methods for Deleting
+ *
+ *  Each of these methods removes elements from +self+:
+ *
+ *  - #clear: Removes all elements.
+ *  - #compact!: Removes all +nil+ elements.
+ *  - #delete: Removes elements equal to a given object.
+ *  - #delete_at: Removes the element at a given offset.
+ *  - #delete_if: Removes elements specified by a given block.
+ *  - #keep_if: Removes elements not specified by a given block.
+ *  - #pop: Removes and returns the last element.
+ *  - #reject!: Removes elements specified by a given block.
+ *  - #select! (aliased as #filter!): Removes elements not specified by a given block.
+ *  - #shift:  Removes and returns the first element.
+ *  - #slice!: Removes and returns a sequence of elements.
+ *  - #uniq!: Removes duplicates.
+ *
+ *  === Methods for Combining
+ *
+ *  - #&: Returns an array containing elements found both in +self+ and a given array.
+ *  - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
+ *  - #-: Returns an array containing all elements of +self+ that are not found in a given array.
+ *  - #|: Returns an array containing all element of +self+ and all elements of a given array, duplicates removed.
+ *  - #difference: Returns an array containing all elements of +self+ that are not found in any of the given arrays..
+ *  - #intersection: Returns an array containing elements found both in +self+ and in each given array.
+ *  - #product: Returns or yields all combinations of elements from +self+ and given arrays.
+ *  - #reverse: Returns an array containing all elements of +self+ in reverse order.
+ *  - #union: Returns an array containing all elements of +self+ and all elements of given arrays, duplicates removed.
+ *
+ *  === Methods for Iterating
+ *
+ *  - #combination: Calls a given block with combinations of elements of +self+; a combination does not use the same element more than once.
+ *  - #cycle: Calls a given block with each element, then does so again, for a specified number of times, or forever.
+ *  - #each: Passes each element to a given block.
+ *  - #each_index: Passes each element index to a given block.
+ *  - #permutation: Calls a given block with permutations of elements of +self+; a permutation does not use the same element more than once.
+ *  - #repeated_combination: Calls a given block with combinations of elements of +self+; a combination may use the same element more than once.
+ *  - #repeated_permutation: Calls a given block with permutations of elements of +self+; a permutation may use the same element more than once.
+ *  - #reverse_each:  Passes each element, in reverse order, to a given block.
+ *
+ *  === Methods for Converting
+ *
+ *  - #collect (aliased as #map): Returns an array containing the block return-value for each element.
+ *  - #collect! (aliased as #map!): Replaces each element with a block return-value.
+ *  - #flatten: Returns an array that is a recursive flattening of +self+.
+ *  - #inspect (aliased as #to_s): Returns a new String containing the elements.
+ *  - #join: Returns a new String containing the elements joined by the field separator.
+ *  - #to_a: Returns +self+ or a new array containing all elements.
+ *  - #to_ary: Returns +self+.
+ *  - #to_h: Returns a new hash formed from the elements.
+ *  - #transpose: Transposes +self+, which must be an array of arrays.
+ *  - #zip: Returns a new array of arrays containing +self+ and given arrays.
+ *
+ *  === Other Methods
+ *
+ *  - #*: Returns one of the following:
+ *
+ *    - With integer argument +n+, a new array that is the concatenation
+ *      of +n+ copies of +self+.
+ *    - With string argument +field_separator+, a new string that is equivalent to
+ *      <tt>join(field_separator)</tt>.
+ *
+ *  - #pack: Packs the elements into a binary sequence.
+ *  - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
+ */
+
+void
+Init_Array(void)
+{
+    fake_ary_flags = init_fake_ary_flags();
+
+    rb_cArray  = rb_define_class("Array", rb_cObject);
+    rb_include_module(rb_cArray, rb_mEnumerable);
+
+    rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
+    rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
+    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
+    rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
+    rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
+
+    rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+    rb_define_alias(rb_cArray,  "to_s", "inspect");
+    rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
+    rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
+    rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
+
+    rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
+    rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
+    rb_define_method(rb_cArray, "hash", rb_ary_hash, 0);
+
+    rb_define_method(rb_cArray, "[]", rb_ary_aref, -1);
+    rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
+    rb_define_method(rb_cArray, "at", rb_ary_at, 1);
+    rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
+    rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+    rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+    rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+    rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+    rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
+    rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
+    rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+    rb_define_alias(rb_cArray,  "append", "push");
+    rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+    rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+    rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+    rb_define_alias(rb_cArray,  "prepend", "unshift");
+    rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
+    rb_define_method(rb_cArray, "each", rb_ary_each, 0);
+    rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
+    rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
+    rb_define_method(rb_cArray, "length", rb_ary_length, 0);
+    rb_define_method(rb_cArray, "size", rb_ary_length, 0);
+    rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
+    rb_define_method(rb_cArray, "find", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "detect", rb_ary_find, -1);
+    rb_define_method(rb_cArray, "rfind", rb_ary_rfind, -1);
+    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+    rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
+    rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
+    rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
+    rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
+    rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
+    rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
+    rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
+    rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
+    rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
+    rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
+    rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
+    rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
+    rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
+    rb_define_method(rb_cArray, "delete_if", rb_ary_delete_if, 0);
+    rb_define_method(rb_cArray, "reject", rb_ary_reject, 0);
+    rb_define_method(rb_cArray, "reject!", rb_ary_reject_bang, 0);
+    rb_define_method(rb_cArray, "zip", rb_ary_zip, -1);
+    rb_define_method(rb_cArray, "transpose", rb_ary_transpose, 0);
+    rb_define_method(rb_cArray, "replace", rb_ary_replace, 1);
+    rb_define_method(rb_cArray, "clear", rb_ary_clear, 0);
+    rb_define_method(rb_cArray, "fill", rb_ary_fill, -1);
+    rb_define_method(rb_cArray, "include?", rb_ary_includes, 1);
+    rb_define_method(rb_cArray, "<=>", rb_ary_cmp, 1);
+
+    rb_define_method(rb_cArray, "slice", rb_ary_aref, -1);
+    rb_define_method(rb_cArray, "slice!", rb_ary_slice_bang, -1);
+
+    rb_define_method(rb_cArray, "assoc", rb_ary_assoc, 1);
+    rb_define_method(rb_cArray, "rassoc", rb_ary_rassoc, 1);
+
+    rb_define_method(rb_cArray, "+", rb_ary_plus, 1);
+    rb_define_method(rb_cArray, "*", rb_ary_times, 1);
+
+    rb_define_method(rb_cArray, "-", rb_ary_diff, 1);
+    rb_define_method(rb_cArray, "&", rb_ary_and, 1);
+    rb_define_method(rb_cArray, "|", rb_ary_or, 1);
+
+    rb_define_method(rb_cArray, "max", rb_ary_max, -1);
+    rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+    rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
+
+    rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
+    rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
+    rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
+    rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
+    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+    rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
+    rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+    rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+    rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+    rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+    rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
+    rb_define_method(rb_cArray, "freeze", rb_ary_freeze, 0);
+
+    rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
+
+    rb_cArray_empty_frozen = RB_OBJ_SET_SHAREABLE(rb_ary_freeze(rb_ary_new()));
+    rb_vm_register_global_object(rb_cArray_empty_frozen);
+}
+
+#include "array.rbinc"
diff --git a/array.rb b/array.rb
new file mode 100644
index 0000000000..81beff0b1c
--- /dev/null
+++ b/array.rb
@@ -0,0 +1,287 @@
+class Array
+  # call-seq:
+  #   shuffle!(random: Random) -> self
+  #
+  # Shuffles all elements in +self+ into a random order,
+  # as selected by the object given by the keyword argument +random+.
+  # Returns +self+:
+  #
+  #   a =             [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle! # => [5, 3, 8, 7, 6, 1, 9, 4, 2, 0]
+  #   a.shuffle! # => [9, 4, 0, 6, 2, 8, 1, 5, 3, 7]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =             [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle! # => [1, 0, 0, 1, 1, 0, 1, 0, 0, 1]
+  #   a.shuffle! # => [0, 1, 0, 1, 1, 0, 1, 0, 1, 0]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+  def shuffle!(random: Random)
+    Primitive.rb_ary_shuffle_bang(random)
+  end
+
+  # call-seq:
+  #   shuffle(random: Random) -> new_array
+  #
+  # Returns a new array containing all elements from +self+ in a random order,
+  # as selected by the object given by the keyword argument +random+:
+  #
+  #   a =            [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.shuffle # => [0, 8, 1, 9, 6, 3, 4, 7, 2, 5]
+  #   a.shuffle # => [8, 9, 0, 5, 1, 2, 6, 4, 7, 3]
+  #
+  # Duplicate elements are included:
+  #
+  #   a =            [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
+  #   a.shuffle # => [1, 0, 1, 1, 0, 0, 1, 0, 0, 1]
+  #   a.shuffle # => [1, 1, 0, 0, 0, 1, 1, 0, 0, 1]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator.
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def shuffle(random: Random)
+    Primitive.rb_ary_shuffle(random)
+  end
+
+  # call-seq:
+  #   sample(random: Random) -> object
+  #   sample(count, random: Random) -> new_ary
+  #
+  # Returns random elements from +self+,
+  # as selected by the object given by the keyword argument +random+.
+  #
+  # With no argument +count+ given, returns one random element from +self+:
+  #
+  #   a = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
+  #   a.sample # => 3
+  #   a.sample # => 8
+  #
+  # Returns +nil+ if +self+ is empty:
+  #
+  #   [].sample # => nil
+  #
+  # With a non-negative numeric argument +count+ given,
+  # returns a new array containing +count+ random elements from +self+:
+  #
+  #   a.sample(3) # => [8, 9, 2]
+  #   a.sample(6) # => [9, 6, 0, 3, 1, 4]
+  #
+  # The order of the result array is unrelated to the order of +self+.
+  #
+  # Returns a new empty array if +self+ is empty:
+  #
+  #   [].sample(4) # => []
+  #
+  # May return duplicates in +self+:
+  #
+  #   a = [1, 1, 1, 2, 2, 3]
+  #   a.sample(a.size) # => [1, 1, 3, 2, 1, 2]
+  #
+  # Returns no more than <tt>a.size</tt> elements
+  # (because no new duplicates are introduced):
+  #
+  #   a.sample(50) # => [6, 4, 1, 8, 5, 9, 0, 2, 3, 7]
+  #
+  # The object given with the keyword argument +random+ is used as the random number generator:
+  #
+  #   a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+  #   a.sample(random: Random.new(1))     # => 6
+  #   a.sample(4, random: Random.new(1))  # => [6, 10, 9, 2]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def sample(n = (ary = false), random: Random)
+    if Primitive.mandatory_only?
+      # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
+      Primitive.ary_sample0
+    else
+      # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
+      Primitive.ary_sample(random, n, ary)
+    end
+  end
+
+  # call-seq:
+  #   first -> object or nil
+  #   first(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; does not modify +self+.
+  #
+  # With no argument given, returns the first element (if available):
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.first # => :foo
+  #   a # => [:foo, "bar", 2]
+  #
+  # If +self+ is empty, returns +nil+.
+  #
+  #   [].first # => nil
+  #
+  # With a non-negative integer argument +count+ given,
+  # returns the first +count+ elements (as available) in a new array:
+  #
+  #   a.first(0)  # => []
+  #   a.first(2)  # => [:foo, "bar"]
+  #   a.first(50) # => [:foo, "bar", 2]
+  #
+  # Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+  def first n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_first(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_first(self) }
+      else
+        Primitive.cexpr! %q{  ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_FIRST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #  last  -> last_object or nil
+  #  last(count) -> new_array
+  #
+  # Returns elements from +self+, or +nil+; +self+ is not modified.
+  #
+  # With no argument given, returns the last element, or +nil+ if +self+ is empty:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last # => 2
+  #   a # => [:foo, "bar", 2]
+  #   [].last # => nil
+  #
+  #
+  # With non-negative integer argument +count+ given,
+  # returns a new array containing the trailing +count+ elements of +self+, as available:
+  #
+  #   a = [:foo, 'bar', 2]
+  #   a.last(2)  # => ["bar", 2]
+  #   a.last(50) # => [:foo, "bar", 2]
+  #   a.last(0)  # => []
+  #   [].last(3) # => []
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def last n = unspecified = true
+    if Primitive.mandatory_only?
+      Primitive.attr! :leaf
+      Primitive.cexpr! %q{ ary_last(self) }
+    else
+      if unspecified
+        Primitive.cexpr! %q{ ary_last(self) }
+      else
+        Primitive.cexpr! %q{ ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_LAST) }
+      end
+    end
+  end
+
+  # call-seq:
+  #   fetch_values(*indexes) -> new_array
+  #   fetch_values(*indexes) { |index| ... } -> new_array
+  #
+  # With no block given, returns a new array containing the elements of +self+
+  # at the offsets specified by +indexes+. Each of the +indexes+ must be an
+  # {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]:
+  #
+  #    a = [:foo, :bar, :baz]
+  #    a.fetch_values(2, 0)   # => [:baz, :foo]
+  #    a.fetch_values(2.1, 0) # => [:baz, :foo]
+  #    a.fetch_values         # => []
+  #
+  # For a negative index, counts backwards from the end of the array:
+  #
+  #    a.fetch_values(-2, -1) # [:bar, :baz]
+  #
+  # When no block is given, raises an exception if any index is out of range.
+  #
+  # With a block given, for each index:
+  #
+  # - If the index is in range, uses an element of +self+ (as above).
+  # - Otherwise, calls the block with the index and uses the block's return value.
+  #
+  # Example:
+  #
+  #   a = [:foo, :bar, :baz]
+  #   a.fetch_values(1, 0, 42, 777) { |index| index.to_s }
+  #   # => [:bar, :foo, "42", "777"]
+  #
+  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+  def fetch_values(*indexes, &block)
+    indexes.map! { |i| fetch(i, &block) }
+    indexes
+  end
+
+  with_jit do
+    if Primitive.rb_builtin_basic_definition_p(:each)
+      undef :each
+
+      def each # :nodoc:
+        Primitive.attr! :inline_block, :c_trace
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+        _i = 0
+        value = nil
+        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
+          yield value
+        end
+        self
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:map)
+      undef :map
+
+      def map # :nodoc:
+        Primitive.attr! :inline_block, :c_trace
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        _i = 0
+        value = nil
+        result = Primitive.ary_sized_alloc
+        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
+          value = yield(value)
+          Primitive.cexpr!(%q{ rb_ary_push(result, value) })
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:collect)
+        undef :collect
+        alias collect map
+      end
+    end
+
+    if Primitive.rb_builtin_basic_definition_p(:select)
+      undef :select
+
+      def select # :nodoc:
+        Primitive.attr! :inline_block, :c_trace
+
+        unless defined?(yield)
+          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
+        end
+
+        _i = 0
+        value = nil
+        result = Primitive.ary_sized_alloc
+        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
+          if yield value
+            Primitive.cexpr!(%q{ rb_ary_push(result, value) })
+          end
+        end
+        result
+      end
+
+      if Primitive.rb_builtin_basic_definition_p(:filter)
+        undef :filter
+        alias filter select
+      end
+    end
+  end
+end
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..5357aa38a5
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,1165 @@
+/* indent-tabs-mode: nil */
+#include "internal.h"
+#include "internal/ruby_parser.h"
+#include "internal/symbol.h"
+#include "internal/warnings.h"
+#include "iseq.h"
+#include "node.h"
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "vm_core.h"
+
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+static VALUE rb_cLocation;
+
+struct ASTNodeData {
+    VALUE ast_value;
+    const NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    rb_gc_mark(data->ast_value);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+    size_t size = sizeof(struct ASTNodeData);
+    if (data->ast_value) {
+        rb_ast_t *ast = rb_ruby_ast_data_get(data->ast_value);
+        size += rb_ast_memsize(ast);
+    }
+
+    return size;
+}
+
+static const rb_data_type_t rb_node_type = {
+    "AST/node",
+    {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+struct ASTLocationData {
+    int first_lineno;
+    int first_column;
+    int last_lineno;
+    int last_column;
+};
+
+static void
+location_gc_mark(void *ptr)
+{
+}
+
+static size_t
+location_memsize(const void *ptr)
+{
+    return sizeof(struct ASTLocationData);
+}
+
+static const rb_data_type_t rb_location_type = {
+    "AST/location",
+    {location_gc_mark, RUBY_TYPED_DEFAULT_FREE, location_memsize,},
+    0, 0,
+    RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, VALUE ast_value, const NODE *node)
+{
+    struct ASTNodeData *data;
+
+    TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+    data->ast_value = ast_value;
+    data->node = node;
+}
+
+static VALUE
+ast_new_internal(VALUE ast_value, const NODE *node)
+{
+    VALUE obj;
+
+    obj = rb_ast_node_alloc(rb_cNode);
+    setup_node(obj, ast_value, node);
+
+    return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
+
+static VALUE
+ast_parse_new(void)
+{
+    return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(VALUE ast_value)
+{
+    rb_ast_t *ast = rb_ruby_ast_data_get(ast_value);
+
+    if (!ast->body.root) {
+        rb_ast_dispose(ast);
+        rb_exc_raise(GET_EC()->errinfo);
+    }
+
+    return ast_new_internal(ast_value, (NODE *)ast->body.root);
+}
+
+static VALUE
+setup_vparser(VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE vparser = ast_parse_new();
+    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
+    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
+    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
+    return vparser;
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+    StringValue(str);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_string_path(vparser, Qnil, str, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE f;
+    VALUE ast_value = Qnil;
+    rb_encoding *enc = rb_utf8_encoding();
+
+    f = rb_file_open_str(path, "r");
+    rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_file_path(vparser, Qnil, f, 1);
+    rb_io_close(f);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE ast_value = Qnil;
+
+    array = rb_check_array_type(array);
+    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
+    ast_value = rb_parser_compile_array(vparser, Qnil, array, 1);
+    return ast_parse_done(ast_value);
+}
+
+static VALUE node_children(VALUE, const NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+    VALUE ary;
+    long i;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    if (nd_node_id(data->node) == node_id) return self;
+
+    ary = node_children(data->ast_value, data->node);
+
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+        VALUE child = RARRAY_AREF(ary, i);
+
+        if (CLASS_OF(child) == rb_cNode) {
+            VALUE result = node_find(child, node_id);
+            if (RTEST(result)) return result;
+        }
+    }
+
+    return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
+{
+    int node_id;
+
+    if (!rb_frame_info_p(location)) {
+        rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
+    }
+
+    node_id = rb_get_node_id_from_frame_info(location);
+    if (node_id == -1) {
+        return Qnil;
+    }
+
+    return INT2NUM(node_id);
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
+{
+    VALUE node, lines = Qnil;
+    const rb_iseq_t *iseq;
+    int node_id;
+
+    if (rb_frame_info_p(body)) {
+        iseq = rb_get_iseq_from_frame_info(body);
+        node_id = rb_get_node_id_from_frame_info(body);
+    }
+    else {
+        iseq = NULL;
+
+        if (rb_obj_is_proc(body)) {
+            iseq = vm_proc_iseq(body);
+
+            if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
+        }
+        else {
+            iseq = rb_method_iseq(body);
+        }
+        if (iseq) {
+            node_id = ISEQ_BODY(iseq)->location.node_id;
+        }
+    }
+
+    if (!iseq) {
+        return Qnil;
+    }
+
+    if (ISEQ_BODY(iseq)->prism) {
+        rb_raise(rb_eRuntimeError, "cannot get AST for ISEQ compiled by prism");
+    }
+
+    lines = ISEQ_BODY(iseq)->variable.script_lines;
+
+    VALUE path = rb_iseq_path(iseq);
+    int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
+
+    if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
+        rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
+    }
+
+    if (!NIL_P(lines)) {
+        node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else if (e_option) {
+        node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
+    }
+    else {
+        node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
+    }
+
+    return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+    struct ASTNodeData *data;
+    VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+    return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+    return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+static VALUE
+ast_node_node_id(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2FIX(nd_node_id(data->node));
+}
+
+#define NEW_CHILD(ast_value, node) (node ? ast_new_internal(ast_value, node) : Qnil)
+
+static VALUE
+rb_ary_new_from_node_args(VALUE ast_value, long n, ...)
+{
+    va_list ar;
+    VALUE ary;
+    long i;
+
+    ary = rb_ary_new2(n);
+
+    va_start(ar, n);
+    for (i=0; i<n; i++) {
+        NODE *node;
+        node = va_arg(ar, NODE *);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node));
+    }
+    va_end(ar);
+    return ary;
+}
+
+static VALUE
+dump_block(VALUE ast_value, const struct RNode_BLOCK *node)
+{
+    VALUE ary = rb_ary_new();
+    do {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    } while (node->nd_next &&
+        nd_type_p(node->nd_next, NODE_BLOCK) &&
+        (node = RNODE_BLOCK(node->nd_next), 1));
+    if (node->nd_next) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+    }
+
+    return ary;
+}
+
+static VALUE
+dump_array(VALUE ast_value, const struct RNode_LIST *node)
+{
+    VALUE ary = rb_ary_new();
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+
+    while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
+        node = RNODE_LIST(node->nd_next);
+        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
+    }
+    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
+
+    return ary;
+}
+
+static VALUE
+dump_parser_array(VALUE ast_value, rb_parser_ary_t *p_ary)
+{
+    VALUE ary;
+
+    if (p_ary->data_type != PARSER_ARY_DATA_NODE) {
+        rb_bug("unexpected rb_parser_ary_data_type: %d", p_ary->data_type);
+    }
+
+    ary = rb_ary_new();
+
+    for (long i = 0; i < p_ary->len; i++) {
+        rb_ary_push(ary, NEW_CHILD(ast_value, p_ary->data[i]));
+    }
+
+    return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+    if (!id) return Qnil;
+    if (!rb_id2str(id)) return Qnil;
+    return ID2SYM(id);
+}
+
+static VALUE
+no_name_rest(void)
+{
+    ID rest;
+    CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
+    return ID2SYM(rest);
+}
+
+static VALUE
+rest_arg(VALUE ast_value, const NODE *rest_arg)
+{
+    return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast_value, rest_arg) : no_name_rest();
+}
+
+static VALUE
+node_children(VALUE ast_value, const NODE *node)
+{
+    char name[sizeof("$") + DECIMAL_SIZE_OF(long)];
+
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_BLOCK:
+        return dump_block(ast_value, RNODE_BLOCK(node));
+      case NODE_IF:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IF(node)->nd_cond, RNODE_IF(node)->nd_body, RNODE_IF(node)->nd_else);
+      case NODE_UNLESS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_UNLESS(node)->nd_cond, RNODE_UNLESS(node)->nd_body, RNODE_UNLESS(node)->nd_else);
+      case NODE_CASE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE(node)->nd_head, RNODE_CASE(node)->nd_body);
+      case NODE_CASE2:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE2(node)->nd_head, RNODE_CASE2(node)->nd_body);
+      case NODE_CASE3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE3(node)->nd_head, RNODE_CASE3(node)->nd_body);
+      case NODE_WHEN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_WHEN(node)->nd_head, RNODE_WHEN(node)->nd_body, RNODE_WHEN(node)->nd_next);
+      case NODE_IN:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IN(node)->nd_head, RNODE_IN(node)->nd_body, RNODE_IN(node)->nd_next);
+      case NODE_WHILE:
+      case NODE_UNTIL:
+        return rb_ary_push(rb_ary_new_from_node_args(ast_value, 2, RNODE_WHILE(node)->nd_cond, RNODE_WHILE(node)->nd_body),
+                           RBOOL(RNODE_WHILE(node)->nd_state));
+      case NODE_ITER:
+      case NODE_FOR:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ITER(node)->nd_iter, RNODE_ITER(node)->nd_body);
+      case NODE_FOR_MASGN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_FOR_MASGN(node)->nd_var);
+      case NODE_BREAK:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BREAK(node)->nd_stts);
+      case NODE_NEXT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_NEXT(node)->nd_stts);
+      case NODE_RETURN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_RETURN(node)->nd_stts);
+      case NODE_REDO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_RETRY:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_BEGIN:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BEGIN(node)->nd_body);
+      case NODE_RESCUE:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_RESCUE(node)->nd_head, RNODE_RESCUE(node)->nd_resq, RNODE_RESCUE(node)->nd_else);
+      case NODE_RESBODY:
+        return rb_ary_new_from_node_args(ast_value, 4, RNODE_RESBODY(node)->nd_args, RNODE_RESBODY(node)->nd_exc_var, RNODE_RESBODY(node)->nd_body, RNODE_RESBODY(node)->nd_next);
+      case NODE_ENSURE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ENSURE(node)->nd_head, RNODE_ENSURE(node)->nd_ensr);
+      case NODE_AND:
+      case NODE_OR:
+        {
+            VALUE ary = rb_ary_new();
+
+            while (1) {
+                rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_1st));
+                if (!RNODE_AND(node)->nd_2nd || !nd_type_p(RNODE_AND(node)->nd_2nd, type))
+                    break;
+                node = RNODE_AND(node)->nd_2nd;
+            }
+            rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_2nd));
+            return ary;
+        }
+      case NODE_MASGN:
+        if (NODE_NAMED_REST_P(RNODE_MASGN(node)->nd_args)) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MASGN(node)->nd_value, RNODE_MASGN(node)->nd_head, RNODE_MASGN(node)->nd_args);
+        }
+        else {
+            return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_value),
+                                        NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_head),
+                                        no_name_rest());
+        }
+      case NODE_LASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_LASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_LASGN(node)->nd_value));
+      case NODE_DASGN:
+        if (NODE_REQUIRED_KEYWORD_P(RNODE_DASGN(node)->nd_value)) {
+            return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+        }
+        return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_DASGN(node)->nd_value));
+      case NODE_IASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_IASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_IASGN(node)->nd_value));
+      case NODE_CVASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_CVASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CVASGN(node)->nd_value));
+      case NODE_GASGN:
+        return rb_ary_new_from_args(2, var_name(RNODE_GASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_GASGN(node)->nd_value));
+      case NODE_CDECL:
+        if (RNODE_CDECL(node)->nd_vid) {
+            return rb_ary_new_from_args(2, ID2SYM(RNODE_CDECL(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+        }
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_else), ID2SYM(RNODE_COLON2(RNODE_CDECL(node)->nd_else)->nd_mid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(4, NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_recv),
+                                    ID2SYM(RNODE_OP_ASGN1(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_index),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_rvalue));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(5, NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_recv),
+                                    RBOOL(RNODE_OP_ASGN2(node)->nd_aid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_vid),
+                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_value));
+      case NODE_OP_ASGN_AND:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_head), ID2SYM(idANDOP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_value));
+      case NODE_OP_ASGN_OR:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_head), ID2SYM(idOROP),
+                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_value));
+      case NODE_OP_CDECL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_head),
+                                    ID2SYM(RNODE_OP_CDECL(node)->nd_aid),
+                                    NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_value));
+      case NODE_CALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CALL(node)->nd_recv),
+                                    ID2SYM(RNODE_CALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_CALL(node)->nd_args));
+      case NODE_OPCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_OPCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_args));
+      case NODE_QCALL:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_recv),
+                                    ID2SYM(RNODE_QCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_args));
+      case NODE_FCALL:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_FCALL(node)->nd_mid),
+                                    NEW_CHILD(ast_value, RNODE_FCALL(node)->nd_args));
+      case NODE_VCALL:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_VCALL(node)->nd_mid));
+      case NODE_SUPER:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SUPER(node)->nd_args);
+      case NODE_ZSUPER:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_LIST:
+        return dump_array(ast_value, RNODE_LIST(node));
+      case NODE_ZLIST:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_HASH:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_HASH(node)->nd_head);
+      case NODE_YIELD:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_YIELD(node)->nd_head);
+      case NODE_LVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_LVAR(node)->nd_vid));
+      case NODE_DVAR:
+        return rb_ary_new_from_args(1, var_name(RNODE_DVAR(node)->nd_vid));
+      case NODE_IVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_IVAR(node)->nd_vid));
+      case NODE_CONST:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CONST(node)->nd_vid));
+      case NODE_CVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_CVAR(node)->nd_vid));
+      case NODE_GVAR:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_GVAR(node)->nd_vid));
+      case NODE_NTH_REF:
+        snprintf(name, sizeof(name), "$%ld", RNODE_NTH_REF(node)->nd_nth);
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_BACK_REF:
+        name[0] = '$';
+        name[1] = (char)RNODE_BACK_REF(node)->nd_nth;
+        name[2] = '\0';
+        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+      case NODE_MATCH:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_MATCH2:
+        if (RNODE_MATCH2(node)->nd_args) {
+            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value, RNODE_MATCH2(node)->nd_args);
+        }
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value);
+      case NODE_MATCH3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH3(node)->nd_recv, RNODE_MATCH3(node)->nd_value);
+      case NODE_STR:
+      case NODE_XSTR:
+        return rb_ary_new_from_args(1, rb_node_str_string_val(node));
+      case NODE_INTEGER:
+        return rb_ary_new_from_args(1, rb_node_integer_literal_val(node));
+      case NODE_FLOAT:
+        return rb_ary_new_from_args(1, rb_node_float_literal_val(node));
+      case NODE_RATIONAL:
+        return rb_ary_new_from_args(1, rb_node_rational_literal_val(node));
+      case NODE_IMAGINARY:
+        return rb_ary_new_from_args(1, rb_node_imaginary_literal_val(node));
+      case NODE_REGX:
+        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
+      case NODE_ONCE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_ONCE(node)->nd_body);
+      case NODE_DSTR:
+      case NODE_DXSTR:
+      case NODE_DREGX:
+      case NODE_DSYM:
+        {
+            struct RNode_LIST *n = RNODE_DSTR(node)->nd_next;
+            VALUE head = Qnil, next = Qnil;
+            if (n) {
+                head = NEW_CHILD(ast_value, n->nd_head);
+                next = NEW_CHILD(ast_value, n->nd_next);
+            }
+            return rb_ary_new_from_args(3, rb_node_dstr_string_val(node), head, next);
+        }
+      case NODE_SYM:
+        return rb_ary_new_from_args(1, rb_node_sym_string_val(node));
+      case NODE_EVSTR:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_EVSTR(node)->nd_body);
+      case NODE_ARGSCAT:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSCAT(node)->nd_head, RNODE_ARGSCAT(node)->nd_body);
+      case NODE_ARGSPUSH:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSPUSH(node)->nd_head, RNODE_ARGSPUSH(node)->nd_body);
+      case NODE_SPLAT:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SPLAT(node)->nd_head);
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_BLOCK_PASS(node)->nd_head, RNODE_BLOCK_PASS(node)->nd_body);
+      case NODE_DEFN:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_DEFN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFN(node)->nd_defn));
+      case NODE_DEFS:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_recv), ID2SYM(RNODE_DEFS(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_defn));
+      case NODE_ALIAS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ALIAS(node)->nd_1st, RNODE_ALIAS(node)->nd_2nd);
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2, ID2SYM(RNODE_VALIAS(node)->nd_alias), ID2SYM(RNODE_VALIAS(node)->nd_orig));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(1, dump_parser_array(ast_value, RNODE_UNDEF(node)->nd_undefs));
+      case NODE_CLASS:
+        return rb_ary_new_from_node_args(ast_value, 3, RNODE_CLASS(node)->nd_cpath, RNODE_CLASS(node)->nd_super, RNODE_CLASS(node)->nd_body);
+      case NODE_MODULE:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MODULE(node)->nd_cpath, RNODE_MODULE(node)->nd_body);
+      case NODE_SCLASS:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_SCLASS(node)->nd_recv, RNODE_SCLASS(node)->nd_body);
+      case NODE_COLON2:
+        return rb_ary_new_from_args(2, NEW_CHILD(ast_value, RNODE_COLON2(node)->nd_head), ID2SYM(RNODE_COLON2(node)->nd_mid));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(1, ID2SYM(RNODE_COLON3(node)->nd_mid));
+      case NODE_DOT2:
+      case NODE_DOT3:
+      case NODE_FLIP2:
+      case NODE_FLIP3:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_DOT2(node)->nd_beg, RNODE_DOT2(node)->nd_end);
