12991 files changed, 1002253 insertions, 1823564 deletions

diff --git a/.dir-locals.el b/.dir-locals.el
deleted file mode 100644
index 8f4b96445c..0000000000
--- a/.dir-locals.el
+++ /dev/null
@@ -1,39 +0,0 @@
-;; Copyright (c) 2018 Urabe, Shyouhei.  All rights reserved.
-;;
-;; This file is a part of  the programming language Ruby.  Permission is hereby
-;; granted, to either  redistribute and/or modify this file,  provided that the
-;; conditions mentioned  in the  file COPYING  are met.   Consult the  file for
-;; details.
-
-((nil .
-     ((indent-tabs-mode . nil)
-      (require-final-newline . t)
-      (tab-width . 8)
-      (show-trailing-whitespace . t)
-      (whitespace-line-column . 80))) ;; See also [Misc #12277]
-
- ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
-
- (ruby-mode . ((ruby-indent-level . 2)))
-
- (rdoc-mode . ((fill-column . 74)))
-
- (yaml-mode . ((yaml-indent-offset . 2)))
-
- (makefile-mode . ((indent-tabs-mode . t)))
-
- (c-mode . ((c-file-style . "ruby")))
-
- (c++-mode . ((c-file-style . "ruby")))
-
- (change-log-mode .
-     ((buffer-file-coding-system . us-ascii)
-      (indent-tabs-mode . t)
-      (change-log-indent-text . 2)
-      (add-log-time-format . (lambda (&optional x y)
-        (let* ((time (or x (current-time)))
-	       (system-time-locale "C")
-	       (diff (+ (cadr time) 32400))
-	       (lo (% diff 65536))
-	       (hi (+ (car time) (/ diff 65536))))
-        (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index 7d4dc02d4a..fb27ba325d 100644
--- a/.document
+++ b/.document
@@ -5,34 +5,9 @@
 
 # Process all the C source files
 *.c
-*.y
 
 # prelude
 prelude.rb
-rbconfig.rb
-
-array.rb
-ast.rb
-dir.rb
-gc.rb
-hash.rb
-io.rb
-kernel.rb
-marshal.rb
-numeric.rb
-nilclass.rb
-pack.rb
-ractor.rb
-string.rb
-symbol.rb
-timev.rb
-thread_sync.rb
-trace_point.rb
-warning.rb
-yjit.rb
-
-# Errno::*
-known_errors.inc
 
 # the lib/ directory (which has its own .document file)
 lib
@@ -41,14 +16,11 @@ lib
 ext
 
 # rdoc files
-NEWS.md
+ChangeLog
+
+NEWS
 
 README.md
 README.ja.md
 
-COPYING
-COPYING.ja
-
-LEGAL
-
 doc
diff --git a/.editorconfig b/.editorconfig
index 4633a7acae..67abf4b978 100644
--- a/.editorconfig
+++ b/.editorconfig
@@ -2,29 +2,15 @@ root = true
 
 [*]
 end_of_line = lf
-indent_size = 4
-indent_style = space
 insert_final_newline = true
-tab_width = 8
 trim_trailing_whitespace = true
-
-[*.bat]
-end_of_line = crlf
-
-[*.gemspec]
-indent_size = 2
-
-[*.rb]
-indent_size = 2
-
-[*.yml]
-indent_size = 2
-
-[{*[Mm]akefile*,*.mak,*.mk,depend}]
+tab_width = 8
 indent_style = tab
+indent_size = 4
 
-[enc/*]
-indent_size = 2
+[**.bat]
+end_of_line = crlf
 
-[reg*.[ch]]
+[**.rb]
+indent_style = space
 indent_size = 2
diff --git a/.gdbinit b/.gdbinit
index a19a9bfc87..03c2b653cb 100644
--- a/.gdbinit
+++ b/.gdbinit
@@ -1,7 +1,21 @@
+define hook-run
+  set $color_type = 0
+  set $color_highlite = 0
+  set $color_end = 0
+end
+
 define ruby_gdb_init
-  init-if-undefined $color_type = "\033[31m"
-  init-if-undefined $color_highlite = "\033[36m"
-  init-if-undefined $color_end = "\033[m"
+  if !$color_type
+    set $color_type = "\033[31m"
+  end
+  if !$color_highlite
+    set $color_highlite = "\033[36m"
+  end
+  if !$color_end
+    set $color_end = "\033[m"
+  end
+  if ruby_dummy_gdb_enums.special_consts
+  end
 end
 
 # set prompt \033[36m(gdb)\033[m\040
@@ -49,15 +63,7 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
     printf "%sT_OBJECT%s: ", $color_type, $color_end
-    print ((struct RObject *)($arg0))->basic
-    if ($flags & ROBJECT_EMBED)
-      print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (rb_shape_get_shape($arg0)->capacity)
-    else
-      print (((struct RObject *)($arg0))->as.heap)
-      if (((struct RObject*)($arg0))->as.heap.numiv) > 0
-        print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
-      end
-    end
+    print (struct RObject *)($arg0)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
     printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
@@ -83,13 +89,14 @@ define rp
     set $regsrc = ((struct RRegexp*)($arg0))->src
     set $rsflags = ((struct RBasic*)$regsrc)->flags
     printf "%sT_REGEXP%s: ", $color_type, $color_end
-    set $len = ((struct RString*)($arg0))->len
     set print address off
-    output *(char *)(($rsflags & RUBY_FL_USER1) ? \
-            ((struct RString*)$regsrc)->as.heap.ptr : \
-            ((struct RString*)$regsrc)->as.embed.ary) @ $len
+    output (char *)(($rsflags & RUBY_FL_USER1) ? \
+	    ((struct RString*)$regsrc)->as.heap.ptr : \
+	    ((struct RString*)$regsrc)->as.ary)
     set print address on
-    printf " len:%ld ", $len
+    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.len : \
+            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
     if $flags & RUBY_FL_USER6
       printf "(none) "
     end
@@ -108,26 +115,26 @@ define rp
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       printf "(embed) "
       if ($len == 0)
-        printf "{(empty)} "
+	printf "{(empty)} "
       else
-        print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
-        printf " "
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+	printf " "
       end
     else
       set $len = ((struct RArray*)($arg0))->as.heap.len
       printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
       if ($flags & RUBY_FL_USER2)
-        printf "(shared) shared="
-        output/x ((struct RArray*)($arg0))->as.heap.aux.shared_root
-        printf " "
+	printf "(shared) shared="
+	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+	printf " "
       else
-        printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
       end
       if ($len == 0)
-        printf "{(empty)} "
+	printf "{(empty)} "
       else
-        print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
-        printf " "
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+	printf " "
       end
     end
     print (struct RArray *)($arg0)
@@ -138,29 +145,34 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_HASH
     printf "%sT_HASH%s: ", $color_type, $color_end,
-    if (((struct RHash *)($arg0))->basic.flags & RHASH_ST_TABLE_FLAG)
-      set $st = (struct st_table *)((uintptr_t)($arg0) + sizeof(struct RHash))
-      printf "st len=%ld ", $st->num_entries
-      print $st
-    else
-      printf "li len=%ld bound=%ld ", \
-        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
-        ((((struct RHash *)($arg0))->basic.flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
-	print (struct ar_table_struct *)((uintptr_t)($arg0) + sizeof(struct RHash))
+    if ((struct RHash *)($arg0))->ntbl
+      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
     end
+    print (struct RHash *)($arg0)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
-    set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
+      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
        ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
        ((struct RStruct *)($arg0))->as.heap.len)
-    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
     print (struct RStruct *)($arg0)
-    output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
-              ((struct RStruct *)($arg0))->as.ary : \
-              ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
+    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+          ((struct RStruct *)($arg0))->as.ary : \
+          ((struct RStruct *)($arg0))->as.heap.ptr)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
-    rp_bignum $arg0
+    printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+      (($flags & RUBY_FL_USER1) != 0), \
+      (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+    if $flags & RUBY_FL_USER2
+      printf "(embed) "
+    end
+    print (struct RBignum *)($arg0)
+    x/xw (($flags & RUBY_FL_USER2) ? \
+          ((struct RBignum*)($arg0))->as.ary : \
+          ((struct RBignum*)($arg0))->as.heap.digits)
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
     printf "%sT_RATIONAL%s: ", $color_type, $color_end
@@ -235,7 +247,7 @@ define rp
   else
   if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
     printf "%sT_IMEMO%s(", $color_type, $color_end
-    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
+    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
     printf "): "
     rp_imemo $arg0
   else
@@ -249,10 +261,6 @@ define rp
     printf "%sT_ZOMBIE%s: ", $color_type, $color_end
     print (struct RData *)($arg0)
   else
-  if ($flags & RUBY_T_MASK) == RUBY_T_MOVED
-    printf "%sT_MOVED%s: ", $color_type, $color_end
-    print *(struct RMoved *)$arg0
-  else
     printf "%sunknown%s: ", $color_type, $color_end
     print (struct RBasic *)($arg0)
   end
@@ -288,7 +296,6 @@ define rp
   end
   end
   end
-  end
 end
 document rp
   Print a Ruby's VALUE.
@@ -320,9 +327,6 @@ define rp_id
   if $id == idLTLT
     printf "(:<<)\n"
   else
-  if $id == idGTGT
-    printf "(:>>)\n"
-  else
   if $id == idLE
     printf "(:<=)\n"
   else
@@ -350,18 +354,6 @@ define rp_id
   if $id == idASET
     printf "(:[]=)\n"
   else
-  if $id == idCOLON2
-    printf "(:'::')\n"
-  else
-  if $id == idANDOP
-    printf "(:&&)\n"
-  else
-  if $id == idOROP
-    printf "(:||)\n"
-  else
-  if $id == idANDDOT
-    printf "(:&.)\n"
-  else
     if $id <= tLAST_OP_ID
       printf "O"
     else
@@ -393,13 +385,12 @@ define rp_id
       end
     end
     printf "(%ld): ", $id
-    print_id $id
-    echo \n
-  end
-  end
-  end
-  end
-  end
+    set $str = lookup_id_str($id)
+    if $str
+      rp_string $str
+    else
+      echo undef\n
+    end
   end
   end
   end
@@ -422,31 +413,16 @@ document rp_id
   Print an ID.
 end
 
-define output_string
-  set $flags = ((struct RBasic*)($arg0))->flags
-  set $len = ((struct RString*)($arg0))->len
-  if $len > 0
-    output *(char *)(($flags & RUBY_FL_USER1) ? \
-            ((struct RString*)($arg0))->as.heap.ptr : \
-            ((struct RString*)($arg0))->as.embed.ary) @ $len
-  else
-    output ""
-  end
-end
-
-define print_string
-  set $flags = ((struct RBasic*)($arg0))->flags
-  set $len = ((struct RString*)($arg0))->len
-  if $len > 0
-    printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
-            ((struct RString*)($arg0))->as.heap.ptr : \
-            ((struct RString*)($arg0))->as.embed.ary) @ $len
-  end
-end
-
 define rp_string
-  output_string $arg0
-  printf " bytesize:%ld ", $len
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set print address off
+  output (char *)(($flags & RUBY_FL_USER1) ? \
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary)
+  set print address on
+  printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+          ((struct RString*)($arg0))->as.heap.len : \
+          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
   if !($flags & RUBY_FL_USER1)
     printf "(embed) "
   else
@@ -477,67 +453,22 @@ document rp_string
   Print the content of a String.
 end
 
-define rp_bignum
-  set $flags = ((struct RBignum*)($arg0))->basic.flags
-  set $len = (($flags & RUBY_FL_USER2) ? \
-       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
-       ((struct RBignum*)($arg0))->as.heap.len)
-  printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
-         (($flags & RUBY_FL_USER1) != 0), $len
-  if $flags & RUBY_FL_USER2
-    printf "(embed) "
-  end
-  print (struct RBignum *)($arg0)
-  set $ptr = (($flags & RUBY_FL_USER2) ? \
-              ((struct RBignum*)($arg0))->as.ary : \
-              ((struct RBignum*)($arg0))->as.heap.digits)
-  set $len = $len-1
-  printf "0x%x", $ptr[$len]
-  while $len > 0
-    set $len = $len-1
-    set $val = $ptr[$len]
-    set $w = sizeof($ptr[0])
-    printf "_"
-    if $w > 8
-      printf "%.32x", $val
-    else
-    if $w > 4
-      printf "%.16x", $val
-    else
-    if $w > 2
-      printf "%.8x", $val
-    else
-    if $w > 1
-      printf "%.4x", $val
-    else
-      printf "%.2x", $val
-    end
-    end
-    end
-    end
-  end
-  printf "\n"
-end
-document rp_bignum
-  Print the content of a Bignum.
-end
-
 define rp_class
-  set $class_and_classext = (struct RClass_and_rb_classext_t *)($arg0)
   printf "(struct RClass *) %p", (void*)$arg0
-  if $class_and_classext->classext->origin_ != (VALUE)$arg0
-    printf " -> %p", $class_and_classext->classext->origin_
+  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
+    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
   end
   printf "\n"
   rb_classname $arg0
-  print/x *$class_and_classext
+  print *(struct RClass *)($arg0)
+  print *((struct RClass *)($arg0))->ptr
 end
 document rp_class
   Print the content of a Class/Module.
 end
 
 define rp_imemo
-  set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
+  set $flags = (((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask
   if $flags == imemo_cref
     printf "(rb_cref_t *) %p\n", (void*)$arg0
     print *(rb_cref_t *)$arg0
@@ -558,14 +489,6 @@ define rp_imemo
     printf "(struct MEMO *) %p\n", (void*)$arg0
     print *(struct MEMO *)$arg0
   else
-  if $flags == imemo_ment
-    printf "(rb_method_entry_t *) %p\n", (void*)$arg0
-    print *(rb_method_entry_t *)$arg0
-  else
-  if $flags == imemo_iseq
-    printf "(rb_iseq_t *) %p\n", (void*)$arg0
-    print *(rb_iseq_t *)$arg0
-  else
     printf "(struct RIMemo *) %p\n", (void*)$arg0
     print *(struct RIMemo *)$arg0
   end
@@ -573,8 +496,6 @@ define rp_imemo
   end
   end
   end
-  end
-  end
 end
 document rp_imemo
   Print the content of a memo
@@ -669,6 +590,11 @@ define nd_stts
 end
 
 
+define nd_entry
+  printf "%su3.entry%s: ", $color_highlite, $color_end
+  p ($arg0).u3.entry
+end
+
 define nd_vid
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -684,6 +610,12 @@ define nd_cval
   rp ($arg0).u3.value
 end
 
+
+define nd_cnt
+  printf "%su3.cnt%s: ", $color_highlite, $color_end
+  p ($arg0).u3.cnt
+end
+
 define nd_tbl
   printf "%su1.tbl%s: ", $color_highlite, $color_end
   p ($arg0).u1.tbl
@@ -722,6 +654,12 @@ define nd_lit
   rp ($arg0).u1.value
 end
 
+
+define nd_frml
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
 define nd_rest
   printf "%su2.argc%s: ", $color_highlite, $color_end
   p ($arg0).u2.argc
@@ -748,6 +686,12 @@ define nd_args
   rp ($arg0).u3.node
 end
 
+
+define nd_noex
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
 define nd_defn
   printf "%su3.node%s: ", $color_highlite, $color_end
   rp ($arg0).u3.node
@@ -765,6 +709,17 @@ define nd_new
 end
 
 
+define nd_cfnc
+  printf "%su1.cfunc%s: ", $color_highlite, $color_end
+  p ($arg0).u1.cfunc
+end
+
+define nd_argc
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
 define nd_cname
   printf "%su1.id%s: ", $color_highlite, $color_end
   p ($arg0).u1.id
@@ -826,7 +781,7 @@ end
 
 define nd_tree
   set $buf = (struct RString *)rb_str_buf_new(0)
-  call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
+  call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
   printf "%s\n", $buf->as.heap.ptr
 end
 
@@ -843,22 +798,22 @@ define rb_numtable_entry
     set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
     while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
       if $rb_numtable_p.k == $rb_numtable_id
-        set $rb_numtable_key = $rb_numtable_p.k
-        set $rb_numtable_rec = $rb_numtable_p.v
-        set $rb_numtable_p = 0
+	set $rb_numtable_key = $rb_numtable_p.k
+	set $rb_numtable_rec = $rb_numtable_p.v
+	set $rb_numtable_p = 0
       else
-        set $rb_numtable_p = $rb_numtable_p + 1
+	set $rb_numtable_p = $rb_numtable_p + 1
       end
     end
   else
     set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
     while $rb_numtable_p
       if $rb_numtable_p->key == $rb_numtable_id
-        set $rb_numtable_key = $rb_numtable_p->key
-        set $rb_numtable_rec = $rb_numtable_p->record
-        set $rb_numtable_p = 0
+	set $rb_numtable_key = $rb_numtable_p->key
+	set $rb_numtable_rec = $rb_numtable_p->record
+	set $rb_numtable_p = 0
       else
-        set $rb_numtable_p = $rb_numtable_p->next
+	set $rb_numtable_p = $rb_numtable_p->next
       end
     end
   end
@@ -896,10 +851,11 @@ document rb_method_entry
 end
 
 define rb_classname
-  set $rb_classname = ((struct RClass_and_rb_classext_t*)$arg0)->classext->classpath
-  if $rb_classname != RUBY_Qfalse
-    print_string $rb_classname
-    printf "\n"
+  # up to 128bit int
+  set $rb_classname_permanent = "0123456789ABCDEF"
+  set $rb_classname = classname($arg0, $rb_classname_permanent)
+  if $rb_classname != RUBY_Qnil
+    rp $rb_classname
   else
     echo anonymous class/module\n
   end
@@ -936,7 +892,7 @@ define iseq
       set $operand_size = ((INSN*)($arg0))->operand_size
       set $operands = ((INSN*)($arg0))->operands
       while $i < $operand_size
-        rp $operands[$i++]
+	rp $operands[$i++]
       end
     end
   end
@@ -946,7 +902,7 @@ define iseq
 end
 
 define rb_ps
-  rb_ps_vm ruby_current_vm_ptr
+  rb_ps_vm ruby_current_vm
 end
 document rb_ps
 Dump all threads and their callstacks
@@ -954,8 +910,8 @@ end
 
 define rb_ps_vm
   print $ps_vm = (rb_vm_t*)$arg0
-  set $ps_thread_ln      = $ps_vm->ractor.main_ractor.threads.set.n.next
-  set $ps_thread_ln_last = $ps_vm->ractor.main_ractor.threads.set.n.prev
+  set $ps_thread_ln = $ps_vm->living_threads.n.next
+  set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
   while 1
     set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
     set $ps_thread = (VALUE)($ps_thread_th->self)
@@ -970,293 +926,16 @@ document rb_ps_vm
 Dump all threads in a (rb_vm_t*) and their callstacks
 end
 
-define print_lineno
-  set $cfp = $arg0
-  set $iseq = $cfp->iseq
-  set $pos = $cfp->pc - $iseq->body->iseq_encoded
-  if $pos != 0
-    set $pos = $pos - 1
-  end
-
-  set $index = 0
-  set $size = $iseq->body->insns_info.size
-  set $table = $iseq->body->insns_info.body
-  set $positions = $iseq->body->insns_info.positions
-  #printf "size: %d\n", $size
-  if $size == 0
-  else
-  if $size == 1
-    printf "%d", $table[0].line_no
-  else
-    if $positions
-      # get_insn_info_linear_search
-      set $index = 1
-      while $index < $size
-        #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
-        if $positions[$index] > $pos
-          loop_break
-        end
-        set $index = $index + 1
-        if $positions[$index] == $pos
-          loop_break
-        end
-      end
-    else
-      # get_insn_info_succinct_bitvector
-      set $sd = $iseq->body->insns_info.succ_index_table
-      set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
-      if $pos < $immediate_table_size
-        set $i = $pos / 9
-        set $j = $pos % 9
-        set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
-      else
-        set $block_index = ($pos - $immediate_table_size) / 512
-        set $block = &$sd->succ_part[$block_index]
-        set $block_bit_index = ($pos - $immediate_table_size) % 512
-        set $small_block_index = $block_bit_index / 64
-        set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
-        set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
-        set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
-        set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
-        set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
-        set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
-        set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
-        set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
-        set $index = $block->rank + $small_block_popcount + $popcnt
-      end
-    end
-    printf "%d", $table[$index-1].line_no
-  end
-  end
-end
-
-define check_method_entry
-  set $imemo = (struct RBasic *)$arg0
-  if $imemo != RUBY_Qfalse
-    set $type = ($imemo->flags >> 12) & 0x07
-    if $type == imemo_ment
-      set $me = (rb_callable_method_entry_t *)$imemo
-    else
-    if $type == imemo_svar
-      set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
-      check_method_entry $imemo
-    end
-    end
-  end
-end
-
-define print_id
-  set $id = $arg0
-  # rb_id_to_serial
-  if $id > tLAST_OP_ID
-    set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
-  else
-    set $serial = (rb_id_serial_t)$id
-  end
-  if $serial && $serial <= ruby_global_symbols.last_id
-    set $idx = $serial / ID_ENTRY_UNIT
-    set $ids = (struct RArray *)ruby_global_symbols.ids
-    set $flags = $ids->basic.flags
-    if ($flags & RUBY_FL_USER1)
-      set $idsptr = $ids->as.ary
-      set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
-    else
-      set $idsptr = $ids->as.heap.ptr
-      set $idslen = $ids->as.heap.len
-    end
-    if $idx < $idslen
-      set $t = 0
-      set $ary = (struct RArray *)$idsptr[$idx]
-      if $ary != RUBY_Qnil
-        set $flags = $ary->basic.flags
-        if ($flags & RUBY_FL_USER1)
-          set $aryptr = $ary->as.ary
-          set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
-        else
-          set $aryptr = $ary->as.heap.ptr
-          set $arylen = $ary->as.heap.len
-        end
-        set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
-        if $result != RUBY_Qnil
-          print_string $result
-        else
-          echo undef
-        end
-      end
-    end
-  end
-end
-
-define print_pathobj
-  set $flags = ((struct RBasic*)($arg0))->flags
-  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
-    print_string $arg0
-  end
-  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
-    if $flags & RUBY_FL_USER1
-      set $str = ((struct RArray*)($arg0))->as.ary[0]
-    else
-      set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
-    end
-    print_string $str
-  end
-end
-
 define rb_ps_thread
   set $ps_thread = (struct RTypedData*)$arg0
   set $ps_thread_th = (rb_thread_t*)$ps_thread->data
   printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
-    $ps_thread, $ps_thread_th, $ps_thread_th->nt
-  set $cfp = $ps_thread_th->ec->cfp
-  set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
-  while $cfp < $cfpend
-    if $cfp->iseq
-      if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
-        printf "%d:ifunc ", $cfpend-$cfp
-        set print symbol-filename on
-        output/a $cfp->iseq.body
-        set print symbol-filename off
-        printf "\n"
-      else
-      if $cfp->pc
-        set $location = $cfp->iseq->body->location
-        printf "%d:", $cfpend-$cfp
-        print_pathobj $location.pathobj
-        printf ":"
-        print_lineno $cfp
-        printf ":in `"
-        print_string $location.label
-        printf "'\n"
-      else
-        printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
-      end
-      end
-    else
-      # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
-      set $ep = $cfp->ep
-      if ($ep[0] & 0xffff0001) == 0x55550001
-        #define VM_ENV_FLAG_LOCAL 0x02
-        #define VM_ENV_PREV_EP(ep)   GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
-        set $me = 0
-        set $env_specval = $ep[-1]
-        set $env_me_cref = $ep[-2]
-        while ($env_specval & 0x02) != 0
-          check_method_entry $env_me_cref
-          if $me != 0
-            loop_break
-          end
-          set $ep = $ep[0]
-          set $env_specval = $ep[-1]
-          set $env_me_cref = $ep[-2]
-        end
-        if $me == 0
-          check_method_entry $env_me_cref
-        end
-        printf "%d:", $cfpend-$cfp
-        set print symbol-filename on
-        output/a $me->def->body.cfunc.func
-        set print symbol-filename off
-        set $mid = $me->def->original_id
-        printf ":in `"
-        print_id $mid
-        printf "'\n"
-      else
-        printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
-      end
-    end
-    set $cfp = $cfp + 1
-  end
-end
-
-define rb_count_objects
-  set $objspace = ruby_current_vm_ptr->objspace
-  set $counts_00 = 0
-  set $counts_01 = 0
-  set $counts_02 = 0
-  set $counts_03 = 0
-  set $counts_04 = 0
-  set $counts_05 = 0
-  set $counts_06 = 0
-  set $counts_07 = 0
-  set $counts_08 = 0
-  set $counts_09 = 0
-  set $counts_0a = 0
-  set $counts_0b = 0
-  set $counts_0c = 0
-  set $counts_0d = 0
-  set $counts_0e = 0
-  set $counts_0f = 0
-  set $counts_10 = 0
-  set $counts_11 = 0
-  set $counts_12 = 0
-  set $counts_13 = 0
-  set $counts_14 = 0
-  set $counts_15 = 0
-  set $counts_16 = 0
-  set $counts_17 = 0
-  set $counts_18 = 0
-  set $counts_19 = 0
-  set $counts_1a = 0
-  set $counts_1b = 0
-  set $counts_1c = 0
-  set $counts_1d = 0
-  set $counts_1e = 0
-  set $counts_1f = 0
-  set $total = 0
-  set $i = 0
-  while $i < $objspace->heap_pages.allocated_pages
-    printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
-    set $page = $objspace->heap_pages.sorted[$i]
-    set $p = $page->start
-    set $pend = $p + $page->total_slots
-    while $p < $pend
-      set $flags = $p->as.basic.flags & 0x1f
-      eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
-      set $p = $p + 1
-    end
-    set $total = $total + $page->total_slots
-    set $i = $i + 1
-  end
-  printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
-  printf "T_OBJECT: %d\n", $counts_01
-  printf "T_CLASS: %d\n", $counts_02
-  printf "T_MODULE: %d\n", $counts_03
-  printf "T_FLOAT: %d\n", $counts_04
-  printf "T_STRING: %d\n", $counts_05
-  printf "T_REGEXP: %d\n", $counts_06
-  printf "T_ARRAY: %d\n", $counts_07
-  printf "T_HASH: %d\n", $counts_08
-  printf "T_STRUCT: %d\n", $counts_09
-  printf "T_BIGNUM: %d\n", $counts_0a
-  printf "T_FILE: %d\n", $counts_0b
-  printf "T_DATA: %d\n", $counts_0c
-  printf "T_MATCH: %d\n", $counts_0d
-  printf "T_COMPLEX: %d\n", $counts_0e
-  printf "T_RATIONAL: %d\n", $counts_0f
-  #printf "UNKNOWN_10: %d\n", $counts_10
-  printf "T_NIL: %d\n", $counts_11
-  printf "T_TRUE: %d\n", $counts_12
-  printf "T_FALSE: %d\n", $counts_13
-  printf "T_SYMBOL: %d\n", $counts_14
-  printf "T_FIXNUM: %d\n", $counts_15
-  printf "T_UNDEF: %d\n", $counts_16
-  #printf "UNKNOWN_17: %d\n", $counts_17
-  #printf "UNKNOWN_18: %d\n", $counts_18
-  #printf "UNKNOWN_19: %d\n", $counts_19
-  printf "T_IMEMO: %d\n", $counts_1a
-  printf "T_NODE: %d\n", $counts_1b
-  printf "T_ICLASS: %d\n", $counts_1c
-  printf "T_ZOMBIE: %d\n", $counts_1d
-  #printf "UNKNOWN_1E: %d\n", $counts_1e
-  printf "T_MASK: %d\n", $counts_1f
-end
-document rb_count_objects
-  Counts all objects grouped by type.
-end
-
-# Details: https://github.com/ruby/ruby/wiki/Machine-Instructions-Trace-with-GDB
+    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
 define trace_machine_instructions
-  set logging enabled
+  set logging on
   set height 0
   set width 0
   display/i $pc
@@ -1285,45 +964,3 @@ define rbi
   end
   end
 end
-
-define dump_node
-  set $str = rb_parser_dump_tree($arg0, 0)
-  set $flags = ((struct RBasic*)($str))->flags
-  printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
-                        ((struct RString*)$str)->as.heap.ptr : \
-                        ((struct RString*)$str)->as.embed.ary)
-end
-
-define print_flags
-  printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
-  printf "RUBY_FL_PROMOTED    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED ? "1" : "0"
-  printf "RUBY_FL_FINALIZE    : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
-  printf "RUBY_FL_SHAREABLE   : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_SHAREABLE ? "1" : "0"
-  printf "RUBY_FL_EXIVAR      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
-  printf "RUBY_FL_FREEZE      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
-
-  printf "RUBY_FL_USER0       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
-  printf "RUBY_FL_USER1       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
-  printf "RUBY_FL_USER2       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
-  printf "RUBY_FL_USER3       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
-  printf "RUBY_FL_USER4       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
-  printf "RUBY_FL_USER5       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
-  printf "RUBY_FL_USER6       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
-  printf "RUBY_FL_USER7       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
-  printf "RUBY_FL_USER8       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
-  printf "RUBY_FL_USER9       : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
-  printf "RUBY_FL_USER10      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
-  printf "RUBY_FL_USER11      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
-  printf "RUBY_FL_USER12      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
-  printf "RUBY_FL_USER13      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
-  printf "RUBY_FL_USER14      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
-  printf "RUBY_FL_USER15      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
-  printf "RUBY_FL_USER16      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
-  printf "RUBY_FL_USER17      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
-  printf "RUBY_FL_USER18      : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
-end
-
-source -s misc/gdb.py
-
-# Moved from beginning, since it fails on older gdbs
-set startup-with-shell off
diff --git a/.git-blame-ignore-revs b/.git-blame-ignore-revs
deleted file mode 100644
index de62eb432a..0000000000
--- a/.git-blame-ignore-revs
+++ /dev/null
@@ -1,36 +0,0 @@
-# This is a file used by GitHub to ignore the following commits on `git blame`.
-#
-# You can also do the same thing in your local repository with:
-# $ git config --local blame.ignoreRevsFile .git-blame-ignore-revs
-
-# Expand tabs
-5b21e94bebed90180d8ff63dad03b8b948361089
-c5e9af9c9d890578182a21e7b71b50334cd5579e
-e63a2115f64433b21cb5dd67c5bf8b30f87ef293
-712ac99e4d0384a941c80a9f48f62943ba7d97c0
-d1474affa8e105bece209cc9d594bb0a989859e1
-2da92388b948821269b18d6b178a680f17e41750
-
-# Enable Style/StringLiterals cop for RubyGems/Bundler
-d7ffd3fea402239b16833cc434404a7af82d44f3
-
-# [ruby/digest] Revert tab-expansion in external files
-48b09aae7ec5632209229dcc294dd0d75a93a17f
-8a65cf3b61c60e4cb886f59a73ff6db44364bfa9
-39dc9f9093901d40d2998653948d5da38b18ee2c
-
-# [ruby/io-nonblock] Revert tab expansion
-f28287d34c03f472ffe90ea262bdde9affd4b965
-0d842fecb4f75ab3b1d4097ebdb8e88f51558041
-4ba2c66761d6a293abdfba409241d31063cefd62
-
-# Make benchmark indentation consistent
-fc4acf8cae82e5196186d3278d831f2438479d91
-
-# Make prism_compile.c indentation consistent
-40b2c8e5e7e6e5f83cee9276dc9c1922a69292d6
-d2c5867357ed88eccc28c2b3bd4a46e206e7ff85
-
-# Miss-and-revived commits
-a0f7de814ae5c299d6ce99bed5fb308a05d50ba0
-d4e24021d39e1f80f0055b55d91f8d5f22e15084
diff --git a/.gitattributes b/.gitattributes
index d0c2d266b4..d9785fad00 100644
--- a/.gitattributes
+++ b/.gitattributes
@@ -1,8 +1,5 @@
 *.gemspec diff=ruby
 *.rb diff=ruby
-bin svn-properties=svn:ignore=ruby
 bin/* diff=ruby
 tool/update-deps diff=ruby
 tool/make-snapshot diff=ruby
-tool/format-release diff=ruby
-tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
deleted file mode 100644
index 56baa29942..0000000000
--- a/.github/SECURITY.md
+++ /dev/null
@@ -1,9 +0,0 @@
-# Security Policy
-
-## Supported Versions
-
-See <https://www.ruby-lang.org/en/downloads/branches/>.
-
-## Reporting a Vulnerability
-
-See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/actions/compilers/action.yml b/.github/actions/compilers/action.yml
deleted file mode 100644
index 30ccd25a12..0000000000
--- a/.github/actions/compilers/action.yml
+++ /dev/null
@@ -1,126 +0,0 @@
-name: Compiles ruby in a container
-description: >-
-  Makes ruby using a dedicated container
-
-inputs:
-  tag:
-    required: false
-    default: clang-18
-    description: >-
-      container image tag to use in this run.
-
-  with_gcc:
-    required: false
-    description: >-
-      override compiler path & flags.
-
-  CFLAGS:
-    required: false
-    description: >-
-      C compiler flags to override.
-
-  CXXFLAGS:
-    required: false
-    description: >-
-      C++ compiler flags to override.
-
-  optflags:
-    required: false
-    # -O1 is faster than -O3 in our tests... Majority of time are consumed trying
-    # to optimize binaries.  Also GitHub Actions run on relatively modern CPUs
-    # compared to, say, GCC 4 or Clang 3.  We don't specify `-march=native`
-    # because compilers tend not understand what the CPU is.
-    default: '-O1'
-    description: >-
-      Compiler flags for optimisations.
-
-  cppflags:
-    required: false
-    description: >-
-      Additional preprocessor flags.
-
-  append_configure:
-    required: false
-    default: >-
-      --without-valgrind
-      --without-jemalloc
-      --without-gmp
-    description: >-
-      flags to append to configure.
-
-  enable_shared:
-    required: false
-    default: true
-    description: >-
-      Whether to build libruby.so.
-
-  check:
-    required: false
-    default: ''
-    description: >-
-      Whether to run `make check`
-
-  mspecopt:
-    required: false
-    default: ''
-    description: >-
-      Additional options for mspec.
-
-  static_exts:
-    required: false
-    description: >-
-      whitespace separated list of extensions that need be linked statically.
-
-runs:
-  using: composite
-  steps:
-    - shell: bash
-      run: docker pull --quiet 'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
-
-    - name: Enable Launchable conditionally
-      id: enable-launchable
-      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
-      shell: bash
-      if: >-
-        ${{
-        github.repository == 'ruby/ruby' ||
-        (github.repository != 'ruby/ruby' && env.LAUNCHABLE_TOKEN)
-        }}
-
-    - name: compile
-      shell: bash
-      run: >-
-        docker run
-        --rm
-        --user=root
-        --volume '${{ github.workspace }}:/github/workspace:ro'
-        --workdir=/github/workspace
-        --entrypoint=/github/workspace/.github/actions/compilers/entrypoint.sh
-        --env CI
-        --env GITHUB_ACTION
-        --env INPUT_WITH_GCC='${{ inputs.with_gcc || inputs.tag }}'
-        --env INPUT_CFLAGS='${{ inputs.CFLAGS }}'
-        --env INPUT_CXXFLAGS='${{ inputs.CXXFLAGS }}'
-        --env INPUT_OPTFLAGS='${{ inputs.OPTFLAGS }}'
-        --env INPUT_CPPFLAGS='${{ inputs.cppflags }}'
-        --env INPUT_APPEND_CONFIGURE='${{ inputs.append_configure }}'
-        --env INPUT_CHECK='${{ inputs.check }}'
-        --env INPUT_MSPECOPT='${{ inputs.mspecopt }}'
-        --env INPUT_ENABLE_SHARED='${{ inputs.enable_shared }}'
-        --env INPUT_STATIC_EXTS='${{ inputs.static_exts }}'
-        --env LAUNCHABLE_ORGANIZATION='${{ github.repository_owner }}'
-        --env LAUNCHABLE_WORKSPACE='${{ github.event.repository.name }}'
-        --env LAUNCHABLE_ENABLED='${{ steps.enable-launchable.outputs.enable-launchable || false }}'
-        --env GITHUB_PR_HEAD_SHA='${{ github.event.pull_request.head.sha || github.sha }}'
-        --env GITHUB_PULL_REQUEST_URL='${{ github.event.pull_request.html_url }}'
-        --env GITHUB_REF='${{ github.ref }}'
-        --env GITHUB_ACTIONS
-        --env GITHUB_RUN_ID
-        --env GITHUB_REPOSITORY
-        --env GITHUB_WORKFLOW
-        --env GITHUB_RUN_NUMBER
-        --env GITHUB_EVENT_NAME
-        --env GITHUB_SHA
-        --env GITHUB_HEAD_REF
-        --env GITHUB_SERVER_URL
-        'ghcr.io/ruby/ruby-ci-image:${{ inputs.tag }}'
diff --git a/.github/actions/compilers/entrypoint.sh b/.github/actions/compilers/entrypoint.sh
deleted file mode 100755
index be10ed9c61..0000000000
--- a/.github/actions/compilers/entrypoint.sh
+++ /dev/null
@@ -1,169 +0,0 @@
-#! /bin/bash
-
-# Copyright (c) 2024 Ruby developers.  All rights reserved.
-#
-# This file is  a part of the programming language  Ruby.  Permission is hereby
-# granted, to  either redistribute and/or  modify this file, provided  that the
-# conditions  mentioned in  the file  COPYING are  met.  Consult  the file  for
-# details.
-
-grouped()
-{
-    echo "::group::${@}"
-    "${@}"
-    echo "::endgroup::"
-}
-
-set -e
-set -u
-set -o pipefail
-
-srcdir="/github/workspace/src"
-builddir="$(mktemp -dt)"
-
-export GITHUB_WORKFLOW='Compilations'
-export CONFIGURE_TTY='never'
-export RUBY_DEBUG='ci rgengc'
-export RUBY_TESTOPTS='-q --color=always --tty=no'
-export RUBY_DEBUG_COUNTER_DISABLE='1'
-export GNUMAKEFLAGS="-j$((1 + $(nproc --all)))"
-
-case "x${INPUT_ENABLE_SHARED}" in
-x | xno | xfalse )
-    enable_shared='--disable-shared'
-    ;;
-*)
-    enable_shared='--enable-shared'
-    ;;
-esac
-
-pushd ${builddir}
-
-grouped git config --global --add safe.directory ${srcdir}
-
-grouped ${srcdir}/configure        \
-    -C                             \
-    --with-gcc="${INPUT_WITH_GCC}" \
-    --enable-debug-env             \
-    --disable-install-doc          \
-    --with-ext=-test-/cxxanyargs,+ \
-    ${enable_shared}               \
-    ${INPUT_APPEND_CONFIGURE}      \
-    CFLAGS="${INPUT_CFLAGS}"       \
-    CXXFLAGS="${INPUT_CXXFLAGS}"   \
-    optflags="${INPUT_OPTFLAGS}"   \
-    cppflags="${INPUT_CPPFLAGS}"   \
-    debugflags='-ggdb3' # -g0 disables backtraces when SEGV.  Do not set that.
-
-popd
-
-if [[ -n "${INPUT_STATIC_EXTS}" ]]; then
-    echo "::group::ext/Setup"
-    set -x
-    mkdir ${builddir}/ext
-    (
-        for ext in ${INPUT_STATIC_EXTS}; do
-            echo "${ext}"
-        done
-    ) >> ${builddir}/ext/Setup
-    set +x
-    echo "::endgroup::"
-fi
-
-btests=''
-tests=''
-spec_opts=''
-
-# Launchable
-setup_launchable() {
-    pushd ${srcdir}
-    # To prevent a slowdown in CI, disable request retries when the Launchable server is unstable.
-    export LAUNCHABLE_SKIP_TIMEOUT_RETRY=1
-    # Launchable creates .launchable file in the current directory, but cannot a file to ${srcdir} directory.
-    # As a workaround, we set LAUNCHABLE_SESSION_DIR to ${builddir}.
-    export LAUNCHABLE_SESSION_DIR=${builddir}
-    local github_ref="${GITHUB_REF//\//_}"
-    local build_name="${github_ref}"_"${GITHUB_PR_HEAD_SHA}"
-    btest_report_path='launchable_bootstraptest.json'
-    test_report_path='launchable_test_all.json'
-    test_spec_report_path='launchable_test_spec_report'
-    test_all_session_file='launchable_test_all_session.txt'
-    btest_session_file='launchable_btest_session.txt'
-    test_spec_session_file='launchable_test_spec_session.txt'
-    btests+=--launchable-test-reports="${btest_report_path}"
-    echo "::group::Setup Launchable"
-    launchable record build --name "${build_name}" || true
-    launchable record session \
-        --build "${build_name}" \
-        --flavor test_task=test \
-        --flavor workflow=Compilations \
-        --flavor with-gcc="${INPUT_WITH_GCC}" \
-        --flavor CFLAGS="${INPUT_CFLAGS}" \
-        --flavor CXXFLAGS="${INPUT_CXXFLAGS}" \
-        --flavor optflags="${INPUT_OPTFLAGS}" \
-        --flavor cppflags="${INPUT_CPPFLAGS}" \
-        --test-suite btest \
-        > "${builddir}"/${btest_session_file} \
-        || true
-    if [ "$INPUT_CHECK" = "true" ]; then
-        tests+=--launchable-test-reports="${test_report_path}"
-        launchable record session \
-            --build "${build_name}" \
-            --flavor test_task=test-all \
-            --flavor workflow=Compilations \
-            --flavor with-gcc="${INPUT_WITH_GCC}" \
-            --flavor CFLAGS="${INPUT_CFLAGS}" \
-            --flavor CXXFLAGS="${INPUT_CXXFLAGS}" \
-            --flavor optflags="${INPUT_OPTFLAGS}" \
-            --flavor cppflags="${INPUT_CPPFLAGS}" \
-            --test-suite test-all \
-            > "${builddir}"/${test_all_session_file} \
-            || true
-        mkdir "${builddir}"/"${test_spec_report_path}"
-        spec_opts+=--launchable-test-reports="${test_spec_report_path}"
-        launchable record session \
-            --build "${build_name}" \
-            --flavor test_task=test-spec \
-            --flavor workflow=Compilations \
-            --flavor with-gcc="${INPUT_WITH_GCC}" \
-            --flavor CFLAGS="${INPUT_CFLAGS}" \
-            --flavor CXXFLAGS="${INPUT_CXXFLAGS}" \
-            --flavor optflags="${INPUT_OPTFLAGS}" \
-            --flavor cppflags="${INPUT_CPPFLAGS}" \
-            --test-suite test-spec \
-            > "${builddir}"/${test_spec_session_file} \
-            || true
-    fi
-    echo "::endgroup::"
-    trap launchable_record_test EXIT
-}
-launchable_record_test() {
-    pushd "${builddir}"
-    grouped launchable record tests --session "$(cat "${btest_session_file}")" raw "${btest_report_path}" || true
-    if [ "$INPUT_CHECK" = "true" ]; then
-        grouped launchable record tests --session "$(cat "${test_all_session_file}")" raw "${test_report_path}" || true
-        grouped launchable record tests --session "$(cat "${test_spec_session_file}")" raw "${test_spec_report_path}"/* || true
-    fi
-}
-if [ "$LAUNCHABLE_ENABLED" = "true" ]; then
-    setup_launchable
-fi
-
-pushd ${builddir}
-
-grouped make showflags
-grouped make all
-grouped make test BTESTS="${btests}"
-
-[[ -z "${INPUT_CHECK}" ]] && exit 0
-
-if [ "$INPUT_CHECK" = "true" ]; then
-  tests+=" -- ruby -ext-"
-else
-  tests+=" -- $INPUT_CHECK"
-fi
-
-# grouped make install
-grouped make test-tool
-grouped make test-all TESTS="$tests"
-grouped env CHECK_LEAKS=true make test-spec MSPECOPT="$INPUT_MSPECOPT" SPECOPTS="${spec_opts}"
diff --git a/.github/actions/launchable/setup/action.yml b/.github/actions/launchable/setup/action.yml
deleted file mode 100644
index 8ea8f61414..0000000000
--- a/.github/actions/launchable/setup/action.yml
+++ /dev/null
@@ -1,323 +0,0 @@
-name: Set up Launchable
-description: >-
-  Install the required dependencies and execute the necessary Launchable commands for test recording
-
-inputs:
-  os:
-    required: true
-    description: The operating system that CI runs on. This value is used in Launchable flavor.
-
-  test-opts:
-    default: none
-    required: false
-    description: >-
-      Test options that determine how tests are run.
-      This value is used in the Launchable flavor.
-
-  launchable-token:
-    required: false
-    description: >-
-      Launchable token is needed if you want to run Launchable on your forked repository.
-      See https://github.com/ruby/ruby/wiki/CI-Servers#launchable-ci for details.
-
-  builddir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Directory to create Launchable report file.
-
-  srcdir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Directory to (re-)checkout source codes. Launchable retrieves the commit information
-      from the directory.
-
-  test-task:
-    required: false
-    default: ${{ matrix.test_task }}
-    description: >-
-      Specifies a single test task to be executed.
-      This value is used in the Launchable flavor.
-      Either 'test-task' or 'multi-test-tasks' must be configured.
-
-  test-tasks:
-    required: false
-    default: '[]'
-    description: >-
-      Specifies an array of multiple test tasks to be executed.
-      For example: '["test", "test-all"]'.
-      If you want to run a single test task, use the 'test-task' input instead.
-
-  is-yjit:
-    required: false
-    default: 'false'
-    description: >-
-      Whether this workflow is executed on YJIT.
-
-runs:
-  using: composite
-
-  steps:
-    - name: Enable Launchable conditionally
-      id: enable-launchable
-      run: echo "enable-launchable=true" >> $GITHUB_OUTPUT
-      shell: bash
-      if: >-
-        ${{
-        (github.repository == 'ruby/ruby'
-          || (github.repository != 'ruby/ruby'
-          && env.LAUNCHABLE_TOKEN))
-        && (inputs.test-task == 'check'
-          || inputs.test-task == 'test-all'
-          || inputs.test-task == 'test'
-          || contains(fromJSON(inputs.test-tasks), 'test-all')
-          || contains(fromJSON(inputs.test-tasks), 'test'))
-        }}
-
-    # Launchable CLI requires Python and Java.
-    # https://www.launchableinc.com/docs/resources/cli-reference/
-    - name: Set up Python
-      uses: actions/setup-python@871daa956ca9ea99f3c3e30acb424b7960676734 # v5.0.0
-      with:
-        python-version: "3.x"
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set up Java
-      uses: actions/setup-java@7a445ee88d4e23b52c33fdc7601e40278616c7f8 # v4.0.0
-      with:
-        distribution: 'temurin'
-        java-version: '17'
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set global vars
-      id: global
-      shell: bash
-      run: |
-        test_all_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-all' || contains(fromJSON(inputs.test-tasks), 'test-all') }}"
-        btest_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test' || contains(fromJSON(inputs.test-tasks), 'test') }}"
-        test_spec_enabled="${{ inputs.test-task == 'check' ||  inputs.test-task == 'test-spec' || contains(fromJSON(inputs.test-tasks), 'test-spec') }}"
-        echo test_all_enabled="${test_all_enabled}" >> $GITHUB_OUTPUT
-        echo btest_enabled="${btest_enabled}" >> $GITHUB_OUTPUT
-        echo test_spec_enabled="${test_spec_enabled}" >> $GITHUB_OUTPUT
-        echo test_all_session_file='launchable_test_all_session.txt' >> $GITHUB_OUTPUT
-        echo btest_session_file='launchable_btest_session.txt' >> $GITHUB_OUTPUT
-        echo test_spec_session_file='launchable_test_spec_session.txt' >> $GITHUB_OUTPUT
-        echo test_all_report_file='launchable_test_all_report.json' >> $GITHUB_OUTPUT
-        echo btest_report_file='launchable_btest_report.json' >> $GITHUB_OUTPUT
-        echo test_spec_report_dir='launchable_test_spec_report' >> $GITHUB_OUTPUT
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set environment variables for Launchable
-      shell: bash
-      run: |
-        : # GITHUB_PULL_REQUEST_URL are used for commenting test reports in Launchable Github App.
-        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/link.py#L42
-        echo "GITHUB_PULL_REQUEST_URL=${{ github.event.pull_request.html_url }}" >> $GITHUB_ENV
-        : # The following envs are necessary in Launchable tokenless authentication.
-        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L20
-        echo "LAUNCHABLE_ORGANIZATION=${{ github.repository_owner }}" >> $GITHUB_ENV
-        echo "LAUNCHABLE_WORKSPACE=${{ github.event.repository.name }}" >> $GITHUB_ENV
-        : # https://github.com/launchableinc/cli/blob/v1.80.1/launchable/utils/authentication.py#L71
-        echo "GITHUB_PR_HEAD_SHA=${{ github.event.pull_request.head.sha || github.sha }}" >> $GITHUB_ENV
-        echo "LAUNCHABLE_TOKEN=${{ inputs.launchable-token }}" >> $GITHUB_ENV
-        : # To prevent a slowdown in CI, disable request retries when the Launchable server is unstable.
-        echo "LAUNCHABLE_SKIP_TIMEOUT_RETRY=1" >> $GITHUB_ENV
-      if: steps.enable-launchable.outputs.enable-launchable
-
-    - name: Set up path
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      # Since updated PATH variable will be available in only subsequent actions, we need to add the path beforehand.
-      # https://docs.github.com/en/actions/using-workflows/workflow-commands-for-github-actions#adding-a-system-path
-      run: echo "$(python -msite --user-base)/bin" >> $GITHUB_PATH
-      if: steps.enable-launchable.outputs.enable-launchable && startsWith(inputs.os, 'macos')
-
-    - name: Set up Launchable
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        set -x
-        pip install --user launchable
-        : # The build name cannot include a slash, so we replace the string here.
-        github_ref="${{ github.ref }}"
-        github_ref="${github_ref//\//_}"
-        : # With the --name option, we need to configure a unique identifier for this build.
-        : # To avoid setting the same build name as the CI which runs on other branches, we use the branch name here.
-        build_name="${github_ref}_${GITHUB_PR_HEAD_SHA}"
-        test_opts="${{ inputs.test-opts }}"
-        test_opts="${test_opts// /}"
-        test_opts="${test_opts//=/:}"
-        test_all_test_suite='test-all'
-        btest_test_suite='btest'
-        test_spec_test_suite='test-spec'
-        if [ "${{ inputs.is-yjit }}" = "true" ]; then
-          test_all_test_suite="yjit-${test_all_test_suite}"
-          btest_test_suite="yjit-${btest_test_suite}"
-          test_spec_test_suite="yjit-${test_spec_test_suite}"
-        fi
-        launchable record build --name "${build_name}"
-        if [ "${test_all_enabled}" = "true" ]; then
-          launchable record session \
-            --build "${build_name}" \
-            --observation \
-            --flavor os="${{ inputs.os }}" \
-            --flavor test_task="${{ inputs.test-task }}" \
-            --flavor test_opts="${test_opts}" \
-            --flavor workflow="${{ github.workflow }}" \
-            --test-suite ${test_all_test_suite} \
-            > "${test_all_session_file}"
-          launchable subset \
-            --get-tests-from-previous-sessions \
-            --non-blocking \
-            --target 90% \
-            --session "$(cat "${test_all_session_file}")" \
-            raw > /dev/null
-          echo "TESTS=${TESTS} --launchable-test-reports=${test_all_report_file}" >> $GITHUB_ENV
-        fi
-        if [ "${btest_enabled}" = "true" ]; then
-          launchable record session \
-            --build "${build_name}" \
-            --observation \
-            --flavor os="${{ inputs.os }}" \
-            --flavor test_task="${{ inputs.test-task }}" \
-            --flavor test_opts="${test_opts}" \
-            --flavor workflow="${{ github.workflow }}" \
-            --test-suite ${btest_test_suite} \
-            > "${btest_session_file}"
-          launchable subset \
-            --get-tests-from-previous-sessions \
-            --non-blocking \
-            --target 90% \
-            --session "$(cat "${btest_session_file}")" \
-            raw > /dev/null
-          echo "BTESTS=${BTESTS} --launchable-test-reports=${btest_report_file}" >> $GITHUB_ENV
-        fi
-        if [ "${test_spec_enabled}" = "true" ]; then
-          launchable record session \
-            --build "${build_name}" \
-            --observation \
-            --flavor os="${{ inputs.os }}" \
-            --flavor test_task="${{ inputs.test-task }}" \
-            --flavor test_opts="${test_opts}" \
-            --flavor workflow="${{ github.workflow }}" \
-            --test-suite ${test_spec_test_suite} \
-            > "${test_spec_session_file}"
-          launchable subset \
-            --get-tests-from-previous-sessions \
-            --non-blocking \
-            --target 90% \
-            --session "$(cat "${test_spec_session_file}")" \
-            raw > /dev/null
-          echo "SPECOPTS=${SPECOPTS} --launchable-test-reports=${test_spec_report_dir}" >> $GITHUB_ENV
-        fi
-      if: steps.enable-launchable.outputs.enable-launchable
-      env:
-        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
-        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
-        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
-        test_all_session_file: ${{ steps.global.outputs.test_all_session_file }}
-        btest_session_file: ${{ steps.global.outputs.btest_session_file }}
-        test_spec_session_file: ${{ steps.global.outputs.test_spec_session_file }}
-        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
-        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
-        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
-
-    - name: Variables to report Launchable
-      id: variables
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        set -x
-        : # report-path from srcdir
-        if [ "${srcdir}" = "${{ github.workspace }}" ]; then
-          dir=
-        else
-          # srcdir must be equal to or under workspace
-          dir=$(echo ${srcdir:+${srcdir}/} | sed 's:[^/][^/]*/:../:g')
-        fi
-        if [ "${test_all_enabled}" = "true" ]; then
-          test_report_path="${dir}${builddir:+${builddir}/}${test_all_report_file}"
-          echo test_report_path="${test_report_path}" >> $GITHUB_OUTPUT
-        fi
-        if [ "${btest_enabled}" = "true" ]; then
-          btest_report_path="${dir}${builddir:+${builddir}/}${btest_report_file}"
-          echo btest_report_path="${btest_report_path}" >> $GITHUB_OUTPUT
-        fi
-        if [ "${test_spec_enabled}" = "true" ]; then
-          test_spec_report_path="${dir}${builddir:+${builddir}/}${test_spec_report_dir}"
-          mkdir "${test_spec_report_path}"
-          echo test_spec_report_path="${test_spec_report_path}" >> $GITHUB_OUTPUT
-        fi
-        stdout_report_path="${dir}${builddir:+${builddir}/}launchable_stdout.log"
-        stderr_report_path="${dir}${builddir:+${builddir}/}launchable_stderr.log"
-        echo stdout_report_path="${stdout_report_path}" >> $GITHUB_OUTPUT
-        echo stderr_report_path="${stderr_report_path}" >> $GITHUB_OUTPUT
-      if: steps.enable-launchable.outputs.enable-launchable
-      env:
-        srcdir: ${{ inputs.srcdir }}
-        builddir: ${{ inputs.builddir }}
-        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
-        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
-        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
-        test_all_report_file: ${{ steps.global.outputs.test_all_report_file }}
-        btest_report_file: ${{ steps.global.outputs.btest_report_file }}
-        test_spec_report_dir: ${{ steps.global.outputs.test_spec_report_dir }}
-
-    - name: Record test results in Launchable
-      uses: gacts/run-and-post-run@674528335da98a7afc80915ff2b4b860a0b3553a # v1.4.0
-      with:
-        shell: bash
-        working-directory: ${{ inputs.srcdir }}
-        post: |
-          if [[ "${test_all_enabled}" = "true" ]]; then \
-            launchable record attachment \
-              --session "$(cat "${test_all_session_file}")" \
-              "${stdout_report_path}" \
-              "${stderr_report_path}"; \
-            launchable record tests \
-              --session "$(cat "${test_all_session_file}")" \
-              raw "${test_report_path}" || true; \
-          fi
-
-          if [[ "${btest_enabled}" = "true" ]]; then \
-            launchable record attachment \
-              --session "$(cat "${btest_session_file}")" \
-              "${stdout_report_path}" \
-              "${stderr_report_path}"; \
-            launchable record tests \
-              --session "$(cat "${btest_session_file}")" \
-              raw "${btest_report_path}" || true; \
-          fi
-
-          if [[ "${test_spec_enabled}" = "true" ]]; then \
-            launchable record attachment \
-              --session "$(cat "${test_spec_session_file}")" \
-              "${stdout_report_path}" \
-              "${stderr_report_path}"; \
-            launchable record tests \
-              --session "$(cat "${test_spec_session_file}")" \
-              raw ${test_spec_report_path}/* || true; \
-          fi
-
-          rm -f "${test_all_session_file}"
-          rm -f "${btest_session_file}"
-          rm -f "${test_spec_session_file}"
-          rm -f "${test_report_path}"
-          rm -f "${btest_report_path}"
-          rm -fr "${test_spec_report_path}"
-          rm -f "${stdout_report_path}"
-          rm -f "${stderr_report_path}"
-      if: ${{ always() && steps.enable-launchable.outputs.enable-launchable }}
-      env:
-        test_report_path: ${{ steps.variables.outputs.test_report_path }}
-        btest_report_path: ${{ steps.variables.outputs.btest_report_path }}
-        test_spec_report_path: ${{ steps.variables.outputs.test_spec_report_path }}
-        test_all_enabled: ${{ steps.global.outputs.test_all_enabled }}
-        btest_enabled: ${{ steps.global.outputs.btest_enabled }}
-        test_spec_enabled: ${{ steps.global.outputs.test_spec_enabled }}
-        test_all_session_file: ${{ steps.global.outputs.test_all_session_file }}
-        btest_session_file: ${{ steps.global.outputs.btest_session_file }}
-        test_spec_session_file: ${{ steps.global.outputs.test_spec_session_file }}
-        stdout_report_path: ${{ steps.variables.outputs.stdout_report_path }}
-        stderr_report_path: ${{ steps.variables.outputs.stderr_report_path }}
diff --git a/.github/actions/setup/directories/action.yml b/.github/actions/setup/directories/action.yml
deleted file mode 100644
index 48e2c64a96..0000000000
--- a/.github/actions/setup/directories/action.yml
+++ /dev/null
@@ -1,185 +0,0 @@
-name: Setup directories etc.
-description: >-
-  Set up the source code and build directories (plus some
-  environmental tweaks)
-
-inputs:
-  srcdir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Directory to (re-)checkout source codes.  This will be created
-      if absent.  If there is no `configure` file that is also
-      generated inside.
-
-  builddir:
-    required: false
-    default: ${{ github.workspace }}
-    description: >-
-      Where binaries and other generated contents go.  This will be
-      created if absent.
-
-  makeup:
-    required: false
-    type: boolean
-    # Note that `default: false` evaluates to a string constant
-    # `'false'`, which is a truthy value :sigh:
-    # https://github.com/actions/runner/issues/2238
-    default: ''
-    description: >-
-      If set to true, additionally runs `make up`.
-
-  checkout:
-    required: false
-    type: boolean
-    default: true
-    description: >-
-      If set to '' (false), skip running actions/checkout. This is useful when
-      you don't want to overwrite a GitHub token that is already set up.
-
-  dummy-files:
-    required: false
-    type: boolean
-    default: ''
-    description: >-
-      If set to true, creates dummy files in build dir.
-
-  fetch-depth:
-    required: false
-    default: '1'
-    description: The depth of commit history fetched from the remote repository
-
-  clean:
-    required: false
-    type: boolean
-    default: ''
-    description: >-
-      If set to true, clean build directory.
-
-outputs: {} # nothing?
-
-runs:
-  using: composite
-
-  steps:
-    # Note that `shell: bash` works on both Windows and Linux, but not
-    # `shell: sh`.  This is because GitHub hosted Windows runners have
-    # their bash manually installed.
-    - shell: bash
-      run: |
-        mkdir -p ${{ inputs.srcdir }}
-        mkdir -p ${{ inputs.builddir }}
-
-    # Did you know that actions/checkout works without git(1)?  We are
-    # checking that here.
-    - id: which
-      shell: bash
-      run: |
-        echo "git=`command -v git`" >> "$GITHUB_OUTPUT"
-        echo "sudo=`command -v sudo`" >> "$GITHUB_OUTPUT"
-        echo "autoreconf=`command -v autoreconf`" >> "$GITHUB_OUTPUT"
-
-    - if: steps.which.outputs.git
-      shell: bash
-      run: |
-        git config --global core.autocrlf false
-        git config --global core.eol lf
-        git config --global advice.detachedHead 0
-        git config --global init.defaultBranch garbage
-
-    - if: inputs.checkout
-      uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-      with:
-        path: ${{ inputs.srcdir }}
-        fetch-depth: ${{ inputs.fetch-depth }}
-
-    - uses: actions/cache@5a3ec84eff668545956fd18022155c47e93e2684 # v4.2.3
-      with:
-        path: ${{ inputs.srcdir }}/.downloaded-cache
-        key: downloaded-cache
-
-    - if: steps.which.outputs.autoreconf
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: ./autogen.sh --install
-
-    # This is for MinGW.
-    - if: runner.os == 'Windows'
-      shell: bash
-      run: echo "GNUMAKEFLAGS=-j$((2 * NUMBER_OF_PROCESSORS))" >> $GITHUB_ENV
-
-    - if: runner.os == 'Linux'
-      shell: bash
-      run: echo "GNUMAKEFLAGS=-sj$((1 + $(nproc --all)))" >> "$GITHUB_ENV"
-
-    # macOS' GNU make is so old that they doesn't understand `GNUMAKEFLAGS`.
-    - if: runner.os == 'macOS'
-      shell: bash
-      run: echo "MAKEFLAGS=-j$((1 + $(sysctl -n hw.activecpu)))" >> "$GITHUB_ENV"
-
-    - if: inputs.makeup
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        touch config.status .rbconfig.time
-        for mk in Makefile GNUmakefile; do
-          sed -f tool/prereq.status template/$mk.in > $mk
-        done
-        make up
-
-    # Cleanup, runs even on failure
-    - if: always() && inputs.makeup
-      shell: bash
-      working-directory: ${{ inputs.srcdir }}
-      run: |
-        rm -f config.status .rbconfig.time \
-          Makefile GNUmakefile uncommon.mk enc.mk noarch-fake.rb
-
-    - if: steps.which.outputs.sudo
-      shell: bash
-      run: |
-        sudo chmod -R go-w /usr/share
-        chmod -v go-w $HOME $HOME/.config || :
-        declare -a dirs # -A is not supported by old bash, e.g. macos
-        SAVE_IFS="$IFS" IFS=:; set $PATH
-        for d do
-          while [ -d "$d" ]; do
-            case "$IFS${dirs[*]}$IFS" in *"$IFS$d$IFS"*) ;; *) dirs+=("$d");; esac
-            d="${d%/*}"
-          done
-        done
-        IFS="$SAVE_IFS"
-        sudo chmod -v go-w "${dirs[@]}" || :
-
-    - if: inputs.dummy-files == 'true'
-      shell: bash
-      id: dummy-files
-      working-directory: ${{ inputs.builddir }}
-      run: |
-        : Create dummy files in build dir
-        set {{a..z},{A..Z},{0..9},foo,bar,test,zzz}.rb
-        for file; do \
-          echo > $file "raise 'do not load $file'"; \
-        done
-        # drop {a..z}.rb if case-insensitive filesystem
-        grep -F A.rb a.rb > /dev/null && set "${@:27}"
-        echo clean="cd ${{ inputs.builddir }} && rm $*" >> $GITHUB_OUTPUT
-
-    - if: inputs.clean == 'true'
-      shell: bash
-      id: clean
-      run: |
-        echo distclean='make -C ${{ inputs.builddir }} distclean' >> $GITHUB_OUTPUT
-        echo remained-files='find ${{ inputs.builddir }} -ls' >> $GITHUB_OUTPUT
-        [ "${{ inputs.builddir }}" = "${{ inputs.srcdir }}" ] ||
-        echo final='rmdir ${{ inputs.builddir }}' >> $GITHUB_OUTPUT
-
-    - name: clean
-      uses: gacts/run-and-post-run@d803f6920adc9a47eeac4cb6c93dbc2e2890c684 # v1.4.2
-      with:
-        working-directory:
-        post: |
-          ${{ steps.dummy-files.outputs.clean }}
-          ${{ steps.clean.outputs.distclean }}
-          ${{ steps.clean.outputs.remained-files }}
-          ${{ steps.clean.outputs.final }}
diff --git a/.github/actions/setup/macos/action.yml b/.github/actions/setup/macos/action.yml
deleted file mode 100644
index 5da7c6d44c..0000000000
--- a/.github/actions/setup/macos/action.yml
+++ /dev/null
@@ -1,29 +0,0 @@
-name: Setup macOS environment
-description: >-
-  Installs necessary packages via Homebrew.
-
-inputs: {} # nothing?
-
-outputs: {} # nothing?
-
-runs:
-  using: composite
-
-  steps:
-    - name: brew
-      shell: bash
-      run: |
-        brew install --quiet jemalloc gmp libffi openssl@3 zlib autoconf automake libtool
-
-    - name: Set ENV
-      shell: bash
-      run: |
-        dir_config() {
-          local args=() lib var="$1"; shift
-          for lib in "$@"; do
-            args+="--with-${lib%@*}-dir=$(brew --prefix $lib)"
-          done
-          echo "$var=${args[*]}" >> $GITHUB_ENV
-        }
-        dir_config ruby_configure_args gmp
-        dir_config CONFIGURE_ARGS openssl@3
diff --git a/.github/actions/setup/ubuntu/action.yml b/.github/actions/setup/ubuntu/action.yml
deleted file mode 100644
index a9e5b41951..0000000000
--- a/.github/actions/setup/ubuntu/action.yml
+++ /dev/null
@@ -1,53 +0,0 @@
-name: Setup ubuntu environment
-description: >-
-  At the beginning there was no way but to copy & paste `apt-get`
-  everywhere.  But now that we have composite actions, it seems better
-  merge them into one.
-
-inputs:
-  arch:
-    required: false
-    default: ''
-    description: >-
-      Architecture.  Because we run this on a GitHub-hosted runner
-      acceptable value for this input is very limited.
-
-outputs:
-  arch:
-    value: ${{ steps.uname.outputs.uname }}
-    description: >-
-      Actual architecture.  This could be different from the one
-      passed to the `inputs.arch`.  For instance giving `i386` to this
-      action yields `i686`.
-
-runs:
-  using: composite
-
-  steps:
-    - name: set SETARCH
-      shell: bash
-      run: echo "SETARCH=${setarch}" >> "$GITHUB_ENV"
-      env:
-        setarch: ${{ inputs.arch && format('setarch {0} --', inputs.arch) }}
-
-    - id: uname
-      name: uname
-      shell: bash
-      run: |
-        echo uname=`${SETARCH} uname -m` >> "$GITHUB_OUTPUT"
-        echo dpkg=`${SETARCH} uname -m | sed s/686/386/` >> "$GITHUB_OUTPUT"
-
-    - name: apt-get
-      shell: bash
-      env:
-        arch: ${{ inputs.arch && format(':{0}', steps.uname.outputs.dpkg) || '' }}
-      run: |
-        set -x
-        ${arch:+sudo dpkg --add-architecture ${arch#:}}
-        sudo apt-get update -qq || :
-        sudo apt-get install --no-install-recommends -qq -y -o=Dpkg::Use-Pty=0 \
-        ${arch:+cross}build-essential${arch/:/-} \
-        libssl-dev${arch} libyaml-dev${arch} libreadline6-dev${arch} \
-        zlib1g-dev${arch} libncurses5-dev${arch} libffi-dev${arch} \
-        autoconf ruby
-        sudo apt-get install -qq -y pkg-config${arch} || :
diff --git a/.github/actions/slack/action.yml b/.github/actions/slack/action.yml
deleted file mode 100644
index 98171efc5e..0000000000
--- a/.github/actions/slack/action.yml
+++ /dev/null
@@ -1,39 +0,0 @@
-name: Post a message to slack
-description: >-
-  We have our ruby/action-slack webhook.  However its arguments are
-  bit verbose to be listed in every workflow files.  Better merge them
-  into one.
-
-inputs:
-  SLACK_WEBHOOK_URL:
-    required: true
-    description: >-
-      The URL to post the payload.  This is an input because it tends
-      to be stored in a secrets vault and a composite action cannot
-      look into one.
-
-  label:
-    required: false
-    description: >-
-      Human-readable description of the run, something like "DEBUG=1".
-      This need not be unique among runs.
-
-outputs: {} # Nothing?
-
-runs:
-  using: composite
-
-  steps:
-    - uses: ruby/action-slack@54175162371f1f7c8eb94d7c8644ee2479fcd375 # v3.2.2
-      with:
-        payload: |
-          {
-            "ci": "GitHub Actions",
-            "env": "${{ github.workflow }}${{ inputs.label && format(' / {0}', inputs.label) }}",
-            "url": "https://github.com/${{ github.repository }}/actions/runs/${{ github.run_id }}",
-            "commit": "${{ github.sha }}",
-            "branch": "${{ github.ref_name }}"
-          }
-      env:
-        SLACK_WEBHOOK_URL: ${{ inputs.SLACK_WEBHOOK_URL }}
-      if: ${{github.event_name == 'push' && startsWith(github.repository, 'ruby/')}}
diff --git a/.github/auto_request_review.yml b/.github/auto_request_review.yml
deleted file mode 100644
index 8726df577d..0000000000
--- a/.github/auto_request_review.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-files:
-  'yjit*': [team:yjit]
-  'yjit/**/*': [team:yjit]
-  'yjit/src/cruby_bindings.inc.rs': []
-  'doc/yjit/*': [team:yjit]
-  'bootstraptest/test_yjit*': [team:yjit]
-  'test/ruby/test_yjit*': [team:yjit]
-options:
-  ignore_draft: true
-  # This currently doesn't work as intended. We want to skip reviews when only
-  # cruby_bingings.inc.rs is modified, but this skips reviews even when other
-  # yjit files are modified as well. To be enabled after fixing the behavior.
-  #last_files_match_only: true
diff --git a/.github/dependabot.yml b/.github/dependabot.yml
deleted file mode 100644
index 426893be2a..0000000000
--- a/.github/dependabot.yml
+++ /dev/null
@@ -1,18 +0,0 @@
-version: 2
-updates:
-  - package-ecosystem: 'github-actions'
-    directory: '/'
-    schedule:
-      interval: 'daily'
-  - package-ecosystem: 'github-actions'
-    directory: '/.github/actions/slack'
-    schedule:
-      interval: 'daily'
-  - package-ecosystem: 'github-actions'
-    directory: '/.github/actions/setup/directories'
-    schedule:
-      interval: 'daily'
-  - package-ecosystem: 'cargo'
-    directory: '/yjit'
-    schedule:
-      interval: 'daily'
diff --git a/.github/labeler.yml b/.github/labeler.yml
deleted file mode 100644
index e81aed8e98..0000000000
--- a/.github/labeler.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-Documentation:
-- changed-files:
-  - all-globs-to-all-files: doc/**
-
-Backport:
-- base-branch: 'ruby_3_\d'
diff --git a/.github/workflows/annocheck.yml b/.github/workflows/annocheck.yml
deleted file mode 100644
index 2a7c169b3b..0000000000
--- a/.github/workflows/annocheck.yml
+++ /dev/null
@@ -1,112 +0,0 @@
-name: Annocheck
-
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  compile:
-    name: test-annocheck
-
-    runs-on: ubuntu-latest
-
-    container:
-      image: ghcr.io/ruby/ruby-ci-image:gcc-11
-      options: --user root
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    env:
-      CONFIGURE_TTY: never
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci rgengc
-      RUBY_TESTOPTS: >-
-        -q
-        --color=always
-        --tty=no
-      # FIXME: Drop skipping options
-      # https://bugs.ruby-lang.org/issues/18061
-      # https://sourceware.org/annobin/annobin.html/Test-pie.html
-      TEST_ANNOCHECK_OPTS: '--skip-pie --skip-gaps'
-
-    steps:
-      - run: id
-        working-directory:
-
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      # Minimal flags to pass the check.
-      # -g0 disables backtraces when SEGV.  Do not set that.
-      - name: Run configure
-        run: >
-          ../src/configure -C
-          --enable-debug-env
-          --disable-install-doc
-          --with-ext=-test-/cxxanyargs,+
-          --without-valgrind
-          --without-jemalloc
-          --without-gmp
-          --with-gcc="gcc-11 -fcf-protection -Wa,--generate-missing-build-notes=yes"
-          --enable-shared
-          debugflags=-ggdb3
-          optflags=-O2
-          LDFLAGS=-Wl,-z,now
-
-      - run: make showflags
-
-      - run: make
-
-      - run: make test-annocheck
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/auto_request_review.yml b/.github/workflows/auto_request_review.yml
deleted file mode 100644
index a6c81c78cd..0000000000
--- a/.github/workflows/auto_request_review.yml
+++ /dev/null
@@ -1,20 +0,0 @@
-name: Auto Request Review
-on:
-  pull_request_target:
-    types: [opened, ready_for_review, reopened]
-    branches: [master]
-
-permissions:
-  contents: read
-
-jobs:
-  auto-request-review:
-    name: Auto Request Review
-    runs-on: ubuntu-latest
-    if: ${{ github.repository == 'ruby/ruby' && github.base_ref == 'master' }}
-    steps:
-      - name: Request review based on files changes and/or groups the author belongs to
-        uses: necojackarc/auto-request-review@e89da1a8cd7c8c16d9de9c6e763290b6b0e3d424 # v0.13.0
-        with:
-          # scope: public_repo
-          token: ${{ secrets.MATZBOT_GITHUB_TOKEN }}
diff --git a/.github/workflows/baseruby.yml b/.github/workflows/baseruby.yml
deleted file mode 100644
index e87641a857..0000000000
--- a/.github/workflows/baseruby.yml
+++ /dev/null
@@ -1,77 +0,0 @@
-name: BASERUBY Check
-
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  baseruby:
-    name: BASERUBY
-
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    strategy:
-      matrix:
-        ruby:
-          - ruby-3.0
-          - ruby-3.1
-          - ruby-3.2
-          - ruby-3.3
-
-    steps:
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: ${{ matrix.ruby }}
-          bundler: none
-
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          makeup: true
-
-      - run: ./configure --disable-install-doc
-
-      - run: make all
-
-      - run: make test
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.ruby }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/bundled_gems.yml b/.github/workflows/bundled_gems.yml
deleted file mode 100644
index 28e9b9f490..0000000000
--- a/.github/workflows/bundled_gems.yml
+++ /dev/null
@@ -1,136 +0,0 @@
-name: bundled_gems
-
-on:
-  push:
-    branches: ['master']
-    paths:
-      - '.github/workflows/bundled_gems.yml'
-      - 'gems/bundled_gems'
-  pull_request:
-    branches: ['master']
-    paths:
-      - '.github/workflows/bundled_gems.yml'
-      - 'gems/bundled_gems'
-  merge_group:
-  schedule:
-    - cron: '45 6 * * *'
-  workflow_dispatch:
-
-permissions: # added using https://github.com/step-security/secure-workflows
-  contents: read
-
-jobs:
-  update:
-    permissions:
-      contents: write # for Git to git push
-
-    if: ${{ github.event_name != 'schedule' || github.repository == 'ruby/ruby' }}
-
-    name: update ${{ github.workflow }}
-
-    runs-on: ubuntu-latest
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_GITHUB_TOKEN || secrets.GITHUB_TOKEN }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          # Skip overwriting MATZBOT_GITHUB_TOKEN
-          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
-
-      - name: Set ENV
-        run: |
-          echo "TODAY=$(date +%F)" >> $GITHUB_ENV
-
-      - name: Download previous gems list
-        run: |
-          mkdir -p .downloaded-cache
-          for data in bundled_gems.json default_gems.json; do
-            ln -s .downloaded-cache/$data .
-            curl -O -R -z ./$data https://stdgems.org/$data
-          done
-
-      - name: Update bundled gems list
-        id: bundled_gems
-        run: |
-          ruby -i~ tool/update-bundled_gems.rb gems/bundled_gems >> $GITHUB_OUTPUT
-
-      - name: Update spec/bundler/support/builders.rb
-        run: |
-          #!ruby
-          rake_version = File.read("gems/bundled_gems")[/^rake\s+(\S+)/, 1]
-          print ARGF.read.sub(/^ *def rake_version\s*\K".*?"/) {rake_version.dump}
-        shell: ruby -i~ {0} spec/bundler/support/builders.rb
-
-      - name: Maintain updated gems list in NEWS
-        run: |
-          ruby tool/update-NEWS-gemlist.rb bundled
-
-      - name: Check diffs
-        id: diff
-        run: |
-          news= gems=
-          git diff --color --no-ext-diff --ignore-submodules --exit-code -- NEWS.md ||
-          news=true
-          git diff --color --no-ext-diff --ignore-submodules --exit-code -- gems/bundled_gems ||
-          gems=true
-          git add -- NEWS.md gems/bundled_gems
-          git add -- spec/bundler/support/builders.rb
-          echo news=$news >> $GITHUB_OUTPUT
-          echo gems=$gems >> $GITHUB_OUTPUT
-          echo update=${news:-$gems} >> $GITHUB_OUTPUT
-
-      - name: Install libraries
-        uses: ./.github/actions/setup/ubuntu
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Build
-        run: |
-          ./autogen.sh
-          ./configure -C --disable-install-doc
-          make
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Prepare bundled gems
-        run: |
-          make -s prepare-gems
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Test bundled gems
-        run: |
-          make -s test-bundled-gems
-        timeout-minutes: 30
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-        if: ${{ steps.diff.outputs.gems }}
-
-      - name: Commit
-        run: |
-          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
-          message="Update bundled gems list"
-          if [ -z "${gems}" ]; then
-            git commit --message="${message} at ${GITHUB_SHA:0:30} [ci skip]"
-          else
-            git commit --message="${message} as of ${TODAY}"
-          fi
-          git push origin ${GITHUB_REF#refs/heads/}
-        env:
-          TODAY: ${{ steps.bundled_gems.outputs.latest_date || env.TODAY }}
-          EMAIL: svn-admin@ruby-lang.org
-          GIT_AUTHOR_NAME: git
-          GIT_COMMITTER_NAME: git
-          gems: ${{ steps.diff.outputs.gems }}
-        if: >-
-          ${{
-          github.repository == 'ruby/ruby' &&
-          !startsWith(github.event_name, 'pull') &&
-          steps.diff.outputs.update
-          }}
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/check_dependencies.yml b/.github/workflows/check_dependencies.yml
deleted file mode 100644
index 39b3f2880c..0000000000
--- a/.github/workflows/check_dependencies.yml
+++ /dev/null
@@ -1,63 +0,0 @@
-name: Check Dependencies
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  update-deps:
-    name: Dependency checks
-
-    strategy:
-      matrix:
-        os: [ubuntu-latest]
-      fail-fast: true
-
-    runs-on: ${{ matrix.os }}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      - uses: ./.github/actions/setup/ubuntu
-        if: ${{ contains(matrix.os, 'ubuntu') }}
-
-      - uses: ./.github/actions/setup/macos
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - uses: ./.github/actions/setup/directories
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      - name: Run configure
-        run: ./configure -C --disable-install-doc --disable-rubygems --with-gcc 'optflags=-O0' 'debugflags=-save-temps=obj -g'
-
-      - run: make all golf
-
-      - run: ./goruby -veh
-
-      - run: ruby tool/update-deps --fix
-
-      - run: git diff --no-ext-diff --ignore-submodules --exit-code
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.os }} / Dependencies need to update
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/check_misc.yml b/.github/workflows/check_misc.yml
deleted file mode 100644
index fb00fd5c0c..0000000000
--- a/.github/workflows/check_misc.yml
+++ /dev/null
@@ -1,81 +0,0 @@
-name: Misc
-on: [push, pull_request, merge_group]
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  checks:
-    name: Miscellaneous checks
-
-    permissions:
-      contents: write # for Git to git push
-
-    runs-on: ubuntu-latest
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_GITHUB_TOKEN || secrets.GITHUB_TOKEN }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          makeup: true
-          # Skip overwriting MATZBOT_GITHUB_TOKEN
-          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
-
-      - name: Check if C-sources are US-ASCII
-        run: |
-          grep -r -n --include='*.[chyS]' --include='*.asm' $'[^\t-~]' -- . && exit 1 || :
-
-#      - name: Check for trailing spaces
-#        run: |
-#          git grep -I -n $'[\t ]$' -- '*.rb' '*.[chy]' '*.rs' '*.yml' && exit 1 || :
-#          git grep -n $'^[\t ][\t ]*$' -- '*.md' && exit 1 || :
-
-      - name: Check for bash specific substitution in configure.ac
-        run: |
-          git grep -n '\${[A-Za-z_0-9]*/' -- configure.ac && exit 1 || :
-
-      - name: Check for header macros
-        run: |
-          fail=
-          for header in ruby/*.h; do
-            git grep -l -F -e $header -e HAVE_`echo $header | tr a-z./ A-Z__` -- . > /dev/null && continue
-            fail=1
-            echo $header
-          done
-          exit $fail
-        working-directory: include
-
-      - name: Generate docs
-        id: docs
-        run: |
-          ruby -W0 --disable-gems -I./lib tool/rdoc-srcdir -q --op html .
-          echo htmlout=ruby-html-${GITHUB_SHA:0:10} >> $GITHUB_OUTPUT
-        # Generate only when document commit/PR
-        if: >-
-          ${{false
-          || contains(github.event.head_commit.message, '[ruby/rdoc]')
-          || contains(github.event.head_commit.message, '[DOC]')
-          || contains(github.event.head_commit.message, 'Document')
-          || contains(github.event.pull_request.title, '[DOC]')
-          || contains(github.event.pull_request.title, 'Document')
-          || contains(github.event.pull_request.labels.*.name, 'Documentation')
-          }}
-
-      - name: Upload docs
-        uses: actions/upload-artifact@v4
-        with:
-          path: html
-          name: ${{ steps.docs.outputs.htmlout }}
-        if: ${{ steps.docs.outcome == 'success' }}
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/codeql-analysis.yml b/.github/workflows/codeql-analysis.yml
deleted file mode 100644
index 549590dd23..0000000000
--- a/.github/workflows/codeql-analysis.yml
+++ /dev/null
@@ -1,121 +0,0 @@
-name: 'CodeQL'
-
-on:
-  push:
-    branches: ['master']
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  schedule:
-    - cron: '0 12 * * *'
-  workflow_dispatch:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions: # added using https://github.com/step-security/secure-workflows
-  contents: read
-
-jobs:
-  analyze:
-    name: Analyze
-    runs-on: ubuntu-latest
-    permissions:
-      actions: read # for github/codeql-action/init to get workflow details
-      contents: read # for actions/checkout to fetch code
-      security-events: write # for github/codeql-action/autobuild to send a status report
-    # CodeQL fails to run pull requests from dependabot due to missing write access to upload results.
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    env:
-      enable_install_doc: no
-
-    strategy:
-      fail-fast: false
-      matrix:
-        include:
-          - language: cpp
-          - language: ruby
-
-    steps:
-      - name: Checkout repository
-        uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      - name: Install libraries
-        if: ${{ contains(matrix.os, 'macos') }}
-        uses: ./.github/actions/setup/macos
-
-      - name: Install libraries
-        if : ${{ matrix.os == 'ubuntu-latest' }}
-        uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-
-      - name: Remove an obsolete rubygems vendored file
-        if: ${{ matrix.os == 'ubuntu-latest' }}
-        run: sudo rm /usr/lib/ruby/vendor_ruby/rubygems/defaults/operating_system.rb
-
-      - name: Initialize CodeQL
-        uses: github/codeql-action/init@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          languages: ${{ matrix.language }}
-
-      - name: Autobuild
-        uses: github/codeql-action/autobuild@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-
-      - name: Perform CodeQL Analysis
-        uses: github/codeql-action/analyze@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          category: '/language:${{ matrix.language }}'
-          upload: False
-          output: sarif-results
-
-      - name: filter-sarif
-        uses: advanced-security/filter-sarif@f3b8118a9349d88f7b1c0c488476411145b6270d # v1.0.1
-        with:
-          patterns: |
-            +**/*.rb
-            -lib/uri/mailto.rb:rb/overly-large-range
-            -lib/uri/rfc3986_parser.rb:rb/overly-large-range
-            -lib/bundler/vendor/uri/lib/uri/mailto.rb:rb/overly-large-range
-            -lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb:rb/overly-large-range
-            -test/ruby/test_io.rb:rb/non-constant-kernel-open
-            -test/open-uri/test_open-uri.rb:rb/non-constant-kernel-open
-            -test/open-uri/test_ssl.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/binread_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/readlines_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/foreach_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/write_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/io/read_spec.rb:rb/non-constant-kernel-open
-            -spec/ruby/core/kernel/open_spec.rb:rb/non-constant-kernel-open
-          input: sarif-results/${{ matrix.language }}.sarif
-          output: sarif-results/${{ matrix.language }}.sarif
-        if: ${{ matrix.language == 'ruby' }}
-        continue-on-error: true
-
-      - name: Upload SARIF
-        uses: github/codeql-action/upload-sarif@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          sarif_file: sarif-results/${{ matrix.language }}.sarif
-        continue-on-error: true
diff --git a/.github/workflows/compilers.yml b/.github/workflows/compilers.yml
deleted file mode 100644
index b28d717b22..0000000000
--- a/.github/workflows/compilers.yml
+++ /dev/null
@@ -1,331 +0,0 @@
-# Some tests depending on this name 'Compilations' via $GITHUB_WORKFLOW. Make sure to update such tests when renaming this workflow.
-name: Compilations
-
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-# Each job is split so that they roughly take 30min to run through.
-jobs:
-  compile-if:
-    name: 'omnibus compilations, trigger'
-    runs-on: ubuntu-latest
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-    steps:
-      - run: true
-        working-directory:
-
-  compile1:
-    name: 'omnibus compilations, #1'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      # Set fetch-depth: 10 so that Launchable can receive commits information.
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - name: 'clang 18 LTO'
-        uses: './.github/actions/compilers'
-        with:
-          tag: clang-18
-          with_gcc: 'clang-18 -flto=auto'
-          optflags: '-O2'
-          enable_shared: false
-      - { uses: './.github/actions/compilers', name: '-O0', with: { optflags: '-O0 -march=x86-64 -mtune=generic' } }
-      # - { uses: './.github/actions/compilers', name: '-O3', with: { optflags: '-O3 -march=x86-64 -mtune=generic', check: true } }
-
-  compile2:
-    name: 'omnibus compilations, #2'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - name: 'GCC 13 LTO'
-        uses: './.github/actions/compilers'
-        with:
-          tag: gcc-13
-          with_gcc: 'gcc-13 -flto=auto -ffat-lto-objects -Werror=lto-type-mismatch'
-          optflags: '-O2'
-          enable_shared: false
-      - { uses: './.github/actions/compilers', name: 'ext/Setup', with: { static_exts: 'etc json/* */escape' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 14', with: { tag: 'gcc-14' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 13', with: { tag: 'gcc-13' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 12', with: { tag: 'gcc-12' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 11', with: { tag: 'gcc-11' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 10', with: { tag: 'gcc-10' } }
-      - { uses: './.github/actions/compilers', name: 'GCC 9',  with: { tag: 'gcc-9'  } }
-      - { uses: './.github/actions/compilers', name: 'GCC 8',  with: { tag: 'gcc-8'  } }
-      - { uses: './.github/actions/compilers', name: 'GCC 7',  with: { tag: 'gcc-7'  } }
-
-  compile3:
-    name: 'omnibus compilations, #3'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'clang 21', with: { tag: 'clang-21' } }
-      - { uses: './.github/actions/compilers', name: 'clang 20', with: { tag: 'clang-20' } }
-      - { uses: './.github/actions/compilers', name: 'clang 19', with: { tag: 'clang-19' } }
-      - { uses: './.github/actions/compilers', name: 'clang 18', with: { tag: 'clang-18' } }
-      - { uses: './.github/actions/compilers', name: 'clang 17', with: { tag: 'clang-17' } }
-      - { uses: './.github/actions/compilers', name: 'clang 16', with: { tag: 'clang-16' } }
-      - { uses: './.github/actions/compilers', name: 'clang 15', with: { tag: 'clang-15' } }
-      - { uses: './.github/actions/compilers', name: 'clang 14', with: { tag: 'clang-14' } }
-
-  compile4:
-    name: 'omnibus compilations, #4'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'clang 13', with: { tag: 'clang-13' } }
-      - { uses: './.github/actions/compilers', name: 'clang 12', with: { tag: 'clang-12' } }
-      - { uses: './.github/actions/compilers', name: 'clang 11', with: { tag: 'clang-11' } }
-      - { uses: './.github/actions/compilers', name: 'clang 10', with: { tag: 'clang-10' } }
-        # llvm-objcopy<=9 doesn't have --wildcard. It compiles, but leaves Rust symbols in libyjit.o.
-      - { uses: './.github/actions/compilers', name: 'clang 9',  with: { tag: 'clang-9',   append_configure: '--disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'clang 8',  with: { tag: 'clang-8',   append_configure: '--disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'clang 7',  with: { tag: 'clang-7',   append_configure: '--disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'clang 6',  with: { tag: 'clang-6.0', append_configure: '--disable-yjit' } }
-
-  compile5:
-    name: 'omnibus compilations, #5'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      # -Wno-strict-prototypes is necessary with current clang-15 since
-      # older autoconf generate functions without prototype and -pedantic
-      # now implies strict-prototypes. Disabling the error but leaving the
-      # warning generates a lot of noise from use of ANYARGS in
-      # rb_define_method() and friends.
-      # See: https://github.com/llvm/llvm-project/commit/11da1b53d8cd3507959022cd790d5a7ad4573d94
-      - { uses: './.github/actions/compilers', name: 'C99',      with: { CFLAGS: '-std=c99 -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C11',   with: { CFLAGS:   '-std=c11   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C17',   with: { CFLAGS:   '-std=c17   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C23',   with: { CFLAGS:   '-std=c2x   -Werror=pedantic -pedantic-errors -Wno-strict-prototypes' } }
-      - { uses: './.github/actions/compilers', name: 'C++98', with: { CXXFLAGS: '-std=c++98 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++11', with: { CXXFLAGS: '-std=c++11 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++14', with: { CXXFLAGS: '-std=c++14 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++17', with: { CXXFLAGS: '-std=c++17 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-
-  compile6:
-    name: 'omnibus compilations, #6'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'C++20', with: { CXXFLAGS: '-std=c++20 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++23', with: { CXXFLAGS: '-std=c++23 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'C++26', with: { CXXFLAGS: '-std=c++26 -Werror=pedantic -pedantic-errors -Wno-c++11-long-long' } }
-      - { uses: './.github/actions/compilers', name: 'gmp',                 with: { append_configure: '--with-gmp', check: 'ruby/test_bignum.rb', mspecopt: "/github/workspace/src/spec/ruby/core/integer" } }
-      - { uses: './.github/actions/compilers', name: 'jemalloc',            with: { append_configure: '--with-jemalloc' } }
-      - { uses: './.github/actions/compilers', name: 'valgrind',            with: { append_configure: '--with-valgrind' } }
-      - { uses: './.github/actions/compilers', name: 'coroutine=ucontext',  with: { append_configure: '--with-coroutine=ucontext' } }
-      - { uses: './.github/actions/compilers', name: 'coroutine=pthread',   with: { append_configure: '--with-coroutine=pthread' } }
-
-  compile7:
-    name: 'omnibus compilations, #7'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'disable-jit',         with: { append_configure: '--disable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'disable-dln',         with: { append_configure: '--disable-dln' } }
-      - { uses: './.github/actions/compilers', name: 'enable-mkmf-verbose', with: { append_configure: '--enable-mkmf-verbose' } }
-      - { uses: './.github/actions/compilers', name: 'disable-rubygems',    with: { append_configure: '--disable-rubygems' } }
-      - { uses: './.github/actions/compilers', name: 'RUBY_DEVEL',          with: { append_configure: '--enable-devel' } }
-      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=0',            with: { cppflags: '-DOPT_THREADED_CODE=0' } }
-      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=1',            with: { cppflags: '-DOPT_THREADED_CODE=1' } }
-      - { uses: './.github/actions/compilers', name: 'OPT_THREADED_CODE=2',            with: { cppflags: '-DOPT_THREADED_CODE=2' } }
-
-  compile8:
-    name: 'omnibus compilations, #8'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'NDEBUG',                         with: { cppflags: '-DNDEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'RUBY_DEBUG',                     with: { cppflags: '-DRUBY_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'ARRAY_DEBUG',                    with: { cppflags: '-DARRAY_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'BIGNUM_DEBUG',                   with: { cppflags: '-DBIGNUM_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'CCAN_LIST_DEBUG',                with: { cppflags: '-DCCAN_LIST_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'CPDEBUG=-1',                     with: { cppflags: '-DCPDEBUG=-1' } }
-      - { uses: './.github/actions/compilers', name: 'ENC_DEBUG',                      with: { cppflags: '-DENC_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'GC_DEBUG',                       with: { cppflags: '-DGC_DEBUG' } }
-
-  compile9:
-    name: 'omnibus compilations, #9'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'HASH_DEBUG',                     with: { cppflags: '-DHASH_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'ID_TABLE_DEBUG',                 with: { cppflags: '-DID_TABLE_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_DEBUG=-1',                with: { cppflags: '-DRGENGC_DEBUG=-1' } }
-      - { uses: './.github/actions/compilers', name: 'SYMBOL_DEBUG',                   with: { cppflags: '-DSYMBOL_DEBUG' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_CHECK_MODE',              with: { cppflags: '-DRGENGC_CHECK_MODE' } }
-      - { uses: './.github/actions/compilers', name: 'VM_CHECK_MODE',                  with: { cppflags: '-DVM_CHECK_MODE' } }
-      - { uses: './.github/actions/compilers', name: 'USE_EMBED_CI=0',                 with: { cppflags: '-DUSE_EMBED_CI=0' } }
-      - { uses: './.github/actions/compilers', name: 'USE_FLONUM=0',                   with: { cppflags: '-DUSE_FLONUM=0', append_configure: '--disable-yjit' } }
-
-  compileX:
-    name: 'omnibus compilations, #10'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'USE_LAZY_LOAD',                  with: { cppflags: '-DUSE_LAZY_LOAD' } }
-      - { uses: './.github/actions/compilers', name: 'USE_SYMBOL_GC=0',                with: { cppflags: '-DUSE_SYMBOL_GC=0' } }
-      - { uses: './.github/actions/compilers', name: 'USE_THREAD_CACHE=0',             with: { cppflags: '-DUSE_THREAD_CACHE=0' } }
-      - { uses: './.github/actions/compilers', name: 'USE_RUBY_DEBUG_LOG=1',           with: { cppflags: '-DUSE_RUBY_DEBUG_LOG=1' } }
-      - { uses: './.github/actions/compilers', name: 'USE_DEBUG_COUNTER',              with: { cppflags: '-DUSE_DEBUG_COUNTER=1' } }
-      - { uses: './.github/actions/compilers', name: 'SHARABLE_MIDDLE_SUBSTRING',      with: { cppflags: '-DSHARABLE_MIDDLE_SUBSTRING=1' } }
-      - { uses: './.github/actions/compilers', name: 'DEBUG_FIND_TIME_NUMGUESS',       with: { cppflags: '-DDEBUG_FIND_TIME_NUMGUESS' } }
-      - { uses: './.github/actions/compilers', name: 'DEBUG_INTEGER_PACK',             with: { cppflags: '-DDEBUG_INTEGER_PACK' } }
-
-  compileB:
-    name: 'omnibus compilations, #11'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'GC_DEBUG_STRESS_TO_CLASS',       with: { cppflags: '-DGC_DEBUG_STRESS_TO_CLASS' } }
-      - { uses: './.github/actions/compilers', name: 'GC_ENABLE_LAZY_SWEEP=0',         with: { cppflags: '-DGC_ENABLE_LAZY_SWEEP=0' } }
-      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_DETAIL_MEMORY',       with: { cppflags: '-DGC_PROFILE_DETAIL_MEMORY' } }
-      - { uses: './.github/actions/compilers', name: 'GC_PROFILE_MORE_DETAIL',         with: { cppflags: '-DGC_PROFILE_MORE_DETAIL' } }
-      - { uses: './.github/actions/compilers', name: 'MALLOC_ALLOCATED_SIZE_CHECK',    with: { cppflags: '-DMALLOC_ALLOCATED_SIZE_CHECK' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_ESTIMATE_OLDMALLOC',      with: { cppflags: '-DRGENGC_ESTIMATE_OLDMALLOC' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_OBJ_INFO',                with: { cppflags: '-DRGENGC_OBJ_INFO' } }
-      - { uses: './.github/actions/compilers', name: 'RGENGC_PROFILE',                 with: { cppflags: '-DRGENGC_PROFILE' } }
-
-  compileC:
-    name: 'omnibus compilations, #12'
-    runs-on: ubuntu-latest
-    needs: compile-if
-    if: ${{ needs.compile-if.result == 'success' }}
-    timeout-minutes: 60
-    services: { docuum: { image: 'stephanmisc/docuum', options: '--init', volumes: [ '/root', '/var/run/docker.sock:/var/run/docker.sock' ] } }
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with: { sparse-checkout-cone-mode: false, sparse-checkout: /.github }
-      - { uses: './.github/actions/setup/directories', with: { srcdir: 'src', builddir: 'build', makeup: true, fetch-depth: 10 } }
-      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_BP_CHECK',              with: { cppflags: '-DVM_DEBUG_BP_CHECK' } }
-      - { uses: './.github/actions/compilers', name: 'VM_DEBUG_VERIFY_METHOD_CACHE',   with: { cppflags: '-DVM_DEBUG_VERIFY_METHOD_CACHE' } }
-      - { uses: './.github/actions/compilers', name: 'enable-yjit',                    with: { append_configure: '--enable-yjit' } }
-      - { uses: './.github/actions/compilers', name: 'YJIT_FORCE_ENABLE',              with: { cppflags: '-DYJIT_FORCE_ENABLE' } }
-      - { uses: './.github/actions/compilers', name: 'UNIVERSAL_PARSER',               with: { cppflags: '-DUNIVERSAL_PARSER' } }
-
-  compilemax:
-    name: 'omnibus compilations, result'
-    runs-on: ubuntu-latest
-    if: ${{ always() }}
-    needs:
-      - 'compile1'
-      - 'compile2'
-      - 'compile3'
-      - 'compile4'
-      - 'compile5'
-      - 'compile6'
-      - 'compile7'
-      - 'compile8'
-      - 'compile9'
-      - 'compileX'
-      - 'compileB'
-      - 'compileC'
-    steps:
-      - uses: ./.github/actions/slack
-        with:
-          label: 'omnibus'
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-      - run: false
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/cygwin.yml b/.github/workflows/cygwin.yml
deleted file mode 100644
index d822a2e9e2..0000000000
--- a/.github/workflows/cygwin.yml
+++ /dev/null
@@ -1,67 +0,0 @@
-name: Cygwin
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    runs-on: windows-2022
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - run: git config --global core.autocrlf input
-
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      - name: Setup Cygwin
-        uses: cygwin/cygwin-install-action@master
-        with:
-          packages: ruby gcc-core make autoconf libtool libssl-devel libyaml-devel libffi-devel zlib-devel
-
-      - name: configure
-        run: |
-          ./autogen.sh
-          ./configure --disable-install-doc
-        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
-
-      - name: Extract bundled gems
-        run: |
-          make ruby -j5
-          make extract-gems
-        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
-
-      - name: make all
-        timeout-minutes: 30
-        run: make -j4 V=1
-        shell: C:\cygwin\bin\bash.EXE --noprofile --norc -e -o igncr -o pipefail {0}
diff --git a/.github/workflows/default_gems.yml b/.github/workflows/default_gems.yml
deleted file mode 100644
index 3399dcbc4f..0000000000
--- a/.github/workflows/default_gems.yml
+++ /dev/null
@@ -1,95 +0,0 @@
-name: Update default gems list
-on: [push, pull_request, merge_group]
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  update_default_gems:
-    name: Update default gems list
-
-    permissions:
-      contents: write # for Git to git push
-
-    runs-on: ubuntu-latest
-
-    if: ${{ github.repository == 'ruby/ruby' }}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          token: ${{ (github.repository == 'ruby/ruby' && !startsWith(github.event_name, 'pull')) && secrets.MATZBOT_GITHUB_TOKEN || secrets.GITHUB_TOKEN }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          makeup: true
-          # Skip overwriting MATZBOT_GITHUB_TOKEN
-          checkout: '' # false (ref: https://github.com/actions/runner/issues/2238)
-
-      - id: gems
-        run: true
-        if: ${{ github.ref == 'refs/heads/master' }}
-
-      - name: Download previous gems list
-        run: |
-          data=default_gems.json
-          mkdir -p .downloaded-cache
-          ln -s .downloaded-cache/$data .
-          curl -O -R -z ./$data https://stdgems.org/$data
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Make default gems list
-        run: |
-          #!ruby
-          require 'rubygems'
-          $:.unshift "lib"
-          rgver = File.foreach("lib/rubygems.rb") do |line|
-            break $1 if /^\s*VERSION\s*=\s*"([^"]+)"/ =~ line
-          end
-          gems = Dir.glob("{ext,lib}/**/*.gemspec").map do |f|
-            spec = Gem::Specification.load(f)
-            "#{spec.name} #{spec.version}"
-          end.sort
-          File.open("gems/default_gems", "w") do |f|
-            f.puts "RubyGems #{rgver}"
-            f.puts gems
-          end
-        shell: ruby --disable=gems {0}
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Maintain updated gems list in NEWS
-        run: |
-          ruby tool/update-NEWS-gemlist.rb default
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Check diffs
-        id: diff
-        run: |
-          git diff --color --no-ext-diff --ignore-submodules --exit-code NEWS.md ||
-          echo update=true >> $GITHUB_OUTPUT
-        if: ${{ steps.gems.outcome == 'success' }}
-
-      - name: Commit
-        run: |
-          git pull --ff-only origin ${GITHUB_REF#refs/heads/}
-          git commit --message="Update default gems list at ${GITHUB_SHA:0:30} [ci skip]" NEWS.md
-          git push origin ${GITHUB_REF#refs/heads/}
-        env:
-          EMAIL: svn-admin@ruby-lang.org
-          GIT_AUTHOR_NAME: git
-          GIT_COMMITTER_NAME: git
-        if: >-
-          ${{
-          github.repository == 'ruby/ruby' &&
-          !startsWith(github.event_name, 'pull') &&
-          steps.diff.outputs.update
-          }}
-
-      - uses: ./.github/actions/slack
-        with:
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/dependabot_automerge.yml b/.github/workflows/dependabot_automerge.yml
deleted file mode 100644
index b1293deb62..0000000000
--- a/.github/workflows/dependabot_automerge.yml
+++ /dev/null
@@ -1,32 +0,0 @@
-# from https://github.com/gofiber/swagger/blob/main/.github/workflows/dependabot_automerge.yml
-name: Dependabot auto-merge
-on:
-  pull_request:
-
-permissions:
-  contents: write
-  pull-requests: write
-
-jobs:
-  automerge:
-    runs-on: ubuntu-latest
-    if: github.event.pull_request.user.login == 'dependabot[bot]' && github.repository == 'ruby/ruby'
-    steps:
-      - name: Dependabot metadata
-        uses: dependabot/fetch-metadata@d7267f607e9d3fb96fc2fbe83e0af444713e90b7 # v2.3.0
-        id: metadata
-
-      - name: Wait for status checks
-        uses: lewagon/wait-on-check-action@ccfb013c15c8afb7bf2b7c028fb74dc5a068cccc # v1.3.4
-        with:
-          repo-token: ${{ secrets.MATZBOT_GITHUB_TOKEN }}
-          ref: ${{ github.event.pull_request.head.sha || github.sha }}
-          check-regexp: 'make \(check, .*\)'
-          wait-interval: 30
-
-      - name: Auto-merge for Dependabot PRs
-        if: ${{ steps.metadata.outputs.update-type == 'version-update:semver-minor' || steps.metadata.outputs.update-type == 'version-update:semver-patch' }}
-        run: gh pr merge --auto --rebase "$PR_URL"
-        env:
-          PR_URL: ${{ github.event.pull_request.html_url }}
-          GITHUB_TOKEN: ${{ secrets.MATZBOT_GITHUB_TOKEN }}
diff --git a/.github/workflows/labeler.yml b/.github/workflows/labeler.yml
deleted file mode 100644
index e57cd86e2b..0000000000
--- a/.github/workflows/labeler.yml
+++ /dev/null
@@ -1,12 +0,0 @@
-name: "Pull Request Labeler"
-on:
-- pull_request_target
-
-jobs:
-  labeler:
-    permissions:
-      contents: read
-      pull-requests: write
-    runs-on: ubuntu-latest
-    steps:
-    - uses: actions/labeler@v5
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
deleted file mode 100644
index 6220df9f56..0000000000
--- a/.github/workflows/macos.yml
+++ /dev/null
@@ -1,193 +0,0 @@
-name: macOS
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: check
-            os: macos-14
-          - test_task: check
-            os: macos-14
-            configure_args: '--with-gcc=gcc-14'
-          - test_task: check
-            os: macos-14
-            configure_args: '--with-jemalloc --with-opt-dir=$(brew --prefix jemalloc)'
-          - test_task: check
-            os: macos-14
-            configure_args: '--with-gmp'
-          - test_task: test-all
-            test_opts: --repeat-count=2
-            os: macos-14
-          - test_task: test-bundler-parallel
-            os: macos-14
-          - test_task: test-bundled-gems
-            os: macos-14
-          - test_task: check
-            os: macos-15
-          - test_task: check
-            os: macos-13
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-
-    runs-on: ${{ matrix.os }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - name: Install libraries
-        uses: ./.github/actions/setup/macos
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 0 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: make sure that kern.coredump=1
-        run: |
-          sysctl -n kern.coredump
-          sudo sysctl -w kern.coredump=1
-          sudo chmod -R +rwx /cores/
-
-      - name: Delete unused SDKs
-        # To free up disk space to not run out during the run
-        run: |
-          sudo rm -rf ~/.dotnet
-          sudo rm -rf /Library/Android
-          sudo rm -rf /Library/Developer/CoreSimulator
-        continue-on-error: true
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc ${ruby_configure_args} ${{ matrix.configure_args }}
-
-      - run: make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: make
-
-      - run: make hello
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ${{ matrix.os }}
-          test-opts: ${{ matrix.test_opts }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-        continue-on-error: true
-
-      - name: Set extra test options
-        run: |
-          echo "TESTS=$TESTS ${{ matrix.test_opts }}" >> $GITHUB_ENV
-          echo "RUBY_TEST_TIMEOUT_SCALE=10" >> $GITHUB_ENV # With --repeat-count=2, flaky test by timeout occurs frequently for some reason
-        if: matrix.test_opts
-
-      - name: make ${{ matrix.test_task }}
-        run: |
-          if [ -n "${LAUNCHABLE_ORGANIZATION}" ]; then
-            exec \
-            > >(tee launchable_stdout.log) \
-            2> >(tee launchable_stderr.log)
-          fi
-
-          ulimit -c unlimited
-          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"}
-        timeout-minutes: 60
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-
-      - name: make skipped tests
-        run: |
-          make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-          PRECHECK_BUNDLED_GEMS: 'no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.os }} / ${{ matrix.test_task }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-      - name: Resolve job ID
-        id: job_id
-        uses: actions/github-script@main
-        env:
-          matrix: ${{ toJson(matrix) }}
-        with:
-          script: |
-            const { data: workflow_run } = await github.rest.actions.listJobsForWorkflowRun({
-              owner: context.repo.owner,
-              repo: context.repo.repo,
-              run_id: context.runId
-            });
-            const matrix = JSON.parse(process.env.matrix);
-            const job_name = `${context.job}${matrix ? ` (${Object.values(matrix).join(", ")})` : ""}`;
-            return workflow_run.jobs.find((job) => job.name === job_name).id;
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: macos-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/mingw.yml b/.github/workflows/mingw.yml
deleted file mode 100644
index 8743785a3b..0000000000
--- a/.github/workflows/mingw.yml
+++ /dev/null
@@ -1,170 +0,0 @@
-name: MinGW
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-# Notes:
-# Actions console encoding causes issues, see test-all & test-spec steps
-#
-jobs:
-  make:
-    runs-on: windows-2022
-
-    name: ${{ github.workflow }} (${{ matrix.msystem }})
-
-    env:
-      MSYSTEM: ${{ matrix.msystem }}
-      MSYS2_ARCH: x86_64
-      CHOST: 'x86_64-w64-mingw32'
-      CFLAGS: '-march=x86-64 -mtune=generic -O3 -pipe'
-      CXXFLAGS: '-march=x86-64 -mtune=generic -O3 -pipe'
-      CPPFLAGS: '-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048'
-      LDFLAGS: '-pipe'
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-
-    strategy:
-      matrix:
-        include:
-          # To mitigate flakiness of MinGW CI, we test only one runtime that newer MSYS2 uses.
-          # Ruby 3.2 is the first Windows Ruby to use OpenSSL 3.x
-          - msystem: 'UCRT64'
-            baseruby: '3.2'
-            test_task: 'check'
-            test-all-opts: '--name=!/TestObjSpace#test_reachable_objects_during_iteration/'
-      fail-fast: false
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - name: Set up Ruby & MSYS2
-        uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: ${{ matrix.baseruby }}
-
-      - name: Misc system & package info
-        working-directory:
-        run: |
-          # show where
-          result=true
-          for e in gcc.exe ragel.exe make.exe libcrypto-3-x64.dll libssl-3-x64.dll; do
-            echo ::group::$'\033[93m'$e$'\033[m'
-            where $e || result=false
-            echo ::endgroup::
-          done
-          # show version
-          for e in gcc ragel make "openssl version"; do
-            case "$e" in *" "*) ;; *) e="$e --version";; esac
-            echo ::group::$'\033[93m'$e$'\033[m'
-            $e || result=false
-            echo ::endgroup::
-          done
-          # show packages
-          echo ::group::$'\033[93m'Packages$'\033[m'
-          pacman -Qs mingw-w64-ucrt-x86_64-* | sed -n "s,local/mingw-w64-ucrt-x86_64-,,p"
-          echo ::endgroup::
-          $result
-
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: configure
-        run: >
-          ../src/configure --disable-install-doc --prefix=/.
-          --build=$CHOST --host=$CHOST --target=$CHOST
-
-      - name: make all
-        timeout-minutes: 30
-        run: make -j4
-
-      - name: make install
-        run: make DESTDIR=../install install-nodoc
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: windows-2022
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          test-tasks: '["test", "test-all", "test-spec"]'
-        continue-on-error: true
-
-      - name: test
-        timeout-minutes: 30
-        run: make test
-        shell: cmd
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test' }}
-
-      - name: test-all
-        timeout-minutes: 45
-        shell: cmd
-        run: |
-          make ${{ StartsWith(matrix.test_task, 'test/') && matrix.test_task || 'test-all' }}
-        env:
-          RUBY_TESTOPTS: >-
-            --retry --job-status=normal --show-skip --timeout-scale=1.5 -j4
-            ${{ matrix.test-all-opts }}
-            ${{ env.TESTS }}
-          BUNDLER_VERSION:
-        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-all' || StartsWith(matrix.test_task, 'test/') }}
-
-      - name: test-spec
-        timeout-minutes: 10
-        run: |
-          make ${{ StartsWith(matrix.test_task, 'spec/') && matrix.test_task || 'test-spec' }}
-        shell: cmd
-        if: ${{ matrix.test_task == 'check' || matrix.test_task == 'test-spec' || StartsWith(matrix.test_task, 'spec/') }}
-
-      - uses: ./src/.github/actions/slack
-        with:
-          label: ${{ matrix.msystem }} / ${{ matrix.test_task }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
-    shell: sh
diff --git a/.github/workflows/modgc.yml b/.github/workflows/modgc.yml
deleted file mode 100644
index e7a1efe9d2..0000000000
--- a/.github/workflows/modgc.yml
+++ /dev/null
@@ -1,177 +0,0 @@
-name: ModGC
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  check:
-    strategy:
-      matrix:
-        gc:
-          - name: default
-          - name: mmtk
-            mmtk_build: release
-        os: [macos-latest, ubuntu-latest]
-        include:
-          - test_task: check
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci
-
-    runs-on: ${{ matrix.os }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - name: Install libraries (macOS)
-        uses: ./.github/actions/setup/macos
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - name: Install libraries (Ubuntu)
-        uses: ./.github/actions/setup/ubuntu
-        if: ${{ contains(matrix.os, 'ubuntu') }}
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-        if: ${{ contains(matrix.os, 'ubuntu') }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: false
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: make sure that kern.coredump=1
-        run: |
-          sysctl -n kern.coredump
-          sudo sysctl -w kern.coredump=1
-          sudo chmod -R +rwx /cores/
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - name: Delete unused SDKs
-        # To free up disk space to not run out during the run
-        run: |
-          sudo rm -rf ~/.dotnet
-          sudo rm -rf /Library/Android
-          sudo rm -rf /Library/Developer/CoreSimulator
-        continue-on-error: true
-        if: ${{ contains(matrix.os, 'macos') }}
-
-      - name: Setup Ruby GC Directory
-        run: |
-          echo "MODULAR_GC_DIR=$HOME/ruby_gc" >> $GITHUB_ENV
-
-      - name: Run configure
-        env:
-          arch: ${{ matrix.arch }}
-        run: >-
-          $SETARCH ../src/configure -C --disable-install-doc --with-modular-gc=${{ env.MODULAR_GC_DIR }}
-          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
-
-      - uses: actions-rust-lang/setup-rust-toolchain@v1
-      - name: Set MMTk environment variables
-        run: |
-          echo 'EXCLUDES=../src/test/.excludes-mmtk' >> $GITHUB_ENV
-          echo 'MSPECOPT=-B../src/spec/mmtk.mspec' >> $GITHUB_ENV
-        if: ${{ matrix.gc.name == 'mmtk' }}
-
-      - run: $SETARCH make
-
-      - name: Build Modular  GC
-        run: |
-          echo "RUBY_GC_LIBRARY=${{ matrix.gc.name }}" >> $GITHUB_ENV
-          make install-modular-gc MODULAR_GC=${{ matrix.gc.name }} MMTK_BUILD=${{ matrix.gc.mmtk_build }}
-          make distclean-modular-gc MODULAR_GC=${{ matrix.gc.name }}
-
-      - run: $SETARCH make hello
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ${{ matrix.os || 'ubuntu-22.04' }}
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: |
-          if [ -n "${LAUNCHABLE_ORGANIZATION}" ]; then
-            exec \
-            > >(tee launchable_stdout.log) \
-            2> >(tee launchable_stderr.log)
-          fi
-
-          $SETARCH make -s ${{ matrix.test_task }} \
-            ${TESTS:+TESTS="$TESTS"} \
-            ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
-        timeout-minutes: ${{ matrix.gc.timeout || 40 }}
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-
-      - name: make skipped tests
-        run: |
-          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/parsey.yml b/.github/workflows/parsey.yml
deleted file mode 100644
index eec4c81188..0000000000
--- a/.github/workflows/parsey.yml
+++ /dev/null
@@ -1,95 +0,0 @@
-name: parse.y
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: check
-          - test_task: test-bundler-parallel
-          - test_task: test-bundled-gems
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci
-      SETARCH: ${{ matrix.arch && format('setarch {0}', matrix.arch) }}
-
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc cppflags=-DRUBY_DEBUG --with-parser=parse.y
-
-      - run: make
-
-      - run: make TESTRUN_SCRIPT='-e "exit !RUBY_DESCRIPTION.include?(%[+PRISM])"' run
-
-      - name: make ${{ matrix.test_task }}
-        run: make -s ${{ matrix.test_task }} RUN_OPTS="$RUN_OPTS" SPECOPTS="$SPECOPTS"
-        env:
-          RUBY_TESTOPTS: ${{ matrix.testopts }}
-          EXCLUDES: '../src/test/.excludes-parsey'
-          RUN_OPTS: ${{ matrix.run_opts || '--parser=parse.y' }}
-          SPECOPTS: ${{ matrix.specopts || '-T --parser=parse.y' }}
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.run_opts }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/pr-playground.yml b/.github/workflows/pr-playground.yml
deleted file mode 100644
index cc06006142..0000000000
--- a/.github/workflows/pr-playground.yml
+++ /dev/null
@@ -1,127 +0,0 @@
-name: Post Playground link to PR
-on:
-  pull_request_target:
-    types: [labeled]
-  workflow_run:
-    workflows: ["WebAssembly"]
-    types: [completed]
-
-jobs:
-  post-summary:
-    name: Post Playground link
-    runs-on: ubuntu-latest
-    permissions:
-      pull-requests: write
-    # Post a comment only if the PR status check is passed and the PR is labeled with `Playground`.
-    # Triggered twice: when the PR is labeled and when PR build is passed.
-    if: >-
-      ${{ false
-      || (true
-        && github.event_name == 'pull_request_target'
-        && contains(github.event.pull_request.labels.*.name, 'Playground'))
-      || (true
-        && github.event_name == 'workflow_run'
-        && github.event.workflow_run.conclusion == 'success'
-        && github.event.workflow_run.event == 'pull_request')
-      }}
-    steps:
-      - uses: actions/github-script@60a0d83039c74a4aee543508d2ffcb1c3799cdea # v7.0.1
-        with:
-          github-token: ${{ secrets.GITHUB_TOKEN }}
-          script: |
-            const fs = require('fs/promises');
-
-            const buildWorkflowPath = '.github/workflows/wasm.yml';
-            const findSuccessfuBuildRun = async (pr) => {
-              const opts = github.rest.actions.listWorkflowRunsForRepo.endpoint.merge({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                status: 'success',
-                branch: pr.head.ref,
-              });
-              const runs = await github.paginate(opts);
-              const buildRun = runs.find(run => run.path == buildWorkflowPath);
-              return buildRun;
-            }
-
-            const postComment = async (body, pr) => {
-              const { data: comments } = await github.rest.issues.listComments({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                issue_number: pr.number,
-              });
-
-              const commentOpts = { owner: context.repo.owner, repo: context.repo.repo, body: comment };
-
-              const existingComment = comments.find(comment => comment.body.startsWith(magicComment));
-              if (existingComment) {
-                core.info(`Updating existing comment: ${existingComment.html_url}`);
-                await github.rest.issues.updateComment({
-                  ...commentOpts, comment_id: existingComment.id
-                });
-              } else {
-                await github.rest.issues.createComment({
-                  ...commentOpts, issue_number: pr.number
-                });
-              }
-            }
-
-            const derivePRNumber = async () => {
-              if (context.payload.pull_request) {
-                return context.payload.pull_request.number;
-              }
-              // Workaround for https://github.com/orgs/community/discussions/25220
-
-              const { data: { artifacts } } = await github.rest.actions.listWorkflowRunArtifacts({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                run_id: context.payload.workflow_run.id,
-              });
-              const artifact = artifacts.find(artifact => artifact.name == 'github-pr-info');
-              if (!artifact) {
-                throw new Error('Cannot find github-pr-info.txt artifact');
-              }
-
-              const { data } = await github.rest.actions.downloadArtifact({
-                owner: context.repo.owner,
-                repo: context.repo.repo,
-                artifact_id: artifact.id,
-                archive_format: 'zip',
-              });
-
-              await fs.writeFile('pr-info.zip', Buffer.from(data));
-              await exec.exec('unzip', ['pr-info.zip']);
-              return await fs.readFile('github-pr-info.txt', 'utf8');
-            }
-
-            const prNumber = await derivePRNumber();
-
-            const { data: pr } = await github.rest.pulls.get({
-              owner: context.repo.owner,
-              repo: context.repo.repo,
-              pull_number: prNumber,
-            });
-
-            core.info(`Checking if the PR ${prNumber} is labeled with Playground...`);
-            if (!pr.labels.some(label => label.name == 'Playground')) {
-              core.info(`The PR is not labeled with Playground.`);
-              return;
-            }
-
-            core.info(`Checking if the build is successful for ${pr.head.ref} in ${pr.head.repo.owner.login}/${pr.head.repo.name}...`);
-            const buildRun = await findSuccessfuBuildRun(pr);
-            if (!buildRun) {
-              core.info(`No successful build run found for ${buildWorkflowPath} on ${pr.head.ref} yet.`);
-              return;
-            }
-            core.info(`Found a successful build run: ${buildRun.html_url}`);
-
-            const runLink = `${process.env.GITHUB_SERVER_URL}/${process.env.GITHUB_REPOSITORY}/actions/runs/${process.env.GITHUB_RUN_ID}`;
-            const magicComment = `<!-- AUTO-GENERATED-COMMENT-PR-PLAYGROUND -->`;
-            const comment = `${magicComment}
-            **Try on Playground**: https://ruby.github.io/play-ruby?run=${buildRun.id}
-            This is an automated comment by [\`pr-playground.yml\`](${runLink}) workflow.
-            `;
-            core.info(`Comment: ${comment}`);
-            await postComment(comment, pr);
-
diff --git a/.github/workflows/publish.yml b/.github/workflows/publish.yml
deleted file mode 100644
index 5d4474d978..0000000000
--- a/.github/workflows/publish.yml
+++ /dev/null
@@ -1,18 +0,0 @@
-name: Start release workflow
-on:
-  push:
-    tags:
-      - '*'
-
-jobs:
-  notify:
-    runs-on: ubuntu-latest
-    steps:
-      - name: Build release package
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/actions/dispatches \
-            -d '{"event_type": "${{ github.ref }}"}'
diff --git a/.github/workflows/release.yml b/.github/workflows/release.yml
deleted file mode 100644
index 25916066d6..0000000000
--- a/.github/workflows/release.yml
+++ /dev/null
@@ -1,107 +0,0 @@
-name: Publish Ruby packages
-
-on:
-  repository_dispatch:
-    types:
-      - release
-  workflow_dispatch:
-    inputs:
-      version:
-        description: 'Version of the Ruby package to release'
-        required: true
-        default: '3.3.4'
-
-jobs:
-  release:
-    runs-on: ubuntu-latest
-    steps:
-      - uses: actions/checkout@v4
-
-      - uses: ruby/setup-ruby@v1
-        with:
-          ruby-version: 3.3.4
-
-      - name: Store Ruby version
-        run: |
-          echo "RUBY_VERSION=${{ github.event.client_payload.version || github.event.inputs.version }}" >> $GITHUB_ENV
-
-      - name: Store ABI version
-        run: echo "ABI_VERSION=$(echo ${{ env.RUBY_VERSION }} | cut -d '.' -f 1-2)" >> $GITHUB_ENV
-
-      - name: Copy draft package `/tmp` to `/pub` directory
-        run: tool/release.sh ${{ env.RUBY_VERSION }}
-        env:
-          AWS_ACCESS_KEY_ID: ${{ secrets.FTP_R_L_O_AWS_ACCESS_KEY_ID }}
-          AWS_SECRET_ACCESS_KEY: ${{ secrets.FTP_R_L_O_AWS_SECRET_ACCESS_KEY }}
-          AWS_DEFAULT_REGION: us-west-2
-
-      - name: Purge URLs of release package
-        run: |
-          curl -X POST \
-            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
-            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.gz
-          curl -X POST \
-            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
-            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.tar.xz
-          curl -X POST \
-            -H "Fastly-Key: ${{ secrets.FASTLY_PURGE_TOKEN }}" \
-            https://api.fastly.com/purge/cache.ruby-lang.org/pub/ruby/${{ env.ABI_VERSION }}/ruby-${{ env.RUBY_VERSION }}.zip
-
-      - name: Create a release on GitHub
-        run: |
-          RELEASE_TAG=$(echo v${{ env.RUBY_VERSION }} | sed 's/\./_/g')
-          echo $RELEASE_TAG
-          PREVIOUS_RELEASE_TAG=$(echo $RELEASE_TAG | awk 'BEGIN {FS="_"; OFS="_"}{ $NF=$NF-1; print }')
-          echo $PREVIOUS_RELEASE_TAG
-          tool/gen-github-release.rb $PREVIOUS_RELEASE_TAG $RELEASE_TAG --no-dry-run
-        env:
-          GITHUB_TOKEN: ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}
-
-      - name: Update versions index
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/actions/dispatches \
-            -d '{"event_type": "update_index"}'
-
-      - name: Build and push Docker images
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/docker-images/dispatches \
-            -d '{"event_type": "build", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}"}}'
-
-      - name: Build snapcraft packages
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/snap.ruby/dispatches \
-            -d '{"event_type": "build", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}"}}'
-
-      - name: Store the latest LTS version of OpenSSL
-        run: |
-          echo "OPENSSL_VERSION=`curl -s https://api.github.com/repos/openssl/openssl/releases | jq -r '.[].tag_name | select(startswith("openssl-3.0"))' | sort -Vr | head -n1 | cut -d'-' -f2`" >> $GITHUB_ENV
-
-      - name: Update ruby-build definition
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.RUBY_BUILD_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/rbenv/ruby-build/dispatches \
-            -d '{"event_type": "update-ruby", "client_payload": {"ruby_version": "${{ env.RUBY_VERSION }}", "openssl_version": "${{ env.OPENSSL_VERSION }}"}}'
-
-      - name: Update all-ruby definition
-        run: |
-          curl -L -X POST \
-            -H "Authorization: Bearer ${{ secrets.MATZBOT_GITHUB_WORKFLOW_TOKEN }}" \
-            -H "Accept: application/vnd.github+json" \
-            -H "X-GitHub-Api-Version: 2022-11-28" \
-            https://api.github.com/repos/ruby/all-ruby/dispatches \
-            -d '{"event_type": "update"}'
diff --git a/.github/workflows/scorecards.yml b/.github/workflows/scorecards.yml
deleted file mode 100644
index ef36e55c16..0000000000
--- a/.github/workflows/scorecards.yml
+++ /dev/null
@@ -1,72 +0,0 @@
-# This workflow uses actions that are not certified by GitHub. They are provided
-# by a third-party and are governed by separate terms of service, privacy
-# policy, and support documentation.
-
-name: Scorecards supply-chain security
-on:
-  # For Branch-Protection check. Only the default branch is supported. See
-  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#branch-protection
-  branch_protection_rule:
-  # To guarantee Maintained check is occasionally updated. See
-  # https://github.com/ossf/scorecard/blob/main/docs/checks.md#maintained
-  schedule:
-    - cron: '22 4 * * 2'
-  # push:
-  #   branches: [ "master" ]
-
-# Declare default permissions as read only.
-permissions: read-all
-
-jobs:
-  analysis:
-    name: Scorecards analysis
-    runs-on: ubuntu-latest
-    permissions:
-      # Needed to upload the results to code-scanning dashboard.
-      security-events: write
-      # Needed to publish results and get a badge (see publish_results below).
-      id-token: write
-      # Uncomment the permissions below if installing in a private repository.
-      # contents: read
-      # actions: read
-
-    steps:
-      - name: 'Checkout code'
-        uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          persist-credentials: false
-
-      - name: 'Run analysis'
-        uses: ossf/scorecard-action@62b2cac7ed8198b15735ed49ab1e5cf35480ba46 # v2.4.0
-        with:
-          results_file: results.sarif
-          results_format: sarif
-          # (Optional) Read-only PAT token. Uncomment the `repo_token` line below if:
-          # - you want to enable the Branch-Protection check on a *public* repository, or
-          # - you are installing Scorecards on a *private* repository
-          # To create the PAT, follow the steps in https://github.com/ossf/scorecard-action#authentication-with-pat.
-          repo_token: ${{ secrets.SCORECARD_READ_TOKEN }}
-
-          # Public repositories:
-          #   - Publish results to OpenSSF REST API for easy access by consumers
-          #   - Allows the repository to include the Scorecard badge.
-          #   - See https://github.com/ossf/scorecard-action#publishing-results.
-          # For private repositories:
-          #   - `publish_results` will always be set to `false`, regardless
-          #     of the value entered here.
-          publish_results: true
-
-      # Upload the results as artifacts (optional). Commenting out will disable uploads of run results in SARIF
-      # format to the repository Actions tab.
-      # - name: "Upload artifact"
-      #   uses: actions/upload-artifact@0b7f8abb1508181956e8e162db84b466c27e18ce # v3.1.2
-      #   with:
-      #     name: SARIF file
-      #     path: results.sarif
-      #     retention-days: 5
-
-      # Upload the results to GitHub's code scanning dashboard.
-      - name: 'Upload to code-scanning'
-        uses: github/codeql-action/upload-sarif@df409f7d9260372bd5f19e5b04e83cb3c43714ae # v3.27.9
-        with:
-          sarif_file: results.sarif
diff --git a/.github/workflows/spec_guards.yml b/.github/workflows/spec_guards.yml
deleted file mode 100644
index ee6252ba10..0000000000
--- a/.github/workflows/spec_guards.yml
+++ /dev/null
@@ -1,68 +0,0 @@
-name: Rubyspec Version Guards Check
-
-on:
-  push:
-    paths:
-      - '.github/workflows/spec_guards.yml'
-      - 'spec/**'
-      - '!spec/*.md'
-  pull_request:
-    paths:
-      - '.github/workflows/spec_guards.yml'
-      - 'spec/**'
-      - '!spec/*.md'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  rubyspec:
-    name: Rubyspec
-
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    strategy:
-      matrix:
-        # Specs from ruby/spec should still run on all supported Ruby versions.
-        # This also ensures the needed ruby_version_is guards are there, see spec/README.md.
-        ruby:
-          - ruby-3.1
-          - ruby-3.2
-          - ruby-3.3
-          - ruby-3.4
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: ${{ matrix.ruby }}
-          bundler: none
-
-      - run: gem install webrick
-
-      - run: ruby ../mspec/bin/mspec
-        working-directory: spec/ruby
-        env:
-          CHECK_LEAKS: true
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.ruby }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
deleted file mode 100644
index 8c72415cfb..0000000000
--- a/.github/workflows/ubuntu.yml
+++ /dev/null
@@ -1,163 +0,0 @@
-name: Ubuntu
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: check
-            configure: 'cppflags=-DVM_CHECK_MODE'
-          - test_task: check
-            arch: i686
-          - test_task: check
-            configure: '--disable-yjit'
-          - test_task: check
-            configure: '--enable-shared --enable-load-relative'
-          - test_task: test-bundler-parallel
-            timeout: 50
-          - test_task: test-bundled-gems
-          - test_task: check
-            os: ubuntu-24.04
-          - test_task: check
-            os: ubuntu-24.04-arm
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUBY_DEBUG: ci
-
-    runs-on: ${{ matrix.os || 'ubuntu-22.04' }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-        with:
-          arch: ${{ matrix.arch }}
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-        if: ${{ !endsWith(matrix.os, 'arm') }}
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          clean: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: Run configure
-        env:
-          arch: ${{ matrix.arch }}
-          configure: ${{ matrix.configure }}
-        run: >-
-          $SETARCH ../src/configure -C --disable-install-doc ${configure:-cppflags=-DRUBY_DEBUG}
-          ${arch:+--target=$arch-$OSTYPE --host=$arch-$OSTYPE}
-
-      - run: $SETARCH make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: $SETARCH make
-
-      - run: $SETARCH make hello
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ${{ matrix.os || 'ubuntu-22.04' }}
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: |
-          if [ -n "${LAUNCHABLE_ORGANIZATION}" ]; then
-            exec \
-            > >(tee launchable_stdout.log) \
-            2> >(tee launchable_stderr.log)
-          fi
-
-          $SETARCH make -s ${{ matrix.test_task }} \
-          ${TESTS:+TESTS="$TESTS"} \
-          ${{ !contains(matrix.test_task, 'bundle') && 'RUBYOPT=-w' || '' }}
-        timeout-minutes: ${{ matrix.timeout || 40 }}
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-
-      - name: make skipped tests
-        run: |
-          $SETARCH make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }}${{ matrix.arch }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: ubuntu-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/wasm.yml b/.github/workflows/wasm.yml
deleted file mode 100644
index 8861ec7fd6..0000000000
--- a/.github/workflows/wasm.yml
+++ /dev/null
@@ -1,181 +0,0 @@
-name: WebAssembly
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions: # added using https://github.com/step-security/secure-workflows
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        entry:
-#         # wasmtime can't compile non-optimized Asyncified binary due to locals explosion
-#         - { name: O0-debuginfo, optflags: '-O0', debugflags: '-g', wasmoptflags: '-O1' }
-#         - { name: O1,           optflags: '-O1', debugflags: ''  , wasmoptflags: '-O1' }
-          - { name: O2, optflags: '-O2', debugflags: '', wasmoptflags: '-O2' }
-#         - { name: O3,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O3' }
-#         # -O4 is equivalent to -O3 in clang, but it's different in wasm-opt
-#         - { name: O4,           optflags: '-O3', debugflags: ''  , wasmoptflags: '-O4' }
-#         - { name: Oz,           optflags: '-Oz', debugflags: ''  , wasmoptflags: '-Oz' }
-      fail-fast: false
-
-    env:
-      RUBY_TESTOPTS: '-q --tty=no'
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      WASI_SDK_VERSION_MAJOR: 25
-      WASI_SDK_VERSION_MINOR: 0
-      BINARYEN_VERSION: 113
-      WASMTIME_VERSION: v15.0.0
-
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-
-      - name: Install libraries
-        run: |
-          set -ex
-          sudo apt-get update -q || :
-          sudo apt-get install --no-install-recommends -q -y ruby make autoconf git wget
-
-          wasi_sdk_deb="wasi-sdk-${WASI_SDK_VERSION_MAJOR}.${WASI_SDK_VERSION_MINOR}-x86_64-linux.deb"
-          wget "https://github.com/WebAssembly/wasi-sdk/releases/download/wasi-sdk-${WASI_SDK_VERSION_MAJOR}/${wasi_sdk_deb}"
-          sudo dpkg -i "$wasi_sdk_deb"
-          rm -f "$wasi_sdk_deb"
-
-          mkdir build-sdk
-          pushd build-sdk
-
-          wasmtime_url="https://github.com/bytecodealliance/wasmtime/releases/download/${WASMTIME_VERSION}/wasmtime-${WASMTIME_VERSION}-x86_64-linux.tar.xz"
-          wget -O - "$wasmtime_url" | tar xJf -
-          sudo ln -fs "$PWD/wasmtime-${WASMTIME_VERSION}-x86_64-linux/wasmtime" /usr/local/bin/wasmtime
-
-          binaryen_tarball="binaryen-version_${BINARYEN_VERSION}-x86_64-linux.tar.gz"
-          binaryen_url="https://github.com/WebAssembly/binaryen/releases/download/version_${BINARYEN_VERSION}/${binaryen_tarball}"
-          wget -O - "$binaryen_url" | tar xfz -
-          sudo ln -fs "$PWD/binaryen-version_${BINARYEN_VERSION}/bin/wasm-opt" /usr/local/bin/wasm-opt
-        working-directory: src
-
-      - name: Set ENV
-        run: |
-          echo "WASI_SDK_PATH=/opt/wasi-sdk" >> $GITHUB_ENV
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      - name: Build baseruby
-        run: |
-          set -ex
-          mkdir ../baseruby
-          pushd ../baseruby
-          ../src/configure --prefix=$PWD/install
-          make
-          make install
-
-      - name: Download config.guess with wasi version
-        run: |
-          rm tool/config.guess tool/config.sub
-          ruby tool/downloader.rb -d tool -e gnu config.guess config.sub
-        working-directory: src
-
-      - name: Run configure
-        run: |
-          ../src/configure \
-            --host wasm32-unknown-wasi \
-            --with-baseruby=$PWD/../baseruby/install/bin/ruby \
-            --with-static-linked-ext \
-            --with-ext=cgi/escape,continuation,coverage,date,digest/bubblebabble,digest,digest/md5,digest/rmd160,digest/sha1,digest/sha2,etc,fcntl,json,json/generator,json/parser,objspace,pathname,rbconfig/sizeof,ripper,stringio,strscan,monitor \
-            LDFLAGS=" \
-              -Xlinker --stack-first \
-              -Xlinker -z -Xlinker stack-size=16777216 \
-            " \
-            optflags="${{ matrix.entry.optflags }}" \
-            debugflags="${{ matrix.entry.debugflags }}" \
-            wasmoptflags="${{ matrix.entry.wasmoptflags }} ${{ matrix.entry.debugflags }}"
-
-      # miniruby may not be built when cross-compling
-      - run: make mini ruby
-
-      - run: make install DESTDIR=$PWD/../install
-      - run: tar cfz ../install.tar.gz -C ../install .
-
-      - name: Upload artifacts
-        uses: actions/upload-artifact@604373da6381bf24206979c74d06a550515601b9 # v4.4.1
-        with:
-          name: ruby-wasm-install
-          path: ${{ github.workspace }}/install.tar.gz
-      - name: Show Playground URL to try the build
-        run: |
-          echo "Try on Playground: https://ruby.github.io/play-ruby?run=$GITHUB_RUN_ID" >> $GITHUB_STEP_SUMMARY
-
-      - name: Run basictest
-        run: wasmtime run ./../build/miniruby --mapdir /::./ -- basictest/test.rb
-        working-directory: src
-
-      - name: Run bootstraptest (no thread)
-        run: |
-          NO_THREAD_TESTS="$(grep -L Thread -R ./bootstraptest | awk -F/ '{ print $NF }' | uniq | sed -n 's/test_\(.*\).rb/\1/p' | paste -s -d, -)"
-          ruby ./bootstraptest/runner.rb --ruby="$(which wasmtime) run $PWD/../build/ruby --mapdir /::./ -- " --verbose "--sets=$NO_THREAD_TESTS"
-        working-directory: src
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.entry.name }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-      # Workaround for https://github.com/orgs/community/discussions/25220
-      - name: Save Pull Request number
-        if: ${{ github.event_name == 'pull_request' }}
-        run: echo "${{ github.event.pull_request.number }}" >> ${{ github.workspace }}/github-pr-info.txt
-      - uses: actions/upload-artifact@604373da6381bf24206979c74d06a550515601b9 # v4.4.1
-        if: ${{ github.event_name == 'pull_request' }}
-        with:
-          name: github-pr-info
-          path: ${{ github.workspace }}/github-pr-info.txt
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
deleted file mode 100644
index 09f33fa66f..0000000000
--- a/.github/workflows/windows.yml
+++ /dev/null
@@ -1,192 +0,0 @@
-name: Windows
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  make:
-    strategy:
-      matrix:
-        include:
-          - os: 2019
-            vc: 2015
-            vcvars: '10.0.14393.0 -vcvars_ver=14.0' # The oldest Windows 10 SDK w/ VC++ 2015 toolset (v140)
-            test_task: check
-          - os: 2019
-            vc: 2019
-            test_task: check
-          - os: 2022
-            vc: 2019
-            vcvars: '10.0.22621.0 -vcvars_ver=14.2' # The defautl Windows 11 SDK and toolset are broken at windows-2022
-            test_task: check
-          - os: 2022
-            vc: 2019
-            vcvars: '10.0.22621.0 -vcvars_ver=14.2'
-            test_task: test-bundled-gems
-      fail-fast: false
-
-    runs-on: windows-${{ matrix.os < 2022 && '2019' || matrix.os }}
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    name: Windows ${{ matrix.os }}/Visual C++ ${{ matrix.vc }} (${{ matrix.test_task }})
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      OS_VER: windows-${{ matrix.os < 2022 && '2019' || matrix.os }}
-      VCPKG_DEFAULT_TRIPLET: ${{ matrix.target || 'x64' }}-windows
-
-    steps:
-      - run: md build
-        working-directory:
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-          windows-toolchain: none
-
-      - name: Install libraries with scoop
-        run: |
-          Set-ExecutionPolicy -ExecutionPolicy RemoteSigned -Scope CurrentUser
-          iwr -useb get.scoop.sh | iex
-          Join-Path (Resolve-Path ~).Path "scoop\shims" >> $Env:GITHUB_PATH
-          scoop install vcpkg uutils-coreutils cmake@3.31.6
-        shell: pwsh
-
-      - name: Export GitHub Actions cache environment variables
-        uses: actions/github-script@v7
-        with:
-          script: |
-            core.exportVariable('ACTIONS_CACHE_URL', process.env.ACTIONS_CACHE_URL || '');
-            core.exportVariable('ACTIONS_RUNTIME_TOKEN', process.env.ACTIONS_RUNTIME_TOKEN || '');
-
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-
-      - name: setup env
-        # Available Ruby versions: https://github.com/actions/runner-images/blob/main/images/windows/Windows2019-Readme.md#ruby
-        # %TEMP% is inconsistent with %TMP% and test-all expects they are consistent.
-        # https://github.com/actions/virtual-environments/issues/712#issuecomment-613004302
-        run: |
-          ::- Set up VC ${{ matrix.vc }}
-          set vswhere="%ProgramFiles(x86)%\Microsoft Visual Studio\Installer\vswhere.exe"
-          for /f "delims=;" %%I in ('%vswhere% -latest -property installationPath') do (
-            set VCVARS="%%I\VC\Auxiliary\Build\vcvars64.bat"
-          )
-          set VCVARS
-          set | uutils sort > old.env
-          call %VCVARS% ${{ matrix.vcvars || '' }}
-          nmake -f nul
-          set TMP=%USERPROFILE%\AppData\Local\Temp
-          set TEMP=%USERPROFILE%\AppData\Local\Temp
-          set MAKEFLAGS=l
-          set /a TEST_JOBS=(15 * %NUMBER_OF_PROCESSORS% / 10) > nul
-          set | uutils sort > new.env
-          uutils comm -13 old.env new.env >> %GITHUB_ENV%
-          del *.env
-
-      - name: baseruby version
-        run: ruby -v
-
-      - name: compiler version
-        run: cl
-
-      - name: volume info
-        run: Get-Volume
-        shell: pwsh
-
-      - name: Install libraries with vcpkg
-        run: |
-          vcpkg install
-        working-directory: src
-        env:
-          VCPKG_BINARY_SOURCES: "clear;x-gha,readwrite"
-
-      # TODO: We should use `../src` instead of `D:/a/ruby/ruby/src`
-      - name: Configure
-        run: >-
-          ../src/win32/configure.bat --disable-install-doc
-          --with-opt-dir=D:/a/ruby/ruby/src/vcpkg_installed/%VCPKG_DEFAULT_TRIPLET%
-          --with-gmp
-
-      - run: nmake prepare-vcpkg
-
-      - run: nmake incs
-
-      - run: nmake extract-extlibs
-
-      # On all other platforms, test-spec depending on extract-gems (in common.mk) is enough.
-      # But not for this Visual Studio workflow. So here we extract gems before building.
-      - run: nmake extract-gems
-
-      - run: nmake
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: windows-${{ matrix.os < 2022 && '2019' || matrix.os }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          test-task: ${{ matrix.test_task || 'check' }}
-        continue-on-error: true
-        if: ${{ matrix.test_task != 'test-bundled-gems' }}
-
-      - run: nmake ${{ matrix.test_task || 'check' }}
-        env:
-          RUBY_TESTOPTS: -j${{ env.TEST_JOBS || 4 }}
-        timeout-minutes: 70
-
-      - uses: ./.github/actions/slack
-        with:
-          label: Windows ${{ matrix.os }} / VC ${{ matrix.vc }} / ${{ matrix.test_task || 'check' }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: windows-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
-    shell: cmd
diff --git a/.github/workflows/wsl.yml b/.github/workflows/wsl.yml
deleted file mode 100644
index e6b4133b76..0000000000
--- a/.github/workflows/wsl.yml
+++ /dev/null
@@ -1,75 +0,0 @@
-name: Ubuntu on WSL
-
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-jobs:
-  wsl:
-    runs-on: windows-latest
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - name: Install winget
-        uses: Cyberboss/install-winget@v1
-
-      - name: Install or update WSL
-        uses: Ubuntu/WSL/.github/actions/wsl-install@main
-        with:
-          distro: Ubuntu-24.04
-
-      - name: Install dependencies
-        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
-        with:
-         distro: Ubuntu-24.04
-         working-dir: /tmp/github/
-         exec: |
-            DEBIAN_FRONTEND=noninteractive sudo apt update
-            DEBIAN_FRONTEND=noninteractive sudo apt install -y ruby build-essential autoconf libssl-dev libyaml-dev zlib1g-dev libgmp-dev libffi-dev
-
-      - name: Check out the repository
-        uses: Ubuntu/WSL/.github/actions/wsl-checkout@main
-        with:
-          distro: Ubuntu-24.04
-          working-dir: /tmp/github/
-          submodules: true
-
-      - name: Build
-        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
-        with:
-         distro: Ubuntu-24.04
-         working-dir: /tmp/github/
-         exec: |
-            ./autogen.sh
-            ./configure --disable-install-doc
-            make ruby -j4
-            make extract-gems
-            make -j4
-
-      - name: Test
-        uses: Ubuntu/WSL/.github/actions/wsl-bash@main
-        with:
-         distro: Ubuntu-24.04
-         working-dir: /tmp/github/
-         exec: |
-            ./ruby -v
-            # make check TESTS="-j4" MSPECOPT="-j"
diff --git a/.github/workflows/yjit-macos.yml b/.github/workflows/yjit-macos.yml
deleted file mode 100644
index 8dd9e33aa5..0000000000
--- a/.github/workflows/yjit-macos.yml
+++ /dev/null
@@ -1,177 +0,0 @@
-name: YJIT macOS Arm64
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  cargo:
-    name: cargo test
-
-    runs-on: macos-14
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      - run: RUST_BACKTRACE=1 cargo test
-        working-directory: yjit
-
-      # Also compile and test with all features enabled
-      - run: RUST_BACKTRACE=1 cargo test --all-features
-        working-directory: yjit
-
-      # Check that we can build in release mode too
-      - run: cargo build --release
-        working-directory: yjit
-
-  make:
-    strategy:
-      matrix:
-        include:
-          - test_task: 'check'
-            configure: '--enable-yjit'
-            yjit_opts: '--yjit'
-          - test_task: 'check'
-            configure: '--enable-yjit=dev'
-            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
-            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
-      fail-fast: false
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUN_OPTS: ${{ matrix.yjit_opts }}
-      SPECOPTS: ${{ matrix.specopts }}
-
-    runs-on: macos-14
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - name: Install libraries
-        uses: ./.github/actions/setup/macos
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc ${{ matrix.configure }}
-
-      - run: make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: make
-
-      - name: Enable YJIT through ENV
-        run: echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
-
-      - name: Set test options for skipped tests
-        run: |
-          set -x
-          TESTS="$(echo "${{ matrix.skipped_tests }}" | sed 's| |$$/ -n!/|g;s|^|-n!/|;s|$|$$/|')"
-          echo "TESTS=${TESTS}" >> $GITHUB_ENV
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: macos-14
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          is-yjit: true
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: |
-          if [ -n "${LAUNCHABLE_ORGANIZATION}" ]; then
-            exec \
-            > >(tee launchable_stdout.log) \
-            2> >(tee launchable_stderr.log)
-          fi
-
-          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
-            RUN_OPTS="$RUN_OPTS" \
-            SPECOPTS="$SPECOPTS"
-        timeout-minutes: 60
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          SYNTAX_SUGGEST_TIMEOUT: '5'
-          PRECHECK_BUNDLED_GEMS: 'no'
-        continue-on-error: ${{ matrix.continue-on-test_task || false }}
-
-      - name: make skipped tests
-        run: |
-          make -s test-all TESTS="${TESTS//-n!\//-n/}"
-        env:
-          GNUMAKEFLAGS: ''
-          RUBY_TESTOPTS: '-v --tty=no'
-          PRECHECK_BUNDLED_GEMS: 'no'
-        if: ${{ matrix.test_task == 'check' && matrix.skipped_tests }}
-        continue-on-error: ${{ matrix.continue-on-skipped_tests || false }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }} ${{ matrix.yjit_opts }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: macos-14
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.github/workflows/yjit-ubuntu.yml b/.github/workflows/yjit-ubuntu.yml
deleted file mode 100644
index 7e4fd85965..0000000000
--- a/.github/workflows/yjit-ubuntu.yml
+++ /dev/null
@@ -1,230 +0,0 @@
-name: YJIT Ubuntu
-on:
-  push:
-    paths-ignore:
-      - 'doc/**'
-      - '**/man/*'
-      - '**.md'
-      - '**.rdoc'
-      - '**/.document'
-      - '.*.yml'
-  pull_request:
-    # Do not use paths-ignore for required status checks
-    # https://docs.github.com/en/pull-requests/collaborating-with-pull-requests/collaborating-on-repositories-with-code-quality-features/troubleshooting-required-status-checks#handling-skipped-but-required-checks
-  merge_group:
-
-concurrency:
-  group: ${{ github.workflow }} / ${{ startsWith(github.event_name, 'pull') && github.ref_name || github.sha }}
-  cancel-in-progress: ${{ startsWith(github.event_name, 'pull') }}
-
-permissions:
-  contents: read
-
-jobs:
-  cargo:
-    name: cargo test
-
-    # GitHub Action's image seems to already contain a Rust 1.58.0.
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      # For now we can't run cargo test --offline because it complains about the
-      # capstone dependency, even though the dependency is optional
-      #- run: cargo test --offline
-
-      - run: RUST_BACKTRACE=1 cargo test
-        working-directory: yjit
-
-      # Also compile and test with all features enabled
-      - run: RUST_BACKTRACE=1 cargo test --all-features
-        working-directory: yjit
-
-      # Check that we can build in release mode too
-      - run: cargo build --release
-        working-directory: yjit
-
-  lint:
-    name: cargo clippy
-
-    # GitHub Action's image seems to already contain a Rust 1.58.0.
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-
-      # Check that we don't have linting errors in release mode, too
-      - run: cargo clippy --all-targets --all-features
-        working-directory: yjit
-
-  make:
-    strategy:
-      fail-fast: false
-      matrix:
-        include:
-          - test_task: 'yjit-bindgen'
-            hint: 'To fix: use patch in logs'
-            configure: '--with-gcc=clang-14 --enable-yjit=dev'
-            libclang_path: '/usr/lib/llvm-14/lib/libclang.so.1'
-
-          - test_task: 'check'
-            # YJIT should be automatically built in release mode on x86-64 Linux with rustc present
-            #configure: "--enable-yjit RUSTC='rustc +1.58.0'"
-            configure: "RUSTC='rustc +1.58.0'"
-            rust_version: '1.58.0'
-
-          - test_task: 'check'
-            configure: '--enable-yjit=dev'
-
-          - test_task: 'check'
-            configure: '--enable-yjit=dev'
-            yjit_opts: '--yjit-call-threshold=1 --yjit-verify-ctx --yjit-code-gc'
-            specopts: '-T --yjit-call-threshold=1 -T --yjit-verify-ctx -T --yjit-code-gc'
-
-          - test_task: 'test-bundled-gems'
-            configure: '--enable-yjit=dev'
-
-          - test_task: 'yjit-bench'
-            configure: '--enable-yjit=dev'
-            yjit_bench_opts: '--yjit-stats'
-            continue-on-test_task: true
-
-    env:
-      GITPULLOPTIONS: --no-tags origin ${{ github.ref }}
-      RUN_OPTS: ${{ matrix.yjit_opts }}
-      YJIT_BENCH_OPTS: ${{ matrix.yjit_bench_opts }}
-      SPECOPTS: ${{ matrix.specopts }}
-      RUBY_DEBUG: ci
-      BUNDLE_JOBS: 8 # for yjit-bench
-      RUST_BACKTRACE: 1
-
-    runs-on: ubuntu-22.04
-
-    if: >-
-      ${{!(false
-      || contains(github.event.head_commit.message, '[DOC]')
-      || contains(github.event.head_commit.message, 'Document')
-      || contains(github.event.pull_request.title, '[DOC]')
-      || contains(github.event.pull_request.title, 'Document')
-      || contains(github.event.pull_request.labels.*.name, 'Documentation')
-      || (github.event_name == 'push' && github.event.pull_request.user.login == 'dependabot[bot]')
-      )}}
-
-    steps:
-      - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4.2.2
-        with:
-          sparse-checkout-cone-mode: false
-          sparse-checkout: /.github
-
-      - uses: ./.github/actions/setup/ubuntu
-
-      - uses: ruby/setup-ruby@d8d83c3960843afb664e821fed6be52f37da5267 # v1.231.0
-        with:
-          ruby-version: '3.0'
-          bundler: none
-
-      - uses: ./.github/actions/setup/directories
-        with:
-          srcdir: src
-          builddir: build
-          makeup: true
-          dummy-files: ${{ matrix.test_task == 'check' }}
-          # Set fetch-depth: 10 so that Launchable can receive commits information.
-          fetch-depth: 10
-
-      - name: Install Rust
-        if: ${{ matrix.rust_version }}
-        run: rustup install ${{ matrix.rust_version }} --profile minimal
-
-      - name: Run configure
-        run: ../src/configure -C --disable-install-doc --prefix=$(pwd)/install ${{ matrix.configure }}
-
-      - run: make incs
-
-      - run: make prepare-gems
-        if: ${{ matrix.test_task == 'test-bundled-gems' }}
-
-      - run: make
-
-      - name: Enable YJIT through ENV
-        run: echo "RUBY_YJIT_ENABLE=1" >> $GITHUB_ENV
-
-      # Check that the binary was built with YJIT
-      - name: Check YJIT enabled
-        run: ./miniruby --yjit -v | grep "+YJIT"
-
-      - name: Set up Launchable
-        uses: ./.github/actions/launchable/setup
-        with:
-          os: ubuntu-22.04
-          test-opts: ${{ matrix.configure }}
-          launchable-token: ${{ secrets.LAUNCHABLE_TOKEN }}
-          builddir: build
-          srcdir: src
-          is-yjit: true
-        continue-on-error: true
-
-      - name: make ${{ matrix.test_task }}
-        run: |
-          if [ -n "${LAUNCHABLE_ORGANIZATION}" ]; then
-            exec \
-            > >(tee launchable_stdout.log) \
-            2> >(tee launchable_stderr.log)
-          fi
-
-          make -s ${{ matrix.test_task }} ${TESTS:+TESTS="$TESTS"} \
-            RUN_OPTS="$RUN_OPTS" MSPECOPT=--debug SPECOPTS="$SPECOPTS" \
-            YJIT_BENCH_OPTS="$YJIT_BENCH_OPTS" YJIT_BINDGEN_DIFF_OPTS="$YJIT_BINDGEN_DIFF_OPTS"
-        timeout-minutes: 90
-        env:
-          RUBY_TESTOPTS: '-q --tty=no'
-          TEST_BUNDLED_GEMS_ALLOW_FAILURES: 'typeprof'
-          PRECHECK_BUNDLED_GEMS: 'no'
-          SYNTAX_SUGGEST_TIMEOUT: '5'
-          YJIT_BINDGEN_DIFF_OPTS: '--exit-code'
-          LIBCLANG_PATH: ${{ matrix.libclang_path }}
-        continue-on-error: ${{ matrix.continue-on-test_task || false }}
-
-      - name: Show ${{ github.event.pull_request.base.ref }} GitHub URL for yjit-bench comparison
-        run: echo "https://github.com/${BASE_REPO}/commit/${BASE_SHA}"
-        env:
-          BASE_REPO: ${{ github.event.pull_request.base.repo.full_name }}
-          BASE_SHA: ${{ github.event.pull_request.base.sha }}
-        if: ${{ matrix.test_task == 'yjit-bench' && startsWith(github.event_name, 'pull') }}
-
-      - uses: ./.github/actions/slack
-        with:
-          label: ${{ matrix.test_task }} ${{ matrix.configure }}
-          SLACK_WEBHOOK_URL: ${{ secrets.SIMPLER_ALERTS_URL }} # ruby-lang slack: ruby/simpler-alerts-bot
-        if: ${{ failure() }}
-
-  result:
-    if: ${{ always() }}
-    name: ${{ github.workflow }} result
-    runs-on: ubuntu-latest
-    needs: [make]
-    steps:
-      - run: exit 1
-        working-directory:
-        if: ${{ contains(needs.*.result, 'failure') || contains(needs.*.result, 'cancelled') }}
-
-defaults:
-  run:
-    working-directory: build
diff --git a/.gitignore b/.gitignore
index 0f3574115b..80c12594dd 100644
--- a/.gitignore
+++ b/.gitignore
@@ -3,55 +3,36 @@
 *-*-*.lib
 *.a
 *.bak
-*.bc
-*.bundle
 *.dSYM
 *.dmyh
 *.dylib
 *.elc
-*.i
-*.ii
 *.inc
 *.log
 *.o
-*.o.tmp
 *.obj
-*.old
 *.orig
-*.pch
 *.pdb
-*.rbinc
 *.rej
-*.s
 *.sav
-*.sl
-*.so
-*.so.*
 *.swp
 *.yarb
 *~
+.*-*
 .*.list
 .*.time
 .DS_Store
-.bundle
 .ccmalloc
 .ext
 .pc
 .ppack
 .svn
-.time
-.ruby-version
 Makefile
+Makefile.old
 cygruby*.def
 extconf.h
 y.output
 y.tab.c
-*.gcda
-*.gcno
-*.gcov
-*.vscode
-!misc/.vscode
-lcov*.info
 
 # /
 /*-fake.rb
@@ -61,13 +42,13 @@ lcov*.info
 /*.pc
 /*.rc
 /*_prelude.c
-/.downloaded-cache
-/.top-enc.mk
-/build*/
 /COPYING.LIB
-/ChangeLog
+/ChangeLog-*
+/ChangeLog.pre-alpha
+/ChangeLog.pre1_1
 /Doxyfile
 /GNUmakefile
+/GNUmakefile.old
 /README.atheos
 /README.fat-patch
 /README.v6
@@ -75,7 +56,6 @@ lcov*.info
 /archive
 /autom4te*.cache
 /automake
-/benchmark/benchmark-driver
 /beos
 /bmlog-*
 /breakpoints.gdb
@@ -99,9 +79,6 @@ lcov*.info
 /goruby
 /id.[ch]
 /largefile.h
-/lcov-c-out
-/lcov-rb-out
-/lcov-out
 /lex.c
 /libruby*.*
 /miniprelude.c
@@ -117,43 +94,28 @@ lcov*.info
 /ppack
 /prelude.c
 /preview
-/probes.dmyh
 /probes.h
 /rbconfig.rb
 /rename2.h
 /repack
 /revision.h
-/revision.tmp
-/ripper.tmp.y
 /riscos
 /rubicon
 /ruby
 /ruby-runner
-/ruby-runner.h
+/ruby-runner.c
 /ruby-man.rd.gz
-/rubyspec_temp
-/run.gdb
 /sizes.c
-/static-ruby
 /test.rb
-/test-coverage.dat
 /tmp
-/vcpkg_installed
 /transdb.h
 /uncommon.mk
 /verconf.h
 /verconf.mk
 /web
-
-# /bin/
-
-/bin/*.exe
-/bin/*.dll
-/bin/goruby
-/bin/ruby
+/yasmdata.rb
 
 # /benchmark/
-/benchmark/bm_require.data
 /benchmark/bmx_*.rb
 /benchmark/fasta.output.*
 /benchmark/wc.input
@@ -161,38 +123,25 @@ lcov*.info
 /enc/*.def
 /enc/*.exp
 /enc/*.lib
-/enc/jis/props.h
 /enc/unicode/data
 
-# /coroutine/
-!/coroutine/**/*.s
-!/coroutine/**/*.S
-
 # /enc/trans/
 /enc/trans/*.c
 /enc/trans/*.def
 /enc/trans/*.exp
 /enc/trans/*.lib
-
-# /exe/
-/exe/goruby
-/exe/ruby
+/enc/trans/.time
 
 # /ext/
 /ext/extinit.c
-/ext/configure-ext.mk
-/ext/*/exts.mk
-
-# /ext/-test-/cxxanyargs
-/ext/-test-/cxxanyargs/failure*.failed
 
 # /ext/-test-/win32/dln/
-/ext/-test-/win32/dln/dlntest.dll
 /ext/-test-/win32/dln/dlntest.exp
 /ext/-test-/win32/dln/dlntest.lib
 
-# /ext/-test-/gems
-/ext/-test-/gems
+# /ext/dl/callback/
+/ext/dl/callback/callback-*.c
+/ext/dl/callback/callback.c
 
 # /ext/etc/
 /ext/etc/constdefs.h
@@ -202,14 +151,10 @@ lcov*.info
 
 # /ext/rbconfig/
 /ext/rbconfig/sizeof/sizes.c
-/ext/rbconfig/sizeof/limits.c
 
 # /ext/ripper/
 /ext/ripper/eventids1.c
-/ext/ripper/eventids1.h
-/ext/ripper/.eventids2-check
 /ext/ripper/eventids2table.c
-/ext/ripper/ripper_init.c
 /ext/ripper/ripper.*
 /ext/ripper/ids1
 /ext/ripper/ids2
@@ -219,20 +164,15 @@ lcov*.info
 /ext/socket/constdefs.h
 /ext/socket/constdefs.c
 
+# /ext/tk/
+/ext/tk/config_list
+
 # /gems
 /gems/*.gem
-/gems/src
-/gems/*-*
-
-# /lib/
-/lib/ruby/[1-9]*.*
-/lib/ruby/vendor_ruby
 
-# /misc/
-/misc/**/__pycache__
-
-# for `make test-bundler`
-/.rspec_status
+# /spec/
+/spec/mspec
+/spec/rubyspec
 
 # /tool/
 /tool/config.guess
@@ -240,36 +180,4 @@ lcov*.info
 
 # /win32/
 /win32/*.ico
-
-
-# YJIT
-/yjit-bench
-/yjit_exit_locations.dump
-
-# /wasm/
-/wasm/tests/*.wasm
-
-# prism
-/lib/prism/compiler.rb
-/lib/prism/dispatcher.rb
-/lib/prism/dot_visitor.rb
-/lib/prism/dsl.rb
-/lib/prism/inspect_visitor.rb
-/lib/prism/mutation_compiler.rb
-/lib/prism/node.rb
-/lib/prism/reflection.rb
-/lib/prism/serialize.rb
-/lib/prism/visitor.rb
-/prism/api_node.c
-/prism/ast.h
-/prism/diagnostic.c
-/prism/diagnostic.h
-/prism/node.c
-/prism/prettyprint.c
-/prism/serialize.c
-/prism/token_type.c
-
-# tool/update-NEWS-gemlist.rb
-/bundled_gems.json
-/default_gems.json
-/gems/default_gems
+/win32/.time
diff --git a/.indent.pro b/.indent.pro
index 1d61cbcad1..6a207a0554 100644
--- a/.indent.pro
+++ b/.indent.pro
@@ -2,15 +2,12 @@
 -nbbb
 -nbc
 -br
--brs
 -nbs
 -ncdb
--nce
--cdw
--cli2
--cbi2
+-ce
+-cli0.5
 -ndj
--ncs
+-ei
 -nfc1
 -i4
 -l120
@@ -19,14 +16,6 @@
 -psl
 -sc
 -sob
--sbi4
--nut
--par
 
 -TID
 -TVALUE
--Tst_data_t
--Tst_index_t
--Tst_table
--Trb_data_type_t
--TFILE
diff --git a/.mailmap b/.mailmap
deleted file mode 100644
index 213a0f4916..0000000000
--- a/.mailmap
+++ /dev/null
@@ -1,431 +0,0 @@
-git[bot]                                <svn-admin@ruby-lang.org>
-git[bot]                                <svn-admin@ruby-lang.org> git <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-svn[bot]                                <svn-admin@ruby-lang.org> svn <svn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# a_matsuda
-Akira Matsuda                           <ronnie@dio.jp>
-Akira Matsuda                           <ronnie@dio.jp> <a_matsuda@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# aamine
-Minero Aoki                             <aamine@loveruby.net>
-Minero Aoki                             <aamine@loveruby.net> <aamine@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# akira
-akira yamada                            <akira@ruby-lang.org>
-## akira yamada                         <akira@ruby-lang.org> <akira@rice.p.arika.org>
-akira yamada                            <akira@ruby-lang.org> <akira@arika.org>
-akira yamada                            <akira@ruby-lang.org> <akira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# akiyoshi
-AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com>
-AKIYOSHI, Masamichi                     <masamichi.akiyoshi@hp.com> <akiyoshi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# akr
-Tanaka Akira                            <akr@fsij.org>
-Tanaka Akira                            <akr@fsij.org> <akr@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# arai
-Koji Arai                               <jca02266@nifty.ne.jp>
-Koji Arai                               <jca02266@nifty.ne.jp> <arai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# arton
-Akio Tajima                             <artonx@yahoo.co.jp>
-Akio Tajima                             <artonx@yahoo.co.jp> <arton@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# aycabta
-aycabta                                 <aycabta@gmail.com>
-aycabta                                 <aycabta@gmail.com> <aycabta@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ayumin
-Ayumu AIZAWA                            <ayumu.aizawa@gmail.com>
-Ayumu AIZAWA                            <ayumu.aizawa@gmail.com> <ayumin@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# azav
-Alexander Zavorine                      <alexandre.zavorine@nokia.com>
-Alexander Zavorine                      <alexandre.zavorine@nokia.com> <azav@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# charliesome
-Charlie Somerville                      <charliesome@ruby-lang.org>
-Charlie Somerville                      <charliesome@ruby-lang.org> <charliesome@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# dave
-Dave Thomas                             <dave@pragprog.com>
-Dave Thomas                             <dave@pragprog.com> <dave@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# davidflanagan
-David Flanagan                          <davidflanagan@ruby-lang.org>
-David Flanagan                          <davidflanagan@ruby-lang.org> <david@think32>
-David Flanagan                          <davidflanagan@ruby-lang.org> <david@davidflanagan.com>
-David Flanagan                          <davidflanagan@ruby-lang.org> <davidflanagan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# dblack
-David A. Black                          <dblack@rubypal.com>
-David A. Black                          <dblack@rubypal.com> <dblack@wobblini.net>
-David A. Black                          <dblack@rubypal.com> <dblack@superlink.net>
-David A. Black                          <dblack@rubypal.com> <dblack@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# drbrain
-Eric Hodel                              <drbrain@segment7.net>
-Eric Hodel                              <drbrain@segment7.net> <drbrain@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# duerst
-Martin Dürst                            <duerst@it.aoyama.ac.jp>
-Martin Dürst                            <duerst@it.aoyama.ac.jp> <duerst@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# eban
-WATANABE Hirofumi                       <eban@ruby-lang.org>
-WATANABE Hirofumi                       <eban@ruby-lang.org> <eban@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# emboss
-Martin Bosslet                          <Martin.Bosslet@gmail.com>
-Martin Bosslet                          <Martin.Bosslet@gmail.com> <Martin.Bosslet@googlemail.com>
-Martin Bosslet                          <Martin.Bosslet@gmail.com> <emboss@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# eregon
-Benoit Daloze                           <eregontp@gmail.com>
-Benoit Daloze                           <eregontp@gmail.com> <eregon@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# evan
-Evan Phoenix                            <evan@ruby-lang.org>
-Evan Phoenix                            <evan@ruby-lang.org> <evan@fallingsnow.net>
-Evan Phoenix                            <evan@ruby-lang.org> <evan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# glass
-Masaki Matsushita                       <glass.saga@gmail.com>
-Masaki Matsushita                       <glass.saga@gmail.com> <glass@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gogotanaka
-Kazuki Tanaka                           <gogotanaka@ruby-lang.org>
-Kazuki Tanaka                           <gogotanaka@ruby-lang.org> <gogotanaka@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gotoken
-Kentaro Goto                            <gotoken@gmail.com>
-Kentaro Goto                            <gotoken@gmail.com> <gotoken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gotoyuzo
-GOTOU Yuuzou                            <gotoyuzo@notwork.org>
-GOTOU Yuuzou                            <gotoyuzo@notwork.org> <gotoyuzo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# gsinclair
-Gavin Sinclair                          <gsinclair@soyabean.com.au>
-Gavin Sinclair                          <gsinclair@soyabean.com.au> <gsinclair@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# H_Konishi
-KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp>
-KONISHI Hiromasa                        <konishih@fd6.so-net.ne.jp> <H_Konishi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# headius
-Charles Oliver Nutter                   <headius@headius.com>
-Charles Oliver Nutter                   <headius@headius.com> <headius@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# hone
-Terence Lee                             <hone@heroku.com>
-Terence Lee                             <hone@heroku.com> <hone@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# hsbt
-Hiroshi SHIBATA                         <hsbt@ruby-lang.org>
-Hiroshi SHIBATA                         <hsbt@ruby-lang.org> <hsbt@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# iwamatsu
-Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org>
-Nobuhiro Iwamatsu                       <iwamatsu@nigauri.org> <iwamatsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# jeg2
-James Edward Gray II                    <james@graysoftinc.com>
-James Edward Gray II                    <james@graysoftinc.com> <jeg2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# jim
-Jim Weirich                             <jim@tardis.local>
-Jim Weirich                             <jim@tardis.local> <jim@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# k0kubun
-Takashi Kokubun                         <takashikkbn@gmail.com>
-Takashi Kokubun                         <takashikkbn@gmail.com> <k0kubun@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kanemoto
-Yutaka Kanemoto                         <kanemoto@ruby-lang.org>
-Yutaka Kanemoto                         <kanemoto@ruby-lang.org> <kanemoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# katsu
-UENO Katsuhiro                          <katsu@blue.sky.or.jp>
-UENO Katsuhiro                          <katsu@blue.sky.or.jp> <katsu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kazu
-Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com>
-Kazuhiro NISHIYAMA                      <zn@mbf.nifty.com> <kazu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# keiju
-Keiju Ishitsuka                         <keiju@ishitsuka.com>
-Keiju Ishitsuka                         <keiju@ishitsuka.com> <keiju@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# knu
-Akinori MUSHA                           <knu@iDaemons.org>
-Akinori MUSHA                           <knu@iDaemons.org> <knu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ko1
-Koichi Sasada                           <ko1@atdot.net>
-Koichi Sasada                           <ko1@atdot.net> <ko1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kosaki
-KOSAKI Motohiro                         <kosaki.motohiro@gmail.com>
-KOSAKI Motohiro                         <kosaki.motohiro@gmail.com> <kosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kosako
-K.Kosako                                <sndgk393@ybb.ne.jp>
-K.Kosako                                <sndgk393@ybb.ne.jp> <kosako@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kou
-Sutou Kouhei                            <kou@clear-code.com>
-Sutou Kouhei                            <kou@clear-code.com> <kou@cozmixng.org>
-Sutou Kouhei                            <kou@clear-code.com> <kou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# kouji
-Kouji Takao                             <kouji.takao@gmail.com>
-Kouji Takao                             <kouji.takao@gmail.com> <kouji@takao7.net>
-Kouji Takao                             <kouji.takao@gmail.com> <kouji@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ksaito
-Kazuo Saito                             <ksaito@uranus.dti.ne.jp>
-Kazuo Saito                             <ksaito@uranus.dti.ne.jp> <ksaito@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ktsj
-Kazuki Tsujimoto                        <kazuki@callcc.net>
-Kazuki Tsujimoto                        <kazuki@callcc.net> <ktsj@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# luislavena
-Luis Lavena                             <luislavena@gmail.com>
-Luis Lavena                             <luislavena@gmail.com> <luislavena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# mame
-Yusuke Endoh                            <mame@ruby-lang.org>
-## Yusuke Endoh                         <mame@ruby-lang.org> <mame@tsg.ne.jp>
-Yusuke Endoh                            <mame@ruby-lang.org> <mame@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# marcandre
-Marc-Andre Lafortune                    <github@marc-andre.ca>
-Marc-Andre Lafortune                    <ruby-core@marc-andre.ca>
-Marc-Andre Lafortune                    <ruby-core@marc-andre.ca> <marcandre@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# matz
-Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp>
-Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@ruby-lang.org>
-Yukihiro "Matz" Matsumoto               <matz@ruby.or.jp> <matz@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# michal
-Michal Rokos                            <michal@ruby-lang.org>
-Michal Rokos                            <michal@ruby-lang.org> <michal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# mneumann
-Michael Neumann                         <mneumann@ruby-lang.org>
-Michael Neumann                         <mneumann@ruby-lang.org> <mneumann@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# mrkn
-Kenta Murata                            <mrkn@mrkn.jp>
-Kenta Murata                            <mrkn@mrkn.jp> <muraken@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-Kenta Murata                            <mrkn@mrkn.jp> <3959+mrkn@users.noreply.github.com>
-Kenta Murata                            <mrkn@mrkn.jp> <mrkn@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nagachika
-nagachika                               <nagachika@ruby-lang.org>
-nagachika                               <nagachika@ruby-lang.org> <nagachika@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nagai
-Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp>
-Hidetoshi NAGAI                         <nagai@ai.kyutech.ac.jp> <nagai@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nahi
-Hiroshi Nakamura                        <nahi@ruby-lang.org>
-Hiroshi Nakamura                        <nahi@ruby-lang.org> <nahi@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nari
-Narihiro Nakamura                       <authornari@gmail.com>
-Narihiro Nakamura                       <authornari@gmail.com> <nari@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# naruse
-NARUSE, Yui                             <naruse@airemix.jp>
-NARUSE, Yui                             <naruse@airemix.jp> <naruse@ruby-lang.org>
-NARUSE, Yui                             <naruse@airemix.jp> <naruse@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ngoto
-Naohisa Goto                            <ngotogenome@gmail.com>
-Naohisa Goto                            <ngotogenome@gmail.com> <ngoto@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# nobu
-Nobuyoshi Nakada                        <nobu@ruby-lang.org>
-Nobuyoshi Nakada                        <nobu@ruby-lang.org> <nobu@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# normal
-Eric Wong                               <normal@ruby-lang.org>
-Eric Wong                               <normal@ruby-lang.org> <e@80x24.org>
-Eric Wong                               <normal@ruby-lang.org> <normal@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ntalbott
-Nathaniel Talbott                       <ntalbott@ruby-lang.org>
-Nathaniel Talbott                       <ntalbott@ruby-lang.org> <ntalbott@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ocean
-Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp>
-Hirokazu Yamamoto                       <ocean@m2.ccsnet.ne.jp> <ocean@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# odaira
-Rei Odaira                              <rodaira@us.ibm.com>
-Rei Odaira                              <rodaira@us.ibm.com> <Rei.Odaira@gmail.com>
-Rei Odaira                              <rodaira@us.ibm.com> <odaira@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# okkez
-okkez                                   <okkez000@gmail.com>
-okkez                                   <okkez000@gmail.com> <okkez@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# rhe
-Kazuki Yamaguchi                        <k@rhe.jp>
-Kazuki Yamaguchi                        <k@rhe.jp> <rhe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ryan
-Ryan Davis                              <ryand-github@zenspider.com>
-Ryan Davis                              <ryand-github@zenspider.com> <ryand-ruby@zenspider.com>
-Ryan Davis                              <ryand-github@zenspider.com> <ryan@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# samuel
-Samuel Williams                         <samuel.williams@oriontransfer.co.nz>
-Samuel Williams                         <samuel.williams@oriontransfer.co.nz> <samuel@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# seki
-Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp>
-Masatoshi SEKI                          <m_seki@mva.biglobe.ne.jp> <seki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ser
-Sean Russell                            <ser@germane-software.com>
-Sean Russell                            <ser@germane-software.com> <ser@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shigek
-Shigeo Kobayashi                        <shigek@ruby-lang.org>
-Shigeo Kobayashi                        <shigek@ruby-lang.org> <shigek@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shirosaki
-Hiroshi Shirosaki                       <h.shirosaki@gmail.com>
-Hiroshi Shirosaki                       <h.shirosaki@gmail.com> <shirosaki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# sho-h
-Sho Hashimoto                           <sho-h@ruby-lang.org>
-Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@netlab.jp>
-Sho Hashimoto                           <sho-h@ruby-lang.org> <sho.hsmt@gmail.com>
-Sho Hashimoto                           <sho-h@ruby-lang.org> <sho-h@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shugo
-Shugo Maeda                             <shugo@ruby-lang.org>
-Shugo Maeda                             <shugo@ruby-lang.org> <shugo@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# shyouhei
-卜部昌平                                    <shyouhei@ruby-lang.org>
-卜部昌平                                    <shyouhei@ruby-lang.org> <shyouhei@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# siena
-Siena.                                  <siena@faculty.chiba-u.jp>
-Siena.                                  <siena@faculty.chiba-u.jp> <siena@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# sonots
-sonots                                  <sonots@gmail.com>
-sonots                                  <sonots@gmail.com> <sonots@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# sorah
-Sorah Fukumori                          <her@sorah.jp>
-Sorah Fukumori                          <her@sorah.jp> <sorah@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# stomar
-Marcus Stollsteimer                     <sto.mar@web.de>
-Marcus Stollsteimer                     <sto.mar@web.de> <stomar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# suke
-Masaki Suketa                           <masaki.suketa@nifty.ne.jp>
-Masaki Suketa                           <masaki.suketa@nifty.ne.jp> <suke@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tadd
-Tadashi Saito                           <tad.a.digger@gmail.com>
-Tadashi Saito                           <tad.a.digger@gmail.com> <tadd@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tadf
-Tadayoshi Funaba                        <tadf@dotrb.org>
-Tadayoshi Funaba                        <tadf@dotrb.org> <tadf@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# takano32
-TAKANO Mitsuhiro                        <takano32@gmail.com>
-TAKANO Mitsuhiro                        <takano32@gmail.com> <takano32@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tarui
-Masaya Tarui                            <tarui@ruby-lang.org>
-Masaya Tarui                            <tarui@ruby-lang.org> <tarui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# technorama
-Technorama Ltd.                         <oss-ruby@technorama.net>
-Technorama Ltd.                         <oss-ruby@technorama.net> <technorama@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tenderlove
-Aaron Patterson                         <tenderlove@ruby-lang.org>
-Aaron Patterson                         <tenderlove@ruby-lang.org> <tenderlove@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# tmm1
-Aman Gupta                              <ruby@tmm1.net>
-Aman Gupta                              <ruby@tmm1.net> <tmm1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ts
-Guy Decoux                              <ts@moulon.inra.fr>
-Guy Decoux                              <ts@moulon.inra.fr> <ts@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# ttate
-Takaaki Tateishi                        <ttate@ttsky.net>
-## Takaaki Tateishi                     <ttate@ttsky.net> <ttate@kt.jaist.ac.jp>
-Takaaki Tateishi                        <ttate@ttsky.net> <ttate@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# uema2
-Takaaki Uematsu                         <uema2x@jcom.home.ne.jp>
-Takaaki Uematsu                         <uema2x@jcom.home.ne.jp> <uema2@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# usa
-U.Nakamura                              <usa@ruby-lang.org>
-U.Nakamura                              <usa@ruby-lang.org> <usa@garbagecollect.jp>
-U.Nakamura                              <usa@ruby-lang.org> <usa@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# wakou
-Wakou Aoyama                            <wakou@ruby-lang.org>
-Wakou Aoyama                            <wakou@ruby-lang.org> <wakou@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# wanabe
-wanabe                                  <s.wanabe@gmail.com>
-wanabe                                  <s.wanabe@gmail.com> <wanabe@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# watson1978
-Watson                                  <watson1978@gmail.com>
-Watson                                  <watson1978@gmail.com> <watson1978@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# wew
-William Webber                          <william@williamwebber.com>
-William Webber                          <william@williamwebber.com> <wew@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# why
-why the lucky stiff                     <why@ruby-lang.org>
-why the lucky stiff                     <why@ruby-lang.org> <why@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# xibbar
-Takeyuki FUJIOKA                        <xibbar@ruby-lang.org>
-Takeyuki FUJIOKA                        <xibbar@ruby-lang.org> <xibbar@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# yugui
-Yuki Yugui Sonoda                       <yugui@yugui.jp>
-Yuki Yugui Sonoda                       <yugui@yugui.jp> <yugui@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# yui-knk
-yui-knk                                 <spiketeika@gmail.com>
-yui-knk                                 <spiketeika@gmail.com> <yui-knk@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# yuki
-Yuki Nishijima                          <yuki24@hey.com>
-Yuki Nishijima                          <yuki24@hey.com> <mail@yukinishijima.net>
-Yuki Nishijima                          <yuki24@hey.com> <yuki@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# zsombor
-Dee Zsombor                             <zsombor@ruby-lang.org>
-Dee Zsombor                             <zsombor@ruby-lang.org> <zsombor@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
-
-# zzak
-zzak                                    <zzakscott@gmail.com>
-zzak                                    <zzakscott@gmail.com> <zzak@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
diff --git a/.rdoc_options b/.rdoc_options
deleted file mode 100644
index 7325a10edf..0000000000
--- a/.rdoc_options
+++ /dev/null
@@ -1,22 +0,0 @@
----
-page_dir: doc
-charset: UTF-8
-encoding: UTF-8
-main_page: index.md
-title: Documentation for Ruby development version
-visibility: :private
-rdoc_include:
-- doc
-
-exclude:
-- \Alib/irb
-- .gemspec\z
-
-autolink_excluded_words:
-- Class
-- Method
-- Module
-- Process
-- RDoc
-- Ruby
-- Set
diff --git a/.rspec_parallel b/.rspec_parallel
deleted file mode 100644
index aaff198a32..0000000000
--- a/.rspec_parallel
+++ /dev/null
@@ -1,2 +0,0 @@
---format progress
---format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
index ca68ed20ab..f87ffd3483 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -1,4 +1,3 @@
-# -*- YAML -*-
 # Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
 #
 # This file is  a part of the programming language  Ruby.  Permission is hereby
@@ -6,106 +5,97 @@
 # conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
 # details.
 