+      case NODE_SELF:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_NIL:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_TRUE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_FALSE:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ERRINFO:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_DEFINED:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_DEFINED(node)->nd_head);
+      case NODE_POSTEXE:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_POSTEXE(node)->nd_body);
+      case NODE_ATTRASGN:
+        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_recv), ID2SYM(RNODE_ATTRASGN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_args));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_node_args(ast_value, 1, RNODE_LAMBDA(node)->nd_body);
+      case NODE_OPT_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_OPT_ARG(node)->nd_body, RNODE_OPT_ARG(node)->nd_next);
+      case NODE_KW_ARG:
+        return rb_ary_new_from_node_args(ast_value, 2, RNODE_KW_ARG(node)->nd_body, RNODE_KW_ARG(node)->nd_next);
+      case NODE_POSTARG:
+        if (NODE_NAMED_REST_P(RNODE_POSTARG(node)->nd_1st)) {
+            return rb_ary_new_from_node_args(ast_value, 2, RNODE_POSTARG(node)->nd_1st, RNODE_POSTARG(node)->nd_2nd);
+        }
+        return rb_ary_new_from_args(2, no_name_rest(),
+                                    NEW_CHILD(ast_value, RNODE_POSTARG(node)->nd_2nd));
+      case NODE_ARGS:
+        {
+            struct rb_args_info *ainfo = &RNODE_ARGS(node)->nd_ainfo;
+            return rb_ary_new_from_args(10,
+                                        INT2NUM(ainfo->pre_args_num),
+                                        NEW_CHILD(ast_value, ainfo->pre_init),
+                                        NEW_CHILD(ast_value, (NODE *)ainfo->opt_args),
+                                        var_name(ainfo->first_post_arg),
+                                        INT2NUM(ainfo->post_args_num),
+                                        NEW_CHILD(ast_value, ainfo->post_init),
+                                        (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
+                                            ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
+                                            : var_name(ainfo->rest_arg)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, (NODE *)ainfo->kw_args)),
+                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, ainfo->kw_rest_arg)),
+                                        var_name(ainfo->block_arg));
+        }
+      case NODE_SCOPE:
+        {
+            rb_ast_id_table_t *tbl = RNODE_SCOPE(node)->nd_tbl;
+            int i, size = tbl ? tbl->size : 0;
+            VALUE locals = rb_ary_new_capa(size);
+            for (i = 0; i < size; i++) {
+                rb_ary_push(locals, var_name(tbl->ids[i]));
+            }
+            return rb_ary_new_from_args(3, locals, NEW_CHILD(ast_value, (NODE *)RNODE_SCOPE(node)->nd_args), NEW_CHILD(ast_value, RNODE_SCOPE(node)->nd_body));
+        }
+      case NODE_ARYPTN:
+        {
+            VALUE rest = rest_arg(ast_value, RNODE_ARYPTN(node)->rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->pre_args),
+                                        rest,
+                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->post_args));
+        }
+      case NODE_FNDPTN:
+        {
+            VALUE pre_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->pre_rest_arg);
+            VALUE post_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->post_rest_arg);
+            return rb_ary_new_from_args(4,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->nd_pconst),
+                                        pre_rest,
+                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->args),
+                                        post_rest);
+        }
+      case NODE_HSHPTN:
+        {
+            VALUE kwrest = RNODE_HSHPTN(node)->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+                                                                                 NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwrestarg);
+
+            return rb_ary_new_from_args(3,
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pconst),
+                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwargs),
+                                        kwrest);
+        }
+      case NODE_LINE:
+        return rb_ary_new_from_args(1, rb_node_line_lineno_val(node));
+      case NODE_FILE:
+        return rb_ary_new_from_args(1, rb_node_file_path_val(node));
+      case NODE_ENCODING:
+        return rb_ary_new_from_args(1, rb_node_encoding_val(node));
+      case NODE_ERROR:
+        return rb_ary_new_from_node_args(ast_value, 0);
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+    }
+
+    rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_children(data->ast_value, data->node);
+}
+
+static int
+null_loc_p(rb_code_location_t *loc)
+{
+    return (loc->beg_pos.lineno == 0 && loc->beg_pos.column == -1 && loc->end_pos.lineno == 0 && loc->end_pos.column == -1);
+}
+
+static VALUE
+location_new(rb_code_location_t *loc)
+{
+    VALUE obj;
+    struct ASTLocationData *data;
+
+    if (null_loc_p(loc)) return Qnil;
+
+    obj = TypedData_Make_Struct(rb_cLocation, struct ASTLocationData, &rb_location_type, data);
+    data->first_lineno = loc->beg_pos.lineno;
+    data->first_column = loc->beg_pos.column;
+    data->last_lineno = loc->end_pos.lineno;
+    data->last_column = loc->end_pos.column;
+
+    return obj;
+}
+
+static VALUE
+node_locations(VALUE ast_value, const NODE *node)
+{
+    enum node_type type = nd_type(node);
+    switch (type) {
+      case NODE_ALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_ALIAS(node)->keyword_loc));
+      case NODE_AND:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_AND(node)->operator_loc));
+      case NODE_BLOCK_PASS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BLOCK_PASS(node)->operator_loc));
+      case NODE_BREAK:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_BREAK(node)->keyword_loc));
+      case NODE_CASE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE(node)->end_keyword_loc));
+      case NODE_CASE2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE2(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE2(node)->end_keyword_loc));
+      case NODE_CASE3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CASE3(node)->case_keyword_loc),
+                                    location_new(&RNODE_CASE3(node)->end_keyword_loc));
+      case NODE_CLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_CLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_CLASS(node)->inheritance_operator_loc),
+                                    location_new(&RNODE_CLASS(node)->end_keyword_loc));
+      case NODE_COLON2:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON2(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON2(node)->name_loc));
+      case NODE_COLON3:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_COLON3(node)->delimiter_loc),
+                                    location_new(&RNODE_COLON3(node)->name_loc));
+      case NODE_DEFINED:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DEFINED(node)->keyword_loc));
+      case NODE_DOT2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT2(node)->operator_loc));
+      case NODE_DOT3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_DOT3(node)->operator_loc));
+      case NODE_EVSTR:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_EVSTR(node)->opening_loc),
+                                    location_new(&RNODE_EVSTR(node)->closing_loc));
+      case NODE_FLIP2:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP2(node)->operator_loc));
+      case NODE_FLIP3:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FLIP3(node)->operator_loc));
+      case NODE_FOR:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_FOR(node)->for_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->in_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->do_keyword_loc),
+                                    location_new(&RNODE_FOR(node)->end_keyword_loc));
+      case NODE_LAMBDA:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_LAMBDA(node)->operator_loc),
+                                    location_new(&RNODE_LAMBDA(node)->opening_loc),
+                                    location_new(&RNODE_LAMBDA(node)->closing_loc));
+      case NODE_IF:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IF(node)->if_keyword_loc),
+                                    location_new(&RNODE_IF(node)->then_keyword_loc),
+                                    location_new(&RNODE_IF(node)->end_keyword_loc));
+      case NODE_IN:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_IN(node)->in_keyword_loc),
+                                    location_new(&RNODE_IN(node)->then_keyword_loc),
+                                    location_new(&RNODE_IN(node)->operator_loc));
+      case NODE_MODULE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_MODULE(node)->module_keyword_loc),
+                                    location_new(&RNODE_MODULE(node)->end_keyword_loc));
+      case NODE_NEXT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_NEXT(node)->keyword_loc));
+      case NODE_OR:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OR(node)->operator_loc));
+      case NODE_OP_ASGN1:
+        return rb_ary_new_from_args(5,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN1(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->opening_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->closing_loc),
+                                    location_new(&RNODE_OP_ASGN1(node)->binary_operator_loc));
+      case NODE_OP_ASGN2:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_OP_ASGN2(node)->call_operator_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->message_loc),
+                                    location_new(&RNODE_OP_ASGN2(node)->binary_operator_loc));
+      case NODE_POSTEXE:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_POSTEXE(node)->keyword_loc),
+                                    location_new(&RNODE_POSTEXE(node)->opening_loc),
+                                    location_new(&RNODE_POSTEXE(node)->closing_loc));
+      case NODE_REDO:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REDO(node)->keyword_loc));
+      case NODE_REGX:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_REGX(node)->opening_loc),
+                                    location_new(&RNODE_REGX(node)->content_loc),
+                                    location_new(&RNODE_REGX(node)->closing_loc));
+      case NODE_RETURN:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_RETURN(node)->keyword_loc));
+
+      case NODE_SCLASS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SCLASS(node)->class_keyword_loc),
+                                    location_new(&RNODE_SCLASS(node)->operator_loc),
+                                    location_new(&RNODE_SCLASS(node)->end_keyword_loc));
+
+      case NODE_SPLAT:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SPLAT(node)->operator_loc));
+      case NODE_SUPER:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_SUPER(node)->keyword_loc),
+                                    location_new(&RNODE_SUPER(node)->lparen_loc),
+                                    location_new(&RNODE_SUPER(node)->rparen_loc));
+      case NODE_UNDEF:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNDEF(node)->keyword_loc));
+      case NODE_UNLESS:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNLESS(node)->keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->then_keyword_loc),
+                                    location_new(&RNODE_UNLESS(node)->end_keyword_loc));
+      case NODE_VALIAS:
+        return rb_ary_new_from_args(2,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_VALIAS(node)->keyword_loc));
+      case NODE_WHEN:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHEN(node)->keyword_loc),
+                                    location_new(&RNODE_WHEN(node)->then_keyword_loc));
+      case NODE_WHILE:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_WHILE(node)->keyword_loc),
+                                    location_new(&RNODE_WHILE(node)->closing_loc));
+      case NODE_UNTIL:
+        return rb_ary_new_from_args(3,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_UNTIL(node)->keyword_loc),
+                                    location_new(&RNODE_UNTIL(node)->closing_loc));
+      case NODE_YIELD:
+        return rb_ary_new_from_args(4,
+                                    location_new(nd_code_loc(node)),
+                                    location_new(&RNODE_YIELD(node)->keyword_loc),
+                                    location_new(&RNODE_YIELD(node)->lparen_loc),
+                                    location_new(&RNODE_YIELD(node)->rparen_loc));
+      case NODE_ARGS_AUX:
+      case NODE_LAST:
+        break;
+      default:
+        return rb_ary_new_from_args(1, location_new(nd_code_loc(node)));
+    }
+
+    rb_bug("node_locations: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_locations(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return node_locations(data->ast_value, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
+{
+    long i;
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    rb_parser_ary_t *parser_tokens;
+    rb_parser_ast_token_t *parser_token;
+    VALUE str, loc, token, all_tokens;
+
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+
+    parser_tokens = ast->node_buffer->tokens;
+    if (parser_tokens == NULL) {
+        return Qnil;
+    }
+
+    all_tokens = rb_ary_new2(parser_tokens->len);
+    for (i = 0; i < parser_tokens->len; i++) {
+        parser_token = parser_tokens->data[i];
+        str = rb_str_new(parser_token->str->ptr, parser_token->str->len);
+        loc = rb_ary_new_from_args(4,
+            INT2FIX(parser_token->loc.beg_pos.lineno),
+            INT2FIX(parser_token->loc.beg_pos.column),
+            INT2FIX(parser_token->loc.end_pos.lineno),
+            INT2FIX(parser_token->loc.end_pos.column)
+        );
+        token = rb_ary_new_from_args(4, INT2FIX(parser_token->id), ID2SYM(rb_intern(parser_token->type_name)), str, loc);
+        rb_ary_push(all_tokens, token);
+    }
+    rb_ary_freeze(all_tokens);
+
+    return all_tokens;
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTNodeData *data;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+                node_type_to_str(data->node),
+                nd_first_lineno(data->node), nd_first_column(data->node),
+                nd_last_lineno(data->node), nd_last_column(data->node));
+
+    return str;
+}
+
+static VALUE
+ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTNodeData *data;
+    rb_ast_t *ast;
+    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+    ast = rb_ruby_ast_data_get(data->ast_value);
+    rb_parser_ary_t *ret = ast->body.script_lines;
+    return rb_parser_build_script_lines_from(ret);
+}
+
+static VALUE
+ast_location_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_lineno);
+}
+
+static VALUE
+ast_location_first_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->first_column);
+}
+
+static VALUE
+ast_location_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_lineno);
+}
+
+static VALUE
+ast_location_last_column(rb_execution_context_t *ec, VALUE self)
+{
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    return INT2NUM(data->last_column);
+}
+
+static VALUE
+ast_location_inspect(rb_execution_context_t *ec, VALUE self)
+{
+    VALUE str;
+    VALUE cname;
+    struct ASTLocationData *data;
+    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
+
+    cname = rb_class_path(rb_obj_class(self));
+    str = rb_str_new2("#<");
+
+    rb_str_append(str, cname);
+    rb_str_catf(str, ":@%d:%d-%d:%d>",
+                data->first_lineno, data->first_column,
+                data->last_lineno, data->last_column);
+
+    return str;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+    rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+    rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+    rb_cLocation = rb_define_class_under(rb_mAST, "Location", rb_cObject);
+    rb_undef_alloc_func(rb_cNode);
+    rb_undef_alloc_func(rb_cLocation);
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..6380621780
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,332 @@
+# for ast.c
+
+# AbstractSyntaxTree provides methods to parse Ruby code into
+# abstract syntax trees. The nodes in the tree
+# are instances of RubyVM::AbstractSyntaxTree::Node.
+#
+# This module is MRI specific as it exposes implementation details
+# of the MRI abstract syntax tree.
+#
+# This module is experimental and its API is not stable, therefore it might
+# change without notice. As examples, the order of children nodes is not
+# guaranteed, the number of children nodes might change, there is no way to
+# access children nodes by name, etc.
+#
+# If you are looking for a stable API or an API working under multiple Ruby
+# implementations, consider using the _prism_ gem, which is the official
+# Ruby API to parse Ruby code.
+#
+module RubyVM::AbstractSyntaxTree
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #  Parses the given _string_ into an abstract syntax tree,
+  #  returning the root node of that tree.
+  #
+  #    RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+  #    # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+  #
+  #  If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
+  #  source is associated with nodes and is available via Node#script_lines.
+  #
+  #  If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
+  #
+  #  SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
+  #  behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
+  #  will produce a tree where expressions with syntax errors would be represented by
+  #  Node with <tt>type=:ERROR</tt>.
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
+  #     # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
+  #     # x = 1; p(x; y=2
+  #     #           ^
+  #
+  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
+  #     # (SCOPE@1:0-1:15
+  #     #  tbl: [:x, :y]
+  #     #  args: nil
+  #     #  body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
+  #     root.children.last.children
+  #     # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
+  #     #  (ERROR@1:7-1:11),
+  #     #  (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
+  #
+  #  Note that parsing continues even after the errored expression.
+  #
+  def self.parse string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Reads the file from _pathname_, then parses it like ::parse,
+  #   returning the root node of the abstract syntax tree.
+  #
+  #   SyntaxError is raised if _pathname_'s contents are not
+  #   valid Ruby syntax.
+  #
+  #     RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.parse_file pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false)   -> RubyVM::AbstractSyntaxTree::Node
+  #     RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
+  #
+  #   Returns AST nodes of the given _proc_ or _method_.
+  #
+  #     RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+  #
+  #     def hello
+  #       puts "hello, world"
+  #     end
+  #
+  #     RubyVM::AbstractSyntaxTree.of(method(:hello))
+  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+  #
+  #   See ::parse for explanation of keyword argument meaning and usage.
+  def self.of body, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
+    Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
+  end
+
+  #  call-seq:
+  #     RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location)   -> integer
+  #
+  #   Returns the node id for the given backtrace location.
+  #
+  #     begin
+  #       raise
+  #     rescue =>  e
+  #       loc = e.backtrace_locations.first
+  #       RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
+  #     end # => 0
+  def self.node_id_for_backtrace_location backtrace_location
+    Primitive.node_id_for_backtrace_location backtrace_location
+  end
+
+  # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+  # RubyVM::AbstractSyntaxTree.
+  #
+  # This class is MRI specific.
+  #
+  class Node
+
+    #  call-seq:
+    #     node.type -> symbol
+    #
+    #  Returns the type of this node as a symbol.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+    #    root.type # => :SCOPE
+    #    lasgn = root.children[2]
+    #    lasgn.type # => :LASGN
+    #    call = lasgn.children[1]
+    #    call.type # => :OPCALL
+    def type
+      Primitive.ast_node_type
+    end
+
+    #  call-seq:
+    #     node.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_node_first_lineno
+    end
+
+    #  call-seq:
+    #     node.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_node_first_column
+    end
+
+    #  call-seq:
+    #     node.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_node_last_lineno
+    end
+
+    #  call-seq:
+    #     node.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_node_last_column
+    end
+
+    #  call-seq:
+    #     node.tokens -> array
+    #
+    #  Returns tokens corresponding to the location of the node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.tokens.map{_1[2]}.join # => "x = 1 + 2"
+    #
+    #  Token is an array of:
+    #
+    #  - id
+    #  - token type
+    #  - source code text
+    #  - location [ first_lineno, first_column, last_lineno, last_column ]
+    def tokens
+      return nil unless all_tokens
+
+      all_tokens.each_with_object([]) do |token, a|
+        loc = token.last
+        if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
+           ([last_lineno, last_column]   <=> [loc[2], loc[3]]) >= 0
+           a << token
+        end
+      end
+    end
+
+    #  call-seq:
+    #     node.all_tokens -> array
+    #
+    #  Returns all tokens for the input script regardless the receiver node.
+    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
+    #
+    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
+    #    root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    #    root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
+    def all_tokens
+      Primitive.ast_node_all_tokens
+    end
+
+    #  call-seq:
+    #     node.children -> array
+    #
+    #  Returns AST nodes under this one.  Each kind of node
+    #  has different children, depending on what kind of node it is.
+    #
+    #  The returned array may contain other nodes or <code>nil</code>.
+    def children
+      Primitive.ast_node_children
+    end
+
+    #  call-seq:
+    #     node.inspect -> string
+    #
+    #  Returns debugging information about this node as a string.
+    def inspect
+      Primitive.ast_node_inspect
+    end
+
+    #  call-seq:
+    #     node.node_id -> integer
+    #
+    #  Returns an internal node_id number.
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def node_id
+      Primitive.ast_node_node_id
+    end
+
+    #  call-seq:
+    #     node.script_lines -> array
+    #
+    #  Returns the original source code as an array of lines.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    def script_lines
+      Primitive.ast_node_script_lines
+    end
+
+    #  call-seq:
+    #     node.source -> string
+    #
+    #  Returns the code fragment that corresponds to this AST.
+    #
+    #  Note that this is an API for ruby internal use, debugging,
+    #  and research. Do not use this for any other purpose.
+    #  The compatibility is not guaranteed.
+    #
+    #  Also note that this API may return an incomplete code fragment
+    #  that does not parse; for example, a here document following
+    #  an expression may be dropped.
+    def source
+      lines = script_lines
+      if lines
+        lines = lines[first_lineno - 1 .. last_lineno - 1]
+        lines[-1] = lines[-1].byteslice(0...last_column)
+        lines[0] = lines[0].byteslice(first_column..-1)
+        lines.join
+      else
+        nil
+      end
+    end
+
+    #  call-seq:
+    #     node.locations -> array
+    #
+    #  Returns location objects associated with the AST node.
+    #  The returned array contains RubyVM::AbstractSyntaxTree::Location.
+    def locations
+      Primitive.ast_node_locations
+    end
+  end
+
+  # RubyVM::AbstractSyntaxTree::Location instances are created by
+  # RubyVM::AbstractSyntaxTree::Node#locations.
+  #
+  # This class is MRI specific.
+  #
+  class Location
+
+    #  call-seq:
+    #     location.first_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text began.
+    def first_lineno
+      Primitive.ast_location_first_lineno
+    end
+
+    #  call-seq:
+    #     location.first_column -> integer
+    #
+    #  The column number in the source code where this AST's text began.
+    def first_column
+      Primitive.ast_location_first_column
+    end
+
+    #  call-seq:
+    #     location.last_lineno -> integer
+    #
+    #  The line number in the source code where this AST's text ended.
+    def last_lineno
+      Primitive.ast_location_last_lineno
+    end
+
+    #  call-seq:
+    #     location.last_column -> integer
+    #
+    #  The column number in the source code where this AST's text ended.
+    def last_column
+      Primitive.ast_location_last_column
+    end
+
+    #  call-seq:
+    #     location.inspect -> string
+    #
+    #  Returns debugging information about this location as a string.
+    def inspect
+      Primitive.ast_location_inspect
+    end
+  end
+end
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000000..6cbc5dddab
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,22 @@
+#!/bin/sh
+
+# Clear PWD to force commands to recompute working directory
+PWD=
+
+# Figure out the source directory for this script
+# configure.ac should be in the same place
+case "$0" in
+    */* )  srcdir=`dirname "$0"` ;; # Called with path
+    *   )  srcdir="";; # Otherwise
+esac
+
+# If install-only is explicitly requested, disable symlink flags
+case " $* " in
+    *" -i "* | *" --install"* ) symlink_flags="" ;;
+    *                         ) symlink_flags="--install --symlink" ;;
+esac
+
+exec ${AUTORECONF:-autoreconf} \
+     $symlink_flags \
+     "$@" \
+     $srcdir
diff --git a/basictest/runner.rb b/basictest/runner.rb
new file mode 100755
index 0000000000..0f398e7acc
--- /dev/null
+++ b/basictest/runner.rb
@@ -0,0 +1,33 @@
+#! ./miniruby
+
+exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
+ruby = ENV["RUBY"]
+unless ruby
+  load './rbconfig.rb'
+  ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
+end
+unless File.exist? ruby
+  print "#{ruby} is not found.\n"
+  print "Try `make' first, then `make test', please.\n"
+  exit false
+end
+ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
+
+$stderr.reopen($stdout)
+error = ''
+
+srcdir = File.expand_path('..', File.dirname(__FILE__))
+if env = ENV["RUBYOPT"]
+  ENV["RUBYOPT"] = env + " -W1"
+end
+`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
+  if line =~ /^end of test/
+    print "\ntest succeeded\n"
+    exit true
+  end
+  error << line if %r:^(basictest/test.rb|not): =~ line
+end
+puts
+print error
+print "test failed\n"
+exit false
diff --git a/basictest/test.rb b/basictest/test.rb
new file mode 100755
index 0000000000..711e4f4ab3
--- /dev/null
+++ b/basictest/test.rb
@@ -0,0 +1,2367 @@
+#! /usr/bin/env ruby
+# -*- coding: us-ascii -*-
+
+$testnum=0
+$ntest=0
+$failed = 0
+class Progress
+  def initialize
+    @color = nil
+    @tty = nil
+    @quiet = nil
+    @verbose = nil
+    ARGV.each do |arg|
+      case arg
+      when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+        warn "unknown --color argument: #$3" if $3
+        @color = $1 ? nil : !$2
+      when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+        warn "unknown --tty argument: #$3" if $3
+        @tty = !$1 || !$2
+        true
+      when /\A-(q|-quiet)\z/
+        @quiet = true
+      when /\A-(v|-verbose)\z/
+        @verbose = true
+      end
+    end
+    @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
+    @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
+    case @color
+    when nil
+      @color = @tty
+    end
+    if @color
+      # dircolors-like style
+      colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+      begin
+        File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+          colors[n] ||= c
+        end
+      rescue
+      end
+      @passed = "\e[;#{colors["pass"] || "32"}m"
+      @failed = "\e[;#{colors["fail"] || "31"}m"
+      @reset = "\e[m"
+    else
+      @passed = @failed = @reset = ""
+    end
+    extend(Rotator) if @tty
+  end
+
+  def passed_string
+    "."
+  end
+  def failed_string
+    "#{@failed}F#{@reset}"
+  end
+  def init_string
+  end
+  def finish_string
+    if @quiet
+      @eol
+    else
+      "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
+    end
+  end
+  def pass
+    STDERR.print passed_string
+  end
+  def fail
+    @ok = false
+    STDERR.print failed_string
+  end
+  def init
+    @ok = true
+    STDERR.print init_string
+  end
+  def finish
+    STDERR.print finish_string
+  end
+
+  module Rotator
+    ROTATOR = %w[- \\ | /]
+    BS = "\b" * ROTATOR[0].size
+    def passed_string
+      "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
+    end
+    def failed_string
+      "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
+    end
+    def init_string
+      @count = 0
+      " "
+    end
+    def finish_string
+      s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
+      s.gsub!(/\n/, "\r\e[2K\r") if @quiet
+      s
+    end
+  end
+end
+PROGRESS = Progress.new
+
+def test_check(what)
+  unless $ntest.zero?
+    PROGRESS.finish
+  end
+  STDERR.print "#{$0}:#{what} "
+  PROGRESS.init
+  $what = what
+  $testnum = 0
+end
+
+def test_ok(cond,n=1)
+  $testnum+=1
+  $ntest+=1
+  where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
+  if cond
+    PROGRESS.pass
+    printf "ok %d (%s)\n", $testnum, where
+  else
+    PROGRESS.fail
+    printf "not ok %s %d -- %s\n", $what, $testnum, where
+    $failed+=1
+  end
+  STDOUT.flush
+  STDERR.flush
+end
+
+# make sure conditional operators work
+
+test_check "assignment"
+
+a=[]; a[0] ||= "bar";
+test_ok(a[0] == "bar")
+h={}; h["foo"] ||= "bar";
+test_ok(h["foo"] == "bar")
+
+aa = 5
+aa ||= 25
+test_ok(aa == 5)
+bb ||= 25
+test_ok(bb == 25)
+cc &&=33
+test_ok(cc == nil)
+cc = 5
+cc &&=44
+test_ok(cc == 44)
+
+a = nil; test_ok(a == nil)
+a = 1; test_ok(a == 1)
+a = []; test_ok(a == [])
+a = [1]; test_ok(a == [1])
+a = [nil]; test_ok(a == [nil])
+a = [[]]; test_ok(a == [[]])
+a = [1,2]; test_ok(a == [1,2])
+a = [*[]]; test_ok(a == [])
+a = [*[1]]; test_ok(a == [1])
+a = [*[1,2]]; test_ok(a == [1,2])
+
+a = *[]; test_ok(a == [])
+a = *[1]; test_ok(a == [1])
+a = *[nil]; test_ok(a == [nil])
+a = *[[]]; test_ok(a == [[]])
+a = *[1,2]; test_ok(a == [1,2])
+a = *[*[]]; test_ok(a == [])
+a = *[*[1]]; test_ok(a == [1])
+a = *[*[1,2]]; test_ok(a == [1,2])
+
+a, = nil; test_ok(a == nil)
+a, = 1; test_ok(a == 1)
+a, = []; test_ok(a == nil)
+a, = [1]; test_ok(a == 1)
+a, = [nil]; test_ok(a == nil)
+a, = [[]]; test_ok(a == [])
+a, = 1,2; test_ok(a == 1)
+a, = [1,2]; test_ok(a == 1)
+a, = [*[]]; test_ok(a == nil)
+a, = [*[1]]; test_ok(a == 1)
+a, = *[1,2]; test_ok(a == 1)
+a, = [*[1,2]]; test_ok(a == 1)
+
+a, = *[]; test_ok(a == nil)
+a, = *[1]; test_ok(a == 1)
+a, = *[nil]; test_ok(a == nil)
+a, = *[[]]; test_ok(a == [])
+a, = *[1,2]; test_ok(a == 1)
+a, = *[*[]]; test_ok(a == nil)
+a, = *[*[1]]; test_ok(a == 1)
+a, = *[*[1,2]]; test_ok(a == 1)
+
+*a = nil; test_ok(a == [nil])
+*a = 1; test_ok(a == [1])
+*a = []; test_ok(a == [])
+*a = [1]; test_ok(a == [1])
+*a = [nil]; test_ok(a == [nil])
+*a = [[]]; test_ok(a == [[]])
+*a = [1,2]; test_ok(a == [1,2])
+*a = [*[]]; test_ok(a == [])
+*a = [*[1]]; test_ok(a == [1])
+*a = [*[1,2]]; test_ok(a == [1,2])
+
+*a = *[]; test_ok(a == [])
+*a = *[1]; test_ok(a == [1])
+*a = *[nil]; test_ok(a == [nil])
+*a = *[[]]; test_ok(a == [[]])
+*a = *[1,2]; test_ok(a == [1,2])
+*a = *[*[]]; test_ok(a == [])
+*a = *[*[1]]; test_ok(a == [1])
+*a = *[*[1,2]]; test_ok(a == [1,2])
+
+a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+def f; yield nil; end; f {|a| test_ok(a == nil)}
+def f; yield 1; end; f {|a| test_ok(a == 1)}
+def f; yield []; end; f {|a| test_ok(a == [])}
+def f; yield [1]; end; f {|a| test_ok(a == [1])}
+def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
+def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
+def f; yield [*[]]; end; f {|a| test_ok(a == [])}
+def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
+def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
+def f; yield *[]; end; f {|a| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a| test_ok(a == [])}
+def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
+
+def f; yield; end; f {|a,| test_ok(a == nil)}
+def f; yield nil; end; f {|a,| test_ok(a == nil)}
+def f; yield 1; end; f {|a,| test_ok(a == 1)}
+def f; yield []; end; f {|a,| test_ok(a == nil)}
+def f; yield [1]; end; f {|a,| test_ok(a == 1)}
+def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield [[]]; end; f {|a,| test_ok(a == [])}
+def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield *[]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield; end; f {|*a| test_ok(a == [])}
+def f; yield nil; end; f {|*a| test_ok(a == [nil])}
+def f; yield 1; end; f {|*a| test_ok(a == [1])}
+def f; yield []; end; f {|*a| test_ok(a == [[]])}
+def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
+def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
+def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
+def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
+
+def f; yield *[]; end; f {|*a| test_ok(a == [])}
+def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
+def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
+def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
+
+def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
+def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def r; return; end; a = r(); test_ok(a == nil)
+def r; return nil; end; a = r(); test_ok(a == nil)
+def r; return 1; end; a = r(); test_ok(a == 1)
+def r; return []; end; a = r(); test_ok(a == [])
+def r; return [1]; end; a = r(); test_ok(a == [1])
+def r; return [nil]; end; a = r(); test_ok(a == [nil])
+def r; return [[]]; end; a = r(); test_ok(a == [[]])
+def r; return [*[]]; end; a = r(); test_ok(a == [])
+def r; return [*[1]]; end; a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; a = r(); test_ok(a == [])
+def r; return *[1]; end; a = r(); test_ok(a == [1])
+def r; return *[nil]; end; a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; a = r(); test_ok(a == [[]])
+def r; return *[*[]]; end; a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
+def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
+
+def r; return; end; *a = r(); test_ok(a == [nil])
+def r; return nil; end; *a = r(); test_ok(a == [nil])
+def r; return 1; end; *a = r(); test_ok(a == [1])
+def r; return []; end; *a = r(); test_ok(a == [])
+def r; return [1]; end; *a = r(); test_ok(a == [1])
+def r; return [nil]; end; *a = r(); test_ok(a == [nil])
+def r; return [[]]; end; *a = r(); test_ok(a == [[]])
+def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return [*[]]; end; *a = r(); test_ok(a == [])
+def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; *a = r(); test_ok(a == [])
+def r; return *[1]; end; *a = r(); test_ok(a == [1])
+def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return *[*[]]; end; *a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
+def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
+
+def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+f = lambda {|r,| test_ok([] == r)}
+f.call([], *[])
+
+f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
+f.call([], *[1])
+
+f = lambda{|x| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|x,| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|*x| x}
+test_ok(f.call(42) == [42])
+test_ok(f.call([42]) == [[42]])
+test_ok(f.call([[42]]) == [[[42]]])
+test_ok(f.call([42,55]) == [[42,55]])
+test_ok(f.call(42,55) == [42,55])
+
+f = lambda { |a, b=42, *c| [a,b,c] }
+test_ok(f.call(1      ) == [1,42,[  ]] )
+test_ok(f.call(1,43   ) == [1,43,[  ]] )
+test_ok(f.call(1,43,44) == [1,43,[44]] )
+
+f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
+test_ok(f.call(8      )     == [8,24,[  ],nil] )
+test_ok(f.call(8,43   )     == [8,43,[  ],nil] )
+test_ok(f.call(8,43,44)     == [8,43,[44],nil] )
+test_ok(f.call(8      ){45} == [8,24,[  ],45 ] )
+test_ok(f.call(8,43   ){45} == [8,43,[  ],45 ] )
+test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
+
+f = lambda { |a, b=42, *c, d| [a,b,c,d] }
+test_ok(f.call(1      ,99) == [1,42,[  ],99] )
+test_ok(f.call(1,43   ,99) == [1,43,[  ],99] )
+test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
+
+f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
+test_ok(f.call(8   )     == [8,24,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8,43)     == [8,43,nil] )
+test_ok(f.call(8   ){45} == [8,24,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+
+f = lambda { |a, b=42, d| [a,b,d] }
+test_ok(f.call(1   ,99) == [1,42,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+
+f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
+test_ok(f.call(     )     == [42,[  ],nil] )
+test_ok(f.call(43   )     == [43,[  ],nil] )
+test_ok(f.call(43,44)     == [43,[44],nil] )
+test_ok(f.call(     ){45} == [42,[  ],45 ] )
+test_ok(f.call(43   ){45} == [43,[  ],45 ] )
+test_ok(f.call(43,44){45} == [43,[44],45 ] )
+
+f = lambda { |b=42, *c, d| [b,c,d] }
+test_ok(f.call(      99) == [42,[  ],99] )
+test_ok(f.call(43   ,99) == [43,[  ],99] )
+test_ok(f.call(43,44,99) == [43,[44],99] )
+
+f = lambda { |b=42, &block| [b,block&&block[]] }
+test_ok(f.call(  )     == [42,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(43)     == [43,nil] )
+test_ok(f.call(  ){45} == [42,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+
+f = lambda { |b=42, d| [b,d] }
+test_ok(f.call(   99) == [42,99] )
+test_ok(f.call(43,99) == [43,99] )
+test_ok(f.call(43,99) == [43,99] )
+
+
+a,=*[1]
+test_ok(a == 1)
+a,=*[[1]]
+test_ok(a == [1])
+a,=*[[[1]]]
+test_ok(a == [[1]])
+
+x, (y, z) = 1, 2, 3
+test_ok([1,2,nil] == [x,y,z])
+x, (y, z) = 1, [2,3]
+test_ok([1,2,3] == [x,y,z])
+x, (y, z) = 1, [2]
+test_ok([1,2,nil] == [x,y,z])
+
+a = loop do break; end; test_ok(a == nil)
+a = loop do break nil; end; test_ok(a == nil)
+a = loop do break 1; end; test_ok(a == 1)
+a = loop do break []; end; test_ok(a == [])
+a = loop do break [1]; end; test_ok(a == [1])
+a = loop do break [nil]; end; test_ok(a == [nil])
+a = loop do break [[]]; end; test_ok(a == [[]])
+a = loop do break [*[]]; end; test_ok(a == [])
+a = loop do break [*[1]]; end; test_ok(a == [1])
+a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+a = loop do break *[]; end; test_ok(a == [])
+a = loop do break *[1]; end; test_ok(a == [1])
+a = loop do break *[nil]; end; test_ok(a == [nil])
+a = loop do break *[[]]; end; test_ok(a == [[]])
+a = loop do break *[*[]]; end; test_ok(a == [])
+a = loop do break *[*[1]]; end; test_ok(a == [1])
+a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break; end; test_ok(a == [nil])
+*a = loop do break nil; end; test_ok(a == [nil])
+*a = loop do break 1; end; test_ok(a == [1])
+*a = loop do break []; end; test_ok(a == [])
+*a = loop do break [1]; end; test_ok(a == [1])
+*a = loop do break [nil]; end; test_ok(a == [nil])
+*a = loop do break [[]]; end; test_ok(a == [[]])
+*a = loop do break [1,2]; end; test_ok(a == [1,2])
+*a = loop do break [*[]]; end; test_ok(a == [])
+*a = loop do break [*[1]]; end; test_ok(a == [1])
+*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break *[]; end; test_ok(a == [])
+*a = loop do break *[1]; end; test_ok(a == [1])
+*a = loop do break *[nil]; end; test_ok(a == [nil])
+*a = loop do break *[[]]; end; test_ok(a == [[]])
+*a = loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = loop do break *[*[]]; end; test_ok(a == [])
+*a = loop do break *[*[1]]; end; test_ok(a == [1])
+*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = *loop do break *[[]]; end; test_ok(a == [[]])
+*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+def r(val); a = yield(); test_ok(a == val, 2); end
+r(nil){next}
+r(nil){next nil}
+r(1){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+r([]){next *[]}
+r([1]){next *[1]}
+r([nil]){next *[nil]}
+r([[]]){next *[[]]}
+r([]){next *[*[]]}
+r([1]){next *[*[1]]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); *a = yield(); test_ok(a == val, 2); end
+r([nil]){next}
+r([nil]){next nil}
+r([1]){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([1,2]){next [1,2]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+def r(val); *a = *yield(); test_ok(a == val, 2); end
+r([[]]){next *[[]]}
+r([1,2]){next *[1,2]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
+r([nil,nil,[]]){next}
+r([nil,nil,[]]){next nil}
+r([1,nil,[]]){next 1}
+r([nil,nil,[]]){next []}
+r([1,nil,[]]){next [1]}
+r([nil,nil,[]]){next [nil]}
+r([[],nil,[]]){next [[]]}
+r([1,2,[]]){next [1,2]}
+r([nil,nil,[]]){next [*[]]}
+r([1,nil,[]]){next [*[1]]}
+r([1,2,[]]){next [*[1,2]]}
+
+def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
+r([[],nil,[]]){next *[[]]}
+r([1,2,[]]){next *[1,2]}
+r([1,2,[]]){next *[*[1,2]]}
+
+test_check "condition"
+
+$x = '0';
+
+$x == $x && test_ok(true)
+$x != $x && test_ok(false)
+$x == $x || test_ok(false)
+$x != $x || test_ok(true)
+
+# first test to see if we can run the tests.
+
+test_check "if/unless";
+
+$x = 'test';
+test_ok(if $x == $x then true else false end)
+$bad = false
+unless $x == $x
+  $bad = true
+end
+test_ok(!$bad)
+test_ok(unless $x != $x then true else false end)
+
+test_check "case"
+
+case 5
+when 1, 2, 3, 4, 6, 7, 8
+  test_ok(false)
+when 5
+  test_ok(true)
+end
+
+case 5
+when 5
+  test_ok(true)
+when 1..10
+  test_ok(false)
+end
+
+case 5
+when 1..10
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case 5
+when 5
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+case "foobar"
+when /^f.*r$/
+  test_ok(true)
+else
+  test_ok(false)
+end
+
+test_check "while/until";
+
+while_tmp = "while_tmp.#{$$}"
+tmp = open(while_tmp, "w")
+tmp.print "tvi925\n";
+tmp.print "tvi920\n";
+tmp.print "vt100\n";
+tmp.print "Amiga\n";
+tmp.print "paper\n";
+tmp.close
+
+# test break
+
+tmp = open(while_tmp, "r")
+test_ok(tmp.kind_of?(File))
+
+while line = tmp.gets()
+  break if /vt100/ =~ line
+end
+
+test_ok(!tmp.eof? && /vt100/ =~ line)
+tmp.close
+
+# test next
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  next if /vt100/ =~ line
+  $bad = 1 if /vt100/ =~ line
+end
+test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
+tmp.close
+
+# test redo
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  lastline = line
+  line = line.gsub(/vt100/, 'VT100')
+  if lastline != line
+    line.gsub!('VT100', 'Vt100')
+    redo
+  end
+  $bad = 1 if /vt100/ =~ line
+  $bad = 1 if /VT100/ =~ line
+end
+test_ok(tmp.eof? && !$bad)
+tmp.close
+
+sum=0
+for i in 1..10
+  sum += i
+  i -= 1
+  if i > 0
+    redo
+  end
+end
+test_ok(sum == 220)
+
+# test interval
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+  break if 3
+  case line
+  when /vt100/, /Amiga/, /paper/
+    $bad = true
+  end
+end
+test_ok(!$bad)
+tmp.close
+
+File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
+test_ok(!File.exist?(while_tmp))
+
+i = 0
+until i>4
+  i+=1
+end
+test_ok(i>4)
+
+
+# exception handling
+test_check "exception";
+
+begin
+  raise "this must be handled"
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  raise "this must be handled no.2"
+rescue
+  if $bad
+    $bad = false
+    retry
+    test_ok(false)
+  end
+end
+test_ok(true)
+
+# exception in rescue clause
+$string = "this must be handled no.3"
+begin
+  begin
+    raise "exception in rescue clause"
+  rescue
+    raise $string
+  end
+  test_ok(false)
+rescue => e
+  test_ok($! == e)
+  test_ok(e.message == $string)
+  test_ok(e != $string)
+end
+
+# exception in ensure clause
+begin
+  begin
+    raise "this must be handled no.4"
+  ensure
+    raise "exception in ensure clause"
+  end
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.5"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+begin
+  begin
+    raise "this must be handled no.6"
+  ensure
+    $bad = false
+  end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+while true
+  begin
+    break
+  ensure
+    $bad = false
+  end
+end
+test_ok(!$bad)
+
+test_ok(catch(:foo) {
+     loop do
+       loop do
+	 throw :foo, true
+	 break
+       end
+       break
+       test_ok(false)			# should not reach here
+     end
+     false
+   })
+
+test_check "array"
+test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
+test_ok([1, 2] * 2 == [1, 2, 1, 2])
+test_ok([1, 2] * ":" == "1:2")
+
+test_ok([1, 2].hash == [1, 2].hash)
+
+test_ok([1,2,3] & [2,3,4] == [2,3])
+test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
+test_ok([1,2,3] - [2,3] == [1])
+
+$x = [0, 1, 2, 3, 4, 5]
+test_ok($x[2] == 2)
+test_ok($x[1..3] == [1, 2, 3])
+test_ok($x[1,3] == [1, 2, 3])
+
+$x[0, 2] = 10
+test_ok($x[0] == 10 && $x[1] == 2)
+
+$x[0, 0] = -1
+test_ok($x[0] == -1 && $x[1] == 10)
+
+$x[-1, 1] = 20
+test_ok($x[-1] == 20 && $x.pop == 20)
+
+# array and/or
+test_ok(([1,2,3]&[2,4,6]) == [2])
+test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
+
+# compact
+$x = [nil, 1, nil, nil, 5, nil, nil]
+$x.compact!
+test_ok($x == [1, 5])
+
+# uniq
+$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
+$x.uniq!
+test_ok($x == [1, 4, 2, 5])
+
+# empty?
+test_ok(!$x.empty?)
+$x = []
+test_ok($x.empty?)
+
+# sort
+$x = ["it", "came", "to", "pass", "that", "..."]
+$x = $x.sort.join(" ")
+test_ok($x == "... came it pass that to")
+$x = [2,5,3,1,7]
+$x.sort!{|a,b| a<=>b}		# sort with condition
+test_ok($x == [1,2,3,5,7])
+$x.sort!{|a,b| b-a}		# reverse sort
+test_ok($x == [7,5,3,2,1])
+
+# split test
+$x = +"The Book of Mormon"
+test_ok($x.split(//).reverse!.join == $x.reverse)
+test_ok($x.reverse == $x.reverse!)
+test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
+$x = "a b c  d"
+test_ok($x.split == ['a', 'b', 'c', 'd'])
+test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
+test_ok(defined? "a".chomp)
+test_ok("abc".scan(/./) == ["a", "b", "c"])
+test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
+# non-greedy match
+test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
+
+$x = [1]
+test_ok(($x * 5).join(":") == '1:1:1:1:1')
+test_ok(($x * 1).join(":") == '1')
+test_ok(($x * 0).join(":") == '')
+
+*$x = *(1..7).to_a
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+$x = [1,2,3]
+$x[1,0] = $x
+test_ok($x == [1,1,2,3,2,3])
+
+$x = [1,2,3]
+$x[-1,0] = $x
+test_ok($x == [1,2,1,2,3,3])
+
+$x = [1,2,3]
+$x.concat($x)
+test_ok($x == [1,2,3,1,2,3])
+
+test_check "hash"
+$x = {1=>2, 2=>4, 3=>6}
+
+test_ok($x[1] == 2)
+
+test_ok(begin
+     for k,v in $x
+       raise if k*2 != v
+     end
+     true
+   rescue
+     false
+   end)
+
+test_ok($x.length == 3)
+test_ok($x.has_key?(1))
+test_ok($x.has_value?(4))
+test_ok($x.values_at(2,3) == [4,6])
+test_ok($x == {1=>2, 2=>4, 3=>6})
+
+$z = $x.keys.sort.join(":")
+test_ok($z == "1:2:3")
+
+$z = $x.values.sort.join(":")
+test_ok($z == "2:4:6")
+test_ok($x == $x)
+
+$x.shift
+test_ok($x.length == 2)
+
+$z = [1,2]
+$x[$z] = 256
+test_ok($x[$z] == 256)
+
+$x = Hash.new(0)
+$x[1] = 1
+test_ok($x[1] == 1)
+test_ok($x[2] == 0)
+
+$x = Hash.new([])
+test_ok($x[22] == [])
+test_ok($x[22].equal?($x[22]))
+
+$x = Hash.new{[]}
+test_ok($x[22] == [])
+test_ok(!$x[22].equal?($x[22]))
+
+$x = Hash.new{|h,k| $z = k; h[k] = k*2}
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+$x.default = 5
+test_ok($x[23] == 5)
+
+$x = Hash.new
+def $x.default(k)
+  $z = k
+  self[k] = k*2
+end
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+
+test_check "iterator"
+
+# yield at top level
+test_ok(!defined?(yield))
+
+$x = [1, 2, 3, 4]
+$y = []
+
+# iterator over array
+for i in $x
+  $y.push i
+end
+test_ok($x == $y)
+
+# nested iterator
+def tt
+  1.upto(10) {|i|
+    yield i
+  }
+end
+
+i=0
+tt{|i| break if i == 5}
+test_ok(i == 0)
+
+def tt2(dummy)
+  yield 1
+end
+
+def tt3(&block)
+  tt2(raise(ArgumentError,""),&block)
+end
+
+$x = false
+begin
+  tt3{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+def tt4 &block
+  tt2(raise(ArgumentError,""),&block)
+end
+$x = false
+begin
+  tt4{}
+rescue ArgumentError
+  $x = true
+rescue Exception
+end
+test_ok($x)
+
+# iterator break/redo/next/retry
+done = true
+loop{
+  break
+  done = false			# should not reach here
+}
+test_ok(done)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  next
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+done = false
+$bad = false
+loop {
+  break if done
+  done = true
+  redo
+  $bad = true			# should not reach here
+}
+test_ok(!$bad)
+
+$x = []
+for i in 1 .. 7
+  $x.push i
+end
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+# append method to built-in class
+class Array
+  def iter_test1
+    collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
+  end
+  def iter_test2
+    a = collect{|e| [e, yield(e)]}
+    a.sort{|a,b|a[1]<=>b[1]}
+  end
+end
+$x = [[1,2],[3,4],[5,6]]
+test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
+
+class IterTest
+  def initialize(e); @body = e; end
+
+  def each0(&block); @body.each(&block); end
+  def each1(&block); @body.each {|*x| block.call(*x) } end
+  def each2(&block); @body.each {|*x| block.call(x) } end
+  def each3(&block); @body.each {|x| block.call(*x) } end
+  def each4(&block); @body.each {|x| block.call(x) } end
+  def each5; @body.each {|*x| yield(*x) } end
+  def each6; @body.each {|*x| yield(x) } end
+  def each7; @body.each {|x| yield(*x) } end
+  def each8; @body.each {|x| yield(x) } end
+
+  def f(a)
+    a
+  end
+end
+test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
+m = /\w+/.match("abc")
+test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
+
+IterTest.new([0]).each0 {|x| test_ok(x == 0)}
+IterTest.new([1]).each1 {|x| test_ok(x == 1)}
+IterTest.new([2]).each2 {|x| test_ok(x == [2])}
+#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
+IterTest.new([4]).each4 {|x| test_ok(x == 4)}
+IterTest.new([5]).each5 {|x| test_ok(x == 5)}
+IterTest.new([6]).each6 {|x| test_ok(x == [6])}
+#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
+IterTest.new([8]).each8 {|x| test_ok(x == 8)}
+
+IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
+IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
+IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
+IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
+IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
+IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
+IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
+IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
+IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
+
+IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
+IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
+
+def m0(v)
+  v
+end
+
+def m1
+  m0(block_given?)
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+def m
+  m0(block_given?,&Proc.new{})
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+class C
+  include Enumerable
+  def initialize
+    @a = [1,2,3]
+  end
+  def each(&block)
+    @a.each(&block)
+  end
+end
+
+test_ok(C.new.collect{|n| n} == [1,2,3])
+
+test_ok(Proc == lambda{}.class)
+test_ok(Proc == Proc.new{}.class)
+lambda{|a|test_ok(a==1)}.call(1)
+def block_test(klass, &block)
+  test_ok(klass === block)
+end
+
+block_test(NilClass)
+block_test(Proc){}
+
+def call_argument_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue ArgumentError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+call_argument_test(true, lambda{||})
+call_argument_test(false, lambda{||}, 1)
+call_argument_test(true, lambda{|a,|}, 1)
+call_argument_test(false, lambda{|a,|})
+call_argument_test(false, lambda{|a,|}, 1,2)
+
+call_argument_test(true, Proc.new{||})
+call_argument_test(true, Proc.new{||}, 1)
+call_argument_test(true, Proc.new{|a,|}, 1)
+call_argument_test(true, Proc.new{|a,|})
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+def block_get(&block)
+  block
+end
+
+test_ok(Proc == block_get{}.class)
+call_argument_test(true, block_get{||})
+call_argument_test(true, block_get{||}, 1)
+call_argument_test(true, block_get{|a,|}, 1)
+call_argument_test(true, block_get{|a,|})
+call_argument_test(true, block_get{|a,|}, 1,2)
+
+call_argument_test(true, block_get(&lambda{||}))
+call_argument_test(false, block_get(&lambda{||}),1)
+call_argument_test(true, block_get(&lambda{|a,|}),1)
+call_argument_test(false, block_get(&lambda{|a,|}),1,2)
+
+blk = block_get{11}
+test_ok(blk.class == Proc)
+test_ok(blk.to_proc.class == Proc)
+test_ok(blk.clone.call == 11)
+test_ok(block_get(&blk).class == Proc)
+
+lmd = lambda{44}
+test_ok(lmd.class == Proc)
+test_ok(lmd.to_proc.class == Proc)
+test_ok(lmd.clone.call == 44)
+test_ok(block_get(&lmd).class == Proc)
+
+test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
+test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
+
+def test_return1
+  Proc.new {
+    return 55
+  }.yield + 5
+end
+test_ok(test_return1() == 55)
+def test_return2
+  lambda {
+    return 55
+  }.call + 5
+end
+test_ok(test_return2() == 60)
+
+def proc_call(&b)
+  b.call
+end
+def proc_yield()
+  yield
+end
+def proc_return1
+  lambda{return 42}.call+1
+end
+test_ok(proc_return1() == 43)
+def proc_return2
+  ->{return 42}.call+1
+end
+test_ok(proc_return2() == 43)
+def proc_return3
+  proc_call{return 42}+1
+end
+test_ok(proc_return3() == 42)
+def proc_return4
+  proc_yield{return 42}+1
+end
+test_ok(proc_return4() == 42)
+
+def ljump_test(state, proc, *args)
+  x = state
+  begin
+    proc.call(*args)
+  rescue LocalJumpError
+    x = !x
+  end
+  test_ok(x,2)
+end
+
+ljump_test(false, block_get{break})
+ljump_test(true, lambda{break})
+
+def exit_value_test(&block)
+  block.call
+rescue LocalJumpError
+  $!.exit_value
+end
+
+test_ok(45 == exit_value_test{break 45})
+
+test_ok(55 == begin
+              block_get{break 55}.call
+            rescue LocalJumpError
+              $!.exit_value
+            end)
+
+def block_call(&block)
+  block.call
+end
+
+def test_b1
+  block_call{break 11}
+end
+test_ok(test_b1() == 11)
+
+def ljump_rescue(r)
+  begin
+    yield
+  rescue LocalJumpError => e
+    r if /from proc-closure/ =~ e.message
+  end
+end
+
+def test_b2
+  ljump_rescue(22) do
+    block_get{break 21}.call
+  end
+end
+test_ok(test_b2() == 22)
+
+def test_b3
+  ljump_rescue(33) do
+    Proc.new{break 31}.yield
+  end
+end
+test_ok(test_b3() == 33)
+
+def test_b4
+  lambda{break 44}.call
+end
+test_ok(test_b4() == 44)
+
+def test_b5
+  ljump_rescue(55) do
+    b = block_get{break 54}
+    block_call(&b)
+  end
+end
+test_ok(test_b5() == 55)
+
+def test_b6
+  b = lambda{break 67}
+  block_call(&b)
+  66
+end
+test_ok(test_b6() == 66)
+
+def util_r7
+  block_get{break 78}
+end
+
+def test_b7
+  b = util_r7()
+  ljump_rescue(77) do
+    block_call(&b)
+  end
+end
+test_ok(test_b7() == 77)
+
+def util_b8(&block)
+  block_call(&block)
+end
+
+def test_b8
+  util_b8{break 88}
+end
+test_ok(test_b8() == 88)
+
+def util_b9(&block)
+  lambda{block.call; 98}.call
+end
+
+def test_b9
+  util_b9{break 99}
+end
+test_ok(test_b9() == 99)
+
+def util_b10
+  util_b9{break 100}
+end
+
+def test_b10
+  util_b10()
+end
+test_ok(test_b10() == 100)
+
+def test_b11
+  ljump_rescue(111) do
+    loop do
+      Proc.new{break 110}.yield
+      break 112
+    end
+  end
+end
+test_ok(test_b11() == 111)
+
+def test_b12
+  loop do
+    break lambda{break 122}.call
+    break 121
+  end
+end
+test_ok(test_b12() == 122)
+
+def test_b13
+  ljump_rescue(133) do
+    while true
+      Proc.new{break 130}.yield
+      break 131
+    end
+  end
+end
+test_ok(test_b13() == 133)
+
+def test_b14
+  while true
+    break lambda{break 144}.call
+    break 143
+  end
+end
+test_ok(test_b14() == 144)
+
+def test_b15
+  [0].each {|c| yield 1 }
+  156
+end
+test_ok(test_b15{|e| break 155 } == 155)
+
+def marity_test(m)
+  method = method(m)
+  test_ok(method.arity == method.to_proc.arity, 2)
+end
+marity_test(:test_ok)
+marity_test(:marity_test)
+marity_test(:p)
+
+class ITER_TEST1
+   def a
+     block_given?
+   end
+end
+
+class ITER_TEST2 < ITER_TEST1
+   def a
+     test_ok(super)
+     super
+   end
+end
+test_ok(ITER_TEST2.new.a {})
+
+class ITER_TEST3
+  def foo x
+    return yield if block_given?
+    x
+  end
+end
+
+class ITER_TEST4 < ITER_TEST3
+  def foo x
+    test_ok(super == yield)
+    test_ok(super(x, &nil) == x)
+  end
+end
+
+ITER_TEST4.new.foo(44){55}
+
+class ITER_TEST5
+   def tt(aa)
+     aa
+   end
+
+   def uu(a)
+      class << self
+         define_method(:tt) do |sym|
+            super(sym)
+         end
+      end
+   end
+
+   def xx(*x)
+     x.size
+   end
+end
+
+a = ITER_TEST5.new
+a.uu(12)
+test_ok(a.tt(1) == 1)
+
+class ITER_TEST6 < ITER_TEST5
+   def xx(*a)
+      a << 12
+      super
+   end
+end
+
+test_ok(ITER_TEST6.new.xx([24]) == 2)
+
+test_check "float"
+test_ok(2.6.floor == 2)
+test_ok((-2.6).floor == -3)
+test_ok(2.6.ceil == 3)
+test_ok((-2.6).ceil == -2)
+test_ok(2.6.truncate == 2)
+test_ok((-2.6).truncate == -2)
+test_ok(2.6.round == 3)
+test_ok((-2.4).truncate == -2)
+test_ok((13.4 % 1 - 0.4).abs < 0.0001)
+nan = 0.0/0
+def nan_test(x,y)
+  test_ok(x != y)
+  test_ok((x < y) == false)
+  test_ok((x > y) == false)
+  test_ok((x <= y) == false)
+  test_ok((x >= y) == false)
+end
+nan_test(nan, nan)
+nan_test(nan, 0)
+nan_test(nan, 1)
+nan_test(nan, -1)
+nan_test(nan, 1000)
+nan_test(nan, -1000)
+nan_test(nan, 1_000_000_000_000)
+nan_test(nan, -1_000_000_000_000)
+nan_test(nan, 100.0);
+nan_test(nan, -100.0);
+nan_test(nan, 0.001);
+nan_test(nan, -0.001);
+nan_test(nan, 1.0/0);
+nan_test(nan, -1.0/0);
+
+#s = "3.7517675036461267e+17"
+#test_ok(s == sprintf("%.16e", s.to_f))
+f = 3.7517675036461267e+17
+test_ok(f == sprintf("%.16e", f).to_f)
+
+
+test_check "bignum"
+def fact(n)
+  return 1 if n == 0
+  f = 1
+  while n>0
+    f *= n
+    n -= 1
+  end
+  return f
+end
+$x = fact(40)
+test_ok($x == $x)
+test_ok($x == fact(40))
+test_ok($x < $x+2)
+test_ok($x > $x-2)
+test_ok($x == 815915283247897734345611269596115894272000000000)
+test_ok($x != 815915283247897734345611269596115894272000000001)
+test_ok($x+1 == 815915283247897734345611269596115894272000000001)
+test_ok($x/fact(20) == 335367096786357081410764800000)
+$x = -$x
+test_ok($x == -815915283247897734345611269596115894272000000000)
+test_ok(2-(2**32) == -(2**32-2))
+test_ok(2**32 - 5 == (2**32-3)-2)
+
+$good = true;
+for i in 1000..1014
+  $good = false if ((1 << i) != (2**i))
+end
+test_ok($good)
+
+$good = true;
+n1= 1 << 1000
+for i in 1000..1014
+  $good = false if ((1 << i) != n1)
+  n1 *= 2
+end
+test_ok($good)
+
+$good = true;
+n2=n1
+for i in 1..10
+  n1 = n1 / 2
+  n2 = n2 >> 1
+  $good = false if (n1 != n2)
+end
+test_ok($good)
+
+$good = true;
+for i in 4000..4096
+  n1 = 1 << i;
+  if (n1**2-1) / (n1+1) != (n1-1)
+    $good = false
+  end
+end
+test_ok($good)
+
+b = 10**80
+a = b * 9 + 7
+test_ok(7 == a.modulo(b))
+test_ok(-b + 7 == a.modulo(-b))
+test_ok(b + -7 == (-a).modulo(b))
+test_ok(-7 == (-a).modulo(-b))
+test_ok(7 == a.remainder(b))
+test_ok(7 == a.remainder(-b))
+test_ok(-7 == (-a).remainder(b))
+test_ok(-7 == (-a).remainder(-b))
+
+test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
+test_ok(10**40/10**20 == 100000000000000000000)
+
+a = 677330545177305025495135714080
+b = 14269972710765292560
+test_ok(a % b == 0)
+test_ok(-a % b == 0)
+
+def shift_test(a)
+  b = a / (2 ** 32)
+  c = a >> 32
+  test_ok(b == c)
+
+  b = a * (2 ** 32)
+  c = a << 32
+  test_ok(b == c)
+end
+
+shift_test(-4518325415524767873)
+shift_test(-0xfffffffffffffffff)
+
+test_check "string & char"
+
+test_ok("abcd" == "abcd")
+test_ok("abcd" =~ /abcd/)
+test_ok("abcd" === "abcd")
+# compile time string concatenation
+test_ok("ab" "cd" == "abcd")
+test_ok("#{22}aa" "cd#{44}" == "22aacd44")
+test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
+test_ok("abc" !~ /^$/)
+test_ok("abc\n" !~ /^$/)
+test_ok("abc" !~ /^d*$/)
+test_ok(("abc" =~ /d*$/) == 3)
+test_ok("" =~ /^$/)
+test_ok("\n" =~ /^$/)
+test_ok("a\n\n" =~ /^$/)
+test_ok("abcabc" =~ /.*a/ && $& == "abca")
+test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
+test_ok("abcabc" =~ /.*?a/ && $& == "a")
+test_ok("abcabc" =~ /.*?c/ && $& == "abc")
+test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
+
+test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
+
+test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+
+$x = +<<END;
+ABCD
+ABCD
+END
+$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
+test_ok($x == "AC\nAC\n")
+
+test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
+test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
+
+$foo = "abc"
+test_ok("#$foo = abc" == "abc = abc")
+test_ok("#{$foo} = abc" == "abc = abc")
+
+foo = "abc"
+test_ok("#{foo} = abc" == "abc = abc")
+
+test_ok('-' * 5 == '-----')
+test_ok('-' * 1 == '-')
+test_ok('-' * 0 == '')
+
+foo = '-'
+test_ok(foo * 5 == '-----')
+test_ok(foo * 1 == '-')
+test_ok(foo * 0 == '')
+
+$x = "a.gif"
+test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
+test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
+
+# character constants(assumes ASCII)
+test_ok("a"[0] == ?a)
+test_ok(?a == ?a)
+test_ok(?\C-a == "\1")
+test_ok(?\M-a == "\341")
+test_ok(?\M-\C-a == "\201")
+test_ok("a".dup.upcase![0] == ?A)
+test_ok("A".dup.downcase![0] == ?a)
+test_ok("abc".dup.tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".dup.tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".dup.squeeze!("a-z") == "abc")
+test_ok("abcd".dup.delete!("bc") == "ad")
+
+$x = "abcdef"
+$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
+$bad = false
+$x.each_byte {|i|
+  if i.chr != $y.shift
+    $bad = true
+    break
+  end
+}
+test_ok(!$bad)
+
+s = +"a string"
+s[0..s.size]="another string"
+test_ok(s == "another string")
+
+s = <<EOS
+#{
+[1,2,3].join(",")
+}
+EOS
+test_ok(s == "1,2,3\n")
+test_ok("Just".to_i(36) == 926381)
+test_ok("-another".to_i(36) == -23200231779)
+test_ok(1299022.to_s(36) == "ruby")
+test_ok(-1045307475.to_s(36) == "-hacker")
+test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
+test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
+
+a = []
+(0..255).each {|n|
+  ch = [n].pack("C")
+  a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
+}
+test_ok(a.size == 0)
+
+test_check "assignment"
+a = nil
+test_ok(defined?(a))
+test_ok(a == nil)
+
+# multiple assignment
+a, b = 1, 2
+test_ok(a == 1 && b == 2)
+
+a, b = b, a
+test_ok(a == 2 && b == 1)
+
+a, = 1,2
+test_ok(a == 1)
+
+a, *b = 1, 2, 3
+test_ok(a == 1 && b == [2, 3])
+
+a, (b, c), d = 1, [2, 3], 4
+test_ok(a == 1 && b == 2 && c == 3 && d == 4)
+
+*a = 1, 2, 3
+test_ok(a == [1, 2, 3])
+
+*a = 4
+test_ok(a == [4])
+
+*a = nil
+test_ok(a == [nil])
+
+test_check "call"
+def aaa(a, b=100, *rest)
+  res = [a, b]
+  res += rest if rest
+  return res
+end
+
+# not enough argument
+begin
+  aaa()				# need at least 1 arg
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+begin
+  aaa				# no arg given (exception raised)
+  test_ok(false)
+rescue
+  test_ok(true)
+end
+
+test_ok(aaa(1) == [1, 100])
+test_ok(aaa(1, 2) == [1, 2])
+test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
+test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
+
+test_check "proc"
+$proc = Proc.new{|i| i}
+test_ok($proc.call(2) == 2)
+test_ok($proc.call(3) == 3)
+
+$proc = Proc.new{|i| i*2}
+test_ok($proc.call(2) == 4)
+test_ok($proc.call(3) == 6)
+
+Proc.new{
+  iii=5				# nested local variable
+  $proc = Proc.new{|i|
+    iii = i
+  }
+  $proc2 = Proc.new {
+    $x = iii			# nested variables shared by procs
+  }
+  # scope of nested variables
+  test_ok(defined?(iii))
+}.call
+test_ok(!defined?(iii))		# out of scope
+
+loop{iii=5; test_ok(eval("defined? iii")); break}
+loop {
+  iii = 10
+  def dyna_var_check
+    loop {
+      test_ok(!defined?(iii))
+      break
+    }
+  end
+  dyna_var_check
+  break
+}
+$x=0
+$proc.call(5)
+$proc2.call
+test_ok($x == 5)
+
+if defined? Process.kill
+  test_check "signal"
+
+  $x = 0
+  trap "SIGINT", Proc.new{|sig| $x = 2}
+  Process.kill "SIGINT", $$
+  100.times {
+    sleep 0.1
+    break if $x != 0
+  }
+  test_ok($x == 2)
+
+  trap "SIGINT", Proc.new{raise "Interrupt"}
+
+  x = false
+  begin
+    Process.kill "SIGINT", $$
+    sleep 0.1
+  rescue
+    x = $!
+  end
+  test_ok(x && /Interrupt/ =~ x.message)
+end
+
+test_check "eval"
+test_ok(eval("") == nil)
+$bad=false
+eval 'while false; $bad = true; print "foo\n" end'
+test_ok(!$bad)
+
+test_ok(eval('Object'))
+test_ok(eval('true'))
+test_ok(!eval('nil'))
+test_ok(!eval('false'))
+
+$foo = 'test_ok(true)'
+begin
+  eval $foo
+rescue
+  test_ok(false)
+end
+
+test_ok(eval("$foo") == 'test_ok(true)')
+test_ok(eval("true") == true)
+i = 5
+test_ok(eval("i == 5"))
+test_ok(eval("i") == 5)
+test_ok(eval("defined? i"))
+
+# eval with binding
+def test_ev
+  local1 = "local1"
+  lambda {
+    local2 = "local2"
+    return binding
+  }.call
+end
+
+$x = test_ev
+test_ok(eval("local1", $x) == "local1") # normal local var
+test_ok(eval("local2", $x) == "local2") # nested local var
+$bad = true
+begin
+  p eval("local1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+module EvTest
+  EVTEST1 = 25
+  evtest2 = 125
+  $x = binding
+end
+test_ok(eval("EVTEST1", $x) == 25)	# constant in module
+test_ok(eval("evtest2", $x) == 125)	# local var in module
+$bad = true
+begin
+  eval("EVTEST1")
+rescue NameError		# must raise error
+  $bad = false
+end
+test_ok(!$bad)
+
+x = binding #! YARV Limitation: Proc.new{}
+eval "i4 = 1", x
+test_ok(eval("i4", x) == 1)
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "i4 = 22", x
+test_ok(eval("i4", x) == 22)
+$x = []
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+
+x = binding
+eval "i = 1", x
+test_ok(eval("i", x) == 1)
+x = Proc.new{binding}.call
+eval "i = 22", x
+test_ok(eval("i", x) == 22)
+$x = []
+x = Proc.new{binding}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+x = Proc.new{binding}.call
+eval "for i6 in 1..1; j6=i6; end", x
+test_ok(eval("defined? i6", x))
+test_ok(eval("defined? j6", x))
+
+Proc.new {
+  p = binding
+  eval "foo11 = 1", p
+  foo22 = 5
+  Proc.new{foo11=22}.call
+  Proc.new{foo22=55}.call
+  test_ok(eval("foo11", p) == eval("foo11"))
+  test_ok(eval("foo11") == 1)
+  test_ok(eval("foo22", p) == eval("foo22"))
+  test_ok(eval("foo22") == 55)
+}.call if false #! YARV Limitation
+
+#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+p1 = Proc.new{i7 = 0; binding}.call
+#! YARV Limitation: test_ok(p1.call == 0)
+eval "i7=5", p1
+#! YARV Limitation: test_ok(p1.call == 5)
+test_ok(!defined?(i7))
+
+if false #! YARV Limitation
+p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+i7 = nil
+test_ok(p1.call == 0)
+eval "i7=1", p1
+test_ok(p1.call == 1)
+eval "i7=5", p1
+test_ok(p1.call == 5)
+test_ok(i7 == nil)
+end
+
+# WASI doesn't support spawning a new process for now.
+unless /wasi/ =~ RUBY_PLATFORM
+test_check "system"
+test_ok(`echo foobar` == "foobar\n")
+test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
+
+script_tmp = "script_tmp.#{$$}"
+tmp = open(script_tmp, "w")
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
+test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
+
+tmp = open(script_tmp, "w")
+tmp.print "this is a leading junk\n";
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.print "__END__\n";
+tmp.print "this is a trailing junk\n";
+tmp.close
+
+test_ok(`./miniruby -x #{script_tmp}` == '')
+test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+for i in 1..5
+  tmp.print i, "\n"
+end
+tmp.close
+
+`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
+done = true
+tmp = open(script_tmp, "r")
+while tmp.gets
+  if $_.to_i % 5 != 0
+    done = false
+    break
+  end
+end
+tmp.close
+test_ok(done)
+
+File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
+File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+end # not /wasi/ =~ RUBY_PLATFORM
+
+test_check "const"
+TEST1 = 1
+TEST2 = 2
+
+module Const
+  TEST3 = 3
+  TEST4 = 4
+end
+
+module Const2
+  TEST3 = 6
+  TEST4 = 8
+end
+
+include Const
+
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
+
+include Const2
+STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
+
+
+test_ok((String <=> Object) == -1)
+test_ok((Object <=> String) == 1)
+test_ok((Array <=> String) == nil)
+
+test_check "clone"
+foo = Object.new
+def foo.test
+  "test"
+end
+bar = foo.clone
+def bar.test2
+  "test2"
+end
+
+test_ok(bar.test2 == "test2")
+test_ok(bar.test == "test")
+test_ok(foo.test == "test")
+
+begin
+  foo.test2
+  test_ok false
+rescue NoMethodError
+  test_ok true
+end
+
+module M001; end
+module M002; end
+module M003; include M002; end
+module M002; include M001; end
+module M003; include M002; end
+
+test_ok(M003.ancestors == [M003, M002, M001])
+
+test_check "marshal"
+$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
+$y = Marshal.dump($x)
+test_ok($x == Marshal.load($y))
+
+StrClone=String.clone;
+test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
+
+[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
+  a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
+  ma = Marshal.dump(a)
+  b = Marshal.load(ma)
+  test_ok(a == b)
+}
+
+test_check "pack"
+
+$format = "c2x5CCxsdils_l_a6";
+# Need the expression in here to force ary[5] to be numeric.  This avoids
+# test2 failing because ary2 goes str->numeric->str and ary does not.
+ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
+$x = ary.pack($format)
+ary2 = $x.unpack($format)
+
+test_ok(ary.length == ary2.length)
+test_ok(ary.join(':') == ary2.join(':'))
+test_ok($x =~ /def/)
+
+$x = [-1073741825]
+test_ok($x.pack("q").unpack("q") == $x)
+
+test_check "math"
+test_ok(Math.sqrt(4) == 2)
+
+include Math
+test_ok(sqrt(4) == 2)
+
+test_check "struct"
+struct_test = Struct.new("Test", :foo, :bar)
+test_ok(struct_test == Struct::Test)
+
+test = struct_test.new(1, 2)
+test_ok(test.foo == 1 && test.bar == 2)
+test_ok(test[0] == 1 && test[1] == 2)
+
+a, b = test.to_a
+test_ok(a == 1 && b == 2)
+
+test[0] = 22
+test_ok(test.foo == 22)
+
+test.bar = 47
+test_ok(test.bar == 47)
+
+test_check "variable"
+test_ok($$.instance_of?(Integer))
+
+# read-only variable
+begin
+  $$ = 5
+  test_ok false
+rescue NameError
+  test_ok true
+end
+
+foobar = "foobar"
+$_ = foobar
+test_ok($_ == foobar)
+
+class Gods
+  @@rule = "Uranus"
+  def ruler0
+    @@rule
+  end
+
+  def self.ruler1		# <= per method definition style
+    @@rule
+  end
+  class << self			# <= multiple method definition style
+    def ruler2
+      @@rule
+    end
+  end
+end
+
+module Olympians
+  @@rule ="Zeus"
+  def ruler3
+    @@rule
+  end
+end
+
+class Titans < Gods
+  @@rule = "Cronus"		# modifies @@rule in Gods
+  include Olympians
+  def ruler4
+    @@rule
+  end
+end
+
+test_ok(Gods.new.ruler0 == "Cronus")
+test_ok(Gods.ruler1 == "Cronus")
+test_ok(Gods.ruler2 == "Cronus")
+test_ok(Titans.ruler1 == "Cronus")
+test_ok(Titans.ruler2 == "Cronus")
+atlas = Titans.new
+test_ok(atlas.ruler0 == "Cronus")
+test_ok(atlas.ruler3 == "Zeus")
+begin
+  atlas.ruler4
+rescue RuntimeError => e
+  test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
+else
+  test_ok(false)
+end
+test_ok(atlas.ruler3 == "Zeus")
+
+test_check "trace"
+$x = 1234
+$y = 0
+trace_var :$x, Proc.new{$y = $x}
+$x = 40414
+test_ok($y == $x)
+
+untrace_var :$x
+$x = 19660208
+test_ok($y != $x)
+
+trace_var :$x, Proc.new{$x *= 2}
+$x = 5
+test_ok($x == 10)
+
+untrace_var :$x
+
+test_check "defined?"
+
+test_ok(defined?($x))		# global variable
+test_ok(defined?($x) == 'global-variable')# returns description
+
+foo=5
+test_ok(defined?(foo))		# local variable
+
+test_ok(defined?(Array))	# constant
+test_ok(defined?(Object.new))	# method
+test_ok(!defined?(Object.print))# private method
+test_ok(defined?(1 == 2))	# operator expression
+
+class Foo
+  def foo
+    p :foo
+  end
+  protected :foo
+  def bar(f)
+    test_ok(defined?(self.foo))
+    test_ok(defined?(f.foo))
+  end
+end
+f = Foo.new
+test_ok(defined?(f.foo) == nil)
+f.bar(f)
+
+def defined_test
+  return !defined?(yield)
+end
+
+test_ok(defined_test)		# not iterator
+test_ok(!defined_test{})	# called as iterator
+
+test_check "alias"
+class Alias0
+  def foo; "foo" end
+end
+class Alias1 < Alias0
+  alias bar foo
+  def foo; "foo+" + super end
+end
+class Alias2 < Alias1
+  alias baz foo
+  undef foo
+end
+
+x = Alias2.new
+test_ok(x.bar == "foo")
+test_ok(x.baz == "foo+foo")
+
+# test_check for cache
+test_ok(x.baz == "foo+foo")
+
+class Alias3 < Alias2
+  def foo
+    defined? super
+  end
+  def bar
+    defined? super
+  end
+  def quux
+    defined? super
+  end
+end
+x = Alias3.new
+test_ok(!x.foo)
+test_ok(x.bar)
+test_ok(!x.quux)
+
+test_check "path"
+test_ok(File.basename("a") == "a")
+test_ok(File.basename("a/b") == "b")
+test_ok(File.basename("a/b/") == "b")
+test_ok(File.basename("/") == "/")
+test_ok(File.basename("//") == "/")
+test_ok(File.basename("///") == "/")
+test_ok(File.basename("a/b////") == "b")
+test_ok(File.basename("a.rb", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".*") == "a")
+test_ok(File.basename("a.rb///", ".c") == "a.rb")
+test_ok(File.dirname("a") == ".")
+test_ok(File.dirname("/") == "/")
+test_ok(File.dirname("/a") == "/")
+test_ok(File.dirname("a/b") == "a")
+test_ok(File.dirname("a/b/c") == "a/b")
+test_ok(File.dirname("/a/b/c") == "/a/b")
+test_ok(File.dirname("/a/b/") == "/a")
+test_ok(File.dirname("/a/b///") == "/a")
+case Dir.pwd
+when %r'\A\w:'
+  test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
+  test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
+  dosish = true
+when %r'\A//'
+  test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
+  test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
+  dosish = true
+else
+  test_ok(File.expand_path(".", "/") == "/")
+  test_ok(File.expand_path("sub", "/") == "/sub")
+end
+if dosish
+  test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
+  test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
+  test_ok(File.expand_path("/", "z:/sub") == "z:/")
+  test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
+end
+test_ok(File.expand_path(".", "//") == "//")
+test_ok(File.expand_path("sub", "//") == "//sub")
+
+# test_check "Proc#binding"
+ObjectSpace.each_object(Proc){|o|
+  begin
+    b = o.binding
+    eval 'self', b
+  rescue ArgumentError
+  end
+}
+
+test_check "gc"
+begin
+  1.upto(10000) {
+    tmp = [0,1,2,3,4,5,6,7,8,9]
+  }
+  tmp = nil
+  test_ok true
+rescue
+  test_ok false
+end
+class S
+  def initialize(a)
+    @a = a
+  end
+end
+l=nil
+100000.times {
+  l = S.new(l)
+}
+GC.start
+test_ok true   # reach here or dumps core
+l = []
+100000.times {
+  l.push([l])
+}
+GC.start
+test_ok true   # reach here or dumps core
+
+ObjectSpace.each_object{|o|
+  o.class.name
+}
+
+test_ok true   # reach here or dumps core
+
+PROGRESS.finish
+if $failed > 0
+  printf "not ok/test: %d failed %d\n", $ntest, $failed
+else
+  printf "end of test(test: %d)\n", $ntest
+end
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..9f9192685e
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,75 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+benchmark-driver --help
+Usage: benchmark-driver [options] RUBY|YAML...
+    -r, --runner TYPE                Specify runner type: ips, time, memory, once, block (default: ips)
+    -o, --output TYPE                Specify output type: compare, simple, markdown, record, all (default: compare)
+    -e, --executables EXECS          Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+        --rbenv VERSIONS             Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+        --repeat-count NUM           Try benchmark NUM times and use the fastest result or the worst memory usage