-# When you see Travis CI issues, or you are interested in understanding how to
-# manage, please check the link below.
-# https://github.com/ruby/ruby/wiki/CI-Servers#travis-ci
-
-# We enable Travis on the specific branches or forked repositories here.
-# https://docs.travis-ci.com/user/conditions-v1
-if: >-
-  (fork OR branch = master OR branch =~ /^ruby_\d_\d$/)
-  AND (commit_message !~ /(\[DOC\]|Document)/)
-  AND NOT (type = 'push' AND sender =~ /\[bot\]/)
+# This is  a Travis-CI  build configuration file.   The list  of configurations
+# available is located in
+#
+#     http://about.travis-ci.org/docs/user/build-configuration/
+#
+# and as Ruby itself is a project written in C language,
+#
+#     http://about.travis-ci.org/docs/user/languages/c/
+#
+# is also a good place to look at.
 
+# Language specification.
 language: c
+sudo: false
 
-os: linux
-
-dist: jammy
-
-git:
-  quiet: true
+# Compilers.  Several  compilers are  provided in Travis,  so we try  them all.
+# The value set here is visible via $CC environment variable.
+compiler:
+  - gcc
 
-env:
-  global:
-    - NPROC="$(nproc)"
-    - JOBS="-j${NPROC}"
-    # https://github.com/travis-ci/travis-build/blob/e411371dda21430a60f61b8f3f57943d2fe4d344/lib/travis/build/bash/travis_apt_get_options.bash#L7
-    - travis_apt_get_options='--allow-downgrades --allow-remove-essential --allow-change-held-packages'
-    - travis_apt_get_options="-yq --no-install-suggests --no-install-recommends $travis_apt_get_options"
-    # -g0 disables backtraces when SEGV. Do not set that.
-    - debugflags=-ggdb3
-    - RUBY_TESTOPTS="$JOBS -q --tty=no"
+os:
+  - linux
 
-.org.ruby-lang.ci.matrix-definitions:
-  - &gcc-11
-    compiler: gcc-11
-    before_install:
-      - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
-      - >-
-        tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install
-        gcc-11
-        g++-11
-        libffi-dev
-        libncurses-dev
-        libncursesw5-dev
-        libreadline-dev
-        libssl-dev
-        libyaml-dev
-        openssl
-        zlib1g-dev
-      - gcc-11 --version
-  - &ppc64le-linux
-    name: ppc64le-linux
-    arch: ppc64le
-    <<: *gcc-11
-  - &s390x-linux
-    name: s390x-linux
-    arch: s390x
-    <<: *gcc-11
-    env:
-      # Avoid possible test failures with the zlib applying the following patch
-      # on s390x CPU architecture.
-      # https://github.com/madler/zlib/pull/410
-      - DFLTCC=0
-
-matrix:
-  include:
-    - <<: *ppc64le-linux
-    - <<: *s390x-linux
-  allow_failures:
-    - name: ppc64le-linux
-    - name: s390x-linux
-  fast_finish: true
+# Dependencies.  Some  header files are missing  in a Travis' worker  VM, so we
+# have  to install  them.  The  "1.9.1" here  is OK.   It is  the  most adopted
+# version string  for Debian/Ubuntu, and  no dependencies have been  changed so
+# far since the 1.9.1 release.
+before_install:
+  - "CONFIG_FLAG="
+  - "JOBS='-j 4'"
 
+# Script is where the test runs.  Note  we just do "make test", not other tests
+# like  test-all, test-rubyspec.   This is  because  they take  too much  time,
+# enough for Travis to shut down the VM as being stalled.
 before_script:
-  - lscpu
-  - ./autogen.sh
-  - mkdir build
-  - cd build
-  - ../configure -C --disable-install-doc --prefix=$(pwd)/install
-  - make -s $JOBS
-  - make -s $JOBS install
-  # Useful info to report issues to the Ruby.
-  - $(pwd)/install/bin/ruby -v
-  # Useful info To report issues to the RubyGems.
-  - $(pwd)/install/bin/gem env
-
+  - "uname -a"
+  - "uname -r"
+  - "rm -fr .ext autom4te.cache"
+  - "echo $TERM"
+  - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
+  - "autoconf"
+  - "mkdir config_1st config_2nd"
+  - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
+  - "cp -pr config.status .ext/include config_1st"
+  - "make reconfig"
+  - "cp -pr config.status .ext/include config_2nd"
+  - "diff -ru config_1st config_2nd"
+  - "make after-update BASERUBY=ruby"
+  - "make -s $JOBS"
+  - "make update-rubyspec"
 script:
-  - make -s test
-  - ../tool/travis_wait.sh make -s test-all RUBYOPT="-w"
-  - ../tool/travis_wait.sh make -s test-spec
+  - "make test TESTOPTS=--color=never"
+  - "make test-all TESTOPTS='-q -j3 --color=never --job-status=normal'"
+  - "make test-rubyspec MSPECOPT=-fm"
+
+# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
+branches:
+  only:
+    - trunk
+    - ruby_2_0_0
+    - ruby_2_1
+    - ruby_2_2
+    - ruby_2_3
 
 # We want to be notified when something happens.
 notifications:
+  irc:
+    channels:
+      - "irc.freenode.org#ruby-core"
+      - "irc.freenode.org#ruby-ja"
+    on_success: change # [always|never|change] # default: always
+    on_failure: always # [always|never|change] # default: always
+    template:
+      - "%{message} by @%{author}: See %{build_url}"
+
+  # Update ruby-head installed on Travis CI so other projects can test against it.
   webhooks:
     urls:
-      # ruby-lang slack: ruby/simpler-alerts-bot (travis)
-      - secure: mRsoS/UbqDkKkW5p3AEqM27d4SZnV6Gsylo3bm8T/deltQzTsGzZwrm7OIBXZv0UFZdE68XmPlyHfZFLSP2V9QZ7apXMf9/vw0GtcSe1gchtnjpAPF6lYBn7nMCbVPPx9cS0dwL927fjdRM1vj7IKZ2bk4F0lAJ25R25S6teqdk=
-    on_success: never
-    on_failure: always
+      - "https://rubies.travis-ci.org/rebuild/ruby-head"
+    on_success: always
+    on_failure: never
+
   email:
-    recipients:
-      - jun.aruga@gmail.com
-    on_success: never
-    on_failure: always
+    - ko1c-failure@atdot.net
+    - shibata.hiroshi@gmail.com
+
+# Local Variables:
+# mode: YAML
+# coding: utf-8-unix
+# indent-tabs-mode: nil
+# tab-width: 4
+# fill-column: 79
+# default-justification: full
+# End:
diff --git a/BSDL b/BSDL
index 66d93598aa..a009caefea 100644
--- a/BSDL
+++ b/BSDL
@@ -4,10 +4,10 @@ Redistribution and use in source and binary forms, with or without
 modification, are permitted provided that the following conditions
 are met:
 1. Redistributions of source code must retain the above copyright
-   notice, this list of conditions and the following disclaimer.
+notice, this list of conditions and the following disclaimer.
 2. Redistributions in binary form must reproduce the above copyright
-   notice, this list of conditions and the following disclaimer in the
-   documentation and/or other materials provided with the distribution.
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
 
 THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
 ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index 35e79dd3b9..ffdf2dd4b8 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -1 +1,4 @@
-See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
+Please see the [official issue tracker] and wiki [HowToContribute].
+
+[official issue tracker]: https://bugs.ruby-lang.org
+[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index 48e5a96de7..a1f19ff99d 100644
--- a/COPYING
+++ b/COPYING
@@ -2,55 +2,55 @@ Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
 You can redistribute it and/or modify it under either the terms of the
 2-clause BSDL (see the file BSDL), or the conditions below:
 
-1. You may make and give away verbatim copies of the source form of the
-   software without restriction, provided that you duplicate all of the
-   original copyright notices and associated disclaimers.
+  1. You may make and give away verbatim copies of the source form of the
+     software without restriction, provided that you duplicate all of the
+     original copyright notices and associated disclaimers.
 
-2. You may modify your copy of the software in any way, provided that
-   you do at least ONE of the following:
+  2. You may modify your copy of the software in any way, provided that
+     you do at least ONE of the following:
 
-   a. place your modifications in the Public Domain or otherwise
-      make them Freely Available, such as by posting said
-      modifications to Usenet or an equivalent medium, or by allowing
-      the author to include your modifications in the software.
+       a) place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+	  modifications to Usenet or an equivalent medium, or by allowing
+	  the author to include your modifications in the software.
 
-   b. use the modified software only within your corporation or
-      organization.
+       b) use the modified software only within your corporation or
+          organization.
 
-   c. give non-standard binaries non-standard names, with
-      instructions on where to get the original software distribution.
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
 
-   d. make other distribution arrangements with the author.
+       d) make other distribution arrangements with the author.
 
-3. You may distribute the software in object code or binary form,
-   provided that you do at least ONE of the following:
+  3. You may distribute the software in object code or binary form,
+     provided that you do at least ONE of the following:
 
-   a. distribute the binaries and library files of the software,
-      together with instructions (in the manual page or equivalent)
-      on where to get the original distribution.
+       a) distribute the binaries and library files of the software,
+	  together with instructions (in the manual page or equivalent)
+	  on where to get the original distribution.
 
-   b. accompany the distribution with the machine-readable source of
-      the software.
+       b) accompany the distribution with the machine-readable source of
+	  the software.
 
-   c. give non-standard binaries non-standard names, with
-      instructions on where to get the original software distribution.
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
 
-   d. make other distribution arrangements with the author.
+       d) make other distribution arrangements with the author.
 
-4. You may modify and include the part of the software into any other
-   software (possibly commercial).  But some files in the distribution
-   are not written by the author, so that they are not under these terms.
+  4. You may modify and include the part of the software into any other
+     software (possibly commercial).  But some files in the distribution
+     are not written by the author, so that they are not under these terms.
 
-   For the list of those files and their copying conditions, see the
-   file LEGAL.
+     For the list of those files and their copying conditions, see the
+     file LEGAL.
 
-5. The scripts and library files supplied as input to or produced as
-   output from the software do not automatically fall under the
-   copyright of the software, but belong to whomever generated them,
-   and may be sold commercially, and may be aggregated with this
-   software.
+  5. The scripts and library files supplied as input to or produced as 
+     output from the software do not automatically fall under the
+     copyright of the software, but belong to whomever generated them, 
+     and may be sold commercially, and may be aggregated with this
+     software.
 
-6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-   IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-   WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-   PURPOSE.
+  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+     PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index 230376bc60..e50d01c8d1 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -2,50 +2,50 @@
 または以下に示す条件で本プログラムを再配布できます
 2-clause BSDLについてはBSDLファイルを参照して下さい．
 
-1. 複製は制限なく自由です．
+  1. 複製は制限なく自由です．
 
-2. 以下の条件のいずれかを満たす時に本プログラムのソースを
-   自由に変更できます．
+  2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+     自由に変更できます．
 
-   a.  ネットニューズにポストしたり，作者に変更を送付する
-       などの方法で，変更を公開する．
+     (a) ネットニューズにポストしたり，作者に変更を送付する
+         などの方法で，変更を公開する．
 
-   b.  変更した本プログラムを自分の所属する組織内部だけで
-       使う．
+     (b) 変更した本プログラムを自分の所属する組織内部だけで
+         使う．
 
-   c.  変更点を明示したうえ，ソフトウェアの名前を変更する．
-       そのソフトウェアを配布する時には変更前の本プログラ
-       ムも同時に配布する．または変更前の本プログラムのソー
-       スの入手法を明示する．
+     (c) 変更点を明示したうえ，ソフトウェアの名前を変更する．
+         そのソフトウェアを配布する時には変更前の本プログラ
+         ムも同時に配布する．または変更前の本プログラムのソー
+         スの入手法を明示する．
 
-   d.  その他の変更条件を作者と合意する．
+     (d) その他の変更条件を作者と合意する．
 
-3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
-   ルしたオブジェクトコードや実行形式でも配布できます．
+  3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+     ルしたオブジェクトコードや実行形式でも配布できます．
 
-   a.  バイナリを受け取った人がソースを入手できるように，
-       ソースの入手法を明示する．
+     (a) バイナリを受け取った人がソースを入手できるように，
+         ソースの入手法を明示する．
 
-   b.  機械可読なソースコードを添付する．
+     (b) 機械可読なソースコードを添付する．
 
-   c.  変更を行ったバイナリは名前を変更したうえ，オリジナ
-       ルのソースコードの入手法を明示する．
+     (c) 変更を行ったバイナリは名前を変更したうえ，オリジナ
+         ルのソースコードの入手法を明示する．
 
-   d.  その他の配布条件を作者と合意する．
+     (d) その他の配布条件を作者と合意する．
 
-4. 他のプログラムへの引用はいかなる目的であれ自由です．た
-   だし，本プログラムに含まれる他の作者によるコードは，そ
-   れぞれの作者の意向による制限が加えられる場合があります．
+  4. 他のプログラムへの引用はいかなる目的であれ自由です．た
+     だし，本プログラムに含まれる他の作者によるコードは，そ
+     れぞれの作者の意向による制限が加えられる場合があります．
 
-   それらファイルの一覧とそれぞれの配布条件などに付いては
-   LEGALファイルを参照してください．
+     それらファイルの一覧とそれぞれの配布条件などに付いては
+     LEGALファイルを参照してください．
 
-5. 本プログラムへの入力となるスクリプトおよび，本プログラ
-   ムからの出力の権利は本プログラムの作者ではなく，それぞ
-   れの入出力を生成した人に属します．また，本プログラムに
-   組み込まれるための拡張ライブラリについても同様です．
+  5. 本プログラムへの入力となるスクリプトおよび，本プログラ
+     ムからの出力の権利は本プログラムの作者ではなく，それぞ
+     れの入出力を生成した人に属します．また，本プログラムに
+     組み込まれるための拡張ライブラリについても同様です．
 