+        --repeat-result TYPE         Yield "best", "average" or "worst" result with --repeat-count (default: best)
+        --alternate                  Alternate executables instead of running the same executable in a row with --repeat-count
+        --bundler                    Install and use gems specified in Gemfile
+        --filter REGEXP              Filter out benchmarks with given regexp
+        --run-duration SECONDS       Warmup estimates loop_count to run for this duration (default: 3)
+        --timeout SECONDS            Timeout ruby command execution with timeout(1)
+    -v, --verbose                    Verbose mode. Multiple -v options increase visibility (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm benchmarks
+make benchmark ITEM=vm
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+#   -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/app_answer.rb b/benchmark/app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+  if m == 0 then
+    n + 1
+  elsif n == 0 then
+    ack(m - 1, 1)
+  else
+    ack(m - 1, ack(m, n - 1))
+  end
+end
+
+def the_answer_to_life_the_universe_and_everything
+  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..c1546e08ab
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def orthoBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    orthoBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+  # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  # $fp = fp
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n")
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+benchmark:
+  app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/app_factorial.rb b/benchmark/app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+  if(n > 1)
+    n * fact(n-1)
+  else
+    1
+  end
+end
+
+100.times {
+  fact(5000)
+}
diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb
new file mode 100644
index 0000000000..e61bc8aa32
--- /dev/null
+++ b/benchmark/app_fib.rb
@@ -0,0 +1,10 @@
+def fib(n)
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+#   "Understanding Computation" by Tom Stuart
+#   http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST     = -> l { LEFT[RIGHT[l]] }
+IF        = -> b { b }
+LEFT      = -> p { p[-> x { -> y { x } } ] }
+RIGHT     = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY  = LEFT
+REST      = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+  proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+  IF[proc][true][false]
+end
+
+def to_array(proc)
+  array = []
+
+  until to_boolean(IS_EMPTY[proc])
+    array.push(FIRST[proc])
+    proc = REST[proc]
+  end
+
+  array
+end
+
+def to_char(c)
+  '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+  to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+  to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+  i = 0
+  while i<100
+    i += 1
+    z = z * z
+    return false if z.abs > 2
+  end
+  true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
+    x = dx / 50.0
+    y = dy / 50.0
+    c = Complex(x, y)
+    ary << c if mandelbrot?(c)
+  }
+}
+
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+  i += 1
+  begin
+    raise
+  rescue
+  end
+end
diff --git a/benchmark/app_strconcat.rb b/benchmark/app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i += 1
+end
diff --git a/benchmark/app_tak.rb b/benchmark/app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/app_tarai.rb b/benchmark/app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+  if x <= y
+  then y
+  else tarai(tarai(x-1, y, z),
+             tarai(y-1, z, x),
+             tarai(z-1, x, y))
+  end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/app_uri.rb b/benchmark/app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+  small_flat_ary = 5.times.to_a
+  large_flat_ary = 100.times.to_a
+  small_pairs_ary = [[1, 2]] * 5
+  large_pairs_ary = [[1, 2]] * 100
+  mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+  small_flat_ary.flatten: small_flat_ary.flatten
+  small_flat_ary.flatten!: small_flat_ary.flatten!
+  large_flat_ary.flatten: large_flat_ary.flatten
+  large_flat_ary.flatten!: large_flat_ary.flatten!
+  small_pairs_ary.flatten: small_pairs_ary.flatten
+  small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+  large_pairs_ary.flatten: large_pairs_ary.flatten
+  large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+  mostly_flat_ary.flatten: mostly_flat_ary.flatten
+  mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+  small1 = [1, 2, 3]
+  small2 = [1, 2, 3, 4, 5]
+  small3 = [2, 3, 4, 5]
+  small4 = [2]
+  big1 = [1, 2, 3, 4] * 64
+  big2 = [1, 2, 3] * 64
+  big3 = [1, 2] * 64
+
+benchmark:
+  small-&: small1 & small2 & small3 & small4
+  small-intersection: small1.intersection(small2, small3, small4)
+  big-&: big1 & big2 & big3
+  big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_large_literal.yml b/benchmark/array_large_literal.yml
new file mode 100644
index 0000000000..423d68391f
--- /dev/null
+++ b/benchmark/array_large_literal.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def def_array(size)
+    Object.class_eval(<<-END)
+      def array_#{size}
+        x = 1
+        [#{(['x'] * size).join(',')}]
+      end
+    END
+  end
+  def_array(100)
+  def_array(1000)
+  def_array(10000)
+  def_array(100000)
+benchmark:
+  array_100: array_100
+  array_1000: array_1000
+  array_10000: array_10000
+  array_100000: array_100000
+
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
new file mode 100644
index 0000000000..ace1ae2e14
--- /dev/null
+++ b/benchmark/array_max_float.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_f).shuffle
+  ary10 = 10.times.map(&:to_f).shuffle
+  ary100 = 100.times.map(&:to_f).shuffle
+  ary500 = 500.times.map(&:to_f).shuffle
+  ary1000 = 1000.times.map(&:to_f).shuffle
+  ary2000 = 2500.times.map(&:to_f).shuffle
+  ary3000 = 2500.times.map(&:to_f).shuffle
+  ary5000 = 5000.times.map(&:to_f).shuffle
+  ary10000 = 10000.times.map(&:to_f).shuffle
+  ary20000 = 20000.times.map(&:to_f).shuffle
+  ary50000 = 50000.times.map(&:to_f).shuffle
+  ary100000 = 100000.times.map(&:to_f).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
new file mode 100644
index 0000000000..acd83684d0
--- /dev/null
+++ b/benchmark/array_max_int.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+  ary1000000.max: ary1000000.max
+
+loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
new file mode 100644
index 0000000000..2aeed010f2
--- /dev/null
+++ b/benchmark/array_max_str.yml
@@ -0,0 +1,30 @@
+prelude: |
+  ary2 = 2.times.map(&:to_s).shuffle
+  ary10 = 10.times.map(&:to_s).shuffle
+  ary100 = 100.times.map(&:to_s).shuffle
+  ary500 = 500.times.map(&:to_s).shuffle
+  ary1000 = 1000.times.map(&:to_s).shuffle
+  ary2000 = 2500.times.map(&:to_s).shuffle
+  ary3000 = 2500.times.map(&:to_s).shuffle
+  ary5000 = 5000.times.map(&:to_s).shuffle
+  ary10000 = 10000.times.map(&:to_s).shuffle
+  ary20000 = 20000.times.map(&:to_s).shuffle
+  ary50000 = 50000.times.map(&:to_s).shuffle
+  ary100000 = 100000.times.map(&:to_s).shuffle
+
+benchmark:
+  ary2.max: ary2.max
+  ary10.max: ary10.max
+  ary100.max: ary100.max
+  ary500.max: ary500.max
+  ary1000.max: ary1000.max
+  ary2000.max: ary2000.max
+  ary3000.max: ary3000.max
+  ary5000.max: ary5000.max
+  ary10000.max: ary10000.max
+  ary20000.max: ary20000.max
+  ary50000.max: ary50000.max
+  ary100000.max: ary100000.max
+
+loop_count: 10000
+
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
new file mode 100644
index 0000000000..53e5072b14
--- /dev/null
+++ b/benchmark/array_min.yml
@@ -0,0 +1,31 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary500 = 500.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary2000 = 2500.times.to_a.shuffle
+  ary3000 = 2500.times.to_a.shuffle
+  ary5000 = 5000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+  ary20000 = 20000.times.to_a.shuffle
+  ary50000 = 50000.times.to_a.shuffle
+  ary100000 = 100000.times.to_a.shuffle
+  ary1000000 = 1000000.times.to_a.shuffle
+
+benchmark:
+  ary2.min: ary2.min
+  ary10.min: ary10.min
+  ary100.min: ary100.min
+  ary500.min: ary500.min
+  ary1000.min: ary1000.min
+  ary2000.min: ary2000.min
+  ary3000.min: ary3000.min
+  ary5000.min: ary5000.min
+  ary10000.min: ary10000.min
+  ary20000.min: ary20000.min
+  ary50000.min: ary50000.min
+  ary100000.min: ary100000.min
+  ary1000000.min: ary1000000.min
+
+loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
new file mode 100644
index 0000000000..1cd2b34794
--- /dev/null
+++ b/benchmark/array_sample.yml
@@ -0,0 +1,4 @@
+prelude: ary = (1..10_000).to_a
+benchmark:
+  - ary.sample
+  - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+  [10_000,1_000_000,100_000_000].each do |n|
+    ary = Array.new(n,0)
+    GC.start
+    x.report("#{n}:shift"){ ary.shift }
+    (0..4).each do |i|
+      ary = Array.new(n,0)
+      GC.start
+      x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+    end
+  end
+end
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 & arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 - arr2
+    end
+  end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+  (MIN_SIZE..MAX_SIZE).map do |size2|
+    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+  end
+end
+
+ITERATIONS.times do
+  ARRAYS.each do |group|
+    group.each do |arr1, arr2|
+      arr1 | arr2
+    end
+  end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
new file mode 100644
index 0000000000..7b9027ebf7
--- /dev/null
+++ b/benchmark/array_sort_int.yml
@@ -0,0 +1,15 @@
+prelude: |
+  ary2 = 2.times.to_a.shuffle
+  ary10 = 10.times.to_a.shuffle
+  ary100 = 100.times.to_a.shuffle
+  ary1000 = 1000.times.to_a.shuffle
+  ary10000 = 10000.times.to_a.shuffle
+
+benchmark:
+  ary2.sort: ary2.sort
+  ary10.sort: ary10.sort
+  ary100.sort: ary100.sort
+  ary1000.sort: ary1000.sort
+  ary10000.sort: ary10000.sort
+
+loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
new file mode 100644
index 0000000000..82134cdf9b
--- /dev/null
+++ b/benchmark/attr_accessor.yml
@@ -0,0 +1,29 @@
+prelude: |
+  class C
+    attr_accessor :x
+    def initialize
+      @x = nil
+    end
+    class_eval <<-END
+      def ar
+        #{'x;'*256}
+      end
+      def aw
+        #{'self.x = nil;'*256}
+      end
+      def arm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def awm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+    END
+  end
+  obj = C.new
+benchmark:
+  attr_reader: "obj.ar"
+  attr_writer: "obj.aw"
+  attr_reader_method: "obj.arm"
+  attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
new file mode 100644
index 0000000000..417941104e
--- /dev/null
+++ b/benchmark/buffer_each.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  array = string.bytes
+  buffer = IO::Buffer.for(string)
+benchmark:
+  string.each_byte: |
+    upcased = String.new
+    string.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
+  array.each: |
+    upcased = String.new
+    array.each do |byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each: |
+    upcased = String.new
+    buffer.each(:U8) do |offset, byte|
+      upcased << (byte ^ 32)
+    end
+  buffer.each_byte: |
+    upcased = String.new
+    buffer.each_byte do |byte|
+      upcased << (byte ^ 32)
+    end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
new file mode 100644
index 0000000000..9e1f99d64e
--- /dev/null
+++ b/benchmark/buffer_get.yml
@@ -0,0 +1,25 @@
+prelude: |
+  # frozen_string_literal: true
+  Warning[:experimental] = false
+  string = "The quick brown fox jumped over the lazy dog."
+  buffer = IO::Buffer.for(string)
+  format = [:U32, :U32, :U32, :U32]
+benchmark:
+  string.unpack1: |
+    [
+      string.unpack1("N"),
+      string.unpack1("N", offset: 4),
+      string.unpack1("N", offset: 8),
+      string.unpack1("N", offset: 12),
+    ]
+  buffer.get_value: |
+    [
+      buffer.get_value(:U32, 0),
+      buffer.get_value(:U32, 4),
+      buffer.get_value(:U32, 8),
+      buffer.get_value(:U32, 12),
+    ]
+  buffer.get_values: |
+    buffer.get_values(format, 0)
+  string.unpack: |
+    string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..655be9d7d8
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'cgi/escape'
+benchmark:
+  - script: CGI.escapeHTML("")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcde")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("abcd<")
+    loop_count: 20000000
+  - script: CGI.escapeHTML("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: CGI.escapeHTML(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: CGI.escapeHTML(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: CGI.escapeHTML(example_html)
+    loop_count: 1000000
diff --git a/benchmark/class_superclass.yml b/benchmark/class_superclass.yml
new file mode 100644
index 0000000000..847ff811f1
--- /dev/null
+++ b/benchmark/class_superclass.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class SimpleClass; end
+  class OneModuleClass
+    1.times { include Module.new }
+  end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+benchmark:
+  object_class_superclass: |
+    Object.superclass
+  simple_class_superclass: |
+    SimpleClass.superclass
+  one_module_class: |
+    OneModuleClass.superclass
+  medium_class_superclass: |
+    MediumClass.superclass
+  large_class_superclass: |
+    LargeClass.superclass
+loop_count: 20000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+  max, min = 1000.0, -1000.0
+  a = Complex(rand(max)+min, rand(max)+min)
+  b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+  complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
new file mode 100644
index 0000000000..a95ec6f37e
--- /dev/null
+++ b/benchmark/constant_invalidation.rb
@@ -0,0 +1,22 @@
+$VERBOSE = nil
+
+CONSTANT1 = 1
+CONSTANT2 = 1
+CONSTANT3 = 1
+CONSTANT4 = 1
+CONSTANT5 = 1
+
+def constants
+  [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
+end
+
+500_000.times do
+  constants
+
+  # With previous behavior, this would cause all of the constant caches
+  # associated with the constant lookups listed above to invalidate, meaning
+  # they would all have to be fetched again. With current behavior, it only
+  # invalidates when a name matches, so the following constant set shouldn't
+  # impact the constant lookups listed above.
+  INVALIDATE = true
+end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+  max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
new file mode 100644
index 0000000000..0ee390a441
--- /dev/null
+++ b/benchmark/enum_lazy_flat_map.yml
@@ -0,0 +1,16 @@
+prelude: |
+  num = (1..).lazy.take(100)
+  ary2 = [[1,2]].cycle.lazy.take(10)
+  ary10 = [[*1..10]].cycle.lazy.take(10)
+  ary20 = [[*1..20]].cycle.lazy.take(10)
+  ary50 = [[*1..50]].cycle.lazy.take(10)
+  ary100 = [[*1..100]].cycle.lazy.take(10)
+
+benchmark:
+  num3: num.flat_map {|x| x}.take(3).to_a
+  num10: num.flat_map {|x| x}.take(3).to_a
+  ary2:  ary2.flat_map {|x| x}.take(3).to_a
+  ary10: ary10.flat_map {|x| x}.take(3).to_a
+  ary20: ary20.flat_map {|x| x}.take(3).to_a
+  ary50: ary50.flat_map {|x| x}.take(3).to_a
+  ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
new file mode 100644
index 0000000000..4566ff0261
--- /dev/null
+++ b/benchmark/enum_lazy_zip.yml
@@ -0,0 +1,22 @@
+prelude: |
+  a = (1..3).lazy
+  b = a.map {|x| x}
+
+benchmark:
+  first_ary: a.zip(["a", "b", "c"]).first
+  first_nonary: a.zip("a".."c").first
+  first_noarg: a.zip.first
+
+  take3_ary: a.zip(["a", "b", "c"]).take(3).force
+  take3_nonary: a.zip("a".."c").take(3).force
+  take3_noarg: a.zip.take(3).force
+
+  chain-first_ary: b.zip(["a", "b", "c"]).first
+  chain-first_nonary: b.zip("a".."c").first
+  chain-first_noarg: b.zip.first
+
+  chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
+  chain-take3_nonary: b.zip("a".."c").take(3).force
+  chain-take3_noarg: b.zip.take(3).force
+
+  block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
new file mode 100644
index 0000000000..9d01731abb
--- /dev/null
+++ b/benchmark/enum_minmax.yml
@@ -0,0 +1,25 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.min: set2.min
+  set10.min: set10.min
+  set100.min: set100.min
+  set1000.min: set1000.min
+  set10000.min: set10000.min
+  set2.max: set2.max
+  set10.max: set10.max
+  set100.max: set100.max
+  set1000.max: set1000.max
+  set10000.max: set10000.max
+  set2.minmax: set2.minmax
+  set10.minmax: set10.minmax
+  set100.minmax: set100.minmax
+  set1000.minmax: set1000.minmax
+  set10000.minmax: set10000.minmax
+
+loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
new file mode 100644
index 0000000000..6f26e748c6
--- /dev/null
+++ b/benchmark/enum_sort.yml
@@ -0,0 +1,15 @@
+prelude: |
+  set2 = 2.times.to_a.shuffle.to_set
+  set10 = 10.times.to_a.shuffle.to_set
+  set100 = 100.times.to_a.shuffle.to_set
+  set1000 = 1000.times.to_a.shuffle.to_set
+  set10000 = 10000.times.to_a.shuffle.to_set
+
+benchmark:
+  set2.sort_by: set2.sort_by { 0 }
+  set10.sort_by: set10.sort_by { 0 }
+  set100.sort_by: set100.sort_by { 0 }
+  set1000.sort_by: set1000.sort_by { 0 }
+  set10000.sort_by: set10000.sort_by { 0 }
+
+loop_count: 10000
diff --git a/benchmark/enum_sort_by.yml b/benchmark/enum_sort_by.yml
new file mode 100644
index 0000000000..d386353888
--- /dev/null
+++ b/benchmark/enum_sort_by.yml
@@ -0,0 +1,53 @@
+prelude: |
+  array_length = 2
+  fixnum_array2 = array_length.times.to_a.map {rand(10000)}
+  float_array2 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array2 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array2 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array2 =array_length.times.to_a.map {0}
+
+  array_length = 10
+  fixnum_array10 = array_length.times.to_a.map {rand(10000)}
+  float_array10 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array10 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array10 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array10 =array_length.times.to_a.map {0}
+
+  array_length = 1000
+  fixnum_array1000 = array_length.times.to_a.map {rand(10000)}
+  float_array1000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array1000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array1000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array1000 =array_length.times.to_a.map {0}
+
+  array_length = 100000
+  fixnum_array100000 = array_length.times.to_a.map {rand(10000)}
+  float_array100000 = array_length.times.to_a.map {rand(10000.0).to_f}
+  string_array100000 = array_length.times.to_a.map {"r" * rand(1..10000)}
+  mix_array100000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
+  all_zero_array100000 =array_length.times.to_a.map {0}
+
+benchmark:
+  fixnum_array2.sort_by: fixnum_array2.sort_by {|a| a}
+  float_array2.sort_by:  float_array2.sort_by {|a| a}
+  string_length2.sort_by: string_array2.sort_by {|a| a.length}
+  mix_array2.sort_by:  mix_array2.sort_by {|a| a}
+  all_zero2.sort_by: all_zero_array2.sort_by{|a| a}
+
+  fixnum_array10.sort_by: fixnum_array10.sort_by {|a| a}
+  float_array10.sort_by:  float_array10.sort_by {|a| a}
+  string_length10.sort_by: string_array10.sort_by {|a| a.length}
+  mix_array10.sort_by:  mix_array10.sort_by {|a| a}
+  all_zero10.sort_by: all_zero_array10.sort_by{|a| a}
+
+  fixnum_array1000.sort_by: fixnum_array1000.sort_by {|a| a}
+  float_array1000.sort_by:  float_array1000.sort_by {|a| a}
+  string_length1000.sort_by: string_array1000.sort_by {|a| a.length}
+  mix_array1000.sort_by:  mix_array1000.sort_by {|a| a}
+  all_zero1000.sort_by: all_zero_array1000.sort_by{|a| a}
+
+  fixnum_array100000.sort_by: fixnum_array100000.sort_by {|a| a}
+  float_array100000.sort_by:  float_array100000.sort_by {|a| a}
+  string_length100000.sort_by: string_array100000.sort_by {|a| a.length}
+  mix_array100000.sort_by:  mix_array100000.sort_by {|a| a}
+  all_zero100000.sort_by: all_zero_array100000.sort_by{|a| a}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
new file mode 100644
index 0000000000..edd2e040a0
--- /dev/null
+++ b/benchmark/enum_tally.yml
@@ -0,0 +1,4 @@
+prelude: |
+  list = ("aaa".."zzz").to_a*10
+benchmark:
+  tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
new file mode 100644
index 0000000000..ca28d756e7
--- /dev/null
+++ b/benchmark/erb_escape_html.yml
@@ -0,0 +1,31 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'erb'
+benchmark:
+  - script: ERB::Util.html_escape("")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcde")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("abcd<")
+    loop_count: 20000000
+  - script: ERB::Util.html_escape("'&\"<>")
+    loop_count: 5000000
+  - prelude: long_no_escape = "abcde" * 300
+    script: ERB::Util.html_escape(long_no_escape)
+    loop_count: 1000000
+  - prelude: long_all_escape = "'&\"<>" * 10
+    script: ERB::Util.html_escape(long_all_escape)
+    loop_count: 1000000
+  - prelude: | # http://example.com/
+      example_html = <<~HTML
+        <body>
+        <div>
+            <h1>Example Domain</h1>
+            <p>This domain is established to be used for illustrative examples in documents. You may use this
+            domain in examples without prior coordination or asking for permission.</p>
+            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+        </div>
+        </body>
+      HTML
+    script: ERB::Util.html_escape(example_html)
+    loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+  require 'erb'
+
+  data = <<erb
+  <html>
+    <head> <%= title %> </head>
+    <body>
+      <h1> <%= title %> </h1>
+      <p>
+        <%= content %>
+      </p>
+    </body>
+  </html>
+  erb
+
+  title = "hello world!"
+  content = "hello world!\n" * 10
+
+  src = "def self.render(title, content); #{ERB.new(data).src}; end"
+  mod = Module.new
+  mod.instance_eval(src, "(ERB)")
+benchmark:
+  erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100644
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+  def make_link(previous)
+    Fiber.new do
+      while message = previous.resume
+        Fiber.yield(message)
+      end
+    end
+  end
+
+  def make_chain(length = 1000, &block)
+    chain = Fiber.new(&block)
+
+    (length - 1).times do
+      chain = make_link(chain)
+    end
+
+    return chain
+  end
+
+  message = "Hello World!"
+
+  chain = make_chain do
+    while true
+      Fiber.yield(message)
+    end
+  end
+benchmark:
+  make_chain: |
+    make_chain(100) do
+      while true
+        Fiber.yield(message)
+      end
+    end
+  resume_chain: |
+    chain.resume
+loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
new file mode 100644
index 0000000000..8588686477
--- /dev/null
+++ b/benchmark/fiber_locals.yml
@@ -0,0 +1,8 @@
+prelude: |
+  th = Thread.current
+  th[:key] = :val
+benchmark:
+  key?: th.key?(:key)
+  []: th[:key]
+  keys: th.keys
+loop_count: 1_000_000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+  File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_join.yml b/benchmark/file_join.yml
new file mode 100644
index 0000000000..845257cf1e
--- /dev/null
+++ b/benchmark/file_join.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  two_strings: File.join(__FILE__, "path")
+  many_strings: File.join(__FILE__, "path", "a", "b", "c", "d")
+  array: File.join([__FILE__, "path", "a", "b", "c", "d"])
+  mixed: File.join(__FILE__, "path", "a", "b", ["c", "d"])
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+  File.rename(a, b)
+  File.rename(b, a)
+end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
new file mode 100644
index 0000000000..56ea41effc
--- /dev/null
+++ b/benchmark/float_methods.yml
@@ -0,0 +1,14 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  to_f: |
+    flo.to_f
+  abs: |
+    flo.abs
+  magnitude: |
+    flo.magnitude
+  -@: |
+    -flo
+  zero?: |
+    flo.zero?
+loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
new file mode 100644
index 0000000000..172db1bf6d
--- /dev/null
+++ b/benchmark/float_neg_posi.yml
@@ -0,0 +1,8 @@
+prelude: |
+  flo = 4.2
+benchmark:
+  negative?: |
+    flo.negative?
+  positive?: |
+    flo.positive?
+loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
new file mode 100644
index 0000000000..0abae5cdb8
--- /dev/null
+++ b/benchmark/float_to_s.yml
@@ -0,0 +1,7 @@
+prelude: |
+  floats = [*0.0.step(1.0, 0.0001)]
+
+benchmark:
+  to_s: floats.each {|f| f.to_s}
+
+loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..275f58b924
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..83347cdd20
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..23d0b91c6c
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,57 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = false
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+  GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+  load script
+}
+
+gc_time = 0
+
+if $gcprof
+  gc_time = GC::Profiler.total_time
+  GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+  GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+  puts
+  puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts "         (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+  h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+  ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+  h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..8ebdff7d1d
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../app_pentomino'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+  dir = File.join(d, 'rdocbench')
+  args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+  args << '--op' << dir
+
+  r = RDoc::RDoc.new
+  r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+  class Node
+    attr_accessor :color
+    attr_accessor :key
+    attr_accessor :left
+    attr_accessor :right
+    attr_accessor :parent
+
+    RED = :red
+    BLACK = :black
+    COLORS = [RED, BLACK].freeze
+
+    def initialize(key, color = RED)
+      raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+      @color = color
+      @key = key
+      @left = @right = @parent = NilNode.instance
+    end
+
+    def black?
+      return color == BLACK
+    end
+
+    def red?
+      return color == RED
+    end
+  end
+
+  class NilNode < Node
+    class << self
+      private :new
+
+      # it's not thread safe
+      def instance
+        @instance ||= begin
+          def instance
+            return @instance
+          end
+
+          new
+        end
+      end
+    end
+
+    def initialize
+      self.color = BLACK
+      self.key = 0
+      self.left = nil
+      self.right = nil
+      self.parent = nil
+    end
+
+    def nil?
+      return true
+    end
+  end
+
+  include Enumerable
+
+  attr_accessor :root
+  attr_accessor :size
+
+  def initialize
+    self.root = NilNode.instance
+    self.size = 0
+  end
+
+  def add(key)
+    insert(Node.new(key))
+  end
+
+  def insert(x)
+    insert_helper(x)
+
+    x.color = Node::RED
+    while x != root && x.parent.color == Node::RED
+      if x.parent == x.parent.parent.left
+        y = x.parent.parent.right
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.right
+            x = x.parent
+            left_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          right_rotate(x.parent.parent)
+        end
+      else
+        y = x.parent.parent.left
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.left
+            x = x.parent
+            right_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          left_rotate(x.parent.parent)
+        end
+      end
+    end
+    root.color = Node::BLACK
+  end
+
+  alias << insert
+
+  def delete(z)
+    y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+    x = y.left.nil? ? y.right : y.left
+    x.parent = y.parent
+
+    if y.parent.nil?
+      self.root = x
+    else
+      if y == y.parent.left
+        y.parent.left = x
+      else
+        y.parent.right = x
+      end
+    end
+
+    z.key = y.key if y != z
+
+    if y.color == Node::BLACK
+      delete_fixup(x)
+    end
+
+    self.size -= 1
+    return y
+  end
+
+  def minimum(x = root)
+    while !x.left.nil?
+      x = x.left
+    end
+    return x
+  end
+
+  def maximum(x = root)
+    while !x.right.nil?
+      x = x.right
+    end
+    return x
+  end
+
+  def successor(x)
+    if !x.right.nil?
+      return minimum(x.right)
+    end
+    y = x.parent
+    while !y.nil? && x == y.right
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def predecessor(x)
+    if !x.left.nil?
+      return maximum(x.left)
+    end
+    y = x.parent
+    while !y.nil? && x == y.left
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def inorder_walk(x = root)
+    x = self.minimum
+    while !x.nil?
+      yield x.key
+      x = successor(x)
+    end
+  end
+
+  alias each inorder_walk
+
+  def reverse_inorder_walk(x = root)
+    x = self.maximum
+    while !x.nil?
+      yield x.key
+      x = predecessor(x)
+    end
+  end
+
+  alias reverse_each reverse_inorder_walk
+
+  def search(key, x = root)
+    while !x.nil? && x.key != key
+      key < x.key ? x = x.left : x = x.right
+    end
+    return x
+  end
+
+  def empty?
+    return self.root.nil?
+  end
+
+  def black_height(x = root)
+    height = 0
+    while !x.nil?
+      x = x.left
+      height +=1 if x.nil? || x.black?
+    end
+    return height
+  end
+
+private
+
+  def left_rotate(x)
+    raise "x.right is nil!" if x.right.nil?
+    y = x.right
+    x.right = y.left
+    y.left.parent = x if !y.left.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.left = x
+    x.parent = y
+  end
+
+  def right_rotate(x)
+    raise "x.left is nil!" if x.left.nil?
+    y = x.left
+    x.left = y.right
+    y.right.parent = x if !y.right.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.right = x
+    x.parent = y
+  end
+
+  def insert_helper(z)
+    y = NilNode.instance
+    x = root
+    while !x.nil?
+      y = x
+      z.key < x.key ? x = x.left : x = x.right
+    end
+    z.parent = y
+    if y.nil?
+      self.root = z
+    else
+      z.key < y.key ? y.left = z : y.right = z
+    end
+    self.size += 1
+  end
+
+  def delete_fixup(x)
+    while x != root && x.color == Node::BLACK
+      if x == x.parent.left
+        w = x.parent.right
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          left_rotate(x.parent)
+          w = x.parent.right
+        end
+        if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.right.color == Node::BLACK
+            w.left.color = Node::BLACK
+            w.color = Node::RED
+            right_rotate(w)
+            w = x.parent.right
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.right.color = Node::BLACK
+          left_rotate(x.parent)
+          x = root
+        end
+      else
+        w = x.parent.left
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          right_rotate(x.parent)
+          w = x.parent.left
+        end
+        if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.left.color == Node::BLACK
+            w.right.color = Node::BLACK
+            w.color = Node::RED
+            left_rotate(w)
+            w = x.parent.left
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.left.color = Node::BLACK
+          right_rotate(x.parent)
+          x = root
+        end
+      end
+    end
+    x.color = Node::BLACK
+  end
+end
+
+def rbt_bm
+  n = 100_000
+  a1 = []; n.times { a1 << rand(999_999) }
+  a2 = []; n.times { a2 << rand(999_999) }
+
+  start = Time.now
+
+  tree = RedBlackTree.new
+
+  n.times {|i| tree.add(i) }
+  n.times { tree.delete(tree.root) }
+
+  tree = RedBlackTree.new
+  a1.each {|e| tree.add(e) }
+  a2.each {|e| tree.search(e) }
+  tree.inorder_walk {|key| key + 1 }
+  tree.reverse_inorder_walk {|key| key + 1 }
+  n.times { tree.minimum }
+  n.times { tree.maximum }
+
+  return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+  # puts rbt_bm.to_f
+  rbt_bm.to_f
+  # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+  attr_reader :next_ring
+  def initialize n = nil
+    @next_ring = n
+  end
+
+
+  def size
+    s = 1
+    ring = self
+    while ring.next_ring
+      s += 1
+      ring = ring.next_ring
+    end
+    s
+  end
+end
+
+ring = Ring.new
+
+max.times{
+  ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
new file mode 100644
index 0000000000..ac7a683d95
--- /dev/null
+++ b/benchmark/hash_aref_array.rb
@@ -0,0 +1,5 @@
+h = {}
+arrays = (0..99).each_slice(10).to_a
+#STDERR.puts arrays.inspect
+arrays.each { |s| h[s] = s }
+200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+  symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+  symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
new file mode 100644
index 0000000000..2217274c82
--- /dev/null
+++ b/benchmark/hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str.rb b/benchmark/hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str_lit.yml b/benchmark/hash_aref_str_lit.yml
new file mode 100644
index 0000000000..ed8142bcf1
--- /dev/null
+++ b/benchmark/hash_aref_str_lit.yml
@@ -0,0 +1,20 @@
+prelude: |
+  # frozen_string_literal: true
+  hash = 10.times.to_h do |i|
+    [i, i]
+  end
+  dyn_sym = "dynamic_symbol".to_sym
+  binary = RubyVM::InstructionSequence.compile("# frozen_string_literal: true\n'iseq_load'").to_binary
+  iseq_literal_string = RubyVM::InstructionSequence.load_from_binary(binary).eval
+
+  hash[:some_symbol] = 1
+  hash[dyn_sym] = 2
+  hash["small"] = 3
+  hash["frozen_string_literal"] = 4
+  hash[iseq_literal_string] = 5
+benchmark:
+  symbol: hash[:some_symbol]
+  dyn_symbol: hash[dyn_sym]
+  small_lit: hash["small"]
+  frozen_lit: hash["frozen_string_literal"]
+  iseq_lit: hash[iseq_literal_string]
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
new file mode 100644
index 0000000000..f75d163fe6
--- /dev/null
+++ b/benchmark/hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
new file mode 100644
index 0000000000..9dab8df7be
--- /dev/null
+++ b/benchmark/hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned  others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
new file mode 100644
index 0000000000..833f10e1c7
--- /dev/null
+++ b/benchmark/hash_defaults.yml
@@ -0,0 +1,6 @@
+prelude: |
+  h = Hash.new { :foo }
+benchmark:
+  default_aref: h[1]
+  default_method: h.default(1)
+loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+  small_hash = { a: 1 }
+  larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+  dup_small: small_hash.dup
+  dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
new file mode 100644
index 0000000000..c26df1a7ed
--- /dev/null
+++ b/benchmark/hash_first.yml
@@ -0,0 +1,11 @@
+prelude: |
+  hash1 = 1_000_000.times.to_h { [rand, true]}
+  hash2 = hash1.dup
+  hash2.keys[1..100_000].each { hash2.delete _1 }
+  hash2.delete hash2.first[0]
+
+benchmark:
+  hash1: hash1.first
+  hash2: hash2.first
+
+loop_count: 100_000
diff --git a/benchmark/hash_flatten.rb b/benchmark/hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+1000.times do
+  h.flatten
+end
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
new file mode 100644
index 0000000000..0c7edfed3e
--- /dev/null
+++ b/benchmark/hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_num.rb b/benchmark/hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/hash_ident_str.rb b/benchmark/hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_key.yml b/benchmark/hash_key.yml
new file mode 100644
index 0000000000..cab4cf9ca4
--- /dev/null
+++ b/benchmark/hash_key.yml
@@ -0,0 +1,5 @@
+prelude: |
+  obj = Object.new
+  hash = { obj => true }
+benchmark: hash.key?(obj)
+loop_count: 30000000
diff --git a/benchmark/hash_keys.rb b/benchmark/hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.keys
+end
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" }  }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_new.yml b/benchmark/hash_new.yml
new file mode 100644
index 0000000000..9d8e34187f
--- /dev/null
+++ b/benchmark/hash_new.yml
@@ -0,0 +1,16 @@
+prelude: |
+  has_hash_with_capa = Hash.instance_method(:initialize).parameters.include?([:key, :capacity])
+  strings_1k = 1_000.times.map { |i| -i.to_s.freeze }
+  strings_100k = 100_000.times.map { |i| -i.to_s.freeze }
+benchmark:
+  new: Hash.new
+  new_with_capa_1k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_1k.size) : {}
+    strings_1k.each do |x|
+      h[x] = true
+    end
+  new_with_capa_100k: |
+    h = has_hash_with_capa ? Hash.new(capacity: strings_100k.size) : {}
+    strings_100k.each do |x|
+      h[x] = true
+    end
diff --git a/benchmark/hash_shift.rb b/benchmark/hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+50000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do |i|
+  [i].map(&h)
+end
diff --git a/benchmark/hash_values.rb b/benchmark/hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.values
+end
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_close.yml b/benchmark/io_close.yml
new file mode 100644
index 0000000000..a552872884
--- /dev/null
+++ b/benchmark/io_close.yml
@@ -0,0 +1,13 @@
+prelude: |
+  ios = 1000.times.map do
+    100.times.map{IO.pipe}
+  end
+benchmark:
+  # Close IO
+  io_close: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 100
diff --git a/benchmark/io_close_contended.yml b/benchmark/io_close_contended.yml
new file mode 100644
index 0000000000..1d9e4e0d0f
--- /dev/null
+++ b/benchmark/io_close_contended.yml
@@ -0,0 +1,21 @@
+prelude: |
+  ios = 100.times.map do
+    10.times.map do
+      pipe = IO.pipe.tap do |r, w|
+        Thread.new do
+          r.read
+        rescue IOError
+          # Ignore
+        end
+      end
+    end
+  end
+benchmark:
+  # Close IO
+  io_close_contended: |
+    # Process each batch of ios per iteration of the benchmark.
+    ios.pop.each do |r, w|
+      r.close
+      w.close
+    end
+loop_count: 10
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  src = Zero.new
+  dst = File.open(IO::NULL, 'wb')
+  n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+  # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+  def initialize
+    @n = 100000
+    @in = File.open('/dev/zero', 'rb')
+  end
+
+  def read(len, buf)
+    return if (@n -= 1) == 0
+    @in.read(len, buf)
+  end
+end
+
+begin
+  require 'socket'
+  src = Zero.new
+  rd, wr = UNIXSocket.pair
+  pid = fork do
+    wr.close
+    buf = String.new
+    while rd.read(16384, buf)
+    end
+  end
+  rd.close
+  IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+  # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+  wr.close if wr
+  Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/io_file_create.rb b/benchmark/io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/io_file_read.rb b/benchmark/io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/benchmark/io_file_write.rb b/benchmark/io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, noex)
+    r.read_nonblock(1, buf, noex)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, exception: false)
+    r.read_nonblock(1, buf, exception: false)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+  i += 1
+  w.write(src)
+  r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/io_select.rb b/benchmark/io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/benchmark/io_select2.rb b/benchmark/io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/benchmark/io_select3.rb b/benchmark/io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
new file mode 100644
index 0000000000..cdb409948b
--- /dev/null
+++ b/benchmark/io_write.rb
@@ -0,0 +1,22 @@
+#!/usr/bin/env ruby
+
+require 'benchmark'
+
+i, o = IO.pipe
+o.sync = true
+
+DOT = ".".freeze
+
+chunks = 100_000.times.collect{DOT}
+
+thread = Thread.new do
+  while i.read(1024)
+  end
+end
+
+100.times do
+  o.write(*chunks)
+end
+
+o.close
+thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'irb/color'
+  code = <<~'CODE'
+    def self.foo # bar
+      :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+    end
+  CODE
+benchmark:
+  irb_color_complete: |
+    IRB::Color.colorize_code(code, complete: true)
+  irb_color_incomplete: |
+    IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+  # frozen_string_literal: true
+  require 'rbconfig'
+  irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+  irb_exec: |
+    IO.popen(irb_f, 'w') do |io|
+      io.write('exit')
+    end
+loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
new file mode 100644
index 0000000000..7e9d73bdd4
--- /dev/null
+++ b/benchmark/iseq_load_from_binary.yml
@@ -0,0 +1,25 @@
+prelude: |
+  symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
+
+  define_method = RubyVM::InstructionSequence.compile(%{
+    def foo; end
+    def bar; end
+    def baz; end
+    def egg; end
+    def spam; end
+  }).to_binary
+
+  all = RubyVM::InstructionSequence.compile(%{
+    module Foo; def foo; :foo; end; end
+    module Bar; def bar; :bar; end; end
+    module Baz; def baz; :baz; end; end
+    class Egg; def egg; :egg; end; end
+    class Spaml; def spam; :spam; end; end
+  }).to_binary
+
+benchmark:
+  symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
+  define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
+  all: RubyVM::InstructionSequence.load_from_binary(all)
+
+loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
new file mode 100644
index 0000000000..eb9ee923f5
--- /dev/null
+++ b/benchmark/ivar_extend.yml
@@ -0,0 +1,23 @@
+prelude: |
+  class Embedded
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+    end
+  end
+
+  class Extended
+    def initialize
+      @a = 1
+      @b = 1
+      @c = 1
+      @d = 1
+      @e = 1
+      @f = 1
+    end
+  end
+benchmark:
+  embedded: Embedded.new
+  extended: Extended.new
+loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
new file mode 100644
index 0000000000..069b23abcd
--- /dev/null
+++ b/benchmark/kernel_clone.yml
@@ -0,0 +1,6 @@
+prelude: "object = Object.new"
+benchmark:
+  clone: "object.clone"
+  clone_true: "object.clone(freeze: true)"
+  clone_false: "object.clone(freeze: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
new file mode 100644
index 0000000000..215f6750fc
--- /dev/null
+++ b/benchmark/kernel_float.yml
@@ -0,0 +1,5 @@
+benchmark:
+  float: "Float(42)"
+  float_true: "Float(42, exception: true)"
+  float_false: "Float(42, exception: false)"
+loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
new file mode 100644
index 0000000000..4dcbb31b4d
--- /dev/null
+++ b/benchmark/kernel_tap.yml
@@ -0,0 +1,6 @@
+prelude: |
+  obj = Object.new
+  x = nil
+benchmark:
+  kernel_tap: obj.tap { |o| x = o }
+loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
new file mode 100644
index 0000000000..85f7341e33
--- /dev/null
+++ b/benchmark/kernel_then.yml
@@ -0,0 +1,6 @@
+benchmark:
+  kernel_then: 1.then { |i| i + 1 }
+  kernel_then_enum: 1.then
+  kernel_yield_self: 1.yield_self { |i| i + 1 }
+  kernel_yield_self_enum: 1.yield_self
+loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
new file mode 100644
index 0000000000..fce6bce0b8
--- /dev/null
+++ b/benchmark/keyword_arguments.yml
@@ -0,0 +1,13 @@
+prelude: |
+  h = {a: 1}
+  def kw(a: 1) a end
+  def kws(**kw) kw end
+benchmark:
+  kw_to_kw: "kw(a: 1)"
+  kw_splat_to_kw: "kw(**h)"
+  kw_to_kw_splat: "kws(a: 1)"
+  kw_splat_to_kw_splat: "kws(**h)"
+  kw_and_splat_to_kw: "kw(a: 1, **h)"
+  kw_splats_to_kw: "kw(**h, **h)"
+  kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
+  kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+  def initialize(*)
+    super
+    @stdout = $stdout
+    @strio  = StringIO.new
+    $stdout = IOMultiplexer.new(@stdout, @strio)
+  end
+
+  def with_benchmark(*)
+    super
+  ensure
+    logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+    puts "\nLog file: #{logfile}"
+
+    $stdout = @stdout
+    File.write(logfile, @strio.tap(&:rewind).read)
+  end
+
+  class IOMultiplexer
+    def initialize(io1, io2)
+      @io1 = io1
+      @io2 = io2
+    end
+
+    [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+      define_method(method) do |*args|
+        @io1.send(method, *args)
+        @io2.send(method, *args)
+      end
+    end
+  end
+  private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cstime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :cutime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      jobs = jobs.map do |job|
+        job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+      end
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => value }, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render) do |path|
+        output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+        if $?.success?
+          Integer(f.read)
+        else
+          $stdout.print(output)
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def target
+    'peak'
+  end
+
+  # Overridden by BenchmarkDriver::Runner::Size
+  def metric
+    METRIC
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    def render
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+  key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+  key = ms.respond_to?(:rss) ? :rss : :size
+else
+  raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      end
+
+      if times > 1
+        <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+        RUBY
+      else
+        content
+      end
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
new file mode 100644
index 0000000000..fd9c2dd4db
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/ractor.rb
@@ -0,0 +1,122 @@
+require 'erb'
+
+# A runner to measure performance *inside* Ractor
+class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob) do
+    attr_accessor :ractor
+  end
+
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
+    def parse(ractor: 1, **kwargs)
+      super(**kwargs).each do |job|
+        job.ractor = ractor
+      end
+    end
+  })
+
+  private
+
+  unless private_instance_methods.include?(:run_benchmark)
+    raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
+  end
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    results = job.ractor.times.map do
+      Tempfile.open('benchmark_driver_result')
+    end
+    duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
+      success = execute(*context.executable.command, path, exception: false)
+      if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
+        value
+      else
+        BenchmarkDriver::Result::ERROR
+      end
+    end
+    results.each(&:close)
+
+    value_duration(
+      loop_count: job.loop_count,
+      duration: duration,
+    )
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(results:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      ERB.new(<<-RUBY).result_with_hash(results: results)
+Warning[:experimental] = false
+# shareable-constant-value: experimental_everything
+#{prelude}
+
+if #{loop_count} == 1
+  __bmdv_loop_before = 0
+  __bmdv_loop_after = 0
+else
+  __bmdv_loop_before = Time.new
+  #{while_loop('', loop_count, id: 0)}
+  __bmdv_loop_after = Time.new
+end
+
+__bmdv_ractors = []
+<% results.size.times do %>
+__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
+  __bmdv_time = Time
+  __bmdv_script_before = __bmdv_time.new
+  #{while_loop(script, loop_count, id: 1)}
+  __bmdv_script_after = __bmdv_time.new
+
+  (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
+}
+<% end %>
+
+# Wait for all Ractors before executing code to write results
+__bmdv_ractors.map!(&:value)
+
+<% results.each do |result| %>
+File.write(<%= result.dump %>, __bmdv_ractors.shift)
+<% end %>
+
+#{teardown}
+      RUBY
+    end
+
+    private
+
+    # id is to prevent:
+    # can not isolate a Proc because it accesses outer variables (__bmdv_i)
+    def while_loop(content, times, id:)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i#{id} = 0
+while __bmdv_i#{id} < #{times}
+  #{content}
+  __bmdv_i#{id} += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+  METRIC = BenchmarkDriver::Metric.new(
+    name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+  )
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Peak#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Peak#target
+  def target
+    'size'
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :stime
+  end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  # @param [BenchmarkDriver::Config::RunnerConfig] config
+  # @param [BenchmarkDriver::Output] output
+  # @param [BenchmarkDriver::Context] contexts
+  def initialize(config:, output:, contexts:)
+    @config = config
+    @output = output
+    @contexts = contexts
+  end
+
+  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+  # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+  def run(jobs)
+    if jobs.any? { |job| job.loop_count.nil? }
+      raise 'missing loop_count is not supported in Ruby repository'
+    end
+
+    @output.with_benchmark do
+      jobs.each do |job|
+        @output.with_job(name: job.name) do
+          job.runnable_contexts(@contexts).each do |context|
+            duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+              run_benchmark(job, context: context)
+            end
+            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+              @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+            end
+          end
+        end
+      end
+    end
+  end
+
+  private
+
+  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+  # @param [BenchmarkDriver::Context] context
+  # @return [BenchmarkDriver::Metrics]
+  def run_benchmark(job, context:)
+    benchmark = BenchmarkScript.new(
+      preludes:   [context.prelude, job.prelude],
+      script:     job.script,
+      teardown:   job.teardown,
+      loop_count: job.loop_count,
+    )
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      with_script(benchmark.render(result: f.path, target: target)) do |path|
+        IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+        if $?.success?
+          Float(f.read)
+        else
+          BenchmarkDriver::Result::ERROR
+        end
+      end
+    end
+  end
+
+  # This method is overridden by some subclasses
+  def metric
+    METRIC
+  end
+
+  # This method is overridden by some subclasses
+  def target
+    :total
+  end
+
+  def with_script(script)
+    if @config.verbose >= 2
+      sep = '-' * 30
+      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+    end
+
+    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+      f.puts script
+      f.close
+      return yield(f.path)
+    end
+  end
+
+  # @param [String] prelude
+  # @param [String] script
+  # @param [String] teardown
+  # @param [Integer] loop_count
+  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+    # @param [String] result - A file to write result
+    def render(result:, target:)
+      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+      <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+  #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+      RUBY
+    end
+
+    private
+
+    def while_loop(content, times)
+      if !times.is_a?(Integer) || times <= 0
+        raise ArgumentError.new("Unexpected times: #{times.inspect}")
+      elsif times == 1
+        return content
+      end
+
+      # TODO: execute in batch
+      <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+  #{content}
+  __bmdv_i += 1
+end
+      RUBY
+    end
+  end
+  private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+  METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+  Job = Class.new(BenchmarkDriver::DefaultJob)
+  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+  private
+
+  # Overriding BenchmarkDriver::Runner::Total#metric
+  def metric
+    METRIC
+  end
+
+  # Overriding BenchmarkDriver::Runner::Total#target
+  def target
+    :utime
+  end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+#   1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+  x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+  x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+  x.report %q{
+    h = {a: 1, b: 2, c: 3, d: 4}
+  }
+}
+=end
+#
+#  2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/loop_each.yml b/benchmark/loop_each.yml
new file mode 100644
index 0000000000..1c757185a8
--- /dev/null
+++ b/benchmark/loop_each.yml
@@ -0,0 +1,4 @@
+prelude: |
+  arr = [nil] * 30_000_000
+benchmark:
+  loop_each: arr.each{|e|}
diff --git a/benchmark/loop_for.rb b/benchmark/loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
new file mode 100644
index 0000000000..6a3194b670
--- /dev/null
+++ b/benchmark/loop_generator.rb
@@ -0,0 +1,14 @@
+max = 6000000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/loop_times.rb b/benchmark/loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/loop_times_megamorphic.yml b/benchmark/loop_times_megamorphic.yml
new file mode 100644
index 0000000000..f9343ba897
--- /dev/null
+++ b/benchmark/loop_times_megamorphic.yml
@@ -0,0 +1,7 @@
+prelude: |
+  eval(<<~EOS)
+    def loop_times_megamorphic
+      #{"1.times {|i|};" * 1000}
+    end
+  EOS
+benchmark: loop_times_megamorphic
diff --git a/benchmark/loop_whileloop.rb b/benchmark/loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+end
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+  i += 1
+end
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
new file mode 100644
index 0000000000..9b8d0c6afb
--- /dev/null
+++ b/benchmark/marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+  @a = :a
+  @b = :b
+  @c = :c
+end
+100000.times do
+  a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
new file mode 100644
index 0000000000..78ebf823d2
--- /dev/null
+++ b/benchmark/marshal_dump_load_integer.yml
@@ -0,0 +1,22 @@
+prelude: |
+  smallint_array = 1000.times.map { |x| x }
+  bigint32_array = 1000.times.map { |x| x + 2**32 }
+  bigint64_array = 1000.times.map { |x| x + 2**64 }
+
+  smallint_dump = Marshal.dump(smallint_array)
+  bigint32_dump = Marshal.dump(bigint32_array)
+  bigint64_dump = Marshal.dump(bigint64_array)
+benchmark:
+  marshal_dump_integer_small: |
+    Marshal.dump(smallint_array)
+  marshal_dump_integer_over_32_bit: |
+    Marshal.dump(bigint32_array)
+  marshal_dump_integer_over_64_bit: |
+    Marshal.dump(bigint64_array)
+  marshal_load_integer_small: |
+    Marshal.load(smallint_dump)
+  marshal_load_integer_over_32_bit: |
+    Marshal.load(bigint32_dump)
+  marshal_load_integer_over_64_bit: |
+    Marshal.load(bigint64_dump)
+loop_count: 4000
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
new file mode 100644
index 0000000000..31cb8ee4a3
--- /dev/null
+++ b/benchmark/masgn.yml
@@ -0,0 +1,53 @@
+prelude: |
+  a = [nil] * 3
+  b = Class.new{attr_writer :a, :b, :c}.new
+  c = d = e = f = g = h = i = nil
+benchmark:
+  array2_2: "c = (a[0], a[1] = 1, 2)"
+  array2_3: "c = (a[0], a[1] = 1, 2, 3)"
+  array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
+  array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
+  attr2_2: "c = (b.a, b.b = 1, 2)"
+  attr2_3: "c = (b.a, b.b = 1, 2, 3)"
+  attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
+  attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
+  lvar2_2: "c = (d, e = 1, 2)"
+  lvar2_3: "c = (d, e = 1, 2, 3)"
+  lvar3_2: "c = (d, e, f = 1, 2)"
+  lvar3_3: "c = (d, e, f = 1, 2, 3)"
+  array2_2p: "(a[0], a[1] = 1, 2; nil)"
+  array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
+  array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
+  array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
+  attr2_2p: "(b.a, b.b = 1, 2; nil)"
+  attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
+  attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
+  attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
+  lvar2_2p: "(d, e = 1, 2; nil)"
+  lvar2_3p: "(d, e = 1, 2, 3; nil)"
+  lvar3_2p: "(d, e, f = 1, 2; nil)"
+  lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
+  array2_2lv: "c = (a[0], a[1] = g, h)"
+  array2_ilv: "c = (a[0], a[1] = g, h, i)"
+  arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
+  arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
+  attr2_2lv: "c = (b.a, b.b = g, h)"
+  attr2_ilv: "c = (b.a, b.b = g, h, i)"
+  attri_2lv: "c = (b.a, b.b, b.c = g, h)"
+  attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
+  lvar2_2lv: "c = (d, e = g, h)"
+  lvar2_ilv: "c = (d, e = g, h, i)"
+  lvari_2lv: "c = (d, e, f = g, h)"
+  lvari_ilv: "c = (d, e, f = g, h, i)"
+  array2_2plv: "(a[0], a[1] = g, h; nil)"
+  array2_iplv: "(a[0], a[1] = g, h, i; nil)"
+  arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
+  arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
+  attr2_2plv: "(b.a, b.b = g, h; nil)"
+  attr2_iplv: "(b.a, b.b = g, h, i; nil)"
+  attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
+  attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
+  lvar2_2plv: "(d, e = g, h; nil)"
+  lvar2_iplv: "(d, e = g, h, i; nil)"
+  lvari_2plv: "(d, e, f = g, h; nil)"
+  lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
new file mode 100644
index 0000000000..9e0e046ed4
--- /dev/null
+++ b/benchmark/method_bind_call.yml
@@ -0,0 +1,16 @@
+prelude: |
+  named_module = Kernel
+
+  module FakeName
+    def self.name
+      "NotMyame".freeze
+    end
+  end
+
+  MOD_NAME = Module.instance_method(:name)
+
+benchmark:
+  fastpath: MOD_NAME.bind_call(Kernel)
+  slowpath: MOD_NAME.bind_call(FakeName)
+
+loop_count: 100_000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
new file mode 100644
index 0000000000..2f9c490d92
--- /dev/null
+++ b/benchmark/module_eqq.yml
@@ -0,0 +1,32 @@
+prelude: |
+  module SomeModule; end
+  class SimpleClass; end
+  class MediumClass
+    10.times { include Module.new }
+  end
+  class LargeClass
+    100.times { include Module.new }
+  end
+  class HugeClass
+    300.times { include Module.new }
+  end
+  SimpleObj = SimpleClass.new
+  MediumObj = MediumClass.new
+  LargeObj = LargeClass.new
+  HugeObj = HugeClass.new
+benchmark:
+  simple_class_eqq_simple_obj: |
+    SimpleClass === SimpleObj
+  medium_class_eqq_simple_obj: |
+    MediumClass === SimpleObj
+  simple_class_eqq_medium_obj: |
+    SimpleClass === MediumObj
+  simple_class_eqq_large_obj: |
+    SimpleClass === LargeObj
+  simple_class_eqq_huge_obj: |
+    SimpleClass === HugeObj
+  simple_class_eqq_module: |
+    SimpleClass === HugeObj
+  module_eqq_module: |
+    SomeModule === HugeObj
+loop_count: 10000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+  class Niller; def nil?; true; end; end
+  xnil, notnil = nil, Object.new
+  niller = Niller.new
+benchmark:
+  - xnil.nil?
+  - notnil.nil?
+  - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
new file mode 100644
index 0000000000..66234c4cdf
--- /dev/null
+++ b/benchmark/nilclass.yml
@@ -0,0 +1,16 @@
+prelude: |
+  def a = nil
+benchmark:
+  rationalize:
+    nil.rationalize
+  to_c: |
+    nil.to_c
+  to_i: |
+    nil.to_i
+  to_f: |
+    nil.to_f
+  to_r: |
+    nil.to_r
+  splat: |
+    a(*nil)
+loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
new file mode 100644
index 0000000000..2195963433
--- /dev/null
+++ b/benchmark/num_zero_p.yml
@@ -0,0 +1,8 @@
+benchmark:
+  - 0.zero?
+  - 1.zero?
+  - 0r.zero?
+  - 1r.zero?
+  - 0i.zero?
+  - 1i.zero?
+loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
new file mode 100644
index 0000000000..1384902935
--- /dev/null
+++ b/benchmark/numeric_methods.yml
@@ -0,0 +1,29 @@
+prelude: |
+  int = 42
+  flo = 4.2
+benchmark:
+  real?: |
+    int.real?
+  integer?: |
+    flo.integer?
+  finite?: |
+    int.finite?
+  infinite?: |
+    int.infinite?
+  integer_real: |
+    int.real
+  float_real: |
+    flo.real
+  integr_imag: |
+    int.imag
+  float_imag: |
+    flo.imag
+  integer_conj: |
+    int.conj
+  float_conj: |
+    flo.conj
+  integer_numerator: |
+    int.numerator
+  integer_denominator: |
+    int.denominator
+loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
new file mode 100644
index 0000000000..c6269923f0
--- /dev/null
+++ b/benchmark/object_allocate.yml
@@ -0,0 +1,49 @@
+prelude: |
+  class Eight
+    8.times { include(Module.new) }
+  end
+  class ThirtyTwo
+    32.times { include(Module.new) }
+  end
+  class SixtyFour
+    64.times { include(Module.new) }
+  end
+  class OneTwentyEight
+    128.times { include(Module.new) }
+  end
+  class OnePositional
+    def initialize a; end
+  end
+  class TwoPositional
+    def initialize a, b; end
+  end
+  class ThreePositional
+    def initialize a, b, c; end
+  end
+  class FourPositional
+    def initialize a, b, c, d; end
+  end
+  class KWArg
+    def initialize a:, b:, c:, d:
+    end
+  end
+  class Mixed
+    def initialize a, b, c:, d:
+    end
+  end
+  # Disable GC to see raw throughput:
+  GC.disable
+benchmark:
+  allocate_8_deep: Eight.new
+  allocate_32_deep: ThirtyTwo.new
+  allocate_64_deep: SixtyFour.new
+  allocate_128_deep: OneTwentyEight.new
+  allocate_1_positional_params: OnePositional.new(1)
+  allocate_2_positional_params: TwoPositional.new(1, 2)
+  allocate_3_positional_params: ThreePositional.new(1, 2, 3)
+  allocate_4_positional_params: FourPositional.new(1, 2, 3, 4)
+  allocate_kwarg_params: "KWArg.new(a: 1, b: 2, c: 3, d: 4)"
+  allocate_mixed_params: "Mixed.new(1, 2, c: 3, d: 4)"
+  allocate_no_params: "Object.new"
+  allocate_allocate: "Object.allocate"
+loop_count: 100000
diff --git a/benchmark/object_class.yml b/benchmark/object_class.yml
new file mode 100644
index 0000000000..1e5409d1e2
--- /dev/null
+++ b/benchmark/object_class.yml
@@ -0,0 +1,40 @@
+prelude: |
+  def get_class(obj)
+    i = 10_000
+    while i > 0
+      i -= 1
+      # 100 times per loop
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+      obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class; obj.class;
+    end
+  end
+
+  class Obj
+  end
+  obj = Obj.new
+
+  singleton = Obj.new
+  def singleton.bar
+  end
+
+  extended = Obj.new
+  2.times do
+    extended.extend Module.new
+  end
+
+  immediate = 1.4
+benchmark:
+  obj: get_class(obj)
+  extended: get_class(extended)
+  singleton: get_class(singleton)
+  immediate: get_class(immediate)
+loop_count: 1000
diff --git a/benchmark/object_id.yml b/benchmark/object_id.yml
new file mode 100644
index 0000000000..2bd52b923f
--- /dev/null
+++ b/benchmark/object_id.yml
@@ -0,0 +1,4 @@
+benchmark:
+  baseline: "Object.new"
+  object_id: "Object.new.object_id"
+# loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
new file mode 100644
index 0000000000..ebab562d2e
--- /dev/null
+++ b/benchmark/objspace_dump_all.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'objspace'
+  require 'tempfile'
+  $objs = 1_000.times.map { Object.new }
+  $strings = 1_000.times.map { |i| "string #{i}" }
+  $file = Tempfile.new('heap')
+  $dev_null = File.open(File::NULL, 'w+')
+
+benchmark:
+  dump_all_string: "ObjectSpace.dump_all(output: :string)"
+  dump_all_file: "ObjectSpace.dump_all(output: $file)"
+  dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
+loop_count: 1
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+    return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+		    : Ack($_[0]-1, 1))
+	: $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+    if (not M):
+        return( N + 1 )
+    if (not N):
+        return( Ack(M-1, 1) )
+    return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+    NUM = 9
+    sys.setrecursionlimit(10000)
+    Ack(3, NUM)
+
+main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+  (cond ((zero? m) (+ n 1))
+	((zero? n) (ack (- m 1) 1))
+	(else      (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+  loop
+  ack
+  fib
+  tak
+  fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+  ruby-cyg
+  ../../../test6/miniruby
+  perl
+  python
+  gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+  .rb
+  .rb
+  .pl
+  .py
+  .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+  m = Benchmark.measure{
+    #p cmd
+    system(cmd)
+  }
+  [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+  r = []
+  Lang.each_with_index{|l, idx|
+    cmd = "#{l} #{b}#{Ext[idx]}"
+    r << bench(cmd)
+  }
+  Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+  my $n = @_[0];
+  if($n < 2){
+    return 1;
+  }
+  else{
+    return $n * fact($n-1);
+  }
+}
+
+for($i=0; $i<10000; $i++){
+  &fact(100);
+}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..1ce9f76275
--- /dev/null
+++ b/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+	r = 1
+	for x in range(2, n+1):
+		r *= x
+	return r
+
+def factR(n):
+	if n < 2:
+		return 1
+	else:
+		return n * factR(n-1)
+
+for i in range(10000):
+	factR(100)
+
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..6cedc752cd
--- /dev/null
+++ b/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+  if n < 2
+    1
+  else
+    n * fact(n-1)
+  end
+end
+
+i = 0
+while i<10000
+  i += 1
+  fact(100)
+end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+        (if (< n 2)
+            1
+          (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+  (fact 100))
+
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+  my $n = $_[0];
+  if($n < 3){
+    return 1;
+  }
+  else{
+    return fib($n-1) + fib($n-2);
+  }
+};
+
+&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+  if n < 3:
+    return 1
+  else:
+    return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+        (if (< n 3)
+            1
+          (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+	pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..b367b9dbf3
--- /dev/null
+++ b/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30000000
+  i += 1
+end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+    local($x, $y, $z) = @_;
+    if (!($y < $x)) {
+	return $z;
+    } else {
+	return &tak(&tak($x - 1, $y, $z),
+		    &tak($y - 1, $z, $x),
+		    &tak($z - 1, $x, $y));
+    }
+}
+&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+	if not(y<x):
+		return z
+	else:
+		return tak(tak(x-1, y, z),
+		           tak(y-1, z, x),
+		           tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+        (if (not (< y x))
+            z
+          (tak (tak (- x 1) y z)
+               (tak (- y 1) z x)
+               (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
new file mode 100644
index 0000000000..babb65a289
--- /dev/null
+++ b/benchmark/pm_array.yml
@@ -0,0 +1,19 @@
+prelude: |
+  def call(*val)
+    case val
+      in [String => body]
+        [200, {}, [body]]
+      in [Integer => status]
+        [status, {}, [""]]
+      in [Integer, String] => response
+        [response[0], {}, [response[1]]]
+      in [Integer, Hash, String] => response
+        [response[0], response[1], [response[2]]]
+    end
+  end
+
+benchmark:
+  first_match: call("ok")
+  second_match: call(401)
+  third_match: call(200, "ok")
+  fourth_match: call(201, {}, "created")
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
new file mode 100644
index 0000000000..d7ab74bdca
--- /dev/null
+++ b/benchmark/ractor_const.yml
@@ -0,0 +1,4 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_const: Object
+ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
new file mode 100644
index 0000000000..8f492be668
--- /dev/null
+++ b/benchmark/ractor_float_to_s.yml
@@ -0,0 +1,8 @@
+type: lib/benchmark_driver/runner/ractor
+prelude: |
+  FLOATS = [*0.0.step(1.0, 0.001)]
+benchmark:
+  ractor_float_to_s: |
+    FLOATS.each {|f| f.to_s}
+loop_count: 100
+ractor: 2
diff --git a/benchmark/ractor_string_fstring.yml b/benchmark/ractor_string_fstring.yml
new file mode 100644
index 0000000000..14b92d8fd8
--- /dev/null
+++ b/benchmark/ractor_string_fstring.yml
@@ -0,0 +1,18 @@
+type: lib/benchmark_driver/runner/ractor
+benchmark:
+  ractor_fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  ractor_fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 2000000
+      -str
+      i += 1
+    end
+loop_count: 1
+ractor: 4
diff --git a/benchmark/range_bsearch_bignum.yml b/benchmark/range_bsearch_bignum.yml
new file mode 100644
index 0000000000..5730c93fcf
--- /dev/null
+++ b/benchmark/range_bsearch_bignum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 2**100
+  last = 2**1000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_bsearch_endpointless.yml b/benchmark/range_bsearch_endpointless.yml
new file mode 100644
index 0000000000..8d7bedb662
--- /dev/null
+++ b/benchmark/range_bsearch_endpointless.yml
@@ -0,0 +1,21 @@
+prelude: |
+  re = (1..)
+  rb = (..0)
+
+benchmark:
+  'endless 10**0': re.bsearch { |x| x >= 1 }
+  'endless 10**1': re.bsearch { |x| x >= 10 }
+  'endless 10**2': re.bsearch { |x| x >= 100 }
+  'endless 10**3': re.bsearch { |x| x >= 1000 }
+  'endless 10**4': re.bsearch { |x| x >= 10000 }
+  'endless 10**5': re.bsearch { |x| x >= 100000 }
+  'endless 10**10': re.bsearch { |x| x >= 10000000000 }
+  'endless 10**100': re.bsearch { |x| x >= 10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
+  'beginless -10**0': rb.bsearch { |x| x >= -1 }
+  'beginless -10**1': rb.bsearch { |x| x >= -10 }
+  'beginless -10**2': rb.bsearch { |x| x >= -100 }
+  'beginless -10**3': rb.bsearch { |x| x >= -1000 }
+  'beginless -10**4': rb.bsearch { |x| x >= -10000 }
+  'beginless -10**5': rb.bsearch { |x| x >= -100000 }
+  'beginless -10**10': rb.bsearch { |x| x >= -10000000000 }
+  'beginless -10**100': rb.bsearch { |x| x >= -10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
diff --git a/benchmark/range_bsearch_fixnum.yml b/benchmark/range_bsearch_fixnum.yml
new file mode 100644
index 0000000000..59416531b9
--- /dev/null
+++ b/benchmark/range_bsearch_fixnum.yml
@@ -0,0 +1,10 @@
+prelude: |
+  first = 1
+  last = 10000
+  mid = (first + last) / 2
+  r = first..last
+
+benchmark:
+  first: r.bsearch { |x| x >= first }
+  mid: r.bsearch { |x| x >= mid }
+  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_count.yml b/benchmark/range_count.yml
new file mode 100644
index 0000000000..58f53a0236
--- /dev/null
+++ b/benchmark/range_count.yml
@@ -0,0 +1,11 @@
+prelude: |
+  r_1 = 1..1
+  r_1k = 1..1000
+  r_1m = 1..1000000
+  r_str = 'a'..'z'
+
+benchmark:
+  'int 1': r_1.count
+  'int 1K': r_1k.count
+  'int 1M': r_1m.count
+  string: r_str.count
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - (1..1_000_000).last(100)
+  - (1..1_000_000).last(1000)
+  - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
new file mode 100644
index 0000000000..9e60dd7308
--- /dev/null
+++ b/benchmark/range_min.yml
@@ -0,0 +1,2 @@
+benchmark:
+  - (1..10).min
diff --git a/benchmark/range_overlap.yml b/benchmark/range_overlap.yml
new file mode 100644
index 0000000000..700a00053c
--- /dev/null
+++ b/benchmark/range_overlap.yml
@@ -0,0 +1,19 @@
+prelude: |
+  class Range
+    unless method_defined?(:overlap?)
+      def overlap?(other)
+        other.begin == self.begin || cover?(other.begin) || other.cover?(self.begin)
+      end
+    end
+  end
+
+benchmark:
+  - (2..3).overlap?(1..1)
+  - (2..3).overlap?(2..4)
+  - (2..3).overlap?(4..5)
+  - (2..3).overlap?(2..1)
+  - (2..3).overlap?(0..1)
+  - (2..3).overlap?(...1)
+  - (2...3).overlap?(..2)
+  - (2...3).overlap?(3...)
+  - (2..3).overlap?('a'..'d')
diff --git a/benchmark/range_reverse_each.yml b/benchmark/range_reverse_each.yml
new file mode 100644
index 0000000000..a32efeccc6
--- /dev/null
+++ b/benchmark/range_reverse_each.yml
@@ -0,0 +1,16 @@
+prelude: |
+  rf_1 = 0..1
+  rf_1k = 0..1000
+  rf_1m = 0..1000000
+  big = 2**1000
+  rb_1 = big..big+1
+  rb_1k = big..big+1000
+  rb_1m = big..big+1000000
+
+benchmark:
+  "Fixnum 1": rf_1.reverse_each { _1 }
+  "Fixnum 1K": rf_1k.reverse_each { _1 }
+  "Fixnum 1M": rf_1m.reverse_each { _1 }
+  "Bignum 1": rb_1.reverse_each { _1 }
+  "Bignum 1K": rb_1k.reverse_each { _1 }
+  "Bignum 1M": rb_1m.reverse_each { _1 }
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..6b6a4836b0
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,33 @@
+prelude: |
+  f = File
+  pwd = Dir.pwd
+  Dir.mkdir('b') unless f.directory?('b')
+  f.write('b/a', '') unless f.file?('b/a')
+
+  relative = 'b/a'
+  absolute = File.join(pwd, relative)
+  dir = 'b'
+  file = 'a'
+
+  relative_dir = 'b/c'
+  absolute_dir = File.join(pwd, relative_dir)
+  file_dir = 'c'
+teardown: |
+  require 'fileutils'
+  FileUtils.rm_rf('b')
+benchmark:
+  relative_nil: "f.realpath(relative, nil)"
+  absolute_nil: "f.realpath(absolute, nil)"
+  relative_relative: "f.realpath(file, dir)"
+  absolute_relative: "f.realpath(absolute, dir)"
+  relative_absolute: "f.realpath(relative, pwd)"
+  relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+  absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+  relative_relative_dir: "f.realdirpath(file_dir, dir)"
+  absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+  relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+  relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+  absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+  relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+  absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+  relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/regexp_dup.yml b/benchmark/regexp_dup.yml
new file mode 100644
index 0000000000..52f89991cd
--- /dev/null
+++ b/benchmark/regexp_dup.yml
@@ -0,0 +1,6 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  dup: re.dup
diff --git a/benchmark/regexp_new.yml b/benchmark/regexp_new.yml
new file mode 100644
index 0000000000..bc9ab3ca21
--- /dev/null
+++ b/benchmark/regexp_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+  str = "a" * 1000
+  re = Regexp.new(str)
+
+benchmark:
+  string: Regexp.new(str)
+  regexp: Regexp.new(re)
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    1.upto(10000) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+  require "fileutils"
+
+  def prepare
+    num_files = 10000
+
+    basename = File.dirname($0)
+    data_dir = File.join(basename, "bm_require.data")
+
+    # skip if all of files exists
+    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+      return
+    end
+
+    FileUtils.mkdir_p(data_dir)
+
+    1.upto(num_files) do |i|
+      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+    end
+  end
+
+  prepare
+benchmark:
+  require_thread: |
+    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+    i=0
+    t = Thread.new do
+      while true
+        i = i+1 # dummy loop
+      end
+    end
+
+    1.upto(100) do |i|
+      require "c#{i}"
+    end
+
+    $:.pop
+    t.kill
+loop_count: 1
diff --git a/benchmark/scan.yaml b/benchmark/scan.yaml
new file mode 100644
index 0000000000..62ad1d6862
--- /dev/null
+++ b/benchmark/scan.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "test"
+  reg = /test/
+benchmark:
+  check(reg): |
+    scanner.check(reg)
+  check(str): |
+    scanner.check(str)
+  match?(reg): |
+    scanner.match?(reg)
+  match?(str): |
+    scanner.match?(str)
diff --git a/benchmark/search.yaml b/benchmark/search.yaml
new file mode 100644
index 0000000000..42a50c90e6
--- /dev/null
+++ b/benchmark/search.yaml
@@ -0,0 +1,16 @@
+prelude: |
+  $LOAD_PATH.unshift(File.expand_path("lib"))
+  require "strscan"
+  str = "test string"
+  scanner = StringScanner.new(str)
+  str = "string"
+  reg = /string/
+benchmark:
+  check_until(reg): |
+    scanner.check_until(reg)
+  check_until(str): |
+    scanner.check_until(str)
+  exist?(reg): |
+    scanner.exist?(reg)
+  exist?(str): |
+    scanner.exist?(str)
diff --git a/benchmark/securerandom.rb b/benchmark/securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+  SecureRandom.random_number(100)
+end
diff --git a/benchmark/set.yml b/benchmark/set.yml
new file mode 100644
index 0000000000..061509cb1f
--- /dev/null
+++ b/benchmark/set.yml
@@ -0,0 +1,261 @@
+prelude: |
+  # First 1000 digits of pi
+  pi = <<~END.gsub(/\D/, '')
+    31415926535897932384626433832795028841971693993751058209749445923078164062862089
+    98628034825342117067982148086513282306647093844609550582231725359408128481117450
+    28410270193852110555964462294895493038196442881097566593344612847564823378678316
+    52712019091456485669234603486104543266482133936072602491412737245870066063155881
+    74881520920962829254091715364367892590360011330530548820466521384146951941511609
+    43305727036575959195309218611738193261179310511854807446237996274956735188575272
+    48912279381830119491298336733624406566430860213949463952247371907021798609437027
+    70539217176293176752384674818467669405132000568127145263560827785771342757789609
+    17363717872146844090122495343014654958537105079227968925892354201995611212902196
+    08640344181598136297747713099605187072113499999983729780499510597317328160963185
+    95024459455346908302642522308253344685035261931188171010003137838752886587533208