-6. 本プログラムは無保証です．作者は本プログラムをサポート
-   する意志はありますが，プログラム自身のバグあるいは本プ
-   ログラムの実行などから発生するいかなる損害に対しても責
-   任を持ちません．
+  6. 本プログラムは無保証です．作者は本プログラムをサポート
+     する意志はありますが，プログラム自身のバグあるいは本プ
+     ログラムの実行などから発生するいかなる損害に対しても責
+     任を持ちません．
diff --git a/ChangeLog b/ChangeLog
new file mode 100644
index 0000000000..2d26904f0b
--- /dev/null
+++ b/ChangeLog
@@ -0,0 +1,14558 @@
+Thu Dec 14 23:53:41 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/net/ftp/test_ftp.rb (process_port_or_eprt): merge a part of
+	  r56973 to pass the test introduced at previous commit.
+
+Thu Dec 14 22:55:05 2017  Shugo Maeda  <shugo@ruby-lang.org>
+
+	Fix a command injection vulnerability in Net::FTP.
+
+Thu Dec 14 22:35:19 2017  Eric Wong  <normalperson@yhbt.net>
+
+	webrick: compile RE correctly for beginning and end match
+
+	Using ^ and $ in regexps means we can accidentally get fooled
+	by "%0a" in HTTP request paths being decoded to newline
+	characters.  Use \A and \z to match beginning and end-of-string
+	respectively, instead.
+
+	Thanks to mame and hsbt for reporting.
+
+	* lib/webrick/httpserver.rb (MountTable#compile):
+	  use \A and \z instead of ^ and $
+	* lib/webrick/httpserver.rb (MountTable#normalize): use \z instead of $
+	* test/webrick/test_httpserver.rb (test_cntrl_in_path): new test
+
+Thu Dec 14 22:29:04 2017  Eric Wong  <normalperson@yhbt.net>
+
+	webrick: do not hang acceptor on slow TLS connections
+
+	OpenSSL::SSL::SSLSocket#accept may block indefinitely on clients
+	which negotiate the TCP connection, but fail (or are slow) to
+	negotiate the subsequent TLS handshake.  This prevents the
+	multi-threaded WEBrick server from accepting other connections.
+
+	Since the TLS handshake (via OpenSSL::SSL::SSLSocket#accept)
+	consists of normal read/write traffic over TCP, handle it in the
+	per-client thread, instead.
+
+	Furthermore, using non-blocking accept() is useful for non-TLS
+	sockets anyways because spurious wakeups are possible from
+	select(2).
+
+	* lib/webrick/server.rb (accept_client): use TCPServer#accept_nonblock
+	  and remove OpenSSL::SSL::SSLSocket#accept call
+	* lib/webrick/server.rb (start_thread): call OpenSSL::SSL::SSLSocket#acc
+ept
+	* test/webrick/test_ssl_server.rb (test_slow_connect): new test
+	  [ruby-core:83221] [Bug #14005]
+
+	webrick: fix up r60172
+
+	By making the socket non-blocking in r60172, TLS/SSL negotiation
+	via the SSL_accept function must handle non-blocking sockets
+	properly and retry on SSL_ERROR_WANT_READ/SSL_ERROR_WANT_WRITE.
+	OpenSSL::SSL::SSLSocket#accept cannot do that properly with a
+	non-blocking socket, so it must use non-blocking logic of
+	OpenSSL::SSL::SSLSocket#accept_nonblock.
+
+	Thanks to MSP-Greg (Greg L) for finding this.
+
+	* lib/webrick/server.rb (start_thread): use SSL_accept properly
+	  with non-blocking socket.
+	  [Bug #14013] [Bug #14005]
+
+	webrick: fix up r60172 and revert r60189
+
+	Thanks to MSP-Greg (Greg L) for helping with this.
+
+	* lib/webrick/server.rb (start_thread): ignore ECONNRESET, ECONNABORTED,
+	  EPROTO, and EINVAL on TLS negotiation errors the same way they
+	  were ignored before r60172 in the accept_client method of the
+	  main acceptor thread.
+	  [Bug #14013] [Bug #14005]
+
+	webrick: fix up r60172 and r60208
+
+	Thanks to MSP-Greg (Greg L) for helping with this.
+
+	* lib/webrick/server.rb (start_thread): fix non-local return
+	  introduced in r60208
+
+	webrick: fix up r60172 and r60210
+
+	Thanks to MSP-Greg (Greg L) for helping with this.
+
+	* lib/webrick/server.rb (start_thread): properly fix non-local return
+	  introduced in r60208 and r60210
+
+Thu Nov 30 23:37:08 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	parse.y: fix line in rescue
+
+	* parse.y (set_line_body, primary): fix line number of bodystmt as the
+	  beginning of the block. [Bug #13181]
+
+Thu Nov 30 23:29:00 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	Merge rubygems-2.6.14 changes.
+
+	It fixed http://blog.rubygems.org/2017/10/09/unsafe-object-deserialization-vulnerability.html
+
+Fri Sep 15 05:40:40 2017  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	fix --with-gmp (broken by r57490)
+
+	Looking at the generated shell script (also the autoconf manual), it
+	seems AC_SEARCH_LIBS() m4 macro does not define HAVE_LIBsomething C
+	preprocessor macros, unlike AC_CHECK_LIB() which does define them.
+	This previous change effectively killed building with GMP because
+	building that mode depends on existence of HAVE_LIBGMP. [Bug #13402]
+
+Thu Sep 14 20:25:55 2017  Yusuke Endoh  <mame@ruby-lang.org>
+
+	lib/webrick/log.rb: sanitize any type of logs
+
+	It had failed to sanitize some type of exception messages.  Reported and
+	patched by Yusuke Endoh (mame) at https://hackerone.com/reports/223363
+
+Thu Sep 14 13:32:39 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	parse.y: empty hash in defined
+
+	* parse.y (command): NODE_ARRAY with NULL is invalid.  traversal
+	  in defined_expr0 is simplified than iseq_compile_each0.
+	  [ruby-core:82113] [Bug #13756]
+
+Thu Sep 14 13:26:31 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	string.c: fix false coderange
+
+	* string.c (rb_enc_str_scrub): enc can differ from the actual encoding
+	  of the string, the cached coderange is useless then. [Bug #13874]
+
+Thu Sep 14 13:24:51 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	parse.y: primary should not be 0
+
+	* parse.y (primary): should not be 0, since it can be a receiver.
+	  [ruby-core:82447] [Bug #13836]
+
+Thu Sep 14 13:19:30 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	vm_method.c: alias warning at refined method
+
+	* vm_method.c (rb_method_entry_make): suppress a warning at
+	  refined method which will not be redefined.
+	  [ruby-core:82385] [Bug #13817]
+
+Thu Sep 14 13:14:19 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_hash): st_index_t may not be
+	  fixable on 64bit mswin/mingw.
+
+	* ext/date/date_core.c (d_lite_hash): ditto.
+	  [Backport #13877]
+
+	* ext/openssl/ossl_bn.c (ossl_bn_hash): ditto.
+
+Sat Sep  9 23:05:31 2017  Kazuki Yamaguchi <k@rhe.jp>
+
+	asn1: fix out-of-bounds read in decoding constructed objects
+
+	* OpenSSL::ASN1.{decode,decode_all,traverse}: have a bug of
+	  out-of-bounds read. int_ossl_asn1_decode0_cons() does not give the
+	  correct available length to ossl_asn1_decode() when decoding the
+	  inner components of a constructed object. This can cause
+	  out-of-bounds read if a crafted input given.
+
+	Reference: https://hackerone.com/reports/170316
+	https://github.com/ruby/openssl/commit/1648afef33c1d97fb203c82291b8a61269e85d3b
+
+Sat Sep  9 22:57:24 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/json: bump to version 1.8.3.1. [Backport #13853]
+
+Sat Sep  9 22:50:10 2017  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	A HTTP Header value must not contain CR or LF.
+	to_str -> to_s
+
+	* lib/net/http/header.rb (set_field): `val` can not have `to_str`.
+
+Sat Sep  9 22:42:22 2017  Kouhei Sutou  <kou@cozmixng.org>
+
+	* REXML: Fix a bug that unexpected methods can be called as a XPath
+	  function. [HackerOne:249295] Reported by Andrea Jegher. Thanks!!!
+
+Sat Sep  9 22:16:01 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: fix several vulnerabilities in RubyGems; bump to version
+	  2.5.2.1. [Backport #13842]
+
+Wed Aug  9 22:27:23 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_syntax.rb (test_invalid_{break,next}): use
+	  assert_in_out_err instead of assert_syntax_error because on ruby_2_3
+	  assert_syntax_error uses eval.
+
+Wed Aug  9 22:27:23 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each0): turned dregx context in "once"
+	  into "guarded" type from "block" type, to disallow `next`,
+	  `break`, `redo` as well as outside "once".
+	  [Bug #13690]
+
+Wed Aug  9 21:28:34 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_process.rb (test_rlimit_{name,value}): test in UTF-8
+	  encoding.  fix test failures introduced at r59531 on some platforms.
+
+Wed Aug  9 21:16:22 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (rb_marshal_dump_limited): do not free dump_arg, which
+	  may be dereferenced in check_dump_arg due to continuation, and
+	  get rid of dangling pointers.
+
+	* marshal.c (rb_marshal_load_with_proc): ditto for load_arg.
+
+Wed Aug  9 21:13:24 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): remove unused definition of unused
+	  variable derived from original patch.
+
+Wed Aug  9 19:45:16 2017  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	Init_frozen_strings definition is removed in r51511.
+	https://bugs.ruby-lang.org/issues/11423
+
+	Patch by Kohei Suzuki <eagletmt@gmail.com>
+
+	* internal.h: Remove declaration of unexist function
+	  [Fix GH-1558]
+
+Wed Aug  9 19:34:17 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (THROW_DATA_P): parenthesize the argument which is
+	  casted.
+
+Wed Aug  9 19:34:17 2017  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: get return_value from imemo_throw_data object (THROW_DATA_VAL()).
+	  imemo_throw_data (TAG_BREAK) contains returned value.
+	  However, imemo_throw_data (TAG_BREAK) can skip several frames so that
+	  we need to use it only once (at most internal frame). To record it,
+	  we introduced THROW_DATA_CONSUMED and check it.
+
+	* internal.h: define THROW_DATA_CONSUMED flag.
+
+	* test/ruby/test_settracefunc.rb: add tests for [Bug #13369]
+
+	* vm_insnhelper.h: add THROW_DATA_CONSUMED_P() and
+	  THROW_DATA_CONSUMED_SET().
+
+Wed Aug  9 19:32:17 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (get_rnd, try_get_rnd): ensure initialized to get rid
+	  of crash in forked processes. [Bug #13753]
+
+Wed Aug  9 19:30:34 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/strscan/strscan.c (strscan_aref): fix segfault after
+	  get_byte or getch which do not apply regexp.
+	  [Bug #13759]
+
+Wed Aug  9 19:28:40 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: add rpath flags which is needed for OPTDIR as well
+	  as -L options, when it is given. [Bug #13411]
+
+Wed Aug  9 19:14:07 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_throw_start): size of catch table has been
+	  included in iseq_catch_table struct, which could be NULL, since
+	  2.2. e.g., proc-closure in `once'. 
+
+Wed Aug  9 19:09:20 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* node.h (nd_line): should sign-extend.  shifting `VALUE` extends
+	  with zero bits if `sizeof(VALUE)` equals to `sizeof(int)`.  the
+	  zero bits are truncated if `sizeof(VALUE)` is bigger enough.
+	  [ruby-core:80920] [Bug #13523]
+
+Wed Aug  9 17:53:09 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): the lifetime of new_opt have to be
+	  until this case block is end.  this is a part of r57971.
+	  [Backport #13766]
+
+Wed Aug  9 17:35:47 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	this patch contains r54158, r57410, r57631 and r57954.
+
+	Prevent GC by volatile [Bug #13150]
+
+	test/ruby/test_marshal.rb test_context_switch (load) and test_gc (dump)
+	are failed on FreeBSD 10.3 and gcc7 (FreeBSD Ports Collection) 7.0.0
+	20170115 (experimental); RB_GC_GUARD looks not worked well.
+
+	* include/ruby/ruby.h (RB_GC_GUARD): prevent guarded pointer from
+	  optimization by using as an input to inline asm.
+
+	* ruby.h: remove comment
+
+	* include/ruby/ruby.h (RB_GC_GUARD): remove comment unsupported by
+	  Solaris AS.
+
+	Hidden objects (klass == 0) are not visible to Ruby code invoked
+	from other threads or signal handlers, so they can never be
+	accessed from other contexts.  This makes it safe to call
+	rb_gc_force_recycle on the object slot after releasing malloc
+	memory.
+
+	* marshal.c (rb_marshal_dump_limited): hide dump_arg and recycle when
+	  done (rb_marshal_load_with_proc): hide load_arg and recycle when done
+	  [ruby-core:79518]
+
+	* marshal.c (rb_marshal_dump_limited): do not free dump_arg, which
+	  may be dereferenced in check_dump_arg due to continuation, and
+	  get rid of dangling pointers.
+
+	* marshal.c (rb_marshal_load_with_proc): ditto for load_arg.
+
+Wed Aug  9 17:28:35 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (setup_exception): make unfrozen copy of special
+	  exception before setting up a cause.
+
+Wed Aug  9 17:22:29 2017  TAKANO `takano32' Mitsuhiro  <tak@no32.tk>
+
+	a64: fix crash on register stack mark/sweep pass
+
+	* thread_pthread.c: move 'register_stack_start' earlier.
+	  [ruby-core:79928] [Bug #13284] [Fix GH-1625]
+
+	Author:    Sergei Trofimovich <slyfox@gentoo.org>
+
+Wed Aug  9 17:10:27 2017  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/net/smtp/test_smtp.rb (test_tls_connect, test_tls_connect):
+	  use Socket.tcp_server_sockets in case localhost is resolved to ::1.
+
+Wed Aug  9 17:10:27 2017  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/smtp.rb (tlsconnect): support timeout for TLS handshake.
+	  [ruby-core:76893] [Bug #12678]
+
+	* lib/net/protocol.rb (ssl_socket_connect): new method to implement
+	  timeout for TLS handshake.
+
+	* lib/net/http.rb (connect): use Net::Protocol#ssl_socket_connect.
+
+Wed Aug  9 17:08:01 2017  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	Zlib::GzipReader#pos underflows after calling #ungetbyte or #ungetc at start of file [Bug #13616]
+
+	patched by Andrew Haines <andrew@haines.org.nz> [ruby-core:81488]
+	zlib.c: fix unnormalized Fixnum
+
+	* ext/zlib/zlib.c (rb_gzfile_total_out): cast to long not to
+	  result in an unsigned long to normalized to Fixnum on LLP64
+	  platforms.  [ruby-core:81488]
+
+Wed Aug  9 17:03:00 2017  Eric Wong  <normalperson@yhbt.net>
+
+	process.c: handle dynamic :rlimit_* symbols in spawn execopts
+
+	* process.c (rb_execarg_addopt_rlimit): hoist out of rb_execarg_addopt
+	  (rlimit_type_by_sym): new wrapper for dynamic symbol
+	  (rb_execarg_addopt): check for dsym via rlimit_type_by_sym
+	* test/ruby/test_process.rb (test_execopts_rlimit): check dsym w/o pindown
+	  Add extra check for bogus rlimit args, too.
+	  [ruby-core:82033] [Bug #13744]
+	process.c: null bytes
+
+	* process.c (rlimit_type_by_sym): prohibit null bytes in key
+	  names.  [ruby-core:82033] [Bug #13744]
+
+Wed Aug  9 16:56:52 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	optparse.rb: get rid of eval
+
+	* lib/optparse.rb: try Float() and Integer() instead of eval,
+	  which does too much things.
+
+
+Fri Jul  7 10:58:10 2017  Eric Wong  <e@80x24.org>
+
+	This backport of r58812 is necessary to ease backporting r59028,
+	which fixes a real bug.
+
+	* thread.c (struct waiting_fd): declare
+	  (rb_thread_io_blocking_region): use on-stack list waiter
+	  (rb_notify_fd_close): walk vm->waiting_fds instead
+	  (call_without_gvl): remove old field setting
+	  (th_init): ditto
+	  [Feature #9632]
+
+	* vm_core.h (typedef struct rb_vm_struct): add waiting_fds list
+
+	* (typedef struct rb_thread_struct): remove waiting_fd field
+	  (rb_vm_living_threads_init): initialize waiting_fds list
+
+	This should fix bad interactions with test_race_gets_and_close
+	in test/ruby/test_io.rb since we ensure rb_notify_fd_close
+	continues returning the busy flag after enqueuing the interrupt.
+
+	* thread.c (rb_notify_fd_close): do not enqueue multiple interrupts
+	  [ruby-core:81581] [Bug #13632]
+
+	* test/ruby/test_io.rb (test_single_exception_on_close):
+	  new test based on script from Nikolay
+
+Wed Jul  5 15:55:35 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/openssl/ossl_cipher.c: remove the encryption key initialization
+	  from Cipher#initialize. This is effectively a revert of r32723
+	  ("Avoid possible SEGV from AES encryption/decryption", 2011-07-28).
+	  the patch is derived from https://github.com/ruby/openssl/commit/8108e0a6db133f3375608303fdd2083eb5115062,
+	  written by Kazuki Yamaguchi.
+	  [Backport #8221]
+
+Sat Jul  1 00:28:22 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/yaml: update libyaml to 0.1.7.
+
+	* ext/psych/psych.gemspec: bump version to 2.1.0.1.
+
+Fri Jun 30 22:05:39 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_precise_mbclen): check invalid multibyte char at
+	  skipping strings following ?x literal string, not to stuck in a
+	  infinite loop. [Bug #13672]
+
+Fri Jun 30 22:00:56 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/pathname/lib/pathname.rb (Pathname#plus): UNC root pathname needs
+	  a separator. File.basename returns "/" on UNC root, as well as sole
+	  drive letter, even if it does not end with a separator. [Bug #13515]
+
+Fri Jun 30 21:57:27 2017  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/parsers/streamparser.rb: add close tag check on end of
+	  document to StreamParser [Bug #13636]
+	  Reported by Anton Sivakov. Thanks!!!
+
+Fri Jun 30 21:54:01 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_insert): check position to insert even if no elements
+	  to be inserted. [Bug #13558]
+
+Fri Jun 30 21:51:40 2017  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* ext/date/date_core.c: [DOC] fix documentation for %Z format of
+	  {Date,DateTime}.strftime.
+	  Reported by Damon Timm. Based on a patch by nano.
+	  [Bug #13231] [Fix GH-1565]
+
+Fri Jun 30 21:46:50 2017  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: Accept empty text element as valid element
+	  Parser has been accepted it but XML serializer wasn't accepted.
+	  Reported by stefano frabetti. Thanks!!!
+	  [Bug #13531]
+
+Fri Jun 30 21:40:42 2017  Kazuki Yamaguchi <k@rhe.jp>
+
+	* ext/openssl/ossl_x509store.c: clear error queue after calling
+	  X509_LOOKUP_load_file()
+
+	  X509_LOOKUP_load_file(), which ends up calling
+	  X509_load_cert_crl_file()
+	  internally, may leave error entries in the queue even when it returns
+	  non-zero value (which indicates success).
+
+	  This will be fixed by OpenSSL 1.1.1, but can be worked around by
+	  clearing the error queue ourselves.
+
+	  Fixes: [Backport #11033]
+
+Fri Jun 30 21:35:16 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (heap_page_allocate): expand sorted pages before inserting
+	  allocated new page. [Bug #12670]
+
+Fri Jun 30 21:33:39 2017  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (heap_page_resurrect): do not return tomb_pages when
+	  page->freelist == NULL.
+	  [Bug #12670]
+
+Fri Jun 30 21:23:20 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): sign and hex-prefix should not be counted
+	  in precision. [Bug #8916]
+
+Fri Jun 30 21:20:14 2017  Koichi Sasada  <ko1@atdot.net>
+
+	* thread.c (ruby_thread_stack_overflow): disable VM events when stack
+	  overflow occurred; it causes another stack overflow again in making
+	  backtrace object, and crashes. [Bug #13425]
+
+	* vm.c (hook_before_rewind): skip rewind hooks if err is
+	  SystemStackError because rewind hooks can cause stack overflow again
+	  and again.
+
+	* thread.c (ruby_thread_stack_overflow): do not disable all hooks.
+	  Additionally, clearing ruby_vm_event_flags is not suitable way
+	  to disable hooks.
+
+Fri Jun 30 21:13:25 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (method_super_method): skip prepended modules and continue from
+	  the super class of the original class. [Bug #13656]
+
+Fri Jun 30 21:10:48 2017  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/smtp.rb (getok, get_response): raise an ArgumentError when
+	  CR or LF is included in a line, because they are not allowed in
+	  RFC5321.  Thanks, Jeremy Daer.
+
+Fri Jun 30 21:07:56 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval.c (exc_setup_cause): need to unfreeze(=dup) the exception before
+	  setting cause if its frozen.
+
+Fri Jun 30 21:07:14 2017  Eric Wong  <e@80x24.org>
+
+	thread.c: avoid busy looping on rb_thread_fd_close
+
+	We no longer use it this function, but extensions do, and
+	we need to ensure it continues to work for them.
+
+	* thread.c (rb_thread_fd_close): schedule other threads in loop
+
+	* ext/-test-/thread_fd_close/thread_fd_close.c: new file
+
+	* ext/-test-/thread_fd_close/depend: ditto
+
+	* ext/-test-/thread_fd_close/extconf.rb: ditto
+
+	* test/-ext-/thread_fd_close/test_thread_fd_close.rb: new test
+
+Fri Jun 30 20:34:49 2017  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* sample/pty/shl.rb: update sample
+	  * Specify frozen_string_literal: true.
+	  * Fix TypeError of raise.
+	  * Use a character literal instead of Integer.
+
+Fri Jun 30 20:31:59 2017  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* string.c: [DOC] clarify docs for String#split when called with limit
+	  and capture groups. Reported by Cichol Tsai. [Bug #13621]
+
+Fri Jun 30 20:23:31 2017  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* lib/erb.rb: Allow explicit trimming carriage return when trim_mode is
+	  "-", for Windows environments. [Bug #5339]
+
+	* lib/erb.rb: Allow trimming CR in all trim_modes to unify a behavior
+	  with r58823 and r58825.
+
+Fri Jun 30 20:16:15 2017  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* lib/erb.rb: Allow trimming carriage return when trim_mode is "<>", for
+	  Windows environments. [Bug #11464]
+
+Fri Jun 30 20:07:37 2017  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* util.c (ruby_strtod) Merge latest dtoa.c [Bug #13545]
+	  Apply some part of http://www.netlib.org/fp/dtoa.c with my eyes...
+
+Fri Jun 30 20:00:18 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (is_case_sensitive): use getattrlist() if fgetattrlist() is
+	  unavailable, on OSX 10.5. [Bug #11054]
+
+Fri Jun 30 19:58:16 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/mkconfig.rb (RbConfig): prefix SDKROOT to oldincludedir
+	  not includedir, the latter is outside the ruby installation.
+	  [ruby-core:72496] [Bug #11881]
+
+Fri Jun 30 19:56:06 2017  Eric Wong  <e@80x24.org>
+
+	* variable.c (check_autoload_required): do not assume a provided feature
+	  means autoload is complete, always wait if autoload is being performed
+	  by another thread. [Bug #11384] Thanks to s.wanabe@gmail.com
+
+Fri Jun 30 19:53:30 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (obj2uid, obj2gid): use temporary string as the buffer
+	  instead of rb_alloc_tmp_buffer, which is NODE_ALLOCA since r51492.
+	  [Bug #13554]
+
+Fri Jun 30 19:50:25 2017  Eric Wong  <e@80x24.org>
+
+	* variable.c (autoload_reset): use idempotent list_del_init
+
+	* variable.c (autoload_sleep): moved code from rb_autoload_load
+
+	* variable.c (autoload_sleep_done): cleanup for use with rb_ensure
+
+	* variable.c (rb_autoload_load): ensure list delete happens in case the
+	  thread dies during sleep
+
+	* test/ruby/bug-13526.rb: new script for separate execution
+
+	* test/ruby/test_autoload.rb (test_bug_13526): new test [Bug #13526]
+
+Fri Jun 30 19:46:46 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): while "% 2f" and "% 4f" result in " Inf"
+	  and " Inf" respectively, "% 3f" results in "Inf" (no space).
+
+	* sprintf.c (rb_str_format): as for non-finite float, calculate the
+	  exact needed size with the space flag.
+
+Fri Jun 30 19:41:48 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread_win32.c (w32_wait_events): do not acquire GVL, to fix deadlock
+	  at read/close race condition. instead, just ignore interrupt_event if
+	  it is closed.
+
+	* thread_win32.c (w32_wait_events): fix wait object index in the case of
+	  interrupt_event is not usable.
+
+Fri Jun 30 19:37:47 2017  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (nogvl_wait_for_single_fd): nogvl_wait_for_single_fd must wait
+	  as its name.
+	  poll(fds, n, 0) mean no timeout and immediately return. If you want to
+	  wait something, you need to use -1 instead.
+
+Fri Jun 30 19:35:31 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (Init_class_hierarchy): prevent rb_cObject which is the class
+	  tree root, from GC. [Bug #12492]
+
+Fri Jun 30 19:32:52 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (Init_class_hierarchy): prevent rb_cObject which is the
+	  class tree root, from GC.  [ruby-dev:49666] [Bug #12492]
+
+Fri Jun 30 19:29:45 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): fix for nested
+	  indedented here documents, where Elems are nested too. [Bug #13536]
+
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): insert stripped
+	  leading spaces as on_ignored_sp elements, so that the original source
+	  can be reconsructed. [Bug #13536]
+
+Mon May  1 06:36:57 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* parse.y (parser_parse_string): set the mark of term to `nd_func`
+	  because in this version `u2.id` is not used for this purpose.
+	  fixed failure of ruby/spec introduced at r58518.
+	  see also [Backport #13363]
+
+Sun Apr 30 23:01:00 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	class.c: ensure_includable
+
+	* class.c (ensure_includable): extract checks to include and
+	  prepend.
+
+	class.c: prohibit refinement module
+
+	* class.c (ensure_includable): cannot include refinement
+	  module, or the type and the class do not match.
+	  [ruby-core:79632] [Bug #13236]
+
+Sun Apr 30 22:55:41 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	keep line number after unterminated string literal
+
+	* parse.y (parser_parse_string): keep line number even after an
+	  unterminated string literal.  it does not matter in the parser,
+	  ripper needs this value after this error.
+
+	parse.y: unterminated content token
+
+	* parse.y (parser_parse_string): defer the end token to next
+	  reading, to yield tSTRING_CONTENT with the unterminated content.
+	  [Bug #13363]
+
+Sun Apr 30 22:52:38 2017  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* io.c: [DOC] expand docs for IO#puts
+	  [Bug #13306]
+
+Sun Apr 30 22:38:44 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	sample/pty/shl.rb: update [ci skip]
+
+	* sample/pty/shl.rb: stop writer loop when the child exited.
+	  PTY::ChildExited no longer raises asynchronously since r20298.
+	  [ruby-dev:49974] [Bug #13191]
+
+	* sample/pty/shl.rb: use io/console instead of stty.
+	  [ruby-dev:49974] [Bug #13191]
+
+	* sample/pty/shl.rb: do not manage array length separately.
+	  [ruby-dev:49974] [Bug #13191]
+
+	* sample/pty/shl.rb: leap exited child process.
+	  [ruby-dev:49974] [Bug #13191]
+
+Sun Apr 30 22:35:10 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	configure.in: use AC_SEARCH_LIBS
+
+	* configure.in (--with-gmp, --with-jemalloc): use AC_SEARCH_LIBS
+	  to check if no library is required, instead of AC_CHECK_LIB.
+	  [ruby-core:79368] [Bug #13175]
+
+Sun Apr 30 22:24:25 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (flo_round): [EXPERIMENTAL] adjust the case that the
+	  receiver is close to the exact but unrepresentable middle value
+	  of two values in the given precision.
+	  http://d.hatena.ne.jp/hnw/20160702
+
+Sun Apr  9 22:21:23 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	thread.c: rb_thread_fd_close [ci skip]
+
+	* thread.c (rb_thread_fd_close): re-define because of a couple of
+	  external libraries used it.
+
+Wed Mar 29 23:47:31 2017  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* hash.c (any_hash): fix CI failure on L32LLP64 architecture.
+	  The patch was provided by usa. [ruby-core:80484] [Bug #13376]
+
+Wed Mar 29 06:22:27 2017  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* hash.c (any_hash): fix Symbol#hash to be nondeterministic.
+	  The patch was provided by Eric Wong. [ruby-core:80433] [Bug #13376]
+
+	* test/ruby/test_symbol.rb: add test for above.
+
+Tue Mar 28 00:38:39 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (poll_child_status): rb_w32_wait_events_blocking() sets
+	  errno internally, then should not set it here.
+
+Mon Mar 27 20:15:17 2017  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* eval.c, method.h, proc.c, vm.c, vm_eval.c, vm_insnhelper.c, vm_method.c:
+	  TracePoint#method_id should return method_id, not callee_id.
+	  [ruby-core:77241] [Feature #12747]
+
+	* test/ruby/test_settracefunc.rb: change accordingly.
+
+Mon Mar 27 20:12:23 2017  Anton Davydov  <mail@davydovanton.com>
+
+	* lib/uri/mailto.rb: Removed needless `return` and use `.`` instead of `::`
+	  with class method.
+	* test/uri/test_mailto.rb: Added tests for coverage.
+
+Mon Mar 20 06:35:08 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): convert -e script to the encoding
+	  given by a command line option on Windows.  assume it is the
+	  expected encoding.  [ruby-dev:49461] [Bug #11900]
+
+Mon Mar 20 05:47:49 2017  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_exception.rb: fix thread issues.
+	  * use Queue instead of a local variable for synchronization.
+	  * join created thread to soleve leaking threads warning.
+
+Mon Mar 20 05:47:49 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_threadptr_raise): set cause from the called thread,
+	  but not from the thread to be interrupted.
+	  [ruby-core:77222] [Bug #12741]
+
+Wed Feb  8 02:17:02 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/forwardable.rb (Forwardable._delegator_method): extract
+	  method generator and deal with non-module objects.
+	  [ruby-dev:49656] [Bug #12478]
+
+Wed Feb  8 02:17:02 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/forwardable.rb (def_instance_delegator): adjust backtrace of
+	  method body by tail call optimization.  adjusting the delegated
+	  target is still done by deleting backtrace.
+
+	* lib/forwardable.rb (def_single_delegator): ditto.
+
+Tue Jan 17 03:51:48 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (setup_args): duplicate splatting array if more
+	  arguments present to obey left-to-right execution order.
+	  [ruby-core:77701] [Bug# 12860]
+
+Thu Nov 24 05:47:18 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/fileutils/test_fileutils.rb (TestFileUtils#setup): Use primary
+	  group as well as supplementary groups.
+	  based on the patch by Vit Ondruch at [Bug #12910]
+
+Thu Nov 24 05:44:04 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/ruby/test_dir_m17n.rb: Don't encode to UTF-8 if it's unnecessary.
+	  If the file system encoding is ISO-8851-1 or if the encoding of the
+	  target string is invalid, don't encode to UTF-8. [Bug#12972]
+
+Mon Nov 21 16:55:15 2016  boshan  <boshan@subsplash.com>
+
+	* lib/tempfile.rb (Tempfile#initialize): [DOC] the first parameter
+	  `basename` is optional and defaulted to an empty string since
+	  [GH-523].  [Fix GH-1225]
+
+Sat Nov 19 14:06:07 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* iseq.c (proc_dup): don't duplicate sym_procs.  [Fix GH-1479]
+	  [ruby-core:78100] [Bug #12927]
+	  Based on the patch provided by Emiliano Ritiro.
+
+Sat Nov 19 11:48:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* iseq.c (iseqw_s_compile_file): deal with syntax error as well as
+	  compile, and should not abort when rescued.
+
+Wed Nov 16 23:40:29 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* vm_eval.c (vm_call0_body): refined module should not be skipped as
+	  prepended. [Bug #12920]
+
+Tue Nov 15 03:14:02 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/-test/file/fs.c (get_atime_p): Updating of file access times
+	  is enabled or not.
+
+Tue Nov 15 03:14:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_file.rb (TestFile#test_stat): fix noatime case.
+	  [ruby-core:77943] [Bug #12903]
+
+Tue Nov 15 03:09:39 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/rinda/test_rinda.rb (test_make_socket_ipv6_multicast,
+	  test_make_socket_ipv6_multicast_hops): skip if IPv6 multicast 
+	  address is not available.
+
+Tue Nov 15 02:49:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (vm_call0_body): follow the original class, not to
+	  loop the prepended module.  [ruby-core:77784] [Bug #12876]
+
+Tue Nov 15 02:45:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (transport_request): other than HTTPContinue
+	  in 1xx (HTTPInformation) also needs to continue. [Bug #12890]
+
+Sat Nov 12 01:05:45 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* object.c: Improve documentation for Float conversion.
+	  [ruby-core:71661][Bug #11736][ci skip]
+
+Sat Nov 12 00:50:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (mnew_internal): follow the original class, not to loop
+	  the prepended module.  [ruby-core:77591] [Bug #12832]
+
+Sat Nov 12 00:46:50 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* cont.c (cont_new): disable optimization if clang's version is
+	  3.8.0.  [ruby-core:77894] [Bug #12893]
+
+Sat Nov 12 00:27:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): enable tail call
+	  optimization inside a conditional block.
+
+Sat Nov  5 11:53:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (copy_stream_body): use IO to write to copy to duplex IO.
+	  http://twitter.com/knu/status/786505317974585344
+
+Sat Nov  5 11:49:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): format exact number more exactly.
+
+Sat Nov  5 11:45:32 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl.c (Init_openssl): register an ex_data index for
+	  X509_STORE and X509_STORE_CTX respectively. Since they don't share
+	  the ex_data index registry, we can't use the same index.
+	  (ossl_verify_cb): use the the correct index.
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_verify_callback): ditto.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_vfy_cb): ditto.
+	  (ossl_x509stctx_verify): ditto.
+
+	* ext/openssl/ossl.h (void ossl_clear_error): add extern declarations
+	  of ossl_store_{ctx_,}ex_verify_cb_idx.
+
+	* ext/openssl/openssl_missing.c: remove X509_STORE_set_ex_data and
+	  X509_STORE_get_ex_data.
+
+	* ext/openssl/openssl_missing.h: implement X509_STORE_get_ex_data,
+	  X509_STORE_set_ex_data and X509_STORE_get_ex_new_index as macros.
+
+Sat Nov  5 11:35:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_pending_interrupt_p): no pending interrupt
+	  before initialization.
+
+	* thread.c (thread_raise_m, rb_thread_kill): uninitialized thread
+	  cannot interrupt.  [ruby-core:72732] [Bug #11959]
+
+Sat Nov  5 11:16:58 2016  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c: Import changes from ruby/bigdecimal
+	  repository.
+
+Tue Oct 18 02:58:22 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* eval_intern.h (TH_PUSH_TAG): Initialize struct rb_vm_tag::tag with
+	  Qundef rather than 0 which is equal to Qfalse. Since Kernel#throw(obj)
+	  searches a tag with rb_vm_tag::tag == obj, throw(false) can
+	  accidentally find an unrelated tag which is not created by
+	  Kernel#catch.  [ruby-core:77229] [Bug #12743]
+
+	* test/ruby/test_exception.rb (test_throw_false): Add a test case for
+	  this.
+
+Tue Oct 18 02:24:29 2016  Aurelien Jacobs  <aurel@gnuage.org>
+
+	* lib/logger.rb (Logger::Period#next_rotate_time): fix monthly log
+	  rotate when DST is applied during a month of 31 days.
+	  [Fix GH-1458]
+
+Wed Oct 12 22:31:09 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* tool/downloader.rb: Removed verification of gem certification.
+	  Because signed gem is not working on rubygems ecosystem.
+	* tool/gem-unpack.rb: ditto.
+
+Fri Oct  7 02:48:06 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* lib/rubygems/ssl_certs/GlobalSignRootCA.pem: add for RugyGems.org.
+
+Mon Sep 26 23:51:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_const_search): raise with the actual class/module
+	  name which defines the private constant.
+
+Mon Sep 26 23:34:09 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): pop errors
+	  leaked by PKCS12_parse(). This is a bug in OpenSSL, which exists
+	  in the versions before the version 1.0.0t, 1.0.1p, 1.0.2d.
+
+Mon Sep 26 23:10:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_dump.c (backtrace): use rip in the saved context for the case
+	  the SIGSEGV is received when the process is in userland.
+	  Note that ip in the stack should be used if the signal is received
+	  when it is in kernel (when it is calling syscall) [Bug #12711]
+
+Mon Sep 26 20:23:32 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* gems/bundled_gems: update minitest to 5.8.5.
+
+	* tool/downloader.rb: revert workarounds.
+
+	* tool/gem-unpack.rb: ditto.
+
+Mon Sep 26 07:26:44 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* tool/gem-unpack.rb: don't set security policy.
+	  workaround for certificate expiration of minitest-5.8.3.gem.
+
+Mon Sep 26 06:33:16 2016  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* lib/uri/generic.rb (def check_password): don't include bad password
+	  in URI exception output
+
+	* test/uri/test_generic.rb (def test_set_component): test for behavior
+
+Mon Sep 26 06:20:58 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* tool/downloader.rb: comment out gem package verification.
+	  workaround for certificate expiration of minitest-5.8.3.gem.
+
+Sun Sep 25 16:37:22 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (nogvl_fsync, nogvl_fdatasync): on Windows, just ignore if the
+	  fd is associated to non-disk device.  if call fsync and/or fdatasync
+	  with such fds, it causes Errno::EBADF exception and the behavior is
+	  incompatible with ruby 2.1 and earlier unintentionally introduced.
+
+Sun Sep 25 15:09:04 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* array.c (flatten): use rb_obj_class instead of rb_class_of
+	  because rb_class_of may return a singleton class.
+	  [ruby-dev:49781] [Bug #12738]
+
+Sun Sep 25 15:07:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/irb.1: remove useless -width option.
+	  [ruby-dev:49767] [Bug #12692]
+
+Tue Aug 30 05:24:33 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_x509ext.c: additional fix memory leak.
+	  [ruby-core:76922] [Bug #12680]
+
+	* text/openssl/test_x509ext.rb: test for above.
+
+Sun Aug 28 00:26:58 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* vm_method.c: revert r55869. it breaks Integer#days with
+	  ActiveSupport-4.1.x. [ruby-core:76949] [Bug #12353]
+
+	* test/ruby/test_marshal.rb: ditto.
+
+Sat Aug 27 03:51:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* id_table.c (hash_table_extend): should not shrink the table than
+	  the previous capacity.  [ruby-core:76534] [Bug #12614]
+
+Sat Aug 27 03:37:49 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_config.c: fix memory leak.
+	  [ruby-core:76922] [Bug #12680]
+
+	* ext/openssl/ossl_ocsp.c: ditto.
+
+	* ext/openssl/ossl_pkcs12.c: ditto.
+
+	* ext/openssl/ossl_pkcs7.c: ditto.
+
+	* ext/openssl/ossl_pkey_ec.c: ditto.
+
+	* ext/openssl/ossl_x509.h: ditto.
+
+	* ext/openssl/ossl_x509attr.c: ditto.
+
+	* ext/openssl/ossl_x509crl.c: ditto.
+
+	* ext/openssl/ossl_x509ext.c: ditto.
+
+	* ext/openssl/ossl_x509req.c: ditto.
+
+	* ext/openssl/ossl_x509revoked.c: ditto.
+
+Thu Aug 25 00:19:24 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/specification.rb: `coding` is affect only first line except
+	  shebang.
+	* lib/rubygems/package.rb, lib/rubygems/package/*: ditto.
+
+Thu Aug 25 00:19:24 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.5.2.
+	  It supports to enable frozen string literal and add `--norc` option for
+	  disable to `.gemrc` configuration.
+	  See 2.5.2 release notes for other fixes and enhancements.
+	  https://github.com/rubygems/rubygems/blob/a8aa3bac723f045c52471c7b9328310a048561e0/History.txt#L3
+
+Wed Aug 24 23:54:40 2016  Charles Oliver Nutter  <headius@headius.com>
+
+	* test/ruby/test_array.rb: split out the test for no stack error
+	  on large input for test_permutation, test_repeated_permutation,
+	  and test_repeated_combination, and make them all timeout:30.
+
+Tue Aug 23 03:22:34 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/fiddle/test_pointer.rb (test_to_str, test_to_s, test_aref_aset):
+	  Attempt to use independent strings for destructive tests that
+	  directly modify values on memory by using Fiddle::Pointer.
+	  [Bug #12537] [ruby-dev:49700]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (str_buf_cat): Fix capa size for embed string.
+	  Fix bug in r55547. [Bug #12536]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (rb_str_change_terminator_length): New function to change
+	  termlen and resize heap for the terminator. This is split from
+	  rb_str_fill_terminator (str_fill_term) because filling terminator
+	  and changing terminator length are different things. [Bug #12536]
+
+	* internal.h: declaration for rb_str_change_terminator_length.
+
+	* string.c (str_fill_term): Simplify only to zero-fill the terminator.
+	  For non-shared strings, it assumes that (capa + termlen) bytes of
+	  heap is allocated. This partially reverts r55557.
+
+	* encoding.c (rb_enc_associate_index): rb_str_change_terminator_length
+	  is used, and it should be called whenever the termlen is changed.
+
+	* string.c (str_capacity): New static function to return capacity
+	  of a string with the given termlen, because the termlen may
+	  sometimes be different from TERM_LEN(str) especially during
+	  changing termlen or filling terminator with specific termlen.
+
+	* string.c (rb_str_capacity): Use str_capacity.
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c: Partially reverts r55547 and r55555.
+	  ChangeLog about the reverted changes are also deleted in this file.
+	  [Bug #12536] [ruby-dev:49699] [ruby-dev:49702]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (str_fill_term): When termlen increases, re-allocation
+	  of memory for termlen should always be needed.
+	  In this fix, if possible, decrease capa instead of realloc.
+	  [Bug #12536] [ruby-dev:49699]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c: Specify termlen as far as possible.
+	  Additional fix for [Bug #12536] [ruby-dev:49699].
+
+	* string.c (str_new_static): Specify termlen from the given encoding
+	  when creating a new String object is needed.
+
+	* string.c (rb_tainted_str_new_with_enc): New function to create a
+	  tainted String object with the given encoding. This means that
+	  the termlen is correctly specified. Currently static function.
+	  The function name might be renamed to rb_tainted_enc_str_new
+	  or rb_enc_tainted_str_new.
+
+	* string.c (rb_external_str_new_with_enc): Use encoding by using the
+	  above rb_tainted_str_new_with_enc().
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (rb_str_subseq, str_substr): When RSTRING_EMBED_LEN_MAX
+	  is used, TERM_LEN(str) should be considered with it because
+	  embedded strings are also processed by TERM_FILL.
+	  Additional fix for [Bug #12536] [ruby-dev:49699].
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c: Fix memory corruptions when using UTF-16/32 strings.
+	  [Bug #12536] [ruby-dev:49699]
+
+	* string.c (rb_str_new_with_class): Use TERM_LEN of the "obj".
+
+	* string.c (rb_str_plus, rb_str_justify): Use str_new0 which is aware
+	  of termlen.
+
+	* string.c (str_shared_replace): Copy +termlen bytes instead of +1.
+
+	* string.c (rb_str_times): termlen should not be included in capa.
+
+	* string.c (RESIZE_CAPA_TERM): When using RSTRING_EMBED_LEN_MAX,
+	  termlen should be counted with it because embedded strings are
+	  also processed by TERM_FILL.
+
+	* string.c (rb_str_capacity, str_shared_replace, str_buf_cat): ditto.
+
+	* string.c (rb_str_drop_bytes, rb_str_setbyte, str_byte_substr): ditto.
+
+Thu Aug 18 23:43:33 2016  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_write_internal):
+	  avoid undefined behavior
+	* test/openssl/test_pair.rb (test_write_zero): new test
+	  [ruby-core:76751] [Bug #12660]
+
+Thu Aug 18 23:18:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c, ext/socket/rubysocket.h (inet_ntop): share
+	  the fallback definition.  [ruby-core:76646] [Bug #12645]
+
+Thu Aug 18 23:07:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (vm_set_main_stack): remove unnecessary check.  toplevel
+	  binding must be initialized.  [Bug #12611] (N1)
+
+	* win32/win32.c (w32_symlink): fix return type.  [Bug #12611] (N3)
+
+	* string.c (rb_str_split_m): simplify the condition.
+	  [Bug #12611](N4)
+
+Thu Aug 18 23:06:20 2016  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/attribute.rb (REXML::Attribute#to_string): Fix wrong
+	  entry reference name of double quote.
+	  [Bug #12609][ruby-core:76509]
+	  Patch by Joseph Marrero. Thanks!!!
+
+Thu Aug 18 23:04:59 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* thread.c (rb_wait_for_single_fd): Clean up fds.revents every time
+	  before calling ppoll(2). [Bug #12575] [ruby-dev:49725]
+
+Thu Aug 18 22:52:19 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_args.c (setup_parameters_complex): don't raise ArgumentError
+	  if an array is given for instance_exec with optional argument.
+	  [ruby-core:76300] [Bug #12568]
+	  https://github.com/rails/rails/pull/25699
+
+Tue Aug 16 12:27:48 2016  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_roots): should mark the VM object itself to mark
+	  singleton class of the VM object.
+	  Before this patch, we only set mark bit for the VM object and
+	  invoke mark function separately.
+	  [Bug #12583]
+
+	* test/ruby/test_gc.rb: add a test.
+
+Tue Aug 16 12:01:35 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* ext/digest/md5/md5ossl.h: Remove excess semicolons.
+	  Suppress warning on Solaris with Oracle Solaris Studio 12.
+	  [ruby-dev:49692] [Bug #12524]
+
+	* ext/digest/md5/md5cc.h: ditto.
+	* ext/digest/sha1/sha1cc.h: ditto.
+	* ext/digest/sha1/sha1ossl.h: ditto.
+	* ext/digest/sha2/sha2cc.h: ditto.
+	* ext/digest/sha2/sha2ossl.h: ditto.
+
+Tue Aug 16 11:51:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (ADD_TRACE): ignore trace instruction on non-positive
+	  line.
+
+	* parse.y (coverage): get rid of ArgumentError when the starting
+	  line number is not positive.  [ruby-core:76141] [Bug #12517]
+
+Tue Aug 16 11:51:52 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/coverage/test_coverage.rb: ignored test when enabled to coverage.
+	  It lead to crash with `make test-all`.
+
+Tue Aug 16 11:46:07 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/mailto.rb (initialize): RFC3986_Parser#split sets opaque
+	  only if the URI has path-rootless, not path-empty.
+	  [ruby-core:76055] [Bug #12498]
+	  patched by Chris Heisterkamp <cheister@squareup.com>
+
+Tue Aug 16 04:57:28 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/http/generic_request.rb (write_header): A Request-Line must
+	  not contain CR or LF.
+
+Tue Aug 16 04:54:12 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (putline): raise an ArgumentError when
+	  CR or LF is included in a line.
+
+Tue Aug 16 04:38:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/date_strftime.c (date_strftime_with_tmx): reject too
+	  large precision to get rid of buffer overflow.
+	  reported by Guido Vranken <guido AT guidovranken.nl>.
+
+Tue Aug 16 04:28:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (append_fspath): normalize directory name to be appended
+	  on OS X.  [ruby-core:75957] [Ruby trunk Bug#12483]
+	  https://github.com/rails/rails/issues/25303#issuecomment-224834804
+
+Tue Aug 16 04:16:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regcomp.c (noname_disable_map): don't optimize out group 0
+	  Ruby's Regexp doesn't allow normal numbered groups if the regexp
+	  has named groups. On such case it optimizes out related NT_ENCLOSE.
+	  But even on the case it can use \g<0>.
+	  This fix not to remove NT_ENCLOSE whose regnum is 0.
+	  [ruby-core:75828] [Bug #12454]
+
+Tue Aug 16 04:06:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* missing/crypt.c: fix size macros to use configured values
+	  for platforms long is larger than 32bit.
+	  [ruby-core:75792] [Bug #12446]
+
+Tue Aug 16 04:03:25 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_bn.c (try_convert_to_bnptr): Extracted from
+	  GetBNPtr(). This doesn't raise exception but returns NULL on error.
+	  (GetBNPtr): Raise TypeError if conversion fails.
+	  (ossl_bn_eq): Implement BN#==.
+	  (ossl_bn_eql): #eql? should not raise TypeError even if the argument
+	  is not compatible with BN.
+	  (ossl_bn_hash): Implement BN#hash.
+
+	* ext/openssl/ossl_bn.c (Init_ossl_bn): Define #== and #hash.
+
+	* test/openssl/test_bn.rb: Test BN#eql?, #== and #hash
+
+Tue Aug 16 03:51:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (str_transcode0): scrub in the given encoding when
+	  the source encoding is given, not in the encoding of the
+	  receiver.  [ruby-core:75732] [Bug #12431]
+
+Tue Aug 16 03:41:21 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_pkey_dh.c (ossl_dh_compute_key): Check that the DH
+	  has 'p' (the prime) before calling DH_size(). We can create a DH with
+	  no parameter but DH_size() does not check and dereferences NULL.
+	  [ruby-core:75720] [Bug #12428]
+
+	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_sign): Ditto. DSA_size() does
+	  not check dsa->q.
+
+	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
+	  ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
+	  ossl_rsa_private_decrypt): Ditto. RSA_size() does not check rsa->n.
+
+Tue Aug 16 03:10:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (enc_arg, str_transcode_enc_args, econv_args):
+	  remove volatile, and add GC guards in callers.
+	  [ruby-core:75664] [Bug #12411]
+
+Tue Aug 16 02:45:52 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/*, test/psych/*: Update psych 2.1.0
+	  This version fixed [Bug #11988][ruby-core:72850]
+
+Fri Aug 12 04:15:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (build-ext), ext/extmk.rb: use variable EXTENCS
+	  different than ENCOBJS, to get rid of circular dependency.
+	  build libencs when linking encodings statically.
+	  [ruby-core:75618] [Bug #12401]
+
+Fri Aug 12 04:04:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_execarg_commandline): build command line string
+	  from argument vector in rb_execarg.
+	  [ruby-core:75611] [Bug #12398]
+
+Fri Aug 12 03:30:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_local_constants_i): exclude private constants
+	  when excluding inherited constants too.  [Bug #12345]
+
+Fri Aug 12 03:00:05 2016  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/timeridconv.rb: don't use keeper thread. [Bug #12342]
+
+	* test/drb/ut_timerholder.rb: ditto.
+
+Fri Aug 12 02:46:37 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_stop): Don't free the SSL struct
+	  here. Since some methods such as SSLSocket#connect releases GVL,
+	  there is a chance of use after free if we free the SSL from another
+	  thread. SSLSocket#stop was documented as "prepares it for another
+	  connection" so this is a slightly incompatible change. However when
+	  this sentence was added (r30090, Add toplevel documentation for
+	  OpenSSL, 2010-12-06), it didn't actually. The current behavior is
+	  from r40304 (Correct shutdown behavior w.r.t GC., 2013-04-15).
+	  [ruby-core:74978] [Bug #12292]
+
+	* ext/openssl/lib/openssl/ssl.rb (sysclose): Update doc.
+
+	* test/openssl/test_ssl.rb: Test this.
+
+Thu Aug 11 01:30:29 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* ext/json/lib/*.rb: Removed some comments. Because these are unnecessary
+	  class description. [ci skip][Bug #12255][ruby-core:74835]
+
+Thu Aug 11 01:09:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* pack.c (pack_pack): use union instead of bare variable to ease
+	  optimizations and avoid assigning x87 floating point number.
+	  [ruby-core:74496] [Bug #12209]
+
+	* pack.c (pack_unpack): ditto.
+
+Tue Aug  2 01:34:12 2016  Eric Wong  <e@80x24.org>
+
+	* lib/webrick/httpservlet/cgihandler.rb (do_GET): delete HTTP_PROXY
+	* test/webrick/test_cgi.rb (test_cgi_env): new test
+	* test/webrick/webrick.cgi (do_GET): new endpoint to dump env
+	  [ruby-core:76511] [Bug #12610]
+
+Tue Aug  2 01:33:11 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/ruby/test_refinement.rb: skip
+	  test_prepend_after_refine_wb_miss on ARM or MIPS.
+	  [ruby-core:76031] [Bug #12491]
+
+Sat Jul 30 12:23:29 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_args.c (vm_caller_setup_arg_block): disable symbol block
+	  argument optimization when tail call optimization is enabled,
+	  in order to avoid SEGV.  [ruby-core:76288] [Bug #12565]
+
+Sat Jul 30 12:10:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (passed_block): convert passed block symbol to proc.
+	  based on the patch by Daisuke Sato in [ruby-dev:49695].
+	  [Bug #12531]
+
+Sat Jul 30 10:58:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_throw_start): check if the iseq is symbol
+	  proc, class definition should not be a symbol proc.
+	  [ruby-core:75856] [Bug #12462]
+
+Mon Jul 11 22:35:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+
+	* bignum.c (rb_big_hash): make it public function to be available in
+	  other source files, and remove documentation comment for Bignum#hash.
+
+	* bignum.c (Bignum#hash): remove its definition because it is unified
+	  with Object#hash.
+
+	* include/ruby/intern.h (rb_big_hash): add a prototype declaration.
+
+	* hash.c (any_hash): treat Bignum values directly.
+
+Sat Jul  2 04:00:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (tr_trans): consider terminator length and fix heap
+	  overflow.  reported by Guido Vranken <guido AT guidovranken.nl>.
+
+Sat Jul  2 03:33:28 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm.c (invoke_bmethod, invoke_block_from_c_0): revert r52104
+	  partially to avoid "self has wrong type to call super in this
+	  context" errors.
+	  [ruby-core:72724] [Bug #11954]
+
+Mon Jun 20 02:38:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb (OptionParser::Completion.candidate): get rid of
+	  nil as key names.  [ruby-core:75773] [Bug #12438]
+
+	* lib/optparse.rb (OptionParser#make_switch): char class option
+	  cannot be NoArgument, default to RequiredArgument.
+
+Mon Jun 20 02:25:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* re.c (unescape_nonascii): scan hex up to only 3 characters.
+	  [Bug #12420] [Bug #12423]
+
+Mon Jun 20 02:25:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regparse.c (fetch_token_in_cc): raise error if given octal escaped
+	  character is too big. [Bug #12420] [Bug #12423]
+
+Sun Jun 19 04:29:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/missing.h (isfinite): move from numeric.c.
+
+Sun Jun 19 04:29:13 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (isfinite): get rid of a warning on
+	  cygwin. [Bug #12417][ruby-core:75691]
+
+Sun Jun 19 04:29:13 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (isfinite): isfinite does not always
+	  exist.  fixed build error on Windows introduced at r55123.
+
+Sun Jun 19 04:29:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): consider
+	  non-finite float values not to raise FloatDomainError.
+	  [ruby-core:75682] [Bug #12414]
+
+Thu Jun 16 00:42:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_modify_expand): check integer overflow.
+	  [ruby-core:75592] [Bug #12390]
+
+Thu Jun 16 00:29:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_get_ev_const): warn deprecated constant even
+	  in the class context.  [ruby-core:75505] [Bug #12382]
+
+Tue Jun 14 03:49:28 2016  Eric Wong  <e@80x24.org>
+
+	* dir.c (dir_close): update RDoc for 2.3 #close change
+	  [ruby-core:75679] [Bug #12413]
+
+Tue Jun 14 03:47:29 2016  Eric Wong  <e@80x24.org>
+
+	* proc.c: fix RDoc of Proc#===/call/yield/[]
+	  [Bug #12332]
+
+Tue Jun 14 03:34:27 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_local_constants_i): exclude hidden constants.
+	  [ruby-core:75575] [Bug #12389]
+
+Tue Jun 14 03:25:14 2016  Benoit Daloze  <eregontp@gmail.com>
+
+	* insns.def (defineclass): Also raise an error when redeclaring the
+	  superclass of a class as Object and it has another superclass.
+	  [Bug #12367] [ruby-core:75446]
+
+	* test/ruby/test_class.rb: test for above.
+
+Tue Jun 14 03:15:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_exec_getargs): honor the expected argument types
+	  over the conversion method.  the basic language functionality
+	  should be robust.  [ruby-core:75388] [Bug #12355]
+
+Tue Jun 14 03:02:38 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c, include/ruby/win32.h (rb_w32_utruncate): implements new
+	  truncate alternative which accepts UTF-8 path.
+
+	* file.c (truncate): use above function.
+	  [Bug #12340]
+
+Tue Jun 14 02:58:41 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* ext/date/date_core.c (Init_date_core): [DOC] Convert DateTime
+	  documentation to RDoc from Markdown.
+	  [ruby-core:75136] [Bug #12311]
+
+Sun Jun 12 02:36:52 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regcomp.c (compile_length_tree): return error code immediately
+	  if compile_length_tree raised error [Bug #12418]
+
+Sun Jun 12 02:27:07 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread.c (recursive_list_access): a object id may be a Bignum.  so,
+	  the list must be a objhash, instead of a identhash.
+	  this fixes many test errors on mswin64 CI.
+
+Sun Jun 12 01:59:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (new_if_gen): set newline flag to NODE_IF to trace all
+	  if/elsif statements.  [ruby-core:67720] [Bug #10763]
+
+Sun May 15 02:33:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (pkg_config): use xsystem consistently to set up
+	  library path environment variable as well as latter pkg-config
+	  calls.  [ruby-dev:49619] [Bug #12379]
+
+Fri May  6 02:30:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb: [DOC] fix example code.  base on the code by
+	  Semyon Gaivoronskiy in [ruby-core:75224].  [Bug #12323]
+
+Fri May  6 02:28:31 2016  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_vstr2wc, ole_variant2val): fix blank
+	  string conversion.
+	  [Bug #11880]
+	  Thanks Akio Tajima for the patch!
+
+Fri May  6 02:24:13 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* bignum.c: [DOC] Update result of 123456789 ** -2.
+	  [ruby-dev:49606] [Bug #12339]
+
+Wed May  4 02:38:08 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* internal.h (RCOMPLEX_SET_IMAG): undef RCOMPLEX_SET_IMAG
+	  instead of duplicated undef RCOMPLEX_SET_REAL.
+
+Wed May  4 02:38:08 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* complex.c (rb_complex_set_imag): Fix to properly set imag
+	  of complex.
+
+Tue Apr 26 23:34:45 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* version.h: Bump versionto 2.3.2.
+
+Tue Apr 26 02:58:51 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* doc/extension.rdoc: Improvements to english grammers.
+	  [Bug #12246][ruby-core:74792][ci skip]
+
+Tue Apr 26 02:58:51 2016  craft4coder  <yooobuntu@163.com>
+
+	* doc/extension.rdoc: [DOC] `nul` should be uppercase.
+	  change 'nul' => 'NUL'.  [Fix GH-1172]
+
+Tue Apr 26 02:54:57 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* encoding.c: Fix return value of `Encoding::ISO8859_1.name`
+	  [Bug #12313][ruby-core:75147][ci skip]
+	* ext/bigdecimal/bigdecimal.c: Fix code sample of `BigDecimal.new`
+
+Mon Apr 25 02:29:07 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* configure.in: add missing -lm for AIX.
+
+Mon Apr 25 02:29:07 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* configure.in: don't use the system-provided round(3) on AIX.
+	  In AIX, round(0.49999999999999994) returns 1.0.
+	  Use round() in numeric.c instead.
+
+Sun Apr 24 03:05:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c: cygwin does not use w32_cmdvector, command line can be
+	  other than UTF-8.  [ruby-dev:49519] [Bug #12184]
+
+Sat Apr 23 01:01:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval_jump.c (exec_end_procs_chain): restore previous error info
+	  for each end procs.  [ruby-core:75038] [Bug #12302]
+
+Sat Apr 23 00:51:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (new_label_body): initialize bit fields, since
+	  compile_data_alloc does not clear the memory.  [Bug #12082]
+
+Sat Apr 23 00:51:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_optimize): disable tail call optimization in
+	  rescued, rescue, and ensure blocks.
+	  [ruby-core:73871] [Bug #12082]
+
+Sat Apr 23 00:33:04 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c (mime_putc): fix typo.
+	  [Bug #12202] [ruby-core:74802]
+
+Sat Apr 23 00:33:04 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: Merge upstream 4f3edf80a0.
+	  patched by Anton Sivakov [Bug #12201] [Bug #12202]
+
+Sat Apr 23 00:29:15 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/securerandom.rb (gen_random): to avoid blocking on Windows.
+	  On Windows OpenSSL RAND_bytes (underlying implementation is
+	  RAND_poll in crypto/rand/rand_win.c) may be blocked at
+	  NetStatisticsGet.
+	  https://wiki.openssl.org/index.php/Random_Numbers#Windows_Issues
+	  Instead of this, use Random.raw_seed directly (whose implementation
+	  CryptGenRandom is one of the source of
+	  entropy of RAND_poll on Windows).
+	  https://wiki.openssl.org/index.php/Random_Numbers
+	  Note: CryptGenRandom function is PRNG and doesn't check its entropy,
+	  so it won't block. [Bug #12139]
+	  https://msdn.microsoft.com/ja-jp/library/windows/desktop/aa379942.aspx
+	  https://tools.ietf.org/html/rfc4086#section-7.1.3
+	  https://eprint.iacr.org/2007/419.pdf
+	  http://www.cs.huji.ac.il/~dolev/pubs/thesis/msc-thesis-leo.pdf
+
+Sat Apr 23 00:25:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* miniinit.c (Init_enc): add some common aliases of built-in
+	  encodings.  [ruby-core:72481] [Bug #11872]
+
+Sat Apr 23 00:13:50 2016  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* lib/forwardable.rb: Convert given accessors to String.
+
+	  r53381 changed to accept only Symbol or String for accessors, but
+	  there are several rubygems that pass classes (e.g. Array,
+	  Hash, ...) as accessors. Prior r53381, it was accepted because Class#to_s
+	  returns its class name. After r53381 given accessors are checked
+	  with define_method, but it accepts only Symbol or String, otherwise
+	  raises TypeError.
+
+	      def_delegator Foo, :some_method
+
+	  This change is to revert unexpected incompatibility. But this behavior
+	  may change in the future.
+
+Sat Apr 23 00:02:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check if succeeded in creating config.h.
+
+	* tool/ifchange: ignore failures when TEST_COLORS unmatched. just
+	  use the default value if expected name is not contained in it.
+	  [ruby-core:75046] [Bug #12303]
+
+Fri Apr 22 23:47:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* doc/regexp.rdoc (comments): [DOC] terminators cannot appear in
+	  comments.  [ruby-core:74838] [Bug #12256]
+
+Fri Apr 22 23:44:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* extension.rdoc, extension.ja.rdoc: [DOC] Fix some errors.
+	  Renamed files, wrong method names or argument types; the example
+	  GetDBM macro is now updated to the current version of the actual
+	  code.  patch by Marcus Stollsteimer in [ruby-core:74690].
+	  [Bug #12228]
+
+Fri Apr 22 23:32:19 2016  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_time_tz.rb: Tests depends on Europe/Moscow removed
+	  to avoid test failures due to the tzdata change.
+	  https://github.com/eggert/tz/commit/8ee11a301cf173afb0c76e0315b9f9ec8ebb9d95
+	  Found by naruse.
+
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_lgamma_r_m0): fix the condition for
+	  lgamma_r(-0.0).  [Bug #12249]
+
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_lgamma_r_m0): check if lgamma_r(-0.0)
+	  returns negative infinity.  [Bug #12249]
+
+	* math.c (ruby_lgamma_r): define by the configured result.
+
+Tue Apr 19 02:32:50 2016  cremno phobia  <cremno@mail.ru>
+
+	* math.c (ruby_lgamma_r): missing/lgamma_r.c is used on Windows,
+	  since msvcrt does not provide it.
+
+	* missing/lgamma_r.c (lgamma_r): fix lgamma(-0.0).
+	  [ruby-core:74823] [Bug #12249]
+
+Tue Apr 19 02:32:50 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* math.c (ruby_lgamma_r): mswin's lgamma_r also seems to be wrong.
+	  cf. [Bug #12249]
+
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* math.c (ruby_tgamma): fix tgamma(-0.0) on mingw.
+	  [ruby-core:74817] [Bug #12249]
+
+Tue Apr 19 01:53:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/keywords (alias, undef): symbol literals are allowed.
+
+	* parse.y (parse_percent): should parse symbol literals for alias
+	  and undef.  [ruby-dev:47681] [Bug #8851]
+
+Mon Apr 18 18:05:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* struct.c (struct_make_members_list, rb_struct_s_def): member
+	  names should be unique. [ruby-core:74971] [Bug #12291]
+
+	* struct.c (struct_make_members_list): extract making member name
+	  list from char* va_list, with creating symbols without
+	  intermediate IDs.
+
+Mon Apr 18 17:54:40 2016  Joe Swatosh  <joe.swatosh@gmail.com>
+
+	* ext/win32/lib/win32/registry.rb (DeleteValue, DeleteKey): fix
+	  API names.  [ruby-core:74863] [Bug #12264]
+
+Mon Apr 18 17:27:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): should not replace the
+	  current target INSN, not to follow the replaced dangling link in
+	  the caller.  [ruby-core:74993] [Bug #11816]
+
+Mon Apr 18 17:18:25 2016  cremno phobia  <cremno@mail.ru>
+
+	* cont.c (fiber_initialize_machine_stack_context): fix wrong
+	  _MSC_VER check, should be decimal but not hexadecimal.
+	  [ruby-core:74936] [Bug #12279]
+
+Mon Apr 18 17:18:25 2016  cremno phobia  <cremno@mail.ru>
+
+	* cont.c (fiber_initialize_machine_stack_context): fix wrong
+	  _MSC_VER check, should be decimal but not hexadecimal.
+	  [ruby-core:74936] [Bug #12279]
+
+Mon Apr 18 17:08:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_vm_struct): make at_exit a single linked list but
+	  not RArray, not to mark the registered functions by the write
+	  barrier.  based on the patches by Evan Phoenix.
+	  [ruby-core:73908] [Bug #12095]
+
+Mon Apr 18 16:56:31 2016  Benoit Daloze  <eregontp@gmail.com>
+
+	* thread.c (update_coverage): Do not track coverage in loaded files
+	  after Coverage.result. Avoids out-of-bounds access. [Bug #12237]
+
+	* ext/coverage/coverage.c (coverage_clear_result_i): document.
+
+Mon Apr 18 16:33:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/date_core.c (Init_date_core): [DOC] fix misplaced doc
+	  of DateTime.  [ruby-core:74729] [Bug #12233]
+
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL_PARAM):
+	  * add missing parentheses and remove double quotes.
+	  * rename to get rid of recursive references.
+	  * as --excludes-dir option is for a path name, its argument
+	    should be converted.
+	  [ruby-dev:49526] [Bug #12199]
+
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (TEST_EXCLUDES, EXCLUDE_TESTFRAMEWORK): use full spell
+	  long option.
+
+	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL): suppress path name
+	  conversions by msys2.  [ruby-dev:49525] [Bug #12199]
+
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit.rb (Options#non_options): make regexp name
+	  options prefixed with "!" negative filters.
+
+	* common.mk (TEST_EXCLUDES): use negative filter to exclude memory
+	  leak tests.  -x option excludes test files, not test methods.
+
+Sun Apr 17 04:30:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parse_ident): allow keyword arguments just after a
+	  method where the same name local variable is defined.
+	  [ruby-core:73816] [Bug#12073]
+
+Sun Apr 17 04:20:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (setup_exception): set the cause only if it is explicitly
+	  given or not set yet.  [Bug #12068]
+
+Sat Apr 16 00:56:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): defer setting native thread name
+	  set in initialize until the native thread is created.
+	  [ruby-core:74963] [Bug #12290]
+
+Fri Apr 15 21:10:00 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/irb/ext/save-history.rb: Fix NoMethodError when method is not defined.
+
+Fri Apr 15 14:52:06 2016  Elliot Winkler  <elliot.winkler@gmail.com>
+
+	* lib/forwardable.rb (def_instance_delegator) fix delegating to
+	  'args' and 'block', clashing with local variables in generated
+	  methods.  [ruby-core:72579] [Bug #11916]
+
+	* lib/forwardable.rb (def_single_delegator): ditto.
+
+Fri Apr 15 14:27:48 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/irb/ext/save-history.rb: suppress warning: method redefined;
+	  discarding old save_history=.
+
+Tue Apr 12 16:15:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in: improve ICC (Intel C Compiler) support.
+
+	* configure.in (CXX): The name of icc's c++ compiler is `icpc`.
+
+	* configure.in (warnings): Add `-diag-disable=2259` to suppress
+	  noisy warnings: "non-pointer conversion from "..." to "..." may
+	  lose significant bits".
+
+	* configure.in (optflags): Add `-fp-model precise` like -fno-fast-math.
+
+	* lib/mkmf.rb: icc supports -Werror=division-by-zero
+	  and -Werror=deprecated-declarations, but doesn't support
+	  -Wdivision-by-zero and -Wdeprecated-declarations.
+
+Tue Apr 12 14:29:01 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/extconf.rb: check SSL_CTX_set_next_proto_select_cb
+	  function rather than OPENSSL_NPN_NEGOTIATED macro. it exists
+	  even if it is disabled by OpenSSL configuration.
+	  [ruby-core:74384] [Bug #12182]
+
+	* ext/openssl/ossl_ssl.c: update #ifdef(s) as above.
+
+	* test/openssl/test_ssl.rb: skip NPN tests if NPN is disabled.
+
+Tue Apr 12 14:27:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/uri/http.rb (URI::HTTP#initialize): [DOC] fix example,
+	  missing mandatory arguments.  [ruby-core:74540] [Bug #12215]
+
+Thu Apr  7 01:07:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): fix buffer overflow, length must be
+	  greater than precision.  reported by William Bowling <will AT
+	  wbowling.info>.
+
+Wed Apr  6 00:33:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rubygems/security.rb (DIGEST_ALGORITHM, KEY_ALGORITHM):
+	  should check same name as the used constants.
+	  [ruby-core:72674] [Bug #11940]
+
+Mon Apr  4 00:31:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (compile_massign_lhs): when index ends with splat,
+	  append rhs value to it like POSTARG, since VM_CALL_ARGS_SPLAT
+	  splats the last argument only.  [ruby-core:72777] [Bug #11970]
+
+Sat Apr  2 02:07:29 2016  Seiei Miyagi  <hanachin@gmail.com>
+
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): Fix
+	  Ripper.lex error in dedenting squiggly heredoc.  heredoc tree is
+	  also an array of Elem in the outer tree.  [Fix GH-1234]
+
+Wed Mar 30 02:28:13 2016  Eric Wong  <e@80x24.org>
+
+	* thread_pthread.c (setup_communication_pipe): delay setting owner
+	  (rb_thread_create_timer_thread): until thread creation succeeds
+	  [ruby-core:72590] [Bug #11922]
+
+Wed Mar 30 02:20:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* localeinit.c (rb_locale_charmap_index): fix prototype.
+	  patched by Andreas Schwab [Bug #12218]
+
+Wed Mar 30 02:20:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (reserve_stack): fix reserving position where
+	  the stack growing bottom to top. [Bug #12118]
+
+Wed Mar 30 02:17:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_readlink): drop garbage after the substitute
+	  name, as rb_w32_read_reparse_point returns the expected buffer
+	  size but "\??\" prefix is dropped from the result.
+
+	* win32/win32.c (w32_readlink): ditto, including NUL-terminator.
+
+Wed Mar 30 02:17:33 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (fileattr_to_unixmode, rb_w32_reparse_symlink_p): volume
+	  mount point should be treated as directory, not symlink.
+	  [ruby-core:72483] [Bug #11874]
+
+	* win32/win32.c (rb_w32_read_reparse_point): check the reparse point is
+	  a volume mount point or not.
+
+	* win32/file.c (rb_readlink): follow above change (but this pass won't
+	  be used).
+
+Wed Mar 30 01:32:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/-ext-/time/test_new.rb (test_timespec_new): change a gmtoff
+	  test to a better one that does not depend on whether the current
+	  time is in summer time or not.
+
+Wed Mar 30 01:32:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/-ext-/time/test_new.rb (test_timespec_new): Time#gmtoff values
+	  are the same only when both or neither of the Time objects are in
+	  summer time (daylight-saving time).
+
+Wed Mar 30 01:30:54 2016  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* lib/rubygems/test_case.rb: Fix test on Windows for inconsistent temp path.
+	  https://github.com/rubygems/rubygems/pull/1554
+	  [Bug #12193][ruby-core:74431]
+
+Wed Mar 30 01:25:46 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (str_new_frozen): if the given string is embeddedable
+	  but not embedded, embed a new copied string. [Bug #11946]
+
+Wed Mar 30 01:23:57 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* doc/extension.ja.rdoc: Fix RDoc markup in doc/extension*.rdoc.
+	  [ci skip][Bug #12143][ruby-core:74143]
+	* doc/extension.rdoc: ditto.
+
+Wed Mar 30 01:00:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_binding): proc from symbol can not make a binding.
+	  [ruby-core:74100] [Bug #12137]
+
+Wed Mar 30 00:54:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/win32.h (O_SHARE_DELETE): change to fit Fixnum
+	  limit.  [ruby-core:74285] [Bug #12171]
+
+Wed Mar 30 00:52:47 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/net/imap/test_imap.rb (test_idle_timeout): Because of the
+	  timeout specified in "imap.idle(0.2)", there is no gurantee that
+	  the server thread has done all the work before the client thread
+	  performs the assertions. It depends on the thread scheduling.
+	  Add checks to avoid false positives (on AIX, particularly).
+
+Wed Mar 30 00:41:42 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/socket/test_socket.rb (test_udp_recvmsg_truncation):
+	  AIX does not set the MSG_TRUNC flag for a message partially read
+	  by recvmsg(2) with the MSG_PEEK flag set.
+
+Wed Mar 30 00:00:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* doc/extension.rdoc, doc/extension.ja.rdoc: add editor local
+	  variables, with commenting out by :enddoc: directives which are
+	  just ignored unless code object mode.  [Bug #12111]
+
+Wed Mar 30 00:00:47 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/extension.ja.rdoc: removed rendering error caused by editor specific
+	  configuration on http://docs.ruby-lang.org/en/trunk/extension_rdoc.html .
+	  [Bug #12111][ruby-core:73990]
+
+Tue Mar 29 23:54:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_mod_const_get): make error message at uninterned
+	  string consistent with symbols.  [ruby-dev:49498] [Bug #12089]
+
+Tue Mar 29 23:45:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (push_pattern, push_glob): deal with read paths as UTF-8
+	  to stat later, on Windows as well as OS X.
+	  [ruby-core:73868] [Bug #12081]
+
+Tue Mar 29 23:36:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: add cygwin case, nothing excluded.
+	  [ruby-core:73806] [Bug#12071]
+
+Tue Mar 29 23:10:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* iseq.c (rb_iseq_mark): mark parent iseq to prevent dynamically
+	  generated iseq by eval from GC.  [ruby-core:72620] [Bug #11928]
+
+Tue Mar 29 22:56:44 2016  Eric Wong  <e@80x24.org>
+
+	* lib/resolv.rb (Resolv::IPv6.create): avoid modifying frozen
+	* test/resolv/test_dns.rb (test_ipv6_create): test for above
+	  [Bug #11910] [ruby-core:72559]
+
+Tue Mar 29 22:31:48 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* range.c (range_eqq): revert r11113 because rb_call_super() is
+	  called in range_include() and thus r11113 doesn't work when the
+	  receiver Range object consists of non linear objects such as Date
+	  objects.
+	  [ruby-core:72908] [Bug #12003]
+
+Tue Mar 29 22:26:55 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_check_funcall_with_hook): also should call the
+	  given hook before returning Qundef when overridden respond_to?
+	  method returned false.  [ruby-core:73556] [Bug #12030]
+
+Tue Mar 29 22:08:36 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* compile.c (iseq_peephole_optimize): don't apply tailcall
+	  optimization to send/invokesuper instructions with blockiseq.
+	  This is a follow-up to the changes in r51903; blockiseq is now
+	  the third operand of send/invokesuper instructions.
+	  [ruby-core:73413] [Bug #12018]
+
+Tue Mar 29 21:22:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (xstring): reset heredoc indent after dedenting,
+	  so that following string literal would not be dedented.
+	  [ruby-core:72857] [Bug #11990]
+
+Tue Mar 29 21:22:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (string1): reset heredoc indent fore each string leteral
+	  so that concatenated string would not be dedented.
+	  [ruby-core:72857] [Bug #11990]
+
+Tue Mar 29 21:18:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_here_document): update indent for each line in
+	  indented here document with single-quotes.
+	  [ruby-core:72479] [Bug #11871]
+
+Tue Mar 29 21:03:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.h (is_attrset_id): ASET is an attrset ID.  fix
+	  unexpected safe call instead of an ordinary ASET.
+
+Tue Mar 29 21:01:07 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/syntax/calling_methods.rdoc: fix old operator for safe navigation
+	  operator. [ci skip][fix GH-1182] Patch by @dougo
+
+Tue Mar 29 18:49:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/ostruct.rb (freeze): define deferred accessors before
+	  freezing to get rid of an error when just reading frozen
+	  OpenStruct.
+
+Tue Mar 29 18:49:54 2016  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/ostruct.rb: Fix new_ostruct_member to correctly avoid
+	  redefinition [#11901]
+
+Tue Mar 29 17:54:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/ostruct.rb (OpenStruct): make respond_to? working on
+	  just-allocated objects for workaround of Psych.
+	  [ruby-core:72501] [Bug #11884]
+
+Tue Mar 29 17:04:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_f_catch): [DOC] fix malformed RDoc syntax, "+...+"
+	  cannot enclose non-identifier characters.
+	  a patch by Sebastian S in [ruby-core:74278].  [Bug#12170]
+
+Tue Mar 29 17:03:28 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/-ext-/float/test_nextafter.rb: In AIX,
+	  nextafter(+0.0,-0.0)=+0.0, and nextafter(-0.0,+0.0)=-0.0,
+	  but they should return -0.0 and +0.0, respectively. This is
+	  a known bug in nextafter(3) on AIX, so skip related tests.
+
+Tue Mar 29 16:54:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (enc_succ_alnum_char): try to skip an invalid character
+	  gap between GREEK CAPITAL RHO and SIGMA.
+	  [ruby-core:74478] [Bug #12204]
+
+Tue Mar 29 16:45:58 2016  Victor Nawothnig  <Victor.Nawothnig@gmail.com>
+
+	* parse.y (parse_numvar): NTH_REF must be less than a half of
+	  INT_MAX, as it is left-shifted to be ORed with back-ref flag.
+	  [ruby-core:74444] [Bug#12192] [Fix GH-1296]
+
+Tue Mar 29 16:44:54 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/trans/JIS: update Unicode's notice. [Bug #11844]
+
+Tue Mar 29 16:41:27 2016  Eric Hodel  <drbrain@segment7.net>
+
+	* marshal.c (r_object0):  raise ArgumentError when linking to undefined
+	  object.
+
+Tue Mar 29 16:41:27 2016  Eric Hodel  <drbrain@segment7.net>
+
+	* marshal.c (r_object0): Fix Marshal crash for corrupt extended object.
+
+Tue Mar 29 16:40:48 2016  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): document as MT-unsafe
+	  [ruby-core:73803] [Bug #12069]
+
+Tue Mar 29 16:29:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* insns.def (opt_mod): show its method name on ZeroDivisionError.
+	  [Bug #12158]
+
+Tue Mar 29 16:25:27 2016  Anthony Dmitriyev  <antstorm@gmail.com>
+
+	* net/ftp.rb: add NullSocket#closed? to fix closing not opened
+	  connection.  [Fix GH-1232]
+
+Tue Mar 29 16:12:08 2016  Koichi ITO  <koic.ito@gmail.com>
+
+	* variable.c: Added documentation about order of `Module#constants`
+	  [ci skip][Bug #12121][ruby-dev:49505][fix GH-1301]
+
+Tue Mar 29 16:02:26 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/ruby/test_process.rb (test_execopts_gid): Skip a test
+	  that is known to fail on AIX. AIX allows setgid to
+	  a supplementary group, but Ruby does not allow the "-e"
+	  option when setgid'ed, so the test does not work as intended.
+
+Tue Mar 29 15:58:18 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/socket/test_addrinfo.rb (test_ipv6_address_predicates):
+	  IN6_IS_ADDR_V4COMPAT and IN6_IS_ADDR_V4MAPPED are broken
+	  on AIX, so skip related tests.
+
+Tue Mar 29 15:31:06 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/rinda/test_rinda.rb (test_make_socket_ipv4_multicast):
+	  The fifth argument to getsockopt(2) should be modified to
+	  indicate the actual size of the value on return,
+	  but not in AIX. This is a know bug. Skip related tests.
+	* test/rinda/test_rinda.rb (test_ring_server_ipv4_multicast):
+	  ditto.
+	* test/rinda/test_rinda.rb (test_make_socket_unicast): ditto.
+	* test/socket/test_basicsocket.rb (test_getsockopt): ditto.
+	* test/socket/test_sockopt.rb (test_bool): ditto.
+
+Tue Mar 29 15:27:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/zlib/test_zlib.rb (test_adler32_combine, test_crc32_combine):
+	  Skip two tests on AIX because zconf.h in zlib does not correctly
+	  recognize _LARGE_FILES in AIX. The problem was already reported
+	  to zlib, and skip these tests until it is fixed.
+
+Tue Mar 29 15:10:31 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* thread_pthread.c (getstack): __pi_stacksize returned by
+	  pthread_getthrds_np() is wrong on AIX. Use
+	  __pi_stackend - __pi_stackaddr instead.
+
+Tue Mar 29 15:10:05 2016  Alex Boyd  <alex@opengroove.org>
+
+	* lib/irb.rb: avoid to needless truncation when using back_trace_limit option.
+	  [fix GH-1205][ruby-core:72773][Bug #11969]
+
+Tue Mar 29 15:05:16 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb: fix method name typo.
+	  [ruby-core:72513] [Bug #11893] The patch provided by Akira Matsuda.
+
+
+Tue Mar 29 15:05:02 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/tcllib/toolbar.rb: fix method name typo.
+	  [ruby-core:72511] [Bug #11891] The patch provided by Akira Matsuda.
+
+
+Tue Mar 29 15:04:42 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/blt/tree.rb: fix method name typo.
+	  [ruby-core:72510] [Bug #11890] The patch provided by Akira Matsuda.
+
+
+Tue Mar 29 15:04:19 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tk/menubar.rb: fix a typo in font name. [ruby-core:72505]
+	  [Bug #11886] The patch provided by Akira Matsuda.
+
+	* ext/tk/sample/*.rb: ditto.
+
+Tue Mar 29 15:03:03 2016  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ruby.h: undef HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P
+	  and HAVE_BUILTIN___BUILTIN_TYPES_COMPATIBLE_P on C++.
+	  [ruby-core:72736] [Bug #11962]
+
+Tue Mar 29 14:58:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c (inspect_tcpi_msec): more accurate condition
+	  for TCPI msec member inspection function.
+	  [ruby-core:74388] [Bug #12185]
+
+Tue Mar 29 14:53:58 2016  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: Remove block from Logger.add as it's not needed
+	  patch provided by Daniel Lobato Garcia [fix GH-1240] [Bug #12054]
+
+Tue Mar 29 14:52:20 2016  Zachary Scott  <zzak@ruby-lang.org>
+
+	* re.c: Remove deprecated kcode argument from Regexp.new and compile
+	  patch provided by Dylan Pulliam [Bug #11495]
+
+Tue Mar 29 14:44:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/socket.c (sock_gethostname): support unlimited size
+	  hostname.
+
+Tue Mar 29 14:35:06 2016  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/xmlrpc/client.rb: Support SSL options in async methods of
+	  XMLRPC::Client.
+	  [Bug #11489]
+	  Reported by Aleksandar Kostadinov. Thanks!!!
+
+Tue Mar 29 14:22:57 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* marshal.c (r_object0): honor Marshal.load post proc
+	  value for TYPE_LINK.  by Hiroshi Nakamura <nahi@ruby-lang.org>
+	  https://github.com/ruby/ruby/pull/1204 fix GH-1204
+
+Tue Mar 29 14:18:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .travis.yml: removed commented-out code.
+
+Tue Mar 29 14:18:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .travis.yml: removed osx code. follow up with r53517
+
+Tue Mar 29 14:12:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c (sockopt_bool): relax boolean size to be one
+	  too not only sizeof(int).  Winsock getsockopt() returns a single
+	  byte as a boolean socket option.  [ruby-core:72730] [Bug #11958]
+
+Tue Mar 29 14:12:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c (check_size): extract a macro to check
+	  binary data size, with a consistent message.
+
+	* ext/socket/option.c (sockopt_byte): fix error message,
+	  sizeof(int) differs from sizeof(unsigned char) in general.
+
+Tue Mar 29 14:01:14 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c (rb_execarg_parent_start1): need to convert the encoding to
+	  ospath's one.
+
+Tue Mar 29 14:01:14 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
+	  reported by naruse via twitter.
+
+	* process.c (rb_execarg_addopt): need to convert the encoding to
+	  ospath's one.
+
+Tue Mar 29 13:56:36 2016  Eric Wong  <e@80x24.org>
+
+	* ext/stringio/stringio.c (strio_binmode): implement to set encoding
+	* test/stringio/test_stringio.rb (test_binmode): new test
+	  [ruby-core:72699] [Bug #11945]
+
+Tue Mar 29 13:50:30 2016  Eric Wong  <e@80x24.org>
+
+	* io.c (io_getpartial): remove unused kwarg from template
+	* test/ruby/test_io.rb (test_readpartial_bad_args): new
+	  [Bug #11885]
+
+Tue Mar 29 13:41:03 2016  Tadashi Saito  <tad.a.digger@gmail.com>
+
+	* compile.c, cont.c, doc, man: fix common misspelling.
+	  [ruby-core:72466] [Bug #11870]
+
+Tue Mar 29 13:31:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (regexp): set_yylval_num sets u1, should use nd_tag
+	  instead of nd_state.  [ruby-core:72638] [Bug #11932]
+
+Tue Mar 29 13:31:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (set_yylval_num): should be used as nd_state, set to u3.
+	  [ruby-core:72638] [Bug #11932]
+
+Tue Mar 29 13:26:15 2016  Joseph Tibbertsma  <josephtibbertsma@gmail.com>
+
+	* gc.c (RVALUE_PAGE_WB_UNPROTECTED): fix a typo of argument name.
+	  [Fix GH-1221]
+
+Thu Jan 21 16:39:55 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* Makefile.in (update-rubyspec): fix r53208 like r53451.
+
+Fri Jan 15 00:05:57 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/generic.rb (URI::Generic#to_s): change encoding to
+	  UTF-8 as Ruby 2.2/ by Koichi ITO <koic.ito@gmail.com>
+	  https://github.com/ruby/ruby/pull/1188 fix GH-1188
+
+Tue Jan 12 17:23:39 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c (rb_execarg_parent_start1): need to convert the encoding to
+	  ospath's one.
+
+Tue Jan 12 17:23:39 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
+	  reported by naruse via twitter.
+
+	* process.c (rb_execarg_addopt): need to convert the encoding to
+	  ospath's one.
+
+Tue Jan 12 15:21:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/missing.h (explicit_bzero_by_memset_s): remove
+	  inline implementation by memset_s, which needs a macro before
+	  including headers and can cause problems in extension libraries
+	  by the order of the macro and headers.
+
+Thu Dec 24 23:01:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: added entry for CGI.escapeHTML optimization.
+
+Thu Dec 24 18:43:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_compile_error_with_enc, rb_compile_error),
+	  (rb_compile_bug): deprecate internal functions.
+
+	* parse.y (parser_yyerror): construct exception message with
+	  source code and caret.
+
+Thu Dec 24 17:25:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (append_compile_error), parse.y (compile_error):
+	  preserve encoding of source file name in exceptions.
+
+	* error.c (rb_compile_error_str, rb_compile_bug_str): add.
+
+Thu Dec 24 16:17:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* common.mk (fake.rb): $(arch)-fake.rb must depend on miniruby because
+	  it may depend on miniruby.
+
+Thu Dec 24 16:13:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* common.mk (ripper.c): r50045 wrongly replace $(PWD) with ../..
+	  It is the top of build directory, not topsrcdir.
+
+Thu Dec 24 15:02:42 2015  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* tool/vcs.rb (IO.popen): Refactor. Avoid assigning in condition.
+
+Thu Dec 24 15:01:38 2015  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* tool/file2lastrev.rb: Fix ArgumentError to work on Ruby 1.8.7.
+
+Thu Dec 24 14:44:08 2015  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* tool/vcs.rb (IO.popen): Enable on Ruby 1.9 where chdir option is not
+	  supported on IO.popen
+
+	* tool/vcs.rb (IO.popen): Fix NoMethodError. I guess r49705 was not
+	  tested... :/
+
+Thu Dec 24 14:57:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* NEWS: rename
+	  "Implementation changes" section to
+	  "Supported platform changes" section.
+
+	* NEWS: add "Implementation improvements" and add several entries.
+
+	* NEWS: add NEWS entries by Eric Wong. [ruby-core:72450]
+
+Thu Dec 24 00:26:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/extconf.rb: fix gem build failure on Windows.
+	  only win32_vk.inc is included in the gem and no dependencies for
+	  the header, so that gperf will not be mandatory.
+	  [ruby-core:72453] [Bug #11866]
+
+	* ext/io/console/io-console.gemspec: include depend file and
+	  win32_vk header.
+
+Wed Dec 23 23:58:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_readwrite_syserr_fail): works with the given errno than
+	  thread local errno.
+
+Wed Dec 23 17:57:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c, io.c, util.c: prefer rb_syserr_fail with saved errno
+	  over setting errno then call rb_sys_fail, not to be clobbered
+	  potentially and to reduce thread local errno accesses.
+
+Wed Dec 23 11:58:52 2015  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* string.c: Fix document. Default value of the first
+	  argument of `String#split` is not `$;` but `nil`.
+	  When `nil` is passed as first argument, `$;` is used.
+	  [ci skip] [Bug #11729] [ruby-dev:49378]
+
+Wed Dec 23 07:15:17 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_init_sock): reject reserved FDs
+	  [ruby-core:72445] [Bug #11862]
+
+Wed Dec 23 02:59:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (__STDC_WANT_LIB_EXT1__): necessary to use memset_s
+	  in strict C99 mode.
+
+Wed Dec 23 02:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regexec.c (match_at): move direct threaded VM code to get rid of
+	  mixed declarations and code, and enable it only for gcc since it
+	  depends on a gcc extension.
+
+Wed Dec 23 02:23:19 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0
+
+	* NEWS: Add news about the did_you_mean gem
+
+Wed Dec 23 02:18:57 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* doc/contributing.rdoc: [DOC] remove an extra word "here".
+	  [Fix GH-1169]
+
+Wed Dec 23 01:58:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regexec.c (USE_DIRECT_THREADED_VM): enable direct threaded VM by
+	  the default.
+
+Tue Dec 22 22:15:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (internal_object_p): should not expose singleton classes
+	  without a metaclass.  based on patches by ko1 and shugo.
+	  [Bug #11740]
+
+	* class.c (rb_singleton_class_object_p): added.
+
+Tue Dec 22 22:15:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/io-console.gemspec: bump up to 0.4.4.
+
+Tue Dec 22 22:11:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: Added news entry of Psych 2.0.17
+
+Tue Dec 22 22:09:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: Added news entry of RDoc 4.2.1
+
+Tue Dec 22 21:20:00 2015  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.gemspec: bump version to 1.2.8.
+
+Tue Dec 22 21:08:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rdoc.rb: bump version to 4.2.1. It contains following fixes.
+	  https://github.com/rdoc/rdoc/pull/340
+	  https://github.com/rdoc/rdoc/pull/341
+	  https://github.com/rdoc/rdoc/pull/367
+	  https://github.com/rdoc/rdoc/pull/368
+	* lib/rdoc/*: ditto.
+	* test/rdoc/*: ditto.
+
+Tue Dec 22 20:25:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/lib/psych.rb: bump version to 2.0.17
+	* ext/psych/psych.gemspec: ditto.
+
+Tue Dec 22 20:14:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: move vm_callee_setup_block_arg() (and related
+	  functions) to the latter location.
+	  This moving recovers performance a little.
+	  [Bug #11829]
+
+Tue Dec 22 15:21:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_compat_and_valid): as scrub does nothing for dummy
+	  encoding string now, incompatible encoding is not a matter.
+
+Tue Dec 22 14:31:28 2015  Toru Iwase  <tietew@tietew.net>
+
+	* ext/cgi/escape/escape.c (optimized_escape_html): CGI.escapeHTML
+	  should return unfrozen new string.
+	  [ruby-core:72426] [Bug #11858]
+
+Tue Dec 22 05:39:58 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* ext/cgi/escape/escape.c (preserve_original_state): Preserve
+	  original state for tainted and frozen.  [Fix GH-1166]
+	  [ruby-dev:49451] [Bug #11855]
+
+Tue Dec 22 03:57:20 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_init_sock): check FD after validating
+	* test/socket/test_basicsocket.rb (test_for_fd): new
+	  [ruby-core:72418] [Bug #11854]
+
+Mon Dec 21 21:29:45 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* variable.c (struct ivar_update): rename "extended" to "iv_extended"
+	  to avoid name conflict with /usr/include/floatingpoint.h on
+	  Solaris. [Bug #11853] [ruby-dev:49448]
+
+Mon Dec 21 12:15:32 2015  Kimura Wataru  <kimuraw@i.nifty.jp>
+
+	* test/ruby/test_io.rb: handled rlimit value same as r52277
+	  [Bug #11852][ruby-dev:49446]
+
+Mon Dec 21 10:21:22 2015  Ilya Vassilevsky <vassilevsky@gmail.com>
+
+	* lib/net/http.rb (open_timeout): update default value in RDoc
+	  [ruby-core:72413]
+
+Mon Dec 21 10:18:46 2015  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* vm_backtrace.c (rb_profile_frames): ignore ifunc frames as it
+	  did before.  [ruby-core:72409] [Bug #11851]
+
+Mon Dec 21 09:33:17 2015  Karol Bucek  <kares@users.noreply.github.com>
+
+	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket): fix
+	  NotImplementedError typo.  [Fix GH-1165]
+
+Sun Dec 20 20:54:51 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* cgi/escape/escape.c: Optimize CGI.escapeHTML for
+	  ASCII-compatible encodings.  [Fix GH-1164]
+
+Sun Dec 20 15:36:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/erb.rb: revert r53123. It breaks compatibility like thor and
+	  rspec-rails.
+	  We should try with Ruby 2.4 or 3.0.
+	  [Bug #11842][ruby-core:72374]
+	* lib/rdoc/erb_partial.rb: ditto.
+	* template/verconf.h.tmpl: ditto.
+
+Sun Dec 20 11:43:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_yylex): allow here documents in labeled
+	  argument.  [ruby-core:72396] [Bug #11849]
+
+Sun Dec 20 11:14:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_mod_define_method): should check Symbol or not.
+	  [Bug #11850]
+
+	* test/ruby/test_method.rb: add a test.
+
+Sun Dec 20 11:01:57 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_mod_define_method): fix notation.
+
+Sun Dec 20 10:54:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (proc_new): fix notation.
+
+Sun Dec 20 00:29:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_proc_get_iseq): proc made from symbol does not have
+	  iseq.  fix infinite loop.  [ruby-core:72381] [Bug #11845]
+
+Sat Dec 19 20:06:10 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* enc/windows_1250.c: Should not use C++ style comments (C99 feature).
+	  [Bug #11843]
+
+Sat Dec 19 17:17:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  use WEBrick::Utils::TimeoutHandler::Thread, which is ignored by
+	  LeakChecker#find_threads, instead of ::Thread to get rid of
+	  thread leak checker.  since this TimeoutHandler is resident
+	  during tests because of Singleton, it waits for the next timeout
+	  if it has any schedules.  in the case of nested timeouts, inner
+	  timeout does not cancel outer timeouts and then those schedules
+	  still remain.
+
+Sat Dec 19 14:28:01 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* ext/zlib/zlib.c (Init_zlib): [DOC] Fix double-word typo and
+	  grammatical error.  [Fix GH-1162]
+
+Sat Dec 19 14:23:59 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* lib/csv.rb (CSV#initialize): [DOC] Fix double-word typo.
+	  [Fix GH-1161]
+
+Sat Dec 19 10:33:33 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/iso_8859_2.c, enc/windows_1250.c: separate Windows-1250
+	  from ISO-8859-2 to fix 0x80..0x9e range (from Kimihito Matsui)
+
+Fri Dec 18 21:26:54 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler): To prevent
+	  potential deadlocks, Queue is used to tell update of @timeout_info
+	  instead of sleep and wakeup. [Bug #11742] [ruby-dev:49387]
+
+Fri Dec 18 17:24:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_load_object_string): use fstring if frozen string.
+
+Fri Dec 18 16:54:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_set_encoding): add StringIO's own
+	  encoding and separate it from the buffer string to override the
+	  encoding of string when reading.  [ruby-core:72189] [Bug #11827]
+	  note that setting the encoding of its buffer string directly
+	  without StringIO#set_encoding may cause unpredictable behavior.
+
+Fri Dec 18 16:50:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_load_setup): check tainted string argument.
+
+Fri Dec 18 16:12:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define USE_LAZY_LOAD if it is not defined.
+
+Fri Dec 18 15:40:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_unget_bytes): extract from
+	  strio_ungetbyte to share with strio_ungetc.
+
+Fri Dec 18 12:39:42 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/syntax/*.rdoc: separated modifier at sentence.
+	  [ci skip][fix GH-1121] Patch by @clandry94
+
+Fri Dec 18 12:09:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_ungetbyte): pad with \000 when
+	  the current position is after the end.
+
+Fri Dec 18 11:24:48 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_method.c (rb_method_entry_make, check_override_opt_method):
+	  should check whether a newly created method overrides an optimize
+	  method in case the method is defined in a prepended module of a
+	  built-in class.
+	  [ruby-core:72226] [Bug #11836]
+
+Fri Dec 18 11:09:38 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm.c (vm_exec): call RUBY_DTRACE_CMETHOD_RETURN_HOOK instead of
+	  RUBY_DTRACE_METHOD_RETURN_HOOK.
+
+Fri Dec 18 10:24:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/irb/ruby-lex.rb: fixed parse error for striped heredocument syntax.
+	  [fix GH-1127] Patch by @koic
+
+Fri Dec 18 09:44:47 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/pty/pty.c: fix double words typo.
+	  [ci skip][fix GH-1157] Patch by @jwworth
+
+Fri Dec 18 09:42:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/utf8tbl.c: fix a typo.
+	  [ci skip][fix GH-1159] Patch by @akshay-vishnoi
+	* ext/nkf/nkf-utf8/utf8tbl.h: ditto.
+
+Fri Dec 18 07:39:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm.c (rb_vm_check_redefinition_opt_method): should check the real
+	  class instead of the origin iclass.
+	  [ruby-core:72188] [Bug #11826]
+
+Thu Dec 17 22:13:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_args.c (vm_caller_setup_arg_block): remove code for ifunc
+	  because it was made unnecessary by r52138.
+
+Thu Dec 17 16:13:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* proc.c (rb_block_arity): should not call GetProcPtr() for symbols.
+	  [ruby-core:72205] [Bug #11830]
+
+Thu Dec 17 14:16:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_scrub): the result should be infected by the
+	  original string.
+
+Thu Dec 17 13:35:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (rb_econv_substr_append, econv_primitive_convert):
+	  the result should be infected by the original string.
+
+Thu Dec 17 09:46:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (reg_names_iter): should consider encoding of regexp.
+	  [ruby-core:72185] [Bug #11825]
+
+Thu Dec 17 03:52:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_make_env_each): should not compare with Qfalse and FALSE.
+	  Pointed at http://d.hatena.ne.jp/nagachika/20151216/ruby_trunk_changes_53128_53163
+
+Thu Dec 17 03:15:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_method_each_type): should not set fastpath
+	  with keyword arguments for VM_METHOD_TYPE_ATTRSET type methods.
+
+	  Normally, we can not use keyword arguments for this kind of methods,
+	  (obj.foo = 1), but we can set alias names for them.
+	  [Bug #11657]
+
+	* test/ruby/test_keyword.rb: add a test for this fix.
+
+Wed Dec 16 20:32:43 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/fiddle/handle.c: check tainted string arguments.
+	  Patch provided by tenderlove and nobu.
+
+	* test/fiddle/test_handle.rb (class TestHandle): add test for above.
+
+
+Wed Dec 16 19:30:56 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm.c (vm_make_proc_from_block): should convert a Symbol to a Proc.
+	  [ruby-core:72083] [Bug #11811]
+
+Wed Dec 16 16:17:34 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_io.rb: fix spelling errors
+
+Wed Dec 16 16:04:49 2015  Eric Wong  <e@80x24.org>
+
+	* NEWS: note IO#advise change [ruby-core:72168]
+
+Wed Dec 16 15:35:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: fix mark miss for proc given as passed block.
+	  [Bug #11750]
+
+	* vm.c (vm_make_proc_from_block): should return a Proc object
+	  if block is given. Previous implementation returns
+	  a Proc object only when corresponding Proc object is not
+	  available.
+
+	* vm.c (vm_make_env_each): ditto.
+
+	* test/ruby/test_proc.rb: add a test for this bug.
+
+Wed Dec 16 12:24:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* test_struct.rb: Test that initialize is overridable [#11708]
+
+Wed Dec 16 10:49:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (block_command, block_call): fix `&.` calls after
+	  block_call.  [Feature #11537]
+
+Wed Dec 16 00:53:45 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler): Acquire
+	  TimeoutMutex only when accessing @timeout_info for avoiding
+	  potential deadlock. [Bug #11742] [ruby-dev:49387]
+
+Wed Dec 16 00:39:27 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* doc/extension.rdoc: [DOC] fix double-word typo.  [Fix GH-1153]
+
+Wed Dec 16 00:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  TimeoutMutex should be acquired when accessing @timeout_info.
+	  To avoid deadlock, interrupt() calls are delayed.
+	  Due to the mutex, it is safe to treat ary without ary.dup.
+	  [Bug #11742] [ruby-dev:49387]
+
+Tue Dec 15 23:13:10 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* gc.c: Delete excess semicolon after RUBY_ALIAS_FUNCTION().
+	  Suppress "syntax error:  empty declaration" warnings by
+	  Oracle Solaris Studio 12.x on Solaris. [Bug #11821]
+
+	* hash.c: ditto, after NOINSERT_UPDATE_CALLBACK().
+
+Tue Dec 15 18:04:04 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* NEWS: added news about EBCDIC encoding
+
+Tue Dec 15 17:57:57 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/ebcdic.h, enc/trans/ebcdic.trans,
+	  test/ruby/test_transcode.rb: Fixed encoding name
+	  to the correct one in the IANA registry (IBM037)
+	  and added an alias (ebcdic-cp-us)
+
+Tue Dec 15 16:19:26 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* lib/erb.rb: Render erb with array buffer for function call optimization.
+	  [fix GH-1143]
+	* lib/rdoc/erb_partial.rb: ditto.
+	* template/verconf.h.tmpl: ditto.
+
+Tue Dec 15 13:50:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_oct): [DOC] mention radix indicators.
+	  [ruby-core:71310] [Bug #11648]
+
+Tue Dec 15 12:20:30 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* lib/erb.rb: Simplify regexp to optimize erb scanner.
+	  [fix GH-1144]
+
+Tue Dec 15 11:56:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/uri/common.rb: make code block for rdoc.
+	  [ci skip][fix GH-1152] Patch by @Tonkpils
+
+Tue Dec 15 11:55:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/zlib/zlib.c: fix a typo.
+	  [ci skip][fix GH-1149] Patch by @crismali
+
+Tue Dec 15 09:14:14 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* tool/transcode_tablegen.rb: detailed documentation
+	  for transcode_tblgen function [ci skip]
+
+Mon Dec 14 22:11:11 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/ebcdic.h: new dummy encoding EBCDIC-US
+	* enc/trans/ebcdic.trans: transcodings between EBCDIC-US
+	  and iso-8859-1 [with code from Andrea Ribuoli]
+	* test/ruby/test_transcode.rb: tests for above
+	* tool/transcode_tablegen.rb: additional argument for
+	  method transcode_tblgen
+
+Mon Dec 14 17:04:14 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/socket/lib/socket.rb: use safe navigation operator.
+	  [fix GH-1142] Patch by @mlarraz
+	* lib/drb/extservm.rb: ditto.
+	* lib/net/http.rb: ditto.
+	* lib/net/http/response.rb: ditto.
+	* lib/scanf.rb: ditto.
+	* lib/uri/generic.rb: ditto.
+
+Mon Dec 14 17:03:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* bootstraptest/runner.rb: use safe navigation operator.
+	  [fix GH-1142] Patch by @mlarraz
+	* test/openssl/test_pair.rb: ditto.
+	* test/ruby/test_econv.rb: ditto.
+	* test/ruby/test_settracefunc.rb: ditto.
+	* test/thread/test_queue.rb: ditto.
+
+Mon Dec 14 14:33:35 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/xmlrpc.rb: added documentation for parser details.
+	  [ci skip][fix GH-1124] Patch by @jrafanie
+
+Mon Dec 14 11:46:52 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enum.c: fix a typo in documentation.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* io.c: ditto.
+	* iseq.c: ditto.
+	* numeric.c: ditto.
+	* process.c: ditto.
+	* string.c: ditto.
+	* vm_trace.c: ditto.
+
+Mon Dec 14 11:41:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/cgi.rb: fix a typo in documentation.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+
+Mon Dec 14 11:31:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* compile.c: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* dir.c: ditto.
+	* gc.c: ditto.
+	* io.c: ditto.
+	* node.h: ditto.
+	* thread_pthread.c: ditto.
+	* vm_insnhelper.c: ditto.
+	* vsnprintf.c: ditto.
+
+Mon Dec 14 11:27:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enc/iso_2022_jp.h: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* enc/utf_16_32.h: ditto.
+	* enc/utf_7.h: ditto.
+
+Mon Dec 14 11:25:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* benchmark/bm_app_aobench.rb: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* benchmark/bm_vm_thread_pipe.rb: ditto.
+
+Sun Dec 13 23:46:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (trace_lex_state): trace lex_state changes if yydebug is
+	  set, and send the messages to rb_stdout.
+
+	* parse.y (rb_parser_printf): store YYPRINTF messages per lines
+	  so that lex_state traces do not mix.
+
+	* tool/ytab.sed: add parser argument to yy_stack_print too.
+
+Sun Dec 13 20:41:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (build_lex_state_name, trace_lex_state): lex_state is
+	  now bit flags and can be set 2 bits or more.
+
+Sun Dec 13 20:26:30 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* test/ruby/test_syntax.rb: fix typo in test
+
+Sun Dec 13 20:12:14 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* parse.y (parse_percent): Allow %-literals in labeled arg as
+	  r51624 did for parentheses.
+	  Fixes [ruby-core:72084] [Bug #11812].
+
+Sun Dec 13 20:02:15 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fix a typo
+
+Sun Dec 13 19:54:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/lib/envutil.rb: move envutil's assertions under Test::Unit::Assertion.
+	* test/lib/test/unit/assertions.rb: ditto.
+
+Sun Dec 13 19:24:20 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* parse.y (lex_state_name): Make it return the correct names.
+	  Add new names to follow r51617; Indices ffs(2) returns are 1-origin.
+
+Sun Dec 13 18:40:45 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* parse.y: debug output of lex_state transition if PARSER_DEBUG
+
+Sun Dec 13 18:49:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (parse_mode_enc): preserve encoding of mode string in
+	  warnings.
+
+	* io.c (io_encname_bom_p): check BOM prefix only, not including
+	  UTF prefix.
+
+	* io.c (parse_mode_enc): warn BOM with non-UTF encoding.
+
+	* io.c (parse_mode_enc): fix buffer overflow.
+
+Sun Dec 13 18:35:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/function.c (initialize): check all arguments first.
+	  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+	* ext/fiddle/conversions.h (PTR2NUM): use signed integer to make
+	  Fixnum for negative values.
+
+Sun Dec 13 18:33:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* pack.c (pack_pack): always check index range against the
+	  receiver array length, which can be shortened by elements
+	  conversion.  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+Sun Dec 13 18:28:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/psych/psych_emitter.c (start_document): should not exceed
+	  tags array range.
+
+	* ext/psych/psych_emitter.c (start_document): ensure string before
+	  encoding conversion.
+
+Sun Dec 13 18:26:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/tk/tkutil/tkutil.c (tk_hash_kv): check types of array
+	  argument.  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+	* ext/tk/tkutil/tkutil.c (cbsubst_table_setup): check length of
+	  argument arrays for each access, as callback methods can modify
+	  them.  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+	* ext/tk/tkutil/tkutil.c (cbsubst_table_setup): check types of
+	  argument elements.  reported by Marcin 'Icewall' Noga of Cisco
+	  Talos.
+
+Sun Dec 13 18:19:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32ole/win32ole.c (ole_vstr2wc): check argument type, vstr
+	  must be a String here.  reported by Marcin 'Icewall' Noga of
+	  Cisco Talos.
+
+Sun Dec 13 16:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (BOOTSTRAPRUBY): make BASERUBY full path before
+	  building ruby to get rid of unexpectedly invoking built ruby.
+	  [ruby-core:72065] [Bug #11807]
+
+	* configure.in (BOOTSTRAPRUBY): use MINIRUBY but not BASERUBY
+	  unless cross compiling.  [ruby-core:72065] [Bug #11807]
+
+Sun Dec 13 14:17:19 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* test/test_shellwords.rb (TestShellwords): Add many more tests
+	  for handling whitespace characters and frozenness.
+
+Sun Dec 13 14:16:09 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/shellwords.rb (Shellwords#shellsplit): Document that this
+	  method does not treat shell metacharacters as such.
+
+Sun Dec 13 12:17:43 2015  Eric Wong  <e@80x24.org>
+
+	* lib/shellwords.rb (shellescape): duplicate frozen literal
+	* test/test_shellwords.rb (test_stringification): new test
+
+Sun Dec 13 11:47:35 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* object.c (rb_inspect): check the default internal encoding as
+	  String#inspect do.
+	  [ruby-dev:49415] [Bug #11787]
+
+Sun Dec 13 11:38:12 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/shellwords.rb: Turn on frozen-string-literal after fixing
+	  shellsplit.
+
+Sun Dec 13 10:44:44 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* KNOWNBUGS.rb: Fixed typo, made more explicit [ci skip]
+
+Sun Dec 13 10:26:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ssl_npn_select_cb_common): fix parsing
+	  protocol list.
+	  The protocol list from OpenSSL is not null-terminated.
+	  patched by Kazuki Yamaguchi [Bug #11810] [ruby-core:72082]
+
+Sun Dec 13 06:40:30 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/ostruct.rb: Have OpenStruct#dig raise if argument is not a
+	  symbol
+	  nor a string. See [#11762]
+
+Sun Dec 13 00:05:42 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_call_method_missing): method_missing should
+	  not be refined.
+	  [ruby-core:72080] [Bug #11809]
+
+Sat Dec 12 23:00:17 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: Merge nkf 2.1.4.
+
+Sat Dec 12 18:52:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_obj_dig): raise TypeError if an element does not
+	  have #dig method.  [ruby-core:71798] [Bug #11762]
+
+Sat Dec 12 17:59:07 2015  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* test/ruby/test_regexp.rb: Add test cases for `$KCODE` and `$=` warning
+	  [Misc #11770][ruby-dev:49398]
+
+Sat Dec 12 17:11:57 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* doc/NEWS-0.2.2: add description about incompatible change in Hash
+	  duplicated key overriding policy. [Bug #10315] [Bug #11501]
+
+Sat Dec 12 07:44:38 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (do_io_advise): do not raise on ENOSYS
+	* test/ruby/test_io.rb (test_advise): do not skip on Errno::ENOSYS
+	  (test_advise_pipe): ditto
+	  [ruby-core:72066] [Feature #11806]
+
+Sat Dec 12 07:05:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enc/windows_1252.c: separate from ISO-8859-1 to fix 0x80..0x9e
+	  range.  [ruby-core:64049] [Bug #10097]
+
+Fri Dec 11 23:33:40 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* sample/trick2015/: added the award-winning entries of TRICK 2015.
+	  See https://github.com/tric/trick2015 for the contest outline.
+
+Fri Dec 11 17:59:05 2015  Eric Wong  <e@80x24.org>
+
+	* insns.def (opt_case_dispatch): avoid converting Infinity
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch_inf): new
+	  [ruby-dev:49423] [Bug #11804]'
+
+Fri Dec 11 16:48:57 2015  Eric Wong  <e@80x24.org>
+
+	* hash.c (rb_num_hash_start): avoid pathological behavior
+	  [ruby-core:72028] [Feature #11405]
+
+Fri Dec 11 11:58:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: Mentioned rubygems-2.5.1
+
+Fri Dec 11 11:52:39 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.1
+	* test/rubygems: ditto.
+
+Fri Dec 11 11:38:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each, ibf_load_object_hash): rehash
+	  case-dispatch hash to reduce collisions.
+	  http://d.hatena.ne.jp/ku-ma-me/20151210
+
+Fri Dec 11 03:44:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* object.c (rb_inspect): dump inspected result with rb_str_escape()
+	  instead of raising Encoding::CompatibilityError. [Feature #11801]
+
+	* string.c (rb_str_escape): added to dump given string like
+	  rb_str_inspect without quotes and always dump in US-ASCII
+	  like rb_str_dump.
+
+Thu Dec 10 14:59:59 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_gc.rb (test_expand_heap): relax condition (1->2).
+
+Thu Dec 10 14:15:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* cont.c: fix a double word typo.
+	  [Bug #11313][ruby-core:69749]
+
+Thu Dec 10 14:13:34 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/tk/lib/multi-tk.rb: fix typos.
+	  [Bug #11764][ruby-core:71800]
+
+Thu Dec 10 11:33:34 2015  Eric Wong  <e@80x24.org>
+
+	* compile.c (iseq_compile_each): reduce needless rb_str_dup
+	  [ruby-core:72018] <5668DB6E.8000101@ruby-lang.org>
+
+Thu Dec 10 09:32:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb, lib/shellwords.rb: disable frozen-string-literal.
+	  [ruby-core:72011] [Bug #11800]
+
+Thu Dec 10 06:33:39 2015  Eric Wong  <e@80x24.org>
+
+	* marshal.c (memsize_dump_arg): remove NULL check
+	  (memsize_load_arg): ditto
+
+Thu Dec 10 05:53:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/mkconfig.rb: rbconfig must not be frozen-string-literal to
+	  expand CONFIG hash.  [ruby-core:72006] [Bug #11798]
+
+Thu Dec 10 05:03:51 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ifaddr.c (ifaddr_mark): remove empty function
+	  (ifaddr_type): pass zero to rb_data_type_t.function.dmark
+
+Thu Dec 10 04:49:16 2015  Eric Wong  <e@80x24.org>
+
+	* proc.c (bm_free): remove, use default free
+	  (method_data_type): use RUBY_TYPED_DEFAULT_FREE
+
+Thu Dec 10 02:01:41 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_compile_each): do not add debug information
+	  without --debug or --debug=frozen-string-literal option
+	  because String#dup slows down with debug information.
+	  [Feature #11725]
+
+	* NEWS: apply about it.
+
+	* test/ruby/test_rubyoptions.rb: catch up this fix with refactoring.
+
+Thu Dec 10 00:06:56 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c: rename methods
+	  RubyVM::InstructionSequence#to_binary_format -> #to_binary
+	  RubyVM::InstructionSequence.from_binary_format -> .load_from_binary
+	  RubyVM::InstructionSequence.from_binary_format_extra_data ->
+	                             .load_from_binary_extra_data
+
+	* iseq.c: fix document of iseq.to_binary.
+	  [Fix GH-1134]
+
+	* sample/iseq_loader.rb: catch up this change.
+
+	* test/lib/iseq_loader_checker.rb: ditto.
+
+Wed Dec  9 17:02:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regparse.h (SET_NTYPE): get rid of breaking strict aliasing.
+	  patch by Zarko Todorovski in [ruby-core:71953].  [Bug #11790]
+
+Wed Dec  9 16:10:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (rb_vm_cref_in_context): Module#define_method in non-class
+	  expression should be public.
+	  [Bug #11754]
+
+	* test/ruby/test_method.rb: add a test.
+
+Wed Dec  9 14:45:27 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_stacked_objects): fix typo.
+	  reported by XIE Zhibang. [Bug #11763]
+
+Wed Dec  9 14:37:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* doc/syntax/refinements.rdoc: remove outdated description.
+
+Wed Dec  9 09:58:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/**/*.c (*_memsize): same as r52986 for extensions.
+
+Wed Dec  9 09:46:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .gitignore: ignored ISeq binary format.
+
+Wed Dec  9 09:34:41 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* *.c (*_memsize): do not check ptr.
+	  NULL checking is finished Before call of memsize functions.
+	  See r52979.
+
+Wed Dec  9 09:25:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/net/smtp/test_response.rb: use Test::Unit. We should use Test::Unit
+	  without rubygems and rdoc.
+
+Wed Dec  9 06:26:23 2015  Colin Kelley <colindkelley@gmail.com>
+
+	* lib/uri/generic.rb: enable frozen_string_literal
+	  (split_userinfo): remove explicit .freeze for string literals
+	  (check_path): ditto
+	  (query): ditto
+	  (fragment): ditto
+	  (to_s): ditto
+	  [ruby-core:71910] [Bug #11759]
+
+Wed Dec  9 06:25:47 2015  Eric Wong  <e@80x24.org>
+
+	* test/uri/test_generic.rb (to_s): new test
+	  [ruby-core:71820]
+
+Wed Dec  9 02:18:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_dump_memsize): should check NULL.
+
+Wed Dec  9 01:46:35 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* string.c (rb_str_init): now accepts new option parameter `encoding'.
+	  [Feature #11785]
+
+Wed Dec  9 00:52:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_stat_wr, rb_stat_ww): call get_stat only once and
+	  reduce checking struct.  patch by Yuki Kurihara in
+	  [ruby-core:71949].  [Misc #11789]
+
+Wed Dec  9 00:24:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_ibf_dump): dump extra data just string length.
+
+	* sample/iseq_loader.rb: add using
+	  RubyVM::InstructionSequence.from_binary_format_extra_data method
+	  (commented out).
+
+Mon Dec  9 00:21:19 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.rc1
+
+Wed Dec  9 00:17:49 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_load_setup): cast to int.
+
+Wed Dec  9 00:13:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_setup_load): rename to ibf_load_setup().
+
+	* compile.c (iseq_load_setup): check binary format.
+
+Tue Dec  8 23:30:07 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/io/console/test_io_console.rb (run_pty): Avoid waiting twice
+	  for a process. Fix Errno::ECHILD in TestIO_Console#test_close and
+	  TestIO_Console#test_sync.
+
+Tue Dec  8 23:05:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_ibf_dump): fix for clang type checker.
+
+Tue Dec  8 23:04:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_s_load): fix mysterious bug.
+
+Tue Dec  8 22:31:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* introduce new ISeq binary format serializer/de-serializer
+	  and a pre-compilation/runtime loader sample.
+	  [Feature #11788]
+
+	* iseq.c: add new methods:
+	  * RubyVM::InstructionSequence#to_binary_format(extra_data = nil)
+	  * RubyVM::InstructionSequence.from_binary_format(binary)
+	  * RubyVM::InstructionSequence.from_binary_format_extra_data(binary)
+
+	* compile.c: implement body of this new feature.
+
+	* load.c (rb_load_internal0), iseq.c (rb_iseq_load_iseq):
+	  call RubyVM::InstructionSequence.load_iseq(fname) with
+	  loading script name if this method is defined.
+
+	  We can return any ISeq object as a result value.
+	  Otherwise loading will be continue as usual.
+
+	  This interface is not matured and is not extensible.
+	  So that we don't guarantee the future compatibility of this method.
+	  Basically, you shouldn't use this method.
+
+	* iseq.h: move ISEQ_MAJOR/MINOR_VERSION (and some definitions)
+	  from iseq.c.
+
+	* encoding.c (rb_data_is_encoding), internal.h: added.
+
+	* vm_core.h: add several supports for lazy load.
+	  * add USE_LAZY_LOAD macro to specify enable or disable of
+	    this feature.
+	  * add several fields to rb_iseq_t.
+	  * introduce new macro rb_iseq_check().
+
+	* insns.def: some check for lazy loading feature.
+
+	* vm_insnhelper.c: ditto.
+
+	* proc.c: ditto.
+
+	* vm.c: ditto.
+
+	* test/lib/iseq_loader_checker.rb: enabled iff suitable
+	  environment variables are provided.
+
+	* test/runner.rb: enable lib/iseq_loader_checker.rb.
+
+	* sample/iseq_loader.rb: add sample compiler and loader.
+
+	    $ ruby sample/iseq_loader.rb [dir]
+
+	  will compile all ruby scripts in [dir].
+	  With default setting, this compile creates *.rb.yarb files
+	  in same directory of target .rb scripts.
+
+	    $ ruby -r sample/iseq_loader.rb [app]
+
+	  will run with enable to load compiled binary data.
+
+Tue Dec  8 21:21:16 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: mention about Enumerator::Lazy#grep_v.
+	  [ruby-core:71845] [Feature #11773]
+
+Tue Dec  8 17:36:36 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* string.c: removed unused variable
+
+Tue Dec  8 16:23:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enumerator.c (lazy_grep_v): add Enumerator::Lazy#grep_v as well
+	  as Enumerable, to enumerate lazily.
+	  [ruby-core:71845] [Feature #11773]
+
+Tue Dec  8 14:27:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_local_variables): new method
+	  NameError#local_variables for internal use only.
+	  [Feature #11777]
+
+Tue Dec  8 14:20:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_objivar): skip internal instance variables in
+	  T_OBJECT too.
+
+Tue Dec  8 12:58:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/io/console/test_io_console.rb (test_getpass): s.getpass
+	  should be tested. Narrow ensure block. This reverts r52911.
+	  [Bug #11780] [ruby-dev:49412]
+
+Tue Dec  8 10:40:21 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_vm2_case_lit.rb: new benchmark
+	* compile.c (case_when_optimizable_literal): add nil/true/false
+	* insns.def (opt_case_dispatch): ditto
+	* vm.c (vm_redefinition_check_flag): ditto
+	* vm.c (vm_init_redefined_flag): ditto
+	* vm_core.h: ditto
+	* object.c (InitVM_Object): define === explicitly for nil/true/false
+	* test/ruby/test_case.rb (test_deoptimize_nil): new test
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch): update
+	  (test_eqq): new test
+	  [ruby-core:71923] [Feature #11769]
+	  Original patch by Aaron Patterson <tenderlove@ruby-lang.org>
+
+Tue Dec  8 10:19:02 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* lib/optparse.rb: fix double word typo in the document.
+	  [Misc #10608] [Fix GH-1126]
+
+Tue Dec  8 09:03:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/date_core.c (d_lite_lshift): should check the argument
+	  before negation.
+
+Tue Dec  8 08:56:16 2015  Eric Wong  <e@80x24.org>
+
+	* insns.def (opt_case_dispatch): check Float#=== redefinition
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch): new
+	  [ruby-core:71920] [Bug #11784]
+
+Tue Dec  8 03:56:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/lib/iseq_loader_checker.rb: add iseq dumper/loader checker.
+	  If you enable this checker (remove `#' in test/runner.rb),
+	  you can see comparison results between an original iseq disassembed
+	  result and dumped and loaded iseq disassembed result.
+
+	  There are several bugs around there, because of inexact stack depth
+	  calculation. Now, I leave these bugs because they are not critical
+	  and difficult to solve completely.
+
+	* test/runner.rb: require test/lib/iseq_loader_checker.rb but
+	  disabled at default (commented out).
+
+Tue Dec  8 03:45:47 2015  Eric Wong  <e@80x24.org>
+
+	* doc/extension.rdoc: warn about kwargs performance in C
+	  [Feature #11339] [ci skip]
+
+Tue Dec  8 03:44:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_load): disable peephole optimization option
+	  because apply it multiple times change the sequence.
+	  (iseq != peephole_optimize(load(iseq.to_a)))
+
+Tue Dec  8 03:43:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (rb_iseq_build_from_ary): do not allocate table
+	  if table_size is 0.
+
+Tue Dec  8 03:30:34 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/unixsocket.c (unix_send_io): document args
+	  (unix_recv_io): ditto
+	* test/socket/test_unix.rb (test_fd_passing_class_mode): added
+
+Tue Dec 08 02:21:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_translate): at the end of constructing an iseq,
+	  call RubyVM::InstructionSequence.translate(iseq) if this method
+	  is defined. If the return value is also an object of
+	  RubyVM::InstructionSequence, then use it instead of created one.
+
+	  For example, this method is useful to test iseq dumper/loader
+	  such as RubyVM::InstructionSequence#to_a and rb_iseq_load().
+
+	  Because this method is for such internal experimental usage,
+	  the interface is not matured. For example, this interface has
+	  no extensibility. Two or more translators can not run
+	  simultaneously.
+
+	  So that we don't guarantee future compatibility of this method.
+	  Basically, do not use this method.
+
+Tue Dec  8 01:57:13 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/psych/*: update psych to 2.0.16
+	* test/psych/*: ditto
+
+Mon Dec  7 23:45:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* string.c: introduce String#+@ and String#-@ to control
+	  String mutability.
+	  [Feature #11782]
+
+Mon Dec  7 23:39:49 2015  Ben Miller  <bjmllr@gmail.com>
+
+	* parse.y: add heredoc <<~ syntax.  [Feature #9098]
+
+Mon Dec  7 23:06:16 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* prelude.rb (IO#read_nonblock): [DOC] add missing options to
+	  call-seq.  [ruby-core:71627] [Bug #11730]
+
+Mon Dec  7 15:50:50 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* .gitignore: added cygruby*.def for Cygwin
+
+Sun Dec  6 19:52:31 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/intern.h (rb_autoload): deprecate
+	* internal.h (rb_autoload_str): declare
+	* load.c (rb_mod_autoload): use rb_autoload_str
+	* variable.c (rb_autoload): become compatibility wrapper
+	  (rb_autoload_str): hoisted out from old rb_autoload
+	  [ruby-core:71369] [Feature #11664]
+
+Sun Dec  6 18:25:22 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/webrick/test_cgi.rb (TestWEBrickCGI#test_cgi): gave up the test
+	  of binary path info test on Windows because the test had passed
+	  occasionally as the comment said.
+
+Sun Dec  6 15:25:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_getpass): add IO#getpass
+	  method.
+
+Sun Dec  6 08:39:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/json/json.gemspec: bump version to json 1.8.3. CRuby already contained
+	  upstream changes.
+
+	  https://github.com/ruby/ruby/commit/4d059bf9f5f10f3d3088de49fc87e5555db7770d
+	  https://github.com/flori/json/commit/d4c99de78905d96c3f301f48b2c789943bb3f098
+
+	* ext/json/lib/json/version.rb: ditto.
+
+Sat Dec  5 17:48:25 2015  Lars Kanis  <lars@greiz-reinsdorf.de>
+
+	* tool/fake.rb: Fix cross build when srcdir is an absolute path.
+
+	* Makefile.in: PREP dependency is needed when cross build too, not
+	  "-r$(arch)-fake" to be  used before created.  [Fix GH-1125]
+
+Sat Dec  5 17:26:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (env_str_new, env_path_str_new): make default string
+	  UTF-8 for the case conversion is not possible.  [Bug #8822]
+
+	* hash.c (get_env_cstr): convert non-ASCII string to UTF-8 string.
+
+	* hash.c (ruby_setenv): use wide char version to put environment
+	  variable to deal with non-ASCII value.
+
+Sat Dec  5 09:56:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby_atomic.h (ATOMIC_CAS): old value to be swapped should be
+	  same as the destination.  immediate value may need type
+	  promotion.
+
+	* ruby_atomic.h (ATOMIC_SIZE_CAS): fix the argument order of
+	  InterlockedCompareExchange64.  new value and then old value is
+	  the last.
+
+Sat Dec  5 09:23:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (fill_random_seed): fix the size to be filled, not the
+	  size of element, but the whole size of array.
+
+Sat Dec  5 06:03:54 2015  Eric Wong  <e@80x24.org>
+
+	* vm.c (ruby_vm_verbose_ptr): make static
+	  (ruby_vm_debug_ptr): ditto
+
+Sat Dec  5 00:56:29 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* include/ruby/ruby.h (RB_OBJ_TAINT): follow-up of r52881.
+	  Turn into void expression not to use unexpected result.
+	  Fix "operands have incompatible types" error with
+	  Oracle Solaris Studio 12.x on Solaris.
+
+Fri Dec  4 19:52:52 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/iso_8859_13.c: Added three missing lower/upper-case
+	  character pairs (from Kimihito Matsui)
+
+Fri Dec  4 18:57:57 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/iso_8859_4.c: Added missing lower/upper-case character
+	  pair (U+014A and U+014B, LATIN CAPITAL/SMALL LETTER ENG)
+	  (from Kimihito Matsui)
+
+Fri Dec  4 16:48:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_obj_as_string): fstring should not be infected.
+	  re-apply r52872 and fix a typo.
+	  TODO: other frozen strings also may not be.
+
+Fri Dec  4 15:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(fdab4c4).
+	  this version includes #1396, #1397, #1398, #1399
+	* test/rubygems: ditto.
+
+Fri Dec  4 11:22:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): name must be ascii-compatible, as
+	  pthread APIs do not accept legacy wide char strings.
+
+Thu Dec  3 15:39:21 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/scanf.rb: fixed double words typo.
+	  [ci skip][fix GH-1123] Patch by @jwworth
+
+Thu Dec  3 15:37:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_mixed_unicode_escapes.rb: fixed typo.
+	  [fix GH-1122] Patch by @davydovanton
+	* test/ruby/test_object.rb: ditto.
+	* test/socket/test_tcp.rb: ditto.
+
+Thu Dec  3 15:33:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): fix wrong shifting position in
+	  Rational conversion when not at the beginning of the result.
+	  [ruby-core:71806] [Bug #11766]
+
+Thu Dec  3 14:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* range.c (range_to_s): should be infected by the receiver.
+	  str2 infects by appending.  [ruby-core:71811] [Bug #11767]
+
+Thu Dec  3 11:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: separate SET_CURRENT_THREAD_NAME, which can set
+	  the name of current thread only, and SET_ANOTHER_THREAD_NAME,
+	  which can set the name of other threads.
+
+	* thread.c (rb_thread_setname): use SET_ANOTHER_THREAD_NAME.  OS X
+	  is not possible to set another thread name.
+
+	* thread_pthread.c (native_set_thread_name, thread_timer): use
+	  SET_CURRENT_THREAD_NAME.
+
+Wed Dec 02 22:57:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, iseq.h: remove rb_iseq_t::variable_body.
+	  Fields in rb_iseq_t::variable_body are contained by
+	  rb_iseq_t::body::mark_ary (hidden Array object).
+
+	  Index 0 to 2 of mark_ary are reserved by these objects.
+
+	* iseq.c: catch up this fix.
+
+	* compile.c (rb_iseq_original_iseq): trivial rewrite.
+
+Wed Dec  2 17:19:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_ORIGINAL_ISEQ() and
+	  ISEQ_ORIGINAL_ISEQ_ALLOC() macro.
+
+	* compile.c: use them to access original iseq buffer.
+
+	* iseq.c: ditto.
+
+	* vm_core.h: rename iseq field to support this fix.
+
+Wed Dec  2 17:10:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_FLIP_CNT_INCREMENT() macro.
+
+	* compile.c (iseq_compile_each): use it.
+
+	* vm_core.h: rename flip_cnt field to support this fix.
+
+Wed Dec  2 17:05:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_COVERAGE() and ISEQ_COVERAGE_SET() macro.
+
+	* compile.c: use them.
+
+	* iseq.c: ditto.
+
+	* iseq.c (rb_iseq_coverage): added.
+
+	* thread.c (update_coverage): use rb_iseq_coverage().
+
+	* vm_core.h: rename coverage field name to support this fix.
+
+Wed Dec  2 17:00:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (enc_name, rb_enc_name_list_i, rb_enc_aliases_enc_i):
+	  make fstring instead of making each copies.
+
+Wed Dec  2 16:32:08 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_COMPILE_DATA() macro.
+
+	* compile.c, iseq.c: use ISEQ_COMPILE_DATA().
+
+	* vm_core.h: rename compile_data field to support this fix.
+
+Wed Dec  2 16:27:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (enc_m_loader): defer finding encoding object not to
+	  be infected by marshal source.  [ruby-core:71793] [Bug #11760]
+
+	* marshal.c (r_object0): enable compatible loader on USERDEF
+	  class.  the loader function is called with the class itself,
+	  instead of an allocated object, and the loaded data.
+
+	* marshal.c (compat_allocator_table): initialize
+	  compat_allocator_tbl on demand.
+
+	* object.c (rb_undefined_alloc): extract from rb_obj_alloc.
+
+Wed Dec  2 15:12:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* configure.in: Fixed double negative comments.
+	  [Bug #11698][ruby-core:71506]
+
+Wed Dec  2 14:55:01 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_string.rb: removed non executing tests.
+	  [Misc #11757][ruby-dev:49397]
+
+Wed Dec  2 11:23:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/csv.rb: enable frozen_string_literal.
+	  [fix GH-1116] Patch by @marshall-lee
+
+Wed Dec  2 10:36:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c: Fix double word typo.
+	  [ci skip][fix GH-1120] Patch by @jwworth
+
+Wed Dec  2 07:43:51 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (mSSLExtConfig): make static
+	  (eSSLError): ditto
+	  (ID_callback_state): ditto
+	  (ossl_ssl_ex_vcb_idx): ditto
+	  (ossl_ssl_ex_store_p): ditto
+	  (ossl_ssl_ex_ptr_idx): ditto
+	* ext/openssl/ossl_ssl.h: remove extern declarations for
+	  mSSLExtConfig and eSSLError
+
+Wed Dec  2 07:41:08 2015  Eric Wong  <e@80x24.org>
+
+	* missing/explicit_bzero.c (explicit_bzero): fixup r52839
+	  for compilers with "weak" attribute
+
+Wed Dec  2 06:47:25 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* missing/explicit_bzero.c: add ruby_explicit_bzero_hook_unused
+	  for preventing optimization. Inspired from OpenBSD.
+
+Tue Dec  1 23:36:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): allow to reset thread name.
+
+Tue Dec  1 23:14:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): check the argument if valid
+	  string.  [ruby-core:71774] [Bug #11756]
+
+Tue Dec  1 17:13:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_string_value_cstr): should not raise on frozen
+	  string.
+
+Tue Dec  1 09:35:29 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* missing/explicit_bzero.c: add a few comment.
+
+Tue Dec  1 09:31:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* missing/explicit_bzero.c: add disabling optimization on gcc.
+
+Tue Dec  1 07:50:33 2015  Eric Wong  <e@80x24.org>
+
+	* missing/explicit_bzero.c: new file. define explicit_bzero.
+	  Fixup r52806
+
+Thu Oct 22 12:54:43 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (register_ubf_list): renamed from
+	  add_signal_thread_list.
+	* thread_pthread.c (unregister_ubf_list): renamed
+	  from remove_signal_thread_list.
+	* thread_pthread.c (ubf_wakeup_all_threads): renamed from
+	  ping_signal_thread_list.
+	* thread_pthread.c (ubf_wakeup_thread): renamed from
+	  ubf_select_each.
+	* thread_pthread.c (ubf_threads_empty): renamed from
+	  check_signal_thread_list().
+	* thread_pthread.c (ubf_list_lock): renamed from
+	  signal_thread_list_lock.
+
+	* thread_pthread.c (register_ubf_list): large simplification
+	  by using ccan/list.h.
+	  bonus: removed malloc() and exit(EXIT_FAILURE).
+	* thread_pthread.c (unregister_ubf_list): ditto.
+	* thread_pthread.c (ubf_threads_empty): ditto.
+	* thread_pthread.c (ubf_wakeup_all_threads): ditto.
+
+	* thread_pthread.c (print_signal_list): removed.
+
+Thu Oct 22 08:03:49 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_rand.rb (TestRand#test_default_seed): add
+	  srand case.
+
+Thu Oct 22 06:33:38 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (InitVM_Random): move Random::DEFAULT initialization
+	  bits to Init_Random_default.
+	* random.c (Init_Random_default): renamed from Init_RandomSeed2.
+	* random.c (Init_RandomSeedCore): renamed from Init_RandomSeed.
+
+Thu Oct 22 06:20:48 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (Init_RandomSeed): move all Random::DEFAULT
+	  construction bits to Init_RandomSeed2. Random::DEFAULT
+	  and Ruby internal hashes are no longer shared their seed.
+	* random.c (Init_RandomSeed2): ditto. And, kill evil
+	  rb_obj_reveal() stuff.
+
+	* random.c (init_hashseed): add MT argument.
+	* random.c: (init_siphash): ditto.
+
+	* test/ruby/test_rand.rb (TestRand#test_default_seed): new
+	  test for Random::DEFAULT::seed.
+
+Thu Oct 22 05:23:48 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (init_hashseed, init_siphash): extract initialize
+	  functions.
+
+Thu Oct 22 01:01:34 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: sort AC_CHECK_HEADERS() by alphabetical order.
+
+Thu Oct 22 00:19:07 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (init_randomseed): remove "initial" argument. It never
+	  be used from outside of this function.
+
+Thu Oct 22 00:12:33 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* lib/securerandom.rb (SecureRandom::gen_random): use /dev/urandom
+	  for initialize OpenSSL's rand.
+
+Wed Oct 21 12:10:04 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/openssl/ossl_rand.c (ossl_rand_bytes): RAND_bytes could
+	  be return -1 as an error. Therefore, added error handling.
+	* ext/openssl/ossl_pkey_dsa.c (dsa_generate): ditto.
+
+Wed Oct 21 09:04:09 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/util.h: remove a warning suppression C4723
+	  (potential divide by zero) for VisualC++. It's meaningless.
+	  Before r26197, there is ruby_div0() in this place and it
+	  actually made divide by zero. But now it's just garbage.
+
+Wed Oct 21 08:23:36 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c: random_raw_seed don't use GRND_NONBLOCK. GRND_NONBLOCK
+	  mean the result might not have an enough cryptic strength and
+	  easy predictable. That's no good for SecureRandom.
+
+Sun Oct 18 17:26:53 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* common.mk: add a rule for explicit_bzero.o.
+	* configure.in: detect explicit_bzero and memset_s.
+	* include/ruby/missing.h: add explicit_bzero.
+	* random.c (init_randomseed): use explicit_bzero() instead of
+	  memset(). memset could be eliminated by compiler optimization.
+
+Mon Nov 30 18:46:44 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/readline/extconf.rb: call dir_config("libedit")
+	  if --enable-libedit is specified. [Bug #11751]
+	  patched by John Hein
+
+Mon Nov 30 08:44:29 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c: remove spurious #define for globals
+	  [ruby-core:71735] [Feature #11749]
+
+Sun Nov 29 09:13:03 2015  Conor Landry  <clandry94@gmail.com>
+
+	* NEWS: [DOC] Various grammar corrections and clarifications to
+	  increase readability.  [Fix GH-1115]
+
+Sat Nov 28 19:33:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_here_document): store dispatched result of
+	  on_tstring_content at the last fragment of a here document.
+
+Fri Nov 27 19:19:44 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (connect): detect closed connection and reconnect
+	  If the server closes a keep-alive http connection, the client socket
+	  reaches EOF. To avoid an EOFError, detect the closed connection and
+	  reconnect.
+	  Added test to ensure HTTP#post succeeds even if the
+	  keep-alive-connection has been closed by the server.
+	  by Kristian Hanekamp <kris.hanekamp@gmail.com>
+	  https://github.com/ruby/ruby/pull/1089 fix GH-1089
+
+Thu Nov 26 21:36:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): enable tail call
+	  optimization for specialized indexers.
+
+	* compile.c (iseq_compile_each): blockiseq should be NULL, but not
+	  Qnil.
+
+Thu Nov 26 17:22:53 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regcomp.c, regenc.c, regexec.c, regint.h, enc/unicode.c:
+	  Merge Onigmo 58fa099ed1a34367de67fb3d06dd48d076839692
+	  + https://github.com/k-takata/Onigmo/pull/52
+
+Thu Nov 26 09:50:02 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/coverage/test_coverage.rb: Added test-case for Coverage.restart.
+	  [Misc #11732][ruby-dev:49379]
+
+Thu Nov 26 09:46:36 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/coverage/test_coverage.rb: Added test-case for Coverage.peek_result
+	  without Coverage.start. [Misc #11726][ruby-core:71622]
+
+Thu Nov 26 07:22:55 2015  Eric Wong  <e@80x24.org>
+
+	* test/openssl/test_ssl.rb (test_copy_stream): new test
+
+Wed Nov 25 21:23:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (copy_stream_body): try to_io conversion before read,
+	  readpartial, and write methods.  [ruby-dev:49008] [Bug #11199]
+
+Wed Nov 25 10:55:21 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* io.c (argf_getpartial): should not resize str if the second
+	  argument is not given.
+	  [ruby-core:71668] [Bug #11738]
+
+Tue Nov 24 23:56:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: On Solaris, it is safe to define _LARGEFILE_SOURCE
+	  when _FILE_OFFSET_BITS=64 is defined (= when 32-bit compile).
+
+Tue Nov 24 10:00:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/installer.rb: Fix two double-word typos.
+	  [ci skip][fix GH-1108] Patch by @jwworth
+
+Tue Nov 24 09:17:02 2015  Alexander von Gluck IV  <kallisti5@unixzen.com>
+
+	* beos: Drop support for BeOS now that Haiku is stable.
+	  [Fix GH-1112]
+
+Tue Nov 24 09:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (rb_gc_for_fd): move to export, as referred by
+	  ext/socket.
+
+Tue Nov 24 09:04:29 2015  David Rodriguez  <deivid.rodriguez@gmail.com>
+
+	* file.c: [DOC] add a missing period to File docs, to terminate
+	  the sentence and separate from the next sentence.  [Fix GH-1111]
+
+Tue Nov 24 08:30:06 2015  JuanitoFatas  <katehuang0320@gmail.com>
+
+	* NEWS: Fix the issue number of `Struct#dig`, which should be
+	  [Feature #11688].  [Fix GH-1110]
+
+Tue Nov 24 07:56:54 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept): handle ENOMEM
+
+Tue Nov 24 07:50:15 2015  Eric Wong  <e@80x24.org>
+
+	* dir.c (dir_initialize): use rb_gc_for_fd for ENOMEM
+	* ext/socket/init.c (rsock_socket): ditto
+	* ext/socket/socket.c (rsock_socketpair): ditto
+	* internal.h (rb_gc_for_fd): prototype
+	* io.c (rb_gc_for_fd): remove static
+	  [ruby-core:71623] [Feature #11727]
+
+Tue Nov 24 06:46:27 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (rb_gc_for_fd): new helper function
+	  (ruby_dup): use rb_gc_for_fd
+	  (rb_sysopen): ditto
+	  (rb_fdopen): ditto
+	  (rb_pipe): ditto
+	  [ruby-core:71623] [Feature #11727]
+
+Tue Nov 24 05:13:35 2015  Eric Wong  <e@80x24.org>
+
+	* ext/fiddle/function.c (struct nogvl_ffi_call_args):
+	  new struct for GVL release
+	  (nogvl_ffi_call): new function
+	  (function_call): adjust for GVL release
+	  [ruby-core:71642] [Feature #11607]
+	* ext/fiddle/closure.c (struct callback_args):
+	  new struct for GVL acquire
+	  (with_gvl_callback): adjusted original callback function
+	  (callback): wrapper for conditional GVL acquire
+	* ext/fiddle/depend: add dependencies
+	* ext/fiddle/extconf.rb: include top_srcdir for internal.h
+	* internal.h (ruby_thread_has_gvl_p): expose for fiddle
+	* vm_core.h (ruby_thread_has_gvl_p): moved to internal.h
+	* test/fiddle/test_function.rb (test_nogvl_poll): new test
+
+Mon Nov 23 19:53:12 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: On Solaris, with gcc, "-std=iso9899:1999"
+	  in $ansi_options is often also needed in CPPFLAGS,
+	  because some feature definitions vary depending on such
+	  standards options.
+
+Mon Nov 23 12:54:39 2015  Hamish Morrison  <hamishm53@gmail.com>
+
+	* configure.in: remove obsolete workarounds for Haiku.
+
+	* dln.c, file.c, io.c: remove obsolete Haiku workarounds.
+
+	* thread_pthread.c: add stack bounds detection for Haiku.
+
+	* signal.c: get stack pointer from signal context on Haiku.
+	  [ruby-core:67923] [Bug #10811] [Fix GH-1109]
+
+Mon Nov 23 11:44:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: bump version to minitest-5.8.3
+
+Mon Nov 23 08:55:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fix wrong reference for r52714
+
+Sun Nov 22 22:23:37 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* gc.c (rb_raw_obj_info): fix compile errors when USE_RGENGC
+	  is 0.
+
+Sun Nov 22 21:58:09 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/cmath.rb: methods which has suffix '!' are now deprecated.
+	  Re-apply r52469 made by Kazuki Tanaka, with fixing bug about
+	  mathn.rb compatibility. [ruby-core:68528] [Feature #10974]
+
+Sun Nov 22 19:36:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/openssl/ossl.c: fix brew command for installation of openssl.
+	  [ci skip][fix GH-1107] Patch by @arthurnn
+
+Sun Nov 22 17:59:50 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: On Solaris, add -D_XOPEN_SOURCE=n only when both
+	  AC_TRY_CPP and AC_TRY_COMPILE pass, because some options
+	  (e.g. -std=iso9899:1999) are not set when running C preprocessor
+	  or building ext.
+
+Sun Nov 22 16:53:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): remove unreachable code
+	  chunk after jump/leave.
+
+	* parse.y: move dead code elimination of logical operation to
+	  compile.c.  not to warn logical operation of literal constants.
+
+Sun Nov 22 16:37:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): eliminate always/never
+	  branches after a literal object and when the value is used after
+	  the branch.
+
+Sun Nov 22 01:23:43 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: Add -D_XOPEN_SOURCE=500 (or 600 or 700) on Solaris
+	  if available, mainly for enabling some features in sockets.
+
+Sun Nov 22 00:17:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/socket/test_socket.rb (test/socket/test_socket.rb): skip
+	  the test when Socket::SO_TIMESTAMP is not defined. Fix error
+	  on Solaris 10. [Bug #11728] [ruby-dev:49377]
+
+Sat Nov 21 18:57:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (need_argument): move frozen-string-literal-debug option
+	  from --enable to --debug.  [Feature #11725]
+
+	* ruby.c (proc_options): fix pointer overrun. do not advance argv
+	  until it is valid.
+
+Sat Nov 21 13:59:09 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/digest/sha1/extconf.rb: OpenSSL's struct name for SHA1 is
+	  SHA_CTX. http://openssl.org/docs/man0.9.8/crypto/SHA1.html
+
+Sat Nov 21 13:31:52 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/digest/*/*.[ch]: include ruby.h before digest.h to avoid
+	  including ext/digest/extconf.h. [Bug #3231]
+	  https://msdn.microsoft.com/library/36k2cdd4.aspx
+
+	* ext/digest/*/extconf.rb: remove ext/digest from include search path
+	  to avoid confusion of cl.exe.
+
+	* ext/digest/*/*.[ch]: explicitly specify def.h's path.
+
+Sat Nov 21 13:05:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl.h: LibreSSL doesn't have and need e_os2.h.
+
+Sat Nov 21 09:18:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_sync.c: reduce the specification of Queue#close.
+	  * Queue#close accepts no arguments.
+	  * deq'ing on closed queue returns nil, always.
+	  [Feature #10600]
+
+	* test/thread/test_queue.rb: catch up this fix.
+
+Sat Nov 21 08:44:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_compile_each): add debug information to NODE_STR
+	  strings as default.
+	  [Feature #11725]
+
+	* insns.def (freezestring): add new instruction to support adding
+	  debug information for dynamically constructed strings.
+
+	* compile.c (iseq_compile_each): support adding debug information
+	  for NODE_DSTR with freezestring instruction.
+
+	* error.c (rb_error_frozen): change the debug information ID name
+	  id_debug_created_info and this field should have a 2 element array
+	  containing path and line information.
+
+	* defs/id.def: ditto.
+
+	* test/ruby/test_rubyoptions.rb: catch up this fix.
+
+	* test/ruby/test_iseq.rb: now frozen strings are not same.
+
+Sat Nov 21 04:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.c (rb_str_intern): should not freeze the receiver itself
+	  unexpectedly.  [ruby-core:71611] [Bug #11721]
+
+Fri Nov 20 23:15:18 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: expose logger mutex
+	  [fix GH-541] Patch by @arthurnn
+
+Fri Nov 20 15:05:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Added missing reference of GitHub
+
+Fri Nov 20 14:57:01 2015  Trevor Rowe  <trevorrowe@gmail.com>
+
+	* lib/net/http.rb: Fixed regression for Net::HTTP::PUT with "Expect-100"
+	  header. [fix GH-949]
+	* test/net/http/test_http.rb: added test.
+
+Fri Nov 20 14:39:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/http.rb: set hostname before call ossl_ssl_set_session.
+	  [Bug #11401][ruby-core:70152][fix GH-964] Patch by @mkarnebeek
+
+Fri Nov 20 12:53:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* array.c: clarify docs for take_while/drop_while samples.
+	  [ci skip][fix GH-1028] Patch by @leriksen
+
+Fri Nov 20 12:48:04 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/socket/socket.c: remove mention of :UNIX in getaddrinfo().
+	  It's typically not a support option.
+	  [ci skip][fix GH-990] Patch by @eam
+
+Fri Nov 20 12:44:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rss/syndication.rb: Add nodoc marker for #validate_sy_updatePeriod.
+	  [ci skip][fix GH-1105] Patch by @davydovanton
+
+Fri Nov 20 09:05:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (rb_vm_cref_replace_with_duplicated_cref): added.
+
+	  CREFs should not be shared by methods between `using'.
+	  [Bug #11247]
+
+	* vm_insnhelper.c (vm_cref_replace_with_duplicated_cref): ditto.
+
+	* vm.c (vm_cref_dup): should copy refinements correctly.
+
+	* eval.c: use rb_vm_cref_replace_with_duplicated_cref().
+
+	* eval_intern.h: add a decl. of
+	  rb_vm_cref_replace_with_duplicated_cref().
+
+	* vm_eval.c (eval_string_with_cref): do not need to pass
+	  scope's CREF because VM can find out CREF from stack frames.
+
+	* test/ruby/test_refinement.rb: add a test.
+
+Fri Nov 20 06:52:53 2015  Eric Wong  <e@80x24.org>
+
+	* .gitattributes: new file for git users
+	  [ruby-core:71578] [Feature #11713]
+
+Thu Nov 19 22:35:31 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/ancdata.c: Check buffer full and ignore MSG_TRUNC flag.
+	  buffer fullness is more robust to detect the message is too big for
+	  the buffer.
+	  AIX 7.1 recvmsg doesn't set MSG_TRUNC for rflags when MSG_PEEK is
+	  given.
+
+Thu Nov 19 21:55:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_start): force to invoke GC by GC.start
+	  even if it is GC.disable'd.
+
+	* test/ruby/test_gc.rb: add a test.
+
+Thu Nov 19 20:08:59 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: trivial performance improvements.
+
+	    name    modified
+	    vm1_gc_short_lived*                1.015
+	    vm1_gc_short_with_complex_long*    1.014
+	    vm1_gc_short_with_long*            1.000
+	    vm1_gc_short_with_symbol*          1.016
+	    vm1_gc_wb_ary*                     1.002
+	    vm1_gc_wb_ary_promoted*            0.996
+	    vm1_gc_wb_obj*                     1.045
+	    vm1_gc_wb_obj_promoted*            1.014
+	    vm3_gc                             1.021
+
+	* gc.c (gc_writebarrier_generational): reorder parameters to optimize
+	  register passing function call.
+
+	* gc.c (gc_writebarrier_incremental): ditto.
+
+	* gc.c (rb_gc_writebarrier): remove LIKELY().
+	  LIKELY() seems to move related functions not better places.
+
+Thu Nov 19 19:45:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (ruby_prog_init): [DOC] ARGV does not contain the name of
+	  the executable.  [ruby-core:71561] [Bug #11711]
+
+Thu Nov 19 15:53:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* signal.c: should also clear ruby_disable_gc.
+	  [Bug #11692]
+
+Thu Nov 19 15:31:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_compile_each): T_IMEMO/iseq objects should be
+	  wrap with ISeq wrappers. [Bug #11676]
+
+Thu Nov 19 15:16:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(c6b4946).
+	  this version includes #1114, #1314, #1322, #1375, #1383, #1387
+	* test/rubygems: ditto.
+
+Thu Nov 19 14:14:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (finish_overlapped_socket): return value of this
+	  function should be only 0 or SOCKET_ERROR.
+
+Thu Nov 19 14:12:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_tailcall_optimize): apply tail call optimization
+	  before conversion to specialized instructions.  when looking
+	  back from `leave` instruction, `send` instructions have been
+	  translated already.
+
+Thu Nov 19 13:57:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (finish_overlapped_socket): ignore EMSGSIZE when input,
+	  because POSIX platforms just do so.  fixes test errors revealed by
+	  r52647.
+
+Thu Nov 19 02:52:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): stretch the buffer size
+	  only when vmaxdatlen is nil.
+
+Thu Nov 19 02:20:11 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/socket/test_socket.rb (test_udp_recvmsg_truncation): rflags is
+	  nil on Solaris 10 which have no HAVE_STRUCT_MSGHDR_MSG_CONTROL.
+	  Reported by Naohisa Goto. [ruby-core:71557] [Bug #11709]
+
+Thu Nov 19 01:48:05 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* configure.in: add -static-libgcc for mingw automatically if available.
+
+Thu Nov 19 00:53:26 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/extmk.rb (--extflags): new option to pass EXTLDFLAGS to children,
+	  especially exts.mk.
+
+	* common.mk (EXTMK_ARGS): use above option.
+
+Wed Nov 18 22:50:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_class_clear_method_cache): should clear all
+	  RCLASS_CALLABLE_M_TBLs of all sub-classes (T_ICLASS).
+
+	  RCLASS_CALLABLE_M_TBL() caches complemented method entries.
+	  It should be cleared when the modules are cleared.
+	  On previous version clears only for direct children.
+	  It is enough for normal modules because corresponding T_ICLASSes
+	  are direct children.
+
+	  However, refinements create complex data structure. So that
+	  we need to clear all children (and descendants).
+	  [ruby-core:71423] [Bug #11672]
+
+	* vm_method.c (rb_clear_method_cache_by_class): rb_mKernel
+	  doesn't call rb_class_clear_method_cache, so that
+	  clear child T_ICLASSes.
+
+	* test/ruby/test_refinement.rb: enable disabled test.
+
+Wed Nov 18 21:09:08 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (prepare_callable_method_entry): use
+	  RCLASS_CALLABLE_M_TBL() instead of accessing a filed directly.
+
+Wed Nov 18 17:08:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: introduce the following field and macros.
+
+	  * rb_method_definition_t::complemented_count to count shared method
+	    entries because of complemented method entries and separate from
+	    alias_count.
+
+	    Shared `def' only by complemented method entries should not prevent
+	    method re-definition warning.
+
+	  * METHOD_ENTRY_COMPLEMENTED(me) to represent complemented method entry.
+	  * METHOD_ENTRY_COMPLEMENTED_SET(me) to check it as  complemented me.
+
+	* vm_insnhelper.c (aliased_callable_method_entry): should also
+	  check me->def->complemented_count.
+
+	* vm_method.c (method_definition_addref_complement): add to count
+	  complemented method entries number.
+
+	* vm_method.c (rb_method_definition_release): release `def' iff
+	  alias_count == 0 and complemented_count == 0.
+
+	* test/ruby/test_module.rb: add a test.
+
+Wed Nov 18 17:06:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): fix trivial issues.
+
+	  * support SPECIAL_CONSTs.
+	  * fix IMEMO/ment outputs.
+
+Wed Nov 18 11:32:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): eliminate always/never
+	  branches after a literal object.  this sequence typically
+	  appears by defined? operator for a method call on a local
+	  variable.
+
+Wed Nov 18 10:33:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): stretch the buffer size
+	  when EMSGSIZE occurs on non HAVE_STRUCT_MSGHDR_MSG_CONTROL platforms
+	  (such as, Windows).  fixes a test error revealed by r52625.
+
+Wed Nov 18 10:12:36 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): use 4096 as
+	  default size to match pre-r52610, which also maps to a common
+	  page size.
+
+Wed Nov 18 10:05:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* doc/syntax/refinements.rdoc: update documentation to reflect
+	  recent changes.
+	  [ci skip] [ruby-core:71466] [Misc #11681] Patch by James Adam
+
+Wed Nov 18 09:50:21 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* test/logger/test_logdevice.rb: Fix tests of logger to make it work on
+	  windows (windows can not remove opened file) [Bug #11702]
+
+Wed Nov 18 06:59:52 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): grow buffer
+	  on unspecified maxdatlen
+	  [ruby-core:71517] [Bug #11701]
+	* ext/socket/lib/socket.rb (Socket#recvmsg): nil default for dlen
+	  (Socket#recvmsg_nonblock): ditto
+	* test/socket/test_socket.rb (test_recvmsg_udp_no_arg): new test
+
+Tue Nov 17 19:50:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (fstat): declare for mingw.
+
+Tue Nov 17 19:02:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* configure.in (BASERUBY): use Kernel#print instead of Kernel#p because
+	  the baseruby may output CRLF as end of line.
+
+Tue Nov 17 15:34:34 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* NEWS: Added update from Unicode 7.0.0 to 8.0.0 [ci skip]
+
+Tue Nov 17 15:30:30 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* enc/unicode/casefold.h, name2ctype.h: Change Unicode
+	  Version for regular expressions from 7.0.0 to
+	  8.0.0 (with help from Kimihito Matsui) [Feature #11563]
+
+Tue Nov 17 14:36:00 2015  Kenichi Kamiya  <kachick1@gmail.com>
+
+	* lib/ostruct.rb (dig): Implement OpenStruct#dig
+	  [Feature #11688]
+
+Tue Nov 17 14:04:14 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/lib/socket.rb (Socket#recvmsg{,_nonblock}): default values
+	  of clen must be nil.
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): handle nil of clen.
+	  fixes test errors introduced at r52602.
+
+Tue Nov 17 13:43:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/lib/socket.rb: UNIXSocket is not always exists.  fixes
+	  install error on Windows, introduced at r52601.
+
+Tue Nov 17 11:27:23 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (Socket#recvfrom_nonblock):
+	  UDPSocket#recvfrom_nonblock):
+	  update doc for `exception: false` and destination buffer
+	  [ruby-core:69542] [Feature #11229]
+	  [ruby-core:69543] [Feature #11242]
+
+Tue Nov 17 11:25:05 2015  Eric Turner  <ericturnerdev@gmail.com>
+
+	* array.c (rb_ary_dig), hash.c (rb_hash_dig): [DOC] Update
+	  comments describing dig methods.  [Fix GH-1103]
+
+	* struct.c (rb_struct_dig): [DOC] add rdoc.
+
+Tue Nov 17 11:22:22 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* NEWS: Small grammatical fix [ci skip]
+
+Tue Nov 17 10:12:30 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (Socket.accept_loop): avoid exceptions
+	  (Socket.udp_server_recv): ditto
+
+Tue Nov 17 09:59:00 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid arg parsing
+	  [ruby-core:71439] [Feature #11339]
+	  (rsock_bsock_sendmsg): make private, adjust for above
+	  (rsock_bsock_sendmsg_nonblock): ditto
+	* ext/socket/rubysocket.h: adjust prototypes
+	  (rsock_opt_false_p): remove
+	* ext/socket/basicsocket.c (rsock_init_basicsocket):
+	  define private methods
+	* ext/socket/lib/socket.rb (BasicSocket#sendmsg): new wrapper
+	  (BasicSocket#sendmsg_nonblock): ditto
+
+Tue Nov 17 09:45:18 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): avoid arg parsing
+	  (rsock_bsock_recvmsg): adjust for above change
+	  (rsock_bsock_recvmsg_nonblock): ditto
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/rubysocket.h: adjust prototypes for above
+	* ext/socket/basicsocket.c (rsock_init_basicsocket):
+	  adjust private methods
+	* ext/socket/lib/socket.rb (BasicSocket#recvmsg): wrapper method
+	  (BasicSocket#recvmsg_nonblock): ditto
+
+Tue Nov 17 08:36:34 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept_nonblock): avoid parsing args
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/rubysocket.h: adjust prototype
+	* ext/socket/socket.c (sock_accept_nonblock): make private
+	* ext/socket/tcpserver.c (tcp_accept_nonblock): ditto
+	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
+	* ext/socket/lib/socket.rb (Socket#accept_nonblock):
+	  implement as wrapper, move RDoc
+	  (TCPServer#accept_nonblock): ditto
+	  (UNIXServer#accept_nonblock): ditto
+
+Tue Nov 17 08:25:57 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/socket.c (sock_connect_nonblock):
+	  avoid argument parsing in C.
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/lib/socket.rb (Socket#connect_nonblock):
+	  new wrapper for private method, move RDoc
+
+Tue Nov 17 08:16:09 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
+	  avoid arg parsing with C API
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/basicsocket.c (bsock_recv_nonblock):
+	  adjust for above change, make private
+	* ext/socket/socket.c (sock_recvfrom_nonblock): ditto
+	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
+	* ext/socket/lib/socket.rb (BasicSocket#recv_nonblock):
+	  new wrapper for private method, move RDoc
+	  (Socket#recvfrom_nonblock): ditto
+	  (UDPSocket#recvfrom_nonblock): ditto
+
+Mon Nov 16 21:27:54 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/dtrace/helper.rb (Dtrace::TestCase#trap_probe): dtrace buffer
+	  size is set as 8m on Solaris (default 4m). [Bug #11697]
+
+Mon Nov 16 20:03:14 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: Add Logger#reopen
+
+Mon Nov 16 18:21:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_obj_dig): dig in nested structs too.
+
+	* struct.c (rb_struct_dig): new method Struct#dig.
+	  [Feature #11688]
+
+Mon Nov 16 17:41:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): optimize tail calls on aref
+	  and aset specialized instructions.
+
+	* compile.c (iseq_peephole_optimize): optimize replaced leave
+	  instruction copied to jump instruction too.
+
+Mon Nov 16 16:39:38 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb: Enable frozen_string_literal.
+
+	* lib/set.rb: Move << out of the begin block that ensures pop.
+
+Mon Nov 16 16:28:30 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb (Hash#flatten!, #add?, #delete?, #collect!, #reject!,
+	  #select!, #^, #classify): Micro-optimize some methods for
+	  performance and readability.
+
+Mon Nov 16 16:17:58 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fixed accidentally commit.
+
+Mon Nov 16 16:10:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* mkconfig.rb: Add some high-level documentation.
+	  [ci skip][fix GH-1081] Patch by @ulfalizer
+
+Mon Nov 16 15:59:14 2015  yui-knk  <spiketeika@gmail.com>
+
+	* proc.c: Add call-seq of `Method#super_method`
+	  [ci skip][fix GH-1094]
+
+Mon Nov 16 15:58:39 2015  Kenichi Kamiya  <kachick1@gmail.com>
+
+	* struct.c: Standardize a method signature of Struct#[]=.
+	  [ci skip][fix GH-1095]
+
+Mon Nov 16 15:42:36 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb (#>=, #>, #<=, #<): Make use of Hash#>=, #>, #<, and
+	  #<= when comparing against an instance of the same kind.
+
+Mon Nov 16 15:37:11 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: Support symbol and string log level setting
+
+Mon Nov 16 15:33:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* tool/rbinstall.rb: fix wrong permission for gem specification without
+	  zlib runtime. [Bug #11685][ruby-dev:49343]
+
+Mon Nov 16 12:11:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/webrick/httpauth/basicauth.rb: fix a typo.
+	  [ci skip][fix GH-1099] Patch by @jwworth
+	* lib/webrick/httpauth/digestauth.rb: ditto.
+
+Sun Nov 15 18:28:43 2015  Kenichi Kamiya  <kachick1@gmail.com>
+
+	* vm_method.c (set_method_visibility): should fail if the receiver
+	  is frozen.  [ruby-core:71489] [Bug #11687]
+
+Sat Nov 14 22:15:07 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/lib/socket.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 21:44:56 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/time.rb: Use "<<" to reduce string allocation.
+
+Sat Nov 14 17:45:49 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/tsort.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 17:25:15 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv-replace.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 17:00:13 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/time.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 16:43:02 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open3.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 05:04:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* node.h: remove old comments.
+
+Sat Nov 14 04:55:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* refactoring CREF related code.
+
+	* eval_intern.h: remove unused setter functions.
+	  CREF_CLASS_SET()
+	  CREF_NEXT_SET()
+	  CREF_SCOPE_VISI_COPY()
+
+	* eval_intern.h: rename flags:
+	  * NODE_FL_CREF_PUSHED_BY_EVAL_ -> CREF_FL_PUSHED_BY_EVAL
+	  * NODE_FL_CREF_OMOD_SHARED_ -> CREF_FL_OMOD_SHARED
+	  and use IMEMO_FL_USER1/2.
+
+	* vm.c (vm_cref_new): accept push_by_eval parameter.
+
+	* vm.c (vm_cref_new_use_prev): added for rb_vm_rewrite_cref().
+
+	* vm_insnhelper.c (vm_cref_push): accept pushed_by_eval parameter.
+
+	* vm_insnhelper.h: remove unused macros:
+	  COPY_CREF_OMOD() and COPY_CREF().
+
+	* vm_eval.c, insns.def: catch up this fix.
+
+Sat Nov 14 02:58:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_define_method): refactoring.
+	  * get CREF in this function.
+	  * cbase is no longer needed (CREF_CLASS(cref) is enough).
+
+	* compile.c: RubyVM::FrozenCore.define_method only accept 2 args.
+
+Sat Nov 14 02:34:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_define_method): do not use current CREF immediately,
+	  but check CREF in environment or methods. Methods defined in methods
+	  should be public.
+	  [Bug #11571]
+
+	* vm_method.c (rb_scope_module_func_check): check CREF in env or me.
+	  if CREF is contained by `me', then return FALSE.
+
+	* test/ruby/test_method.rb: add a test.
+
+Sat Nov 14 02:19:16 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_cref_t::scope_visi;
+
+	* eval_intern.h (CREF_SCOPE_VISI_COPY): catch up this fix.
+
+	* vm_method.c: ditto.
+
+Sat Nov 14 01:53:52 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* pack.c (pack_unpack, AVOID_CC_BUG): Very ugly workaround for
+	  optimization bug of Oracle Solaris Studio 12.4 on Solaris
+	  with -xO4 optimization option. [Bug #11684]
+
+Fri Nov 13 23:00:23 2015  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* configure.in: unset LD_PRELOAD on mingw. msys2 child processes
+	  crash at make test-all with LD_PRELOAD.
+	  [ruby-core:71461] [Bug #11680]
+
+Fri Nov 13 14:00:43 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl_pkey.c: Merge ruby/openssl@b9ea8ef [Bug #10735]
+
+Fri Nov 13 13:09:16 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: Merge ruby/openssl@81e1a30
+
+	* test/openssl/test_ssl.rb: ditto
+
+Fri Nov 13 13:05:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* prelude.rb (Thread.exclusive): warn as deprecated.
+
+Fri Nov 13 10:36:39 2015  Victor Nawothnig  <Victor.Nawothnig@gmail.com>
+
+	* parse.y (new_unless): optimize constant condition for `unless`
+	  as well as `if`.  [Fix GH-1092]
+
+Fri Nov 13 10:08:41 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/psych.gemspec: bump version to 2.0.15
+
+Thu Nov 12 18:44:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_magic_comment): should match exactly.
+	  [ruby-core:71460] [Bug #11679]
+
+Thu Nov 12 16:16:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/prelude.c.tmpl: enable tail call optimization.
+
+Thu Nov 12 14:17:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_yylex): ANDDOT at the head of the line denote
+	  line continuation from previous one to support fluent interface,
+	  as well as single dot.
+
+Thu Nov 12 13:49:50 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(db78980).
+	  this version includes #1367 , #1373 , #1375
+	* test/rubygems: ditto.
+
+Thu Nov 12 10:53:41 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_io_nonblock_noex2.rb: new benchmark based
+	  on bm_io_nonblock_noex.rb
+	* io.c (io_read_nonblock): move documentation to prelude.rb
+	  (io_write_nonblock): ditto
+	  (Init_io): private, internal methods for prelude.rb use only
+	* prelude.rb (IO#read_nonblock): wrapper + documentation
+	  (IO#write_nonblock): ditto
+	  [ruby-core:71439] [Feature #11339]
+
+Wed Nov 11 18:30:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): look up the key, then get default
+	  value and raise KeyError if the returned value is nil.
+	  [ruby-dev:49338] [Ruby trunk - Bug #11677]
+
+Wed Nov 11 17:38:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (local_var_list_add): skip internal local variable
+	  name by its type but not if it has a name.  internal local
+	  variable names are just unique per frame, not globally.
+	  [ruby-core:71437] [Bug #11674]
+
+Wed Nov 11 14:14:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* transcode.c: fix a typo
+	[ci skip][fix GH-1091] Patch by @jwworth
+
+Wed Nov 11 11:58:38 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (initialize): Connections are in passive mode per
+	  default now.  The default mode can be changed by
+	  Net::FTP.default_passive=.
+	  [ruby-core:71146] [Feature #11612]
+
+	* lib/net/ftp.rb (default_passive=, default_passive): new methods.
+
+Wed Nov 11 09:03:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): respect default value of a hash.  no
+	  longer raises KeyError unless the default value of the hash is
+	  nil.  [ruby-core:71354] [Bug #11661]
+
+Tue Nov 10 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open-uri.rb: Remove indicator for "frozen_string_literal: true".
+
+	* lib/pp.rb: Ditto.
+
+	* lib/prettyprint.rb: Ditto.
+
+	* lib/resolv.rb: Ditto.
+
+	* lib/securerandom.rb: Ditto.
+
+	* lib/tmpdir.rb: Ditto.
+
+	* lib/unicode_normalize/tables.rb: Ditto.
+
+	* test/net/ftp/test_buffered_socket.rb: Ditto.
+
+	* test/net/ftp/test_mlsx_entry.rb: Ditto.
+
+	* test/open-uri/test_open-uri.rb: Ditto.
+
+	* test/open-uri/test_ssl.rb: Ditto.
+
+	* test/pathname/test_pathname.rb: Ditto.
+
+	* test/test_pp.rb: Ditto.
+
+	* test/test_prettyprint.rb: Ditto.
+
+	* tool/transcode-tblgen.rb: Ditto.
+
+	* ext/pathname/lib/pathname.rb: Ditto.
+
+Tue Nov 10 18:42:24 2015  Aleksandrs Ledovskis  <aleksandrs@ledovskis.lv>
+
+	* defs/id.def, parse.y: Switch internal token name to reflect
+	  current form of safe-call operator.  [Fix GH-1090]
+
+Tue Nov 10 18:25:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_to_proc): use rb_func_proc_new to make light
+	  weight proc.  [Feature #11653]
+
+Tue Nov 10 18:23:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (cfunc_proc_t): add room for me.
+
+	* proc.c (cfunc_proc_new): generalise for cfunc proc without env.
+
+	* proc.c (rb_func_proc_new, rb_func_lambda_new): new functions to
+	  make proc/lambda without env from cfunc.
+
+Tue Nov 10 17:32:35 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* bootstraptest/test_fork.rb ([ruby-dev:37934]): :NPROC (RLIMIT_NPROC)
+	  is not supported on some platforms (e.g. Solaris 10).
+
+Tue Nov 10 16:57:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_to_proc): new method Hash#to_proc.
+	  [Feature #11653]
+
+Tue Nov 10 14:34:09 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* time.c (rb_time_timespec_new): swap utc and localtime
+	  to generate gmt flag by INT_MAX - gmtoff.
+
+Tue Nov 10 14:01:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_{le,lt,ge,gt}): new methods, Hash#<=, Hash#<,
+	  Hash#>=, Hash#>, to test if all elements of a hash are also
+	  included in another hash, and vice versa.
+	  [ruby-core:68561] [Feature #10984]
+
+Tue Nov 10 11:25:29 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* time.c (rb_timespec_now): added.  [Feature #11558]
+
+	* time.c (rb_time_timespec_new): added.  [Feature #11558]
+
+Tue Nov 10 06:17:17 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (rb_autoload_load): allow recursive calls
+	  [ruby-core:71345] [Bug #11658]
+	* test/ruby/test_autoload.rb (test_autoload_while_autoloading):
+	  new test by: Hiroshi Shirosaki <h.shirosaki@gmail.com>
+	  [ruby-core:71390]
+
+Tue Nov 10 00:36:46 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Message::MessageEncoder#put_labels):
+	  Prevent overflow of pointer to labels.
+	  Patch by Hannes Georg.  [ruby-core:71248] [Bug #11632]
+
+Tue Nov 10 00:25:41 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* gems/bundled_gems: update to power_assert 0.2.6.
+
+Mon Nov  9 21:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_check_funcall_default): split from
+	  rb_check_funcall to return the given fallback value.
+
+	* object.c (rb_obj_dig): use rb_check_funcall_default so that tail
+	  call optimization will be possible.  [Feature #11643]
+
+Mon Nov  9 21:27:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_dig): new method Array#dig.
+
+	* hash.c (rb_hash_dig): new method Hash#dig.
+
+	* object.c (rb_obj_dig): dig in nested arrays/hashes.
+	  [Feature #11643]
+
+Mon Nov  9 18:00:47 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta3
+
+Mon Nov  9 17:38:14 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/runner.rb: use official repository for coverage tool.
+	* Makefile.in: ditto.
+	* common.mk: ditto.
+	* .gitignore: ignored third party repositories.
+
+Mon Nov  9 17:29:09 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): Dynamic string literals should be
+	  frozen.
+	  [ruby-core:57574] [Feature #8976]
+
+Mon Nov  9 15:56:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* common.mk: Use ruby organization url for simplecov repository.
+
+Sun Nov  8 16:24:09 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* NEWS: describe addition of File::TMPFILE
+
+Sun Nov  8 15:19:17 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* file.c: Add O_TMPFILE.
+
+Sun Nov  8 14:24:43 2015  windwiny  <windwiny.ubt@gmail.com>
+
+	* method.h (METHOD_ENTRY_{VISI,BASIC,FLAGS}_SET): suppress
+	  shift-op-parentheses warnings.  [Fix GH-1082]
+
+Sun Nov  8 14:01:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/psych_emitter.c: backport 5bd7744 from tenderlove/psych.
+	  support backward compatibility of Ruby 2.0
+
+Sun Nov  8 10:55:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* io.c (rb_io_gets_m): Update IO#gets doc for characters more than
+	  1 byte.  [Fix GH-1085]
+
+Sun Nov  8 10:37:58 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/uri/ftp.rb: fix a typo.
+	  [fix GH-1084][ci skip] Patch by @windwiny
+
+Sun Nov  8 08:10:31 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (exec_hooks_precheck): check need_clean everytime
+	  to clean-up unused hooks.
+
+	* vm_trace.c (list->need_clean): use as boolean value.
+
+Sun Nov  8 01:31:27 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (Net::HTTP#initialize):
+	  default value of Net::HTTP#open_timeout is now 60 (was nil).
+
+Sat Nov  7 12:18:05 2015  Eric Wong  <e@80x24.org>
+
+	* string.c (id_to_s): remove redundant variable
+	  (rb_obj_as_string): trade id_to_s for idTo_s
+	  (rb_str_equal): replace rb_intern(...) with pre-defined ID
+	  (rb_str_cmp_m): ditto
+	  (rb_str_match): ditto
+	  (str_upto_each): ditto
+	  (rb_str_sum): ditto
+	  (Init_String): remove id_to_s initialization
+
+Sat Nov  7 11:40:05 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (rb_cThreadShield): make static
+
+Sat Nov  7 09:51:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (rb_threadptr_exec_event_hooks_orig):
+	  maintain trace_running counter on internal events.
+
+	  This patch is made by Takashi Kokubun <takashikkbn@gmail.com>.
+	  [Bug #11603] https://github.com/ruby/ruby/pull/1059
+
+Sat Nov  7 03:32:27 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h (RSTRUCT_PTR): need a close parenthesis.
+
+Sat Nov  7 01:32:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* dir.c (dir_fileno, dirfd): support of Dir#fileno on Solaris 10.
+	  Solaris 10 does not have dirfd, but the file descriptor of a
+	  directory is stored in the d_fd or dd_fd member in the DIR struct.
+	  Note that Solaris 11 has dirfd(3C).
+
+	* configure.in: checks for DIR.d_fd and DIR.dd_fd on Solaris 10.
+
+Fri Nov  6 23:13:53 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* array.c: clarifies Array#reject! documentation.
+	  [fix GH-894][ci skip] Patch by @GxSplinter
+
+Fri Nov  6 20:18:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/runner.rb: extracted test helper.
+	* test/lib/zombie_hunter.rb: ditto.
+
+Fri Nov  6 18:07:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* include/ruby/ruby.h (rb_array_const_ptr, rb_struct_const_ptr):
+	  Suppress pointer type mismatch warnings occurred with old version
+	  of Fujitsu C Compiler (fcc) on Solaris 10. The warnings cause
+	  failure of TestMkmf::TestConvertible. [Bug #11644] [ruby-dev:49326]
+	* include/ruby/ruby.h (FIX_CONST_VALUE_PTR): macro for the above,
+	  only effective with fcc.
+
+Fri Nov  6 12:39:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def (token_ops), parse.y (parser_yylex): change DOTQ
+	  from ".?" to "&.".  [ruby-core:71363] [Feature #11537]
+
+Fri Nov  6 09:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (kwd_append): fix segv after invalid keyword argument,
+	  preceding keyword list is NULL when syntax error is there.
+	  [ruby-core:71356] [Bug #11663]
+
+Fri Nov  6 06:59:37 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_autoload: hoist out ruby_impl_require
+
+Thu Nov  5 13:03:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def (token_ops): gather associations between IDs,
+	  operators, and parser tokens.
+
+Thu Nov  5 10:17:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/socket.c (make_addrinfo): use RARRAY_ASET for
+	  write-barrier.
+
+	* ext/tk/tcltklib.c ({call,eval,invoke}_queue_handler): ditto.
+
+	* ext/tk/tkutil/tkutil.c (ary2list, ary2list2): ditto.
+
+Thu Nov  5 10:09:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/**/*.c: prefer RARRAY_AREF to indexing RARRAY_CONST_PTR.
+	  pointed out by hanmac.
+	  https://github.com/ruby/ruby/commit/3553a86#commitcomment-14187670
+
+Wed Nov  4 17:33:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/debug.rb: Add documentation for #thread_list_all.
+	  [Misc #11580][ci skip]
+
+Wed Nov  4 15:45:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* class.c: fix documentation for rb_define_class{_id}_under.
+	  [fix GH-991][ci skip] Patch by @kachick
+
+Wed Nov  4 15:40:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* method.h: fix typo. Patch by @davydovanton
+	  [fix GH-1076][ci skip]
+
+Wed Nov  4 15:39:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* hash.c: use correct grammar. Patch by @tveastman
+	  [fix GH-1079][ci skip]
+
+Wed Nov  4 11:38:23 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* process.c (proc_getsid): [DOC] Fix double word 'for' and typo.
+	  [Fix GH-1080]
+
+Wed Nov  4 06:01:52 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/ruby.h (struct RObject): hide iv_index_tbl type
+	  [ruby-core:71306] [Feature #11647]
+
+Tue Nov  3 06:48:58 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (find_class_path): remove cast for rb_class_ivar_set
+	  (rb_ivar_set): ditto
+	  (rb_cvar_set): ditto
+
+Tue Nov  3 06:18:21 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (rb_global_tbl): convert to id_table
+
+Tue Nov  3 01:58:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* parse.y (NO_QCALL): fix type mismatch of operands that causes
+	  compile error with Oracle Solaris Studio on Solaris.
+	  [Bug #11645] [ruby-dev:49327]
+
+Sun Nov  1 17:14:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.c (mix_id_table_insert): do not touch list during
+	  list->hash transition because GC can run during transition.
+
+Sun Nov  1 11:07:31 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_memsize): account for rb_call_cache entries
+
+Sun Nov  1 09:12:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_yylex): ':' separated by a comment and a newline
+	  is not valid as symbol.
+
+Sat Oct 31 20:15:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/openssl/test_pair.rb: skipped tests if openssl doesn't support
+	  ECDH cipher.
+
+Sat Oct 31 14:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
+	  it does not allow spaces before its argument.
+	  [ruby-core:71283] [Bug #11641]
+
+Sat Oct 31 14:58:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
+	  it does not allow spaces before its argument.
+	  [ruby-core:71283] [Bug #11641]
+
+Sat Oct 31 10:22:49 2015  yui-knk  <spiketeika@gmail.com>
+
+	* eval_error.c (undef_mesg_for): fix typo.  Before this commit
+	  `ArgumentError: malformed format string - %$` was raised when
+	  `NameError#message` is called.  [ruby-core:71282] [Bug #11640]
+	  [Fix GH-1077]
+
+Fri Oct 30 21:12:45 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* gems/bundled_gems: update to power_assert 0.2.5.
+
+Fri Oct 30 19:29:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_slowpath): do not need to use flags hack (commit miss).
+
+Fri Oct 30 19:08:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (heap_get_freeobj_from_next_freepage): not so UNLIKELY.
+
+Fri Oct 30 18:09:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_slowpath): reduce 1 parameter to use only registers
+	  for performance.
+
+	  On my laptop, 'N.times{x = []}' (where N = 29_000_000) is
+	  1.86 sec -> 1.74 sec.
+
+Fri Oct 30 12:53:21 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_call.rb: added test for safe navigation operator.
+	  [fix GH-1066]
+
+Fri Oct 30 12:47:34 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fix wrong commit name.
+
+Fri Oct 30 12:36:16 2015  yui-knk  <spiketeika@gmail.com>
+
+	* vm_method.c: added documentation of protected/private methods.
+	  [fix GH-1072]
+	* test/ruby/test_module.rb: added testcase for method_defined?
+	  [fix GH-1071]
+
+Fri Oct 30 12:06:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_class_ivar_set): rename as class specific ivar
+	  setter, and st_table is no longer involved.
+
+Fri Oct 30 11:36:33 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (generic_ivar_remove): adjust type, set valp
+	  (rb_obj_remove_instance_variable): simplify call
+	* test/ruby/test_object.rb (test_remove_instance_variable):
+	  expand for implementation details
+
+Fri Oct 30 10:37:56 2015  Eric Wong  <e@80x24.org>
+
+	* internal.h (rb_st_insert_id_and_value): update prototype
+	* variable.c (rb_st_insert_id_and_value): reduce args
+	  (find_class_path): adjust call for less args
+	  (rb_ivar_set): ditto
+	  (rb_cvar_set): ditto
+	* class.c (rb_singleton_class_attached): ditto
+
+Fri Oct 30 09:57:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: update latest gems.
+	  test-unit-3.1.5 and minitest-5.8.2
+
+Fri Oct 30 09:54:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems HEAD(60d7972).
+	  this version contains pull requests number of #1343, #1356, #1357, #1363
+	  at https://github.com/rubygems/rubygems/pulls
+	* test/rubygems: ditto.
+
+Fri Oct 30 07:38:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def (getinlinecache/setinlinecache): compare ic->ic_cref and
+	  current cref only when cached CREF list includes singleton class.
+
+	  Singleton classes have own namespaces, so that we need to check
+	  cref as a key (#10943).
+
+	  However, if current CREF list does not include singleton class,
+	  no need to check CREF because it should be same name space.
+
+	* vm_insnhelper.c (vm_get_const_key_cref): add a function returns
+	  CREF only when it includes singleton class.
+
+	* vm_core.h: constify iseq_inline_cache_entry::ic_cref.
+
+Fri Oct 30 06:43:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_env_cref): make it inline for performance.
+
+	* vm_insnhelper.c (rb_vm_get_cref): use NULL instead of 0.
+
+Fri Oct 30 06:20:40 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def: nobody set ic->ic_value.value to Qundef.
+
+Fri Oct 30 06:15:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: add ifndef guard for VM_CHECK_MODE.
+
+Fri Oct 30 06:13:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_check_frame_detail): should require me for
+	  VM_FRAME_FLAG_BMETHOD type frame.
+
+Thu Oct 29 18:42:30 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_ptr): specify NOINLINE so that gc_mark() can return
+	  immediately when obj is not a markable object.
+
+Thu Oct 29 18:05:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* encoding.c (rb_enc_check_str): add for performance.
+	  This function only accepts T_STRING (and T_REGEXP).
+
+	  This patch improves performance of a tiny_segmenter benchmark
+	  (num=2) 2.54sec -> 2.42sec on my machine.
+	  https://github.com/chezou/TinySegmenter.jl/blob/master/benchmark/benchmark.rb
+
+	* encoding.c: add ENC_DEBUG and ENC_ASSERT() macros.
+
+	* internal.h: add a decl. of rb_enc_check_str().
+
+	* string.c (rb_str_plus): use rb_enc_check_str().
+
+	* string.c (rb_str_subpat_set): ditto.
+
+Thu Oct 29 17:16:40 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: export rb_wb_(un)protected_newobj_of()
+	  because some extensions include internal.h.
+
+Thu Oct 29 16:42:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_imemo_new): should not pass FL_WB_PROTECTED flag.
+
+	* gc.c (rb_wb_protected_newobj_of): add more assertions.
+
+	* gc.c (rb_wb_unprotected_newobj_of): ditto.
+
+Thu Oct 29 16:20:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: introduce rb_wb_unprotected_newobj_of() and
+	  rb_wb_protected_newobj_of(), pass the WB_PROTECTED
+	  information explicitly.
+
+	* internal.h: use introduced functions by NEWOBJ_OF().
+	  `flag' is immediate value, so that C compilers can
+	  solve them at compile time.
+
+	* include/ruby/ruby.h: add a comment about that.
+
+Thu Oct 29 14:52:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: add rb_objspace::flags::has_hook to represent hook availability.
+
+	* gc.c: add gc_event_hook_available_p(objspace) to check that flag.
+
+	* gc.c (newobj_of): use gc_event_hook_available_p() instead of
+	  checking gc_event_hook_needed_p(objspace, RUBY_INTERNAL_EVENT_NEWOBJ).
+	  for performance.
+
+	* gc.c (newobj_init): add UNLIKELY() for FL_WB_PROTECTED flag.
+
+	* gc.c (newobj_init): change parameters order (trivial change).
+
+Thu Oct 29 14:45:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_thread_struct): move forward declarations before
+	  used.
+
+Thu Oct 29 14:07:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_ptr): remove debug code for #11244.
+
+Thu Oct 29 10:08:33 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (struct autoload_state): usable as wait-queue head
+	  (struct autoload_data_i): remove 2 words of overhead
+	  (autoload_i_mark): remove marking for thread
+	  (autoload_reset): adjust for struct changes
+	  (rb_autoload): ditto
+	  (rb_autoloading_value): ditto
+	  (rb_autoload_load): ditto
+	  (const_update): ditto
+
+Thu Oct 29 08:48:05 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (struct autoload_data_i): add waitq_head
+	  (struct autoload_state): new struct
+	  (autoload_require): save result in autoload_state for use
+	    in autoload_reset
+	  (autoload_reset): wake up other waiters with open-coded
+	    wait-queues
+	  (rb_autoload_load): add ensure autoload_const_set happens
+	    atomically w.r.t. autoload-triggered "require"
+	  [ruby-core:70075] [ruby-core:71239] [Bug #11384]
+
+Wed Oct 29 00:39:50 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/rubygems/test_gem_commands_server_command.rb
+	  (test_handle_options_port): change port from http to discard.
+	  Solaris does not include "http 80/tcp" in its default
+	  /etc/inet/services. AFAIK, discard (9/tcp) is older than http
+	  and it is expected that all OS can resolve the service name.
+	  [Bug #10004] [ruby-core:63518]
+
+Wed Oct 28 23:52:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* probes_helper.h (RUBY_DTRACE_HOOK): add RB_GC_GUARD, though paranoic.
+
+Wed Oct 28 15:36:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_name_err_new): store the receiver directly.
+
+	* error.c (name_err_receiver): return directly stored receiver.
+	  [Feature #10881]
+
+	* error.c (name_err_mesg_to_str): quote the name if unprintable.
+
+	* object.c (check_setter_id): use rb_check_id to convert names.
+
+	* variable.c (uninitialized_constant): use NameError::message to
+	  keep the receiver of uninitialized constant.  [Feature #10881]
+
+	* error.c (rb_name_err_new): new function to create NameError
+	  exception instance.  [Feature #10881]
+
+Wed Oct 28 13:29:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (new_attr_op_assign): fix op_assign type, which is
+	  already an ID since r52284.  [Feature #11537]
+
+Tue Oct 27 23:14:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def: enable anonymous IDs not to expose internal IDs for
+	  frozen-string-literal-debug by Marshal.dump.
+
+Tue Oct 27 17:06:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def: move internal IDs for frozen-string-literal-debug.
+
+Tue Oct 27 16:41:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_error_frozen_object): use rb_attr_get instead of
+	  rb_ivar_get to get rid of warnings for string objects created
+	  when frozen-string-literal-debug is disabled.
+
+Tue Oct 27 16:18:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/logger.rb (Logger::Period#previous_period_end): as weekly
+	  rotation shifts the log file on Sundays, the end date of the
+	  previous period should be Saturdays.  fix r45072.
+	  [ruby-dev:49314] [Bug #11622]
+
+Tue Oct 27 16:12:37 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_dump.c (rb_print_backtrace): our addr2line doesn't work on sparc.
+	  http://rubyci.s3.amazonaws.com/unstable11s/ruby-trunk/log/20151027T043311Z.log.html.gz
+
+Tue Oct 27 12:00:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/logger.rb (Logger::Period#next_rotate_time): get rid of
+	  adding to mday not to exceed the days of the month.
+	  [ruby-core:71185] [Bug #11620]
+
+Mon Oct 26 22:43:03 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_module.rb (test_method_defined): Add test cases
+	  for `public/protected/private _method_defined?`
+	  These methods accept string as argument, so add string argument
+	  cases.  [Fix GH-1067]
+
+Mon Oct 26 22:23:30 2015  SimonDKnight  <simondknight@hotmail.com>
+
+	* lib/racc/rdoc/grammar.en.rdoc: Grammatical errors fixed.
+	  [Fix GH-1070]
+
+Mon Oct 26 18:36:43 2015  Shota Fukumori (sora_h) <her@sorah.jp>
+
+	* vm_method.c(rb_method_entry_make):
+	  [DOC] [ci skip] Remove a needless space from comment
+	  [Fixes GH-1069] Patch by @yui-knk
+
+Mon Oct 26 17:30:13 2015  Ryan Hosford  <tad.hosford@gmail.com>
+
+	* lib/fileutils.rb: rename tailing to trailing.
+	  [Misc #11548]
+
+Mon Oct 26 17:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (call_op, call_op2): fix values on ripper.  [Feature #11537]
+
+Mon Oct 26 12:55:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (call_op2): separate from call_op and also allow "::",
+	  while dot_or_colon should not allow ".?".  [Feature #11537]
+
+Mon Oct 26 01:03:23 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* thread_pthread.c: fix compile errors when
+	  USE_SLEEPY_TIMER_THREAD is disabled.
+
+Sun Oct 25 10:12:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.c (op_tbl): add DOTQ for ripper.  [Feature #11537]
+
+Sat Oct 24 22:51:18 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* configure.in: fixed build failure of Haiku.
+	  [fix GH-984] Patch by @kallisti5
+	* ext/socket/getaddrinfo.c: ditto.
+	* ext/socket/getnameinfo.c: ditto.
+	* ext/socket/rubysocket.h: ditto.
+
+Sat Oct 24 21:16:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/fileutils/test_fileutils.rb (test_uptodate): relax error
+	  message format.  [Feature #9025], [ruby-core:71178] [Bug #11617]
+
+Sat Oct 24 21:06:43 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+
+	* lib/mkmf.rb: Revert r45640 because it may lead to link
+	  with different libruby. [Bug #9760]
+
+Sat Oct 24 15:42:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* bootstraptest/test_method.rb: relax error message format.
+
+	* test/ruby/test_arity.rb (err_mess): ditto.
+	  [Feature #9025], [ruby-core:71178] [Bug #11617]
+
+Sat Oct 24 12:47:47 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* vm_insnhelper.c: improved error message for "wrong number
+	  of arguments", distinguishing given and expected argument
+	  numbers clearly. [Feature #9025]
+
+Sat Oct 24 11:57:59 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_insnhelper.c: remove the typedef redeclaration of
+	  vm_call_handler.
+
+Sat Oct 24 07:29:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/forwardable.rb (def_instance_delegator, def_single_delegator):
+	  match backtraces against ::Forwardable in case the target class
+	  is a subclass of BasicObject and does not include Kernel.
+	  [ruby-core:71176] [Bug #11616]
+
+Sat Oct 24 04:10:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (make_compile_option_value): include frozen_string_literal*
+	  in a made option value.
+
+	* vm_opts.h: forgot to add OPT_FROZEN_STRING_LITERAL_DEBUG
+	  at last commit.
+
+Sat Oct 24 03:58:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ruby.c: introduce --enable-frozen-string-literal-debug option.
+	  If this option is enabled, the modify error will be:
+	    can't modify frozen String (RuntimeError) =>
+	    can't modify frozen String, created at test.rb:3 (RuntimeError)
+
+	* iseq.h: add compile option frozen_string_literal_debug.
+
+	* compile.c: catch up this fix.
+
+	* error.c (rb_error_frozen): ditto.
+
+	* iseq.c (set_compile_option_from_hash): ditto.
+
+	* test/ruby/test_rubyoptions.rb: add a test for this fix.
+
+Sat Oct 24 02:02:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: introduce new call handler for simple ISeqs.
+
+	  vm_call_iseq_setup_normal_0start() is simple, however it has
+	  some loops/conditions depends on ISeq::param.size and
+	  ISeq::local_size (in vm_push_frame(), inlined into this function).
+
+	  There are many simple methods which has a few parameters and local
+	  variables. So that this patch introduces several special functions
+	  generated in vm_call_iseq_optimized.inc by
+	  tool/mk_call_iseq_optimized.rb.
+
+	  This script makes
+	    vm_call_iseq_setup_normal_0start_Xparams_Ylocals()
+	  where X is 0 to 3 and Y is 1 to 6 (as current setting).
+	  In this case, X * Y = 24 functions are created.
+
+	  These functions creates fast method dispatch by inlining
+	  vm_push_frame() with immediate params/locals sizes.
+
+	  On my laptop, we can have the following results.
+
+	  vm2_method*       1.083 (8.3% faster)
+	  vm2_poly_method*  0.961 (3.4% slower)
+
+	  It shows 8.3% faster for inner loop method dispatch (hit inline
+	  cache), but 3.4% slower when inline cache miss because we need
+	  to find a suitable call handler.
+
+	* common.mk: add a rule for vm_call_iseq_optimized.inc.
+
+	* tool/mk_call_iseq_optimized.rb: added.
+
+	* vm.c: include vm_call_iseq_optimized.inc.
+
+Sat Oct 24 01:58:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define vm_call_handler.
+
+Sat Oct 24 01:56:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, vm_insnhelper.h: move definition of VMDEBUG
+	  from vm_insnhelper.h to vm_core.h.
+
+Sat Oct 24 01:51:01 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* NEWS: [DOC] In the new safe call syntax, arguments are evaluated
+	  only if a call is made.
+
+	* doc/syntax/calling_methods.rdoc: Fix a typo.
+
+Sat Oct 24 00:38:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/forwardable (def_instance_delegator, def_single_delegator):
+	  rescue ::Exception instead of Exception in case Exception is
+	  defined under the target class.
+	  [ruby-core:71175] [Ruby trunk - Bug #11615]
+
+Fri Oct 23 21:10:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_mesg_to_str): separate class names from the
+	  receiver description.
+
+	* vm_eval.c (make_no_method_exception, raise_method_missing): add
+	  format specifiers for class names.
+
+Fri Oct 23 18:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .gitignore: ignored environmental wrapper files.
+
+Fri Oct 23 17:55:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/irb.rb: Ignored assignment of STDOUT.sync = true
+	  when irb.rb loaded. It's affected to IDE such as Jetbrain.
+	  [fix GH-864] Patch by @os97673
+
+Fri Oct 23 16:35:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/ipaddr.rb, test/test_ipaddr.rb: Reject invalid address contained
+	  EOL string. Patch by @kachick [fix GH-942][Bug #11513]
+
+Fri Oct 23 16:03:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* file.c: fix indent style. [fix GH-977]
+	* test/ruby/test_string.rb: indent. [fix GH-975]
+	  [ci skip] These patches are contributed from @yui-knk
+
+Fri Oct 23 15:46:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* string.c: Added method signature to include hash. It's inconsistency
+	  with `gsub` method signature.
+	  [ci skip][fix GH-1023] Patch by @danielevans
+
+Fri Oct 23 15:25:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb: remove an empty comment line and -*-.
+
+Fri Oct 23 15:20:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (gettextfile, getbinaryfile): use the safe
+	  navigation operator.
+
+Fri Oct 23 13:51:33 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test_call.rb (test_safe_call): Add test cases for safe
+	  navigation operator assignment.  [Fix GH-1064]
+	  Validate:
+	  * can assign an attribute which is `nil`
+	  * can "or assign" an attribute which is `nil`
+
+Fri Oct 23 11:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): optimize lengthy safe
+	  navigation method chain.  [Feature #11537]
+
+Fri Oct 23 10:58:41 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/matrix/eigenvalue_decomposition.rb (tridiagonalize): fix
+	  indentation to avoid a warning when the command line option -w of
+	  ruby is specified.
+
+	* lib/matrix/eigenvalue_decomposition.rb (hessenberg_to_real_schur):
+	  change the name of a block parameter to avoid a warning when the
+	  command line option -w of ruby is specified.
+
+Fri Oct 23 10:49:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): support safe navigation of simple
+	  attribute assignment.  [Feature #11537]
+
+	* parse.y (mlhs_node, lhs, attrset_gen): ditto.  keep mid
+	  non-attrset as the sign of safe navigation.
+
+Fri Oct 23 07:17:11 2015  Eric Wong  <e@80x24.org>
+
+	* test/io/wait/test_io_wait.rb (test_wait_eof): test return value
+
+Fri Oct 23 00:32:02 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ssl_npn_select_cb): explicitly raise error
+	  in ext/openssl instead of OpenSSL itself because LibreSSL
+	  silently truncate the selected protocol name by casting the length
+	  from int to unsigned char. [Bug #11369]
+	  Patch by Jeremy Evans <merch-redmine@jeremyevans.net>
+
+Fri Oct 23 00:49:45 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/un.rb (help): change the name of a block parameter to avoid
+	  a warning when the command line option -w of ruby is specified.
+
+Fri Oct 23 00:22:20 2015  Josef Simanek  <josef.simanek@gmail.com>
+
+	* string.c (rb_str_tr): [DOC] Escape backslash in String#tr
+	  documentation.  [Fix GH-1063]
+
+Fri Oct 23 00:19:04 2015  yui-knk  <spiketeika@gmail.com>
+
+	* array.c (rb_ary_collect): [DOC] Fix space of code example of
+	  Array#map.  [Fix GH-1062]
+
+Thu Oct 22 18:52:53 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* vm_eval.c (rb_f_loop): When a loop is stopped by a StopIteration
+	  exception, return what the enumerator has returned instead of
+	  nil. [ruby-core:71133] [Feature #11498]
+
+Thu Oct 22 18:25:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (idle): add a new argument timeout for keep-alive.
+	  [ruby-core:63693] [Bug #10031]
+
+Thu Oct 22 15:30:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): peephole optimization for
+	  branchnil jumps.
+
+	* compile.c (iseq_compile_each): generate save navigation operator
+	  code.
+
+	* insns.def (branchnil): new opcode to pop the tos and branch if
+	  it is nil.
+
+	* parse.y (NEW_QCALL, call_op, parser_yylex): parse token '.?'.
+	  [Feature #11537]
+
+Thu Oct 22 13:16:19 2015  Guilherme Reis Campos  <guilhermekbsa@gmail.com>
+
+	* dir.c (ruby_brace_expand): glob brace expansion edge case fix.
+	  When there are closing braces '}' before a open brace '{' it
+	  must be ignored and considered as literal.
+	  [ruby-core:71138] [Bug #11609]
+
+Thu Oct 22 13:13:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_next_argv): check ARGV element type, and try
+	  conversion if necessary.  [ruby-core:71140] [Bug #11610]
+
+Thu Oct 22 11:11:16 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/net/ftp/test_ftp.rb: add tests for getbinaryfile and
+	  gettextfile.
+
+Wed Oct 21 18:34:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_magic_comment): allow a sole magic comment without
+	  indicators, neither other non-space comments.  [Feature #8976]
+
+Tue Oct 20 12:17:56 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Add basic argument checking to Prime.prime?
+	  [Bug #11606]
+
+Tue Oct 20 12:17:50 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Optimize Integer#prime?
+	  Patch by Nick Slocum [Bug #10354]
+
+Tue Oct 20 08:12:47 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* configure.in: pthread_getattr_np is broken on AIX.
+	  More specifically, the stack address and size returned are
+	  not correct.
+
+Tue Oct 20 05:54:46 2015  Eric Wong  <e@80x24.org>
+
+	* ext/fiddle/closure.c (callback): static function
+
+Mon Oct 19 10:33:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/init.c (rsock_raise_socket_error): get rid of a glibc
+	  bug.  [ruby-core:71100] [Bug #11600]
+
+Mon Oct 19 01:26:26 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (rb_file_identical_p): not necessary to compare the paths after
+	  comparing the file indexes on Windows.  designate by kosaki.
+
+Sun Oct 18 21:17:27 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open-uri.rb: Specify frozen_string_literal: true.
+
+Sun Oct 18 14:37:56 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (fill_random_bytes_urandom): add a comment why using
+	  O_NONBLOCK and O_NOCTTY.
+
+Sun Oct 18 13:24:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (fill_random_bytes_syscall): use ATOMIC_SET() for
+	  updating try_syscall.
+
+Sun Oct 18 13:03:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/backward/util.h: Good-by Borland-C.
+
+Sun Oct 18 13:03:09 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* common.mk: add a comment how to use "make test-all"
+
+Sun Oct 18 12:59:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* common.mk: add comments how to use "make benchmark"
+
+Sun Oct 18 12:58:15 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/securerandom.rb: Specify frozen_string_literal: true.
+
+Sun Oct 18 11:22:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* dln.c: remove defined(__WATCOMC__).
+
+Sun Oct 18 11:16:33 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* lib/mkmf.rb: Good-by Borland-C.
+
+Sun Oct 18 11:04:36 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* numeric.c: Good-by Borland-C.
+	* include/ruby/backward/rubyio.h: ditto.
+	* include/ruby/backward/st.h: ditto.
+	* include/ruby/backward/util.h: ditto.
+	* include/ruby/backward/rubysig.h: ditto.
+	* include/ruby/backward/classext.h: ditto.
+	* dln.c: ditto.
+	* gc.c: ditto.
+	* win32/resource.rb: ditto.
+	* win32/dir.h: ditto.
+	* ext/tk/tcltklib.c: ditto.
+	* NEWS: announce that Borland-C is no longer supported.
+
+Sun Oct 18 10:54:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* dln.c: simplify #ifdef. _WIN32 and __CYGWIN__ are exclusive.
+	  see include/ruby/defines.h
+	* gc.c: ditto.
+	* ext/sdbm/_sdbm.c: ditto.
+
+Sun Oct 18 10:42:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ruby.c (open_load_file): add a comment.
+
+Sun Oct 18 10:12:46 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* file.c (rb_file_identical_p): simplify ifdefs
+
+Sun Oct 18 10:01:40 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ChangeLog: Good-bye OS/2.
+	* common.mk: ditto.
+	* configure.in: ditto.
+	* dln_find.c: ditto.
+	* ext/Setup.emx: ditto.
+	* ext/extmk.rb: ditto.
+	* ext/socket/extconf.rb: ditto.
+	* ext/zlib/extconf.rb: ditto.
+	* file.c: ditto.
+	* include/ruby/defines.h: ditto.
+	* io.c: ditto.
+	* lib/mkmf.rb: ditto.
+	* missing/os2.c: ditto.
+	* process.c: ditto.
+	* ruby.c: ditto.
+	* NEWS: announce OS/2 is no longer supported.
+
+Sun Oct 18 08:50:15 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/defines.h (DOSISH): add comments.
+
+Sun Oct 18 08:26:51 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (fptr_finalize): don't release gvl if fptr is not writable.
+	  writable fd may block on close(2) when it's on NFS. But readonly
+	  fd doesn't. [Bug #11559]
+	  result: make benchmark OPTS="-p bm_require_t -e ruby-trunk -e ruby-2.2.2"
+	    build-ruby:             0.171
+	    ruby 2.3.0dev(r52151):  0.659
+	    ruby 2.2.0p95 (r50295): 0.834
+
+Sun Oct 18 09:32:58 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* file.c (ruby_is_fd_loadable): this should be fail if st_mode is
+	  not regular file nor FIFO.
+
+Sun Oct 18 09:20:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ruby.c (open_load_file): use rb_thread_wait_fd() instead of reopen.
+
+Sun Oct 18 05:11:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ruby.c (open_load_file): reset O_NONBLOCK after open.
+	  Even if S_ISREG() is true, the file may be file on FUSE filesystem
+	  or something. We can't assume O_NONBLOCK is safe.
+	  Moreover, we should wait if the path is point to FIFO. That's
+	  FIFO semantics. GVL should be transparent from ruby script.
+	  Thus, just reopen without O_NONBLOCK for filling the requirements.
+	  [Bug #11060][Bug #11559]
+
+	* ruby.c (loadopen_func): new for the above.
+
+	* file.c (ruby_is_fd_loadable): new. for checks loadable file type
+	  of not.
+	* file.c (rb_file_load_ok): use ruby_is_fd_loadble()
+	* internal.h: add ruby_is_fd_loadble()
+
+	* common.mk: now, ruby.o depend on thread.h.
+
+	* test/ruby/test_require.rb
+	(TestRequire#test_loading_fifo_threading_success): new test.
+	  This test successful case that loading from FIFO.
+
+	* test/ruby/test_require.rb
+	(TestRequire#test_loading_fifo_threading_raise): rename from
+	  test_loading_fifo_threading. You shouldn't rescue an exception
+	  if you test raise or not.
+	  Moreover, this case should be caught IOError because load(FIFO)
+	  should be blocked until given any input.
+
+Sat Oct 17 13:55:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_expand_path_internal): concatenate converted
+	  string to the result instead of making converted string and
+	  append it.
+
+	* string.c (rb_str_cat_conv_enc_opts): from rb_str_conv_enc_opts,
+	  separate function to concatenate with transcoding.
+
+Sat Oct 17 13:19:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (load_file): unify each preparations and clean-ups by
+	  merging load_file_internal and load_file_internal2, and remove
+	  nested rb_protect and rb_ensure.
+
+Sat Oct 17 05:28:32 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): add a warm-up
+	  code and check RSS to avoid false positive on AIX and false
+	  negative on Mac OS X. [Bug #10686]
+
+Fri Oct 16 15:54:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_load_ok): open in non-blocking mode withoout
+	  releasing GVL.  don't care about others than regular files and
+	  directories.  [ruby-dev:49272] [Bug #11559]
+
+	* ruby.c (load_file_internal): ditto.
+
+Thu Oct 15 23:56:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_sym_to_proc): make void env.
+
+Thu Oct 15 13:37:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_sym_to_proc): move from string.c and create a Proc
+	  with no environments.  [ruby-core:71088] [Bug #11594]
+
+Thu Oct 15 01:57:03 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/objspace/test_objspace.rb
+	  (test_trace_object_allocations_start_stop_clear): clear object
+	  allocation table first to get rid of erroneous detection for obj3.
+	  [ruby-dev:49095] [Bug #11271]
+
+Thu Oct 15 01:53:38 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ostruct/test_ostruct.rb: Add tests for OpenStruct#respond_to.
+	  Patch by @jeremy in [GH-1041]: https://github.com/ruby/ruby/pull/1041
+
+Thu Oct 15 01:49:25 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* lib/ostruct.rb: Finish defining OpenStruct attributes lazily.
+	  Patch by @sferik in [GH-1037]: https://github.com/ruby/ruby/pull/1037
+	  This commit is an addendum to https://github.com/ruby/ruby/pull/1033.
+	  It:
+	  1. lazily defines attribute accessors for copied and marshaled objects,
+	  2. returns nil when an attribute reader is not defined, and
+	  3. defines respond_to_missing? to maintain the same respond_to? behavior
+
+Wed Oct 14 16:56:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check for libunwind.h, which is not available in
+	  very old OS X SDK.  [ruby-core:71080] [Bug #11591]
+
+Wed Oct 14 14:11:42 2015  Brian Black  <bblack@veracode.com>
+
+	* iseq.c (rb_insn_operand_intern): change kw in callinfo disasm from the
+	  number of keyword arguments to an ordered list of the keywords used.
+	  [Feature #11589]
+
+Wed Oct 14 13:58:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_nextc): send a warning to ripper, not to STDERR
+	  always.
+
+	* parse.y (rb_warn1, rb_warning1): move argument conversions to
+	  callers.  PRIsVALUE is not valid in String#%.
+
+Wed Oct 14 13:37:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/racc/rdoc/grammar.en.rdoc: fix spell error.
+	  [fix GH-1053][ci skip] Patch by @Matrixbirds
+
+Tue Oct 13 22:06:50 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/raddrinfo.c (rsock_fd_family): Check sa_len.
+
+Tue Oct 13 12:14:10 2015  Craig Davison  <craig65535@gmail.com>
+
+	* ext/socket/rsock_addrinfo (rsock_addrinfo): specify address
+	  family.  [Fix GH-1052]
+
+	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send):
+	  address family by the receiver.
+
+Sun Oct 11 07:09:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_push_frame): initialize other than sp (and ep)
+	  first for performance.
+
+Sun Oct 11 06:21:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_eval.c, internal.h (rb_yield_1): added for performance which
+	  doesn't check Qundef.
+
+	* numeric.c (int_dotimes): use rb_yield_1.
+
+Sun Oct 11 06:19:49 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_iseq_setup_normal): setup sp first
+	  for performance.
+
+Sun Oct 11 05:29:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (invoke_block_from_c): split this function into several
+	  functions.
+
+	* vm_insnhelper.c (vm_yield_callee_setup_arg): remove this function
+	  because it is only delegation function.
+
+Sun Oct 11 03:48:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_of_slowpass): fix typo (pass -> path).
+	  Pointed out by Yukihiro Matsumoto  <matz@ruby-lang.org>.
+
+	* gc.c (newobj_of_...): `of' is unnecessary.
+
+Sat Oct 10 19:04:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/udpsocket.c (udp_connect, udp_bind): get open files
+	  inside ensure functions.
+
+Sat Oct 10 18:35:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_method0): do not propagate enable_fastpath,
+	  but pass dummy CC to prevent wrong caching.
+
+Sat Oct 10 15:28:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* import a github pull request
+	  https://github.com/ruby/ruby/pull/1050
+	  by Kazuho Oku <kazuho@natadeco.co>.
+
+	  This pull request has the following commits.
+
+	* gc.c: reduce # of args to 6 (max. of register args on x86-64) so
+	  that the `newobj_of_slowpass` can be called via TCO.
+
+	* gc.c (newobj_of), string.c (str_duplicate): for performance,
+	  the hot functions must be inlined.
+
+	* gc.c: for performance, preceding arguments of `.*newobj_of.*`
+	  must be same, so that the arg registers can be reused in case of
+	  TCO.
+
+Sat Oct 10 08:52:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send): fix
+	  memory leaks at closed socket.
+
+Fri Oct  9 17:29:07 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (parse257): refactor.
+
+Fri Oct  9 16:42:26 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb: use frozen_string_literal: true.
+
+	* test/net/imap/test_imap.rb: ditto.
+
+	* test/net/imap/test_imap_response_parser.rb: ditto.
+
+Fri Oct  9 15:52:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb: use frozen_string_literal: true.
+
+	* test/net/ftp/test_buffered_socket.rb: ditto.
+
+	* test/net/ftp/test_ftp.rb: ditto.
+
+	* test/net/ftp/test_mlsx_entry.rb: ditto.
+
+Fri Oct  9 14:12:35 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+
+	* ext/openssl/lib/openssl/ssl.rb: Revert r52082 because it was
+	  dropping TLS v1.1 support too. Supporting only TLS v1.2 is too
+	  early, because many popular websites still don't support it.
+
+	  For instance, Servers where aws-sdk connects to still don't support
+	  TLS v1.2 and it became broken.
+
+	  We should consider more carefully about this.
+
+	  [Fix GH-873] [Feature #11524]
+
+Fri Oct  9 12:52:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): Dynamic string literals (e.g.,
+	  "#{x}") should not be frozen because they don't literally
+	  represent strings.
+	  https://twitter.com/shugomaeda/status/651937650027401216
+	  https://twitter.com/yukihiro_matz/status/651942882312482817
+	  https://twitter.com/yukihiro_matz/status/651980835181096960
+
+Fri Oct  9 06:52:49 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* benchmark/prepare_require.rb: skip file creation if it already
+	  exist. Suggested by ko1.
+
+Fri Oct  9 06:18:04 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* benchmark/bm_require.rb: new benchmark for require.
+	* benchmark/bm_require_thread.rb: new benchmark for conflicting
+	  require vs thread. like [Bug #11559]
+	* prepare_require.rb: new file for preparing above tests.
+	* prepare_require.rb: ditto.
+
+Thu Oct  8 14:10:45 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb: Default to TLSv1.2 and drop TLS v1
+	  Patch provided by @claudijd [Fixes GH-873] [Feature #11524]:
+	  https://github.com/ruby/ruby/pull/873
+
+Wed Oct  7 22:55:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/minitest/metametameta.rb (with_output): restore output to
+	  fix mixing test result output in worker responses.
+
+Wed Oct  7 21:32:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_duplicate): move from rb_str_resurrect to short
+	  circuit initialization.
+
+Wed Oct  7 20:43:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_resurrect): fix resurrection of short enough to
+	  be embedded but not embedded string.
+
+Wed Oct  7 20:17:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_of): divide fast path and slow path
+	  to avoid register savings for fast path.
+
+	  This idea is given by Kazuho Oku <kazuho@natadeco.co>.
+
+Wed Oct  7 17:30:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_times): optimize for the argument 0 and 1.
+
+Wed Oct  7 01:20:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.h, gc.c: introduce new debug function rb_obj_info_dump(VALUE obj)
+	  which prints the result of rb_raw_obj_info(..., obj).
+
+Wed Oct  7 01:16:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_args.c: remove an unused field args_info::calling.
+
+Tue Oct  6 23:43:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_method_entry_min_max_arity): should support
+	  OPTIMIZED_METHOD_TYPE_CALL.
+
+Tue Oct  6 21:29:08 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/tmpdir.rb (Dir.tmpdir): return duplicated string to be
+	  modify safely even when $SAFE > 0.
+
+Tue Oct  6 19:24:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_method0): use switch() for visibilities
+	  (for readability).
+
+Tue Oct  6 19:23:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (Init_Proc): Proc#call and others should be public.
+
+Tue Oct  6 18:51:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: IMEMO_FL_USER3 and IMEMO_FL_USER4 is not needed any more.
+
+Tue Oct  6 18:47:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: remove METHOD_ENTRY_SAFE(me) and related code
+	  because $SAFE = 3 and 4 is not available.
+	  Now, $SAFE is not checked on method dispatch at all.
+
+	* vm_eval.c, vm_insnhelper.c, vm_method.c: ditto.
+
+Tue Oct  6 13:56:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h: turn function macros into inline functions,
+	  for debuggers.
+
+	* include/ruby/ruby.h: turn constant macros into enums, for
+	  debuggers.
+
+Tue Oct  6 13:48:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* method.h: typo fix. Patch by @davydovanton [fix GH-1032][ci skip]
+
+Tue Oct  6 06:54:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (rb_iseq_free): free iseq::variable_body to avoid memory
+	  leak.
+
+Tue Oct  6 06:32:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: enable optimization of Proc#call.
+	  [Feature #11569]
+
+	* NEWS: write about this optimization and incompatibilities.
+
+	* test/ruby/test_backtrace.rb: catch up this fix.
+
+Tue Oct  6 04:41:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: solve goto spaghetti.
+
+	  Change all goto statement across blocks to tail call functions.
+
+Tue Oct  6 02:29:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_resurrect): optimize by short circuit to copy
+	  hidden string without checking length, encoding and so on.
+
+Mon Oct  5 23:08:17 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/ruby/test_thread.rb (test_handle_interrupt_blocking): check if
+	  exception handling was postponed until sleep.
+
+Mon Oct  5 22:25:49 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/pp.rb: Use frozen_string_literal: true.
+
+	* lib/prettyprint.rb: Ditto.
+
+	* lib/resolv.rb: Ditto.
+
+	* lib/tmpdir.rb: Ditto.
+
+	* test/test_pp.rb: Ditto.
+
+	* test/test_prettyprint.rb: Ditto.
+
+	* tool/transcode-tblgen.rb: Ditto.
+
+Mon Oct  5 20:39:32 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ruby/test_thread.rb: fix potential race condition.
+	  The thread could have a "sleep" status because it tries
+	  to acquire the mutex, but does not have it yet.
+
+Mon Oct  5 15:39:30 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* numeric.c: [DOC] Overview for Numeric class by Joe Corcoran
+	  This patch was created at ROSSConf Berlin 2015 [Bug #11555]
+
+Mon Oct  5 15:34:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_new): link ep to calling block.
+	  [ruby-core:70980] [Bug #11566]
+
+Mon Oct  5 00:53:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (rb_dir_getwd): make ASCII-8BIT if filesystem encoding is
+	  US-ASCII, like as Dir.glob.
+
+Sun Oct  4 23:39:09 2015  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c (nmin_filter): Fix limit value.
+	  patch by Helder Pereira.
+	  [Bug #11471] [ruby-core:70477]
+
+Sun Oct  4 15:11:48 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/euc_jp.c (mbc_case_fold): check given string is valid or not,
+	  and if invalid, return 1. [Bug #11486]
+
+Sun Oct  4 10:09:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (rb_dir_getwd): normalize OS path to UTF-8 on OS X.
+
+Sun Oct  4 00:09:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/ruby-runner.c.in: wrapper to set dynamic loading path
+	  environment variable.  /bin/sh on Mac OS X 10.11 (El Capitan)
+	  clears DYLD_LIBRARY_PATH.
+
+	  it must:
+	  - do nothing even if current directory is not present
+	  - do not set other environment variables, e.g. PWD, SHLVL, etc
+	  - do not open other FDs, e.g. pipes for timer thread
+
+Sun Oct 2 10:59:00 2015  schneems  <richard.schneeman@gmail.com>
+
+	* ext/pathname/lib/pathname.rb: freeze string literals for
+	  reduced object allocation.
+	  [Feature #11375] [ruby-core:70043]
+
+Fri Oct  2 09:20:20 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* common.mk, lib/unicode_normalize/tables.rb: Change Unicode
+	  Version for character normalization data from 7.0.0 to
+	  8.0.0.
+
+Fri Oct  2 00:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_mark): block.ep of Proc from Symbol is now NULL.
+	  [ruby-core:70961] [Bug #11560]
+
+Wed Sep 30 15:47:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_args.c (vm_caller_setup_arg_block): bypass Symbol#to_proc
+	  call to optimize symbol block passing.
+
+Wed Sep 30 01:34:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_free): fix memory leak at syntax error when
+	  warn-indent is enabled.
+
+Tue Sep 29 22:27:50 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* parse.y: fix minor typo. [ci skip][fix GH-1038].
+	  Patch by @ltratt.
+
+Tue Sep 29 16:53:53 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* tool/unicode_norm_gen.tmpl, lib/unicode_normalize/tables.rb:
+	  get rid of many .freeze commands by using frozen_string_literal
+	  pragma.
+
+Tue Sep 29 16:37:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (compile_dstr_fragments): fix performance by omitting
+	  the first empty string only for keeping literal encoding if
+	  other literals are too.  [ruby-core:70930] [Bug #11556]
+
+	* string.c (rb_str_append_literal): append but keep encoding non
+	  US-ASCII.
+
+Mon Sep 28 17:40:17 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (mtime): use usec instead of fractions to parse
+	  decimal fractions of a second correctly when the number of digits
+	  is not 6.
+
+Mon Sep 28 16:07:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (mtime): parse decimal fractions of a second as
+	  specified in RFC 3659.
+
+Mon Sep 28 10:31:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/test_forwardable.rb: Write basic tests for lib/forwardable.
+	  [fix GH-1035] Patch by @kachick
+
+Sun Sep 27 23:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (rb_define_class, rb_define_class_id_under): refine
+	  error messages.
+
+	* class.c (rb_define_module, rb_define_module_id_under): ditto,
+	  and make consistent with class.
+
+Sun Sep 27 18:44:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: removed duplicated message.
+
+Sun Sep 27 15:46:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): add an option to enable/disable
+	  frozen-string-literal.  [Feature #8976]
+
+	* compile.c (iseq_compile_each): override compile option by option
+	  given by pragma.
+
+	* iseq.c (rb_iseq_make_compile_option): extract a function to
+	  overwrite rb_compile_option_t.
+
+	* parse.y (parser_set_compile_option_flag): introduce pragma to
+	  override compile options.
+
+	* parse.y (magic_comments): new pragma "frozen-string-literal".
+	  [Feature #8976]
+
+Sun Sep 27 08:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/ostruct.rb (delete_field): do not raise NameError for
+	  existing keys.  [Fix GH-1033]
+
+Sun Sep 27 00:34:31 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* lib/ostruct.rb: Move method definitions for getter/setter to be lazy
+	  Patch by @sferik in [GH-1033]: https://github.com/ruby/ruby/pull/1033
+
+Fri Sep 25 10:07:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/http.rb: removed unused variable. It's removed at r13648.
+	  [fix GH-1022] Patch by @nkondratyev
+
+Fri Sep 25 09:48:27 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: upgrade to minitest-5.8.1
+
+Fri Sep 25 09:47:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* id_table.c: fix typo. [ci skip][fix GH-1031] Patch @davydovanton
+
+Fri Sep 25 07:54:05 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_lock): skip
+	  this test on AIX. The issue is the same as on Solaris.
+	  [ruby-dev:47631]
+
+Thu Sep 24 17:25:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (paren_args): fix separator token at `foo::bar()` in
+	  ripper.
+
+Thu Sep 24 00:00:17 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* complex.c: ruby/config.h must be included before math.h
+	  because it defines _LARGE_FILES on AIX and _LARGE_FILES
+	  must be defined before sys/types.h is included from math.h.
+	  [Bug #11483]
+
+Wed Sep 23 22:22:38 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl_pkcs12*: Remove svn commit id macro
+
+Wed Sep 23 01:11:28 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/*: Remove svn commit id macros to make sync easier
+
+Tue Sep 22 04:20:01 2015  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/drb/test_drb.rb: Run Rinda/DRb tests on localhost. [Fix GH-1027]
+	  patch by voxik.
+
+	* test/rinda/test_rinda.rb: ditto
+
+Mon Sep 21 20:53:39 2015  tbpgr  <tbpgr@tbpgr.jp>
+
+	* test/win32ole/test_win32ole_event.rb: fix typo.
+	  swbemsink_avairable? => swbemsink_available?  [Fix GH-1025]
+
+Sun Sep 20 10:07:35 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* cont.c (rb_callcc): [DOC] append continuations example accros
+	  methods.  [Fix GH-1026]
+
+Sun Sep 20 03:20:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (rb_iseq_free): free rb_iseq_t::body::cc_entries.
+
+Sun Sep 20 02:46:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: split rb_call_info_t into several structs.
+	  * rb_call_info (ci) has compiled fixed information.
+	  * if ci->flag & VM_CALL_KWARG, then rb_call_info is
+	    also rb_call_info_with_kwarg. This technique reduce one word
+	    for major rb_call_info data.
+	  * rb_calling_info has temporary data (argc, blockptr, recv).
+	    for each method dispatch. This data is allocated only on
+	    machine stack.
+	  * rb_call_cache is for inline method cache.
+
+	  Before this patch, only rb_call_info_t data is passed.
+	  After this patch, above three structs are passed.
+
+	  This patch improves:
+	  * data locality (rb_call_info is now read-only data).
+	  * reduce memory consumption (rb_call_info_with_kwarg,
+	    rb_calling_info).
+
+	* compile.c: use above data.
+
+	* insns.def: ditto.
+
+	* iseq.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_insnhelper.h: ditto.
+
+	* iseq.h: add iseq_compile_data::ci_index and
+	  iseq_compile_data::ci_kw_index.
+
+	* tool/instruction.rb: introduce TS_CALLCACHE operand type.
+
+Sun Sep 20 02:18:10 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/lib/envutil.rb: mkfifo command based File.mkfifo method
+	  definition removed.
+
+Fri Sep 18 20:11:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_s_mkfifo): implement File.mkfifo.
+	  [Feature #11536]
+
+Fri Sep 18 16:56:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* NEWS: add Net::FTP#mlst and Net::FTP#mlsd.
+
+Fri Sep 18 07:39:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/objspace/objspace_dump.c (obj_type): add IMEMO types to the heap
+	  dump information.
+
+Thu Sep 17 22:33:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* common.mk: fix command error with outside builddir.
+
+Thu Sep 17 17:42:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* common.mk: separated test for test-framework from test-all task.
+	  They should be invoke at first before tests of test-all.
+
+Thu Sep 17 12:05:54 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_dir.rb (TestDir#test_fileno): s/?x/"x"/. Don't
+	  use tricky code, please.
+
+Wed Sep 16 20:49:56 2015  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* encindex.h: fix typo of last #endif comment. [ci skip]
+
+Wed Sep 16 20:39:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (set_const_visibility): fail if the class/module is
+	  frozen.  [ruby-core:70828] [Bug #11532]
+
+Wed Sep 16 17:16:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (ENABLE_VM_OBJSPACE): enable per-VM object space on
+	  Windows by default, as rb_w32_sysinit() no longer depends on
+	  ruby_xmalloc.
+
+Wed Sep 16 15:08:17 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* doc/syntax/literals.rdoc (Strings): [DOC] Revise the character
+	  literal part.
+
+Wed Sep 16 14:55:33 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* doc/syntax/literals.rdoc (Strings): [DOC] Document the full list
+	  of supported escape sequences in string literals.
+
+Wed Sep 16 14:49:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_setbyte): keep the code range as possible.
+
+Wed Sep 16 13:23:48 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* doc/syntax/literals.rdoc (Strings): mention about ?a literal.
+
+Wed Sep 16 12:06:53 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* dir.c (glob_helper): check pathtype once again by lstat(2) if
+	  dp->d_type is DT_UNKNOWN. XFS may return DT_UNKNOWN.
+
+Wed Sep 16 03:49:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_thread.rb (TestThread#test_mutex_synchronize):
+	  insert waste loop for invoking preemptive thread context switch.
+	  [Bug #11496]
+
+Tue Sep 15 19:38:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (rb_objspace_alloc, rb_objspace_free): define always
+	  regardless ENABLE_VM_OBJSPACE, and free heap pages.
+
+Tue Sep 15 15:15:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_sysinit, rb_w32_readdir): compare by
+	  encoding index to get rid of encoding initialization before VM
+	  object space allocation.
+
+	* dir.c (fundamental_encoding_p, push_glob): compare by encoding
+	  index immediately.
+
+	* enc/{ascii,us_ascii,utf_8}.c: set encoding indexes of
+	  fundamental built-in encodings so that usable as well as
+	  allocated rb_encoding before rb_enc_init().
+
+	* encindex.h: separate encoding index constants from internal.h.
+
+Tue Sep 15 13:13:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] correct block
+	  return values, which may be a negative or positive integer, not
+	  only -1 or +1.
+
+Tue Sep 15 12:49:10 2015  Jason Barnabe  <jason.barnabe@gmail.com>
+
+	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] Correct
+	  description of array sort block return values.  And also fix up
+	  the grammar a bit.  [Fix GH-1020]
+
+Tue Sep 15 12:44:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* util.c (ruby_qsort): use BSD-style qsort_r if available.
+
+Mon Sep 14 19:26:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (parse_mlsx_entry): parse pathnames including
+	  space correctly.
+
+Mon Sep 14 11:12:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* lib/racc/rdoc/grammar.en.rdoc: [DOC] fix typo, "convertion" to
+	  "conversion".  [Fix GH-1016]
+
+Sun Sep 13 11:03:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h: prefix RUBY or RB to global symbols to get
+	  rid of name conflicts with other headers.
+
+	* include/ruby/encoding.h, include/ruby/intern.h: ditto.
+
+Sun Sep 13 09:38:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (size, modify, create, type, unique, perm, lang,
+	  media_type, charset): new methods to return standard facts.
+
+Sat Sep 12 19:43:49 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_iseq_setup_normal): do not clear local
+	  variables here. vm_push_frame() clears.
+
+	* vm_insnhelper.c (vm_call_iseq_setup_tailcall): ditto.
+
+	* vm_insnhelper.c (vm_push_frame): move check code to
+	  vm_check_frame().
+
+	  Reorder initialization timing to reuse same values (sp).
+
+	* compile.c (rb_iseq_compile_node): use
+	  iseq_set_exception_local_table() for ISEQ_TYPE_DEFINED_GUARD.
+
+Sat Sep 12 23:06:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (file?, directory?, appendable?, creatable?,
+	  deletable?, enterable?, renamable?, listable?, directory_makable?,
+	  purgeable?, readable?, writable?): new methods.
+
+Sat Sep 12 21:27:22 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (FACT_PARSERS): support system dependent facts
+	  UNIX.mode, UNIX.owner, UNIX.group, UNIX.ctime, and UNIX.atime.
+
+Sat Sep 12 19:08:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_dup2): should return the new fd on
+	  success, while msvcrt returns 0 wrongly.
+
+Sat Sep 12 18:14:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (parse_mlsx_entry, mlst) raise an FTPProtoError
+	  when parsing failed.
+
+Sat Sep 12 18:00:35 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (TIME_PARSER): use "Z" instead of "+00:00" to
+	  get UTC time.  Thanks, Wilson Bilkovich.
+
+Sat Sep 12 17:55:24 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (mlst, mlsd): support new commands MLST and MLSD
+	  specified in RFC 3659.
+
+Sat Sep 12 16:14:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* file.c: access()/eaccess() wrapping methods check more than just uid.
+	  [fix GH-1007][ci skip] Patch by @eam
+
+Sat Sep 12 16:07:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* README.md: improve markdown rendering for readability.
+	  [fix GH-1015][ci skip] Patch by @Matrixbirds
+
+Sat Sep 12 14:30:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (save_redirect_fd): make saved FDs close-on-exec not
+	  to be inherited.
+
+	* process.c (run_exec_dup2): restore close-on-exec flags too.
+
+	* win32/win32.c (fcntl): implement F_GETFD, F_SETFD, and
+	  F_DUPFD_CLOEXEC.
+
+Sat Sep 12 05:35:24 2015  Eric Wong  <e@80x24.org>
+
+	* rational.c (string_to_r_strict): preserve encoding in exception
+
+Fri Sep 11 20:23:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_call_info_t::aux.opt_pc.
+
+	* vm_insnhelper.c: introduce shortcut functions for opt_pc == 0
+	  because opt_pc is always 0 on shortcut function.
+
+Fri Sep 11 17:49:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c: disable ISeq.load. It enabled accidentally at r51794.
+
+Fri Sep 11 11:15:12 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (size, mdtm, system): parse responses according to
+	  RFC 959 and 3659, where reply codes must be followed by SP.
+
+	* lib/net/ftp.rb (system): remove LF from the return value.
+
+Thu Sep 10 22:48:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (literal_concat_gen, evstr2dstr_gen): keep literal
+	  encoding beginning with an interpolation same as the source file
+	  encoding.  [ruby-core:70703] [Bug #11519]
+
+Thu Sep 10 22:15:51 2015  Joe Rafaniello  <jrafanie@redhat.com>
+
+	* process.c (rb_f_spawn): Be more specific regarding "other
+	  values" by having "non-zero positive integers" Add nil, the
+	  default value, as a possible value and what it means.
+
+	  Try to use more consistent language.
+	  [Fix GH-1008]
+
+Thu Sep 10 15:16:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (getmultiline): refactor.
+
+Thu Sep 10 12:17:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_build_from_ary_body): register cdhash to the
+	  iseq constant body instead of compile time mark array, not to
+	  get GCed.  [ruby-core:70708] [Feature #8543]
+
+Wed Sep  9 18:16:14 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/rubygems/stub_specification.rb (Gem::StubSpecification#data):
+	  should not change the value of $. when `require`ing gems.
+	  this fixed test failures introduced by r51813.
+
+Wed Sep  9 16:55:45 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ruby.c (usage, enable_option, disable_option, process_options): new
+	  option `--disable-did_you_mean`.
+
+	* gem_prelude.rb: now requires did_you_mean gem by default if available.
+
+Wed Sep  9 13:38:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/extlibs.rb (do_patch): let "patch" command change the
+	  working directory and open the patch file there, instead of
+	  spawn options, so that proper error message will be shown by the
+	  command not just "chdir" or "open".
+
+Wed Sep  9 11:33:05 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* common.mk (update-gems): use BASERUBY instead of RUNRUBY.
+
+Wed Sep  9 11:08:59 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* lib/delegate.rb: Remove backtrace cleaning for delegated methods
+	  This patch was provided by Rafael Franca and greatly improves
+	  performance when an exception is raised. [Bug #11461]
+
+Wed Sep  9 10:05:41 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/rubygems/test_config.rb: fix broken tests for Windows platform.
+
+Wed Sep  9 07:46:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems HEAD(fe61e4c112).
+	  this version contains new feature that warn invalid SPDX license
+	  identifiers. https://github.com/rubygems/rubygems/pull/1249
+	  and #1032, #1023, #1332, #1328, #1306, #1321, #1324
+	* test/rubygems: ditto.
+
+Tue Sep  8 23:17:36 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta2.
+
+Tue Sep  8 23:09:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_s_popen): do not wait the child process during being
+	  killed.  [ruby-core:70671] [Bug #11510]
+
+Tue Sep  8 22:18:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gems/bundled_gems: revert because ruby trunk never be able to install
+	  the did_you_mean gem.  retry after enough test.
+
+Tue Sep  8 21:48:22 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Automatically install the did_you_mean gem
+	  as a bundled gem.  [Feature #11252]
+
+Tue Sep  8 17:17:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_call_info_t::blockiseq.
+
+	* insns.def (send, invokesuper): pass blockiseq explicitly.
+
+	* compile.c: catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* iseq.c (ISEQ_MINOR_VERSION): 2->3 because instruction spec was
+	  changed.
+
+Tue Sep  8 15:01:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (list): fetch all the lines before yielding a block
+	  to allow other commands in the block.  [Feature #11454]
+	  Patched by Srikanth Shreenivas.
+
+Tue Sep  8 12:05:00 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_read_reparse_point): return correct required
+	  buffer size for IO_REPARSE_TAG_MOUNT_POINT.
+
+Tue Sep  8 00:14:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_execarg_parent_start1): raise with the target path
+	  name when open() failed.
+
+Mon Sep  7 23:45:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_exec_fail): raise with the target directory name
+	  when chdir() failed.  pointed out by sorah.
+
+Mon Sep  7 22:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (insert): should use plain strdup() instead of
+	  ruby_strdup() at startup time, and plain free()ed in cmdglob().
+
+Mon Sep  7 16:49:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_vm_struct): define objspace always regardless
+	  ENABLE_VM_OBJSPACE.
+
+Mon Sep  7 15:54:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby_atomic.h (ATOMIC_VALUE_CAS): fix typo.
+	  TODO: make arguments of all CAS macros consistent.
+
+Sun Sep  6 16:07:22 2015  Eric Wong  <e@80x24.org>
+
+	* ccan/list/list.h: suppress unused argument warnings
+	  [ccan commit 6aaca17e07588997417a73fac19dcf0ff17ed81b]
+
+Sat Sep  5 11:39:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rss/rss.rb (Time#w3cdtf): fix zero-trimmed width of fraction
+	  digits.  [ruby-core:70667] [Bug #11509]
+
+Sat Sep  5 08:28:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_equal, rb_hash_eql): [DOC] the orders of each
+	  hashes are not compared.  [Bug #11508]
+
+Fri Sep  4 23:26:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/win32.h: fix macro name for VC runtime version,
+	  RT_VER is only in Makefile.
+
+Fri Sep  4 17:46:17 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/contributing.rdoc: fix configuration option.
+	  [ci skip] [fix GH-1009]
+
+Fri Sep  4 04:46:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_memsize): functions for wrapper object should have
+	  iseqw_ prefix.
+
+Thu Sep  3 21:12:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/cgi/session.rb (create_new_id): use SHA512 instead of MD5.
+	  pointed out by SARWAR JAHAN.
+
+Thu Sep  3 20:29:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): iseq->body->location.first_lineno is Fixnum.
+
+Thu Sep  3 17:54:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (raise_method_missing): "names" should be singular.
+	  pointed out by Filip Bartuzi.
+
+Thu Sep  3 17:50:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): should support IMEMO/iseq.
+
+Thu Sep  3 10:07:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (raise_method_missing): refine error messages when a
+	  symbol is not given.  [Fix GH-1013]
+
+Wed Sep  2 18:49:55 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/*: merge psych master(8737e5b). It contains following fixes.
+	  https://github.com/tenderlove/psych/pull/242
+	  https://github.com/tenderlove/psych/pull/246 [ruby-list:50219]
+	* test/psych/*: ditto.
+
+Wed Sep  2 18:04:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h (GET_PC_COUNT): remove unused macro.
+
+Wed Sep  2 17:18:37 2015  Chris Schneider  <chris@christopher-schneider.com>
+
+	* process.c (proc_detach): [DOC] fix typo "intent" as "intend" in
+	  rdoc.  [Fix GH-1011]
+
+Wed Sep  2 16:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_realpath_internal): use filesystem encoding if the
+	  argument is in ASCII encodings.
+
+	* win32/file.c (rb_readlink): needs the result encoding.
+
+Tue Sep  1 18:37:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/thread/test_queue.rb: catch up last commit.
+
+Tue Sep  1 18:16:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_sync.c (queue_do_close): ignore multiple close to allow
+	  multiple producers.
+	  https://bugs.ruby-lang.org/issues/10600#note-14
+
+Tue Sep  1 18:06:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_tools.c: rename thread_tools.c to thread_sync.c.
+
+Mon Aug 31 17:04:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (move_refined_method): should insert a write barrier
+	  from an original class to a created (cloned) method entry.
+
+	* test/ruby/test_refinement.rb: add a test.
+
+Sun Aug 30 02:42:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_method_tab): Only add SSLv3 support
+	  if the SSL library supports it.  Thanks Kurt Roeckx <kurt@roeckx.be>
+	  [Bug #11376]
+
+	* ext/openssl/extconf.rb: check for SSLv3 support in the SSL
+	  implementation.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): Skip tests that need SSLv3
+	  if there is no support.
+
+Fri Aug 28 16:05:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rdoc/*: Update rdoc master(cfffed5)
+	  https://github.com/rdoc/rdoc/pull/337
+	  https://github.com/rdoc/rdoc/pull/367
+
+Fri Aug 28 10:16:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (hook_before_rewind): prevent kicking :return event while
+	  finishing vm_exec func because invoke_block_from_c() kick a :return
+	  event for bmethods.
+	  [Bug #11492]
+
+	* test/ruby/test_settracefunc.rb: add a test.
+
+Thu Aug 27 18:05:42 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/webrick/server.rb: use IO::NULL instead of '/dev/null'
+	* test/ruby/test_string.rb: ditto.
+
+Thu Aug 27 15:24:57 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_set_sequence): rename variable names
+	  to make it readable.
+
+Thu Aug 27 07:45:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_tools.c: add Queue#close(exception=false) and
+	  SizedQueue#close(exception=false).
+	  [Feature #10600]
+
+	  Trying to deq from a closed empty queue return nil
+	  if exception parameter equals to false (default).
+
+	  If exception parameter is truthy, it raises
+	  ClosedQueueError (< StopIteration).
+	  ClosedQueueError inherits StopIteration so that you can write:
+
+	    loop{ e = q.deq; (using e) }
+
+	  Trying to close a closed queue raises ClosedQueueError.
+
+	  Blocking threads to wait deq for Queue and SizedQueue will be
+	  restarted immediately by returning nil (exception=false) or
+	  raising a ClosedQueueError (exception=true).
+
+	  Blocking threads to wait enq for SizedQueue will be
+	  restarted by raising a ClosedQueueError immediately.
+
+	  The above specification is not proposed specification, so that
+	  we need to continue discussion to conclude specification this
+	  method.
+
+	* test/thread/test_queue.rb: add tests originally written by
+	  John Anderson and modify detailed behavior.
+
+Wed Aug 26 10:52:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (rb_memsearch_wchar, rb_memsearch_qchar): test matching
+	  till the end of string.  [ruby-core:70592] [Bug #11488]
+
+	* test/ruby/test_m17n.rb (test_include?, test_index): add tests by
+	  Tom Stuart.
+
+Wed Aug 26 09:26:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* id_table.c (list_table_extend, hash_table_extend): remove C99
+	  features.  [ruby-dev:49239] [Bug #11487]
+
+Tue Aug 25 06:34:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (w32_symlink): implement symlink().
+
+Mon Aug 24 16:01:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (rb_locale_encindex): find encoding index without
+	  making a string object every time.  [ruby-core:58160] [Bug #9080]
+
+Sat Aug 22 15:43:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (check_funcall_failed, check_funcall_missing): cache
+	  results of respond_to? and respond_to_missing?, and search a
+	  public method only for compatibility with rb_respond_to.
+
+Sat Aug 22 08:23:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/thread/thread.c: move definitions of Queue, SizedQueue
+	  and ConditionalVariables to thread_tools.c. In other words,
+	  such classes are built-in.
+	  [Feature #8919]
+
+	  At first, I planned to embed only a Queue class.
+	  However, rubygems requires 'thread.rb' (rubygems are
+	  required at first, when launch MRI without --disable-gems).
+	  So most of people require 'thread.rb' as an embedded library.
+
+	  Now, ext/thread/thread.c is empty, only for a dummy for
+	  compatibility.
+
+	* thread.c: move a definition of Mutex class to thread_tools.c.
+
+	  And define Mutex class under Thread (so now Mutex is Thread::Mutex).
+	  Because other thread related classes are also defined under Thread.
+	  We remain ::Mutex as Thread::Mutex. Only an inspect result is changed.
+
+	* common.mk: add dependency from thread.o to thread_tools.c.
+
+Sat Aug 22 05:31:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_opts.h, iseq.c, iseq.h: add compile option to force frozen
+	  string literals.
+	  [Feature #11473]
+
+	  This addition is not specification change, but to try frozen
+	  string literal world discussed on [Feature #11473].
+
+	  You can try frozen string literal world using this magical line:
+
+	    RubyVM::InstructionSequence.compile_option =
+	      {frozen_string_literal: true}
+
+	  Note that this is a global compilation option, so that you need to
+	  compile another script like that:
+
+	    p 'foo'.frozen? #=> false
+	    RubyVM::InstructionSequence.compile_option =
+	      {frozen_string_literal: true}
+	    p 'foo'.frozen? #=> false, because this line is already compiled.
+	    p eval("'foo'.frozen?") #=> true
+
+	  Details:
+	    * String literals are deduped by rb_fstring().
+	    * Dynamic string literals ("...#{xyz}...") is now only frozen,
+	      not deduped. Maybe you have other ideas.
+
+	  Now, please do not use this option on your productions :)
+	  Of course, current specification can be changed.
+
+	* compile.c: ditto.
+
+	* test/ruby/test_iseq.rb: add a test.
+
+Sat Aug 22 02:53:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/psych/*: update to Psych 2.0.14
+
+	* test/psych/*: ditto
+
+Fri Aug 21 19:58:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c: add a new method ObjectSpace.count_symbols.
+	  [Feature #11158]
+
+	* symbol.c (rb_sym_immortal_count): added to count immortal symbols.
+
+	* symbol.h: ditto.
+
+	* test/objspace/test_objspace.rb: add a test for this method.
+
+	* NEWS: describe about this method.
+
+Fri Aug 21 19:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/Makefile.sub ($(LIBRUBY_SO)): needs additional libraries
+	  for extension libraries to link statically.
+	  [ruby-core:70499] [Feature #9018]
+
+Fri Aug 21 18:49:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h, cont.c, vm_trace.c: add a new event
+	  fiber_switch. We need more discussion about this feature
+	  so that I don't write it on NEWS.
+	  [Feature #11348]
+
+	* test/ruby/test_settracefunc.rb: add tests.
+
+Fri Aug 21 17:32:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_invoke_block): we should not expect ci->argc is
+	  stable after invoking a block. [Bug #11451]
+
+	* test/ruby/test_yield.rb: add a test. This test script is given by
+	  Alex Dowad.
+
+Fri Aug 21 06:35:50 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* test/openssl/test_ssl_session.rb: Fix tests so that they take in to
+	  account OpenSSL installations that have SSLv3 disabled by default.
+	  Thanks Jeremy Evans <code@jeremyevans.net> for the patches.
+	  [Bug #11366] [Bug #11367]
+
+Thu Aug 20 22:19:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_method.c (basic_obj_respond_to): call respond_to_missing?
+	  only when redefined.  [ruby-core:70460] [Bug #11465]
+
+Thu Aug 20 14:13:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (check_funcall_respond_to): share the behavior with
+	  rb_obj_respond_to.  [ruby-core:70460] [Bug #11465]
+
+	* vm_method.c (vm_respond_to): extract from rb_obj_respond_to and
+	  merge r39881.
+
+Thu Aug 20 08:53:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_method.c (rb_obj_respond_to): reuse found method entry
+	  instead of searching same entry repeatedly.
+
+Thu Aug 20 08:31:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename), win32/win32.c (opendir_internal):
+	  check reparse point tags and treat supported tags only as
+	  symbolic links.  [ruby-core:70454] [Bug #11462]
+
+Wed Aug 19 23:59:28 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add OP_ALL to
+	  existing options rather than just setting it.  Some vendors apply
+	  custom patches to their versions of OpenSSL that set default values
+	  for options.  This commit respects the custom patches they've
+	  applied.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): check that OP_ALL has been
+	  added to the options.
+
+Wed Aug 19 23:55:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_f_spawn): [DOC] elaborate environment variable
+	  values.  [ruby-core:70456] [Bug #11463]
+
+Wed Aug 19 23:48:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (winnt_lstat): check reparse point tags and treat
+	  supported tags only as symbolic links.
+	  [ruby-core:70454] [Bug #11462]
+
+Tue Aug 18 20:05:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (reserve_stack): ensure the memory is really
+	  allocated. [Bug #11457]
+
+Tue Aug 18 17:19:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (IS_BEG): include labeled argument state, which was
+	  EXPR_LABELARG.  [ruby-dev:49221] [Bug #11456]
+
+Tue Aug 18 16:16:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (RClass): define only in C, `__attribute__`
+	  between `struct` and the name can't compile with g++.
+	  [ruby-core:70297] [Bug #11426]
+
+Mon Aug 17 20:56:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y: fix syntax error at do-block after a conditional
+	  operator.  separate label-allowed and after-a-label states from
+	  others as bit flags.  [ruby-dev:48790] [Bug #10653]
+
+Mon Aug 17 11:57:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_each_codepoint): raise an exception at incomplete
+	  character before EOF when conversion takes place.  [Bug #11444]
+
+Sun Aug 16 17:33:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: update latest version of bundled gems.
+	  It includes minitest-5.8.0 and test-unit 3.1.3.
+
+Sun Aug 16 17:24:10 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* gc.c (gc_mark_children): check if RCLASS_EXT is valid
+	  before marking. This fixes the following test failure
+	  introduced in r51126:
+
+	    make test-all TESTOPTS='--gc-stress ruby/test_refinement.rb'
+
+Sat Aug 15 10:51:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32/lib/win32/registry.rb (API#SetValue): data size should
+	  be in bytes, not in chars.  [ruby-core:70365] [Bug #11439]
+
+Sat Aug 15 10:15:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_each_codepoint): read more data when read partially.
+	  [ruby-core:70379] [Bug #11444]
+
+Sat Aug 15 04:33:39 2015  Eric Wong  <e@80x24.org>
+
+	* hash.c (any_hash): skip rb_objid_hash for static syms
+	  (rb_num_hash_start): extract from rb_ident_hash
+	  (rb_objid_hash): call rb_num_hash_start
+	  (rb_ident_hash): ditto
+	  [ruby-core:70181] [Feature #11405]
+
+Sat Aug 15 04:16:13 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (rb_iseq_mark): reduce NULL checks
+
+Fri Aug 14 18:50:57 2015  Eric Wong  <e@80x24.org>
+
+	* method.h (METHOD_ENTRY_VISI_SET): cast visi to int
+	  (METHOD_ENTRY_FLAGS_SET): ditto
+
+Fri Aug 14 18:43:11 2015  Eric Wong  <e@80x24.org>
+
+	* process.c (close_unless_reserved): add extra check
+	  (dup2_with_divert): remove
+	  (redirect_dup2): use dup2 without divert
+	  (before_exec_non_async_signal_safe): adjust call + comment
+	  (rb_f_exec): stop timer thread for all OSes
+	  (rb_exec_without_timer_thread): remove
+	* eval.c (ruby_cleanup): adjust call
+	* thread.c (rb_thread_stop_timer_thread): always close pipes
+	* thread_pthread.c (struct timer_thread_pipe): add writing field,
+	  mark owner_process volatile for signal handlers
+	  (rb_thread_wakeup_timer_thread_fd): check valid FD
+	  (rb_thread_wakeup_timer_thread): set writing flag to prevent close
+	  (rb_thread_wakeup_timer_thread_low): ditto
+	  (CLOSE_INVALIDATE): new macro
+	  (close_invalidate): new function
+	  (close_communication_pipe): removed
+	  (setup_communication_pipe_internal): make errors non-fatal
+	  (setup_communication_pipe): ditto
+	  (thread_timer): close reading ends inside timer thread
+	  (rb_thread_create_timer_thread): make errors non-fatal
+	  (native_stop_timer_thread): close write ends only, always,
+	   wait for signal handlers to finish
+	  (rb_divert_reserved_fd): remove
+	* thread_win32.c (native_stop_timer_thread): adjust (untested)
+	  (rb_divert_reserved_fd): remove
+	* vm_core.h: adjust prototype
+	  [ruby-core:70386] [Bug #11336]
+
+Fri Aug 14 18:40:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32/lib/win32/registry.rb (API#SetValue): add terminator
+	  size, not 1 byte.  [ruby-core:70365] [Bug #11439]
+
+Thu Aug 13 22:49:42 2015  Juanito Fatas  <katehuang0320@gmail.com>
+
+	* lib/timeout.rb (Timeout#timeout): freeze a string message to
+	  reduce string allocations.  [Fix GH-996]
+
+Thu Aug 13 17:42:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (rb_call_info_kw_arg_bytes): move the definition
+	  to iseq.h because this function is shared with iseq.c and compile.c.
+
+Thu Aug 13 14:36:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_num_to_dbl): move from num2dbl_with_to_f in math.c.
+
+Thu Aug 13 09:01:25 2015  Eric Wong  <e@80x24.org>
+
+	* load.c (features_index_add): avoid repeat calculation
+
+Wed Aug 12 21:57:31 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.c: IMPL() macro accept op as _opname instead of opname
+	  because jemalloc seems to replace the word `free' to `je_free'.
+
+Wed Aug 12 21:51:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.c (mix_id_table_insert): fix memory leak.
+
+Wed Aug 12 21:17:38 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_memsize): reimplement for wrapper
+	  (param_keyword_size): extracted from iseq_memsize
+	  (iseqw_mark): new mark function
+	  (iseqw_data_type): new data type
+	  (iseqw_new): wrap as iseqw_data_type
+	  (iseqw_check): adjust for wrapper
+	  (Init_ISeq): remove iseqw_iseq_key initialization
+	* test/objspace/test_objspace.rb: new test
+	  [ruby-core:70344] [Feature #11435]
+
+Wed Aug 12 21:15:27 2015  Eric Wong  <e@80x24.org>
+
+	* vm_core.h (rb_call_info_kw_arg_bytes): extract from compile.c
+	* compile.c (iseq_build_callinfo_from_hash): use above function
+
+Wed Aug 12 18:00:17 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (move_refined_method): same as the last commit.
+
+Wed Aug 12 17:57:53 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c, gc.c vm.c: use ID_TABLE_* instead of ST_*
+	  (such as ST_CONTINUE) for enum rb_id_table_iterator_result.
+
+Wed Aug 12 17:05:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.h: introduce ID key table.
+	  [Feature #11420]
+
+	  This table only manage ID->VALUE table to reduce overhead of st.
+
+	  Some functions prefixed rb_id_table_* are provided.
+
+	* id_table.c: implement rb_id_table_*.
+
+	  There are several algorithms to implement it.
+
+	  Now, there are roughly 4 types:
+
+	    * st
+	    * array
+	    * hash (implemented by  Yura Sokolov)
+	    * mix of array and hash
+
+	  The macro ID_TABLE_IMPL can choose implementation.
+	  You can see detailes about them at the head of id_table.c.
+
+	  At the default, I choose 34 (mix of list and hash).
+	  This is not final decision.
+	  Please report your suitable parameters or
+	  your data structure.
+
+	  * symbol.c: introduce rb_id_serial_t and rb_id_to_serial()
+	    to represent ID by serial number.
+
+	  * internal.h: use id_table for method tables.
+
+	  * class.c, gc.c, marshal.c, vm.c, vm_method.c: ditto.
+
+Wed Aug 12 05:19:11 2015  Eric Wong  <e@80x24.org>
+
+	* parse.y (rb_parser_compile_cstr): remove volatile arg
+	  (rb_parser_compile_string): ditto
+	  (rb_parser_compile_file): ditto
+	  (rb_parser_compile_string_path): ditto
+	  (rb_parser_compile_file_path): ditto
+	  [ruby-core:70323] [Misc #11431]
+
+Tue Aug 11 22:59:57 2015  Tanaka Akira  <akr@fsij.org>
+
+	* numeric.c (Init_Numeric): Fix document for Float::MIN and
+	  Float::EPSILON.
+
+Tue Aug 11 15:22:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (ALLOCV_N): check integer overflow, as well
+	  as ruby_xmalloc2.  pointed out by Paul <pawlkt AT gmail.com>.
+
+Tue Aug 11 14:57:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_repeated_permutation): fix buffer size, ALLOCV_N
+	  already multiplies element size.
+
+Tue Aug 11 12:13:20 2015  Jeremy Evans  <merch-redmine@jeremyevans.net>
+
+	* test/openssl/test_ssl.rb: Fix LocalJumpErrors being raised
+	  in OpenSSL tests. [ruby-core:70020][Bug #11368]
+
+Tue Aug 11 11:54:13 2015  Alexey Lipnyagov  <liptonshmidt@gmail.com>
+
+	* string.c: Fix documentation for String#slice
+	  [ruby-core:70298][Bug #11427]
+
+Tue Aug 11 11:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (superclass): make superclass rule optional and allow
+	  any contents without a terminator.  [EXPERIMENTAL]
+
+Tue Aug 11 10:58:42 2015  Juanito Fatas  <juanitofatas@gmail.com>
+
+	* string.c: [DOC] Make #end_with? example doc symmetry
+	  with #start_with? [fix GH-992][ci skip]
+
+Tue Aug 11 10:51:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_array.rb: Add test for `Array#flatten` with level 1
+	  [fix GH-986] Patch @yui-knk
+
+Tue Aug 11 10:48:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enum.c: added doc for Enumerable#zip
+	  [fix GH-985] Patch by @yui-knk
+	* test/ruby/test_enum.rb: added tests for Enumerable#zip
+	  [fix GH-985] Patch @yui-knk
+
+Tue Aug 11 10:33:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* vm_method.c: typo fix [fix GH-993][ci skip] Patch by @0x0dea
+	* test/ruby/test_refinement.rb: ditto.
+
+Sun Aug  9 14:15:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (Init_vm_objects, rb_vm_fstring_table): use frozen_strings
+	  table in rb_vm_t.  [ruby-core:70274] [Bug #11423]
+
+Sat Aug  8 03:59:51 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* object.c: [DOC] Improve grammar for Module#===
+	  Patch by @SkyBirdSoar in documenting-ruby/ruby#52:
+	  https://github.com/documenting-ruby/ruby/pull/52
+
+Sat Aug  8 03:39:33 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* hash.c: [DOC] Improve description of symbol key syntax
+	  Patch by Raphael Das Gupta in documenting-ruby/ruby#51:
+	  https://github.com/documenting-ruby/ruby/pull/51
+
+Fri Aug  7 21:04:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_params): turn in_def and in_single into bit
+	  flags and reduce the size by 2-words.
+
+	* parse.y (parser_params): remove redundant prefixes.
+
+	* parse.y (yylex): non-pure parser has not been supported since
+	  merger of ripper.  change argument types from void pointers.
+
+Fri Aug  7 17:07:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (method_super_method): uncallable method entry does not
+	  have the defined class, use the owner instead.
+	  [ruby-core:70254] [Bug #11419]
+
+	* test/ruby/test_method.rb (test_super_method_unbound): add test
+	  by Akira Matsuda.
+
+Thu Aug  6 10:49:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* node.c (rb_alloc_tmp_buffer): round up the size and check the
+	  range.
+
+	* ruby_atomic.h (ATOMIC_VALUE_EXCHANGE, ATOMIC_VALUE_CAS): add
+	  atomic operations for VALUE.
+
+Thu Aug  6 08:15:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  SSLSocket#sysclose to Ruby.
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_close): ditto
+
+Thu Aug  6 07:57:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move nonblock
+	  enable to SSLSocket#initialize and remove Nonblock module.
+
+Thu Aug  6 07:53:47 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  OpenSSL::SSL::SSLSocket#initialize to Ruby.
+
+	* ext/openssl/ossl_ssl.c: ditto
+
+Thu Aug  6 02:25:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* node.c (rb_alloc_tmp_buffer): use NODE_ALLOCA to mark locations
+	  like as builtin alloca.  [ruby-core:70251] [Bug #11418]
+
+Wed Aug  5 14:37:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (rb_econv_open0): rb_econv_t::source_encoding_name
+	  and rb_econv_t::destination_encoding_name should refer static
+	  strings always or NULL.  [ruby-core:70247] [Bug #11416]
+
+Tue Aug  4 16:53:43 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): extract callback
+	  lookup to private Ruby methods. This means we can keep the default
+	  DH callback logic hidden from consumers.  Also, since the SSLSocket
+	  always has a context, we can remove conditionals about that
+	  instance.
+
+	* ext/openssl/ossl_ssl.c: move callback lookup methods to private Ruby
+	  methods.
+
+Tue Aug  4 16:40:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_module.rb: should not expect a method table ordering.
+	  [Feature #11414]
+
+Tue Aug 04 15:30:04 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_block_clear_env_self): clear by Qfalse instead of Qnil.
+	  [Bug #11409]
+
+	* test/ruby/test_eval.rb: add tests for this issue,
+	  written by @0x0dea.
+	  https://github.com/ruby/ruby/pull/988
+
+Tue Aug  4 12:12:14 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c: wrap long lines
+
+Tue Aug  4 09:32:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* proc.c: Removing duplicate doc [fix GH-987][ci skip]
+	  Patch by @ronakjangir47
+
+Tue Aug  4 09:21:58 2015  Richard Schneeman  <richard.schneeman+foo@gmail.com>
+
+	* doc/contributing.rdoc: fixed wrong instructions with OS X
+	  [fix GH-989][ci skip] Patch by @schneems
+
+Mon Aug  3 10:08:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (rb_memsearch): should match only char boundaries in wide
+	  character encodings.  [ruby-core:70220] [Bug #11413]
+
+Sun Aug  2 07:01:17 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/lib/openssl/buffering.rb (gets):
+	  avoid comparing fixnum with nil
+	* test/openssl/test_pair.rb: test gets with limit when EOF is hit
+	  Thanks to Bar Hofesh <bar.hofesh@safe-t.com> for the bug report
+	  and testing.
+	  [ruby-core:70149] [Bug #11400]
+
+Sat Aug  1 17:13:15 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* lib/net/http/response.rb (Net::HTTPResponse::Inflater#finish):
+	  fix a bug that empty gzipped response body causes Zlib::BufError.
+	  [ruby-core:68846] [Bug #11058]
+
+	* test/net/http/test_httpresponse.rb: tests for the above.
+
+Sat Aug  1 17:05:18 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* lib/net/http/response.rb (Net::HTTPResponse#inflater):
+	  fix TypeError. An exception object might be nil.
+	  [ruby-core:68846] [Bug #11058]
+
+Sat Aug  1 09:09:46 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): Implement
+	  SSLContext#options and options= using SSL_CTX_set_options and
+	  SSL_CTX_get_options. This reduces the number of ivars we need and
+	  simplifies `ossl_sslctx_setup`.
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Default `options`
+	  to SSL_OP_ALL
+
+Sat Aug  1 06:54:36 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): OpenSSL declares these
+	  constants as longs, so we should follow that and use LONG2NUM.
+	  http://git.io/vOqxD
+
+Sat Aug  1 04:06:29 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): change callback
+	  to return the Ruby dh (or ecdh) object that the caller cares about
+	  instead of doing rb_iv_get / set to communicate.  This means we can
+	  remove an rb_iv_get call, and only use the set calls for their
+	  intended purpose (to prevent the object from being GC'd).
+
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): ditto
+	* ext/openssl/ossl_ssl.c (ossl_tmp_ecdh_callback): ditto
+
+Sat Aug  1 03:49:31 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): Similarly to the
+	  tmp_ecdh_callback, the SSLSocket instance always holds a reference
+	  to the SSLContext object (it's always set in `initialize`).  The
+	  SSLContext holds a reference to the tmp_dh_callback.  Ask the
+	  context for the callback instead of storing the callback in two
+	  places.
+
+Sat Aug  1 03:43:10 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): create an array
+	  and use `rb_apply` to clean up calls to `rb_protect`.
+
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
+
+Sat Aug  1 03:27:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): The SSL socket
+	  always holds a reference to the SSLContext object, which will have
+	  the callback object.  Ask the context for the callback instead of
+	  storing the callback in two places.
+
+Sat Aug  1 03:14:07 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): convert
+	  `tmp_dh_callback` to Ruby, and call it when setting up an SSL
+	  connection.  This allows us to move the "default" behavior to the
+	  reader method.
+
+	* ext/openssl/ossl_ssl.c: call the tmp_dh_callback instead of
+	  accessing the SSLContext's internals.
+
+Fri Jul 31 23:34:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* .travis.yml: update libssl before running tests.
+	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for figuring out the
+	  travis settings!
+
+Fri Jul 31 21:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_require_internal): use rb_load_internal0 not to raise
+	  a exception to be caught.
+
+Thu Jul 30 13:19:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_const_get_0): warn deprecated constant reference.
+
+	* variable.c (rb_mod_deprecate_constant): mark constants to be
+	  warned as deprecated.  [Feature #11398]
+
+Thu Jul 30 11:53:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_s_handle_interrupt): make identity hash, to
+	  compare masking classes just by their IDs.
+
+Thu Jul 30 11:52:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_load_internal0): stop separating exits at loading
+	  from exits from execution.  TAG_FATAL is the only case that
+	  `errinfo` is a Fixnum, and should continue to exit by JUMP_TAG
+	  but not raising as an ordinary exception.
+	  [ruby-core:70169] [Bug #11404]
+
+Thu Jul 30 10:42:27 2015  Alex Dowad  <alexinbeijing@gmail.com>
+
+	* load.c (rb_load_internal0): extra check before returning
+	  TAG_RAISE when a non-local transfer of control happens while
+	  loading and parsing a Ruby source file.
+	  [ruby-core:70169] [Bug #11404]
+
+Thu Jul 30 08:48:42 2015  Eric Wong  <e@80x24.org>
+
+	* st.c (find_entry): constify st_table*
+	  (find_packed_index_from): ditto
+	  (find_packed_index): ditto
+	  (get_keys): ditto
+	  (get_values): ditto
+
+Thu Jul 30 04:29:25 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_hash_aref_dsym.rb: new benchmark
+	* benchmark/bm_hash_aref_dsym_long.rb: ditto
+	* benchmark/bm_hash_aref_fix.rb: ditto
+
+Wed Jul 29 21:38:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (any_hash), symbol.c (dsymbol_alloc): fix dynamic symbol
+	  hash value by restricting in Fixnum range, that is `long`.
+
+Wed Jul 29 17:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_obj_hash): move in order to share with rb_any_hash.
+
+Wed Jul 29 16:00:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_buf_cat): consider empty non-embed string case,
+	  not to loop infinitely.  [ruby-core:70074] [Bug #11383]
+
+Wed Jul 29 15:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (send_internal): set method_missing_reason before
+	  invoking overriding method_missing method so that the default
+	  method_missing can achieve it properly.
+	  [ruby-core:68515] [Bug #10969]
+
+Wed Jul 29 14:54:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_sym_hash): return same value as rb_any_hash() of
+	  Symbol.  [Bug #9381]
+
+	* hash.c (rb_any_hash): fix Float hash.  rb_dbl_hash() returns a
+	  Fixnum, but not a long.  [Bug #9381]
+
+Wed Jul 29 11:07:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (LIKELY, UNLIKELY): make a boolean to enforce 1 or 0.
+
+Wed Jul 29 10:44:43 2015  Alex Dowad  <alexinbeijing@gmail.com>
+
+	* gc.c: document argument passed to finalizer proc.
+	  [fix GH-976][ci skip] Patch by @alexdowad
+
+Wed Jul 29 10:36:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_io_extract_modeenc): add option parameter `flags'
+	  to append extra oflags to normal mode.
+	  [Feature #11253] [ruby-core:69539]
+
+Wed Jul 29 04:54:47 2015  Eric Wong  <e@80x24.org>
+
+	* test/rubygems/test_gem_remote_fetcher.rb: pre-generate test key
+	  [ruby-core:70151] [Bug #11397]
+
+Tue Jul 28 10:32:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (struct RClass): moved from ruby/ruby.h to hide the
+	  internals.
+
+Tue Jul 28 08:48:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_TYPE_ATTRIBUTE): attribute declaration for
+	  types.
+
+Tue Jul 28 07:23:03 2015  Eric Wong  <e@80x24.org>
+
+	* symbol.h (struct RSymbol): add hashval field
+	* symbol.c (dsymbol_alloc): setup hashval field once
+	* hash.c (rb_any_hash): return RSymbol->hashval directly
+	* common.mk: hash.o depends on symbol.h
+	  Thanks to Bruno Escherl <bruno@escherl.net> for the bug report
+	  [ruby-core:70129] [Bug #11396]
+
+Tue Jul 28 03:26:15 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): raise a more
+	  helpful exception when verifying the peer connection and an
+	  anonymous cipher has been selected. [ruby-core:68330] [Bug #10910]
+	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for the patch.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): test for change
+
+Mon Jul 27 13:24:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* template/id.h.tmpl (ID2ATTRSET): remove an unused macro.
+
+Mon Jul 27 12:21:15 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/openssl/test_ssl.rb: run tests on non-Unix platforms.
+
+Sun Jul 26 19:21:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_alpn_protocol): fix condition
+	  to compile, needs ALPN to be available.  [Feature #9390]
+
+Sun Jul 26 11:29:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* signal.c (default_handler, Init_signal): discard SIGSYS, ENOSYS
+	  should raise a SystemCallError always instead.
+
+Sun Jul 26 10:26:35 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_servername_cb): set the ssl context
+	  object returned by the servername callback on to the socket as an
+	  instance variable.  If the callback allocated a new context object
+	  and didn't keep a reference to it, it could be GC'd out from under
+	  the socket object.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): test for change.
+
+Sun Jul 26 10:07:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* test/openssl/test_ssl.rb (class OpenSSL): add test coverage around
+	  OpenSSL::SSL::SSLContext#servername_cb
+
+Sun Jul 26 09:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: update latest version of bundled power_assert.
+
+Sun Jul 26 08:49:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/rubygems/test_gem_remote_fetcher.rb: backport rubygems upstream
+	  change for OpenSSL key length. see detail to
+	  https://github.com/rubygems/rubygems/pull/1290
+
+Sun Jul 26 08:33:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/pkey.rb: implement DEFAULT_512 and
+	  DEFAULT_1024 constants in Ruby.
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Ask PKey for the
+	  default DH callback since it already must check whether openssl has
+	  been compiled with DH support.
+
+	* ext/openssl/ossl_pkey_dh.c (OSSL_PKEY_BN): Remove C definitions of
+	  DEFAULT_512 and DEFAULT_1024
+
+	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
+
+	* test/openssl/test_pkey_dh.rb (class OpenSSL): add test to ensure the
+	  Ruby definitions are the same as the C definitions were.
+
+Sun Jul 26 08:14:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): support
+	  specifically setting the tmp_dh_callback to nil.
+
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
+
+	* test/openssl/test_pair.rb (module OpenSSL): add a test
+
+Sun Jul 26 07:47:14 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move the default
+	  tmp_dh_callback Ruby code and set it as a default in `initialize`.
+
+	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_512_GEN):
+	  move this constant to Ruby.
+
+	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_1024_GEN):
+	  ditto
+
+	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
+
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): tmp_dh_callback should
+	  always be set, so we can remove this conditional
+
+Sun Jul 26 06:22:24 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* test/openssl/test_pair.rb: add a test ensuring that the default DH
+	  callback is used when no DH callback is specified.
+
+Sun Jul 26 04:08:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add missing
+	  instance variables to squash warnings with alpn.
+
+Sun Jul 26 03:42:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  OpenSSL::SSL::SSLContext#initialize implementation to pure Ruby.
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): ditto
+
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
+
+Sat Jul 25 21:03:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (fill_random_bytes_syscall): get rid of blocking when
+	  no entropy is available.  based on the patch by mame in
+	  [ruby-core:70114].  [Bug #11395]
+
+Sat Jul 25 11:05:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_replace_shared_without_enc): fill the terminator
+	  of embedded strings in wide char encodings.
+
+Sat Jul 25 06:38:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: size should be unsigned.
+	  * rb_call_info_t::index
+	  * rb_iseq_constant_body::stack_max
+	  * rb_iseq_constant_body::local_size
+	  * rb_iseq_constant_body::param::size
+	  * rb_iseq_constant_body::local_table_size
+	  * rb_iseq_constant_body::is_size
+	  * rb_iseq_constant_body::callinfo_size
+
+	* iseq.h: same for iseq_catch_table::size.
+
+	* compile.c: catch up these fix.
+
+	* iseq.c: ditto.
+
+	* proc.c: ditto.
+
+	* vm.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Sat Jul 25 06:00:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::line_info_table.
+
+	* iseq.c: catch up this fix.
+
+Sat Jul 25 05:56:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::param::opt_table and
+	  rb_iseq_constant_body::param::keyword.
+
+	* compile.c: catch up this fix.
+
+Sat Jul 25 04:47:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::catch_table.
+
+	* compile.c (iseq_set_exception_table): catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm.c (vm_exec): ditto.
+
+Fri Jul 24 21:29:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* st.c (EQUAL, st_delete_safe): fix arguments order to compare
+	  function, searching key is the first and stored key is the
+	  second always.
+
+Fri Jul 24 21:27:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (fstr_update_callback): fstring must not be a shared
+	  string, or the content without RSTRING_FSTR may be freed.
+	  [ruby-dev:49188] [Bug #11386]
+
+Fri Jul 24 20:09:43 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/rinda/test_rinda.rb (RingIPv6#prepare_ipv6): prevent to use
+	  IPv6 loopback interface for
+	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast and
+	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast_hops.
+	  The tests are skipped if there are no IPv6 devices other than the
+	  loopback device. [Bug #11394] [ruby-dev:49199]
+
+	* test/rinda/test_rinda.rb (test_make_socket_ipv6_multicast): ditto
+	  for Rinda::TestRingServer#test_make_socket_ipv6_multicast.
+
+	* test/rinda/test_rinda.rb (test_ring_server_ipv6_multicast): ditto
+	  for Rinda::TestRingServer#test_ring_server_ipv6_multicast.
+
+Fri Jul 24 16:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (fstr_update_callback): pool bare strings only.
+
+	* string.c (rb_fstring): return the original string with sharing a
+	  fstring if it has extra attributes, not the fstring itself.
+	  [ruby-dev:49188] [Bug #11386]
+
+Fri Jul 24 16:35:34 2015  yui-knk  <spiketeika@gmail.com>
+
+	* file.c (rb_file_s_extname): [DOC] add an example.
+
+	* test/ruby/test_path.rb (test_extname): add tests.  [Fix GH-978]
+	  * path starts with dot ('.a.rb')
+	  * path includes dir name ('a/b/d/test.rb')
+	  * path includes dir name and dir name starts with dot
+	    ('.a/b/d/test.rb')
+
+Thu Jul 23 18:50:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::local_table and
+	  rb_iseq_param_keyword::table and
+	  rb_iseq_param_keyword::default_values.
+
+	* compile.c: catch up this fix.
+
+	* iseq.c: ditto.
+
+Thu Jul 23 17:30:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::iseq_encoded and
+	  rb_control_frame_t::pc.
+
+	* compile.c (rb_iseq_translate_threaded_code): catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm_exec.c (vm_exec_core): ditto.
+
+Thu Jul 23 10:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h: add raw FL macros, which assume always the
+	  argument object is not a special constant.
+
+	* internal.h (STR_EMBED_P, STR_SHARED_P): valid only for T_STRING.
+
+	* string.c: deal with taint flags directly across String instances.
+
+Thu Jul 23 09:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (lambda_body): pop cmdarg stack for lookahead
+	  token.  [ruby-core:70067] [Bug #11380]
+
+Thu Jul 23 04:03:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: fix tests by not setting the instance
+	  variable on the frozen ssl instance.
+
+Thu Jul 23 03:32:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: add ECDH callback support. [Feature #11356]
+
+	* test/openssl/test_pair.rb: test for ECDH callback support
+
+Thu Jul 23 03:29:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: add ALPN support. [Feature #9390]
+
+	* ext/openssl/extconf.rb: detect ALPN support in OpenSSL
+
+	* test/openssl/test_ssl.rb: test for ALPN
+
+Wed Jul 22 23:44:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_reverse): reversed string is not a substring,
+	  and should not set coderange of the original string.
+	  [ruby-dev:49189] [Bug #11387]
+
+Wed Jul 22 20:17:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: modify layout of rb_iseq_constant_body.
+
+	  Move frequent accessing fields to upper part.
+
+Wed Jul 22 19:57:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove unused declaration of
+	  iseq_compile_data_ensure_node_stack.
+
+Wed Jul 22 19:52:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: separate rb_iseq_body into rb_iseq_constant_body and
+	  rb_iseq_variable_body (rb_iseq_t::variable_body).
+
+	  rb_iseq_variable_body can be modified after compilation.
+
+	* compile.c: use rb_iseq_t::variable_body.
+
+	* iseq.c: ditto.
+
+	* thread.c: ditto.
+
+Wed Jul 22 17:50:35 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/matrix/eigenvalue_decomposition.rb: refine code style.
+	  [fix GH-959][ci skip] Patch by @bogdanvlviv
+
+Wed Jul 22 15:48:47 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_range.rb: Add test case for Range#end with
+	  exclude_end true case. [fix GH-968] Patch by @yui-knk
+
+Wed Jul 22 09:45:31 2015  Maksim Sitnikov  <sitnikovme@undev.ru>
+
+	* numeric.c (num_coerce): [DOC] fix doc for Numeric#coerce,
+	  missing '+'.  [Fix GH-974]
+
+Wed Jul 22 07:24:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* make rb_iseq_t T_IMEMO object (type is imemo_iseq).
+
+	  All contents of previous rb_iseq_t is in rb_iseq_t::body.
+	  Remove rb_iseq_t::self because rb_iseq_t is an object.
+
+	  RubyVM::InstructionSequence is wrapper object points T_IMEMO/iseq.
+	  So RubyVM::ISeq.of(something) method returns different wrapper
+	  objects but they point the same T_IMEMO/iseq object.
+
+	  This patch is big, but most of difference is replacement of
+	  iseq->xxx to iseq->body->xxx.
+
+	  (previous) rb_iseq_t::compile_data is also located to
+	  rb_iseq_t::compile_data.
+	  It was moved from rb_iseq_body::compile_data.
+
+	  Now rb_iseq_t has empty two pointers.
+	  I will split rb_iseq_body data into static data and dynamic data.
+
+	* compile.c: rename some functions/macros.
+	  Now, we don't need to separate iseq and iseqval (only VALUE).
+
+	* eval.c (ruby_exec_internal): `n' is rb_iseq_t (T_IMEMO/iseq).
+
+	* ext/objspace/objspace.c (count_imemo_objects): count T_IMEMO/iseq.
+
+	* gc.c: check T_IMEMO/iseq.
+
+	* internal.h: add imemo_type::imemo_iseq.
+
+	* iseq.c: define RubyVM::InstructionSequence as T_OBJECT.
+	  Methods are implemented by functions named iseqw_....
+
+	* load.c (rb_load_internal0): rb_iseq_new_top() returns
+	  rb_iseq_t (T_IMEMO/iesq).
+
+	* method.h (rb_add_method_iseq): accept rb_iseq_t (T_IMEMO/iseq).
+
+	* vm_core.h (GetISeqPtr): removed because it is not T_DATA now.
+
+	* vm_core.h (struct rb_iseq_body): remove padding for
+	  [Bug #10037][ruby-core:63721].
+
+Wed Jul 22 07:15:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (total_i): no need to skip singleton classes.
+
+Wed Jul 22 06:37:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_call_info_t::kw_arg,
+	  rb_control_frame_t::iseq and rb_control_frame_t::block_iseq.
+
+	* iseq.c (iseq_free): catch up this fix.
+
+	* vm.c: ditto.
+
+	* vm_dump.c: ditto.
+
+Wed Jul 22 06:25:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_call_info_t::blockiseq and rb_block_t::iseq.
+
+	* vm.c, vm_insnhelper.c: catch up this fix.
+
+	* iseq.c (iseq_data_to_ary): constify the first iseq parameter.
+
+	* vm_insnhelper.c (vm_make_proc_with_iseq): ditto.
+
+Wed Jul 22 06:17:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_method_iseq_t::iseqptr.
+
+	* proc.c (rb_method_entry_min_max_arity): catch up this fix.
+
+	* vm_insnhelper.c (def_iseq_ptr): constify.
+
+Wed Jul 22 03:37:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (internal_object_p): Now a singleton classes appear by
+	  ObjectSpace.each_object. [Bug #11360]
+
+	* test/ruby/test_objectspace.rb: add a test about it.
+
+Tue Jul 21 21:21:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (do_select): replace switch and goto with a loop to
+	  suppress maybe-uninitialized warnings by gcc6.
+
+	* thread.c (set_unblock_function, rb_wait_for_single_fd): ditto.
+
+Tue Jul 21 20:32:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_range.rb: Add test for Range#hash
+	  [fix GH-969] Patch by @yui-knk
+
+Tue Jul 21 19:43:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c: constify the first parameter (iseq).
+	  * iseq_add_mark_object()
+	  * iseq_add_mark_object_compile_time()
+
+	* iseq.c, iseq.h (rb_iseq_add_mark_object): ditto.
+
+Tue Jul 21 16:18:48 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_nonblock.rb: increase buffer sizes
+	  to OpenBSD limits. Thanks to Jeremy Evans <code@jeremyevans.net>
+	  [ruby-core:70058]
+
+Tue Jul 21 16:08:53 2015  Eric Wong  <e@80x24.org>
+
+	* load.c (ruby_dln_librefs): make static
+
+Tue Jul 21 13:36:54 2015  yuuji.yaginuma  <yuuji.yaginuma@gmail.com>
+
+	* lib/optparse.rb (complete): [DOC] fix typo.  [Fix GH-973]
+
+Tue Jul 21 05:20:21 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (nogvl_wait_for_single_fd): new function for Linux
+	  (maygvl_copy_stream_wait_read): Linux-specific version
+	  (nogvl_copy_stream_wait_write): use nogvl_wait_for_single_fd
+	  [ruby-core:70051] [Feature #11377]
+
+Mon Jul 20 15:04:30 2015  Eric Wong  <e@80x24.org>
+
+	* parse.y (parser_initialize): avoid redundant zero-ing
+
+Mon Jul 20 12:12:05 2015  Eric Wong  <e@80x24.org>
+
+	* parse.y (struct parser_params): pack: 88 => 256 bytes on 64-bit
+	  [ruby-core:70034] [Feature #11371]
+
+Sun Jul 19 14:29:18 2015  windwiny  <windwiny.ubt@gmail.com>
+
+	* ext/pty/pty.c: [DOC] fix example typo, an old name at move from
+	  PTY.open.  [Fix GH-972]
+
+Sat Jul 18 21:29:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (vm_check_ints_blocking): gather common statements at
+	  the end, and prefer LIKELY for Visual C optimization.
+
+Sat Jul 18 20:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_load_internal0): do not raise any exceptions but
+	  return the result tag state.
+
+	* load.c (rb_load_protect): reduce nested EXEC_TAGs.
+
+Sat Jul 18 19:52:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (run_finalizer): set and restore safe level here to reduce
+	  nested EXEC_TAGs.
+
+Sat Jul 18 18:45:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ruby_cleanup): error_handle() returns exit status to the
+	  system, not internal error state, do not convert the exit status
+	  again.
+
+Sat Jul 18 10:29:03 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_process.rb: test thread+sigs work after failed exec
+
+Sat Jul 18 07:20:18 2015  Jeremy Evans  <code@jeremyevans.net>
+
+	* test/socket/test_nonblock: use smaller buffer for sendmsg
+	  [ruby-core:70016] [Bug #11364]
+
+Sat Jul 18 07:04:24 2015  Eric Wong  <e@80x24.org>
+
+	* signal.c (trap_handler): cleanup to use RSTRING_GETMEM + memcmp
+
+Sat Jul 18 02:53:06 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (argf_read_nonblock): support `exception: false'
+	  (io_nonblock_eof): new function
+	  (io_read_nonblock): use io_nonblock_eof
+	  (argf_getpartial): accept kwargs hash for `exception: false'
+	* test/ruby/test_argf.rb (test_read_nonblock): new test
+	* NEWS: add item for ARGF.read_nonblock
+	  [ruby-core:70000] [Feature #11358]
+
+Fri Jul 17 23:51:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_eval_cmd): $SAFE=4 has been deprecated.
+
+Fri Jul 17 22:18:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): use enum ruby_tag_type names.
+
+	* vm_core.h (ruby_tag_type): move from eval_intern.h for compiling
+	  break/next/redo/return.
+
+Fri Jul 17 15:39:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/encoding.h (ENC_CODERANGE_CLEAN_P): predicate that
+	  tells if the coderange is clean, that is 7bit or valid, and no
+	  needs to scrub.
+
+	* re.c (rb_reg_expr_str): use ENC_CODERANGE_CLEAN_P.
+
+	* string.c (enc_strlen, rb_enc_cr_str_buf_cat, rb_str_scrub):
+	  ditto.
+
+	* string.c (rb_str_enumerate_chars): ditto, and suppress a warning
+	  by gcc6.
+
+Fri Jul 17 15:36:52 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_range.rb (test_first_last): Add test for
+	  `Range.new`.  [Fix GH-971]
+
+Fri Jul 17 15:36:40 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_range.rb (test_first_last): Add assertions to
+	  test of `Range#last` with exclude_end true case.  [Fix GH-970]
+
+Fri Jul 17 09:59:14 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (rb_thread_alone): simplify
+
+Fri Jul 17 09:58:32 2015  Eric Wong  <e@80x24.org>
+
+	* lib/rinda/tuplespace.rb: remove enumerator require
+	* test/pathname/test_pathname.rb: ditto
+
+Fri Jul 17 05:33:58 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (rb_iseq_compile_with_option): reuse result of previous
+	  GET_THREAD() call
+	* thread.c (thread_create_core): ditto
+	  (rb_mutex_trylock): ditto
+	  (rb_mutex_lock): ditto
+	* process.c (rb_waitpid): avoid multiple eval from RUBY_VM_CHECK_INTS
+	* thread.c (rb_thread_check_ints): ditto
+
+Thu Jul 16 19:12:30 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (mutex_alloc): remove needless volatile
+
+Thu Jul 16 22:05:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_t::parent_iseq.
+
+	  rb_iseq_t::local_iseq is not constant data because
+	  local_iseq::flip_cnt can be modified (commented).
+
+	* compile.c: catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Thu Jul 16 21:47:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* process.c (redirect_dup2): when the new FD of dup2() conflicts
+	  with one of the timer thread FDs, the internal FD is diverted.
+	  [Bug #11336] [ruby-core:69886] [Bug #11350] [ruby-core:69961]
+
+	* process.c (dup2_with_divert): new function for the above purpose.
+
+	* thread_pthread.c (rb_divert_reserved_fd): new function for
+	  diverting reserved FD. If the given FD is the same as one of the
+	  reserved FDs, the reserved FD number is internally changed.
+	  It returns -1 when error. Otherwise, returns 0. It also returns
+	  0 if there is no need to change reserved FD number.
+
+	* thread_win32.c (rb_divert_reserved_fd): always returns 0 because
+	  of no reserved FDs.
+
+	* internal.h (rb_divert_reserved_fd): prototype declaration.
+	  It is Ruby internal use only.
+
+Thu Jul 16 21:47:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (rb_iseq_disasm): rename rb_iseq_t *iseqdat to iseq
+	  and VALUE *iseq to code.
+
+	* iseq.c (rb_iseq_disasm_insn): ditto.
+
+Thu Jul 16 14:34:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (REWIND_CFP): keep the arguments region inside the valid
+	  value stack.  [ruby-core:69969] [Bug #11352]
+
+Thu Jul 16 11:38:21 2015  Eric Wong  <e@80x24.org>
+
+	* process.c (close_unless_reserved): declare type of `fd' arg
+
+Thu Jul 16 08:47:29 2015  Eric Wong  <e@80x24.org>
+
+	* load.c (rb_construct_expanded_load_path): fstring expanded path
+	  (get_loaded_features_index): fstring feature path
+	  (rb_provide_feature): ditto
+	  [ruby-core:69871] [Feature #11331]
+
+Thu Jul 16 02:56:14 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (thread_initialize): avoid RSTRING_PTR and NUMT2INT
+
+Thu Jul 16 01:00:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/ruby/test_process.rb (test_exec_close_reserved_fd): test for
+	  [Bug #11353]
+
+Thu Jul 16 00:35:42 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* .gitignore: ignore version.i.
+
+Wed Jul 15 23:40:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
+	  use RUBY (= EnvUtil.rubybin)
+
+Wed Jul 15 23:01:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* process.c (redirect_close, parent_redirect_close): should not close
+	  reserved FD. It should be closed in the exec system call due to the
+	  O_CLOEXEC or FD_CLOEXEC flag. [Bug #11353] [ruby-core:69977]
+
+	* process.c (close_unless_reserved): new function to close FD unless
+	  it is reserved for internal communication.
+
+	* thread_pthread.c (rb_reserved_fd_p): should check owner_process pid
+	  to avoid false positive in forked child process.
+
+Wed Jul 15 18:31:18 2015  Eric Wong  <e@80x24.org>
+
+	* proc.c (proc_mark): remove redundant check
+	* vm.c (env_mark): ditto
+
+Wed Jul 15 17:27:40 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_mark): remove check for data pointer
+	* proc.c (binding_mark): ditto
+	* vm.c (rb_thread_mark): ditto
+	* vm_trace.c (tp_mark): ditto
+
+Wed Jul 15 16:55:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (enc_autoload): drop dummy encoding flag from
+	  the loaded encoding index.  this flag is used only in this
+	  source.
+
+Wed Jul 15 14:39:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_make_env_each): add comments about env layout.
+	  Do not use `i' to specify `new_ep'.
+
+	* vm.c (rb_proc_create, rb_vm_make_proc_lambda): envval is not used.
+
+Wed Jul 15 08:59:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.h (RUBY_MARK_UNLESS_NULL): evaluate the argument only once
+	  to get rid of inadvertent side effects.
+
+Wed Jul 15 02:53:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, vm.c: remove rb_proc_t::envval because we can know it via
+	  rb_proc_t::block::ep.
+
+	  rb_vm_proc_envval(const rb_proc_t *proc) returns an Env object which
+	  the Proc object use.
+
+	* proc.c: catch up this fix.
+
+	* vm_dump.c (rb_vmdebug_proc_dump_raw): ditto.
+
+Wed Jul 15 02:27:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, vm.c: remove rb_env_t::prev_envval because we can know it
+	  via env->ep.
+
+	  rb_vm_env_prev_envval(env) returns prev_envval via env->ep.
+
+	* vm_core.h (rb_vm_env_local_variables): change parameter type
+	  from VALUE (T_DATA/env) to `const rb_env_t *' to make same as
+	  rb_vm_env_prev_envval().
+
+	* proc.c: catch up these changes.
+
+	* vm_dump.c: ditto.
+
+	* vm.c: rename macros.
+
+	  * ENV_IN_HEAP_P() to VM_EP_IN_HEAP_P() because it uses ep.
+	  * ENV_VAL() to VM_ENV_EP_ENVVAL() because it is too short.
+
+Wed Jul 15 01:09:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: refactoring Proc/Env related code.
+
+	* vm_core.h: remove blockprocval field from rb_proc_t and rb_binding_t.
+	  Instead of this field, mark given block in Proc at rb_env_t::env.
+
+	* vm.c (vm_make_env_each): make an Env object with this layout.
+	  And also simplify parameters.
+
+	* proc.c: catch up this fix.
+
+	* vm_core.h: remove rb_env_t::local_size because it is not used.
+
+	* vm_dump.c (rb_vmdebug_env_dump_raw): catch up this fix.
+
+	* vm_core.h (rb_vm_make_env_object): remove rb_vm_make_env_object()
+	  because it is only referred from vm.c.
+
+	* vm_eval.c (eval_string_with_cref): catch up this fix.
+
+Wed Jul 15 00:03:36 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* gc.c (__has_feature): move into internal.h.
+
+	* internal.h (__has_feature): ditto.
+
+	* internal.h (__has_extension): new macro.
+
+	* internal.h (STATIC_ASSERT): use _Static_assert with
+	  clang. [ruby-core:69931] [Bug #11343]
+
+Wed Jul 15 00:00:00 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* random.c (fill_random_bytes_syscall): fix compile error with
+	  clang. [ruby-core:69931] [Bug #11343]
+
+Tue Jul 14 11:22:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#register):
+	  notify the handler thread of new timeout registration.
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  make sleep intervals adaptive than fixed period intervals.
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#start): flush
+	  shutdown pipe.
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#stop): request the
+	  server to stop immediately by sending data via shutdown pipe.
+
+Mon Jul 13 23:58:08 2015  Stefano Tortarolo  <stefano.tortarolo@gmail.com>
+
+	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#do_CONNECT):
+	  fix typos in debugger statements.  [Fix GH-967]
+
+Mon Jul 13 19:11:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/timeout.rb (timeout): warn as deprecated for a long time.
+
+Mon Jul 13 01:37:27 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl.c: [DOC] Backport ruby/openssl@dbb3fdb [Bug #11345]
+	  Thanks to Tomoya Chiba for the report and help with patch.
+
+Sun Jul 12 09:20:02 2015  Shota Fukumori  <her@sorah.jp>
+
+	* ext/socket/basicsocket.c: [DOC] typo (Errno::AGAIN -> Errno::EAGAIN)
+
+	* ext/socket/socket.c: ditto
+
+	* ext/socket/tcpserver.c: ditto
+
+	* ext/socket/udpsocket.c: ditto
+
+	* ext/socket/unixserver.c: ditto
+
+	* io.c: ditto
+
+Sun Jul 12 06:42:23 2015  ksss  <co000ri@gmail.com>
+
+	* test/stringio/test_stringio.rb (test_sysread): add a test for
+	  StringIO#sysread.  [Fix GH-966]
+
+Sat Jul 11 21:16:34 2015  ksss  <co000ri@gmail.com>
+
+	* ext/stringio/stringio.c (Init_stringio): [DOC] Fix an example,
+	  StringIO#puts should be set "\n" at last.  [Fix GH-965]
+
+Sat Jul 11 12:45:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/timeout.rb (Timeout#timeout): remove regexp with wrong line
+	  number and fix caller depth.
+
+Fri Jul 10 22:05:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/timeout.rb (ExitException): removed internal exception class
+	  and use Timeout::Error instead, as using throw/catch to isolate
+	  each timeouts now.  [ruby-dev:49179] [Bug #11344]
+
+Fri Jul 10 17:41:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (is_case_sensitive): get attributes by the file descriptor
+	  of open directory, instead of using mount point name.
+
+Fri Jul 10 10:46:02 2015  ksss  <co000ri@gmail.com>
+
+	* ext/stringio/stringio.c (writable): remove unnecessary check for
+	  deprecated safe level 4.  [Fix GH-963]
+
+Thu Jul  9 15:07:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (waitpid): return immediately if interrupted.
+	  reported by <takkanm AT gmail.com> [ruby-dev:49176] [Bug #11340]
+
+Thu Jul  9 13:03:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_search_super_method): use CI_SET_FASTPATH().
+
+Thu Jul  9 11:07:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_call_info_t::klass because
+	  rb_callable_method_entry_t has information about defined class.
+
+	* vm_insnhelper.c (vm_search_method): don't set ci->klass because
+	  it is removed.
+
+	* vm_insnhelper.c (rb_equal_opt): ditto.
+
+	* vm_insnhelper.c (vm_search_superclass): removed because it is too
+	  simple to write code directly.
+
+	* vm_insnhelper.c (vm_defined): don't use vm_search_superclass().
+	  This fix avoid searching current callable `me' twice.
+
+	* vm_insnhelper.c (vm_search_super_method): ditto.
+
+Thu Jul  9 10:03:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/http/responses.rb: Added 308 status to CODE_TO_OBJ list.
+	  [fix GH-961] Patch by @billinghamj
+
+Thu Jul  9 09:34:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (rb_control_frame_t): fix comments (layout index).
+
+Thu Jul  9 09:25:50 2015  Zachary Scott  <e@zzak.io>
+
+	* parse.y: Improve duplicate key warning with patch by @andremedeiros
+	  [Fix GH-938] https://github.com/ruby/ruby/pull/938 [Bug #11327]
+
+Wed Jul  8 07:43:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/csv.rb: typo fix [ci skip][fix GH-958] Patch by @henrik
+
+Wed Jul  8 04:42:27 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_data_to_ary): dump kw_arg as symbol
+	* test/-ext-/iseq_load/test_iseq_load.rb: test kw_arg roundtrip
+	  [ruby-core:69891] [Bug #11338]
+
+Tue Jul  7 18:18:41 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* random.c (fill_random_bytes_syscall): fix compile error.
+
+Tue Jul  7 16:47:30 2015  Eric Wong  <e@80x24.org>
+
+	* compile.c (COMPILE_ERROR): reduce GET_THREAD() calls
+
+Tue Jul  7 16:39:04 2015  Eric Wong  <e@80x24.org>
+
+	* random.c (fill_random_bytes_syscall): return -1 for error
+	* random.c (fill_random_bytes): try urandom on syscall failure
+
+Tue Jul  7 15:02:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_str_normalize_ospath): skip invalid byte sequence not
+	  to loop infinitely.  this case usually does not happen as the
+	  input name should come from real file systems.
+
+Tue Jul  7 14:40:08 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_backtrace.c: remove debug flag introduced accidentally.
+
+Tue Jul  7 12:05:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* cont.c (cont_free): remove mysterious fflush()
+	  introduced at r19890, maybe accidentally.
+
+Tue Jul  7 11:45:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_method_call): because data->me should be non-NULL,
+	  do not check data->me
+
+	* proc.c (method_inspect): ditto.
+
+Tue Jul  7 11:37:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_iseq_t::orig because rb_iseq_clone()
+	  no longer exists.
+
+	* iseq.c: don't use rb_iseq_t::orig.
+
+Tue Jul 07 11:25:57 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c, internal.h (rb_iseq_clone): removed because we don't need to
+	  clone iseq any more.
+
+	* class.c (clone_method): share iseq between cloned methods. All of
+	  method dependent information are able to refer from method entry.
+
+Tue Jul  7 04:42:25 2015  Eric Wong  <e@80x24.org>
+
+	* string.c (Init_String): use rb_str_freeze for String#freeze
+	  to resize internal buffer
+	  [ruby-core:69870] [Feature #11330]
+
+Tue Jul  7 04:12:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_define_method): remove an unused local variable.
+
+Tue Jul  7 03:57:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_iseq_t::defined_method_id because it is not
+	  needed.
+
+	* eval.c (frame_func_id): simplify. rb_callable_method_entry_t
+	  has enough information.
+
+	* eval.c (frame_called_id): ditto.
+
+	* iseq.c (prepare_iseq_build): catch up this fix.
+
+	* proc.c (rb_mod_define_method): ditto.
+
+	* vm.c (vm_define_method): ditto.
+
+Tue Jul  7 03:47:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove a useless declaration.
+
+Tue Jul  7 03:33:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_iseq_t::klass to reduce dynamic data.
+
+	* internal.h, iseq.c (rb_iseq_klass): remove it because
+	  rb_iseq_t::klass is removed.
+
+	* vm_insnhelper.c (vm_super_outside): do not see cfp->iseq, but
+	  check callable method entry on a frame.
+	  This fix simplify the logic to search super class.
+
+	* test/ruby/test_method.rb: support super() from Proc.
+	  Now, [Bug #4881] and [Bug #3136] was solved.
+
+	* proc.c (rb_mod_define_method): catch up this change.
+
+	* vm.c (vm_define_method): ditto.
+
+	* vm_backtrace.c (rb_profile_frames): now, each `frame' objects
+	  are rb_callable_method_entry_t data or iseq VALUEs.
+
+	  This fix introduce minor compatibility issue that
+	  rb_profile_frame_label() always returns
+	  rb_profile_frame_base_label().
+
+	* test/-ext-/debug/test_profile_frames.rb: catch up this change.
+
+Tue Jul  7 01:52:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* cont.c (fiber_init): initialize control frame correctly.
+	  This fix does not affect any ordinal execution, but
+	  affects debug prints.
+
+Mon Jul  6 17:59:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_search_super_method): do not skip calling
+	  same methods in super.
+	  [Bug #3351]
+
+	* test/ruby/test_super.rb: fix a test.
+
+Mon Jul  6 17:59:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/tk/tcltklib.c: removed deprecated safe level.
+
+Mon Jul  6 17:16:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h, proc.c (rb_method_entry_location): make it static
+	  and remove prefix `rb_' because it is used only in proc.c.
+
+Mon Jul  6 16:42:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/lib/memory_status.rb: removed redundant path.
+
+Mon Jul  6 01:18:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit/parallel.rb: make @@project_dir one level
+	  upper as this file had moved one level deeper.
+
+Sun Jul  5 23:54:10 2015  mizokami  <suzunatsu@yahoo.com>
+
+	* lib/optparse.rb: [DOC] Fix typo.
+
+Sun Jul  5 18:25:37 2015  Eric Wong  <e@80x24.org>
+
+	* gc.c (gc_profile_record_get): fix spelling error in keys
+
+Sun Jul  5 14:49:01 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* README.md: fix a typo pointed out by raoulvdberge.
+	  https://github.com/ruby/ruby/pull/953#commitcomment-11998186
+
+Sun Jul  5 12:56:20 2015  Irvi Firqotul Aini  <viarc7@gmail.com>
+
+	* README.md: Added link HowToReport bugs.
+
+Sun Jul  5 10:51:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_sort_bang): the original array may not be
+	  embedded even if a substitution array is embedded, as it is
+	  embedded when the original array is short enough but not
+	  embedded.  [ruby-dev:49166] [Bug #11332]
+
+Sun Jul  5 09:31:40 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_process.rb: test for fd=3 usability in child
+
+Sat Jul  4 19:43:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Add test case for empty array and first method with args.
+	  Patch by @yui-knk [fix GH-955]
+
+Sat Jul  4 19:39:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Add test for `Enumerable#sort` with block. Patch by @yui-knk
+	  [fix GH-954]
+
+Sat Jul  4 14:38:43 2015  Eric Wong  <e@80x24.org>
+
+	* enum.c (zip_ary): remove volatile, use RB_GC_GUARD
+	  (zip_i): ditto
+
+Sat Jul  4 10:42:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rubygems/test_case.rb (teardown): do not delete features
+	  loaded from the original load paths, the same libraries should
+	  be loaded again when the same features are required.
+	  [ruby-dev:49031] [Bug #11222]
+
+Sat Jul  4 09:38:52 2015  Eric Wong  <e@80x24.org>
+
+	* vm.c (rb_vm_mark): reduce branches for always-set VM fields
+	  (rb_vm_add_root_module): ditto
+
+Fri Jul 03 20:05:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: introduce rb_callable_method_entry_t to remove
+	  rb_control_frame_t::klass.
+	  [Bug #11278], [Bug #11279]
+
+	  rb_method_entry_t data belong to modules/classes.
+	  rb_method_entry_t::owner points defined module or class.
+
+	    module M
+	      def foo; end
+	    end
+
+	  In this case, owner is M.
+
+	  rb_callable_method_entry_t data belong to only classes.
+	  For modules, MRI creates corresponding T_ICLASS internally.
+	  rb_callable_method_entry_t can also belong to T_ICLASS.
+
+	  rb_callable_method_entry_t::defined_class points T_CLASS or
+	  T_ICLASS.
+	  rb_method_entry_t data for classes (not for modules) are also
+	  rb_callable_method_entry_t data because it is completely same data.
+	  In this case, rb_method_entry_t::owner == rb_method_entry_t::defined_class.
+
+	  For example, there are classes C and D, and includes M,
+
+	    class C; include M; end
+	    class D; include M; end
+
+	  then, two T_ICLASS objects for C's super class and D's super class
+	  will be created.
+
+	  When C.new.foo is called, then M#foo is searched and
+	  rb_callable_method_t data is used by VM to invoke M#foo.
+
+	  rb_method_entry_t data is only one for M#foo.
+	  However, rb_callable_method_entry_t data are two (and can be more).
+	  It is proportional to the number of including (and prepending)
+	  classes (the number of T_ICLASS which point to the module).
+
+	  Now, created rb_callable_method_entry_t are collected when
+	  the original module M was modified. We can think it is a cache.
+
+	  We need to select what kind of method entry data is needed.
+	  To operate definition, then you need to use rb_method_entry_t.
+
+	  You can access them by the following functions.
+
+	  * rb_method_entry(VALUE klass, ID id);
+	  * rb_method_entry_with_refinements(VALUE klass, ID id);
+	  * rb_method_entry_without_refinements(VALUE klass, ID id);
+	  * rb_resolve_refined_method(VALUE refinements, const rb_method_entry_t *me);
+
+	  To invoke methods, then you need to use rb_callable_method_entry_t
+	  which you can get by the following APIs corresponding to the
+	  above listed functions.
+
+	  * rb_callable_method_entry(VALUE klass, ID id);
+	  * rb_callable_method_entry_with_refinements(VALUE klass, ID id);
+	  * rb_callable_method_entry_without_refinements(VALUE klass, ID id);
+	  * rb_resolve_refined_method_callable(VALUE refinements, const rb_callable_method_entry_t *me);
+
+	  VM pushes rb_callable_method_entry_t, so that rb_vm_frame_method_entry()
+	  returns rb_callable_method_entry_t.
+	  You can check a super class of current method by
+	  rb_callable_method_entry_t::defined_class.
+
+	* method.h: renamed from rb_method_entry_t::klass to
+	  rb_method_entry_t::owner.
+
+	* internal.h: add rb_classext_struct::callable_m_tbl to cache
+	  rb_callable_method_entry_t data.
+
+	  We need to consider about this field again because it is only
+	  active for T_ICLASS.
+
+	* class.c (method_entry_i): ditto.
+
+	* class.c (rb_define_attr): rb_method_entry() does not takes
+	  defined_class_ptr.
+
+	* gc.c (mark_method_entry): mark RCLASS_CALLABLE_M_TBL() for T_ICLASS.
+
+	* cont.c (fiber_init): rb_control_frame_t::klass is removed.
+
+	* proc.c: fix `struct METHOD' data structure because
+	  rb_callable_method_t has all information.
+
+	* vm_core.h: remove several fields.
+	  * rb_control_frame_t::klass.
+	  * rb_block_t::klass.
+
+	  And catch up changes.
+
+	* eval.c: catch up changes.
+
+	* gc.c: ditto.
+
+	* insns.def: ditto.
+
+	* vm.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* vm_backtrace.c: ditto.
+
+	* vm_dump.c: ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Fri Jul  3 14:30:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c: some mingw compilers need a tweek for the
+	  declarations of _wfreopen_s.  [Bug #11320]
+
+Fri Jul  3 12:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (rb_econv_set_replacement): target encoding name can
+	  be empty now.  [ruby-core:69841] [Bug #11324]
+
+Fri Jul  3 07:21:06 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_io_nonblock_noex.rb: new benchmark
+	* ext/openssl/ossl_ssl.c (no_exception_p): new function
+	  (ossl_start_ssl): adjust for no_exception_p
+	  (ossl_ssl_connect): adjust ossl_start_ssl call
+	  (ossl_ssl_connect_nonblock): ditto
+	  (ossl_ssl_accept): ditto
+	  (ossl_ssl_accept_nonblock): ditto
+	  (ossl_ssl_read_internal): adjust for no_exception_p
+	  (ossl_ssl_write_internal): ditto
+	  (ossl_ssl_write): adjust ossl_write_internal call
+	  (ossl_ssl_write_nonblock): ditto
+	* ext/stringio/stringio.c (strio_read_nonblock):
+	  delay exception check
+	* io.c (no_exception_p): new function
+	  (io_getpartial): call no_exception_p
+	  (io_readpartial): adjust for io_getpartial
+	  (get_kwargs_exception): remove
+	  (io_read_nonblock): adjust for io_getpartial,
+	  check no_exception_p on EOF
+	  (io_write_nonblock): call no_exception_p
+	  (rb_io_write_nonblock): do not check `exception: false'
+	  (argf_getpartial): adjust for io_getpartial
+	  [ruby-core:69778] [Feature #11318]
+
+Fri Jul  3 07:13:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename): Win32 API does not set errno, get
+	  the last error by GetLastError() and map to errno.  [Bug #10015]
+
+Thu Jul  2 21:32:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename): show warnings at errors.
+	  [Bug #10015]
+
+Thu Jul  2 18:39:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: remove `#define RGENGC_OBJ_INFO 1' line introduced to
+	  debug Bug #11244.
+
+Thu Jul  2 18:34:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): separated from rb_obj_info().
+	  Fill internal object information into passed buffer.
+
+	* gc.h: declare rb_raw_obj_info().
+
+Thu Jul  2 16:15:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename): update path type by the target
+	  attributes if possible, to improve the performance.  [Bug #10015]
+
+Thu Jul  2 14:45:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* st.c: get rid of VC++'s warnings of C4700 (uninitialized local
+	  variable used).  I think that these are wrong, but should shut them
+	  up.
+
+Thu Jul  2 14:15:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rubygems.rb (Gem.load_path_insert_index): search
+	  @gem_prelude_index first.
+
+	* lib/rubygems/test_case.rb (Gem::TestCase#setup): keep already
+	  expanded paths to preserve instance variables.
+
+Thu Jul  2 14:12:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): also copy initial load path marks at
+	  setting load paths encoding.
+
+Thu Jul  2 12:26:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/rubygems/test_gem_server.rb (process_based_port): use
+	  dynamically chosen port numbers to get rid of conflicts.
+
+Thu Jul  2 11:58:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/rubygems/test_gem_specification.rb: skip tests which the
+	  platform does not permit the filename of its test file.
+
+Thu Jul  2 11:36:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/rubygems/test_gem_resolver_git_specification.rb: require
+	  rubygems/installer.rb before Gem::TestCase#setup runs, otherwise
+	  as Gem::TestCase#teardown restores $LOADED_FEATURES to the state
+	  at that time, the requiring the file in GitSpecification#install
+	  method causes a lot of constant redefinitions.
+
+Thu Jul  2 10:43:36 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/rubysocket.h: flags for common socket families
+	  (rsock_getfamily): update signature
+	* include/ruby/io.h: comment socket FMODE flags
+	* ext/socket/init.c (rsock_getfamily): memoize family
+	* ext/socket/basicsocket.c: adjust rsock_getfamily calls
+	* ext/socket/ancdata.c: ditto
+	  [ruby-core:69713] [Feature #11298]
+
+Thu Jul  2 10:30:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/resolver.rb: fixed NameError of Gem::Util::NULL_DEVICE.
+
+Thu Jul  2 09:51:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/resolver.rb: fix error of null device reference with DOSISH
+	  platform.
+
+Thu Jul  2 06:49:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems HEAD(c202db2).
+	  this version contains many enhancements see http://git.io/vtNwF
+	* test/rubygems: ditto.
+
+Wed Jul  1 23:50:34 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/net/http/test_httpresponse.rb
+	(HTTPResponseTest#test_read_body_content_encoding_deflate_uppercase):
+	fix a failure without zlib.
+
+Wed Jul  1 10:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Add test for Enumerable#none? [fix GH-950] Patch by @yui-knk
+
+Wed Jul  1 09:30:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* struct.c (struct_set_members): hide internal back_members
+	  object, and members object does not need to be duped as it
+	  should be frozen and hidden.
+
+Wed Jul  1 09:28:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* struct.c (struct_member_pos): revert r51080 to fix other
+	  implicit conversions but cast the return value to fix the
+	  previous implicit conversion.
+
+Wed Jul  1 08:47:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* struct.c (struct_member_pos): avoid implicit conversion loses
+	  integer precision: 'long' to 'int'.
+
+Wed Jul  1 05:57:03 2015  Eric Wong  <e@80x24.org>
+
+	* vm_method.c (rb_add_method_iseq): add RB_GC_GUARD
+	* class.c (clone_method): remove RB_GC_GUARD
+	* struct.c (define_aref_method): ditto
+	  (define_aset_method): ditto
+	* vm.c (vm_define_method):
+	* iseq.c (rb_iseq_clone): add RB_GC_GUARD
+
+Wed Jul  1 05:43:58 2015  Eric Wong  <e@80x24.org>
+
+	* struct.c (AREF_HASH_THRESHOLD): new macro
+	  (id_back_members): new ID
+	  (struct_member_pos_ideal): new function
+	  (struct_member_pos_probe): ditto
+	  (struct_set_members): ditto
+	  (struct_member_pos): ditto
+	  (rb_struct_getmember): use struct_member_pos for O(1) access
+	  (rb_struct_aref_sym): ditto
+	  (rb_struct_aset_sym): ditto
+	  (setup_struct): call struct_set_members
+	  (struct_define_without_accessor): ditto
+	  (Init_Struct): initialize __members_back__
+	  [ruby-core:66851] [ruby-core:69705] [ruby-core:69821]
+
+Tue Jun 30 23:12:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_reopen): FilePathValue() ensures the path
+	  NUL-terminated and frozen, so it is unnecessary to make it shared.
+
+Tue Jun 30 23:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (check_dirname): ensure path name NUL-terminated for
+	  SHARABLE_MIDDLE_SUBSTRING.
+
+	* io.c (rb_sysopen): ditto.
+
+Tue Jun 30 18:38:16 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/file.c (rb_freopen): need to terminate by NUL.
+
+Tue Jun 30 17:28:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_reopen): freopen(3) with OS encoding path.
+	  [ruby-core:69780] [Bug #11320]
+
+	* win32/file.c (rb_freopen): wrapper of wchar version freopen(3).
+	  use _wfreopen_s() if available.
+
+Tue Jun 30 08:24:08 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (rb_io_oflags_modestr): handle O_TRUNC correctly
+	* test/ruby/test_io.rb (test_reopen_stdio): new test
+	  Patch-by: cremno phobia <cremno@mail.ru>
+	  [ruby-core:69779] [Bug #11319]
+
+Tue Jun 30 02:47:02 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/st.h (struct st_table): hide struct list_head
+	* st.c (struct st_table_entry): adjust struct
+	  (head, tail): remove shortcut macros
+	  (st_head): new wrapper function
+	  (st_init_table_with_size): adjust to new struct and API
+	  (st_clear): ditto
+	  (add_direct): ditto
+	  (unpack_entries): ditto
+	  (rehash): ditto
+	  (st_copy): ditto
+	  (remove_entry): ditto
+	  (st_shift): ditto
+	  (st_foreach_check): ditto
+	  (st_foreach): ditto
+	  (get_keys): ditto
+	  (get_values): ditto
+	  (st_values_check): ditto
+	  (st_reverse_foreach_check): ditto (unused)
+	  (st_reverse_foreach): ditto (unused)
+	  [ruby-core:69726] [Misc #10278]
+
+Mon Jun 29 17:38:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* insns.def (defineclass): do not quote unprintable characters at
+	  raising an exception.
+
+Mon Jun 29 16:01:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http/response.rb (inflater): CONTENT_ENCODING can be upper
+	  case. [ruby-core:69670] [Bug #11285] patched by Andy Chu
+
+Mon Jun 29 14:50:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* eval.c (add_activated_refinement): should not include the original
+	  class.
+
+Mon Jun 29 12:09:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* README.md: tweak styles. [fix GH-945][ci skip] Patch by @bryndyment
+
+Mon Jun 29 07:23:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/sizes.c.tmpl: extract RUBY_DEFINT to define sizes of
+	  types checked by configure.in, and fix size of intptr_t in
+	  universal binary.
+
+Mon Jun 29 02:10:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages for super class mismatch.
+
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages for non-class super.
+
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages when already defined but type mismatch.
+
+Sun Jun 28 12:07:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (rb_define_class_id_under): raise TypeError exception
+	  same as ruby level class definition when superclass mismatch.
+
+Sun Jun 14 19:02:03 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* lib/net/ftp.rb (makeport): close the TCPServer
+	  when sending the port fails.
+
+	* test/net/ftp/test_ftp.rb: test for above.
+
+Fri Jun 26 12:48:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (load_transcoder_entry): fix transcoder loading race
+	  condition, by waiting in require.  [ruby-dev:49106] [Bug #11277]
+
+Fri Jun 26 07:53:56 2015  Eric Wong  <e@80x24.org>
+
+	* enum.c (enum_minmax): simplify return value creation
+	* test/ruby/test_enum.rb: test behavior on empty
+	* hash.c (rb_hash_fetch_m): remove unnecessary volatile since r41597
+	  (env_reject_bang): trade volatile for GC guard
+	  (env_select): ditto
+	  (env_select_bang): ditto
+	  (env_keep_if): ditto
+	  (rb_env_clear): ditto
+
+Thu Jun 25 21:24:28 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/-ext-/popen_deadlock/test_popen_deadlock.rb: test [Bug #11265]
+
+	* ext/-test-/popen_deadlock/infinite_loop_dlsym.c: new ext to call
+	  dlsym(3) infinitely without GVL, used in the above test.
+
+	* ext/-test-/popen_deadlock/extconf.rb: extconf.rb for the above
+	  ext. Currently, only enabled on Solaris (main target) and Linux
+	  (as a reference platform and for debugging the ext).
+
+Thu Jun 25 19:24:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: not to use vfork on Solaris to avoid deadlock
+	  occurred in vfork(2) with multi-threading and dynamic linker
+	  on Solaris. [Bug #11265] [ruby-dev:49089]
+
+Thu Jun 25 18:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/lib/envutil.rb (Test::Unit::Assertions#assert_no_memory_leak):
+	  NO_MEMORY_LEAK_ENVS is moved to Memory::NO_MEMORY_LEAK_ENVS
+	  to reduce child executions during test-all on Solaris.
+
+	* test/lib/memory_status.rb (Memory::NO_MEMORY_LEAK_ENVS): ditto.
+
+Thu Jun 25 17:32:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_method_entry_create): need to call
+	  method_definition_reset() if def is given.
+
+	  Actually, `me' is a new object, so we don't need to call it.
+	  It is just to make sure.
+
+	* vm_method.c (method_definition_reset): remove duplicated insertion.
+
+	* vm_method.c (rb_method_entry_clone): assign dst->def here,
+	  not in method_definition_reset().
+
+Thu Jun 25 16:44:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c: make a rb_method_definition_t data (def) *after* making
+	  a rb_method_entry_t data (me).
+
+	  Normally, `me' points `def'. Some Ruby objects pointed from `def'
+	  and objects are marked by `me' (mark_method_entry() in gc.c).
+	  However, `def' is built before making a `me', then nobody can mark
+	  objects pointed from `def' before making (and pointing from) `me'.
+
+	  I hope this patch solve #11244.
+
+	* vm_method.c: remove `rb_' prefix from some static functions.
+
+	* method.h (rb_method_entry_create): constify
+
+	* gc.c (mark_method_entry): add checking `def' and
+	  `def->body.iseq.iseqptr' availability because they can be NULL.
+
+Thu Jun 25 14:14:16 2015  takiy33  <takiy33@gmail.com>
+
+	* test/test_prime.rb (test_eratosthenes_works_fine_after_timeout):
+	  use spaces instead of TABs in ruby codes.  [Fix GH-944]
+
+Thu Jun 25 07:08:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info, method_type_name): show method type name in a string
+	  instead of a number.
+
+Thu Jun 25 06:49:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show more details for T_IMEMO/imemo_ment.
+
+Thu Jun 25 06:40:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_method_definition_reset): need a WB for
+	  VM_METHOD_TYPE_ATTRSET.
+
+Thu Jun 25 03:33:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (RGENGC_OBJ_INFO, obj_info): add a macro to enable/disable
+	  rich obj_info() output.
+
+	  At the default, the value of RGENGC_OBJ_INFO is
+	  (RGENGC_DEBUG | RGENGC_CHECK_MODE).
+
+	* gc.c (RGENGC_OBJ_INFO): force enable it to debug #11244.
+
+	* gc.c (gc_mark_ptr): print more details with obj_info().
+
+	* gc.c (gc_mark_children): remove useless debug prints.
+
+Thu Jun 25 02:40:33 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_read_internal):
+	  do not process kwargs in blocking mode
+	* test/openssl/test_ssl.rb: test sysread
+
+Wed Jun 24 16:54:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_children): add additional debug code for #11244.
+
+Wed Jun 24 16:05:42 2015  Eric Wong  <e@80x24.org>
+
+	* string.c (rb_str_justify): use RB_GC_GUARD
+
+Wed Jun 24 14:25:17 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_ptr): add a check code for #11244.
+
+	  It should be removed later. But we can remain this check
+	  because it is only a branch.
+
+Wed Jun 24 12:49:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_fstring_cstr): new function to make a fstring from
+	  a string literal.
+
+	* internal.h (rb_fstring_lit): new macro to make a fstring from a
+	  string literal.
+
+	* include/ruby/intern.h (rb_strlen_lit): new macro to get the
+	  length of a string literal, borrowed from mruby/mruby@e4afd53.
+
+Wed Jun 24 12:21:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* re.c: Update documentation for Regexp class.
+	  [fix GH-937][ci skip] Patch by @davydovanton
+
+Wed Jun 24 09:23:03 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (generic_ivar_set): remove FL_ABLE check
+	  (gen_ivar_copy): ditto
+	  [ruby-core:69715]
+
+Wed Jun 24 08:28:15 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): reduce stack use
+	  [ruby-core:69595] [Feature #11263]
+
+Tue Jun 23 14:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_receiver): raise ArgumentError if no receiver
+	  is available on this exception object.  [Feature #10881]
+
+Tue Jun 23 09:48:34 2015  Eric Wong  <e@80x24.org>
+
+	* dir.c (check_dirname): avoid volatile, use return value
+	  (dir_s_chroot, dir_s_mkdir, dir_s_rmdir): adjust callers
+
+Tue Jun 23 06:37:10 2015  Eric Wong  <e@80x24.org>
+
+	* struct.c (struct_ivar_get): cache member definition in a subclass
+	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
+	  in https://bugs.ruby-lang.org/issues/10585
+
+Tue Jun 23 04:58:06 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_vm2_struct_big_href_hi.rb: new benchmark
+	* benchmark/bm_vm2_struct_big_href_lo.rb: ditto
+	* benchmark/bm_vm2_struct_big_hset.rb: ditto
+	* benchmark/bm_vm2_struct_small_href.rb: ditto
+	* benchmark/bm_vm2_struct_small_hset.rb: ditto
+	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
+	  in https://bugs.ruby-lang.org/issues/10585
+
+Mon Jun 22 18:08:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/lib/test/unit.rb (Test::Unit::Parallel#start_watchdog): removed
+	  because it has been meaningless since r36385. [Bug #11288]
+
+	* test/lib/test/unit.rb (Test::Unit::Parallel#_run_parallel): delete
+	  lines related to the removed start_watchdog method
+
+Sun Jun 21 23:52:46 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: mention about Array#bsearch_index and Hash#fetch_values.
+
+Sun Jun 21 23:46:27 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: add a reference to a ticket.
+
+Sun Jun 21 20:28:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (roomof): extract from type_roomof, and move from
+	  bignum.c.
+
+Sun Jun 21 18:32:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby_atomic.h (ATOMIC_PTR_CAS): define by generic CAS macro, not
+	  via size_t, to suppress a warning by mingw gcc.
+
+Sun Jun 21 05:31:41 2015  Shota Fukumori  <her@sorah.jp>
+
+	* ext/objspace/objspace_dump.c(dump_object): Return empty JSON object when
+	  passed object is a special const, instead of SEGV.
+	  Based patch by Kohei Suzuki (eagletmt). [ruby-core:69692] [Bug #11291]
+
+	* test/objspace/test_objspace.rb(test_dump_special_consts): Test for above fix.
+
+
+Sat Jun 20 03:56:58 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* enc/make_encmake.rb: the list of encoding extension libraries must
+	  not include encinit.c itself.  It caused "undefined reference to
+	  Init_encinit".
+
+Sat Jun 20 02:03:53 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* process.c (rb_execarg_parent_start1): new macro ALWAYS_NEED_ENVP
+	  to generate envp_str anytime on Solaris 10 (or earlier version
+	  of Solaris) to avoid calling execv() which is async-signal unsafe
+	  on Solaris 10. [Bug #11265] [ruby-dev:49089]
+
+	* process.c (exec_with_sh, proc_exec_cmd): On Solaris 10,
+	  because ALWAYS_NEED_ENVP is 1 and envp_str is always generated,
+	  execv() in exec_with_sh() and proc_exec_cmd() are never called.
+	  To guarantee this, execv() is replaced by a macro to print
+	  out error message on Solaris 10.
+
+	* process.c (proc_exec_sh): Because proc_exec_sh() may be called
+	  by rb_proc_exec() with envp_str = Qfalse, execl() is replaced
+	  by a macro that calls execle() with "extern char **environ"
+	  traditional global variable on Solaris 10.
+	  TODO: This may be unsafe and should be changed in the future.
+	  Although rb_proc_exec() is not used from inside current version
+	  of ruby, it may be called by third-party extensions.
+
+Sat Jun 20 01:10:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: mention about $SAFE.
+
+Fri Jun 19 14:53:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_mod_define_method): now requires a block direct to
+	  this method call.  [ruby-core:69655] [Bug #11283]
+
+Fri Jun 19 13:54:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_mod_define_method): get rid of inadvertent ID
+	  creations at error.
+
+Fri Jun 19 07:58:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: if no with-ext option is given, default to
+	  enable everything.  [ruby-dev:49108] [Bug #11280]
+
+Fri Jun 19 06:30:07 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* bootstraptest/test_method.rb: remove a test because $SAFE=2 was
+	  obsolete.
+
+	  Please check btest, too.
+
+Thu Jun 18 23:51:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* bin/erb: $SAFE=3 is obsolete.
+
+Thu Jun 18 23:45:11 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* safe.c: removed needless doc related $SAFE=2
+
+Thu Jun 18 23:38:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread.c (rb_thread_safe_level): fix document.  $SAFE=3 is obsolete.
+	  [ci skip]
+
+Thu Jun 18 23:25:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: configure intersection of with-ext and not
+	  without-ext, as withouts is no longer true by default if
+	  with-ext option is given.  [ruby-dev:49108] [Bug #11280]
+
+Thu Jun 18 23:20:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* include/ruby/ruby.h: $SAFE=2 is now obsolete.
+
+	* dir.c, ext/fiddle/handle.c, ext/socket/basicsocket.c, file.c
+	  gc.c, io.c, process.c, safe.c, signal.c, win32/file.c:
+	  removed code for $SAFE=2
+
+	* test/erb/test_erb.rb, test/fiddle/test_handle.rb
+	  test/ruby/test_env.rb: removed tests for $SAFE=2.
+
+Thu Jun 18 22:50:07 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* enc/make_encmake.rb: added --transes and --no-transes options.
+
+Thu Jun 18 18:24:12 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_unix.rb: replace sleep with select
+
+Thu Jun 18 17:59:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (rb_vm_control_frame_id_and_class): remove useless codes.
+	  `me' knows ID and owner class.
+
+Thu Jun 18 16:58:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_method_alias_struct::original_me and
+	  rb_method_refined_struct::orig_me.
+
+	* class.c (move_refined_method): use RB_OBJ_WRITE() for
+	  me->def->body.refined.orig_me.
+
+Thu Jun 18 14:35:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (count_imemo_objects): support imemo_ment.
+
+Thu Jun 18 13:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_receiver): add NameError#receiver method.
+	  [Feature #10881]
+
+Thu Jun 18 10:00:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* safe.c: removed needless doc related $SAFE=3
+
+Thu Jun 18 09:59:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* safe.c: rename old method name for $SAFE=3
+
+Thu Jun 18 06:02:42 2015  Eric Wong  <e@80x24.org>
+
+	* compile.c (get_exception_sym2type, iseq_build_from_ary_body):
+	  rely on %+PRIsVALUE instead of calling rb_inspect directly
+
+Wed Jun 17 20:59:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (ENC_MK): needs fake.rb if cross compilation.
+	  [ruby-dev:49098] [Bug #11272]
+
+Wed Jun 17 20:23:29 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/rbconfig/sizeof/extconf.rb: Check __float80.
+
+Wed Jun 17 15:15:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* safe.c (safe_setter): of course, don't have to warn the limitation of
+	  $SAFE=3 after it's removed.
+
+Wed Jun 17 14:29:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* include/ruby/ruby.h: $SAFE=3 is now obsolete.
+
+	* ext/socket/init.c, ext/socket/socket.c, ext/socket/tcpsocket.c
+	  ext/socket/udpsocket.c, gc.c, object.c, re.c, safe.c: removed code
+	  for $SAFE=3
+
+	* bootstraptest/test_method.rb, test/erb/test_erb.rb, test/ruby/test_dir.rb
+	  test/ruby/test_file.rb, test/ruby/test_method.rb, test/ruby/test_regexp.rb
+	  test/ruby/test_thread.rb: remove tests for $SAFE=3
+
+Wed Jun 17 12:13:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: added contributor name.
+
+Wed Jun 17 10:57:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/csv.rb: accept to use Range object for row selection.
+	  contributed by Mitsutaka Mimura.
+	  [Feature #11267][ruby-dev:49091]
+
+Wed Jun 17 09:50:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/servlet.rb (documentation_search, root_search):
+	  requires json for JSON.dump and fix sporadic failures due to
+	  the loading order.
+
+Tue Jun 16 19:19:53 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/rbconfig/sizeof/extconf.rb: Check several types defined in C99
+	  and x86_64 ABI.
+
+	* template/sizes.c.tmpl: Relax a pattern for types.
+
+Tue Jun 16 17:37:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/objspace/test_objspace.rb: relax pattern because uncollectible
+	  flag and marked flag can be false at major GC.
+	  [Bug #10852]
+
+Tue Jun 16 04:50:44 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/basicsocket.c (bsock_recv): document outbuf
+	* ext/socket/unixsocket.c (unix_recvfrom): ditto
+	* ext/socket/init.c (rsock_strbuf, recvfrom_locktmp): new functions
+	  (rsock_s_recvfrom): support destination buffer as 3rd arg
+	  (rsock_s_recvfrom_nonblock): ditto
+	* string.c (rb_str_locktmp_ensure): export for internal ext
+	* test/socket/test_nonblock.rb: test recv_nonblock
+	* test/socket/test_unix.rb: test recv
+	  [ruby-core:69543] [Feature #11242]
+
+Tue Jun 16 04:38:02 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal,
+	  bsock_recvmsg_internal):
+	  support "exception: false" kwarg
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
+	  ditto
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock): use rsock_opt_false_p
+	* ext/socket/socket.c (sock_connect_nonblock): ditto
+	* ext/socket/rubysocket.h (rsock_opt_false_p): new function
+	* ext/socket/basicsocket.c (bsock_recv_nonblock): update rdoc
+	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
+	* test/socket/test_nonblock.rb: new tests
+	  [ruby-core:69542] [Feature #11229]
+
+Mon Jun 15 14:33:02 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb: Make Set#each and SortedSet#each generate a sized
+	  enumerator. [GH-931] by kachick (Kenichi Kamiya)
+
+	* test/test_set.rb: Import tests from Set into SortedSet. [GH-931]
+	  by kachick (Kenichi Kamiya)
+
+Mon Jun 15 02:26:34 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (Net::HTTP#connect): use connect_nonblock and
+	  io/wait to eliminate timeout use. fix GH-899
+
+Sat Jun 13 07:21:18 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (thread_start_func_2): don't interrupt when last thread
+	  exit unless main thread is already exited. Otherwise main thread
+	  could be wrongly interrupted when it uses rb_thread_call_without_gvl().
+	  Patch by Takehiro Kubo. [Bug #11237][ruby-dev:49044][GH-898]
+
+	* test/-ext-/gvl/test_last_thread.rb: new test for the above fix.
+
+	* ext/-test-/gvl/call_without_gvl/call_without_gvl.c: new ext for
+	  the above test.
+	* ext/-test-/gvl/call_without_gvl/extconf.rb: ditto.
+
+Mon Jun 15 00:14:33 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/lib/pathname.rb (descend): Blockless form supported.
+	  (ascend): Ditto.
+	  [ruby-core:68820] [Feature #11052] Patch by Piotr Szotkowski.
+
+Sun Jun 14 20:09:25 2015  Tanaka Akira  <akr@fsij.org>
+
+	* time.c (time_getlocaltime): [DOC] Add examples of valid utc_offset
+	  formats.
+	  [ruby-core:68306] [Misc #10905] Patch by Charles Korn.
+
+Sun Jun 14 18:49:56 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/raddrinfo.c (parse_numeric_port): Detect
+	  port overflow.
+	  (numeric_getaddrinfo): Use parse_numeric_port.
+	  numeric_getaddrinfo fails if port is too big now.
+	  This makes rb_getaddrinfo invokes the real getaddrinfo()
+	  on such condition.
+	  This change is related to [ruby-core:69355] [Bug #11179].
+
+Sun Jun 14 17:26:03 2015  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c (enum_chunk_while): New method Enumerable#chunk_while.
+	  [ruby-core:67738] [Feature #10769] proposed by Tsuyoshi Sawada.
+
+Sun Jun 14 17:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_load_ok): try opening file without gvl not to
+	  lock entire process.  [Bug #11060]
+
+Sun Jun 14 10:43:50 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/runruby.rb: just remove the lines of RUBY_VERSION check and raise
+	  instead of replacing the check to `true`, for getting rid of a
+	  warning `possibly useless use of true in void context`.
+
+Sun Jun 14 10:13:55 2015  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/source.rb (REXML::IOSource#scan): Fix a typo in
+	  document. [fix GH-934]
+	  Patch by Anton Davydov. Thanks!!!
+
+Sun Jun 14 10:09:48 2015  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/attlistdecl.rb (REXML::AttlistDecl): Fix a typo in
+	  document. [fix GH-934]
+	  Patch by Anton Davydov. Thanks!!!
+
+Sun Jun 14 06:24:57 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ruby/test_io.rb: add test for IO.binread fd leak.
+	  See r50881.
+
+Sun Jun 14 05:23:51 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* io.c (rb_io_s_binread): close fd if seek offset is invalid.
+
+Sun Jun 14 04:40:32 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/lib/leakchecker.rb (check): refactor.
+
+Sun Jun 14 04:34:14 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/lib/leakchecker.rb: Return false for no leaks.
+	  Otherwise the GC could run for nothing.
+
+Sun Jun 14 04:15:40 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* lib/delegate.rb: [DOC] Update SimpleDelegator example. [ci skip]
+
+Sat Jun 13 20:28:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* file.c (rb_stat_ino): get inode from the interval of struct st.
+
+	* win32/win32.c (stati64_set_inode): get nFileIndexHigh/Low, and set it
+	  to the interval of struct st as inode.
+	  [Feature #11216]
+
+	* win32/win32.c (stati64_set_inode_handle): call stati64_set_inode.
+
+	* win32/win32.c (rb_w32_fstati64): call stati64_set_inode_handle.
+
+	* win32/win32.c (stati64_handle): call stati64_set_inode.
+
+Sat Jun 13 19:44:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/io/console/depend (.list.chksum): revert a part of r50859, because
+	  it was not mentioned at its commit log and it caused a build error on
+	  Windows ($(MAKE) is already quoted).
+
+Sat Jun 13 17:35:11 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_core.h (rb_thread_t): add th->name.
+
+	* vm.c (th_init): initialize th->name.
+
+	* thread.c (Init_Thread): add Thread.name and name=. [Feature #11251]
+
+	* thread.c (rb_thread_inspect): show thread's name if set.
+
+	* thread.c (rb_thread_getname): defined.
+
+	* thread.c (rb_thread_setname): ditto.
+
+Sat Jun 13 11:39:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/tempfile.rb: Fix typo. [fix GH-933] Patch by @Zorbash
+
+Sat Jun 13 11:38:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/openssl/ossl_ocsp.c: fix documentation on ocsp response cert status.
+	  [fix GH-932] Patch by @chrisholmes
+
+Sat Jun 13 11:35:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.gemspec: Fix require paths for released gem.
+	  [fix GH-929] Patch by @voxik
+	* ext/io/console/io-console.gemspec: ditto.
+
+Sat Jun 13 00:45:08 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Return sized enumerators.
+	  Patch by Kenichi Kamiya [GH-931]
+
+Sat Jun 13 00:45:06 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Fix with_object with no block given
+
+Sat Jun 13 00:44:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Have with_index accept an offset parameter.
+	  Based on patch by T Yamada. [#11007]
+
+Fri Jun 12 22:21:12 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/ruby/test_extlibs.rb (TestExtLibs::check_existence): fix
+	  error. [Bug #11255] [ruby-dev:49079]
+
+Fri Jun 12 21:17:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* pack.c (pack_{un,}pack): new template character `j` and `J`, pointer
+	  with signed and unsigned integers.
+
+	* NEWS: mention about this feature.
+	  [Feature #11215] [ruby-dev:49015]
+
+Fri Jun 12 21:01:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (File::SHARE_DELETE): new flag to be able to delete opened file
+	  on Windows.
+
+	* include/win32/win32.c (O_SHARE_DELETE): new pseudo file mode flag.
+
+	* win32/win32.c (rb_w32_{w,}open): support above flag.  [EXPERIMENTAL]
+
+	* NEWS: mention about this feature.
+	  [Feature #11218] [ruby-dev:49022]
+
+Fri Jun 12 18:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: added missing commit message.
+
+Fri Jun 12 18:20:37 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* sample/exyacc.rb: Fix some typos. [fix GH-927] Patch by @davydovanton
+	* sample/list.rb: ditto.
+	* sample/trick2013/kinaba/remarks.markdown: ditto.
+
+Fri Jun 12 17:34:14 2015  Wojciech Mach  <wojtek@wojtekmach.pl>
+
+	* hash.c (rb_hash_fetch_values): add `Hash#fetch_values`.
+	  [Feature #10017] [Fix GH-776]
+
+Fri Jun 12 16:28:17 2015  Radan Skoric  <radan.skoric@gmail.com>
+
+	* array.c (rb_ary_bsearch_index): Implement Array#bsearch_index
+	  method, which is similar to bsearch and returns the index or
+	  nil.  [Feature #10730]
+
+Thu Jun 11 19:11:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/zlib/zlib.c: Fix indentation for rdoc.
+	  [Bug #11221][ruby-core:69465]
+
+Thu Jun 11 16:23:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h (METHOD_ENTRY_BASIC_SET): fix last commit (unbalanced parens).
+
+Thu Jun 11 15:14:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in: define SET_THREAD_NAME if it has pthread_set_name_np
+	  for FreeBSD, and don't define it if both pthread_setname_np
+	  and pthread_set_name_np don't exist.
+
+	* thread_pthread.c (SET_THREAD_NAME): don't define if they don't exist.
+
+	* thread_pthread.c (native_set_thread_name): run if SET_THREAD_NAME
+	  is defined.
+
+Thu Jun 11 15:53:31 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h (METHOD_ENTRY_BASIC_SET): should clear last bit.
+
+Thu Jun 11 14:34:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems.rb: bump version to 2.4.7 and 2.4.8. these versions fixed
+	  CVE-2015-3900.
+	* lib/rubygems/remote_fetcher.rb: ditto.
+	* test/rubygems/test_gem_remote_fetcher.rb: added testcase for CVE-2015-3900
+
+Thu Jun 11 14:18:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems.rb: bump version to 2.4.6. It's missing change at r49774.
+
+Thu Jun 11 13:50:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (ary_ensure_room_for_push): check if array size will
+	  exceed maximum size to get rid of buffer overflow.
+	  [ruby-dev:49043] [Bug #11235]
+
+	* array.c (ary_ensure_room_for_unshift, rb_ary_splice): ditto.
+
+Thu Jun 11 13:17:34 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/test_cmath.rb (TestCMath#test_trigonometric_functions): should
+	  not compare float values (in complex values) by `==`.
+
+Thu Jun 11 08:52:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: embed rb_method_entry_t::attr::flags (5 bits) into
+	  rb_method_entry_t::flags to make one word spare space.
+
+	  Add some macros to access these flags.
+
+	* vm_method.c: use these macros.
+
+	* internal.h: define IMEMO_FL_USHIFT and IMEMO_FL_USER[0-4]
+	  for T_IMEMO local flags.
+
+Thu Jun 11 08:27:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: use VM_ASSERT instead of assert().
+
+	* vm_args.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Thu Jun 11 08:16:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define VM_ASSERT() for assertion
+	  enabled only when (VM_CHECK_MODE > 0).
+
+	* vm_insnhelper.c: move definition VM_CHECK_MODE
+	  from vm_insnhelper.c to vm_core.h.
+
+	* vm.c: remove <assert.h>
+
+Thu Jun 11 06:46:07 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (check_frame): check type of cref_or_me first.
+
+Thu Jun 11 04:34:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/test_cmath.rb: Add some assertions.
+
+Thu Jun 11 00:34:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/fake.rb.in: expanded macro result may have spaces
+	  between tokens.  [ruby-dev:49047] [Bug #11243]
+
+Wed Jun 10 22:27:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/mkmf.rb: revert r50804 because of build failure when specifying
+	  LDFLAGS during configure, observed on Solaris with GCC 4.6.
+	  [Bug #11245]
+
+Wed Jun 10 21:59:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* README.ja.md: fix markup miss.
+
+Wed Jun 10 11:06:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/fake.rb.in: turn into erb template from autoconf
+	  template to fake more accurately.
+
+	* common.mk (fake.rb): needs preprocessed file now.
+
+	* version.c (Init_version): add dummy expression to
+	  RUBY_ENGINE_VERSION.
+
+Tue Jun  9 12:31:25 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Simplify and optimize EratosthenesSieve
+
+Tue Jun  9 11:45:00 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Simplify and optimize EratosthenesSieve
+	  based on patch by Ajay Kumar. [Fixes GH-921]
+
+Mon Jun  8 05:09:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): print method id for T_IMEMO/ment.
+
+Sun Jun  7 07:05:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* Move test cases from test/ruby/test_complex.rb to test/test_cmath.rb
+
+Sat Jun  6 18:23:41 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: back to share rb_method_definition_t by
+	  rb_method_entry_t.
+
+	  r50728 changed sharing `def's to isolating `def's
+	  on alias and so on. However, this change conflicts
+	  future improvement plan. So I change back to sharing approach.
+
+	* method.h: move rb_method_definition_t::flags to
+	  rb_method_entry_t::attr::flags.
+
+	  rb_method_entry_t::attr is union with VALUE because this field
+	  should have same size of VALUE. rb_method_entry_t is T_IMEMO).
+
+	  And also add the following access macros to it's fields.
+
+	  * METHOD_ENTRY_VISI(me)
+	  * METHOD_ENTRY_BASIC(me)
+	  * METHOD_ENTRY_SAFE(me)
+
+	* vm_method.c (rb_method_definition_addref): added instead of
+	  rb_method_definition_clone().
+
+	  Do not create new definition, but increment alias_count.
+
+	* class.c (clone_method): catch up this fix.
+
+	* class.c (method_entry_i): ditto.
+
+	* proc.c (mnew_internal): ditto.
+
+	* proc.c (mnew_missing): ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Sat Jun  6 15:59:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c: ins_methods_push() needs rb_method_visibility_t type on
+	  2nd arg.
+
+Sat Jun  6 15:05:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (ins_methods_push): Change type and name of parameters
+	  to make more clear.
+
+Sat Jun  6 08:52:13 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_nonblock.rb: try to avoid EMSGSIZE
+	  [ruby-core:69466]
+
+Sat Jun  6 07:58:30 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: remove struct mark_tbl_arg and pass objspace directly
+	  to avoid indirect access overhead.
+
+Sat Jun  6 07:08:45 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): drop redundant assignment
+
+Sat Jun  6 01:00:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): all arguments are
+	  parsed even on systems without HAVE_STRUCT_MSGHDR_MSG_CONTROL
+	  to prevent SEGV caused by passing Qnil to RARRAY_LENINT and
+	  to preserve behavior before r50776.
+	  [Bug #11224] [ruby-core:69468] [Bug #11225] [ruby-core:69469]
+
+Fri Jun  5 22:37:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (ins_methods_push): change 3rd parameter's type
+	  from long to rb_method_visibility_t.
+
+	* class.c (ins_methods_i): catch up this fix.
+
+	* class.c (method_entry_i): cast to st_data_t instead of `long'.
+
+Fri Jun  5 20:37:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: move definition of rb_cref_t to method.h.
+
+	* eval_intern.h: move definition of rb_scope_visibility_t
+	  to method.h.
+
+	* method.h: change rb_cref_t::scope_visi from VALUE to
+	  rb_scope_visibility_t.
+	  [Bug #11219]
+
+	* vm.c (vm_cref_new): accept rb_method_visibility_t directly.
+
+	* vm_insnhelper.c (rb_vm_rewrite_cref): don't use 0,
+	  but METHOD_VISI_UNDEF.
+
+	* vm_method.c (rb_scope_visibility_set): don't need to use cast.
+
+	* vm_method.c (rb_scope_module_func_set): ditto.
+
+Fri Jun  5 17:27:30 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid msg_control
+	  ptr if msg_controllen is zero to fix portability problems.
+
+Fri Jun  5 09:17:45 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): fix build error
+	  from r50776
+
+Fri Jun  5 07:05:58 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (sym_wait_readable, sym_wait_writable): declare
+	  (io_getpartial): use sym_wait_readable
+	  (io_write_nonblock): use sym_wait_writable
+	  (Init_IO): initialize sym_wait_*able
+
+Fri Jun  5 06:43:00 2015  Eric Wong  <e@80x24.org>
+
+	* doc/extension.rdoc: note rb_get_kwargs changes keywords_hash
+	  [ruby-core:68507]
+
+Fri Jun  5 05:50:29 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): use rb_scan_args
+	  [ruby-core:69439] [Feature #11207]
+
+Fri Jun  5 02:20:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/lib/envutil.rb (assert_no_memory_leak): change default value
+	  of limit from 1.5 to 2.0. It is ad-hoc fix to solve test failure
+	  in travis-ci.
+
+Fri Jun  5 01:17:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): no need to use cast.
+
+Fri Jun  5 01:14:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): show additional messages on rb_bug().
+
+Fri Jun  5 01:06:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_add_method_iseq): use intermediate struct to
+	  avoid initializing struct with variables.
+	  [Bug #11217]
+
+	* method.h: add a comment about it.
+
+Fri Jun  5 00:55:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_method_refined_t::orig_me.
+
+	  Also constify the following functions.
+
+	  * rb_resolve_refined_method()
+	  * rb_method_entry_with_refinements()
+	  * rb_method_entry_without_refinements()
+	  * rb_method_entry_copy()'s parameter.
+
+	* class.c: catch up this fix.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Thu Jun  4 12:47:54 SGT 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* array.c: Revert r50763. because "reentered" is not typo.
+
+Thu Jun  4 11:12:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/win32ole/win32ole.c: fix a typo. Patch by @davydovanton
+	  [fix GH-923]
+	* include/ruby/st.h: ditto.
+	* include/ruby/util.h: ditto.
+
+Thu Jun  4 10:54:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* array.c: fix a typo. Patch by @manish-shrivastava
+	  [fix GH-922]
+
+Thu Jun  4 09:52:02 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/lib/openssl/ssl.rb: use io/nonblock instead of fcntl
+	  [ruby-core:69382] [Feature #11190]
+
+Thu Jun  4 07:22:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: introduce rb_method_refined_t for refined method entry.
+
+	* class.c (move_refined_method): catch up this fix.
+
+	* gc.c (mark_method_entry): ditto.
+
+	* vm_eval.c (vm_call0_body): ditto.
+
+	* vm_insnhelper.c (vm_call_method): ditto.
+
+	* vm_method.c: ditto.
+
+Thu Jun  4 07:12:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dirent_match): match short names only when FNM_SHORTNAME
+	  flag is given, for the backward compatibility, and the new
+	  behavior is often dangerous.  [ruby-core:69435] [Bug #11206]
+
+Thu Jun  4 05:44:01 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (special_generic_ivar): remove flag
+	  (givar_i, rb_mark_generic_ivar_tbl): remove functions
+	  (rb_free_generic_ivar, rb_ivar_lookup, rb_ivar_delete,
+	   generic_ivar_set, rb_ivar_set, rb_ivar_defined,
+	   rb_copy_generic_ivar, rb_ivar_foreach, rb_ivar_count,
+	   rb_obj_remove_instance_variable):
+	   adjust for lack of ivar support in special constants
+	* test/ruby/test_variable.rb: test ivars for special consts
+	* internal.h: remove rb_mark_generic_ivar_tbl decl
+	* gc.c (gc_mark_roots): remove rb_mark_generic_ivar_tbl call
+	  [ruby-core:69441] [Feature #11208]
+
+Thu Jun  4 05:13:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (def_iseq_ptr): `iseqval' is not available any more.
+
+Thu Jun  4 04:50:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (method_entry_i): mtbl should not have `me' as NULL.
+
+Thu Jun  4 04:28:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (clone_method): do not use me->klass, but use explicitly
+	  passed argument.
+
+Thu Jun  4 04:10:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (rb_vm_rewrite_cref_stack): rename to rb_vm_rewrite_cref().
+
+	* class.c (clone_method): use renamed name.
+
+	* vm_insnhelper.c (rb_vm_rewrite_cref): do not use `node' in variable
+	  names.
+
+Wed Jun  3 23:03:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c: rename `rb_frame_...' to `rb_scope_...'.
+
+	* eval_intern.h: move decl. of rb_scope_visibility_set() to method.h.
+
+	* load.c: catch up this fix.
+
+Wed Jun  3 21:14:20 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/rbconfig/sizeof/extconf.rb: Check C99 standard integer types.
+
+Wed Jun  3 21:00:47 2015  Tanaka Akira  <akr@fsij.org>
+
+	* configure.in: Don't check __int128.
+
+	* ext/rbconfig/sizeof/extconf.rb: Check __int128.
+
+	* ext/rbconfig/sizeof/depend: sizes.c depends on
+	  ext/rbconfig/sizeof/extconf.rb.
+
+	* template/sizes.c.tmpl: Detect check_sizeof.
+
+Wed Jun  3 20:07:07 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (clone_method): remove redundant check for me->def != NULL.
+	  Now, all `me` have `me->def`.
+
+	* proc.c (rb_method_entry_location): ditto.
+
+	* vm.c (rb_vm_check_redefinition_opt_method): ditto.
+
+	* vm.c (add_opt_method): ditto.
+
+	* vm_eval.c (vm_call0_body): ditto.
+
+Wed Jun  3 19:24:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: rename enum missing_reason to enum method_missing_reason.
+
+	* vm_core.h: use enum method_missing_reason for
+	  rb_thread_t::method_missing_reason.
+
+	* vm_eval.c: catch up this fix.
+
+	* vm_insnhelper.c: ditto.
+
+Wed Jun  3 16:17:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* vm.c: eagerly allocate `loading_table`.  This eliminates the need to
+	  do NULL checks when looking up the `loading_table` hash.
+	  https://github.com/ruby/ruby/pull/918
+
+	* load.c: remove various NULL checks
+
+Wed Jun  3 11:47:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: change fields order to gather frequent access fields.
+
+	* vm_insnhelper.c (vm_call_method): add LIKELY().
+
+Wed Jun 03 10:35:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: split rb_method_definition_t::flag to several flags.
+
+	  `flag' contains several categories of attributes and it makes us
+	  confusion (at least, I had confused).
+
+	  * rb_method_visibility_t (flags::visi)
+	    * NOEX_UNDEF     -> METHOD_VISI_UNDEF     = 0
+	    * NOEX_PUBLIC    -> METHOD_VISI_PUBLIC    = 1
+	    * NOEX_PRIVATE   -> METHOD_VISI_PRIVATE   = 2
+	    * NOEX_PROTECTED -> METHOD_VISI_PROTECTED = 3
+	  * NOEX_SAFE(flag)  -> safe (flags::safe, 3 bits)
+	  * NOEX_BASIC       -> basic (flags::basic, 1 bit)
+	  * NOEX_MODFUNC     -> rb_scope_visibility_t in CREF
+	  * NOEX_SUPER       -> MISSING_SUPER (enum missing_reason)
+	  * NOEX_VCALL       -> MISSING_VCALL (enum missing_reason)
+	  * NOEX_RESPONDS    -> BOUND_RESPONDS (macro)
+
+	  Now, NOEX_NOREDEF is not supported (I'm not sure it is needed).
+
+	  Background:
+	    I did not know what "NOEX" stands for.
+	    I asked Matz (who made this name) and his answer was "Nothing".
+	    "At first, it meant NO EXport (private), but the original
+	    meaning was gone."
+	    This is why I remove the mysterious word "NOEX" from MRI.
+
+	* vm_core.h: introduce `enum missing_reason' to represent
+	  method_missing (NoMethodError) reason.
+
+	* eval_intern.h: introduce rb_scope_visibility_t to represent
+	  scope visibility.
+	  It has 3 method visibilities (public/private/protected)
+	  and `module_function`.
+
+Wed Jun  3 08:06:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gem/bundled_gems: updated to test-unit 3.1.1 and minitest 5.7.0.
+
+Wed Jun  3 04:48:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): check respond_to_missing?
+	  at defined?(func()).
+	  [Bug #11212]
+
+	* test/ruby/test_defined.rb: add a test for this fix.
+
+Wed Jun  3 04:34:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): skip respond_to_missing? when
+	  a method is available.
+	  [Bug #11211]
+
+	* test/ruby/test_defined.rb: add a test for this fix.
+
+Wed Jun  3 04:14:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def (defined), vm_insnhelper.c (vm_defined):
+	  move instruction body to the vm_defined() function.
+
+Wed Jun  3 02:29:25 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ruby/test_module.rb: Do not assume class variable order.
+	  Patch by @enebo.
+
+Wed Jun  3 01:10:38 2015  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* vm_method.c (rb_method_definition_set): remove a double assignment.
+	  Coverity Scan found this bug.
+
+Wed Jun  3 00:04:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_alias): rename parameter names.
+
+Tue Jun  2 23:27:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: remove rb_method_iseq_t::iseqval.
+	  While making a r50728, iseqval is needed (to mark correctly),
+	  but now just iseqptr is enough.
+
+	* class.c: catch up this fix.
+
+	* gc.c: ditto.
+
+	* proc.c: ditto.
+
+	* vm_method.c: ditto.
+
+Tue Jun  2 21:29:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (proc_curry): remove a debug line.
+
+Tue Jun  2 12:43:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: make rb_method_entry_t a VALUE.
+	  Motivation and new data structure are described in [Bug #11203].
+
+	  This patch also solve the following issues.
+
+	  * [Bug #11200] Memory leak of method entries
+	  * [Bug #11046] __callee__ returns incorrect method name in orphan
+	                 proc
+
+	* test/ruby/test_method.rb: add a test for [Bug #11046].
+
+	* vm_core.h: remove rb_control_frame_t::me. me is located at value
+	  stack.
+
+	* vm_core.h, gc.c, vm_method.c: remove unlinked_method... codes
+	  because method entries are simple VALUEs.
+
+	* method.h: Now, all method entries has own independent method
+	  definitions. Strictly speaking, this change is not essential,
+	  but for future changes.
+
+	  * rb_method_entry_t::flag is move to rb_method_definition_t::flag.
+	  * rb_method_definition_t::alias_count is now
+	    rb_method_definition_t::alias_count_ptr, a pointer to the counter.
+
+	* vm_core.h, vm_insnhelper.c (rb_vm_frame_method_entry) added to
+	  search the current method entry from value stack.
+
+	* vm_insnhelper.c (VM_CHECK_MODE): introduced to enable/disable
+	  assertions.
+
+Tue Jun  2 10:46:36 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_nonblock.rb: new test for sendmsg_nonblock
+
+Tue Jun  2 09:04:14 2015  Eric Wong  <e@80x24.org>
+
+	* lib/benchmark.rb: just use Process::CLOCK_MONOTONIC
+	  [ruby-core:69390]
+
+Mon Jun  1 22:01:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (pkg_config): split --libs if --libs-only-l option
+	  is not available.  patch in [ruby-core:69428] by Hans Mackowiak.
+	  [ruby-core:69421] [Bug #11201]
+
+Mon Jun  1 21:18:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_children): remove a garbage character
+	  introduced at the last commit.
+
+Mon Jun  1 19:24:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_method_entry_make): do not show warning message
+	  when method_entry is an alias.
+
+Mon Jun  1 15:47:16 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: move class related definitions.
+
+Mon Jun  1 15:43:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c: remove needless include pragma for method.h.
+
+	* struct.c: ditto.
+
+	* vm_method.c: ditto.
+
+Mon Jun  1 05:42:00 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* eval_intern.h, vm_method.c: move macros to functions.
+	  * SCOPE_TEST(f)  -> rb_frame_visibility_test(flag).
+	  * SCOPE_CHECK(f) -> rb_frame_visibility_check(flag).
+	  * SCOPE_SET(f)   -> rb_frame_visibility_set(flag).
+
+	* load.c (load_ext): use it.
+
+Mon Jun  1 04:47:37 2015  Zachary Scott  <e@zzak.io>
+
+	* ext/date/date_core.c: [DOC] Add comparison of Time and DateTime
+	  Patch provided by @pixeltrix
+
+Mon Jun  1 04:22:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (VM_FRAME_MAGIC_DUMMY): introduce new frame type to
+	  recognize dummy frame.
+
+	* vm.c (th_init): use new frame type.
+
+	* vm_args.c (raise_argument_error): ditto.
+
+Mon Jun  1 04:15:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (rb_class_has_methods): added to reduce dependency
+	  to internal class data structure.
+
+	* internal.h: ditto.
+
+	* hash.c (has_extra_methods): use added function.
+
+Mon Jun  1 04:11:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c , gc.h (rb_obj_info): export obj_info(VALUE) for debugging.
+
+Mon Jun  1 03:52:55 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_gc.rb: increase timeout seconds for GC stressful
+	  debugging.
+
+Sun May 31 04:18:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: fix typo of comments.
+
+Sun May 31 03:36:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: add VM_METHOD_TYPE_ALIAS rb_method_definition_t::type
+	  to fix [Bug #11173].
+
+	  Now, inter class/method alias creates new method entry
+	  VM_METHOD_TYPE_ALIAS, which has an original method entry.
+
+	* vm_insnhelper.c (find_defined_class_by_owner): added.
+	  Search corresponding defined_class from owner class/module.
+
+	* vm_method.c (rb_method_entry_get_without_cache): return me->klass
+	  directly for defined_class.
+
+	  Now, no need to check me->klass any more.
+
+	* vm_method.c (method_entry_set0): separated from method_entry_set().
+
+	* vm_method.c (rb_alias): make method entry has VM_METHOD_TYPE_ALIAS.
+
+	* vm_method.c (release_method_definition): support VM_METHOD_TYPE_ALIAS.
+
+	* vm_method.c (rb_hash_method_definition): ditto.
+
+	* vm_method.c (rb_method_definition_eq): ditto.
+
+	* vm_method.c (release_method_definition): ditto.
+
+	* vm_insnhelper.c (vm_call_method): ditto.
+
+	* vm_insnhelper.c (vm_method_cfunc_entry): ditto.
+
+	* vm_eval.c (vm_call0_body): ditto.
+
+	* gc.c (mark_method_entry): ditto.
+
+	* proc.c (method_def_iseq): ditto.
+
+	* proc.c (method_cref): ditto.
+
+	* proc.c (rb_method_entry_min_max_arity): ditto.
+
+	* test/ruby/test_alias.rb: add tests.
+
+	* test/ruby/test_module.rb: fix a test to catch up current behavior.
+
+Sun May 31 03:34:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_unlink_method_entry): make it static.
+
+Sun May 31 03:26:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h, vm_method.c (rb_free_method_entry): constify a parameter.
+
+	* vm_core.h: remove useless declaration about rb_unlink_method_entry().
+
+Sat May 30 18:05:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/tempfile.rb (Remover#call): fixed wrong condition.  introduced at
+	  r50682.
+
+Sat May 30 16:12:35 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c: use RB_GC_GUARD instead of volatile
+	  [ruby-core:69419] [Feature #11198]
+
+Sat May 30 15:59:10 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/tempfile.rb (Tempfile#initialize): initialize @unlinked to fix
+	  test failures introduced at r50682.  I hope that check the results of
+	  tests before committing, at least the tests about the changed feature.
+
+Sat May 30 11:02:55 2015  Martin Englund <martin@englund.nu>
+
+	* doc/dtrace_probes.rdoc: change lingering dtrace probe documentation
+	  from function- to method-
+
+Sat May 30 10:26:09 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* lib/tempfile.rb: refactoring.
+	  * use warn instead of STDERR.print
+	  * remove @tmpname and use @tmpfile.path
+	  * introduce @unlinked flag
+	  * Remover takes only @tmpfile
+	  * mode will be modified just before file reopen
+
+Sat May 30 09:02:51 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/intern.h (rb_generic_ivar_table): deprecate
+	* internal.h (rb_attr_delete): declare
+	* marshal.c (has_ivars): use rb_ivar_foreach
+	  (w_ivar): ditto
+	  (w_object): update for new interface
+	* time.c (time_mload): use rb_attr_delete
+	* variable.c (generic_ivar_delete): implement
+	  (rb_ivar_delete): ditto
+	  (rb_attr_delete): ditto
+	  [ruby-core:69323] [Feature #11170]
+
+Sat May 30 09:14:28 2015  Scott Francis  <scott.francis@shopify.com>
+
+	* cont.c (cont_free): check if ruby_current_thread is still valid.
+	  [Fix GH-914]
+
+Sat May 30 08:36:04 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (static int special_generic_ivar): move
+	  (rb_generic_ivar_table): rewrite for compatibility
+	  (gen_ivtbl_bytes): new function
+	  (generic_ivar_get): update to use ivar index
+	  (generic_ivar_update): ditto
+	  (generic_ivar_set): ditto
+	  (generic_ivar_defined): ditto
+	  (generic_ivar_remove): ditto
+	  (rb_mark_generic_ivar): ditto
+	  (givar_i): ditto
+	  (rb_free_generic_ivar): ditto
+	  (rb_mark_generic_ivar_tbl): ditto
+	  (rb_generic_ivar_memsize): ditto
+	  (rb_copy_generic_ivar): ditto
+	  (rb_ivar_set): ditto
+	  (rb_ivar_foreach): ditto
+	  (rb_ivar_count): ditto
+	  (givar_mark_i): remove
+	  (gen_ivtbl_mark): new function
+	  (gen_ivar_each): ditto
+	  (iv_index_tbl_extend): update for struct ivar_update
+	  (iv_index_tbl_newsize): ditto
+	  [ruby-core:69323] [Feature #11170]
+
+Sat May 30 08:10:46 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (iv_index_tbl_make): extract from rb_ivar_set
+	  (iv_index_tbl_extend): ditto
+	  (iv_index_tbl_newsize): ditto
+	  (rb_ivar_set): use extracted functions
+	  [ruby-core:69323] (Part 1)
+
+Fri May 29 17:39:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* tool/make_hgraph.rb: added.
+
+Fri May 29 14:39:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): out of range NTH_REF is always
+	  nil.
+
+	* parse.y (parse_numvar): check overflow of NTH_REF and range.
+	  [ruby-core:69393] [Bug #11192]
+
+	* util.c (ruby_scan_digits): make public and add length parameter.
+
+Fri May 29 11:18:58 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal,
+	  bsock_recvmsg_internal):
+	  avoid redundant fcntl on Linux
+	  [ruby-core:69154] [Feature #11145]
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock): ditto
+	* ext/socket/rubysocket.h (MSG_DONTWAIT_RELIABLE): new macro
+
+Fri May 29 10:30:34 2015  Eric Wong  <e@80x24.org>
+
+	* lib/net/resolv.rb (request): use monotonic clock
+	* lib/net/http.rb (begin_transport, end_transport): ditto
+	  [ruby-core:69384] [Feature #11124]
+
+Fri May 29 04:37:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c: add two methods to debug internals.
+
+	  * ObjectSpace.internal_class_of: return RBASIC_CLASS(obj).
+	  * ObjectSpace.internal_super_of: return RCLASS_SUPER(cls).
+
+	* NEWS: add information about both methods.
+
+	* test/objspace/test_objspace.rb: add tests for both methods.
+
+Thu May 28 06:55:53 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* ext/tk/sample/figmemo_sample.rb (open_file),
+	  ext/tk/sample/tktextio.rb (TkTextIO): fix typo in messages.
+	  [Fix GH-916]
+
+Wed May 27 09:50:51 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
+	  ossl_asn1_decode_all): use RB_GC_GUARD instead of volatile
+	  [ruby-core:69371] [Bug #11185]
+
+Wed May 27 09:27:30 2015  Eric Wong  <e@80x24.org>
+
+	* lib/drb/drb.rb (set_sockopt): remove redundant fcntl call
+	* lib/drb/unix.rb (set_sockopt): ditto
+	  [ruby-core:69128] [Feature #11137]
+
+Tue May 26 22:10:43 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_method.c (rb_alias): should resolve refined methods.
+	  [ruby-core:69360] [Bug #11182]
+
+Tue May 26 21:35:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* include/ruby/defines.h (RUBY_ATTR_ALLOC_SIZE): fix condition.
+
+Mon May 25 22:35:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (rel): after the relations is changed,
+	  @changesets is no longer right.
+
+Mon May 25 11:27:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (setup_overlapped): seek to the file end only when
+	  writing (mode:a), not reading (mode:a+, read).
+
+Mon May 25 00:27:37 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* numeric.c (Numeric#negative?): [DOC] Fix call-seq.
+	  Patch by @yui-knk. [Fixes GH-908]
+
+Sun May 24 01:35:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* debug.c (ruby_debug_print_id): use rb_id2name() for fprintf().
+
+Sat May 23 18:38:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/*.1: updated dates in man pages.
+	  [ruby-dev:48988] [Bug #11171]
+
+Sat May 23 03:10:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_write_console): should return the count of
+	  actually eaten characters, include escape sequences.
+
+Fri May 22 22:36:14 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Remove obsolete Prime.new
+	  patch by Ajay Kumar. [Fixes GH-891]
+
+Fri May 22 21:13:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/intern.h (rb_sym_count): move `rb_sym_all_symbols`
+	  to a symbol.c specific section.  a part of patch by Lourens
+	  Naude.
+
+Fri May 22 20:56:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* complex.c (f_complex_polar): simple bug reproduced only when y is
+	  a float but x is not a float.
+
+Fri May 22 19:42:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_spawn_process): do not discard global escape
+	  status.  [ruby-core:69304] [Bug #11166]
+
+	* process.c (rb_execarg_spawn): extract the start procedure in a
+	  parent process with ensuring the end procedure.
+
+Fri May 22 16:48:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: added news for net-telnet and rake
+
+Thu May 21 20:27:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in (RUBY_DTRACE_POSTPROCESS): cmp -b is GNU extension.
+	  darwin uses GNU cmp, and FreeBSD and Solaris are not.
+	  Note that accidentally equals to expected result.
+
+Thu May 21 18:00:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c: constify.
+
+	* iseq.h: ditto.
+
+	* method.h: ditto.
+
+	* proc.c: ditto.
+
+	* vm_method.c: ditto.
+
+Thu May 21 17:44:53 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: fix issues caused by binding created from Method#to_proc.
+	  [Bug #11163]
+
+	* vm.c (vm_cref_new_toplevel): export as rb_vm_cref_new_toplevel().
+
+	* test/ruby/test_method.rb: add some assertions.
+
+Thu May 21 17:29:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/matrix.rb: added documentation for Matrix#empty and Matrix#/
+	  [Feature #10070][ruby-dev:48433] Patch by @gogotanaka
+
+Thu May 21 17:02:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: rename functions.
+	  * method_get_def() -> method_def()
+	  * method_get_iseq() -> method_def_iseq()
+	  * method_get_cref() -> method_cref()
+
+Thu May 21 16:52:44 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_method_get_iseq): rename to rb_method_iseq.
+
+	* iseq.c: catch up this fix.
+
+	* iseq.h: commit ditto.
+
+Thu May 21 15:41:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/telnet.rb: gemify net-telnet.
+	  [Feature #11083]
+	* gems/bundled_gems: added net-telnet to bundled gems.
+
+Thu May 21 15:37:32 2015  Zachary Scott  <e@zzak.io>
+
+	* vm_method.c: Remove private attribute warning [Bug #10967]
+	  Patch by @spastorino [Fixes GH-849]
+	  https://github.com/ruby/ruby/pull/849
+
+	* test/ruby/test_module.rb: Update test for changes
+
+Thu May 21 10:59:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (method_proc): rename to method_to_proc.
+
+Thu May 21 10:51:54 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* io.c (rb_f_select): [DOC] Fixes for grammar and style.
+	  [Fix GH-906]
+
+Thu May 21 08:25:19 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (Init_var_tables): init generic_iv_tbl
+	  (rb_generic_ivar_table, generic_ivar_get, generic_ivar_set,
+	   generic_ivar_defined, generic_ivar_remove,
+	   rb_mark_generic_ivar, givar_i, rb_mark_generic_ivar_tbl,
+	   rb_free_generic_ivar, rb_copy_generic_ivar, rb_ivar_foreach,
+	   rb_ivar_count): remove checks for uninitialize generic_iv_tbl
+	[ruby-core:69155] [Feature #11146]
+
+Thu May 21 04:11:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (exception_type2symbol): show correct bug message.
+
+Wed May 20 23:19:05 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* lib/base64.rb: Fix rdoc-formatting for padding argument.
+	  [fix GH-905][ci skip] Patch by @davydovanton
+
+Wed May 20 13:16:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (DEPRECATED_BY): deprecate warning with preferable
+	  alternative.
+
+	* configure.in (RUBY_FUNC_ATTRIBUTE): allow attribute arguments in
+	  the macro.
+
+Wed May 20 11:23:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_dump.c (rb_print_backtrace): return value of libexec's backtrace
+	  is size_t, so simply cast as int.
+
+Tue May 19 18:54:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* iseq.c (rb_iseq_compile_with_option): check source type, must be
+	  an IO or a String.  [ruby-core:69219] [Bug #11159]
+
+Tue May 19 17:15:03 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/benchmark.rb: Update Benchmark documentation and formatting.
+	  [fix GH-903][ci skip] Patch by @davydovanton
+
+Tue May 19 13:10:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (num_positive_p): should false on Bignum 0.
+	  http://twitter.com/rafaelfranca/status/600509783427391488
+	  [ruby-core:69173] [Feature #11151]
+
+Tue May 19 11:22:28 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/rfc2396_parser.rb (initialize_pattern):
+	  URI::Generic.build should accept port as a string.
+	  pattern[:PORT] is not defined for long.
+	  by Dave Slutzkin <daveslutzkin@fastmail.fm>
+	  https://github.com/ruby/ruby/pull/804 fix GH-804
+
+Tue May 19 11:18:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (rb_data_typed_object_alloc),
+	  (rb_data_object_alloc): add old names for source level backward
+	  compatibilities.
+
+	* gc.c (rb_data_object_alloc, rb_data_typed_object_alloc): add
+	  aliases for binary level backward compatibilities.
+
+Tue May 19 09:54:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (Data_Make_Struct0): needs function pointer
+	  casts to fix function overloading in C++.
+
+Tue May 19 09:43:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (Data_Make_Struct0, TypedData_Make_Struct0):
+	  explicit cast from void* is necessary as implicit cast is
+	  disallowed in C++.
+
+Mon May 18 15:31:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/intern.h (rb_f_notimplement): should not respond to
+	  not-implemented methods.  as the address inside a DLL and the
+	  imported address are different on Windows, use an exported
+	  variable to share the same address.
+
+Mon May 18 13:55:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/monitor.rb (mon_try_enter, mon_enter): should reset @mon_count
+	  just in case the previous owner thread dies without mon_exit.
+	  [fix GH-874] Patch by @chrisberkhout
+
+Sun May 17 17:21:29 2015  Eric Wong  <e@80x24.org>
+
+	* lib/webrick/utils.rb (set_non_blocking): use IO#nonblock=
+	* (set_close_on_exec): use IO#close_on_exec=
+	  [Feature #11136]
+
+Sun May 17 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (num_positive_p, num_negative_p): add methods
+	  Numeric#positive? and Numeric#negative?.
+	  [ruby-core:69173] [Feature #11151]
+
+	* numeric.c (flo_positive_p, flo_negative_p): specialized
+	  functions for Float.
+
+	* complex.c (Init_Complex): Complex do not have positive? and
+	  negative? methods
+
+Sun May 17 14:57:42 2015  Eric Wong  <e@80x24.org>
+
+	* lib/webrick/server.rb (accept_client): avoid redundant fcntl call
+	  [Feature #11137]
+
+Sun May 17 12:13:33 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (cloexec_accept): support nonblock flag and
+	  use SOCK_NONBLOCK if possible
+	* ext/socket/init.c (rsock_s_accept_nonblock):
+	  update cloexec_accept call
+	* ext/socket/init.c (accept_blocking): ditto for blocking
+	* test/socket/test_nonblock.rb: check nonblock? on accepted socket
+	  [Feature #11138]
+
+Sun May 17 03:58:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* load.c (loaded_feature_path): stop returning false negatives for
+	  filenames which are trailing substrings of file extensions.  For
+	  example, 'b', which a trailing substring of ".rb" should not return
+	  false. [Bug #11155][ruby-core:69206]
+
+	* test/ruby/test_autoload.rb: test for fix
+
+Sat May 16 21:41:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* string.c: added documentation for character sequence \' with String#sub
+	  [Bug #11132][ruby-core:69121][fix GH-900][ci skip] Patch by @shishir127
+
+Sat May 16 21:38:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enum.c: fix a sample code. Patch by @eagletmt
+	  [fix GH-901][ci skip]
+
+Sat May 16 21:17:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (rb_data_object_wrap, rb_data_typed_object_wrap): rename
+	  alloc as wrap.  these functions do not allocate data pointers
+	  but just wrap the given pointers.
+
+Sat May 16 19:59:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_accept): simplified.
+
+Fri May 15 18:28:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_assoc, rb_ary_rassoc): [DOC] the result when key
+	  was found is the existing element, not a new array.  reported by
+	  Giau Nguyen <giaunv AT nustechnology.com>.
+
+Fri May 15 08:24:28 2015  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
+
+	* lib/cgi/cookie.rb: Implement HttpOnly flag for cookies.
+	  [fix GH-887] Patch by @martinpovolny
+
+Fri May 15 06:54:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* variable.c: Change autoload to call `require` through Ruby rather
+	  than directly calling `rb_require_safe`.  This allows things like
+	  RubyGems to intercept file loading done though `autoload`.
+	  [Feature #11140]
+
+	* test/ruby/test_autoload.rb: Test for change.
+
+Wed Apr  8 19:18:02 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+
+	* enum.c (enum_grep_v, grep_i, grep_iter_i, Init_enum):
+	  Implement Enumerable#grep_v. [Feature #11049]
+
+Thu May 14 15:54:13 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/pathname/lib/pathname.rb: Remove condition of RUBY_VERSION <= 1.9.
+	  [Feature #11082]
+
+Wed May 13 17:10:37 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* enum.c (enum_to_a): revert r50457.
+	  it requires recursion check.
+	  then, it doesn't make performance improvement.
+	  [Bug #11130] [Feature #9118]
+
+Wed May 13 11:13:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parse_gvar): separate message for gvar without
+	  non-space characters from message for invalid identifiers.
+
+Tue May 12 22:18:27 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* enum.c (enum_to_a): fix incompatibility introduced in r50457.
+	  [Bug #11130]
+
+	* test/ruby/test_enum.rb: test for above.
+
+Tue May 12 17:08:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: remove unused declaration.
+
+Mon May 11 10:58:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: Update minitest-5.6.1 and power_assert-0.2.3.
+
+Mon May 11 00:20:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (Data_Make_Struct, TypedData_Make_Struct):
+	  allocate wrapper data object before allocating DATA_PTR to get
+	  rid of possible memory leak when the former failed.
+
+Sun May 10 21:32:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (gc_mark_children): call dmark function for non-NULL
+	  pointers only, so that DATA_PTR can be NULL safely now.
+
+Sun May 10 16:23:58 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* proc.c (proc_binding): fix segmentation fault on marking phase.
+	  envptr of newenvval should not be NULL.
+
+	  You can reproduce by
+	   make test-all TESTS='--gc-stress -n test_to_proc_binding ruby/test_method.rb'
+
+Sun May 10 12:41:18 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* ext/zlib/zlib.c (rb_gzreader_external_encoding):
+	  define GzipReader#external_encoding.
+	  [Bug #10900]
+
+	* test/zlib/test_zlib.rb: test for above.
+
+Sun May 10 11:57:48 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* ext/win32ole/win32ole_variant.c: fix typo "indicies".
+	  the patch is from davydovanton <antondavydov.o at gmail.com>.
+	  [fix GH-892]
+
+	* lib/rubygems/indexer.rb: ditto.
+
+	* test/rubygems/test_gem_indexer.rb: ditto.
+
+Sun May 10 11:44:37 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* string.c (rb_str_crypt): Raise ArgumentError when
+	  string passed to String#crypt contains null.
+	  the patch is from jrusnack <jrusnack at redhat.com>.
+	  [Bug #10988] [fix GH-853]
+
+	* test/ruby/test_string.rb: test for above.
+
+Sun May 10 11:23:03 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* enum.c (enum_to_a): Use size to set array capa when possible.
+	  the patch is from HonoreDB <aweiner at mdsol.com>.
+	  [fix GH-444]
+
+Sat May  9 06:48:36 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): GC guard
+	  [Bug #11123]
+
+Fri May  8 22:57:24 2015  takiy33  <takiy33@gmail.com>
+
+	* test/matrix/test_matrix.rb (test_determinant): refactor test on
+	  Matrix#determinant, by merging with test_det for an alias method
+	  det.  [Fix GH-897]
+
+Fri May  8 15:43:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (body_ext_mpart): should work even if body-fld-dsp
+	  is omitted.  [ruby-core:69093] [Bug #11128]
+
+Fri May  8 15:05:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/syntax/control_expressions.rdoc: fix a missing "a"
+	  [fix GH-888][ci skip] Patch by @riffraff
+
+Fri May  8 12:11:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_method_call_status): resolve refined method entry
+	  to check if undefined.  [ruby-core:69064] [Bug #11117]
+
+Thu May  7 22:22:59 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
+
+	* proc.c: [DOC] fix Binding#local_variable_set example. [ci skip]
+
+Thu May  7 11:32:57 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* Makefile.in (rbconfig.rb): add rule to make.
+
+Thu May  7 05:14:39 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (connect_nonblock): use IO#wait_writable
+	* lib/drb/drb.rb (DRB::DRbTCPSocket#alive?): use IO#wait_readable
+	* lib/webrick/httpserver.rb (run): ditto
+	* lib/resolv.rb (request): ditto for single socket case
+	  [ruby-core:68943] [Feature #11081]
+
+Wed May  6 22:49:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_method_call_status): undefined refined method is
+	  not callable unless using.  [ruby-core:69064] [Bug #11117]
+
+Sun May  3 22:40:06 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* ext/-test-/file/fs.c: need to include sys/statvfs.h
+	  to use statvfs().
+
+	* ext/-test-/file/extconf.rb: check the existence of
+	  sys/statvfs.h
+
+Sun May  3 21:59:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/yaml.rb: fix typo. [ci skip][fix GH-890]
+	  Patch by @miketheman
+
+Sun May  3 10:02:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* range.c (linear_object_p, range_include): test if covered for
+	  linear objects.  [ruby-core:69052] [Bug #11113]
+
+Fri May  1 13:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln.c (dln_load): check if a different libruby is loaded by the
+	  extension library, and then bail out to get rid of very
+	  frequently reported stale bug reports.
+
+Thu Apr 30 19:51:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): revert r46873 and r46875, not to
+	  allow to execute private readers by pretending op assign.
+	  [ruby-core:68984] [Bug #11096]
+
+Thu Apr 30 17:02:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* rational.c: Added documentation for rational literal.
+	  [Bug #11075][fix GH-885][ci skip] Patch by @shishir127
+
+Thu Apr 30 16:39:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/ipsocket.c (init_inetsock_internal): preserve errno
+	  before other library calls and use rb_syserr_fail.
+	  [ruby-core:68531] [Bug #10975]
+
+Thu Apr 30 16:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (lambda): push and reset cmdarg_stack in lambda body.
+	  [ruby-core:69017] [Bug #11107]
+
+Sun Apr 26 07:36:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enc/utf_8.c (code_to_mbclen, code_to_mbc): reject values larger
+	  than UTF-8 max codepoints.  [Feature #11094]
+
+Sat Apr 25 14:26:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_buf_cat): expand later so that the buffer can be
+	  larger for further use.  [Bug #11080] [Bug #11095]
+
+Fri Apr 24 23:48:45 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* misc/ruby-electric.el: Import version 2.2.3 from
+	  https://github.com/knu/ruby-electric.el.
+
+Fri Apr 24 10:40:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_{getc,putc}): removed.  they are needed for old
+	  ruby (before 1.8), but not now.
+
+Fri Apr 24 08:40:13 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c: remove bcc related code.
+
+	* include/ruby/win32.h: ditto.
+
+Fri Apr 24 08:21:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (rb_acrt_lowio_lock_fh): wrap _pioinfo(i)->lock.
+
+	* win32/win32.c (rb_acrt_lowio_unlock_fh): ditto.
+
+Fri Apr 24 06:47:19 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (_filbuf): msvc14 doesn't have it, use _fgetc_nolock.
+
+	* win32/win32.c (_flsbuf): msvc14 doesn't have it, use _fputc_nolock.
+
+	* win32/win32.c (vcruntime_file): define vcruntime_file on msvc14
+	  because it doesn't export FILE's internal structure.
+
+	* win32/win32.c (FILE_COUNT): added to abstract FILE->_cnt.
+
+	* win32/win32.c (FILE_READPTR): added to abstract FILE->_ptr.
+
+	* win32/win32.c (FILE_FILENO): added to abstract FILE->_file.
+
+	* win32/win32.c (init_stdhandle): use FILE_FILENO.
+
+	* win32/win32.c (rb_w32_getc): use FILE_COUNT and FILE_READPTR.
+
+	* win32/win32.c (rb_w32_putc): ditto.
+
+Fri Apr 24 06:37:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (dupfd): use _set_osfhnd.
+
+	* win32/win32.c (rb_w32_wopen): use _set_osflags.
+
+Thu Apr 24 05:38:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_roots): fox to work PRINT_ROOT_TICKS.
+
+Fri Apr 24 04:49:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/Makefile.sub: MSVC14 have struct timespec.
+
+	* win32/rtname.cmd: support vcruntime140.dll.
+
+	* time.c (localtime_with_gmtoff_zone): MSVC14 doesn't have tzname and
+	  daylight but have _tzname and _daylight.
+
+Thu Apr 23 11:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_obj_instance_eval, rb_obj_instance_exec): allow
+	  symbols to just instance_eval/exec, except for definition of
+	  singletons.  [ruby-core:68961] [Bug #11086]
+
+Thu Apr 23 10:01:36 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/delegate.rb: fix a typo.
+	  [fix GH-881][ci skip] Patch by @Zorbash
+
+Wed Apr 22 18:36:50 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (move, uid_move): support the MOVE command defined
+	  in RFC6851.  Patch by ojab ojab.
+	  [ruby-core:68960] [Feature #11077]
+
+Tue Apr 22 12:42:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_object.rb: add tests for Kernel#String and Kernel#Array.
+	  [fix GH-879][fix GH-880] Patch by @yui-knk
+
+Tue Apr 21 20:46:02 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_object.rb: renamed tests to explicitly class name.
+	  [fix GH-877] Patch by @yui-knk
+
+Tue Apr 21 05:31:00 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (connect_internal): avoid common exceptions
+	  from connect_nonblock. [ruby-core:68909]
+
+Mon Apr 20 23:46:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_wreadlink): follow the official format of
+	  REPARSE_DATA_BUFFER structure.
+
+Mon Apr 20 20:23:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* common.mk ($(arch)-fake.rb): revert r50354 because bsdmake seems not
+	  to handle such substitution.
+
+	* tool/expand-config.rb: convert path separators here.
+
+Mon Apr 20 16:52:20 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/fake.rb: don't fake libdir.  use libdirname instead.
+
+Mon Apr 20 16:49:52 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/mkmf.rb (MakeMakefile#configuration): DESTDIR should never affect
+	  top_srcdir and builddir.
+
+Mon Apr 20 16:18:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* common.mk ($(arch)-fake.rb): fix the path separator up for Windows.
+
+Mon Apr 20 15:02:47 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_wreadlink): fixed a bug that a junction misses
+	  its drive letter.
+
+Mon Apr 20 12:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/openssl/*: use license instead of licence.
+	  [fix GH-876][ci skip] Patch by @davydovanton
+	* lib/net/https.rb: ditto.
+
+Mon Apr 20 12:42:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* benchmark/bm_so_meteor_contest.rb: fix a typo.
+	  [fix GH-876][ci skip] Patch by @davydovanton
+	* tool/bisect.sh: ditto.
+	* tool/update-deps: ditto.
+
+Mon Apr 20 11:10:46 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/socket.c (sock_connect_nonblock): do not raise EISCONN
+	  [ruby-core:68926] [Feature #11072]
+	* test/socket/test_nonblock.rb: check non-EISCONN on 2nd connect
+
+Sun Apr 19 12:19:17 2015  Chad Brewbaker  <crb002@gmail.com>
+
+	* ext/{etc,openssl,tk}: Adding parens and comparisons around
+	  assignments to get rid of Wparentheses warnings.  [Fix GH-875]
+
+Sun Apr 19 10:42:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (get_env_cstr): environment variables must be ASCII
+	  compatible, as dummy encodings and wide char encodings are
+	  unsupported now.
+
+Sat Apr 18 15:18:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/parser/parser.rl: raise with messages in UTF-8
+	  encoding.  [ruby-core:67386] [Bug #10705]
+
+Fri Apr 17 11:58:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (STR_SET_EMBED): clear NOFREE flag at embedding as
+	  embedded strings no longer refer static strings.
+	  [ruby-core:68436] [Bug #10942]
+
+Thu Apr 16 05:15:50 2015  Eric Wong  <e@80x24.org>
+
+	* NEWS: note IO#wait_readable change in r50263
+
+Thu Apr 16 05:09:36 2015  Eric Wong  <e@80x24.org>
+
+	* lib/net/protocol.rb (rbuf_fill): use IO#wait_*able
+	* lib/net/http/generic_request.rb (wait_for_continue): ditto
+	  [ruby-core:68891] [Feature #11056]
+
+Wed Apr 15 18:43:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (rb_tracepoint_new): fix documentation.
+	  Commented by @emilsoman.
+
+Wed Apr 15 17:36:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (rb_tracepoint_new): Add documentation for
+	  rb_tracepoint_new C level API [ci skip]
+	  Provided by @emilsoman. [fix GH-869]
+
+Wed Apr 15 10:37:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/contributors.rdoc: fix a typo. Patch by @davydovanton
+	  [fix GH-872][ci skip]
+	* doc/syntax/methods.rdoc: ditto.
+	* ext/digest/sha2/sha2.c: ditto.
+	* ext/socket/ipsocket.c: ditto.
+	* ext/tk/*: ditto.
+
+Wed Apr 15 07:51:23 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* doc/extension.ja.rdoc: Added description of TypedData_XXX.
+	  Deprecated the old DATA_XXX.
+	  Reviewed by ko1 and nobu.
+	  Fixes [ruby-dev:40881] #3064
+
+	* doc/extension.rdoc: ditto.
+
+Wed Apr 15 07:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread_pthread.c (reserve_stack): keep sp safe zone to get rid
+	  of crash by -fstack-check.  [ruby-core:68740] [Bug #11030]
+
+Tue Apr 14 16:03:49 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/merger.rb (versionup): should also increment revision when
+	  changing teeny.
+
+Tue Apr 14 11:24:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/printf/printf.c (uint_to_str): renamed to get rid of
+	  conflict on cygwin.  [ruby-core:68877] [Bug #11065]
+
+Tue Apr 14 08:59:04 2015  Zachary Scott  <e@zzak.io>
+
+	* gc.c: [DOC] Improve documentation for ObjectSpace.count_objects
+	  with regards to `:TOTAL` key, with patch by @schneems [Fixes GH-871]
+	  https://github.com/ruby/ruby/pull/871 [Bug #11067]
+
+Mon Apr 13 22:44:07 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/lib/envutil.rb (File.mkfifo): Defined using mkfifo command.
+
+	* test/ruby/test_io.rb: Use File.mkfifo.
+
+	* test/ruby/test_file_exhaustive.rb: Ditto.
+
+	* test/ruby/test_process.rb: Ditto.
+
+Mon Apr 13 21:20:20 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb: stricter hostname verification
+	  following RFC 6125. with the patch provided by Tony Arcieri and
+	  Hiroshi Nakamura [ruby-core:61545] [Bug #9644]
+	* test/openssl/test_ssl.rb: add tests for above.
+
+Sun Apr 12 18:40:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/json.gemspec: bump version to 1.8.2.
+	* ext/json/lib/json/version.rb: ditto.
+
+Sun Apr 12 18:12:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/json.gemspec, lib/rdoc/rdoc.gemspec: added gemspec directly.
+	* defs/default_gems, tool/rbinstall.rb: removed default_gems definition.
+	  it make simple installation for default gems.
+
+Sun Apr 12 17:35:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/*, test/json/*: Reverted r50231.  Because it's not
+	  working with cross-compile environment.
+
+Sun Apr 12 15:34:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (arg): fix segfault by null caused by syntax error.
+	  [ruby-core:68851] [Bug #10957]
+
+Sun Apr 12 15:11:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems/test_case.rb: use explicitly exception class and reverted
+	  to require JSON library for rubygems tests with Ruby 2.2.0 or earlier.
+
+Sun Apr 12 15:10:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/wait/wait.c (io_wait_readable): simply returns that IO is
+	  readable without blocking, but no longer returns EOF.
+
+	* ext/io/wait/wait.c (io_ready_p, io_wait_readable): try polling
+	  first and check FIONREAD optionally to see if EOF.
+	  [ruby-core:36805] [Feature #4849]
+
+Sun Apr 12 14:53:23 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems/test_case.rb: fixed json load error for rubygems tests.
+
+Sun Apr 12 14:13:28 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* gc.c: Document require name for ObjectSpace methods.
+	  [ci skip][fix GH-860] Patch by @schneems
+
+Sun Apr 12 13:54:05 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_io.rb: New test that open(fifo) doesn't block other
+	  threads.
+
+Sun Apr 12 13:52:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/coverage/coverage.c: Remove extension from require argument.
+	  [ci skip][fix GH-870] Patch by @yui-knk
+
+Sun Apr 12 10:29:14 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock):
+	  support `exception: false'
+	* (get_no_exception): move function location
+	* ext/socket/socket.c (sock_connect_nonblock):
+	  support `exception: false'
+	* test/openssl/test_pair.rb (test_connect_accept_nonblock_no_exception):
+	  test `exception: false' on connect,
+	  rename from `test_accept_nonblock_no_exception'
+	* test/socket/test_nonblock.rb (test_connect_nonblock_no_exception):
+	  new test
+
+Sun Apr 12 09:57:16 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test a block device on GNU/Linux.
+
+Sun Apr 12 09:24:03 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test a file not owned.
+
+Sun Apr 12 09:05:44 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/fiddle/depend: Fix "Wrong mix of special targets" error with
+	  OpenBSD make.
+
+Sun Apr 12 09:04:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_file_exhaustive.rb: Windows doesn't support Unix file
+	  modes.
+
+Sun Apr 12 08:56:44 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/-test-/file/fs.c: OpenBSD needs sys/param.h before sys/mount.h.
+
+Sun Apr 12 08:52:01 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test suid, sgid and sticky file.
+
+Sat Apr 11 23:48:30 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* template/fake.rb.in: Don't assign baseruby, Because it's affect to
+	  Makefile of native gem like json on bundled gems.
+
+Sat Apr 11 23:33:22 2015  Tanaka Akira  <akr@fsij.org>
+
+	* file.c (rb_f_test): Consider nsec for "=", "<" and ">" for "test"
+	  method.
+
+Sat Apr 11 23:26:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/rbinstall.rb: support destdir for native extension gem.
+
+Sat Apr 11 21:02:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_file_exhaustive.rb
+	  (TestFileExhaustive#test_stat_socket_p): r50226 accidentally missed
+	  the guard for non-unix environments.
+
+Sat Apr 11 20:14:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/*, test/json/*, defs/default_gems: Gemify JSON library.
+	  [fix GH-867][Feature #11057]
+	* test/ruby/test_extlibs.rb: removed json gem from existence extensions.
+	* gems/bundled_gems: added json gem into bundled gem.
+	* lib/rdoc/rubygems_hook.rb: ignored no json environment.
+	* lib/rubygems/test_case.rb, test/rubygems/*: ditto.
+	* lib/rdoc/test_case.rb, test/rdoc/*: ditto.
+
+Sat Apr 11 15:56:58 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Create sample files lazily.
+
+Sat Apr 11 14:03:47 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test character device using
+	  /dev/null.
+
+Sat Apr 11 10:59:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (append_cppflags, append_cflags, append_ldflags):
+	  utility methods to append compiler options.
+
+Sat Apr 11 08:22:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rdoc/text.rb: removed duplicated code.
+
+Sat Apr 11 04:46:42 2015  Eric Wong  <e@80x24.org>
+
+	* lib/net/protocol.rb (rbuf_fill): avoid exception with read_nonblock
+	  [ruby-core:68787] [Feature #11044]
+
+Fri Apr 10 23:57:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (need_normalization): use getattrlist() if fgetattrlist()
+	  is unavailable, on OSX 10.5.  [ruby-core:68829] [Bug #11054]
+
+Fri Apr 10 22:29:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (try_compile): pass the given werror flag to try_do
+	  to check if stderr is empty.
+
+	* lib/mkmf.rb (try_cflags, try_ldflags): default werror to true.
+
+	* win32/Makefile.sub (WERRORFLAG): remove useless option.  VC does
+	  not make warnings of unknown command option an error.
+
+Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test socket.
+
+Fri Apr 10 19:38:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/objspace/test_objspace.rb: remove debug prints.
+
+Fri Apr 10 19:35:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c: add ObjectSpace.count_imemo_objects method
+	  to count imemo objects for each type.
+
+	* test/objspace/test_objspace.rb: add a test.
+
+	* NEWS: describe about this addition.
+
+Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test anonymous pipe.
+
+Fri Apr 10 19:31:56 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test named pipe.
+
+Fri Apr 10 19:10:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (setup_hash): unify common routine.
+
+Fri Apr 10 18:29:49 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (rb_execarg_parent_start1): Handle EINTR.
+
+Fri Apr 10 17:27:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_exec): check other events when RETURN is thrown.
+	  [Bug #10724]
+
+	* test/ruby/test_settracefunc.rb: add a test.
+
+Fri Apr 10 11:44:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/extconf.rb: check warnings.
+
+	* lib/mkmf.rb (try_cflags): pass options to try_compile.
+
+	* win32/Makefile.sub (WERRORFLAG): make unknown command line
+	  options an error.
+
+Fri Apr 10 08:00:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_process.rb: unfortunately, windows is not POSIX...
+	  cygwin has mkfifo command, but it does not affect system-wide.
+
+Fri Apr 10 02:18:53 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_process.rb: Use mkfifo command instead of mknod
+	  command to create a named pipe.  mkfifo command is defined by POSIX.
+
+Fri Apr 10 01:29:05 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c: Release GVL when opening a file in spawn() to avoid whole
+	  process blocking when opening a named pipe.
+	  (open_func): New function.
+	  (rb_execarg_parent_start1): Extracted from rb_execarg_parent_start and
+	  use rb_thread_call_without_gvl2 to release GVL when opening a file.
+	  (rb_execarg_parent_start): Invoke rb_execarg_parent_start1 via
+	  rb_protect and invoke rb_execarg_parent_end when error.
+
+Thu Apr  9 22:19:19 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (redirect_open): Removed.
+
+Thu Apr  9 21:38:20 2015  Tanaka Akira  <akr@fsij.org>
+
+	* internal.h (rb_execarg_parent_end): Declared.
+
+	* process.c: "spawn" opens files in the parent process.
+	  (check_exec_redirect): Add an placeholder for fd in parameters
+	  for fd_open.
+	  (check_exec_fds_1): Delete fd_open condition.
+	  (check_exec_fds): Don't call check_exec_fds_1 with fd_open.
+	  (rb_execarg_parent_start): Open files specified as "spawn" options
+	  and add "dup2" options.
+	  (rb_execarg_parent_end): New function to close opened fds.
+	  (run_exec_open): Removed.
+	  (rb_execarg_run_options): Don't call run_exec_open.
+	  (rb_spawn_internal): Call rb_execarg_parent_end.
+
+	* io.c (pipe_open): Call rb_execarg_parent_end.
+
+	* ext/pty/pty.c (establishShell): Call rb_execarg_parent_end.
+
+Thu Apr  9 20:52:31 2015  Tanaka Akira  <akr@fsij.org>
+
+	* internal.h (rb_execarg_parent_start): Renamed from rb_execarg_fixup.
+
+	* process.c: Follows the above change.
+
+	* io.c: Ditto.
+
+	* ext/pty/pty.c: Ditto.
+
+Thu Apr  9 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (fd_clear_cloexec): Extracted from run_exec_dup2.
+
+Thu Apr  9 09:26:47 2015  Eric Wong  <e@80x24.org>
+
+	* ccan/list/list.h: sync with ccan upstream
+	  [ccan commit c2fbfe5282ba264f3485586e7efa8a5967f2d386]
+
+Thu Apr  9 08:24:03 2015  Masahiro Tomita  <tommy@tmtm.org>
+
+	* ext/socket/raddrinfo.c (addrinfo_mload): fix memory leak of
+	  addrinfo.  [ruby-dev:48923] [Bug #11051]
+
+Wed Apr  8 17:45:02 2015  Shannon Skipper  <shannonskipper@gmail.com>
+
+	* version.c (Init_version): the version of the engine or
+	  interpreter.  [Fix GH-858]
+
+Wed Apr  8 16:15:30 2015  Kenta Murata  <mrkn@cookpad.com>
+
+	* bigdecimal: conform to ruby's license.  [ruby-core:68466] [Bug #10952]
+
+Wed Apr  8 14:57:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_wreadlink): should treat junctions like as
+	  symlinks.
+
+Wed Apr  8 14:03:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_symbol.rb: fix syntax error.
+
+Wed Apr  8 13:01:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_any_hash): Symbols are compared by the identities
+	  always.  [ruby-core:68767] [Bug #11035]
+
+Tue Apr  7 10:22:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* internal.h: fix typo. Patch by @sferik [fix GH-865]
+
+Mon Apr  6 22:52:35 2015  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c: Enumerable#chunk and Enumerable#slice_before no longer takes
+	  the initial_state argument.  [Feature #10958]
+
+Mon Apr  6 16:09:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_args.c: protect value stack from calling other methods
+	  during complex parameter setting process (splat, kw, and so on).
+	  [Bug #11027]
+
+	* vm_core.h: remove rb_thread_t::mark_stack_len.
+	  With this modification, we don't need to use th->mark_stack_len.
+
+	* test/ruby/test_keyword.rb: add a test.
+
+	* cont.c (cont_capture): catch up this fix.
+
+	* vm.c (rb_thread_mark): ditto.
+
+Mon Apr  6 11:26:42 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/downloader.rb (http_options): prevent content auto decoding
+	  because this is a downloader.
+
+Sun Apr  5 09:55:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* doc/contributing.rdoc: update Maintainers list.
+
+Sun Apr  5 09:11:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/rbinstall.rb: fix bin script permission of bundled gems.
+
+Sun Apr  5 08:46:08 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/rbinstall.rb: support --program-suffix option.
+
+Sat Apr  4 21:31:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rake/*: Gemify rake [fix GH-862][Feature #11025]
+	* test/rake/*: ditto.
+	* tool/rbinstall.rb: ditto.
+
+Sat Apr  4 11:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_setbyte): check the argument first not to
+	  discard shared string and code range unnecessarily until
+	  actually changing the contents.  pointed out by headius.
+
+Sat Apr  4 08:16:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (edit_path): use path which is absolute ftp url
+	  on using ftp_proxy.
+
+Fri Apr  3 11:43:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (vm_call0_cfunc): update invoker arguments.
+
+	* vm_insnhelper.c (vm_call_cfunc_latter): ditto.
+
+	* vm_insnhelper.c (rb_vm_call_cfunc_push_frame): ditto, and prefix
+	  with rb_.
+
+Thu Apr  2 16:26:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk, tool/mkconfig.rb: check the running ruby version in
+	  rbconfig.rb with the program version, as RUBY_VERSION has never
+	  been affected by --with-ruby-version option.
+	  [ruby-core:68639] [Bug #11002]
+
+	* configure.in (LIBRUBY_DLDFLAGS): compatibility_version must be
+	  valid version numbers, not an arbitrary string.
+
+Wed Apr  1 11:09:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (push_glob): remove indirect links of arguments for
+	  trampoline.
+
+Wed Apr  1 09:59:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/fileutils.rb (FileUtils#mv): show the exact target path in
+	  the error message instead of the destination parent directory
+	  name.  patched by Joao Britto <jabcalves AT gmail.com> at
+	  [ruby-core:68706].  [Bug #11021]
+
+Tue Mar 31 15:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/ChangeLog-0.06_to_0.52: added archived Changelog.
+	  [ruby-list:50105]
+	* doc/ChangeLog-0.50_to_0.60: ditto.
+	* doc/ChangeLog-0.60_to_1.1: ditto.
+
+Mon Mar 30 22:02:55 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* README.EXT.ja: add redirect [ruby-core:68631]
+
+Mon Mar 30 14:42:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (fileattr_to_unixmode, winnt_lstat): deal with
+	  symbolic link than directory, and set executable bits.
+
+Mon Mar 30 11:27:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (copy_stream_body): use the arguments without conversion if
+	  having read, readpartial, and write methods, than conversion by
+	  to_path method.  [ruby-core:68676] [Bug #11015]
+
+Sun Mar 29 21:08:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* gc.c (objspace_allrefs_destruct_i): fix a typo.
+	  [Bug #11013]
+
+Sun Mar 29 11:51:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_binding): replicate env from method object, and
+	  allocate the local variable area for the iseq local table.
+	  [ruby-core:68673] [Bug #11012]
+
+Sat Mar 28 09:19:41 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/date/extconf.rb: try_cflags("-std=iso9899:1999") [Bug #10906]
+	  ruby itself (including numeric.c) is built with strict compile
+	  options including -std=iso9899:1999, but ext/date is not.
+	  By the way -std=iso9899:1999 is not only a warning option but also
+	  changes behavior like MACRO definitions for example INFINITY.
+	  gcc on Solaris affect this.
+
+Fri Mar 27 16:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk: revert using BOOTSTRAPRUBY for enc.mk, as
+	  enc/depend uses CONFIG.  [ruby-core:68647] [Bug #11004]
+
+Thu Mar 26 10:05:13 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/test_observer.rb: add tests for Observable module.
+	  [fix GH-859] Patch by @brightbits
+
+Thu Mar 26 06:35:10 2015  Eric Wong  <e@80x24.org>
+
+	* README.EXT: add redirect [ruby-core:68631]
+
+Wed Mar 25 16:46:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/socket/extconf.rb: Solaris 11 has struct tcp_info.tcpi_ca_state,
+	  but it is a dummy.
+
+	* ext/socket/option.c: Solaris 11 doesn't have u_intN_t.
+
+	* ext/socket/option.c: Solaris 11 needs inspect_tcpi_msec.
+
+	* ext/socket/raddrinfo.c: Solaris 11 has AF_PACKET but doesn't have
+	  related macros.
+
+Wed Mar 25 17:03:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/file/fs.c (get_fsname): try magic number only if
+	  f_type is included.  [ruby-dev:48913] [Bug #11000]
+
+Wed Mar 25 11:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* benchmark/bm_hash_aref_flo.rb: make more realistic data.
+	  [ruby-core:68632] [[Bug #10999]
+
+Wed Mar 25 10:39:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .document: removed needless entries.
+
+Wed Mar 25 08:07:28 2015  Eric Wong  <e@80x24.org>
+
+	* doc/extension.rdoc: fix spelling of filename
+	* doc/extension.ja.rdoc: ditto.
+
+Tue Mar 25 06:55:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* complex.c (k_inexact_p, k_exact_zero_p): use k_exact_zero_p macro
+	  to remove k_inexact_p macro.
+
+	* complex.c (k_exact_one_p): remove unused macro k_exact_one_p.
+
+Tue Mar 24 22:23:33 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/extension.rdoc: move from toplevel document and added extname.
+	* doc/extension.ja.rdoc: ditto.
+
+Tue Mar 24 22:06:58 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/standard_library.rdoc: strip.
+
+Tue Mar 24 22:06:27 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/standard_library.rdoc: move Thread to Extensions.
+
+Tue Mar 24 21:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/contributing.rdoc: update Maintainers list.
+
+Tue Mar 24 19:10:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_writebarrier_generational): fix messages for rb_bug().
+	  Remove `rb_' prefix.
+
+	* gc.c (gc_writebarrier_incremental): ditto.
+
+Tue Mar 24 17:34:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* README.ja.md: should be chunibyo.
+
+Tue Mar 24 17:30:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/file/fs.c (get_fsname): return filesystem name by
+	  statfs/statvfs.  [ruby-core:68624] [Bug #10998]
+
+Tue Mar 24 16:46:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: now doesn't required spaces just after
+	  `!`.
+
+Mon Mar 23 23:18:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_close): don't raise on double close for consistent to
+	  IO#close.  [Feature #10950]
+
+Mon Mar 23 21:22:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_readlink): move from file.c for better buffer
+	  allocation and the result encoding.
+
+	* win32/win32.c (wreadlink, rb_w32_ureadlink): implement readlink().
+
+Mon Mar 23 14:40:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (winnt_stat): stat with following symbolic links.
+
+	* win32/win32.c (winnt_lstat): rename old winnt_stat, which does
+	  not follow symbolic links.
+
+Mon Mar 23 01:44:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (r_symreal): register symbol names as strings first so
+	  that r_symlink always returns valid names.
+	  [ruby-core:68587] [Bug #10991]
+
+	* marshal.c (r_ivar, r_object0): now need to intern symbol names.
+
+	* marshal.c (r_object0): compare with symbol names.
+
+Sun Mar 22 22:07:40 2015  Kouhei Sutou  <kou@cozmixng.org>
+
+	* doc/etc.rd.ja: Fix wrong coding for Emacs.
+
+Sun Mar 22 09:53:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/make-snapshot (package): add default CONFIGURE name to
+	  follow r50039.
+
+	* tool/make-snapshot (package): substitute configuration variables
+	  in Makefile.in instead of passing by the command line, and make
+	  temporary Makefile instead of a pipe.
+
+Sun Mar 22 08:09:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (ext/ripper/ripper.c, ext/rbconfig/sizeof/sizes.c):
+	  strip autogenerated dependencies which have invalid syntax in
+	  other than nmake.
+
+Sat Mar 21 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_set_winsize): use handle for
+	  writing.  GetConsoleScreenBufferInfo seems failing on a handle
+	  for reading.
+
+	* io.c: [DOC] update the example of IO#winsize to use $stdout
+	  instead of $stdin, which does not work on Windows.  a patch by
+	  Jan Lelis <mail AT janlelis.de> at [ruby-core:68574].
+	  [Bug #10986]
+
+Fri Mar 20 18:41:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (respond_to_missing_p): check if the receiver responds to
+	  the given method by respond_to_missing?.
+
+	* proc.c (mnew_missing): create Method object for method_missing.
+	  [ruby-core:68564] [Bug #10985]
+
+Fri Mar 20 17:43:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .travis.yml: enabled email notification.
+
+Fri Mar 20 17:39:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .travis.yml: removed Ruby 1.9.3 build on Travis CI
+
+Fri Mar 20 12:38:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): obj_info() can receive internal objects.
+
+	* gc.c (check_rvalue_consistency): obj_info() returns const char *.
+
+Fri Mar 20 12:14:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show class name and T_DATA type_name.
+
+Thu Mar 19 22:12:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_copy_wb_protected_attribute): `dest' can be WB unprotected.
+
+Thu Mar 19 21:25:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_copy_wb_protected_attribute): demote `dest' object.
+
+Thu Mar 19 16:18:00 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c, internal.h: export rb_gc_verify_internal_consistency().
+
+Thu Mar 19 16:15:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show allocation site if GC_DEBUG is not 0.
+
+Thu Mar 19 16:12:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_of): fix RGENGC_OLD_NEWOBJ_CHECK logics.
+	  * skip on incremental marking because not sure what happen :p
+	  * rb_gc_writebarrier_remember() is enough to mark children.
+
+Thu Mar 19 16:08:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_copy_wb_protected_attribute): need demote for old objects.
+
+Thu Mar 19 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (fill_random_bytes): release the handle in the static
+	  variable, not a local variable.
+
+Thu Mar 19 06:30:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* object.c (rb_obj_clone): do not touch age (FL_PROMOTED[01]) because
+	  rb_obj_alloc() can return old object in debug.
+
+Thu Mar 19 06:29:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/objspace/test_objspace.rb: flag name was changed
+	  (long_lived -> uncollectible).
+
+Thu Mar 19 05:30:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_mark): skip some marking if iseq->orig is available.
+
+	* iseq.c (rb_iseq_clone): need WB for iseq1->klass = iseq0->klass
+	  (done in MEMCPY).
+
+Thu Mar 19 04:55:53 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h (IMEMO_DEBUG): added.
+
+	* internal.h: remove unused FL_IMEMO_MARK_V[0-3].
+
+	* gc.c (rb_imemo_new_debug): added.
+
+	* gc.c (obj_info): show imemo type name.
+
+Thu Mar 19 04:52:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (RGENGC_OLD_NEWOBJ_CHECK): add check mechanism.
+
+	  If RGENGC_OLD_NEWOBJ_CHECK > 0, then create old objects
+	  (not new objects) periodically.
+
+	  Create one old objects per RGENGC_OLD_NEWOBJ_CHECK objects are
+	  created.
+
+Thu Mar 19 04:46:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* enum.c (enum_sort_by): add WBs.
+
+Thu Mar 19 03:37:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (check_rvalue_consistency): refactoring.
+	  * not inline on RGENGC_CHECK_MODE > 0.
+	  * check SPECIAL_CONST_P(obj) first.
+	  * add a check that remembered_bit is only TRUE when old (age == 3).
+
+	* gc.c (RVALUE_DEMOTE): should clear RVALUE_REMEMBERED bit.
+
+	  remembered_bit should be TRUE only for old (age == 3) objects.
+
+	  Actually there are no effect because demoted objects will be
+	  uncollectible WB unprotected objects (marked at the beginning of
+	  every minor GC).
+
+Thu Mar 19 02:52:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: rename terminologies.
+	  * long_lived -> uncollectible:
+	    because this bitmap does not mean "long lived objects in past",
+	    but means "prohibit collection these objects until next major GC".
+
+	    Uncollectible objects consist of two types objects, one is old
+	    objects (WB protected objects which age == 3) and another is
+	    uncollectible WB unprotected objects which are referred from old
+	    objects
+
+	  * remembered_wb_unprotected_objects ->
+	    uncollectible_wb_unprotected_objects:
+	    because uncollectible objects does not mean remembered objects.
+
+Wed Mar 18 17:21:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_writebarrier_generational): add an alternative write
+	  barrier (WB) implementation.
+	  When finding reference from [Old obj] to [New obj] by WB, current
+	  implementation marks [Old obj] as remembered old objects and marks
+	  children of [Old obj] at the beginning of marking.
+
+	  Added (but disabled) code changes current behaviour. This fix promote
+	  [New obj] to old and marks as a remembered old object. We can assume
+	  "new objects referred from old objects are maybe long-lived old
+	  objects".
+
+	  Disadvantage of added algorithm is we may promote unwilling
+	  short-lived objects. For example, consider many new objects push and
+	  pop to an old stack object. All of new objects (short-lived objects)
+	  promote to old objects unexpectedly.
+
+	  To compare these behaviour, I add this new code (but disabled it).
+
+Wed Mar 18 17:14:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (RVALUE_PROMOTE_RAW): rename to RVALUE_OLD_LONG_LIVED_SET()
+	  to make clear.
+
+Wed Mar 18 17:10:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (check_rvalue_consistency): do not need to check is_sweeping().
+
+Wed Mar 18 14:13:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm1_gc_wb_ary.rb: run GC to finish "marking" phase.
+
+	* benchmark/bm_vm1_gc_wb_obj.rb: ditto.
+
+	* benchmark/bm_vm1_gc_wb_ary_promoted.rb: add parameter
+	  full_mark: false to invoke only minor GC.
+
+	* benchmark/bm_vm1_gc_wb_obj_promoted.rb: ditto.
+
+Wed Mar 18 12:07:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* string.c: add a comment about RSTRING_FSTR.
+
+Wed Mar 18 12:01:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_any_hash): use same hash values with Float#hash so
+	  that -0.0 and +0.0 will be identical.
+	  [ruby-core:68541] [Bug #10979]
+
+Wed Mar 18 05:34:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* string.c: introduce STR_FAKESTR to show string is FAKESTR or not.
+
+	* string.c (STR_SET_SHARED): ignore FAKESTR because only Ruby objects
+	  can use write barrier.
+
+Tue Mar 17 18:59:16 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h: use rb_gc_writebrrier() simply.
+	  For incremental GC, we need to get a pointer to the objspace.
+	  We can share this pointer for the following WB process.
+	  And considering icache hit ratio, process in the GC.
+
+	* gc.c (rb_gc_writebarrier): added.
+
+	* gc.c (gc_writebarrier_generational, gc_writebarrier_incremental):
+	  make them NOINLINE because inlining them into rb_gc_writebarrier()
+	  makes a prologue code of rb_gc_writebarrier() longer (storing callee
+	  save registers).
+
+	  This patch improve the performance of WB on micro-benchmarks.
+
+	  name                   ruby 2.1   trunk   modified
+	  vm1_gc_wb_ary*            0.511   0.632      0.532
+	  vm1_gc_wb_ary_promoted*   0.578   0.701      0.674
+	  vm1_gc_wb_obj*            0.419   0.575      0.492
+	  vm1_gc_wb_obj_promoted*   0.537   0.664      0.618
+	                                                 (sec)
+
+Tue Mar 17 18:51:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm1_gc_wb_ary(_promoted).rb: separate fastpath and
+	  slowpath for WB.
+
+	  Before this change bm_vm1_gc_wb_ary.rb tried to check the performance
+	  for WB slowpath (making a reference from oldobj to newobj). However,
+	  from Ruby 2.2, 3 GCs are needed to promote new objects because
+	  only 3 age objects are promoted objects.
+
+	  To compare fastpath and slowpath, introduce new "promoted" version
+	  benchmark.
+
+	  bm_vm1_gc_wb_ary.rb is for fastpath and
+	  bm_vm1_gc_wb_ary_promoted.rb is for slowpath.
+
+	* benchmark/bm_vm1_gc_wb_obj(_promoted).rb: ditto.
+
+Tue Mar 17 17:23:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): distinguish not-yet-stated and DT_UNKNOWN
+	  by readdir, and traverse recursively for the former.  Linux
+	  readdir returns DT_UNKNOWN on some filesystems, e.g., smbfs,
+	  iso9660.
+
+Mon Mar 16 17:43:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/webrick/server.rb: Fix regression bug in WEBrick's
+	  :DoNotReverseLookup config option implementation.
+	  [fix GH-731] Patch by @vais
+	* test/webrick/test_do_not_reverse_lookup.rb: ditto.
+
+Sat Mar 14 20:05:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (math_gamma): optimization for passed small integer.
+
+Sat Mar 14 18:07:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* enum.c: [DOC] Fixes Enumerable#member? documentation
+	  [fix GH-756][ci skip] Patch by @shamanime
+
+Sat Mar 14 12:23:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): use d_type to reduce lstat system calls.
+
+	* win32/dir.h (struct direct): add d_type instead of d_isdir and
+	  d_isrep.  SYMLINKD is unreliable, since the target can be
+	  replaced after a link was created.
+
+	* win32/win32.c (readdir_internal): set d_type.
+
+Sat Mar 14 02:14:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (primary): empty parentheses at cmdarg can be null.
+	  [ruby-core:68477] [Bug #10957]
+
+Fri Mar 13 15:04:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_close): don't raise on double
+	  close for consistent to IO#close.
+
+Fri Mar 13 15:03:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_close_read, rb_io_close_write): don't raise after
+	  close same as IO#close.
+
+Fri Mar 13 12:29:07 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/readline/test_readline.rb: Restore environment variables:
+	  COLUMNS LINES
+
+Fri Mar 13 11:37:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/extconf.rb: needs --enable-shared when linked to
+	  libruby or fiddle.so.  since --with-static-linked-ext does no
+	  longer link extensions to ruby program with --enable-shared, the
+	  only combination needs --enable-static is --disable-shared and
+	  --with-static-linked-ext.  [ruby-dev:48901] [Bug #10960]
+
+Fri Mar 13 07:02:20 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept_nonblock): use rb_hash_lookup2
+	* ext/openssl/ossl_ssl.c (get_no_exception): new function
+	  (ossl_ssl_accept_nonblock): use get_no_exception
+	  (ossl_ssl_read_internal): ditto
+	  (ossl_ssl_write_nonblock): ditto
+	  [ruby-core:68511]
+
+Fri Mar 13 07:01:38 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c: predefine wait_*able symbols
+
+Thu Mar 12 22:59:53 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/lib/leakchecker.rb: Check environment variables.
+
+Thu Mar 12 05:54:27 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept_nonblock):
+	  support exception: false
+	  [ruby-core:66385] [Feature #10532]
+	* ext/socket/init.c (rsock_init_socket_init): define new symbols
+	* ext/socket/rubysocket.h: adjust prototype
+	* ext/socket/socket.c (sock_accept_nonblock): support exception: false
+	* ext/openssl/ossl_ssl.c (ossl_ssl_accept_nonblock): ditto
+	* ext/socket/socket.c (Init_socket): adjust accept_nonblock definition
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
+	* ext/socket/tcpserver.c (rsock_init_tcpserver): ditto
+	* ext/socket/unixserver.c (rsock_init_unixserver): ditto
+	* ext/socket/tcpserver.c (tcp_accept_nonblock): adjust
+	  rsock_s_accept_nonblock call
+	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
+	* ext/openssl/ossl_ssl.c (ossl_start_ssl): support no_exception
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): adjust ossl_start_ssl call
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock): ditto
+	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto
+	* test/socket/test_nonblock.rb (test_accept_nonblock): test for
+	  "exception :false"
+	* test/socket/test_tcp.rb (test_accept_nonblock): new test
+	* test/socket/test_unix.rb (test_accept_nonblock): ditto
+	* test/openssl/test_pair.rb (test_accept_nonblock_no_exception): ditto
+
+Thu Mar 12 10:53:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h, node.h: move a definition of `struct rb_global_entry'
+	  and related functions from node.h to internal.h.
+
+	* variable.c: remove unused include pragma.
+
+	* common.mk: remove unused dependency.
+
+Thu Mar 12 10:32:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* common.mk: remove unused dependency.
+
+Thu Mar 12 08:20:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* load.c: removed unused header file "node.h".
+
+	* method.h: ditto.
+
+	* symbol.c: ditto.
+
+Thu Mar 12 08:14:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: RGENGC_CHECK_MODE should be 0.
+
+Thu Mar 12 07:44:17 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: use T_IMEMO to represent `struct MEMO' value.
+	  memo->v1 and memo->v2 is WB protected values.
+	  So use MEMO_V1/V2_SET() macros to set these values.
+	  memo->u3 is ambiguous (sometimes a VALUE, sometimes an integer
+	  value), so use gc_mark_maybe() in gc.c to mark it.
+
+	  Rename NEW_MEMO() to MEMO_NEW().
+
+	  Move MEMO_FOR and NEW_MEMO_FOR macros from node.h.
+
+	  Export a rb_imemo_new() function for ext/ripper.
+
+	* node.h: remove NODE_MEMO.
+
+	* enum.c: catch up these change.
+
+	* enumerator.c: ditto.
+
+	* load.c: ditto.
+
+	* ext/objspace/objspace.c (count_nodes): ditto.
+
+	* gc.c (gc_mark_children): mark imemo_memo type.
+
+	* parse.y (new_args_gen): use T_IMEMO.
+	  (I'm not sure it is working correctly...)
+
+Wed Mar 11 22:36:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* eval.c (frame_called_id): it should use vm_ifunc type.
+
+	* eval.c (frame_func_id): ditto.
+
+Wed Mar 11 22:27:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* node.h: remove NODE_IFUNC, NEW_IFUNC.
+
+	* internal.h: use T_IMEMO for IFUNC.
+
+	  rename `struct IFUNC' to `struct vm_ifunc' and move the definition
+	  from vm_insnhelper.h. Add imemo_ifunc.
+
+	* gc.c (gc_mark_children): mark imemo_ifunc type T_IMEMO object.
+
+	* compile.c: catch up these changes.
+
+	* proc.c: ditto.
+
+	* vm_core.h (RUBY_VM_IFUNC_P): ditto.
+
+	* vm_eval.c (rb_iterate): ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* ext/objspace/objspace.c: ditto.
+
+Wed Mar 11 21:53:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h, eval_intern.h: move CREF accessors.
+
+	  List IMEMO supported types in internal.h.
+
+Wed Mar 11 21:45:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: use T_IMEMO to create THROW_DATA.
+
+	  Add THROW_DATA_NEW().
+
+	* internal.h: move definition of `struct THROW_DATA'
+	  from vm_insnhelper.h to internal.h.
+
+	  Rename `THROW_DATA' to `vm_throw_data'.
+
+	* eval_intern.h (THROW_DATA_P): move to internal.h.
+	  THROW_DATA is no longer T_NODE, so check T_IMEMO.
+
+	* gc.c (gc_mark_children): mark THROW_DATA.
+
+	* vm.c: catch up these changes.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Wed Mar 11 21:21:56 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: use T_IMEMO to create SVAR.
+
+	* internal.h, vm_insnhelper.h: move definition `struct SVAR'
+	  from vm_insnhelper.h to internal.h. And rename it to struct vm_svar.
+
+	  new imemo_type imemo_svar is added.
+
+	* gc.c (gc_mark_children): mark imemo_svar.
+
+	* node.c (rb_gc_mark_node): remove useless marking.
+
+Wed Mar 11 19:35:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h: introduce new type T_IMEMO.
+	  T_IMEMO is Internal Memo type, internal use only.
+	  T_IMEMO has same purpose of NODE_MEMO.
+
+	  To insert T_IMEMO, type numbers are modified a little.
+
+	* internal.h: define struct RIMemo. Each RIMemo objects
+	  has imemo_type. We can observe it by the imemo_type() function.
+
+	* gc.c (rb_imemo_new): added.
+
+	* node.h: remove NODE_CREF and NEW_CREF().
+
+	* node.c (rb_gc_mark_node): ditto.
+
+	* vm.c (vm_cref_new): use rb_imem_new().
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: use RIMemo objects for CREF.
+
+	* ext/objspace/objspace.c: support T_IMEMO.
+
+Wed Mar 11 17:03:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: fix memory leak by prepend method.
+
+	  It is easy to reproduce with such script:
+
+	    module M; def bar; end; end
+	    loop{
+	      Class.new do
+	        def foo; end
+	        prepend M
+	      end
+	    }
+
+	* gc.c (obj_free): free T_ICLASS::m_tbl if it is created by prepend.
+	  To recognize it, check RICLASS_IS_ORIGIN flag.
+
+	* gc.c (gc_mark_children): T_ICLASS objects only need to mark
+	  T_ICLASS::m_tbl if RICLASS_IS_ORIGIN is set.
+
+	* gc.c (obj_memsize_of): count T_ICLASS if RICLASS_IS_ORIGIN is set.
+
+	* internal.h (RCLASS_SET_ORIGIN): add to set RCLASS_SET_ORIGIN.
+
+	  TODO: The word `origin' seems not good name. We need to invent
+	  another good name.
+
+	* class.c: use RCLASS_SET_ORIGIN().
+
+	* class.c (class_alloc): zero clear rb_classext_t.
+
+Wed Mar 11 13:28:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check also procstat_getvmmap, which is not
+	  available on FreeBSD 9.  [ruby-core:68468] [Bug #10954]
+
+	* vm_dump.c (procstat_vm): use kinfo_getvmmap instead if
+	  procstat_getvmmap is not available.
+
+Wed Mar 11 09:15:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: define struct MEMO.
+
+	* enum.c: use MEMO.
+
+	* enumerator.c: ditto.
+
+	* load.c: ditto.
+
+	* node.h: return (struct MEMO *) pointer.
+
+Wed Mar 11 06:26:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h (THROW_DATA_STATE): return int, not VALUE.
+
+	* vm_insnhelper.h (THROW_DATA_STATE_SET): accept int value.
+
+Wed Mar 11 05:06:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_eval.c (rb_catch_protect): use THROW_DATA_VAL().
+
+Wed Mar 11 04:56:04 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: define struct IFUNC.
+
+	* vm_eval.c (rb_iterate): use it.
+
+	* vm_insnhelper.c (vm_yield_with_cfunc): ditto.
+
+Wed Mar 11 03:52:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* eval_intern.h (THROW_DATA_P): use RB_TYPE_P() instead of
+	  BUILTIN_TYPE().
+
+	* thread.c (thread_join): use THROW_DATA_P().
+
+Wed Mar 11 03:48:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: use RUBY_VM_IFUNC_P() to recognize IFUNC or not.
+
+	* vm.c: ditto.
+
+	* vm_dump.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_core.h (RUBY_VM_IFUNC_P): use RB_TYPE_P() instead of
+	  BUILTIN_TYPE().
+
+Wed Mar 11 03:21:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: define struct THROW_DATA to represent
+	  throwing data. Also define accessor functions.
+
+	* eval_intern.h: move related changes into vm_insnhelper.h.
+	  Now these MACROs (functions) are only used in vm*.c.
+
+	  There is only THROW_DATA_P(err) to check this data type or not.
+
+	* vm.c: catch up these changes.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Wed Mar 11 00:57:00 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/rubygems/test_gem_security_trust_dir.rb: The return value of
+	  File::Stat#mode is OS dependent. In AIX, 0200000 is set.
+
+Tue Mar 10 20:03:41 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/webrick/server.rb: Invoke setup_shutdown_pipe in start method
+	  instead of listen method.
+	  [ruby-core:68476] [Bug #10956] Reported by Shintaro Kojima.
+
+Tue Mar 10 17:27:27 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread.c (thread_join): Fixnum (except TAG_FATAL) and
+	  NODE should not be reached here.
+
+Mon Mar  9 21:42:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (ep_cref): rename to lep_cref() because it should be
+	  local ep.
+
+Mon Mar  9 16:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_close): don't raise on double
+	  close for consistent to IO#close.
+
+Mon Mar 09 06:44:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: define struct SVAR for SVAR.
+	  This data type is also same layout of NODE (NODE_IF).
+
+	* vm_insnhelper.c: catch up this change.
+
+Mon Mar  9 06:43:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (lep_svar_set): add WBs.
+
+Mon Mar  9 06:19:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: define rb_cref_t and change to use it.
+
+	  rb_cref_t is data type of CREF. Now, the body is still NODE.
+	  It is easy to understand what is CREF and what is pure NODE.
+
+Mon Mar  9 06:00:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h (COPY_CREF_OMOD): fix translation miss.
+
+Mon Mar  9 04:47:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: define CREF accessor macros.
+	  * CREF_CLASS(cref)
+	  * CREF_NEXT(cref)
+	  * CREF_VISI(cref)
+	  * CREF_VISI_SET(cref, v)
+	  * CREF_REFINEMENTS(cref)
+	  * CREF_PUSHED_BY_EVAL(cref)
+	  * CREF_PUSHED_BY_EVAL_SET(cref)
+	  * CREF_OMOD_SHARED(cref)
+	  * CREF_OMOD_SHARED_SET(cref)
+	  * CREF_OMOD_SHARED_UNSET(cref)
+
+	  This is process to change CREF data type from NODE.
+
+Sun Mar  8 22:50:57 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/zlib/zlib.c (rb_gzfile_close): Don't raise on double
+	  close for consistent to IO#close.
+
+Sun Mar  8 16:57:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): match patterns against legacy short names
+	  too, not only ordinary names.  [ruby-core:67954] [Bug #10819]
+
+	* win32/dir.h (struct direct): add short name members.
+
+	* win32/win32.c (opendir_internal, readdir_internal): ditto.
+
+Sat Mar  7 09:36:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* array.c: document that first element is kept when using
+	  Array#uniq and #uniq! [fix GH-845][ci skip]
+	  Patch by @riffraff
+
+Sat Mar  7 09:28:02 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* thread.c: Mutex#owned? is no longer experimental since 2.1.0
+	  [fix GH-839][ci skip] Patch by @takiy33
+
+Sat Mar  7 09:18:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/merger.rb: Added documentation to version method.
+	  [fix GH-847][ci skip] Patch by @magikid
+
+Fri Mar  6 22:50:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (rb_prepend_module): need a WB for klass -> origin.
+
+Fri Mar  6 20:18:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* fix namespace issue on singleton class expressions. [Bug #10943]
+
+	* vm_core.h, method.h: remove rb_iseq_t::cref_stack. CREF is stored
+	  to rb_method_definition_t::body.iseq_body.cref.
+
+	* vm_insnhelper.c: modify SVAR usage.
+	  When calling ISEQ type method, push CREF information onto method
+	  frame, SVAR located place. Before this fix, SVAR is simply nil.
+	  After this patch, CREF (or NULL == Qfalse for not iseq methods)
+	  is stored at the method invocation.
+
+	  When SVAR is required, then put NODE_IF onto SVAR location,
+	  and NDOE_IF::nd_reserved points CREF itself.
+
+	* vm.c (vm_cref_new, vm_cref_dump, vm_cref_new_toplevel): added.
+
+	* vm_insnhelper.c (vm_push_frame): accept CREF.
+
+	* method.h, vm_method.c (rb_add_method_iseq): added. This function
+	  accepts iseq and CREF.
+
+	* class.c (clone_method): use rb_add_method_iseq().
+
+	* gc.c (mark_method_entry): mark method_entry::body.iseq_body.cref.
+
+	* iseq.c: remove CREF related codes.
+
+	* insns.def (getinlinecache/setinlinecache): CREF should be cache key
+	  because a different CREF has a different namespace.
+
+	* node.c (rb_gc_mark_node): mark NODE_IF::nd_reserved for SVAR.
+
+	* proc.c: catch up changes.
+
+	* struct.c: ditto.
+
+	* insns.def: ditto.
+
+	* vm_args.c (raise_argument_error): ditto.
+
+	* vm_eval.c: ditto.
+
+	* test/ruby/test_class.rb: add a test.
+
+Fri Mar  6 18:19:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/webrick/test_filehandler.rb: on vboxsf (on VirtualBox
+	  on Windows 7), file name and permissions are strange (can access
+	  by short file name and so on).
+
+	  Simply skip on such tests on such FS. To detect strange FS, this
+	  patch use a part of code `File.executable?(__FILE__)`.
+	  Please correct them if there are better ways.
+
+Fri Mar  6 17:31:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_beginendblock.rb: do not change directory.
+
+	  Run system command in the directory mounted by vboxsf on Windows 7
+	  and get warning like that "warning: Insecure world writable dir...".
+
+Fri Mar  6 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (vm_call_super): search next super class from the
+	  original class, to get rid of infinite recursion with
+	  prepending.  a patch by Seiei Higa <hanachin AT gmail.com> at
+	  [ruby-core:68434].  [ruby-core:68093] [Bug #10847]
+
+Fri Mar  6 08:45:26 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Add Vector#round. Patch by Jordan Stephens.
+	  [Fixes GH-802]
+
+Fri Mar  6 07:33:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show node name too.
+
+Fri Mar  6 07:00:44 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: remove struct method_table_wrapper.
+	  struct method_table_wrapper was introduced to avoid duplicate marking
+	  for method tables.
+
+	  For example, `module M1; def foo; end; end` make one method table
+	  (mtbl) contains a method `foo`. M1 (T_MODULE) points mtbl.
+	  Classes C1 and C2 includes M1, then two T_ICLASS objects are created
+	  and they points mtbl too. In this case, three objects (one T_MODULE
+	  and two T_ICLASS objects) points same mtbl. On marking phase, these
+	  three objects mark same mtbl. To avoid such duplication, struct
+	  method_table_wrapper was introduced.
+
+	  However, created two T_ICLASS objects have same or shorter lifetime
+	  than M1 (T_MODULE) object. So that we only need to mark mtbl from M1,
+	  not from T_ICLASS objects. This patch tries marking only from M1.
+	  In other words, original module (M1) has responsibility to mark mtbl.
+	  Because of no duplicate marking, we don't need method_table_wrapper
+	  any more.
+
+	  Note that one `Module#prepend` call creates two T_ICLASS objects.
+	  One for referring to a prepending Module object, same as
+	  `Module#include`. We don't need to care this T_ICLASS.
+	  One for moving original mtbl from a prepending class. We need to
+	  mark such mtbl from this T_ICLASS object. To mark the mtbl,
+	  we need to use `RCLASS_ORIGIN(klass)` on marking from a prepended
+	  class `klass`.
+
+	* class.c: ditto.
+
+	* eval.c (rb_using_refinement): ditto.
+
+	* gc.c: ditto.
+
+	* include/ruby/ruby.h: define m_tbl directly. The definition of
+	  struct RClass should be moved to (srcdir)/internal.h.
+
+	* method.h: remove decl of rb_free_m_tbl_wrapper().
+
+	* object.c: use RCLASS_M_TBL() directly.
+
+Fri Mar  6 02:50:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* dir.c (replace_real_basename): need to check the return value of
+	  GLOB_REALLOC().
+
+Fri Mar  6 02:26:03 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* dir.c (replace_real_basename): shouldn't create Ruby object before
+	  the object system is loaded.
+	  [ruby-core:68430] [Bug #10941]
+
+Wed Mar  5 16:58:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* hash.c: [DOC] #delete method actually returns nil, if the key
+	  is not found. [fix GH-844][ci skip] Patch by @ivdma
+
+Wed Mar  5 12:22:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c: refactoring: remove unnecessary variable d0 to unify code
+	  appearance.
+
+Thu Mar  5 11:50:54 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_eval.c (eval_string_with_cref): A binding should keep
+	  refinements activation information and the refinements should be
+	  activated in subsequent eval calls with the binding.
+	  [ruby-core:67945] [Bug #10818]
+
+Thu Mar  5 11:16:55 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/ruby/test_refinement.rb: There is no need anymore to suppress
+	  warnings.
+
+Thu Mar  5 08:31:02 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* random.c (random_raw_seed): Avoid calling fill_random_bytes()
+	  if the requested size is 0. AIX returns -1 for 0-byte read from
+	  /dev/urandom, while other UNIX returns 0. With this change,
+	  Random.raw_seed(0) consistently returns "" in any UNIX.
+
+Wed Mar  4 12:43:32 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_math.rb (assert_float_and_int): Refactor test cases
+	  by introducing assert_float_and_int. [misc #10810]
+
+Wed Mar  4 11:52:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.c (Init_sym): make dsym_fstrs a hash compared by identity
+	  as the keys are unique fstrings, to get rid of running hash and
+	  compare methods and causing new object allocation during garbage
+	  collection phase.  [ruby-dev:48891] [Bug #10933]
+
+Wed Mar  4 10:16:57 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* enum.c: Fix typo in slice_after's exception message.
+	  [fix GH-842][ci skip] Patch by @jsyeo
+
+Wed Mar  4 10:15:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/syntax/methods.rdoc: add some missing spaces and
+	  fix a grammatical error in method docs.
+	  [fix GH-843][ci skip] Patch by @nikolas
+
+Wed Mar  4 02:13:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (backport_command_string): pick up only
+	  when the revision exists in trunk.
+
+Wed Mar  4 00:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_io_blocking_region): assigned variables
+	  inside EXEC_TAG() should be volatile.
+
+	* thread.c (rb_thread_s_handle_interrupt): ditto.
+
+	* thread.c (exec_recursive): ditto.
+
+Wed Mar  4 00:29:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: now can specify shorten form of commands.
+
+Tue Mar  3 23:41:42 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (Readline.readline): drop untreated control
+	  characters.
+
+Tue Mar  3 22:25:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/lib/envutil.rb (EnvUtil.invoke_ruby): need to rescue because
+	  Signal.signame may raise exception.
+
+Tue Mar  3 16:57:39 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: use 'b' instead of 's' for showing
+	  Backport options for merger.rb.
+
+Tue Mar  3 16:55:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: show selected ticket number at prompt.
+
+Tue Mar  3 14:47:30 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (num2dbl_with_to_f): direct casting from Rational to double.
+	  [Feature #10909]
+
+	* test/ruby/test_math.rb: add tests for the above change.
+
+Tue Mar  3 07:52:20 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/ruby/test_symbol.rb: avoid a false positive in AIX.
+
+Tue Mar  3 00:59:39 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: set PRELOADENV in Solaris to avoid "wrong ELF class"
+	  error. [Bug #10926] [ruby-dev:48888]
+	* configure.in: set LIBPATHENV for 32-bit compile in Solaris
+	  in addition to 64-bit.
+
+Mon Mar  2 15:36:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: do not check _setjmp unless _longjmp is available,
+	  so that configure results will not be changed by cache.
+
+Mon Mar  2 14:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
+	  cached variable only if the target type is not available.
+
+Mon Mar  2 13:04:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* signal.c (sig_signame): return nil if the argument is a valid
+	  signal number.
+
+Mon Mar  2 12:05:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/net/ftp/test_ftp.rb (create_ftp_server): set SO_OOBINLINE
+	  for receiving OOB data which is sent with MSG_OOB flag in
+	  portable way. [Bug #10915] [ruby-dev:48885]
+	* test/net/ftp/test_ftp.rb (test_abort, test_status): use gets
+	  for receiving OOB data in portable way.
+
+Mon Mar  2 11:43:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
+	  cached variable.
+
+Mon Mar  2 06:01:41 2015  Eric Wong  <e@80x24.org>
+
+	* ext/io/wait/wait.c (io_nread): wrap return value with INT2FIX
+	  Thanks to Yura Sokolov <funny.falcon@gmail.com>
+	  [ruby-core:68369] [Bug#10923]
+	* test/io/wait/test_io_wait.rb (test_nread_buffered):
+	  fix broken test
+
+Sun Mar  1 20:21:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_REPLACE_TYPE): restore convertible type from
+	  cached variable, so that configured results will be stable.
+
+Sun Mar  1 18:10:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_broken_memmem): check before adding the
+	  result HAVE_MEMMEM macro to confdefs.h, so that configured
+	  results will be stable.
+
+Sun Mar  1 11:17:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (id2ref): prohibit from accessing internal objects.
+	  [ruby-core:68348] [Bug #10918]
+
+Sun Mar  1 09:06:11 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/time.rb (strptime): Support %s.%N.
+	  [ruby-core:68301] [Bug #10904] Patch by Sadayuki Furuhashi.
+
+Sat Feb 28 17:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c (enum_each_slice, enum_each_cons): limit elements size by
+	  the enumerator size.  suggested by Hans Mackowiak <hanmac AT
+	  gmx.de> at [ruby-core:68335]
+
+Sat Feb 28 15:44:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_dump.c (rb_vm_bugreport): get rid of making new strings
+	  inside signal context.
+
+	* variable.c (rb_tmp_class_path): defer making temporary class
+	  path string.
+
+	* variable.c (rb_search_class_path): search class path or return
+	  Qnil or Qfalse if unnamed, not creating a temporary path.
+
+Sat Feb 28 15:02:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_tmp_class_path): preserve name encoding of an
+	  anonymous instance of module/class subclass.
+
+Sat Feb 28 08:24:30 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* ext/pty/pty.c: AIX supports autopush.
+	  Patch by Perry Smith [ruby-core:58539] [Bug #9144]
+
+Fri Feb 27 22:00:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems: Update to RubyGems 2.4.6 and HEAD(800f2e6).
+	  Fixed #1159, #1171, #1173 on rubygems/rubygems
+	* test/rubygems: ditto.
+
+Fri Feb 27 20:55:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rake: Update to rake (9237e74), typo fix and remove needless
+	  private syntax.
+	* test/rake: ditto.
+
+Fri Feb 27 17:06:44 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define vm_svar_index.
+
+	* vm_insnhelper.c, vm.c, compile.c: use vm_svar_index names.
+
+	* iseq.h: remove DEFAULT_SPECIAL_VAR_COUNT.
+	  use VM_SVAR_FLIPFLOP_START instead.
+
+Fri Feb 27 13:57:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (setup_narg): wipe away expanded part of buffer to get rid
+	  of revealing uncleaned data.  reported by Dongkwan Kim <dkay AT
+	  kaist.ac.kr>.
+
+Wed Feb 25 22:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* spec/default.mspec: use default configuration file name.
+	  https://github.com/ruby/rubyspec/commit/cc69f337b06362e5607ffa3e3ad40ef7494960cf
+
+Wed Feb 25 22:21:56 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* spec/default.mspec: remove specific version number.
+	  https://github.com/ruby/rubyspec/commit/7a909e925c1baa9c700bd44af9241aef6e596714
+
+Wed Feb 25 22:04:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/win32/Win32API.rb (initialize): accept both a string and an array
+	  for the arguments of the imported function.
+	  reported by Aaron Stone [ruby-core:68208] [Bug #10876] [Fixes GH-835]
+
+Wed Feb 25 18:12:11 2015  Eric Wong  <e@80x24.org>
+
+	* signal.c (sighandler): preserve errno
+	  Patch by Steven Stewart-Gallus <sstewartgallus00@mylangara.bc.ca>
+	  [ruby-core:68172] [Bug #10866]
+
+Wed Feb 25 15:59:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (push_pattern, push_glob): make globbed file names same
+	  encoding to the given pattern.
+
+Wed Feb 25 15:27:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/merger.rb: support 2.1+ versioning scheme.
+
+Tue Feb 25 08:49:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* lib/cmath.rb (log): raise ArgumentError when more than 2 arguments
+	  are passed. [ruby-core:66143] [Bug #10487]
+
+Tue Feb 25 02:15:17 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_math.rb: Use assert_infinity instead of assert_equal(1.0/0, ...).
+
+	* test/ruby/test_math.rb: Add tests for overriding Integer#to_f.
+	  [ruby-core:67919] [Misc #10809]
+
+Tue Feb 24 22:58:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* complex.c (nucomp_mul): calculate as rotation in complex plane
+	  if matrix calculation resulted in NaN.
+
+Tue Feb 24 21:45:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_math.rb(test_cbrt): Add an assertion for Math.cbrt(1.0/0)
+	  and move #test_cbrt to more proper place.
+
+Tue Feb 24 19:09:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (lep_svar_place, lep_svar_get): do not create
+	  additional T_NODE object (svars holder) when only getting
+	  svars.
+
+Tue Feb 24 11:49:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* time.c (time_zone_name): should be US-ASCII only if all 7-bits,
+	  otherwise locale encoding.  [ruby-core:68230] [Bug #10887]
+
+Tue Feb 24 09:47:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (chompped_length): enable smart chomp for all non-dummy
+	  encoding strings, not only default_rs.
+	  [ruby-core:68258] [Bug #10893]
+
+Mon Feb 23 23:19:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/vcs.rb (IO.popen): support :chdir option.
+
+	* tool/vcs.rb (VCS::GIT.get_revisions): use :chdir option instead
+	  of -C option which is not supported by older git.
+	  [ruby-dev:48880] [Bug #10890]
+
+Mon Feb 23 15:26:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_split_m): raise ArgumentError at broken string
+	  not RegexpError, as Regexp is not involved in.
+	  [ruby-core:68229] [Bug #10886]
+
+Mon Feb 23 07:25:29 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* time.c: Zone encoding should be US-ASCII if all 7-bits. Fix r46907.
+
+	* test/ruby/test_time.rb, test/ruby/test_time_tz.rb: Update tests.
+
+Sun Feb 22 18:33:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* common.mk: use ruby organization for rubyspec.
+
+Sun Feb 22 15:56:06 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* vm_insnhelper.c (rb_vm_rewrite_cref_stack): copy nd_refinements
+	  of original crefs. It fixes segmentation fault when calling
+	  refined method in duplicate module. [ruby-dev:48878] [Bug #10885]
+
+	* vm_core.h, class.c: change accordingly.
+
+	* test/ruby/test_refinement.rb: add a test for above.
+
+Sun Feb 22 10:43:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_objspace_call_finalizer): control GC execution during
+	  force firnalizations at the end of interpreter process.
+	  [Bug #10768]
+
+	  1) Prohibit incremental GC while running Ruby-level finalizers
+	     to avoid any danger.
+	  2) Prohibit GC while invoking T_DATA/T_FILE data structure
+	     because these operations break object relations consistency.
+
+	  This patch can introduce another memory consuming issue because
+	  Ruby-level finalizers can run after (2), GC is disabled.
+	  However, basically object consistency was broken at (2) as I
+	  described above. So that running Ruby-level finalizers contains
+	  danger originally. Because of this point, I need to suggest to
+	  remove these 3 lines (invoking remaining finalizers). And add a
+	  rule to add that finalizers should not add new finalizers, or
+	  say there is no guarantee to invoke finalizers that added by
+	  another finalizer.
+
+Sun Feb 22 04:07:05 2015  Zachary Scott  <e@zzak.io>
+
+	* ext/openssl/ossl_asn1.c: [DOC] RDoc formatting fixes for
+	  ASN1::ObjectId with patch from @vbatts [Fixes GH-834]
+
+	* ext/openssl/ossl_bn.c: ditto.
+
+Sat Feb 21 19:51:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (match_aref): RMatch::regexp is Qnil after matching by a
+	  string since r45451.  [ruby-core:68209] [Bug #10877]
+
+Sat Feb 21 16:18:42 2015  Stefan Schuler  <mail@stefanschuessler.de>
+
+	* compar.c (Init_Comparable): [DOC] Replace camelcase variable name.
+	  [Fix GH-833]
+
+Fri Feb 20 17:27:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_identical_p): fix handle leak, ensure to close
+	  the handle of the first argument.
+
+Fri Feb 20 17:19:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (different_device_p): compare by volume serial
+	  numbers, not by path names.  [ruby-core:68162] [Bug #10865]
+
+Thu Feb 19 01:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_file_expand_path_internal): neither the drive
+	  of base directory nor the current drive are involved in the
+	  result if different than the drive of path.
+	  [ruby-core:68130] [Bug #10858]
+
+Wed Feb 18 10:48:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (wrename): return EXDEV if moving a directory to
+	  another drive, since MoveFileExW does not set proper error code.
+	  [ruby-core:68162] [Bug #10865]
+
+Wed Feb 18 03:13:52 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bump psych version.
+	* ext/psych/psych.gemspec: ditto
+	* ext/psych/yaml/scanner.c: add latest libyaml change.
+	* test/psych/helper.rb: support newer minitest
+	* test/psych/test_to_yaml_properties.rb: ditto
+
+Tue Feb 17 11:47:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/resolv.rb (Resolv::DNS::Resource#==, #hash): elements
+	  returned by Kernel#instance_variables are Symbols now.
+	  [ruby-core:68128] [Bug #10857]
+
+Tue Feb 17 10:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/syntax/calling_methods.rdoc: Fix documentation for "calling_methods"
+	  Patch by @sos4nt [fix GH-830][ci skip]
+
+Tue Feb 17 10:53:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_file_expand_path_internal): do not make invalid
+	  (or ADS) path if the path has a drive letter, the result also
+	  should have be under it.  [ruby-core:68130] [Bug #10858]
+
+Tue Feb 17 10:47:20 2015  Iain Beeston  <iain.beeston@gmail.com>
+
+	* hash.c: Added docs to explain that #include? and #member? do not
+	  check member equality
+	* lib/set.rb: ditto
+
+Mon Feb 16 20:58:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (compile_massign): optimization for special case,
+	  assignments by aset or attrset.
+	  http://kokizzu.blogspot.jp/2015/02/c-java-hhvm-ruby-nodejsrhinojscspidermo.html
+	  http://www.atdot.net/~ko1/diary/201502.html#d16
+
+Sun Feb 15 10:41:23 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
+
+	* doc/standard_library.rdoc: [DOC] delete removed libraries.
+	  [misc #10843] [ci skip]
+
+Sat Feb 14 12:20:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (rand_random_number): add a method to return a random
+	  number like SecureRandom to Random::Formatter.
+
+	* lib/securerandom.rb (random_bytes): move to Random::Formatter,
+	  the base method of the module.
+
+Sat Feb 14 12:01:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (random_raw_seed): extract platform dependent random
+	  seed initialization function as a new method Random.raw_seed.
+
+	* lib/securerandom.rb (SecureRandom): use Random.raw_seed.
+
+Sat Feb 14 00:49:37 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/coverage/coverage.c: Add Coverage.peek_result.  Allows you to
+	  capture coverage information without stopping the coverage tool.
+	  [ruby-core:67940] [Feature #10816]
+
+	* test/coverage/test_coverage.rb: test for change.
+
+Fri Feb 13 21:52:05 2015  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* string.c (str_discard): does not free for STR_NOFREE string.
+	  [Bug #10853][ruby-core:68110]
+
+	* bootstraptest/test_string.rb: test for above.
+
+Fri Feb 13 21:16:00 2015  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* lib/base64.rb: make urlsafe mode user-friendly.
+
+	* lib/base64.rb (Base64.urlsafe_encode64): a new option "padding" to
+	  suppress the padding character ("=").
+
+	* lib/base64.rb (Base64.urlsafe_decode64): now it accepts not only
+	  correctly-padded input but also unpadded input.
+	  [Feature #10740][ruby-core:67570]
+
+	* test/base64/test_base64.rb: Test for above
+
+Fri Feb 13 14:19:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json: merge upstream from flori/json
+	  change usage of TypedData. [Feature #10739][ruby-core:67564]
+
+Thu Feb 12 18:34:01 2015  multisnow  <infinity.blick.winkel@gmail.com>
+
+	* ext/openssl/extconf.rb: check RAND_edg to support libressl.
+
+	* ext/openssl/ossl_rand.c (ossl_rand_egd): define only if RAND_edg
+	  is available.  [Fix GH-829]
+
+Thu Feb 12 10:46:14 2015  Eric Hodel  <drbrain@segment7.net>
+
+	* proc.c (proc_call):  Improve Proc#call documentation.  Patch by
+	  Hsing-Hui Hsu.  [fix GH-761]
+
+Thu Feb 12 04:33:02 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* compar.c (cmp_equal): no more error hiding for Comparable#==.
+	  It now behaves as other Comparable methods. See #7688.
+
+	* test/ruby/test_comparable.rb: update related test.
+
+Thu Feb 12 03:28:05 2015  Eric Wong  <e@80x24.org>
+
+	* lib/set.rb (initialize): internal hash defaults to false
+
+	* lib/set.rb (include?): use Hash#[] for optimized dispatch.
+	  Patch by Ismael Abreu <ismaelga@gmail.com>
+	  [ruby-core:67664] [Misc #10754]
+
+Wed Feb 11 11:09:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/digest/digest_conf.rb (digest_conf): check for CommonDigest.
+
+	* ext/digest/*/*cc.h: for Apple CommonCrypto/CommonDigest.h.
+
+	* ext/digest/digest.h (DEFINE_FINISH_FUNC_FROM_FINAL): macro for
+	  finish functions, by inverting arguments order.
+
+	* ext/digest/digest_conf.rb (digest_conf): extract common
+	  configurations.
+
+Wed Feb 11 11:01:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/generator/generator.c (generate_json): get rid of
+	  unnecessary recursive calls which can cause infinite recursion.
+	  T_STRING may not have rb_cString.
+
+Wed Feb 11 07:53:35 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_word.rb: use skip method to skip test.
+
+Tue Feb 10 11:38:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_call_method): stop method search when a method
+	  is not found in a refinement, to support undef in refinements.
+	  [ruby-core:66741] [Bug #10578]
+
+Tue Feb 10 11:19:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (chdir, delete, gettextfile, mdtm, mkdir, nlst,
+	  putbinaryfile, puttextfile, rename, rmdir, size): support
+	  Pathname. Patch by Joe Rafaniello. [fix GH-828]
+
+Mon Feb  9 16:36:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/make-snapshot (package): get rid of loading unbundled and
+	  unexpected libraries.  [ruby-core:67977] [Bug #10822]
+
+Sun Feb  8 20:09:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/net/http/header.rb: pass header names as symbols.
+	  Patch by @DamirSvrtan [fix GH-805]
+	* test/net/http/test_httpheader.rb: added test.
+
+Sun Feb  8 13:04:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/getaddrinfo.c (get_addr): reject too long hostname to
+	  get rid of GHOST vulnerability on very old platforms.
+
+	* ext/socket/raddrinfo.c (make_hostent_internal): ditto, paranoic
+	  check for the canonical name.
+
+Sun Feb  8 12:48:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32/lib/win32/registry.rb (Win32::Registry::API): use wide
+	  versions of RegDeleteValue and RegDeleteKey.
+	  [ruby-core:67958] [Bug #10820]
+
+Sat Feb  7 22:13:08 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_win32ole_record.rb: remove test using .NET
+	  Framework 3.5 because it is not included in Windows 8/8.1.
+
+Sat Feb  7 19:25:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (has_magic): always get long path name on Windows even if
+	  no tilde is there.  [ruby-core:68011] [Bug #10819]
+
+	* dir.c (replace_real_basename): FindFirstFile ignore redirection
+	  character, check if exists before call it.  cf. [Bug #8597]
+
+Sat Feb  7 13:30:11 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_win32ole_record.rb
+	  (test_ole_instance_variable_get): correct VT_RECORD type and
+	  instance variables.
+
+Fri Feb  6 17:47:05 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: register nodes when
+	  dumping objects with custom coders. [ruby-core:66215] [Bug #10496]
+
+	* test/psych/test_coder.rb: test for fix
+
+Fri Feb  6 16:58:31 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix support for regular
+	  expressions with newlines. tenderlove/psych#222
+
+	* test/psych/test_yaml.rb: test for change.
+
+Fri Feb  6 10:31:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_call_info_kw_arg_struct): make keywords a symbols
+	  list to get rid of inadvertent creation by variable keyword
+	  arguments.  [ruby-core:68031] [Bug #10831]
+
+Thu Feb  5 22:42:34 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems:  Update to RubyGems HEAD(5c3b6f3).
+	  Fixed #1156, #1142, #1115, #1142, #1139 on rubygems/rubygems
+	* test/rubygems:  ditto.
+
+Thu Feb  5 13:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (send_internal), vm_insnhelper.c (vm_call_opt_send):
+	  convert String method name into a Symbol, as method_missing
+	  method expects its first argument to be a Symbol.  [Bug #10828]
+
+	* vm_insnhelper.c (ci_missing_reason): return the reason of method
+	  missing in call info.
+
+	* vm_insnhelper.c (vm_call_opt_send): re-apply r49500 with the
+	  proper missing reason.  [Bug #10828]
+
+Thu Feb  5 10:31:46 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* class.c (rb_obj_singleton_methods): should use RTEST() to convert
+	  VALUE to int.
+
+Thu Feb  5 03:59:33 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* vm_insnhelper.c: Fix symbol leak with +send+ [Bug #10828]
+
+Wed Feb  4 20:26:54 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (Init_win32ole): should not use atexit to
+	  free allocated hash table to avoid error on Cygwin.
+
+Wed Feb  4 15:34:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* class.c (method_entry_i, class_instance_method_list,
+	  rb_obj_singleton_methods): should not include methods of
+	  superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
+
+Wed Feb  4 16:32:40 2015  Matt Hoyle  <matt@deployable.co>
+
+	* ext/bigdecimal/bigdecimal.c (VpSetPTR): fix a typo, 'expoennt'
+	  to 'exponent'.  [ruby-core:67980] [Bug #10823] [Fix GH-825]
+
+Wed Feb  4 15:55:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/sdbm/_sdbm.c: include ruby/ruby.h for PRIdPTRDIFF when a
+	  macro `DEBUG` is defined.  based on the patch by Owen Rodley in
+	  [ruby-core:67987]. [Bug #10825]
+
+Wed Feb  4 11:12:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (probes.stamp): rebuild dtrace dependent objects
+	  only when `dtrace -G` modifies its input files.
+
+Tue Feb  3 19:27:16 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* common.mk (ruby-glommed.o): dependency on $(OBJ) should be written
+	  in common.mk (in which OBJ is defined) because of Makefile include
+	  and parse order. This partly reverts r49419.
+	  [ruby-dev:48849] [Bug #10808]
+
+	* Makefile.in (ruby-glommed.o): ditto.
+
+	* Makefile.in (ruby-glommed.o): remove excess $(DTRACE_OBJ) because
+	  it is included in $(OBJS) since r49451.
+
+	* Makefile.in (probes.o): should depend on $(DTRACE_DEPENDENT_OBJS)
+
+Tue Feb  3 17:15:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (try_cppflags, try_cflags, try_ldflags): get rid of
+	  interference by modifying global variables in have_devel? method.
+	  [ruby-core:67962] [Bug #10821]
+
+Tue Feb  3 15:23:58 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_method.c (remove_method): When remove refined
+	  method, raise a NameError if the method is not
+	  defined in refined class.
+
+	  But if the method is defined in refined class,
+	  it should keep refined method and remove original
+	  method.
+
+	  Patch by Seiei Higa. [ruby-core:67722] [Bug #10765]
+
+Tue Feb  3 14:04:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): obtain real name with FindFirstFile API
+	  instead of matching all entries, on Windows.
+	  [ruby-core:67954] [Bug #10819]
+
+Tue Feb  3 12:26:35 2015  Katsuhiko Nishimra  <ktns.87@gmail.com>
+
+	* lib/mkmf.rb (configuration): set the default cxxflags, which is
+	  referred from the default CXXFLAGS, for extension libraries.
+	  [Fix GH-823]
+
+Tue Feb  3 05:52:00 2015  Aman Gupta <ruby@tmm1.net>
+
+	* gc.c (rb_objspace_free): cause rb_bug if lazy sweep is in progress
+	  during rb_objspace_free. Adds extra protection for r46340.
+	  Patch by Vicent Marti. [Bug #10768] [ruby-core:67734]
+	* gc.c (rb_objspace_call_finalizer): Ensure GC is completed after
+	  finalizers have run. We already call gc_rest() before invoking
+	  finalizers, but finalizer can allocate new objects and start new GC
+	  cycle, so we call gc_rest() again after finalizers are complete.
+
+Mon Feb  2 10:51:34 2015  Ari Pollak  <ajp@aripollak.com>
+
+	* doc/security.rdoc (Symbols): update about Symbol GC.  Symbols
+	  explicitly converted from Strings now can be collected, but
+	  reflection/metaprogramming still can cause memory flooding.
+	  [Fix GH-725]
+
+Sun Feb  1 13:46:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/rbinstall.rb (bin-comm): drop batch file installation.
+	  Windows 95 support has not been supported already.
+	  [Feature #10806]
+
+Sat Jan 31 12:06:23 2015  Scott Francis  <scott.francis@shopify.com>
+
+	* thread_pthread.c (reserve_stack): fix intermittent SIGBUS on
+	  Linux, by reserving the stack virtual address space at process
+	  start up so that it will not clash with the heap space.
+	  [Fix GH-822]
+
+Fri Jan 30 17:28:29 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (num2dbl_with_to_f): make faster when Bignum passed by
+	  direct conversion using rb_big2dbl().  [Feature #10800]
+
+Thu Jan 29 23:30:00 2015  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (rb_rational_num): add fallback function
+	  for rubies lower than 2.2.0.
+
+	* ext/bigdecimal/bigdecimal.c (rb_rational_den): ditto.
+
+	* ext/bigdecimal/extconf.rb: check the existences of struct RRational,
+	  rb_rational_num, and rb_rational_den.
+
+	* ext/bigdecimal/bigdecimal.bundle: bump version.
+
+Thu Jan 29 20:28:25 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/make-snapshot: removed md5 digest with package information
+
+Thu Jan 29 10:41:52 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (Get_Double): direct casting from Fixnum to double.
+	  [Feature #10785]
+
+Thu Jan 29 02:34:27 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix parsing hashes with
+	  instance variables when it is referenced multiple times.
+	* ext/psych/lib/psych.rb: bump version
+	* ext/psych/psych.gemspec: bump version
+	* test/psych/test_hash.rb: test for fix
+
+Thu Jan 29 02:06:09 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (struct join_arg): restructure and make smaller
+	  (thread_join_sleep): avoid timeofday() call if forever
+	  (thread_join): pass join_arg.delay directly
+	  (rb_thread_inspect_msg): remove, inline into rb_thread_inspect
+	  (rb_thread_inspect): reduce branching and string creation
+	* thread_pthread.c (native_set_thread_name): create string directly
+	  to avoid reparsing. [Misc #10723]
+
+Wed Jan 28 21:32:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* thread.c: Improve documentation for Thread#value
+	  [Bug #10694][ruby-core:67324][ci skip]
+
+Tue Jan 27 16:04:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: added `!` command.
+
+Tue Jan 27 15:58:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: added history feature for platforms which
+	  lack readline.
+
+Mon Jan 26 22:09:35 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .gitignore: ignored temporary file with git.
+
+Mon Jan 26 18:06:03 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* misc/ruby-electric.el: Import version 2.2.2 from
+	  https://github.com/knu/ruby-electric.el.
+
+Mon Jan 26 11:37:49 2015  Dave Stevens  <dave@crowdlab.com>
+
+	* string.c (str_make_independent_expand): terminate String when
+	  moved from heap to embedded.  [Fix GH-821].
+
+Sun Jan 25 12:04:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (flatten): no need to call to_ary method on elements
+	  beyond the given level.  [ruby-core:67637] [Bug #10748]
+
+Sun Jan 25 00:42:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/win32/libffi.mk.tmpl: assemble without directory prefix.
+	  workaround of a bug of VC12 ml, by unak at [ruby-core:67792].
+	  [ruby-core:67789] [Bug #10780]
+
+Sat Jan 24 19:56:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln_find.c (dln_find_1): search regular files only.  based on
+	  the patch by Alex Coomans in [ruby-core:67766].  [Bug #10776]
+
+Fri Jan 23 23:57:05 2015  Misumi Rize  <r@ayase-e.li>
+
+	* vm_insnhelper.c (vm_throw_start): search the target to break
+	  from a block with nested rescue, from the nested blocks.
+	  [ruby-core:67765] [Bug #10775] [Fix GH-820]
+
+Fri Jan 23 20:00:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_object, marshal_dump): use identity tables for
+	  arbitrary VALUE keys, because of performance of FLONUM.
+	  [Bug #10761]
+
+	* marshal.c (obj_alloc_by_klass, marshal_load): ditto.
+
+Fri Jan 23 17:12:33 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_marshal_dump_flo.rb: new benchmark for [Bug #10761]
+
+Thu Jan 22 18:03:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (find_svn_log): use double quotes instead
+	  of single quotes because cmd.exe doesn't handle them.
+
+	* tool/redmine-backporter.rb (done): the 2nd element of matched data
+	  is the offset of the end of matched string, not length.
+
+Thu Jan 22 16:45:24 2015  Eric Wong  <e@80x24.org>
+
+	* st.c (st_numhash): mix float value for flonum
+	* hash.c (rb_any_hash): ditto
+	* benchmark/bm_hash_aref_flo.rb: new benchmark
+	* benchmark/bm_hash_ident_flo.rb: ditto
+	  [Bug #10761]
+
+Wed Jan 21 22:33:51 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* misc/ruby-electric.el: Import version 2.2.1 from
+	  https://github.com/knu/ruby-electric.el.  Improve compatibility
+	  with and optimize for Emacs 24.4.
+
+Wed Jan 21 09:40:52 2015  Zachary Scott  <e@zzak.io>
+
+	* file.c: Document other cases of missing birthtime on OS with patch
+	  provided by @sho-h similar to GH-817. [ci skip] [DOC]
+
+Wed Jan 21 09:09:19 2015  Tanaka Akira  <akr@fsij.org>
+
+	* NEWS: References to tickets added.
+	  [ruby-core:67701] [Bug #10760] Suggested by Zachary Scott.
+
+Tue Jan 20 22:59:54 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/vcs.rb: fix the exception given remote-url of svn.
+
+Tue Jan 20 12:58:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: now can change the page of `ls`.
+
+Tue Jan 20 12:28:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (readline): fallback to normal gets on
+	  Windows because IO.console.getch is not always do as expected.
+
+Tue Jan 20 11:31:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: update usage.
+
+Tue Jan 20 11:23:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (mygets): to support Backspace
+	  implement gets by itself.
+
+Tue Jan 20 02:54:11 2015  Zachary Scott  <e@zzak.io>
+
+	* file.c: NotImplementedError is raised if birthtime is unavailable.
+	  Patch by @y-yagi san and [Fixes GH-817] [ci skip] [DOC]
+
+	* ext/pathname/pathname.c: ditto.
+
+Mon Jan 19 22:08:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (include_modules_at): allow to prepend each module up to
+	  once for each classe.  [EXPERIMENTAL]
+
+Sun Jan 18 18:32:20 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* math.c (math_atan2): revive documentation before r49220.
+	  http://d.hatena.ne.jp/nagachika/20150112/ruby_trunk_changes_49213_49226
+
+Sun Jan 18 15:57:32 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (check_definition): Module#public_method_defined?,
+	  Module#private_method_defined?, Module#protected_method_defined?
+	  should not use refinements. [ruby-core:67656] [Bug #10753]
+
+Sun Jan 18 15:50:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_dump.c (rb_vm_bugreport): check by configured result instead
+	  of system name for old FreeBSD.  based on a patch by Steve Wills
+	  at [ruby-core:67655].  [Bug #10752]
+
+Sun Jan 18 12:56:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (VPATH, NEWLINE_C), common.mk (common-srcs): make
+	  and use newline.c under enc/trans directory, not toplevel.  no
+	  longer search enc directory implicitly.
+
+	* configure.in, enc/Makefile.in (BUILTIN_ENCS, BUILTIN_TRANSES):
+	  prefix respective directory names to builtin encodings and
+	  transcoder source names.
+
+Sun Jan 18 11:49:46 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_invoke): avoid SEGV when VT_RECORD
+	  variable is passed by reference. [ruby-dev:48803] [Bug #10697]
+
+Sat Jan 17 23:59:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
+	  anchors like `\Z` are not valid inside character class.  use
+	  negative-lookahead instead.
+	  Fixes: https://github.com/tenderlove/psych/issues/221
+
+Sat Jan 17 23:42:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: get rid of pattern substitution, which is not
+	  supported by ash, and ash on NetBSD parses whole source first
+	  and fails to start.  [ruby-dev:48823] [Bug #10750]
+
+Fri Jan 16 18:42:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: support adding related revisions
+	  to issues.
+
+Fri Jan 16 17:20:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	vm.c, vm_core.h: constify VM_CF_LEP, VM_CF_PREV_EP, VM_CF_BLOCK_PTR
+	and rb_vm_control_frame_block_ptr.
+
+Fri Jan 16 15:41:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bump version
+
+	* ext/psych/psych.gemspec: ditto
+
+Fri Jan 16 15:37:49 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: only dump hash
+	  subclasses. Thanks Joe Eli McIlvain <joe.eli.mac@gmail.com>
+
+	* test/psych/test_hash.rb: test for change
+
+Fri Jan 16 15:35:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bump version
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix line width wrapping
+	  for long strings.  Thanks Jakub Jirutka <jakub@jirutka.cz>
+
+	* test/psych/test_string.rb: test for change
+
+Fri Jan 16 11:44:44 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* eval_intern.h, vm.c, vm_eval.c, vm_insnhelper.c:
+	  change throw mechanism (not save target ep, but save target cfp).
+	  It fixes `unexpected break' bug that occurs when
+	  TracePoint#binding is called.
+	  [ruby-dev:48797] [Bug #10689]
+
+	* test/ruby/test_settracefunc.rb: add a test.
+
+Thu Jan 15 23:55:15 2015  Tanaka Akira  <akr@fsij.org>
+
+	* io.c (rb_io_close_m): Don't raise when the IO object is closed.
+	  [ruby-core:67444] [Feature #10718]
+
+Thu Jan 15 21:34:57 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* proc.c (rb_obj_singleton_method): Kernel#singleton_method should
+	  not use refinements, as well as Kernel#method.
+	  [ruby-core:67603] [Bug #10744]
+
+Thu Jan 15 10:45:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_select_bang, ary_reject_bang): linear
+	  performance.  [ruby-core:67418] [Feature #10714]
+
+Wed Jan 14 18:06:06 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* lib/uri/mailto.rb: raising URI::InvalidComponentError instead
+	  of failing with undefined method `split' for nil:NilClass for
+	  mailto: URIs without opaque part. [Bug #10738]
+	* test/uri/testuri.rb: Test for above
+
+Wed Jan 14 16:45:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/downloader.rb (RubyGems.download): verify downloaded gem
+	  packages.  LowSecurity to allow untrusted certificates now.
+
+Wed Jan 14 15:43:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/readline/readline.c (readline_s_refresh_line): initialize
+	  before rl_refresh_line(), as some function make the internal
+	  state non-clean but rl_refresh_line() does not re-initialize it.
+	  [ruby-core:43957] [Bug #6232]
+
+Tue Jan 13 21:59:24 2015  Michal Papis  <mpapis@gmail.com>
+
+	* tool/rbinstall.rb (gem): fix changing permissions of installed
+	  bundled gems.  [Fix GH-812]
+
+Tue Jan 13 21:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (distclean-local): remove autom4te.cache generated by
+	  autoconf.
+
+	* common.mk (realclean-local): remove id sources and dummy header
+	  for dtrace.  [ruby-core:67562] [Bug #10737]
+
+Tue Jan 13 21:08:22 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json, test/json: merge JSON HEAD(259dee6)
+	  separate implementation of Typed_Data macro.
+	  https://github.com/flori/json/compare/v1.8.1...v1.8.2
+
+Tue Jan 13 14:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/net/http/test_http.rb: get rid of accessing DNS actually
+	  for some servers returning wrong results.
+	  [ruby-core:67454] [Bug #10721]
+
+Mon Jan 12 23:21:57 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gems/bundled_gems: update test-unit to 3.0.9.
+
+Mon Jan 12 18:35:44 2015  Eric Wong  <e@80x24.org>
+
+	* numeric.c (bit_coerce): use original value for error message
+	  [ruby-core:67405] [Bug #10711]
+	* test/ruby/test_numeric.rb (test_coerce): check error message
+
+Mon Jan 12 18:01:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/text.rb (expand_tabs): get rid of infinite loop with
+	  CR.  should check if substitution occurred too.
+	  [ruby-dev:48813] [Bug #10732]
+
+Mon Jan 12 16:45:46 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (rb_alias): raise a NameError when creating alias to
+	  a refined method if the original method of the refined method is
+	  not defined.  [ruby-core:67523] [Bug #10731]
+
+Mon Jan 12 13:53:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* math.c (math_atan2): improve documentation.
+	  [Feature #10323][ruby-core:65400][ci skip]
+
+Mon Jan 12 13:50:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/bigdecimal/bigdecimal.c: fixes documentation like labeled lists,
+	  code examples etc. [ruby-core:66730][Bug #10576][ci skip]
+
+Mon Jan 12 13:36:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/optparse.rb: improvements for OptionParser documentation.
+	  [misc #10608][ruby-core:66901][ci skip]
+
+Mon Jan 12 13:33:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* array.c (rb_ary_each): documented return value.
+	  [misc #10469][ruby-core:66063]
+
+Sun Jan 11 15:11:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/webrick/test_utils.rb (test_create_listeners): use
+	  dynamically chosen port number, not hardcoded port number.
+	  [ruby-core:67508]
+
+Sat Jan 10 12:57:12 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/zlib/zlib.c: fix document of method signatures.
+	  [Bug #10668][ruby-core:67186][ci skip]
+
+Sat Jan 10 12:32:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval_error.c (error_print): pos and len parameters of rb_str_substr()
+	  are counted by characters, not bytes.  use rb_str_subseq() instead.
+	  [Bug #10727] [ruby-core:67473]
+
+Sat Jan 10 10:58:55 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* complex.c: removed commented-out code.
+
+Sat Jan 10 10:57:19 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* rational.c: removed commented-out code.
+	  [Feature #10376][ruby-core:65643]
+
+Sat Jan 10 10:12:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_select_bang): keep the array consistent by
+	  removing unselected values soon.  [ruby-dev:48805] [Bug #10722]
+
+Fri Jan  9 23:20:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems:  Update to RubyGems HEAD(e53c54a).
+	* test/rubygems:  ditto.
+
+Fri Jan  9 11:13:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (assocs, assoc): eliminate splatting empty literal
+	  hashes.  [ruby-core:67446] [Bug #10719]
+
+	* compile.c (compile_array_): support splatted hash in hash type.
+
+Fri Jan  9 10:57:09 2015  Vit Ondruch  <vondruch@redhat.com>
+
+	* configure.in (RUBY_SETJMP_TYPE): Remove superfluous semicolon
+	  which causes a syntax error with autoconf 2.63.
+	  [ruby-core:67429] [Bug #10716]
+
+Fri Jan  9 07:23:32 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: correctly quote non-ascii
+	  letters. Thanks @jirutka for the patch.
+
+	* test/psych/test_string.rb: test for change
+
+Fri Jan  9 07:13:55 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: call `allocate` on hash
+	  subclasses.  Fixes github.com/tenderlove/psych/issues/196
+
+	* test/psych/test_hash.rb: test for change
+
+Fri Jan  9 06:58:43 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: revive hashes with ivars
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: dump hashes with ivars.
+	  Fixes github.com/psych/issues/43
+
+	* test/psych/test_hash.rb: test for change
+
+Thu Jan  8 17:05:00 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (rb_method_entry): if no super class, no original
+	  method entry.  [ruby-core:67389] [Bug #10707]
+
+Thu Jan  8 16:31:43 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (rb_export_method): bail out if the original method
+	  is undefined when the method is refined.
+	  [ruby-core:67387] [Bug #10706]
+
+Thu Jan  8 12:53:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): match in case-folding only if the directory
+	  resides on a case-insensitive file system, on OSX.
+	  [ruby-core:67364] [Bug #10700]
+
+Thu Jan  8 11:39:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .travis.yml: Remove redundant configuration option.
+	  [fix GH-809] Patch by @gxworld
+
+Thu Jan  8 07:17:14 2015  Eric Wong  <e@80x24.org>
+
+	* lib/resolv.rb: consider ENETUNREACH as ResolvTimeout
+	  [ruby-core:67411] [Bug #10712]
+
+Thu Jan  8 00:13:52 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open3.rb: Open3 properly passes non-keyword hash args to spawn.
+	  Fixed by Josh Cheek.  [Fix GH-808]
+	  Related to [ruby-core:67347] [Bug #10699]
+
+Wed Jan  7 19:19:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_initialize): workaround of opendir failure at symlink
+	  directories on Windows via CIFS.
+
+Wed Jan  7 18:52:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (need_normalization): not only HFS+, CIFS (SMB) is also
+	  decomposed.  [Bug #10704]
+
+	* dir.c (NORMALIZE_UTF8PATH): Unicode decomposition seems to
+	  perform in an upper layer than file systems on OSX, as all path
+	  names are always decomposed regardless of file system types.
+
+Tue Jan  6 21:41:04 2015  Tanaka Akira  <akr@fsij.org>
+
+	* time.c (timelocalw): Set tm_isdst field -1 if vtm->isdst is
+	  VTM_ISDST_INITVAL.  This bug is introduced at packing struct
+	  vtm (r45155).
+	  [ruby-core:67345] [Bug #10698] Reported by Boris Ruf.
+
+Tue Jan  6 03:10:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/fiddle/test_handle.rb: fix syntax.
+
+Tue Jan  6 00:16:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/fiddle/test_handle.rb (test_NEXT): use -test-/dln/empty
+	  which is always a shared object and is not used by others.
+	  [ruby-dev:48629] [Bug #10384]
+
+Mon Jan  5 14:58:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/ruby/test_io.rb: added timeout for AIX environment.
+	  [ruby-core:62983][Bug #9917]
+
+Sun Jan  4 22:33:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit.rb (ExcludesOption): add "excludes" support
+	  to test suite, for alternative implementations and platforms.
+	  [Feature #10682]
+
+Sun Jan  4 22:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit.rb (Test::Unit): reorder modules and merge
+	  each modules.
+
+	* test/lib/test/unit.rb (Test::Unit): split the large class into
+	  each modules.
+
+Sun Jan  4 21:32:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (f_label): return tLABEL value as it is.
+	  [ruby-core:67315] [Bug #10693]
+
+Sun Jan  4 14:02:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit/parallel.rb (run): expand the file name to be
+	  loaded, so that relative paths work in parallel mode.
+
+Sun Jan  4 13:36:56 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* test/test_tempfile.rb: use assert_file for more descriptive message.
+	  following r49131.
+
+Sun Jan  4 13:05:09 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* string.c: improve docs for String#<=>. [ruby-core:65399][Feature #10322]
+	  Patch by gogo tanaka.
+
+Sun Jan  4 12:42:24 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* array.c: improve docs for Array#reject. [ruby-core:65324][misc #10307]
+	  Patched by Nebu Pookins.
+
+Sun Jan  4 12:24:11 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* string.c: improve docs for String#strip and variations.
+	  [ruby-core:66081][Bug #10476]
+
+Sun Jan  4 09:21:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/drb/drb.rb: removed unused argument. Patch by @vipulnsward
+	  [fix GH-515]
+
+Sun Jan  4 09:18:31 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/tempfile.rb: provide default basename parameter.
+	  [fix GH-523] Patch by @dissolved
+	* test/test_tempfile.rb: ditto.
+
+Sun Jan  4 00:43:41 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* README.ja.md: add guidance of mailing list and bugs.r-l.o.
+
+Sat Jan  3 23:56:28 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* hash.c: fix docs for Hash#invert. [ruby-core:66917] [Bug #10612]
+
+Sat Jan  3 19:52:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/intern.h (rb_str_new_literal): define on all
+	  platforms, not only gcc.
+
+Sat Jan  3 18:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/lib/fiddle/cparser.rb (parse_ctype): limit split word
+	  number as the rest are not used.
+
+Sat Jan  3 18:19:50 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/fiddle/lib/fiddle/cparser.rb: r49110 broke Fiddle::Import with
+	  type_alias.
+	* test/fiddle/test_cparser.rb: added type_alias test for parse_ctype
+	  and parse_struct_signature.
+
+Sat Jan  3 11:50:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/openssl/ossl.h: avoid to build failure of Windows environment.
+	* ext/openssl/ossl_ssl_session.c: ditto.
+
+Sat Jan  3 11:27:46 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* array.c: Improve performance of Array#shift. use shared instead of
+	  MEMMOVE if with arguments. Patch by @ksss [fix GH-537]
+	* test/ruby/test_array.rb: ditto.
+	* benchmark/bm_array_shift.rb: Added benchmark of GH-537 issue.
+
+Sat Jan  3 10:38:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/net/http.rb: More descriptive error message when net/http fails
+	  to connect to a server. Patch by @xaviershay [fix GH-700]
+	* test/net/http/test_http.rb: ditto.
+
+Sat Jan  3 10:14:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/openssl/ossl.h: Make `SSL_SESSION_cmp` use `CRYPTO_memcmp`
+	  [fix GH-591] Patch by @PiPeep
+	* ext/openssl/ossl_ssl_session.c: ditto.
+
+Sat Jan  3 09:54:32 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/fiddle/lib/fiddle/cparser.rb: Support for Fiddle::CParser
+	  to handle rich signatures including parameter names and function
+	  pointer types. Patch by @theryan [fix GH-590]
+	* test/fiddle/test_cparser.rb: ditto.
+
+Sat Jan  3 09:01:43 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* NEWS: added compatibility entry of r49101.
+
+Fri Jan  2 21:06:59 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/net/http.rb (Net::HTTP#send_request): there is no response body
+	  with HEAD request. Patch by @rodrigosaito [fix GH-520]
+
+Fri Jan  2 21:04:36 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/net/http/test_http.rb (_test_send_request__HEAD): Added
+	  failing test for send_request with HEAD method.
+
+Fri Jan  2 18:41:20 2015  Tanaka Akira  <akr@fsij.org>
+
+	* eval.c (ruby_init): Print ruby_setup() error only in debug mode.
+	  Unsuppressable error message is not a good idea.
+	  Note that the message is printed sometimes with following
+	  code (highly timing dependent, though):
+	  pid = spawn("ruby -e ''"); Process.kill(:TERM, pid)
+
+Fri Jan  2 16:18:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/ruby/test_module.rb: Refactor invalid testcase.
+	  [fix GH-472][ruby-core:59035][Bug #9240]
+
+Fri Jan  2 15:53:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/webrick/utils.rb: removed unused argument variable.
+	  [fix GH-356] Patch by @vipulnsward
+	* lib/webrick/server.rb: ditto.
+	* lib/webrick/ssl.rb: ditto.
+	* test/webrick/test_utils.rb: added test for WEBrick::Utils#create_listeners.
+
+Fri Jan  2 15:35:53 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/securerandom.rb: improve syntax and grammar of documentation.
+	  [fix GH-796][ci skip] Patch by @Erol
+
+Fri Jan  2 15:10:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/openssl/test_ssl_session.rb (OpenSSL#test_ctx_client_session_cb):
+	  fix test failure with OpenSSL disabled SSLv3 protocol.
+	  [ruby-core:63772] [Bug #10046]
+
+Fri Jan  2 09:08:31 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Label::Str#==): Check class equality.
+	  (Resolv::DNS::Name#initialize): Normalize labels as
+	  Resolv::DNS::Label::Str objects.
+
+Thu Jan  1 21:41:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/regexp.rdoc: fix regexp docs for whitespace character.
+	  [ruby-dev:48765] [Bug #10624]
+
+Thu Jan  1 17:50:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_rubyoptions.rb: try locale encoding name.
+	  [ruby-core:67109] [Bug #10643]
+
+Thu Jan  1 11:07:12 2015  Eric Wong  <e@80x24.org>
+
+	* symbol.c (rb_gc_free_dsymbol): delete from global fstr hash
+	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): test for bug
+	  [ruby-core:67268] [Bug #10686]
+
+Thu Jan  1 09:14:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_args.c (keyword_hash_p): fix non-symbol keys hash.
+	  rb_extract_keywords() returns 0 not Qnil when no symbol keys is
+	  included.  [ruby-core:67264] [Bug #10685]
+
+Wed Dec 31 17:48:43 2014  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Label::Str#initialize): Set encoding
+	  ASCII-8BIT before downcase.  case insensitivity of DNS labels doesn't
+	  apply non-ASCII characters.  [RFC 4343]
+
+Wed Dec 31 16:48:44 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (gettable_gen): disable warnings of possible reference
+	  to a local variable defined in a past scope.
+	  [ruby-core:67162] [Bug #10661]
+
+Wed Dec 31 13:43:48 2014  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Name#==): Compare an array of Label:Str
+	  objects.  Label#Str#== is case-insensitive.
+
+Tue Dec 30 16:16:12 2014  Ben Miller  <bmiller@rackspace.com>
+
+	* lib/resolv.rb (Resolv::DNS::Name#==): DNS is case-insensitive, so the
+	  comparison should be case-insensitive as well.
+	  [ruby-core:66498] [Bug #10550]
+
+Tue Dec 30 16:03:45 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/resolv.rb (Resolv::DNS::Name): names with different dots
+	  should be different.
+
+Tue Dec 30 13:16:56 2014  Martin Duerst  <bernhard+git@lsmod.de>
+
+	* lib/uri/common.rb: Initialize HTML5ASCIIINCOMPAT to empty Array
+	  to avoid error during bootstrap when encodings are not yet defined.
+	  [Bug #10678]
+
+Tue Dec 30 09:29:26 2014  Bernhard M. Wiedemann  <bernhard+git@lsmod.de>
+
+	* ext/dbm/dbm.c (Init_dbm): [DOC] as UNIX permissions are octal
+	  numbers, needs to be prefixed by 0.  [Fix GH-800]
+
+Tue Dec 30 08:57:39 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/unicode_normalize.rb: typo fix. [ci skip]
+	  [ruby-dev:48794][misc #10675]
+
+Mon Dec 29 19:38:01 2014  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* version.h (RUBY_VERSION): 2.3.0 development has started.
+
+Mon Dec 29 18:58:46 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (unescape_nonascii): append escape sequence as-is not
+	  unescaped character, to get rid of unexpected meta-character.
+	  [ruby-core:67193] [Bug #10670]
+
+Mon Dec 29 14:27:33 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* doc/syntax/literals.rdoc (Symbols): now Symbols created by
+	  interpolation can be garbage collected.  patch by Yihang Ho in
+	  [ruby-core:67194].  [Bug #10671]
+
+Mon Dec 29 11:18:17 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_variable_get): fix dynamic symbol keys.
+	  rb_check_id() returns non-zero only for static symbols, whereas
+	  thread local variable keys can be dynamic symbols.
+	  [ruby-core:67185] [Bug #10667]
+
+Mon Dec 29 10:37:27 2014  Thiago Lewin  <thiago_lewin@yahoo.com.br>
+
+	* io.c (rb_f_select): [DOC] workaround for YARD doc.  [Fix GH-799]
+
+	* process.c (proc_detach): [DOC] fix missing closing parenthesis.
+	  [Fix GH-799]
+
+Mon Dec 29 07:27:23 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json, test/json: merge JSON HEAD(17fe8e7)
+	  https://github.com/flori/json/compare/v1.8.1...17fe8e7
+
+Sun Dec 28 23:49:37 2014  Michal Papis  <mpapis@gmail.com>
+
+	* rbinstall.rb: fix target location for installing bundled gems.
+	  install to the prepared directory instead of default Gem.dir,
+	  not to be affected GEM_HOME environment variable.  [Fix GH-798]
+
+Sun Dec 28 18:19:28 2014  Eric Wong  <e@80x24.org>
+
+	* test/-ext-/iseq_load/test_iseq_load.rb
+	  (test_next_in_block_in_block): test using ISeq#eval
+	  (test_break_ensure): ditto
+	  [ruby-core:66988]
+
+Sun Dec 28 16:25:12 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* cygwin/GNUmakefile.in (EXTOBJS): override to add resource files
+	  always.  [ruby-core:67153] [Bug #10657]
+
+Sun Dec 28 13:54:26 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (f_kwrest, new_args_tail_gen): unnamed rest keyword and
+	  keywords bits arguments should be unique.  since internal IDs
+	  depend on the local variable index in the current scope, new ID
+	  should be made before popping those vtables.
+	  [ruby-core:67157] [Bug #10659]
+
+Sat Dec 27 20:12:55 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/generator/generator.c (JSON_Generator_State_type): add
+	  #ifdef for backward compatibility.
+
+	* ext/json/parser/parser.rl (JSON_Parser_type): ditto.
+
+	* ext/json/generator/generator.h (ZALLOC): add fallback definition.
+
+	* ext/json/parser/parser.h (ZALLOC): ditto.
+
+Sat Dec 27 16:54:05 2014  Tanaka Akira  <akr@fsij.org>
+
+	* process.c: Unused code removed.
+	  It seems waitpid() is universally available on POSIX platforms.
+
+Sat Dec 27 15:08:27 2014  Eric Wong  <e@80x24.org>
+
+	* vm_core.h (rb_vm_living_threads_insert): preserve order
+	  [Bug #10660] [ruby-core:67154] [ruby-core:67159]
+
+Sat Dec 27 13:08:20 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/socket/socket.c: improved document for YARD doc.
+	  [fix GH-795][ci skip] Patch by @tlewin
+
+Sat Dec 27 10:11:21 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/tk/lib/tkextlib/tcllib/plotchart.rb: fix to invoke correct function
+	  of tcllib. Patch by @zalt50 [fix GH-787]
+
+Sat Dec 27 10:03:41 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/make-snapshot: show sha1 digest when making packages.
+	  it's request from https://github.com/ruby/www.ruby-lang.org/issues/921
+	  [fix GH-794]
+
+Fri Dec 26 15:32:16 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/tk/tcltklib.c (ip_invoke_core): remove probably duplicate
+	  dead code.
+
+Fri Dec 26 15:28:27 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/tk/tcltklib.c (ip_ruby_cmd_receiver_const_get): simply use
+	  rb_path2class() to get a class/module from its name.
+
+Fri Dec 26 15:20:54 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_long): append at once by w_nbyte() instead of
+	  appending byte by byte.
+
+Fri Dec 26 15:13:13 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/parser/parser.rl (unescape_unicode): check if valid
+	  before bit-or assignments.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* ext/nkf/nkf-utf8/nkf.c (nkf_iconv_t): fix a missing semicolon.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* process.c (rb_spawn_process): get rid of usage of uninitialized
+	  variable.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* regexec.c (match_at): ditto.
+
+	* ext/win32ole/win32ole.c (ole_wc2mb_alloc, ole_vstr2wc, ole_mb2wc):
+	  ditto.
+
+	* dir.c (ruby_glob0): no need to check never-NULL pointer.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* win32/file.c (rb_file_expand_path_internal): ditto.
+
+	* win32/file.c (code_page_i): handle realloc failure.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* win32/stub.c (stub_sysinit): ditto.
+
+	* fix printf format conversion specifiers.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+Fri Dec 26 01:41:40 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/rbinstall.rb: skip installing bundle gems if zlib is unavailable.
+	  [Bug #10647] [ruby-dev:48787]
+
+Fri Dec 26 01:24:42 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/downloader.rb: support old versions of ruby.
+
+	* tool/downloader.rb: now can download gems by http if openssl is not
+	  available (this may be danger!)
+
+Fri Dec 26 00:13:48 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_extlibs.rb: check existence of extension libraries
+	  which not depend on outer libraries. (experimental)
+
+Thu Dec 25 21:58:15 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/extconf.rb: make PIC objects if it will be linked as
+	  a shared object eventually.  [ruby-core:67128]
+
+Thu Dec 25 19:01:13 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/fiddle/win32/libffi-3.2.1-mswin.patch: support mswin32.
+
+Thu Dec 25 17:30:40 2014  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* gc.c (wmap_final_func): fix memory size shortage when realloc wmap.
+	  Fix SEGV during finalize of WeakRef on Solaris (though the SEGV
+	  could occur on all OS/platforms). [ruby-dev:48779] [Bug #10646]
+
+Thu Dec 25 17:27:06 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (NET_LUID): include winsock2.h instead of windows.h.
+	  patch by Jon Forums in [ruby-core:67125].  [Bug #10640]
+
+Thu Dec 25 16:14:10 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_dev): send the given arguments
+	  to the opened console.  as a special case, do nothing if :close
+	  is given.
+
+	* test/lib/leakchecker.rb (LeakChecker#check_fd_leak): close if
+	  console.
+
+For the changes before 2.2.0, see doc/ChangeLog-2.2.0
+For the changes before 2.1.0, see doc/ChangeLog-2.1.0
+For the changes before 2.0.0, see doc/ChangeLog-2.0.0
+For the changes before 1.9.3, see doc/ChangeLog-1.9.3
+For the changes before 1.8.0, see doc/ChangeLog-1.8.0
+
+Local variables:
+coding: us-ascii
+add-log-time-format: (lambda ()
+  (let* ((time (current-time))
+	 (system-time-locale "C")
+	 (diff (+ (cadr time) 32400))
+	 (lo (% diff 65536))
+	 (hi (+ (car time) (/ diff 65536))))
+  (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
+indent-tabs-mode: t
+tab-width: 8
+change-log-indent-text: 2
+end:
+vim: tabstop=8 shiftwidth=2
diff --git a/LEGAL b/LEGAL
index a05cd6eaa3..2607f0082a 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,331 +1,116 @@
-# -*- rdoc -*-
-
-= LEGAL NOTICE INFORMATION
---------------------------
+LEGAL NOTICE INFORMATION
+------------------------
 