+    38142061717766914730359825349042875546873115956286388235378759375195778185778053
+    21712268066130019278766111959092164201989380952572010654505906988788448549
+  END
+  array1 = 10.times.flat_map do |i|
+    pi[i...].chars.each_slice(10).map(&:join)
+  end
+  array2 = array1.map(&:reverse)
+  array1.map!(&:to_i)
+  array2.map!(&:to_i)
+  a1 = array1[...10]
+  a2 = array1[...100]
+  a3 = array1
+  oa1 = array2[...10]
+  oa2 = array2[...100]
+  oa3 = array2
+  s0 = Set.new
+  s0 = Set.new
+  s1 = Set.new(a1)
+  s2 = Set.new(a2)
+  s3 = Set.new(a3)
+  o0 = Set.new
+  o1 = Set.new(array2[...10])
+  o2 = Set.new(array2[...100])
+  o3 = Set.new(array2)
+  d0 = s0.dup
+  d1 = s1.dup
+  d2 = s2.dup
+  d3 = s3.dup
+  ss1 = s1 - a1[-1..-1]
+  ss2 = s2 - a2[-1..-1]
+  ss3 = s3 - a3[-1..-1]
+  os1 = o1 - oa1[-1..-1]
+  os2 = o2 - oa2[-1..-1]
+  os3 = o3 - oa3[-1..-1]
+  member = a1.first
+  cbi = s0.dup.compare_by_identity
+  ns = Set[s3, o3, d3]
+  set_subclass = Class.new(Set)
+
+benchmark:
+  new_0: Set.new
+  new_10: Set.new(a1)
+  new_100: Set.new(a2)
+  new_1000: Set.new(a3)
+  aref_0: Set[]
+  aref_10: Set[*a1]
+  aref_100: Set[*a2]
+  aref_1000: Set[*a3]
+  amp_0: s0 & o0
+  amp_10: s1 & o1
+  amp_100: s2 & o2
+  amp_1000: s3 & o3
+  amp_same_0: s0 & d0
+  amp_same_10: s1 & d1
+  amp_same_100: s2 & d2
+  amp_same_1000: s3 & d3
+  minus_0: s0 - o0
+  minus_10: s1 - o1
+  minus_100: s2 - o2
+  minus_1000: s3 - o3
+  minus_same_0: s0 - d0
+  minus_same_10: s1 - d1
+  minus_same_100: s2 - d2
+  minus_same_1000: s3 - d3
+  spaceship_0: s0 <=> o0
+  spaceship_diff_10: s1 <=> o1
+  spaceship_diff_100: s2 <=> o2
+  spaceship_diff_1000: s2 <=> o3
+  spaceship_sub_10: s1 <=> ss1
+  spaceship_sub_100: s2 <=> ss2
+  spaceship_sub_1000: s2 <=> ss3
+  spaceship_sup_10: ss1 <=> s1
+  spaceship_sup_100: ss2 <=> s2
+  spaceship_sup_1000: ss2 <=> s3
+  eq_0: s0 == o0
+  eq_10: s1 == o1
+  eq_100: s2 == o2
+  eq_1000: s3 == o3
+  eq_same_0: s0 == d0
+  eq_same_10: s1 == d1
+  eq_same_100: s2 == d2
+  eq_same_1000: s3 == d3
+  xor_0: s0 ^ o0
+  xor_10: s1 ^ o1
+  xor_100: s2 ^ o2
+  xor_1000: s3 ^ o3
+  xor_same_0: s0 ^ d0
+  xor_same_10: s1 ^ d1
+  xor_same_100: s2 ^ d2
+  xor_same_1000: s3 ^ d3
+  pipe_0: s0 | o0
+  pipe_10: s1 | o1
+  pipe_100: s2 | o2
+  pipe_1000: s3 | o3
+  pipe_same_0: s0 | d0
+  pipe_same_10: s1 | d1
+  pipe_same_100: s2 | d2
+  pipe_same_1000: s3 | d3
+  add: a3.each { s0.add(it) }
+  add_exist: a3.each { s3.add(it) }
+  addq: a3.each { s0.add?(it) }
+  addq_exist: a3.each { s3.add?(it) }
+  classify_0: s0.classify { it }
+  classify_10: s1.classify { it & 2 }
+  classify_100: s2.classify { it & 8 }
+  classify_1000: s3.classify { it & 32 }
+  clear: s0.clear
+  collect_0: s0.collect! { it }
+  collect_10: s1.collect! { it }
+  collect_100: s2.collect! { it }
+  collect_1000: s3.collect! { it }
+  compare_by_identity_0: s0.dup.compare_by_identity
+  compare_by_identity_10: s1.dup.compare_by_identity
+  compare_by_identity_100: s2.dup.compare_by_identity
+  compare_by_identity_1000: s3.dup.compare_by_identity
+  compare_by_identityq_false: s0.compare_by_identity?
+  compare_by_identityq_true: cbi.compare_by_identity?
+  clone_0: s0.clone
+  clone_10: s1.clone
+  clone_100: s2.clone
+  clone_1000: s3.clone
+  delete: a3.each { s3.delete(it) }
+  delete_not_exist: a3.each { o3.delete(it) }
+  deleteq: a3.each { s3.delete?(it) }
+  deleteq_not_exist: a3.each { o3.delete?(it) }
+  delete_if_0: s0.delete_if { it }
+  delete_if_10: s1.delete_if { it & 2 == 0 }
+  delete_if_100: s2.delete_if { it & 2 == 0 }
+  delete_if_1000: s3.delete_if { it & 2 == 0 }
+  disjoint_0: s0.disjoint? o0
+  disjoint_10: s1.disjoint? o1
+  disjoint_100: s2.disjoint? o2
+  disjoint_1000: s3.disjoint? o3
+  disjoint_same_0: s0.disjoint? d0
+  disjoint_same_10: s1.disjoint? d1
+  disjoint_same_100: s2.disjoint? d2
+  disjoint_same_1000: s3.disjoint? d3
+  divide_1arity_0: s0.divide { true }
+  divide_1arity_10: s1.divide { it & 2 }
+  divide_1arity_100: s2.divide { it & 8 }
+  divide_1arity_1000: s3.divide { it & 32 }
+  divide_2arity_0: s0.divide { true }
+  divide_2arity_10: s1.divide { (_1 & 2) == (_2 & 2) }
+  divide_2arity_100: s2.divide { (_1 & 8) == (_2 & 8) }
+  divide_2arity_1000: s3.divide { (_1 & 32) == (_2 & 32) }
+  dup_0: s0.dup
+  dup_10: s1.dup
+  dup_100: s2.dup
+  dup_1000: s3.dup
+  each_0: s0.each { it }
+  each_10: s1.each { it }
+  each_100: s2.each { it }
+  each_1000: s3.each { it }
+  empty_true: s0.empty?
+  empty_false: s3.empty?
+  flatten: ns.flatten
+  flattenb: ns.flatten!
+  include_true_0: s0.include? member
+  include_true_10: s1.include? member
+  include_true_100: s2.include? member
+  include_true_1000: s3.include? member
+  include_false_0: s0.include?(-1)
+  include_false_10: s1.include?(-1)
+  include_false_100: s2.include?(-1)
+  include_false_1000: s3.include?(-1)
+  intersect_0: s0.intersect? o0
+  intersect_10: s1.intersect? o1
+  intersect_100: s2.intersect? o2
+  intersect_1000: s3.intersect? o3
+  intersect_same_0: s0.intersect? d0
+  intersect_same_10: s1.intersect? d1
+  intersect_same_100: s2.intersect? d2
+  intersect_same_1000: s3.intersect? d3
+  join_0: s0.join
+  join_10: s1.join
+  join_100: s2.join
+  join_1000: s3.join
+  join_arg_0: s0.join ""
+  join_arg_10: s1.join ""
+  join_arg_100: s2.join ""
+  join_arg_1000: s3.join ""
+  keep_if_0: s0.keep_if { it }
+  keep_if_10: s1.keep_if { it & 2 == 0 }
+  keep_if_100: s2.keep_if { it & 2 == 0 }
+  keep_if_1000: s3.keep_if { it & 2 == 0 }
+  merge_set: s0.dup.merge(s3, o3)
+  merge_enum: s0.dup.merge(array1, array2)
+  proper_subset_0: s0.proper_subset? s0
+  proper_subset_10: s1.proper_subset? ss1
+  proper_subset_100: s2.proper_subset? ss2
+  proper_subset_1000: s3.proper_subset? ss3
+  proper_subset_false_10: s1.proper_subset? os1
+  proper_subset_false_100: s2.proper_subset? os2
+  proper_subset_false_1000: s3.proper_subset? os3
+  proper_superset_0: s0.proper_superset? s0
+  proper_superset_10: ss1.proper_superset? s1
+  proper_superset_100: ss2.proper_superset? s2
+  proper_superset_1000: ss3.proper_superset? s3
+  proper_superset_false_10: os1.proper_superset? s1
+  proper_superset_false_100: os2.proper_superset? s2
+  proper_superset_false_1000: os3.proper_superset? s3
+  reject_0: s0.reject! { it }
+  reject_10: s1.reject! { it & 2 == 0 }
+  reject_100: s2.reject! { it & 2 == 0 }
+  reject_1000: s3.reject! { it & 2 == 0 }
+  replace_0: s = Set.new; array1.each { s.replace(s0) }
+  replace_10: s = Set.new; array1.each { s.replace(s1) }
+  replace_100: s = Set.new; array1.each { s.replace(s2) }
+  replace_1000: s = Set.new; array1.each { s.replace(s3) }
+  reset_0: s0.reset
+  reset_10: s1.reset
+  reset_100: s2.reset
+  reset_1000: s3.reset
+  select_0: s0.select! { it }
+  select_10: s1.select! { it & 2 == 0 }
+  select_100: s2.select! { it & 2 == 0 }
+  select_1000: s3.select! { it & 2 == 0 }
+  size_0: s0.size
+  size_10: s1.size
+  size_100: s2.size
+  size_1000: s3.size
+  subtract_set: s3.dup.subtract(os3)
+  subtract_enum: s3.dup.subtract(oa3)
+  subtract_same_set: s3.dup.subtract(s3)
+  subtract_same_enum: s3.dup.subtract(a3)
+  subset_0: s0.subset? s0
+  subset_10: s1.subset? ss1
+  subset_100: s2.subset? ss2
+  subset_1000: s3.subset? ss3
+  subset_false_10: s1.subset? os1
+  subset_false_100: s2.subset? os2
+  subset_false_1000: s3.subset? os3
+  superset_0: s0.superset? s0
+  superset_10: ss1.superset? s1
+  superset_100: ss2.superset? s2
+  superset_1000: ss3.superset? s3
+  superset_false_10: os1.superset? s1
+  superset_false_100: os2.superset? s2
+  superset_false_1000: os3.superset? s3
+  to_a_0: s0.to_a
+  to_a_10: s1.to_a
+  to_a_100: s2.to_a
+  to_a_1000: s3.to_a
+  to_set_0: s0.to_set
+  to_set_10: s1.to_set
+  to_set_100: s2.to_set
+  to_set_1000: s3.to_set
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/so_binary_trees.rb b/benchmark/so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+  # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..f7322a8541
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,66 @@
+prelude: |
+  #!/usr/bin/ruby
+
+  wc_input_base = <<EOS
+  Subject:      Re: Who was Izchak Miller?
+  From:         "Jane D. Anonymous" <nobody@yale.edu>
+  Date:         1996/04/28
+  Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+  References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+  To:           75176.2330@compuserve.com
+  Content-Type: text/plain; charset=us-ascii
+  Organization: Yale University
+  X-Url:        news:4lk6vl$gde@ns.oar.net
+  Mime-Version: 1.0
+  Newsgroups:   rec.games.roguelike.nethack
+  X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+  Hello there,  Izchak Miller was my  father.  When I was  younger I spent
+  many  a night,  hunched over  the keyboard  with a  cup of  tea, playing
+  nethack with him and my brother.  my dad was a philosopher with a strong
+  weakness for fantasy/sci fi.  I remember when he started to get involved
+  with the  Nethack team- my  brother's Dungeons and Dragons  monster book
+  found a regular place beside my dad's  desk. it's nice to see him living
+  on in the game he loved so much :-).
+                                                                    Tamar Miller
+
+  The following is a really long word of 5000 characters:
+
+  wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+  EOS
+
+  # prepare 'wc.input'
+
+  def prepare_wc_input(wcbase)
+    wcinput = File.join(File.dirname($0), 'wc.input')
+    unless FileTest.exist?(wcinput)
+      data = wcbase.dup
+      13.times{
+        data << data
+      }
+      File.write(wcinput, data)
+    end
+    at_exit {File.unlink(wcinput) rescue nil}
+  end
+
+  prepare_wc_input(wc_input_base)
+
+benchmark:
+  so_count_words: |
+    # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+    # http://www.bagley.org/~doug/shootout/
+    # with help from Paul Brannan
+
+    nl = nw = nc = 0
+    File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|
+      while tmp = input.read(4096)
+        data = tmp << (input.gets || "")
+        nc += data.length
+        nl += data.count("\n")
+        ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+        nw += data.count(" ") + 1
+      end
+    end
+    # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_k_nucleotide
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(100_000)
+    script: |
+      # The Computer Language Shootout
+      # http://shootout.alioth.debian.org
+      #
+      # contributed by jose fco. gonzalez
+      # modified by Sokolov Yura
+
+      seq = String.new
+
+      def frecuency( seq,length )
+          n, table = seq.length - length + 1, Hash.new(0)
+          f, i = nil, nil
+          (0 ... length).each do |f|
+              (f ... n).step(length) do |i|
+                  table[seq[i,length]] += 1
+              end
+          end
+          [n,table]
+
+      end
+
+      def sort_by_freq( seq,length )
+          n,table = frecuency( seq,length )
+          a, b, v = nil, nil, nil
+          table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+              puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+          end
+          puts
+      end
+
+      def find_seq( seq,s )
+          n,table = frecuency( seq,s.length )
+          puts "#{table[s].to_s}\t#{s.upcase}"
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+      line = input.gets while line !~ /^>THREE/
+      line = input.gets
+
+      while (line !~ /^>/) & line do
+          seq << line.chomp
+          line = input.gets
+      end
+
+      [1,2].each {|i| sort_by_freq( seq,i ) }
+
+      %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+    loop_count: 1
diff --git a/benchmark/so_lists.rb b/benchmark/so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+  # create a list of integers (Li1) from 1 to SIZE
+  li1 = (1..SIZE).to_a
+  # copy the list to li2 (not by individual items)
+  li2 = li1.dup
+  # remove each individual item from left side of li2 and
+  # append to right side of li3 (preserving order)
+  li3 = Array.new
+  while (not li2.empty?)
+    li3.push(li2.shift)
+  end
+  # li2 must now be empty
+  # remove each individual item from right side of li3 and
+  # append to right side of li2 (reversing list)
+  while (not li3.empty?)
+    li2.push(li3.pop)
+  end
+  # li3 must now be empty
+  # reverse li1 in place
+  li1.reverse!
+  # check that first item is now SIZE
+  if li1[0] != SIZE then
+    p "not SIZE"
+    0
+  else
+    # compare li1 and li2 for equality
+    if li1 != li2 then
+      return(0)
+    else
+      # return the length of the list
+      li1.length
+    end
+  end
+end
+
+i = 0
+while i<NUM
+  i += 1
+  result = test_lists()
+end
+
+result
diff --git a/benchmark/so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/so_mandelbrot.rb
@@ -0,0 +1,57 @@
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..d8c8e3ab9c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminish over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644
index 0000000000..9884fc4edc
--- /dev/null
+++ b/benchmark/so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+  attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+  def initialize(x, y, z, vx, vy, vz, mass)
+    @x, @y, @z = x, y, z
+    @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+    @mass = mass * SOLAR_MASS
+  end
+
+  def move_from_i(bodies, nbodies, dt, i)
+    while i < nbodies
+      b2 = bodies[i]
+      dx = @x - b2.x
+      dy = @y - b2.y
+      dz = @z - b2.z
+
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      mag = dt / (distance * distance * distance)
+      b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+      @vx -= dx * b2_mass_mag
+      @vy -= dy * b2_mass_mag
+      @vz -= dz * b2_mass_mag
+      b2.vx += dx * b_mass_mag
+      b2.vy += dy * b_mass_mag
+      b2.vz += dz * b_mass_mag
+      i += 1
+    end
+
+    @x += dt * @vx
+    @y += dt * @vy
+    @z += dt * @vz
+  end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
new file mode 100644
index 0000000000..766fcf7b84
--- /dev/null
+++ b/benchmark/so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/so_nsieve.rb b/benchmark/so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+  flags = Flags.dup[0,m]
+  count = 0
+  pmax = m - 1
+  p = 2
+  while p <= pmax
+    unless flags[p].zero?
+      count += 1
+      mult = p
+      while mult <= pmax
+        flags[mult] = 0
+        mult += p
+      end
+    end
+    p += 1
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+  break if exponent < 0
+  m = (1 << exponent) * 10_000
+  # m = (2 ** exponent) * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+  items = "\xFF" * ((m / BitsPerChar) + 1)
+  masks = ""
+  BitsPerChar.times do |b|
+    masks << (1 << b).chr
+  end
+
+  count = 0
+  pmax = m - 1
+  2.step(pmax, 1) do |p|
+    if items[p >> CharExponent][p & LowMask] == 1
+      count += 1
+      p.step(pmax, p) do |mult|
+	a = mult >> CharExponent
+	b = mult & LowMask
+	items[a] -= masks[b] if items[a][b] != 0
+      end
+    end
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+  break if exponent < 0
+  m = 2 ** exponent * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
new file mode 100644
index 0000000000..131f44624c
--- /dev/null
+++ b/benchmark/so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/so_partial_sums.rb b/benchmark/so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+  s0 += (2.0 / 3.0) ** (d - 1.0)
+  s1 += 1.0 / Math.sqrt(d)
+  s2 += 1.0 / (d * (d + 1.0))
+  s3 += 1.0 / (d3 * ds * ds)
+  s4 += 1.0 / (d3 * dc * dc)
+  s5 += 1.0 / d
+  s6 += 1.0 / d2
+  s7 += alt / d
+  s8 += alt / (2.0 * d - 1.0)
+
+  alt = -alt
+end
+
+if false
+  printf("%.9f\t(2/3)^k\n", s0)
+  printf("%.9f\tk^-0.5\n", s1)
+  printf("%.9f\t1/k(k+1)\n", s2)
+  printf("%.9f\tFlint Hills\n", s3)
+  printf("%.9f\tCookson Hills\n", s4)
+  printf("%.9f\tHarmonic\n", s5)
+  printf("%.9f\tRiemann Zeta\n", s6)
+  printf("%.9f\tAlternating Harmonic\n", s7)
+  printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
new file mode 100644
index 0000000000..9a537b2d1c
--- /dev/null
+++ b/benchmark/so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize(q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/so_random.rb b/benchmark/so_random.rb
new file mode 100644
index 0000000000..a66b9e8e63
--- /dev/null
+++ b/benchmark/so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+  (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i = 0
+while i<N
+  i +=1
+  gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+  bm_so_fasta = <<'EOS'
+  # The Computer Language Shootout
+  # http://shootout.alioth.debian.org/
+  # Contributed by Sokolov Yura
+
+  $last = 42.0
+  def gen_random(max, im=139968, ia=3877, ic=29573)
+      (max * ($last = ($last * ia + ic) % im)) / im
+  end
+
+  alu =
+     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+  iub = [
+      ["a", 0.27],
+      ["c", 0.12],
+      ["g", 0.12],
+      ["t", 0.27],
+
+      ["B", 0.02],
+      ["D", 0.02],
+      ["H", 0.02],
+      ["K", 0.02],
+      ["M", 0.02],
+      ["N", 0.02],
+      ["R", 0.02],
+      ["S", 0.02],
+      ["V", 0.02],
+      ["W", 0.02],
+      ["Y", 0.02],
+  ]
+  homosapiens = [
+      ["a", 0.3029549426680],
+      ["c", 0.1979883004921],
+      ["g", 0.1975473066391],
+      ["t", 0.3015094502008],
+  ]
+
+  def make_repeat_fasta(id, desc, src, n)
+      puts ">#{id} #{desc}"
+      v = nil
+      width = 60
+      l = src.length
+      s = src * ((n / l) + 1)
+      s.slice!(n, l)
+      puts(s.scan(/.{1,#{width}}/).join("\n"))
+  end
+
+  def make_random_fasta(id, desc, table, n)
+      puts ">#{id} #{desc}"
+      rand, v = nil,nil
+      width = 60
+      chunk = 1 * width
+      prob = 0.0
+      table.each{|v| v[1]= (prob += v[1])}
+      for i in 1..(n/width)
+          puts((1..width).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+      if n%width != 0
+          puts((1..(n%width)).collect{
+              rand = gen_random(1.0)
+              table.find{|v| v[1]>rand}[0]
+          }.join)
+      end
+  end
+
+
+  n = (ARGV[0] or 250_000).to_i
+
+  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+  EOS
+benchmark:
+  - name: so_reverse_complement
+    prelude: |
+      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+      File.write(script, bm_so_fasta)
+
+      def prepare_fasta_output n
+        filebase = File.join(File.dirname($0), 'fasta.output')
+        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+        file = "#{filebase}.#{n}"
+
+        unless FileTest.exist?(file)
+          STDERR.puts "preparing #{file}"
+
+          open(file, 'w'){|f|
+            ARGV[0] = n
+            $stdout = f
+            load script
+            $stdout = STDOUT
+          }
+        end
+      end
+      prepare_fasta_output(2_500_000)
+    script: |
+      # The Great Computer Language Shootout
+      # http://shootout.alioth.debian.org/
+      #
+      # Contributed by Peter Bjarke Olsen
+      # Modified by Doug King
+
+      seq=Array.new
+
+      def revcomp(seq)
+        seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+        stringlen=seq.length
+        0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+      end
+
+      input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+      while input.gets
+        if $_ =~ />/
+          if seq.length != 0
+            revcomp(seq.join)
+            seq=Array.new
+          end
+          puts $_
+        else
+          $_.sub(/\n/,'')
+          seq.push $_
+        end
+      end
+      revcomp(seq.join)
+    loop_count: 1
diff --git a/benchmark/so_sieve.rb b/benchmark/so_sieve.rb
new file mode 100644
index 0000000000..43dc302648
--- /dev/null
+++ b/benchmark/so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+  k += 1
+  count = 0
+  flags = flags0.dup
+  i = 2
+  while i<8192
+    i += 1
+    if flags[i]
+      # remove all multiples of prime: i
+      j = i*i
+      while j < 8192
+        j += i
+        flags[j] = nil
+      end
+      count += 1
+    end
+  end
+end
+count
diff --git a/benchmark/so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/benchmark/so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+	return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+        v, i = nil, nil
+	(0..u.length-1).collect { |i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(i,j)*u[j]
+                end
+                v
+        }
+end
+
+def eval_At_times_u(u)
+	v, i = nil, nil
+	(0..u.length-1).collect{|i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(j,i)*u[j]
+                end
+                v
+        }
+end
+
+def eval_AtA_times_u(u)
+	return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+        v=eval_AtA_times_u(u)
+        u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+        vBv += u[i]*v[i]
+        vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
new file mode 100644
index 0000000000..7d23fd3d35
--- /dev/null
+++ b/benchmark/string_capitalize.yml
@@ -0,0 +1,10 @@
+prelude: |
+  str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  capitalize-1: str1.capitalize
+  capitalize-10: str10.capitalize
+  capitalize-100: str100.capitalize
+  capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
new file mode 100644
index 0000000000..88a3555c8a
--- /dev/null
+++ b/benchmark/string_casecmp.yml
@@ -0,0 +1,28 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp-1: lstr1.casecmp(ustr1)
+  casecmp-10: lstr10.casecmp(ustr10)
+  casecmp-100: lstr100.casecmp(ustr100)
+  casecmp-1000: lstr1000.casecmp(ustr1000)
+  casecmp-1000vs10: lstr1000.casecmp(ustr10)
+  casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
+  casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
+  casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
+  casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
+  casecmp-nonascii1000vs10: lnonascii1000.casecmp(unonascii10)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
new file mode 100644
index 0000000000..a790ce7d55
--- /dev/null
+++ b/benchmark/string_casecmp_p.yml
@@ -0,0 +1,26 @@
+prelude: |
+  lstr1 = [*"a".."z",*"0".."9"].join("")
+  lstr10 = lstr1 * 10
+  lstr100 = lstr10 * 10
+  lstr1000 = lstr100 * 10
+  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  lnonascii10 = lnonascii1 * 10
+  lnonascii100 = lnonascii10 * 10
+  lnonascii1000 = lnonascii100 * 10
+  ustr1 = [*"A".."Z",*"0".."9"].join("")
+  ustr10 = ustr1 * 10
+  ustr100 = ustr10 * 10
+  ustr1000 = ustr100 * 10
+  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  unonascii10 = unonascii1 * 10
+  unonascii100 = unonascii10 * 10
+  unonascii1000 = unonascii100 * 10
+benchmark:
+  casecmp_p-1: lstr1.casecmp?(ustr1)
+  casecmp_p-10: lstr10.casecmp?(ustr10)
+  casecmp_p-100: lstr100.casecmp?(ustr100)
+  casecmp_p-1000: lstr1000.casecmp?(ustr1000)
+  casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
+  casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
+  casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
+  casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
new file mode 100644
index 0000000000..f11f95ee9a
--- /dev/null
+++ b/benchmark/string_concat.yml
@@ -0,0 +1,51 @@
+prelude: |
+  CHUNK = "a" * 64
+  UCHUNK = "é" * 32
+  SHORT = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] / 2)
+  LONG = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] * 2)
+  GC.disable # GC causes a lot of variance
+benchmark:
+  binary_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_7bit: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
+  utf8_concat_UTF8: |
+    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
+  interpolation: |
+    buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
+      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
+  interpolation_same_heap: |
+    buffer = "#{SHORT}#{SHORT}"
+  interpolation_switching_heaps: |
+    buffer = "#{SHORT}#{LONG}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
new file mode 100644
index 0000000000..1fea6afbec
--- /dev/null
+++ b/benchmark/string_downcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."Z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{df}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  downcase-1: str1.upcase
+  downcase-10: str10.upcase
+  downcase-100: str100.upcase
+  downcase-1000: str1000.upcase
+  downcase-nonascii1: nonascii1.downcase
+  downcase-nonascii10: nonascii10.downcase
+  downcase-nonascii100: nonascii100.downcase
+  downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_dup.yml b/benchmark/string_dup.yml
new file mode 100644
index 0000000000..90793f9f2a
--- /dev/null
+++ b/benchmark/string_dup.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  uplus: |
+    +"A"
+  dup: |
+    "A".dup
diff --git a/benchmark/string_fstring.yml b/benchmark/string_fstring.yml
new file mode 100644
index 0000000000..cafef1f3fe
--- /dev/null
+++ b/benchmark/string_fstring.yml
@@ -0,0 +1,16 @@
+benchmark:
+  fstring_random: |
+    i = 0
+    str = "same".dup
+    while i < 5_000_000
+      -(i.to_s.freeze)
+      i += 1
+    end
+  fstring_same: |
+    i = 0
+    str = "same".dup
+    while i < 10_000_000
+      -str
+      i += 1
+    end
+loop_count: 1
diff --git a/benchmark/string_gsub.yml b/benchmark/string_gsub.yml
new file mode 100644
index 0000000000..0f964337dd
--- /dev/null
+++ b/benchmark/string_gsub.yml
@@ -0,0 +1,43 @@
+prelude: |
+  # frozen_string_literal: true
+  STR = ((("a" * 31) + "<") * 1000).freeze
+  STR_UNICODE = ((("a" * 30) + "\u2028") * 1000).freeze
+  ESCAPED_CHARS_BINARY = {
+    "\u2028".b => '\u2028'.b,
+    "\u2029".b => '\u2029'.b,
+    ">".b => '\u003e'.b.freeze,
+    "<".b => '\u003c'.b.freeze,
+    "&".b => '\u0026'.b.freeze,
+  }
+  BINARY_PATTERN = Regexp.union(ESCAPED_CHARS_BINARY.keys)
+
+  ESCAPED_CHARS = {
+    "\u2028" => '\u2028',
+    "\u2029" => '\u2029',
+    ">" => '\u003e',
+    "<" => '\u003c',
+    "&" => '\u0026',
+  }
+  ESCAPE_PATTERN = Regexp.union(ESCAPED_CHARS.keys)
+
+
+benchmark:
+  escape: |
+    str = STR.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_bin: |
+    str = STR.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
+
+  escape_utf8: |
+    str = STR_UNICODE.dup
+    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
+    str
+
+  escape_utf8_bin: |
+    str = STR_UNICODE.b
+    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
+    str.force_encoding(Encoding::UTF_8)
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
new file mode 100644
index 0000000000..7783111082
--- /dev/null
+++ b/benchmark/string_index.rb
@@ -0,0 +1,3 @@
+str1 = "あ" * 1024 + "い" # not single byte optimizable
+str2 = "い"
+100_000.times { str1.index(str2) }
diff --git a/benchmark/string_rpartition.yml b/benchmark/string_rpartition.yml
new file mode 100644
index 0000000000..37e9d1b071
--- /dev/null
+++ b/benchmark/string_rpartition.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10 + ":"
+  str100 = str1 * 100 + ":"
+  str1000 = str1 * 1000 + ":"
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10 + ":"
+  nonascii100 = nonascii1 * 100 + ":"
+  nonascii1000 = nonascii1 * 1000 + ":"
+benchmark:
+  rpartition-1: str1.rpartition(":")
+  rpartition-10: str10.rpartition(":")
+  rpartition-100: str100.rpartition(":")
+  rpartition-1000: str1000.rpartition(":")
+  rpartition-nonascii1: nonascii1.rpartition(":")
+  rpartition-nonascii10: nonascii10.rpartition(":")
+  rpartition-nonascii100: nonascii100.rpartition(":")
+  rpartition-nonascii1000: nonascii1000.rpartition(":")
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
new file mode 100644
index 0000000000..b0d60201a9
--- /dev/null
+++ b/benchmark/string_scan_re.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
new file mode 100644
index 0000000000..42440bd948
--- /dev/null
+++ b/benchmark/string_scan_str.rb
@@ -0,0 +1,2 @@
+str = Array.new(1_000, 'abc').join(',')
+1_000.times { str.scan('abc') }
diff --git a/benchmark/string_slice.yml b/benchmark/string_slice.yml
new file mode 100644
index 0000000000..fc2393c5d1
--- /dev/null
+++ b/benchmark/string_slice.yml
@@ -0,0 +1,11 @@
+prelude: |
+  long_string = "x"*1000+"-hår"
+benchmark:
+  regexp-short: |
+    "x-hår".slice!(/-(.)(.)(.)/, 3)
+  regexp-long: |
+    long_string.dup.slice!(/-(.)(.)(.)/, 3)
+  string-short: |
+    "x-hår".slice!("r")
+  string-long: |
+    long_string.dup.slice!("r")
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
new file mode 100644
index 0000000000..cc2c7d7855
--- /dev/null
+++ b/benchmark/string_split.yml
@@ -0,0 +1,22 @@
+prelude: |
+  str1 = [*0..5].join(" ") + " "
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+benchmark:
+  to_chars-1: str1.split('')
+  to_chars-10: str10.split('')
+  to_chars-100: str100.split('')
+  to_chars-1000: str1000.split('')
+  to_words-1: str1.split(' ')
+  to_words-10: str10.split(' ')
+  to_words-100: str100.split(' ')
+  to_words-1000: str1000.split(' ')
+  re_chars-1: str1.split(//)
+  re_chars-10: str10.split(//)
+  re_chars-100: str100.split(//)
+  re_chars-1000: str1000.split(//)
+  re_space-1: str1.split(/ /)
+  re_space-10: str10.split(/ /)
+  re_space-100: str100.split(/ /)
+  re_space-1000: str1000.split(/ /)
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
new file mode 100644
index 0000000000..eeb5928907
--- /dev/null
+++ b/benchmark/string_swapcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  swapcase-1: str1.swapcase
+  swapcase-10: str10.swapcase
+  swapcase-100: str100.swapcase
+  swapcase-1000: str1000.swapcase
+  swapcase-nonascii1: nonascii1.swapcase
+  swapcase-nonascii10: nonascii10.swapcase
+  swapcase-nonascii100: nonascii100.swapcase
+  swapcase-nonascii1000: nonascii1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
new file mode 100644
index 0000000000..dab84bbde2
--- /dev/null
+++ b/benchmark/string_upcase.yml
@@ -0,0 +1,18 @@
+prelude: |
+  str1 = [*"a".."z",*"0".."9"].join("")
+  str10 = str1 * 10
+  str100 = str10 * 10
+  str1000 = str100 * 10
+  nonascii1 = [*"\u{e0}".."\u{ff}"].join("")
+  nonascii10 = nonascii1 * 10
+  nonascii100 = nonascii10 * 10
+  nonascii1000 = nonascii100 * 10
+benchmark:
+  upcase-1: str1.upcase
+  upcase-10: str10.upcase
+  upcase-100: str100.upcase
+  upcase-1000: str1000.upcase
+  upcase-nonascii1: nonascii1.upcase
+  upcase-nonascii10: nonascii10.upcase
+  upcase-nonascii100: nonascii100.upcase
+  upcase-nonascii1000: nonascii1000.upcase
diff --git a/benchmark/struct_accessor.yml b/benchmark/struct_accessor.yml
new file mode 100644
index 0000000000..d95240e2dd
--- /dev/null
+++ b/benchmark/struct_accessor.yml
@@ -0,0 +1,37 @@
+prelude: |
+  C = Struct.new(:x) do
+    def initialize(...)
+      super
+      @ivar = 42
+    end
+
+    attr_accessor :ivar
+
+    class_eval <<-END
+      def r
+        #{'x;'*256}
+      end
+      def w
+        #{'self.x = nil;'*256}
+      end
+      def rm
+        m = method(:x)
+        #{'m.call;'*256}
+      end
+      def wm
+        m = method(:x=)
+        #{'m.call(nil);'*256}
+      end
+      def r_ivar
+        #{'ivar;'*256}
+      end
+    END
+  end
+  C.new(nil) # ensure common shape is known
+  obj = C.new(nil)
+benchmark:
+  member_reader: "obj.r"
+  member_writer: "obj.w"
+  member_reader_method: "obj.rm"
+  member_writer_method: "obj.wm"
+  ivar_reader: "obj.r_ivar"
diff --git a/benchmark/time_at.yml b/benchmark/time_at.yml
new file mode 100644
index 0000000000..3247efbe77
--- /dev/null
+++ b/benchmark/time_at.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+benchmark:
+  - 'Time.at(0)'
+  - 'Time.at(0, 500)'
+  - 'Time.at(0, in: "+09:00")'
+  - 'Time.at(0, 500, in: "+09:00")'
diff --git a/benchmark/time_new.yml b/benchmark/time_new.yml
new file mode 100644
index 0000000000..5947dd3a41
--- /dev/null
+++ b/benchmark/time_new.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.new(2021)'
+  - 'Time.new(2021, 8, 22)'
+  - 'Time.new(2021, 8, 22, in: "+09:00")'
diff --git a/benchmark/time_now.yml b/benchmark/time_now.yml
new file mode 100644
index 0000000000..9336877cd4
--- /dev/null
+++ b/benchmark/time_now.yml
@@ -0,0 +1,4 @@
+benchmark:
+  - 'Time.now'
+  - 'Time.now(in: "+09:00")'
+  - 'Time.now.year'
diff --git a/benchmark/time_parse.yml b/benchmark/time_parse.yml
new file mode 100644
index 0000000000..6060b58bc6
--- /dev/null
+++ b/benchmark/time_parse.yml
@@ -0,0 +1,10 @@
+prelude: |
+  require 'time'
+  inspect = "2021-08-23 09:57:02 +0900"
+  iso8601 = "2021-08-23T09:57:02+09:00"
+benchmark:
+  - Time.iso8601(iso8601)
+  - Time.parse(iso8601)
+  - Time.parse(inspect)
+  - Time.new(iso8601) rescue Time.iso8601(iso8601)
+  - Time.new(inspect) rescue Time.parse(inspect)
diff --git a/benchmark/time_strftime.yml b/benchmark/time_strftime.yml
new file mode 100644
index 0000000000..28f62aec87
--- /dev/null
+++ b/benchmark/time_strftime.yml
@@ -0,0 +1,7 @@
+prelude: |
+  # frozen_string_literal: true
+  time = Time.now
+benchmark:
+  - time.strftime("%FT%T")     # 19B
+  - time.strftime("%FT%T.%3N") # 23B
+  - time.strftime("%FT%T.%6N") # 26B
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
new file mode 100644
index 0000000000..8d89ebb7a7
--- /dev/null
+++ b/benchmark/time_strptime.yml
@@ -0,0 +1,13 @@
+prelude: |
+  require 'time'
+benchmark:
+  - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
+  - Time.strptime("1", "%s")
+  - Time.strptime("0 +0100", "%s %z")
+  - Time.strptime("0 UTC", "%s %z")
+  - Time.strptime("1.5", "%s.%N")
+  - Time.strptime("1.000000000001", "%s.%N")
+  - Time.strptime("20010203 -0200", "%Y%m%d %z")
+  - Time.strptime("20010203 UTC", "%Y%m%d %z")
+  - Time.strptime("2018-365", "%Y-%j")
+  - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
new file mode 100644
index 0000000000..505021c701
--- /dev/null
+++ b/benchmark/time_subsec.rb
@@ -0,0 +1,2 @@
+t = Time.now
+4000000.times { t.subsec }
diff --git a/benchmark/time_xmlschema.yml b/benchmark/time_xmlschema.yml
new file mode 100644
index 0000000000..654e5cfcbc
--- /dev/null
+++ b/benchmark/time_xmlschema.yml
@@ -0,0 +1,27 @@
+prelude: |
+  # frozen_string_literal
+  unless Time.method_defined?(:xmlschema)
+    class Time
+      def xmlschema(fraction_digits=0)
+        fraction_digits = fraction_digits.to_i
+        s = strftime("%FT%T")
+        if fraction_digits > 0
+          s << strftime(".%#{fraction_digits}N")
+        end
+        s << (utc? ? 'Z' : strftime("%:z"))
+      end
+    end
+  end
+  time = Time.now
+  utc_time = Time.now.utc
+  fraction_sec = Time.at(123456789.quo(9999999999)).getlocal("+09:00")
+  future_time = Time.utc(10000)
+benchmark:
+  - time.xmlschema
+  - utc_time.xmlschema
+  - time.xmlschema(6)
+  - utc_time.xmlschema(6)
+  - time.xmlschema(9)
+  - utc_time.xmlschema(9)
+  - fraction_sec.xmlschema(10)
+  - future_time.xmlschema
diff --git a/benchmark/vm_array.yml b/benchmark/vm_array.yml
new file mode 100644
index 0000000000..2a177237ef
--- /dev/null
+++ b/benchmark/vm_array.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_array: |
+    a = [1,2,3,4,5,6,7,8,9,10]
+loop_count: 6000000
diff --git a/benchmark/vm_attr_ivar.yml b/benchmark/vm_attr_ivar.yml
new file mode 100644
index 0000000000..75b803478e
--- /dev/null
+++ b/benchmark/vm_attr_ivar.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_reader :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar: |
+    j = obj.a
+    k = obj.b
+loop_count: 30000000
diff --git a/benchmark/vm_attr_ivar_set.yml b/benchmark/vm_attr_ivar_set.yml
new file mode 100644
index 0000000000..a0d379b18a
--- /dev/null
+++ b/benchmark/vm_attr_ivar_set.yml
@@ -0,0 +1,14 @@
+prelude: |
+  class C
+    attr_accessor :a, :b
+    def initialize
+      @a = nil
+      @b = nil
+    end
+  end
+  obj = C.new
+benchmark:
+  vm_attr_ivar_set: |
+    obj.a = 1
+    obj.b = 2
+loop_count: 30000000
diff --git a/benchmark/vm_backtrace.rb b/benchmark/vm_backtrace.rb
new file mode 100644
index 0000000000..0fbf73e1ca
--- /dev/null
+++ b/benchmark/vm_backtrace.rb
@@ -0,0 +1,22 @@
+# get last backtrace
+
+begin
+  caller(0, 0)
+rescue ArgumentError
+  alias caller_orig caller
+  def caller lev, n
+    caller_orig(lev)[0..n]
+  end
+end
+
+def rec n
+  if n < 0
+    100_000.times{
+      caller(0, 1)
+    }
+  else
+    rec(n-1)
+  end
+end
+
+rec 50
diff --git a/benchmark/vm_bigarray.yml b/benchmark/vm_bigarray.yml
new file mode 100644
index 0000000000..8b2d3f3443
--- /dev/null
+++ b/benchmark/vm_bigarray.yml
@@ -0,0 +1,105 @@
+benchmark:
+  vm_bigarray: |
+    a = [
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+      1,2,3,4,5,6,7,8,9,10,
+    ]
+loop_count: 6000000
diff --git a/benchmark/vm_bighash.yml b/benchmark/vm_bighash.yml
new file mode 100644
index 0000000000..4dacfde793
--- /dev/null
+++ b/benchmark/vm_bighash.yml
@@ -0,0 +1,4 @@
+benchmark:
+  vm_bighash: |
+    a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+loop_count: 60000
diff --git a/benchmark/vm_block.yml b/benchmark/vm_block.yml
new file mode 100644
index 0000000000..68b3e40bf5
--- /dev/null
+++ b/benchmark/vm_block.yml
@@ -0,0 +1,9 @@
+prelude: |
+  def m
+    yield
+  end
+benchmark:
+  vm_block: |
+    m{
+    }
+loop_count: 30000000
diff --git a/benchmark/vm_block_handler.yml b/benchmark/vm_block_handler.yml
new file mode 100644
index 0000000000..461d7953ad
--- /dev/null
+++ b/benchmark/vm_block_handler.yml
@@ -0,0 +1,27 @@
+# :FIXME: is there a way to benchmark block_handler_type_ifunc?
+
+prelude: |
+  p = proc{_1}
+  o = Object.new
+  def o.each
+    i = 0
+    while i < 3_000_000 do
+      yield i
+      i += 1
+    end
+  end
+
+benchmark:
+  - name: block_handler_type_iseq
+    script: |
+      o.each{_1}
+
+  - name: block_handler_type_symbol
+    script: |
+      o.each(&:itself)
+
+  - name: block_handler_type_proc
+    script: |
+      o.each(&p)
+
+loop_count: 1
diff --git a/benchmark/vm_blockparam.yml b/benchmark/vm_blockparam.yml
new file mode 100644
index 0000000000..5e5a0170a2
--- /dev/null
+++ b/benchmark/vm_blockparam.yml
@@ -0,0 +1,7 @@
+prelude: |
+  def m &b
+  end
+benchmark:
+  vm_blockparam: |
+    m{}
+loop_count: 30000000
diff --git a/benchmark/vm_blockparam_call.yml b/benchmark/vm_blockparam_call.yml
new file mode 100644