 All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-[addr2line.c]
-
-  A part of this file is from FreeBSD.
-
-  >>>
-    Copyright (c) 1986, 1988, 1991, 1993::
-    The Regents of the University of California.  All rights reserved.
-
-    (c) UNIX System Laboratories, Inc.
-
-    All or some portions of this file are derived from material licensed
-    to the University of California by American Telephone and Telegraph
-    Co. or Unix System Laboratories, Inc. and are reproduced herein with
-    the permission of UNIX System Laboratories, Inc.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    4. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
-
-
-[ccan/build_assert/build_assert.h]
-[ccan/check_type/check_type.h]
-[ccan/container_of/container_of.h]
-[ccan/str/str.h]
-
-  These files are licensed under the {CC0}[https://creativecommons.org/choose/zero/].
-
-[ccan/list/list.h]
-
-  This file is licensed under the {MIT License}[rdoc-ref:@MIT+License].
-
-[coroutine]
-
-  Unless otherwise specified, these files are licensed under the
-  {MIT License}[rdoc-ref:@MIT+License].
-
-[include/ruby/onigmo.h]
-[include/ruby/oniguruma.h]
-[regcomp.c]
-[regenc.c]
-[regenc.h]
-[regerror.c]
-[regexec.c]
-[regint.h]
-[regparse.c]
-[regparse.h]
-[enc/ascii.c]
-[enc/big5.c]
-[enc/cp949.c]
-[enc/emacs_mule.c]
-[enc/encdb.c]
-[enc/euc_jp.c]
-[enc/euc_kr.c]
-[enc/euc_tw.c]
-[enc/gb18030.c]
-[enc/gb2312.c]
-[enc/gbk.c]
-[enc/iso_8859_1.c]
-[enc/iso_8859_10.c]
-[enc/iso_8859_11.c]
-[enc/iso_8859_13.c]
-[enc/iso_8859_14.c]
-[enc/iso_8859_15.c]
-[enc/iso_8859_16.c]
-[enc/iso_8859_2.c]
-[enc/iso_8859_3.c]
-[enc/iso_8859_4.c]
-[enc/iso_8859_5.c]
-[enc/iso_8859_6.c]
-[enc/iso_8859_7.c]
-[enc/iso_8859_8.c]
-[enc/iso_8859_9.c]
-[enc/koi8_r.c]
-[enc/koi8_u.c]
-[enc/shift_jis.c]
-[enc/unicode.c]
-[enc/us_ascii.c]
-[enc/utf_16be.c]
-[enc/utf_16le.c]
-[enc/utf_32be.c]
-[enc/utf_32le.c]
-[enc/utf_8.c]
-[enc/windows_1251.c]
-[enc/windows_31j.c]
-
-  Onigmo (Oniguruma-mod) LICENSE
-
-  >>>
-    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    Copyright (c) 2011-2014::  K.Takata  <kentkt AT csc DOT jp>
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-  Oniguruma LICENSE
-
-  >>>
-    Copyright (c) 2002-2009::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-  * https://github.com/k-takata/Onigmo/
-  * https://github.com/kkos/oniguruma
-  * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
-
-    When this software is partly used or it is distributed with Ruby,
-    this of Ruby follows the license of Ruby.
-
-[enc/windows_1250.c]
-[enc/windows_1252.c]
-
-  >>>
-    Copyright (c) 2006-2007::  Byte      <byte AT mail DOT kna DOT ru>
-                               K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-[enc/cesu_8.c]
-[enc/windows_1253.c]
-[enc/windows_1254.c]
-[enc/windows_1257.c]
-
-  >>>
-    Copyright (c) 2002-2007::  K.Kosako  <sndgk393 AT ybb DOT ne DOT jp>
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-[enc/trans/GB/GB12345%UCS.src]
-[enc/trans/GB/UCS%GB12345.src]
-[enc/trans/GB/GB2312%UCS.src]
-[enc/trans/GB/UCS%GB2312.src]
-
-  These files have this explanatory texts.
-
-  >>>
-    This mapping data was created from files provided by Unicode, Inc.
-    (The Unicode Consortium). The files were used to create a product supporting
-    Unicode, as explicitly permitted in the files' copyright notices.
-    Please note that Unicode, Inc. never made any claims as to fitness of these
-    files for any particular purpose, and has ceased to publish the files many
-    years ago.
-
-[enc/trans/JIS/JISX0201-KANA%UCS.src]
-[enc/trans/JIS/JISX0208\@1990%UCS.src]
-[enc/trans/JIS/JISX0212%UCS.src]
-[enc/trans/JIS/UCS%JISX0201-KANA.src]
-[enc/trans/JIS/UCS%JISX0208@1990.src]
-[enc/trans/JIS/UCS%JISX0212.src]
+ccan/build_assert/build_assert.h
+ccan/check_type/check_type.h
+ccan/container_of/container_of.h
+ccan/str/str.h
 
-  These files are copyrighted as the following.
+  These files are licensed under the CC0.
 
-  >>>
-    © 2015 Unicode®, Inc.
+    http://creativecommons.org/choose/zero/
 
-    For terms of use, see http://www.unicode.org/terms_of_use.html
+ccan/list/list.h
 
-[enc/trans/JIS/JISX0213-1%UCS@BMP.src]
-[enc/trans/JIS/JISX0213-1%UCS@SIP.src]
-[enc/trans/JIS/JISX0213-2%UCS@BMP.src]
-[enc/trans/JIS/JISX0213-2%UCS@SIP.src]
+  This file is licensed under the MIT License.
 
-  These files are copyrighted as the following.
+    Permission is hereby granted, free of charge, to any person obtaining a copy
+    of this software and associated documentation files (the "Software"), to deal
+    in the Software without restriction, including without limitation the rights
+    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the Software is
+    furnished to do so, subject to the following conditions:
 
-  >>>
-    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
-    Copyright (C) 2001:: I'O, All Rights Reserved.
-    Copyright (C) 2006:: Project X0213, All Rights Reserved.
-    You can use, modify, distribute this table freely.
+    The above copyright notice and this permission notice shall be included in
+    all copies or substantial portions of the Software.
 
-[enc/trans/JIS/UCS@BMP%JISX0213-1.src]
-[enc/trans/JIS/UCS@BMP%JISX0213-2.src]
-[enc/trans/JIS/UCS@SIP%JISX0213-1.src]
-[enc/trans/JIS/UCS@SIP%JISX0213-2.src]
-
-  These files are copyrighted as the following.
-
-  >>>
-    Copyright (C) 2001:: earthian@tama.or.jp, All Rights Reserved.
-    Copyright (C) 2001:: I'O, All Rights Reserved.
-    You can use, modify, distribute this table freely.
-
-[enc/trans/ucm/glibc-BIG5-2.3.3.ucm]
-[enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm]
-
-  >>>
-    Copyright (C) 2001-2005:: International Business Machines
-                              Corporation and others.  All Rights Reserved.
-
-[enc/trans/ucm/windows-950-2000.ucm]
-[enc/trans/ucm/windows-950_hkscs-2001.ucm]
-
-  >>>
-    Copyright (C) 2001-2002:: International Business Machines
-                              Corporation and others.  All Rights Reserved.
-
-
-[configure]
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+    THE SOFTWARE.
+
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+
+http://www.geocities.jp/kosako3/oniguruma/
+http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
+http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
+
+   When this software is partly used or it is distributed with Ruby,
+   this of Ruby follows the license of Ruby.
+
+configure:
 
   This file is free software.
 
-  >>>
-    Copyright (C) 1992-1996, 1998-2012:: Free Software Foundation, Inc.
+    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
 
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-[tool/config.guess]
-[tool/config.sub]
+tool/config.guess:
+tool/config.sub:
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
 
-  >>>
-    Copyright 1992-2018:: Free Software Foundation, Inc.
+      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
+      Free Software Foundation, Inc.
 
     This file is free software; you can redistribute it and/or modify it
     under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 3 of the License, or
+    the Free Software Foundation; either version 2 of the License, or
     (at your option) any later version.
 
     This program is distributed in the hope that it will be useful, but
@@ -334,85 +119,54 @@ mentioned below.
     General Public License for more details.
 
     You should have received a copy of the GNU General Public License
-    along with this program; if not, see <https://www.gnu.org/licenses/>.
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
 
     As a special exception to the GNU General Public License, if you
     distribute this file as part of a program that contains a
     configuration script generated by Autoconf, you may include it under
-    the same distribution terms that you use for the rest of that
-    program.  This Exception is an additional permission under section 7
-    of the GNU General Public License, version 3 ("GPLv3").
-
-[tool/lib/test/*]
-[tool/lib/core_assertions.rb]
-
-  Some of methods on these files are based on MiniTest 4. MiniTest 4 is
-  distributed under the MIT License.
-
-  >>>
-    Copyright (c) Ryan Davis, seattle.rb
-
-    Permission is hereby granted, free of charge, to any person obtaining
-    a copy of this software and associated documentation files (the
-    'Software'), to deal in the Software without restriction, including
-    without limitation the rights to use, copy, modify, merge, publish,
-    distribute, sublicense, and/or sell copies of the Software, and to
-    permit persons to whom the Software is furnished to do so, subject to
-    the following conditions:
-
-    The above copyright notice and this permission notice shall be
-    included in all copies or substantial portions of the Software.
-
-    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND,
-    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-    MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
-    IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
-    CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
-    TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
-    SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
-
-[parse.c]
-[parse.h]
-
-  These files are licensed under the GPL, but are incorporated into Ruby and
+    the same distribution terms that you use for the rest of that program.
+
+parse.c:
+
+  This file is licensed under the GPL, but is incorporated into Ruby and
   redistributed under the terms of the Ruby license, as permitted by the
   exception to the GPL below.
 
-  >>>
-    Copyright (C) 1984, 1989-1990, 2000-2015, 2018:: Free Software Foundation, Inc.
+     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+     Free Software Foundation, Inc.
 
-    This program is free software: you can redistribute it and/or modify
-    it under the terms of the GNU General Public License as published by
-    the Free Software Foundation, either version 3 of the License, or
-    (at your option) any later version.
+     This program is free software; you can redistribute it and/or modify
+     it under the terms of the GNU General Public License as published by
+     the Free Software Foundation; either version 2, or (at your option)
+     any later version.
 
-    This program is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-    GNU General Public License for more details.
+     This program is distributed in the hope that it will be useful,
+     but WITHOUT ANY WARRANTY; without even the implied warranty of
+     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+     GNU General Public License for more details.
 
-    You should have received a copy of the GNU General Public License
-    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+     You should have received a copy of the GNU General Public License
+     along with this program; if not, write to the Free Software
+     Foundation, Inc., 51 Franklin Street, Fifth Floor,
+     Boston, MA 02110-1301, USA.  */
 
-    As a special exception, you may create a larger work that contains
-    part or all of the Bison parser skeleton and distribute that work
-    under terms of your choice, so long as that work isn't itself a
-    parser generator using the skeleton or a modified version thereof
-    as a parser skeleton.  Alternatively, if you modify or redistribute
-    the parser skeleton itself, you may (at your option) remove this
-    special exception, which will cause the skeleton and the resulting
-    Bison output files to be licensed under the GNU General Public
-    License without this special exception.
+  /* As a special exception, you may create a larger work that contains
+     part or all of the Bison parser skeleton and distribute that work
+     under terms of your choice, so long as that work isn't itself a
+     parser generator using the skeleton or a modified version thereof
+     as a parser skeleton.  Alternatively, if you modify or redistribute
+     the parser skeleton itself, you may (at your option) remove this
+     special exception, which will cause the skeleton and the resulting
+     Bison output files to be licensed under the GNU General Public
+     License without this special exception.
 
-    This special exception was added by the Free Software Foundation in
-    version 2.2 of Bison.
+     This special exception was added by the Free Software Foundation in
+     version 2.2 of Bison.  */
 
-[missing/dtoa.c]
+util.c (partly):
 
-  This file is under these licenses.
-
-  >>>
-    Copyright (c) 1991, 2000, 2001:: by Lucent Technologies.
+    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
 
     Permission to use, copy, modify, and distribute this software for any
     purpose without fee is hereby granted, provided that this entire notice
@@ -425,74 +179,71 @@ mentioned below.
     REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
     OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
 
-  >>>
-    Copyright (c) 2004-2008:: David Schultz <das@FreeBSD.ORG>
-                              All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-[win32/win32.c]
-[include/ruby/win32.h]
+win32/win32.[ch]:
 
   You can apply the Artistic License to these files. (or GPL,
   alternatively)
 
-  >>>
-    Copyright (c) 1993:: Intergraph Corporation
+    Copyright (c) 1993, Intergraph Corporation
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
-[missing/mt19937.c]
+util.c (partly):
+
+   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+
+   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+   SUCH DAMAGE.
+
+random.c
 
   This file is under the new-style BSD license.
 
-  >>>
-    A C-program for MT19937, with initialization improved 2002/2/10.::
+    A C-program for MT19937, with initialization improved 2002/2/10.
     Coded by Takuji Nishimura and Makoto Matsumoto.
-
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
     Before using, initialize the state by using init_genrand(seed)
     or init_by_array(init_key, key_length).
 
-    Copyright (C) 1997 - 2002:: Makoto Matsumoto and Takuji Nishimura,
-                                All rights reserved.
+    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
+    All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
     are met:
 
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
+      1. Redistributions of source code must retain the above copyright
+	 notice, this list of conditions and the following disclaimer.
 
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
+      2. Redistributions in binary form must reproduce the above copyright
+	 notice, this list of conditions and the following disclaimer in the
+	 documentation and/or other materials provided with the distribution.
 
-    3. The names of its contributors may not be used to endorse or promote
-       products derived from this software without specific prior written
-       permission.
+      3. The names of its contributors may not be used to endorse or promote
+	 products derived from this software without specific prior written
+	 permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
     "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -511,15 +262,12 @@ mentioned below.
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
-  The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
-
-[missing/procstat_vm.c]
+vm_dump.c:procstat_vm
 
   This file is under the new-style BSD license.
 
-  >>>
-    Copyright (c) 2007:: Robert N. M. Watson
-                         All rights reserved.
+    Copyright (c) 2007 Robert N. M. Watson
+    All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -544,98 +292,181 @@ mentioned below.
 
     $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
 
-[vsnprintf.c]
+vsnprintf.c:
 
-  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-  >>>
-    Copyright (c) 1990, 1993::
-    The Regents of the University of California.  All rights reserved.
+    Copyright (c) 1990, 1993
+         The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Chris Torek.
 
-[st.c]
-[strftime.c]
-[include/ruby/st.h]
-[missing/acosh.c]
-[missing/alloca.c]
-[missing/erf.c]
-[missing/hypot.c]
-[missing/lgamma_r.c]
-[missing/memcmp.c]
-[missing/memmove.c]
-[missing/strchr.c]
-[missing/strerror.c]
-[missing/strstr.c]
-[missing/tgamma.c]
-[ext/date/date_strftime.c]
-[ext/digest/sha1/sha1.c]
-[ext/digest/sha1/sha1.h]
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    IMPORTANT NOTE:
+    --------------
+    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+    paragraph 3 above is now null and void.
+
+st.[ch]:
+missing/alloca.c:
+missing/dup2.c:
+missing/erf.c:
+missing/finite.c:
+missing/hypot.c:
+missing/isinf.c:
+missing/isnan.c:
+missing/lgamma_r.c:
+missing/memcmp.c:
+missing/memmove.c:
+missing/strchr.c:
+missing/strstr.c:
+missing/strtol.c:
+missing/tgamma.c:
+ext/digest/sha1/sha1.[ch]:
 
   These files are all under public domain.
 
-[missing/crypt.c]
+missing/crypt.c:
 
-  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-  >>>
-    Copyright (c) 1989, 1993::
-    The Regents of the University of California.  All rights reserved.
+    Copyright (c) 1989, 1993
+    	The Regents of the University of California.  All rights reserved.
 
     This code is derived from software contributed to Berkeley by
     Tom Truscott.
 
-[missing/setproctitle.c]
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+missing/setproctitle.c
 
-  This file is under the {old-style BSD license}[rdoc-ref:@Old-style+BSD+license].
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-  >>>
-    Copyright 2003:: Damien Miller
-    Copyright (c) 1983, 1995-1997:: Eric P. Allman
-    Copyright (c) 1988, 1993::
-    The Regents of the University of California.  All rights reserved.
+    Copyright 2003 Damien Miller
+    Copyright (c) 1983, 1995-1997 Eric P. Allman
+    Copyright (c) 1988, 1993
+    	The Regents of the University of California.  All rights reserved.
 
-[missing/strlcat.c]
-[missing/strlcpy.c]
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
 
-  These files are under an ISC-style license.
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
 
-  >>>
-    Copyright (c) 1998, 2015:: Todd C. Miller <Todd.Miller@courtesan.com>
+missing/strlcat.c
+missing/strlcpy.c
 
-    Permission to use, copy, modify, and distribute this software for any
-    purpose with or without fee is hereby granted, provided that the above
-    copyright notice and this permission notice appear in all copies.
+  These files are under the new-style BSD license.
+
+    Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. The name of the author may not be used to endorse or promote products
+       derived from this software without specific prior written permission.
 
-    THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
-    WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
-    MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
-    ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
-    WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
-    ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
-    OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+    THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
+    INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
+    AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
+    THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
+    OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+    WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
+    OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
+    ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
 
-[missing/langinfo.c]
+missing/langinfo.c
 
   This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
   Ruby uses a modified version. The file contains the following
   author/copyright notice:
 
-  >>>
-    Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11::
-    Permission to use, copy, modify, and distribute this software
-    for any purpose and without fee is hereby granted. The author
-    disclaims all warranties with regard to this software.
+  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+  Permission to use, copy, modify, and distribute this software
+  for any purpose and without fee is hereby granted. The author
+  disclaims all warranties with regard to this software.
 
-[ext/digest/md5/md5.c]
-[ext/digest/md5/md5.h]
+ext/digest/md5/md5.[ch]:
 
   These files are under the following license.  Ruby uses modified
   versions of them.
 
-  >>>
-    Copyright (C) 1999, 2000:: Aladdin Enterprises.  All rights reserved.
+    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
 
     This software is provided 'as-is', without any express or implied
     warranty.  In no event will the authors be held liable for any damages
@@ -656,27 +487,23 @@ mentioned below.
     L. Peter Deutsch
     ghost@aladdin.com
 
-[ext/digest/rmd160/rmd160.c]
-[ext/digest/rmd160/rmd160.h]
+ext/digest/rmd160/rmd160.[ch]:
 
   These files have the following copyright information, and by the
   author we are allowed to use it under the new-style BSD license.
 
-  >>>
-    AUTHOR::  Antoon Bosselaers, ESAT-COSIC
+    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
               (Arranged for libc by Todd C. Miller)
-    DATE::    1 March 1996
+    DATE:     1 March 1996
 
-    Copyright (c):: Katholieke Universiteit Leuven
+    Copyright (c) Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-[ext/digest/sha2/sha2.c]
-[ext/digest/sha2/sha2.h]
+ext/digest/sha2/sha2.[ch]:
 
   These files are under the new-style BSD license.
 
-  >>>
-    Copyright 2000:: Aaron D. Gifford.  All rights reserved.
+    Copyright 2000 Aaron D. Gifford.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -702,92 +529,29 @@ mentioned below.
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-[ext/json/vendor/fpconv.c]
-
-  This file is under the Boost Software License.
-
-  >>>
-    Boost Software License - Version 1.0 - August 17th, 2003
-    
-    Permission is hereby granted, free of charge, to any person or organization
-    obtaining a copy of the software and accompanying documentation covered by
-    this license (the "Software") to use, reproduce, display, distribute,
-    execute, and transmit the Software, and to prepare derivative works of the
-    Software, and to permit third-parties to whom the Software is furnished to
-    do so, all subject to the following:
-    
-    The copyright notices in the Software and this entire statement, including
-    the above license grant, this restriction and the following disclaimer,
-    must be included in all copies of the Software, in whole or in part, and
-    all derivative works of the Software, unless such copies or derivative
-    works are solely in the form of machine-executable object code generated by
-    a source language processor.
-    
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE, TITLE AND NON-INFRINGEMENT. IN NO EVENT
-    SHALL THE COPYRIGHT HOLDERS OR ANYONE DISTRIBUTING THE SOFTWARE BE LIABLE
-    FOR ANY DAMAGES OR OTHER LIABILITY, WHETHER IN CONTRACT, TORT OR OTHERWISE,
-    ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
-    DEALINGS IN THE SOFTWARE.
-
-[ext/json/vendor/jeaiii-ltoa.h]
-
-  >>>
-    Copyright (c) 2024,2025 Enrico Thierbach - https://github.com/radiospiel
-    Copyright (c) 2022 James Edward Anhalt III - https://github.com/jeaiii/itoa
-
-    {MIT License}[rdoc-ref:@MIT+License]
-  
-
-[ext/psych]
-[test/psych]
-
-  The files under these directories are under the following license.
-
-  >>>
-    Copyright 2009:: Aaron Patterson, et al.
+ext/nkf/nkf-utf8/config.h:
+ext/nkf/nkf-utf8/nkf.c:
+ext/nkf/nkf-utf8/utf8tbl.c:
 
-    Permission is hereby granted, free of charge, to any person obtaining a copy of
-    this software and associated documentation files (the 'Software'), to deal in
-    the Software without restriction, including without limitation the rights to
-    use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
-    of the Software, and to permit persons to whom the Software is furnished to do
-    so, subject to the following conditions:
+  These files are under the following license.  So to speak, it is
+  copyrighted semi-public-domain software.
 
-    The above copyright notice and this permission notice shall be included in all
-    copies or substantial portions of the Software.
+    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
+       Everyone is permitted to do anything on this program
+       including copying, modifying, improving,
+       as long as you don't try to pretend that you wrote it.
+       i.e., the above copyright notice has to appear in all copies.
+       Binary distribution requires original version messages.
+       You don't have to ask before copying, redistribution or publishing.
+       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
 
-    THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-    SOFTWARE.
-
-[ext/pty/pty.c]
-
-  >>>
-    C) Copyright 1998:: by Akinori Ito.
-
-    This software may be redistributed freely for this purpose, in full
-    or in part, provided that this entire copyright notice is included
-    on any copies of this software and applications and derivations thereof.
-
-    This software is provided on an "as is" basis, without warranty of any
-    kind, either expressed or implied, as to any matter including, but not
-    limited to warranty of fitness of purpose, or merchantability, or
-    results obtained from use of this software.
-
-[ext/socket/addrinfo.h]
-[ext/socket/getaddrinfo.c]
-[ext/socket/getnameinfo.c]
+ext/socket/addrinfo.h:
+ext/socket/getaddrinfo.c:
+ext/socket/getnameinfo.c:
 
   These files are under the new-style BSD license.
 
-  >>>
-    Copyright (C) 1995, 1996, 1997, 1998, and 1999:: WIDE Project.
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
     All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
@@ -814,275 +578,17 @@ mentioned below.
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-[ext/win32ole/win32ole.c]
+ext/win32ole/win32ole.c:
 
   You can apply the Artistic License to this file. (or GPL,
   alternatively)
 
-  >>>
-    (c) 1995:: Microsoft Corporation. All rights reserved.
+    (c) 1995 Microsoft Corporation. All rights reserved.
     Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
 
-    Other modifications Copyright (c) 1997, 1998:: by Gurusamy Sarathy
+    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the README file
     of the Perl distribution.
-
-  The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
-
-[lib/rdoc/generator/template/darkfish/css/fonts.css]
-
-  This file is licensed under the {SIL Open Font License}[http://scripts.sil.org/OFL].
-
-[spec/mspec]
-[spec/ruby]
-
-  The files under these directories are under the following license.
-
-  >>>
-    Copyright (c) 2008:: Engine Yard, Inc. All rights reserved.
-
-    Permission is hereby granted, free of charge, to any person
-    obtaining a copy of this software and associated documentation
-    files (the "Software"), to deal in the Software without
-    restriction, including without limitation the rights to use,
-    copy, modify, merge, publish, distribute, sublicense, and/or sell
-    copies of the Software, and to permit persons to whom the
-    Software is furnished to do so, subject to the following
-    conditions:
-
-    The above copyright notice and this permission notice shall be
-    included in all copies or substantial portions of the Software.
-
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-    EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
-    OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-    NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
-    HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
-    WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
-    FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
-    OTHER DEALINGS IN THE SOFTWARE.
-
-[lib/rubygems.rb]
-[lib/rubygems]
-[test/rubygems]
-
-  RubyGems is under the following license.
-
-  >>>
-    RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
-    Weirich and others.  You can redistribute it and/or modify it under
-    either the terms of the {MIT license}[rdoc-ref:@MIT+License], or the conditions
-    below:
-
-    1. You may make and give away verbatim copies of the source form of the
-       software without restriction, provided that you duplicate all of the
-       original copyright notices and associated disclaimers.
-
-    2. You may modify your copy of the software in any way, provided that
-       you do at least ONE of the following:
-
-       a. place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-          modifications to Usenet or an equivalent medium, or by allowing
-          the author to include your modifications in the software.
-
-       b. use the modified software only within your corporation or
-          organization.
-
-       c. give non-standard executables non-standard names, with
-          instructions on where to get the original software distribution.
-
-       d. make other distribution arrangements with the author.
-
-    3. You may distribute the software in object code or executable
-       form, provided that you do at least ONE of the following:
-
-       a. distribute the executables and library files of the software,
-          together with instructions (in the manual page or equivalent)
-          on where to get the original distribution.
-
-       b. accompany the distribution with the machine-readable source of
-          the software.
-
-       c. give non-standard executables non-standard names, with
-          instructions on where to get the original software distribution.
-
-       d. make other distribution arrangements with the author.
-
-    4. You may modify and include the part of the software into any other
-       software (possibly commercial).
-
-    5. The scripts and library files supplied as input to or produced as
-       output from the software do not automatically fall under the
-       copyright of the software, but belong to whomever generated them,
-       and may be sold commercially, and may be aggregated with this
-       software.
-
-    6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-       IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-       WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-       PURPOSE.
-
-[lib/bundler]
-[lib/bundler.rb]
-[spec/bundler]
-
-  Bundler is under the following license.
-
-  >>>
-    Portions copyright (c) 2010:: Andre Arko
-    Portions copyright (c) 2009:: Engine Yard
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/thor]
-
-  Thor is under the following license.
-
-  >>>
-    Copyright (c) 2008 Yehuda Katz, Eric Hodel, et al.
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/rubygems/vendor/molinillo]
-
-  molinillo is under the following license.
-
-  >>>
-    Copyright (c) 2014 Samuel E. Giddins segiddins@segiddins.me
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/pub_grub]
-
-  pub_grub is under the following license.
-
-  >>>
-    Copyright (c) 2018 John Hawthorn
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/connection_pool]
-
-  connection_pool is under the following license.
-
-  >>>
-    Copyright (c) 2011 Mike Perham
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/bundler/vendor/net-http-persistent]
-
-  net-http-persistent is under the following license.
-
-  >>>
-    Copyright (c) Eric Hodel, Aaron Patterson
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/did_you_mean]
-[lib/did_you_mean.rb]
-[test/did_you_mean]
-
-  did_you_mean is under the following license.
-
-  >>>
-    Copyright (c) 2014-2016 Yuki Nishijima
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[lib/error_highlight]
-[lib/error_highlight.rb]
-[test/error_highlight]
-
-  error_highlight is under the following license.
-
-  >>>
-    Copyright (c) 2021 Yusuke Endoh
-
-    {MIT License}[rdoc-ref:@MIT+License]
-
-[benchmark/so_ackermann.rb]
-[benchmark/so_array.rb]
-[benchmark/so_binary_trees.rb]
-[benchmark/so_concatenate.rb]
-[benchmark/so_count_words.yml]
-[benchmark/so_exception.rb]
-[benchmark/so_fannkuch.rb]
-[benchmark/so_fasta.rb]
-[benchmark/so_k_nucleotide.yml]
-[benchmark/so_lists.rb]
-[benchmark/so_mandelbrot.rb]
-[benchmark/so_matrix.rb]
-[benchmark/so_meteor_contest.rb]
-[benchmark/so_nbody.rb]
-[benchmark/so_nested_loop.rb]
-[benchmark/so_nsieve.rb]
-[benchmark/so_nsieve_bits.rb]
-[benchmark/so_object.rb]
-[benchmark/so_partial_sums.rb]
-[benchmark/so_pidigits.rb]
-[benchmark/so_random.rb]
-[benchmark/so_reverse_complement.yml]
-[benchmark/so_sieve.rb]
-[benchmark/so_spectralnorm.rb]
-
-  These files are very old copy of then-called "The Great Computer Language
-  Shootout".  LEGAL SITUATION OF THESE FILES ARE UNCLEAR because the original
-  site has been lost.  Upstream diverged to delete several benchmarks listed
-  above.
-
-== MIT License
->>>
-      Permission is hereby granted, free of charge, to any person obtaining
-      a copy of this software and associated documentation files (the
-      "Software"), to deal in the Software without restriction, including
-      without limitation the rights to use, copy, modify, merge, publish,
-      distribute, sublicense, and/or sell copies of the Software, and to
-      permit persons to whom the Software is furnished to do so, subject to
-      the following conditions:
-
-      The above copyright notice and this permission notice shall be
-      included in all copies or substantial portions of the Software.
-
-      THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-      EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-      MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-      NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
-      LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
-      OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
-      WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
-
-== Old-style BSD license
->>>
-      Redistribution and use in source and binary forms, with or without
-      modification, are permitted provided that the following conditions
-      are met:
-      1. Redistributions of source code must retain the above copyright
-         notice, this list of conditions and the following disclaimer.
-      2. Redistributions in binary form must reproduce the above copyright
-         notice, this list of conditions and the following disclaimer in the
-         documentation and/or other materials provided with the distribution.
-      3. Neither the name of the University nor the names of its contributors
-         may be used to endorse or promote products derived from this software
-         without specific prior written permission.
-
-      THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-      ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-      IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-      ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-      FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-      DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-      OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-      HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-      LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-      OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-      SUCH DAMAGE.
-
-      IMPORTANT NOTE::
-
-      From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-      paragraph 3 above is now null and void.
diff --git a/Makefile.in b/Makefile.in
new file mode 100644
index 0000000000..ff475091ab
--- /dev/null
+++ b/Makefile.in
@@ -0,0 +1,554 @@
+SHELL = /bin/sh
+NULLCMD = @NULLCMD@
+n=$(NULLCMD)
+ECHO1 = $(V:1=$n)
+RUNCMD = $(SHELL)
+CDPATH = .
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
+PATH_SEPARATOR = @PATH_SEPARATOR@
+
+#### Start of system configuration section. ####
+
+srcdir = @srcdir@
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
+
+CC = @CC@
+CPP = @CPP@
+LD = @LD@
+YACC = bison
+PURIFY =
+AUTOCONF = autoconf
+CONFIGURE = @CONFIGURE@
+@SET_MAKE@
+MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+HAVE_BASERUBY = @HAVE_BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+CROSS_COMPILING = @CROSS_COMPILING@
+DOXYGEN = @DOXYGEN@
+
+prefix = @prefix@
+exec_prefix = @exec_prefix@
+bindir = @bindir@
+sbindir = @sbindir@
+libdir = @libdir@
+libexecdir = @libexecdir@
+datarootdir = @datarootdir@
+datadir = @datadir@
+arch = @arch@
+sitearch = @sitearch@
+sitedir = @sitedir@
+archlibdir = @archlibdir@
+ruby_version = @ruby_version@
+
+TESTUI = console
+TESTS =
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
+
+EXTOUT = @EXTOUT@
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
+
+empty =
+CC_VERSION = @CC_VERSION@
+OUTFLAG = @OUTFLAG@$(empty)
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS_NO_ARCH = @CFLAGS@
+CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@ @strict_warnflags@
+cppflags = @cppflags@
+INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
+LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
+EXTLDFLAGS = @EXTLDFLAGS@
+XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
+EXTLIBS =
+LIBS = @LIBS@ $(EXTLIBS)
+MISSING = @LIBOBJS@ @ALLOCA@
+LDSHARED = @LIBRUBY_LDSHARED@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
+SOLIBS = @SOLIBS@
+MAINLIBS = @MAINLIBS@
+ARCHMINIOBJS = @MINIOBJS@
+DLNOBJ = @DLNOBJ@
+ENCOBJS = @ENCOBJS@
+EXTOBJS = @EXTOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+POSTLINK = @POSTLINK@
+
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
+RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
+RUBY_SO_NAME=@RUBY_SO_NAME@
+EXEEXT = @EXEEXT@
+LIBEXT = @LIBEXT@
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+RUBY = $(RUBY_INSTALL_NAME)
+MINIRUBY = @MINIRUBY@\
+	$(MINIRUBYOPT)
+# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
+RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
+# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
+RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
+# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
+RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
+XRUBY = @XRUBY@
+BTESTRUBY = @BTESTRUBY@\
+	$(MINIRUBYOPT)
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
+BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
+
+#### End of system configuration section. ####
+
+MAJOR=	@MAJOR@
+MINOR=	@MINOR@
+TEENY=	@TEENY@
+
+LIBRUBY_A     = @LIBRUBY_A@
+LIBRUBY_SO    = @LIBRUBY_SO@
+LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
+LIBRUBY	      = @LIBRUBY@
+LIBRUBYARG    = @LIBRUBYARG@
+LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
+LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
+LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
+
+DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
+
+DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
+			eval.$(OBJEXT) \
+			gc.$(OBJEXT) \
+			hash.$(OBJEXT) \
+			load.$(OBJEXT) \
+			object.$(OBJEXT) \
+			parse.$(OBJEXT) \
+			string.$(OBJEXT) \
+			symbol.$(OBJEXT) \
+			vm.$(OBJEXT)
+
+THREAD_MODEL  = @THREAD_MODEL@
+
+PREP          = @PREP@
+ARCHFILE      = @ARCHFILE@
+SETUP         =
+EXTSTATIC     = @EXTSTATIC@
+ENCSTATIC     = @ENCSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
+
+MAKEDIRS      = @MKDIR_P@
+CP            = cp
+MV            = mv
+RM            = rm -f
+RMDIR         = @RMDIR@
+RMDIRS        = @RMDIRS@
+RMALL         = @RMALL@
+NM            = @NM@
+AR            = @AR@
+ARFLAGS       = rcu
+RANLIB        = @RANLIB@
+AS            = @AS@
+ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE      = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP       = @OBJDUMP@
+OBJCOPY       = @OBJCOPY@
+VCS           = @VCS@
+VCSUP         = @VCSUP@
+DTRACE        = @DTRACE@
+DTRACE_EXT    = @DTRACE_EXT@
+DTRACE_OBJ    = @DTRACE_OBJ@
+DTRACE_REBUILD= @DTRACE_REBUILD@
+DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
+
+OBJEXT        = @OBJEXT@
+ASMEXT        = S
+DLEXT         = @DLEXT@
+MANTYPE	      = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
+
+INSTALLED_LIST= .installed.list
+
+NEWLINE_C     = enc/trans/newline.c
+MINIPRELUDE_C = miniprelude.c
+PRELUDE_C     = prelude.c
+RBCONFIG      = .rbconfig.time
+
+SRC_FILE      = $<
+OS_SRC_FILE   = $<
+DEST_FILE     = $@
+OS_DEST_FILE  = $@
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
+ECHO_BEGIN = @sep=''; for word in
+ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
+
+DESTDIR       = @DESTDIR@
+
+configure_args = @configure_args@
+#### End of variables
+
+.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
+
+all:
+
+# Prevent GNU make v3 from overflowing arg limit on SysV.
+.NOEXPORT:
+
+miniruby$(EXEEXT):
+		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
+
+$(PROGRAM):
+		@$(RM) $@
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
+		$(Q) $(POSTLINK)
+
+# We must `rm' the library each time this rule is invoked because "updating" a
+# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
+# supported.
+$(LIBRUBY_A):
+		@$(RM) $@
+		$(ECHO) linking static-library $@
+		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
+		@-$(RANLIB) $@ 2> /dev/null || true
+		$(ECHO) verifying static-library $@
+		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
+		@$(RM) conftest$(EXEEXT) conftest.c
+
+$(LIBRUBY_SO):
+		@-$(PRE_LIBRUBY_UPDATE)
+		$(ECHO) linking shared-library $@
+		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
+		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
+			-L '$(SYMBOL_PREFIX)*_threadptr_*' $@
+		$(Q) $(POSTLINK)
+		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
+						  File.symlink "$(LIBRUBY_SO)", link}' \
+				$(LIBRUBY_ALIASES) || true
+
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+ruby-runner.c: template/ruby-runner.c.in
+		@./config.status --file=$@:$(srcdir)/template/$(@F).in
+
+ruby-runner$(EXEEXT): ruby-runner.c
+	$(Q) $(PURIFY) $(CC) $(CFLAGS) $(CPPFLAGS) -DRUBY_INSTALL_NAME=$(RUBY_INSTALL_NAME) $(LDFLAGS) $(LIBS) $(OUTFLAG)$@ ruby-runner.c
+
+$(RBCONFIG): $(PREP)
+
+rbconfig.rb: $(RBCONFIG)
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+	$(ECHO) installing cross-compiling stuff
+	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+	$(Q) $(BASERUBY) -p \
+	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+	rbconfig.rb > fake-rbconfig.rb
+	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+	@$(RM) fake.rb fake-rbconfig.rb
+	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status $(srcdir)/version.h
+		@[ -f $@ ] && mv $@ $@.old
+		MAKE=$(MAKE) $(SHELL) ./config.status $@
+		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
+		{ \
+		    echo "all:; -@rm -f conftest.mk"; \
+		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
+		    echo ".force:"; \
+		} > conftest.mk || exit 1; \
+		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
+		{ echo "$@ updated, restart."; exit 1; }
+
+uncommon.mk: $(srcdir)/common.mk
+		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
+
+.PHONY: reconfig
+reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
+reconfig-exec-1 = set -x; "$$@"
+
+reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
+			$(srcdir)/include/ruby/version.h
+	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
+
+$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in $(srcdir)/aclocal.m4
+	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
+
+incs: id.h
+all-incs: probes.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+	@\
+	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+	  [ $(Q) ] && echo copying $@ || set -x; \
+	  $(CP) $(srcdir)/lex.c.blt $@; \
+	else \
+	  [ $(Q) ] && echo generating $@ || set -x; \
+	  gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
+	  | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
+	  > $@.tmp && \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(srcdir)/defs/lex.c.src && \
+	  $(CP) $@ $(srcdir)/lex.c.blt; \
+	fi
+
+NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
+
+enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  trap '$(RM) $@-1.h $@-2.h' 0 && \
+	  set -x; \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
+	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
+
+JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
+
+enc/jis/props.h: enc/jis/props.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  set -x; \
+	  gperf $(JIS_PROPS_OPTIONS) $? | \
+	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
+
+.c.@OBJEXT@:
+	@$(ECHO) compiling $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
+
+.s.@OBJEXT@:
+	@$(ECHO) assembling $<
+	$(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+	@$(ECHO) translating $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+	@$(ECHO) preprocessing $<
+	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
+
+.d.h:
+	@$(ECHO) translating probes $<
+	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
+	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
+	$(Q) $(RM) $@.tmp
+
+.dmyh.h:
+	@$(ECHO) copying dummy $(DEST_FILE)
+	$(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
+
+probes.stamp: $(DTRACE_REBUILD_OBJS)
+	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
+	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
+	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
+	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
+	fi
+	$(Q) touch $@
+
+probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
+	@$(ECHO) processing probes in object files
+	$(Q) $(RM) $@
+	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
+
+# DTrace static library hacks described here:
+# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
+ruby-glommed.$(OBJEXT):
+	@$(ECHO) generating a glommed object with DTrace probes for static library
+	$(Q) $(LD) -r -o $@ $(OBJS)
+
+clean-local::
+	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
+		enc/encinit.c enc/encinit.$(OBJEXT)
+	-$(Q)$(RM) $(pkgconfig_DATA)
+
+distclean-local::
+	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+	-$(Q)$(RM) run.gdb
+	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
+	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+clean-ext distclean-ext realclean-ext::
+	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+	test "$$#" = 0 && set .; \
+	set dummy `\
+	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
+	`; shift; \
+	cd ..; \
+	for dir do \
+	    echo $(@:-ext=)ing "$$dir"; \
+	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
+	    case "$@" in \
+	    *distclean-ext*|*realclean-ext*) \
+		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
+	    esac; \
+	done
+	-$(Q)$(RM) ext/extinit.$(OBJEXT)
+
+distclean-ext realclean-ext::
+	-$(Q)$(RM) ext/extinit.c
+	-$(Q)$(RMDIR) ext 2> /dev/null || true
+
+clean-extout:
+
+clean-enc distclean-enc realclean-enc:
+	@test -f "$(ENC_MK)" || exit 0; \
+	echo $(@:-enc=ing) encodings; \
+	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
+
+ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
+	$(ECHO) compiling $@
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
+
+up::
+	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+after-update:: update-config_files common-srcs
+
+update-mspec:
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/mspec ]; then \
+	  echo updating mspec ...; \
+	  $(Q1:0=:) set -x; \
+	  cd spec/mspec && \
+	  exec git pull; \
+	else \
+	  echo retrieving mspec ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
+	fi
+
+update-rubyspec: update-mspec
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/rubyspec ]; then \
+	  echo updating rubyspec ...; \
+	  $(Q1:0=:) set -x; \
+	  cd spec/rubyspec && \
+	  exec git pull; \
+	else \
+	  echo retrieving rubyspec ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
+	fi
+
+test-rubyspec-precheck:
+	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
+
+update-doclie:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/doclie ]; then \
+	  echo updating doclie ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/doclie && \
+	  git fetch && \
+	  exec git checkout $(DOCLIE_GIT_REF); \
+	else \
+	  echo retrieving doclie ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone --branch $(DOCLIE_GIT_REF) $(DOCLIE_GIT_URL) coverage/doclie; \
+	fi
+
+update-simplecov-html:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/simplecov-html ]; then \
+	  echo updating simplecov-html ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/simplecov-html && \
+	  git fetch && \
+	  exec git checkout $(SIMPLECOV_HTML_GIT_REF); \
+	else \
+	  echo retrieving simplecov-html ...; \
+	  exec git clone --branch $(SIMPLECOV_HTML_GIT_REF) $(SIMPLECOV_HTML_GIT_URL) coverage/simplecov-html; \
+	fi
+
+update-simplecov:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/simplecov ]; then \
+	  echo updating simplecov ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/simplecov && \
+	  git fetch && \
+	  exec git checkout $(SIMPLECOV_GIT_REF); \
+	else \
+	  echo retrieving simplecov ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone --branch $(SIMPLECOV_GIT_REF) $(SIMPLECOV_GIT_URL) coverage/simplecov; \
+	fi
+
+update-coverage: update-simplecov update-simplecov-html update-doclie
+
+INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+	  vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+	$(ECHO) generating $@
+	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
+
+verconf.h: $(RBCONFIG)
+
+loadpath: verconf.h
+	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
+	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
+	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
diff --git a/NEWS b/NEWS
new file mode 100644
index 0000000000..be722bc9de
--- /dev/null
+++ b/NEWS
@@ -0,0 +1,404 @@
+# -*- rdoc -*-
+
+= NEWS for Ruby 2.3.0
+
+This document is a list of user visible feature changes made between
+releases except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or
+reference information is supplied with.  For a full list of changes
+with all sufficient information, see the ChangeLog file or Redmine
+(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
+
+== Changes since the 2.2.0 release
+
+=== Language changes
+
+* frozen-string-literal pragma:
+
+  * new pragma, frozen-string-literal has been experimentally introduced.
+    [Feature #8976]
+  * besides, --enable/--disable=frozen-string-literal options also have
+    been introduced. [Feature #8976]
+  * command line options --debug or --debug=frozen-string-literal enable
+    additional debugging mode which shows created location with at frozen
+    object error (RuntimeError).
+    [Feature #11725]
+
+* safe navigation operator:
+
+  * new method call syntax, `object&.foo', method #foo is called on
+    `object' if it is not nil.
+    this is similar to `try!' in Active Support, except:
+    * method name is syntactically required
+          obj.try! {} # valid
+          obj&. {}    # syntax error
+    * arguments are evaluated only if a call is made:
+          obj.try!(:foo, bar())  # bar() is always evaluated
+          obj&.foo(bar())        # bar() is conditionally evaluated
+    * attribute assignment is valid
+          obj&.attr += 1
+    [Feature #11537]
+
+* the did_you_mean gem:
+
+  * When a NameError or NoMethodError occurs because of a typo in the name,
+    the did_you_mean gem automatically suggests other names similar to the
+    method name.
+
+      "Yuki".starts_with?("Y")
+      # => NoMethodError: undefined method `starts_with?' for "Yuki":String
+      #    Did you mean?  start_with?
+
+* indented here document:
+
+  * new string literal, here document starts with `<<~`.
+    refer doc/syntax/literals.rdoc for more details.
+    [Feature #9098]
+
+=== Core classes updates (outstanding ones only)
+
+* ARGF
+
+  * ARGF.read_nonblock supports `exception: false' like IO#read_nonblock.
+    [Feature #11358]
+
+* Array
+
+  * Array#bsearch_index [Feature #10730]
+  * Array#dig [Feature #11643]
+
+* Comparable
+
+  * Comparable#== no longer rescues exceptions [Feature #7688]
+
+* Encoding
+
+  * new Encoding::IBM037 (alias ebcdic-cp-us; dummy)
+
+* Enumerable
+
+  * Enumerable#grep_v is added as inverse version of Enumerable#grep.
+    [Feature #11049]
+  * Enumerable#chunk_while [Feature #10769]
+
+* Enumerator::Lazy
+
+  * Enumerator::Lazy#grep_v [Feature #11773]
+
+* File
+
+  * File.mkfifo [Feature #11536]
+  * Add File::TMPFILE corresponding to O_TMPFILE
+
+* Hash
+
+  * Hash#fetch_values [Feature #10017]
+  * Hash#dig [Feature #11643]
+  * Hash#<=, Hash#<, Hash#>=, Hash#> [Feature #10984]
+  * Hash#to_proc [Feature #11653]
+
+* IO
+
+  * new mode flag File::SHARE_DELETE is available.
+    this flag means to permit deleting opened file on Windows, but currently
+    this affect only files opened as binary.  [Feature #11218]
+
+  * new option parameter `flags' is added.
+    this parameter is bitwise-ORed to oflags generated by normal mode argument.
+    [Feature #11253]
+
+  * IO#advise no longer raises Errno::ENOSYS in cases where it was
+    detected at build time but not available at runtime.  [Feature #11806]
+
+* Kernel
+
+  * Kernel#loop, when stopped by a StopIteration exception, returns
+    what the enumerator has returned instead of nil. [Feature #11498]
+
+* Module
+  * Module#deprecate_constant [Feature #11398]
+
+* NameError
+  * NameError#receiver is added to take the receiver object. [Feature #10881]
+
+* Numeric
+
+  * Numeric#positive? and Numeric#negative? are added, which return
+    true when the receiver is positive and negative respectively.
+    [Feature #11151]
+
+* Proc
+
+  * Proc#call (and also #[], #===, #yield) are optimized.
+    Backtrace doesn't show each method (show block lines directly).
+    TracePoint also ignores these calls. [Feature #11569]
+
+* Queue (Thread::Queue)
+
+  * Queue#close is added to notice a termination. [Feature #10600]
+
+* Regexp/String: Updated Unicode version from 7.0.0 to 8.0.0
+
+* RubyVM::InstructionSequence
+  * add the following methods as a primitive tool of iseq loader.
+    See sample/iseq_loader.rb for usage.
+    Note that loader does not have verifier so it is easy to cause
+    critical problem by loading modified/broken binary data.
+    See [Feature #11788] for more details. (experimental feature)
+    * RubyVM::InstructionSequence#to_binary(extra_data = nil)
+    * RubyVM::InstructionSequence.load_from_binary(binary)
+    * RubyVM::InstructionSequence.load_from_binary_extra_data(binary)
+
+* String
+
+  * String#+@ and String#-@ are added to get mutable/frozen strings.
+    [Feature #11782]
+
+  * String.new now accepts new option parameter `encoding'.
+    [Feature #11785]
+
+* Struct
+  * Struct#dig [Feature #11688]
+
+* Thread
+  * Thread#name, Thread#name= are added to handle thread names [Feature #11251]
+
+=== Core classes compatibility issues (excluding feature bug fixes)
+
+* Array
+  * Array#select!, Array#keep_if, Array#reject!, and Array#delete_if
+    no longer changes the receiver array instantly every time the
+    block is called.  [Feature #10714]
+
+  * Array#flatten and Array#flatten! no longer try to call #to_ary
+    method on elements beyond the given level.  [Bug #10748]
+
+  * Array#inspect doesn't raise error even if its content returns
+    a string which is not compatible with Encoding.default_external
+    as inspected result. [Feature #11801]
+
+* Enumerable
+  * Enumerable#chunk and Enumerable#slice_before no longer takes the
+    initial_state argument.  [Feature #10958]
+    Use a local variable instead to maintain a state.
+
+* File::Stat
+  * On Windows File::Stat#ino always returned 0, but now returns
+    BY_HANDLE_FILE_INFORMATION.nFileIndexHigh/Low.  [Feature #11216]
+
+* Hash
+  * Hash#inspect doesn't raise error even if its content returns
+    a string which is not compatible with Encoding.default_external
+    as inspected result. [Feature #11801]
+
+* IO
+  * IO#close doesn't raise when the IO object is closed.  [Feature #10718]
+  * IO#each_codepoint raises an exception at incomplete character
+    before EOF when conversion takes place.  [Bug #11444]
+
+* Module
+  * Module#define_method and Object.define_singleton_method now
+    require method body, Proc, Method, or a block, and raise
+    ArgumentError if no block is given directly.  [Bug #11283]
+
+* pack/unpack (Array/String)
+  * j and J directives for pointer width integer type.  [Feature #11215]
+
+
+=== Stdlib updates (outstanding ones only)
+
+* Logger
+
+  * Logger#level= now supports symbol and string levels such as :debug, :info,
+    :warn, :error, :fatal (case insensitive) [Feature #11695]
+  * Logger#reopen is added to reopen a log device. [Feature #11696]
+
+* io/wait
+  * IO#wait_readable no longer checks FIONREAD, it may be used for
+    non-bytestream IO such as listen sockets.
+
+* Net::FTP
+  * Net::FTP#mlst is added.
+  * Net::FTP#mlsd is added.
+
+* nkf
+  * Merge nkf 2.1.4.
+
+* ObjectSpace (objspace)
+  * ObjectSpace.count_symbols is added.
+  * ObjectSpace.count_imemo_objects is added.
+  * ObjectSpace.internal_class_of is added.
+  * ObjectSpace.internal_super_of is added.
+
+* OpenSSL
+  * OpenSSL::SSL::SSLSocket#accept_nonblock and
+    OpenSSL::SSL::SSLSocket#connect_nonblock supports `exception: false`.
+    [Feature #10532]
+
+* Pathname
+  * Pathname#descend and Pathname#ascend supported blockless form.
+    [Feature #11052]
+
+* Socket
+  * Socket#connect_nonblock, Socket#accept_nonblock,
+    TCPServer#accept_nonblock, UNIXServer#accept_nonblock,
+    BasicSocket#recv_nonblock, BasicSocket#recvmsg_nonblock,
+    BasicSocket#sendmsg_nonblock all support `exception: false` to return
+    :wait_readable or :wait_writable symbols instead of raising
+    IO::WaitReadable or IO::WaitWritable exceptions
+    [Feature #10532] [Feature #11229]
+  * BasicSocket#recv and BasicSocket#recv_nonblock allow an output
+    String buffer argument like IO#read and IO#read_nonblock to reduce
+    GC overhead [Feature #11242]
+
+* StringIO
+  * In read-only mode, StringIO#set_encoding no longer sets the encoding
+    of its buffer string.  Setting the encoding of the string directly
+    without StringIO#set_encoding may cause unpredictable behavior now.
+    [Bug #11827]
+
+* timeout
+  * Object#timeout is now warned as deprecated when called.
+
+=== Stdlib compatibility issues (excluding feature bug fixes)
+
+* ext/coverage/coverage.c
+  * Coverage.peek_result: new method to allow coverage to be captured without
+    stopping the coverage tool.  [Feature #10816]
+
+* Fiddle
+  * Fiddle::Function#call releases the GVL.  [Feature #11607]
+
+* io-console
+  * Update to io-console 0.4.5, and change the license to BSD 2-clause
+    "Simplified" License.
+
+* lib/base64.rb
+  * Base64.urlsafe_encode64: added a "padding" option to suppress
+    the padding character ("=").  [Feature #10740]
+  * Base64.urlsafe_decode64: now it accepts not only correctly-padded
+    input but also unpadded input.  [Feature #10740]
+
+* lib/drb/drb.rb
+  * removed unused argument. https://github.com/ruby/ruby/pull/515
+
+* lib/matrix.rb
+  * Add Vector#round. https://github.com/ruby/ruby/pull/802
+
+* lib/webrick/utils.rb
+  * removed unused argument. https://github.com/ruby/ruby/pull/356
+
+* Net::FTP
+  * Connections are in passive mode per default now.  The default mode can
+    be changed by Net::FTP.default_passive=.  [Feature #11612]
+
+* Net::HTTP
+  * default value of Net::HTTP#open_timeout is now 60 (was nil).
+
+* Net::Telnet
+  * Net::Telnet is extracted to net-telnet gem. It's unmaintain code.
+    [Feature #11083]
+
+* Psych
+  * Updated to Psych 2.0.17
+
+* Rake
+  * Rake is removed from stdlib.  [Feature #11025]
+
+* RDoc
+  * Updated to RDoc 4.2.1.  For full release notes see:
+
+    https://github.com/rdoc/rdoc/blob/master/History.rdoc#421--2015-12-22
+
+* RubyGems
+  * Updated to RubyGems 2.5.1.  For full release notes see:
+
+    http://docs.seattlerb.org/rubygems/History_txt.html#label-2.5.0+-2F+2015-11-03
+    and
+    http://docs.seattlerb.org/rubygems/History_txt.html#label-2.5.1+-2F+2015-12-10
+
+=== Built-in global variables compatibility issues
+
+* $SAFE
+  * $SAFE=2 and $SAFE=3 are obsolete.  If $SAFE is set to 2 or larger,
+    an ArgumentError is raised.  [Feature #5455]
+
+=== C API updates
+
+* rb_define_class_id_under() now raises a TypeError exception when the
+  class is already defined but its superclass does not match the given
+  superclass, as well as definitions in ruby level.
+
+* rb_timespec_now() is added to fetch current datetime as struct timespec.
+  [Feature #11558]
+
+* rb_time_timespec_new() is added to create a time object with epoch,
+  nanosecond, and UTC/localtime/time offset arguments.  [Feature #11558]
+
+* rb_autoload() deprecated, use rb_funcall() instead.  [Feature #11664]
+
+* rb_compile_error_with_enc(), rb_compile_error(), and rb_compile_bug()
+  deprecated.  these functions are exposed but only for internal use.
+  external libraries should not use them.
+
+=== Supported platform changes
+
+* OS/2 is no longer supported
+
+* BeOS is no longer supported
+
+* Borland-C is no longer supported
+
+* Haiku now stable and best effort
+
+=== Implementation improvements
+
+* Optimize Proc#call to eliminate method frame construction.
+  [Feature #11569]
+
+* Reconsidering method entry data structure.
+  [Bug #11278]
+
+* Introducing new table data structure for ID keys tables used by
+  method table and so on. New table structure is simple and fast
+  than st_table. [Feature #11420]
+
+* Machine code level tuning for object allocation and method calling
+  code. r52099, r52254
+
+* RubyVM::InstructionSequence is extended for future improvement.
+  [Feature #11788]
+
+* Case dispatch is now optimized for all special constant literals
+  including nil, true, and false.  Previously, only literal strings,
+  symbols, integers and floats compiled to optimized case dispatch.
+  [Feature #11769]
+
+* Instance variables on non-pure Ruby classes (T_DATA, T_FILE,
+  etc..) is less expensive to store than before. [Feature #11170]
+
+* All accesses to members of big Struct objects are performed in
+  constant-time.  Previously, Struct elements beyond the first 10
+  10 elements used a linear scan. [Feature #10585]
+
+* The Set class got several speed up.
+  [Misc #10754], [r52591]
+
+* Socket and I/O-related improvements
+
+  * Calling overhead of most of new keyword-using I/O methods in
+    [Feature #11229] is reduced by avoiding the inefficient C API
+    to parse keywords.  [Feature #11339]
+
+  * The standard library is updated to use the improved
+    exception-free non-blocking I/O from [Feature #11229].
+    This has the additional benefit of quieter $DEBUG output in
+    addition to reducing expensive exceptions. [Feature #11044]
+
+  * (Linux-only) waiting on a single FD anywhere in the stdlib no longer
+    uses select(2), making it immune to slowdowns with high-numbered FDs.
+    [Feature #11081] [Feature #11377]
+
+* CGI.escapeHTML is optimized with C extention.
+  https://github.com/ruby/ruby/pull/1164
diff --git a/NEWS.md b/NEWS.md
deleted file mode 100644
index 3f2a9d0cc1..0000000000
--- a/NEWS.md
+++ /dev/null
@@ -1,99 +0,0 @@
-# NEWS for Ruby 3.5.0
-
-This document is a list of user-visible feature changes
-since the **3.4.0** release, except for bug fixes.
-
-Note that each entry is kept to a minimum, see links for details.
-
-## Language changes
-
-* `*nil` no longer calls `nil.to_a`, similar to how `**nil` does
-  not call `nil.to_hash`.  [[Feature #21047]]
-
-## Core classes updates
-
-Note: We're only listing outstanding class updates.
-
-* Binding
-
-    * `Binding#local_variables` does no longer include numbered parameters.
-      Also, `Binding#local_variable_get` and `Binding#local_variable_set` reject to handle numbered parameters.
-      [[Bug #21049]]
-
-* IO
-
-    * `IO.select` accepts +Float::INFINITY+ as a timeout argument.
-      [[Feature #20610]]
-
-* String
-
-    * Update Unicode to Version 15.1.0 and Emoji Version 15.1. [[Feature #19908]]
-        (also applies to Regexp)
-
-## Stdlib updates
-
-The following bundled gems are promoted from default gems.
-
-* ostruct 0.6.1
-* pstore 0.2.0
-* benchmark 0.4.0
-* logger 1.7.0
-* rdoc 6.13.1
-* win32ole 1.9.2
-* irb 1.15.2
-* reline 0.6.1
-* readline 0.0.4
-* fiddle 1.1.6
-
-We only list stdlib changes that are notable feature changes.
-
-Other changes are listed in the following sections. we also listed release history from the previous bundled version that is Ruby 3.3.0 if it has GitHub releases.
-
-The following default gem is added.
-
-* win32-registry 0.1.0
-
-The following default gems are updated.
-
-* RubyGems 3.7.0.dev
-* bundler 2.7.0.dev
-* cgi 0.4.2
-* json 2.10.2
-* optparse 0.7.0.dev.2
-* prism 1.4.0
-* psych 5.2.3
-* stringio 3.1.6
-* strscan 3.1.3
-* uri 1.0.3
-
-The following bundled gems are added.
-
-
-The following bundled gems are updated.
-
-* minitest 5.25.5
-* test-unit 3.6.8
-* rexml 3.4.1
-* net-imap 0.5.6
-* net-smtp 0.5.1
-* rbs 3.9.2
-* bigdecimal 3.1.9
-* syslog 0.3.0
-* csv 3.3.4
-* repl_type_completor 0.1.11
-
-## Supported platforms
-
-## Compatibility issues
-
-## Stdlib compatibility issues
-
-## C API updates
-
-## Implementation improvements
-
-## JIT
-
-[Feature #19908]: https://bugs.ruby-lang.org/issues/19908
-[Feature #21047]: https://bugs.ruby-lang.org/issues/21047
-[Bug #21049]:     https://bugs.ruby-lang.org/issues/21049
diff --git a/README.ja.md b/README.ja.md
index 278285dc83..eee54a9171 100644
--- a/README.ja.md
+++ b/README.ja.md
@@ -1,9 +1,3 @@
-[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
-[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
-[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
-[![AppVeyor status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
-[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
-
 # Rubyとは
 
 Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
@@ -16,79 +10,83 @@ Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい
 
 *   シンプルな文法
 *   普通のオブジェクト指向機能(クラス，メソッドコールなど)
-*   特殊なオブジェクト指向機能(Mixin，特異メソッドなど)
+*   特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
 *   演算子オーバーロード
 *   例外処理機能
 *   イテレータとクロージャ
 *   ガーベージコレクタ
 *   ダイナミックローディング (アーキテクチャによる)
-*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， macOS，
-    Haikuなどの上でも動く cf.
-    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， Mac OS
+    X，BeOSなどの上でも動く cf.
+    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
 
 
 ## 入手法
 
-サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
+### FTPで
+
+以下の場所においてあります．
+
+ftp://ftp.ruby-lang.org/pub/ruby/
 
-https://www.ruby-lang.org/ja/downloads/
+### Subversionで
 
-を参照してください．
+開発先端のソースコードは次のコマンドで取得できます．
 
-### Git
+    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
 
-ミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
+他に開発中のブランチの一覧は次のコマンドで見られます．
 
-```console
-$ git clone https://github.com/ruby/ruby.git
-```
+    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
 
-他のブランチの一覧は次のコマンドで見られます．
+### Gitで
 
-```console
-$ git ls-remote https://github.com/ruby/ruby.git
-```
+SubversionのミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
 
-Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります．
-コミッタはこちらを使います．
+    $ git clone git://github.com/ruby/ruby.git
 
 ## ホームページ
 
 RubyのホームページのURLは
 
-https://www.ruby-lang.org/
+http://www.ruby-lang.org/
 
 です．
 
 ## メーリングリスト
 
-Rubyのメーリングリストがあります．参加希望の方は [ruby-list-request@ml.ruby-lang.org] まで件名に
+Rubyのメーリングリストがあります．参加希望の方は
+
+mailto:ruby-list-request@ruby-lang.org
+
+まで本文に
 
-    join
+    subscribe
 
 と書いて送って下さい．
 
-Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています．
-参加希望の方は [ruby-dev-request@ml.ruby-lang.org] までruby-listと同様の方法でメールしてください．
+Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています． 参加希望の方は
+
+mailto:ruby-dev-request@ruby-lang.org
+
+までruby-listと同様の方法でメールしてください．
 
 Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
 英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
 
-[ruby-list-request@ml.ruby-lang.org]: mailto:ruby-list-request@ml.ruby-lang.org?subject=join
-[ruby-dev-request@ml.ruby-lang.org]: mailto:ruby-dev-request@ml.ruby-lang.org?subject=join
-
 ## コンパイル・インストール
 
 以下の手順で行ってください．
 
-1.  (Gitリポジトリから取得したソースをビルドする場合) `./autogen.sh` を実行して新しく `configure` を生成する
+1.  もし `configure` ファイルが見つからない，もしくは `configure.in` より古いようなら， `autoconf` を実行して
+    新しく `configure` を生成する
 
 2.  `configure` を実行して `Makefile` などを生成する
 
     環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
     `warnflags=..` 等で上書きできます．
 
-3.  (必要ならば)`include/ruby/defines.h` を編集する
+3.  (必要ならば)`defines.h` を編集する
 
     多分，必要無いと思います．
 
@@ -97,8 +95,7 @@ Ruby拡張モジュールについて話し合うruby-extメーリングリス�
     `ext/Setup` に記述したモジュールは静的にリンクされます．
 
     ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
-    メントを外す必要があります．
-    また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
+    メントを外す必要があります．また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
 
 5.  `make` を実行してコンパイルする
 
@@ -154,21 +151,21 @@ UNIXであれば `configure` がほとんどの差異を吸収してくれるは
 
 ## 配布条件
 
-[COPYING.ja](https://docs.ruby-lang.org/en/master/COPYING_ja.html) ファイルを参照してください．
+`COPYING.ja` ファイルを参照してください．
 
 ## フィードバック
 
-Rubyに関する質問は [Ruby-Talk]（英語）や [Ruby-List]（日本語）や，
-[stackoverflow] などのWebサイトに投稿してください．
+Rubyに関する質問は Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
+stackoverflow (http://ja.stackoverflow.com/) などのWebサイトに投稿してください．
 
-バグ報告は https://bugs.ruby-lang.org で受け付けています．
+バグ報告は http://bugs.ruby-lang.org で受け付けています．
 
-[Ruby-Talk]: https://www.ruby-lang.org/en/community/mailing-lists
-[Ruby-List]: https://www.ruby-lang.org/ja/community/mailing-lists
-[stackoverflow]: https://ja.stackoverflow.com/
 
 ## 著者
 
 Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
 
 <mailto:matz@ruby-lang.org>
+
+---
+created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
index 5ed312cca8..14fb7aa213 100644
--- a/README.md
+++ b/README.md
@@ -1,94 +1,164 @@
-[![Actions Status: MinGW](https://github.com/ruby/ruby/workflows/MinGW/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"MinGW")
-[![Actions Status: Ubuntu](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Ubuntu")
-[![Actions Status: Windows](https://github.com/ruby/ruby/workflows/Windows/badge.svg)](https://github.com/ruby/ruby/actions?query=workflow%3A"Windows")
-[![Travis Status](https://app.travis-ci.com/ruby/ruby.svg?branch=master)](https://app.travis-ci.com/ruby/ruby)
+# What's Ruby
 
-# What is Ruby?
-
-Ruby is an interpreted object-oriented programming language often
-used for web development. It also offers many scripting features
-to process plain text and serialized files, or manage system tasks.
-It is simple, straightforward, and extensible.
+Ruby is the interpreted scripting language for quick and easy object-oriented
+programming.  It has many features to process text files and to do system
+management tasks (as in Perl).  It is simple, straight-forward, and
+extensible.
 
 ## Features of Ruby
 
-* Simple Syntax
-* **Normal** Object-oriented Features (e.g. class, method calls)
-* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
-* Operator Overloading
-* Exception Handling
-* Iterators and Closures
-* Garbage Collection
-* Dynamic Loading of Object Files (on some architectures)
-* Highly Portable (works on many Unix-like/POSIX compatible platforms as
-  well as Windows, macOS, etc.) cf.
-    https://docs.ruby-lang.org/en/master/maintainers_md.html#label-Platform+Maintainers
+*   Simple Syntax
+*   **Normal** Object-oriented Features (e.g. class, method calls)
+*   **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
+*   Operator Overloading
+*   Exception Handling
+*   Iterators and Closures
+*   Garbage Collection
+*   Dynamic Loading of Object Files (on some architectures)
+*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
+    well as Windows, Mac OS X, BeOS, etc.) cf.
+    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+
 
 ## How to get Ruby
 
 For a complete list of ways to install Ruby, including using third-party tools
 like rvm, see:
 
-https://www.ruby-lang.org/en/downloads/
+http://www.ruby-lang.org/en/downloads/
 
-You can download release packages and the snapshot of the repository. If you want to
-download whole versions of Ruby, please visit https://www.ruby-lang.org/en/downloads/releases/.
+The Ruby distribution files can be found on the following FTP site:
 
-### Download with Git
+ftp://ftp.ruby-lang.org/pub/ruby/
 
-The mirror of the Ruby source tree can be checked out with the following command:
+The trunk of the Ruby source tree can be checked out with the following
+command:
 
-    $ git clone https://github.com/ruby/ruby.git
+    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
 
-There are some other branches under development. Try the following command
-to see the list of branches:
+Or if you are using git then use the following command:
+
+    $ git clone git://github.com/ruby/ruby.git
 
-    $ git ls-remote https://github.com/ruby/ruby.git
+There are some other branches under development.  Try the following command
+to see the list of branches:
 
-You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
-if you are a committer.
+    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
 
-## How to build
+Or if you are using git then use the following command:
 
-See [Building Ruby](https://docs.ruby-lang.org/en/master/contributing/building_ruby_md.html)
+    $ git ls-remote git://github.com/ruby/ruby.git
 
 ## Ruby home page
 
-https://www.ruby-lang.org/
-
-## Documentation
+The URL of the Ruby home page is:
 
-- [English](https://docs.ruby-lang.org/en/master/index.html)
-- [Japanese](https://docs.ruby-lang.org/ja/master/index.html)
+http://www.ruby-lang.org/
 
 ## Mailing list
 
-There is a mailing list to discuss Ruby. To subscribe to this list, please
+There is a mailing list to talk about Ruby. To subscribe this list, please
 send the following phrase:
 
-    join
+    subscribe
+
+in the mail body (not subject) to the address
+<mailto:ruby-talk-request@ruby-lang.org>.
+
+## How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+1.  If you want to use Microsoft Visual C++ to compile ruby, read
+    win32/README.win32 instead of this document.
+
+2.  If `./configure` does not exist or is older than configure.in, run
+    `autoconf` to (re)generate configure.
+
+3.  Run `./configure`, which will generate `config.h` and `Makefile`.
+
+    Some C compiler flags may be added by default depending on your
+    environment.  Specify `optflags=..` and `warnflags=..` as necessary to
+    override them.
+
+4.  Edit `defines.h` if you need. Usually this step will not be needed.
+
+5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
+    module names if not present), if you want to link modules statically.
 
-in the mail subject (not body) to the address [ruby-talk-request@ml.ruby-lang.org].
+    If you don't want to compile non static extension modules (probably on
+    architectures which do not allow dynamic loading), remove comment mark
+    from the line "`#option nodynamic`" in `ext/Setup`.
 
-[ruby-talk-request@ml.ruby-lang.org]: mailto:ruby-talk-request@ml.ruby-lang.org?subject=join
+    Usually this step will not be needed.
+
+6.  Run `make`.
+
+7.  Optionally, run '`make check`' to check whether the compiled Ruby
+    interpreter works well. If you see the message "`check succeeded`", your
+    ruby works as it should (hopefully).
+
+8.  Run '`make install`'
+
+    This command will create following directories and install files onto
+    them.
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
+    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
+
+    **NOTE**: teeny of the API version may be different from one of Ruby's
+    program version
+
+    You may have to be a super user to install ruby.
+
+
+If you fail to compile ruby, please send the detailed error report with the
+error log and machine/OS type, to help others.
+
+Some extension libraries may not get compiled because of lack of necessary
+external libraries and/or headers, then you will need to run '`make distclean-ext`'
+to remove old configuration after installing them in such case.
 
 ## Copying
 
-See the file [COPYING](rdoc-ref:COPYING).
+See the file `COPYING`.
 
 ## Feedback
 
-Questions about the Ruby language can be asked on the [Ruby-Talk](https://www.ruby-lang.org/en/community/mailing-lists) mailing list
-or on websites like https://stackoverflow.com.
+Questions about the Ruby language can be asked on the Ruby-Talk mailing list
+(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
+(http://stackoverflow.com).
+
+Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
+
+[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
 
-Bugs should be reported at https://bugs.ruby-lang.org. Read ["Reporting Issues"](https://docs.ruby-lang.org/en/master/contributing/reporting_issues_md.html) for more information.
+##Contributing
 
-## Contributing
+See the file `CONTRIBUTING.md`
 
-See ["Contributing to Ruby"](https://docs.ruby-lang.org/en/master/contributing/contributing_md.html), which includes setup and build instructions.
 
 ## The Author
 
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
+1995.
 
-<matz@ruby-lang.org>
+<mailto:matz@ruby-lang.org>
diff --git a/aclocal.m4 b/aclocal.m4
index e69de29bb2..30fccd52fe 100644
--- a/aclocal.m4
+++ b/aclocal.m4
@@ -0,0 +1,46 @@
+# -*- autoconf -*-
+
+AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
+    msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
+    AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
+	msg_begin="`tput smso 2>/dev/null`"
+    	AS_CASE(["$msg_begin"], ['@<:@'*m],
+	    [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
+	    msg_checking="${msg_begin}33m"
+	    AS_IF([test ${TEST_COLORS:+set}], [
+		msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
+		msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
+		msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
+	    ])
+	    msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
+	    msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
+	    msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
+	    msg_reset="${msg_begin}m"
+	    ])
+	AS_UNSET(msg_begin)
+	])
+    AS_REQUIRE_SHELL_FN([colorize_result],
+	[AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
+        [AS_CASE(["$[]1"],
+            [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
+            [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
+            [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
+])
+
+AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+    AS_LITERAL_IF([$1],
+	[m4_case([$1],
+		[yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
+		[no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
+		[AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
+	[colorize_result "$1"]) dnl
+])
+
+AC_DEFUN([AC_CHECKING],[dnl
+AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
+
+AC_DEFUN([AC_MSG_RESULT], [dnl
+{ _AS_ECHO_LOG([result: $1])
+COLORIZE_RESULT([$1]); dnl
+}])
diff --git a/addr2line.c b/addr2line.c
index dc0892e308..c8faf48d62 100644
--- a/addr2line.c
+++ b/addr2line.c
@@ -8,30 +8,14 @@
 
 **********************************************************************/
 
-#if defined(__clang__) && defined(__has_warning)
-#if __has_warning("-Wgnu-empty-initializer")
-#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
-#endif
-#if __has_warning("-Wgcc-compat")
-#pragma clang diagnostic ignored "-Wgcc-compat"
-#endif
-#endif
-
-#include "ruby/internal/config.h"
-#include "ruby/defines.h"
+#include "ruby/config.h"
 #include "ruby/missing.h"
 #include "addr2line.h"
 
 #include <stdio.h>
 #include <errno.h>
 
-#ifdef HAVE_LIBPROC_H
-#include <libproc.h>
-#endif
-
-#include "ruby/internal/stdbool.h"
-
-#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
+#ifdef USE_ELF
 
 #include <fcntl.h>
 #include <limits.h>
@@ -44,11 +28,19 @@
 #include <sys/stat.h>
 #include <unistd.h>
 
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+
 /* Make alloca work the best possible way.  */
 #ifdef __GNUC__
-# ifndef alloca
-#  define alloca __builtin_alloca
-# endif
+# ifndef atarist
+#  ifndef alloca
+#   define alloca __builtin_alloca
+#  endif
+# endif	/* atarist */
 #else
 # ifdef HAVE_ALLOCA_H
 #  include <alloca.h>
@@ -56,44 +48,35 @@
 #  ifdef _AIX
 #pragma alloca
 #  else
-#   ifndef alloca                /* predefined by HP cc +Olibcalls */
+#   ifndef alloca		/* predefined by HP cc +Olibcalls */
 void *alloca();
 #   endif
 #  endif /* AIX */
-# endif        /* HAVE_ALLOCA_H */
-# ifndef UNREACHABLE
-#  define UNREACHABLE __builtin_unreachable()
-# endif
-# ifndef UNREACHABLE_RETURN
-#  define UNREACHABLE_RETURN(_) __builtin_unreachable()
-# endif
+# endif	/* HAVE_ALLOCA_H */
 #endif /* __GNUC__ */
 
-#ifndef UNREACHABLE
-# define UNREACHABLE abort()
-#endif
-#ifndef UNREACHABLE_RETURN
-# define UNREACHABLE_RETURN(_) return (abort(), (_))
-#endif
-
 #ifdef HAVE_DLADDR
 # include <dlfcn.h>
 #endif
 
-#ifdef HAVE_MACH_O_LOADER_H
-# include <crt_externs.h>
-# include <mach-o/fat.h>
-# include <mach-o/loader.h>
-# include <mach-o/nlist.h>
-# include <mach-o/stab.h>
-#endif
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
 
-#ifdef USE_ELF
-# ifdef __OpenBSD__
-#  include <elf_abi.h>
-# else
-#  include <elf.h>
-# endif
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
 
 #ifndef ElfW
 # if SIZEOF_VOIDP == 8
@@ -109,44 +92,13 @@ void *alloca();
 #  define ELF_ST_TYPE ELF32_ST_TYPE
 # endif
 #endif
-#endif
-
-#ifdef SHF_COMPRESSED
-# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
-   /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
-#  include <zlib.h>
-#  define SUPPORT_COMPRESSED_DEBUG_LINE
-# endif
-#else /* compatibility with glibc < 2.22 */
-# define SHF_COMPRESSED 0
-#endif
-
 #ifndef PATH_MAX
 #define PATH_MAX 4096
 #endif
 
-#define DW_LNS_copy                     0x01
-#define DW_LNS_advance_pc               0x02
-#define DW_LNS_advance_line             0x03
-#define DW_LNS_set_file                 0x04
-#define DW_LNS_set_column               0x05
-#define DW_LNS_negate_stmt              0x06
-#define DW_LNS_set_basic_block          0x07
-#define DW_LNS_const_add_pc             0x08
-#define DW_LNS_fixed_advance_pc         0x09
-#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
-#define DW_LNS_set_isa                  0x0c /* DWARF3 */
-
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence             0x01
-#define DW_LNE_set_address              0x02
-#define DW_LNE_define_file              0x03
-#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
-
-#define kprintf(...) fprintf(errout, "" __VA_ARGS__)
+int kprintf(const char *fmt, ...);
 
-typedef struct line_info {
+typedef struct {
     const char *dirname;
     const char *filename;
     const char *path; /* object path */
@@ -155,1912 +107,368 @@ typedef struct line_info {
     uintptr_t base_addr;
     uintptr_t saddr;
     const char *sname; /* function name */
-
-    struct line_info *next;
 } line_info_t;
-
-struct dwarf_section {
-    char *ptr;
-    size_t size;
-    uint64_t flags;
-};
-
-typedef struct obj_info {
+typedef struct obj_info obj_info_t;
+struct obj_info {
     const char *path; /* object path */
-    char *mapped;
+    int fd;
+    void *mapped;
     size_t mapped_size;
-    void *uncompressed;
     uintptr_t base_addr;
-    uintptr_t vmaddr;
-    struct dwarf_section debug_abbrev;
-    struct dwarf_section debug_info;
-    struct dwarf_section debug_line;
-    struct dwarf_section debug_ranges;
-    struct dwarf_section debug_str_offsets;
-    struct dwarf_section debug_addr;
-    struct dwarf_section debug_rnglists;
-    struct dwarf_section debug_str;
-    struct dwarf_section debug_line_str;
-    struct obj_info *next;
-} obj_info_t;
-
-#define DWARF_SECTION_COUNT 9
-
-static struct dwarf_section *
-obj_dwarf_section_at(obj_info_t *obj, int n)
-{
-    struct dwarf_section *ary[] = {
-        &obj->debug_abbrev,
-        &obj->debug_info,
-        &obj->debug_line,
-        &obj->debug_ranges,
-        &obj->debug_str_offsets,
-        &obj->debug_addr,
-        &obj->debug_rnglists,
-        &obj->debug_str,
-        &obj->debug_line_str
-    };
-    if (n < 0 || DWARF_SECTION_COUNT <= n) {
-        UNREACHABLE_RETURN(0);
-    }
-    return ary[n];
-}
-
-struct debug_section_definition {
-    const char *name;
-    struct dwarf_section *dwarf;
+    obj_info_t *next;
 };
 
 /* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX + 1];
+static char binary_filename[PATH_MAX];
 
 static unsigned long
-uleb128(const char **p)
+uleb128(char **p)
 {
     unsigned long r = 0;
     int s = 0;
     for (;;) {
-        unsigned char b = (unsigned char)*(*p)++;
-        if (b < 0x80) {
-            r += (unsigned long)b << s;
-            break;
-        }
-        r += (b & 0x7f) << s;
-        s += 7;
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    r += (unsigned long)b << s;
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
     }
     return r;
 }
 
 static long
-sleb128(const char **p)
+sleb128(char **p)
 {
     long r = 0;
     int s = 0;
     for (;;) {
-        unsigned char b = (unsigned char)*(*p)++;
-        if (b < 0x80) {
-            if (b & 0x40) {
-                r -= (0x80 - b) << s;
-            }
-            else {
-                r += (b & 0x3f) << s;
-            }
-            break;
-        }
-        r += (b & 0x7f) << s;
-        s += 7;
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    if (b & 0x40) {
+		r -= (0x80 - b) << s;
+	    }
+	    else {
+		r += (b & 0x3f) << s;
+	    }
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
     }
     return r;
 }
 
 static const char *
-get_nth_dirname(unsigned long dir, const char *p, FILE *errout)
+get_nth_dirname(unsigned long dir, char *p)
 {
     if (!dir--) {
-        return "";
+	return "";
     }
     while (dir--) {
-        while (*p) p++;
-        p++;
-        if (!*p) {
-            kprintf("Unexpected directory number %lu in %s\n",
-                    dir, binary_filename);
-            return "";
-        }
+	while (*p) p++;
+	p++;
+	if (!*p) {
+	    kprintf("Unexpected directory number %lu in %s\n",
+		    dir, binary_filename);
+	    return "";
+	}
     }
     return p;
 }
 
-static const char *parse_ver5_debug_line_header(
-    const char *p, int idx, uint8_t format,
-    obj_info_t *obj, const char **out_path,
-    uint64_t *out_directory_index, FILE *errout);
-
 static void
-fill_filename(int file, uint8_t format, uint16_t version, const char *include_directories,
-              const char *filenames, line_info_t *line, obj_info_t *obj, FILE *errout)
+fill_filename(int file, char *include_directories, char *filenames,
+	      line_info_t *line)
 {
     int i;
-    const char *p = filenames;
-    const char *filename;
+    char *p = filenames;
+    char *filename;
     unsigned long dir;
-    if (version >= 5) {
-        const char *path;
-        uint64_t directory_index = -1;
-        parse_ver5_debug_line_header(filenames, file, format, obj, &path, &directory_index, errout);
-        line->filename = path;
-        parse_ver5_debug_line_header(include_directories, (int)directory_index, format, obj, &path, NULL, errout);
-        line->dirname = path;
-    }
-    else {
-        for (i = 1; i <= file; i++) {
-            filename = p;
-            if (!*p) {
-#ifndef __APPLE__
-                /* Need to output binary file name? */
-                kprintf("Unexpected file number %d in %s at %tx\n",
-                        file, binary_filename, filenames - obj->mapped);
-#endif
-                return;
-            }
-            while (*p) p++;
-            p++;
-            dir = uleb128(&p);
-            /* last modified. */
-            uleb128(&p);
-            /* size of the file. */
-            uleb128(&p);
-
-            if (i == file) {
-                line->filename = filename;
-                line->dirname = get_nth_dirname(dir, include_directories, errout);
-            }
-        }
+    for (i = 1; i <= file; i++) {
+	filename = p;
+	if (!*p) {
+	    /* Need to output binary file name? */
+	    kprintf("Unexpected file number %d in %s\n",
+		    file, binary_filename);
+	    return;
+	}
+	while (*p) p++;
+	p++;
+	dir = uleb128(&p);
+	/* last modified. */
+	uleb128(&p);
+	/* size of the file. */
+	uleb128(&p);
+
+	if (i == file) {
+	    line->filename = filename;
+	    line->dirname = get_nth_dirname(dir, include_directories);
+	}
     }
 }
 
 static void
 fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
-          uint8_t format, uint16_t version, const char *include_directories, const char *filenames,
-          obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+	  char *include_directories, char *filenames,
+	  obj_info_t *obj, line_info_t *lines, int offset)
 {
     int i;
-    addr += obj->base_addr - obj->vmaddr;
+    addr += obj->base_addr;
     for (i = offset; i < num_traces; i++) {
-        uintptr_t a = (uintptr_t)traces[i];
-        /* We assume one line code doesn't result >100 bytes of native code.
+	uintptr_t a = (uintptr_t)traces[i];
+	/* We assume one line code doesn't result >100 bytes of native code.
        We may want more reliable way eventually... */
-        if (addr < a && a < addr + 100) {
-            fill_filename(file, format, version, include_directories, filenames, &lines[i], obj, errout);
-            lines[i].line = line;
-        }
+	if (addr < a && a < addr + 100) {
+	    fill_filename(file, include_directories, filenames, &lines[i]);
+	    lines[i].line = line;
+	}
     }
 }
 
-struct LineNumberProgramHeader {
-    uint64_t unit_length;
-    uint16_t version;
-    uint8_t format; /* 4 or 8 */
-    uint64_t header_length;
-    uint8_t minimum_instruction_length;
-    uint8_t maximum_operations_per_instruction;
-    uint8_t default_is_stmt;
-    int8_t line_base;
-    uint8_t line_range;
-    uint8_t opcode_base;
-    /* uint8_t standard_opcode_lengths[opcode_base-1]; */
-    const char *include_directories;
-    const char *filenames;
-    const char *cu_start;
-    const char *cu_end;
-};
-
-static int
-parse_debug_line_header(obj_info_t *obj, const char **pp, struct LineNumberProgramHeader *header, FILE *errout)
+static void
+parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
+		obj_info_t *obj, line_info_t *lines, int offset)
 {
-    const char *p = *pp;
-    header->unit_length = *(uint32_t *)p;
-    p += sizeof(uint32_t);
-
-    header->format = 4;
-    if (header->unit_length == 0xffffffff) {
-        header->unit_length = *(uint64_t *)p;
-        p += sizeof(uint64_t);
-        header->format = 8;
-    }
+    char *p, *cu_end, *cu_start, *include_directories, *filenames;
+    unsigned long unit_length;
+    int default_is_stmt, line_base;
+    unsigned int header_length, minimum_instruction_length, line_range,
+		 opcode_base;
+    /* unsigned char *standard_opcode_lengths; */
 
-    header->cu_end = p + header->unit_length;
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
 
-    header->version = *(uint16_t *)p;
-    p += sizeof(uint16_t);
-    if (header->version > 5) return -1;
+    p = *debug_line;
 
-    if (header->version >= 5) {
-        /* address_size = *(uint8_t *)p++; */
-        /* segment_selector_size = *(uint8_t *)p++; */
-        p += 2;
+    unit_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+    if (unit_length == 0xffffffff) {
+	unit_length = *(unsigned long *)p;
+	p += sizeof(unsigned long);
     }
 
-    header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
-    p += header->format;
-    header->cu_start = p + header->header_length;
+    cu_end = p + unit_length;
 
-    header->minimum_instruction_length = *(uint8_t *)p++;
+    /*dwarf_version = *(unsigned short *)p;*/
+    p += 2;
 
-    if (header->version >= 4) {
-        /* maximum_operations_per_instruction = *(uint8_t *)p; */
-        if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
-        p++;
-    }
+    header_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
 
-    header->default_is_stmt = *(uint8_t *)p++;
-    header->line_base = *(int8_t *)p++;
-    header->line_range = *(uint8_t *)p++;
-    header->opcode_base = *(uint8_t *)p++;
-    /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
-    p += header->opcode_base - 1;
-
-    if (header->version >= 5) {
-        header->include_directories = p;
-        p = parse_ver5_debug_line_header(p, -1, header->format, obj, NULL, NULL, errout);
-        header->filenames = p;
-    }
-    else {
-        header->include_directories = p;
+    cu_start = p + header_length;
 
-        /* temporary measure for compress-debug-sections */
-        if (p >= header->cu_end) return -1;
+    minimum_instruction_length = *(unsigned char *)p;
+    p++;
 
-        /* skip include directories */
-        while (*p) {
-            p = memchr(p, '\0', header->cu_end - p);
-            if (!p) return -1;
-            p++;
-        }
-        p++;
+    is_stmt = default_is_stmt = *(unsigned char *)p;
+    p++;
 
-        header->filenames = p;
-    }
+    line_base = *(signed char *)p;
+    p++;
 
-    *pp = header->cu_start;
+    line_range = *(unsigned char *)p;
+    p++;
 
-    return 0;
-}
+    opcode_base = *(unsigned char *)p;
+    p++;
 
-static int
-parse_debug_line_cu(int num_traces, void **traces, const char **debug_line,
-                obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
-{
-    const char *p = (const char *)*debug_line;
-    struct LineNumberProgramHeader header;
+    /* standard_opcode_lengths = (unsigned char *)p - 1; */
+    p += opcode_base - 1;
 
-    /* The registers. */
-    unsigned long addr = 0;
-    unsigned int file = 1;
-    unsigned int line = 1;
-    /* unsigned int column = 0; */
-    int is_stmt;
-    /* int basic_block = 0; */
-    /* int end_sequence = 0; */
-    /* int prologue_end = 0; */
-    /* int epilogue_begin = 0; */
-    /* unsigned int isa = 0; */
+    include_directories = p;
+
+    /* skip include directories */
+    while (*p) {
+	while (*p) p++;
+	p++;
+    }
+    p++;
 
-    if (parse_debug_line_header(obj, &p, &header, errout))
-        return -1;
-    is_stmt = header.default_is_stmt;
-
-#define FILL_LINE()                                                 \
-    do {                                                            \
-        fill_line(num_traces, traces, addr, file, line,             \
-                  header.format,                                    \
-                  header.version,                                   \
-                  header.include_directories,                       \
-                  header.filenames,                                 \
-                  obj, lines, offset, errout);                      \
-        /*basic_block = prologue_end = epilogue_begin = 0;*/        \
+    filenames = p;
+
+    p = cu_start;
+
+#define FILL_LINE()						    \
+    do {							    \
+	fill_line(num_traces, traces, addr, file, line,		    \
+		  include_directories, filenames,		    \
+		  obj, lines, offset);				    \
+	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
     } while (0)
 
-    while (p < header.cu_end) {
-        unsigned long a;
-        unsigned char op = *p++;
-        switch (op) {
-        case DW_LNS_copy:
-            FILL_LINE();
-            break;
-        case DW_LNS_advance_pc:
-            a = uleb128(&p) * header.minimum_instruction_length;
-            addr += a;
-            break;
-        case DW_LNS_advance_line: {
-            long a = sleb128(&p);
-            line += a;
-            break;
-        }
-        case DW_LNS_set_file:
-            file = (unsigned int)uleb128(&p);
-            break;
-        case DW_LNS_set_column:
-            /*column = (unsigned int)*/(void)uleb128(&p);
-            break;
-        case DW_LNS_negate_stmt:
-            is_stmt = !is_stmt;
-            break;
-        case DW_LNS_set_basic_block:
-            /*basic_block = 1; */
-            break;
-        case DW_LNS_const_add_pc:
-            a = ((255UL - header.opcode_base) / header.line_range) *
-                header.minimum_instruction_length;
-            addr += a;
-            break;
-        case DW_LNS_fixed_advance_pc:
-            a = *(uint16_t *)p;
-            p += sizeof(uint16_t);
-            addr += a;
-            break;
-        case DW_LNS_set_prologue_end:
-            /* prologue_end = 1; */
-            break;
-        case DW_LNS_set_epilogue_begin:
-            /* epilogue_begin = 1; */
-            break;
-        case DW_LNS_set_isa:
-            /* isa = (unsigned int)*/(void)uleb128(&p);
-            break;
-        case 0:
-            a = uleb128(&p);
-            op = *p++;
-            switch (op) {
-            case DW_LNE_end_sequence:
-                /* end_sequence = 1; */
-                FILL_LINE();
-                addr = 0;
-                file = 1;
-                line = 1;
-                /* column = 0; */
-                is_stmt = header.default_is_stmt;
-                /* end_sequence = 0; */
-                /* isa = 0; */
-                break;
-            case DW_LNE_set_address:
-                addr = *(unsigned long *)p;
-                p += sizeof(unsigned long);
-                break;
-            case DW_LNE_define_file:
-                kprintf("Unsupported operation in %s\n",
-                        binary_filename);
-                break;
-            case DW_LNE_set_discriminator:
-                /* TODO:currently ignore */
-                uleb128(&p);
-                break;
-            default:
-                kprintf("Unknown extended opcode: %d in %s\n",
-                        op, binary_filename);
-            }
-            break;
-        default: {
-            uint8_t adjusted_opcode = op - header.opcode_base;
-            uint8_t operation_advance = adjusted_opcode / header.line_range;
-            /* NOTE: this code doesn't support VLIW */
-            addr += operation_advance * header.minimum_instruction_length;
-            line += header.line_base + (adjusted_opcode % header.line_range);
-            FILL_LINE();
-        }
-        }
-    }
-    *debug_line = (char *)p;
-    return 0;
+    while (p < cu_end) {
+	unsigned long a;
+	unsigned char op = *p++;
+	switch (op) {
+	case DW_LNS_copy:
+	    FILL_LINE();
+	    break;
+	case DW_LNS_advance_pc:
+	    a = uleb128(&p);
+	    addr += a;
+	    break;
+	case DW_LNS_advance_line: {
+	    long a = sleb128(&p);
+	    line += a;
+	    break;
+	}
+	case DW_LNS_set_file:
+	    file = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_set_column:
+	    /*column = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case DW_LNS_negate_stmt:
+	    is_stmt = !is_stmt;
+	    break;
+	case DW_LNS_set_basic_block:
+	    /*basic_block = 1; */
+	    break;
+	case DW_LNS_const_add_pc:
+	    a = ((255 - opcode_base) / line_range) *
+		minimum_instruction_length;
+	    addr += a;
+	    break;
+	case DW_LNS_fixed_advance_pc:
+	    a = *(unsigned char *)p++;
+	    addr += a;
+	    break;
+	case DW_LNS_set_prologue_end:
+	    /* prologue_end = 1; */
+	    break;
+	case DW_LNS_set_epilogue_begin:
+	    /* epilogue_begin = 1; */
+	    break;
+	case DW_LNS_set_isa:
+	    /* isa = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case 0:
+	    a = *(unsigned char *)p++;
+	    op = *p++;
+	    switch (op) {
+	    case DW_LNE_end_sequence:
+		/* end_sequence = 1; */
+		FILL_LINE();
+		addr = 0;
+		file = 1;
+		line = 1;
+		/* column = 0; */
+		is_stmt = default_is_stmt;
+		/* end_sequence = 0; */
+		/* isa = 0; */
+		break;
+	    case DW_LNE_set_address:
+		addr = *(unsigned long *)p;
+		p += sizeof(unsigned long);
+		break;
+	    case DW_LNE_define_file:
+		kprintf("Unsupported operation in %s\n",
+			binary_filename);
+		break;
+	    case DW_LNE_set_discriminator:
+		/* TODO:currently ignore */
+		uleb128(&p);
+		break;
+	    default:
+		kprintf("Unknown extended opcode: %d in %s\n",
+			op, binary_filename);
+	    }
+	    break;
+	default: {
+	    unsigned long addr_incr;
+	    unsigned long line_incr;
+	    a = op - opcode_base;
+	    addr_incr = (a / line_range) * minimum_instruction_length;
+	    line_incr = line_base + (a % line_range);
+	    addr += (unsigned int)addr_incr;
+	    line += (unsigned int)line_incr;
+	    FILL_LINE();
+	}
+	}
+    }
+    *debug_line = p;
 }
 
-static int
+static void
 parse_debug_line(int num_traces, void **traces,
-                 const char *debug_line, unsigned long size,
-                 obj_info_t *obj, line_info_t *lines, int offset, FILE *errout)
+		 char *debug_line, unsigned long size,
+		 obj_info_t *obj, line_info_t *lines, int offset)
 {
-    const char *debug_line_end = debug_line + size;
+    char *debug_line_end = debug_line + size;
     while (debug_line < debug_line_end) {
-        if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset, errout))
-            return -1;
+	parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
     }
     if (debug_line != debug_line_end) {
-        kprintf("Unexpected size of .debug_line in %s\n",
-                binary_filename);
+	kprintf("Unexpected size of .debug_line in %s\n",
+		binary_filename);
     }
-    return 0;
 }
 
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout);
+	   obj_info_t **objp, line_info_t *lines, int offset);
 
 static void
-append_obj(obj_info_t **objp)
-{
+append_obj(obj_info_t **objp) {
     obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
     if (*objp) (*objp)->next = newobj;
     *objp = newobj;
 }
 
-#ifdef USE_ELF
-/* Ideally we should check 4 paths to follow gnu_debuglink:
- *
- *   - /usr/lib/debug/.build-id/ab/cdef1234.debug
- *   - /usr/bin/ruby.debug
- *   - /usr/bin/.debug/ruby.debug
- *   - /usr/lib/debug/usr/bin/ruby.debug.
- *
- * but we handle only two cases for now as the two formats are
- * used by some linux distributions.
- *
- * See GDB's info for detail.
- * https://sourceware.org/gdb/onlinedocs/gdb/Separate-Debug-Files.html
- */
-
-// check the path pattern of "/usr/lib/debug/usr/bin/ruby.debug"
 static void
-follow_debuglink(const char *debuglink, int num_traces, void **traces,
-                 obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+follow_debuglink(char *debuglink, int num_traces, void **traces,
+		 obj_info_t **objp, line_info_t *lines, int offset)
 {
+    /* Ideally we should check 4 paths to follow gnu_debuglink,
+       but we handle only one case for now as this format is used
+       by some linux distributions. See GDB's info for detail. */
     static const char global_debug_dir[] = "/usr/lib/debug";
-    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
-    char *p;
+    char *p, *subdir;
     obj_info_t *o1 = *objp, *o2;
-    size_t len;
 
     p = strrchr(binary_filename, '/');
     if (!p) {
-        return;
+	return;
     }
     p[1] = '\0';
 
-    len = strlen(binary_filename);
-    if (len >= PATH_MAX - global_debug_dir_len)
-        len = PATH_MAX - global_debug_dir_len - 1;
-    memmove(binary_filename + global_debug_dir_len, binary_filename, len);
-    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
-    len += global_debug_dir_len;
-    strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+    subdir = (char *)alloca(strlen(binary_filename) + 1);
+    strcpy(subdir, binary_filename);
+    strcpy(binary_filename, global_debug_dir);
+    strlcat(binary_filename, subdir, PATH_MAX);
+    strlcat(binary_filename, debuglink, PATH_MAX);
 
     append_obj(objp);
     o2 = *objp;
     o2->base_addr = o1->base_addr;
     o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
-}
-
-// check the path pattern of "/usr/lib/debug/.build-id/ab/cdef1234.debug"
-static void
-follow_debuglink_build_id(const char *build_id, size_t build_id_size, int num_traces, void **traces,
-                          obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
-{
-    static const char global_debug_dir[] = "/usr/lib/debug/.build-id/";
-    const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
-    char *p;
-    obj_info_t *o1 = *objp, *o2;
-    size_t i;
-
-    if (PATH_MAX < global_debug_dir_len + 1 + build_id_size * 2 + 6) return;
-
-    memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
-    p = binary_filename + global_debug_dir_len;
-    for (i = 0; i < build_id_size; i++) {
-        static const char tbl[] = "0123456789abcdef";
-        unsigned char n = build_id[i];
-        *p++ = tbl[n / 16];
-        *p++ = tbl[n % 16];
-        if (i == 0) *p++ = '/';
-    }
-    strcpy(p, ".debug");
-
-    append_obj(objp);
-    o2 = *objp;
-    o2->base_addr = o1->base_addr;
-    o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset, errout);
-}
-#endif
-
-enum
-{
-    DW_TAG_compile_unit = 0x11,
-    DW_TAG_inlined_subroutine = 0x1d,
-    DW_TAG_subprogram = 0x2e,
-};
-
-/* Attributes encodings */
-enum
-{
-    DW_AT_sibling = 0x01,
-    DW_AT_location = 0x02,
-    DW_AT_name = 0x03,
-    /* Reserved 0x04 */
-    /* Reserved 0x05 */
-    /* Reserved 0x06 */
-    /* Reserved 0x07 */
-    /* Reserved 0x08 */
-    DW_AT_ordering = 0x09,
-    /* Reserved 0x0a */
-    DW_AT_byte_size = 0x0b,
-    /* Reserved 0x0c */
-    DW_AT_bit_size = 0x0d,
-    /* Reserved 0x0e */
-    /* Reserved 0x0f */
-    DW_AT_stmt_list = 0x10,
-    DW_AT_low_pc = 0x11,
-    DW_AT_high_pc = 0x12,
-    DW_AT_language = 0x13,
-    /* Reserved 0x14 */
-    DW_AT_discr = 0x15,
-    DW_AT_discr_value = 0x16,
-    DW_AT_visibility = 0x17,
-    DW_AT_import = 0x18,
-    DW_AT_string_length = 0x19,
-    DW_AT_common_reference = 0x1a,
-    DW_AT_comp_dir = 0x1b,
-    DW_AT_const_value = 0x1c,
-    DW_AT_containing_type = 0x1d,
-    DW_AT_default_value = 0x1e,
-    /* Reserved 0x1f */
-    DW_AT_inline = 0x20,
-    DW_AT_is_optional = 0x21,
-    DW_AT_lower_bound = 0x22,
-    /* Reserved 0x23 */
-    /* Reserved 0x24 */
-    DW_AT_producer = 0x25,
-    /* Reserved 0x26 */
-    DW_AT_prototyped = 0x27,
-    /* Reserved 0x28 */
-    /* Reserved 0x29 */
-    DW_AT_return_addr = 0x2a,
-    /* Reserved 0x2b */
-    DW_AT_start_scope = 0x2c,
-    /* Reserved 0x2d */
-    DW_AT_bit_stride = 0x2e,
-    DW_AT_upper_bound = 0x2f,
-    /* Reserved 0x30 */
-    DW_AT_abstract_origin = 0x31,
-    DW_AT_accessibility = 0x32,
-    DW_AT_address_class = 0x33,
-    DW_AT_artificial = 0x34,
-    DW_AT_base_types = 0x35,
-    DW_AT_calling_convention = 0x36,
-    DW_AT_count = 0x37,
-    DW_AT_data_member_location = 0x38,
-    DW_AT_decl_column = 0x39,
-    DW_AT_decl_file = 0x3a,
-    DW_AT_decl_line = 0x3b,
-    DW_AT_declaration = 0x3c,
-    DW_AT_discr_list = 0x3d,
-    DW_AT_encoding = 0x3e,
-    DW_AT_external = 0x3f,
-    DW_AT_frame_base = 0x40,
-    DW_AT_friend = 0x41,
-    DW_AT_identifier_case = 0x42,
-    /* Reserved 0x43 */
-    DW_AT_namelist_item = 0x44,
-    DW_AT_priority = 0x45,
-    DW_AT_segment = 0x46,
-    DW_AT_specification = 0x47,
-    DW_AT_static_link = 0x48,
-    DW_AT_type = 0x49,
-    DW_AT_use_location = 0x4a,
-    DW_AT_variable_parameter = 0x4b,
-    DW_AT_virtuality = 0x4c,
-    DW_AT_vtable_elem_location = 0x4d,
-    DW_AT_allocated = 0x4e,
-    DW_AT_associated = 0x4f,
-    DW_AT_data_location = 0x50,
-    DW_AT_byte_stride = 0x51,
-    DW_AT_entry_pc = 0x52,
-    DW_AT_use_UTF8 = 0x53,
-    DW_AT_extension = 0x54,
-    DW_AT_ranges = 0x55,
-    DW_AT_trampoline = 0x56,
-    DW_AT_call_column = 0x57,
-    DW_AT_call_file = 0x58,
-    DW_AT_call_line = 0x59,
-    DW_AT_description = 0x5a,
-    DW_AT_binary_scale = 0x5b,
-    DW_AT_decimal_scale = 0x5c,
-    DW_AT_small = 0x5d,
-    DW_AT_decimal_sign = 0x5e,
-    DW_AT_digit_count = 0x5f,
-    DW_AT_picture_string = 0x60,
-    DW_AT_mutable = 0x61,
-    DW_AT_threads_scaled = 0x62,
-    DW_AT_explicit = 0x63,
-    DW_AT_object_pointer = 0x64,
-    DW_AT_endianity = 0x65,
-    DW_AT_elemental = 0x66,
-    DW_AT_pure = 0x67,
-    DW_AT_recursive = 0x68,
-    DW_AT_signature = 0x69,
-    DW_AT_main_subprogram = 0x6a,
-    DW_AT_data_bit_offset = 0x6b,
-    DW_AT_const_expr = 0x6c,
-    DW_AT_enum_class = 0x6d,
-    DW_AT_linkage_name = 0x6e,
-    DW_AT_string_length_bit_size = 0x6f,
-    DW_AT_string_length_byte_size = 0x70,
-    DW_AT_rank = 0x71,
-    DW_AT_str_offsets_base = 0x72,
-    DW_AT_addr_base = 0x73,
-    DW_AT_rnglists_base = 0x74,
-    /* Reserved 0x75 */
-    DW_AT_dwo_name = 0x76,
-    DW_AT_reference = 0x77,
-    DW_AT_rvalue_reference = 0x78,
-    DW_AT_macros = 0x79,
-    DW_AT_call_all_calls = 0x7a,
-    DW_AT_call_all_source_calls = 0x7b,
-    DW_AT_call_all_tail_calls = 0x7c,
-    DW_AT_call_return_pc = 0x7d,
-    DW_AT_call_value = 0x7e,
-    DW_AT_call_origin = 0x7f,
-    DW_AT_call_parameter = 0x80,
-    DW_AT_call_pc = 0x81,
-    DW_AT_call_tail_call = 0x82,
-    DW_AT_call_target = 0x83,
-    DW_AT_call_target_clobbered = 0x84,
-    DW_AT_call_data_location = 0x85,
-    DW_AT_call_data_value = 0x86,
-    DW_AT_noreturn = 0x87,
-    DW_AT_alignment = 0x88,
-    DW_AT_export_symbols = 0x89,
-    DW_AT_deleted = 0x8a,
-    DW_AT_defaulted = 0x8b,
-    DW_AT_loclists_base = 0x8c,
-    DW_AT_lo_user = 0x2000,
-    DW_AT_hi_user = 0x3fff
-};
-
-/* Attribute form encodings */
-enum
-{
-    DW_FORM_addr = 0x01,
-    /* Reserved 0x02 */
-    DW_FORM_block2 = 0x03,
-    DW_FORM_block4 = 0x04,
-    DW_FORM_data2 = 0x05,
-    DW_FORM_data4 = 0x06,
-    DW_FORM_data8 = 0x07,
-    DW_FORM_string = 0x08,
-    DW_FORM_block = 0x09,
-    DW_FORM_block1 = 0x0a,
-    DW_FORM_data1 = 0x0b,
-    DW_FORM_flag = 0x0c,
-    DW_FORM_sdata = 0x0d,
-    DW_FORM_strp = 0x0e,
-    DW_FORM_udata = 0x0f,
-    DW_FORM_ref_addr = 0x10,
-    DW_FORM_ref1 = 0x11,
-    DW_FORM_ref2 = 0x12,
-    DW_FORM_ref4 = 0x13,
-    DW_FORM_ref8 = 0x14,
-    DW_FORM_ref_udata = 0x15,
-    DW_FORM_indirect = 0x16,
-    DW_FORM_sec_offset = 0x17,
-    DW_FORM_exprloc = 0x18,
-    DW_FORM_flag_present = 0x19,
-    DW_FORM_strx = 0x1a,
-    DW_FORM_addrx = 0x1b,
-    DW_FORM_ref_sup4 = 0x1c,
-    DW_FORM_strp_sup = 0x1d,
-    DW_FORM_data16 = 0x1e,
-    DW_FORM_line_strp = 0x1f,
-    DW_FORM_ref_sig8 = 0x20,
-    DW_FORM_implicit_const = 0x21,
-    DW_FORM_loclistx = 0x22,
-    DW_FORM_rnglistx = 0x23,
-    DW_FORM_ref_sup8 = 0x24,
-    DW_FORM_strx1 = 0x25,
-    DW_FORM_strx2 = 0x26,
-    DW_FORM_strx3 = 0x27,
-    DW_FORM_strx4 = 0x28,
-    DW_FORM_addrx1 = 0x29,
-    DW_FORM_addrx2 = 0x2a,
-    DW_FORM_addrx3 = 0x2b,
-    DW_FORM_addrx4 = 0x2c,
-
-    /* GNU extensions for referring to .gnu_debugaltlink dwz-compressed info */
-    DW_FORM_GNU_ref_alt = 0x1f20,
-    DW_FORM_GNU_strp_alt = 0x1f21
-};
-
-/* Range list entry encodings */
-enum {
-    DW_RLE_end_of_list = 0x00,
-    DW_RLE_base_addressx = 0x01,
-    DW_RLE_startx_endx = 0x02,
-    DW_RLE_startx_length = 0x03,
-    DW_RLE_offset_pair = 0x04,
-    DW_RLE_base_address = 0x05,
-    DW_RLE_start_end = 0x06,
-    DW_RLE_start_length = 0x07
-};
-
-enum {
-    VAL_none = 0,
-    VAL_cstr = 1,
-    VAL_data = 2,
-    VAL_uint = 3,
-    VAL_int = 4,
-    VAL_addr = 5
-};
-
-# define ABBREV_TABLE_SIZE 256
-typedef struct {
-    obj_info_t *obj;
-    const char *file;
-    uint8_t current_version;
-    const char *current_cu;
-    uint64_t current_low_pc;
-    uint64_t current_str_offsets_base;
-    uint64_t current_addr_base;
-    uint64_t current_rnglists_base;
-    const char *debug_line_cu_end;
-    uint8_t debug_line_format;
-    uint16_t debug_line_version;
-    const char *debug_line_files;
-    const char *debug_line_directories;
-    const char *p;
-    const char *cu_end;
-    const char *pend;
-    const char *q0;
-    const char *q;
-    int format; // 4 or 8
-    uint8_t address_size;
-    int level;
-    const char *abbrev_table[ABBREV_TABLE_SIZE];
-} DebugInfoReader;
-
-typedef struct {
-    ptrdiff_t pos;
-    int tag;
-    int has_children;
-} DIE;
-
-typedef struct {
-    union {
-        const char *ptr;
-        uint64_t uint64;
-        int64_t int64;
-        uint64_t addr_idx;
-    } as;
-    uint64_t off;
-    uint64_t at;
-    uint64_t form;
-    size_t size;
-    int type;
-} DebugInfoValue;
-
-#if defined(WORDS_BIGENDIAN)
-#define MERGE_2INTS(a,b,sz) (((uint64_t)(a)<<sz)|(b))
-#else
-#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
-#endif
-
-static uint16_t
-get_uint16(const uint8_t *p)
-{
-    return (uint16_t)MERGE_2INTS(p[0],p[1],8);
-}
-
-static uint32_t
-get_uint32(const uint8_t *p)
-{
-    return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
-}
-
-static uint64_t
-get_uint64(const uint8_t *p)
-{
-    return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
-}
-
-static uint8_t
-read_uint8(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 1);
-    return (uint8_t)*p;
-}
-
-static uint16_t
-read_uint16(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 2);
-    return get_uint16((const uint8_t *)p);
-}
-
-static uint32_t
-read_uint24(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 3);
-    return ((uint8_t)*p << 16) | get_uint16((const uint8_t *)p+1);
-}
-
-static uint32_t
-read_uint32(const char **ptr)
-{
-    const char *p = *ptr;
-    *ptr = (p + 4);
-    return get_uint32((const uint8_t *)p);
-}
-
-static uint64_t
-read_uint64(const char **ptr)
-{
-    const unsigned char *p = (const unsigned char *)*ptr;
-    *ptr = (char *)(p + 8);
-    return get_uint64(p);
-}
-
-static uintptr_t
-read_uintptr(const char **ptr)
-{
-    const unsigned char *p = (const unsigned char *)*ptr;
-    *ptr = (char *)(p + SIZEOF_VOIDP);
-#if SIZEOF_VOIDP == 8
-    return get_uint64(p);
-#else
-    return get_uint32(p);
-#endif
-}
-
-static uint64_t
-read_uint(DebugInfoReader *reader)
-{
-    if (reader->format == 4) {
-        return read_uint32(&reader->p);
-    } else { /* 64 bit */
-        return read_uint64(&reader->p);
-    }
-}
-
-static uint64_t
-read_uleb128(DebugInfoReader *reader)
-{
-    return uleb128(&reader->p);
-}
-
-static int64_t
-read_sleb128(DebugInfoReader *reader)
-{
-    return sleb128(&reader->p);
-}
-
-static void
-debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
-{
-    reader->file = obj->mapped;
-    reader->obj = obj;
-    reader->p = obj->debug_info.ptr;
-    reader->pend = obj->debug_info.ptr + obj->debug_info.size;
-    reader->debug_line_cu_end = obj->debug_line.ptr;
-    reader->current_low_pc = 0;
-    reader->current_str_offsets_base = 0;
-    reader->current_addr_base = 0;
-    reader->current_rnglists_base = 0;
-}
-
-static void
-di_skip_die_attributes(const char **p)
-{
-    for (;;) {
-        uint64_t at = uleb128(p);
-        uint64_t form = uleb128(p);
-        if (!at && !form) break;
-        switch (form) {
-          default:
-            break;
-          case DW_FORM_implicit_const:
-            sleb128(p);
-            break;
-        }
-    }
-}
-
-static void
-di_read_debug_abbrev_cu(DebugInfoReader *reader)
-{
-    uint64_t prev = 0;
-    const char *p = reader->q0;
-    for (;;) {
-        uint64_t abbrev_number = uleb128(&p);
-        if (abbrev_number <= prev) break;
-        if (abbrev_number < ABBREV_TABLE_SIZE) {
-            reader->abbrev_table[abbrev_number] = p;
-        }
-        prev = abbrev_number;
-        uleb128(&p); /* tag */
-        p++; /* has_children */
-        di_skip_die_attributes(&p);
-    }
-}
-
-static int
-di_read_debug_line_cu(DebugInfoReader *reader, FILE *errout)
-{
-    const char *p;
-    struct LineNumberProgramHeader header;
-
-    p = (const char *)reader->debug_line_cu_end;
-    if (parse_debug_line_header(reader->obj, &p, &header, errout))
-        return -1;
-
-    reader->debug_line_cu_end = (char *)header.cu_end;
-    reader->debug_line_format = header.format;
-    reader->debug_line_version = header.version;
-    reader->debug_line_directories = (char *)header.include_directories;
-    reader->debug_line_files = (char *)header.filenames;
-
-    return 0;
-}
-
-static void
-set_addr_idx_value(DebugInfoValue *v, uint64_t n)
-{
-    v->as.addr_idx = n;
-    v->type = VAL_addr;
-}
-
-static void
-set_uint_value(DebugInfoValue *v, uint64_t n)
-{
-    v->as.uint64 = n;
-    v->type = VAL_uint;
-}
-
-static void
-set_int_value(DebugInfoValue *v, int64_t n)
-{
-    v->as.int64 = n;
-    v->type = VAL_int;
-}
-
-static void
-set_cstr_value(DebugInfoValue *v, const char *s)
-{
-    v->as.ptr = s;
-    v->off = 0;
-    v->type = VAL_cstr;
-}
-
-static void
-set_cstrp_value(DebugInfoValue *v, const char *s, uint64_t off)
-{
-    v->as.ptr = s;
-    v->off = off;
-    v->type = VAL_cstr;
-}
-
-static void
-set_data_value(DebugInfoValue *v, const char *s)
-{
-    v->as.ptr = s;
-    v->type = VAL_data;
-}
-
-static const char *
-get_cstr_value(DebugInfoValue *v)
-{
-    if (v->as.ptr) {
-        return v->as.ptr + v->off;
-    } else {
-        return NULL;
-    }
-}
-
-static const char *
-resolve_strx(DebugInfoReader *reader, uint64_t idx)
-{
-    const char *p = reader->obj->debug_str_offsets.ptr + reader->current_str_offsets_base;
-    uint64_t off;
-    if (reader->format == 4) {
-        off = ((uint32_t *)p)[idx];
-    }
-    else {
-        off = ((uint64_t *)p)[idx];
-    }
-    return reader->obj->debug_str.ptr + off;
-}
-
-static bool
-debug_info_reader_read_addr_value_member(DebugInfoReader *reader, DebugInfoValue *v, int size)
-{
-    if (size == 4) {
-        set_uint_value(v, read_uint32(&reader->p));
-    } else if (size == 8) {
-        set_uint_value(v, read_uint64(&reader->p));
-    } else {
-        return false;
-    }
-    return true;
-}
-
-#define debug_info_reader_read_addr_value(reader, v, mem) \
-    if (!debug_info_reader_read_addr_value_member((reader), (v), (reader)->mem)) { \
-        kprintf("unknown " #mem ":%d", (reader)->mem); \
-        return false; \
-    }
-
-
-static bool
-debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v, FILE *errout)
-{
-    switch (form) {
-      case DW_FORM_addr:
-        debug_info_reader_read_addr_value(reader, v, address_size);
-        break;
-      case DW_FORM_block2:
-        v->size = read_uint16(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_block4:
-        v->size = read_uint32(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_data2:
-        set_uint_value(v, read_uint16(&reader->p));
-        break;
-      case DW_FORM_data4:
-        set_uint_value(v, read_uint32(&reader->p));
-        break;
-      case DW_FORM_data8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_string:
-        v->size = strlen(reader->p);
-        set_cstr_value(v, reader->p);
-        reader->p += v->size + 1;
-        break;
-      case DW_FORM_block:
-        v->size = uleb128(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_block1:
-        v->size = read_uint8(&reader->p);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_data1:
-        set_uint_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_flag:
-        set_uint_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_sdata:
-        set_int_value(v, read_sleb128(reader));
-        break;
-      case DW_FORM_strp:
-        set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
-        break;
-      case DW_FORM_udata:
-        set_uint_value(v, read_uleb128(reader));
-        break;
-      case DW_FORM_ref_addr:
-        if (reader->current_version <= 2) {
-            // DWARF Version 2 specifies that references have
-            // the same size as an address on the target system
-            debug_info_reader_read_addr_value(reader, v, address_size);
-        } else {
-            debug_info_reader_read_addr_value(reader, v, format);
-        }
-        break;
-      case DW_FORM_ref1:
-        set_uint_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_ref2:
-        set_uint_value(v, read_uint16(&reader->p));
-        break;
-      case DW_FORM_ref4:
-        set_uint_value(v, read_uint32(&reader->p));
-        break;
-      case DW_FORM_ref8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_ref_udata:
-        set_uint_value(v, uleb128(&reader->p));
-        break;
-      case DW_FORM_indirect:
-        /* TODO: read the referred value */
-        set_uint_value(v, uleb128(&reader->p));
-        break;
-      case DW_FORM_sec_offset:
-        set_uint_value(v, read_uint(reader)); /* offset */
-        /* addrptr: debug_addr */
-        /* lineptr: debug_line */
-        /* loclist: debug_loclists */
-        /* loclistptr: debug_loclists */
-        /* macptr: debug_macro */
-        /* rnglist: debug_rnglists */
-        /* rnglistptr: debug_rnglists */
-        /* stroffsetsptr: debug_str_offsets */
-        break;
-      case DW_FORM_exprloc:
-        v->size = (size_t)read_uleb128(reader);
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_flag_present:
-        set_uint_value(v, 1);
-        break;
-      case DW_FORM_strx:
-        set_cstr_value(v, resolve_strx(reader, uleb128(&reader->p)));
-        break;
-      case DW_FORM_addrx:
-        set_addr_idx_value(v, uleb128(&reader->p));
-        break;
-      case DW_FORM_ref_sup4:
-        set_uint_value(v, read_uint32(&reader->p));
-        break;
-      case DW_FORM_strp_sup:
-        set_uint_value(v, read_uint(reader));
-        /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
-        break;
-      case DW_FORM_data16:
-        v->size = 16;
-        set_data_value(v, reader->p);
-        reader->p += v->size;
-        break;
-      case DW_FORM_line_strp:
-        set_cstrp_value(v, reader->obj->debug_line_str.ptr, read_uint(reader));
-        break;
-      case DW_FORM_ref_sig8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_implicit_const:
-        set_int_value(v, sleb128(&reader->q));
-        break;
-      case DW_FORM_loclistx:
-        set_uint_value(v, read_uleb128(reader));
-        break;
-      case DW_FORM_rnglistx:
-        set_uint_value(v, read_uleb128(reader));
-        break;
-      case DW_FORM_ref_sup8:
-        set_uint_value(v, read_uint64(&reader->p));
-        break;
-      case DW_FORM_strx1:
-        set_cstr_value(v, resolve_strx(reader, read_uint8(&reader->p)));
-        break;
-      case DW_FORM_strx2:
-        set_cstr_value(v, resolve_strx(reader, read_uint16(&reader->p)));
-        break;
-      case DW_FORM_strx3:
-        set_cstr_value(v, resolve_strx(reader, read_uint24(&reader->p)));
-        break;
-      case DW_FORM_strx4:
-        set_cstr_value(v, resolve_strx(reader, read_uint32(&reader->p)));
-        break;
-      case DW_FORM_addrx1:
-        set_addr_idx_value(v, read_uint8(&reader->p));
-        break;
-      case DW_FORM_addrx2:
-        set_addr_idx_value(v, read_uint16(&reader->p));
-        break;
-      case DW_FORM_addrx3:
-        set_addr_idx_value(v, read_uint24(&reader->p));
-        break;
-      case DW_FORM_addrx4:
-        set_addr_idx_value(v, read_uint32(&reader->p));
-        break;
-      /* we have no support for actually reading the real values of these refs out
-       * of the .gnu_debugaltlink dwz-compressed debuginfo at the moment, but "read"
-       * them anyway so that we advance the reader by the right amount. */
-      case DW_FORM_GNU_ref_alt:
-      case DW_FORM_GNU_strp_alt:
-        read_uint(reader);
-        set_uint_value(v, 0);
-        break;
-      case 0:
-        goto fail;
-        break;
-    }
-    return true;
-
-  fail:
-    kprintf("%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
-    return false;
-}
-
-/* find abbrev in current compilation unit */
-static const char *
-di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number, FILE *errout)
-{
-    const char *p;
-    if (abbrev_number < ABBREV_TABLE_SIZE) {
-        return reader->abbrev_table[abbrev_number];
-    }
-    p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
-    /* skip 255th record */
-    uleb128(&p); /* tag */
-    p++; /* has_children */
-    di_skip_die_attributes(&p);
-    for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
-        if (n == 0) {
-            kprintf("%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
-            return NULL;
-        }
-        uleb128(&p); /* tag */
-        p++; /* has_children */
-        di_skip_die_attributes(&p);
-    }
-    return p;
-}
-
-#if 0
-static void
-hexdump0(const unsigned char *p, size_t n, FILE *errout)
-{
-    size_t i;
-    kprintf("     0  1  2  3  4  5  6  7  8  9  A  B  C  D  E  F\n");
-    for (i=0; i < n; i++){
-        switch (i & 15) {
-          case 0:
-            kprintf("%02" PRIdSIZE ": %02X ", i/16, p[i]);
-            break;
-          case 15:
-            kprintf("%02X\n", p[i]);
-            break;
-          default:
-            kprintf("%02X ", p[i]);
-            break;
-        }
-    }
-    if ((i & 15) != 15) {
-        kprintf("\n");
-    }
-}
-#define hexdump(p,n,e) hexdump0((const unsigned char *)p, n, e)
-
-static void
-div_inspect(DebugInfoValue *v, FILE *errout)
-{
-    switch (v->type) {
-      case VAL_uint:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRIx64"\n",__LINE__,v->type,v->size,v->as.uint64);
-        break;
-      case VAL_int:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:%"PRId64"\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
-        break;
-      case VAL_cstr:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
-        break;
-      case VAL_data:
-        kprintf("%d: type:%d size:%" PRIxSIZE " v:\n",__LINE__,v->type,v->size);
-        hexdump(v->as.ptr, 16, errout);
-        break;
-    }
-}
-#endif
-
-static DIE *
-di_read_die(DebugInfoReader *reader, DIE *die, FILE *errout)
-{
-    uint64_t abbrev_number = uleb128(&reader->p);
-    if (abbrev_number == 0) {
-        reader->level--;
-        return NULL;
-    }
-
-    if (!(reader->q = di_find_abbrev(reader, abbrev_number, errout))) return NULL;
-
-    die->pos = reader->p - reader->obj->debug_info.ptr - 1;
-    die->tag = (int)uleb128(&reader->q); /* tag */
-    die->has_children = *reader->q++; /* has_children */
-    if (die->has_children) {
-        reader->level++;
-    }
-    return die;
-}
-
-static DebugInfoValue *
-di_read_record(DebugInfoReader *reader, DebugInfoValue *vp, FILE *errout)
-{
-    uint64_t at = uleb128(&reader->q);
-    uint64_t form = uleb128(&reader->q);
-    if (!at || !form) return NULL;
-    vp->at = at;
-    vp->form = form;
-    if (!debug_info_reader_read_value(reader, form, vp, errout)) return NULL;
-    return vp;
-}
-
-static bool
-di_skip_records(DebugInfoReader *reader, FILE *errout)
-{
-    for (;;) {
-        DebugInfoValue v = {{0}};
-        uint64_t at = uleb128(&reader->q);
-        uint64_t form = uleb128(&reader->q);
-        if (!at || !form) return true;
-        if (!debug_info_reader_read_value(reader, form, &v, errout)) return false;
-    }
-}
-
-typedef struct addr_header {
-    const char *ptr;
-    uint64_t unit_length;
-    uint8_t format;
-    uint8_t address_size;
-    /* uint8_t segment_selector_size; */
-} addr_header_t;
-
-static bool
-addr_header_init(obj_info_t *obj, addr_header_t *header, FILE *errout)
-{
-    const char *p = obj->debug_addr.ptr;
-
-    header->ptr = p;
-
-    if (!p) return true;
-
-    header->unit_length = *(uint32_t *)p;
-    p += sizeof(uint32_t);
-
-    header->format = 4;
-    if (header->unit_length == 0xffffffff) {
-        header->unit_length = *(uint64_t *)p;
-        p += sizeof(uint64_t);
-        header->format = 8;
-    }
-
-    p += 2; /* version */
-    header->address_size = *p++;
-    if (header->address_size != 4 && header->address_size != 8) {
-        kprintf("unknown address_size:%d", header->address_size);
-        return false;
-    }
-    p++; /* segment_selector_size */
-    return true;
-}
-
-static uint64_t
-read_addr(addr_header_t *header, uint64_t addr_base, uint64_t idx) {
-    if (header->address_size == 4) {
-        return ((uint32_t*)(header->ptr + addr_base))[idx];
-    }
-    else {
-        return ((uint64_t*)(header->ptr + addr_base))[idx];
-    }
-}
-
-typedef struct rnglists_header {
-    uint64_t unit_length;
-    uint8_t format;
-    uint8_t address_size;
-    uint32_t offset_entry_count;
-} rnglists_header_t;
-
-static bool
-rnglists_header_init(obj_info_t *obj, rnglists_header_t *header, FILE *errout)
-{
-    const char *p = obj->debug_rnglists.ptr;
-
-    if (!p) return true;
-
-    header->unit_length = *(uint32_t *)p;
-    p += sizeof(uint32_t);
-
-    header->format = 4;
-    if (header->unit_length == 0xffffffff) {
-        header->unit_length = *(uint64_t *)p;
-        p += sizeof(uint64_t);
-        header->format = 8;
-    }
-
-    p += 2; /* version */
-    header->address_size = *p++;
-    if (header->address_size != 4 && header->address_size != 8) {
-        kprintf("unknown address_size:%d", header->address_size);
-        return false;
-    }
-    p++; /* segment_selector_size */
-    header->offset_entry_count = *(uint32_t *)p;
-    return true;
-}
-
-typedef struct {
-    uint64_t low_pc;
-    uint64_t high_pc;
-    uint64_t ranges;
-    bool low_pc_set;
-    bool high_pc_set;
-    bool ranges_set;
-} ranges_t;
-
-static void
-ranges_set(ranges_t *ptr, DebugInfoValue *v, addr_header_t *addr_header, uint64_t addr_base)
-{
-    uint64_t n = 0;
-    if (v->type == VAL_uint) {
-        n = v->as.uint64;
-    }
-    else if (v->type == VAL_addr) {
-        n = read_addr(addr_header, addr_base, v->as.addr_idx);
-    }
-    switch (v->at) {
-      case DW_AT_low_pc:
-        ptr->low_pc = n;
-        ptr->low_pc_set = true;
-        break;
-      case DW_AT_high_pc:
-        if (v->form == DW_FORM_addr) {
-            ptr->high_pc = n;
-        }
-        else {
-            ptr->high_pc = ptr->low_pc + n;
-        }
-        ptr->high_pc_set = true;
-        break;
-      case DW_AT_ranges:
-        ptr->ranges = n;
-        ptr->ranges_set = true;
-        break;
-    }
-}
-
-static uint64_t
-read_dw_form_addr(DebugInfoReader *reader, const char **ptr, FILE *errout)
-{
-    const char *p = *ptr;
-    *ptr = p + reader->address_size;
-    if (reader->address_size == 4) {
-        return read_uint32(&p);
-    } else {
-        return read_uint64(&p);
-    }
-}
-
-static uintptr_t
-ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr, rnglists_header_t *rnglists_header, FILE *errout)
-{
-    if (ptr->high_pc_set) {
-        if (ptr->ranges_set || !ptr->low_pc_set) {
-            return UINTPTR_MAX;
-        }
-        if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
-            return (uintptr_t)ptr->low_pc;
-        }
-    }
-    else if (ptr->ranges_set) {
-        /* TODO: support base address selection entry */
-        const char *p;
-        uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
-        bool base_valid = true;
-        if (reader->current_version >= 5) {
-            if (rnglists_header->offset_entry_count == 0) {
-                // DW_FORM_sec_offset
-                p = reader->obj->debug_rnglists.ptr + ptr->ranges + reader->current_rnglists_base;
-            }
-            else {
-                // DW_FORM_rnglistx
-                const char *offset_array = reader->obj->debug_rnglists.ptr + reader->current_rnglists_base;
-                if (rnglists_header->format == 4) {
-                    p = offset_array + ((uint32_t *)offset_array)[ptr->ranges];
-                }
-                else {
-                    p = offset_array + ((uint64_t *)offset_array)[ptr->ranges];
-                }
-            }
-            for (;;) {
-                uint8_t rle = read_uint8(&p);
-                uintptr_t from = 0, to = 0;
-                if (rle == DW_RLE_end_of_list) break;
-                switch (rle) {
-                  case DW_RLE_base_addressx:
-                    uleb128(&p);
-                    base_valid = false; /* not supported yet */
-                    break;
-                  case DW_RLE_startx_endx:
-                    uleb128(&p);
-                    uleb128(&p);
-                    break;
-                  case DW_RLE_startx_length:
-                    uleb128(&p);
-                    uleb128(&p);
-                    break;
-                  case DW_RLE_offset_pair:
-                    if (!base_valid) break;
-                    from = (uintptr_t)base + uleb128(&p);
-                    to = (uintptr_t)base + uleb128(&p);
-                    break;
-                  case DW_RLE_base_address:
-                    base = read_dw_form_addr(reader, &p, errout);
-                    base_valid = true;
-                    break;
-                  case DW_RLE_start_end:
-                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
-                    to = (uintptr_t)read_dw_form_addr(reader, &p, errout);
-                    break;
-                  case DW_RLE_start_length:
-                    from = (uintptr_t)read_dw_form_addr(reader, &p, errout);
-                    to = from + uleb128(&p);
-                    break;
-                }
-                if (from <= addr && addr < to) {
-                    return from;
-                }
-            }
-            return 0;
-        }
-        p = reader->obj->debug_ranges.ptr + ptr->ranges;
-        for (;;) {
-            uintptr_t from = read_uintptr(&p);
-            uintptr_t to = read_uintptr(&p);
-            if (!from && !to) break;
-            if (from == UINTPTR_MAX) {
-                /* base address selection entry */
-                base = to;
-            }
-            else if (base + from <= addr && addr < base + to) {
-                return (uintptr_t)base + from;
-            }
-        }
-    }
-    else if (ptr->low_pc_set) {
-        if (ptr->low_pc == addr) {
-            return (uintptr_t)ptr->low_pc;
-        }
-    }
-    return 0;
-}
-
-#if 0
-static void
-ranges_inspect(DebugInfoReader *reader, ranges_t *ptr, FILE *errout)
-{
-    if (ptr->high_pc_set) {
-        if (ptr->ranges_set || !ptr->low_pc_set) {
-            kprintf("low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
-            return;
-        }
-        kprintf("low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
-    }
-    else if (ptr->ranges_set) {
-        char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
-        kprintf("low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
-        for (;;) {
-            uintptr_t from = read_uintptr(&p);
-            uintptr_t to = read_uintptr(&p);
-            if (!from && !to) break;
-            kprintf("%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
-        }
-        kprintf("\n");
-    }
-    else if (ptr->low_pc_set) {
-        kprintf("low_pc:%"PRIx64"\n",ptr->low_pc);
-    }
-    else {
-        kprintf("empty\n");
-    }
-}
-#endif
-
-static int
-di_read_cu(DebugInfoReader *reader, FILE *errout)
-{
-    uint64_t unit_length;
-    uint16_t version;
-    uint64_t debug_abbrev_offset;
-    reader->format = 4;
-    reader->current_cu = reader->p;
-    unit_length = read_uint32(&reader->p);
-    if (unit_length == 0xffffffff) {
-        unit_length = read_uint64(&reader->p);
-        reader->format = 8;
-    }
-    reader->cu_end = reader->p + unit_length;
-    version = read_uint16(&reader->p);
-    reader->current_version = version;
-    if (version > 5) {
-        return -1;
-    }
-    else if (version == 5) {
-        /* unit_type = */ read_uint8(&reader->p);
-        reader->address_size = read_uint8(&reader->p);
-        debug_abbrev_offset = read_uint(reader);
-    }
-    else {
-        debug_abbrev_offset = read_uint(reader);
-        reader->address_size = read_uint8(&reader->p);
-    }
-    if (reader->address_size != 4 && reader->address_size != 8) {
-        kprintf("unknown address_size:%d", reader->address_size);
-        return -1;
-    }
-    reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
-
-    reader->level = 0;
-    di_read_debug_abbrev_cu(reader);
-    if (di_read_debug_line_cu(reader, errout)) return -1;
-
-    do {
-        DIE die;
-
-        if (!di_read_die(reader, &die, errout)) continue;
-
-        if (die.tag != DW_TAG_compile_unit) {
-            if (!di_skip_records(reader, errout)) return -1;
-            break;
-        }
-
-        reader->current_str_offsets_base = 0;
-        reader->current_addr_base = 0;
-        reader->current_rnglists_base = 0;
-
-        DebugInfoValue low_pc = {{0}};
-        /* enumerate abbrev */
-        for (;;) {
-            DebugInfoValue v = {{0}};
-            if (!di_read_record(reader, &v, errout)) break;
-            switch (v.at) {
-              case DW_AT_low_pc:
-                // clang may output DW_AT_addr_base after DW_AT_low_pc.
-                // We need to resolve the DW_FORM_addr* after DW_AT_addr_base is parsed.
-                low_pc = v;
-                break;
-              case DW_AT_str_offsets_base:
-                reader->current_str_offsets_base = v.as.uint64;
-                break;
-              case DW_AT_addr_base:
-                reader->current_addr_base = v.as.uint64;
-                break;
-              case DW_AT_rnglists_base:
-                reader->current_rnglists_base = v.as.uint64;
-                break;
-            }
-        }
-        // Resolve the DW_FORM_addr of DW_AT_low_pc
-        switch (low_pc.type) {
-            case VAL_uint:
-                reader->current_low_pc = low_pc.as.uint64;
-                break;
-            case VAL_addr:
-                {
-                    addr_header_t header = {0};
-                    if (!addr_header_init(reader->obj, &header, errout)) return -1;
-                    reader->current_low_pc = read_addr(&header, reader->current_addr_base, low_pc.as.addr_idx);
-                }
-                break;
-        }
-    } while (0);
-
-    return 0;
-}
-
-static void
-read_abstract_origin(DebugInfoReader *reader, uint64_t form, uint64_t abstract_origin, line_info_t *line, FILE *errout)
-{
-    const char *p = reader->p;
-    const char *q = reader->q;
-    int level = reader->level;
-    DIE die;
-
-    switch (form) {
-      case DW_FORM_ref1:
-      case DW_FORM_ref2:
-      case DW_FORM_ref4:
-      case DW_FORM_ref8:
-      case DW_FORM_ref_udata:
-        reader->p = reader->current_cu + abstract_origin;
-        break;
-      case DW_FORM_ref_addr:
-        goto finish; /* not supported yet */
-      case DW_FORM_ref_sig8:
-        goto finish; /* not supported yet */
-      case DW_FORM_ref_sup4:
-      case DW_FORM_ref_sup8:
-        goto finish; /* not supported yet */
-      default:
-        goto finish;
-    }
-    if (!di_read_die(reader, &die, errout)) goto finish;
-
-    /* enumerate abbrev */
-    for (;;) {
-        DebugInfoValue v = {{0}};
-        if (!di_read_record(reader, &v, errout)) break;
-        switch (v.at) {
-          case DW_AT_name:
-            line->sname = get_cstr_value(&v);
-            break;
-        }
-    }
-
-  finish:
-    reader->p = p;
-    reader->q = q;
-    reader->level = level;
-}
-
-static bool
-debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
-                line_info_t *lines, int offset, FILE *errout)
-{
-
-    addr_header_t addr_header = {0};
-    if (!addr_header_init(reader->obj, &addr_header, errout)) return false;
-
-    rnglists_header_t rnglists_header = {0};
-    if (!rnglists_header_init(reader->obj, &rnglists_header, errout)) return false;
-
-    while (reader->p < reader->cu_end) {
-        DIE die;
-        ranges_t ranges = {0};
-        line_info_t line = {0};
-
-        if (!di_read_die(reader, &die, errout)) continue;
-        /* kprintf("%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
-
-        if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
-          skip_die:
-            if (!di_skip_records(reader, errout)) return false;
-            continue;
-        }
-
-        /* enumerate abbrev */
-        for (;;) {
-            DebugInfoValue v = {{0}};
-            /* ptrdiff_t pos = reader->p - reader->p0; */
-            if (!di_read_record(reader, &v, errout)) break;
-            /* kprintf("\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
-            /* div_inspect(&v, errout); */
-            switch (v.at) {
-              case DW_AT_name:
-                line.sname = get_cstr_value(&v);
-                break;
-              case DW_AT_call_file:
-                fill_filename((int)v.as.uint64, reader->debug_line_format, reader->debug_line_version, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj, errout);
-                break;
-              case DW_AT_call_line:
-                line.line = (int)v.as.uint64;
-                break;
-              case DW_AT_low_pc:
-              case DW_AT_high_pc:
-              case DW_AT_ranges:
-                ranges_set(&ranges, &v, &addr_header, reader->current_addr_base);
-                break;
-              case DW_AT_declaration:
-                goto skip_die;
-              case DW_AT_inline:
-                /* 1 or 3 */
-                break; /* goto skip_die; */
-              case DW_AT_abstract_origin:
-                read_abstract_origin(reader, v.form, v.as.uint64, &line, errout);
-                break; /* goto skip_die; */
-            }
-        }
-        /* ranges_inspect(reader, &ranges, errout); */
-        /* kprintf("%d:%tx: %x ",__LINE__,diepos,die.tag); */
-        for (int i=offset; i < num_traces; i++) {
-            uintptr_t addr = (uintptr_t)traces[i];
-            uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
-            uintptr_t saddr = ranges_include(reader, &ranges, offset, &rnglists_header, errout);
-            if (saddr == UINTPTR_MAX) return false;
-            if (saddr) {
-                /* kprintf("%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
-                if (lines[i].sname) {
-                    line_info_t *lp = malloc(sizeof(line_info_t));
-                    memcpy(lp, &lines[i], sizeof(line_info_t));
-                    lines[i].next = lp;
-                    lp->dirname = line.dirname;
-                    lp->filename = line.filename;
-                    lp->line = line.line;
-                    lp->saddr = 0;
-                }
-                lines[i].path = reader->obj->path;
-                lines[i].base_addr = line.base_addr;
-                lines[i].sname = line.sname;
-                lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
-            }
-        }
-    }
-    return true;
-}
-
-// This function parses the following attributes of Line Number Program Header in DWARF 5:
-//
-// * directory_entry_format_count
-// * directory_entry_format
-// * directories_count
-// * directories
-//
-// or
-//
-// * file_name_entry_format_count
-// * file_name_entry_format
-// * file_names_count
-// * file_names
-//
-// It records DW_LNCT_path and DW_LNCT_directory_index at the index "idx".
-static const char *
-parse_ver5_debug_line_header(const char *p, int idx, uint8_t format,
-                             obj_info_t *obj, const char **out_path,
-                             uint64_t *out_directory_index, FILE *errout)
-{
-    int i, j;
-    int entry_format_count = *(uint8_t *)p++;
-    const char *entry_format = p;
-
-    /* skip the part of entry_format */
-    for (i = 0; i < entry_format_count * 2; i++) uleb128(&p);
-
-    int entry_count = (int)uleb128(&p);
-
-    DebugInfoReader reader = {0};
-    debug_info_reader_init(&reader, obj);
-    reader.format = format;
-    reader.p = p;
-    for (j = 0; j < entry_count; j++) {
-        const char *format = entry_format;
-        for (i = 0; i < entry_format_count; i++) {
-            DebugInfoValue v = {{0}};
-            unsigned long dw_lnct = uleb128(&format);
-            unsigned long dw_form = uleb128(&format);
-            if (!debug_info_reader_read_value(&reader, dw_form, &v, errout)) return 0;
-            if (dw_lnct == 1 /* DW_LNCT_path */ && v.type == VAL_cstr && out_path)
-                *out_path = v.as.ptr + v.off;
-            if (dw_lnct == 2 /* DW_LNCT_directory_index */ && v.type == VAL_uint && out_directory_index)
-                *out_directory_index = v.as.uint64;
-        }
-        if (j == idx) return 0;
-    }
-
-    return reader.p;
-}
-
-#ifdef USE_ELF
-static unsigned long
-uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
-{
-    *ptr = NULL;
-#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
-    ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
-    unsigned long destsize = chdr->ch_size;
-    int ret = 0;
-
-    if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
-        /* unsupported compression type */
-        return 0;
-    }
-
-    *ptr = malloc(destsize);
-    if (!*ptr) return 0;
-    ret = uncompress((Bytef *)*ptr, &destsize,
-            (const Bytef*)chdr + sizeof(ElfW(Chdr)),
-            shdr->sh_size - sizeof(ElfW(Chdr)));
-    if (ret != Z_OK) goto fail;
-    return destsize;
-
-fail:
-    free(*ptr);
-    *ptr = NULL;
-#endif
-    return 0;
+    fill_lines(num_traces, traces, 0, objp, lines, offset);
 }
 
 /* read file and fill lines */
 static uintptr_t
 fill_lines(int num_traces, void **traces, int check_debuglink,
-           obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
+	   obj_info_t **objp, line_info_t *lines, int offset)
 {
     int i, j;
     char *shstr;
+    char *section_name;
     ElfW(Ehdr) *ehdr;
     ElfW(Shdr) *shdr, *shstr_shdr;
-    ElfW(Shdr) *gnu_debuglink_shdr = NULL;
-    ElfW(Shdr) *note_gnu_build_id = NULL;
+    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
     int fd;
     off_t filesize;
     char *file;
@@ -2071,41 +479,43 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
 
     fd = open(binary_filename, O_RDONLY);
     if (fd < 0) {
-        goto fail;
+	goto fail;
     }
     filesize = lseek(fd, 0, SEEK_END);
     if (filesize < 0) {
-        int e = errno;
-        close(fd);
-        kprintf("lseek: %s\n", strerror(e));
-        goto fail;
+	int e = errno;
+	close(fd);
+	kprintf("lseek: %s\n", strerror(e));
+	goto fail;
     }
 #if SIZEOF_OFF_T > SIZEOF_SIZE_T
     if (filesize > (off_t)SIZE_MAX) {
-        close(fd);
-        kprintf("Too large file %s\n", binary_filename);
-        goto fail;
+	close(fd);
+	kprintf("Too large file %s\n", binary_filename);
+	goto fail;
     }
 #endif
     lseek(fd, 0, SEEK_SET);
     /* async-signal unsafe */
     file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
     if (file == MAP_FAILED) {
-        int e = errno;
-        close(fd);
-        kprintf("mmap: %s\n", strerror(e));
-        goto fail;
+	int e = errno;
+	close(fd);
+	kprintf("mmap: %s\n", strerror(e));
+	goto fail;
     }
-    close(fd);
 
     ehdr = (ElfW(Ehdr) *)file;
     if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
-        /*
-         * Huh? Maybe filename was overridden by setproctitle() and
-         * it match non-elf file.
-         */
-        goto fail;
+	/*
+	 * Huh? Maybe filename was overridden by setproctitle() and
+	 * it match non-elf file.
+	 */
+	close(fd);
+	goto fail;
     }
+
+    obj->fd = fd;
     obj->mapped = file;
     obj->mapped_size = (size_t)filesize;
 
@@ -2115,507 +525,152 @@ fill_lines(int num_traces, void **traces, int check_debuglink,
     shstr = file + shstr_shdr->sh_offset;
 
     for (i = 0; i < ehdr->e_shnum; i++) {
-        char *section_name = shstr + shdr[i].sh_name;
-        switch (shdr[i].sh_type) {
-          case SHT_STRTAB:
-            if (!strcmp(section_name, ".strtab")) {
-                strtab_shdr = shdr + i;
-            }
-            else if (!strcmp(section_name, ".dynstr")) {
-                dynstr_shdr = shdr + i;
-            }
-            break;
-          case SHT_SYMTAB:
-            /* if (!strcmp(section_name, ".symtab")) */
-            symtab_shdr = shdr + i;
-            break;
-          case SHT_DYNSYM:
-            /* if (!strcmp(section_name, ".dynsym")) */
-            dynsym_shdr = shdr + i;
-            break;
-          case SHT_NOTE:
-            if (!strcmp(section_name, ".note.gnu.build-id")) {
-                note_gnu_build_id = shdr + i;
-            }
-            break;
-          case SHT_PROGBITS:
-            if (!strcmp(section_name, ".gnu_debuglink")) {
-                gnu_debuglink_shdr = shdr + i;
-            }
-            else {
-                const char *debug_section_names[] = {
-                    ".debug_abbrev",
-                    ".debug_info",
-                    ".debug_line",
-                    ".debug_ranges",
-                    ".debug_str_offsets",
-                    ".debug_addr",
-                    ".debug_rnglists",
-                    ".debug_str",
-                    ".debug_line_str"
-                };
-
-                for (j=0; j < DWARF_SECTION_COUNT; j++) {
-                    struct dwarf_section *s = obj_dwarf_section_at(obj, j);
-
-                    if (strcmp(section_name, debug_section_names[j]) != 0)
-                        continue;
-
-                    s->ptr = file + shdr[i].sh_offset;
-                    s->size = shdr[i].sh_size;
-                    s->flags = shdr[i].sh_flags;
-                    if (s->flags & SHF_COMPRESSED) {
-                        s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
-                        if (!s->size) goto fail;
-                    }
-                    break;
-                }
-            }
-            break;
-        }
+	section_name = shstr + shdr[i].sh_name;
+	switch (shdr[i].sh_type) {
+	  case SHT_STRTAB:
+	    if (!strcmp(section_name, ".strtab")) {
+		strtab_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".dynstr")) {
+		dynstr_shdr = shdr + i;
+	    }
+	    break;
+	  case SHT_SYMTAB:
+	    /* if (!strcmp(section_name, ".symtab")) */
+	    symtab_shdr = shdr + i;
+	    break;
+	  case SHT_DYNSYM:
+	    /* if (!strcmp(section_name, ".dynsym")) */
+	    dynsym_shdr = shdr + i;
+	    break;
+	  case SHT_PROGBITS:
+	    if (!strcmp(section_name, ".debug_line")) {
+		debug_line_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".gnu_debuglink")) {
+		gnu_debuglink_shdr = shdr + i;
+	    }
+	    break;
+	}
     }
 
     if (offset == -1) {
-        /* main executable */
-        offset = 0;
-        if (dynsym_shdr && dynstr_shdr) {
-            char *strtab = file + dynstr_shdr->sh_offset;
-            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
-            int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
-            void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
-            if (handle) {
-                for (j = 0; j < symtab_count; j++) {
-                    ElfW(Sym) *sym = &symtab[j];
-                    Dl_info info;
-                    void *s;
-                    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
-                    s = dlsym(handle, strtab + sym->st_name);
-                    if (s && dladdr(s, &info)) {
-                        obj->base_addr = dladdr_fbase;
-                        dladdr_fbase = (uintptr_t)info.dli_fbase;
-                        break;
-                    }
-                }
-                dlclose(handle);
-            }
-            if (ehdr->e_type == ET_EXEC) {
-                obj->base_addr = 0;
-            }
-            else {
-                /* PIE (position-independent executable) */
-                obj->base_addr = dladdr_fbase;
-            }
-        }
-    }
-
-    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
-        DebugInfoReader reader;
-        debug_info_reader_init(&reader, obj);
-        i = 0;
-        while (reader.p < reader.pend) {
-            /* kprintf("%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
-            if (di_read_cu(&reader, errout)) goto use_symtab;
-            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
-                goto use_symtab;
-        }
-    }
-    else {
-        /* This file doesn't have dwarf, use symtab or dynsym */
-use_symtab:
-        if (!symtab_shdr) {
-            /* This file doesn't have symtab, use dynsym instead */
-            symtab_shdr = dynsym_shdr;
-            strtab_shdr = dynstr_shdr;
-        }
-
-        if (symtab_shdr && strtab_shdr) {
-            char *strtab = file + strtab_shdr->sh_offset;
-            ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
-            int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
-            for (j = 0; j < symtab_count; j++) {
-                ElfW(Sym) *sym = &symtab[j];
-                uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
-                if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
-                for (i = offset; i < num_traces; i++) {
-                    uintptr_t d = (uintptr_t)traces[i] - saddr;
-                    if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
-                        continue;
-                    /* fill symbol name and addr from .symtab */
-                    if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
-                    lines[i].saddr = saddr;
-                    lines[i].path  = obj->path;
-                    lines[i].base_addr = obj->base_addr;
-                }
-            }
-        }
-    }
-
-    if (!obj->debug_line.ptr) {
-        /* This file doesn't have .debug_line section,
-           let's check .gnu_debuglink section instead. */
-        if (gnu_debuglink_shdr && check_debuglink) {
-            follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
-                             num_traces, traces,
-                             objp, lines, offset, errout);
-        }
-        if (note_gnu_build_id && check_debuglink) {
-            ElfW(Nhdr) *nhdr = (ElfW(Nhdr)*) (file + note_gnu_build_id->sh_offset);
-            const char *build_id = (char *)(nhdr + 1) + nhdr->n_namesz;
-            follow_debuglink_build_id(build_id, nhdr->n_descsz,
-                               num_traces, traces,
-                               objp, lines, offset, errout);
-        }
-        goto finish;
-    }
-
-    if (parse_debug_line(num_traces, traces,
-            obj->debug_line.ptr,
-            obj->debug_line.size,
-            obj, lines, offset, errout) == -1)
-        goto fail;
-
+	/* main executable */
+	offset = 0;
+	if (dynsym_shdr && dynstr_shdr) {
+	    char *strtab = file + dynstr_shdr->sh_offset;
+	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+	    for (j = 0; j < symtab_count; j++) {
+		ElfW(Sym) *sym = &symtab[j];
+		Dl_info info;
+		void *h, *s;
+		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+		if (!h) continue;
+		s = dlsym(h, strtab + sym->st_name);
+		if (!s) continue;
+		if (dladdr(s, &info)) {
+		    dladdr_fbase = (uintptr_t)info.dli_fbase;
+		    break;
+		}
+	    }
+	    if (ehdr->e_type == ET_EXEC) {
+		obj->base_addr = 0;
+	    }
+	    else {
+		/* PIE (position-independent executable) */
+		obj->base_addr = dladdr_fbase;
+	    }
+	}
+    }
+
+    if (!symtab_shdr) {
+	symtab_shdr = dynsym_shdr;
+	strtab_shdr = dynstr_shdr;
+    }
+
+    if (symtab_shdr && strtab_shdr) {
+	char *strtab = file + strtab_shdr->sh_offset;
+	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+	for (j = 0; j < symtab_count; j++) {
+	    ElfW(Sym) *sym = &symtab[j];
+	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+	    for (i = offset; i < num_traces; i++) {
+		uintptr_t d = (uintptr_t)traces[i] - saddr;
+		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
+		    continue;
+		/* fill symbol name and addr from .symtab */
+		lines[i].sname = strtab + sym->st_name;
+		lines[i].saddr = saddr;
+		lines[i].path  = obj->path;
+		lines[i].base_addr = obj->base_addr;
+	    }
+	}
+    }
+
+    if (!debug_line_shdr) {
+	/* This file doesn't have .debug_line section,
+	   let's check .gnu_debuglink section instead. */
+	if (gnu_debuglink_shdr && check_debuglink) {
+	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+			     num_traces, traces,
+			     objp, lines, offset);
+	}
+	goto finish;
+    }
+
+    parse_debug_line(num_traces, traces,
+		     file + debug_line_shdr->sh_offset,
+		     debug_line_shdr->sh_size,
+		     obj, lines, offset);
 finish:
     return dladdr_fbase;
 fail:
     return (uintptr_t)-1;
 }
-#else /* Mach-O */
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
-        obj_info_t **objp, line_info_t *lines, int offset, FILE *errout)
-{
-# ifdef __LP64__
-#  define LP(x) x##_64
-# else
-#  define LP(x) x
-# endif
-    int fd;
-    off_t filesize;
-    char *file, *p = NULL;
-    obj_info_t *obj = *objp;
-    struct LP(mach_header) *header;
-    uintptr_t dladdr_fbase = 0;
-
-    {
-        char *s = binary_filename;
-        char *base = strrchr(binary_filename, '/')+1;
-        size_t max = PATH_MAX;
-        size_t size = strlen(binary_filename);
-        size_t basesize = size - (base - binary_filename);
-        s += size;
-        max -= size;
-        p = s;
-        size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
-        if (size == 0) goto fail;
-        s += size;
-        max -= size;
-        if (max <= basesize) goto fail;
-        memcpy(s, base, basesize);
-        s[basesize] = 0;
-
-        fd = open(binary_filename, O_RDONLY);
-        if (fd < 0) {
-            *p = 0; /* binary_filename becomes original file name */
-            fd = open(binary_filename, O_RDONLY);
-            if (fd < 0) {
-                goto fail;
-            }
-        }
-    }
-
-    filesize = lseek(fd, 0, SEEK_END);
-    if (filesize < 0) {
-        int e = errno;
-        close(fd);
-        kprintf("lseek: %s\n", strerror(e));
-        goto fail;
-    }
-#if SIZEOF_OFF_T > SIZEOF_SIZE_T
-    if (filesize > (off_t)SIZE_MAX) {
-        close(fd);
-        kprintf("Too large file %s\n", binary_filename);
-        goto fail;
-    }
-#endif
-    lseek(fd, 0, SEEK_SET);
-    /* async-signal unsafe */
-    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
-    if (file == MAP_FAILED) {
-        int e = errno;
-        close(fd);
-        kprintf("mmap: %s\n", strerror(e));
-        goto fail;
-    }
-    close(fd);
-
-    obj->mapped = file;
-    obj->mapped_size = (size_t)filesize;
-
-    header = (struct LP(mach_header) *)file;
-    if (header->magic == LP(MH_MAGIC)) {
-        /* non universal binary */
-        p = file;
-    }
-    else if (header->magic == FAT_CIGAM) {
-        struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
-        struct fat_header *fat = (struct fat_header *)file;
-        char *q = file + sizeof(*fat);
-        uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
-        /* kprintf("%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
-        for (uint32_t i = 0; i < nfat_arch; i++) {
-            struct fat_arch *arch = (struct fat_arch *)q;
-            cpu_type_t cputype = __builtin_bswap32(arch->cputype);
-            cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
-            uint32_t offset = __builtin_bswap32(arch->offset);
-            /* kprintf("%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
-            if (mhp->cputype == cputype &&
-                    (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
-                p = file + offset;
-                file = p;
-                header = (struct LP(mach_header) *)p;
-                if (header->magic == LP(MH_MAGIC)) {
-                    goto found_mach_header;
-                }
-                break;
-            }
-            q += sizeof(*arch);
-        }
-        kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
-        close(fd);
-        goto fail;
-    }
-    else {
-# ifdef __LP64__
-#   define bitsize "64"
-# else
-#   define bitsize "32"
-# endif
-        kprintf("'%s' is not a " bitsize
-                "-bit Mach-O file!\n",binary_filename);
-# undef bitsize
-        close(fd);
-        goto fail;
-    }
-found_mach_header:
-    p += sizeof(*header);
-
-    for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
-        struct load_command *lcmd = (struct load_command *)p;
-        switch (lcmd->cmd) {
-          case LP(LC_SEGMENT):
-            {
-                static const char *debug_section_names[] = {
-                    "__debug_abbrev",
-                    "__debug_info",
-                    "__debug_line",
-                    "__debug_ranges",
-                    "__debug_str_offsets",
-                    "__debug_addr",
-                    "__debug_rnglists",
-                    "__debug_str",
-                    "__debug_line_str",
-                };
-                struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
-                if (strcmp(scmd->segname, "__TEXT") == 0) {
-                    obj->vmaddr = scmd->vmaddr;
-                }
-                else if (strcmp(scmd->segname, "__DWARF") == 0) {
-                    p += sizeof(struct LP(segment_command));
-                    for (uint64_t i = 0; i < scmd->nsects; i++) {
-                        struct LP(section) *sect = (struct LP(section) *)p;
-                        p += sizeof(struct LP(section));
-                        for (int j=0; j < DWARF_SECTION_COUNT; j++) {
-                            struct dwarf_section *s = obj_dwarf_section_at(obj, j);
-
-                            if (strcmp(sect->sectname, debug_section_names[j]) != 0
-#ifdef __APPLE__
-                                    /* macOS clang 16 generates DWARF5, which have Mach-O
-                                     * section names that are limited to 16 characters,
-                                     * which causes sections with long names to be truncated
-                                     * and not match above.
-                                     * See: https://wiki.dwarfstd.org/Best_Practices.md#Mach-2d-O
-                                     */
-                                    && strncmp(sect->sectname, debug_section_names[j], 16) != 0
-#endif
-                                )
-                                continue;
-
-                            s->ptr = file + sect->offset;
-                            s->size = sect->size;
-                            s->flags = sect->flags;
-                            if (s->flags & SHF_COMPRESSED) {
-                                goto fail;
-                            }
-                            break;
-                        }
-                    }
-                }
-            }
-            break;
-
-          case LC_SYMTAB:
-            {
-                struct symtab_command *cmd = (struct symtab_command *)lcmd;
-                struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
-                char *strtab = file + cmd->stroff, *sname = 0;
-                uint32_t j;
-                uintptr_t saddr = 0;
-                /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, (void *)p); */
-                for (j = 0; j < cmd->nsyms; j++) {
-                    uintptr_t symsize, d;
-                    struct LP(nlist) *e = &nl[j];
-                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
-                    if (e->n_type != N_FUN) continue;
-                    if (e->n_sect) {
-                        saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
-                        sname = strtab + e->n_un.n_strx;
-                        /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
-                        continue;
-                    }
-                    for (int k = offset; k < num_traces; k++) {
-                        d = (uintptr_t)traces[k] - saddr;
-                        symsize = e->n_value;
-                        /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
-                        if (lines[k].line > 0 || d > (uintptr_t)symsize)
-                            continue;
-                        /* fill symbol name and addr from .symtab */
-                        if (!lines[k].sname) lines[k].sname = sname;
-                        lines[k].saddr = saddr;
-                        lines[k].path  = obj->path;
-                        lines[k].base_addr = obj->base_addr;
-                    }
-                }
-            }
-        }
-        p += lcmd->cmdsize;
-    }
-
-    if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
-        DebugInfoReader reader;
-        debug_info_reader_init(&reader, obj);
-        while (reader.p < reader.pend) {
-            if (di_read_cu(&reader, errout)) goto fail;
-            if (!debug_info_read(&reader, num_traces, traces, lines, offset, errout))
-                goto fail;
-        }
-    }
-
-    if (parse_debug_line(num_traces, traces,
-            obj->debug_line.ptr,
-            obj->debug_line.size,
-            obj, lines, offset, errout) == -1)
-        goto fail;
-
-    return dladdr_fbase;
-fail:
-    return (uintptr_t)-1;
-}
-#endif
 