path: root/encoding.c

/**********************************************************************

  encoding.c -

  $Author$
  created at: Thu May 24 17:23:27 JST 2007

  Copyright (C) 2007 Yukihiro Matsumoto

**********************************************************************/

#include "ruby/encoding.h"
#include "internal.h"
#include "encindex.h"
#include "regenc.h"
#include <ctype.h>
#include "ruby/util.h"

#include "ruby_assert.h"
#ifndef ENC_DEBUG
#define ENC_DEBUG 0
#endif
#define ENC_ASSERT (!ENC_DEBUG)?(void)0:assert
#define MUST_STRING(str) (ENC_ASSERT(RB_TYPE_P(str, T_STRING)), str)

#undef rb_ascii8bit_encindex
#undef rb_utf8_encindex
#undef rb_usascii_encindex

typedef OnigEncodingType rb_raw_encoding;

#if defined __GNUC__ && __GNUC__ >= 4
#pragma GCC visibility push(default)
int rb_enc_register(const char *name, rb_encoding *encoding);
void rb_enc_set_base(const char *name, const char *orig);
int rb_enc_set_dummy(int index);
void rb_encdb_declare(const char *name);
int rb_encdb_replicate(const char *name, const char *orig);
int rb_encdb_dummy(const char *name);
int rb_encdb_alias(const char *alias, const char *orig);
void rb_encdb_set_unicode(int index);
#pragma GCC visibility pop
#endif

static ID id_encoding;
VALUE rb_cEncoding;
static VALUE rb_encoding_list;

struct rb_encoding_entry {
    const char *name;
    rb_encoding *enc;
    rb_encoding *base;
};

static struct {
    struct rb_encoding_entry *list;
    int count;
    int size;
    st_table *names;
} enc_table;

#define ENC_DUMMY_FLAG (1<<24)
#define ENC_INDEX_MASK (~(~0U<<24))

#define ENC_TO_ENCINDEX(enc) (int)((enc)->ruby_encoding_index & ENC_INDEX_MASK)
#define ENC_DUMMY_P(enc) ((enc)->ruby_encoding_index & ENC_DUMMY_FLAG)
#define ENC_SET_DUMMY(enc) ((enc)->ruby_encoding_index |= ENC_DUMMY_FLAG)

void rb_enc_init(void);

#define ENCODING_COUNT ENCINDEX_BUILTIN_MAX
#define UNSPECIFIED_ENCODING INT_MAX

#define ENCODING_NAMELEN_MAX 63
#define valid_encoding_name_p(name) ((name) && strlen(name) <= ENCODING_NAMELEN_MAX)

#define enc_autoload_p(enc) (!rb_enc_mbmaxlen(enc))

static int load_encoding(const char *name);

static const rb_data_type_t encoding_data_type = {
    "encoding",
    {0, 0, 0,},
    0, 0, RUBY_TYPED_FREE_IMMEDIATELY
};

#define is_data_encoding(obj) (RTYPEDDATA_P(obj) && RTYPEDDATA_TYPE(obj) == &encoding_data_type)
#define is_obj_encoding(obj) (RB_TYPE_P((obj), T_DATA) && is_data_encoding(obj))

int
rb_data_is_encoding(VALUE obj)
{
    return is_data_encoding(obj);
}

static VALUE
enc_new(rb_encoding *encoding)
{
    return TypedData_Wrap_Struct(rb_cEncoding, &encoding_data_type, (void *)encoding);
}

static VALUE
rb_enc_from_encoding_index(int idx)
{
    VALUE list, enc;

    if (!(list = rb_encoding_list)) {
	rb_bug("rb_enc_from_encoding_index(%d): no rb_encoding_list", idx);
    }
    enc = rb_ary_entry(list, idx);
    if (NIL_P(enc)) {
	rb_bug("rb_enc_from_encoding_index(%d): not created yet", idx);
    }
    return enc;
}

VALUE
rb_enc_from_encoding(rb_encoding *encoding)
{
    int idx;
    if (!encoding) return Qnil;
    idx = ENC_TO_ENCINDEX(encoding);
    return rb_enc_from_encoding_index(idx);
}

int
rb_enc_to_index(rb_encoding *enc)
{
    return enc ? ENC_TO_ENCINDEX(enc) : 0;
}

int
rb_enc_dummy_p(rb_encoding *enc)
{
    return ENC_DUMMY_P(enc) != 0;
}

static int enc_autoload(rb_encoding *);

static int
check_encoding(rb_encoding *enc)
{
    int index = rb_enc_to_index(enc);
    if (rb_enc_from_index(index) != enc)
	return -1;
    if (enc_autoload_p(enc)) {
	index = enc_autoload(enc);
    }
    return index;
}

static int
enc_check_encoding(VALUE obj)
{
    if (!is_obj_encoding(obj)) {
	return -1;
    }
    return check_encoding(RDATA(obj)->data);
}

NORETURN(static void not_encoding(VALUE enc));
static void
not_encoding(VALUE enc)
{
    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (expected Encoding)",
	     rb_obj_class(enc));
}

static rb_encoding *
must_encoding(VALUE enc)
{
    int index = enc_check_encoding(enc);
    if (index < 0) {
	not_encoding(enc);
    }
    return DATA_PTR(enc);
}

static rb_encoding *
must_encindex(int index)
{
    rb_encoding *enc = rb_enc_from_index(index);
    if (!enc) {
	rb_raise(rb_eEncodingError, "encoding index out of bound: %d",
		 index);
    }
    if (ENC_TO_ENCINDEX(enc) != (int)(index & ENC_INDEX_MASK)) {
	rb_raise(rb_eEncodingError, "wrong encoding index %d for %s (expected %d)",
		 index, rb_enc_name(enc), ENC_TO_ENCINDEX(enc));
    }
    if (enc_autoload_p(enc) && enc_autoload(enc) == -1) {
	rb_loaderror("failed to load encoding (%s)",
		     rb_enc_name(enc));
    }
    return enc;
}

int
rb_to_encoding_index(VALUE enc)
{
    int idx;

    idx = enc_check_encoding(enc);
    if (idx >= 0) {
	return idx;
    }
    else if (NIL_P(enc = rb_check_string_type(enc))) {
	return -1;
    }
    if (!rb_enc_asciicompat(rb_enc_get(enc))) {
	return -1;
    }
    return rb_enc_find_index(StringValueCStr(enc));
}

/* Returns encoding index or UNSPECIFIED_ENCODING */
static int
str_find_encindex(VALUE enc)
{
    int idx;

    StringValue(enc);
    if (!rb_enc_asciicompat(rb_enc_get(enc))) {
	rb_raise(rb_eArgError, "invalid name encoding (non ASCII)");
    }
    idx = rb_enc_find_index(StringValueCStr(enc));
    return idx;
}

static int
str_to_encindex(VALUE enc)
{
    int idx = str_find_encindex(enc);
    if (idx < 0) {
	rb_raise(rb_eArgError, "unknown encoding name - %"PRIsVALUE, enc);
    }
    return idx;
}

static rb_encoding *
str_to_encoding(VALUE enc)
{
    return rb_enc_from_index(str_to_encindex(enc));
}

rb_encoding *
rb_to_encoding(VALUE enc)
{
    if (enc_check_encoding(enc) >= 0) return RDATA(enc)->data;
    return str_to_encoding(enc);
}

rb_encoding *
rb_find_encoding(VALUE enc)
{
    int idx;
    if (enc_check_encoding(enc) >= 0) return RDATA(enc)->data;
    idx = str_find_encindex(enc);
    if (idx < 0) return NULL;
    return rb_enc_from_index(idx);
}

static int
enc_table_expand(int newsize)
{
    struct rb_encoding_entry *ent;
    int count = newsize;

    if (enc_table.size >= newsize) return newsize;
    newsize = (newsize + 7) / 8 * 8;
    ent = realloc(enc_table.list, sizeof(*enc_table.list) * newsize);
    if (!ent) return -1;
    memset(ent + enc_table.size, 0, sizeof(*ent)*(newsize - enc_table.size));
    enc_table.list = ent;
    enc_table.size = newsize;
    return count;
}

static int
enc_register_at(int index, const char *name, rb_encoding *base_encoding)
{
    struct rb_encoding_entry *ent = &enc_table.list[index];
    rb_raw_encoding *encoding;
    VALUE list;

    if (!valid_encoding_name_p(name)) return -1;
    if (!ent->name) {
	ent->name = name = strdup(name);
    }
    else if (STRCASECMP(name, ent->name)) {
	return -1;
    }
    encoding = (rb_raw_encoding *)ent->enc;
    if (!encoding) {
	encoding = xmalloc(sizeof(rb_encoding));
    }
    if (base_encoding) {
	*encoding = *base_encoding;
    }
    else {
	memset(encoding, 0, sizeof(*ent->enc));
    }
    encoding->name = name;
    encoding->ruby_encoding_index = index;
    ent->enc = encoding;
    st_insert(enc_table.names, (st_data_t)name, (st_data_t)index);
    list = rb_encoding_list;
    if (list && NIL_P(rb_ary_entry(list, index))) {
	/* initialize encoding data */
	rb_ary_store(list, index, enc_new(encoding));
    }
    return index;
}

static int
enc_register(const char *name, rb_encoding *encoding)
{
    int index = enc_table.count;

    if ((index = enc_table_expand(index + 1)) < 0) return -1;
    enc_table.count = index;
    return enc_register_at(index - 1, name, encoding);
}

static void set_encoding_const(const char *, rb_encoding *);
int rb_enc_registered(const char *name);

int
rb_enc_register(const char *name, rb_encoding *encoding)
{
    int index = rb_enc_registered(name);

    if (index >= 0) {
	rb_encoding *oldenc = rb_enc_from_index(index);
	if (STRCASECMP(name, rb_enc_name(oldenc))) {
	    index = enc_register(name, encoding);
	}
	else if (enc_autoload_p(oldenc) || !ENC_DUMMY_P(oldenc)) {
	    enc_register_at(index, name, encoding);
	}
	else {
	    rb_raise(rb_eArgError, "encoding %s is already registered", name);
	}
    }
    else {
	index = enc_register(name, encoding);
	set_encoding_const(name, rb_enc_from_index(index));
    }
    return index;
}

void
rb_encdb_declare(const char *name)
{
    int idx = rb_enc_registered(name);
    if (idx < 0) {
	idx = enc_register(name, 0);
    }
    set_encoding_const(name, rb_enc_from_index(idx));
}

static void
enc_check_duplication(const char *name)
{
    if (rb_enc_registered(name) >= 0) {
	rb_raise(rb_eArgError, "encoding %s is already registered", name);
    }
}

static rb_encoding*
set_base_encoding(int index, rb_encoding *base)
{
    rb_encoding *enc = enc_table.list[index].enc;

    enc_table.list[index].base = base;
    if (ENC_DUMMY_P(base)) ENC_SET_DUMMY((rb_raw_encoding *)enc);
    return enc;
}

/* for encdb.h
 * Set base encoding for encodings which are not replicas
 * but not in their own files.
 */
void
rb_enc_set_base(const char *name, const char *orig)
{
    int idx = rb_enc_registered(name);
    int origidx = rb_enc_registered(orig);
    set_base_encoding(idx, rb_enc_from_index(origidx));
}

/* for encdb.h
 * Set encoding dummy.
 */
int
rb_enc_set_dummy(int index)
{
    rb_encoding *enc = enc_table.list[index].enc;

    ENC_SET_DUMMY((rb_raw_encoding *)enc);
    return index;
}

int
rb_enc_replicate(const char *name, rb_encoding *encoding)
{
    int idx;

    enc_check_duplication(name);
    idx = enc_register(name, encoding);
    set_base_encoding(idx, encoding);
    set_encoding_const(name, rb_enc_from_index(idx));
    return idx;
}

/*
 * call-seq:
 *   enc.replicate(name) -> encoding
 *
 * Returns a replicated encoding of _enc_ whose name is _name_.
 * The new encoding should have the same byte structure of _enc_.
 * If _name_ is used by another encoding, raise ArgumentError.
 *
 */
static VALUE
enc_replicate(VALUE encoding, VALUE name)
{
    return rb_enc_from_encoding_index(
	rb_enc_replicate(StringValueCStr(name),
			 rb_to_encoding(encoding)));
}

static int
enc_replicate_with_index(const char *name, rb_encoding *origenc, int idx)
{
    if (idx < 0) {
	idx = enc_register(name, origenc);
    }
    else {
	idx = enc_register_at(idx, name, origenc);
    }
    if (idx >= 0) {
	set_base_encoding(idx, origenc);
	set_encoding_const(name, rb_enc_from_index(idx));
    }
    return idx;
}

int
rb_encdb_replicate(const char *name, const char *orig)
{
    int origidx = rb_enc_registered(orig);
    int idx = rb_enc_registered(name);

    if (origidx < 0) {
	origidx = enc_register(orig, 0);
    }
    return enc_replicate_with_index(name, rb_enc_from_index(origidx), idx);
}

int
rb_define_dummy_encoding(const char *name)
{
    int index = rb_enc_replicate(name, rb_ascii8bit_encoding());
    rb_encoding *enc = enc_table.list[index].enc;

    ENC_SET_DUMMY((rb_raw_encoding *)enc);
    return index;
}

int
rb_encdb_dummy(const char *name)
{
    int index = enc_replicate_with_index(name, rb_ascii8bit_encoding(),
					 rb_enc_registered(name));
    rb_encoding *enc = enc_table.list[index].enc;

    ENC_SET_DUMMY((rb_raw_encoding *)enc);
    return index;
}

/*
 * call-seq:
 *   enc.dummy? -> true or false
 *
 * Returns true for dummy encodings.
 * A dummy encoding is an encoding for which character handling is not properly
 * implemented.
 * It is used for stateful encodings.
 *
 *   Encoding::ISO_2022_JP.dummy?       #=> true
 *   Encoding::UTF_8.dummy?             #=> false
 *
 */
static VALUE
enc_dummy_p(VALUE enc)
{
    return ENC_DUMMY_P(must_encoding(enc)) ? Qtrue : Qfalse;
}

/*
 * call-seq:
 *   enc.ascii_compatible? -> true or false
 *
 * Returns whether ASCII-compatible or not.
 *
 *   Encoding::UTF_8.ascii_compatible?     #=> true
 *   Encoding::UTF_16BE.ascii_compatible?  #=> false
 *
 */
static VALUE
enc_ascii_compatible_p(VALUE enc)
{
    return rb_enc_asciicompat(must_encoding(enc)) ? Qtrue : Qfalse;
}

/*
 * Returns non-zero when the encoding is Unicode series other than UTF-7 else 0.
 */
int
rb_enc_unicode_p(rb_encoding *enc)
{
    return ONIGENC_IS_UNICODE(enc);
}

static st_data_t
enc_dup_name(st_data_t name)
{
    return (st_data_t)strdup((const char *)name);
}

/*
 * Returns copied alias name when the key is added for st_table,
 * else returns NULL.
 */
static int
enc_alias_internal(const char *alias, int idx)
{
    return st_insert2(enc_table.names, (st_data_t)alias, (st_data_t)idx,
		      enc_dup_name);
}

static int
enc_alias(const char *alias, int idx)
{
    if (!valid_encoding_name_p(alias)) return -1;
    if (!enc_alias_internal(alias, idx))
	set_encoding_const(alias, rb_enc_from_index(idx));
    return idx;
}

int
rb_enc_alias(const char *alias, const char *orig)
{
    int idx;

    enc_check_duplication(alias);
    if (!enc_table.list) {
	rb_enc_init();
    }
    if ((idx = rb_enc_find_index(orig)) < 0) {
	return -1;
    }
    return enc_alias(alias, idx);
}

int
rb_encdb_alias(const char *alias, const char *orig)
{
    int idx = rb_enc_registered(orig);

    if (idx < 0) {
	idx = enc_register(orig, 0);
    }
    return enc_alias(alias, idx);
}

void
rb_encdb_set_unicode(int index)
{
    ((rb_raw_encoding *)rb_enc_from_index(index))->flags |= ONIGENC_FLAG_UNICODE;
}

void
rb_enc_init(void)
{
    enc_table_expand(ENCODING_COUNT + 1);
    if (!enc_table.names) {
	enc_table.names = st_init_strcasetable();
    }
#define ENC_REGISTER(enc) enc_register_at(ENCINDEX_##enc, rb_enc_name(&OnigEncoding##enc), &OnigEncoding##enc)
    ENC_REGISTER(ASCII);
    ENC_REGISTER(UTF_8);
    ENC_REGISTER(US_ASCII);
#undef ENC_REGISTER
#define ENCDB_REGISTER(name, enc) enc_register_at(ENCINDEX_##enc, name, NULL)
    ENCDB_REGISTER("UTF-16BE", UTF_16BE);
    ENCDB_REGISTER("UTF-16LE", UTF_16LE);
    ENCDB_REGISTER("UTF-32BE", UTF_32BE);
    ENCDB_REGISTER("UTF-32LE", UTF_32LE);
    ENCDB_REGISTER("UTF-16", UTF_16);
    ENCDB_REGISTER("UTF-32", UTF_32);
    ENCDB_REGISTER("UTF8-MAC", UTF8_MAC);

    ENCDB_REGISTER("EUC-JP", EUC_JP);
    ENCDB_REGISTER("Windows-31J", Windows_31J);
#undef ENCDB_REGISTER
    enc_table.count = ENCINDEX_BUILTIN_MAX;
}

rb_encoding *
rb_enc_from_index(int index)
{
    if (!enc_table.list) {
	rb_enc_init();
    }
    if (index < 0 || enc_table.count <= (index &= ENC_INDEX_MASK)) {
	return 0;
    }
    return enc_table.list[index].enc;
}

rb_encoding *
rb_enc_get_from_index(int index)
{
    return must_encindex(index);
}

int
rb_enc_registered(const char *name)
{
    st_data_t idx = 0;

    if (!name) return -1;
    if (!enc_table.list) return -1;
    if (st_lookup(enc_table.names, (st_data_t)name, &idx)) {
	return (int)idx;
    }
    return -1;
}

static int
load_encoding(const char *name)
{
    VALUE enclib = rb_sprintf("enc/%s.so", name);
    VALUE verbose = ruby_verbose;
    VALUE debug = ruby_debug;
    VALUE errinfo;
    char *s = RSTRING_PTR(enclib) + 4, *e = RSTRING_END(enclib) - 3;
    int loaded;
    int idx;

    while (s < e) {
	if (!ISALNUM(*s)) *s = '_';
	else if (ISUPPER(*s)) *s = (char)TOLOWER(*s);
	++s;
    }
    FL_UNSET(enclib, FL_TAINT);
    enclib = rb_fstring(enclib);
    ruby_verbose = Qfalse;
    ruby_debug = Qfalse;
    errinfo = rb_errinfo();
    loaded = rb_require_internal(enclib, rb_safe_level());
    ruby_verbose = verbose;
    ruby_debug = debug;
    rb_set_errinfo(errinfo);
    if (loaded < 0 || 1 < loaded) return -1;
    if ((idx = rb_enc_registered(name)) < 0) return -1;
    if (enc_autoload_p(enc_table.list[idx].enc)) return -1;
    return idx;
}

static int
enc_autoload(rb_encoding *enc)
{
    int i;
    rb_encoding *base = enc_table.list[ENC_TO_ENCINDEX(enc)].base;

    if (base) {
	i = 0;
	do {
	    if (i >= enc_table.count) return -1;
	} while (enc_table.list[i].enc != base && (++i, 1));
	if (enc_autoload_p(base)) {
	    if (enc_autoload(base) < 0) return -1;
	}
	i = enc->ruby_encoding_index;
	enc_register_at(i & ENC_INDEX_MASK, rb_enc_name(enc), base);
	((rb_raw_encoding *)enc)->ruby_encoding_index = i;
	i &= ENC_INDEX_MASK;
    }
    else {
	i = load_encoding(rb_enc_name(enc));
    }
    return i;
}

/* Return encoding index or UNSPECIFIED_ENCODING from encoding name */
int
rb_enc_find_index(const char *name)
{
    int i = rb_enc_registered(name);
    rb_encoding *enc;

    if (i < 0) {
	i = load_encoding(name);
    }
    else if (!(enc = rb_enc_from_index(i))) {
	if (i != UNSPECIFIED_ENCODING) {
	    rb_raise(rb_eArgError, "encoding %s is not registered", name);
	}
    }
    else if (enc_autoload_p(enc)) {
	if (enc_autoload(enc) < 0) {
	    rb_warn("failed to load encoding (%s); use ASCII-8BIT instead",
		    name);
	    return 0;
	}
    }
    return i;
}

int
rb_enc_find_index2(const char *name, long len)
{
    char buf[ENCODING_NAMELEN_MAX+1];

    if (len > ENCODING_NAMELEN_MAX) return -1;
    memcpy(buf, name, len);
    buf[len] = '\0';
    return rb_enc_find_index(buf);
}

rb_encoding *
rb_enc_find(const char *name)
{
    int idx = rb_enc_find_index(name);
    if (idx < 0) idx = 0;
    return rb_enc_from_index(idx);
}

static inline int
enc_capable(VALUE obj)
{
    if (SPECIAL_CONST_P(obj)) return SYMBOL_P(obj);
    switch (BUILTIN_TYPE(obj)) {
      case T_STRING:
      case T_REGEXP:
      case T_FILE:
      case T_SYMBOL:
	return TRUE;
      case T_DATA:
	if (is_data_encoding(obj)) return TRUE;
      default:
	return FALSE;
    }
}

int
rb_enc_capable(VALUE obj)
{
    return enc_capable(obj);
}

ID
rb_id_encoding(void)
{
    CONST_ID(id_encoding, "encoding");
    return id_encoding;
}

static int
enc_get_index_str(VALUE str)
{
    int i = ENCODING_GET_INLINED(str);
    if (i == ENCODING_INLINE_MAX) {
	VALUE iv;

	iv = rb_ivar_get(str, rb_id_encoding());
	i = NUM2INT(iv);
    }
    return i;
}

int
rb_enc_get_index(VALUE obj)
{
    int i = -1;
    VALUE tmp;

    if (SPECIAL_CONST_P(obj)) {
	if (!SYMBOL_P(obj)) return -1;
	obj = rb_sym2str(obj);
    }
    switch (BUILTIN_TYPE(obj)) {
      as_default:
      default:
      case T_STRING:
      case T_REGEXP:
	i = enc_get_index_str(obj);
	break;
      case T_FILE:
	tmp = rb_funcallv(obj, rb_intern("internal_encoding"), 0, 0);
	if (NIL_P(tmp)) obj = rb_funcallv(obj, rb_intern("external_encoding"), 0, 0);
	else obj = tmp;
	if (NIL_P(obj)) break;
      case T_DATA:
	if (is_data_encoding(obj)) {
	    i = enc_check_encoding(obj);
	}
	else {
	    goto as_default;
	}
	break;
    }
    return i;
}

static void
enc_set_index(VALUE obj, int idx)
{
    if (!enc_capable(obj)) rb_bug("enc_set_index: not capable object");

    if (idx < ENCODING_INLINE_MAX) {
	ENCODING_SET_INLINED(obj, idx);
	return;
    }
    ENCODING_SET_INLINED(obj, ENCODING_INLINE_MAX);
    rb_ivar_set(obj, rb_id_encoding(), INT2NUM(idx));
}

void
rb_enc_set_index(VALUE obj, int idx)
{
    rb_check_frozen(obj);
    must_encindex(idx);
    enc_set_index(obj, idx);
}