 #define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__) || defined(__DragonFly__)
+#if defined(__FreeBSD__)
 # include <sys/sysctl.h>
 #endif
-/* ssize_t main_exe_path(FILE *errout)
+/* ssize_t main_exe_path(void)
  *
  * store the path of the main executable to `binary_filename`,
  * and returns strlen(binary_filename).
  * it is NUL terminated.
  */
-#if defined(__linux__) || defined(__NetBSD__)
-static ssize_t
-main_exe_path(FILE *errout)
+#if defined(__linux__)
+ssize_t
+main_exe_path(void)
 {
-# if defined(__linux__)
-#  define PROC_SELF_EXE "/proc/self/exe"
-# elif defined(__NetBSD__)
-#  define PROC_SELF_EXE "/proc/curproc/exe"
-# endif
+# define PROC_SELF_EXE "/proc/self/exe"
     ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
-    if (len < 0) return 0;
     binary_filename[len] = 0;
     return len;
 }
-#elif defined(__FreeBSD__) || defined(__DragonFly__)
-static ssize_t
-main_exe_path(FILE *errout)
+#elif defined(__FreeBSD__)
+ssize_t
+main_exe_path(void)
 {
     int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
     size_t len = PATH_MAX;
     int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
     if (err) {
-        kprintf("Can't get the path of ruby");
-        return -1;
+	kprintf("Can't get the path of ruby");
+	return -1;
     }
     len--; /* sysctl sets strlen+1 */
     return len;
 }
-#elif defined(HAVE_LIBPROC_H)
-static ssize_t
-main_exe_path(FILE *errout)
-{
-    int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
-    if (len == 0) return 0;
-    binary_filename[len] = 0;
-    return len;
-}
 #else
 #undef HAVE_MAIN_EXE_PATH
 #endif
 
-static void
-print_line0(line_info_t *line, void *address, FILE *errout)
-{
-    uintptr_t addr = (uintptr_t)address;
-    uintptr_t d = addr - line->saddr;
-    if (!address) {
-        /* inlined */
-        if (line->dirname && line->dirname[0]) {
-            kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
-        }
-        else {
-            kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
-        }
-    }
-    else if (!line->path) {
-        kprintf("[0x%"PRIxPTR"]\n", addr);
-    }
-    else if (!line->sname) {
-        kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
-    }
-    else if (!line->saddr) {
-        kprintf("%s(%s) [0x%"PRIxPTR"]\n", line->path, line->sname, addr);
-    }
-    else if (line->line <= 0) {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
-                d, addr);
-    }
-    else if (!line->filename) {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
-                d, addr, line->line);
-    }
-    else if (line->dirname && line->dirname[0]) {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
-                d, addr, line->dirname, line->filename, line->line);
-    }
-    else {
-        kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
-                d, addr, line->filename, line->line);
-    }
-}
-
-static void
-print_line(line_info_t *line, void *address, FILE *errout)
-{
-    print_line0(line, address, errout);
-    if (line->next) {
-        print_line(line->next, NULL, errout);
-    }
-}
-
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
+rb_dump_backtrace_with_lines(int num_traces, void **traces)
 {
     int i;
     /* async-signal unsafe */
@@ -2623,99 +678,531 @@ rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout)
     obj_info_t *obj = NULL;
     /* 2 is NULL + main executable */
     void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
-
 #ifdef HAVE_MAIN_EXE_PATH
     char *main_path = NULL; /* used on printing backtrace */
     ssize_t len;
-    if ((len = main_exe_path(errout)) > 0) {
-        main_path = (char *)alloca(len + 1);
-        if (main_path) {
-            uintptr_t addr;
-            memcpy(main_path, binary_filename, len+1);
-            append_obj(&obj);
-            obj->path = main_path;
-            addr = fill_lines(num_traces, traces, 1, &obj, lines, 0, errout);
-            if (addr != (uintptr_t)-1) {
-                dladdr_fbases[0] = (void *)addr;
-            }
-        }
+    if ((len = main_exe_path()) > 0) {
+	main_path = (char *)alloca(len + 1);
+	if (main_path) {
+	    uintptr_t addr;
+	    memcpy(main_path, binary_filename, len+1);
+	    append_obj(&obj);
+	    obj->path = main_path;
+	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
+	    if (addr != (uintptr_t)-1) {
+		dladdr_fbases[0] = (void *)addr;
+	    }
+	}
     }
 #endif
 
     /* fill source lines by reading dwarf */
     for (i = 0; i < num_traces; i++) {
-        Dl_info info;
-        if (lines[i].line) continue;
-        if (dladdr(traces[i], &info)) {
-            const char *path;
-            void **p;
-
-            /* skip symbols which is in already checked objects */
-            /* if the binary is strip-ed, this may effect */
-            for (p=dladdr_fbases; *p; p++) {
-                if (*p == info.dli_fbase) {
-                    if (info.dli_fname) lines[i].path = info.dli_fname;
-                    if (info.dli_sname) lines[i].sname = info.dli_sname;
-                    goto next_line;
-                }
-            }
-            *p = info.dli_fbase;
-
-            append_obj(&obj);
-            obj->base_addr = (uintptr_t)info.dli_fbase;
-            path = info.dli_fname;
-            obj->path = path;
-            if (path) lines[i].path = path;
-            if (info.dli_sname) {
-                lines[i].sname = info.dli_sname;
-                lines[i].saddr = (uintptr_t)info.dli_saddr;
-            }
-            strlcpy(binary_filename, path, PATH_MAX);
-            if (fill_lines(num_traces, traces, 1, &obj, lines, i, errout) == (uintptr_t)-1)
-                break;
-        }
+	Dl_info info;
+	if (lines[i].line) continue;
+	if (dladdr(traces[i], &info)) {
+	    const char *path;
+	    void **p;
+
+	    /* skip symbols which is in already checked objects */
+	    /* if the binary is strip-ed, this may effect */
+	    for (p=dladdr_fbases; *p; p++) {
+		if (*p == info.dli_fbase) {
+		    lines[i].path = info.dli_fname;
+		    lines[i].sname = info.dli_sname;
+		    goto next_line;
+		}
+	    }
+	    *p = info.dli_fbase;
+
+	    append_obj(&obj);
+	    obj->base_addr = (uintptr_t)info.dli_fbase;
+	    path = info.dli_fname;
+	    obj->path = path;
+	    lines[i].path = path;
+	    strcpy(binary_filename, path);
+	    fill_lines(num_traces, traces, 1, &obj, lines, i);
+	}
 next_line:
-        continue;
+	continue;
     }
 
     /* output */
     for (i = 0; i < num_traces; i++) {
-        print_line(&lines[i], traces[i], errout);
-
-        /* FreeBSD's backtrace may show _start and so on */
-        if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
-            break;
+	line_info_t *line = &lines[i];
+	uintptr_t addr = (uintptr_t)traces[i];
+	uintptr_t d = addr - line->saddr;
+	if (!line->path) {
+	    kprintf("[0x%lx]\n", addr);
+	}
+	else if (!line->saddr || !line->sname) {
+	    kprintf("%s [0x%lx]\n", line->path, addr);
+	}
+	else if (line->line <= 0) {
+	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
+		    d, addr);
+	}
+	else if (!line->filename) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
+		    d, addr, line->line);
+	}
+	else if (line->dirname && line->dirname[0]) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
+		    d, addr, line->dirname, line->filename, line->line);
+	}
+	else {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
+		    d, addr, line->filename, line->line);
+	}
+	/* FreeBSD's backtrace may show _start and so on */
+	if (line->sname && strcmp("main", line->sname) == 0)
+	    break;
     }
 
     /* free */
     while (obj) {
-        obj_info_t *o = obj;
-        for (i=0; i < DWARF_SECTION_COUNT; i++) {
-            struct dwarf_section *s = obj_dwarf_section_at(obj, i);
-            if (s->flags & SHF_COMPRESSED) {
-                free(s->ptr);
-            }
-        }
-        if (obj->mapped_size) {
-            munmap(obj->mapped, obj->mapped_size);
-        }
-        obj = o->next;
-        free(o);
-    }
-    for (i = 0; i < num_traces; i++) {
-        line_info_t *line = lines[i].next;
-        while (line) {
-            line_info_t *l = line;
-            line = line->next;
-            free(l);
-        }
+	obj_info_t *o = obj;
+	obj = o->next;
+	if (o->fd) {
+	    munmap(o->mapped, o->mapped_size);
+	    close(o->fd);
+	}
+	free(o);
     }
     free(lines);
     free(dladdr_fbases);
 }
 
-#undef kprintf
+/* From FreeBSD's lib/libstand/printf.c */
+/*-
+ * Copyright (c) 1986, 1988, 1991, 1993
+ *	The Regents of the University of California.  All rights reserved.
+ * (c) UNIX System Laboratories, Inc.
+ * All or some portions of this file are derived from material licensed
+ * to the University of California by American Telephone and Telegraph
+ * Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ * the permission of UNIX System Laboratories, Inc.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ * 4. Neither the name of the University nor the names of its contributors
+ *    may be used to endorse or promote products derived from this software
+ *    without specific prior written permission.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+ */
+
+#include <stdarg.h>
+#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
+extern int rb_toupper(int c);
+#define    toupper(c)  rb_toupper(c)
+#define    hex2ascii(hex)  (hex2ascii_data[hex])
+char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static inline int imax(int a, int b) { return (a > b ? a : b); }
+static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
+
+static void putce(int c)
+{
+    char s[1];
+    ssize_t ret;
+
+    s[0] = (char)c;
+    ret = write(2, s, 1);
+    (void)ret;
+}
+
+int
+kprintf(const char *fmt, ...)
+{
+	va_list ap;
+	int retval;
+
+	va_start(ap, fmt);
+	retval = kvprintf(fmt, putce, NULL, 10, ap);
+	va_end(ap);
+	return retval;
+}
 
+/*
+ * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
+ * order; return an optional length and a pointer to the last character
+ * written in the buffer (i.e., the first character of the string).
+ * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
+ */
+static char *
+ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
+{
+	char *p, c;
+
+	p = nbuf;
+	*p = '\0';
+	do {
+		c = hex2ascii(num % base);
+		*++p = upper ? toupper(c) : c;
+	} while (num /= base);
+	if (lenp)
+		*lenp = (int)(p - nbuf);
+	return (p);
+}
+
+/*
+ * Scaled down version of printf(3).
+ *
+ * Two additional formats:
+ *
+ * The format %b is supported to decode error registers.
+ * Its usage is:
+ *
+ *	printf("reg=%b\n", regval, "<base><arg>*");
+ *
+ * where <base> is the output base expressed as a control character, e.g.
+ * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
+ * the first of which gives the bit number to be inspected (origin 1), and
+ * the next characters (up to a control character, i.e. a character <= 32),
+ * give the name of the register.  Thus:
+ *
+ *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
+ *
+ * would produce output:
+ *
+ *	reg=3<BITTWO,BITONE>
+ *
+ * XXX:  %D  -- Hexdump, takes pointer and separator string:
+ *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
+ *		("%*D", len, ptr, " " -> XX XX XX XX ...
+ */
+static int
+kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
+{
+#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
+	char nbuf[MAXNBUF];
+	char *d;
+	const char *p, *percent, *q;
+	unsigned char *up;
+	int ch, n;
+	uintmax_t num;
+	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
+	int cflag, hflag, jflag, tflag, zflag;
+	int dwidth, upper;
+	char padc;
+	int stop = 0, retval = 0;
+
+	num = 0;
+	if (!func)
+		d = (char *) arg;
+	else
+		d = NULL;
+
+	if (fmt == NULL)
+		fmt = "(fmt null)\n";
+
+	if (radix < 2 || radix > 36)
+		radix = 10;
+
+	for (;;) {
+		padc = ' ';
+		width = 0;
+		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
+			if (ch == '\0')
+				return (retval);
+			PCHAR(ch);
+		}
+		percent = fmt - 1;
+		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
+		sign = 0; dot = 0; dwidth = 0; upper = 0;
+		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
+reswitch:	switch (ch = (unsigned char)*fmt++) {
+		case '.':
+			dot = 1;
+			goto reswitch;
+		case '#':
+			sharpflag = 1;
+			goto reswitch;
+		case '+':
+			sign = 1;
+			goto reswitch;
+		case '-':
+			ladjust = 1;
+			goto reswitch;
+		case '%':
+			PCHAR(ch);
+			break;
+		case '*':
+			if (!dot) {
+				width = va_arg(ap, int);
+				if (width < 0) {
+					ladjust = !ladjust;
+					width = -width;
+				}
+			} else {
+				dwidth = va_arg(ap, int);
+			}
+			goto reswitch;
+		case '0':
+			if (!dot) {
+				padc = '0';
+				goto reswitch;
+			}
+		case '1': case '2': case '3': case '4':
+		case '5': case '6': case '7': case '8': case '9':
+				for (n = 0;; ++fmt) {
+					n = n * 10 + ch - '0';
+					ch = *fmt;
+					if (ch < '0' || ch > '9')
+						break;
+				}
+			if (dot)
+				dwidth = n;
+			else
+				width = n;
+			goto reswitch;
+		case 'b':
+			num = (unsigned int)va_arg(ap, int);
+			p = va_arg(ap, char *);
+			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
+				PCHAR(*q--);
+
+			if (num == 0)
+				break;
+
+			for (tmp = 0; *p;) {
+				n = *p++;
+				if (num & (1 << (n - 1))) {
+					PCHAR(tmp ? ',' : '<');
+					for (; (n = *p) > ' '; ++p)
+						PCHAR(n);
+					tmp = 1;
+				} else
+					for (; *p > ' '; ++p)
+						continue;
+			}
+			if (tmp)
+				PCHAR('>');
+			break;
+		case 'c':
+			PCHAR(va_arg(ap, int));
+			break;
+		case 'D':
+			up = va_arg(ap, unsigned char *);
+			p = va_arg(ap, char *);
+			if (!width)
+				width = 16;
+			while(width--) {
+				PCHAR(hex2ascii(*up >> 4));
+				PCHAR(hex2ascii(*up & 0x0f));
+				up++;
+				if (width)
+					for (q=p;*q;q++)
+						PCHAR(*q);
+			}
+			break;
+		case 'd':
+		case 'i':
+			base = 10;
+			sign = 1;
+			goto handle_sign;
+		case 'h':
+			if (hflag) {
+				hflag = 0;
+				cflag = 1;
+			} else
+				hflag = 1;
+			goto reswitch;
+		case 'j':
+			jflag = 1;
+			goto reswitch;
+		case 'l':
+			if (lflag) {
+				lflag = 0;
+				qflag = 1;
+			} else
+				lflag = 1;
+			goto reswitch;
+		case 'n':
+			if (jflag)
+				*(va_arg(ap, intmax_t *)) = retval;
+			else if (qflag)
+				*(va_arg(ap, int64_t *)) = retval;
+			else if (lflag)
+				*(va_arg(ap, long *)) = retval;
+			else if (zflag)
+				*(va_arg(ap, size_t *)) = retval;
+			else if (hflag)
+				*(va_arg(ap, short *)) = retval;
+			else if (cflag)
+				*(va_arg(ap, char *)) = retval;
+			else
+				*(va_arg(ap, int *)) = retval;
+			break;
+		case 'o':
+			base = 8;
+			goto handle_nosign;
+		case 'p':
+			base = 16;
+			sharpflag = (width == 0);
+			sign = 0;
+			num = (uintptr_t)va_arg(ap, void *);
+			goto number;
+		case 'q':
+			qflag = 1;
+			goto reswitch;
+		case 'r':
+			base = radix;
+			if (sign)
+				goto handle_sign;
+			goto handle_nosign;
+		case 's':
+			p = va_arg(ap, char *);
+			if (p == NULL)
+				p = "(null)";
+			if (!dot)
+				n = (int)strlen (p);
+			else
+				for (n = 0; n < dwidth && p[n]; n++)
+					continue;
+
+			width -= n;
+
+			if (!ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			while (n--)
+				PCHAR(*p++);
+			if (ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			break;
+		case 't':
+			tflag = 1;
+			goto reswitch;
+		case 'u':
+			base = 10;
+			goto handle_nosign;
+		case 'X':
+			upper = 1;
+		case 'x':
+			base = 16;
+			goto handle_nosign;
+		case 'y':
+			base = 16;
+			sign = 1;
+			goto handle_sign;
+		case 'z':
+			zflag = 1;
+			goto reswitch;
+handle_nosign:
+			sign = 0;
+			if (jflag)
+				num = va_arg(ap, uintmax_t);
+			else if (qflag)
+				num = va_arg(ap, uint64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, unsigned long);
+			else if (zflag)
+				num = va_arg(ap, size_t);
+			else if (hflag)
+				num = (unsigned short)va_arg(ap, int);
+			else if (cflag)
+				num = (unsigned char)va_arg(ap, int);
+			else
+				num = va_arg(ap, unsigned int);
+			goto number;
+handle_sign:
+			if (jflag)
+				num = va_arg(ap, intmax_t);
+			else if (qflag)
+				num = va_arg(ap, int64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, long);
+			else if (zflag)
+				num = va_arg(ap, ssize_t);
+			else if (hflag)
+				num = (short)va_arg(ap, int);
+			else if (cflag)
+				num = (char)va_arg(ap, int);
+			else
+				num = va_arg(ap, int);
+number:
+			if (sign && (intmax_t)num < 0) {
+				neg = 1;
+				num = -(intmax_t)num;
+			}
+			p = ksprintn(nbuf, num, base, &n, upper);
+			tmp = 0;
+			if (sharpflag && num != 0) {
+				if (base == 8)
+					tmp++;
+				else if (base == 16)
+					tmp += 2;
+			}
+			if (neg)
+				tmp++;
+
+			if (!ladjust && padc == '0')
+				dwidth = width - tmp;
+			width -= tmp + imax(dwidth, n);
+			dwidth -= n;
+			if (!ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+			if (neg)
+				PCHAR('-');
+			if (sharpflag && num != 0) {
+				if (base == 8) {
+					PCHAR('0');
+				} else if (base == 16) {
+					PCHAR('0');
+					PCHAR('x');
+				}
+			}
+			while (dwidth-- > 0)
+				PCHAR('0');
+
+			while (*p)
+				PCHAR(*p--);
+
+			if (ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+
+			break;
+		default:
+			while (percent < fmt)
+				PCHAR(*percent++);
+			/*
+			 * Since we ignore an formatting argument it is no
+			 * longer safe to obey the remaining formatting
+			 * arguments as the arguments will no longer match
+			 * the format specs.
+			 */
+			stop = 1;
+			break;
+		}
+	}
+#undef PCHAR
+}
 #else /* defined(USE_ELF) */
 #error not supported
 #endif
diff --git a/addr2line.h b/addr2line.h
index ff8e476b92..d99f010934 100644
--- a/addr2line.h
+++ b/addr2line.h
@@ -1,5 +1,3 @@
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
 /**********************************************************************
 
   addr2line.h -
@@ -10,12 +8,13 @@
 
 **********************************************************************/
 
-#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
 
-#include <stdio.h>
+#ifdef USE_ELF
 
 void
-rb_dump_backtrace_with_lines(int num_traces, void **traces, FILE *errout);
+rb_dump_backtrace_with_lines(int num_traces, void **traces);
 
 #endif /* USE_ELF */
 
diff --git a/array.c b/array.c
index 8c75abeabf..de81ee7fab 100644
--- a/array.c
+++ b/array.c
@@ -11,115 +11,66 @@
 
 **********************************************************************/
 
-#include "debug_counter.h"
-#include "id.h"
 #include "internal.h"
-#include "internal/array.h"
-#include "internal/compar.h"
-#include "internal/enum.h"
-#include "internal/gc.h"
-#include "internal/hash.h"
-#include "internal/numeric.h"
-#include "internal/object.h"
-#include "internal/proc.h"
-#include "internal/rational.h"
-#include "internal/vm.h"
-#include "probes.h"
-#include "ruby/encoding.h"
-#include "ruby/st.h"
-#include "ruby/thread.h"
 #include "ruby/util.h"
-#include "vm_core.h"
-#include "builtin.h"
+#include "ruby/st.h"
+#include "probes.h"
+#include "id.h"
 
-#if !ARRAY_DEBUG
-# undef NDEBUG
+#ifndef ARRAY_DEBUG
 # define NDEBUG
 #endif
-#include "ruby_assert.h"
+#include <assert.h>
 
 VALUE rb_cArray;
-VALUE rb_cArray_empty_frozen;
-
-/* Flags of RArray
- *
- * 0:   RARRAY_SHARED_FLAG (equal to ELTS_SHARED)
- *          The array is shared. The buffer this array points to is owned by
- *          another array (the shared root).
- * 1:   RARRAY_EMBED_FLAG
- *          The array is embedded (its contents follow the header, rather than
- *          being on a separately allocated buffer).
- * 3-9: RARRAY_EMBED_LEN
- *          The length of the array when RARRAY_EMBED_FLAG is set.
- * 12:  RARRAY_SHARED_ROOT_FLAG
- *          The array is a shared root that does reference counting. The buffer
- *          this array points to is owned by this array but may be pointed to
- *          by other arrays.
- *          Note: Frozen arrays may be a shared root without this flag being
- *                set. Frozen arrays do not have reference counting because
- *                they cannot be modified. Not updating the reference count
- *                improves copy-on-write performance. Their reference count is
- *                assumed to be infinity.
- * 14:  RARRAY_PTR_IN_USE_FLAG
- *          The buffer of the array is in use. This is only used during
- *          debugging.
- */
 
-/* for OPTIMIZED_CMP: */
-#define id_cmp idCmp
+static ID id_cmp, id_div, id_power;
 
 #define ARY_DEFAULT_SIZE 16
 #define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
-#define SMALL_ARRAY_LEN 16
 
-RBIMPL_ATTR_MAYBE_UNUSED()
-static int
-should_be_T_ARRAY(VALUE ary)
-{
-    return RB_TYPE_P(ary, T_ARRAY);
-}
-
-#define ARY_HEAP_PTR(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_HEAP_CAPA(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(!ARY_SHARED_ROOT_P(a)), \
-                          RARRAY(a)->as.heap.aux.capa)
+# define ARY_SHARED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
 
-#define ARY_EMBED_PTR(a) (RUBY_ASSERT(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
 #define ARY_EMBED_LEN(a) \
-    (RUBY_ASSERT(ARY_EMBED_P(a)), \
+    (assert(ARY_EMBED_P(a)), \
      (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
-         (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (RUBY_ASSERT(!ARY_EMBED_P(a)), RUBY_ASSERT(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
-
-#define ARY_OWNS_HEAP_P(a) (RUBY_ASSERT(should_be_T_ARRAY((VALUE)(a))), \
-                            !FL_TEST_RAW((a), RARRAY_SHARED_FLAG|RARRAY_EMBED_FLAG))
+	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
 
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
 #define FL_SET_EMBED(a) do { \
-    RUBY_ASSERT(!ARY_SHARED_P(a)); \
+    assert(!ARY_SHARED_P(a)); \
     FL_SET((a), RARRAY_EMBED_FLAG); \
-    ary_verify(a); \
 } while (0)
-
 #define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
 #define FL_SET_SHARED(ary) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), RARRAY_SHARED_FLAG); \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), ELTS_SHARED); \
 } while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), RARRAY_SHARED_FLAG)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
 
 #define ARY_SET_PTR(ary, p) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.ptr = (p); \
 } while (0)
 #define ARY_SET_EMBED_LEN(ary, n) do { \
     long tmp_n = (n); \
-    RUBY_ASSERT(ARY_EMBED_P(ary)); \
+    assert(ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
     RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
 } while (0)
 #define ARY_SET_HEAP_LEN(ary, n) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
     RARRAY(ary)->as.heap.len = (n); \
 } while (0)
 #define ARY_SET_LEN(ary, n) do { \
@@ -129,15 +80,15 @@ should_be_T_ARRAY(VALUE ary)
     else { \
         ARY_SET_HEAP_LEN((ary), (n)); \
     } \
-    RUBY_ASSERT(RARRAY_LEN(ary) == (n)); \
+    assert(RARRAY_LEN(ary) == (n)); \
 } while (0)
 #define ARY_INCREASE_PTR(ary, n) do  { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.ptr += (n); \
 } while (0)
 #define ARY_INCREASE_LEN(ary, n) do  { \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     if (ARY_EMBED_P(ary)) { \
         ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
     } \
@@ -146,150 +97,45 @@ should_be_T_ARRAY(VALUE ary)
     } \
 } while (0)
 
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? ary_embed_capa(ary) : \
-                       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
 #define ARY_SET_CAPA(ary, n) do { \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
-    RUBY_ASSERT(!ARY_SHARED_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!ARY_SHARED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
     RARRAY(ary)->as.heap.aux.capa = (n); \
 } while (0)
 
-#define ARY_SHARED_ROOT_OCCUPIED(ary) (!OBJ_FROZEN(ary) && ARY_SHARED_ROOT_REFCNT(ary) == 1)
-#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
-    RUBY_ASSERT(ARY_SHARED_ROOT_P(ary)); \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
-    RUBY_ASSERT((value) >= 0); \
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+    const VALUE _ary_ = (ary); \
+    const VALUE _value_ = (value); \
+    assert(!ARY_EMBED_P(_ary_)); \
+    assert(ARY_SHARED_P(_ary_)); \
+    assert(ARY_SHARED_ROOT_P(_value_)); \
+    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+    assert(ARY_SHARED_ROOT_P(ary)); \
     RARRAY(ary)->as.heap.aux.capa = (value); \
 } while (0)
 #define FL_SET_SHARED_ROOT(ary) do { \
-    RUBY_ASSERT(!OBJ_FROZEN(ary)); \
-    RUBY_ASSERT(!ARY_EMBED_P(ary)); \
+    assert(!ARY_EMBED_P(ary)); \
     FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
 } while (0)
 
-static inline void
-ARY_SET(VALUE a, long i, VALUE v)
-{
-    RUBY_ASSERT(!ARY_SHARED_P(a));
-    RUBY_ASSERT(!OBJ_FROZEN(a));
-
-    RARRAY_ASET(a, i, v);
-}
-#undef RARRAY_ASET
-
-static long
-ary_embed_capa(VALUE ary)
-{
-    size_t size = rb_gc_obj_slot_size(ary) - offsetof(struct RArray, as.ary);
-    RUBY_ASSERT(size % sizeof(VALUE) == 0);
-    return size / sizeof(VALUE);
-}
-
-static size_t
-ary_embed_size(long capa)
-{
-    return offsetof(struct RArray, as.ary) + (sizeof(VALUE) * capa);
-}
-
-static bool
-ary_embeddable_p(long capa)
-{
-    return rb_gc_size_allocatable_p(ary_embed_size(capa));
-}
-
-bool
-rb_ary_embeddable_p(VALUE ary)
-{
-    /* An array cannot be turned embeddable when the array is:
-     *  - Shared root: other objects may point to the buffer of this array
-     *    so we cannot make it embedded.
-     *  - Frozen: this array may also be a shared root without the shared root
-     *    flag.
-     *  - Shared: we don't want to re-embed an array that points to a shared
-     *    root (to save memory).
-     */
-    return !(ARY_SHARED_ROOT_P(ary) || OBJ_FROZEN(ary) || ARY_SHARED_P(ary));
-}
-
-size_t
-rb_ary_size_as_embedded(VALUE ary)
-{
-    size_t real_size;
-
-    if (ARY_EMBED_P(ary)) {
-        real_size = ary_embed_size(ARY_EMBED_LEN(ary));
-    }
-    else if (rb_ary_embeddable_p(ary)) {
-        real_size = ary_embed_size(ARY_HEAP_CAPA(ary));
-    }
-    else {
-        real_size = sizeof(struct RArray);
-    }
-    return real_size;
-}
-
-
-#if ARRAY_DEBUG
-#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
-
-static VALUE
-ary_verify_(VALUE ary, const char *file, int line)
-{
-    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
-
-    if (ARY_SHARED_P(ary)) {
-        VALUE root = ARY_SHARED_ROOT(ary);
-        const VALUE *ptr = ARY_HEAP_PTR(ary);
-        const VALUE *root_ptr = RARRAY_CONST_PTR(root);
-        long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
-        RUBY_ASSERT(ARY_SHARED_ROOT_P(root) || OBJ_FROZEN(root));
-        RUBY_ASSERT(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
-        ary_verify(root);
-    }
-    else if (ARY_EMBED_P(ary)) {
-        RUBY_ASSERT(!ARY_SHARED_P(ary));
-        RUBY_ASSERT(RARRAY_LEN(ary) <= ary_embed_capa(ary));
-    }
-    else {
-        const VALUE *ptr = RARRAY_CONST_PTR(ary);
-        long i, len = RARRAY_LEN(ary);
-        volatile VALUE v;
-        if (len > 1) len = 1; /* check only HEAD */
-        for (i=0; i<len; i++) {
-            v = ptr[i]; /* access check */
-        }
-        v = v;
-    }
-
-    return ary;
-}
-#else
-#define ary_verify(ary) ((void)0)
-#endif
-
-VALUE *
-rb_ary_ptr_use_start(VALUE ary)
-{
-#if ARRAY_DEBUG
-    FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
-#endif
-    return (VALUE *)RARRAY_CONST_PTR(ary);
-}
-
-void
-rb_ary_ptr_use_end(VALUE ary)
-{
-#if ARRAY_DEBUG
-    FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
-#endif
-}
+#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
 
 void
-rb_mem_clear(VALUE *mem, long size)
+rb_mem_clear(register VALUE *mem, register long size)
 {
     while (size--) {
-        *mem++ = Qnil;
+	*mem++ = Qnil;
     }
 }
 
@@ -297,7 +143,7 @@ static void
 ary_mem_clear(VALUE ary, long beg, long size)
 {
     RARRAY_PTR_USE(ary, ptr, {
-        rb_mem_clear(ptr + beg, size);
+	rb_mem_clear(ptr + beg, size);
     });
 }
 
@@ -305,7 +151,7 @@ static inline void
 memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
-        *mem++ = val;
+	*mem++ = val;
     }
 }
 
@@ -313,30 +159,36 @@ static void
 ary_memfill(VALUE ary, long beg, long size, VALUE val)
 {
     RARRAY_PTR_USE(ary, ptr, {
-        memfill(ptr + beg, size, val);
-        RB_OBJ_WRITTEN(ary, Qundef, val);
+	memfill(ptr + beg, size, val);
+	RB_OBJ_WRITTEN(ary, Qundef, val);
     });
 }
 
 static void
 ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
 {
-    RUBY_ASSERT(!ARY_SHARED_P(buff_owner_ary));
+#if 1
+    assert(!ARY_SHARED_P(buff_owner_ary));
 
     if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
-        rb_gc_writebarrier_remember(buff_owner_ary);
-        RARRAY_PTR_USE(ary, ptr, {
-            MEMCPY(ptr+beg, argv, VALUE, argc);
-        });
+	rb_gc_writebarrier_remember(buff_owner_ary);
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMCPY(ptr+beg, argv, VALUE, argc);
+	});
     }
     else {
-        int i;
-        RARRAY_PTR_USE(ary, ptr, {
-            for (i=0; i<argc; i++) {
-                RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
-            }
-        });
+	int i;
+	RARRAY_PTR_USE(ary, ptr, {
+	    for (i=0; i<argc; i++) {
+		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+	    }
+	});
     }
+#else
+    /* giveup write barrier (traditional way) */
+    RARRAY_PTR(buff_owner_ary);
+    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
+#endif
 }
 
 static void
@@ -345,105 +197,49 @@ ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
     ary_memcpy0(ary, beg, argc, argv, ary);
 }
 
-static VALUE *
-ary_heap_alloc_buffer(size_t capa)
-{
-    return ALLOC_N(VALUE, capa);
-}
-
-static void
-ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
-{
-    ruby_sized_xfree((void *)ptr, size);
-}
-
-static void
-ary_heap_free(VALUE ary)
-{
-    ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
-}
-
-static size_t
-ary_heap_realloc(VALUE ary, size_t new_capa)
-{
-    RUBY_ASSERT(!OBJ_FROZEN(ary));
-    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, ARY_HEAP_CAPA(ary));
-    ary_verify(ary);
-
-    return new_capa;
-}
-
-void
-rb_ary_make_embedded(VALUE ary)
-{
-    RUBY_ASSERT(rb_ary_embeddable_p(ary));
-    if (!ARY_EMBED_P(ary)) {
-        const VALUE *buf = ARY_HEAP_PTR(ary);
-        long len = ARY_HEAP_LEN(ary);
-
-        FL_SET_EMBED(ary);
-        ARY_SET_EMBED_LEN(ary, len);
-
-        MEMCPY((void *)ARY_EMBED_PTR(ary), (void *)buf, VALUE, len);
-
-        ary_heap_free_ptr(ary, buf, len * sizeof(VALUE));
-    }
-}
-
 static void
 ary_resize_capa(VALUE ary, long capacity)
 {
-    RUBY_ASSERT(RARRAY_LEN(ary) <= capacity);
-    RUBY_ASSERT(!OBJ_FROZEN(ary));
-    RUBY_ASSERT(!ARY_SHARED_P(ary));
-
-    if (capacity > ary_embed_capa(ary)) {
-        size_t new_capa = capacity;
+    assert(RARRAY_LEN(ary) <= capacity);
+    assert(!OBJ_FROZEN(ary));
+    assert(!ARY_SHARED_P(ary));
+    if (capacity > RARRAY_EMBED_LEN_MAX) {
         if (ARY_EMBED_P(ary)) {
             long len = ARY_EMBED_LEN(ary);
-            VALUE *ptr = ary_heap_alloc_buffer(capacity);
-
+            VALUE *ptr = ALLOC_N(VALUE, (capacity));
             MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
             FL_UNSET_EMBED(ary);
             ARY_SET_PTR(ary, ptr);
             ARY_SET_HEAP_LEN(ary, len);
         }
         else {
-            new_capa = ary_heap_realloc(ary, capacity);
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
         }
-        ARY_SET_CAPA(ary, new_capa);
+        ARY_SET_CAPA(ary, (capacity));
     }
     else {
         if (!ARY_EMBED_P(ary)) {
-            long len = ARY_HEAP_LEN(ary);
-            long old_capa = ARY_HEAP_CAPA(ary);
-            const VALUE *ptr = ARY_HEAP_PTR(ary);
+            long len = RARRAY_LEN(ary);
+	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
 
-            if (len > capacity) len = capacity;
+	    if (len > capacity) len = capacity;
             MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
-            ary_heap_free_ptr(ary, ptr, old_capa);
-
             FL_SET_EMBED(ary);
             ARY_SET_LEN(ary, len);
+	    ruby_xfree((VALUE *)ptr);
         }
     }
-
-    ary_verify(ary);
 }
 
 static inline void
 ary_shrink_capa(VALUE ary)
 {
     long capacity = ARY_HEAP_LEN(ary);
-    long old_capa = ARY_HEAP_CAPA(ary);
-    RUBY_ASSERT(!ARY_SHARED_P(ary));
-    RUBY_ASSERT(old_capa >= capacity);
-    if (old_capa > capacity) {
-        size_t new_capa = ary_heap_realloc(ary, capacity);
-        ARY_SET_CAPA(ary, new_capa);
-    }
-
-    ary_verify(ary);
+    long old_capa = RARRAY(ary)->as.heap.aux.capa;
+    assert(!ARY_SHARED_P(ary));
+    assert(old_capa >= capacity);
+    if (old_capa > capacity)
+	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
 }
 
 static void
@@ -452,128 +248,106 @@ ary_double_capa(VALUE ary, long min)
     long new_capa = ARY_CAPA(ary) / 2;
 
     if (new_capa < ARY_DEFAULT_SIZE) {
-        new_capa = ARY_DEFAULT_SIZE;
+	new_capa = ARY_DEFAULT_SIZE;
     }
     if (new_capa >= ARY_MAX_SIZE - min) {
-        new_capa = (ARY_MAX_SIZE - min) / 2;
+	new_capa = (ARY_MAX_SIZE - min) / 2;
     }
     new_capa += min;
     ary_resize_capa(ary, new_capa);
-
-    ary_verify(ary);
 }
 
 static void
-rb_ary_decrement_share(VALUE shared_root)
+rb_ary_decrement_share(VALUE shared)
 {
-    if (!OBJ_FROZEN(shared_root)) {
-        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
-        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num - 1);
+    if (shared) {
+	long num = ARY_SHARED_NUM(shared) - 1;
+	if (num == 0) {
+	    rb_ary_free(shared);
+	    rb_gc_force_recycle(shared);
+	}
+	else if (num > 0) {
+	    ARY_SET_SHARED_NUM(shared, num);
+	}
     }
 }
 
 static void
 rb_ary_unshare(VALUE ary)
 {
-    VALUE shared_root = ARY_SHARED_ROOT(ary);
-    rb_ary_decrement_share(shared_root);
+    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+    rb_ary_decrement_share(shared);
     FL_UNSET_SHARED(ary);
 }
 
-static void
-rb_ary_reset(VALUE ary)
+static inline void
+rb_ary_unshare_safe(VALUE ary)
 {
-    if (ARY_OWNS_HEAP_P(ary)) {
-        ary_heap_free(ary);
-    }
-    else if (ARY_SHARED_P(ary)) {
-        rb_ary_unshare(ary);
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
     }
-
-    FL_SET_EMBED(ary);
-    ARY_SET_EMBED_LEN(ary, 0);
 }
 
 static VALUE
-rb_ary_increment_share(VALUE shared_root)
+rb_ary_increment_share(VALUE shared)
 {
-    if (!OBJ_FROZEN(shared_root)) {
-        long num = ARY_SHARED_ROOT_REFCNT(shared_root);
-        RUBY_ASSERT(num >= 0);
-        ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
+    long num = ARY_SHARED_NUM(shared);
+    if (num >= 0) {
+	ARY_SET_SHARED_NUM(shared, num + 1);
     }
-    return shared_root;
+    return shared;
 }
 
 static void
-rb_ary_set_shared(VALUE ary, VALUE shared_root)
+rb_ary_set_shared(VALUE ary, VALUE shared)
 {
-    RUBY_ASSERT(!ARY_EMBED_P(ary));
-    RUBY_ASSERT(!OBJ_FROZEN(ary));
-    RUBY_ASSERT(ARY_SHARED_ROOT_P(shared_root) || OBJ_FROZEN(shared_root));
-
-    rb_ary_increment_share(shared_root);
+    rb_ary_increment_share(shared);
     FL_SET_SHARED(ary);
-    RB_OBJ_WRITE(ary, &RARRAY(ary)->as.heap.aux.shared_root, shared_root);
-
-    RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+    ARY_SET_SHARED(ary, shared);
 }
 
 static inline void
 rb_ary_modify_check(VALUE ary)
 {
-    RUBY_ASSERT(ruby_thread_has_gvl_p());
-
     rb_check_frozen(ary);
-    ary_verify(ary);
 }
 
 void
-rb_ary_cancel_sharing(VALUE ary)
+rb_ary_modify(VALUE ary)
 {
+    rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-        long shared_len, len = RARRAY_LEN(ary);
-        VALUE shared_root = ARY_SHARED_ROOT(ary);
-
-        ary_verify(shared_root);
-
-        if (len <= ary_embed_capa(ary)) {
-            const VALUE *ptr = ARY_HEAP_PTR(ary);
+	long shared_len, len = RARRAY_LEN(ary);
+	VALUE shared = ARY_SHARED(ary);
+        if (len <= RARRAY_EMBED_LEN_MAX) {
+	    const VALUE *ptr = ARY_HEAP_PTR(ary);
             FL_UNSET_SHARED(ary);
             FL_SET_EMBED(ary);
-            MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
-            rb_ary_decrement_share(shared_root);
+	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared);
             ARY_SET_EMBED_LEN(ary, len);
         }
-        else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
-            long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared_root);
-            FL_UNSET_SHARED(ary);
-            ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared_root));
-            ARY_SET_CAPA(ary, shared_len);
-            RARRAY_PTR_USE(ary, ptr, {
-                MEMMOVE(ptr, ptr+shift, VALUE, len);
-            });
-            FL_SET_EMBED(shared_root);
-            rb_ary_decrement_share(shared_root);
-        }
+	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
+	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
+	    FL_UNSET_SHARED(ary);
+	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
+	    ARY_SET_CAPA(ary, shared_len);
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+shift, VALUE, len);
+	    });
+	    FL_SET_EMBED(shared);
+	    rb_ary_decrement_share(shared);
+	}
         else {
-            VALUE *ptr = ary_heap_alloc_buffer(len);
-            MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
+            VALUE *ptr = ALLOC_N(VALUE, len);
+            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
             rb_ary_unshare(ary);
             ARY_SET_CAPA(ary, len);
             ARY_SET_PTR(ary, ptr);
         }
 
-        rb_gc_writebarrier_remember(ary);
+	rb_gc_writebarrier_remember(ary);
     }
-    ary_verify(ary);
-}
-
-void
-rb_ary_modify(VALUE ary)
-{
-    rb_ary_modify_check(ary);
-    rb_ary_cancel_sharing(ary);
 }
 
 static VALUE
@@ -584,75 +358,66 @@ ary_ensure_room_for_push(VALUE ary, long add_len)
     long capa;
 
     if (old_len > ARY_MAX_SIZE - add_len) {
-        rb_raise(rb_eIndexError, "index %ld too big", new_len);
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
     }
     if (ARY_SHARED_P(ary)) {
-        if (new_len > ary_embed_capa(ary)) {
-            VALUE shared_root = ARY_SHARED_ROOT(ary);
-            if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
-                if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
-                    rb_ary_modify_check(ary);
-
-                    ary_verify(ary);
-                    ary_verify(shared_root);
-                    return shared_root;
-                }
-                else {
-                    /* if array is shared, then it is likely it participate in push/shift pattern */
-                    rb_ary_modify(ary);
-                    capa = ARY_CAPA(ary);
-                    if (new_len > capa - (capa >> 6)) {
-                        ary_double_capa(ary, new_len);
-                    }
-                    ary_verify(ary);
-                    return ary;
-                }
-            }
-        }
-        ary_verify(ary);
-        rb_ary_modify(ary);
-    }
-    else {
-        rb_ary_modify_check(ary);
+	if (new_len > RARRAY_EMBED_LEN_MAX) {
+	    VALUE shared = ARY_SHARED(ary);
+	    if (ARY_SHARED_OCCUPIED(shared)) {
+		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
+		    rb_ary_modify_check(ary);
+		    return shared;
+		}
+		else {
+		    /* if array is shared, then it is likely it participate in push/shift pattern */
+		    rb_ary_modify(ary);
+		    capa = ARY_CAPA(ary);
+		    if (new_len > capa - (capa >> 6)) {
+			ary_double_capa(ary, new_len);
+		    }
+		    return ary;
+		}
+	    }
+	}
     }
+    rb_ary_modify(ary);
     capa = ARY_CAPA(ary);
     if (new_len > capa) {
-        ary_double_capa(ary, new_len);
+	ary_double_capa(ary, new_len);
     }
 
-    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *    freeze -> self
+ *      ary.freeze -> ary
  *
- *  Freezes +self+ (if not already frozen); returns +self+:
+ *  Calls Object#freeze on +ary+ to prevent any further
+ *  modification. A RuntimeError will be raised if a modification
+ *  attempt is made.
  *
- *    a = []
- *    a.frozen? # => false
- *    a.freeze
- *    a.frozen? # => true
- *
- *  No further changes may be made to +self+;
- *  raises FrozenError if a change is attempted.
- *
- *  Related: Kernel#frozen?.
  */
 
 VALUE
 rb_ary_freeze(VALUE ary)
 {
-    RUBY_ASSERT(RB_TYPE_P(ary, T_ARRAY));
-
-    if (OBJ_FROZEN(ary)) return ary;
+    return rb_obj_freeze(ary);
+}
 
-    if (!ARY_EMBED_P(ary) && !ARY_SHARED_P(ary) && !ARY_SHARED_ROOT_P(ary)) {
-        ary_shrink_capa(ary);
-    }
+/*
+ *  call-seq:
+ *     ary.frozen?  -> true or false
+ *
+ *  Return +true+ if this array is frozen (or temporarily frozen
+ *  while being sorted). See also Object#frozen?
+ */
 
-    return rb_obj_freeze(ary);
+static VALUE
+rb_ary_frozen_p(VALUE ary)
+{
+    if (OBJ_FROZEN(ary)) return Qtrue;
+    return Qfalse;
 }
 
 /* This can be used to take a snapshot of an array (with
@@ -666,22 +431,18 @@ VALUE
 rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
 {
     if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
-            !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
-            ARY_SHARED_ROOT(ary1) == ARY_SHARED_ROOT(ary2) &&
-            ARY_HEAP_LEN(ary1) == ARY_HEAP_LEN(ary2)) {
-        return Qtrue;
+	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
+	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
+	return Qtrue;
     }
     return Qfalse;
 }
 
 static VALUE
-ary_alloc_embed(VALUE klass, long capa)
+ary_alloc(VALUE klass)
 {
-    size_t size = ary_embed_size(capa);
-    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
-    NEWOBJ_OF(ary, struct RArray, klass,
-                     T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-                     size, 0);
+    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
     /* Created array is:
      *   FL_SET_EMBED((VALUE)ary);
      *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
@@ -690,46 +451,32 @@ ary_alloc_embed(VALUE klass, long capa)
 }
 
 static VALUE
-ary_alloc_heap(VALUE klass)
-{
-    NEWOBJ_OF(ary, struct RArray, klass,
-                     T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-                     sizeof(struct RArray), 0);
-    return (VALUE)ary;
-}
-
-static VALUE
 empty_ary_alloc(VALUE klass)
 {
     RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
-    return ary_alloc_embed(klass, 0);
+    return ary_alloc(klass);
 }
 
 static VALUE
 ary_new(VALUE klass, long capa)
 {
-    RUBY_ASSERT(ruby_thread_has_gvl_p());
-
-    VALUE ary;
+    VALUE ary,*ptr;
 
     if (capa < 0) {
-        rb_raise(rb_eArgError, "negative array size (or size too big)");
+	rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
     if (capa > ARY_MAX_SIZE) {
-        rb_raise(rb_eArgError, "array size too big");
+	rb_raise(rb_eArgError, "array size too big");
     }
 
     RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
 
-    if (ary_embeddable_p(capa)) {
-        ary = ary_alloc_embed(klass, capa);
-    }
-    else {
-        ary = ary_alloc_heap(klass);
+    ary = ary_alloc(klass);
+    if (capa > RARRAY_EMBED_LEN_MAX) {
+	ptr = ALLOC_N(VALUE, capa);
+        FL_UNSET_EMBED(ary);
+        ARY_SET_PTR(ary, ptr);
         ARY_SET_CAPA(ary, capa);
-        RUBY_ASSERT(!ARY_EMBED_P(ary));
-
-        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
         ARY_SET_HEAP_LEN(ary, 0);
     }
 
@@ -745,7 +492,7 @@ rb_ary_new_capa(long capa)
 VALUE
 rb_ary_new(void)
 {
-    return rb_ary_new_capa(0);
+    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
 }
 
 VALUE
@@ -759,7 +506,7 @@ VALUE
 
     va_start(ar, n);
     for (i=0; i<n; i++) {
-        ARY_SET(ary, i, va_arg(ar, VALUE));
+	ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
@@ -768,103 +515,29 @@ VALUE
 }
 
 VALUE
-rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
-{
-    VALUE ary;
-
-    ary = ary_new(klass, n);
-    if (n > 0 && elts) {
-        ary_memcpy(ary, 0, n, elts);
-        ARY_SET_LEN(ary, n);
-    }
-
-    return ary;
-}
-
-VALUE
 rb_ary_new_from_values(long n, const VALUE *elts)
 {
-    return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
-}
-
-static VALUE
-ec_ary_alloc_embed(rb_execution_context_t *ec, VALUE klass, long capa)
-{
-    size_t size = ary_embed_size(capa);
-    RUBY_ASSERT(rb_gc_size_allocatable_p(size));
-    NEWOBJ_OF(ary, struct RArray, klass,
-            T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-            size, ec);
-    /* Created array is:
-     *   FL_SET_EMBED((VALUE)ary);
-     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
-     */
-    return (VALUE)ary;
-}
-
-static VALUE
-ec_ary_alloc_heap(rb_execution_context_t *ec, VALUE klass)
-{
-    NEWOBJ_OF(ary, struct RArray, klass,
-            T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0),
-            sizeof(struct RArray), ec);
-    return (VALUE)ary;
-}
-
-static VALUE
-ec_ary_new(rb_execution_context_t *ec, VALUE klass, long capa)
-{
     VALUE ary;
 
-    if (capa < 0) {
-        rb_raise(rb_eArgError, "negative array size (or size too big)");
-    }
-    if (capa > ARY_MAX_SIZE) {
-        rb_raise(rb_eArgError, "array size too big");
-    }
-
-    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
-
-    if (ary_embeddable_p(capa)) {
-        ary = ec_ary_alloc_embed(ec, klass, capa);
-    }
-    else {
-        ary = ec_ary_alloc_heap(ec, klass);
-        ARY_SET_CAPA(ary, capa);
-        RUBY_ASSERT(!ARY_EMBED_P(ary));
-
-        ARY_SET_PTR(ary, ary_heap_alloc_buffer(capa));
-        ARY_SET_HEAP_LEN(ary, 0);
-    }
-
-    return ary;
-}
-
-VALUE
-rb_ec_ary_new_from_values(rb_execution_context_t *ec, long n, const VALUE *elts)
-{
-    VALUE ary;
-
-    ary = ec_ary_new(ec, rb_cArray, n);
+    ary = rb_ary_new2(n);
     if (n > 0 && elts) {
-        ary_memcpy(ary, 0, n, elts);
-        ARY_SET_LEN(ary, n);
+	ary_memcpy(ary, 0, n, elts);
+	ARY_SET_LEN(ary, n);
     }
 
     return ary;
 }
 
 VALUE
-rb_ary_hidden_new(long capa)
+rb_ary_tmp_new(long capa)
 {
-    VALUE ary = ary_new(0, capa);
-    return ary;
+    return ary_new(0, capa);
 }
 
 VALUE
-rb_ary_hidden_new_fill(long capa)
+rb_ary_tmp_new_fill(long capa)
 {
-    VALUE ary = rb_ary_hidden_new(capa);
+    VALUE ary = ary_new(0, capa);
     ary_memfill(ary, 0, capa, Qnil);
     ARY_SET_LEN(ary, capa);
     return ary;
@@ -874,107 +547,59 @@ void
 rb_ary_free(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-        if (USE_DEBUG_COUNTER &&
-            !ARY_SHARED_ROOT_P(ary) &&
-            ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
-            RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
-        }
-
-        RB_DEBUG_COUNTER_INC(obj_ary_ptr);
-        ary_heap_free(ary);
-    }
-    else {
-        RB_DEBUG_COUNTER_INC(obj_ary_embed);
-    }
-
-    if (ARY_SHARED_P(ary)) {
-        RB_DEBUG_COUNTER_INC(obj_ary_shared);
-    }
-    if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
-        RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
+	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
     }
 }
 
-static VALUE fake_ary_flags;
-
-static VALUE
-init_fake_ary_flags(void)
-{
-    struct RArray fake_ary = {0};
-    fake_ary.basic.flags = T_ARRAY;
-    VALUE ary = (VALUE)&fake_ary;
-    rb_ary_freeze(ary);
-    return fake_ary.basic.flags;
-}
-
-VALUE
-rb_setup_fake_ary(struct RArray *fake_ary, const VALUE *list, long len)
-{
-    fake_ary->basic.flags = fake_ary_flags;
-    RBASIC_CLEAR_CLASS((VALUE)fake_ary);
-
-    // bypass frozen checks
-    fake_ary->as.heap.ptr = list;
-    fake_ary->as.heap.len = len;
-    fake_ary->as.heap.aux.capa = len;
-    return (VALUE)fake_ary;
-}
-
-size_t
+RUBY_FUNC_EXPORTED size_t
 rb_ary_memsize(VALUE ary)
 {
     if (ARY_OWNS_HEAP_P(ary)) {
-        return ARY_CAPA(ary) * sizeof(VALUE);
+	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
     }
     else {
-        return 0;
+	return 0;
     }
 }
 
+static inline void
+ary_discard(VALUE ary)
+{
+    rb_ary_free(ary);
+    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
+}
+
 static VALUE
 ary_make_shared(VALUE ary)
 {
-    ary_verify(ary);
-
+    assert(!ARY_EMBED_P(ary));
     if (ARY_SHARED_P(ary)) {
-        return ARY_SHARED_ROOT(ary);
+	return ARY_SHARED(ary);
     }
     else if (ARY_SHARED_ROOT_P(ary)) {
-        return ary;
+	return ary;
     }
     else if (OBJ_FROZEN(ary)) {
-        return ary;
+	ary_shrink_capa(ary);
+	FL_SET_SHARED_ROOT(ary);
+	ARY_SET_SHARED_NUM(ary, 1);
+	return ary;
     }
     else {
-        long capa = ARY_CAPA(ary);
-        long len = RARRAY_LEN(ary);
-
-        /* Shared roots cannot be embedded because the reference count
-         * (refcnt) is stored in as.heap.aux.capa. */
-        VALUE shared = ary_alloc_heap(0);
-        FL_SET_SHARED_ROOT(shared);
-
-        if (ARY_EMBED_P(ary)) {
-            VALUE *ptr = ary_heap_alloc_buffer(capa);
-            ARY_SET_PTR(shared, ptr);
-            ary_memcpy(shared, 0, len, RARRAY_CONST_PTR(ary));
-
-            FL_UNSET_EMBED(ary);
-            ARY_SET_HEAP_LEN(ary, len);
-            ARY_SET_PTR(ary, ptr);
-        }
-        else {
-            ARY_SET_PTR(shared, RARRAY_CONST_PTR(ary));
-        }
-
-        ARY_SET_LEN(shared, capa);
-        ary_mem_clear(shared, len, capa - len);
-        rb_ary_set_shared(ary, shared);
-
-        ary_verify(shared);
-        ary_verify(ary);
+	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
+	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+        FL_UNSET_EMBED(shared);
 
-        return shared;
+	ARY_SET_LEN((VALUE)shared, capa);
+	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
+	ary_mem_clear((VALUE)shared, len, capa - len);
+	FL_SET_SHARED_ROOT(shared);
+	ARY_SET_SHARED_NUM((VALUE)shared, 1);
+	FL_SET_SHARED(ary);
+	ARY_SET_SHARED(ary, (VALUE)shared);
+	OBJ_FREEZE(shared);
+	return (VALUE)shared;
     }
 }
 
@@ -983,11 +608,9 @@ ary_make_substitution(VALUE ary)
 {
     long len = RARRAY_LEN(ary);
 
-    if (ary_embeddable_p(len)) {
-        VALUE subst = rb_ary_new_capa(len);
-        RUBY_ASSERT(ARY_EMBED_P(subst));
-
-        ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE subst = rb_ary_new2(len);
+	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
         ARY_SET_EMBED_LEN(subst, len);
         return subst;
     }
@@ -1002,47 +625,35 @@ rb_assoc_new(VALUE car, VALUE cdr)
     return rb_ary_new3(2, car, cdr);
 }
 
-VALUE
-rb_to_array_type(VALUE ary)
+static VALUE
+to_ary(VALUE ary)
 {
-    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
-#define to_ary rb_to_array_type
 
 VALUE
 rb_check_array_type(VALUE ary)
 {
-    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
-}
-
-VALUE
-rb_check_to_array(VALUE ary)
-{
-    return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
-}
-
-VALUE
-rb_to_array(VALUE ary)
-{
-    return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+    return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
 /*
  *  call-seq:
- *    Array.try_convert(object) -> object, new_array, or nil
+ *     Array.try_convert(obj) -> array or nil
  *
- *  Attempts to return an array, based on the given +object+.
+ *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
+ *  converted array or +nil+ if +obj+ cannot be converted for any reason.
+ *  This method can be used to check if an argument is an array.
  *
- *  If +object+ is an array, returns +object+.
+ *     Array.try_convert([1])   #=> [1]
+ *     Array.try_convert("1")   #=> nil
  *
- *  Otherwise if +object+ responds to <tt>:to_ary</tt>.
- *  calls <tt>object.to_ary</tt>:
- *  if the return value is an array or +nil+, returns that value;
- *  if not, raises TypeError.
+ *     if tmp = Array.try_convert(arg)
+ *       # the argument is an array
+ *     elsif tmp = String.try_convert(arg)
+ *       # the argument is a string
+ *     end
  *
- *  Otherwise returns +nil+.
- *
- *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -1051,79 +662,60 @@ rb_ary_s_try_convert(VALUE dummy, VALUE ary)
     return rb_check_array_type(ary);
 }
 
-/* :nodoc: */
-static VALUE
-rb_ary_s_new(int argc, VALUE *argv, VALUE klass)
-{
-    VALUE ary;
-
-    if (klass == rb_cArray) {
-        long size = 0;
-        if (argc > 0 && FIXNUM_P(argv[0])) {
-            size = FIX2LONG(argv[0]);
-            if (size < 0) size = 0;
-        }
-
-        ary = ary_new(klass, size);
-
-        rb_obj_call_init_kw(ary, argc, argv, RB_PASS_CALLED_KEYWORDS);
-    }
-    else {
-        ary = rb_class_new_instance_pass_kw(argc, argv, klass);
-    }
-
-    return ary;
-}
-
 /*
  *  call-seq:
- *    Array.new -> new_empty_array
- *    Array.new(array) -> new_array
- *    Array.new(size, default_value = nil) -> new_array
- *    Array.new(size = 0) {|index| ... } -> new_array
+ *     Array.new(size=0, default=nil)
+ *     Array.new(array)
+ *     Array.new(size) {|index| block }
  *
  *  Returns a new array.
  *
- *  With no block and no argument given, returns a new empty array:
+ *  In the first form, if no arguments are sent, the new array will be empty.
+ *  When a +size+ and an optional +default+ are sent, an array is created with
+ *  +size+ copies of +default+.  Take notice that all elements will reference the
+ *  same object +default+.
+ *
+ *  The second form creates a copy of the array passed as a parameter (the
+ *  array is generated by calling to_ary on the parameter).
+ *
+ *    first_array = ["Matz", "Guido"]
  *
- *    Array.new # => []
+ *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
  *
- *  With no block and array argument given, returns a new array with the same elements:
+ *    first_array.equal? second_array       #=> false
  *
- *    Array.new([:foo, 'bar', 2]) # => [:foo, "bar", 2]
+ *  In the last form, an array of the given size is created.  Each element in
+ *  this array is created by passing the element's index to the given block
+ *  and storing the return value.
  *
- *  With no block and integer argument given, returns a new array containing
- *  that many instances of the given +default_value+:
+ *    Array.new(3){ |index| index ** 2 }
+ *    # => [0, 1, 4]
  *
- *    Array.new(0)    # => []
- *    Array.new(3)    # => [nil, nil, nil]
- *    Array.new(2, 3) # => [3, 3]
+ *  == Common gotchas
  *
- *  With a block given, returns an array of the given +size+;
- *  calls the block with each +index+ in the range <tt>(0...size)</tt>;
- *  the element at that +index+ in the returned array is the blocks return value:
+ *  When sending the second parameter, the same object will be used as the
+ *  value for all the array elements:
  *
- *    Array.new(3)  {|index| "Element #{index}" } # => ["Element 0", "Element 1", "Element 2"]
+ *     a = Array.new(2, Hash.new)
+ *     # => [{}, {}]
  *
- *  A common pitfall for new Rubyists is providing an expression as +default_value+:
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
  *
- *    array = Array.new(2, {})
- *    array # => [{}, {}]
- *    array[0][:a] = 1
- *    array # => [{a: 1}, {a: 1}], as array[0] and array[1] are same object
+ *     a[1]['cat'] = 'Felix'
+ *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
  *
- *  If you want the elements of the array to be distinct, you should pass a block:
+ *  Since all the Array elements store the same hash, changes to one of them
+ *  will affect them all.
  *
- *    array = Array.new(2) { {} }
- *    array # => [{}, {}]
- *    array[0][:a] = 1
- *    array # => [{a: 1}, {}], as array[0] and array[1] are different objects
+ *  If multiple copies are what you want, you should use the block
+ *  version which uses the result of that block each time an element
+ *  of the array needs to be initialized:
  *
- *  Raises TypeError if the first argument is not either an array
- *  or an {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]).
- *  Raises ArgumentError if the first argument is a negative integer.
+ *     a = Array.new(2) { Hash.new }
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {}]
  *
- *  Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
  */
 
 static VALUE
@@ -1134,60 +726,61 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 
     rb_ary_modify(ary);
     if (argc == 0) {
-        rb_ary_reset(ary);
-        RUBY_ASSERT(ARY_EMBED_P(ary));
-        RUBY_ASSERT(ARY_EMBED_LEN(ary) == 0);
-        if (rb_block_given_p()) {
-            rb_warning("given block not used");
-        }
-        return ary;
+	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
+	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
+	}
+        rb_ary_unshare_safe(ary);
+        FL_SET_EMBED(ary);
+	ARY_SET_EMBED_LEN(ary, 0);
+	if (rb_block_given_p()) {
+	    rb_warning("given block not used");
+	}
+	return ary;
     }
     rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
-        val = rb_check_array_type(size);
-        if (!NIL_P(val)) {
-            rb_ary_replace(ary, val);
-            return ary;
-        }
+	val = rb_check_array_type(size);
+	if (!NIL_P(val)) {
+	    rb_ary_replace(ary, val);
+	    return ary;
+	}
     }
 
     len = NUM2LONG(size);
     /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
-        rb_raise(rb_eArgError, "negative array size");
+	rb_raise(rb_eArgError, "negative array size");
     }
     if (len > ARY_MAX_SIZE) {
-        rb_raise(rb_eArgError, "array size too big");
+	rb_raise(rb_eArgError, "array size too big");
     }
     /* recheck after argument conversion */
     rb_ary_modify(ary);
     ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
-        long i;
+	long i;
 
-        if (argc == 2) {
-            rb_warn("block supersedes default value argument");
-        }
-        for (i=0; i<len; i++) {
-            rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-            ARY_SET_LEN(ary, i + 1);
-        }
+	if (argc == 2) {
+	    rb_warn("block supersedes default value argument");
+	}
+	for (i=0; i<len; i++) {
+	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+	    ARY_SET_LEN(ary, i + 1);
+	}
     }
     else {
-        ary_memfill(ary, 0, len, val);
-        ARY_SET_LEN(ary, len);
+	ary_memfill(ary, 0, len, val);
+	ARY_SET_LEN(ary, len);
     }
     return ary;
 }
 
 /*
- * Returns a new array, populated with the given objects:
- *
- *   Array[1, 'a', /^A/]    # => [1, "a", /^A/]
- *   Array[]                # => []
- *   Array.[](1, 'a', /^A/) # => [1, "a", /^A/]
+ * Returns a new array populated with the given objects.
  *
- * Related: see {Methods for Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array].
+ *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
+ *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
  */
 
 static VALUE
@@ -1208,26 +801,26 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
     long len = RARRAY_LEN(ary);
 
     if (idx < 0) {
-        idx += len;
-        if (idx < 0) {
-            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-                     idx - len, -len);
-        }
+	idx += len;
+	if (idx < 0) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     idx - len, -len);
+	}
     }
     else if (idx >= ARY_MAX_SIZE) {
-        rb_raise(rb_eIndexError, "index %ld too big", idx);
+	rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
     rb_ary_modify(ary);
     if (idx >= ARY_CAPA(ary)) {
-        ary_double_capa(ary, idx);
+	ary_double_capa(ary, idx);
     }
     if (idx > len) {
-        ary_mem_clear(ary, len, idx - len + 1);
+	ary_mem_clear(ary, len, idx - len + 1);
     }
 
     if (idx >= len) {
-        ARY_SET_LEN(ary, idx + 1);
+	ARY_SET_LEN(ary, idx + 1);
     }
     ARY_SET(ary, idx, val);
 }
@@ -1235,98 +828,35 @@ rb_ary_store(VALUE ary, long idx, VALUE val)
 static VALUE
 ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
 {
-    RUBY_ASSERT(offset >= 0);
-    RUBY_ASSERT(len >= 0);
-    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
+    assert(offset >= 0);
+    assert(len >= 0);
+    assert(offset+len <= RARRAY_LEN(ary));
 
-    VALUE result = ary_alloc_heap(klass);
-    size_t embed_capa = ary_embed_capa(result);
-    if ((size_t)len <= embed_capa) {
-        FL_SET_EMBED(result);
-        ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+        VALUE result = ary_alloc(klass);
+	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
         ARY_SET_EMBED_LEN(result, len);
+        return result;
     }
     else {
-        VALUE shared = ary_make_shared(ary);
-
-        /* The ary_make_shared call may allocate, which can trigger a GC
-         * compaction. This can cause the array to be embedded because it has
-         * a length of 0. */
+        VALUE shared, result = ary_alloc(klass);
         FL_UNSET_EMBED(result);
 
+        shared = ary_make_shared(ary);
         ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
         ARY_SET_LEN(result, RARRAY_LEN(ary));
         rb_ary_set_shared(result, shared);
 
         ARY_INCREASE_PTR(result, offset);
         ARY_SET_LEN(result, len);
-
-        ary_verify(shared);
-    }
-
-    ary_verify(result);
-    return result;
-}
-
-static VALUE
-ary_make_partial_step(VALUE ary, VALUE klass, long offset, long len, long step)
-{
-    RUBY_ASSERT(offset >= 0);
-    RUBY_ASSERT(len >= 0);
-    RUBY_ASSERT(offset+len <= RARRAY_LEN(ary));
-    RUBY_ASSERT(step != 0);
-
-    const long orig_len = len;
-
-    if (step > 0 && step >= len) {
-        VALUE result = ary_new(klass, 1);
-        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
-        const VALUE *values = RARRAY_CONST_PTR(ary);
-
-        RB_OBJ_WRITE(result, ptr, values[offset]);
-        ARY_SET_EMBED_LEN(result, 1);
         return result;
     }
-    else if (step < 0 && step < -len) {
-        step = -len;
-    }
-
-    long ustep = (step < 0) ? -step : step;
-    len = roomof(len, ustep);
-
-    long i;
-    long j = offset + ((step > 0) ? 0 : (orig_len - 1));
-
-    VALUE result = ary_new(klass, len);
-    if (ARY_EMBED_P(result)) {
-        VALUE *ptr = (VALUE *)ARY_EMBED_PTR(result);
-        const VALUE *values = RARRAY_CONST_PTR(ary);
-
-        for (i = 0; i < len; ++i) {
-            RB_OBJ_WRITE(result, ptr+i, values[j]);
-            j += step;
-        }
-        ARY_SET_EMBED_LEN(result, len);
-    }
-    else {
-        const VALUE *values = RARRAY_CONST_PTR(ary);
-
-        RARRAY_PTR_USE(result, ptr, {
-            for (i = 0; i < len; ++i) {
-                RB_OBJ_WRITE(result, ptr+i, values[j]);
-                j += step;
-            }
-        });
-        ARY_SET_LEN(result, len);
-    }
-
-    return result;
 }
 
 static VALUE
 ary_make_shared_copy(VALUE ary)
 {
-    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
 }
 
 enum ary_take_pos_flags
@@ -1336,59 +866,50 @@ enum ary_take_pos_flags
 };
 
 static VALUE
-ary_take_first_or_last_n(VALUE ary, long n, enum ary_take_pos_flags last)
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
 {
-    long len = RARRAY_LEN(ary);
+    VALUE nv;
+    long n;
+    long len;
     long offset = 0;
 
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    len = RARRAY_LEN(ary);
     if (n > len) {
-        n = len;
+	n = len;
     }
     else if (n < 0) {
-        rb_raise(rb_eArgError, "negative array size");
+	rb_raise(rb_eArgError, "negative array size");
     }
     if (last) {
-        offset = len - n;
+	offset = len - n;
     }
     return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
-static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
-{
-    argc = rb_check_arity(argc, 0, 1);
-    /* the case optional argument is omitted should be handled in
-     * callers of this function.  if another arity case is added,
-     * this arity check needs to rewrite. */
-    RUBY_ASSERT_ALWAYS(argc == 1);
-    return ary_take_first_or_last_n(ary, NUM2LONG(argv[0]), last);
-}
-
 /*
  *  call-seq:
- *    self << object -> self
- *
- *  Appends +object+ as the last element in +self+; returns +self+:
+ *     ary << obj            -> ary
  *
- *    [:foo, 'bar', 2] << :baz # => [:foo, "bar", 2, :baz]
+ *  Append---Pushes the given object on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together.
  *
- *  Appends +object+ as a single element, even if it is another array:
+ *     [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
+ *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
  *
- *    [:foo, 'bar', 2] << [3, 4] # => [:foo, "bar", 2, [3, 4]]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 VALUE
 rb_ary_push(VALUE ary, VALUE item)
 {
-    long idx = RARRAY_LEN((ary_verify(ary), ary));
+    long idx = RARRAY_LEN(ary);
     VALUE target_ary = ary_ensure_room_for_push(ary, 1);
     RARRAY_PTR_USE(ary, ptr, {
-        RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
     });
     ARY_SET_LEN(ary, idx + 1);
-    ary_verify(ary);
     return ary;
 }
 
@@ -1404,20 +925,18 @@ rb_ary_cat(VALUE ary, const VALUE *argv, long len)
 
 /*
  *  call-seq:
- *    push(*objects) -> self
- *    append(*objects) -> self
- *
- *  Appends each argument in +objects+ to +self+; returns +self+:
- *
- *    a = [:foo, 'bar', 2] # => [:foo, "bar", 2]
- *    a.push(:baz, :bat)   # => [:foo, "bar", 2, :baz, :bat]
- *
- *  Appends each argument as a single element, even if it is another array:
- *
- *    a = [:foo, 'bar', 2]               # => [:foo, "bar", 2]
-      a.push([:baz, :bat], [:bam, :bad]) # => [:foo, "bar", 2, [:baz, :bat], [:bam, :bad]]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     ary.push(obj, ... )   -> ary
+ *
+ *  Append --- Pushes the given object(s) on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together. See also Array#pop for the opposite
+ *  effect.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.push("d", "e", "f")
+ *             #=> ["a", "b", "c", "d", "e", "f"]
+ *     [1, 2, 3,].push(4).push(5)
+ *             #=> [1, 2, 3, 4, 5]
  */
 
 static VALUE
@@ -1434,45 +953,32 @@ rb_ary_pop(VALUE ary)
     n = RARRAY_LEN(ary);
     if (n == 0) return Qnil;
     if (ARY_OWNS_HEAP_P(ary) &&
-        n * 3 < ARY_CAPA(ary) &&
-        ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+	n * 3 < ARY_CAPA(ary) &&
+	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
     {
-        ary_resize_capa(ary, n * 2);
+	ary_resize_capa(ary, n * 2);
     }
     --n;
     ARY_SET_LEN(ary, n);
-    ary_verify(ary);
     return RARRAY_AREF(ary, n);
 }
 
 /*
  *  call-seq:
- *    pop -> object or nil
- *    pop(count) -> new_array
- *
- *  Removes and returns trailing elements of +self+.
+ *     ary.pop    -> obj or nil
+ *     ary.pop(n) -> new_ary
  *
- *  With no argument given, removes and returns the last element, if available;
- *  otherwise returns +nil+:
+ *  Removes the last element from +self+ and returns it, or
+ *  +nil+ if the array is empty.
  *
- *    a = [:foo, 'bar', 2]
- *    a.pop  # => 2
- *    a      # => [:foo, "bar"]
- *    [].pop # => nil
+ *  If a number +n+ is given, returns an array of the last +n+ elements
+ *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
+ *  Array#push for the opposite effect.
  *
- *  With non-negative integer argument +count+ given,
- *  returns a new array containing the trailing +count+ elements of +self+, as available:
- *
- *    a = [:foo, 'bar', 2]
- *    a.pop(2) # => ["bar", 2]
- *    a        # => [:foo]
- *
- *    a = [:foo, 'bar', 2]
- *    a.pop(50) # => [:foo, "bar", 2]
- *    a         # => []
- *
- *  Related: Array#push;
- *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.pop     #=> "d"
+ *     a.pop(2)  #=> ["b", "c"]
+ *     a         #=> ["a"]
  */
 
 static VALUE
@@ -1481,13 +987,12 @@ rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
     VALUE result;
 
     if (argc == 0) {
-        return rb_ary_pop(ary);
+	return rb_ary_pop(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
-    ary_verify(ary);
     return result;
 }
 
@@ -1497,54 +1002,52 @@ rb_ary_shift(VALUE ary)
     VALUE top;
     long len = RARRAY_LEN(ary);
 
-    if (len == 0) {
-        rb_ary_modify_check(ary);
-        return Qnil;
-    }
-
+    rb_ary_modify_check(ary);
+    if (len == 0) return Qnil;
     top = RARRAY_AREF(ary, 0);
-
-    rb_ary_behead(ary, 1);
+    if (!ARY_SHARED_P(ary)) {
+	if (len < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+1, VALUE, len-1);
+	    }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -1);
+	    return top;
+	}
+        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+	ARY_SET(ary, 0, Qnil);
+	ary_make_shared(ary);
+    }
+    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+    }
+    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
+    ARY_INCREASE_LEN(ary, -1);
 
     return top;
 }
 
 /*
  *  call-seq:
- *    shift -> object or nil
- *    shift(count) -> new_array or nil
- *
- *  Removes and returns leading elements from +self+.
+ *     ary.shift    -> obj or nil
+ *     ary.shift(n) -> new_ary
  *
- *  With no argument, removes and returns one element, if available,
- *  or +nil+ otherwise:
+ *  Removes the first element of +self+ and returns it (shifting all
+ *  other elements down by one). Returns +nil+ if the array
+ *  is empty.
  *
- *    a = [0, 1, 2, 3]
- *    a.shift  # => 0
- *    a        # => [1, 2, 3]
- *    [].shift # => nil
+ *  If a number +n+ is given, returns an array of the first +n+ elements
+ *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
+ *  containing only the remainder elements, not including what was shifted to
+ *  +new_ary+. See also Array#unshift for the opposite effect.
  *
- *  With non-negative numeric argument +count+ given,
- *  removes and returns the first +count+ elements:
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift     #=> "-m"
+ *     args           #=> ["-q", "filename"]
  *
- *    a = [0, 1, 2, 3]
- *    a.shift(2)   # => [0, 1]
- *    a            # => [2, 3]
- *    a.shift(1.1) # => [2]
- *    a            # => [3]
- *    a.shift(0)   # => []
- *    a            # => [3]
- *
- *  If +count+ is large,
- *  removes and returns all elements:
- *
- *    a = [0, 1, 2, 3]
- *    a.shift(50) # => [0, 1, 2, 3]
- *    a           # => []
- *
- *  If +self+ is empty, returns a new empty array.
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift(2)  #=> ["-m", "-q"]
+ *     args           #=> ["filename"]
  */
 
 static VALUE
@@ -1554,158 +1057,115 @@ rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
     long n;
 
     if (argc == 0) {
-        return rb_ary_shift(ary);
+	return rb_ary_shift(ary);
     }
 
     rb_ary_modify_check(ary);
     result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     n = RARRAY_LEN(result);
-    rb_ary_behead(ary,n);
-
-    return result;
-}
-
-VALUE
-rb_ary_behead(VALUE ary, long n)
-{
-    if (n <= 0) {
-        return ary;
-    }
-
-    rb_ary_modify_check(ary);
-
-    if (!ARY_SHARED_P(ary)) {
-        if (ARY_EMBED_P(ary) || RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
-            RARRAY_PTR_USE(ary, ptr, {
-                MEMMOVE(ptr, ptr + n, VALUE, RARRAY_LEN(ary) - n);
-            }); /* WB: no new reference */
-            ARY_INCREASE_LEN(ary, -n);
-            ary_verify(ary);
-            return ary;
-        }
-
-        ary_mem_clear(ary, 0, n);
-        ary_make_shared(ary);
+    if (ARY_SHARED_P(ary)) {
+	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	  setup_occupied_shared:
+	    ary_mem_clear(ary, 0, n);
+	}
+        ARY_INCREASE_PTR(ary, n);
     }
-    else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
-        ary_mem_clear(ary, 0, n);
+    else {
+	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
+	    }); /* WB: no new reference */
+	}
+	else {
+	    ary_make_shared(ary);
+	    goto setup_occupied_shared;
+	}
     }
-
-    ARY_INCREASE_PTR(ary, n);
     ARY_INCREASE_LEN(ary, -n);
-    ary_verify(ary);
 
-    return ary;
-}
-
-static VALUE
-make_room_for_unshift(VALUE ary, const VALUE *head, VALUE *sharedp, int argc, long capa, long len)
-{
-    if (head - sharedp < argc) {
-        long room = capa - len - argc;
-
-        room -= room >> 4;
-        MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
-        head = sharedp + argc + room;
-    }
-    ARY_SET_PTR(ary, head - argc);
-    RUBY_ASSERT(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
-
-    ary_verify(ary);
-    return ARY_SHARED_ROOT(ary);
+    return result;
 }
 
 static VALUE
-ary_modify_for_unshift(VALUE ary, int argc)
+ary_ensure_room_for_unshift(VALUE ary, int argc)
 {
     long len = RARRAY_LEN(ary);
     long new_len = len + argc;
     long capa;
     const VALUE *head, *sharedp;
 
-    rb_ary_modify(ary);
-    capa = ARY_CAPA(ary);
-    if (capa - (capa >> 6) <= new_len) {
-        ary_double_capa(ary, new_len);
+    if (len > ARY_MAX_SIZE - argc) {
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
     }
 
-    /* use shared array for big "queues" */
-    if (new_len > ARY_DEFAULT_SIZE * 4 && !ARY_EMBED_P(ary)) {
-        ary_verify(ary);
-
-        /* make a room for unshifted items */
-        capa = ARY_CAPA(ary);
-        ary_make_shared(ary);
-
-        head = sharedp = RARRAY_CONST_PTR(ary);
-        return make_room_for_unshift(ary, head, (void *)sharedp, argc, capa, len);
+    if (ARY_SHARED_P(ary)) {
+	VALUE shared = ARY_SHARED(ary);
+	capa = RARRAY_LEN(shared);
+	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
+	    head = RARRAY_CONST_PTR(ary);
+	    sharedp = RARRAY_CONST_PTR(shared);
+	    goto makeroom_if_need;
+	}
     }
-    else {
-        /* sliding items */
-        RARRAY_PTR_USE(ary, ptr, {
-            MEMMOVE(ptr + argc, ptr, VALUE, len);
-        });
 
-        ary_verify(ary);
-        return ary;
+    rb_ary_modify(ary);
+    capa = ARY_CAPA(ary);
+    if (capa - (capa >> 6) <= new_len) {
+	ary_double_capa(ary, new_len);
     }
-}
-
-static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
-{
-    long len = RARRAY_LEN(ary);
-    long new_len = len + argc;
 
-    if (len > ARY_MAX_SIZE - argc) {
-        rb_raise(rb_eIndexError, "index %ld too big", new_len);
-    }
-    else if (! ARY_SHARED_P(ary)) {
-        return ary_modify_for_unshift(ary, argc);
+    /* use shared array for big "queues" */
+    if (new_len > ARY_DEFAULT_SIZE * 4) {
+	/* make a room for unshifted items */
+	capa = ARY_CAPA(ary);
+	ary_make_shared(ary);
+
+	head = sharedp = RARRAY_CONST_PTR(ary);
+	goto makeroom;
+      makeroom_if_need:
+	if (head - sharedp < argc) {
+	    long room;
+	  makeroom:
+	    room = capa - new_len;
+	    room -= room >> 4;
+	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+	    head = sharedp + argc + room;
+	}
+	ARY_SET_PTR(ary, head - argc);
+	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
+	return ARY_SHARED(ary);
     }
     else {
-        VALUE shared_root = ARY_SHARED_ROOT(ary);
-        long capa = RARRAY_LEN(shared_root);
-
-        if (! ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
-            return ary_modify_for_unshift(ary, argc);
-        }
-        else if (new_len > capa) {
-            return ary_modify_for_unshift(ary, argc);
-        }
-        else {
-            const VALUE * head = RARRAY_CONST_PTR(ary);
-            void *sharedp = (void *)RARRAY_CONST_PTR(shared_root);
+	/* sliding items */
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMMOVE(ptr + argc, ptr, VALUE, len);
+	});
 
-            rb_ary_modify_check(ary);
-            return make_room_for_unshift(ary, head, sharedp, argc, capa, len);
-        }
+	return ary;
     }
 }
 
 /*
  *  call-seq:
- *    unshift(*objects) -> self
- *    prepend(*objects) -> self
+ *     ary.unshift(obj, ...)  -> ary
  *
- *  Prepends the given +objects+ to +self+:
+ *  Prepends objects to the front of +self+, moving other elements upwards.
+ *  See also Array#shift for the opposite effect.
  *
- *    a = [:foo, 'bar', 2]
- *    a.unshift(:bam, :bat) # => [:bam, :bat, :foo, "bar", 2]
- *
- *  Related: Array#shift;
- *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "b", "c", "d" ]
+ *     a.unshift("a")   #=> ["a", "b", "c", "d"]
+ *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
  */
 
-VALUE
+static VALUE
 rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
     long len = RARRAY_LEN(ary);
     VALUE target_ary;
 
     if (argc == 0) {
-        rb_ary_modify_check(ary);
-        return ary;
+	rb_ary_modify_check(ary);
+	return ary;
     }
 
     target_ary = ary_ensure_room_for_unshift(ary, argc);
@@ -1717,7 +1177,7 @@ rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 VALUE
 rb_ary_unshift(VALUE ary, VALUE item)
 {
-    return rb_ary_unshift_m(1, &item, ary);
+    return rb_ary_unshift_m(1,&item,ary);
 }
 
 /* faster version - use this if you don't need to treat negative offset */
@@ -1727,7 +1187,7 @@ rb_ary_elt(VALUE ary, long offset)
     long len = RARRAY_LEN(ary);
     if (len == 0) return Qnil;
     if (offset < 0 || len <= offset) {
-        return Qnil;
+	return Qnil;
     }
     return RARRAY_AREF(ary, offset);
 }
@@ -1735,11 +1195,14 @@ rb_ary_elt(VALUE ary, long offset)
 VALUE
 rb_ary_entry(VALUE ary, long offset)
 {
-    return rb_ary_entry_internal(ary, offset);
+    if (offset < 0) {
+	offset += RARRAY_LEN(ary);
+    }
+    return rb_ary_elt(ary, offset);
 }
 
 VALUE
-rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
+rb_ary_subseq(VALUE ary, long beg, long len)
 {
     VALUE klass;
     long alen = RARRAY_LEN(ary);
@@ -1748,213 +1211,95 @@ rb_ary_subseq_step(VALUE ary, long beg, long len, long step)
     if (beg < 0 || len < 0) return Qnil;
 
     if (alen < len || alen < beg + len) {
-        len = alen - beg;
+	len = alen - beg;
     }
-    klass = rb_cArray;
+    klass = rb_obj_class(ary);
     if (len == 0) return ary_new(klass, 0);
-    if (step == 0)
-        rb_raise(rb_eArgError, "slice step cannot be zero");
-    if (step == 1)
-        return ary_make_partial(ary, klass, beg, len);
-    else
-        return ary_make_partial_step(ary, klass, beg, len, step);
-}
 
-VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
-{
-    return rb_ary_subseq_step(ary, beg, len, 1);
+    return ary_make_partial(ary, klass, beg, len);
 }
 
-static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
-
 /*
  *  call-seq:
- *    self[index] -> object or nil
- *    self[start, length] -> object or nil
- *    self[range] -> object or nil
- *    self[aseq] -> object or nil
- *    slice(index) -> object or nil
- *    slice(start, length) -> object or nil
- *    slice(range) -> object or nil
- *    slice(aseq) -> object or nil
- *
- *  Returns elements from +self+; does not modify +self+.
- *
- *  In brief:
- *
- *    a = [:foo, 'bar', 2]
- *
- *    # Single argument index: returns one element.
- *    a[0]     # => :foo          # Zero-based index.
- *    a[-1]    # => 2             # Negative index counts backwards from end.
- *
- *    # Arguments start and length: returns an array.
- *    a[1, 2]  # => ["bar", 2]
- *    a[-2, 2] # => ["bar", 2]    # Negative start counts backwards from end.
- *
- *    # Single argument range: returns an array.
- *    a[0..1]  # => [:foo, "bar"]
- *    a[0..-2] # => [:foo, "bar"] # Negative range-begin counts backwards from end.
- *    a[-2..2] # => ["bar", 2]    # Negative range-end counts backwards from end.
- *
- *  When a single integer argument +index+ is given, returns the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0] # => :foo
- *    a[2] # => 2
- *    a # => [:foo, "bar", 2]
- *
- *  If +index+ is negative, counts backwards from the end of +self+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-1] # => 2
- *    a[-2] # => "bar"
- *
- *  If +index+ is out of range, returns +nil+.
- *
- *  When two Integer arguments +start+ and +length+ are given,
- *  returns a new array of size +length+ containing successive elements beginning at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0, 2] # => [:foo, "bar"]
- *    a[1, 2] # => ["bar", 2]
- *
- *  If <tt>start + length</tt> is greater than <tt>self.length</tt>,
- *  returns all elements from offset +start+ to the end:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0, 4] # => [:foo, "bar", 2]
- *    a[1, 3] # => ["bar", 2]
- *    a[2, 2] # => [2]
- *
- *  If <tt>start == self.size</tt> and <tt>length >= 0</tt>,
- *  returns a new empty array.
- *
- *  If +length+ is negative, returns +nil+.
- *
- *  When a single Range argument +range+ is given,
- *  treats <tt>range.min</tt> as +start+ above
- *  and <tt>range.size</tt> as +length+ above:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0..1] # => [:foo, "bar"]
- *    a[1..2] # => ["bar", 2]
- *
- *  Special case: If <tt>range.start == a.size</tt>, returns a new empty array.
- *
- *  If <tt>range.end</tt> is negative, calculates the end index from the end:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0..-1] # => [:foo, "bar", 2]
- *    a[0..-2] # => [:foo, "bar"]
- *    a[0..-3] # => [:foo]
- *
- *  If <tt>range.start</tt> is negative, calculates the start index from the end:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-1..2] # => [2]
- *    a[-2..2] # => ["bar", 2]
- *    a[-3..2] # => [:foo, "bar", 2]
- *
- *  If <tt>range.start</tt> is larger than the array size, returns +nil+.
- *
- *    a = [:foo, 'bar', 2]
- *    a[4..1] # => nil
- *    a[4..0] # => nil
- *    a[4..-1] # => nil
- *
- *  When a single Enumerator::ArithmeticSequence argument +aseq+ is given,
- *  returns an array of elements corresponding to the indexes produced by
- *  the sequence.
- *
- *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
- *    a[(1..).step(2)] # => ["data1", "data2", "data3"]
- *
- *  Unlike slicing with range, if the start or the end of the arithmetic sequence
- *  is larger than array size, throws RangeError.
- *
- *    a = ['--', 'data1', '--', 'data2', '--', 'data3']
- *    a[(1..11).step(2)]
- *    # RangeError (((1..11).step(2)) out of range)
- *    a[(7..).step(2)]
- *    # RangeError (((7..).step(2)) out of range)
- *
- *  If given a single argument, and its type is not one of the listed, tries to
- *  convert it to Integer, and raises if it is impossible:
+ *     ary[index]                -> obj     or nil
+ *     ary[start, length]        -> new_ary or nil
+ *     ary[range]                -> new_ary or nil
+ *     ary.slice(index)          -> obj     or nil
+ *     ary.slice(start, length)  -> new_ary or nil
+ *     ary.slice(range)          -> new_ary or nil
+ *
+ *  Element Reference --- Returns the element at +index+, or returns a
+ *  subarray starting at the +start+ index and continuing for +length+
+ *  elements, or returns a subarray specified by +range+ of indices.
+ *
+ *  Negative indices count backward from the end of the array (-1 is the last
+ *  element).  For +start+ and +range+ cases the starting index is just before
+ *  an element.  Additionally, an empty array is returned when the starting
+ *  index for an element range is at the end of the array.
+ *
+ *  Returns +nil+ if the index (or starting index) are out of range.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a[2] +  a[0] + a[1]    #=> "cab"
+ *     a[6]                   #=> nil
+ *     a[1, 2]                #=> [ "b", "c" ]
+ *     a[1..3]                #=> [ "b", "c", "d" ]
+ *     a[4..7]                #=> [ "e" ]
+ *     a[6..10]               #=> nil
+ *     a[-3, 3]               #=> [ "c", "d", "e" ]
+ *     # special cases
+ *     a[5]                   #=> nil
+ *     a[6, 1]                #=> nil
+ *     a[5, 1]                #=> []
+ *     a[5..10]               #=> []
  *
- *    a = [:foo, 'bar', 2]
- *    # Raises TypeError (no implicit conversion of Symbol into Integer):
- *    a[:foo]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 VALUE
 rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
 {
-    rb_check_arity(argc, 1, 2);
+    VALUE arg;
+    long beg, len;
+
     if (argc == 2) {
-        return rb_ary_aref2(ary, argv[0], argv[1]);
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	if (beg < 0) {
+	    beg += RARRAY_LEN(ary);
+	}
+	return rb_ary_subseq(ary, beg, len);
     }
-    return rb_ary_aref1(ary, argv[0]);
-}
-
-static VALUE
-rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
-{
-    long beg = NUM2LONG(b);
-    long len = NUM2LONG(e);
-    if (beg < 0) {
-        beg += RARRAY_LEN(ary);
+    if (argc != 1) {
+	rb_scan_args(argc, argv, "11", NULL, NULL);
     }
-    return rb_ary_subseq(ary, beg, len);
-}
-
-VALUE
-rb_ary_aref1(VALUE ary, VALUE arg)
-{
-    long beg, len, step;
-
+    arg = argv[0];
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
-        return rb_ary_entry(ary, FIX2LONG(arg));
+	return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    /* check if idx is Range or ArithmeticSequence */
-    switch (rb_arithmetic_sequence_beg_len_step(arg, &beg, &len, &step, RARRAY_LEN(ary), 0)) {
+    /* check if idx is Range */
+    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
       case Qfalse:
-        break;
+	break;
       case Qnil:
-        return Qnil;
+	return Qnil;
       default:
-        return rb_ary_subseq_step(ary, beg, len, step);
+	return rb_ary_subseq(ary, beg, len);
     }
-
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
 /*
  *  call-seq:
- *    at(index) -> object or nil
- *
- *  Returns the element of +self+ specified by the given +index+
- *  or +nil+ if there is no such element;
- *  +index+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
- *
- *  For non-negative +index+, returns the element of +self+ at offset +index+:
+ *     ary.at(index)   ->   obj  or nil
  *
- *    a = [:foo, 'bar', 2]
- *    a.at(0)   # => :foo
- *    a.at(2)   # => 2
- *    a.at(2.0) # => 2
+ *  Returns the element at +index+. A negative index counts from the end of
+ *  +self+. Returns +nil+ if the index is out of range. See also
+ *  Array#[].
  *
- *  For negative +index+, counts backwards from the end of +self+:
- *
- *    a.at(-2) # => "bar"
- *
- *  Related: Array#[];
- *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.at(0)     #=> "a"
+ *     a.at(-1)    #=> "e"
  */
 
 VALUE
@@ -1963,82 +1308,82 @@ rb_ary_at(VALUE ary, VALUE pos)
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
-#if 0
+/*
+ *  call-seq:
+ *     ary.first     ->   obj or nil
+ *     ary.first(n)  ->   new_ary
+ *
+ *  Returns the first element, or the first +n+ elements, of the array.
+ *  If the array is empty, the first form returns +nil+, and the
+ *  second form returns an empty array. See also Array#last for
+ *  the opposite effect.
+ *
+ *     a = [ "q", "r", "s", "t" ]
+ *     a.first     #=> "q"
+ *     a.first(2)  #=> ["q", "r"]
+ */
+
 static VALUE
 rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-        if (RARRAY_LEN(ary) == 0) return Qnil;
-        return RARRAY_AREF(ary, 0);
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_AREF(ary, 0);
     }
     else {
-        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
-#endif
-
-static VALUE
-ary_first(VALUE self)
-{
-    return (RARRAY_LEN(self) == 0) ? Qnil : RARRAY_AREF(self, 0);
-}
 
-static VALUE
-ary_last(VALUE self)
-{
-    long len = RARRAY_LEN(self);
-    return (len == 0) ? Qnil : RARRAY_AREF(self, len-1);
-}
+/*
+ *  call-seq:
+ *     ary.last     ->  obj or nil
+ *     ary.last(n)  ->  new_ary
+ *
+ *  Returns the last element(s) of +self+. If the array is empty,
+ *  the first form returns +nil+.
+ *
+ *  See also Array#first for the opposite effect.
+ *
+ *     a = [ "w", "x", "y", "z" ]
+ *     a.last     #=> "z"
+ *     a.last(2)  #=> ["y", "z"]
+ */
 
 VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary) // used by parse.y
+rb_ary_last(int argc, const VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-        return ary_last(ary);
+	long len = RARRAY_LEN(ary);
+	if (len == 0) return Qnil;
+	return RARRAY_AREF(ary, len-1);
     }
     else {
-        return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *    fetch(index) -> element
- *    fetch(index, default_value) -> element or default_value
- *    fetch(index) {|index| ... } -> element or block_return_value
- *
- *  Returns the element of +self+ at offset +index+ if +index+ is in range; +index+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
- *
- *  With the single argument +index+ and no block,
- *  returns the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(1)   # => "bar"
- *    a.fetch(1.1) # => "bar"
- *
- *  If +index+ is negative, counts from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(-1) # => 2
- *    a.fetch(-2) # => "bar"
- *
- *  With arguments +index+ and +default_value+ (which may be any object) and no block,
- *  returns +default_value+ if +index+ is out-of-range:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(1, nil)  # => "bar"
- *    a.fetch(3, :foo) # => :foo
- *
- *  With argument +index+ and a block,
- *  returns the element at offset +index+ if index is in range
- *  (and the block is not called); otherwise calls the block with index and returns its return value:
- *
- *    a = [:foo, 'bar', 2]
- *    a.fetch(1) {|index| raise 'Cannot happen' } # => "bar"
- *    a.fetch(50) {|index| "Value for #{index}" } # => "Value for 50"
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     ary.fetch(index)                    -> obj
+ *     ary.fetch(index, default)           -> obj
+ *     ary.fetch(index) { |index| block }  -> obj
+ *
+ *  Tries to return the element at position +index+, but throws an IndexError
+ *  exception if the referenced +index+ lies outside of the array bounds.  This
+ *  error can be prevented by supplying a second argument, which will act as a
+ *  +default+ value.
+ *
+ *  Alternatively, if a block is given it will only be executed when an
+ *  invalid +index+ is referenced.  Negative values of +index+ count from the
+ *  end of the array.
+ *
+ *     a = [ 11, 22, 33, 44 ]
+ *     a.fetch(1)               #=> 22
+ *     a.fetch(-1)              #=> 44
+ *     a.fetch(4, 'cat')        #=> "cat"
+ *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
+ *                              #=> "100 is out of bounds"
  */
 
 static VALUE
@@ -2051,143 +1396,149 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
     rb_scan_args(argc, argv, "11", &pos, &ifnone);
     block_given = rb_block_given_p();
     if (block_given && argc == 2) {
-        rb_warn("block supersedes default value argument");
+	rb_warn("block supersedes default value argument");
     }
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-        idx +=  RARRAY_LEN(ary);
+	idx +=  RARRAY_LEN(ary);
     }
     if (idx < 0 || RARRAY_LEN(ary) <= idx) {
-        if (block_given) return rb_yield(pos);
-        if (argc == 1) {
-            rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
-                        idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
-        }
-        return ifnone;
+	if (block_given) return rb_yield(pos);
+	if (argc == 1) {
+	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+	}
+	return ifnone;
     }
     return RARRAY_AREF(ary, idx);
 }
 
 /*
  *  call-seq:
- *    find_index(object) -> integer or nil
- *    find_index {|element| ... } -> integer or nil
- *    find_index -> new_enumerator
- *    index(object) -> integer or nil
- *    index {|element| ... } -> integer or nil
- *    index -> new_enumerator
- *
- *  Returns the zero-based integer index of a specified element, or +nil+.
- *
- *  With only argument +object+ given,
- *  returns the index of the first element +element+
- *  for which <tt>object == element</tt>:
+ *     ary.find_index(obj)             ->  int or nil
+ *     ary.find_index { |item| block } ->  int or nil
+ *     ary.find_index                  ->  Enumerator
+ *     ary.index(obj)             ->  int or nil
+ *     ary.index { |item| block } ->  int or nil
+ *     ary.index                  ->  Enumerator
  *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.index('bar') # => 1
+ *  Returns the _index_ of the first object in +ary+ such that the object is
+ *  <code>==</code> to +obj+.
  *
- *  Returns +nil+ if no such element found.
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+.  Returns +nil+ if no
+ *  match is found.
  *
- *  With only a block given,
- *  calls the block with each successive element;
- *  returns the index of the first element for which the block returns a truthy value:
+ *  See also Array#rindex.
  *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.index {|element| element == 'bar' } # => 1
+ *  An Enumerator is returned if neither a block nor argument is given.
  *
- *  Returns +nil+ if the block never returns a truthy value.
- *
- *  With neither an argument nor a block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     a = [ "a", "b", "c" ]
+ *     a.index("b")              #=> 1
+ *     a.index("z")              #=> nil
+ *     a.index { |x| x == "b" }  #=> 1
  */
 
 static VALUE
 rb_ary_index(int argc, VALUE *argv, VALUE ary)
 {
+    const VALUE *ptr;
     VALUE val;
-    long i;
+    long i, len;
 
     if (argc == 0) {
-        RETURN_ENUMERATOR(ary, 0, 0);
-        for (i=0; i<RARRAY_LEN(ary); i++) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-                return LONG2NUM(i);
-            }
-        }
-        return Qnil;
+	RETURN_ENUMERATOR(ary, 0, 0);
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+		return LONG2NUM(i);
+	    }
+	}
+	return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-        rb_warn("given block not used");
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-        VALUE e = RARRAY_AREF(ary, i);
-        if (rb_equal(e, val)) {
-            return LONG2NUM(i);
-        }
+	rb_warn("given block not used");
+    len = RARRAY_LEN(ary);
+    ptr = RARRAY_CONST_PTR(ary);
+    for (i=0; i<len; i++) {
+	VALUE e = ptr[i];
+	switch (rb_equal_opt(e, val)) {
+	  case Qundef:
+	    if (!rb_equal(e, val)) break;
+	  case Qtrue:
+	    return LONG2NUM(i);
+	  case Qfalse:
+	    continue;
+	}
+	len = RARRAY_LEN(ary);
+	ptr = RARRAY_CONST_PTR(ary);
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *    rindex(object) -> integer or nil
- *    rindex {|element| ... } -> integer or nil
- *    rindex -> new_enumerator
- *
- *  Returns the index of the last element for which <tt>object == element</tt>.
- *
- *  With argument +object+ given, returns the index of the last such element found:
- *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.rindex('bar') # => 3
+ *     ary.rindex(obj)             ->  int or nil
+ *     ary.rindex { |item| block } ->  int or nil
+ *     ary.rindex                  ->  Enumerator
  *
- *  Returns +nil+ if no such object found.
+ *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
  *
- *  With a block given, calls the block with each successive element;
- *  returns the index of the last element for which the block returns a truthy value:
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+, starting from the last
+ *  object.
  *
- *    a = [:foo, 'bar', 2, 'bar']
- *    a.rindex {|element| element == 'bar' } # => 3
+ *  Returns +nil+ if no match is found.
  *
- *  Returns +nil+ if the block never returns a truthy value.
+ *  See also Array#index.
  *
- *  When neither an argument nor a block is given, returns a new Enumerator.
+ *  If neither block nor argument is given, an Enumerator is returned instead.
  *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.rindex("b")             #=> 3
+ *     a.rindex("z")             #=> nil
+ *     a.rindex { |x| x == "b" } #=> 3
  */
 
 static VALUE
 rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
 {
+    const VALUE *ptr;
     VALUE val;
     long i = RARRAY_LEN(ary), len;
 
     if (argc == 0) {
-        RETURN_ENUMERATOR(ary, 0, 0);
-        while (i--) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
-                return LONG2NUM(i);
-            if (i > (len = RARRAY_LEN(ary))) {
-                i = len;
-            }
-        }
-        return Qnil;
+	RETURN_ENUMERATOR(ary, 0, 0);
+	while (i--) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+		return LONG2NUM(i);
+	    if (i > (len = RARRAY_LEN(ary))) {
+		i = len;
+	    }
+	}
+	return Qnil;
     }
     rb_check_arity(argc, 0, 1);
     val = argv[0];
     if (rb_block_given_p())
-        rb_warn("given block not used");
+	rb_warn("given block not used");
+    ptr = RARRAY_CONST_PTR(ary);
     while (i--) {
-        VALUE e = RARRAY_AREF(ary, i);
-        if (rb_equal(e, val)) {
-            return LONG2NUM(i);
-        }
-        if (i > RARRAY_LEN(ary)) {
-            break;
-        }
+	VALUE e = ptr[i];
+	switch (rb_equal_opt(e, val)) {
+	  case Qundef:
+	    if (!rb_equal(e, val)) break;
+	  case Qtrue:
+	    return LONG2NUM(i);
+	  case Qfalse:
+	    continue;
+	}
+	if (i > (len = RARRAY_LEN(ary))) {
+	    i = len;
+	}
+	ptr = RARRAY_CONST_PTR(ary);
     }
     return Qnil;
 }
@@ -2202,78 +1553,68 @@ rb_ary_to_ary(VALUE obj)
 }
 
 static void
-rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
+rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
 {
+    long rlen;
     long olen;
-    long rofs;
 
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
     olen = RARRAY_LEN(ary);
     if (beg < 0) {
-        beg += olen;
-        if (beg < 0) {
-            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-                     beg - olen, -olen);
-        }
+	beg += olen;
+	if (beg < 0) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     beg - olen, -olen);
+	}
     }
     if (olen < len || olen < beg + len) {
-        len = olen - beg;
+	len = olen - beg;
     }
 
-    {
-        const VALUE *optr = RARRAY_CONST_PTR(ary);
-        rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+    if (rpl == Qundef) {
+	rlen = 0;
+    }
+    else {
+	rpl = rb_ary_to_ary(rpl);
+	rlen = RARRAY_LEN(rpl);
+	olen = RARRAY_LEN(ary);	/* ary may be resized in rpl.to_ary too */
     }
-
     if (beg >= olen) {
-        VALUE target_ary;
-        if (beg > ARY_MAX_SIZE - rlen) {
-            rb_raise(rb_eIndexError, "index %ld too big", beg);
-        }
-        target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
-        len = beg + rlen;
-        ary_mem_clear(ary, olen, beg - olen);
-        if (rlen > 0) {
-            if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
-            ary_memcpy0(ary, beg, rlen, rptr, target_ary);
-        }
-        ARY_SET_LEN(ary, len);
+	VALUE target_ary;
+	if (beg > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", beg);
+	}
+	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+	len = beg + rlen;
+	ary_mem_clear(ary, olen, beg - olen);
+	if (rlen > 0) {
+	    ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
+	}
+	ARY_SET_LEN(ary, len);
     }
     else {
-        long alen;
-
-        if (olen - len > ARY_MAX_SIZE - rlen) {
-            rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
-        }
-        rb_ary_modify(ary);
-        alen = olen + rlen - len;
-        if (alen >= ARY_CAPA(ary)) {
-            ary_double_capa(ary, alen);
-        }
-
-        if (len != rlen) {
-            RARRAY_PTR_USE(ary, ptr,
-                                     MEMMOVE(ptr + beg + rlen, ptr + beg + len,
-                                             VALUE, olen - (beg + len)));
-            ARY_SET_LEN(ary, alen);
-        }
-        if (rlen > 0) {
-            if (rofs == -1) {
-                rb_gc_writebarrier_remember(ary);
-            }
-            else {
-                /* In this case, we're copying from a region in this array, so
-                 * we don't need to fire the write barrier. */
-                rptr = RARRAY_CONST_PTR(ary) + rofs;
-            }
-
-            /* do not use RARRAY_PTR() because it can causes GC.
-             * ary can contain T_NONE object because it is not cleared.
-             */
-            RARRAY_PTR_USE(ary, ptr,
-                                     MEMMOVE(ptr + beg, rptr, VALUE, rlen));
-        }
+	long alen;
+
+	if (olen - len > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+	}
+	rb_ary_modify(ary);
+	alen = olen + rlen - len;
+	if (alen >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, alen);
+	}
+
+	if (len != rlen) {
+	    RARRAY_PTR_USE(ary, ptr,
+			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+				   VALUE, olen - (beg + len)));
+	    ARY_SET_LEN(ary, alen);
+	}
+	if (rlen > 0) {
+	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
+	}
     }
+    RB_GC_GUARD(rpl);
 }
 
 void
@@ -2283,14 +1624,22 @@ rb_ary_set_len(VALUE ary, long len)
 
     rb_ary_modify_check(ary);
     if (ARY_SHARED_P(ary)) {
-        rb_raise(rb_eRuntimeError, "can't set length of shared ");
+	rb_raise(rb_eRuntimeError, "can't set length of shared ");
     }
     if (len > (capa = (long)ARY_CAPA(ary))) {
-        rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
     }
     ARY_SET_LEN(ary, len);
 }
 
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary  an array
+ * \param len  new size
+ * \return     \a ary
+ * \post       the size of \a ary is \a len.
+ */
 VALUE
 rb_ary_resize(VALUE ary, long len)
 {
@@ -2300,199 +1649,68 @@ rb_ary_resize(VALUE ary, long len)
     olen = RARRAY_LEN(ary);
     if (len == olen) return ary;
     if (len > ARY_MAX_SIZE) {
-        rb_raise(rb_eIndexError, "index %ld too big", len);
+	rb_raise(rb_eIndexError, "index %ld too big", len);
     }
     if (len > olen) {
-        if (len > ARY_CAPA(ary)) {
-            ary_double_capa(ary, len);
-        }
-        ary_mem_clear(ary, olen, len - olen);
-        ARY_SET_LEN(ary, len);
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
+	}
+	ary_mem_clear(ary, olen, len - olen);
+	ARY_SET_LEN(ary, len);
     }
     else if (ARY_EMBED_P(ary)) {
         ARY_SET_EMBED_LEN(ary, len);
     }
-    else if (len <= ary_embed_capa(ary)) {
-        const VALUE *ptr = ARY_HEAP_PTR(ary);
-        long ptr_capa = ARY_HEAP_SIZE(ary);
-        bool is_malloc_ptr = !ARY_SHARED_P(ary);
-
-        FL_SET_EMBED(ary);
-
-        MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len); /* WB: no new reference */
+    else if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE tmp[RARRAY_EMBED_LEN_MAX];
+	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+	ary_discard(ary);
+	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
         ARY_SET_EMBED_LEN(ary, len);
-
-        if (is_malloc_ptr) ruby_sized_xfree((void *)ptr, ptr_capa);
     }
     else {
-        if (olen > len + ARY_DEFAULT_SIZE) {
-            size_t new_capa = ary_heap_realloc(ary, len);
-            ARY_SET_CAPA(ary, new_capa);
-        }
-        ARY_SET_HEAP_LEN(ary, len);
+	if (olen > len + ARY_DEFAULT_SIZE) {
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
+	    ARY_SET_CAPA(ary, len);
+	}
+	ARY_SET_HEAP_LEN(ary, len);
     }
-    ary_verify(ary);
     return ary;
 }
 
-static VALUE
-ary_aset_by_rb_ary_store(VALUE ary, long key, VALUE val)
-{
-    rb_ary_store(ary, key, val);
-    return val;
-}
-
-static VALUE
-ary_aset_by_rb_ary_splice(VALUE ary, long beg, long len, VALUE val)
-{
-    VALUE rpl = rb_ary_to_ary(val);
-    rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
-    RB_GC_GUARD(rpl);
-    return val;
-}
-
 /*
  *  call-seq:
- *    self[index] = object -> object
- *    self[start, length] = object -> object
- *    self[range] = object -> object
- *
- *  Assigns elements in +self+, based on the given +object+; returns +object+.
- *
- *  In brief:
- *
- *      a_orig = [:foo, 'bar', 2]
- *
- *      # With argument index.
- *      a = a_orig.dup
- *      a[0] = 'foo' # => "foo"
- *      a # => ["foo", "bar", 2]
- *      a = a_orig.dup
- *      a[7] = 'foo' # => "foo"
- *      a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
- *
- *      # With arguments start and length.
- *      a = a_orig.dup
- *      a[0, 2] = 'foo' # => "foo"
- *      a # => ["foo", 2]
- *      a = a_orig.dup
- *      a[6, 50] = 'foo' # => "foo"
- *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *      # With argument range.
- *      a = a_orig.dup
- *      a[0..1] = 'foo' # => "foo"
- *      a # => ["foo", 2]
- *      a = a_orig.dup
- *      a[6..50] = 'foo' # => "foo"
- *      a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *  When Integer argument +index+ is given, assigns +object+ to an element in +self+.
- *
- *  If +index+ is non-negative, assigns +object+ the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0] = 'foo' # => "foo"
- *    a # => ["foo", "bar", 2]
- *
- *  If +index+ is greater than <tt>self.length</tt>, extends the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[7] = 'foo' # => "foo"
- *    a # => [:foo, "bar", 2, nil, nil, nil, nil, "foo"]
- *
- *  If +index+ is negative, counts backwards from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-1] = 'two' # => "two"
- *    a # => [:foo, "bar", "two"]
- *
- *  When Integer arguments +start+ and +length+ are given and +object+ is not an array,
- *  removes <tt>length - 1</tt> elements beginning at offset +start+,
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0, 2] = 'foo' # => "foo"
- *    a # => ["foo", 2]
- *
- *  If +start+ is negative, counts backwards from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-2, 2] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  If +start+ is non-negative and outside the array (<tt> >= self.size</tt>),
- *  extends the array with +nil+, assigns +object+ at offset +start+,
- *  and ignores +length+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[6, 50] = 'foo' # => "foo"
- *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *  If +length+ is zero, shifts elements at and following offset +start+
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1, 0] = 'foo' # => "foo"
- *    a # => [:foo, "foo", "bar", 2]
- *
- *  If +length+ is too large for the existing array, does not extend the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1, 5] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  When Range argument +range+ is given and +object+ is not an array,
- *  removes <tt>length - 1</tt> elements beginning at offset +start+,
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[0..1] = 'foo' # => "foo"
- *    a # => ["foo", 2]
- *
- *  if <tt>range.begin</tt> is negative, counts backwards from the end of the array:
- *
- *    a = [:foo, 'bar', 2]
- *    a[-2..2] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  If the array length is less than <tt>range.begin</tt>,
- *  extends the array with +nil+, assigns +object+ at offset <tt>range.begin</tt>,
- *  and ignores +length+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[6..50] = 'foo' # => "foo"
- *    a # => [:foo, "bar", 2, nil, nil, nil, "foo"]
- *
- *  If <tt>range.end</tt> is zero, shifts elements at and following offset +start+
- *  and assigns +object+ at offset +start+:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1..0] = 'foo' # => "foo"
- *    a # => [:foo, "foo", "bar", 2]
- *
- *  If <tt>range.end</tt> is negative, assigns +object+ at offset +start+,
- *  retains <tt>range.end.abs -1</tt> elements past that, and removes those beyond:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1..-1] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *    a = [:foo, 'bar', 2]
- *    a[1..-2] = 'foo' # => "foo"
- *    a # => [:foo, "foo", 2]
- *    a = [:foo, 'bar', 2]
- *    a[1..-3] = 'foo' # => "foo"
- *    a # => [:foo, "foo", "bar", 2]
- *    a = [:foo, 'bar', 2]
- *
- *  If <tt>range.end</tt> is too large for the existing array,
- *  replaces array elements, but does not extend the array with +nil+ values:
- *
- *    a = [:foo, 'bar', 2]
- *    a[1..5] = 'foo' # => "foo"
- *    a # => [:foo, "foo"]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     ary[index]         = obj                      ->  obj
+ *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
+ *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
+ *
+ *  Element Assignment --- Sets the element at +index+, or replaces a subarray
+ *  from the +start+ index for +length+ elements, or replaces a subarray
+ *  specified by the +range+ of indices.
+ *
+ *  If indices are greater than the current capacity of the array, the array
+ *  grows automatically.  Elements are inserted into the array at +start+ if
+ *  +length+ is zero.
+ *
+ *  Negative indices will count backward from the end of the array.  For
+ *  +start+ and +range+ cases the starting index is just before an element.
+ *
+ *  An IndexError is raised if a negative index points past the beginning of
+ *  the array.
+ *
+ *  See also Array#push, and Array#unshift.
+ *
+ *     a = Array.new
+ *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
+ *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
+ *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
+ *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
+ *     a[0..2] = "A"               #=> ["A", "4"]
+ *     a[-1]   = "Z"               #=> ["A", "Z"]
+ *     a[1..-1] = nil              #=> ["A", nil]
+ *     a[1..-1] = []               #=> ["A"]
+ *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
+ *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
  */
 
 static VALUE
@@ -2500,60 +1718,45 @@ rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
 
-    rb_check_arity(argc, 2, 3);
-    rb_ary_modify_check(ary);
     if (argc == 3) {
-        beg = NUM2LONG(argv[0]);
-        len = NUM2LONG(argv[1]);
-        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[2]);
+	rb_ary_modify_check(ary);
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	rb_ary_splice(ary, beg, len, argv[2]);
+	return argv[2];
     }
+    rb_check_arity(argc, 2, 2);
+    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
-        offset = FIX2LONG(argv[0]);
-        return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
+	offset = FIX2LONG(argv[0]);
+	goto fixnum;
     }
     if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
-        /* check if idx is Range */
-        return ary_aset_by_rb_ary_splice(ary, beg, len, argv[1]);
+	/* check if idx is Range */
+	rb_ary_splice(ary, beg, len, argv[1]);
+	return argv[1];
     }
 
     offset = NUM2LONG(argv[0]);
-    return ary_aset_by_rb_ary_store(ary, offset, argv[1]);
+fixnum:
+    rb_ary_store(ary, offset, argv[1]);
+    return argv[1];
 }
 
 /*
  *  call-seq:
- *    insert(index, *objects) -> self
- *
- *  Inserts the given +objects+ as elements of +self+;
- *  returns +self+.
- *
- *  When +index+ is non-negative, inserts +objects+
- *  _before_ the element at offset +index+:
- *
- *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
- *    a.insert(1, :x, :y, :z) # => ["a", :x, :y, :z, "b", "c"]
+ *     ary.insert(index, obj...)  -> ary
  *
- *  Extends the array if +index+ is beyond the array (<tt>index >= self.size</tt>):
+ *  Inserts the given values before the element with the given +index+.
  *
- *    a = ['a', 'b', 'c']     # => ["a", "b", "c"]
- *    a.insert(5, :x, :y, :z) # => ["a", "b", "c", nil, nil, :x, :y, :z]
+ *  Negative indices count backwards from the end of the array, where +-1+ is
+ *  the last element. If a negative index is used, the given values will be
+ *  inserted after that element, so using an index of +-1+ will insert the
+ *  values at the end of the array.
  *
- *  When +index+ is negative, inserts +objects+
- *  _after_ the element at offset <tt>index + self.size</tt>:
- *
- *    a = ['a', 'b', 'c']      # => ["a", "b", "c"]
- *    a.insert(-2, :x, :y, :z) # => ["a", "b", :x, :y, :z, "c"]
- *
- *  With no +objects+ given, does nothing:
- *
- *    a = ['a', 'b', 'c'] # => ["a", "b", "c"]
- *    a.insert(1)         # => ["a", "b", "c"]
- *    a.insert(50)        # => ["a", "b", "c"]
- *    a.insert(-50)       # => ["a", "b", "c"]
- *
- *  Raises IndexError if +objects+ are given and +index+ is negative and out of range.
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = %w{ a b c d }
+ *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
+ *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
  */
 
 static VALUE
@@ -2566,17 +1769,12 @@ rb_ary_insert(int argc, VALUE *argv, VALUE ary)
     pos = NUM2LONG(argv[0]);
     if (argc == 1) return ary;
     if (pos == -1) {
-        pos = RARRAY_LEN(ary);
+	pos = RARRAY_LEN(ary);
     }
-    else if (pos < 0) {
-        long minpos = -RARRAY_LEN(ary) - 1;
-        if (pos < minpos) {
-            rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-                     pos, minpos);
-        }
-        pos++;
+    if (pos < 0) {
+	pos++;
     }
-    rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
+    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
     return ary;
 }
 
@@ -2589,97 +1787,52 @@ ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
     return rb_ary_length(ary);
 }
 
-// Primitive to avoid a race condition in Array#each.
-// Return `true` and write `value` and `index` if the element exists.
-static VALUE
-ary_fetch_next(VALUE self, VALUE *index, VALUE *value)
-{
-    long i = NUM2LONG(*index);
-    if (i >= RARRAY_LEN(self)) {
-        return Qfalse;
-    }
-    *value = RARRAY_AREF(self, i);
-    *index = LONG2NUM(i + 1);
-    return Qtrue;
-}
-
 /*
  *  call-seq:
- *    each {|element| ... } -> self
- *    each -> new_enumerator
- *
- *  With a block given, iterates over the elements of +self+,
- *  passing each element to the block;
- *  returns +self+:
+ *     ary.each { |item| block }  -> ary
+ *     ary.each                   -> Enumerator
  *
- *    a = [:foo, 'bar', 2]
- *    a.each {|element|  puts "#{element.class} #{element}" }
+ *  Calls the given block once for each element in +self+, passing that element
+ *  as a parameter.  Returns the array itself.
  *
- *  Output:
+ *  If no block is given, an Enumerator is returned.
  *
- *    Symbol foo
- *    String bar
- *    Integer 2
+ *     a = [ "a", "b", "c" ]
+ *     a.each {|x| print x, " -- " }
  *
- *  Allows the array to be modified during iteration:
+ *  produces:
  *
- *    a = [:foo, 'bar', 2]
- *    a.each {|element| puts element; a.clear if element.to_s.start_with?('b') }
- *
- *  Output:
- *
- *    foo
- *    bar
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *     a -- b -- c --
  */
 
 VALUE
 rb_ary_each(VALUE ary)
 {
     long i;
-    ary_verify(ary);
+
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        rb_yield(RARRAY_AREF(ary, i));
+	rb_yield(RARRAY_AREF(ary, i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    each_index {|index| ... } -> self
- *    each_index -> new_enumerator
- *
- *  With a block given, iterates over the elements of +self+,
- *  passing each <i>array index</i> to the block;
- *  returns +self+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.each_index {|index|  puts "#{index} #{a[index]}" }
+ *     ary.each_index { |index| block }  -> ary
+ *     ary.each_index                    -> Enumerator
  *
- *  Output:
+ *  Same as Array#each, but passes the +index+ of the element instead of the
+ *  element itself.
  *
- *    0 foo
- *    1 bar
- *    2 2
+ *  An Enumerator is returned if no block is given.
  *
- *  Allows the array to be modified during iteration:
+ *     a = [ "a", "b", "c" ]
+ *     a.each_index {|x| print x, " -- " }
  *
- *    a = [:foo, 'bar', 2]
- *    a.each_index {|index| puts index; a.clear if index > 0 }
- *    a # => []
+ *  produces:
  *
- *  Output:
- *
- *    0
- *    1
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *     0 -- 1 -- 2 --
  */
 
 static VALUE
@@ -2689,33 +1842,24 @@ rb_ary_each_index(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        rb_yield(LONG2NUM(i));
+	rb_yield(LONG2NUM(i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    reverse_each {|element| ... } -> self
- *    reverse_each -> Enumerator
- *
- *  When a block given, iterates backwards over the elements of +self+,
- *  passing, in reverse order, each element to the block;
- *  returns +self+:
+ *     ary.reverse_each { |item| block }  -> ary
+ *     ary.reverse_each                   -> Enumerator
  *
- *    a = []
- *    [0, 1, 2].reverse_each {|element| a.push(element) }
- *    a # => [2, 1, 0]
+ *  Same as Array#each, but traverses +self+ in reverse order.
  *
- *  Allows the array to be modified during iteration:
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse_each {|x| print x, " " }
  *
- *    a = ['a', 'b', 'c']
- *    a.reverse_each {|element| a.clear if element.start_with?('b') }
- *    a # => []
+ *  produces:
  *
- *  When no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *     c b a
  */
 
 static VALUE
@@ -2726,27 +1870,24 @@ rb_ary_reverse_each(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     len = RARRAY_LEN(ary);
     while (len--) {
-        long nlen;
-        rb_yield(RARRAY_AREF(ary, len));
-        nlen = RARRAY_LEN(ary);
-        if (nlen < len) {
-            len = nlen;
-        }
+	long nlen;
+	rb_yield(RARRAY_AREF(ary, len));
+	nlen = RARRAY_LEN(ary);
+	if (nlen < len) {
+	    len = nlen;
+	}
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    length -> integer
- *    size -> integer
- *
- *  Returns the count of elements in +self+:
+ *     ary.length -> int
  *
- *    [0, 1, 2].length # => 3
- *    [].length        # => 0
+ *  Returns the number of elements in +self+. May be zero.
  *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     [ 1, 2, 3, 4, 5 ].length   #=> 5
+ *     [].length                  #=> 0
  */
 
 static VALUE
@@ -2758,18 +1899,19 @@ rb_ary_length(VALUE ary)
 
 /*
  *  call-seq:
- *    empty?  -> true or false
+ *     ary.empty?   -> true or false
  *
- *  Returns +true+ if the count of elements in +self+ is zero,
- *  +false+ otherwise.
+ *  Returns +true+ if +self+ contains no elements.
  *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     [].empty?   #=> true
  */
 
 static VALUE
 rb_ary_empty_p(VALUE ary)
 {
-    return RBOOL(RARRAY_LEN(ary) == 0);
+    if (RARRAY_LEN(ary) == 0)
+	return Qtrue;
+    return Qfalse;
 }
 
 VALUE
@@ -2779,16 +1921,13 @@ rb_ary_dup(VALUE ary)
     VALUE dup = rb_ary_new2(len);
     ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
     ARY_SET_LEN(dup, len);
-
-    ary_verify(ary);
-    ary_verify(dup);
     return dup;
 }
 
 VALUE
 rb_ary_resurrect(VALUE ary)
 {
-    return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
 }
 
 extern VALUE rb_output_fs;
@@ -2805,15 +1944,15 @@ recursive_join(VALUE obj, VALUE argp, int recur)
     int *first = (int *)arg[3];
 
     if (recur) {
-        rb_raise(rb_eArgError, "recursive array join");
+	rb_raise(rb_eArgError, "recursive array join");
     }
     else {
-        ary_join_1(obj, ary, sep, 0, result, first);
+	ary_join_1(obj, ary, sep, 0, result, first);
     }
     return Qnil;
 }
 
-static long
+static void
 ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
     long i;
@@ -2821,40 +1960,11 @@ ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 
     if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
     for (i=0; i<max; i++) {
-        val = RARRAY_AREF(ary, i);
-        if (!RB_TYPE_P(val, T_STRING)) break;
-        if (i > 0 && !NIL_P(sep))
-            rb_str_buf_append(result, sep);
-        rb_str_buf_append(result, val);
-    }
-    return i;
-}
-
-static void
-ary_join_1_str(VALUE dst, VALUE src, int *first)
-{
-    rb_str_buf_append(dst, src);
-    if (*first) {
-        rb_enc_copy(dst, src);
-        *first = FALSE;
-    }
-}
-
-static void
-ary_join_1_ary(VALUE obj, VALUE ary, VALUE sep, VALUE result, VALUE val, int *first)
-{
-    if (val == ary) {
-        rb_raise(rb_eArgError, "recursive array join");
-    }
-    else {
-        VALUE args[4];
-
-        *first = FALSE;
-        args[0] = val;
-        args[1] = sep;
-        args[2] = result;
-        args[3] = (VALUE)first;
-        rb_exec_recursive(recursive_join, obj, (VALUE)args);
+	val = RARRAY_AREF(ary, i);
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+	rb_str_buf_append(result, val);
+	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
     }
 }
 
@@ -2864,25 +1974,50 @@ ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
     VALUE val, tmp;
 
     for (; i<RARRAY_LEN(ary); i++) {
-        if (i > 0 && !NIL_P(sep))
-            rb_str_buf_append(result, sep);
-
-        val = RARRAY_AREF(ary, i);
-        if (RB_TYPE_P(val, T_STRING)) {
-            ary_join_1_str(result, val, first);
-        }
-        else if (RB_TYPE_P(val, T_ARRAY)) {
-            ary_join_1_ary(val, ary, sep, result, val, first);
-        }
-        else if (!NIL_P(tmp = rb_check_string_type(val))) {
-            ary_join_1_str(result, tmp, first);
-        }
-        else if (!NIL_P(tmp = rb_check_array_type(val))) {
-            ary_join_1_ary(val, ary, sep, result, tmp, first);
-        }
-        else {
-            ary_join_1_str(result, rb_obj_as_string(val), first);
-        }
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+
+	val = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(val, T_STRING)) {
+	  str_join:
+	    rb_str_buf_append(result, val);
+	    *first = FALSE;
+	}
+	else if (RB_TYPE_P(val, T_ARRAY)) {
+	    obj = val;
+	  ary_join:
+	    if (val == ary) {
+		rb_raise(rb_eArgError, "recursive array join");
+	    }
+	    else {
+		VALUE args[4];
+
+		args[0] = val;
+		args[1] = sep;
+		args[2] = result;
+		args[3] = (VALUE)first;
+		rb_exec_recursive(recursive_join, obj, (VALUE)args);
+	    }
+	}
+	else {
+	    tmp = rb_check_string_type(val);
+	    if (!NIL_P(tmp)) {
+		val = tmp;
+		goto str_join;
+	    }
+	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
+	    if (!NIL_P(tmp)) {
+		obj = val;
+		val = tmp;
+		goto ary_join;
+	    }
+	    val = rb_obj_as_string(val);
+	    if (*first) {
+		rb_enc_copy(result, val);
+		*first = FALSE;
+	    }
+	    goto str_join;
+	}
     }
 }
 
@@ -2890,36 +2025,36 @@ VALUE
 rb_ary_join(VALUE ary, VALUE sep)
 {
     long len = 1, i;
+    int taint = FALSE;
     VALUE val, tmp, result;
 
     if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+    if (OBJ_TAINTED(ary)) taint = TRUE;
 
     if (!NIL_P(sep)) {
-        StringValue(sep);
-        len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+	StringValue(sep);
+	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
     }
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        val = RARRAY_AREF(ary, i);
-        tmp = rb_check_string_type(val);
-
-        if (NIL_P(tmp) || tmp != val) {
-            int first;
-            long n = RARRAY_LEN(ary);
-            if (i > n) i = n;
-            result = rb_str_buf_new(len + (n-i)*10);
-            rb_enc_associate(result, rb_usascii_encoding());
-            i = ary_join_0(ary, sep, i, result);
-            first = i == 0;
-            ary_join_1(ary, ary, sep, i, result, &first);
-            return result;
-        }
+	val = RARRAY_AREF(ary, i);
+	tmp = rb_check_string_type(val);
 
-        len += RSTRING_LEN(tmp);
-    }
+	if (NIL_P(tmp) || tmp != val) {
+	    int first;
+	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+	    rb_enc_associate(result, rb_usascii_encoding());
+	    if (taint) OBJ_TAINT(result);
+	    ary_join_0(ary, sep, i, result);
+	    first = i == 0;
+	    ary_join_1(ary, ary, sep, i, result, &first);
+	    return result;
+	}
 
-    result = rb_str_new(0, len);
-    rb_str_set_len(result, 0);
+	len += RSTRING_LEN(tmp);
+    }
 
+    result = rb_str_buf_new(len);
+    if (taint) OBJ_TAINT(result);
     ary_join_0(ary, sep, RARRAY_LEN(ary), result);
 
     return result;
@@ -2927,44 +2062,24 @@ rb_ary_join(VALUE ary, VALUE sep)
 
 /*
  *  call-seq:
- *    join(separator = $,) -> new_string
- *
- *  Returns the new string formed by joining the converted elements of +self+;
- *  for each element +element+:
+ *     ary.join(separator=$,)    -> str
  *
- *  - Converts recursively using <tt>element.join(separator)</tt>
- *    if +element+ is a <tt>kind_of?(Array)</tt>.
- *  - Otherwise, converts using <tt>element.to_s</tt>.
+ *  Returns a string created by converting each element of the array to
+ *  a string, separated by the given +separator+.
+ *  If the +separator+ is +nil+, it uses current $,.
+ *  If both the +separator+ and $, are nil, it uses empty string.
  *
- *  With no argument given, joins using the output field separator, <tt>$,</tt>:
- *
- *    a = [:foo, 'bar', 2]
- *    $, # => nil
- *    a.join # => "foobar2"
- *
- *  With string argument +separator+ given, joins using that separator:
- *
- *    a = [:foo, 'bar', 2]
- *    a.join("\n") # => "foo\nbar\n2"
- *
- *  Joins recursively for nested arrays:
- *
- *   a = [:foo, [:bar, [:baz, :bat]]]
- *   a.join # => "foobarbazbat"
- *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     [ "a", "b", "c" ].join        #=> "abc"
+ *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
  */
+
 static VALUE
 rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
-    if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
-        sep = rb_output_fs;
-        if (!NIL_P(sep)) {
-            rb_category_warn(RB_WARN_CATEGORY_DEPRECATED, "$, is set to non-nil value");
-        }
-    }
+    rb_scan_args(argc, argv, "01", &sep);
+    if (NIL_P(sep)) sep = rb_output_fs;
 
     return rb_ary_join(ary, sep);
 }
@@ -2972,33 +2087,32 @@ rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 static VALUE
 inspect_ary(VALUE ary, VALUE dummy, int recur)
 {
+    int tainted = OBJ_TAINTED(ary);
     long i;
     VALUE s, str;
 
     if (recur) return rb_usascii_str_new_cstr("[...]");
     str = rb_str_buf_new2("[");
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        s = rb_inspect(RARRAY_AREF(ary, i));
-        if (i > 0) rb_str_buf_cat2(str, ", ");
-        else rb_enc_copy(str, s);
-        rb_str_buf_append(str, s);
+	s = rb_inspect(RARRAY_AREF(ary, i));
+	if (OBJ_TAINTED(s)) tainted = TRUE;
+	if (i > 0) rb_str_buf_cat2(str, ", ");
+	else rb_enc_copy(str, s);
+	rb_str_buf_append(str, s);
     }
     rb_str_buf_cat2(str, "]");
+    if (tainted) OBJ_TAINT(str);
     return str;
 }
 
 /*
  *  call-seq:
- *    inspect -> new_string
- *    to_s -> new_string
- *
- *  Returns the new string formed by calling method <tt>#inspect</tt>
- *  on each array element:
+ *     ary.inspect  -> string
+ *     ary.to_s     -> string
  *
- *    a = [:foo, 'bar', 2]
- *    a.inspect # => "[:foo, \"bar\", 2]"
+ *  Creates a string representation of +self+.
  *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
  */
 
 static VALUE
@@ -3016,84 +2130,59 @@ rb_ary_to_s(VALUE ary)
 
 /*
  *  call-seq:
- *    to_a -> self or new_array
+ *     ary.to_a     -> ary
  *
- *  When +self+ is an instance of \Array, returns +self+.
- *
- *  Otherwise, returns a new array containing the elements of +self+:
- *
- *    class MyArray < Array; end
- *    my_a = MyArray.new(['foo', 'bar', 'two'])
- *    a = my_a.to_a
- *    a # => ["foo", "bar", "two"]
- *    a.class # => Array # Not MyArray.
+ *  Returns +self+.
  *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *  If called on a subclass of Array, converts the receiver to an Array object.
  */
 
 static VALUE
 rb_ary_to_a(VALUE ary)
 {
     if (rb_obj_class(ary) != rb_cArray) {
-        VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
-        rb_ary_replace(dup, ary);
-        return dup;
+	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+	rb_ary_replace(dup, ary);
+	return dup;
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    to_h -> new_hash
- *    to_h {|element| ... } -> new_hash
+ *     ary.to_h     -> hash
  *
- *  Returns a new hash formed from +self+.
+ *  Returns the result of interpreting <i>ary</i> as an array of
+ *  <tt>[key, value]</tt> pairs.
  *
- *  With no block given, each element of +self+ must be a 2-element sub-array;
- *  forms each sub-array into a key-value pair in the new hash:
- *
- *    a = [['foo', 'zero'], ['bar', 'one'], ['baz', 'two']]
- *    a.to_h # => {"foo"=>"zero", "bar"=>"one", "baz"=>"two"}
- *    [].to_h # => {}
- *
- *  With a block given, the block must return a 2-element array;
- *  calls the block with each element of +self+;
- *  forms each returned array into a key-value pair in the returned hash:
- *
- *    a = ['foo', :bar, 1, [2, 3], {baz: 4}]
- *    a.to_h {|element| [element, element.class] }
- *    # => {"foo"=>String, :bar=>Symbol, 1=>Integer, [2, 3]=>Array, {:baz=>4}=>Hash}
- *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     [[:foo, :bar], [1, 2]].to_h
+ *       # => {:foo => :bar, 1 => 2}
  */
 
 static VALUE
 rb_ary_to_h(VALUE ary)
 {
     long i;
-    VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
-    int block_given = rb_block_given_p();
-
+    VALUE hash = rb_hash_new();
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        const VALUE e = rb_ary_elt(ary, i);
-        const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
-        const VALUE key_value_pair = rb_check_array_type(elt);
-        if (NIL_P(key_value_pair)) {
-            rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
-                     rb_obj_class(elt), i);
-        }
-        if (RARRAY_LEN(key_value_pair) != 2) {
-            rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
-                i, RARRAY_LEN(key_value_pair));
-        }
-        rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+	const VALUE elt = rb_ary_elt(ary, i);
+	const VALUE key_value_pair = rb_check_array_type(elt);
+	if (NIL_P(key_value_pair)) {
+	    rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+		     rb_obj_class(elt), i);
+	}
+	if (RARRAY_LEN(key_value_pair) != 2) {
+	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+		i, RARRAY_LEN(key_value_pair));
+	}
+	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
     return hash;
 }
 
 /*
  *  call-seq:
- *    to_ary -> self
+ *     ary.to_ary -> ary
  *
  *  Returns +self+.
  */
@@ -3108,9 +2197,9 @@ static void
 ary_reverse(VALUE *p1, VALUE *p2)
 {
     while (p1 < p2) {
-        VALUE tmp = *p1;
-        *p1++ = *p2;
-        *p2-- = tmp;
+	VALUE tmp = *p1;
+	*p1++ = *p2;
+	*p2-- = tmp;
     }
 }
 
@@ -3122,26 +2211,23 @@ rb_ary_reverse(VALUE ary)
 
     rb_ary_modify(ary);
     if (len > 1) {
-        RARRAY_PTR_USE(ary, p1, {
-            p2 = p1 + len - 1;	/* points last item */
-            ary_reverse(p1, p2);
-        }); /* WB: no new reference */
+	RARRAY_PTR_USE(ary, p1, {
+	    p2 = p1 + len - 1;	/* points last item */
+	    ary_reverse(p1, p2);
+	}); /* WB: no new reference */
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    reverse! -> self
+ *     ary.reverse!   -> ary
  *
- *  Reverses the order of the elements of +self+;
- *  returns +self+:
+ *  Reverses +self+ in place.
  *
- *    a = [0, 1, 2]
- *    a.reverse! # => [2, 1, 0]
- *    a          # => [2, 1, 0]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse!       #=> ["c", "b", "a"]
+ *     a                #=> ["c", "b", "a"]
  */
 
 static VALUE
@@ -3152,13 +2238,12 @@ rb_ary_reverse_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    reverse -> new_array
- *
- *  Returns a new array containing the elements of +self+ in reverse order:
+ *     ary.reverse    -> new_ary
  *
- *    [0, 1, 2].reverse # => [2, 1, 0]
+ *  Returns a new array containing +self+'s elements in reverse order.
  *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
+ *     [ 1 ].reverse               #=> [1]
  */
 
 static VALUE
@@ -3168,9 +2253,9 @@ rb_ary_reverse_m(VALUE ary)
     VALUE dup = rb_ary_new2(len);
 
     if (len > 0) {
-        const VALUE *p1 = RARRAY_CONST_PTR(ary);
-        VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
-        do *p2-- = *p1++; while (--len > 0);
+	const VALUE *p1 = RARRAY_CONST_PTR(ary);
+	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+	do *p2-- = *p1++; while (--len > 0);
     }
     ARY_SET_LEN(dup, RARRAY_LEN(ary));
     return dup;
@@ -3182,113 +2267,73 @@ rotate_count(long cnt, long len)
     return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
 }
 
-static void
-ary_rotate_ptr(VALUE *ptr, long len, long cnt)
-{
-    if (cnt == 1) {
-        VALUE tmp = *ptr;
-        memmove(ptr, ptr + 1, sizeof(VALUE)*(len - 1));
-        *(ptr + len - 1) = tmp;
-    }
-    else if (cnt == len - 1) {
-        VALUE tmp = *(ptr + len - 1);
-        memmove(ptr + 1, ptr, sizeof(VALUE)*(len - 1));
-        *ptr = tmp;
-    }
-    else {
-        --len;
-        if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
-        if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
-        if (len > 0) ary_reverse(ptr, ptr + len);
-    }
-}
-
 VALUE
 rb_ary_rotate(VALUE ary, long cnt)
 {
     rb_ary_modify(ary);
 
     if (cnt != 0) {
-        long len = RARRAY_LEN(ary);
-        if (len > 1 && (cnt = rotate_count(cnt, len)) > 0) {
-            RARRAY_PTR_USE(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
-            return ary;
-        }
+	VALUE *ptr = RARRAY_PTR(ary);
+	long len = RARRAY_LEN(ary);
+
+	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+	    --len;
+	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+	    if (len > 0) ary_reverse(ptr, ptr + len);
+	    return ary;
+	}
     }
+
     return Qnil;
 }
 
 /*
  *  call-seq:
- *    rotate!(count = 1) -> self
- *
- *  Rotates +self+ in place by moving elements from one end to the other; returns +self+.
- *
- *  With non-negative numeric +count+,
- *  rotates +count+ elements from the beginning to the end:
- *
- *    [0, 1, 2, 3].rotate!(2)   # => [2, 3, 0, 1]
-      [0, 1, 2, 3].rotate!(2.1) # => [2, 3, 0, 1]
- *
- *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
- *
- *    [0, 1, 2, 3].rotate!(21) # => [1, 2, 3, 0]
- *
- *  If +count+ is zero, rotates no elements:
- *
- *    [0, 1, 2, 3].rotate!(0) # => [0, 1, 2, 3]
- *
- *  With a negative numeric +count+, rotates in the opposite direction,
- *  from end to beginning:
+ *     ary.rotate!(count=1)   -> ary
  *
- *    [0, 1, 2, 3].rotate!(-1) # => [3, 0, 1, 2]
- *
- *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *  Rotates +self+ in place so that the element at +count+ comes first, and
+ *  returns +self+.
  *
- *    [0, 1, 2, 3].rotate!(-21) # => [3, 0, 1, 2]
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of the array where +-1+ is the last element.
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate!        #=> ["b", "c", "d", "a"]
+ *     a                #=> ["b", "c", "d", "a"]
+ *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
+ *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
 rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+    long n = 1;
+
+    switch (argc) {
+      case 1: n = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
     rb_ary_rotate(ary, n);
     return ary;
 }
 
 /*
  *  call-seq:
- *    rotate(count = 1) -> new_array
- *
- *  Returns a new array formed from +self+ with elements
- *  rotated from one end to the other.
- *
- *  With non-negative numeric +count+,
- *  rotates elements from the beginning to the end:
- *
- *    [0, 1, 2, 3].rotate(2)   # => [2, 3, 0, 1]
- *    [0, 1, 2, 3].rotate(2.1) # => [2, 3, 0, 1]
- *
- *  If +count+ is large, uses <tt>count % array.size</tt> as the count:
- *
- *    [0, 1, 2, 3].rotate(22) # => [2, 3, 0, 1]
- *
- *  With a +count+ of zero, rotates no elements:
- *
- *    [0, 1, 2, 3].rotate(0) # => [0, 1, 2, 3]
- *
- *  With negative numeric +count+, rotates in the opposite direction,
- *  from the end to the beginning:
- *
- *    [0, 1, 2, 3].rotate(-1) # => [3, 0, 1, 2]
+ *     ary.rotate(count=1)    -> new_ary
  *
- *  If +count+ is small (far from zero), uses <tt>count % array.size</tt> as the count:
+ *  Returns a new array by rotating +self+ so that the element at +count+ is
+ *  the first element of the new array.
  *
- *    [0, 1, 2, 3].rotate(-21) # => [3, 0, 1, 2]
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of +self+ where +-1+ is the last element.
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate         #=> ["b", "c", "d", "a"]
+ *     a                #=> ["a", "b", "c", "d"]
+ *     a.rotate(2)      #=> ["c", "d", "a", "b"]
+ *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
  */
 
 static VALUE
@@ -3296,17 +2341,22 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE rotated;
     const VALUE *ptr;
-    long len;
-    long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+    long len, cnt = 1;
+
+    switch (argc) {
+      case 1: cnt = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
 
     len = RARRAY_LEN(ary);
     rotated = rb_ary_new2(len);
     if (len > 0) {
-        cnt = rotate_count(cnt, len);
-        ptr = RARRAY_CONST_PTR(ary);
-        len -= cnt;
-        ary_memcpy(rotated, 0, len, ptr + cnt);
-        ary_memcpy(rotated, len, cnt, ptr);
+	cnt = rotate_count(cnt, len);
+	ptr = RARRAY_CONST_PTR(ary);
+	len -= cnt;
+	ary_memcpy(rotated, 0, len, ptr + cnt);
+	ary_memcpy(rotated, len, cnt, ptr);
     }
     ARY_SET_LEN(rotated, RARRAY_LEN(ary));
     return rotated;
@@ -3314,41 +2364,46 @@ rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 
 struct ary_sort_data {
     VALUE ary;
-    VALUE receiver;
+    int opt_methods;
+    int opt_inited;
 };
 
+enum {
+    sort_opt_Fixnum,
+    sort_opt_String,
+    sort_optimizable_count
+};
+
+#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
+
+#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
+#define SORT_OPTIMIZABLE(data, type) \
+    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
+     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
+     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
+      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
+      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
+
 static VALUE
 sort_reentered(VALUE ary)
 {
     if (RBASIC(ary)->klass) {
-        rb_raise(rb_eRuntimeError, "sort reentered");
+	rb_raise(rb_eRuntimeError, "sort reentered");
     }
     return Qnil;
 }
 
-static void
-sort_returned(struct ary_sort_data *data)
-{
-    if (rb_obj_frozen_p(data->receiver)) {
-        rb_raise(rb_eFrozenError, "array frozen during sort");
-    }
-    sort_reentered(data->ary);
-}
-
 static int
 sort_1(const void *ap, const void *bp, void *dummy)
 {
     struct ary_sort_data *data = dummy;
     VALUE retval = sort_reentered(data->ary);
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
-    VALUE args[2];
     int n;
 
-    args[0] = a;
-    args[1] = b;
-    retval = rb_yield_values2(2, args);
+    retval = rb_yield_values(2, a, b);
     n = rb_cmpint(retval, a, b);
-    sort_returned(data);
+    sort_reentered(data->ary);
     return n;
 }
 
@@ -3360,61 +2415,68 @@ sort_2(const void *ap, const void *bp, void *dummy)
     VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(INTEGER)) {
-        if ((long)a > (long)b) return 1;
-        if ((long)a < (long)b) return -1;
-        return 0;
+    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
+	if ((long)a > (long)b) return 1;
+	if ((long)a < (long)b) return -1;
+	return 0;
     }
-    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(STRING)) {
-        return rb_str_cmp(a, b);
-    }
-    if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(FLOAT)) {
-        return rb_float_cmp(a, b);
+    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+	return rb_str_cmp(a, b);
     }
 
     retval = rb_funcallv(a, id_cmp, 1, &b);
     n = rb_cmpint(retval, a, b);
-    sort_returned(data);
+    sort_reentered(data->ary);
 
     return n;
 }
 
 /*
  *  call-seq:
- *    sort! -> self
- *    sort! {|a, b| ... } -> self
+ *     ary.sort!                   -> ary
+ *     ary.sort! { |a, b| block }  -> ary
+ *
+ *  Sorts +self+ in place.
+ *
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
+ *
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
  *
- *  Like Array#sort, but returns +self+ with its elements sorted in place.
+ *  See also Enumerable#sort_by.
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort! { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
  */
 
 VALUE
 rb_ary_sort_bang(VALUE ary)
 {
     rb_ary_modify(ary);
-    RUBY_ASSERT(!ARY_SHARED_P(ary));
+    assert(!ARY_SHARED_P(ary));
     if (RARRAY_LEN(ary) > 1) {
-        VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
-        struct ary_sort_data data;
-        long len = RARRAY_LEN(ary);
-        RBASIC_CLEAR_CLASS(tmp);
-        data.ary = tmp;
-        data.receiver = ary;
-        RARRAY_PTR_USE(tmp, ptr, {
-            ruby_qsort(ptr, len, sizeof(VALUE),
-                       rb_block_given_p()?sort_1:sort_2, &data);
-        }); /* WB: no new reference */
-        rb_ary_modify(ary);
+	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+	struct ary_sort_data data;
+	long len = RARRAY_LEN(ary);
+
+	RBASIC_CLEAR_CLASS(tmp);
+	data.ary = tmp;
+	data.opt_methods = 0;
+	data.opt_inited = 0;
+	RARRAY_PTR_USE(tmp, ptr, {
+	    ruby_qsort(ptr, len, sizeof(VALUE),
+		       rb_block_given_p()?sort_1:sort_2, &data);
+	}); /* WB: no new reference */
+	rb_ary_modify(ary);
         if (ARY_EMBED_P(tmp)) {
             if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
                 rb_ary_unshare(ary);
-                FL_SET_EMBED(ary);
+		FL_SET_EMBED(ary);
             }
-            if (ARY_EMBED_LEN(tmp) > ARY_CAPA(ary)) {
-                ary_resize_capa(ary, ARY_EMBED_LEN(tmp));
-            }
-            ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
             ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
         }
         else {
@@ -3423,7 +2485,7 @@ rb_ary_sort_bang(VALUE ary)
                 ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
             }
             else {
-                RUBY_ASSERT(!ARY_SHARED_P(tmp));
+                assert(!ARY_SHARED_P(tmp));
                 if (ARY_EMBED_P(ary)) {
                     FL_UNSET_EMBED(ary);
                 }
@@ -3432,57 +2494,44 @@ rb_ary_sort_bang(VALUE ary)
                     rb_ary_unshare(ary);
                 }
                 else {
-                    ary_heap_free(ary);
+		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
                 }
-                ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
+                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
                 ARY_SET_HEAP_LEN(ary, len);
-                ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
             }
             /* tmp was lost ownership for the ptr */
             FL_UNSET(tmp, FL_FREEZE);
             FL_SET_EMBED(tmp);
             ARY_SET_EMBED_LEN(tmp, 0);
             FL_SET(tmp, FL_FREEZE);
-        }
+	}
         /* tmp will be GC'ed. */
         RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
     }
-    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *    sort -> new_array
- *    sort {|a, b| ... } -> new_array
- *
- *  Returns a new array containing the elements of +self+, sorted.
- *
- *  With no block given, compares elements using operator <tt>#<=></tt>
- *  (see Object#<=>):
- *
- *    [0, 2, 3, 1].sort # => [0, 1, 2, 3]
- *
- *  With a block given, calls the block with each combination of pairs of elements from +self+;
- *  for each pair +a+ and +b+, the block should return a numeric:
+ *     ary.sort                   -> new_ary
+ *     ary.sort { |a, b| block }  -> new_ary
  *
- *  - Negative when +b+ is to follow +a+.
- *  - Zero when +a+ and +b+ are equivalent.
- *  - Positive when +a+ is to follow +b+.
+ *  Returns a new array created by sorting +self+.
  *
- *  Example:
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
  *
- *    a = [3, 2, 0, 1]
- *    a.sort {|a, b| a <=> b } # => [0, 1, 2, 3]
- *    a.sort {|a, b| b <=> a } # => [3, 2, 1, 0]
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
  *
- *  When the block returns zero, the order for +a+ and +b+ is indeterminate,
- *  and may be unstable.
  *
- *  See an example in Numeric#nonzero? for the idiom to sort more
- *  complex structure.
+ *  See also Enumerable#sort_by.
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
  */
 
 VALUE
@@ -3497,15 +2546,55 @@ static VALUE rb_ary_bsearch_index(VALUE ary);
 
 /*
  *  call-seq:
- *    bsearch {|element| ... } -> found_element or nil
- *    bsearch -> new_enumerator
- *
- *  Returns the element from +self+ found by a binary search,
- *  or +nil+ if the search found no suitable element.
- *
- *  See {Binary Searching}[rdoc-ref:bsearch.rdoc].
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     ary.bsearch {|x| block }  -> elem
+ *
+ *  By using binary search, finds a value from this array which meets
+ *  the given condition in O(log n) where n is the size of the array.
+ *
+ *  You can use this method in two use cases: a find-minimum mode and
+ *  a find-any mode.  In either case, the elements of the array must be
+ *  monotone (or sorted) with respect to the block.
+ *
+ *  In find-minimum mode (this is a good choice for typical use case),
+ *  the block must return true or false, and there must be an index i
+ *  (0 <= i <= ary.size) so that:
+ *
+ *  - the block returns false for any element whose index is less than
+ *    i, and
+ *  - the block returns true for any element whose index is greater
+ *    than or equal to i.
+ *
+ *  This method returns the i-th element.  If i is equal to ary.size,
+ *  it returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     ary.bsearch {|x| x >=   4 } #=> 4
+ *     ary.bsearch {|x| x >=   6 } #=> 7
+ *     ary.bsearch {|x| x >=  -1 } #=> 0
+ *     ary.bsearch {|x| x >= 100 } #=> nil
+ *
+ *  In find-any mode (this behaves like libc's bsearch(3)), the block
+ *  must return a number, and there must be two indices i and j
+ *  (0 <= i <= j <= ary.size) so that:
+ *
+ *  - the block returns a positive number for ary[k] if 0 <= k < i,
+ *  - the block returns zero for ary[k] if i <= k < j, and
+ *  - the block returns a negative number for ary[k] if
+ *    j <= k < ary.size.
+ *
+ *  Under this condition, this method returns any element whose index
+ *  is within i...j.  If i is equal to j (i.e., there is no element
+ *  that satisfies the block), this method returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     # try to find v such that 4 <= v < 8
+ *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
+ *     # try to find v such that 8 <= v < 10
+ *     ary.bsearch {|x| 4 - x / 2 } #=> nil
+ *
+ *  You must not mix the two modes at a time; the block must always
+ *  return either true/false, or always return a number.  It is
+ *  undefined which value is actually picked up at each iteration.
  */
 
 static VALUE
@@ -3514,22 +2603,22 @@ rb_ary_bsearch(VALUE ary)
     VALUE index_result = rb_ary_bsearch_index(ary);
 
     if (FIXNUM_P(index_result)) {
-        return rb_ary_entry(ary, FIX2LONG(index_result));
+	return rb_ary_entry(ary, FIX2LONG(index_result));
     }
     return index_result;
 }
 
 /*
  *  call-seq:
- *    bsearch_index {|element| ... } -> integer or nil
- *    bsearch_index -> new_enumerator
- *
- *  Returns the integer index of the element from +self+ found by a binary search,
- *  or +nil+ if the search found no suitable element.
+ *     ary.bsearch_index {|x| block }  -> int or nil
  *
- *  See {Binary Searching}[rdoc-ref:bsearch.rdoc].
+ *  By using binary search, finds an index of a value from this array which
+ *  meets the given condition in O(log n) where n is the size of the array.
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *  It supports two modes, depending on the nature of the block and they are
+ *  exactly the same as in the case of #bsearch method with the only difference
+ *  being that this method returns the index of the element instead of the
+ *  element itself. For more details consult the documentation for #bsearch.
  */
 
 static VALUE
@@ -3541,39 +2630,39 @@ rb_ary_bsearch_index(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     while (low < high) {
-        mid = low + ((high - low) / 2);
-        val = rb_ary_entry(ary, mid);
-        v = rb_yield(val);
-        if (FIXNUM_P(v)) {
-            if (v == INT2FIX(0)) return INT2FIX(mid);
-            smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
-        }
-        else if (v == Qtrue) {
-            satisfied = 1;
-            smaller = 1;
-        }
-        else if (!RTEST(v)) {
-            smaller = 0;
-        }
-        else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
-            const VALUE zero = INT2FIX(0);
-            switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
-              case 0: return INT2FIX(mid);
-              case 1: smaller = 0; break;
-              case -1: smaller = 1;
-            }
-        }
-        else {
-            rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
-                     " (must be numeric, true, false or nil)",
-                     rb_obj_class(v));
-        }
-        if (smaller) {
-            high = mid;
-        }
-        else {
-            low = mid + 1;
-        }
+	mid = low + ((high - low) / 2);
+	val = rb_ary_entry(ary, mid);
+	v = rb_yield(val);
+	if (FIXNUM_P(v)) {
+	    if (v == INT2FIX(0)) return INT2FIX(mid);
+	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+	}
+	else if (v == Qtrue) {
+	    satisfied = 1;
+	    smaller = 1;
+	}
+	else if (v == Qfalse || v == Qnil) {
+	    smaller = 0;
+	}
+	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+	    const VALUE zero = INT2FIX(0);
+	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+	      case 0: return INT2FIX(mid);
+	      case 1: smaller = 1; break;
+	      case -1: smaller = 0;
+	    }
+	}
+	else {
+	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+		     " (must be numeric, true, false or nil)",
+		     rb_obj_class(v));
+	}
+	if (smaller) {
+	    high = mid;
+	}
+	else {
+	    low = mid + 1;
+	}
     }
     if (!satisfied) return Qnil;
     return INT2FIX(low);
@@ -3588,24 +2677,14 @@ sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
 
 /*
  *  call-seq:
- *    sort_by! {|element| ... } -> self
- *    sort_by! -> new_enumerator
+ *     ary.sort_by! { |obj| block }    -> ary
+ *     ary.sort_by!                    -> Enumerator
  *
- *  With a block given, sorts the elements of +self+ in place;
- *  returns self.
+ *  Sorts +self+ in place using a set of keys generated by mapping the
+ *  values in +self+ through the given block.
  *
- *  Calls the block with each successive element;
- *  sorts elements based on the values returned from the block:
+ *  If no block is given, an Enumerator is returned instead.
  *
- *    a = ['aaaa', 'bbb', 'cc', 'd']
- *    a.sort_by! {|element| element.size }
- *    a # => ["d", "cc", "bbb", "aaaa"]
- *
- *  For duplicate values returned by the block, the ordering is indeterminate, and may be unstable.
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
  */
 
 static VALUE
@@ -3615,32 +2694,31 @@ rb_ary_sort_by_bang(VALUE ary)
 
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
-    if (RARRAY_LEN(ary) > 1) {
-        sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
-        rb_ary_replace(ary, sorted);
-    }
+    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+    rb_ary_replace(ary, sorted);
     return ary;
 }
 
 
 /*
  *  call-seq:
- *    collect {|element| ... } -> new_array
- *    collect -> new_enumerator
- *    map {|element| ... } -> new_array
- *    map -> new_enumerator
+ *     ary.collect { |item| block }  -> new_ary
+ *     ary.map     { |item| block }  -> new_ary
+ *     ary.collect                   -> Enumerator
+ *     ary.map                       -> Enumerator
+ *
+ *  Invokes the given block once for each element of +self+.
  *
- *  With a block given, calls the block with each element of +self+;
- *  returns a new array whose elements are the return values from the block:
+ *  Creates a new array containing the values returned by the block.
  *
- *    a = [:foo, 'bar', 2]
- *    a1 = a.map {|element| element.class }
- *    a1 # => [Symbol, String, Integer]
+ *  See also Enumerable#collect.
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: #collect!;
- *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.collect { |x| x + "!" }         #=> ["a!", "b!", "c!", "d!"]
+ *     a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
+ *     a                                 #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
@@ -3652,7 +2730,7 @@ rb_ary_collect(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     collect = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
     }
     return collect;
 }
@@ -3660,22 +2738,23 @@ rb_ary_collect(VALUE ary)
 
 /*
  *  call-seq:
- *    collect! {|element| ... } -> new_array
- *    collect! -> new_enumerator
- *    map! {|element| ... } -> new_array
- *    map! -> new_enumerator
+ *     ary.collect! {|item| block }   -> ary
+ *     ary.map!     {|item| block }   -> ary
+ *     ary.collect!                   -> Enumerator
+ *     ary.map!                       -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+
- *  and replaces the element with the block's return value;
- *  returns +self+:
+ *  Invokes the given block once for each element of +self+, replacing the
+ *  element with the value returned by the block.
  *
- *    a = [:foo, 'bar', 2]
- *    a.map! { |element| element.class } # => [Symbol, String, Integer]
+ *  See also Enumerable#collect.
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: #collect;
- *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.map! {|x| x + "!" }
+ *     a #=>  [ "a!", "b!", "c!", "d!" ]
+ *     a.collect!.with_index {|x, i| x[0...i] }
+ *     a #=>  ["", "b", "c!", "d!"]
  */
 
 static VALUE
@@ -3686,7 +2765,7 @@ rb_ary_collect_bang(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
     }
     return ary;
 }
@@ -3698,190 +2777,66 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
     long beg, len, i, j;
 
     for (i=0; i<argc; i++) {
-        if (FIXNUM_P(argv[i])) {
-            rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
-            continue;
-        }
-        /* check if idx is Range */
-        if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
-            long end = olen < beg+len ? olen : beg+len;
-            for (j = beg; j < end; j++) {
-                rb_ary_push(result, (*func)(obj, j));
-            }
-            if (beg + len > j)
-                rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
-            continue;
-        }
-        rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+	if (FIXNUM_P(argv[i])) {
+	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+	    continue;
+	}
+	/* check if idx is Range */
+	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+	    long end = olen < beg+len ? olen : beg+len;
+	    for (j = beg; j < end; j++) {
+		rb_ary_push(result, (*func)(obj, j));
+	    }
+	    if (beg + len > j)
+		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+	    continue;
+	}
+	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
     }
     return result;
 }
 