VALUE
rb_enc_associate_index(VALUE obj, int idx)
{
    rb_encoding *enc;
    int oldidx, oldtermlen, termlen;

/*    enc_check_capable(obj);*/
    rb_check_frozen(obj);
    oldidx = rb_enc_get_index(obj);
    if (oldidx == idx)
	return obj;
    if (SPECIAL_CONST_P(obj)) {
	rb_raise(rb_eArgError, "cannot set encoding");
    }
    enc = must_encindex(idx);
    if (!ENC_CODERANGE_ASCIIONLY(obj) ||
	!rb_enc_asciicompat(enc)) {
	ENC_CODERANGE_CLEAR(obj);
    }
    termlen = rb_enc_mbminlen(enc);
    oldtermlen = rb_enc_mbminlen(rb_enc_from_index(oldidx));
    if (oldtermlen != termlen && RB_TYPE_P(obj, T_STRING)) {
	rb_str_change_terminator_length(obj, oldtermlen, termlen);
    }
    enc_set_index(obj, idx);
    return obj;
}

VALUE
rb_enc_associate(VALUE obj, rb_encoding *enc)
{
    return rb_enc_associate_index(obj, rb_enc_to_index(enc));
}

rb_encoding*
rb_enc_get(VALUE obj)
{
    return rb_enc_from_index(rb_enc_get_index(obj));
}

static rb_encoding* enc_compatible_str(VALUE str1, VALUE str2);

rb_encoding*
rb_enc_check_str(VALUE str1, VALUE str2)
{
    rb_encoding *enc = enc_compatible_str(MUST_STRING(str1), MUST_STRING(str2));
    if (!enc)
	rb_raise(rb_eEncCompatError, "incompatible character encodings: %s and %s",
		 rb_enc_name(rb_enc_get(str1)),
		 rb_enc_name(rb_enc_get(str2)));
    return enc;
}

rb_encoding*
rb_enc_check(VALUE str1, VALUE str2)
{
    rb_encoding *enc = rb_enc_compatible(str1, str2);
    if (!enc)
	rb_raise(rb_eEncCompatError, "incompatible character encodings: %s and %s",
		 rb_enc_name(rb_enc_get(str1)),
		 rb_enc_name(rb_enc_get(str2)));
    return enc;
}

static rb_encoding*
enc_compatible_latter(VALUE str1, VALUE str2, int idx1, int idx2)
{
    int isstr1, isstr2;
    rb_encoding *enc1 = rb_enc_from_index(idx1);
    rb_encoding *enc2 = rb_enc_from_index(idx2);

    isstr2 = RB_TYPE_P(str2, T_STRING);
    if (isstr2 && RSTRING_LEN(str2) == 0)
	return enc1;
    isstr1 = RB_TYPE_P(str1, T_STRING);
    if (isstr1 && RSTRING_LEN(str1) == 0)
	return (rb_enc_asciicompat(enc1) && rb_enc_str_asciionly_p(str2)) ? enc1 : enc2;
    if (!rb_enc_asciicompat(enc1) || !rb_enc_asciicompat(enc2)) {
	return 0;
    }

    /* objects whose encoding is the same of contents */
    if (!isstr2 && idx2 == ENCINDEX_US_ASCII)
	return enc1;
    if (!isstr1 && idx1 == ENCINDEX_US_ASCII)
	return enc2;

    if (!isstr1) {
	VALUE tmp = str1;
	int idx0 = idx1;
	str1 = str2;
	str2 = tmp;
	idx1 = idx2;
	idx2 = idx0;
	idx0 = isstr1;
	isstr1 = isstr2;
	isstr2 = idx0;
    }
    if (isstr1) {
	int cr1, cr2;

	cr1 = rb_enc_str_coderange(str1);
	if (isstr2) {
	    cr2 = rb_enc_str_coderange(str2);
	    if (cr1 != cr2) {
		/* may need to handle ENC_CODERANGE_BROKEN */
		if (cr1 == ENC_CODERANGE_7BIT) return enc2;
		if (cr2 == ENC_CODERANGE_7BIT) return enc1;
	    }
	    if (cr2 == ENC_CODERANGE_7BIT) {
		return enc1;
	    }
	}
	if (cr1 == ENC_CODERANGE_7BIT)
	    return enc2;
    }
    return 0;
}

static rb_encoding*
enc_compatible_str(VALUE str1, VALUE str2)
{
    int idx1 = enc_get_index_str(str1);
    int idx2 = enc_get_index_str(str2);

    if (idx1 < 0 || idx2 < 0)
        return 0;

    if (idx1 == idx2) {
	return rb_enc_from_index(idx1);
    }
    else {
	return enc_compatible_latter(str1, str2, idx1, idx2);
    }
}

rb_encoding*
rb_enc_compatible(VALUE str1, VALUE str2)
{
    int idx1 = rb_enc_get_index(str1);
    int idx2 = rb_enc_get_index(str2);

    if (idx1 < 0 || idx2 < 0)
        return 0;

    if (idx1 == idx2) {
	return rb_enc_from_index(idx1);
    }

    return enc_compatible_latter(str1, str2, idx1, idx2);
}

void
rb_enc_copy(VALUE obj1, VALUE obj2)
{
    rb_enc_associate_index(obj1, rb_enc_get_index(obj2));
}


/*
 *  call-seq:
 *     obj.encoding   -> encoding
 *
 *  Returns the Encoding object that represents the encoding of obj.
 */

VALUE
rb_obj_encoding(VALUE obj)
{
    int idx = rb_enc_get_index(obj);
    if (idx < 0) {
	rb_raise(rb_eTypeError, "unknown encoding");
    }
    return rb_enc_from_encoding_index(idx & ENC_INDEX_MASK);
}

int
rb_enc_fast_mbclen(const char *p, const char *e, rb_encoding *enc)
{
    return ONIGENC_MBC_ENC_LEN(enc, (UChar*)p, (UChar*)e);
}

int
rb_enc_mbclen(const char *p, const char *e, rb_encoding *enc)
{
    int n = ONIGENC_PRECISE_MBC_ENC_LEN(enc, (UChar*)p, (UChar*)e);
    if (MBCLEN_CHARFOUND_P(n) && MBCLEN_CHARFOUND_LEN(n) <= e-p)
        return MBCLEN_CHARFOUND_LEN(n);
    else {
        int min = rb_enc_mbminlen(enc);
        return min <= e-p ? min : (int)(e-p);
    }
}

int
rb_enc_precise_mbclen(const char *p, const char *e, rb_encoding *enc)
{
    int n;
    if (e <= p)
        return ONIGENC_CONSTRUCT_MBCLEN_NEEDMORE(1);
    n = ONIGENC_PRECISE_MBC_ENC_LEN(enc, (UChar*)p, (UChar*)e);
    if (e-p < n)
        return ONIGENC_CONSTRUCT_MBCLEN_NEEDMORE(n-(int)(e-p));
    return n;
}

int
rb_enc_ascget(const char *p, const char *e, int *len, rb_encoding *enc)
{
    unsigned int c;
    int l;
    if (e <= p)
        return -1;
    if (rb_enc_asciicompat(enc)) {
        c = (unsigned char)*p;
        if (!ISASCII(c))
            return -1;
        if (len) *len = 1;
        return c;
    }
    l = rb_enc_precise_mbclen(p, e, enc);
    if (!MBCLEN_CHARFOUND_P(l))
        return -1;
    c = rb_enc_mbc_to_codepoint(p, e, enc);
    if (!rb_enc_isascii(c, enc))
        return -1;
    if (len) *len = l;
    return c;
}

unsigned int
rb_enc_codepoint_len(const char *p, const char *e, int *len_p, rb_encoding *enc)
{
    int r;
    if (e <= p)
        rb_raise(rb_eArgError, "empty string");
    r = rb_enc_precise_mbclen(p, e, enc);
    if (!MBCLEN_CHARFOUND_P(r)) {
	rb_raise(rb_eArgError, "invalid byte sequence in %s", rb_enc_name(enc));
    }
    if (len_p) *len_p = MBCLEN_CHARFOUND_LEN(r);
    return rb_enc_mbc_to_codepoint(p, e, enc);
}

#undef rb_enc_codepoint
unsigned int
rb_enc_codepoint(const char *p, const char *e, rb_encoding *enc)
{
    return rb_enc_codepoint_len(p, e, 0, enc);
}

int
rb_enc_codelen(int c, rb_encoding *enc)
{
    int n = ONIGENC_CODE_TO_MBCLEN(enc,c);
    if (n == 0) {
	rb_raise(rb_eArgError, "invalid codepoint 0x%x in %s", c, rb_enc_name(enc));
    }
    return n;
}

#undef rb_enc_code_to_mbclen
int
rb_enc_code_to_mbclen(int code, rb_encoding *enc)
{
    return ONIGENC_CODE_TO_MBCLEN(enc, code);
}

int
rb_enc_toupper(int c, rb_encoding *enc)
{
    return (ONIGENC_IS_ASCII_CODE(c)?ONIGENC_ASCII_CODE_TO_UPPER_CASE(c):(c));
}

int
rb_enc_tolower(int c, rb_encoding *enc)
{
    return (ONIGENC_IS_ASCII_CODE(c)?ONIGENC_ASCII_CODE_TO_LOWER_CASE(c):(c));
}

/*
 * call-seq:
 *   enc.inspect -> string
 *
 * Returns a string which represents the encoding for programmers.
 *
 *   Encoding::UTF_8.inspect       #=> "#<Encoding:UTF-8>"
 *   Encoding::ISO_2022_JP.inspect #=> "#<Encoding:ISO-2022-JP (dummy)>"
 */
static VALUE
enc_inspect(VALUE self)
{
    rb_encoding *enc;

    if (!is_data_encoding(self)) {
	not_encoding(self);
    }
    if (!(enc = DATA_PTR(self)) || rb_enc_from_index(rb_enc_to_index(enc)) != enc) {
	rb_raise(rb_eTypeError, "broken Encoding");
    }
    return rb_enc_sprintf(rb_usascii_encoding(),
			  "#<%"PRIsVALUE":%s%s%s>", rb_obj_class(self),
			  rb_enc_name(enc),
			  (ENC_DUMMY_P(enc) ? " (dummy)" : ""),
			  enc_autoload_p(enc) ? " (autoload)" : "");
}

/*
 * call-seq:
 *   enc.name -> string
 *   enc.to_s -> string
 *
 * Returns the name of the encoding.
 *
 *   Encoding::UTF_8.name      #=> "UTF-8"
 */
static VALUE
enc_name(VALUE self)
{
    return rb_fstring_cstr(rb_enc_name((rb_encoding*)DATA_PTR(self)));
}

static int
enc_names_i(st_data_t name, st_data_t idx, st_data_t args)
{
    VALUE *arg = (VALUE *)args;

    if ((int)idx == (int)arg[0]) {
	VALUE str = rb_fstring_cstr((char *)name);
	rb_ary_push(arg[1], str);
    }
    return ST_CONTINUE;
}

/*
 * call-seq:
 *   enc.names -> array
 *
 * Returns the list of name and aliases of the encoding.
 *
 *   Encoding::WINDOWS_31J.names  #=> ["Windows-31J", "CP932", "csWindows31J"]
 */
static VALUE
enc_names(VALUE self)
{
    VALUE args[2];

    args[0] = (VALUE)rb_to_encoding_index(self);
    args[1] = rb_ary_new2(0);
    st_foreach(enc_table.names, enc_names_i, (st_data_t)args);
    return args[1];
}

/*
 * call-seq:
 *   Encoding.list -> [enc1, enc2, ...]
 *
 * Returns the list of loaded encodings.
 *
 *   Encoding.list
 *   #=> [#<Encoding:ASCII-8BIT>, #<Encoding:UTF-8>,
 *         #<Encoding:ISO-2022-JP (dummy)>]
 *
 *   Encoding.find("US-ASCII")
 *   #=> #<Encoding:US-ASCII>
 *
 *   Encoding.list
 *   #=> [#<Encoding:ASCII-8BIT>, #<Encoding:UTF-8>,
 *         #<Encoding:US-ASCII>, #<Encoding:ISO-2022-JP (dummy)>]
 *
 */
static VALUE
enc_list(VALUE klass)
{
    VALUE ary = rb_ary_new2(0);
    rb_ary_replace(ary, rb_encoding_list);
    return ary;
}

/*
 * call-seq:
 *   Encoding.find(string) -> enc
 *
 * Search the encoding with specified <i>name</i>.
 * <i>name</i> should be a string.
 *
 *   Encoding.find("US-ASCII")  #=> #<Encoding:US-ASCII>
 *
 * Names which this method accept are encoding names and aliases
 * including following special aliases
 *
 * "external"::   default external encoding
 * "internal"::   default internal encoding
 * "locale"::     locale encoding
 * "filesystem":: filesystem encoding
 *
 * An ArgumentError is raised when no encoding with <i>name</i>.
 * Only <code>Encoding.find("internal")</code> however returns nil
 * when no encoding named "internal", in other words, when Ruby has no
 * default internal encoding.
 */
static VALUE
enc_find(VALUE klass, VALUE enc)
{
    int idx;
    if (is_obj_encoding(enc))
	return enc;
    idx = str_to_encindex(enc);
    if (idx == UNSPECIFIED_ENCODING) return Qnil;
    return rb_enc_from_encoding_index(idx);
}

/*
 * call-seq:
 *   Encoding.compatible?(obj1, obj2) -> enc or nil
 *
 * Checks the compatibility of two objects.
 *
 * If the objects are both strings they are compatible when they are
 * concatenatable.  The encoding of the concatenated string will be returned
 * if they are compatible, nil if they are not.
 *
 *   Encoding.compatible?("\xa1".force_encoding("iso-8859-1"), "b")
 *   #=> #<Encoding:ISO-8859-1>
 *
 *   Encoding.compatible?(
 *     "\xa1".force_encoding("iso-8859-1"),
 *     "\xa1\xa1".force_encoding("euc-jp"))
 *   #=> nil
 *
 * If the objects are non-strings their encodings are compatible when they
 * have an encoding and:
 * * Either encoding is US-ASCII compatible
 * * One of the encodings is a 7-bit encoding
 *
 */
static VALUE
enc_compatible_p(VALUE klass, VALUE str1, VALUE str2)
{
    rb_encoding *enc;

    if (!enc_capable(str1)) return Qnil;
    if (!enc_capable(str2)) return Qnil;
    enc = rb_enc_compatible(str1, str2);
    if (!enc) return Qnil;
    return rb_enc_from_encoding(enc);
}

/* :nodoc: */
static VALUE
enc_s_alloc(VALUE klass)
{
    rb_undefined_alloc(klass);
    return Qnil;
}

/* :nodoc: */
static VALUE
enc_dump(int argc, VALUE *argv, VALUE self)
{
    rb_check_arity(argc, 0, 1);
    return enc_name(self);
}

/* :nodoc: */
static VALUE
enc_load(VALUE klass, VALUE str)
{
    return str;
}

/* :nodoc: */
static VALUE
enc_m_loader(VALUE klass, VALUE str)
{
    return enc_find(klass, str);
}

rb_encoding *
rb_ascii8bit_encoding(void)
{
    if (!enc_table.list) {
	rb_enc_init();
    }
    return enc_table.list[ENCINDEX_ASCII].enc;
}

int
rb_ascii8bit_encindex(void)
{
    return ENCINDEX_ASCII;
}

rb_encoding *
rb_utf8_encoding(void)
{
    if (!enc_table.list) {
	rb_enc_init();
    }
    return enc_table.list[ENCINDEX_UTF_8].enc;
}

int
rb_utf8_encindex(void)
{
    return ENCINDEX_UTF_8;
}

rb_encoding *
rb_usascii_encoding(void)
{
    if (!enc_table.list) {
	rb_enc_init();
    }
    return enc_table.list[ENCINDEX_US_ASCII].enc;
}

int
rb_usascii_encindex(void)
{
    return ENCINDEX_US_ASCII;
}

int rb_locale_charmap_index(void);

int
rb_locale_encindex(void)
{
    int idx = rb_locale_charmap_index();

    if (idx < 0) idx = ENCINDEX_ASCII;

    if (rb_enc_registered("locale") < 0) {
# if defined _WIN32
	void Init_w32_codepage(void);
	Init_w32_codepage();
# endif
	enc_alias_internal("locale", idx);
    }

    return idx;
}

rb_encoding *
rb_locale_encoding(void)
{
    return rb_enc_from_index(rb_locale_encindex());
}

int
rb_filesystem_encindex(void)
{
    int idx = rb_enc_registered("filesystem");
    if (idx < 0)
	idx = ENCINDEX_ASCII;
    return idx;
}

rb_encoding *
rb_filesystem_encoding(void)
{
    return rb_enc_from_index(rb_filesystem_encindex());
}

struct default_encoding {
    int index;			/* -2 => not yet set, -1 => nil */
    rb_encoding *enc;
};

static struct default_encoding default_external = {0};

static int
enc_set_default_encoding(struct default_encoding *def, VALUE encoding, const char *name)
{
    int overridden = FALSE;

    if (def->index != -2)
	/* Already set */
	overridden = TRUE;

    if (NIL_P(encoding)) {
	def->index = -1;
	def->enc = 0;
	st_insert(enc_table.names, (st_data_t)strdup(name),
		  (st_data_t)UNSPECIFIED_ENCODING);
    }
    else {
	def->index = rb_enc_to_index(rb_to_encoding(encoding));
	def->enc = 0;
	enc_alias_internal(name, def->index);
    }

    if (def == &default_external)
	enc_alias_internal("filesystem", Init_enc_set_filesystem_encoding());

    return overridden;
}

rb_encoding *
rb_default_external_encoding(void)
{
    if (default_external.enc) return default_external.enc;

    if (default_external.index >= 0) {
        default_external.enc = rb_enc_from_index(default_external.index);
        return default_external.enc;
    }
    else {
        return rb_locale_encoding();
    }
}

VALUE
rb_enc_default_external(void)
{
    return rb_enc_from_encoding(rb_default_external_encoding());
}

/*
 * call-seq:
 *   Encoding.default_external -> enc
 *
 * Returns default external encoding.
 *
 * The default external encoding is used by default for strings created from
 * the following locations:
 *
 * * CSV
 * * File data read from disk
 * * SDBM
 * * StringIO
 * * Zlib::GzipReader
 * * Zlib::GzipWriter
 * * String#inspect
 * * Regexp#inspect
 *
 * While strings created from these locations will have this encoding, the
 * encoding may not be valid.  Be sure to check String#valid_encoding?.
 *
 * File data written to disk will be transcoded to the default external
 * encoding when written.
 *
 * The default external encoding is initialized by the locale or -E option.
 */
static VALUE
get_default_external(VALUE klass)
{
    return rb_enc_default_external();
}

void
rb_enc_set_default_external(VALUE encoding)
{
    if (NIL_P(encoding)) {
        rb_raise(rb_eArgError, "default external can not be nil");
    }
    enc_set_default_encoding(&default_external, encoding,
                            "external");
}

/*
 * call-seq:
 *   Encoding.default_external = enc
 *
 * Sets default external encoding.  You should not set
 * Encoding::default_external in ruby code as strings created before changing
 * the value may have a different encoding from strings created after the value
 * was changed., instead you should use <tt>ruby -E</tt> to invoke ruby with
 * the correct default_external.
 *
 * See Encoding::default_external for information on how the default external
 * encoding is used.
 */
static VALUE
set_default_external(VALUE klass, VALUE encoding)
{
    rb_warning("setting Encoding.default_external");
    rb_enc_set_default_external(encoding);
    return encoding;
}

static struct default_encoding default_internal = {-2};

rb_encoding *
rb_default_internal_encoding(void)
{
    if (!default_internal.enc && default_internal.index >= 0) {
        default_internal.enc = rb_enc_from_index(default_internal.index);
    }
    return default_internal.enc; /* can be NULL */
}

VALUE
rb_enc_default_internal(void)
{
    /* Note: These functions cope with default_internal not being set */
    return rb_enc_from_encoding(rb_default_internal_encoding());
}

/*
 * call-seq:
 *   Encoding.default_internal -> enc
 *
 * Returns default internal encoding.  Strings will be transcoded to the
 * default internal encoding in the following places if the default internal
 * encoding is not nil:
 *
 * * CSV
 * * Etc.sysconfdir and Etc.systmpdir
 * * File data read from disk
 * * File names from Dir
 * * Integer#chr
 * * String#inspect and Regexp#inspect
 * * Strings returned from Readline
 * * Strings returned from SDBM
 * * Time#zone
 * * Values from ENV
 * * Values in ARGV including $PROGRAM_NAME
 *
 * Additionally String#encode and String#encode! use the default internal
 * encoding if no encoding is given.
 *
 * The locale encoding (__ENCODING__), not default_internal, is used as the
 * encoding of created strings.
 *
 * Encoding::default_internal is initialized by the source file's
 * internal_encoding or -E option.
 */
static VALUE
get_default_internal(VALUE klass)
{
    return rb_enc_default_internal();
}

void
rb_enc_set_default_internal(VALUE encoding)
{
    enc_set_default_encoding(&default_internal, encoding,
                            "internal");
}

/*
 * call-seq:
 *   Encoding.default_internal = enc or nil
 *
 * Sets default internal encoding or removes default internal encoding when
 * passed nil.  You should not set Encoding::default_internal in ruby code as
 * strings created before changing the value may have a different encoding
 * from strings created after the change.  Instead you should use
 * <tt>ruby -E</tt> to invoke ruby with the correct default_internal.
 *
 * See Encoding::default_internal for information on how the default internal
 * encoding is used.
 */
static VALUE
set_default_internal(VALUE klass, VALUE encoding)
{
    rb_warning("setting Encoding.default_internal");
    rb_enc_set_default_internal(encoding);
    return encoding;
}

static void
set_encoding_const(const char *name, rb_encoding *enc)
{
    VALUE encoding = rb_enc_from_encoding(enc);
    char *s = (char *)name;
    int haslower = 0, hasupper = 0, valid = 0;

    if (ISDIGIT(*s)) return;
    if (ISUPPER(*s)) {
	hasupper = 1;
	while (*++s && (ISALNUM(*s) || *s == '_')) {
	    if (ISLOWER(*s)) haslower = 1;
	}
    }
    if (!*s) {
	if (s - name > ENCODING_NAMELEN_MAX) return;
	valid = 1;
	rb_define_const(rb_cEncoding, name, encoding);
    }
    if (!valid || haslower) {
	size_t len = s - name;
	if (len > ENCODING_NAMELEN_MAX) return;
	if (!haslower || !hasupper) {
	    do {
		if (ISLOWER(*s)) haslower = 1;
		if (ISUPPER(*s)) hasupper = 1;
	    } while (*++s && (!haslower || !hasupper));
	    len = s - name;
	}
	len += strlen(s);
	if (len++ > ENCODING_NAMELEN_MAX) return;
	MEMCPY(s = ALLOCA_N(char, len), name, char, len);
	name = s;
	if (!valid) {
	    if (ISLOWER(*s)) *s = ONIGENC_ASCII_CODE_TO_UPPER_CASE((int)*s);
	    for (; *s; ++s) {
		if (!ISALNUM(*s)) *s = '_';
	    }
	    if (hasupper) {
		rb_define_const(rb_cEncoding, name, encoding);
	    }
	}
	if (haslower) {
	    for (s = (char *)name; *s; ++s) {
		if (ISLOWER(*s)) *s = ONIGENC_ASCII_CODE_TO_UPPER_CASE((int)*s);
	    }
	    rb_define_const(rb_cEncoding, name, encoding);
	}
    }
}

static int
rb_enc_name_list_i(st_data_t name, st_data_t idx, st_data_t arg)
{
    VALUE ary = (VALUE)arg;
    VALUE str = rb_fstring_cstr((char *)name);
    rb_ary_push(ary, str);
    return ST_CONTINUE;
}

/*
 * call-seq:
 *   Encoding.name_list -> ["enc1", "enc2", ...]
 *
 * Returns the list of available encoding names.
 *
 *   Encoding.name_list
 *   #=> ["US-ASCII", "ASCII-8BIT", "UTF-8",
 *         "ISO-8859-1", "Shift_JIS", "EUC-JP",
 *         "Windows-31J",
 *         "BINARY", "CP932", "eucJP"]
 *
 */

static VALUE
rb_enc_name_list(VALUE klass)
{
    VALUE ary = rb_ary_new2(enc_table.names->num_entries);
    st_foreach(enc_table.names, rb_enc_name_list_i, (st_data_t)ary);
    return ary;
}

static int
rb_enc_aliases_enc_i(st_data_t name, st_data_t orig, st_data_t arg)
{
    VALUE *p = (VALUE *)arg;
    VALUE aliases = p[0], ary = p[1];
    int idx = (int)orig;
    VALUE key, str = rb_ary_entry(ary, idx);

    if (NIL_P(str)) {
	rb_encoding *enc = rb_enc_from_index(idx);

	if (!enc) return ST_CONTINUE;
	if (STRCASECMP((char*)name, rb_enc_name(enc)) == 0) {
	    return ST_CONTINUE;
	}
	str = rb_fstring_cstr(rb_enc_name(enc));
	rb_ary_store(ary, idx, str);
    }
    key = rb_fstring_cstr((char *)name);
    rb_hash_aset(aliases, key, str);
    return ST_CONTINUE;
}

/*
 * call-seq:
 *   Encoding.aliases -> {"alias1" => "orig1", "alias2" => "orig2", ...}
 *
 * Returns the hash of available encoding alias and original encoding name.
 *
 *   Encoding.aliases
 *   #=> {"BINARY"=>"ASCII-8BIT", "ASCII"=>"US-ASCII", "ANSI_X3.4-1986"=>"US-ASCII",
 *         "SJIS"=>"Shift_JIS", "eucJP"=>"EUC-JP", "CP932"=>"Windows-31J"}
 *
 */

static VALUE
rb_enc_aliases(VALUE klass)
{
    VALUE aliases[2];
    aliases[0] = rb_hash_new();
    aliases[1] = rb_ary_new();
    st_foreach(enc_table.names, rb_enc_aliases_enc_i, (st_data_t)aliases);
    return aliases[0];
}

/*
 * An Encoding instance represents a character encoding usable in Ruby. It is
 * defined as a constant under the Encoding namespace. It has a name and
 * optionally, aliases:
 *
 *   Encoding::ISO_8859_1.name
 *   #=> "ISO-8859-1"
 *
 *   Encoding::ISO_8859_1.names
 *   #=> ["ISO-8859-1", "ISO8859-1"]
 *
 * Ruby methods dealing with encodings return or accept Encoding instances as
 * arguments (when a method accepts an Encoding instance as an argument, it
 * can be passed an Encoding name or alias instead).
 *
 *   "some string".encoding
 *   #=> #<Encoding:UTF-8>
 *
 *   string = "some string".encode(Encoding::ISO_8859_1)
 *   #=> "some string"
 *   string.encoding
 *   #=> #<Encoding:ISO-8859-1>
 *
 *   "some string".encode "ISO-8859-1"
 *   #=> "some string"
 *
 * <code>Encoding::ASCII_8BIT</code> is a special encoding that is usually
 * used for a byte string, not a character string. But as the name insists,
 * its characters in the range of ASCII are considered as ASCII characters.
 * This is useful when you use ASCII-8BIT characters with other ASCII
 * compatible characters.
 *
 * == Changing an encoding
 *
 * The associated Encoding of a String can be changed in two different ways.
 *
 * First, it is possible to set the Encoding of a string to a new Encoding
 * without changing the internal byte representation of the string, with
 * String#force_encoding. This is how you can tell Ruby the correct encoding
 * of a string.
 *
 *   string
 *   #=> "R\xC3\xA9sum\xC3\xA9"
 *   string.encoding
 *   #=> #<Encoding:ISO-8859-1>
 *   string.force_encoding(Encoding::UTF_8)
 *   #=> "R\u00E9sum\u00E9"
 *
 * Second, it is possible to transcode a string, i.e. translate its internal
 * byte representation to another encoding. Its associated encoding is also
 * set to the other encoding. See String#encode for the various forms of
 * transcoding, and the Encoding::Converter class for additional control over
 * the transcoding process.
 *
 *   string
 *   #=> "R\u00E9sum\u00E9"
 *   string.encoding
 *   #=> #<Encoding:UTF-8>
 *   string = string.encode!(Encoding::ISO_8859_1)
 *   #=> "R\xE9sum\xE9"
 *   string.encoding
 *   #=> #<Encoding::ISO-8859-1>
 *
 * == Script encoding
 *
 * All Ruby script code has an associated Encoding which any String literal
 * created in the source code will be associated to.
 *
 * The default script encoding is <code>Encoding::UTF-8</code> after v2.0, but it can
 * be changed by a magic comment on the first line of the source code file (or
 * second line, if there is a shebang line on the first). The comment must
 * contain the word <code>coding</code> or <code>encoding</code>, followed
 * by a colon, space and the Encoding name or alias:
 *
 *   # encoding: UTF-8
 *
 *   "some string".encoding
 *   #=> #<Encoding:UTF-8>
 *
 * The <code>__ENCODING__</code> keyword returns the script encoding of the file
 * which the keyword is written:
 *
 *   # encoding: ISO-8859-1
 *
 *   __ENCODING__
 *   #=> #<Encoding:ISO-8859-1>
 *
 * <code>ruby -K</code> will change the default locale encoding, but this is
 * not recommended. Ruby source files should declare its script encoding by a
 * magic comment even when they only depend on US-ASCII strings or regular
 * expressions.
 *
 * == Locale encoding
 *
 * The default encoding of the environment. Usually derived from locale.
 *
 * see Encoding.locale_charmap, Encoding.find('locale')
 *
 * == Filesystem encoding
 *
 * The default encoding of strings from the filesystem of the environment.
 * This is used for strings of file names or paths.
 *
 * see Encoding.find('filesystem')
 *
 * == External encoding
 *
 * Each IO object has an external encoding which indicates the encoding that
 * Ruby will use to read its data. By default Ruby sets the external encoding
 * of an IO object to the default external encoding. The default external
 * encoding is set by locale encoding or the interpreter <code>-E</code> option.
 * Encoding.default_external returns the current value of the external
 * encoding.
 *
 *   ENV["LANG"]
 *   #=> "UTF-8"
 *   Encoding.default_external
 *   #=> #<Encoding:UTF-8>
 *
 *   $ ruby -E ISO-8859-1 -e "p Encoding.default_external"
 *   #<Encoding:ISO-8859-1>
 *
 *   $ LANG=C ruby -e 'p Encoding.default_external'
 *   #<Encoding:US-ASCII>
 *
 * The default external encoding may also be set through
 * Encoding.default_external=, but you should not do this as strings created
 * before and after the change will have inconsistent encodings.  Instead use
 * <code>ruby -E</code> to invoke ruby with the correct external encoding.
 *
 * When you know that the actual encoding of the data of an IO object is not
 * the default external encoding, you can reset its external encoding with
 * IO#set_encoding or set it at IO object creation (see IO.new options).
 *
 * == Internal encoding
 *
 * To process the data of an IO object which has an encoding different
 * from its external encoding, you can set its internal encoding. Ruby will use
 * this internal encoding to transcode the data when it is read from the IO
 * object.
 *
 * Conversely, when data is written to the IO object it is transcoded from the
 * internal encoding to the external encoding of the IO object.
 *
 * The internal encoding of an IO object can be set with
 * IO#set_encoding or at IO object creation (see IO.new options).
 *
 * The internal encoding is optional and when not set, the Ruby default
 * internal encoding is used. If not explicitly set this default internal
 * encoding is +nil+ meaning that by default, no transcoding occurs.
 *
 * The default internal encoding can be set with the interpreter option
 * <code>-E</code>. Encoding.default_internal returns the current internal
 * encoding.
 *
 *    $ ruby -e 'p Encoding.default_internal'
 *    nil
 *
 *    $ ruby -E ISO-8859-1:UTF-8 -e "p [Encoding.default_external, \
 *      Encoding.default_internal]"
 *    [#<Encoding:ISO-8859-1>, #<Encoding:UTF-8>]
 *
 * The default internal encoding may also be set through
 * Encoding.default_internal=, but you should not do this as strings created
 * before and after the change will have inconsistent encodings.  Instead use
 * <code>ruby -E</code> to invoke ruby with the correct internal encoding.
 *
 * == IO encoding example
 *
 * In the following example a UTF-8 encoded string "R\u00E9sum\u00E9" is transcoded for
 * output to ISO-8859-1 encoding, then read back in and transcoded to UTF-8:
 *
 *   string = "R\u00E9sum\u00E9"
 *
 *   open("transcoded.txt", "w:ISO-8859-1") do |io|
 *     io.write(string)
 *   end
 *
 *   puts "raw text:"
 *   p File.binread("transcoded.txt")
 *   puts
 *
 *   open("transcoded.txt", "r:ISO-8859-1:UTF-8") do |io|
 *     puts "transcoded text:"
 *     p io.read
 *   end
 *
 * While writing the file, the internal encoding is not specified as it is
 * only necessary for reading.  While reading the file both the internal and
 * external encoding must be specified to obtain the correct result.
 *
 *   $ ruby t.rb
 *   raw text:
 *   "R\xE9sum\xE9"
 *
 *   transcoded text:
 *   "R\u00E9sum\u00E9"
 *
 */

void
Init_Encoding(void)
{
#undef rb_intern
#define rb_intern(str) rb_intern_const(str)
    VALUE list;
    int i;

    rb_cEncoding = rb_define_class("Encoding", rb_cObject);
    rb_define_alloc_func(rb_cEncoding, enc_s_alloc);
    rb_undef_method(CLASS_OF(rb_cEncoding), "new");
    rb_define_method(rb_cEncoding, "to_s", enc_name, 0);
    rb_define_method(rb_cEncoding, "inspect", enc_inspect, 0);
    rb_define_method(rb_cEncoding, "name", enc_name, 0);
    rb_define_method(rb_cEncoding, "names", enc_names, 0);
    rb_define_method(rb_cEncoding, "dummy?", enc_dummy_p, 0);
    rb_define_method(rb_cEncoding, "ascii_compatible?", enc_ascii_compatible_p, 0);
    rb_define_method(rb_cEncoding, "replicate", enc_replicate, 1);
    rb_define_singleton_method(rb_cEncoding, "list", enc_list, 0);
    rb_define_singleton_method(rb_cEncoding, "name_list", rb_enc_name_list, 0);
    rb_define_singleton_method(rb_cEncoding, "aliases", rb_enc_aliases, 0);
    rb_define_singleton_method(rb_cEncoding, "find", enc_find, 1);
    rb_define_singleton_method(rb_cEncoding, "compatible?", enc_compatible_p, 2);

    rb_define_method(rb_cEncoding, "_dump", enc_dump, -1);
    rb_define_singleton_method(rb_cEncoding, "_load", enc_load, 1);

    rb_define_singleton_method(rb_cEncoding, "default_external", get_default_external, 0);
    rb_define_singleton_method(rb_cEncoding, "default_external=", set_default_external, 1);
    rb_define_singleton_method(rb_cEncoding, "default_internal", get_default_internal, 0);
    rb_define_singleton_method(rb_cEncoding, "default_internal=", set_default_internal, 1);
    rb_define_singleton_method(rb_cEncoding, "locale_charmap", rb_locale_charmap, 0); /* in localeinit.c */

    list = rb_ary_new2(enc_table.count);
    RBASIC_CLEAR_CLASS(list);
    rb_encoding_list = list;
    rb_gc_register_mark_object(list);

    for (i = 0; i < enc_table.count; ++i) {
	rb_ary_push(list, enc_new(enc_table.list[i].enc));
    }

    rb_marshal_define_compat(rb_cEncoding, Qnil, NULL, enc_m_loader);
}

/* locale insensitive ctype functions */

void
rb_enc_foreach_name(int (*func)(st_data_t name, st_data_t idx, st_data_t arg), st_data_t arg)
{
    st_foreach(enc_table.names, func, arg);
}