-static VALUE
-append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
-{
-    long beg, len;
-    if (FIXNUM_P(idx)) {
-        beg = FIX2LONG(idx);
-    }
-    /* check if idx is Range */
-    else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
-        if (len > 0) {
-            const VALUE *const src = RARRAY_CONST_PTR(ary);
-            const long end = beg + len;
-            const long prevlen = RARRAY_LEN(result);
-            if (beg < olen) {
-                rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
-            }
-            if (end > olen) {
-                rb_ary_store(result, prevlen + len - 1, Qnil);
-            }
-        }
-        return result;
-    }
-    else {
-        beg = NUM2LONG(idx);
-    }
-    return rb_ary_push(result, rb_ary_entry(ary, beg));
-}
-
 /*
  *  call-seq:
- *    values_at(*specifiers) -> new_array
- *
- *  Returns elements from +self+ in a new array; does not modify +self+.
- *
- *  The objects included in the returned array are the elements of +self+
- *  selected by the given +specifiers+,
- *  each of which must be a numeric index or a Range.
- *
- *  In brief:
- *
- *    a = ['a', 'b', 'c', 'd']
+ *     ary.values_at(selector, ...)  -> new_ary
  *
- *    # Index specifiers.
- *    a.values_at(2, 0, 2, 0)     # => ["c", "a", "c", "a"] # May repeat.
- *    a.values_at(-4, -3, -2, -1) # => ["a", "b", "c", "d"] # Counts backwards if negative.
- *    a.values_at(-50, 50)        # => [nil, nil]           # Outside of self.
+ *  Returns an array containing the elements in +self+ corresponding to the
+ *  given +selector+(s).
  *
- *    # Range specifiers.
- *    a.values_at(1..3)       # => ["b", "c", "d"] # From range.begin to range.end.
- *    a.values_at(1...3)      # => ["b", "c"]      # End excluded.
- *    a.values_at(3..1)       # => []              # No such elements.
+ *  The selectors may be either integer indices or ranges.
  *
- *    a.values_at(-3..3)  # => ["b", "c", "d"]     # Negative range.begin counts backwards.
- *    a.values_at(-50..3)                          # Raises RangeError.
+ *  See also Array#select.
  *
- *    a.values_at(1..-2)  # => ["b", "c"]          # Negative range.end counts backwards.
- *    a.values_at(1..-50) # => []                  # No such elements.
- *
- *    # Mixture of specifiers.
- *    a.values_at(2..3, 3, 0..1, 0) # => ["c", "d", "d", "a", "b", "a"]
- *
- *  With no +specifiers+ given, returns a new empty array:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.values_at # => []
- *
- *  For each numeric specifier +index+, includes an element:
- *
- *  - For each non-negative numeric specifier +index+ that is in-range (less than <tt>self.size</tt>),
- *    includes the element at offset +index+:
- *
- *      a.values_at(0, 2)     # => ["a", "c"]
- *      a.values_at(0.1, 2.9) # => ["a", "c"]
- *
- *  - For each negative numeric +index+ that is in-range (greater than or equal to <tt>- self.size</tt>),
- *    counts backwards from the end of +self+:
- *
- *      a.values_at(-1, -4) # => ["d", "a"]
- *
- *  The given indexes may be in any order, and may repeat:
- *
- *    a.values_at(2, 0, 1, 0, 2) # => ["c", "a", "b", "a", "c"]
- *
- *  For each +index+ that is out-of-range, includes +nil+:
- *
- *    a.values_at(4, -5) # => [nil, nil]
- *
- *  For each Range specifier +range+, includes elements
- *  according to <tt>range.begin</tt> and <tt>range.end</tt>:
- *
- *  - If both <tt>range.begin</tt> and <tt>range.end</tt>
- *    are non-negative and in-range (less than <tt>self.size</tt>),
- *    includes elements from index <tt>range.begin</tt>
- *    through <tt>range.end - 1</tt> (if <tt>range.exclude_end?</tt>),
- *    or through <tt>range.end</tt> (otherwise):
- *
- *      a.values_at(1..2)  # => ["b", "c"]
- *      a.values_at(1...2) # => ["b"]
- *
- *  - If <tt>range.begin</tt> is negative and in-range (greater than or equal to <tt>- self.size</tt>),
- *    counts backwards from the end of +self+:
- *
- *      a.values_at(-2..3) # => ["c", "d"]
- *
- *  - If <tt>range.begin</tt> is negative and out-of-range, raises an exception:
- *
- *      a.values_at(-5..3) # Raises RangeError.
- *
- *  - If <tt>range.end</tt> is positive and out-of-range,
- *    extends the returned array with +nil+ elements:
- *
- *      a.values_at(1..5) # => ["b", "c", "d", nil, nil]
- *
- *  - If <tt>range.end</tt> is negative and in-range,
- *    counts backwards from the end of +self+:
- *
- *      a.values_at(1..-2) # => ["b", "c"]
- *
- *  - If <tt>range.end</tt> is negative and out-of-range,
- *    returns an empty array:
- *
- *      a.values_at(1..-5) # => []
- *
- *  The given ranges may be in any order and may repeat:
- *
- *    a.values_at(2..3, 0..1, 2..3) # => ["c", "d", "a", "b", "c", "d"]
- *
- *  The given specifiers may be any mixture of indexes and ranges:
- *
- *    a.values_at(3, 1..2, 0, 2..3) # => ["d", "b", "c", "a", "c", "d"]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = %w{ a b c d e f }
+ *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
+ *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
+ *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
+ *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
  */
 
 static VALUE
 rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    long i, olen = RARRAY_LEN(ary);
-    VALUE result = rb_ary_new_capa(argc);
-    for (i = 0; i < argc; ++i) {
-        append_values_at_single(result, ary, olen, argv[i]);
-    }
-    RB_GC_GUARD(ary);
-    return result;
+    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
 }
 
 
 /*
  *  call-seq:
- *    select {|element| ... } -> new_array
- *    select -> new_enumerator
- *    filter {|element| ... } -> new_array
- *    filter -> new_enumerator
+ *     ary.select { |item| block } -> new_ary
+ *     ary.select                  -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+;
- *  returns a new array containing those elements of +self+
- *  for which the block returns a truthy value:
+ *  Returns a new array containing all elements of +ary+
+ *  for which the given +block+ returns a true value.
  *
- *    a = [:foo, 'bar', 2, :bam]
- *    a.select {|element| element.to_s.start_with?('b') }
- *    # => ["bar", :bam]
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  With no block given, returns a new Enumerator.
+ *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     a = %w{ a b c d e f }
+ *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *
+ *  See also Enumerable#select.
  */
 
 static VALUE
@@ -3893,9 +2848,9 @@ rb_ary_select(VALUE ary)
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     result = rb_ary_new2(RARRAY_LEN(ary));
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-            rb_ary_push(result, rb_ary_elt(ary, i));
-        }
+	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+	    rb_ary_push(result, rb_ary_elt(ary, i));
+	}
     }
     return result;
 }
@@ -3913,12 +2868,12 @@ select_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-        VALUE v = RARRAY_AREF(ary, i1);
-        if (!RTEST(rb_yield(v))) continue;
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, v);
-        }
-        arg->len[1] = ++i2;
+	VALUE v = RARRAY_AREF(ary, i1);
+	if (!RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -3932,39 +2887,34 @@ select_bang_ensure(VALUE a)
     long i1 = arg->len[0], i2 = arg->len[1];
 
     if (i2 < len && i2 < i1) {
-        long tail = 0;
-        rb_ary_modify(ary);
-        if (i1 < len) {
-            tail = len - i1;
-            RARRAY_PTR_USE(ary, ptr, {
-                    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
-                });
-        }
-        ARY_SET_LEN(ary, i2 + tail);
+	long tail = 0;
+	if (i1 < len) {
+	    tail = len - i1;
+	    RARRAY_PTR_USE(ary, ptr, {
+		    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+		});
+	}
+	ARY_SET_LEN(ary, i2 + tail);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    select! {|element| ... } -> self or nil
- *    select! -> new_enumerator
- *    filter! {|element| ... } -> self or nil
- *    filter! -> new_enumerator
+ *     ary.select!  {|item| block } -> ary or nil
+ *     ary.select!                  -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+;
- *  removes from +self+ those elements for which the block returns +false+ or +nil+.
+ *  Invokes the given block passing in successive elements from +self+,
+ *  deleting elements for which the block returns a +false+ value.
  *
- *  Returns +self+ if any elements were removed:
+ *  The array may not be changed instantly every time the block is called.
  *
- *    a = [:foo, 'bar', 2, :bam]
- *    a.select! {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *  If changes were made, it will return +self+, otherwise it returns +nil+.
  *
- *  Returns +nil+ if no elements were removed.
+ *  See also Array#keep_if
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
 
 static VALUE
@@ -3982,18 +2932,18 @@ rb_ary_select_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    keep_if {|element| ... } -> self
- *    keep_if -> new_enumerator
+ *     ary.keep_if { |item| block } -> ary
+ *     ary.keep_if                  -> Enumerator
  *
- *  With a block given, calls the block with each element of +self+;
- *  removes the element from +self+ if the block does not return a truthy value:
+ *  Deletes every element of +self+ for which the given block evaluates to
+ *  +false+.
  *
- *    a = [:foo, 'bar', 2, :bam]
- *    a.keep_if {|element| element.to_s.start_with?('b') } # => ["bar", :bam]
+ *  See also Array#select!
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = %w{ a b c d e f }
+ *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
  */
 
 static VALUE
@@ -4009,49 +2959,32 @@ ary_resize_smaller(VALUE ary, long len)
 {
     rb_ary_modify(ary);
     if (RARRAY_LEN(ary) > len) {
-        ARY_SET_LEN(ary, len);
-        if (len * 2 < ARY_CAPA(ary) &&
-            ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
-            ary_resize_capa(ary, len * 2);
-        }
+	ARY_SET_LEN(ary, len);
+	if (len * 2 < ARY_CAPA(ary) &&
+	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+	    ary_resize_capa(ary, len * 2);
+	}
     }
 }
 
 /*
  *  call-seq:
- *    delete(object) -> last_removed_object
- *    delete(object) {|element| ... } -> last_removed_object or block_return
- *
- *  Removes zero or more elements from +self+.
- *
- *  With no block given,
- *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>;
- *  returns the last removed element:
- *
- *    a = [0, 1, 2, 2.0]
- *    a.delete(2) # => 2.0
- *    a           # => [0, 1]
- *
- *  Returns +nil+ if no elements removed:
- *
- *    a.delete(2) # => nil
+ *     ary.delete(obj)            -> item or nil
+ *     ary.delete(obj) { block }  -> item or result of block
  *
- *  With a block given,
- *  removes from +self+ each element +ele+ such that <tt>ele == object</tt>.
+ *  Deletes all items from +self+ that are equal to +obj+.
  *
- *  If any such elements are found, ignores the block
- *  and returns the last removed element:
+ *  Returns the last deleted item, or +nil+ if no matching item is found.
  *
- *    a = [0, 1, 2, 2.0]
- *    a.delete(2) {|element| fail 'Cannot happen' } # => 2.0
- *    a                                             # => [0, 1]
+ *  If the optional code block is given, the result of the block is returned if
+ *  the item is not found.  (To remove +nil+ elements and get an informative
+ *  return value, use Array#compact!)
  *
- *  If no such element is found, returns the block's return value:
- *
- *    a.delete(2) {|element| "Element #{element} not found." }
- *    # => "Element 2 not found."
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.delete("b")                   #=> "b"
+ *     a                               #=> ["a", "c"]
+ *     a.delete("z")                   #=> nil
+ *     a.delete("z") { "not found" }   #=> "not found"
  */
 
 VALUE
@@ -4061,27 +2994,26 @@ rb_ary_delete(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-        VALUE e = RARRAY_AREF(ary, i1);
+	VALUE e = RARRAY_AREF(ary, i1);
 
-        if (rb_equal(e, item)) {
-            v = e;
-            continue;
-        }
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, e);
-        }
-        i2++;
+	if (rb_equal(e, item)) {
+	    v = e;
+	    continue;
+	}
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, e);
+	}
+	i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-        if (rb_block_given_p()) {
-            return rb_yield(item);
-        }
-        return Qnil;
+	if (rb_block_given_p()) {
+	    return rb_yield(item);
+	}
+	return Qnil;
     }
 
     ary_resize_smaller(ary, i2);
 
-    ary_verify(ary);
     return v;
 }
 
@@ -4091,18 +3023,18 @@ rb_ary_delete_same(VALUE ary, VALUE item)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-        VALUE e = RARRAY_AREF(ary, i1);
+	VALUE e = RARRAY_AREF(ary, i1);
 
-        if (e == item) {
-            continue;
-        }
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, e);
-        }
-        i2++;
+	if (e == item) {
+	    continue;
+	}
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, e);
+	}
+	i2++;
     }
     if (RARRAY_LEN(ary) == i2) {
-        return;
+	return;
     }
 
     ary_resize_smaller(ary, i2);
@@ -4116,46 +3048,33 @@ rb_ary_delete_at(VALUE ary, long pos)
 
     if (pos >= len) return Qnil;
     if (pos < 0) {
-        pos += len;
-        if (pos < 0) return Qnil;
+	pos += len;
+	if (pos < 0) return Qnil;
     }
 
     rb_ary_modify(ary);
     del = RARRAY_AREF(ary, pos);
     RARRAY_PTR_USE(ary, ptr, {
-        MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
     });
     ARY_INCREASE_LEN(ary, -1);
-    ary_verify(ary);
+
     return del;
 }
 
 /*
  *  call-seq:
- *    delete_at(index) -> removed_object or nil
- *
- *  Removes the element of +self+ at the given +index+, which must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
- *
- *  When +index+ is non-negative, deletes the element at offset +index+:
- *
- *    a = [:foo, 'bar', 2]
- *    a.delete_at(1) # => "bar"
- *    a # => [:foo, 2]
- *
- *  When +index+ is negative, counts backward from the end of the array:
+ *     ary.delete_at(index)  -> obj or nil
  *
- *    a = [:foo, 'bar', 2]
- *    a.delete_at(-2) # => "bar"
- *    a # => [:foo, 2]
+ *  Deletes the element at the specified +index+, returning that element, or
+ *  +nil+ if the +index+ is out of range.
  *
- *  When +index+ is out of range, returns +nil+.
+ *  See also Array#slice!
  *
- *    a = [:foo, 'bar', 2]
- *    a.delete_at(3)  # => nil
- *    a.delete_at(-4) # => nil
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = ["ant", "bat", "cat", "dog"]
+ *     a.delete_at(2)    #=> "cat"
+ *     a                 #=> ["ant", "bat", "dog"]
+ *     a.delete_at(99)   #=> nil
  */
 
 static VALUE
@@ -4164,156 +3083,73 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
-static VALUE
-ary_slice_bang_by_rb_ary_splice(VALUE ary, long pos, long len)
-{
-    const long orig_len = RARRAY_LEN(ary);
-
-    if (len < 0) {
-        return Qnil;
-    }
-    else if (pos < -orig_len) {
-        return Qnil;
-    }
-    else if (pos < 0) {
-        pos += orig_len;
-    }
-    else if (orig_len < pos) {
-        return Qnil;
-    }
-    if (orig_len < pos + len) {
-        len = orig_len - pos;
-    }
-    if (len == 0) {
-        return rb_ary_new2(0);
-    }
-    else {
-        VALUE arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
-        rb_ary_splice(ary, pos, len, 0, 0);
-        return arg2;
-    }
-}
-
 /*
  *  call-seq:
- *    slice!(index) -> object or nil
- *    slice!(start, length) -> new_array or nil
- *    slice!(range) -> new_array or nil
- *
- *  Removes and returns elements from +self+.
- *
- *  With numeric argument +index+ given,
- *  removes and returns the element at offset +index+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(2)   # => "c"
- *    a             # => ["a", "b", "d"]
- *    a.slice!(2.1) # => "d"
- *    a             # => ["a", "b"]
- *
- *  If +index+ is negative, counts backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(-2) # => "c"
- *    a            # => ["a", "b", "d"]
- *
- *  If +index+ is out of range, returns +nil+.
- *
- *  With numeric arguments +start+ and +length+ given,
- *  removes +length+ elements from +self+ beginning at zero-based offset +start+;
- *  returns the removed objects in a new array:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(1, 2)     # => ["b", "c"]
- *    a                  # => ["a", "d"]
- *    a.slice!(0.1, 1.1) # => ["a"]
- *    a                  # => ["d"]
- *
- *  If +start+ is negative, counts backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(-2, 1) # => ["c"]
- *    a               # => ["a", "b", "d"]
- *
- *  If +start+ is out-of-range, returns +nil+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(5, 1)  # => nil
- *    a.slice!(-5, 1) # => nil
- *
- *  If <tt>start + length</tt> exceeds the array size,
- *  removes and returns all elements from offset +start+ to the end:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(2, 50) # => ["c", "d"]
- *    a               # => ["a", "b"]
- *
- *  If <tt>start == a.size</tt> and +length+ is non-negative,
- *  returns a new empty array.
- *
- *  If +length+ is negative, returns +nil+.
- *
- *  With Range argument +range+ given,
- *  treats <tt>range.min</tt> as +start+ (as above)
- *  and <tt>range.size</tt> as +length+ (as above):
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(1..2) # => ["b", "c"]
- *    a              # => ["a", "d"]
- *
- *  If <tt>range.start == a.size</tt>, returns a new empty array:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(4..5) # => []
- *
- *  If <tt>range.start</tt> is larger than the array size, returns +nil+:
- *
- *    a = ['a', 'b', 'c', 'd']
-      a.slice!(5..6) # => nil
- *
- *  If <tt>range.start</tt> is negative,
- *  calculates the start index by counting backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(-2..2) # => ["c"]
- *
- *  If <tt>range.end</tt> is negative,
- *  calculates the end index by counting backwards from the end of +self+:
- *
- *    a = ['a', 'b', 'c', 'd']
- *    a.slice!(0..-2) # => ["a", "b", "c"]
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     ary.slice!(index)         -> obj or nil
+ *     ary.slice!(start, length) -> new_ary or nil
+ *     ary.slice!(range)         -> new_ary or nil
+ *
+ *  Deletes the element(s) given by an +index+ (optionally up to +length+
+ *  elements) or by a +range+.
+ *
+ *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
+ *  range.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.slice!(1)     #=> "b"
+ *     a               #=> ["a", "c"]
+ *     a.slice!(-1)    #=> "c"
+ *     a               #=> ["a"]
+ *     a.slice!(100)   #=> nil
+ *     a               #=> ["a"]
  */
 
 static VALUE
 rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1;
-    long pos, len;
+    VALUE arg1, arg2;
+    long pos, len, orig_len;
 
     rb_ary_modify_check(ary);
-    rb_check_arity(argc, 1, 2);
-    arg1 = argv[0];
-
     if (argc == 2) {
-        pos = NUM2LONG(argv[0]);
-        len = NUM2LONG(argv[1]);
-        return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
+	pos = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+      delete_pos_len:
+	if (len < 0) return Qnil;
+	orig_len = RARRAY_LEN(ary);
+	if (pos < 0) {
+	    pos += orig_len;
+	    if (pos < 0) return Qnil;
+	}
+	else if (orig_len < pos) return Qnil;
+	if (orig_len < pos + len) {
+	    len = orig_len - pos;
+	}
+	if (len == 0) return rb_ary_new2(0);
+	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
+	rb_ary_splice(ary, pos, len, Qundef);
+	return arg2;
+    }
+
+    if (argc != 1) {
+	/* error report */
+	rb_scan_args(argc, argv, "11", NULL, NULL);
     }
+    arg1 = argv[0];
 
     if (!FIXNUM_P(arg1)) {
-        switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
-          case Qtrue:
-            /* valid range */
-            return ary_slice_bang_by_rb_ary_splice(ary, pos, len);
-          case Qnil:
-            /* invalid range */
-            return Qnil;
-          default:
-            /* not a range */
-            break;
-        }
+	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+	  case Qtrue:
+	    /* valid range */
+	    goto delete_pos_len;
+	  case Qnil:
+	    /* invalid range */
+	    return Qnil;
+	  default:
+	    /* not a range */
+	    break;
+	}
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
@@ -4325,11 +3161,10 @@ ary_reject(VALUE orig, VALUE result)
     long i;
 
     for (i = 0; i < RARRAY_LEN(orig); i++) {
-        VALUE v = RARRAY_AREF(orig, i);
-
-        if (!RTEST(rb_yield(v))) {
-            rb_ary_push(result, v);
-        }
+	VALUE v = RARRAY_AREF(orig, i);
+	if (!RTEST(rb_yield(v))) {
+	    rb_ary_push(result, v);
+	}
     }
     return result;
 }
@@ -4342,12 +3177,12 @@ reject_bang_i(VALUE a)
     long i1, i2;
 
     for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-        VALUE v = RARRAY_AREF(ary, i1);
-        if (RTEST(rb_yield(v))) continue;
-        if (i1 != i2) {
-            rb_ary_store(ary, i2, v);
-        }
-        arg->len[1] = ++i2;
+	VALUE v = RARRAY_AREF(ary, i1);
+	if (RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	arg->len[1] = ++i2;
     }
     return (i1 == i2) ? Qnil : ary;
 }
@@ -4356,6 +3191,7 @@ static VALUE
 ary_reject_bang(VALUE ary)
 {
     struct select_bang_arg args;
+
     rb_ary_modify_check(ary);
     args.ary = ary;
     args.len[0] = args.len[1] = 0;
@@ -4364,47 +3200,37 @@ ary_reject_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    reject! {|element| ... } -> self or nil
- *    reject! -> new_enumerator
- *
- *  With a block given, calls the block with each element of +self+;
- *  removes each element for which the block returns a truthy value.
+ *     ary.reject! { |item| block }  -> ary or nil
+ *     ary.reject!                   -> Enumerator
  *
- *  Returns +self+ if any elements removed:
+ *  Deletes every element of +self+ for which the block evaluates to +true+,
+ *  if no changes were made returns +nil+.
  *
- *    a = [:foo, 'bar', 2, 'bat']
- *    a.reject! {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *  The array may not be changed instantly every time the block is called.
  *
- *  Returns +nil+ if no elements removed.
+ *  See also Enumerable#reject and Array#delete_if.
  *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
 rb_ary_reject_bang(VALUE ary)
 {
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_modify(ary);
     return ary_reject_bang(ary);
 }
 
 /*
  *  call-seq:
- *    reject {|element| ... } -> new_array
- *    reject -> new_enumerator
+ *     ary.reject  {|item| block }  -> new_ary
+ *     ary.reject                   -> Enumerator
  *
- *  With a block given, returns a new array whose elements are all those from +self+
- *  for which the block returns +false+ or +nil+:
+ *  Returns a new array containing the items in +self+ for which the given
+ *  block is not +true+. The ordering of non-rejected elements is maintained.
  *
- *    a = [:foo, 'bar', 2, 'bat']
- *    a1 = a.reject {|element| element.to_s.start_with?('b') }
- *    a1 # => [:foo, 2]
+ *  See also Array#delete_if
  *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
@@ -4420,25 +3246,25 @@ rb_ary_reject(VALUE ary)
 
 /*
  *  call-seq:
- *    delete_if {|element| ... } -> self
- *    delete_if -> new_numerator
+ *     ary.delete_if { |item| block }  -> ary
+ *     ary.delete_if                   -> Enumerator
+ *
+ *  Deletes every element of +self+ for which block evaluates to +true+.
  *
- *  With a block given, calls the block with each element of +self+;
- *  removes the element if the block returns a truthy value;
- *  returns +self+:
+ *  The array is changed instantly every time the block is called, not after
+ *  the iteration is over.
  *
- *    a = [:foo, 'bar', 2, 'bat']
- *    a.delete_if {|element| element.to_s.start_with?('b') } # => [:foo, 2]
+ *  See also Array#reject!
  *
- *  With no block given, returns a new Enumerator.
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     scores = [ 97, 42, 75 ]
+ *     scores.delete_if {|score| score < 80 }   #=> [97]
  */
 
 static VALUE
 rb_ary_delete_if(VALUE ary)
 {
-    ary_verify(ary);
     RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     ary_reject_bang(ary);
     return ary;
@@ -4448,9 +3274,9 @@ static VALUE
 take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
 {
     VALUE *args = (VALUE *)cbarg;
+    if (args[1]-- == 0) rb_iter_break();
     if (argc > 1) val = rb_ary_new4(argc, argv);
     rb_ary_push(args[0], val);
-    if (--args[1] == 0) rb_iter_break();
     return Qnil;
 }
 
@@ -4460,108 +3286,38 @@ take_items(VALUE obj, long n)
     VALUE result = rb_check_array_type(obj);
     VALUE args[2];
 
-    if (n == 0) return result;
     if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
     result = rb_ary_new2(n);
     args[0] = result; args[1] = (VALUE)n;
-    if (UNDEF_P(rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args)))
-        rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
-                 rb_obj_class(obj));
+    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
+	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+		 rb_obj_class(obj));
     return result;
 }
 
 
 /*
  *  call-seq:
- *    zip(*other_arrays) -> new_array
- *    zip(*other_arrays) {|sub_array| ... } -> nil
- *
- *  With no block given, combines +self+ with the collection of +other_arrays+;
- *  returns a new array of sub-arrays:
- *
- *    [0, 1].zip(['zero', 'one'], [:zero, :one])
- *    # => [[0, "zero", :zero], [1, "one", :one]]
- *
- *  Returned:
- *
- *  - The outer array is of size <tt>self.size</tt>.
- *  - Each sub-array is of size <tt>other_arrays.size + 1</tt>.
- *  - The _nth_ sub-array contains (in order):
- *
- *    - The _nth_ element of +self+.
- *    - The _nth_ element of each of the other arrays, as available.
- *
- *  Example:
- *
- *    a = [0, 1]
- *    zipped = a.zip(['zero', 'one'], [:zero, :one])
- *    # => [[0, "zero", :zero], [1, "one", :one]]
- *    zipped.size       # => 2 # Same size as a.
- *    zipped.first.size # => 3 # Size of other arrays plus 1.
- *
- *  When the other arrays are all the same size as +self+,
- *  the returned sub-arrays are a rearrangement containing exactly elements of all the arrays
- *  (including +self+), with no omissions or additions:
- *
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2, :b3]
- *    c = [:c0, :c1, :c2, :c3]
- *    d = a.zip(b, c)
- *    pp d
- *    # =>
- *    [[:a0, :b0, :c0],
- *     [:a1, :b1, :c1],
- *     [:a2, :b2, :c2],
- *     [:a3, :b3, :c3]]
- *
- *  When one of the other arrays is smaller than +self+,
- *  pads the corresponding sub-array with +nil+ elements:
- *
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2]
- *    c = [:c0, :c1]
- *    d = a.zip(b, c)
- *    pp d
- *    # =>
- *    [[:a0, :b0, :c0],
- *     [:a1, :b1, :c1],
- *     [:a2, :b2, nil],
- *     [:a3, nil, nil]]
- *
- *  When one of the other arrays is larger than +self+,
- *  _ignores_ its trailing elements:
- *
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2, :b3, :b4]
- *    c = [:c0, :c1, :c2, :c3, :c4, :c5]
- *    d = a.zip(b, c)
- *    pp d
- *    # =>
- *    [[:a0, :b0, :c0],
- *     [:a1, :b1, :c1],
- *     [:a2, :b2, :c2],
- *     [:a3, :b3, :c3]]
- *
- *  With a block given, calls the block with each of the other arrays;
- *  returns +nil+:
- *
- *    d = []
- *    a = [:a0, :a1, :a2, :a3]
- *    b = [:b0, :b1, :b2, :b3]
- *    c = [:c0, :c1, :c2, :c3]
- *    a.zip(b, c) {|sub_array| d.push(sub_array.reverse) } # => nil
- *    pp d
- *    # =>
- *    [[:c0, :b0, :a0],
- *     [:c1, :b1, :a1],
- *     [:c2, :b2, :a2],
- *     [:c3, :b3, :a3]]
- *
- *  For an *object* in *other_arrays* that is not actually an array,
- *  forms the the "other array" as <tt>object.to_ary</tt>, if defined,
- *  or as <tt>object.each.to_a</tt> otherwise.
- *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     ary.zip(arg, ...)                  -> new_ary
+ *     ary.zip(arg, ...) { |arr| block }  -> nil
+ *
+ *  Converts any arguments to arrays, then merges elements of +self+ with
+ *  corresponding elements from each argument.
+ *
+ *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
+ *  where _n_ is one more than the count of arguments.
+ *
+ *  If the size of any argument is less than the size of the initial array,
+ *  +nil+ values are supplied.
+ *
+ *  If a block is given, it is invoked for each output +array+, otherwise an
+ *  array of arrays is returned.
+ *
+ *     a = [ 4, 5, 6 ]
+ *     b = [ 7, 8, 9 ]
+ *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
+ *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
  */
 
 static VALUE
@@ -4572,51 +3328,51 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
     VALUE result = Qnil;
 
     for (i=0; i<argc; i++) {
-        argv[i] = take_items(argv[i], len);
+	argv[i] = take_items(argv[i], len);
     }
 
     if (rb_block_given_p()) {
-        int arity = rb_block_arity();
-
-        if (arity > 1) {
-            VALUE work, *tmp;
-
-            tmp = ALLOCV_N(VALUE, work, argc+1);
-
-            for (i=0; i<RARRAY_LEN(ary); i++) {
-                tmp[0] = RARRAY_AREF(ary, i);
-                for (j=0; j<argc; j++) {
-                    tmp[j+1] = rb_ary_elt(argv[j], i);
-                }
-                rb_yield_values2(argc+1, tmp);
-            }
-
-            if (work) ALLOCV_END(work);
-        }
-        else {
-            for (i=0; i<RARRAY_LEN(ary); i++) {
-                VALUE tmp = rb_ary_new2(argc+1);
-
-                rb_ary_push(tmp, RARRAY_AREF(ary, i));
-                for (j=0; j<argc; j++) {
-                    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-                }
-                rb_yield(tmp);
-            }
-        }
+	int arity = rb_block_arity();
+
+	if (arity > 1) {
+	    VALUE work, *tmp;
+
+	    tmp = ALLOCV_N(VALUE, work, argc+1);
+
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		tmp[0] = RARRAY_AREF(ary, i);
+		for (j=0; j<argc; j++) {
+		    tmp[j+1] = rb_ary_elt(argv[j], i);
+		}
+		rb_yield_values2(argc+1, tmp);
+	    }
+
+	    if (work) ALLOCV_END(work);
+	}
+	else {
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		VALUE tmp = rb_ary_new2(argc+1);
+
+		rb_ary_push(tmp, RARRAY_AREF(ary, i));
+		for (j=0; j<argc; j++) {
+		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+		}
+		rb_yield(tmp);
+	    }
+	}
     }
     else {
-        result = rb_ary_new_capa(len);
+	result = rb_ary_new_capa(len);
 
-        for (i=0; i<len; i++) {
-            VALUE tmp = rb_ary_new_capa(argc+1);
+	for (i=0; i<len; i++) {
+	    VALUE tmp = rb_ary_new_capa(argc+1);
 
-            rb_ary_push(tmp, RARRAY_AREF(ary, i));
-            for (j=0; j<argc; j++) {
-                rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-            }
-            rb_ary_push(result, tmp);
-        }
+	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
+	    for (j=0; j<argc; j++) {
+		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	    }
+	    rb_ary_push(result, tmp);
+	}
     }
 
     return result;
@@ -4624,17 +3380,15 @@ rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *    transpose -> new_array
+ *     ary.transpose -> new_ary
  *
- *  Returns a new array that is +self+
- *  as a {transposed matrix}[https://en.wikipedia.org/wiki/Transpose]:
+ *  Assumes that +self+ is an array of arrays and transposes the rows and
+ *  columns.
  *
- *    a = [[:a0, :a1], [:b0, :b1], [:c0, :c1]]
- *    a.transpose # => [[:a0, :b0, :c0], [:a1, :b1, :c1]]
+ *     a = [[1,2], [3,4], [5,6]]
+ *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
  *
- *  The elements of +self+ must all be the same size.
- *
- *  Related: see {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *  If the length of the subarrays don't match, an IndexError is raised.
  */
 
 static VALUE
@@ -4646,38 +3400,36 @@ rb_ary_transpose(VALUE ary)
     alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
-        tmp = to_ary(rb_ary_elt(ary, i));
-        if (elen < 0) {		/* first element */
-            elen = RARRAY_LEN(tmp);
-            result = rb_ary_new2(elen);
-            for (j=0; j<elen; j++) {
-                rb_ary_store(result, j, rb_ary_new2(alen));
-            }
-        }
-        else if (elen != RARRAY_LEN(tmp)) {
-            rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
-                     RARRAY_LEN(tmp), elen);
-        }
-        for (j=0; j<elen; j++) {
-            rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
-        }
+	tmp = to_ary(rb_ary_elt(ary, i));
+	if (elen < 0) {		/* first element */
+	    elen = RARRAY_LEN(tmp);
+	    result = rb_ary_new2(elen);
+	    for (j=0; j<elen; j++) {
+		rb_ary_store(result, j, rb_ary_new2(alen));
+	    }
+	}
+	else if (elen != RARRAY_LEN(tmp)) {
+	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+		     RARRAY_LEN(tmp), elen);
+	}
+	for (j=0; j<elen; j++) {
+	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+	}
     }
     return result;
 }
 
 /*
  *  call-seq:
- *    initialize_copy(other_array) -> self
- *    replace(other_array) -> self
+ *     ary.replace(other_ary)  -> ary
+ *     ary.initialize_copy(other_ary)	-> ary
  *
- *  Replaces the elements of +self+ with the elements of +other_array+, which must be an
- *  {array-convertible object}[rdoc-ref:implicit_conversion.rdoc@Array-Convertible+Objects];
- *  returns +self+:
+ *  Replaces the contents of +self+ with the contents of +other_ary+,
+ *  truncating or expanding if necessary.
  *
- *    a = ['a', 'b', 'c']   # => ["a", "b", "c"]
- *    a.replace(['d', 'e']) # => ["d", "e"]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
+ *     a                              #=> ["x", "y", "z"]
  */
 
 VALUE
@@ -4687,328 +3439,183 @@ rb_ary_replace(VALUE copy, VALUE orig)
     orig = to_ary(orig);
     if (copy == orig) return copy;
 
-    rb_ary_reset(copy);
-
-    /* orig has enough space to embed the contents of orig. */
-    if (RARRAY_LEN(orig) <= ary_embed_capa(copy)) {
-        RUBY_ASSERT(ARY_EMBED_P(copy));
-        ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
-        ARY_SET_EMBED_LEN(copy, RARRAY_LEN(orig));
-    }
-    /* orig is embedded but copy does not have enough space to embed the
-     * contents of orig. */
-    else if (ARY_EMBED_P(orig)) {
-        long len = ARY_EMBED_LEN(orig);
-        VALUE *ptr = ary_heap_alloc_buffer(len);
+    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE shared = 0;
 
-        FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, ptr);
-        ARY_SET_LEN(copy, len);
-        ARY_SET_CAPA(copy, len);
-
-        // No allocation and exception expected that could leave `copy` in a
-        // bad state from the edits above.
-        ary_memcpy(copy, 0, len, RARRAY_CONST_PTR(orig));
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+	}
+        else if (ARY_SHARED_P(copy)) {
+            shared = ARY_SHARED(copy);
+            FL_UNSET_SHARED(copy);
+        }
+        FL_SET_EMBED(copy);
+	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        if (shared) {
+            rb_ary_decrement_share(shared);
+        }
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
     }
-    /* Otherwise, orig is on heap and copy does not have enough space to embed
-     * the contents of orig. */
     else {
-        VALUE shared_root = ary_make_shared(orig);
+        VALUE shared = ary_make_shared(orig);
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+        }
+        else {
+            rb_ary_unshare_safe(copy);
+        }
         FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
-        ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
-        rb_ary_set_shared(copy, shared_root);
+        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+        rb_ary_set_shared(copy, shared);
     }
-    ary_verify(copy);
     return copy;
 }
 
 /*
  *  call-seq:
- *    clear -> self
- *
- *  Removes all elements from +self+; returns +self+:
+ *     ary.clear    -> ary
  *
- *    a = [:foo, 'bar', 2]
- *    a.clear # => []
+ *  Removes all elements from +self+.
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.clear    #=> [ ]
  */
 
 VALUE
 rb_ary_clear(VALUE ary)
 {
     rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
     if (ARY_SHARED_P(ary)) {
-        rb_ary_unshare(ary);
-        FL_SET_EMBED(ary);
-        ARY_SET_EMBED_LEN(ary, 0);
+	if (!ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
     }
-    else {
-        ARY_SET_LEN(ary, 0);
-        if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
-            ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
-        }
+    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
     }
-    ary_verify(ary);
     return ary;
 }
 
 /*
  *  call-seq:
- *    fill(object, start = nil, count = nil) -> new_array
- *    fill(object, range) -> new_array
- *    fill(start = nil, count = nil) {|element| ... } -> new_array
- *    fill(range) {|element| ... } -> new_array
- *
- *  Replaces selected elements in +self+;
- *  may add elements to +self+;
- *  always returns +self+ (never a new array).
- *
- *  In brief:
- *
- *    # Non-negative start.
- *    ['a', 'b', 'c', 'd'].fill('-', 1, 2)          # => ["a", "-", "-", "d"]
- *    ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *    # Extends with specified values if necessary.
- *    ['a', 'b', 'c', 'd'].fill('-', 3, 2)          # => ["a", "b", "c", "-", "-"]
- *    ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
- *
- *    # Fills with nils if necessary.
- *    ['a', 'b', 'c', 'd'].fill('-', 6, 2)          # => ["a", "b", "c", "d", nil, nil, "-", "-"]
- *    ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
- *
- *    # For negative start, counts backwards from the end.
- *    ['a', 'b', 'c', 'd'].fill('-', -3, 3)          # => ["a", "-", "-", "-"]
- *    ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
- *
- *    # Range.
- *    ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
- *    ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *  When arguments +start+ and +count+ are given,
- *  they select the elements of +self+ to be replaced;
- *  each must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
- *  (or +nil+):
- *
- *  - +start+ specifies the zero-based offset of the first element to be replaced;
- *    +nil+ means zero.
- *  - +count+ is the number of consecutive elements to be replaced;
- *    +nil+ means "all the rest."
- *
- *  With argument +object+ given,
- *  that one object is used for all replacements:
- *
- *    o = Object.new           # => #<Object:0x0000014e7bff7600>
- *    a = ['a', 'b', 'c', 'd'] # => ["a", "b", "c", "d"]
- *    a.fill(o, 1, 2)
- *    # => ["a", #<Object:0x0000014e7bff7600>, #<Object:0x0000014e7bff7600>, "d"]
- *
- *  With a block given, the block is called once for each element to be replaced;
- *  the value passed to the block is the _index_ of the element to be replaced
- *  (not the element itself);
- *  the block's return value replaces the element:
- *
- *    a = ['a', 'b', 'c', 'd']               # => ["a", "b", "c", "d"]
- *    a.fill(1, 2) {|element| element.to_s } # => ["a", "1", "2", "d"]
+ *     ary.fill(obj)                                 -> ary
+ *     ary.fill(obj, start [, length])               -> ary
+ *     ary.fill(obj, range )                         -> ary
+ *     ary.fill { |index| block }                    -> ary
+ *     ary.fill(start [, length] ) { |index| block } -> ary
+ *     ary.fill(range) { |index| block }             -> ary
  *
- *  For arguments +start+ and +count+:
+ *  The first three forms set the selected elements of +self+ (which
+ *  may be the entire array) to +obj+.
  *
- *  - If +start+ is non-negative,
- *    replaces +count+ elements beginning at offset +start+:
+ *  A +start+ of +nil+ is equivalent to zero.
  *
- *      ['a', 'b', 'c', 'd'].fill('-', 0, 2) # => ["-", "-", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 1, 2) # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 2, 2) # => ["a", "b", "-", "-"]
+ *  A +length+ of +nil+ is equivalent to the length of the array.
  *
- *      ['a', 'b', 'c', 'd'].fill(0, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1, 2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(2, 2) {|e| e.to_s } # => ["a", "b", "2", "3"]
+ *  The last three forms fill the array with the value of the given block,
+ *  which is passed the absolute index of each element to be filled.
  *
- *    Extends +self+ if necessary:
+ *  Negative values of +start+ count from the end of the array, where +-1+ is
+ *  the last element.
  *
- *      ['a', 'b', 'c', 'd'].fill('-', 3, 2) # => ["a", "b", "c", "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill('-', 4, 2) # => ["a", "b", "c", "d", "-", "-"]
- *
- *      ['a', 'b', 'c', 'd'].fill(3, 2) {|e| e.to_s } # => ["a", "b", "c", "3", "4"]
- *      ['a', 'b', 'c', 'd'].fill(4, 2) {|e| e.to_s } # => ["a", "b", "c", "d", "4", "5"]
- *
- *    Fills with +nil+ if necessary:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 5, 2) # => ["a", "b", "c", "d", nil, "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill('-', 6, 2) # => ["a", "b", "c", "d", nil, nil, "-", "-"]
- *
- *      ['a', 'b', 'c', 'd'].fill(5, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, "5", "6"]
- *      ['a', 'b', 'c', 'd'].fill(6, 2) {|e| e.to_s } # => ["a", "b", "c", "d", nil, nil, "6", "7"]
- *
- *    Does nothing if +count+ is non-positive:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 2, 0)    # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 2, -100) # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 6, -100) # => ["a", "b", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(2, 0) {|e| fail 'Cannot happen' }    # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(2, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(6, -100) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
- *
- *  - If +start+ is negative, counts backwards from the end of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -4, 3) # => ["-", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -3, 3) # => ["a", "-", "-", "-"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-4, 3) {|e| e.to_s } # => ["0", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-3, 3) {|e| e.to_s } # => ["a", "1", "2", "3"]
- *
- *    Extends +self+ if necessary:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -2, 3) # => ["a", "b", "-", "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill('-', -1, 3) # => ["a", "b", "c", "-", "-", "-"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-2, 3) {|e| e.to_s } # => ["a", "b", "2", "3", "4"]
- *      ['a', 'b', 'c', 'd'].fill(-1, 3) {|e| e.to_s } # => ["a", "b", "c", "3", "4", "5"]
- *
- *    Starts at the beginning of +self+ if +start+ is negative and out-of-range:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -5, 2) # => ["-", "-", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -6, 2) # => ["-", "-", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-5, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-6, 2) {|e| e.to_s } # => ["0", "1", "c", "d"]
- *
- *    Does nothing if +count+ is non-positive:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -2, 0)  # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -2, -1) # => ["a", "b", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-2, 0) {|e| fail 'Cannot happen' }  # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-2, -1) {|e| fail 'Cannot happen' } # => ["a", "b", "c", "d"]
- *
- *  When argument +range+ is given,
- *  it must be a Range object whose members are numeric;
- *  its +begin+ and +end+ values determine the elements of +self+
- *  to be replaced:
- *
- *  - If both +begin+ and +end+ are positive, they specify the first and last elements
- *    to be replaced:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 1..2)          # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1..2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *    If +end+ is smaller than +begin+, replaces no elements:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 2..1)          # => ["a", "b", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(2..1) {|e| e.to_s } # => ["a", "b", "c", "d"]
- *
- *  - If either is negative (or both are negative), counts backwards from the end of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', -3..2)  # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 1..-2)  # => ["a", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', -3..-2) # => ["a", "-", "-", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(-3..2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1..-2) {|e| e.to_s }  # => ["a", "1", "2", "d"]
- *      ['a', 'b', 'c', 'd'].fill(-3..-2) {|e| e.to_s } # => ["a", "1", "2", "d"]
- *
- *  - If the +end+ value is excluded (see Range#exclude_end?), omits the last replacement:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 1...2)  # => ["a", "-", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill('-', 1...-2) # => ["a", "-", "c", "d"]
- *
- *      ['a', 'b', 'c', 'd'].fill(1...2) {|e| e.to_s }  # => ["a", "1", "c", "d"]
- *      ['a', 'b', 'c', 'd'].fill(1...-2) {|e| e.to_s } # => ["a", "1", "c", "d"]
- *
- *  - If the range is endless (see {Endless Ranges}[rdoc-ref:Range@Endless+Ranges]),
- *    replaces elements to the end of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', 1..)          # => ["a", "-", "-", "-"]
- *      ['a', 'b', 'c', 'd'].fill(1..) {|e| e.to_s } # => ["a", "1", "2", "3"]
- *
- *  - If the range is beginless (see {Beginless Ranges}[rdoc-ref:Range@Beginless+Ranges]),
- *    replaces elements from the beginning of +self+:
- *
- *      ['a', 'b', 'c', 'd'].fill('-', ..2)          # => ["-", "-", "-", "d"]
- *      ['a', 'b', 'c', 'd'].fill(..2) {|e| e.to_s } # => ["0", "1", "2", "d"]
- *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.fill("x")              #=> ["x", "x", "x", "x"]
+ *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
+ *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
+ *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
+ *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
  */
 
 static VALUE
 rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE item = Qundef, arg1, arg2;
+    VALUE item, arg1, arg2;
     long beg = 0, end = 0, len = 0;
+    int block_p = FALSE;
 
     if (rb_block_given_p()) {
-        rb_scan_args(argc, argv, "02", &arg1, &arg2);
-        argc += 1;		/* hackish */
+	block_p = TRUE;
+	rb_scan_args(argc, argv, "02", &arg1, &arg2);
+	argc += 1;		/* hackish */
     }
     else {
-        rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
     }
     switch (argc) {
       case 1:
-        beg = 0;
-        len = RARRAY_LEN(ary);
-        break;
+	beg = 0;
+	len = RARRAY_LEN(ary);
+	break;
       case 2:
-        if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
-            break;
-        }
-        /* fall through */
+	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+	    break;
+	}
+	/* fall through */
       case 3:
-        beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
-        if (beg < 0) {
-            beg = RARRAY_LEN(ary) + beg;
-            if (beg < 0) beg = 0;
-        }
-        len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
-        break;
+	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+	if (beg < 0) {
+	    beg = RARRAY_LEN(ary) + beg;
+	    if (beg < 0) beg = 0;
+	}
+	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+	break;
     }
     rb_ary_modify(ary);
     if (len < 0) {
         return ary;
     }
     if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
-        rb_raise(rb_eArgError, "argument too big");
+	rb_raise(rb_eArgError, "argument too big");
     }
     end = beg + len;
     if (RARRAY_LEN(ary) < end) {
-        if (end >= ARY_CAPA(ary)) {
-            ary_resize_capa(ary, end);
-        }
-        ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
-        ARY_SET_LEN(ary, end);
+	if (end >= ARY_CAPA(ary)) {
+	    ary_resize_capa(ary, end);
+	}
+	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+	ARY_SET_LEN(ary, end);
     }
 
-    if (UNDEF_P(item)) {
-        VALUE v;
-        long i;
+    if (block_p) {
+	VALUE v;
+	long i;
 
-        for (i=beg; i<end; i++) {
-            v = rb_yield(LONG2NUM(i));
-            if (i>=RARRAY_LEN(ary)) break;
-            ARY_SET(ary, i, v);
-        }
+	for (i=beg; i<end; i++) {
+	    v = rb_yield(LONG2NUM(i));
+	    if (i>=RARRAY_LEN(ary)) break;
+	    ARY_SET(ary, i, v);
+	}
     }
     else {
-        ary_memfill(ary, beg, len, item);
+	ary_memfill(ary, beg, len, item);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    self + other_array -> new_array
+ *     ary + other_ary   -> new_ary
  *
- *  Returns a new array containing all elements of +self+
- *  followed by all elements of +other_array+:
+ *  Concatenation --- Returns a new array built by concatenating the
+ *  two arrays together to produce a third array.
  *
- *    a = [0, 1] + [2, 3]
- *    a # => [0, 1, 2, 3]
+ *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
+ *     a = [ "a", "b", "c" ]
+ *     c = a + [ "d", "e", "f" ]
+ *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
+ *     a                         #=> [ "a", "b", "c" ]
  *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  Note that
+ *     x += y
+ *  is the same as
+ *     x = x + y
+ *  This means that it produces a new array. As a consequence,
+ *  repeated use of <code>+=</code> on arrays can be quite inefficient.
+ *
+ *  See also Array#concat.
  */
 
 VALUE
@@ -5029,72 +3636,46 @@ rb_ary_plus(VALUE x, VALUE y)
     return z;
 }
 
-static VALUE
-ary_append(VALUE x, VALUE y)
-{
-    long n = RARRAY_LEN(y);
-    if (n > 0) {
-        rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
-    }
-    RB_GC_GUARD(y);
-    return x;
-}
-
 /*
  *  call-seq:
- *    concat(*other_arrays) -> self
+ *     ary.concat(other_ary)   -> ary
  *
- *  Adds to +self+ all elements from each array in +other_arrays+; returns +self+:
+ *  Appends the elements of +other_ary+ to +self+.
  *
- *    a = [0, 1]
- *    a.concat(['two', 'three'], [:four, :five], a)
- *    # => [0, 1, "two", "three", :four, :five, 0, 1]
+ *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ *     a = [ 1, 2, 3 ]
+ *     a.concat( [ 4, 5 ] )
+ *     a                                 #=> [ 1, 2, 3, 4, 5 ]
  *
- *  Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *  See also Array#+.
  */
 
-static VALUE
-rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
-{
-    rb_ary_modify_check(ary);
-
-    if (argc == 1) {
-        rb_ary_concat(ary, argv[0]);
-    }
-    else if (argc > 1) {
-        int i;
-        VALUE args = rb_ary_hidden_new(argc);
-        for (i = 0; i < argc; i++) {
-            rb_ary_concat(args, argv[i]);
-        }
-        ary_append(ary, args);
-    }
-
-    ary_verify(ary);
-    return ary;
-}
-
 VALUE
 rb_ary_concat(VALUE x, VALUE y)
 {
-    return ary_append(x, to_ary(y));
+    rb_ary_modify_check(x);
+    y = to_ary(y);
+    if (RARRAY_LEN(y) > 0) {
+	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
+    }
+    return x;
 }
 
+
 /*
  *  call-seq:
- *    self * n -> new_array
- *    self * string_separator -> new_string
+ *     ary * int     -> new_ary
+ *     ary * str     -> new_string
  *
- *  When non-negative integer argument +n+ is given,
- *  returns a new array built by concatenating +n+ copies of +self+:
+ *  Repetition --- With a String argument, equivalent to
+ *  <code>ary.join(str)</code>.
  *
- *    a = ['x', 'y']
- *    a * 3 # => ["x", "y", "x", "y", "x", "y"]
+ *  Otherwise, returns a new array built by concatenating the +int+ copies of
+ *  +self+.
  *
- *  When string argument +string_separator+ is given,
- *  equivalent to <tt>self.join(string_separator)</tt>:
  *
- *    [0, [0, 1], {foo: 0}] * ', ' # => "0, 0, 1, {foo: 0}"
+ *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
+ *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
  *
  */
 
@@ -5107,55 +3688,61 @@ rb_ary_times(VALUE ary, VALUE times)
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
-        return rb_ary_join(ary, tmp);
+	return rb_ary_join(ary, tmp);
     }
 
     len = NUM2LONG(times);
     if (len == 0) {
-        ary2 = ary_new(rb_cArray, 0);
-        goto out;
+	ary2 = ary_new(rb_obj_class(ary), 0);
+	goto out;
     }
     if (len < 0) {
-        rb_raise(rb_eArgError, "negative argument");
+	rb_raise(rb_eArgError, "negative argument");
     }
     if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
-        rb_raise(rb_eArgError, "argument too big");
+	rb_raise(rb_eArgError, "argument too big");
     }
     len *= RARRAY_LEN(ary);
 
-    ary2 = ary_new(rb_cArray, len);
+    ary2 = ary_new(rb_obj_class(ary), len);
     ARY_SET_LEN(ary2, len);
 
     ptr = RARRAY_CONST_PTR(ary);
     t = RARRAY_LEN(ary);
     if (0 < t) {
-        ary_memcpy(ary2, 0, t, ptr);
-        while (t <= len/2) {
-            ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+	ary_memcpy(ary2, 0, t, ptr);
+	while (t <= len/2) {
+	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
             t *= 2;
         }
         if (t < len) {
-            ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
         }
     }
   out:
+    OBJ_INFECT(ary2, ary);
+
     return ary2;
 }
 
 /*
  *  call-seq:
- *    assoc(object) -> found_array or nil
+ *     ary.assoc(obj)   -> element_ary  or  nil
  *
- *  Returns the first element +ele+ in +self+ such that +ele+ is an array
- *  and <tt>ele[0] == object</tt>:
+ *  Searches through an array whose elements are also arrays comparing +obj+
+ *  with the first element of each contained array using <code>obj.==</code>.
  *
- *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
- *    a.assoc(4) # => [4, 5, 6]
+ *  Returns the first contained array that matches (that is, the first
+ *  associated array), or +nil+ if no match is found.
  *
- *  Returns +nil+ if no such element is found.
+ *  See also Array#rassoc
  *
- *  Related: Array#rassoc;
- *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *     s1 = [ "colors", "red", "blue", "green" ]
+ *     s2 = [ "letters", "a", "b", "c" ]
+ *     s3 = "foo"
+ *     a  = [ s1, s2, s3 ]
+ *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
+ *     a.assoc("foo")      #=> nil
  */
 
 VALUE
@@ -5165,29 +3752,30 @@ rb_ary_assoc(VALUE ary, VALUE key)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-        v = rb_check_array_type(RARRAY_AREF(ary, i));
-        if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
-            rb_equal(RARRAY_AREF(v, 0), key))
-            return v;
+	v = rb_check_array_type(RARRAY_AREF(ary, i));
+	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+	    rb_equal(RARRAY_AREF(v, 0), key))
+	    return v;
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *    rassoc(object) -> found_array or nil
+ *     ary.rassoc(obj) -> element_ary or nil
  *
- *  Returns the first element +ele+ in +self+ such that +ele+ is an array
- *  and <tt>ele[1] == object</tt>:
+ *  Searches through the array whose elements are also arrays.
  *
- *    a = [{foo: 0}, [2, 4], [4, 5, 6], [4, 5]]
- *    a.rassoc(4) # => [2, 4]
- *    a.rassoc(5) # => [4, 5, 6]
+ *  Compares +obj+ with the second element of each contained array using
+ *  <code>obj.==</code>.
  *
- *  Returns +nil+ if no such element is found.
+ *  Returns the first contained array that matches +obj+.
  *
- *  Related: Array#assoc;
- *  see also {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *  See also Array#assoc.
+ *
+ *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
+ *     a.rassoc("two")    #=> [2, "two"]
+ *     a.rassoc("four")   #=> nil
  */
 
 VALUE
@@ -5197,11 +3785,11 @@ rb_ary_rassoc(VALUE ary, VALUE value)
     VALUE v;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-        v = rb_check_array_type(RARRAY_AREF(ary, i));
-        if (RB_TYPE_P(v, T_ARRAY) &&
-            RARRAY_LEN(v) > 1 &&
-            rb_equal(RARRAY_AREF(v, 1), value))
-            return v;
+	v = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(v, T_ARRAY) &&
+	    RARRAY_LEN(v) > 1 &&
+	    rb_equal(RARRAY_AREF(v, 1), value))
+	    return v;
     }
     return Qnil;
 }
@@ -5214,54 +3802,43 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
 
-    /* rb_equal() can evacuate ptrs */
     p1 = RARRAY_CONST_PTR(ary1);
     p2 = RARRAY_CONST_PTR(ary2);
     len1 = RARRAY_LEN(ary1);
 
     for (i = 0; i < len1; i++) {
-        if (*p1 != *p2) {
-            if (rb_equal(*p1, *p2)) {
-                len1 = RARRAY_LEN(ary1);
-                if (len1 != RARRAY_LEN(ary2))
-                    return Qfalse;
-                if (len1 < i)
-                    return Qtrue;
-                p1 = RARRAY_CONST_PTR(ary1) + i;
-                p2 = RARRAY_CONST_PTR(ary2) + i;
-            }
-            else {
-                return Qfalse;
-            }
-        }
-        p1++;
-        p2++;
+	if (*p1 != *p2) {
+	    if (rb_equal(*p1, *p2)) {
+		len1 = RARRAY_LEN(ary1);
+		if (len1 != RARRAY_LEN(ary2))
+		    return Qfalse;
+		if (len1 < i)
+		    return Qtrue;
+		p1 = RARRAY_CONST_PTR(ary1) + i;
+		p2 = RARRAY_CONST_PTR(ary2) + i;
+	    }
+	    else {
+		return Qfalse;
+	    }
+	}
+	p1++;
+	p2++;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *    self == other_array -> true or false
- *
- *  Returns whether both:
- *
- *  - +self+ and +other_array+ are the same size.
- *  - Their corresponding elements are the same;
- *    that is, for each index +i+ in <tt>(0...self.size)</tt>,
- *    <tt>self[i] == other_array[i]</tt>.
+ *     ary == other_ary   ->   bool
  *
- *  Examples:
+ *  Equality --- Two arrays are equal if they contain the same number of
+ *  elements and if each element is equal to (according to Object#==) the
+ *  corresponding element in +other_ary+.
  *
- *    [:foo, 'bar', 2] == [:foo, 'bar', 2]   # => true
- *    [:foo, 'bar', 2] == [:foo, 'bar', 2.0] # => true
- *    [:foo, 'bar', 2] == [:foo, 'bar']      # => false # Different sizes.
- *    [:foo, 'bar', 2] == [:foo, 'bar', 3]   # => false # Different elements.
+ *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
+ *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
+ *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
  *
- *  This method is different from method Array#eql?,
- *  which compares elements using <tt>Object#eql?</tt>.
- *
- *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 static VALUE
@@ -5269,10 +3846,10 @@ rb_ary_equal(VALUE ary1, VALUE ary2)
 {
     if (ary1 == ary2) return Qtrue;
     if (!RB_TYPE_P(ary2, T_ARRAY)) {
-        if (!rb_respond_to(ary2, idTo_ary)) {
-            return Qfalse;
-        }
-        return rb_equal(ary2, ary1);
+	if (!rb_respond_to(ary2, idTo_ary)) {
+	    return Qfalse;
+	}
+	return rb_equal(ary2, ary1);
     }
     if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
     if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
@@ -5286,29 +3863,18 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
 
     if (recur) return Qtrue; /* Subtle! */
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-        if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-            return Qfalse;
+	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+	    return Qfalse;
     }
     return Qtrue;
 }
 
 /*
  *  call-seq:
- *    eql?(other_array) -> true or false
- *
- *  Returns +true+ if +self+ and +other_array+ are the same size,
- *  and if, for each index +i+ in +self+, <tt>self[i].eql?(other_array[i])</tt>:
- *
- *    a0 = [:foo, 'bar', 2]
- *    a1 = [:foo, 'bar', 2]
- *    a1.eql?(a0) # => true
+ *     ary.eql?(other)  -> true or false
  *
- *  Otherwise, returns +false+.
- *
- *  This method is different from method Array#==,
- *  which compares using method <tt>Object#==</tt>.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *  Returns +true+ if +self+ and +other+ are the same object,
+ *  or are both arrays with the same content (according to Object#eql?).
  */
 
 static VALUE
@@ -5321,56 +3887,45 @@ rb_ary_eql(VALUE ary1, VALUE ary2)
     return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
-VALUE
-rb_ary_hash_values(long len, const VALUE *elements)
-{
-    long i;
-    st_index_t h;
-    VALUE n;
-
-    h = rb_hash_start(len);
-    h = rb_hash_uint(h, (st_index_t)rb_ary_hash_values);
-    for (i=0; i<len; i++) {
-        n = rb_hash(elements[i]);
-        h = rb_hash_uint(h, NUM2LONG(n));
-    }
-    h = rb_hash_end(h);
-    return ST2FIX(h);
-}
-
 /*
  *  call-seq:
- *    hash -> integer
- *
- *  Returns the integer hash value for +self+.
+ *     ary.hash   -> fixnum
  *
- *  Two arrays with the same content will have the same hash value
- *  (and will compare using eql?):
+ *  Compute a hash-code for this array.
  *
- *    ['a', 'b'].hash == ['a', 'b'].hash # => true
- *    ['a', 'b'].hash == ['a', 'c'].hash # => false
- *    ['a', 'b'].hash == ['a'].hash      # => false
+ *  Two arrays with the same content will have the same hash code (and will
+ *  compare using #eql?).
  *
+ *  See also Object#hash.
  */
 
 static VALUE
 rb_ary_hash(VALUE ary)
 {
-    return rb_ary_hash_values(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+    long i;
+    st_index_t h;
+    VALUE n;
+
+    h = rb_hash_start(RARRAY_LEN(ary));
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	n = rb_hash(RARRAY_AREF(ary, i));
+	h = rb_hash_uint(h, NUM2LONG(n));
+    }
+    h = rb_hash_end(h);
+    return LONG2FIX(h);
 }
 
 /*
  *  call-seq:
- *    include?(object) -> true or false
+ *     ary.include?(object)   -> true or false
  *
- *  Returns whether for some element +element+ in +self+,
- *  <tt>object == element</tt>:
+ *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
+ *  element <code>==</code> +object+), otherwise returns +false+.
  *
- *    [0, 1, 2].include?(2)   # => true
- *    [0, 1, 2].include?(2.0) # => true
- *    [0, 1, 2].include?(2.1) # => false
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *     a = [ "a", "b", "c" ]
+ *     a.include?("b")   #=> true
+ *     a.include?("z")   #=> false
  */
 
 VALUE
@@ -5380,28 +3935,18 @@ rb_ary_includes(VALUE ary, VALUE item)
     VALUE e;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (rb_equal(e, item)) {
-            return Qtrue;
-        }
+	e = RARRAY_AREF(ary, i);
+	switch (rb_equal_opt(e, item)) {
+	  case Qundef:
+	    if (rb_equal(e, item)) return Qtrue;
+	    break;
+	  case Qtrue:
+	    return Qtrue;
+	}
     }
     return Qfalse;
 }
 
-static VALUE
-rb_ary_includes_by_eql(VALUE ary, VALUE item)
-{
-    long i;
-    VALUE e;
-
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (rb_eql(item, e)) {
-            return Qtrue;
-        }
-    }
-    return Qfalse;
-}
 
 static VALUE
 recursive_cmp(VALUE ary1, VALUE ary2, int recur)
@@ -5411,54 +3956,46 @@ recursive_cmp(VALUE ary1, VALUE ary2, int recur)
     if (recur) return Qundef;	/* Subtle! */
     len = RARRAY_LEN(ary1);
     if (len > RARRAY_LEN(ary2)) {
-        len = RARRAY_LEN(ary2);
+	len = RARRAY_LEN(ary2);
     }
     for (i=0; i<len; i++) {
-        VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
-        VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
-        if (v != INT2FIX(0)) {
-            return v;
-        }
+	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+	if (v != INT2FIX(0)) {
+	    return v;
+	}
     }
     return Qundef;
 }
 
 /*
  *  call-seq:
- *    self <=> other_array -> -1, 0, or 1
- *
- *  Returns -1, 0, or 1 as +self+ is determined
- *  to be less than, equal to, or greater than +other_array+.
- *
- *  Iterates over each index +i+ in <tt>(0...self.size)</tt>:
- *
- *  - Computes <tt>result[i]</tt> as <tt>self[i] <=> other_array[i]</tt>.
- *  - Immediately returns 1 if <tt>result[i]</tt> is 1:
- *
- *      [0, 1, 2] <=> [0, 0, 2] # => 1
+ *     ary <=> other_ary   ->  -1, 0, +1 or nil
  *
- *  - Immediately returns -1 if <tt>result[i]</tt> is -1:
+ *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
+ *  array is less than, equal to, or greater than +other_ary+.
  *
- *      [0, 1, 2] <=> [0, 2, 2] # => -1
+ *  Each object in each array is compared (using the <=> operator).
  *
- *  - Continues if <tt>result[i]</tt> is 0.
+ *  Arrays are compared in an "element-wise" manner; the first element of +ary+
+ *  is compared with the first one of +other_ary+ using the <=> operator, then
+ *  each of the second elements, etc...
+ *  As soon as the result of any such comparison is non zero (i.e. the two
+ *  corresponding elements are not equal), that result is returned for the
+ *  whole array comparison.
  *
- *  When every +result+ is 0,
- *  returns <tt>self.size <=> other_array.size</tt>
- *  (see Integer#<=>):
+ *  If all the elements are equal, then the result is based on a comparison of
+ *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
+ *  and only if, they have the same length and the value of each element is
+ *  equal to the value of the corresponding element in the other array.
  *
- *    [0, 1, 2] <=> [0, 1]        # => 1
- *    [0, 1, 2] <=> [0, 1, 2]     # => 0
- *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
+ *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
+ *  of two elements returned +nil+.
  *
- *  Note that when +other_array+ is larger than +self+,
- *  its trailing elements do not affect the result:
+ *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
+ *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
+ *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
  *
- *    [0, 1, 2] <=> [0, 1, 2, -3] # => -1
- *    [0, 1, 2] <=> [0, 1, 2, 0]  # => -1
- *    [0, 1, 2] <=> [0, 1, 2, 3]  # => -1
- *
- *  Related: see {Methods for Comparing}[rdoc-ref:Array@Methods+for+Comparing].
  */
 
 VALUE
@@ -5471,7 +4008,7 @@ rb_ary_cmp(VALUE ary1, VALUE ary2)
     if (NIL_P(ary2)) return Qnil;
     if (ary1 == ary2) return INT2FIX(0);
     v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
-    if (!UNDEF_P(v)) return v;
+    if (v != Qundef) return v;
     len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
@@ -5484,17 +4021,18 @@ ary_add_hash(VALUE hash, VALUE ary)
     long i;
 
     for (i=0; i<RARRAY_LEN(ary); i++) {
-        VALUE elt = RARRAY_AREF(ary, i);
-        rb_hash_add_new_element(hash, elt, elt);
+	VALUE elt = RARRAY_AREF(ary, i);
+	if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
+	    rb_hash_aset(hash, elt, elt);
+	}
     }
     return hash;
 }
 
 static inline VALUE
-ary_tmp_hash_new(VALUE ary)
+ary_tmp_hash_new(void)
 {
-    long size = RARRAY_LEN(ary);
-    VALUE hash = rb_hash_new_with_size(size);
+    VALUE hash = rb_hash_new();
 
     RBASIC_CLEAR_CLASS(hash);
     return hash;
@@ -5503,7 +4041,7 @@ ary_tmp_hash_new(VALUE ary)
 static VALUE
 ary_make_hash(VALUE ary)
 {
-    VALUE hash = ary_tmp_hash_new(ary);
+    VALUE hash = ary_tmp_hash_new();
     return ary_add_hash(hash, ary);
 }
 
@@ -5513,8 +4051,10 @@ ary_add_hash_by(VALUE hash, VALUE ary)
     long i;
 
     for (i = 0; i < RARRAY_LEN(ary); ++i) {
-        VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
-        rb_hash_add_new_element(hash, k, v);
+	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
+	    rb_hash_aset(hash, k, v);
+	}
     }
     return hash;
 }
@@ -5522,134 +4062,70 @@ ary_add_hash_by(VALUE hash, VALUE ary)
 static VALUE
 ary_make_hash_by(VALUE ary)
 {
-    VALUE hash = ary_tmp_hash_new(ary);
+    VALUE hash = ary_tmp_hash_new();
     return ary_add_hash_by(hash, ary);
 }
 
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+    if (RHASH(hash)->ntbl) {
+	st_table *tbl = RHASH(hash)->ntbl;
+	RHASH(hash)->ntbl = 0;
+	st_free_table(tbl);
+    }
+    RB_GC_GUARD(hash);
+}
+
 /*
  *  call-seq:
- *    self - other_array -> new_array
+ *     ary - other_ary    -> new_ary
+ *
+ *  Array Difference
  *
- *  Returns a new array containing only those elements of +self+
- *  that are not found in +other_array+;
- *  the order from +self+ is preserved:
+ *  Returns a new array that is a copy of the original array, removing any
+ *  items that also appear in +other_ary+. The order is preserved from the
+ *  original array.
  *
- *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [1]             # => [0, 2, 3]
- *    [0, 1, 1, 2, 1, 1, 3, 1, 1] - [3, 2, 0, :foo] # => [1, 1, 1, 1, 1, 1]
- *    [0, 1, 2] - [:foo]                            # => [0, 1, 2]
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *  Element are compared using method <tt>#eql?</tt>
- *  (as defined in each element of +self+).
+ *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
  *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  If you need set-like behavior, see the library class Set.
  */
 
-VALUE
+static VALUE
 rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
     VALUE hash;
     long i;
 
-    ary2 = to_ary(ary2);
-    if (RARRAY_LEN(ary2) == 0) { return ary_make_shared_copy(ary1); }
+    hash = ary_make_hash(to_ary(ary2));
     ary3 = rb_ary_new();
 
-    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        for (i=0; i<RARRAY_LEN(ary1); i++) {
-            VALUE elt = rb_ary_elt(ary1, i);
-            if (rb_ary_includes_by_eql(ary2, elt)) continue;
-            rb_ary_push(ary3, elt);
-        }
-        return ary3;
-    }
-
-    hash = ary_make_hash(ary2);
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-        if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
-        rb_ary_push(ary3, rb_ary_elt(ary1, i));
+	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
+	rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
-
+    ary_recycle_hash(hash);
     return ary3;
 }
 
 /*
  *  call-seq:
- *    difference(*other_arrays = []) -> new_array
+ *     ary & other_ary      -> new_ary
  *
- *  Returns a new array containing only those elements from +self+
- *  that are not found in any of the given +other_arrays+;
- *  items are compared using <tt>eql?</tt>;  order from +self+ is preserved:
+ *  Set Intersection --- Returns a new array containing elements common to the
+ *  two arrays, excluding any duplicates. The order is preserved from the
+ *  original array.
  *
- *    [0, 1, 1, 2, 1, 1, 3, 1, 1].difference([1]) # => [0, 2, 3]
- *    [0, 1, 2, 3].difference([3, 0], [1, 3])     # => [2]
- *    [0, 1, 2].difference([4])                   # => [0, 1, 2]
- *    [0, 1, 2].difference                        # => [0, 1, 2]
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *  Returns a copy of +self+ if no arguments are given.
+ *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]                 #=> [ 1, 3 ]
+ *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
  *
- *  Related: Array#-;
- *  see also {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
- */
-
-static VALUE
-rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE ary_diff;
-    long i, length;
-    volatile VALUE t0;
-    bool *is_hash = ALLOCV_N(bool, t0, argc);
-    ary_diff = rb_ary_new();
-    length = RARRAY_LEN(ary);
-
-    for (i = 0; i < argc; i++) {
-        argv[i] = to_ary(argv[i]);
-        is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
-        if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
-    }
-
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        int j;
-        VALUE elt = rb_ary_elt(ary, i);
-        for (j = 0; j < argc; j++) {
-            if (is_hash[j]) {
-                if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
-                    break;
-            }
-            else {
-                if (rb_ary_includes_by_eql(argv[j], elt)) break;
-            }
-        }
-        if (j == argc) rb_ary_push(ary_diff, elt);
-    }
-
-    ALLOCV_END(t0);
-
-    return ary_diff;
-}
-
-
-/*
- *  call-seq:
- *    self & other_array -> new_array
- *
- *  Returns a new array containing the _intersection_ of +self+ and +other_array+;
- *  that is, containing those elements found in both +self+ and +other_array+:
- *
- *    [0, 1, 2, 3] & [1, 2] # => [1, 2]
- *
- *  Omits duplicates:
- *
- *    [0, 1, 1, 0] & [0, 1] # => [0, 1]
- *
- *  Preserves order from +self+:
- *
- *    [0, 1, 2] & [3, 2, 1, 0] # => [0, 1, 2]
- *
- *  Identifies common elements using method <tt>#eql?</tt>
- *  (as defined in each element of +self+).
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  See also Array#uniq.
  */
 
 
@@ -5657,70 +4133,28 @@ static VALUE
 rb_ary_and(VALUE ary1, VALUE ary2)
 {
     VALUE hash, ary3, v;
+    st_table *table;
     st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
     ary3 = rb_ary_new();
-    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
-
-    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        for (i=0; i<RARRAY_LEN(ary1); i++) {
-            v = RARRAY_AREF(ary1, i);
-            if (!rb_ary_includes_by_eql(ary2, v)) continue;
-            if (rb_ary_includes_by_eql(ary3, v)) continue;
-            rb_ary_push(ary3, v);
-        }
-        return ary3;
-    }
-
+    if (RARRAY_LEN(ary2) == 0) return ary3;
     hash = ary_make_hash(ary2);
+    table = rb_hash_tbl_raw(hash);
 
     for (i=0; i<RARRAY_LEN(ary1); i++) {
-        v = RARRAY_AREF(ary1, i);
-        vv = (st_data_t)v;
-        if (rb_hash_stlike_delete(hash, &vv, 0)) {
-            rb_ary_push(ary3, v);
-        }
+	v = RARRAY_AREF(ary1, i);
+	vv = (st_data_t)v;
+	if (st_delete(table, &vv, 0)) {
+	    rb_ary_push(ary3, v);
+	}
     }
+    ary_recycle_hash(hash);
 
     return ary3;
 }
 
-/*
- *  call-seq:
- *    intersection(*other_arrays) -> new_array
- *
- *  Returns a new array containing each element in +self+ that is +#eql?+
- *  to at least one element in each of the given +other_arrays+;
- *  duplicates are omitted:
- *
- *    [0, 0, 1, 1, 2, 3].intersection([0, 1, 2], [0, 1, 3]) # => [0, 1]
- *
- *  Each element must correctly implement method <tt>#hash</tt>.
- *
- *  Order from +self+ is preserved:
- *
- *    [0, 1, 2].intersection([2, 1, 0]) # => [0, 1, 2]
- *
- *  Returns a copy of +self+ if no arguments are given.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
- */
-
-static VALUE
-rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE result = rb_ary_dup(ary);
-    int i;
-
-    for (i = 0; i < argc; i++) {
-        result = rb_ary_and(result, argv[i]);
-    }
-
-    return result;
-}
-
 static int
 ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
 {
@@ -5729,551 +4163,38 @@ ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
     return ST_CONTINUE;
 }
 
-static void
-rb_ary_union(VALUE ary_union, VALUE ary)
-{
-    long i;
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        VALUE elt = rb_ary_elt(ary, i);
-        if (rb_ary_includes_by_eql(ary_union, elt)) continue;
-        rb_ary_push(ary_union, elt);
-    }
-}
-
-static void
-rb_ary_union_hash(VALUE hash, VALUE ary2)
-{
-    long i;
-    for (i = 0; i < RARRAY_LEN(ary2); i++) {
-        VALUE elt = RARRAY_AREF(ary2, i);
-        if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
-            RB_OBJ_WRITTEN(hash, Qundef, elt);
-        }
-    }
-}
-
-/*
- *  call-seq:
- *    self | other_array -> new_array
- *
- *  Returns the union of +self+ and +other_array+;
- *  duplicates are removed; order is preserved;
- *  items are compared using <tt>eql?</tt>:
- *
- *    [0, 1] | [2, 3] # => [0, 1, 2, 3]
- *    [0, 1, 1] | [2, 2, 3] # => [0, 1, 2, 3]
- *    [0, 1, 2] | [3, 2, 1, 0] # => [0, 1, 2, 3]
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
- */
-
-static VALUE
-rb_ary_or(VALUE ary1, VALUE ary2)
-{
-    VALUE hash;
-
-    ary2 = to_ary(ary2);
-    if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        VALUE ary3 = rb_ary_new();
-        rb_ary_union(ary3, ary1);
-        rb_ary_union(ary3, ary2);
-        return ary3;
-    }
-
-    hash = ary_make_hash(ary1);
-    rb_ary_union_hash(hash, ary2);
-
-    return rb_hash_values(hash);
-}
-
 /*
  *  call-seq:
- *    union(*other_arrays) -> new_array
- *
- *  Returns a new array that is the union of the elements of +self+
- *  and all given arrays +other_arrays+;
- *  items are compared using <tt>eql?</tt>:
- *
- *    [0, 1, 2, 3].union([4, 5], [6, 7]) # => [0, 1, 2, 3, 4, 5, 6, 7]
+ *     ary | other_ary     -> new_ary
  *
- *  Removes duplicates (preserving the first found):
+ *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
+ *  excluding any duplicates and preserving the order from the original array.
  *
- *    [0, 1, 1].union([2, 1], [3, 1]) # => [0, 1, 2, 3]
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *  Preserves order (preserving the position of the first found):
+ *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
  *
- *    [3, 2, 1, 0].union([5, 3], [4, 2]) # => [3, 2, 1, 0, 5, 4]
- *
- *  With no arguments given, returns a copy of +self+.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *  See also Array#uniq.
  */
 
 static VALUE
-rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
-{
-    int i;
-    long sum;
-    VALUE hash;
-
-    sum = RARRAY_LEN(ary);
-    for (i = 0; i < argc; i++) {
-        argv[i] = to_ary(argv[i]);
-        sum += RARRAY_LEN(argv[i]);
-    }
-
-    if (sum <= SMALL_ARRAY_LEN) {
-        VALUE ary_union = rb_ary_new();
-
-        rb_ary_union(ary_union, ary);
-        for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
-
-        return ary_union;
-    }
-
-    hash = ary_make_hash(ary);
-    for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
-
-    return rb_hash_values(hash);
-}
-
-/*
- *  call-seq:
- *    intersect?(other_array) -> true or false
- *
- *  Returns whether +other_array+ has at least one element that is +#eql?+ to some element of +self+:
- *
- *    [1, 2, 3].intersect?([3, 4, 5]) # => true
- *    [1, 2, 3].intersect?([4, 5, 6]) # => false
- *
- *  Each element must correctly implement method <tt>#hash</tt>.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_intersect_p(VALUE ary1, VALUE ary2)
+rb_ary_or(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, v, result, shorter, longer;
-    st_data_t vv;
+    VALUE hash, ary3;
     long i;
 
     ary2 = to_ary(ary2);
-    if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return Qfalse;
-
-    if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
-        for (i=0; i<RARRAY_LEN(ary1); i++) {
-            v = RARRAY_AREF(ary1, i);
-            if (rb_ary_includes_by_eql(ary2, v)) return Qtrue;
-        }
-        return Qfalse;
-    }
-
-    shorter = ary1;
-    longer = ary2;
-    if (RARRAY_LEN(ary1) > RARRAY_LEN(ary2)) {
-        longer = ary1;
-        shorter = ary2;
-    }
-
-    hash = ary_make_hash(shorter);
-    result = Qfalse;
-
-    for (i=0; i<RARRAY_LEN(longer); i++) {
-        v = RARRAY_AREF(longer, i);
-        vv = (st_data_t)v;
-        if (rb_hash_stlike_lookup(hash, vv, 0)) {
-            result = Qtrue;
-            break;
-        }
-    }
-
-    return result;
-}
-
-static VALUE
-ary_max_generic(VALUE ary, long i, VALUE vmax)
-{
-    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
-
-    VALUE v;
-    for (; i < RARRAY_LEN(ary); ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (rb_cmpint(rb_funcallv(vmax, id_cmp, 1, &v), vmax, v) < 0) {
-            vmax = v;
-        }
-    }
-
-    return vmax;
-}
-
-static VALUE
-ary_max_opt_fixnum(VALUE ary, long i, VALUE vmax)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(FIXNUM_P(vmax));
-
-    VALUE v;
-    for (; i < n; ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (FIXNUM_P(v)) {
-            if ((long)vmax < (long)v) {
-                vmax = v;
-            }
-        }
-        else {
-            return ary_max_generic(ary, i, vmax);
-        }
-    }
-
-    return vmax;
-}
-
-static VALUE
-ary_max_opt_float(VALUE ary, long i, VALUE vmax)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmax));
-
-    VALUE v;
-    for (; i < n; ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (RB_FLOAT_TYPE_P(v)) {
-            if (rb_float_cmp(vmax, v) < 0) {
-                vmax = v;
-            }
-        }
-        else {
-            return ary_max_generic(ary, i, vmax);
-        }
-    }
-
-    return vmax;
-}
-
-static VALUE
-ary_max_opt_string(VALUE ary, long i, VALUE vmax)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(STRING_P(vmax));
-
-    VALUE v;
-    for (; i < n; ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (STRING_P(v)) {
-            if (rb_str_cmp(vmax, v) < 0) {
-                vmax = v;
-            }
-        }
-        else {
-            return ary_max_generic(ary, i, vmax);
-        }
-    }
-
-    return vmax;
-}
-
-/*
- *  call-seq:
- *    max -> element
- *    max(count) -> new_array
- *    max {|a, b| ... } -> element
- *    max(count) {|a, b| ... } -> new_array
- *
- *  Returns one of the following:
- *
- *  - The maximum-valued element from +self+.
- *  - A new array of maximum-valued elements from +self+.
- *
- *  Does not modify +self+.
- *
- *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
- *  with a numeric.
- *
- *  With no argument and no block, returns the element in +self+
- *  having the maximum value per method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].max # => 3
- *
- *  With non-negative numeric argument +count+ and no block,
- *  returns a new array with at most +count+ elements,
- *  in descending order, per method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].max(3)   # => [3, 2, 1]
- *    [1, 0, 3, 2].max(3.0) # => [3, 2, 1]
- *    [1, 0, 3, 2].max(9)   # => [3, 2, 1, 0]
- *    [1, 0, 3, 2].max(0)   # => []
- *
- *  With a block given, the block must return a numeric.
- *
- *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
- *  returns the element having the maximum value per the block:
- *
- *    ['0', '', '000', '00'].max {|a, b| a.size <=> b.size }
- *    # => "000"
- *
- *  With non-negative numeric argument +count+ and a block,
- *  returns a new array with at most +count+ elements,
- *  in descending order, per the block:
- *
- *    ['0', '', '000', '00'].max(2) {|a, b| a.size <=> b.size }
- *    # => ["000", "00"]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
- */
-static VALUE
-rb_ary_max(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE result = Qundef, v;
-    VALUE num;
-    long i;
-
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
-       return rb_nmin_run(ary, num, 0, 1, 1);
-
-    const long n = RARRAY_LEN(ary);
-    if (rb_block_given_p()) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-           v = RARRAY_AREF(ary, i);
-           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
-               result = v;
-           }
-        }
-    }
-    else if (n > 0) {
-        result = RARRAY_AREF(ary, 0);
-        if (n > 1) {
-            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
-                return ary_max_opt_fixnum(ary, 1, result);
-            }
-            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
-                return ary_max_opt_string(ary, 1, result);
-            }
-            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
-                return ary_max_opt_float(ary, 1, result);
-            }
-            else {
-                return ary_max_generic(ary, 1, result);
-            }
-        }
-    }
-    if (UNDEF_P(result)) return Qnil;
-    return result;
-}
-
-static VALUE
-ary_min_generic(VALUE ary, long i, VALUE vmin)
-{
-    RUBY_ASSERT(i > 0 && i < RARRAY_LEN(ary));
-
-    VALUE v;
-    for (; i < RARRAY_LEN(ary); ++i) {
-        v = RARRAY_AREF(ary, i);
-
-        if (rb_cmpint(rb_funcallv(vmin, id_cmp, 1, &v), vmin, v) > 0) {
-            vmin = v;
-        }
-    }
-
-    return vmin;
-}
-
-static VALUE
-ary_min_opt_fixnum(VALUE ary, long i, VALUE vmin)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(FIXNUM_P(vmin));
-
-    VALUE a;
-    for (; i < n; ++i) {
-        a = RARRAY_AREF(ary, i);
-
-        if (FIXNUM_P(a)) {
-            if ((long)vmin > (long)a) {
-                vmin = a;
-            }
-        }
-        else {
-            return ary_min_generic(ary, i, vmin);
-        }
-    }
-
-    return vmin;
-}
-
-static VALUE
-ary_min_opt_float(VALUE ary, long i, VALUE vmin)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(RB_FLOAT_TYPE_P(vmin));
-
-    VALUE a;
-    for (; i < n; ++i) {
-        a = RARRAY_AREF(ary, i);
-
-        if (RB_FLOAT_TYPE_P(a)) {
-            if (rb_float_cmp(vmin, a) > 0) {
-                vmin = a;
-            }
-        }
-        else {
-            return ary_min_generic(ary, i, vmin);
-        }
-    }
-
-    return vmin;
-}
-
-static VALUE
-ary_min_opt_string(VALUE ary, long i, VALUE vmin)
-{
-    const long n = RARRAY_LEN(ary);
-    RUBY_ASSERT(i > 0 && i < n);
-    RUBY_ASSERT(STRING_P(vmin));
-
-    VALUE a;
-    for (; i < n; ++i) {
-        a = RARRAY_AREF(ary, i);
-
-        if (STRING_P(a)) {
-            if (rb_str_cmp(vmin, a) > 0) {
-                vmin = a;
-            }
-        }
-        else {
-            return ary_min_generic(ary, i, vmin);
-        }
-    }
-
-    return vmin;
-}
-
-/*
- *  call-seq:
- *    min -> element
- *    min(count) -> new_array
- *    min {|a, b| ... } -> element
- *    min(count) {|a, b| ... } -> new_array
- *
- *  Returns one of the following:
- *
- *  - The minimum-valued element from +self+.
- *  - A new array of minimum-valued elements from +self+.
- *
- *  Does not modify +self+.
- *
- *  With no block given, each element in +self+ must respond to method <tt>#<=></tt>
- *  with a numeric.
- *
- *  With no argument and no block, returns the element in +self+
- *  having the minimum value per method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].min # => 0
- *
- *  With non-negative numeric argument +count+ and no block,
- *  returns a new array with at most +count+ elements,
- *  in ascending order, per method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].min(3)   # => [0, 1, 2]
- *    [1, 0, 3, 2].min(3.0) # => [0, 1, 2]
- *    [1, 0, 3, 2].min(9)   # => [0, 1, 2, 3]
- *    [1, 0, 3, 2].min(0)   # => []
- *
- *  With a block given, the block must return a numeric.
- *
- *  With a block and no argument, calls the block <tt>self.size - 1</tt> times to compare elements;
- *  returns the element having the minimum value per the block:
- *
- *    ['0', '', '000', '00'].min {|a, b| a.size <=> b.size }
- *    # => ""
- *
- *  With non-negative numeric argument +count+ and a block,
- *  returns a new array with at most +count+ elements,
- *  in ascending order, per the block:
- *
- *    ['0', '', '000', '00'].min(2) {|a, b| a.size <=> b.size }
- *    # => ["", "0"]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
- */
-static VALUE
-rb_ary_min(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE result = Qundef, v;
-    VALUE num;
-    long i;
-
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
-       return rb_nmin_run(ary, num, 0, 0, 1);
-
-    const long n = RARRAY_LEN(ary);
-    if (rb_block_given_p()) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-           v = RARRAY_AREF(ary, i);
-           if (UNDEF_P(result) || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
-               result = v;
-           }
-        }
-    }
-    else if (n > 0) {
-        result = RARRAY_AREF(ary, 0);
-        if (n > 1) {
-            if (FIXNUM_P(result) && CMP_OPTIMIZABLE(INTEGER)) {
-                return ary_min_opt_fixnum(ary, 1, result);
-            }
-            else if (STRING_P(result) && CMP_OPTIMIZABLE(STRING)) {
-                return ary_min_opt_string(ary, 1, result);
-            }
-            else if (RB_FLOAT_TYPE_P(result) && CMP_OPTIMIZABLE(FLOAT)) {
-                return ary_min_opt_float(ary, 1, result);
-            }
-            else {
-                return ary_min_generic(ary, 1, result);
-            }
-        }
-    }
-    if (UNDEF_P(result)) return Qnil;
-    return result;
-}
+    hash = ary_make_hash(ary1);
 
-/*
- *  call-seq:
- *    minmax -> array
- *    minmax {|a, b| ... } -> array
- *
- *  Returns a 2-element array containing the minimum-valued and maximum-valued
- *  elements from +self+;
- *  does not modify +self+.
- *
- *  With no block given, the minimum and maximum values are determined using method <tt>#<=></tt>:
- *
- *    [1, 0, 3, 2].minmax # => [0, 3]
- *
- *  With a block given, the block must return a numeric;
- *  the block is called <tt>self.size - 1</tt> times to compare elements;
- *  returns the elements having the minimum and maximum values per the block:
- *
- *    ['0', '', '000', '00'].minmax {|a, b| a.size <=> b.size }
- *    # => ["", "000"]
- *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
- */
-static VALUE
-rb_ary_minmax(VALUE ary)
-{
-    if (rb_block_given_p()) {
-        return rb_call_super(0, NULL);
+    for (i=0; i<RARRAY_LEN(ary2); i++) {
+	VALUE elt = RARRAY_AREF(ary2, i);
+	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+	    RB_OBJ_WRITTEN(hash, Qundef, elt);
+	}
     }
-    return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+    ary3 = rb_hash_values(hash);
+    ary_recycle_hash(hash);
+    return ary3;
 }
 
 static int
@@ -6285,31 +4206,31 @@ push_value(st_data_t key, st_data_t val, st_data_t ary)
 
 /*
  *  call-seq:
- *    uniq! -> self or nil
- *    uniq! {|element| ... } -> self or nil
+ *     ary.uniq!                -> ary or nil
+ *     ary.uniq! { |item| ... } -> ary or nil
+ *
+ *  Removes duplicate elements from +self+.
+ *
+ *  If a block is given, it will use the return value of the block for
+ *  comparison.
+ *
+ *  It compares values using their #hash and #eql? methods for efficiency.
  *
- *  Removes duplicate elements from +self+, the first occurrence always being retained;
- *  returns +self+ if any elements removed, +nil+ otherwise.
+ *  +self+ is traversed in order, and the first occurrence is kept.
  *
- *  With no block given, identifies and removes elements using method <tt>eql?</tt>
- *  to compare elements:
+ *  Returns +nil+ if no changes are made (that is, no duplicates are found).
  *
- *    a = [0, 0, 1, 1, 2, 2]
- *    a.uniq! # => [0, 1, 2]
- *    a.uniq! # => nil
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq!   # => ["a", "b", "c"]
  *
- *  With a block given, calls the block for each element;
- *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
- *  to compare <i>block return values</i>;
- *  that is, an element is a duplicate if its block return value
- *  is the same as that of a previous element:
+ *     b = [ "a", "b", "c" ]
+ *     b.uniq!   # => nil
  *
- *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
- *    a.uniq! {|element| element.size } # => ["a", "aa", "aaa"]
- *    a.uniq! {|element| element.size } # => nil
+ *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
  *
- *  Related: see {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
  */
+
 static VALUE
 rb_ary_uniq_bang(VALUE ary)
 {
@@ -6320,50 +4241,46 @@ rb_ary_uniq_bang(VALUE ary)
     if (RARRAY_LEN(ary) <= 1)
         return Qnil;
     if (rb_block_given_p())
-        hash = ary_make_hash_by(ary);
+	hash = ary_make_hash_by(ary);
     else
-        hash = ary_make_hash(ary);
+	hash = ary_make_hash(ary);
 
     hash_size = RHASH_SIZE(hash);
     if (RARRAY_LEN(ary) == hash_size) {
-        return Qnil;
+	return Qnil;
     }
     rb_ary_modify_check(ary);
     ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary)) {
-        rb_ary_unshare(ary);
-        FL_SET_EMBED(ary);
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+	FL_SET_EMBED(ary);
     }
     ary_resize_capa(ary, hash_size);
-    rb_hash_foreach(hash, push_value, ary);
+    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+    ary_recycle_hash(hash);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *    uniq -> new_array
- *    uniq {|element| ... } -> new_array
+ *     ary.uniq                -> new_ary
+ *     ary.uniq { |item| ... } -> new_ary
+ *
+ *  Returns a new array by removing duplicate values in +self+.
  *
- *  Returns a new array containing those elements from +self+ that are not duplicates,
- *  the first occurrence always being retained.
+ *  If a block is given, it will use the return value of the block for comparison.
  *
- *  With no block given, identifies and omits duplicate elements using method <tt>eql?</tt>
- *  to compare elements:
+ *  It compares values using their #hash and #eql? methods for efficiency.
  *
- *    a = [0, 0, 1, 1, 2, 2]
- *    a.uniq # => [0, 1, 2]
+ *  +self+ is traversed in order, and the first occurrence is kept.
  *
- *  With a block given, calls the block for each element;
- *  identifies and omits "duplicate" elements using method <tt>eql?</tt>
- *  to compare <i>block return values</i>;
- *  that is, an element is a duplicate if its block return value
- *  is the same as that of a previous element:
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq   # => ["a", "b", "c"]
  *
- *    a = ['a', 'aa', 'aaa', 'b', 'bb', 'bbb']
- *    a.uniq {|element| element.size } # => ["a", "aa", "aaa"]
+ *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
  *
- *  Related: {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -6371,36 +4288,32 @@ rb_ary_uniq(VALUE ary)
 {
     VALUE hash, uniq;
 
-    if (RARRAY_LEN(ary) <= 1) {
-        hash = 0;
-        uniq = rb_ary_dup(ary);
-    }
-    else if (rb_block_given_p()) {
-        hash = ary_make_hash_by(ary);
-        uniq = rb_hash_values(hash);
+    if (RARRAY_LEN(ary) <= 1)
+        return rb_ary_dup(ary);
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	uniq = rb_hash_values(hash);
     }
     else {
-        hash = ary_make_hash(ary);
-        uniq = rb_hash_values(hash);
+	hash = ary_make_hash(ary);
+	uniq = rb_hash_values(hash);
     }
+    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
+    ary_recycle_hash(hash);
 
     return uniq;
 }
 
 /*
  *  call-seq:
- *    compact! -> self or nil
+ *     ary.compact!    -> ary  or  nil
  *
- *  Removes all +nil+ elements from +self+;
- *  Returns +self+ if any elements are removed, +nil+ otherwise:
+ *  Removes +nil+ elements from the array.
  *
- *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
- *    a.compact! # => [0, false, "", [], {}]
- *    a          # => [0, false, "", [], {}]
- *    a.compact! # => nil
+ *  Returns +nil+ if no changes were made, otherwise returns the array.
  *
- *  Related: Array#compact;
- *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
+ *     [ "a", "b", "c" ].compact!           #=> nil
  */
 
 static VALUE
@@ -6414,12 +4327,12 @@ rb_ary_compact_bang(VALUE ary)
     end = p + RARRAY_LEN(ary);
 
     while (t < end) {
-        if (NIL_P(*t)) t++;
-        else *p++ = *t++;
+	if (NIL_P(*t)) t++;
+	else *p++ = *t++;
     }
     n = p - RARRAY_CONST_PTR(ary);
     if (RARRAY_LEN(ary) == n) {
-        return Qnil;
+	return Qnil;
     }
     ary_resize_smaller(ary, n);
 
@@ -6428,16 +4341,12 @@ rb_ary_compact_bang(VALUE ary)
 
 /*
  *  call-seq:
- *    compact -> new_array
- *
- *  Returns a new array containing only the non-+nil+ elements from +self+;
- *  element order is preserved:
+ *     ary.compact     -> new_ary
  *
- *    a = [nil, 0, nil, false, nil, '', nil, [], nil, {}]
- *    a.compact # => [0, false, "", [], {}]
+ *  Returns a copy of +self+ with all +nil+ elements removed.
  *
- *  Related: Array#compact!;
- *  see also {Methods for Deleting}[rdoc-ref:Array@Methods+for+Deleting].
+ *     [ "a", nil, "b", nil, "c", nil ].compact
+ *                       #=> [ "a", "b", "c" ]
  */
 
 static VALUE
@@ -6450,29 +4359,23 @@ rb_ary_compact(VALUE ary)
 
 /*
  *  call-seq:
- *    count -> integer
- *    count(object) -> integer
- *    count {|element| ... } -> integer
+ *     ary.count                   -> int
+ *     ary.count(obj)              -> int
+ *     ary.count { |item| block }  -> int
  *
- *  Returns a count of specified elements.
+ *  Returns the number of elements.
  *
- *  With no argument and no block, returns the count of all elements:
+ *  If an argument is given, counts the number of elements which equal +obj+
+ *  using <code>==</code>.
  *
- *    [0, :one, 'two', 3, 3.0].count # => 5
+ *  If a block is given, counts the number of elements for which the block
+ *  returns a true value.
  *
- *  With argument +object+ given, returns the count of elements <tt>==</tt> to +object+:
+ *     ary = [1, 2, 4, 2]
+ *     ary.count                  #=> 4
+ *     ary.count(2)               #=> 2
+ *     ary.count { |x| x%2 == 0 } #=> 3
  *
- *    [0, :one, 'two', 3, 3.0].count(3) # => 2
- *
- *  With no argument and a block given, calls the block with each element;
- *  returns the count of elements for which the block returns a truthy value:
- *
- *    [0, 1, 2, 3].count {|element| element > 1 } # => 2
- *
- *  With argument +object+ and a block given, issues a warning, ignores the block,
- *  and returns the count of elements <tt>==</tt> to +object+.
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
  */
 
 static VALUE
@@ -6480,149 +4383,108 @@ rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
     long i, n = 0;
 
-    if (rb_check_arity(argc, 0, 1) == 0) {
-        VALUE v;
+    if (argc == 0) {
+	VALUE v;
 
-        if (!rb_block_given_p())
-            return LONG2NUM(RARRAY_LEN(ary));
+	if (!rb_block_given_p())
+	    return LONG2NUM(RARRAY_LEN(ary));
 
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            v = RARRAY_AREF(ary, i);
-            if (RTEST(rb_yield(v))) n++;
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    v = RARRAY_AREF(ary, i);
+	    if (RTEST(rb_yield(v))) n++;
+	}
     }
     else {
-        VALUE obj = argv[0];
+	VALUE obj;
 
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
-        }
+	rb_scan_args(argc, argv, "1", &obj);
+	if (rb_block_given_p()) {
+	    rb_warn("given block not used");
+	}
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+	}
     }
 
     return LONG2NUM(n);
 }
 
 static VALUE
-flatten(VALUE ary, int level)
+flatten(VALUE ary, int level, int *modified)
 {
-    long i;
-    VALUE stack, result, tmp = 0, elt;
-    VALUE memo = Qfalse;
-
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        elt = RARRAY_AREF(ary, i);
-        tmp = rb_check_array_type(elt);
-        if (!NIL_P(tmp)) {
-            break;
-        }
-    }
-    if (i == RARRAY_LEN(ary)) {
-        return ary;
-    }
-
-    result = ary_new(0, RARRAY_LEN(ary));
-    ary_memcpy(result, 0, i, RARRAY_CONST_PTR(ary));
-    ARY_SET_LEN(result, i);
+    long i = 0;
+    VALUE stack, result, tmp, elt;
+    st_table *memo;
+    st_data_t id;
 
     stack = ary_new(0, ARY_DEFAULT_SIZE);
-    rb_ary_push(stack, ary);
-    rb_ary_push(stack, LONG2NUM(i + 1));
-
-    if (level < 0) {
-        memo = rb_obj_hide(rb_ident_hash_new());
-        rb_hash_aset(memo, ary, Qtrue);
-        rb_hash_aset(memo, tmp, Qtrue);
-    }
-
-    ary = tmp;
-    i = 0;
+    result = ary_new(0, RARRAY_LEN(ary));
+    memo = st_init_numtable();
+    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+    *modified = 0;
 
     while (1) {
-        while (i < RARRAY_LEN(ary)) {
-            elt = RARRAY_AREF(ary, i++);
-            if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
-                rb_ary_push(result, elt);
-                continue;
-            }
-            tmp = rb_check_array_type(elt);
-            if (RBASIC(result)->klass) {
-                if (RTEST(memo)) {
-                    rb_hash_clear(memo);
-                }
-                rb_raise(rb_eRuntimeError, "flatten reentered");
-            }
-            if (NIL_P(tmp)) {
-                rb_ary_push(result, elt);
-            }
-            else {
-                if (memo) {
-                    if (rb_hash_aref(memo, tmp) == Qtrue) {
-                        rb_hash_clear(memo);
-                        rb_raise(rb_eArgError, "tried to flatten recursive array");
-                    }
-                    rb_hash_aset(memo, tmp, Qtrue);
-                }
-                rb_ary_push(stack, ary);
-                rb_ary_push(stack, LONG2NUM(i));
-                ary = tmp;
-                i = 0;
-            }
-        }
-        if (RARRAY_LEN(stack) == 0) {
-            break;
-        }
-        if (memo) {
-            rb_hash_delete(memo, ary);
-        }
-        tmp = rb_ary_pop(stack);
-        i = NUM2LONG(tmp);
-        ary = rb_ary_pop(stack);
-    }
-
-    if (memo) {
-        rb_hash_clear(memo);
-    }
-
-    RBASIC_SET_CLASS(result, rb_cArray);
+	while (i < RARRAY_LEN(ary)) {
+	    elt = RARRAY_AREF(ary, i++);
+	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+		rb_ary_push(result, elt);
+		continue;
+	    }
+	    tmp = rb_check_array_type(elt);
+	    if (RBASIC(result)->klass) {
+		rb_raise(rb_eRuntimeError, "flatten reentered");
+	    }
+	    if (NIL_P(tmp)) {
+		rb_ary_push(result, elt);
+	    }
+	    else {
+		*modified = 1;
+		id = (st_data_t)tmp;
+		if (st_lookup(memo, id, 0)) {
+		    st_free_table(memo);
+		    rb_raise(rb_eArgError, "tried to flatten recursive array");
+		}
+		st_insert(memo, id, (st_data_t)Qtrue);
+		rb_ary_push(stack, ary);
+		rb_ary_push(stack, LONG2NUM(i));
+		ary = tmp;
+		i = 0;
+	    }
+	}
+	if (RARRAY_LEN(stack) == 0) {
+	    break;
+	}
+	id = (st_data_t)ary;
+	st_delete(memo, &id, 0);
+	tmp = rb_ary_pop(stack);
+	i = NUM2LONG(tmp);
+	ary = rb_ary_pop(stack);
+    }
+
+    st_free_table(memo);
+
+    RBASIC_SET_CLASS(result, rb_obj_class(ary));
     return result;
 }
 
 /*
  *  call-seq:
- *    flatten!(depth = nil) -> self or nil
+ *     ary.flatten!        -> ary or nil
+ *     ary.flatten!(level) -> ary or nil
  *
- *  Returns +self+ as a recursively flattening of +self+ to +depth+ levels of recursion;
- *  +depth+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
- *  or +nil+.
- *  At each level of recursion:
+ *  Flattens +self+ in place.
  *
- *  - Each element that is an array is "flattened"
- *    (that is, replaced by its individual array elements).
- *  - Each element that is not an array is unchanged
- *    (even if the element is an object that has instance method +flatten+).
+ *  Returns +nil+ if no modifications were made (i.e., the array contains no
+ *  subarrays.)
  *
- *  Returns +nil+ if no elements were flattened.
+ *  The optional +level+ argument determines the level of recursion to flatten.
  *
- *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
- *
- *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
- *    a                   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(1)   # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *
- *  With +nil+ or negative argument +depth+, flattens all levels:
- *
- *    a.dup.flatten!     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.dup.flatten!(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *
- *  Related: Array#flatten;
- *  see also {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!   #=> [1, 2, 3, 4, 5]
+ *     a.flatten!   #=> nil
+ *     a            #=> [1, 2, 3, 4, 5]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
@@ -6631,16 +4493,17 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
     int mod = 0, level = -1;
     VALUE result, lv;
 
-    lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
+    rb_scan_args(argc, argv, "01", &lv);
     rb_ary_modify_check(ary);
     if (!NIL_P(lv)) level = NUM2INT(lv);
     if (level == 0) return Qnil;
 
-    result = flatten(ary, level);
-    if (result == ary) {
-        return Qnil;
+    result = flatten(ary, level, &mod);
+    if (mod == 0) {
+	ary_discard(result);
+	return Qnil;
     }
-    if (!(mod = ARY_EMBED_P(result))) rb_ary_freeze(result);
+    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
     rb_ary_replace(ary, result);
     if (mod) ARY_SET_EMBED_LEN(result, 0);
 
@@ -6649,221 +4512,246 @@ rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
 
 /*
  *  call-seq:
- *    flatten(depth = nil) -> new_array
- *
- *  Returns a new array that is a recursive flattening of +self+
- *  to +depth+ levels of recursion;
- *  +depth+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
- *  or +nil+.
- *  At each level of recursion:
- *
- *  - Each element that is an array is "flattened"
- *    (that is, replaced by its individual array elements).
- *  - Each element that is not an array is unchanged
- *    (even if the element is an object that has instance method +flatten+).
+ *     ary.flatten -> new_ary
+ *     ary.flatten(level) -> new_ary
  *
- *  With non-negative integer argument +depth+, flattens recursively through +depth+ levels:
+ *  Returns a new array that is a one-dimensional flattening of +self+
+ *  (recursively).
  *
- *    a = [ 0, [ 1, [2, 3], 4 ], 5, {foo: 0}, Set.new([6, 7]) ]
- *    a              # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(0)   # => [0, [1, [2, 3], 4], 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(1  ) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(1.1) # => [0, 1, [2, 3], 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(2)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(3)   # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
+ *  That is, for every element that is an array, extract its elements into
+ *  the new array.
  *
- *  With +nil+ or negative +depth+, flattens all levels.
+ *  The optional +level+ argument determines the level of recursion to
+ *  flatten.
  *
- *    a.flatten     # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *    a.flatten(-1) # => [0, 1, 2, 3, 4, 5, {:foo=>0}, #<Set: {6, 7}>]
- *
- *  Related: Array#flatten!;
- *  see also {Methods for Converting}[rdoc-ref:Array@Methods+for+Converting].
+ *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
+ *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
+ *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
 rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
 {
-    int level = -1;
-    VALUE result;
+    int mod = 0, level = -1;
+    VALUE result, lv;
 
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
-        level = NUM2INT(argv[0]);
-        if (level == 0) return ary_make_shared_copy(ary);
-    }
+    rb_scan_args(argc, argv, "01", &lv);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return ary_make_shared_copy(ary);
 
-    result = flatten(ary, level);
-    if (result == ary) {
-        result = ary_make_shared_copy(ary);
-    }
+    result = flatten(ary, level, &mod);
+    OBJ_INFECT(result, ary);
 
     return result;
 }
 
+#define OPTHASH_GIVEN_P(opts) \
+    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static ID id_random;
+
 #define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
 
+/*
+ *  call-seq:
+ *     ary.shuffle!              -> ary
+ *     ary.shuffle!(random: rng) -> ary
+ *
+ *  Shuffles elements in +self+ in place.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle!                #=> [2, 3, 1]
+ *     a                         #=> [2, 3, 1]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
 static VALUE
-rb_ary_shuffle_bang(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
 {
+    VALUE opts, randgen = rb_cRandom;
     long i, len;
 
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
+    }
+    rb_check_arity(argc, 0, 0);
     rb_ary_modify(ary);
     i = len = RARRAY_LEN(ary);
     RARRAY_PTR_USE(ary, ptr, {
-        while (i > 1) {
-            long j = RAND_UPTO(i);
-            VALUE tmp;
-            if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
-                rb_raise(rb_eRuntimeError, "modified during shuffle");
-            }
-            tmp = ptr[--i];
-            ptr[i] = ptr[j];
-            ptr[j] = tmp;
-        }
+	while (i) {
+	    long j = RAND_UPTO(i);
+	    VALUE tmp;
+	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+		rb_raise(rb_eRuntimeError, "modified during shuffle");
+	    }
+	    tmp = ptr[--i];
+	    ptr[i] = ptr[j];
+	    ptr[j] = tmp;
+	}
     }); /* WB: no new reference */
     return ary;
 }
 
+
+/*
+ *  call-seq:
+ *     ary.shuffle              -> new_ary
+ *     ary.shuffle(random: rng) -> new_ary
+ *
+ *  Returns a new array with elements of +self+ shuffled.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle                 #=> [2, 3, 1]
+ *     a                         #=> [1, 2, 3]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
 static VALUE
-rb_ary_shuffle(rb_execution_context_t *ec, VALUE ary, VALUE randgen)
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
 {
     ary = rb_ary_dup(ary);
-    rb_ary_shuffle_bang(ec, ary, randgen);
+    rb_ary_shuffle_bang(argc, argv, ary);
     return ary;
 }
 
-static const rb_data_type_t ary_sample_memo_type = {
-    .wrap_struct_name = "ary_sample_memo",
-    .function = {
-        .dfree = (RUBY_DATA_FUNC)st_free_table,
-    },
-    .flags = RUBY_TYPED_WB_PROTECTED | RUBY_TYPED_FREE_IMMEDIATELY
-};
+
+/*
+ *  call-seq:
+ *     ary.sample                  -> obj
+ *     ary.sample(random: rng)     -> obj
+ *     ary.sample(n)               -> new_ary
+ *     ary.sample(n, random: rng)  -> new_ary
+ *
+ *  Choose a random element or +n+ random elements from the array.
+ *
+ *  The elements are chosen by using random and unique indices into the array
+ *  in order to ensure that an element doesn't repeat itself unless the array
+ *  already contained duplicate elements.
+ *
+ *  If the array is empty the first form returns +nil+ and the second form
+ *  returns an empty array.
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+ *     a.sample         #=> 7
+ *     a.sample(4)      #=> [6, 4, 2, 5]
+ */
+
 
 static VALUE
-ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE to_array)
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE result;
+    VALUE nv, result;
+    VALUE opts, randgen = rb_cRandom;
     long n, len, i, j, k, idx[10];
     long rnds[numberof(idx)];
-    long memo_threshold;
 
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
+    }
     len = RARRAY_LEN(ary);
-    if (!to_array) {
-        if (len < 2)
-            i = 0;
-        else
-            i = RAND_UPTO(len);
+    if (argc == 0) {
+	if (len < 2)
+	    i = 0;
+	else
+	    i = RAND_UPTO(len);
 
-        return rb_ary_elt(ary, i);
+	return rb_ary_elt(ary, i);
     }
+    rb_scan_args(argc, argv, "1", &nv);
     n = NUM2LONG(nv);
     if (n < 0) rb_raise(rb_eArgError, "negative sample number");
     if (n > len) n = len;
     if (n <= numberof(idx)) {
-        for (i = 0; i < n; ++i) {
-            rnds[i] = RAND_UPTO(len - i);
-        }
+	for (i = 0; i < n; ++i) {
+	    rnds[i] = RAND_UPTO(len - i);
+	}
     }
     k = len;
     len = RARRAY_LEN(ary);
     if (len < k && n <= numberof(idx)) {
-        for (i = 0; i < n; ++i) {
-            if (rnds[i] >= len) return rb_ary_new_capa(0);
-        }
+	for (i = 0; i < n; ++i) {
+	    if (rnds[i] >= len) return rb_ary_new_capa(0);
+	}
     }
     if (n > len) n = len;
     switch (n) {
       case 0:
-        return rb_ary_new_capa(0);
+	return rb_ary_new_capa(0);
       case 1:
-        i = rnds[0];
-        return rb_ary_new_from_args(1, RARRAY_AREF(ary, i));
+	i = rnds[0];
+	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
       case 2:
-        i = rnds[0];
-        j = rnds[1];
-        if (j >= i) j++;
-        return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+	i = rnds[0];
+	j = rnds[1];
+	if (j >= i) j++;
+	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
       case 3:
-        i = rnds[0];
-        j = rnds[1];
-        k = rnds[2];
-        {
-            long l = j, g = i;
-            if (j >= i) l = i, g = ++j;
-            if (k >= l && (++k >= g)) ++k;
-        }
-        return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+	i = rnds[0];
+	j = rnds[1];
+	k = rnds[2];
+	{
+	    long l = j, g = i;
+	    if (j >= i) l = i, g = ++j;
+	    if (k >= l && (++k >= g)) ++k;
+	}
+	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
     }
-    memo_threshold =
-        len < 2560 ? len / 128 :
-        len < 5120 ? len / 64 :
-        len < 10240 ? len / 32 :
-        len / 16;
     if (n <= numberof(idx)) {
-        long sorted[numberof(idx)];
-        sorted[0] = idx[0] = rnds[0];
-        for (i=1; i<n; i++) {
-            k = rnds[i];
-            for (j = 0; j < i; ++j) {
-                if (k < sorted[j]) break;
-                ++k;
-            }
-            memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
-            sorted[j] = idx[i] = k;
-        }
-        result = rb_ary_new_capa(n);
-        RARRAY_PTR_USE(result, ptr_result, {
-            for (i=0; i<n; i++) {
-                ptr_result[i] = RARRAY_AREF(ary, idx[i]);
-            }
-        });
-    }
-    else if (n <= memo_threshold / 2) {
-        long max_idx = 0;
-        VALUE vmemo = TypedData_Wrap_Struct(0, &ary_sample_memo_type, 0);
-        st_table *memo = st_init_numtable_with_size(n);
-        RTYPEDDATA_DATA(vmemo) = memo;
-        result = rb_ary_new_capa(n);
-        RARRAY_PTR_USE(result, ptr_result, {
-            for (i=0; i<n; i++) {
-                long r = RAND_UPTO(len-i) + i;
-                ptr_result[i] = r;
-                if (r > max_idx) max_idx = r;
-            }
-            len = RARRAY_LEN(ary);
-            if (len <= max_idx) n = 0;
-            else if (n > len) n = len;
-            RARRAY_PTR_USE(ary, ptr_ary, {
-                for (i=0; i<n; i++) {
-                    long j2 = j = ptr_result[i];
-                    long i2 = i;
-                    st_data_t value;
-                    if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
-                    if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
-                    st_insert(memo, (st_data_t)j, (st_data_t)i2);
-                    ptr_result[i] = ptr_ary[j2];
-                }
-            });
-        });
-        RTYPEDDATA_DATA(vmemo) = 0;
-        st_free_table(memo);
-        RB_GC_GUARD(vmemo);
+	long sorted[numberof(idx)];
+	sorted[0] = idx[0] = rnds[0];
+	for (i=1; i<n; i++) {
+	    k = rnds[i];
+	    for (j = 0; j < i; ++j) {
+		if (k < sorted[j]) break;
+		++k;
+	    }
+	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+	    sorted[j] = idx[i] = k;
+	}
+	result = rb_ary_new_capa(n);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+	    }
+	});
     }
     else {
-        result = rb_ary_dup(ary);
-        RBASIC_CLEAR_CLASS(result);
-        RB_GC_GUARD(ary);
-        RARRAY_PTR_USE(result, ptr_result, {
-            for (i=0; i<n; i++) {
-                j = RAND_UPTO(len-i) + i;
-                nv = ptr_result[j];
-                ptr_result[j] = ptr_result[i];
-                ptr_result[i] = nv;
-            }
-        });
-        RBASIC_SET_CLASS_RAW(result, rb_cArray);
+	result = rb_ary_dup(ary);
+	RBASIC_CLEAR_CLASS(result);
+	RB_GC_GUARD(ary);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		j = RAND_UPTO(len-i) + i;
+		nv = ptr_result[j];
+		ptr_result[j] = ptr_result[i];
+		ptr_result[i] = nv;
+	    }
+	});
+	RBASIC_SET_CLASS_RAW(result, rb_cArray);
     }
     ARY_SET_LEN(result, n);
 
@@ -6871,79 +4759,55 @@ ary_sample(rb_execution_context_t *ec, VALUE ary, VALUE randgen, VALUE nv, VALUE
 }
 
 static VALUE
-ary_sized_alloc(rb_execution_context_t *ec, VALUE self)
-{
-    return rb_ary_new2(RARRAY_LEN(self));
-}
-
-static VALUE
-ary_sample0(rb_execution_context_t *ec, VALUE ary)
-{
-    return ary_sample(ec, ary, rb_cRandom, Qfalse, Qfalse);
-}
-
-static VALUE
 rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
 {
     long mul;
     VALUE n = Qnil;
     if (args && (RARRAY_LEN(args) > 0)) {
-        n = RARRAY_AREF(args, 0);
+	n = RARRAY_AREF(args, 0);
     }
     if (RARRAY_LEN(self) == 0) return INT2FIX(0);
-    if (NIL_P(n)) return DBL2NUM(HUGE_VAL);
+    if (n == Qnil) return DBL2NUM(INFINITY);
     mul = NUM2LONG(n);
     if (mul <= 0) return INT2FIX(0);
     n = LONG2FIX(mul);
-    return rb_fix_mul_fix(rb_ary_length(self), n);
+    return rb_funcallv(rb_ary_length(self), '*', 1, &n);
 }
 
 /*
  *  call-seq:
- *    cycle(count = nil) {|element| ... } -> nil
- *    cycle(count = nil) -> new_enumerator
- *
- *  With a block given, may call the block, depending on the value of argument +count+;
- *  +count+ must be an
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects],
- *  or +nil+.
+ *     ary.cycle(n=nil) { |obj| block }  -> nil
+ *     ary.cycle(n=nil)                  -> Enumerator
  *
- *  When +count+ is positive,
- *  calls the block with each element, then does so repeatedly,
- *  until it has done so +count+ times; returns +nil+:
+ *  Calls the given block for each element +n+ times or forever if +nil+ is
+ *  given.
  *
- *    output = []
- *    [0, 1].cycle(2) {|element| output.push(element) } # => nil
- *    output # => [0, 1, 0, 1]
+ *  Does nothing if a non-positive number is given or the array is empty.
  *
- *  When +count+ is zero or negative, does not call the block:
+ *  Returns +nil+ if the loop has finished without getting interrupted.
  *
- *    [0, 1].cycle(0) {|element| fail 'Cannot happen' }  # => nil
- *    [0, 1].cycle(-1) {|element| fail 'Cannot happen' } # => nil
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  When +count+ is +nil+, cycles forever:
+ *     a = ["a", "b", "c"]
+ *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
+ *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
  *
- *    # Prints 0 and 1 forever.
- *    [0, 1].cycle {|element| puts element }
- *    [0, 1].cycle(nil) {|element| puts element }
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
+
 static VALUE
 rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
 {
     long n, i;
+    VALUE nv = Qnil;
 
-    rb_check_arity(argc, 0, 1);
+    rb_scan_args(argc, argv, "01", &nv);
 
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
-    if (argc == 0 || NIL_P(argv[0])) {
+    if (NIL_P(nv)) {
         n = -1;
     }
     else {
-        n = NUM2LONG(argv[0]);
+        n = NUM2LONG(nv);
         if (n <= 0) return Qnil;
     }
 
@@ -6955,6 +4819,11 @@ rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
     return Qnil;
 }
 
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
+
 /*
  * Build a ruby array of the corresponding values and yield it to the
  * associated block.
@@ -6964,9 +4833,11 @@ static int
 yield_indexed_values(const VALUE values, const long r, const long *const p)
 {
     const VALUE result = rb_ary_new2(r);
+    VALUE *const result_array = RARRAY_PTR(result);
+    const VALUE *const values_array = RARRAY_CONST_PTR(values);
     long i;
 
-    for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
+    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
     ARY_SET_LEN(result, r);
     rb_yield(result);
     return !RBASIC(values)->klass;
@@ -6975,8 +4846,8 @@ yield_indexed_values(const VALUE values, const long r, const long *const p)
 /*
  * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
  *
- * When we have a complete permutation of array indices, copy the values
- * at those indices into a new array and yield that array.
+ * When we have a complete permutation of array indexes, copy the values
+ * at those indexes into a new array and yield that array.
  *
  * n: the size of the set
  * r: the number of elements in each permutation
@@ -6990,52 +4861,46 @@ permute0(const long n, const long r, long *const p, char *const used, const VALU
     long i = 0, index = 0;
 
     for (;;) {
-        const char *const unused = memchr(&used[i], 0, n-i);
-        if (!unused) {
-            if (!index) break;
-            i = p[--index];                /* pop index */
-            used[i++] = 0;                 /* index unused */
-        }
-        else {
-            i = unused - used;
-            p[index] = i;
-            used[i] = 1;                   /* mark index used */
-            ++index;
-            if (index < r-1) {             /* if not done yet */
-                p[index] = i = 0;
-                continue;
-            }
-            for (i = 0; i < n; ++i) {
-                if (used[i]) continue;
-                p[index] = i;
-                if (!yield_indexed_values(values, r, p)) {
-                    rb_raise(rb_eRuntimeError, "permute reentered");
-                }
-            }
-            i = p[--index];                /* pop index */
-            used[i] = 0;                   /* index unused */
-            p[index] = ++i;
-        }
+	const char *const unused = memchr(&used[i], 0, n-i);
+	if (!unused) {
+	    if (!index) break;
+	    i = p[--index];                /* pop index */
+	    used[i++] = 0;                 /* index unused */
+	}
+	else {
+	    i = unused - used;
+	    p[index] = i;
+	    used[i] = 1;                   /* mark index used */
+	    ++index;
+	    if (index < r-1) {             /* if not done yet */
+		p[index] = i = 0;
+		continue;
+	    }
+	    for (i = 0; i < n; ++i) {
+		if (used[i]) continue;
+		p[index] = i;
+		if (!yield_indexed_values(values, r, p)) {
+		    rb_raise(rb_eRuntimeError, "permute reentered");
+		}
+	    }
+	    i = p[--index];                /* pop index */
+	    used[i] = 0;                   /* index unused */
+	    p[index] = ++i;
+	}
     }
 }
 
 /*
  * Returns the product of from, from-1, ..., from - how_many + 1.
- * https://en.wikipedia.org/wiki/Pochhammer_symbol
+ * http://en.wikipedia.org/wiki/Pochhammer_symbol
  */
 static VALUE
 descending_factorial(long from, long how_many)
 {
-    VALUE cnt;
-    if (how_many > 0) {
-        cnt = LONG2FIX(from);
-        while (--how_many > 0) {
-            long v = --from;
-            cnt = rb_int_mul(cnt, LONG2FIX(v));
-        }
-    }
-    else {
-        cnt = LONG2FIX(how_many == 0);
+    VALUE cnt = LONG2FIX(how_many >= 0);
+    while (how_many-- > 0) {
+	VALUE v = LONG2FIX(from--);
+	cnt = rb_funcallv(cnt, '*', 1, &v);
     }
     return cnt;
 }
@@ -7043,23 +4908,16 @@ descending_factorial(long from, long how_many)
 static VALUE
 binomial_coefficient(long comb, long size)
 {
-    VALUE r;
-    long i;
+    VALUE r, v;
     if (comb > size-comb) {
-        comb = size-comb;
+	comb = size-comb;
     }
     if (comb < 0) {
-        return LONG2FIX(0);
-    }
-    else if (comb == 0) {
-        return LONG2FIX(1);
+	return LONG2FIX(0);
     }
-    r = LONG2FIX(size);
-    for (i = 1; i < comb; ++i) {
-        r = rb_int_mul(r, LONG2FIX(size - i));
-        r = rb_int_idiv(r, LONG2FIX(i + 1));
-    }
-    return r;
+    r = descending_factorial(size, comb);
+    v = descending_factorial(comb, comb);
+    return rb_funcallv(r, id_div, 1, &v);
 }
 
 static VALUE
@@ -7073,80 +4931,66 @@ rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *    permutation(count = self.size) {|permutation| ... } -> self
- *    permutation(count = self.size) -> new_enumerator
- *
- *  Iterates over permutations of the elements of +self+;
- *  the order of permutations is indeterminate.
- *
- *  With a block and an in-range positive integer argument +count+ (<tt>0 < count <= self.size</tt>) given,
- *  calls the block with each permutation of +self+ of size +count+;
- *  returns +self+:
- *
- *    a = [0, 1, 2]
- *    perms = []
- *    a.permutation(1) {|perm| perms.push(perm) }
- *    perms # => [[0], [1], [2]]
- *
- *    perms = []
- *    a.permutation(2) {|perm| perms.push(perm) }
- *    perms # => [[0, 1], [0, 2], [1, 0], [1, 2], [2, 0], [2, 1]]
+ *     ary.permutation { |p| block }          -> ary
+ *     ary.permutation                        -> Enumerator
+ *     ary.permutation(n) { |p| block }       -> ary
+ *     ary.permutation(n)                     -> Enumerator
  *
- *    perms = []
- *    a.permutation(3) {|perm| perms.push(perm) }
- *    perms # => [[0, 1, 2], [0, 2, 1], [1, 0, 2], [1, 2, 0], [2, 0, 1], [2, 1, 0]]
+ * When invoked with a block, yield all permutations of length +n+ of the
+ * elements of the array, then return the array itself.
  *
- *  When +count+ is zero, calls the block once with a new empty array:
+ * If +n+ is not specified, yield all permutations of all elements.
  *
- *    perms = []
- *    a.permutation(0) {|perm| perms.push(perm) }
- *    perms # => [[]]
+ * The implementation makes no guarantees about the order in which the
+ * permutations are yielded.
  *
- *  When +count+ is out of range (negative or larger than <tt>self.size</tt>),
- *  does not call the block:
+ * If no block is given, an Enumerator is returned instead.
  *
- *    a.permutation(-1) {|permutation| fail 'Cannot happen' }
- *    a.permutation(4) {|permutation| fail 'Cannot happen' }
+ * Examples:
  *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
+ *   a = [1, 2, 3]
+ *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(1).to_a #=> [[1],[2],[3]]
+ *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
+ *   a.permutation(4).to_a #=> []   # no permutations of length 4
  */
 
 static VALUE
 rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
 {
+    VALUE num;
     long r, n, i;
 
     n = RARRAY_LEN(ary);                  /* Array length */
     RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
-    r = n;
-    if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
-        r = NUM2LONG(argv[0]);            /* Permutation size from argument */
+    rb_scan_args(argc, argv, "01", &num);
+    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
 
     if (r < 0 || n < r) {
-        /* no permutations: yield nothing */
+	/* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else {             /* this is the general case */
-        volatile VALUE t0;
-        long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
-        char *used = (char*)(p + r);
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        RBASIC_CLEAR_CLASS(ary0);
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+	char *used = (char*)(p + r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
 
-        MEMZERO(used, char, n); /* initialize array */
+	MEMZERO(used, char, n); /* initialize array */
 
-        permute0(n, r, p, used, ary0); /* compute and yield permutations */
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	permute0(n, r, p, used, ary0); /* compute and yield permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -7159,16 +5003,16 @@ combinate0(const long len, const long n, long *const stack, const VALUE values)
     MEMZERO(stack+1, long, n);
     stack[0] = -1;
     for (;;) {
-        for (lev++; lev < n; lev++) {
-            stack[lev+1] = stack[lev]+1;
-        }
-        if (!yield_indexed_values(values, n, stack+1)) {
-            rb_raise(rb_eRuntimeError, "combination reentered");
-        }
-        do {
-            if (lev == 0) return;
-            stack[lev--]++;
-        } while (stack[lev+1]+n == len+lev+1);
+	for (lev++; lev < n; lev++) {
+	    stack[lev+1] = stack[lev]+1;
+	}
+	if (!yield_indexed_values(values, n, stack+1)) {
+	    rb_raise(rb_eRuntimeError, "combination reentered");
+	}
+	do {
+	    if (lev == 0) return;
+	    stack[lev--]++;
+	} while (stack[lev+1]+n == len+lev+1);
     }
 }
 
@@ -7183,46 +5027,27 @@ rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
 
 /*
  *  call-seq:
- *    combination(count) {|element| ... } -> self
- *    combination(count) -> new_enumerator
- *
- *  When a block and a positive
- *  {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]
- *  argument +count+ (<tt>0 < count <= self.size</tt>)
- *  are given, calls the block with each combination of +self+ of size +count+;
- *  returns +self+:
- *
- *    a = %w[a b c]                                   # => ["a", "b", "c"]
- *    a.combination(2) {|combination| p combination } # => ["a", "b", "c"]
+ *     ary.combination(n) { |c| block }    -> ary
+ *     ary.combination(n)                  -> Enumerator
  *
- *  Output:
+ * When invoked with a block, yields all combinations of length +n+ of elements
+ * from the array and then returns the array itself.
  *
- *    ["a", "b"]
- *    ["a", "c"]
- *    ["b", "c"]
+ * The implementation makes no guarantees about the order in which the
+ * combinations are yielded.
  *
- *  The order of the yielded combinations is not guaranteed.
+ * If no block is given, an Enumerator is returned instead.
  *
- *  When +count+ is zero, calls the block once with a new empty array:
+ * Examples:
  *
- *    a.combination(0) {|combination| p combination }
- *    [].combination(0) {|combination| p combination }
+ *     a = [1, 2, 3, 4]
+ *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
+ *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ *     a.combination(4).to_a  #=> [[1,2,3,4]]
+ *     a.combination(0).to_a  #=> [[]] # one combination of length 0
+ *     a.combination(5).to_a  #=> []   # no combinations of length 5
  *
- *  Output:
- *
- *    []
- *    []
- *
- *  When +count+ is negative or larger than +self.size+ and +self+ is non-empty,
- *  does not call the block:
- *
- *    a.combination(-1) {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
- *    a.combination(4)  {|combination| fail 'Cannot happen' } # => ["a", "b", "c"]
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: Array#permutation;
- *  see also {Methods for Iterating}[rdoc-ref:Array@Methods+for+Iterating].
  */
 
 static VALUE
@@ -7234,25 +5059,25 @@ rb_ary_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
     len = RARRAY_LEN(ary);
     if (n < 0 || len < n) {
-        /* yield nothing */
+	/* yield nothing */
     }
     else if (n == 0) {
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else {
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        volatile VALUE t0;
-        long *stack = ALLOCV_N(long, t0, n+1);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	volatile VALUE t0;
+	long *stack = ALLOCV_N(long, t0, n+1);
 
-        RBASIC_CLEAR_CLASS(ary0);
-        combinate0(len, n, stack, ary0);
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	RBASIC_CLEAR_CLASS(ary0);
+	combinate0(len, n, stack, ary0);
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -7261,8 +5086,8 @@ rb_ary_combination(VALUE ary, VALUE num)
  * Compute repeated permutations of +r+ elements of the set
  * <code>[0..n-1]</code>.
  *
- * When we have a complete repeated permutation of array indices, copy the
- * values at those indices into a new array and yield that array.
+ * When we have a complete repeated permutation of array indexes, copy the
+ * values at those indexes into a new array and yield that array.
  *
  * n: the size of the set
  * r: the number of elements in each permutation
@@ -7276,19 +5101,19 @@ rpermute0(const long n, const long r, long *const p, const VALUE values)
 
     p[index] = i;
     for (;;) {
-        if (++index < r-1) {
-            p[index] = i = 0;
-            continue;
-        }
-        for (i = 0; i < n; ++i) {
-            p[index] = i;
-            if (!yield_indexed_values(values, r, p)) {
-                rb_raise(rb_eRuntimeError, "repeated permute reentered");
-            }
-        }
-        do {
-            if (index <= 0) return;
-        } while ((i = ++p[--index]) >= n);
+	if (++index < r-1) {
+	    p[index] = i = 0;
+	    continue;
+	}
+	for (i = 0; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated permute reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -7297,54 +5122,39 @@ rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 {
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
+    VALUE v;
 
     if (k < 0) {
-        return LONG2FIX(0);
-    }
-    if (n <= 0) {
-        return LONG2FIX(!k);
+	return LONG2FIX(0);
     }
-    return rb_int_positive_pow(n, (unsigned long)k);
+
+    v = LONG2NUM(k);
+    return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
 }
 
 /*
  *  call-seq:
- *    repeated_permutation(size) {|permutation| ... } -> self
- *    repeated_permutation(size) -> new_enumerator
- *
- *  With a block given, calls the block with each repeated permutation of length +size+
- *  of the elements of +self+;
- *  each permutation is an array;
- *  returns +self+. The order of the permutations is indeterminate.
- *
- *  If a positive integer argument +size+ is given,
- *  calls the block with each +size+-tuple repeated permutation of the elements of +self+.
- *  The number of permutations is <tt>self.size**size</tt>.
+ *     ary.repeated_permutation(n) { |p| block } -> ary
+ *     ary.repeated_permutation(n)               -> Enumerator
  *
- *  Examples:
+ * When invoked with a block, yield all repeated permutations of length +n+ of
+ * the elements of the array, then return the array itself.
  *
- *  - +size+ is 1:
+ * The implementation makes no guarantees about the order in which the repeated
+ * permutations are yielded.
  *
- *      p = []
- *      [0, 1, 2].repeated_permutation(1) {|permutation| p.push(permutation) }
- *      p # => [[0], [1], [2]]
+ * If no block is given, an Enumerator is returned instead.
  *
- *  - +size+ is 2:
+ * Examples:
  *
- *      p = []
- *      [0, 1, 2].repeated_permutation(2) {|permutation| p.push(permutation) }
- *      p # => [[0, 0], [0, 1], [0, 2], [1, 0], [1, 1], [1, 2], [2, 0], [2, 1], [2, 2]]
- *
- *  If +size+ is zero, calls the block once with an empty array.
- *
- *  If +size+ is negative, does not call the block:
- *
- *    [0, 1, 2].repeated_permutation(-1) {|permutation| fail 'Cannot happen' }
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *     a = [1, 2]
+ *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
+ *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
  */
+
 static VALUE
 rb_ary_repeated_permutation(VALUE ary, VALUE num)
 {
@@ -7355,25 +5165,25 @@ rb_ary_repeated_permutation(VALUE ary, VALUE num)
     r = NUM2LONG(num);                    /* Permutation size from argument */
 
     if (r < 0) {
-        /* no permutations: yield nothing */
+	/* no permutations: yield nothing */
     }
     else if (r == 0) { /* exactly one permutation: the zero-length array */
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (r == 1) { /* this is a special, easy case */
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else {             /* this is the general case */
-        volatile VALUE t0;
-        long *p = ALLOCV_N(long, t0, r);
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        RBASIC_CLEAR_CLASS(ary0);
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
 
-        rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
@@ -7385,19 +5195,19 @@ rcombinate0(const long n, const long r, long *const p, const long rest, const VA
 
     p[index] = i;
     for (;;) {
-        if (++index < r-1) {
-            p[index] = i;
-            continue;
-        }
-        for (; i < n; ++i) {
-            p[index] = i;
-            if (!yield_indexed_values(values, r, p)) {
-                rb_raise(rb_eRuntimeError, "repeated combination reentered");
-            }
-        }
-        do {
-            if (index <= 0) return;
-        } while ((i = ++p[--index]) >= n);
+	if (++index < r-1) {
+	    p[index] = i;
+	    continue;
+	}
+	for (; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated combination reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
     }
 }
 
@@ -7407,48 +5217,36 @@ rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
     long n = RARRAY_LEN(ary);
     long k = NUM2LONG(RARRAY_AREF(args, 0));
     if (k == 0) {
-        return LONG2FIX(1);
+	return LONG2FIX(1);
     }
     return binomial_coefficient(k, n + k - 1);
 }
 
 /*
  *  call-seq:
- *    repeated_combination(size) {|combination| ... } -> self
- *    repeated_combination(size) -> new_enumerator
- *
- *  With a block given, calls the block with each repeated combination of length +size+
- *  of the elements of +self+;
- *  each combination is an array;
- *  returns +self+. The order of the combinations is indeterminate.
- *
- *  If a positive integer argument +size+ is given,
- *  calls the block with each +size+-tuple repeated combination of the elements of +self+.
- *  The number of combinations is <tt>(size+1)(size+2)/2</tt>.
- *
- *  Examples:
- *
- *  - +size+ is 1:
+ *     ary.repeated_combination(n) { |c| block } -> ary
+ *     ary.repeated_combination(n)               -> Enumerator
  *
- *      c = []
- *      [0, 1, 2].repeated_combination(1) {|combination| c.push(combination) }
- *      c # => [[0], [1], [2]]
+ * When invoked with a block, yields all repeated combinations of length +n+ of
+ * elements from the array and then returns the array itself.
  *
- *  - +size+ is 2:
+ * The implementation makes no guarantees about the order in which the repeated
+ * combinations are yielded.
  *
- *      c = []
- *      [0, 1, 2].repeated_combination(2) {|combination| c.push(combination) }
- *      c # => [[0, 0], [0, 1], [0, 2], [1, 1], [1, 2], [2, 2]]
+ * If no block is given, an Enumerator is returned instead.
  *
- *  If +size+ is zero, calls the block once with an empty array.
+ * Examples:
  *
- *  If +size+ is negative, does not call the block:
+ *   a = [1, 2, 3]
+ *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
+ *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
  *
- *    [0, 1, 2].repeated_combination(-1) {|combination| fail 'Cannot happen' }
- *
- *  With no block given, returns a new Enumerator.
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
  */
 
 static VALUE
@@ -7460,98 +5258,67 @@ rb_ary_repeated_combination(VALUE ary, VALUE num)
     RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
     len = RARRAY_LEN(ary);
     if (n < 0) {
-        /* yield nothing */
+	/* yield nothing */
     }
     else if (n == 0) {
-        rb_yield(rb_ary_new2(0));
+	rb_yield(rb_ary_new2(0));
     }
     else if (n == 1) {
-        for (i = 0; i < RARRAY_LEN(ary); i++) {
-            rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-        }
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
     }
     else if (len == 0) {
-        /* yield nothing */
+	/* yield nothing */
     }
     else {
-        volatile VALUE t0;
-        long *p = ALLOCV_N(long, t0, n);
-        VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-        RBASIC_CLEAR_CLASS(ary0);
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, n);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
 
-        rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
-        ALLOCV_END(t0);
-        RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *    product(*other_arrays) -> new_array
- *    product(*other_arrays) {|combination| ... } -> self
- *
- *  Computes all combinations of elements from all the arrays,
- *  including both +self+ and +other_arrays+:
- *
- *  - The number of combinations is the product of the sizes of all the arrays,
- *    including both +self+ and +other_arrays+.
- *  - The order of the returned combinations is indeterminate.
- *
- *  With no block given, returns the combinations as an array of arrays:
+ *     ary.product(other_ary, ...)                -> new_ary
+ *     ary.product(other_ary, ...) { |p| block }  -> ary
  *
- *    p = [0, 1].product([2, 3])
- *    # => [[0, 2], [0, 3], [1, 2], [1, 3]]
- *    p.size # => 4
- *    p = [0, 1].product([2, 3], [4, 5])
- *    # => [[0, 2, 4], [0, 2, 5], [0, 3, 4], [0, 3, 5], [1, 2, 4], [1, 2, 5], [1, 3, 4], [1, 3,...
- *    p.size # => 8
+ *  Returns an array of all combinations of elements from all arrays.
  *
- *  If +self+ or any argument is empty, returns an empty array:
+ *  The length of the returned array is the product of the length of +self+ and
+ *  the argument arrays.
  *
- *    [].product([2, 3], [4, 5]) # => []
- *    [0, 1].product([2, 3], []) # => []
+ *  If given a block, #product will yield all combinations and return +self+
+ *  instead.
  *
- *  If no argument is given, returns an array of 1-element arrays,
- *  each containing an element of +self+:
- *
- *    a.product # => [[0], [1], [2]]
- *
- *  With a block given, calls the block with each combination; returns +self+:
- *
- *    p = []
- *    [0, 1].product([2, 3]) {|combination| p.push(combination) }
- *    p # => [[0, 2], [0, 3], [1, 2], [1, 3]]
- *
- *  If +self+ or any argument is empty, does not call the block:
- *
- *    [].product([2, 3], [4, 5]) {|combination| fail 'Cannot happen' }
- *    # => []
- *    [0, 1].product([2, 3], []) {|combination| fail 'Cannot happen' }
- *    # => [0, 1]
- *
- *  If no argument is given, calls the block with each element of +self+ as a 1-element array:
- *
- *    p = []
- *    [0, 1].product {|combination| p.push(combination) }
- *    p # => [[0], [1]]
- *
- *  Related: see {Methods for Combining}[rdoc-ref:Array@Methods+for+Combining].
+ *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ *     [1,2].product()            #=> [[1],[2]]
+ *     [1,2].product([])          #=> []
  */
 
 static VALUE
 rb_ary_product(int argc, VALUE *argv, VALUE ary)
 {
     int n = argc+1;    /* How many arrays we're operating on */
-    volatile VALUE t0 = rb_ary_hidden_new(n);
-    volatile VALUE t1 = Qundef;
+    volatile VALUE t0 = tmpary(n);
+    volatile VALUE t1 = tmpbuf(n, sizeof(int));
     VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
-    int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
+    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
     VALUE result = Qnil;      /* The array we'll be returning, when no block given */
     long i,j;
     long resultlen = 1;
 
     RBASIC_CLEAR_CLASS(t0);
+    RBASIC_CLEAR_CLASS(t1);
 
     /* initialize the arrays of arrays */
     ARY_SET_LEN(t0, n);
@@ -7564,85 +5331,82 @@ rb_ary_product(int argc, VALUE *argv, VALUE ary)
 
     /* Otherwise, allocate and fill in an array of results */
     if (rb_block_given_p()) {
-        /* Make defensive copies of arrays; exit if any is empty */
-        for (i = 0; i < n; i++) {
-            if (RARRAY_LEN(arrays[i]) == 0) goto done;
-            arrays[i] = ary_make_shared_copy(arrays[i]);
-        }
+	/* Make defensive copies of arrays; exit if any is empty */
+	for (i = 0; i < n; i++) {
+	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
+	    arrays[i] = ary_make_shared_copy(arrays[i]);
+	}
     }
     else {
-        /* Compute the length of the result array; return [] if any is empty */
-        for (i = 0; i < n; i++) {
-            long k = RARRAY_LEN(arrays[i]);
-            if (k == 0) {
-                result = rb_ary_new2(0);
-                goto done;
-            }
+	/* Compute the length of the result array; return [] if any is empty */
+	for (i = 0; i < n; i++) {
+	    long k = RARRAY_LEN(arrays[i]);
+	    if (k == 0) {
+		result = rb_ary_new2(0);
+		goto done;
+	    }
             if (MUL_OVERFLOW_LONG_P(resultlen, k))
-                rb_raise(rb_eRangeError, "too big to product");
-            resultlen *= k;
-        }
-        result = rb_ary_new2(resultlen);
+		rb_raise(rb_eRangeError, "too big to product");
+	    resultlen *= k;
+	}
+	result = rb_ary_new2(resultlen);
     }
     for (;;) {
-        int m;
-        /* fill in one subarray */
-        VALUE subarray = rb_ary_new2(n);
-        for (j = 0; j < n; j++) {
-            rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
-        }
-
-        /* put it on the result array */
-        if (NIL_P(result)) {
-            FL_SET(t0, RARRAY_SHARED_ROOT_FLAG);
-            rb_yield(subarray);
-            if (!FL_TEST(t0, RARRAY_SHARED_ROOT_FLAG)) {
-                rb_raise(rb_eRuntimeError, "product reentered");
-            }
-            else {
-                FL_UNSET(t0, RARRAY_SHARED_ROOT_FLAG);
-            }
-        }
-        else {
-            rb_ary_push(result, subarray);
-        }
-
-        /*
-         * Increment the last counter.  If it overflows, reset to 0
-         * and increment the one before it.
-         */
-        m = n-1;
-        counters[m]++;
-        while (counters[m] == RARRAY_LEN(arrays[m])) {
-            counters[m] = 0;
-            /* If the first counter overflows, we are done */
-            if (--m < 0) goto done;
-            counters[m]++;
-        }
+	int m;
+	/* fill in one subarray */
+	VALUE subarray = rb_ary_new2(n);
+	for (j = 0; j < n; j++) {
+	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+	}
+
+	/* put it on the result array */
+	if (NIL_P(result)) {
+	    FL_SET(t0, FL_USER5);
+	    rb_yield(subarray);
+	    if (! FL_TEST(t0, FL_USER5)) {
+		rb_raise(rb_eRuntimeError, "product reentered");
+	    }
+	    else {
+		FL_UNSET(t0, FL_USER5);
+	    }
+	}
+	else {
+	    rb_ary_push(result, subarray);
+	}
+
+	/*
+	 * Increment the last counter.  If it overflows, reset to 0
+	 * and increment the one before it.
+	 */
+	m = n-1;
+	counters[m]++;
+	while (counters[m] == RARRAY_LEN(arrays[m])) {
+	    counters[m] = 0;
+	    /* If the first counter overflows, we are done */
+	    if (--m < 0) goto done;
+	    counters[m]++;
+	}
     }
-
 done:
-    ALLOCV_END(t1);
+    tmpary_discard(t0);
+    tmpbuf_discard(t1);
 
     return NIL_P(result) ? ary : result;
 }
 
 /*
  *  call-seq:
- *    take(count) -> new_array
+ *     ary.take(n)               -> new_ary
+ *
+ *  Returns first +n+ elements from the array.
  *
- *  Returns a new array containing the first +count+ element of +self+
- *  (as available);
- *  +count+ must be a non-negative numeric;
- *  does not modify +self+:
+ *  If a negative number is given, raises an ArgumentError.
  *
- *    a = ['a', 'b', 'c', 'd']
- *    a.take(2)   # => ["a", "b"]
- *    a.take(2.1) # => ["a", "b"]
- *    a.take(50)  # => ["a", "b", "c", "d"]
- *    a.take(0)   # => []
+ *  See also Array#drop
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take(3)             #=> [1, 2, 3]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7650,30 +5414,26 @@ rb_ary_take(VALUE obj, VALUE n)
 {
     long len = NUM2LONG(n);
     if (len < 0) {
-        rb_raise(rb_eArgError, "attempt to take negative size");
+	rb_raise(rb_eArgError, "attempt to take negative size");
     }
     return rb_ary_subseq(obj, 0, len);
 }
 
 /*
  *  call-seq:
- *    take_while {|element| ... } -> new_array
- *    take_while -> new_enumerator
+ *     ary.take_while { |obj| block }  -> new_ary
+ *     ary.take_while                  -> Enumerator
  *
- *  With a block given, calls the block with each successive element of +self+;
- *  stops iterating if the block returns +false+ or +nil+;
- *  returns a new array containing those elements for which the block returned a truthy value:
+ *  Passes elements to the block until the block returns +nil+ or +false+, then
+ *  stops iterating and returns an array of all prior elements.
  *
- *    a = [0, 1, 2, 3, 4, 5]
- *    a.take_while {|element| element < 3 } # => [0, 1, 2]
- *    a.take_while {|element| true }        # => [0, 1, 2, 3, 4, 5]
- *    a.take_while {|element| false }       # => []
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  With no block given, returns a new Enumerator.
+ *  See also Array#drop_while
  *
- *  Does not modify +self+.
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take_while { |i| i < 3 }  #=> [1, 2]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7683,28 +5443,25 @@ rb_ary_take_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_take(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *    drop(count) -> new_array
+ *     ary.drop(n)               -> new_ary
+ *
+ *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
+ *  an array.
  *
- *  Returns a new array containing all but the first +count+ element of +self+,
- *  where +count+ is a non-negative integer;
- *  does not modify +self+.
+ *  If a negative number is given, raises an ArgumentError.
  *
- *  Examples:
+ *  See also Array#take
  *
- *    a = [0, 1, 2, 3, 4, 5]
- *    a.drop(0) # => [0, 1, 2, 3, 4, 5]
- *    a.drop(1) # => [1, 2, 3, 4, 5]
- *    a.drop(2) # => [2, 3, 4, 5]
- *    a.drop(9) # => []
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop(3)             #=> [4, 5, 0]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7713,30 +5470,30 @@ rb_ary_drop(VALUE ary, VALUE n)
     VALUE result;
     long pos = NUM2LONG(n);
     if (pos < 0) {
-        rb_raise(rb_eArgError, "attempt to drop negative size");
+	rb_raise(rb_eArgError, "attempt to drop negative size");
     }
 
     result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
-    if (NIL_P(result)) result = rb_ary_new();
+    if (result == Qnil) result = rb_ary_new();
     return result;
 }
 
 /*
  *  call-seq:
- *    drop_while {|element| ... } -> new_array
- *    drop_while -> new_enumerator
+ *     ary.drop_while { |obj| block }   -> new_ary
+ *     ary.drop_while                  -> Enumerator
  *
- *  With a block given, calls the block with each successive element of +self+;
- *  stops if the block returns +false+ or +nil+;
- *  returns a new array _omitting_ those elements for which the block returned a truthy value;
- *  does not modify +self+:
+ *  Drops elements up to, but not including, the first element for which the
+ *  block returns +nil+ or +false+ and returns an array containing the
+ *  remaining elements.
  *
- *    a = [0, 1, 2, 3, 4, 5]
- *    a.drop_while {|element| element < 3 } # => [3, 4, 5]
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  With no block given, returns a new Enumerator.
+ *  See also Array#take_while
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
  */
 
 static VALUE
@@ -7746,301 +5503,53 @@ rb_ary_drop_while(VALUE ary)
 
     RETURN_ENUMERATOR(ary, 0, 0);
     for (i = 0; i < RARRAY_LEN(ary); i++) {
-        if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
     }
     return rb_ary_drop(ary, LONG2FIX(i));
 }
 
 /*
  *  call-seq:
- *    any? -> true or false
- *    any?(object) -> true or false
- *    any? {|element| ... } -> true or false
- *
- *  Returns whether for any element of +self+, a given criterion is satisfied.
- *
- *  With no block and no argument, returns whether any element of +self+ is truthy:
+ *     ary.any? [{ |obj| block }]   -> true or false
  *
- *    [nil, false, []].any? # => true  # Array object is truthy.
- *    [nil, false, {}].any? # => true  # Hash object is truthy.
- *    [nil, false, ''].any? # => true  # String object is truthy.
- *    [nil, false].any?     # => false # Nil and false are not truthy.
- *
- *  With argument +object+ given,
- *  returns whether <tt>object === ele</tt> for any element +ele+ in +self+:
- *
- *    [nil, false, 0].any?(0)          # => true
- *    [nil, false, 1].any?(0)          # => false
- *    [nil, false, 'food'].any?(/foo/) # => true
- *    [nil, false, 'food'].any?(/bar/) # => false
- *
- *  With a block given,
- *  calls the block with each element in +self+;
- *  returns whether the block returns any truthy value:
- *
- *    [0, 1, 2].any? {|ele| ele < 1 } # => true
- *    [0, 1, 2].any? {|ele| ele < 0 } # => false
- *
- *  With both a block and argument +object+ given,
- *  ignores the block and uses +object+ as above.
- *
- *  <b>Special case</b>: returns +false+ if +self+ is empty
- *  (regardless of any given argument or block).
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
+ *  See also Enumerable#any?
  */
 
 static VALUE
-rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
+rb_ary_any_p(VALUE ary)
 {
     long i, len = RARRAY_LEN(ary);
+    const VALUE *ptr = RARRAY_CONST_PTR(ary);
 
-    rb_check_arity(argc, 0, 1);
     if (!len) return Qfalse;
-    if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
-        }
-    }
-    else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
-        }
+    if (!rb_block_given_p()) {
+	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
     }
     else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
-        }
+	for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+	}
     }
     return Qfalse;
 }
 
 /*
- *  call-seq:
- *    all? -> true or false
- *    all?(object) -> true or false
- *    all? {|element| ... } -> true or false
- *
- *  Returns whether for every element of +self+,
- *  a given criterion is satisfied.
- *
- *  With no block and no argument,
- *  returns whether every element of +self+ is truthy:
- *
- *    [[], {}, '', 0, 0.0, Object.new].all? # => true  # All truthy objects.
- *    [[], {}, '', 0, 0.0, nil].all?        # => false # nil is not truthy.
- *    [[], {}, '', 0, 0.0, false].all?      # => false # false is not truthy.
- *
- *  With argument +object+ given, returns whether <tt>object === ele</tt>
- *  for every element +ele+ in +self+:
- *
- *    [0, 0, 0].all?(0)                    # => true
- *    [0, 1, 2].all?(1)                    # => false
- *    ['food', 'fool', 'foot'].all?(/foo/) # => true
- *    ['food', 'drink'].all?(/foo/)        # => false
- *
- *  With a block given, calls the block with each element in +self+;
- *  returns whether the block returns only truthy values:
- *
- *    [0, 1, 2].all? { |ele| ele < 3 } # => true
- *    [0, 1, 2].all? { |ele| ele < 2 } # => false
- *
- *  With both a block and argument +object+ given,
- *  ignores the block and uses +object+ as above.
- *
- *  <b>Special case</b>: returns +true+ if +self+ is empty
- *  (regardless of any given argument or block).
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
-{
-    long i, len = RARRAY_LEN(ary);
-
-    rb_check_arity(argc, 0, 1);
-    if (!len) return Qtrue;
-    if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
-        }
-    }
-    else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    return Qtrue;
-}
-
-/*
- *  call-seq:
- *    none? -> true or false
- *    none?(object) -> true or false
- *    none? {|element| ... } -> true or false
- *
- *  Returns +true+ if no element of +self+ meets a given criterion, +false+ otherwise.
- *
- *  With no block given and no argument, returns +true+ if +self+ has no truthy elements,
- *  +false+ otherwise:
- *
- *    [nil, false].none?    # => true
- *    [nil, 0, false].none? # => false
- *    [].none?              # => true
- *
- *  With argument +object+ given, returns +false+ if for any element +element+,
- *  <tt>object === element</tt>; +true+ otherwise:
- *
- *    ['food', 'drink'].none?(/bar/) # => true
- *    ['food', 'drink'].none?(/foo/) # => false
- *    [].none?(/foo/)                # => true
- *    [0, 1, 2].none?(3)             # => true
- *    [0, 1, 2].none?(1)             # => false
- *
- *  With a block given, calls the block with each element in +self+;
- *  returns +true+ if the block returns no truthy value, +false+ otherwise:
- *
- *    [0, 1, 2].none? {|element| element > 3 } # => true
- *    [0, 1, 2].none? {|element| element > 1 } # => false
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
-{
-    long i, len = RARRAY_LEN(ary);
-
-    rb_check_arity(argc, 0, 1);
-    if (!len) return Qtrue;
-    if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
-        }
-    }
-    else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
-        }
-    }
-    return Qtrue;
-}
-
-/*
- *  call-seq:
- *    one? -> true or false
- *    one? {|element| ... } -> true or false
- *    one?(object) -> true or false
- *
- *  Returns +true+ if exactly one element of +self+ meets a given criterion.
- *
- *  With no block given and no argument, returns +true+ if +self+ has exactly one truthy element,
- *  +false+ otherwise:
- *
- *    [nil, 0].one? # => true
- *    [0, 0].one? # => false
- *    [nil, nil].one? # => false
- *    [].one? # => false
- *
- *  With a block given, calls the block with each element in +self+;
- *  returns +true+ if the block a truthy value for exactly one element, +false+ otherwise:
- *
- *    [0, 1, 2].one? {|element| element > 0 } # => false
- *    [0, 1, 2].one? {|element| element > 1 } # => true
- *    [0, 1, 2].one? {|element| element > 2 } # => false
- *
- *  With argument +object+ given, returns +true+ if for exactly one element +element+, <tt>object === element</tt>;
- *  +false+ otherwise:
- *
- *    [0, 1, 2].one?(0) # => true
- *    [0, 0, 1].one?(0) # => false
- *    [1, 1, 2].one?(0) # => false
- *    ['food', 'drink'].one?(/bar/) # => false
- *    ['food', 'drink'].one?(/foo/) # => true
- *    [].one?(/foo/) # => false
- *
- *  Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
- */
-
-static VALUE
-rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
-{
-    long i, len = RARRAY_LEN(ary);
-    VALUE result = Qfalse;
-
-    rb_check_arity(argc, 0, 1);
-    if (!len) return Qfalse;
-    if (argc) {
-        if (rb_block_given_p()) {
-            rb_warn("given block not used");
-        }
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
-                if (result) return Qfalse;
-                result = Qtrue;
-            }
-        }
-    }
-    else if (!rb_block_given_p()) {
-        for (i = 0; i < len; ++i) {
-            if (RTEST(RARRAY_AREF(ary, i))) {
-                if (result) return Qfalse;
-                result = Qtrue;
-            }
-        }
-    }
-    else {
-        for (i = 0; i < RARRAY_LEN(ary); ++i) {
-            if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-                if (result) return Qfalse;
-                result = Qtrue;
-            }
-        }
-    }
-    return result;
-}
-
-/*
- *  call-seq:
- *    dig(index, *identifiers) -> object
- *
- *  Finds and returns the object in nested object
- *  specified by +index+ and +identifiers+;
- *  the nested objects may be instances of various classes.
- *  See {Dig Methods}[rdoc-ref:dig_methods.rdoc].
+ * call-seq:
+ *   ary.dig(idx, ...)                 -> object
  *
- *  Examples:
+ * Extracts the nested value specified by the sequence of <i>idx</i>
+ * objects by calling +dig+ at each step, returning +nil+ if any
+ * intermediate step is +nil+.
  *
- *    a = [:foo, [:bar, :baz, [:bat, :bam]]]
- *    a.dig(1) # => [:bar, :baz, [:bat, :bam]]
- *    a.dig(1, 2) # => [:bat, :bam]
- *    a.dig(1, 2, 0) # => :bat
- *    a.dig(1, 2, 3) # => nil
+ *   a = [[1, [2, 3]]]
  *
- *  Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
+ *   a.dig(0, 1, 1)                    #=> 3
+ *   a.dig(1, 2, 3)                    #=> nil
+ *   a.dig(0, 0, 0)                    #=> NoMethodError, undefined method `dig' for 1:Fixnum
+ *   [42, {foo: :bar}].dig(1, :foo)    #=> :bar
  */
 
-static VALUE
+VALUE
 rb_ary_dig(int argc, VALUE *argv, VALUE self)
 {
     rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
@@ -8050,334 +5559,56 @@ rb_ary_dig(int argc, VALUE *argv, VALUE self)
     return rb_obj_dig(argc, argv, self, Qnil);
 }
 
-static inline VALUE
-finish_exact_sum(long n, VALUE r, VALUE v, int z)
-{
-    if (n != 0)
-        v = rb_fix_plus(LONG2FIX(n), v);
-    if (!UNDEF_P(r)) {
-        v = rb_rational_plus(r, v);
-    }
-    else if (!n && z) {
-        v = rb_fix_plus(LONG2FIX(0), v);
-    }
-    return v;
-}
-
-/*
- * call-seq:
- *   sum(init = 0) -> object
- *   sum(init = 0) {|element| ... } -> object
- *
- *  With no block given, returns the sum of +init+ and all elements of +self+;
- *  for array +array+ and value +init+, equivalent to:
- *
- *    sum = init
- *    array.each {|element| sum += element }
- *    sum
- *
- *  For example, <tt>[e0, e1, e2].sum</tt> returns <tt>init + e0 + e1 + e2</tt>.
- *
- *  Examples:
- *
- *    [0, 1, 2, 3].sum                 # => 6
- *    [0, 1, 2, 3].sum(100)            # => 106
- *    ['abc', 'def', 'ghi'].sum('jkl') # => "jklabcdefghi"
- *    [[:foo, :bar], ['foo', 'bar']].sum([2, 3])
- *    # => [2, 3, :foo, :bar, "foo", "bar"]
- *
- *  The +init+ value and elements need not be numeric, but must all be <tt>+</tt>-compatible:
- *
- *    # Raises TypeError: Array can't be coerced into Integer.
- *    [[:foo, :bar], ['foo', 'bar']].sum(2)
- *
- *  With a block given, calls the block with each element of +self+;
- *  the block's return value (instead of the element itself) is used as the addend:
- *
- *    ['zero', 1, :two].sum('Coerced and concatenated: ') {|element| element.to_s }
- *    # => "Coerced and concatenated: zero1two"
- *
- *  Notes:
- *
- *  - Array#join and Array#flatten may be faster than Array#sum
- *    for an array of strings or an array of arrays.
- *  - Array#sum method may not respect method redefinition of "+" methods such as Integer#+.
- *
- */
-
-static VALUE
-rb_ary_sum(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE e, v, r;
-    long i, n;
-    int block_given;
-
-    v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
-
-    block_given = rb_block_given_p();
-
-    if (RARRAY_LEN(ary) == 0)
-        return v;
-
-    n = 0;
-    r = Qundef;
-
-    if (!FIXNUM_P(v) && !RB_BIGNUM_TYPE_P(v) && !RB_TYPE_P(v, T_RATIONAL)) {
-        i = 0;
-        goto init_is_a_value;
-    }
-
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (block_given)
-            e = rb_yield(e);
-        if (FIXNUM_P(e)) {
-            n += FIX2LONG(e); /* should not overflow long type */
-            if (!FIXABLE(n)) {
-                v = rb_big_plus(LONG2NUM(n), v);
-                n = 0;
-            }
-        }
-        else if (RB_BIGNUM_TYPE_P(e))
-            v = rb_big_plus(e, v);
-        else if (RB_TYPE_P(e, T_RATIONAL)) {
-            if (UNDEF_P(r))
-                r = e;
-            else
-                r = rb_rational_plus(r, e);
-        }
-        else
-            goto not_exact;
-    }
-    v = finish_exact_sum(n, r, v, argc!=0);
-    return v;
-
-  not_exact:
-    v = finish_exact_sum(n, r, v, i!=0);
-
-    if (RB_FLOAT_TYPE_P(e)) {
-        /*
-         * Kahan-Babuska balancing compensated summation algorithm
-         * See https://link.springer.com/article/10.1007/s00607-005-0139-x
-         */
-        double f, c;
-        double x, t;
-
-        f = NUM2DBL(v);
-        c = 0.0;
-        goto has_float_value;
-        for (; i < RARRAY_LEN(ary); i++) {
-            e = RARRAY_AREF(ary, i);
-            if (block_given)
-                e = rb_yield(e);
-            if (RB_FLOAT_TYPE_P(e))
-              has_float_value:
-                x = RFLOAT_VALUE(e);
-            else if (FIXNUM_P(e))
-                x = FIX2LONG(e);
-            else if (RB_BIGNUM_TYPE_P(e))
-                x = rb_big2dbl(e);
-            else if (RB_TYPE_P(e, T_RATIONAL))
-                x = rb_num2dbl(e);
-            else
-                goto not_float;
-
-            if (isnan(f)) continue;
-            if (isnan(x)) {
-                f = x;
-                continue;
-            }
-            if (isinf(x)) {
-                if (isinf(f) && signbit(x) != signbit(f))
-                    f = NAN;
-                else
-                    f = x;
-                continue;
-            }
-            if (isinf(f)) continue;
-
-            t = f + x;
-            if (fabs(f) >= fabs(x))
-                c += ((f - t) + x);
-            else
-                c += ((x - t) + f);
-            f = t;
-        }
-        f += c;
-        return DBL2NUM(f);
-
-      not_float:
-        v = DBL2NUM(f);
-    }
-
-    goto has_some_value;
-    init_is_a_value:
-    for (; i < RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (block_given)
-            e = rb_yield(e);
-      has_some_value:
-        v = rb_funcall(v, idPLUS, 1, e);
-    }
-    return v;
-}
-
-/* :nodoc: */
-static VALUE
-rb_ary_deconstruct(VALUE ary)
-{
-    return ary;
-}
-
 /*
- *  An \Array object is an ordered, integer-indexed collection of objects,
- *  called _elements_;
- *  the object represents
- *  an {array data structure}[https://en.wikipedia.org/wiki/Array_(data_structure)].
- *
- *  An element may be any object (even another array);
- *  elements may be any mixture of objects of different types.
- *
- *  Important data structures that use arrays include:
+ *  Arrays are ordered, integer-indexed collections of any object.
  *
- *  - {Coordinate vector}[https://en.wikipedia.org/wiki/Coordinate_vector].
- *  - {Matrix}[https://en.wikipedia.org/wiki/Matrix_(mathematics)].
- *  - {Heap}[https://en.wikipedia.org/wiki/Heap_(data_structure)].
- *  - {Hash table}[https://en.wikipedia.org/wiki/Hash_table].
- *  - {Deque (double-ended queue)}[https://en.wikipedia.org/wiki/Double-ended_queue].
- *  - {Queue}[https://en.wikipedia.org/wiki/Queue_(abstract_data_type)].
- *  - {Stack}[https://en.wikipedia.org/wiki/Stack_(abstract_data_type)].
- *
- *  There are also array-like data structures:
- *
- *  - {Associative array}[https://en.wikipedia.org/wiki/Associative_array] (see Hash).
- *  - {Directory}[https://en.wikipedia.org/wiki/Directory_(computing)] (see Dir).
- *  - {Environment}[https://en.wikipedia.org/wiki/Environment_variable] (see ENV).
- *  - {Set}[https://en.wikipedia.org/wiki/Set_(abstract_data_type)] (see Set).
- *  - {String}[https://en.wikipedia.org/wiki/String_(computer_science)] (see String).
- *
- *  == \Array Indexes
- *
- *  \Array indexing starts at 0, as in C or Java.
- *
- *  A non-negative index is an offset from the first element:
- *
- *  - Index 0 indicates the first element.
- *  - Index 1 indicates the second element.
- *  - ...
- *
- *  A negative index is an offset, backwards, from the end of the array:
- *
- *  - Index -1 indicates the last element.
- *  - Index -2 indicates the next-to-last element.
- *  - ...
- *
- *
- *  === In-Range and Out-of-Range Indexes
- *
- *  A non-negative index is <i>in range</i> if and only if it is smaller than
- *  the size of the array.  For a 3-element array:
- *
- *  - Indexes 0 through 2 are in range.
- *  - Index 3 is out of range.
- *
- *  A negative index is <i>in range</i> if and only if its absolute value is
- *  not larger than the size of the array.  For a 3-element array:
- *
- *  - Indexes -1 through -3 are in range.
- *  - Index -4 is out of range.
- *
- *  === Effective Index
- *
- *  Although the effective index into an array is always an integer,
- *  some methods (both within class \Array and elsewhere)
- *  accept one or more non-integer arguments that are
- *  {integer-convertible objects}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects].
+ *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
+ *  to be relative to the end of the array---that is, an index of -1 indicates
+ *  the last element of the array, -2 is the next to last element in the
+ *  array, and so on.
  *
  *  == Creating Arrays
  *
- *  You can create an \Array object explicitly with:
- *
- *  - An {array literal}[rdoc-ref:syntax/literals.rdoc@Array+Literals]:
- *
- *      [1, 'one', :one, [2, 'two', :two]]
- *
- *  - A {%w or %W string-array Literal}[rdoc-ref:syntax/literals.rdoc@25w+and+-25W-3A+String-Array+Literals]:
- *
- *      %w[foo bar baz] # => ["foo", "bar", "baz"]
- *      %w[1 % *]       # => ["1", "%", "*"]
- *
- *  - A {%i or %I symbol-array Literal}[rdoc-ref:syntax/literals.rdoc@25i+and+-25I-3A+Symbol-Array+Literals]:
+ *  A new array can be created by using the literal constructor
+ *  <code>[]</code>.  Arrays can contain different types of objects.  For
+ *  example, the array below contains an Integer, a String and a Float:
  *
- *      %i[foo bar baz] # => [:foo, :bar, :baz]
- *      %i[1 % *]       # => [:"1", :%, :*]
+ *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
  *
- *  - Method Kernel#Array:
+ *  An array can also be created by explicitly calling Array.new with zero, one
+ *  (the initial size of the Array) or two arguments (the initial size and a
+ *  default object).
  *
- *      Array(["a", "b"])             # => ["a", "b"]
- *      Array(1..5)                   # => [1, 2, 3, 4, 5]
- *      Array(key: :value)            # => [[:key, :value]]
- *      Array(nil)                    # => []
- *      Array(1)                      # => [1]
- *      Array({:a => "a", :b => "b"}) # => [[:a, "a"], [:b, "b"]]
+ *     ary = Array.new    #=> []
+ *     Array.new(3)       #=> [nil, nil, nil]
+ *     Array.new(3, true) #=> [true, true, true]
  *
- *  - Method Array.new:
+ *  Note that the second argument populates the array with references to the
+ *  same object.  Therefore, it is only recommended in cases when you need to
+ *  instantiate arrays with natively immutable objects such as Symbols,
+ *  numbers, true or false.
  *
- *      Array.new               # => []
- *      Array.new(3)            # => [nil, nil, nil]
- *      Array.new(4) {Hash.new} # => [{}, {}, {}, {}]
- *      Array.new(3, true)      # => [true, true, true]
+ *  To create an array with separate objects a block can be passed instead.
+ *  This method is safe to use with mutable objects such as hashes, strings or
+ *  other arrays:
  *
- *    Note that the last example above populates the array
- *    with references to the same object.
- *    This is recommended only in cases where that object is a natively immutable object
- *    such as a symbol, a numeric, +nil+, +true+, or +false+.
+ *     Array.new(4) { Hash.new }  #=> [{}, {}, {}, {}]
+ *     Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
  *
- *    Another way to create an array with various objects, using a block;
- *    this usage is safe for mutable objects such as hashes, strings or
- *    other arrays:
+ *  This is also a quick way to build up multi-dimensional arrays:
  *
- *      Array.new(4) {|i| i.to_s } # => ["0", "1", "2", "3"]
+ *     empty_table = Array.new(3) { Array.new(3) }
+ *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
  *
- *    Here is a way to create a multi-dimensional array:
+ *  An array can also be created by using the Array() method, provided by
+ *  Kernel, which tries to call #to_ary, then #to_a on its argument.
  *
- *      Array.new(3) {Array.new(3)}
- *      # => [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
- *
- *  A number of Ruby methods, both in the core and in the standard library,
- *  provide instance method +to_a+, which converts an object to an array.
- *
- *  - ARGF#to_a
- *  - Array#to_a
- *  - Enumerable#to_a
- *  - Hash#to_a
- *  - MatchData#to_a
- *  - NilClass#to_a
- *  - OptionParser#to_a
- *  - Range#to_a
- *  - Set#to_a
- *  - Struct#to_a
- *  - Time#to_a
- *  - Benchmark::Tms#to_a
- *  - CSV::Table#to_a
- *  - Enumerator::Lazy#to_a
- *  - Gem::List#to_a
- *  - Gem::NameTuple#to_a
- *  - Gem::Platform#to_a
- *  - Gem::RequestSet::Lockfile::Tokenizer#to_a
- *  - Gem::SourceList#to_a
- *  - OpenSSL::X509::Extension#to_a
- *  - OpenSSL::X509::Name#to_a
- *  - Racc::ISet#to_a
- *  - Rinda::RingFinger#to_a
- *  - Ripper::Lexer::Elem#to_a
- *  - RubyVM::InstructionSequence#to_a
- *  - YAML::DBM#to_a
+ *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
  *
  *  == Example Usage
  *
- *  In addition to the methods it mixes in through the Enumerable module,
- *  class \Array has proprietary methods for accessing, searching and otherwise
+ *  In addition to the methods it mixes in through the Enumerable module, the
+ *  Array class has proprietary methods for accessing, searching and otherwise
  *  manipulating arrays.
  *
  *  Some of the more common ones are illustrated below.
@@ -8425,9 +5656,9 @@ rb_ary_deconstruct(VALUE ary)
  *
  *     arr.drop(3) #=> [4, 5, 6]
  *
- *  == Obtaining Information about an \Array
+ *  == Obtaining Information about an Array
  *
- *  An array keeps track of its own length at all times.  To query an array
+ *  Arrays keep track of their own length at all times.  To query an array
  *  about the number of elements it contains, use #length, #count or #size.
  *
  *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
@@ -8442,7 +5673,7 @@ rb_ary_deconstruct(VALUE ary)
  *
  *    browsers.include?('Konqueror') #=> false
  *
- *  == Adding Items to an \Array
+ *  == Adding Items to Arrays
  *
  *  Items can be added to the end of an array by using either #push or #<<
  *
@@ -8463,7 +5694,7 @@ rb_ary_deconstruct(VALUE ary)
  *     arr.insert(3, 'orange', 'pear', 'grapefruit')
  *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
  *
- *  == Removing Items from an \Array
+ *  == Removing Items from an Array
  *
  *  The method #pop removes the last element in an array and returns it:
  *
@@ -8503,17 +5734,17 @@ rb_ary_deconstruct(VALUE ary)
  *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
  *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
  *
- *  == Iterating over an \Array
+ *  == Iterating over Arrays
  *
- *  Like all classes that include the Enumerable module, class \Array has an each
+ *  Like all classes that include the Enumerable module, Array has an each
  *  method, which defines what elements should be iterated over and how.  In
- *  case of Array#each, all elements in +self+ are yielded to
+ *  case of Array's #each, all elements in the Array instance are yielded to
  *  the supplied block in sequence.
  *
  *  Note that this operation leaves the array unchanged.
  *
  *     arr = [1, 2, 3, 4, 5]
- *     arr.each {|a| print a -= 10, " "}
+ *     arr.each { |a| print a -= 10, " " }
  *     # prints: -9 -8 -7 -6 -5
  *     #=> [1, 2, 3, 4, 5]
  *
@@ -8522,19 +5753,18 @@ rb_ary_deconstruct(VALUE ary)
  *
  *     words = %w[first second third fourth fifth sixth]
  *     str = ""
- *     words.reverse_each {|word| str += "#{word} "}
+ *     words.reverse_each { |word| str += "#{word} " }
  *     p str #=> "sixth fifth fourth third second first "
  *
  *  The #map method can be used to create a new array based on the original
  *  array, but with the values modified by the supplied block:
  *
- *     arr.map {|a| 2*a}     #=> [2, 4, 6, 8, 10]
+ *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
  *     arr                   #=> [1, 2, 3, 4, 5]
- *     arr.map! {|a| a**2}   #=> [1, 4, 9, 16, 25]
+ *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
  *     arr                   #=> [1, 4, 9, 16, 25]
  *
- *
- *  == Selecting Items from an \Array
+ *  == Selecting Items from an Array
  *
  *  Elements can be selected from an array according to criteria defined in a
  *  block.  The selection can happen in a destructive or a non-destructive
@@ -8545,9 +5775,9 @@ rb_ary_deconstruct(VALUE ary)
  *  === Non-destructive Selection
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.select {|a| a > 3}       #=> [4, 5, 6]
- *     arr.reject {|a| a < 3}       #=> [3, 4, 5, 6]
- *     arr.drop_while {|a| a < 4}   #=> [4, 5, 6]
+ *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
+ *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
+ *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
  *     arr                          #=> [1, 2, 3, 4, 5, 6]
  *
  *  === Destructive Selection
@@ -8558,190 +5788,25 @@ rb_ary_deconstruct(VALUE ary)
  *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
  *  opposite result when supplied with the same block:
  *
- *     arr.delete_if {|a| a < 4}   #=> [4, 5, 6]
+ *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
  *     arr                         #=> [4, 5, 6]
  *
  *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.keep_if {|a| a < 4}   #=> [1, 2, 3]
+ *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
  *     arr                       #=> [1, 2, 3]
  *
- *  == What's Here
- *
- *  First, what's elsewhere. Class \Array:
- *
- *  - Inherits from {class Object}[rdoc-ref:Object@What-27s+Here].
- *  - Includes {module Enumerable}[rdoc-ref:Enumerable@What-27s+Here],
- *    which provides dozens of additional methods.
- *
- *  Here, class \Array provides methods that are useful for:
- *
- *  - {Creating an Array}[rdoc-ref:Array@Methods+for+Creating+an+Array]
- *  - {Querying}[rdoc-ref:Array@Methods+for+Querying]
- *  - {Comparing}[rdoc-ref:Array@Methods+for+Comparing]
- *  - {Fetching}[rdoc-ref:Array@Methods+for+Fetching]
- *  - {Assigning}[rdoc-ref:Array@Methods+for+Assigning]
- *  - {Deleting}[rdoc-ref:Array@Methods+for+Deleting]
- *  - {Combining}[rdoc-ref:Array@Methods+for+Combining]
- *  - {Iterating}[rdoc-ref:Array@Methods+for+Iterating]
- *  - {Converting}[rdoc-ref:Array@Methods+for+Converting]
- *  - {And more....}[rdoc-ref:Array@Other+Methods]
- *
- *  === Methods for Creating an \Array
- *
- *  - ::[]: Returns a new array populated with given objects.
- *  - ::new: Returns a new array.
- *  - ::try_convert: Returns a new array created from a given object.
- *
- *  See also {Creating Arrays}[rdoc-ref:Array@Creating+Arrays].
- *
- *  === Methods for Querying
- *
- *  - #all?: Returns whether all elements meet a given criterion.
- *  - #any?: Returns whether any element meets a given criterion.
- *  - #count: Returns the count of elements that meet a given criterion.
- *  - #empty?: Returns whether there are no elements.
- *  - #find_index (aliased as #index): Returns the index of the first element that meets a given criterion.
- *  - #hash: Returns the integer hash code.
- *  - #include?: Returns whether any element <tt>==</tt> a given object.
- *  - #length (aliased as #size): Returns the count of elements.
- *  - #none?: Returns whether no element <tt>==</tt> a given object.
- *  - #one?: Returns whether exactly one element <tt>==</tt> a given object.
- *  - #rindex: Returns the index of the last element that meets a given criterion.
- *
- *  === Methods for Comparing
- *
- *  - #<=>: Returns -1, 0, or 1, as +self+ is less than, equal to, or greater than a given object.
- *  - #==: Returns whether each element in +self+ is <tt>==</tt> to the corresponding element in a given object.
- *  - #eql?: Returns whether each element in +self+ is <tt>eql?</tt> to the corresponding element in a given object.
-
- *  === Methods for Fetching
- *
- *  These methods do not modify +self+.
- *
- *  - #[] (aliased as #slice): Returns consecutive elements as determined by a given argument.
- *  - #assoc: Returns the first element that is an array whose first element <tt>==</tt> a given object.
- *  - #at: Returns the element at a given offset.
- *  - #bsearch: Returns an element selected via a binary search as determined by a given block.
- *  - #bsearch_index: Returns the index of an element selected via a binary search as determined by a given block.
- *  - #compact: Returns an array containing all non-+nil+ elements.
- *  - #dig: Returns the object in nested objects that is specified by a given index and additional arguments.
- *  - #drop: Returns trailing elements as determined by a given index.
- *  - #drop_while: Returns trailing elements as determined by a given block.
- *  - #fetch: Returns the element at a given offset.
- *  - #fetch_values: Returns elements at given offsets.
- *  - #first: Returns one or more leading elements.
- *  - #last: Returns one or more trailing elements.
- *  - #max: Returns one or more maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
- *  - #min: Returns one or more minimum-valued elements, as determined by <tt>#<=></tt> or a given block.
- *  - #minmax: Returns the minimum-valued and maximum-valued elements, as determined by <tt>#<=></tt> or a given block.
- *  - #rassoc: Returns the first element that is an array whose second element <tt>==</tt> a given object.
- *  - #reject: Returns an array containing elements not rejected by a given block.
- *  - #reverse: Returns all elements in reverse order.
- *  - #rotate: Returns all elements with some rotated from one end to the other.
- *  - #sample: Returns one or more random elements.
- *  - #select (aliased as #filter): Returns an array containing elements selected by a given block.
- *  - #shuffle: Returns elements in a random order.
- *  - #sort: Returns all elements in an order determined by <tt>#<=></tt> or a given block.
- *  - #take: Returns leading elements as determined by a given index.
- *  - #take_while: Returns leading elements as determined by a given block.
- *  - #uniq: Returns an array containing non-duplicate elements.
- *  - #values_at: Returns the elements at given offsets.
- *
- *  === Methods for Assigning
- *
- *  These methods add, replace, or reorder elements in +self+.
- *
- *  - #<<: Appends an element.
- *  - #[]=: Assigns specified elements with a given object.
- *  - #concat: Appends all elements from given arrays.
- *  - #fill: Replaces specified elements with specified objects.
- *  - #flatten!: Replaces each nested array in +self+ with the elements from that array.
- *  - #initialize_copy (aliased as #replace): Replaces the content of +self+ with the content of a given array.
- *  - #insert: Inserts given objects at a given offset; does not replace elements.
- *  - #push (aliased as #append): Appends elements.
- *  - #reverse!: Replaces +self+ with its elements reversed.
- *  - #rotate!: Replaces +self+ with its elements rotated.
- *  - #shuffle!: Replaces +self+ with its elements in random order.
- *  - #sort!: Replaces +self+ with its elements sorted, as determined by <tt>#<=></tt> or a given block.
- *  - #sort_by!: Replaces +self+ with its elements sorted, as determined by a given block.
- *  - #unshift (aliased as #prepend): Prepends leading elements.
- *
- *  === Methods for Deleting
- *
- *  Each of these methods removes elements from +self+:
- *
- *  - #clear: Removes all elements.
- *  - #compact!: Removes all +nil+ elements.
- *  - #delete: Removes elements equal to a given object.
- *  - #delete_at: Removes the element at a given offset.
- *  - #delete_if: Removes elements specified by a given block.
- *  - #keep_if: Removes elements not specified by a given block.
- *  - #pop: Removes and returns the last element.
- *  - #reject!: Removes elements specified by a given block.
- *  - #select! (aliased as #filter!): Removes elements not specified by a given block.
- *  - #shift:  Removes and returns the first element.
- *  - #slice!: Removes and returns a sequence of elements.
- *  - #uniq!: Removes duplicates.
- *
- *  === Methods for Combining
- *
- *  - #&: Returns an array containing elements found both in +self+ and a given array.
- *  - #+: Returns an array containing all elements of +self+ followed by all elements of a given array.
- *  - #-: Returns an array containing all elements of +self+ that are not found in a given array.
- *  - #|: Returns an array containing all element of +self+ and all elements of a given array, duplicates removed.
- *  - #difference: Returns an array containing all elements of +self+ that are not found in any of the given arrays..
- *  - #intersection: Returns an array containing elements found both in +self+ and in each given array.
- *  - #product: Returns or yields all combinations of elements from +self+ and given arrays.
- *  - #reverse: Returns an array containing all elements of +self+ in reverse order.
- *  - #union: Returns an array containing all elements of +self+ and all elements of given arrays, duplicates removed.
- *
- *  === Methods for Iterating
- *
- *  - #combination: Calls a given block with combinations of elements of +self+; a combination does not use the same element more than once.
- *  - #cycle: Calls a given block with each element, then does so again, for a specified number of times, or forever.
- *  - #each: Passes each element to a given block.
- *  - #each_index: Passes each element index to a given block.
- *  - #permutation: Calls a given block with permutations of elements of +self+; a permutation does not use the same element more than once.
- *  - #repeated_combination: Calls a given block with combinations of elements of +self+; a combination may use the same element more than once.
- *  - #repeated_permutation: Calls a given block with permutations of elements of +self+; a permutation may use the same element more than once.
- *  - #reverse_each:  Passes each element, in reverse order, to a given block.
- *
- *  === Methods for Converting
- *
- *  - #collect (aliased as #map): Returns an array containing the block return-value for each element.
- *  - #collect! (aliased as #map!): Replaces each element with a block return-value.
- *  - #flatten: Returns an array that is a recursive flattening of +self+.
- *  - #inspect (aliased as #to_s): Returns a new String containing the elements.
- *  - #join: Returns a newsString containing the elements joined by the field separator.
- *  - #to_a: Returns +self+ or a new array containing all elements.
- *  - #to_ary: Returns +self+.
- *  - #to_h: Returns a new hash formed from the elements.
- *  - #transpose: Transposes +self+, which must be an array of arrays.
- *  - #zip: Returns a new array of arrays containing +self+ and given arrays.
- *
- *  === Other Methods
- *
- *  - #*: Returns one of the following:
- *
- *    - With integer argument +n+, a new array that is the concatenation
- *      of +n+ copies of +self+.
- *    - With string argument +field_separator+, a new string that is equivalent to
- *      <tt>join(field_separator)</tt>.
- *
- *  - #pack: Packs the elements into a binary sequence.
- *  - #sum: Returns a sum of elements according to either <tt>+</tt> or a given block.
  */
 
 void
 Init_Array(void)
 {
-    fake_ary_flags = init_fake_ary_flags();
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
 
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
     rb_define_alloc_func(rb_cArray, empty_ary_alloc);
-    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
     rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
@@ -8752,6 +5817,7 @@ Init_Array(void)
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
     rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
+    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
     rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
     rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -8761,24 +5827,20 @@ Init_Array(void)
     rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
     rb_define_method(rb_cArray, "at", rb_ary_at, 1);
     rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
-    rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
-    rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
-    rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
-    rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
-    rb_define_method(rb_cArray, "intersect?", rb_ary_intersect_p, 1);
+    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
+    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
+    rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
-    rb_define_alias(rb_cArray,  "append", "push");
     rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
     rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
     rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
-    rb_define_alias(rb_cArray,  "prepend", "unshift");
     rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
     rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
     rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
-    rb_define_method(rb_cArray, "size", rb_ary_length, 0);
+    rb_define_alias(rb_cArray,  "size", "length");
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
     rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
     rb_define_method(rb_cArray, "index", rb_ary_index, -1);
@@ -8797,8 +5859,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
     rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
-    rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
-    rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
     rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
@@ -8827,10 +5887,6 @@ Init_Array(void)
     rb_define_method(rb_cArray, "&", rb_ary_and, 1);
     rb_define_method(rb_cArray, "|", rb_ary_or, 1);
 
-    rb_define_method(rb_cArray, "max", rb_ary_max, -1);
-    rb_define_method(rb_cArray, "min", rb_ary_min, -1);
-    rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
-
     rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
@@ -8838,6 +5894,9 @@ Init_Array(void)
     rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
     rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
     rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
     rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
     rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
     rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
@@ -8851,18 +5910,11 @@ Init_Array(void)
     rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
     rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
     rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
-    rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
-    rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
-    rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
-    rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
     rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
-    rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
-    rb_define_method(rb_cArray, "freeze", rb_ary_freeze, 0);
-
-    rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
 
-    rb_cArray_empty_frozen = rb_ary_freeze(rb_ary_new());
-    rb_vm_register_global_object(rb_cArray_empty_frozen);
+    id_cmp = rb_intern("<=>");
+    id_random = rb_intern("random");
+    id_div = rb_intern("div");
+    id_power = rb_intern("**");
 }
-
-#include "array.rbinc"
diff --git a/array.rb b/array.rb
deleted file mode 100644
index 5f31693cab..0000000000
--- a/array.rb
+++ /dev/null
@@ -1,284 +0,0 @@
-class Array
-  # call-seq:
-  #   shuffle!(random: Random) -> self
-  #
-  # Shuffles all elements in +self+ into a random order,
-  # as selected by the object given by the keyword argument +random+.
-  # Returns +self+:
-  #
-  #   a =             [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
-  #   a.shuffle! # => [5, 3, 8, 7, 6, 1, 9, 4, 2, 0]
-  #   a.shuffle! # => [9, 4, 0, 6, 2, 8, 1, 5, 3, 7]
-  #
-  # Duplicate elements are included:
-  #
-  #   a =             [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
-  #   a.shuffle! # => [1, 0, 0, 1, 1, 0, 1, 0, 0, 1]
-  #   a.shuffle! # => [0, 1, 0, 1, 1, 0, 1, 0, 1, 0]
-  #
-  # The object given with the keyword argument +random+ is used as the random number generator.
-  #
-  # Related: see {Methods for Assigning}[rdoc-ref:Array@Methods+for+Assigning].
-  def shuffle!(random: Random)
-    Primitive.rb_ary_shuffle_bang(random)
-  end
-
-  # call-seq:
-  #   shuffle(random: Random) -> new_array
-  #
-  # Returns a new array containing all elements from +self+ in a random order,
-  # as selected by the object given by the keyword argument +random+:
-  #
-  #   a =            [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
-  #   a.shuffle # => [0, 8, 1, 9, 6, 3, 4, 7, 2, 5]
-  #   a.shuffle # => [8, 9, 0, 5, 1, 2, 6, 4, 7, 3]
-  #
-  # Duplicate elements are included:
-  #
-  #   a =            [0, 1, 0, 1, 0, 1, 0, 1, 0, 1]
-  #   a.shuffle # => [1, 0, 1, 1, 0, 0, 1, 0, 0, 1]
-  #   a.shuffle # => [1, 1, 0, 0, 0, 1, 1, 0, 0, 1]
-  #
-  # The object given with the keyword argument +random+ is used as the random number generator.
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def shuffle(random: Random)
-    Primitive.rb_ary_shuffle(random)
-  end
-
-  # call-seq:
-  #   sample(random: Random) -> object
-  #   sample(count, random: Random) -> new_ary
-  #
-  # Returns random elements from +self+,
-  # as selected by the object given by the keyword argument +random+.
-  #
-  # With no argument +count+ given, returns one random element from +self+:
-  #
-  #   a = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
-  #   a.sample # => 3
-  #   a.sample # => 8
-  #
-  # Returns +nil+ if +self+ is empty:
-  #
-  #   [].sample # => nil
-  #
-  # With a non-negative numeric argument +count+ given,
-  # returns a new array containing +count+ random elements from +self+:
-  #
-  #   a.sample(3) # => [8, 9, 2]
-  #   a.sample(6) # => [9, 6, 0, 3, 1, 4]
-  #
-  # The order of the result array is unrelated to the order of +self+.
-  #
-  # Returns a new empty array if +self+ is empty:
-  #
-  #   [].sample(4) # => []
-  #
-  # May return duplicates in +self+:
-  #
-  #   a = [1, 1, 1, 2, 2, 3]
-  #   a.sample(a.size) # => [1, 1, 3, 2, 1, 2]
-  #
-  # Returns no more than <tt>a.size</tt> elements
-  # (because no new duplicates are introduced):
-  #
-  #   a.sample(50) # => [6, 4, 1, 8, 5, 9, 0, 2, 3, 7]
-  #
-  # The object given with the keyword argument +random+ is used as the random number generator:
-  #
-  #   a = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
-  #   a.sample(random: Random.new(1))     # => 6
-  #   a.sample(4, random: Random.new(1))  # => [6, 10, 9, 2]
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def sample(n = (ary = false), random: Random)
-    if Primitive.mandatory_only?
-      # Primitive.cexpr! %{ rb_ary_sample(self, rb_cRandom, Qfalse, Qfalse) }
-      Primitive.ary_sample0
-    else
-      # Primitive.cexpr! %{ rb_ary_sample(self, random, n, ary) }
-      Primitive.ary_sample(random, n, ary)
-    end
-  end
-
-  # call-seq:
-  #   first -> object or nil
-  #   first(count) -> new_array
-  #
-  # Returns elements from +self+, or +nil+; does not modify +self+.
-  #
-  # With no argument given, returns the first element (if available):
-  #
-  #   a = [:foo, 'bar', 2]
-  #   a.first # => :foo
-  #   a # => [:foo, "bar", 2]
-  #
-  # If +self+ is empty, returns +nil+.
-  #
-  #   [].first # => nil
-  #
-  # With a non-negative integer argument +count+ given,
-  # returns the first +count+ elements (as available) in a new array:
-  #
-  #   a.first(0)  # => []
-  #   a.first(2)  # => [:foo, "bar"]
-  #   a.first(50) # => [:foo, "bar", 2]
-  #
-  # Related: see {Methods for Querying}[rdoc-ref:Array@Methods+for+Querying].
-  def first n = unspecified = true
-    if Primitive.mandatory_only?
-      Primitive.attr! :leaf
-      Primitive.cexpr! %q{ ary_first(self) }
-    else
-      if unspecified
-        Primitive.cexpr! %q{ ary_first(self) }
-      else
-        Primitive.cexpr! %q{  ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_FIRST) }
-      end
-    end
-  end
-
-  # call-seq:
-  #  last  -> last_object or nil
-  #  last(count) -> new_array
-  #
-  # Returns elements from +self+, or +nil+; +self+ is not modified.
-  #
-  # With no argument given, returns the last element, or +nil+ if +self+ is empty:
-  #
-  #   a = [:foo, 'bar', 2]
-  #   a.last # => 2
-  #   a # => [:foo, "bar", 2]
-  #   [].last # => nil
-  #
-  #
-  # With non-negative integer argument +count+ given,
-  # returns a new array containing the trailing +count+ elements of +self+, as available:
-  #
-  #   a = [:foo, 'bar', 2]
-  #   a.last(2)  # => ["bar", 2]
-  #   a.last(50) # => [:foo, "bar", 2]
-  #   a.last(0)  # => []
-  #   [].last(3) # => []
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def last n = unspecified = true
-    if Primitive.mandatory_only?
-      Primitive.attr! :leaf
-      Primitive.cexpr! %q{ ary_last(self) }
-    else
-      if unspecified
-        Primitive.cexpr! %q{ ary_last(self) }
-      else
-        Primitive.cexpr! %q{ ary_take_first_or_last_n(self, NUM2LONG(n), ARY_TAKE_LAST) }
-      end
-    end
-  end
-
-  # call-seq:
-  #   fetch_values(*indexes) -> new_array
-  #   fetch_values(*indexes) { |index| ... } -> new_array
-  #
-  # With no block given, returns a new array containing the elements of +self+
-  # at the offsets specified by +indexes+. Each of the +indexes+ must be an
-  # {integer-convertible object}[rdoc-ref:implicit_conversion.rdoc@Integer-Convertible+Objects]:
-  #
-  #    a = [:foo, :bar, :baz]
-  #    a.fetch_values(2, 0)   # => [:baz, :foo]
-  #    a.fetch_values(2.1, 0) # => [:baz, :foo]
-  #    a.fetch_values         # => []
-  #
-  # For a negative index, counts backwards from the end of the array:
-  #
-  #    a.fetch_values(-2, -1) # [:bar, :baz]
-  #
-  # When no block is given, raises an exception if any index is out of range.
-  #
-  # With a block given, for each index:
-  #
-  # - If the index is in range, uses an element of +self+ (as above).
-  # - Otherwise, calls the block with the index and uses the block's return value.
-  #
-  # Example:
-  #
-  #   a = [:foo, :bar, :baz]
-  #   a.fetch_values(1, 0, 42, 777) { |index| index.to_s }
-  #   # => [:bar, :foo, "42", "777"]
-  #
-  # Related: see {Methods for Fetching}[rdoc-ref:Array@Methods+for+Fetching].
-  def fetch_values(*indexes, &block)
-    indexes.map! { |i| fetch(i, &block) }
-    indexes
-  end
-
-  with_yjit do
-    if Primitive.rb_builtin_basic_definition_p(:each)
-      undef :each
-
-      def each # :nodoc:
-        Primitive.attr! :inline_block, :c_trace
-
-        unless defined?(yield)
-          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
-        end
-        _i = 0
-        value = nil
-        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
-          yield value
-        end
-        self
-      end
-    end
-
-    if Primitive.rb_builtin_basic_definition_p(:map)
-      undef :map
-
-      def map # :nodoc:
-        Primitive.attr! :inline_block, :c_trace
-
-        unless defined?(yield)
-          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
-        end
-
-        _i = 0
-        value = nil
-        result = Primitive.ary_sized_alloc
-        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
-          result << yield(value)
-        end
-        result
-      end
-
-      if Primitive.rb_builtin_basic_definition_p(:collect)
-        undef :collect
-        alias collect map
-      end
-    end
-
-    if Primitive.rb_builtin_basic_definition_p(:select)
-      undef :select
-
-      def select # :nodoc:
-        Primitive.attr! :inline_block, :c_trace
-
-        unless defined?(yield)
-          return Primitive.cexpr! 'SIZED_ENUMERATOR(self, 0, 0, ary_enum_length)'
-        end
-
-        _i = 0
-        value = nil
-        result = Primitive.ary_sized_alloc
-        while Primitive.cexpr!(%q{ ary_fetch_next(self, LOCAL_PTR(_i), LOCAL_PTR(value)) })
-          result << value if yield value
-        end
-        result
-      end
-
-      if Primitive.rb_builtin_basic_definition_p(:filter)
-        undef :filter
-        alias filter select
-      end
-    end
-  end
-end
diff --git a/ast.c b/ast.c
deleted file mode 100644
index b98fba6fab..0000000000
--- a/ast.c
+++ /dev/null
@@ -1,1128 +0,0 @@
-/* indent-tabs-mode: nil */
-#include "internal.h"
-#include "internal/ruby_parser.h"
-#include "internal/symbol.h"
-#include "internal/warnings.h"
-#include "iseq.h"
-#include "node.h"
-#include "ruby.h"
-#include "ruby/encoding.h"
-#include "ruby/util.h"
-#include "vm_core.h"
-
-#include "builtin.h"
-
-static VALUE rb_mAST;
-static VALUE rb_cNode;
-static VALUE rb_cLocation;
-
-struct ASTNodeData {
-    VALUE ast_value;
-    const NODE *node;
-};
-
-static void
-node_gc_mark(void *ptr)
-{
-    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
-    rb_gc_mark(data->ast_value);
-}
-
-static size_t
-node_memsize(const void *ptr)
-{
-    struct ASTNodeData *data = (struct ASTNodeData *)ptr;
-    rb_ast_t *ast = rb_ruby_ast_data_get(data->ast_value);
-
-    return sizeof(struct ASTNodeData) + rb_ast_memsize(ast);
-}
-
-static const rb_data_type_t rb_node_type = {
-    "AST/node",
-    {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
-    0, 0,
-    RUBY_TYPED_FREE_IMMEDIATELY,
-};
-
-struct ASTLocationData {
-    int first_lineno;
-    int first_column;
-    int last_lineno;
-    int last_column;
-};
-
-static void
-location_gc_mark(void *ptr)
-{
-}
-
-static size_t
-location_memsize(const void *ptr)
-{
-    return sizeof(struct ASTLocationData);
-}
-
-static const rb_data_type_t rb_location_type = {
-    "AST/location",
-    {location_gc_mark, RUBY_TYPED_DEFAULT_FREE, location_memsize,},
-    0, 0,
-    RUBY_TYPED_FREE_IMMEDIATELY,
-};
-
-
-static VALUE rb_ast_node_alloc(VALUE klass);
-
-static void
-setup_node(VALUE obj, VALUE ast_value, const NODE *node)
-{
-    struct ASTNodeData *data;
-
-    TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
-    data->ast_value = ast_value;
-    data->node = node;
-}
-
-static VALUE
-ast_new_internal(VALUE ast_value, const NODE *node)
-{
-    VALUE obj;
-
-    obj = rb_ast_node_alloc(rb_cNode);
-    setup_node(obj, ast_value, node);
-
-    return obj;
-}
-
-static VALUE rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
-static VALUE rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens);
-
-static VALUE
-ast_parse_new(void)
-{
-    return rb_parser_set_context(rb_parser_new(), NULL, 0);
-}
-
-static VALUE
-ast_parse_done(VALUE ast_value)
-{
-    rb_ast_t *ast = rb_ruby_ast_data_get(ast_value);
-
-    if (!ast->body.root) {
-        rb_ast_dispose(ast);
-        rb_exc_raise(GET_EC()->errinfo);
-    }
-
-    return ast_new_internal(ast_value, (NODE *)ast->body.root);
-}
-
-static VALUE
-setup_vparser(VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE vparser = ast_parse_new();
-    if (RTEST(keep_script_lines)) rb_parser_set_script_lines(vparser);
-    if (RTEST(error_tolerant)) rb_parser_error_tolerant(vparser);
-    if (RTEST(keep_tokens)) rb_parser_keep_tokens(vparser);
-    return vparser;
-}
-
-static VALUE
-ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    return rb_ast_parse_str(str, keep_script_lines, error_tolerant, keep_tokens);
-}
-
-static VALUE
-rb_ast_parse_str(VALUE str, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE ast_value = Qnil;
-    StringValue(str);
-    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
-    ast_value = rb_parser_compile_string_path(vparser, Qnil, str, 1);
-    return ast_parse_done(ast_value);
-}
-
-static VALUE
-ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    return rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
-}
-
-static VALUE
-rb_ast_parse_file(VALUE path, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE f;
-    VALUE ast_value = Qnil;
-    rb_encoding *enc = rb_utf8_encoding();
-
-    f = rb_file_open_str(path, "r");
-    rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
-    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
-    ast_value = rb_parser_compile_file_path(vparser, Qnil, f, 1);
-    rb_io_close(f);
-    return ast_parse_done(ast_value);
-}
-
-static VALUE
-rb_ast_parse_array(VALUE array, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE ast_value = Qnil;
-
-    array = rb_check_array_type(array);
-    VALUE vparser = setup_vparser(keep_script_lines, error_tolerant, keep_tokens);
-    ast_value = rb_parser_compile_array(vparser, Qnil, array, 1);
-    return ast_parse_done(ast_value);
-}
-
-static VALUE node_children(VALUE, const NODE*);
-
-static VALUE
-node_find(VALUE self, const int node_id)
-{
-    VALUE ary;
-    long i;
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    if (nd_node_id(data->node) == node_id) return self;
-
-    ary = node_children(data->ast_value, data->node);
-
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        VALUE child = RARRAY_AREF(ary, i);
-
-        if (CLASS_OF(child) == rb_cNode) {
-            VALUE result = node_find(child, node_id);
-            if (RTEST(result)) return result;
-        }
-    }
-
-    return Qnil;
-}
-
-extern VALUE rb_e_script;
-
-static VALUE
-node_id_for_backtrace_location(rb_execution_context_t *ec, VALUE module, VALUE location)
-{
-    int node_id;
-
-    if (!rb_frame_info_p(location)) {
-        rb_raise(rb_eTypeError, "Thread::Backtrace::Location object expected");
-    }
-
-    node_id = rb_get_node_id_from_frame_info(location);
-    if (node_id == -1) {
-        return Qnil;
-    }
-
-    return INT2NUM(node_id);
-}
-
-static VALUE
-ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body, VALUE keep_script_lines, VALUE error_tolerant, VALUE keep_tokens)
-{
-    VALUE node, lines = Qnil;
-    const rb_iseq_t *iseq;
-    int node_id;
-
-    if (rb_frame_info_p(body)) {
-        iseq = rb_get_iseq_from_frame_info(body);
-        node_id = rb_get_node_id_from_frame_info(body);
-    }
-    else {
-        iseq = NULL;
-
-        if (rb_obj_is_proc(body)) {
-            iseq = vm_proc_iseq(body);
-
-            if (!rb_obj_is_iseq((VALUE)iseq)) return Qnil;
-        }
-        else {
-            iseq = rb_method_iseq(body);
-        }
-        if (iseq) {
-            node_id = ISEQ_BODY(iseq)->location.node_id;
-        }
-    }
-
-    if (!iseq) {
-        return Qnil;
-    }
-
-    if (ISEQ_BODY(iseq)->prism) {
-        rb_raise(rb_eRuntimeError, "cannot get AST for ISEQ compiled by prism");
-    }
-
-    lines = ISEQ_BODY(iseq)->variable.script_lines;
-
-    VALUE path = rb_iseq_path(iseq);
-    int e_option = RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0;
-
-    if (NIL_P(lines) && rb_iseq_from_eval_p(iseq) && !e_option) {
-        rb_raise(rb_eArgError, "cannot get AST for method defined in eval");
-    }
-
-    if (!NIL_P(lines)) {
-        node = rb_ast_parse_array(lines, keep_script_lines, error_tolerant, keep_tokens);
-    }
-    else if (e_option) {
-        node = rb_ast_parse_str(rb_e_script, keep_script_lines, error_tolerant, keep_tokens);
-    }
-    else {
-        node = rb_ast_parse_file(path, keep_script_lines, error_tolerant, keep_tokens);
-    }
-
-    return node_find(node, node_id);
-}
-
-static VALUE
-rb_ast_node_alloc(VALUE klass)
-{
-    struct ASTNodeData *data;
-    VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
-
-    return obj;
-}
-
-static const char*
-node_type_to_str(const NODE *node)
-{
-    return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
-}
-
-static VALUE
-ast_node_type(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
-}
-
-static VALUE
-ast_node_node_id(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2FIX(nd_node_id(data->node));
-}
-
-#define NEW_CHILD(ast_value, node) (node ? ast_new_internal(ast_value, node) : Qnil)
-
-static VALUE
-rb_ary_new_from_node_args(VALUE ast_value, long n, ...)
-{
-    va_list ar;
-    VALUE ary;
-    long i;
-
-    ary = rb_ary_new2(n);
-
-    va_start(ar, n);
-    for (i=0; i<n; i++) {
-        NODE *node;
-        node = va_arg(ar, NODE *);
-        rb_ary_push(ary, NEW_CHILD(ast_value, node));
-    }
-    va_end(ar);
-    return ary;
-}
-
-static VALUE
-dump_block(VALUE ast_value, const struct RNode_BLOCK *node)
-{
-    VALUE ary = rb_ary_new();
-    do {
-        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
-    } while (node->nd_next &&
-        nd_type_p(node->nd_next, NODE_BLOCK) &&
-        (node = RNODE_BLOCK(node->nd_next), 1));
-    if (node->nd_next) {
-        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
-    }
-
-    return ary;
-}
-
-static VALUE
-dump_array(VALUE ast_value, const struct RNode_LIST *node)
-{
-    VALUE ary = rb_ary_new();
-    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
-
-    while (node->nd_next && nd_type_p(node->nd_next, NODE_LIST)) {
-        node = RNODE_LIST(node->nd_next);
-        rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_head));
-    }
-    rb_ary_push(ary, NEW_CHILD(ast_value, node->nd_next));
-
-    return ary;
-}
-
-static VALUE
-dump_parser_array(VALUE ast_value, rb_parser_ary_t *p_ary)
-{
-    VALUE ary;
-
-    if (p_ary->data_type != PARSER_ARY_DATA_NODE) {
-        rb_bug("unexpected rb_parser_ary_data_type: %d", p_ary->data_type);
-    }
-
-    ary = rb_ary_new();
-
-    for (long i = 0; i < p_ary->len; i++) {
-        rb_ary_push(ary, NEW_CHILD(ast_value, p_ary->data[i]));
-    }
-
-    return ary;
-}
-
-static VALUE
-var_name(ID id)
-{
-    if (!id) return Qnil;
-    if (!rb_id2str(id)) return Qnil;
-    return ID2SYM(id);
-}
-
-static VALUE
-no_name_rest(void)
-{
-    ID rest;
-    CONST_ID(rest, "NODE_SPECIAL_NO_NAME_REST");
-    return ID2SYM(rest);
-}
-
-static VALUE
-rest_arg(VALUE ast_value, const NODE *rest_arg)
-{
-    return NODE_NAMED_REST_P(rest_arg) ? NEW_CHILD(ast_value, rest_arg) : no_name_rest();
-}
-
-static VALUE
-node_children(VALUE ast_value, const NODE *node)
-{
-    char name[sizeof("$") + DECIMAL_SIZE_OF(long)];
-
-    enum node_type type = nd_type(node);
-    switch (type) {
-      case NODE_BLOCK:
-        return dump_block(ast_value, RNODE_BLOCK(node));
-      case NODE_IF:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IF(node)->nd_cond, RNODE_IF(node)->nd_body, RNODE_IF(node)->nd_else);
-      case NODE_UNLESS:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_UNLESS(node)->nd_cond, RNODE_UNLESS(node)->nd_body, RNODE_UNLESS(node)->nd_else);
-      case NODE_CASE:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE(node)->nd_head, RNODE_CASE(node)->nd_body);
-      case NODE_CASE2:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE2(node)->nd_head, RNODE_CASE2(node)->nd_body);
-      case NODE_CASE3:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_CASE3(node)->nd_head, RNODE_CASE3(node)->nd_body);
-      case NODE_WHEN:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_WHEN(node)->nd_head, RNODE_WHEN(node)->nd_body, RNODE_WHEN(node)->nd_next);
-      case NODE_IN:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_IN(node)->nd_head, RNODE_IN(node)->nd_body, RNODE_IN(node)->nd_next);
-      case NODE_WHILE:
-      case NODE_UNTIL:
-        return rb_ary_push(rb_ary_new_from_node_args(ast_value, 2, RNODE_WHILE(node)->nd_cond, RNODE_WHILE(node)->nd_body),
-                           RBOOL(RNODE_WHILE(node)->nd_state));
-      case NODE_ITER:
-      case NODE_FOR:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ITER(node)->nd_iter, RNODE_ITER(node)->nd_body);
-      case NODE_FOR_MASGN:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_FOR_MASGN(node)->nd_var);
-      case NODE_BREAK:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BREAK(node)->nd_stts);
-      case NODE_NEXT:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_NEXT(node)->nd_stts);
-      case NODE_RETURN:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_RETURN(node)->nd_stts);
-      case NODE_REDO:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_RETRY:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_BEGIN:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_BEGIN(node)->nd_body);
-      case NODE_RESCUE:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_RESCUE(node)->nd_head, RNODE_RESCUE(node)->nd_resq, RNODE_RESCUE(node)->nd_else);
-      case NODE_RESBODY:
-        return rb_ary_new_from_node_args(ast_value, 4, RNODE_RESBODY(node)->nd_args, RNODE_RESBODY(node)->nd_exc_var, RNODE_RESBODY(node)->nd_body, RNODE_RESBODY(node)->nd_next);
-      case NODE_ENSURE:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ENSURE(node)->nd_head, RNODE_ENSURE(node)->nd_ensr);
-      case NODE_AND:
-      case NODE_OR:
-        {
-            VALUE ary = rb_ary_new();
-
-            while (1) {
-                rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_1st));
-                if (!RNODE_AND(node)->nd_2nd || !nd_type_p(RNODE_AND(node)->nd_2nd, type))
-                    break;
-                node = RNODE_AND(node)->nd_2nd;
-            }
-            rb_ary_push(ary, NEW_CHILD(ast_value, RNODE_AND(node)->nd_2nd));
-            return ary;
-        }
-      case NODE_MASGN:
-        if (NODE_NAMED_REST_P(RNODE_MASGN(node)->nd_args)) {
-            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MASGN(node)->nd_value, RNODE_MASGN(node)->nd_head, RNODE_MASGN(node)->nd_args);
-        }
-        else {
-            return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_value),
-                                        NEW_CHILD(ast_value, RNODE_MASGN(node)->nd_head),
-                                        no_name_rest());
-        }
-      case NODE_LASGN:
-        if (NODE_REQUIRED_KEYWORD_P(RNODE_LASGN(node)->nd_value)) {
-            return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
-        }
-        return rb_ary_new_from_args(2, var_name(RNODE_LASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_LASGN(node)->nd_value));
-      case NODE_DASGN:
-        if (NODE_REQUIRED_KEYWORD_P(RNODE_DASGN(node)->nd_value)) {
-            return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
-        }
-        return rb_ary_new_from_args(2, var_name(RNODE_DASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_DASGN(node)->nd_value));
-      case NODE_IASGN:
-        return rb_ary_new_from_args(2, var_name(RNODE_IASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_IASGN(node)->nd_value));
-      case NODE_CVASGN:
-        return rb_ary_new_from_args(2, var_name(RNODE_CVASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CVASGN(node)->nd_value));
-      case NODE_GASGN:
-        return rb_ary_new_from_args(2, var_name(RNODE_GASGN(node)->nd_vid), NEW_CHILD(ast_value, RNODE_GASGN(node)->nd_value));
-      case NODE_CDECL:
-        if (RNODE_CDECL(node)->nd_vid) {
-            return rb_ary_new_from_args(2, ID2SYM(RNODE_CDECL(node)->nd_vid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
-        }
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_else), ID2SYM(RNODE_COLON2(RNODE_CDECL(node)->nd_else)->nd_mid), NEW_CHILD(ast_value, RNODE_CDECL(node)->nd_value));
-      case NODE_OP_ASGN1:
-        return rb_ary_new_from_args(4, NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_recv),
-                                    ID2SYM(RNODE_OP_ASGN1(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_index),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN1(node)->nd_rvalue));
-      case NODE_OP_ASGN2:
-        return rb_ary_new_from_args(5, NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_recv),
-                                    RBOOL(RNODE_OP_ASGN2(node)->nd_aid),
-                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_vid),
-                                    ID2SYM(RNODE_OP_ASGN2(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN2(node)->nd_value));
-      case NODE_OP_ASGN_AND:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_head), ID2SYM(idANDOP),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_AND(node)->nd_value));
-      case NODE_OP_ASGN_OR:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_head), ID2SYM(idOROP),
-                                    NEW_CHILD(ast_value, RNODE_OP_ASGN_OR(node)->nd_value));
-      case NODE_OP_CDECL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_head),
-                                    ID2SYM(RNODE_OP_CDECL(node)->nd_aid),
-                                    NEW_CHILD(ast_value, RNODE_OP_CDECL(node)->nd_value));
-      case NODE_CALL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_CALL(node)->nd_recv),
-                                    ID2SYM(RNODE_CALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_CALL(node)->nd_args));
-      case NODE_OPCALL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_recv),
-                                    ID2SYM(RNODE_OPCALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_OPCALL(node)->nd_args));
-      case NODE_QCALL:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_recv),
-                                    ID2SYM(RNODE_QCALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_QCALL(node)->nd_args));
-      case NODE_FCALL:
-        return rb_ary_new_from_args(2, ID2SYM(RNODE_FCALL(node)->nd_mid),
-                                    NEW_CHILD(ast_value, RNODE_FCALL(node)->nd_args));
-      case NODE_VCALL:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_VCALL(node)->nd_mid));
-      case NODE_SUPER:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SUPER(node)->nd_args);
-      case NODE_ZSUPER:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_LIST:
-        return dump_array(ast_value, RNODE_LIST(node));
-      case NODE_ZLIST:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_HASH:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_HASH(node)->nd_head);
-      case NODE_YIELD:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_YIELD(node)->nd_head);
-      case NODE_LVAR:
-        return rb_ary_new_from_args(1, var_name(RNODE_LVAR(node)->nd_vid));
-      case NODE_DVAR:
-        return rb_ary_new_from_args(1, var_name(RNODE_DVAR(node)->nd_vid));
-      case NODE_IVAR:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_IVAR(node)->nd_vid));
-      case NODE_CONST:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_CONST(node)->nd_vid));
-      case NODE_CVAR:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_CVAR(node)->nd_vid));
-      case NODE_GVAR:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_GVAR(node)->nd_vid));
-      case NODE_NTH_REF:
-        snprintf(name, sizeof(name), "$%ld", RNODE_NTH_REF(node)->nd_nth);
-        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
-      case NODE_BACK_REF:
-        name[0] = '$';
-        name[1] = (char)RNODE_BACK_REF(node)->nd_nth;
-        name[2] = '\0';
-        return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
-      case NODE_MATCH:
-        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
-      case NODE_MATCH2:
-        if (RNODE_MATCH2(node)->nd_args) {
-            return rb_ary_new_from_node_args(ast_value, 3, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value, RNODE_MATCH2(node)->nd_args);
-        }
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH2(node)->nd_recv, RNODE_MATCH2(node)->nd_value);
-      case NODE_MATCH3:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MATCH3(node)->nd_recv, RNODE_MATCH3(node)->nd_value);
-      case NODE_STR:
-      case NODE_XSTR:
-        return rb_ary_new_from_args(1, rb_node_str_string_val(node));
-      case NODE_INTEGER:
-        return rb_ary_new_from_args(1, rb_node_integer_literal_val(node));
-      case NODE_FLOAT:
-        return rb_ary_new_from_args(1, rb_node_float_literal_val(node));
-      case NODE_RATIONAL:
-        return rb_ary_new_from_args(1, rb_node_rational_literal_val(node));
-      case NODE_IMAGINARY:
-        return rb_ary_new_from_args(1, rb_node_imaginary_literal_val(node));
-      case NODE_REGX:
-        return rb_ary_new_from_args(1, rb_node_regx_string_val(node));
-      case NODE_ONCE:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_ONCE(node)->nd_body);
-      case NODE_DSTR:
-      case NODE_DXSTR:
-      case NODE_DREGX:
-      case NODE_DSYM:
-        {
-            struct RNode_LIST *n = RNODE_DSTR(node)->nd_next;
-            VALUE head = Qnil, next = Qnil;
-            if (n) {
-                head = NEW_CHILD(ast_value, n->nd_head);
-                next = NEW_CHILD(ast_value, n->nd_next);
-            }
-            return rb_ary_new_from_args(3, rb_node_dstr_string_val(node), head, next);
-        }
-      case NODE_SYM:
-        return rb_ary_new_from_args(1, rb_node_sym_string_val(node));
-      case NODE_EVSTR:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_EVSTR(node)->nd_body);
-      case NODE_ARGSCAT:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSCAT(node)->nd_head, RNODE_ARGSCAT(node)->nd_body);
-      case NODE_ARGSPUSH:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ARGSPUSH(node)->nd_head, RNODE_ARGSPUSH(node)->nd_body);
-      case NODE_SPLAT:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_SPLAT(node)->nd_head);
-      case NODE_BLOCK_PASS:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_BLOCK_PASS(node)->nd_head, RNODE_BLOCK_PASS(node)->nd_body);
-      case NODE_DEFN:
-        return rb_ary_new_from_args(2, ID2SYM(RNODE_DEFN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFN(node)->nd_defn));
-      case NODE_DEFS:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_recv), ID2SYM(RNODE_DEFS(node)->nd_mid), NEW_CHILD(ast_value, RNODE_DEFS(node)->nd_defn));
-      case NODE_ALIAS:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_ALIAS(node)->nd_1st, RNODE_ALIAS(node)->nd_2nd);
-      case NODE_VALIAS:
-        return rb_ary_new_from_args(2, ID2SYM(RNODE_VALIAS(node)->nd_alias), ID2SYM(RNODE_VALIAS(node)->nd_orig));
-      case NODE_UNDEF:
-        return rb_ary_new_from_args(1, dump_parser_array(ast_value, RNODE_UNDEF(node)->nd_undefs));
-      case NODE_CLASS:
-        return rb_ary_new_from_node_args(ast_value, 3, RNODE_CLASS(node)->nd_cpath, RNODE_CLASS(node)->nd_super, RNODE_CLASS(node)->nd_body);
-      case NODE_MODULE:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_MODULE(node)->nd_cpath, RNODE_MODULE(node)->nd_body);
-      case NODE_SCLASS:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_SCLASS(node)->nd_recv, RNODE_SCLASS(node)->nd_body);
-      case NODE_COLON2:
-        return rb_ary_new_from_args(2, NEW_CHILD(ast_value, RNODE_COLON2(node)->nd_head), ID2SYM(RNODE_COLON2(node)->nd_mid));
-      case NODE_COLON3:
-        return rb_ary_new_from_args(1, ID2SYM(RNODE_COLON3(node)->nd_mid));
-      case NODE_DOT2:
-      case NODE_DOT3:
-      case NODE_FLIP2:
-      case NODE_FLIP3:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_DOT2(node)->nd_beg, RNODE_DOT2(node)->nd_end);
-      case NODE_SELF:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_NIL:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_TRUE:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_FALSE:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_ERRINFO:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_DEFINED:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_DEFINED(node)->nd_head);
-      case NODE_POSTEXE:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_POSTEXE(node)->nd_body);
-      case NODE_ATTRASGN:
-        return rb_ary_new_from_args(3, NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_recv), ID2SYM(RNODE_ATTRASGN(node)->nd_mid), NEW_CHILD(ast_value, RNODE_ATTRASGN(node)->nd_args));
-      case NODE_LAMBDA:
-        return rb_ary_new_from_node_args(ast_value, 1, RNODE_LAMBDA(node)->nd_body);
-      case NODE_OPT_ARG:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_OPT_ARG(node)->nd_body, RNODE_OPT_ARG(node)->nd_next);
-      case NODE_KW_ARG:
-        return rb_ary_new_from_node_args(ast_value, 2, RNODE_KW_ARG(node)->nd_body, RNODE_KW_ARG(node)->nd_next);
-      case NODE_POSTARG:
-        if (NODE_NAMED_REST_P(RNODE_POSTARG(node)->nd_1st)) {
-            return rb_ary_new_from_node_args(ast_value, 2, RNODE_POSTARG(node)->nd_1st, RNODE_POSTARG(node)->nd_2nd);
-        }
-        return rb_ary_new_from_args(2, no_name_rest(),
-                                    NEW_CHILD(ast_value, RNODE_POSTARG(node)->nd_2nd));
-      case NODE_ARGS:
-        {
-            struct rb_args_info *ainfo = &RNODE_ARGS(node)->nd_ainfo;
-            return rb_ary_new_from_args(10,
-                                        INT2NUM(ainfo->pre_args_num),
-                                        NEW_CHILD(ast_value, ainfo->pre_init),
-                                        NEW_CHILD(ast_value, (NODE *)ainfo->opt_args),
-                                        var_name(ainfo->first_post_arg),
-                                        INT2NUM(ainfo->post_args_num),
-                                        NEW_CHILD(ast_value, ainfo->post_init),
-                                        (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
-                                            ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
-                                            : var_name(ainfo->rest_arg)),
-                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, (NODE *)ainfo->kw_args)),
-                                        (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast_value, ainfo->kw_rest_arg)),
-                                        var_name(ainfo->block_arg));
-        }
-      case NODE_SCOPE:
-        {
-            rb_ast_id_table_t *tbl = RNODE_SCOPE(node)->nd_tbl;
-            int i, size = tbl ? tbl->size : 0;
-            VALUE locals = rb_ary_new_capa(size);
-            for (i = 0; i < size; i++) {
-                rb_ary_push(locals, var_name(tbl->ids[i]));
-            }
-            return rb_ary_new_from_args(3, locals, NEW_CHILD(ast_value, (NODE *)RNODE_SCOPE(node)->nd_args), NEW_CHILD(ast_value, RNODE_SCOPE(node)->nd_body));
-        }
-      case NODE_ARYPTN:
-        {
-            VALUE rest = rest_arg(ast_value, RNODE_ARYPTN(node)->rest_arg);
-            return rb_ary_new_from_args(4,
-                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->nd_pconst),
-                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->pre_args),
-                                        rest,
-                                        NEW_CHILD(ast_value, RNODE_ARYPTN(node)->post_args));
-        }
-      case NODE_FNDPTN:
-        {
-            VALUE pre_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->pre_rest_arg);
-            VALUE post_rest = rest_arg(ast_value, RNODE_FNDPTN(node)->post_rest_arg);
-            return rb_ary_new_from_args(4,
-                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->nd_pconst),
-                                        pre_rest,
-                                        NEW_CHILD(ast_value, RNODE_FNDPTN(node)->args),
-                                        post_rest);
-        }
-      case NODE_HSHPTN:
-        {
-            VALUE kwrest = RNODE_HSHPTN(node)->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
-                                                                                 NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwrestarg);
-
-            return rb_ary_new_from_args(3,
-                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pconst),
-                                        NEW_CHILD(ast_value, RNODE_HSHPTN(node)->nd_pkwargs),
-                                        kwrest);
-        }
-      case NODE_LINE:
-        return rb_ary_new_from_args(1, rb_node_line_lineno_val(node));
-      case NODE_FILE:
-        return rb_ary_new_from_args(1, rb_node_file_path_val(node));
-      case NODE_ENCODING:
-        return rb_ary_new_from_args(1, rb_node_encoding_val(node));
-      case NODE_ERROR:
-        return rb_ary_new_from_node_args(ast_value, 0);
-      case NODE_ARGS_AUX:
-      case NODE_LAST:
-        break;
-    }
-
-    rb_bug("node_children: unknown node: %s", ruby_node_name(type));
-}
-
-static VALUE
-ast_node_children(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return node_children(data->ast_value, data->node);
-}
-
-static int
-null_loc_p(rb_code_location_t *loc)
-{
-    return (loc->beg_pos.lineno == 0 && loc->beg_pos.column == -1 && loc->end_pos.lineno == 0 && loc->end_pos.column == -1);
-}
-
-static VALUE
-location_new(rb_code_location_t *loc)
-{
-    VALUE obj;
-    struct ASTLocationData *data;
-
-    if (null_loc_p(loc)) return Qnil;
-
-    obj = TypedData_Make_Struct(rb_cLocation, struct ASTLocationData, &rb_location_type, data);
-    data->first_lineno = loc->beg_pos.lineno;
-    data->first_column = loc->beg_pos.column;
-    data->last_lineno = loc->end_pos.lineno;
-    data->last_column = loc->end_pos.column;
-
-    return obj;
-}
-
-static VALUE
-node_locations(VALUE ast_value, const NODE *node)
-{
-    enum node_type type = nd_type(node);
-    switch (type) {
-      case NODE_ALIAS:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_ALIAS(node)->keyword_loc));
-      case NODE_AND:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_AND(node)->operator_loc));
-      case NODE_BLOCK_PASS:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_BLOCK_PASS(node)->operator_loc));
-      case NODE_BREAK:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_BREAK(node)->keyword_loc));
-      case NODE_CASE:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_CASE(node)->case_keyword_loc),
-                                    location_new(&RNODE_CASE(node)->end_keyword_loc));
-      case NODE_CASE2:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_CASE2(node)->case_keyword_loc),
-                                    location_new(&RNODE_CASE2(node)->end_keyword_loc));
-      case NODE_CASE3:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_CASE3(node)->case_keyword_loc),
-                                    location_new(&RNODE_CASE3(node)->end_keyword_loc));
-      case NODE_CLASS:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_CLASS(node)->class_keyword_loc),
-                                    location_new(&RNODE_CLASS(node)->inheritance_operator_loc),
-                                    location_new(&RNODE_CLASS(node)->end_keyword_loc));
-      case NODE_DOT2:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_DOT2(node)->operator_loc));
-      case NODE_DOT3:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_DOT3(node)->operator_loc));
-      case NODE_EVSTR:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_EVSTR(node)->opening_loc),
-                                    location_new(&RNODE_EVSTR(node)->closing_loc));
-      case NODE_FLIP2:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_FLIP2(node)->operator_loc));
-      case NODE_FLIP3:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_FLIP3(node)->operator_loc));
-      case NODE_FOR:
-        return rb_ary_new_from_args(5,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_FOR(node)->for_keyword_loc),
-                                    location_new(&RNODE_FOR(node)->in_keyword_loc),
-                                    location_new(&RNODE_FOR(node)->do_keyword_loc),
-                                    location_new(&RNODE_FOR(node)->end_keyword_loc));
-      case NODE_LAMBDA:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_LAMBDA(node)->operator_loc),
-                                    location_new(&RNODE_LAMBDA(node)->opening_loc),
-                                    location_new(&RNODE_LAMBDA(node)->closing_loc));
-      case NODE_IF:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_IF(node)->if_keyword_loc),
-                                    location_new(&RNODE_IF(node)->then_keyword_loc),
-                                    location_new(&RNODE_IF(node)->end_keyword_loc));
-      case NODE_NEXT:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_NEXT(node)->keyword_loc));
-      case NODE_OR:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_OR(node)->operator_loc));
-      case NODE_OP_ASGN1:
-        return rb_ary_new_from_args(5,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_OP_ASGN1(node)->call_operator_loc),
-                                    location_new(&RNODE_OP_ASGN1(node)->opening_loc),
-                                    location_new(&RNODE_OP_ASGN1(node)->closing_loc),
-                                    location_new(&RNODE_OP_ASGN1(node)->binary_operator_loc));
-      case NODE_OP_ASGN2:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_OP_ASGN2(node)->call_operator_loc),
-                                    location_new(&RNODE_OP_ASGN2(node)->message_loc),
-                                    location_new(&RNODE_OP_ASGN2(node)->binary_operator_loc));
-      case NODE_POSTEXE:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_POSTEXE(node)->keyword_loc),
-                                    location_new(&RNODE_POSTEXE(node)->opening_loc),
-                                    location_new(&RNODE_POSTEXE(node)->closing_loc));
-      case NODE_REDO:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_REDO(node)->keyword_loc));
-      case NODE_REGX:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_REGX(node)->opening_loc),
-                                    location_new(&RNODE_REGX(node)->content_loc),
-                                    location_new(&RNODE_REGX(node)->closing_loc));
-      case NODE_RETURN:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_RETURN(node)->keyword_loc));
-      case NODE_SPLAT:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_SPLAT(node)->operator_loc));
-      case NODE_SUPER:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_SUPER(node)->keyword_loc),
-                                    location_new(&RNODE_SUPER(node)->lparen_loc),
-                                    location_new(&RNODE_SUPER(node)->rparen_loc));
-      case NODE_UNDEF:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_UNDEF(node)->keyword_loc));
-      case NODE_UNLESS:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_UNLESS(node)->keyword_loc),
-                                    location_new(&RNODE_UNLESS(node)->then_keyword_loc),
-                                    location_new(&RNODE_UNLESS(node)->end_keyword_loc));
-      case NODE_VALIAS:
-        return rb_ary_new_from_args(2,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_VALIAS(node)->keyword_loc));
-      case NODE_WHEN:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_WHEN(node)->keyword_loc),
-                                    location_new(&RNODE_WHEN(node)->then_keyword_loc));
-      case NODE_WHILE:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_WHILE(node)->keyword_loc),
-                                    location_new(&RNODE_WHILE(node)->closing_loc));
-      case NODE_UNTIL:
-        return rb_ary_new_from_args(3,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_UNTIL(node)->keyword_loc),
-                                    location_new(&RNODE_UNTIL(node)->closing_loc));
-      case NODE_YIELD:
-        return rb_ary_new_from_args(4,
-                                    location_new(nd_code_loc(node)),
-                                    location_new(&RNODE_YIELD(node)->keyword_loc),
-                                    location_new(&RNODE_YIELD(node)->lparen_loc),
-                                    location_new(&RNODE_YIELD(node)->rparen_loc));
-      case NODE_ARGS_AUX:
-      case NODE_LAST:
-        break;
-      default:
-        return rb_ary_new_from_args(1, location_new(nd_code_loc(node)));
-    }
-
-    rb_bug("node_locations: unknown node: %s", ruby_node_name(type));
-}
-
-static VALUE
-ast_node_locations(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return node_locations(data->ast_value, data->node);
-}
-
-static VALUE
-ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_first_lineno(data->node));
-}
-
-static VALUE
-ast_node_first_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_first_column(data->node));
-}
-
-static VALUE
-ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_last_lineno(data->node));
-}
-
-static VALUE
-ast_node_last_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    return INT2NUM(nd_last_column(data->node));
-}
-
-static VALUE
-ast_node_all_tokens(rb_execution_context_t *ec, VALUE self)
-{
-    long i;
-    struct ASTNodeData *data;
-    rb_ast_t *ast;
-    rb_parser_ary_t *parser_tokens;
-    rb_parser_ast_token_t *parser_token;
-    VALUE str, loc, token, all_tokens;
-
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-    ast = rb_ruby_ast_data_get(data->ast_value);
-
-    parser_tokens = ast->node_buffer->tokens;
-    if (parser_tokens == NULL) {
-        return Qnil;
-    }
-
-    all_tokens = rb_ary_new2(parser_tokens->len);
-    for (i = 0; i < parser_tokens->len; i++) {
-        parser_token = parser_tokens->data[i];
-        str = rb_str_new(parser_token->str->ptr, parser_token->str->len);
-        loc = rb_ary_new_from_args(4,
-            INT2FIX(parser_token->loc.beg_pos.lineno),
-            INT2FIX(parser_token->loc.beg_pos.column),
-            INT2FIX(parser_token->loc.end_pos.lineno),
-            INT2FIX(parser_token->loc.end_pos.column)
-        );
-        token = rb_ary_new_from_args(4, INT2FIX(parser_token->id), ID2SYM(rb_intern(parser_token->type_name)), str, loc);
-        rb_ary_push(all_tokens, token);
-    }
-    rb_ary_freeze(all_tokens);
-
-    return all_tokens;
-}
-
-static VALUE
-ast_node_inspect(rb_execution_context_t *ec, VALUE self)
-{
-    VALUE str;
-    VALUE cname;
-    struct ASTNodeData *data;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
-    cname = rb_class_path(rb_obj_class(self));
-    str = rb_str_new2("#<");
-
-    rb_str_append(str, cname);
-    rb_str_catf(str, ":%s@%d:%d-%d:%d>",
-                node_type_to_str(data->node),
-                nd_first_lineno(data->node), nd_first_column(data->node),
-                nd_last_lineno(data->node), nd_last_column(data->node));
-
-    return str;
-}
-
-static VALUE
-ast_node_script_lines(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTNodeData *data;
-    rb_ast_t *ast;
-    TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-    ast = rb_ruby_ast_data_get(data->ast_value);
-    rb_parser_ary_t *ret = ast->body.script_lines;
-    return rb_parser_build_script_lines_from(ret);
-}
-
-static VALUE
-ast_location_first_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->first_lineno);
-}
-
-static VALUE
-ast_location_first_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->first_column);
-}
-
-static VALUE
-ast_location_last_lineno(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->last_lineno);
-}
-
-static VALUE
-ast_location_last_column(rb_execution_context_t *ec, VALUE self)
-{
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    return INT2NUM(data->last_column);
-}
-
-static VALUE
-ast_location_inspect(rb_execution_context_t *ec, VALUE self)
-{
-    VALUE str;
-    VALUE cname;
-    struct ASTLocationData *data;
-    TypedData_Get_Struct(self, struct ASTLocationData, &rb_location_type, data);
-
-    cname = rb_class_path(rb_obj_class(self));
-    str = rb_str_new2("#<");
-
-    rb_str_append(str, cname);
-    rb_str_catf(str, ":@%d:%d-%d:%d>",
-                data->first_lineno, data->first_column,
-                data->last_lineno, data->last_column);
-
-    return str;
-}
-
-#include "ast.rbinc"
-
-void
-Init_ast(void)
-{
-    rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
-    rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
-    rb_cLocation = rb_define_class_under(rb_mAST, "Location", rb_cObject);
-    rb_undef_alloc_func(rb_cNode);
-    rb_undef_alloc_func(rb_cLocation);
-}
diff --git a/ast.rb b/ast.rb
deleted file mode 100644
index 6380621780..0000000000
--- a/ast.rb
+++ /dev/null
@@ -1,332 +0,0 @@
-# for ast.c
-
-# AbstractSyntaxTree provides methods to parse Ruby code into
-# abstract syntax trees. The nodes in the tree
-# are instances of RubyVM::AbstractSyntaxTree::Node.
-#
-# This module is MRI specific as it exposes implementation details
-# of the MRI abstract syntax tree.
-#
-# This module is experimental and its API is not stable, therefore it might
-# change without notice. As examples, the order of children nodes is not
-# guaranteed, the number of children nodes might change, there is no way to
-# access children nodes by name, etc.
-#
-# If you are looking for a stable API or an API working under multiple Ruby
-# implementations, consider using the _prism_ gem, which is the official
-# Ruby API to parse Ruby code.
-#
-module RubyVM::AbstractSyntaxTree
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.parse(string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
-  #
-  #  Parses the given _string_ into an abstract syntax tree,
-  #  returning the root node of that tree.
-  #
-  #    RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
-  #    # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
-  #
-  #  If <tt>keep_script_lines: true</tt> option is provided, the text of the parsed
-  #  source is associated with nodes and is available via Node#script_lines.
-  #
-  #  If <tt>keep_tokens: true</tt> option is provided, Node#tokens are populated.
-  #
-  #  SyntaxError is raised if the given _string_ is invalid syntax. To overwrite this
-  #  behavior, <tt>error_tolerant: true</tt> can be provided. In this case, the parser
-  #  will produce a tree where expressions with syntax errors would be represented by
-  #  Node with <tt>type=:ERROR</tt>.
-  #
-  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2")
-  #     # <internal:ast>:33:in `parse': syntax error, unexpected ';', expecting ')' (SyntaxError)
-  #     # x = 1; p(x; y=2
-  #     #           ^
-  #
-  #     root = RubyVM::AbstractSyntaxTree.parse("x = 1; p(x; y=2", error_tolerant: true)
-  #     # (SCOPE@1:0-1:15
-  #     #  tbl: [:x, :y]
-  #     #  args: nil
-  #     #  body: (BLOCK@1:0-1:15 (LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)) (ERROR@1:7-1:11) (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))))
-  #     root.children.last.children
-  #     # [(LASGN@1:0-1:5 :x (LIT@1:4-1:5 1)),
-  #     #  (ERROR@1:7-1:11),
-  #     #  (LASGN@1:12-1:15 :y (LIT@1:14-1:15 2))]
-  #
-  #  Note that parsing continues even after the errored expression.
-  #
-  def self.parse string, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
-    Primitive.ast_s_parse string, keep_script_lines, error_tolerant, keep_tokens
-  end
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.parse_file(pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
-  #
-  #   Reads the file from _pathname_, then parses it like ::parse,
-  #   returning the root node of the abstract syntax tree.
-  #
-  #   SyntaxError is raised if _pathname_'s contents are not
-  #   valid Ruby syntax.
-  #
-  #     RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
-  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
-  #
-  #   See ::parse for explanation of keyword argument meaning and usage.
-  def self.parse_file pathname, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
-    Primitive.ast_s_parse_file pathname, keep_script_lines, error_tolerant, keep_tokens
-  end
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.of(proc, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false)   -> RubyVM::AbstractSyntaxTree::Node
-  #     RubyVM::AbstractSyntaxTree.of(method, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false) -> RubyVM::AbstractSyntaxTree::Node
-  #
-  #   Returns AST nodes of the given _proc_ or _method_.
-  #
-  #     RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
-  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
-  #
-  #     def hello
-  #       puts "hello, world"
-  #     end
-  #
-  #     RubyVM::AbstractSyntaxTree.of(method(:hello))
-  #     # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
-  #
-  #   See ::parse for explanation of keyword argument meaning and usage.
-  def self.of body, keep_script_lines: RubyVM.keep_script_lines, error_tolerant: false, keep_tokens: false
-    Primitive.ast_s_of body, keep_script_lines, error_tolerant, keep_tokens
-  end
-
-  #  call-seq:
-  #     RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(backtrace_location)   -> integer
-  #
-  #   Returns the node id for the given backtrace location.
-  #
-  #     begin
-  #       raise
-  #     rescue =>  e
-  #       loc = e.backtrace_locations.first
-  #       RubyVM::AbstractSyntaxTree.node_id_for_backtrace_location(loc)
-  #     end # => 0
-  def self.node_id_for_backtrace_location backtrace_location
-    Primitive.node_id_for_backtrace_location backtrace_location
-  end
-
-  # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
-  # RubyVM::AbstractSyntaxTree.
-  #
-  # This class is MRI specific.
-  #
-  class Node
-
-    #  call-seq:
-    #     node.type -> symbol
-    #
-    #  Returns the type of this node as a symbol.
-    #
-    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
-    #    root.type # => :SCOPE
-    #    lasgn = root.children[2]
-    #    lasgn.type # => :LASGN
-    #    call = lasgn.children[1]
-    #    call.type # => :OPCALL
-    def type
-      Primitive.ast_node_type
-    end
-
-    #  call-seq:
-    #     node.first_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text began.
-    def first_lineno
-      Primitive.ast_node_first_lineno
-    end
-
-    #  call-seq:
-    #     node.first_column -> integer
-    #
-    #  The column number in the source code where this AST's text began.
-    def first_column
-      Primitive.ast_node_first_column
-    end
-
-    #  call-seq:
-    #     node.last_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text ended.
-    def last_lineno
-      Primitive.ast_node_last_lineno
-    end
-
-    #  call-seq:
-    #     node.last_column -> integer
-    #
-    #  The column number in the source code where this AST's text ended.
-    def last_column
-      Primitive.ast_node_last_column
-    end
-
-    #  call-seq:
-    #     node.tokens -> array
-    #
-    #  Returns tokens corresponding to the location of the node.
-    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
-    #
-    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
-    #    root.tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
-    #    root.tokens.map{_1[2]}.join # => "x = 1 + 2"
-    #
-    #  Token is an array of:
-    #
-    #  - id
-    #  - token type
-    #  - source code text
-    #  - location [ first_lineno, first_column, last_lineno, last_column ]
-    def tokens
-      return nil unless all_tokens
-
-      all_tokens.each_with_object([]) do |token, a|
-        loc = token.last
-        if ([first_lineno, first_column] <=> [loc[0], loc[1]]) <= 0 &&
-           ([last_lineno, last_column]   <=> [loc[2], loc[3]]) >= 0
-           a << token
-        end
-      end
-    end
-
-    #  call-seq:
-    #     node.all_tokens -> array
-    #
-    #  Returns all tokens for the input script regardless the receiver node.
-    #  Returns +nil+ if +keep_tokens+ is not enabled when #parse method is called.
-    #
-    #    root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2", keep_tokens: true)
-    #    root.all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
-    #    root.children[-1].all_tokens # => [[0, :tIDENTIFIER, "x", [1, 0, 1, 1]], [1, :tSP, " ", [1, 1, 1, 2]], ...]
-    def all_tokens
-      Primitive.ast_node_all_tokens
-    end
-
-    #  call-seq:
-    #     node.children -> array
-    #
-    #  Returns AST nodes under this one.  Each kind of node
-    #  has different children, depending on what kind of node it is.
-    #
-    #  The returned array may contain other nodes or <code>nil</code>.
-    def children
-      Primitive.ast_node_children
-    end
-
-    #  call-seq:
-    #     node.inspect -> string
-    #
-    #  Returns debugging information about this node as a string.
-    def inspect
-      Primitive.ast_node_inspect
-    end
-
-    #  call-seq:
-    #     node.node_id -> integer
-    #
-    #  Returns an internal node_id number.
-    #  Note that this is an API for ruby internal use, debugging,
-    #  and research. Do not use this for any other purpose.
-    #  The compatibility is not guaranteed.
-    def node_id
-      Primitive.ast_node_node_id
-    end
-
-    #  call-seq:
-    #     node.script_lines -> array
-    #
-    #  Returns the original source code as an array of lines.
-    #
-    #  Note that this is an API for ruby internal use, debugging,
-    #  and research. Do not use this for any other purpose.
-    #  The compatibility is not guaranteed.
-    def script_lines
-      Primitive.ast_node_script_lines
-    end
-
-    #  call-seq:
-    #     node.source -> string
-    #
-    #  Returns the code fragment that corresponds to this AST.
-    #
-    #  Note that this is an API for ruby internal use, debugging,
-    #  and research. Do not use this for any other purpose.
-    #  The compatibility is not guaranteed.
-    #
-    #  Also note that this API may return an incomplete code fragment
-    #  that does not parse; for example, a here document following
-    #  an expression may be dropped.
-    def source
-      lines = script_lines
-      if lines
-        lines = lines[first_lineno - 1 .. last_lineno - 1]
-        lines[-1] = lines[-1].byteslice(0...last_column)
-        lines[0] = lines[0].byteslice(first_column..-1)
-        lines.join
-      else
-        nil
-      end
-    end
-
-    #  call-seq:
-    #     node.locations -> array
-    #
-    #  Returns location objects associated with the AST node.
-    #  The returned array contains RubyVM::AbstractSyntaxTree::Location.
-    def locations
-      Primitive.ast_node_locations
-    end
-  end
-
-  # RubyVM::AbstractSyntaxTree::Location instances are created by
-  # RubyVM::AbstractSyntaxTree::Node#locations.
-  #
-  # This class is MRI specific.
-  #
-  class Location
-
-    #  call-seq:
-    #     location.first_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text began.
-    def first_lineno
-      Primitive.ast_location_first_lineno
-    end
-
-    #  call-seq:
-    #     location.first_column -> integer
-    #
-    #  The column number in the source code where this AST's text began.
-    def first_column
-      Primitive.ast_location_first_column
-    end
-
-    #  call-seq:
-    #     location.last_lineno -> integer
-    #
-    #  The line number in the source code where this AST's text ended.
-    def last_lineno
-      Primitive.ast_location_last_lineno
-    end
-
-    #  call-seq:
-    #     location.last_column -> integer
-    #
-    #  The column number in the source code where this AST's text ended.
-    def last_column
-      Primitive.ast_location_last_column
-    end
-
-    #  call-seq:
-    #     location.inspect -> string
-    #
-    #  Returns debugging information about this location as a string.
-    def inspect
-      Primitive.ast_location_inspect
-    end
-  end
-end
diff --git a/autogen.sh b/autogen.sh
deleted file mode 100755
index f8cdf3c0c1..0000000000
--- a/autogen.sh
+++ /dev/null
@@ -1,17 +0,0 @@
-#!/bin/sh
-
-PWD=
-case "$0" in
-*/*) srcdir=`dirname $0`;;
-*) srcdir="";;
-esac
-
-symlink='--install --symlink'
-case " $* " in
-    *" -i "*|*" --install "*)
-        # reset to copy missing standard auxiliary files, instead of symlinks
-        symlink=
-        ;;
-esac
-
-exec ${AUTORECONF:-autoreconf} ${symlink} "$@" ${srcdir:+"$srcdir"}
diff --git a/basictest/runner.rb b/basictest/runner.rb
deleted file mode 100755
index 0f398e7acc..0000000000
--- a/basictest/runner.rb
+++ /dev/null
@@ -1,33 +0,0 @@
-#! ./miniruby
-
-exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
-ruby = ENV["RUBY"]
-unless ruby
-  load './rbconfig.rb'
-  ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
-end
-unless File.exist? ruby
-  print "#{ruby} is not found.\n"
-  print "Try `make' first, then `make test', please.\n"
-  exit false
-end
-ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
-
-$stderr.reopen($stdout)
-error = ''
-
-srcdir = File.expand_path('..', File.dirname(__FILE__))
-if env = ENV["RUBYOPT"]
-  ENV["RUBYOPT"] = env + " -W1"
-end
-`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
-  if line =~ /^end of test/
-    print "\ntest succeeded\n"
-    exit true
-  end
-  error << line if %r:^(basictest/test.rb|not): =~ line
-end
-puts
-print error
-print "test failed\n"
-exit false
diff --git a/basictest/test.rb b/basictest/test.rb
deleted file mode 100755
index 711e4f4ab3..0000000000
--- a/basictest/test.rb
+++ /dev/null
@@ -1,2367 +0,0 @@
-#! /usr/bin/env ruby
-# -*- coding: us-ascii -*-
-
-$testnum=0
-$ntest=0
-$failed = 0
-class Progress
-  def initialize
-    @color = nil
-    @tty = nil
-    @quiet = nil
-    @verbose = nil
-    ARGV.each do |arg|
-      case arg
-      when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
-        warn "unknown --color argument: #$3" if $3
-        @color = $1 ? nil : !$2
-      when /\A--tty(=(?:yes|(no)|(.*)))?\z/
-        warn "unknown --tty argument: #$3" if $3
-        @tty = !$1 || !$2
-        true
-      when /\A-(q|-quiet)\z/
-        @quiet = true
-      when /\A-(v|-verbose)\z/
-        @verbose = true
-      end
-    end
-    @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
-    @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
-    case @color
-    when nil
-      @color = @tty
-    end
-    if @color
-      # dircolors-like style
-      colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
-      begin
-        File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
-          colors[n] ||= c
-        end
-      rescue
-      end
-      @passed = "\e[;#{colors["pass"] || "32"}m"
-      @failed = "\e[;#{colors["fail"] || "31"}m"
-      @reset = "\e[m"
-    else
-      @passed = @failed = @reset = ""
-    end
-    extend(Rotator) if @tty
-  end
-
-  def passed_string
-    "."
-  end
-  def failed_string
-    "#{@failed}F#{@reset}"
-  end
-  def init_string
-  end
-  def finish_string
-    if @quiet
-      @eol
-    else
-      "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
-    end
-  end
-  def pass
-    STDERR.print passed_string
-  end
-  def fail
-    @ok = false
-    STDERR.print failed_string
-  end
-  def init
-    @ok = true
-    STDERR.print init_string
-  end
-  def finish
-    STDERR.print finish_string
-  end
-
-  module Rotator
-    ROTATOR = %w[- \\ | /]
-    BS = "\b" * ROTATOR[0].size
-    def passed_string
-      "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
-    end
-    def failed_string
-      "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
-    end
-    def init_string
-      @count = 0
-      " "
-    end
-    def finish_string
-      s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
-      s.gsub!(/\n/, "\r\e[2K\r") if @quiet
-      s
-    end
-  end
-end
-PROGRESS = Progress.new
-
-def test_check(what)
-  unless $ntest.zero?
-    PROGRESS.finish
-  end
-  STDERR.print "#{$0}:#{what} "
-  PROGRESS.init
-  $what = what
-  $testnum = 0
-end
-
-def test_ok(cond,n=1)
-  $testnum+=1
-  $ntest+=1
-  where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
-  if cond
-    PROGRESS.pass
-    printf "ok %d (%s)\n", $testnum, where
-  else
-    PROGRESS.fail
-    printf "not ok %s %d -- %s\n", $what, $testnum, where
-    $failed+=1
-  end
-  STDOUT.flush
-  STDERR.flush
-end
-
-# make sure conditional operators work
-
-test_check "assignment"
-
-a=[]; a[0] ||= "bar";
-test_ok(a[0] == "bar")
-h={}; h["foo"] ||= "bar";
-test_ok(h["foo"] == "bar")
-
-aa = 5
-aa ||= 25
-test_ok(aa == 5)
-bb ||= 25
-test_ok(bb == 25)
-cc &&=33
-test_ok(cc == nil)
-cc = 5
-cc &&=44
-test_ok(cc == 44)
-
-a = nil; test_ok(a == nil)
-a = 1; test_ok(a == 1)
-a = []; test_ok(a == [])
-a = [1]; test_ok(a == [1])
-a = [nil]; test_ok(a == [nil])
-a = [[]]; test_ok(a == [[]])
-a = [1,2]; test_ok(a == [1,2])
-a = [*[]]; test_ok(a == [])
-a = [*[1]]; test_ok(a == [1])
-a = [*[1,2]]; test_ok(a == [1,2])
-
-a = *[]; test_ok(a == [])
-a = *[1]; test_ok(a == [1])
-a = *[nil]; test_ok(a == [nil])
-a = *[[]]; test_ok(a == [[]])
-a = *[1,2]; test_ok(a == [1,2])
-a = *[*[]]; test_ok(a == [])
-a = *[*[1]]; test_ok(a == [1])
-a = *[*[1,2]]; test_ok(a == [1,2])
-
-a, = nil; test_ok(a == nil)
-a, = 1; test_ok(a == 1)
-a, = []; test_ok(a == nil)
-a, = [1]; test_ok(a == 1)
-a, = [nil]; test_ok(a == nil)
-a, = [[]]; test_ok(a == [])
-a, = 1,2; test_ok(a == 1)
-a, = [1,2]; test_ok(a == 1)
-a, = [*[]]; test_ok(a == nil)
-a, = [*[1]]; test_ok(a == 1)
-a, = *[1,2]; test_ok(a == 1)
-a, = [*[1,2]]; test_ok(a == 1)
-
-a, = *[]; test_ok(a == nil)
-a, = *[1]; test_ok(a == 1)
-a, = *[nil]; test_ok(a == nil)
-a, = *[[]]; test_ok(a == [])
-a, = *[1,2]; test_ok(a == 1)
-a, = *[*[]]; test_ok(a == nil)
-a, = *[*[1]]; test_ok(a == 1)
-a, = *[*[1,2]]; test_ok(a == 1)
-
-*a = nil; test_ok(a == [nil])
-*a = 1; test_ok(a == [1])
-*a = []; test_ok(a == [])
-*a = [1]; test_ok(a == [1])
-*a = [nil]; test_ok(a == [nil])
-*a = [[]]; test_ok(a == [[]])
-*a = [1,2]; test_ok(a == [1,2])
-*a = [*[]]; test_ok(a == [])
-*a = [*[1]]; test_ok(a == [1])
-*a = [*[1,2]]; test_ok(a == [1,2])
-
-*a = *[]; test_ok(a == [])
-*a = *[1]; test_ok(a == [1])
-*a = *[nil]; test_ok(a == [nil])
-*a = *[[]]; test_ok(a == [[]])
-*a = *[1,2]; test_ok(a == [1,2])
-*a = *[*[]]; test_ok(a == [])
-*a = *[*[1]]; test_ok(a == [1])
-*a = *[*[1,2]]; test_ok(a == [1,2])
-
-a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-def f; yield nil; end; f {|a| test_ok(a == nil)}
-def f; yield 1; end; f {|a| test_ok(a == 1)}
-def f; yield []; end; f {|a| test_ok(a == [])}
-def f; yield [1]; end; f {|a| test_ok(a == [1])}
-def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
-def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
-def f; yield [*[]]; end; f {|a| test_ok(a == [])}
-def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
-def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
-def f; yield *[]; end; f {|a| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a| test_ok(a == [])}
-def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
-
-def f; yield; end; f {|a,| test_ok(a == nil)}
-def f; yield nil; end; f {|a,| test_ok(a == nil)}
-def f; yield 1; end; f {|a,| test_ok(a == 1)}
-def f; yield []; end; f {|a,| test_ok(a == nil)}
-def f; yield [1]; end; f {|a,| test_ok(a == 1)}
-def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield [[]]; end; f {|a,| test_ok(a == [])}
-def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield *[]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield; end; f {|*a| test_ok(a == [])}
-def f; yield nil; end; f {|*a| test_ok(a == [nil])}
-def f; yield 1; end; f {|*a| test_ok(a == [1])}
-def f; yield []; end; f {|*a| test_ok(a == [[]])}
-def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
-def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
-def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
-def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
-
-def f; yield *[]; end; f {|*a| test_ok(a == [])}
-def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
-def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
-def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
-
-def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
-def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def r; return; end; a = r(); test_ok(a == nil)
-def r; return nil; end; a = r(); test_ok(a == nil)
-def r; return 1; end; a = r(); test_ok(a == 1)
-def r; return []; end; a = r(); test_ok(a == [])
-def r; return [1]; end; a = r(); test_ok(a == [1])
-def r; return [nil]; end; a = r(); test_ok(a == [nil])
-def r; return [[]]; end; a = r(); test_ok(a == [[]])
-def r; return [*[]]; end; a = r(); test_ok(a == [])
-def r; return [*[1]]; end; a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; a = r(); test_ok(a == [])
-def r; return *[1]; end; a = r(); test_ok(a == [1])
-def r; return *[nil]; end; a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; a = r(); test_ok(a == [[]])
-def r; return *[*[]]; end; a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
-def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
-
-def r; return; end; *a = r(); test_ok(a == [nil])
-def r; return nil; end; *a = r(); test_ok(a == [nil])
-def r; return 1; end; *a = r(); test_ok(a == [1])
-def r; return []; end; *a = r(); test_ok(a == [])
-def r; return [1]; end; *a = r(); test_ok(a == [1])
-def r; return [nil]; end; *a = r(); test_ok(a == [nil])
-def r; return [[]]; end; *a = r(); test_ok(a == [[]])
-def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return [*[]]; end; *a = r(); test_ok(a == [])
-def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; *a = r(); test_ok(a == [])
-def r; return *[1]; end; *a = r(); test_ok(a == [1])
-def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return *[*[]]; end; *a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
-def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
-
-def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-f = lambda {|r,| test_ok([] == r)}
-f.call([], *[])
-
-f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
-f.call([], *[1])
-
-f = lambda{|x| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|x,| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|*x| x}
-test_ok(f.call(42) == [42])
-test_ok(f.call([42]) == [[42]])
-test_ok(f.call([[42]]) == [[[42]]])
-test_ok(f.call([42,55]) == [[42,55]])
-test_ok(f.call(42,55) == [42,55])
-
-f = lambda { |a, b=42, *c| [a,b,c] }
-test_ok(f.call(1      ) == [1,42,[  ]] )
-test_ok(f.call(1,43   ) == [1,43,[  ]] )
-test_ok(f.call(1,43,44) == [1,43,[44]] )
-
-f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
-test_ok(f.call(8      )     == [8,24,[  ],nil] )
-test_ok(f.call(8,43   )     == [8,43,[  ],nil] )
-test_ok(f.call(8,43,44)     == [8,43,[44],nil] )
-test_ok(f.call(8      ){45} == [8,24,[  ],45 ] )
-test_ok(f.call(8,43   ){45} == [8,43,[  ],45 ] )
-test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
-
-f = lambda { |a, b=42, *c, d| [a,b,c,d] }
-test_ok(f.call(1      ,99) == [1,42,[  ],99] )
-test_ok(f.call(1,43   ,99) == [1,43,[  ],99] )
-test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
-
-f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
-test_ok(f.call(8   )     == [8,24,nil] )
-test_ok(f.call(8,43)     == [8,43,nil] )
-test_ok(f.call(8,43)     == [8,43,nil] )
-test_ok(f.call(8   ){45} == [8,24,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-
-f = lambda { |a, b=42, d| [a,b,d] }
-test_ok(f.call(1   ,99) == [1,42,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-
-f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
-test_ok(f.call(     )     == [42,[  ],nil] )
-test_ok(f.call(43   )     == [43,[  ],nil] )
-test_ok(f.call(43,44)     == [43,[44],nil] )
-test_ok(f.call(     ){45} == [42,[  ],45 ] )
-test_ok(f.call(43   ){45} == [43,[  ],45 ] )
-test_ok(f.call(43,44){45} == [43,[44],45 ] )
-
-f = lambda { |b=42, *c, d| [b,c,d] }
-test_ok(f.call(      99) == [42,[  ],99] )
-test_ok(f.call(43   ,99) == [43,[  ],99] )
-test_ok(f.call(43,44,99) == [43,[44],99] )
-
-f = lambda { |b=42, &block| [b,block&&block[]] }
-test_ok(f.call(  )     == [42,nil] )
-test_ok(f.call(43)     == [43,nil] )
-test_ok(f.call(43)     == [43,nil] )
-test_ok(f.call(  ){45} == [42,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-
-f = lambda { |b=42, d| [b,d] }
-test_ok(f.call(   99) == [42,99] )
-test_ok(f.call(43,99) == [43,99] )
-test_ok(f.call(43,99) == [43,99] )
-
-
-a,=*[1]
-test_ok(a == 1)
-a,=*[[1]]
-test_ok(a == [1])
-a,=*[[[1]]]
-test_ok(a == [[1]])
-
-x, (y, z) = 1, 2, 3
-test_ok([1,2,nil] == [x,y,z])
-x, (y, z) = 1, [2,3]
-test_ok([1,2,3] == [x,y,z])
-x, (y, z) = 1, [2]
-test_ok([1,2,nil] == [x,y,z])
-
-a = loop do break; end; test_ok(a == nil)
-a = loop do break nil; end; test_ok(a == nil)
-a = loop do break 1; end; test_ok(a == 1)
-a = loop do break []; end; test_ok(a == [])
-a = loop do break [1]; end; test_ok(a == [1])
-a = loop do break [nil]; end; test_ok(a == [nil])
-a = loop do break [[]]; end; test_ok(a == [[]])
-a = loop do break [*[]]; end; test_ok(a == [])
-a = loop do break [*[1]]; end; test_ok(a == [1])
-a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-a = loop do break *[]; end; test_ok(a == [])
-a = loop do break *[1]; end; test_ok(a == [1])
-a = loop do break *[nil]; end; test_ok(a == [nil])
-a = loop do break *[[]]; end; test_ok(a == [[]])
-a = loop do break *[*[]]; end; test_ok(a == [])
-a = loop do break *[*[1]]; end; test_ok(a == [1])
-a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break; end; test_ok(a == [nil])
-*a = loop do break nil; end; test_ok(a == [nil])
-*a = loop do break 1; end; test_ok(a == [1])
-*a = loop do break []; end; test_ok(a == [])
-*a = loop do break [1]; end; test_ok(a == [1])
-*a = loop do break [nil]; end; test_ok(a == [nil])
-*a = loop do break [[]]; end; test_ok(a == [[]])
-*a = loop do break [1,2]; end; test_ok(a == [1,2])
-*a = loop do break [*[]]; end; test_ok(a == [])
-*a = loop do break [*[1]]; end; test_ok(a == [1])
-*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break *[]; end; test_ok(a == [])
-*a = loop do break *[1]; end; test_ok(a == [1])
-*a = loop do break *[nil]; end; test_ok(a == [nil])
-*a = loop do break *[[]]; end; test_ok(a == [[]])
-*a = loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = loop do break *[*[]]; end; test_ok(a == [])
-*a = loop do break *[*[1]]; end; test_ok(a == [1])
-*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = *loop do break *[[]]; end; test_ok(a == [[]])
-*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-def r(val); a = yield(); test_ok(a == val, 2); end
-r(nil){next}
-r(nil){next nil}
-r(1){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-r([]){next *[]}
-r([1]){next *[1]}
-r([nil]){next *[nil]}
-r([[]]){next *[[]]}
-r([]){next *[*[]]}
-r([1]){next *[*[1]]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); *a = yield(); test_ok(a == val, 2); end
-r([nil]){next}
-r([nil]){next nil}
-r([1]){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([1,2]){next [1,2]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-def r(val); *a = *yield(); test_ok(a == val, 2); end
-r([[]]){next *[[]]}
-r([1,2]){next *[1,2]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
-r([nil,nil,[]]){next}
-r([nil,nil,[]]){next nil}
-r([1,nil,[]]){next 1}
-r([nil,nil,[]]){next []}
-r([1,nil,[]]){next [1]}
-r([nil,nil,[]]){next [nil]}
-r([[],nil,[]]){next [[]]}
-r([1,2,[]]){next [1,2]}
-r([nil,nil,[]]){next [*[]]}
-r([1,nil,[]]){next [*[1]]}
-r([1,2,[]]){next [*[1,2]]}
-
-def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
-r([[],nil,[]]){next *[[]]}
-r([1,2,[]]){next *[1,2]}
-r([1,2,[]]){next *[*[1,2]]}
-
-test_check "condition"
-
-$x = '0';
-
-$x == $x && test_ok(true)
-$x != $x && test_ok(false)
-$x == $x || test_ok(false)
-$x != $x || test_ok(true)
-
-# first test to see if we can run the tests.
-
-test_check "if/unless";
-
-$x = 'test';
-test_ok(if $x == $x then true else false end)
-$bad = false
-unless $x == $x
-  $bad = true
-end
-test_ok(!$bad)
-test_ok(unless $x != $x then true else false end)
-
-test_check "case"
-
-case 5
-when 1, 2, 3, 4, 6, 7, 8
-  test_ok(false)
-when 5
-  test_ok(true)
-end
-
-case 5
-when 5
-  test_ok(true)
-when 1..10
-  test_ok(false)
-end
-
-case 5
-when 1..10
-  test_ok(true)
-else
-  test_ok(false)
-end
-
-case 5
-when 5
-  test_ok(true)
-else
-  test_ok(false)
-end
-
-case "foobar"
-when /^f.*r$/
-  test_ok(true)
-else
-  test_ok(false)
-end
-
-test_check "while/until";
-
-while_tmp = "while_tmp.#{$$}"
-tmp = open(while_tmp, "w")
-tmp.print "tvi925\n";
-tmp.print "tvi920\n";
-tmp.print "vt100\n";
-tmp.print "Amiga\n";
-tmp.print "paper\n";
-tmp.close
-
-# test break
-
-tmp = open(while_tmp, "r")
-test_ok(tmp.kind_of?(File))
-
-while line = tmp.gets()
-  break if /vt100/ =~ line
-end
-
-test_ok(!tmp.eof? && /vt100/ =~ line)
-tmp.close
-
-# test next
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
-  next if /vt100/ =~ line
-  $bad = 1 if /vt100/ =~ line
-end
-test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
-tmp.close
-
-# test redo
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
-  lastline = line
-  line = line.gsub(/vt100/, 'VT100')
-  if lastline != line
-    line.gsub!('VT100', 'Vt100')
-    redo
-  end
-  $bad = 1 if /vt100/ =~ line
-  $bad = 1 if /VT100/ =~ line
-end
-test_ok(tmp.eof? && !$bad)
-tmp.close
-
-sum=0
-for i in 1..10
-  sum += i
-  i -= 1
-  if i > 0
-    redo
-  end
-end
-test_ok(sum == 220)
-
-# test interval
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
-  break if 3
-  case line
-  when /vt100/, /Amiga/, /paper/
-    $bad = true
-  end
-end
-test_ok(!$bad)
-tmp.close
-
-File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
-test_ok(!File.exist?(while_tmp))
-
-i = 0
-until i>4
-  i+=1
-end
-test_ok(i>4)
-
-
-# exception handling
-test_check "exception";
-
-begin
-  raise "this must be handled"
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-$bad = true
-begin
-  raise "this must be handled no.2"
-rescue
-  if $bad
-    $bad = false
-    retry
-    test_ok(false)
-  end
-end
-test_ok(true)
-
-# exception in rescue clause
-$string = "this must be handled no.3"
-begin
-  begin
-    raise "exception in rescue clause"
-  rescue
-    raise $string
-  end
-  test_ok(false)
-rescue => e
-  test_ok($! == e)
-  test_ok(e.message == $string)
-  test_ok(e != $string)
-end
-
-# exception in ensure clause
-begin
-  begin
-    raise "this must be handled no.4"
-  ensure
-    raise "exception in ensure clause"
-  end
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-$bad = true
-begin
-  begin
-    raise "this must be handled no.5"
-  ensure
-    $bad = false
-  end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-begin
-  begin
-    raise "this must be handled no.6"
-  ensure
-    $bad = false
-  end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-while true
-  begin
-    break
-  ensure
-    $bad = false
-  end
-end
-test_ok(!$bad)
-
-test_ok(catch(:foo) {
-     loop do
-       loop do
-	 throw :foo, true
-	 break
-       end
-       break
-       test_ok(false)			# should not reach here
-     end
-     false
-   })
-
-test_check "array"
-test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
-test_ok([1, 2] * 2 == [1, 2, 1, 2])
-test_ok([1, 2] * ":" == "1:2")
-
-test_ok([1, 2].hash == [1, 2].hash)
-
-test_ok([1,2,3] & [2,3,4] == [2,3])
-test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
-test_ok([1,2,3] - [2,3] == [1])
-
-$x = [0, 1, 2, 3, 4, 5]
-test_ok($x[2] == 2)
-test_ok($x[1..3] == [1, 2, 3])
-test_ok($x[1,3] == [1, 2, 3])
-
-$x[0, 2] = 10
-test_ok($x[0] == 10 && $x[1] == 2)
-
-$x[0, 0] = -1
-test_ok($x[0] == -1 && $x[1] == 10)
-
-$x[-1, 1] = 20
-test_ok($x[-1] == 20 && $x.pop == 20)
-
-# array and/or
-test_ok(([1,2,3]&[2,4,6]) == [2])
-test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
-
-# compact
-$x = [nil, 1, nil, nil, 5, nil, nil]
-$x.compact!
-test_ok($x == [1, 5])
-
-# uniq
-$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
-$x.uniq!
-test_ok($x == [1, 4, 2, 5])
-
-# empty?
-test_ok(!$x.empty?)
-$x = []
-test_ok($x.empty?)
-
-# sort
-$x = ["it", "came", "to", "pass", "that", "..."]
-$x = $x.sort.join(" ")
-test_ok($x == "... came it pass that to")
-$x = [2,5,3,1,7]
-$x.sort!{|a,b| a<=>b}		# sort with condition
-test_ok($x == [1,2,3,5,7])
-$x.sort!{|a,b| b-a}		# reverse sort
-test_ok($x == [7,5,3,2,1])
-
-# split test
-$x = +"The Book of Mormon"
-test_ok($x.split(//).reverse!.join == $x.reverse)
-test_ok($x.reverse == $x.reverse!)
-test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
-$x = "a b c  d"
-test_ok($x.split == ['a', 'b', 'c', 'd'])
-test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
-test_ok(defined? "a".chomp)
-test_ok("abc".scan(/./) == ["a", "b", "c"])
-test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
-# non-greedy match
-test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
-
-$x = [1]
-test_ok(($x * 5).join(":") == '1:1:1:1:1')
-test_ok(($x * 1).join(":") == '1')
-test_ok(($x * 0).join(":") == '')
-
-*$x = *(1..7).to_a
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-$x = [1,2,3]
-$x[1,0] = $x
-test_ok($x == [1,1,2,3,2,3])
-
-$x = [1,2,3]
-$x[-1,0] = $x
-test_ok($x == [1,2,1,2,3,3])
-
-$x = [1,2,3]
-$x.concat($x)
-test_ok($x == [1,2,3,1,2,3])
-
-test_check "hash"
-$x = {1=>2, 2=>4, 3=>6}
-
-test_ok($x[1] == 2)
-
-test_ok(begin
-     for k,v in $x
-       raise if k*2 != v
-     end
-     true
-   rescue
-     false
-   end)
-
-test_ok($x.length == 3)
-test_ok($x.has_key?(1))
-test_ok($x.has_value?(4))
-test_ok($x.values_at(2,3) == [4,6])
-test_ok($x == {1=>2, 2=>4, 3=>6})
-
-$z = $x.keys.sort.join(":")
-test_ok($z == "1:2:3")
-
-$z = $x.values.sort.join(":")
-test_ok($z == "2:4:6")
-test_ok($x == $x)
-
-$x.shift
-test_ok($x.length == 2)
-
-$z = [1,2]
-$x[$z] = 256
-test_ok($x[$z] == 256)
-
-$x = Hash.new(0)
-$x[1] = 1
-test_ok($x[1] == 1)
-test_ok($x[2] == 0)
-
-$x = Hash.new([])
-test_ok($x[22] == [])
-test_ok($x[22].equal?($x[22]))
-
-$x = Hash.new{[]}
-test_ok($x[22] == [])
-test_ok(!$x[22].equal?($x[22]))
-
-$x = Hash.new{|h,k| $z = k; h[k] = k*2}
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-$x.default = 5
-test_ok($x[23] == 5)
-
-$x = Hash.new
-def $x.default(k)
-  $z = k
-  self[k] = k*2
-end
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-
-test_check "iterator"
-
-# yield at top level
-test_ok(!defined?(yield))
-
-$x = [1, 2, 3, 4]
-$y = []
-
-# iterator over array
-for i in $x
-  $y.push i
-end
-test_ok($x == $y)
-
-# nested iterator
-def tt
-  1.upto(10) {|i|
-    yield i
-  }
-end
-
-i=0
-tt{|i| break if i == 5}
-test_ok(i == 0)
-
-def tt2(dummy)
-  yield 1
-end
-
-def tt3(&block)
-  tt2(raise(ArgumentError,""),&block)
-end
-
-$x = false
-begin
-  tt3{}
-rescue ArgumentError
-  $x = true
-rescue Exception
-end
-test_ok($x)
-
-def tt4 &block
-  tt2(raise(ArgumentError,""),&block)
-end
-$x = false
-begin
-  tt4{}
-rescue ArgumentError
-  $x = true
-rescue Exception
-end
-test_ok($x)
-
-# iterator break/redo/next/retry
-done = true
-loop{
-  break
-  done = false			# should not reach here
-}
-test_ok(done)
-
-done = false
-$bad = false
-loop {
-  break if done
-  done = true
-  next
-  $bad = true			# should not reach here
-}
-test_ok(!$bad)
-
-done = false
-$bad = false
-loop {
-  break if done
-  done = true
-  redo
-  $bad = true			# should not reach here
-}
-test_ok(!$bad)
-
-$x = []
-for i in 1 .. 7
-  $x.push i
-end
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-# append method to built-in class
-class Array
-  def iter_test1
-    collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
-  end
-  def iter_test2
-    a = collect{|e| [e, yield(e)]}
-    a.sort{|a,b|a[1]<=>b[1]}
-  end
-end
-$x = [[1,2],[3,4],[5,6]]
-test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
-
-class IterTest
-  def initialize(e); @body = e; end
-
-  def each0(&block); @body.each(&block); end
-  def each1(&block); @body.each {|*x| block.call(*x) } end
-  def each2(&block); @body.each {|*x| block.call(x) } end
-  def each3(&block); @body.each {|x| block.call(*x) } end
-  def each4(&block); @body.each {|x| block.call(x) } end
-  def each5; @body.each {|*x| yield(*x) } end
-  def each6; @body.each {|*x| yield(x) } end
-  def each7; @body.each {|x| yield(*x) } end
-  def each8; @body.each {|x| yield(x) } end
-
-  def f(a)
-    a
-  end
-end
-test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
-m = /\w+/.match("abc")
-test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
-
-IterTest.new([0]).each0 {|x| test_ok(x == 0)}
-IterTest.new([1]).each1 {|x| test_ok(x == 1)}
-IterTest.new([2]).each2 {|x| test_ok(x == [2])}
-#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
-IterTest.new([4]).each4 {|x| test_ok(x == 4)}
-IterTest.new([5]).each5 {|x| test_ok(x == 5)}
-IterTest.new([6]).each6 {|x| test_ok(x == [6])}
-#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
-IterTest.new([8]).each8 {|x| test_ok(x == 8)}
-
-IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
-IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
-IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
-IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
-IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
-IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
-IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
-IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
-IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
-
-IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
-IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
-
-def m0(v)
-  v
-end
-
-def m1
-  m0(block_given?)
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-def m
-  m0(block_given?,&Proc.new{})
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-class C
-  include Enumerable
-  def initialize
-    @a = [1,2,3]
-  end
-  def each(&block)
-    @a.each(&block)
-  end
-end
-
-test_ok(C.new.collect{|n| n} == [1,2,3])
-
-test_ok(Proc == lambda{}.class)
-test_ok(Proc == Proc.new{}.class)
-lambda{|a|test_ok(a==1)}.call(1)
-def block_test(klass, &block)
-  test_ok(klass === block)
-end
-
-block_test(NilClass)
-block_test(Proc){}
-
-def call_argument_test(state, proc, *args)
-  x = state
-  begin
-    proc.call(*args)
-  rescue ArgumentError
-    x = !x
-  end
-  test_ok(x,2)
-end
-
-call_argument_test(true, lambda{||})
-call_argument_test(false, lambda{||}, 1)
-call_argument_test(true, lambda{|a,|}, 1)
-call_argument_test(false, lambda{|a,|})
-call_argument_test(false, lambda{|a,|}, 1,2)
-
-call_argument_test(true, Proc.new{||})
-call_argument_test(true, Proc.new{||}, 1)
-call_argument_test(true, Proc.new{|a,|}, 1)
-call_argument_test(true, Proc.new{|a,|})
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-def block_get(&block)
-  block
-end
-
-test_ok(Proc == block_get{}.class)
-call_argument_test(true, block_get{||})
-call_argument_test(true, block_get{||}, 1)
-call_argument_test(true, block_get{|a,|}, 1)
-call_argument_test(true, block_get{|a,|})
-call_argument_test(true, block_get{|a,|}, 1,2)
-
-call_argument_test(true, block_get(&lambda{||}))
-call_argument_test(false, block_get(&lambda{||}),1)
-call_argument_test(true, block_get(&lambda{|a,|}),1)
-call_argument_test(false, block_get(&lambda{|a,|}),1,2)
-
-blk = block_get{11}
-test_ok(blk.class == Proc)
-test_ok(blk.to_proc.class == Proc)
-test_ok(blk.clone.call == 11)
-test_ok(block_get(&blk).class == Proc)
-
-lmd = lambda{44}
-test_ok(lmd.class == Proc)
-test_ok(lmd.to_proc.class == Proc)
-test_ok(lmd.clone.call == 44)
-test_ok(block_get(&lmd).class == Proc)
-
-test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
-test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
-
-def test_return1
-  Proc.new {
-    return 55
-  }.yield + 5
-end
-test_ok(test_return1() == 55)
-def test_return2
-  lambda {
-    return 55
-  }.call + 5
-end
-test_ok(test_return2() == 60)
-
-def proc_call(&b)
-  b.call
-end
-def proc_yield()
-  yield
-end
-def proc_return1
-  lambda{return 42}.call+1
-end
-test_ok(proc_return1() == 43)
-def proc_return2
-  ->{return 42}.call+1
-end
-test_ok(proc_return2() == 43)
-def proc_return3
-  proc_call{return 42}+1
-end
-test_ok(proc_return3() == 42)
-def proc_return4
-  proc_yield{return 42}+1
-end
-test_ok(proc_return4() == 42)
-
-def ljump_test(state, proc, *args)
-  x = state
-  begin
-    proc.call(*args)
-  rescue LocalJumpError
-    x = !x
-  end
-  test_ok(x,2)
-end
-
-ljump_test(false, block_get{break})
-ljump_test(true, lambda{break})
-
-def exit_value_test(&block)
-  block.call
-rescue LocalJumpError
-  $!.exit_value
-end
-
-test_ok(45 == exit_value_test{break 45})
-
-test_ok(55 == begin
-              block_get{break 55}.call
-            rescue LocalJumpError
-              $!.exit_value
-            end)
-
-def block_call(&block)
-  block.call
-end
-
-def test_b1
-  block_call{break 11}
-end
-test_ok(test_b1() == 11)
-
-def ljump_rescue(r)
-  begin
-    yield
-  rescue LocalJumpError => e
-    r if /from proc-closure/ =~ e.message
-  end
-end
-
-def test_b2
-  ljump_rescue(22) do
-    block_get{break 21}.call
-  end
-end
-test_ok(test_b2() == 22)
-
-def test_b3
-  ljump_rescue(33) do
-    Proc.new{break 31}.yield
-  end
-end
-test_ok(test_b3() == 33)
-
-def test_b4
-  lambda{break 44}.call
-end
-test_ok(test_b4() == 44)
-
-def test_b5
-  ljump_rescue(55) do
-    b = block_get{break 54}
-    block_call(&b)
-  end
-end
-test_ok(test_b5() == 55)
-
-def test_b6
-  b = lambda{break 67}
-  block_call(&b)
-  66
-end
-test_ok(test_b6() == 66)
-
-def util_r7
-  block_get{break 78}
-end
-
-def test_b7
-  b = util_r7()
-  ljump_rescue(77) do
-    block_call(&b)
-  end
-end
-test_ok(test_b7() == 77)
-
-def util_b8(&block)
-  block_call(&block)
-end
-
-def test_b8
-  util_b8{break 88}
-end
-test_ok(test_b8() == 88)
-
-def util_b9(&block)
-  lambda{block.call; 98}.call
-end
-
-def test_b9
-  util_b9{break 99}
-end
-test_ok(test_b9() == 99)
-
-def util_b10
-  util_b9{break 100}
-end
-
-def test_b10
-  util_b10()
-end
-test_ok(test_b10() == 100)
-
-def test_b11
-  ljump_rescue(111) do
-    loop do
-      Proc.new{break 110}.yield
-      break 112
-    end
-  end
-end
-test_ok(test_b11() == 111)
-
-def test_b12
-  loop do
-    break lambda{break 122}.call
-    break 121
-  end
-end
-test_ok(test_b12() == 122)
-
-def test_b13
-  ljump_rescue(133) do
-    while true
-      Proc.new{break 130}.yield
-      break 131
-    end
-  end
-end
-test_ok(test_b13() == 133)
-
-def test_b14
-  while true
-    break lambda{break 144}.call
-    break 143
-  end
-end
-test_ok(test_b14() == 144)
-
-def test_b15
-  [0].each {|c| yield 1 }
-  156
-end
-test_ok(test_b15{|e| break 155 } == 155)
-
-def marity_test(m)
-  method = method(m)
-  test_ok(method.arity == method.to_proc.arity, 2)
-end
-marity_test(:test_ok)
-marity_test(:marity_test)
-marity_test(:p)
-
-class ITER_TEST1
-   def a
-     block_given?
-   end
-end
-
-class ITER_TEST2 < ITER_TEST1
-   def a
-     test_ok(super)
-     super
-   end
-end
-test_ok(ITER_TEST2.new.a {})
-
-class ITER_TEST3
-  def foo x
-    return yield if block_given?
-    x
-  end
-end
-
-class ITER_TEST4 < ITER_TEST3
-  def foo x
-    test_ok(super == yield)
-    test_ok(super(x, &nil) == x)
-  end
-end
-
-ITER_TEST4.new.foo(44){55}
-
-class ITER_TEST5
-   def tt(aa)
-     aa
-   end
-
-   def uu(a)
-      class << self
-         define_method(:tt) do |sym|
-            super(sym)
-         end
-      end
-   end
-
-   def xx(*x)
-     x.size
-   end
-end
-
-a = ITER_TEST5.new
-a.uu(12)
-test_ok(a.tt(1) == 1)
-
-class ITER_TEST6 < ITER_TEST5
-   def xx(*a)
-      a << 12
-      super
-   end
-end
-
-test_ok(ITER_TEST6.new.xx([24]) == 2)
-
-test_check "float"
-test_ok(2.6.floor == 2)
-test_ok((-2.6).floor == -3)
-test_ok(2.6.ceil == 3)
-test_ok((-2.6).ceil == -2)
-test_ok(2.6.truncate == 2)
-test_ok((-2.6).truncate == -2)
-test_ok(2.6.round == 3)
-test_ok((-2.4).truncate == -2)
-test_ok((13.4 % 1 - 0.4).abs < 0.0001)
-nan = 0.0/0
-def nan_test(x,y)
-  test_ok(x != y)
-  test_ok((x < y) == false)
-  test_ok((x > y) == false)
-  test_ok((x <= y) == false)
-  test_ok((x >= y) == false)
-end
-nan_test(nan, nan)
-nan_test(nan, 0)
-nan_test(nan, 1)
-nan_test(nan, -1)
-nan_test(nan, 1000)
-nan_test(nan, -1000)
-nan_test(nan, 1_000_000_000_000)
-nan_test(nan, -1_000_000_000_000)
-nan_test(nan, 100.0);
-nan_test(nan, -100.0);
-nan_test(nan, 0.001);
-nan_test(nan, -0.001);
-nan_test(nan, 1.0/0);
-nan_test(nan, -1.0/0);
-
-#s = "3.7517675036461267e+17"
-#test_ok(s == sprintf("%.16e", s.to_f))
-f = 3.7517675036461267e+17
-test_ok(f == sprintf("%.16e", f).to_f)
-
-
-test_check "bignum"
-def fact(n)
-  return 1 if n == 0
-  f = 1
-  while n>0
-    f *= n
-    n -= 1
-  end
-  return f
-end
-$x = fact(40)
-test_ok($x == $x)
-test_ok($x == fact(40))
-test_ok($x < $x+2)
-test_ok($x > $x-2)
-test_ok($x == 815915283247897734345611269596115894272000000000)
-test_ok($x != 815915283247897734345611269596115894272000000001)
-test_ok($x+1 == 815915283247897734345611269596115894272000000001)
-test_ok($x/fact(20) == 335367096786357081410764800000)
-$x = -$x
-test_ok($x == -815915283247897734345611269596115894272000000000)
-test_ok(2-(2**32) == -(2**32-2))
-test_ok(2**32 - 5 == (2**32-3)-2)
-
-$good = true;
-for i in 1000..1014
-  $good = false if ((1 << i) != (2**i))
-end
-test_ok($good)
-
-$good = true;
-n1= 1 << 1000
-for i in 1000..1014
-  $good = false if ((1 << i) != n1)
-  n1 *= 2
-end
-test_ok($good)
-
-$good = true;
-n2=n1
-for i in 1..10
-  n1 = n1 / 2
-  n2 = n2 >> 1
-  $good = false if (n1 != n2)
-end
-test_ok($good)
-
-$good = true;
-for i in 4000..4096
-  n1 = 1 << i;
-  if (n1**2-1) / (n1+1) != (n1-1)
-    $good = false
-  end
-end
-test_ok($good)
-
-b = 10**80
-a = b * 9 + 7
-test_ok(7 == a.modulo(b))
-test_ok(-b + 7 == a.modulo(-b))
-test_ok(b + -7 == (-a).modulo(b))
-test_ok(-7 == (-a).modulo(-b))
-test_ok(7 == a.remainder(b))
-test_ok(7 == a.remainder(-b))
-test_ok(-7 == (-a).remainder(b))
-test_ok(-7 == (-a).remainder(-b))
-
-test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
-test_ok(10**40/10**20 == 100000000000000000000)
-
-a = 677330545177305025495135714080
-b = 14269972710765292560
-test_ok(a % b == 0)
-test_ok(-a % b == 0)
-
-def shift_test(a)
-  b = a / (2 ** 32)
-  c = a >> 32
-  test_ok(b == c)
-
-  b = a * (2 ** 32)
-  c = a << 32
-  test_ok(b == c)
-end
-
-shift_test(-4518325415524767873)
-shift_test(-0xfffffffffffffffff)
-
-test_check "string & char"
-
-test_ok("abcd" == "abcd")
-test_ok("abcd" =~ /abcd/)
-test_ok("abcd" === "abcd")
-# compile time string concatenation
-test_ok("ab" "cd" == "abcd")
-test_ok("#{22}aa" "cd#{44}" == "22aacd44")
-test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
-test_ok("abc" !~ /^$/)
-test_ok("abc\n" !~ /^$/)
-test_ok("abc" !~ /^d*$/)
-test_ok(("abc" =~ /d*$/) == 3)
-test_ok("" =~ /^$/)
-test_ok("\n" =~ /^$/)
-test_ok("a\n\n" =~ /^$/)
-test_ok("abcabc" =~ /.*a/ && $& == "abca")
-test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
-test_ok("abcabc" =~ /.*?a/ && $& == "a")
-test_ok("abcabc" =~ /.*?c/ && $& == "abc")
-test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
-
-test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
-
-test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-
-$x = +<<END;
-ABCD
-ABCD
-END
-$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
-test_ok($x == "AC\nAC\n")
-
-test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
-test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
-
-$foo = "abc"
-test_ok("#$foo = abc" == "abc = abc")
-test_ok("#{$foo} = abc" == "abc = abc")
-
-foo = "abc"
-test_ok("#{foo} = abc" == "abc = abc")
-
-test_ok('-' * 5 == '-----')
-test_ok('-' * 1 == '-')
-test_ok('-' * 0 == '')
-
-foo = '-'
-test_ok(foo * 5 == '-----')
-test_ok(foo * 1 == '-')
-test_ok(foo * 0 == '')
-
-$x = "a.gif"
-test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
-test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
-
-# character constants(assumes ASCII)
-test_ok("a"[0] == ?a)
-test_ok(?a == ?a)
-test_ok(?\C-a == "\1")
-test_ok(?\M-a == "\341")
-test_ok(?\M-\C-a == "\201")
-test_ok("a".dup.upcase![0] == ?A)
-test_ok("A".dup.downcase![0] == ?a)
-test_ok("abc".dup.tr!("a-z", "A-Z") == "ABC")
-test_ok("aabbcccc".dup.tr_s!("a-z", "A-Z") == "ABC")
-test_ok("abcc".dup.squeeze!("a-z") == "abc")
-test_ok("abcd".dup.delete!("bc") == "ad")
-
-$x = "abcdef"
-$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
-$bad = false
-$x.each_byte {|i|
-  if i.chr != $y.shift
-    $bad = true
-    break
-  end
-}
-test_ok(!$bad)
-
-s = +"a string"
-s[0..s.size]="another string"
-test_ok(s == "another string")
-
-s = <<EOS
-#{
-[1,2,3].join(",")
-}
-EOS
-test_ok(s == "1,2,3\n")
-test_ok("Just".to_i(36) == 926381)
-test_ok("-another".to_i(36) == -23200231779)
-test_ok(1299022.to_s(36) == "ruby")
-test_ok(-1045307475.to_s(36) == "-hacker")
-test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
-test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
-
-a = []
-(0..255).each {|n|
-  ch = [n].pack("C")
-  a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
-}
-test_ok(a.size == 0)
-
-test_check "assignment"
-a = nil
-test_ok(defined?(a))
-test_ok(a == nil)
-
-# multiple assignment
-a, b = 1, 2
-test_ok(a == 1 && b == 2)
-
-a, b = b, a
-test_ok(a == 2 && b == 1)
-
-a, = 1,2
-test_ok(a == 1)
-
-a, *b = 1, 2, 3
-test_ok(a == 1 && b == [2, 3])
-
-a, (b, c), d = 1, [2, 3], 4
-test_ok(a == 1 && b == 2 && c == 3 && d == 4)
-
-*a = 1, 2, 3
-test_ok(a == [1, 2, 3])
-
-*a = 4
-test_ok(a == [4])
-
-*a = nil
-test_ok(a == [nil])
-
-test_check "call"
-def aaa(a, b=100, *rest)
-  res = [a, b]
-  res += rest if rest
-  return res
-end
-
-# not enough argument
-begin
-  aaa()				# need at least 1 arg
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-begin
-  aaa				# no arg given (exception raised)
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-test_ok(aaa(1) == [1, 100])
-test_ok(aaa(1, 2) == [1, 2])
-test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
-test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
-
-test_check "proc"
-$proc = Proc.new{|i| i}
-test_ok($proc.call(2) == 2)
-test_ok($proc.call(3) == 3)
-
-$proc = Proc.new{|i| i*2}
-test_ok($proc.call(2) == 4)
-test_ok($proc.call(3) == 6)
-
-Proc.new{
-  iii=5				# nested local variable
-  $proc = Proc.new{|i|
-    iii = i
-  }
-  $proc2 = Proc.new {
-    $x = iii			# nested variables shared by procs
-  }
-  # scope of nested variables
-  test_ok(defined?(iii))
-}.call
-test_ok(!defined?(iii))		# out of scope
-
-loop{iii=5; test_ok(eval("defined? iii")); break}
-loop {
-  iii = 10
-  def dyna_var_check
-    loop {
-      test_ok(!defined?(iii))
-      break
-    }
-  end
-  dyna_var_check
-  break
-}
-$x=0
-$proc.call(5)
-$proc2.call
-test_ok($x == 5)
-
-if defined? Process.kill
-  test_check "signal"
-
-  $x = 0
-  trap "SIGINT", Proc.new{|sig| $x = 2}
-  Process.kill "SIGINT", $$
-  100.times {
-    sleep 0.1
-    break if $x != 0
-  }
-  test_ok($x == 2)
-
-  trap "SIGINT", Proc.new{raise "Interrupt"}
-
-  x = false
-  begin
-    Process.kill "SIGINT", $$
-    sleep 0.1
-  rescue
-    x = $!
-  end
-  test_ok(x && /Interrupt/ =~ x.message)
-end
-
-test_check "eval"
-test_ok(eval("") == nil)
-$bad=false
-eval 'while false; $bad = true; print "foo\n" end'
-test_ok(!$bad)
-
-test_ok(eval('Object'))
-test_ok(eval('true'))
-test_ok(!eval('nil'))
-test_ok(!eval('false'))
-
-$foo = 'test_ok(true)'
-begin
-  eval $foo
-rescue
-  test_ok(false)
-end
-
-test_ok(eval("$foo") == 'test_ok(true)')
-test_ok(eval("true") == true)
-i = 5
-test_ok(eval("i == 5"))
-test_ok(eval("i") == 5)
-test_ok(eval("defined? i"))
-
-# eval with binding
-def test_ev
-  local1 = "local1"
-  lambda {
-    local2 = "local2"
-    return binding
-  }.call
-end
-
-$x = test_ev
-test_ok(eval("local1", $x) == "local1") # normal local var
-test_ok(eval("local2", $x) == "local2") # nested local var
-$bad = true
-begin
-  p eval("local1")
-rescue NameError		# must raise error
-  $bad = false
-end
-test_ok(!$bad)
-
-module EvTest
-  EVTEST1 = 25
-  evtest2 = 125
-  $x = binding
-end
-test_ok(eval("EVTEST1", $x) == 25)	# constant in module
-test_ok(eval("evtest2", $x) == 125)	# local var in module
-$bad = true
-begin
-  eval("EVTEST1")
-rescue NameError		# must raise error
-  $bad = false
-end
-test_ok(!$bad)
-
-x = binding #! YARV Limitation: Proc.new{}
-eval "i4 = 1", x
-test_ok(eval("i4", x) == 1)
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "i4 = 22", x
-test_ok(eval("i4", x) == 22)
-$x = []
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-
-x = binding
-eval "i = 1", x
-test_ok(eval("i", x) == 1)
-x = Proc.new{binding}.call
-eval "i = 22", x
-test_ok(eval("i", x) == 22)
-$x = []
-x = Proc.new{binding}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-x = Proc.new{binding}.call
-eval "for i6 in 1..1; j6=i6; end", x
-test_ok(eval("defined? i6", x))
-test_ok(eval("defined? j6", x))
-
-Proc.new {
-  p = binding
-  eval "foo11 = 1", p
-  foo22 = 5
-  Proc.new{foo11=22}.call
-  Proc.new{foo22=55}.call
-  test_ok(eval("foo11", p) == eval("foo11"))
-  test_ok(eval("foo11") == 1)
-  test_ok(eval("foo22", p) == eval("foo22"))
-  test_ok(eval("foo22") == 55)
-}.call if false #! YARV Limitation
-
-#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-p1 = Proc.new{i7 = 0; binding}.call
-#! YARV Limitation: test_ok(p1.call == 0)
-eval "i7=5", p1
-#! YARV Limitation: test_ok(p1.call == 5)
-test_ok(!defined?(i7))
-
-if false #! YARV Limitation
-p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-i7 = nil
-test_ok(p1.call == 0)
-eval "i7=1", p1
-test_ok(p1.call == 1)
-eval "i7=5", p1
-test_ok(p1.call == 5)
-test_ok(i7 == nil)
-end
-
-# WASI doesn't support spawning a new process for now.
-unless /wasi/ =~ RUBY_PLATFORM
-test_check "system"
-test_ok(`echo foobar` == "foobar\n")
-test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
-
-script_tmp = "script_tmp.#{$$}"
-tmp = open(script_tmp, "w")
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
-test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
-
-tmp = open(script_tmp, "w")
-tmp.print "this is a leading junk\n";
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.print "__END__\n";
-tmp.print "this is a trailing junk\n";
-tmp.close
-
-test_ok(`./miniruby -x #{script_tmp}` == '')
-test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-for i in 1..5
-  tmp.print i, "\n"
-end
-tmp.close
-
-`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
-done = true
-tmp = open(script_tmp, "r")
-while tmp.gets
-  if $_.to_i % 5 != 0
-    done = false
-    break
-  end
-end
-tmp.close
-test_ok(done)
-
-File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
-File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
-end # not /wasi/ =~ RUBY_PLATFORM
-
-test_check "const"
-TEST1 = 1
-TEST2 = 2
-
-module Const
-  TEST3 = 3
-  TEST4 = 4
-end
-
-module Const2
-  TEST3 = 6
-  TEST4 = 8
-end
-
-include Const
-
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
-
-include Const2
-STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
-
-
-test_ok((String <=> Object) == -1)
-test_ok((Object <=> String) == 1)
-test_ok((Array <=> String) == nil)
-
-test_check "clone"
-foo = Object.new
-def foo.test
-  "test"
-end
-bar = foo.clone
-def bar.test2
-  "test2"
-end
-
-test_ok(bar.test2 == "test2")
-test_ok(bar.test == "test")
-test_ok(foo.test == "test")
-
-begin
-  foo.test2
-  test_ok false
-rescue NoMethodError
-  test_ok true
-end
-
-module M001; end
-module M002; end
-module M003; include M002; end
-module M002; include M001; end
-module M003; include M002; end
-
-test_ok(M003.ancestors == [M003, M002, M001])
-
-test_check "marshal"
-$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
-$y = Marshal.dump($x)
-test_ok($x == Marshal.load($y))
-
-StrClone=String.clone;
-test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
-
-[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
-  a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
-  ma = Marshal.dump(a)
-  b = Marshal.load(ma)
-  test_ok(a == b)
-}
-
-test_check "pack"
-
-$format = "c2x5CCxsdils_l_a6";
-# Need the expression in here to force ary[5] to be numeric.  This avoids
-# test2 failing because ary2 goes str->numeric->str and ary does not.
-ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
-$x = ary.pack($format)
-ary2 = $x.unpack($format)
-
-test_ok(ary.length == ary2.length)
-test_ok(ary.join(':') == ary2.join(':'))
-test_ok($x =~ /def/)
-
-$x = [-1073741825]
-test_ok($x.pack("q").unpack("q") == $x)
-
-test_check "math"
-test_ok(Math.sqrt(4) == 2)
-
-include Math
-test_ok(sqrt(4) == 2)
-
-test_check "struct"
-struct_test = Struct.new("Test", :foo, :bar)
-test_ok(struct_test == Struct::Test)
-
-test = struct_test.new(1, 2)
-test_ok(test.foo == 1 && test.bar == 2)
-test_ok(test[0] == 1 && test[1] == 2)
-
-a, b = test.to_a
-test_ok(a == 1 && b == 2)
-
-test[0] = 22
-test_ok(test.foo == 22)
-
-test.bar = 47
-test_ok(test.bar == 47)
-
-test_check "variable"
-test_ok($$.instance_of?(Integer))
-
-# read-only variable
-begin
-  $$ = 5
-  test_ok false
-rescue NameError
-  test_ok true
-end
-
-foobar = "foobar"
-$_ = foobar
-test_ok($_ == foobar)
-
-class Gods
-  @@rule = "Uranus"
-  def ruler0
-    @@rule
-  end
-
-  def self.ruler1		# <= per method definition style
-    @@rule
-  end
-  class << self			# <= multiple method definition style
-    def ruler2
-      @@rule
-    end
-  end
-end
-
-module Olympians
-  @@rule ="Zeus"
-  def ruler3
-    @@rule
-  end
-end
-
-class Titans < Gods
-  @@rule = "Cronus"		# modifies @@rule in Gods
-  include Olympians
-  def ruler4
-    @@rule
-  end
-end
-
-test_ok(Gods.new.ruler0 == "Cronus")
-test_ok(Gods.ruler1 == "Cronus")
-test_ok(Gods.ruler2 == "Cronus")
-test_ok(Titans.ruler1 == "Cronus")
-test_ok(Titans.ruler2 == "Cronus")
-atlas = Titans.new
-test_ok(atlas.ruler0 == "Cronus")
-test_ok(atlas.ruler3 == "Zeus")
-begin
-  atlas.ruler4
-rescue RuntimeError => e
-  test_ok(e.message.include?("class variable @@rule of Olympians is overtaken by Gods"))
-else
-  test_ok(false)
-end
-test_ok(atlas.ruler3 == "Zeus")
-
-test_check "trace"
-$x = 1234
-$y = 0
-trace_var :$x, Proc.new{$y = $x}
-$x = 40414
-test_ok($y == $x)
-
-untrace_var :$x
-$x = 19660208
-test_ok($y != $x)
-
-trace_var :$x, Proc.new{$x *= 2}
-$x = 5
-test_ok($x == 10)
-
-untrace_var :$x
-
-test_check "defined?"
-
-test_ok(defined?($x))		# global variable
-test_ok(defined?($x) == 'global-variable')# returns description
-
-foo=5
-test_ok(defined?(foo))		# local variable
-
-test_ok(defined?(Array))	# constant
-test_ok(defined?(Object.new))	# method
-test_ok(!defined?(Object.print))# private method
-test_ok(defined?(1 == 2))	# operator expression
-
-class Foo
-  def foo
-    p :foo
-  end
-  protected :foo
-  def bar(f)
-    test_ok(defined?(self.foo))
-    test_ok(defined?(f.foo))
-  end
-end
-f = Foo.new
-test_ok(defined?(f.foo) == nil)
-f.bar(f)
-
-def defined_test
-  return !defined?(yield)
-end
-
-test_ok(defined_test)		# not iterator
-test_ok(!defined_test{})	# called as iterator
-
-test_check "alias"
-class Alias0
-  def foo; "foo" end
-end
-class Alias1 < Alias0
-  alias bar foo
-  def foo; "foo+" + super end
-end
-class Alias2 < Alias1
-  alias baz foo
-  undef foo
-end
-
-x = Alias2.new
-test_ok(x.bar == "foo")
-test_ok(x.baz == "foo+foo")
-
-# test_check for cache
-test_ok(x.baz == "foo+foo")
-
-class Alias3 < Alias2
-  def foo
-    defined? super
-  end
-  def bar
-    defined? super
-  end
-  def quux
-    defined? super
-  end
-end
-x = Alias3.new
-test_ok(!x.foo)
-test_ok(x.bar)
-test_ok(!x.quux)
-
-test_check "path"
-test_ok(File.basename("a") == "a")
-test_ok(File.basename("a/b") == "b")
-test_ok(File.basename("a/b/") == "b")
-test_ok(File.basename("/") == "/")
-test_ok(File.basename("//") == "/")
-test_ok(File.basename("///") == "/")
-test_ok(File.basename("a/b////") == "b")
-test_ok(File.basename("a.rb", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".*") == "a")
-test_ok(File.basename("a.rb///", ".c") == "a.rb")
-test_ok(File.dirname("a") == ".")
-test_ok(File.dirname("/") == "/")
-test_ok(File.dirname("/a") == "/")
-test_ok(File.dirname("a/b") == "a")
-test_ok(File.dirname("a/b/c") == "a/b")
-test_ok(File.dirname("/a/b/c") == "/a/b")
-test_ok(File.dirname("/a/b/") == "/a")
-test_ok(File.dirname("/a/b///") == "/a")
-case Dir.pwd
-when %r'\A\w:'
-  test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
-  test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
-  dosish = true
-when %r'\A//'
-  test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
-  test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
-  dosish = true
-else
-  test_ok(File.expand_path(".", "/") == "/")
-  test_ok(File.expand_path("sub", "/") == "/sub")
-end
-if dosish
-  test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
-  test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
-  test_ok(File.expand_path("/", "z:/sub") == "z:/")
-  test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
-end
-test_ok(File.expand_path(".", "//") == "//")
-test_ok(File.expand_path("sub", "//") == "//sub")
-
-# test_check "Proc#binding"
-ObjectSpace.each_object(Proc){|o|
-  begin
-    b = o.binding
-    eval 'self', b
-  rescue ArgumentError
-  end
-}
-
-test_check "gc"
-begin
-  1.upto(10000) {
-    tmp = [0,1,2,3,4,5,6,7,8,9]
-  }
-  tmp = nil
-  test_ok true
-rescue
-  test_ok false
-end
-class S
-  def initialize(a)
-    @a = a
-  end
-end
-l=nil
-100000.times {
-  l = S.new(l)
-}
-GC.start
-test_ok true   # reach here or dumps core
-l = []
-100000.times {
-  l.push([l])
-}
-GC.start
-test_ok true   # reach here or dumps core
-
-ObjectSpace.each_object{|o|
-  o.class.name
-}
-
-test_ok true   # reach here or dumps core
-
-PROGRESS.finish
-if $failed > 0
-  printf "not ok/test: %d failed %d\n", $ntest, $failed
-else
-  printf "end of test(test: %d)\n", $ntest
-end
diff --git a/benchmark/README.md b/benchmark/README.md
deleted file mode 100644
index c5c29d0daf..0000000000
--- a/benchmark/README.md
+++ /dev/null
@@ -1,75 +0,0 @@
-# ruby/benchmark
-
-This directory has benchmark definitions to be run with
-[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
-
-## Normal usage
-
-Execute `gem install benchmark_driver` and run a command like:
-
-```bash
-# Run a benchmark script with the ruby in the $PATH
-benchmark-driver benchmark/app_fib.rb
-
-# Run benchmark scripts with multiple Ruby executables or options
-benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
-
-# Or compare Ruby versions managed by rbenv
-benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
-
-# You can collect many metrics in many ways
-benchmark-driver benchmark/*.rb --runner memory --output markdown
-
-# Some are defined with YAML for complex setup or accurate measurement
-benchmark-driver benchmark/*.yml
-```
-
-See also:
-
-```console
-benchmark-driver --help
-Usage: benchmark-driver [options] RUBY|YAML...
-    -r, --runner TYPE                Specify runner type: ips, time, memory, once, block (default: ips)
-    -o, --output TYPE                Specify output type: compare, simple, markdown, record, all (default: compare)
-    -e, --executables EXECS          Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
-        --rbenv VERSIONS             Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
-        --repeat-count NUM           Try benchmark NUM times and use the fastest result or the worst memory usage
-        --repeat-result TYPE         Yield "best", "average" or "worst" result with --repeat-count (default: best)
-        --alternate                  Alternate executables instead of running the same executable in a row with --repeat-count
-        --bundler                    Install and use gems specified in Gemfile
-        --filter REGEXP              Filter out benchmarks with given regexp
-        --run-duration SECONDS       Warmup estimates loop_count to run for this duration (default: 3)
-        --timeout SECONDS            Timeout ruby command execution with timeout(1)
-    -v, --verbose                    Verbose mode. Multiple -v options increase visilibity (max: 2)
-```
-
-## make benchmark
-
-Using `make benchmark`, `make update-benchmark-driver` automatically downloads
-the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
-benchmark\_driver.
-
-```bash
-# Run all benchmarks with the ruby in the $PATH and the built ruby
-make benchmark
-
-# Or compare with specific ruby binary
-make benchmark COMPARE_RUBY="/path/to/ruby --jit"
-
-# Run vm benchmarks
-make benchmark ITEM=vm
-
-# Run some limited benchmarks in ITEM-matched files
-make benchmark ITEM=vm OPTS=--filter=block
-
-# You can specify the benchmark by an exact filename instead of using the default argument:
-# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
-make benchmark ARGS=benchmark/erb_render.yml
-
-# You can specify any option via $OPTS
-make benchmark OPTS="--help"
-
-# With `make benchmark`, some special runner plugins are available:
-#   -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
-make benchmark ITEM=vm_bigarray OPTS="-r peak"
-```
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
deleted file mode 100644
index c1546e08ab..0000000000
--- a/benchmark/app_aobench.rb
+++ /dev/null
@@ -1,297 +0,0 @@
-# coding: US-ASCII
-
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-#      https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-srand(0)
-
-class Vec
-  def initialize(x, y, z)
-    @x = x
-    @y = y
-    @z = z
-  end
-
-  attr_accessor :x, :y, :z
-
-  def vadd(b)
-    Vec.new(@x + b.x, @y + b.y, @z + b.z)
-  end
-
-  def vsub(b)
-    Vec.new(@x - b.x, @y - b.y, @z - b.z)
-  end
-
-  def vcross(b)
-    Vec.new(@y * b.z - @z * b.y,
-            @z * b.x - @x * b.z,
-            @x * b.y - @y * b.x)
-  end
-
-  def vdot(b)
-    @x * b.x + @y * b.y + @z * b.z
-  end
-
-  def vlength
-    Math.sqrt(@x * @x + @y * @y + @z * @z)
-  end
-
-  def vnormalize
-    len = vlength
-    v = Vec.new(@x, @y, @z)
-    if len > 1.0e-17 then
-      v.x = v.x / len
-      v.y = v.y / len
-      v.z = v.z / len
-    end
-    v
-  end
-end
-
-
-class Sphere
-  def initialize(center, radius)
-    @center = center
-    @radius = radius
-  end
-
-  attr_reader :center, :radius
-
-  def intersect(ray, isect)
-    rs = ray.org.vsub(@center)
-    b = rs.vdot(ray.dir)
-    c = rs.vdot(rs) - (@radius * @radius)
-    d = b * b - c
-    if d > 0.0 then
-      t = - b - Math.sqrt(d)
-
-      if t > 0.0 and t < isect.t then
-        isect.t = t
-        isect.hit = true
-        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
-                          ray.org.y + ray.dir.y * t,
-                          ray.org.z + ray.dir.z * t)
-        n = isect.pl.vsub(@center)
-        isect.n = n.vnormalize
-      else
-        0.0
-      end
-    end
-    nil
-  end
-end
-
-class Plane
-  def initialize(p, n)
-    @p = p
-    @n = n
-  end
-
-  def intersect(ray, isect)
-    d = -@p.vdot(@n)
-    v = ray.dir.vdot(@n)
-    v0 = v
-    if v < 0.0 then
-      v0 = -v
-    end
-    if v0 < 1.0e-17 then
-      return
-    end
-
-    t = -(ray.org.vdot(@n) + d) / v
-
-    if t > 0.0 and t < isect.t then
-      isect.hit = true
-      isect.t = t
-      isect.n = @n
-      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
-                        ray.org.y + t * ray.dir.y,
-                        ray.org.z + t * ray.dir.z)
-    end
-    nil
-  end
-end
-
-class Ray
-  def initialize(org, dir)
-    @org = org
-    @dir = dir
-  end
-
-  attr_accessor :org, :dir
-end
-
-class Isect
-  def initialize
-    @t = 10000000.0
-    @hit = false
-    @pl = Vec.new(0.0, 0.0, 0.0)
-    @n = Vec.new(0.0, 0.0, 0.0)
-  end
-
-  attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
-  i = f * 255.5
-  if i > 255.0 then
-    i = 255.0
-  end
-  if i < 0.0 then
-    i = 0.0
-  end
-  i.to_i
-end
-
-def orthoBasis(basis, n)
-  basis[2] = Vec.new(n.x, n.y, n.z)
-  basis[1] = Vec.new(0.0, 0.0, 0.0)
-
-  if n.x < 0.6 and n.x > -0.6 then
-    basis[1].x = 1.0
-  elsif n.y < 0.6 and n.y > -0.6 then
-    basis[1].y = 1.0
-  elsif n.z < 0.6 and n.z > -0.6 then
-    basis[1].z = 1.0
-  else
-    basis[1].x = 1.0
-  end
-
-  basis[0] = basis[1].vcross(basis[2])
-  basis[0] = basis[0].vnormalize
-
-  basis[1] = basis[2].vcross(basis[0])
-  basis[1] = basis[1].vnormalize
-end
-
-class Scene
-  def initialize
-    @spheres = Array.new
-    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
-    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
-    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
-    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
-  end
-
-  def ambient_occlusion(isect)
-    basis = Array.new
-    orthoBasis(basis, isect.n)
-
-    ntheta    = NAO_SAMPLES
-    nphi      = NAO_SAMPLES
-    eps       = 0.0001
-    occlusion = 0.0
-
-    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
-                isect.pl.y + eps * isect.n.y,
-                isect.pl.z + eps * isect.n.z)
-    nphi.times do |j|
-      ntheta.times do |i|
-        r = rand
-        phi = 2.0 * 3.14159265 * rand
-        x = Math.cos(phi) * Math.sqrt(1.0 - r)
-        y = Math.sin(phi) * Math.sqrt(1.0 - r)
-        z = Math.sqrt(r)
-
-        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
-        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
-        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
-        raydir = Vec.new(rx, ry, rz)
-        ray = Ray.new(p0, raydir)
-
-        occisect = Isect.new
-        @spheres[0].intersect(ray, occisect)
-        @spheres[1].intersect(ray, occisect)
-        @spheres[2].intersect(ray, occisect)
-        @plane.intersect(ray, occisect)
-        if occisect.hit then
-          occlusion = occlusion + 1.0
-        else
-          0.0
-        end
-      end
-    end
-
-    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
-    Vec.new(occlusion, occlusion, occlusion)
-  end
-
-  def render(w, h, nsubsamples)
-    cnt = 0
-    nsf = nsubsamples.to_f
-    h.times do |y|
-      w.times do |x|
-        rad = Vec.new(0.0, 0.0, 0.0)
-
-        # Subsampling
-        nsubsamples.times do |v|
-          nsubsamples.times do |u|
-
-            cnt = cnt + 1
-            wf = w.to_f
-            hf = h.to_f
-            xf = x.to_f
-            yf = y.to_f
-            uf = u.to_f
-            vf = v.to_f
-
-            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
-            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
-            eye = Vec.new(px, py, -1.0).vnormalize
-
-            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
-            isect = Isect.new
-            @spheres[0].intersect(ray, isect)
-            @spheres[1].intersect(ray, isect)
-            @spheres[2].intersect(ray, isect)
-            @plane.intersect(ray, isect)
-            if isect.hit then
-              col = ambient_occlusion(isect)
-              rad.x = rad.x + col.x
-              rad.y = rad.y + col.y
-              rad.z = rad.z + col.z
-            end
-          end
-        end
-
-        r = rad.x / (nsf * nsf)
-        g = rad.y / (nsf * nsf)
-        b = rad.z / (nsf * nsf)
-        printf("%c", clamp(r))
-        printf("%c", clamp(g))
-        printf("%c", clamp(b))
-      end
-      nil
-    end
-
-    nil
-  end
-end
-
-alias printf_orig printf
-def printf *args
-  # $fp.printf(*args)
-end
-
-# File.open("ao.ppm", "w") do |fp|
-  # $fp = fp
-  printf("P6\n")
-  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  printf("255\n")
-  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
deleted file mode 100644
index 31e29b7644..0000000000
--- a/benchmark/app_erb.yml
+++ /dev/null
@@ -1,23 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-prelude: |
-  require 'erb'
-
-  data = <<erb
-  <html>
-    <head> <%= title %> </head>
-    <body>
-      <h1> <%= title %> </h1>
-      <p>
-        <%= content %>
-      </p>
-    </body>
-  </html>
-  erb
-
-  title = "hello world!"
-  content = "hello world!\n" * 10
-benchmark:
-  app_erb: ERB.new(data).result(binding)
-loop_count: 15000
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
deleted file mode 100644
index 47be7b203f..0000000000
--- a/benchmark/app_pentomino.rb
+++ /dev/null
@@ -1,130 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
-  nb.each{|x|
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      [-ROW, -1, 1, ROW].each{|d|
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      }
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  }
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  (0...ROW*COL).each{|i|
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  }
-end
-
-def pboard
-  return # skip print
-  print "No. #$no\n"
-  (0...COL).each{|i|
-    print "|"
-    (0...ROW-NP).each{|j|
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    }
-    print "\n"
-  }
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      x.each{|s|
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      }
-      if f == 0 then
-        x.each{|s|
-          $b[pos+s] = i
-        }
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        x.each{|s|
-          $b[pos+s] = -1
-        }
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
deleted file mode 100644
index 88ef544ba0..0000000000
--- a/benchmark/array_flatten.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  small_flat_ary = 5.times.to_a
-  large_flat_ary = 100.times.to_a
-  small_pairs_ary = [[1, 2]] * 5
-  large_pairs_ary = [[1, 2]] * 100
-  mostly_flat_ary = 100.times.to_a.push([101, 102])
-
-benchmark:
-  small_flat_ary.flatten: small_flat_ary.flatten
-  small_flat_ary.flatten!: small_flat_ary.flatten!
-  large_flat_ary.flatten: large_flat_ary.flatten
-  large_flat_ary.flatten!: large_flat_ary.flatten!
-  small_pairs_ary.flatten: small_pairs_ary.flatten
-  small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
-  large_pairs_ary.flatten: large_pairs_ary.flatten
-  large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
-  mostly_flat_ary.flatten: mostly_flat_ary.flatten
-  mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
-loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
deleted file mode 100644
index 26705323fd..0000000000
--- a/benchmark/array_intersection.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
-  small1 = [1, 2, 3]
-  small2 = [1, 2, 3, 4, 5]
-  small3 = [2, 3, 4, 5]
-  small4 = [2]
-  big1 = [1, 2, 3, 4] * 64
-  big2 = [1, 2, 3] * 64
-  big3 = [1, 2] * 64
-
-benchmark:
-  small-&: small1 & small2 & small3 & small4
-  small-intersection: small1.intersection(small2, small3, small4)
-  big-&: big1 & big2 & big3
-  big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_large_literal.yml b/benchmark/array_large_literal.yml
deleted file mode 100644
index 423d68391f..0000000000
--- a/benchmark/array_large_literal.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  def def_array(size)
-    Object.class_eval(<<-END)
-      def array_#{size}
-        x = 1
-        [#{(['x'] * size).join(',')}]
-      end
-    END
-  end
-  def_array(100)
-  def_array(1000)
-  def_array(10000)
-  def_array(100000)
-benchmark:
-  array_100: array_100
-  array_1000: array_1000
-  array_10000: array_10000
-  array_100000: array_100000
-
diff --git a/benchmark/array_max_float.yml b/benchmark/array_max_float.yml
deleted file mode 100644
index ace1ae2e14..0000000000
--- a/benchmark/array_max_float.yml
+++ /dev/null
@@ -1,30 +0,0 @@
-prelude: |
-  ary2 = 2.times.map(&:to_f).shuffle
-  ary10 = 10.times.map(&:to_f).shuffle
-  ary100 = 100.times.map(&:to_f).shuffle
-  ary500 = 500.times.map(&:to_f).shuffle
-  ary1000 = 1000.times.map(&:to_f).shuffle
-  ary2000 = 2500.times.map(&:to_f).shuffle
-  ary3000 = 2500.times.map(&:to_f).shuffle
-  ary5000 = 5000.times.map(&:to_f).shuffle
-  ary10000 = 10000.times.map(&:to_f).shuffle
-  ary20000 = 20000.times.map(&:to_f).shuffle
-  ary50000 = 50000.times.map(&:to_f).shuffle
-  ary100000 = 100000.times.map(&:to_f).shuffle
-
-benchmark:
-  ary2.max: ary2.max
-  ary10.max: ary10.max
-  ary100.max: ary100.max
-  ary500.max: ary500.max
-  ary1000.max: ary1000.max
-  ary2000.max: ary2000.max
-  ary3000.max: ary3000.max
-  ary5000.max: ary5000.max
-  ary10000.max: ary10000.max
-  ary20000.max: ary20000.max
-  ary50000.max: ary50000.max
-  ary100000.max: ary100000.max
-
-loop_count: 10000
-
diff --git a/benchmark/array_max_int.yml b/benchmark/array_max_int.yml
deleted file mode 100644
index acd83684d0..0000000000
--- a/benchmark/array_max_int.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  ary2 = 2.times.to_a.shuffle
-  ary10 = 10.times.to_a.shuffle
-  ary100 = 100.times.to_a.shuffle
-  ary500 = 500.times.to_a.shuffle
-  ary1000 = 1000.times.to_a.shuffle
-  ary2000 = 2500.times.to_a.shuffle
-  ary3000 = 2500.times.to_a.shuffle
-  ary5000 = 5000.times.to_a.shuffle
-  ary10000 = 10000.times.to_a.shuffle
-  ary20000 = 20000.times.to_a.shuffle
-  ary50000 = 50000.times.to_a.shuffle
-  ary100000 = 100000.times.to_a.shuffle
-  ary1000000 = 1000000.times.to_a.shuffle
-
-benchmark:
-  ary2.max: ary2.max
-  ary10.max: ary10.max
-  ary100.max: ary100.max
-  ary500.max: ary500.max
-  ary1000.max: ary1000.max
-  ary2000.max: ary2000.max
-  ary3000.max: ary3000.max
-  ary5000.max: ary5000.max
-  ary10000.max: ary10000.max
-  ary20000.max: ary20000.max
-  ary50000.max: ary50000.max
-  ary100000.max: ary100000.max
-  ary1000000.max: ary1000000.max
-
-loop_count: 10000
diff --git a/benchmark/array_max_str.yml b/benchmark/array_max_str.yml
deleted file mode 100644
index 2aeed010f2..0000000000
--- a/benchmark/array_max_str.yml
+++ /dev/null
@@ -1,30 +0,0 @@
-prelude: |
-  ary2 = 2.times.map(&:to_s).shuffle
-  ary10 = 10.times.map(&:to_s).shuffle
-  ary100 = 100.times.map(&:to_s).shuffle
-  ary500 = 500.times.map(&:to_s).shuffle
-  ary1000 = 1000.times.map(&:to_s).shuffle
-  ary2000 = 2500.times.map(&:to_s).shuffle
-  ary3000 = 2500.times.map(&:to_s).shuffle
-  ary5000 = 5000.times.map(&:to_s).shuffle
-  ary10000 = 10000.times.map(&:to_s).shuffle
-  ary20000 = 20000.times.map(&:to_s).shuffle
-  ary50000 = 50000.times.map(&:to_s).shuffle
-  ary100000 = 100000.times.map(&:to_s).shuffle
-
-benchmark:
-  ary2.max: ary2.max
-  ary10.max: ary10.max
-  ary100.max: ary100.max
-  ary500.max: ary500.max
-  ary1000.max: ary1000.max
-  ary2000.max: ary2000.max
-  ary3000.max: ary3000.max
-  ary5000.max: ary5000.max
-  ary10000.max: ary10000.max
-  ary20000.max: ary20000.max
-  ary50000.max: ary50000.max
-  ary100000.max: ary100000.max
-
-loop_count: 10000
-
diff --git a/benchmark/array_min.yml b/benchmark/array_min.yml
deleted file mode 100644
index 53e5072b14..0000000000
--- a/benchmark/array_min.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  ary2 = 2.times.to_a.shuffle
-  ary10 = 10.times.to_a.shuffle
-  ary100 = 100.times.to_a.shuffle
-  ary500 = 500.times.to_a.shuffle
-  ary1000 = 1000.times.to_a.shuffle
-  ary2000 = 2500.times.to_a.shuffle
-  ary3000 = 2500.times.to_a.shuffle
-  ary5000 = 5000.times.to_a.shuffle
-  ary10000 = 10000.times.to_a.shuffle
-  ary20000 = 20000.times.to_a.shuffle
-  ary50000 = 50000.times.to_a.shuffle
-  ary100000 = 100000.times.to_a.shuffle
-  ary1000000 = 1000000.times.to_a.shuffle
-
-benchmark:
-  ary2.min: ary2.min
-  ary10.min: ary10.min
-  ary100.min: ary100.min
-  ary500.min: ary500.min
-  ary1000.min: ary1000.min
-  ary2000.min: ary2000.min
-  ary3000.min: ary3000.min
-  ary5000.min: ary5000.min
-  ary10000.min: ary10000.min
-  ary20000.min: ary20000.min
-  ary50000.min: ary50000.min
-  ary100000.min: ary100000.min
-  ary1000000.min: ary1000000.min
-
-loop_count: 10000
diff --git a/benchmark/array_sample.yml b/benchmark/array_sample.yml
deleted file mode 100644
index 1cd2b34794..0000000000
--- a/benchmark/array_sample.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-prelude: ary = (1..10_000).to_a
-benchmark:
-  - ary.sample
-  - ary.sample(2)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
deleted file mode 100644
index 5f41ecc32b..0000000000
--- a/benchmark/array_sample_100k_10.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
deleted file mode 100644
index 18b1715319..0000000000
--- a/benchmark/array_sample_100k_11.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
deleted file mode 100644
index 22863afe89..0000000000
--- a/benchmark/array_sample_100k__100.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
deleted file mode 100644
index 4cd79e6c67..0000000000
--- a/benchmark/array_sample_100k__1k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
deleted file mode 100644
index b3d264249e..0000000000
--- a/benchmark/array_sample_100k__6k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
deleted file mode 100644
index 5dd55ec058..0000000000
--- a/benchmark/array_sample_100k___10k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
deleted file mode 100644
index 1506732c3c..0000000000
--- a/benchmark/array_sample_100k___50k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
deleted file mode 100644
index e53a6edae6..0000000000
--- a/benchmark/array_small_and.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
-MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
-ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
-
-ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
-  (MIN_SIZE..MAX_SIZE).map do |size2|
-    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
-  end
-end
-
-ITERATIONS.times do
-  ARRAYS.each do |group|
-    group.each do |arr1, arr2|
-      arr1 & arr2
-    end
-  end
-end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
deleted file mode 100644
index 9661ee48db..0000000000
--- a/benchmark/array_small_diff.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
-MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
-ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
-
-ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
-  (MIN_SIZE..MAX_SIZE).map do |size2|
-    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
-  end
-end
-
-ITERATIONS.times do
-  ARRAYS.each do |group|
-    group.each do |arr1, arr2|
-      arr1 - arr2
-    end
-  end
-end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
deleted file mode 100644
index c58b5fd1ff..0000000000
--- a/benchmark/array_small_or.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
-MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
-ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
-
-ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
-  (MIN_SIZE..MAX_SIZE).map do |size2|
-    [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
-  end
-end
-
-ITERATIONS.times do
-  ARRAYS.each do |group|
-    group.each do |arr1, arr2|
-      arr1 | arr2
-    end
-  end
-end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
deleted file mode 100644
index 3579786056..0000000000
--- a/benchmark/array_sort_block.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(1000) { rand(1000) }
-10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
deleted file mode 100644
index 9a6e2f8bd2..0000000000
--- a/benchmark/array_sort_float.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = Array.new(1000) { rand }
-10000.times { arr.sort }
diff --git a/benchmark/array_sort_int.yml b/benchmark/array_sort_int.yml
deleted file mode 100644
index 7b9027ebf7..0000000000
--- a/benchmark/array_sort_int.yml
+++ /dev/null
@@ -1,15 +0,0 @@
-prelude: |
-  ary2 = 2.times.to_a.shuffle
-  ary10 = 10.times.to_a.shuffle
-  ary100 = 100.times.to_a.shuffle
-  ary1000 = 1000.times.to_a.shuffle
-  ary10000 = 10000.times.to_a.shuffle
-
-benchmark:
-  ary2.sort: ary2.sort
-  ary10.sort: ary10.sort
-  ary100.sort: ary100.sort
-  ary1000.sort: ary1000.sort
-  ary10000.sort: ary10000.sort
-
-loop_count: 10000
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
deleted file mode 100644
index 6cb394cb9f..0000000000
--- a/benchmark/array_values_at_int.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(10000) {|i| i}
-100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
deleted file mode 100644
index 5b53806d1c..0000000000
--- a/benchmark/array_values_at_range.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(10000) {|i| i}
-100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/attr_accessor.yml b/benchmark/attr_accessor.yml
deleted file mode 100644
index 82134cdf9b..0000000000
--- a/benchmark/attr_accessor.yml
+++ /dev/null
@@ -1,29 +0,0 @@
-prelude: |
-  class C
-    attr_accessor :x
-    def initialize
-      @x = nil
-    end
-    class_eval <<-END
-      def ar
-        #{'x;'*256}
-      end
-      def aw
-        #{'self.x = nil;'*256}
-      end
-      def arm
-        m = method(:x)
-        #{'m.call;'*256}
-      end
-      def awm
-        m = method(:x=)
-        #{'m.call(nil);'*256}
-      end
-    END
-  end
-  obj = C.new
-benchmark:
-  attr_reader: "obj.ar"
-  attr_writer: "obj.aw"
-  attr_reader_method: "obj.arm"
-  attr_writer_method: "obj.awm"
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
deleted file mode 100644
index e2ad5a5c94..0000000000
--- a/benchmark/bighash.rb
+++ /dev/null
@@ -1 +0,0 @@
-h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/app_answer.rb b/benchmark/bm_app_answer.rb
index 3cd8a8fd37..3cd8a8fd37 100644
--- a/benchmark/app_answer.rb
+++ b/benchmark/bm_app_answer.rb
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
new file mode 100644
index 0000000000..2bd6acfaf8
--- /dev/null
+++ b/benchmark/bm_app_aobench.rb
@@ -0,0 +1,291 @@
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def otherBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    otherBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/benchmark/app_factorial.rb b/benchmark/bm_app_factorial.rb
index 45f471dfdb..45f471dfdb 100644
--- a/benchmark/app_factorial.rb
+++ b/benchmark/bm_app_factorial.rb
diff --git a/benchmark/app_fib.rb b/benchmark/bm_app_fib.rb
index 34a7b2e725..34a7b2e725 100644
--- a/benchmark/app_fib.rb
+++ b/benchmark/bm_app_fib.rb
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
index f09574bbeb..f09574bbeb 100644
--- a/benchmark/app_lc_fizzbuzz.rb
+++ b/benchmark/bm_app_lc_fizzbuzz.rb
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
index 801b75e8e2..801b75e8e2 100644
--- a/benchmark/app_mandelbrot.rb
+++ b/benchmark/bm_app_mandelbrot.rb
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+  for x in nb
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      for d in [-ROW, -1, 1, ROW]
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      end
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  end
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  for i in 0...ROW*COL
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  end
+end
+
+def pboard
+  print "No. #$no\n"
+  for i in 0...COL
+    print "|"
+    for j in 0...ROW-NP
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    end
+    print "\n"
+  end
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      for s in x do
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      end
+      if f == 0 then
+        for s in x do
+          $b[pos+s] = i
+        end
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        for s in x do
+          $b[pos+s] = -1
+        end
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/bm_app_raise.rb
index 5db8f95d50..5db8f95d50 100644
--- a/benchmark/app_raise.rb
+++ b/benchmark/bm_app_raise.rb
diff --git a/benchmark/app_strconcat.rb b/benchmark/bm_app_strconcat.rb
index 7eed7c1aed..7eed7c1aed 100644
--- a/benchmark/app_strconcat.rb
+++ b/benchmark/bm_app_strconcat.rb
diff --git a/benchmark/app_tak.rb b/benchmark/bm_app_tak.rb
index efe5380f4e..efe5380f4e 100644
--- a/benchmark/app_tak.rb
+++ b/benchmark/bm_app_tak.rb
diff --git a/benchmark/app_tarai.rb b/benchmark/bm_app_tarai.rb
index 4c146f5ccf..4c146f5ccf 100644
--- a/benchmark/app_tarai.rb
+++ b/benchmark/bm_app_tarai.rb
diff --git a/benchmark/app_uri.rb b/benchmark/bm_app_uri.rb
index 586edfd5dc..586edfd5dc 100644
--- a/benchmark/app_uri.rb
+++ b/benchmark/bm_app_uri.rb
diff --git a/benchmark/array_shift.rb b/benchmark/bm_array_shift.rb
index 798bb9e3f4..798bb9e3f4 100644
--- a/benchmark/array_shift.rb
+++ b/benchmark/bm_array_shift.rb
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb
index af4f8c36d4..af4f8c36d4 100644
--- a/benchmark/hash_aref_dsym.rb
+++ b/benchmark/bm_hash_aref_dsym.rb
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb
index 9d7759379e..9d7759379e 100644
--- a/benchmark/hash_aref_dsym_long.rb
+++ b/benchmark/bm_hash_aref_dsym_long.rb
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb
index 1346890582..1346890582 100644
--- a/benchmark/hash_aref_fix.rb
+++ b/benchmark/bm_hash_aref_fix.rb
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb
index 2217274c82..2217274c82 100644
--- a/benchmark/hash_aref_flo.rb
+++ b/benchmark/bm_hash_aref_flo.rb
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
index b0913dd4bb..b0913dd4bb 100644
--- a/benchmark/hash_aref_miss.rb
+++ b/benchmark/bm_hash_aref_miss.rb
diff --git a/benchmark/hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
index 19439b061b..19439b061b 100644
--- a/benchmark/hash_aref_str.rb
+++ b/benchmark/bm_hash_aref_str.rb
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
index f75d163fe6..f75d163fe6 100644
--- a/benchmark/hash_aref_sym.rb
+++ b/benchmark/bm_hash_aref_sym.rb
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
index 9dab8df7be..9dab8df7be 100644
--- a/benchmark/hash_aref_sym_long.rb
+++ b/benchmark/bm_hash_aref_sym_long.rb
diff --git a/benchmark/hash_flatten.rb b/benchmark/bm_hash_flatten.rb
index e944aae9f2..e944aae9f2 100644
--- a/benchmark/hash_flatten.rb
+++ b/benchmark/bm_hash_flatten.rb
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb
index 0c7edfed3e..0c7edfed3e 100644
--- a/benchmark/hash_ident_flo.rb
+++ b/benchmark/bm_hash_ident_flo.rb
diff --git a/benchmark/hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
index b226736c6f..b226736c6f 100644
--- a/benchmark/hash_ident_num.rb
+++ b/benchmark/bm_hash_ident_num.rb
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
index 4b3b58edec..4b3b58edec 100644
--- a/benchmark/hash_ident_obj.rb
+++ b/benchmark/bm_hash_ident_obj.rb
diff --git a/benchmark/hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
index 8582b38e31..8582b38e31 100644
--- a/benchmark/hash_ident_str.rb
+++ b/benchmark/bm_hash_ident_str.rb
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
index 4c81e3d28e..4c81e3d28e 100644
--- a/benchmark/hash_ident_sym.rb
+++ b/benchmark/bm_hash_ident_sym.rb
diff --git a/benchmark/hash_keys.rb b/benchmark/bm_hash_keys.rb
index 6863cd01f9..6863cd01f9 100644
--- a/benchmark/hash_keys.rb
+++ b/benchmark/bm_hash_keys.rb
diff --git a/benchmark/hash_shift.rb b/benchmark/bm_hash_shift.rb
index a645671a5b..a645671a5b 100644
--- a/benchmark/hash_shift.rb
+++ b/benchmark/bm_hash_shift.rb
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/bm_hash_shift_u16.rb
index ec800d0342..ec800d0342 100644
--- a/benchmark/hash_shift_u16.rb
+++ b/benchmark/bm_hash_shift_u16.rb
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/bm_hash_shift_u24.rb
index de4e0fa696..de4e0fa696 100644
--- a/benchmark/hash_shift_u24.rb
+++ b/benchmark/bm_hash_shift_u24.rb
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/bm_hash_shift_u32.rb
index 656aa55583..656aa55583 100644
--- a/benchmark/hash_shift_u32.rb
+++ b/benchmark/bm_hash_shift_u32.rb
diff --git a/benchmark/hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb
index 2b675bf509..2b675bf509 100644
--- a/benchmark/hash_to_proc.rb
+++ b/benchmark/bm_hash_to_proc.rb
diff --git a/benchmark/hash_values.rb b/benchmark/bm_hash_values.rb
index 069441302f..069441302f 100644
--- a/benchmark/hash_values.rb
+++ b/benchmark/bm_hash_values.rb
diff --git a/benchmark/io_file_create.rb b/benchmark/bm_io_file_create.rb
index 2f205c1333..2f205c1333 100644
--- a/benchmark/io_file_create.rb
+++ b/benchmark/bm_io_file_create.rb
diff --git a/benchmark/io_file_read.rb b/benchmark/bm_io_file_read.rb
index b9e796ed30..b9e796ed30 100644
--- a/benchmark/io_file_read.rb
+++ b/benchmark/bm_io_file_read.rb
diff --git a/benchmark/io_file_write.rb b/benchmark/bm_io_file_write.rb
index aa1be0e5fe..aa1be0e5fe 100644
--- a/benchmark/io_file_write.rb
+++ b/benchmark/bm_io_file_write.rb
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb
index da9357fdc6..da9357fdc6 100644
--- a/benchmark/io_nonblock_noex.rb
+++ b/benchmark/bm_io_nonblock_noex.rb
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/bm_io_nonblock_noex2.rb
index 56819d049b..56819d049b 100644
--- a/benchmark/io_nonblock_noex2.rb
+++ b/benchmark/bm_io_nonblock_noex2.rb
diff --git a/benchmark/io_select.rb b/benchmark/bm_io_select.rb
index 19248daeb1..19248daeb1 100644
--- a/benchmark/io_select.rb
+++ b/benchmark/bm_io_select.rb
diff --git a/benchmark/io_select2.rb b/benchmark/bm_io_select2.rb
index 10e37d71b2..10e37d71b2 100644
--- a/benchmark/io_select2.rb
+++ b/benchmark/bm_io_select2.rb
diff --git a/benchmark/io_select3.rb b/benchmark/bm_io_select3.rb
index 7d0ba1f092..7d0ba1f092 100644
--- a/benchmark/io_select3.rb
+++ b/benchmark/bm_io_select3.rb
diff --git a/benchmark/loop_for.rb b/benchmark/bm_loop_for.rb
index 0fc4cc1511..0fc4cc1511 100644
--- a/benchmark/loop_for.rb
+++ b/benchmark/bm_loop_for.rb
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/loop_times.rb b/benchmark/bm_loop_times.rb
index 521f72ad1a..521f72ad1a 100644
--- a/benchmark/loop_times.rb
+++ b/benchmark/bm_loop_times.rb
diff --git a/benchmark/loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
index 0072822c06..0072822c06 100644
--- a/benchmark/loop_whileloop.rb
+++ b/benchmark/bm_loop_whileloop.rb
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
index 47d02dffc4..47d02dffc4 100644
--- a/benchmark/loop_whileloop2.rb
+++ b/benchmark/bm_loop_whileloop2.rb
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb
index 9b8d0c6afb..9b8d0c6afb 100644
--- a/benchmark/marshal_dump_flo.rb
+++ b/benchmark/bm_marshal_dump_flo.rb
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb
index 8252ad90fa..8252ad90fa 100644
--- a/benchmark/marshal_dump_load_geniv.rb
+++ b/benchmark/bm_marshal_dump_load_geniv.rb
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb
index e29743b791..e29743b791 100644
--- a/benchmark/marshal_dump_load_time.rb
+++ b/benchmark/bm_marshal_dump_load_time.rb
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
new file mode 100644
index 0000000000..b8abc88f41
--- /dev/null
+++ b/benchmark/bm_require.rb
@@ -0,0 +1,7 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+1.upto(10000) do |i|
+  require "c#{i}"
+end
+
+$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
new file mode 100644
index 0000000000..e54db6c6e5
--- /dev/null
+++ b/benchmark/bm_require_thread.rb
@@ -0,0 +1,15 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+i=0
+t = Thread.new do
+  while true
+    i = i+1 # dummy loop
+  end
+end
+
+1.upto(100) do |i|
+  require "c#{i}"
+end
+
+$:.pop
+t.kill
diff --git a/benchmark/securerandom.rb b/benchmark/bm_securerandom.rb
index a082ea6d5b..a082ea6d5b 100644
--- a/benchmark/securerandom.rb
+++ b/benchmark/bm_securerandom.rb
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
index b1693e4109..b1693e4109 100644
--- a/benchmark/so_binary_trees.rb
+++ b/benchmark/bm_so_binary_trees.rb
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..873214de7c
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+  tmp = input.read(4096) or break
+  data = tmp << (input.gets || "")
+  nc += data.length
+  nl += data.count("\n")
+  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+  nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..deb003a594
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
index bac5ecd44c..bac5ecd44c 100644
--- a/benchmark/so_fannkuch.rb
+++ b/benchmark/bm_so_fannkuch.rb
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/so_lists.rb b/benchmark/bm_so_lists.rb
index e8f4a2a5f7..e8f4a2a5f7 100644
--- a/benchmark/so_lists.rb
+++ b/benchmark/bm_so_lists.rb
diff --git a/benchmark/so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
index 76331c64b8..76331c64b8 100644
--- a/benchmark/so_mandelbrot.rb
+++ b/benchmark/bm_so_mandelbrot.rb
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..17e9c046a8
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values ( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+  @x, @y, @z = x, y, z
+  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+  @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+  while i < nbodies
+   b2 = bodies[i]
+   dx = @x - b2.x
+   dy = @y - b2.y
+   dz = @z - b2.z
+
+   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+   mag = dt / (distance * distance * distance)
+   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+   @vx -= dx * b2_mass_mag
+   @vy -= dy * b2_mass_mag
+   @vz -= dz * b2_mass_mag
+   b2.vx += dx * b_mass_mag
+   b2.vy += dy * b_mass_mag
+   b2.vz += dz * b_mass_mag
+   i += 1
+  end
+
+  @x += dt * @vx
+  @y += dt * @vy
+  @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/so_nsieve.rb b/benchmark/bm_so_nsieve.rb
index a65cc78233..a65cc78233 100644
--- a/benchmark/so_nsieve.rb
+++ b/benchmark/bm_so_nsieve.rb
diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
index 6f958ee44e..6f958ee44e 100644
--- a/benchmark/so_nsieve_bits.rb
+++ b/benchmark/bm_so_nsieve_bits.rb
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
index 630b45cb8d..630b45cb8d 100644
--- a/benchmark/so_partial_sums.rb
+++ b/benchmark/bm_so_partial_sums.rb
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
new file mode 100644
index 0000000000..c7d6fbfb4d
--- /dev/null
+++ b/benchmark/bm_so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize (q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/so_random.rb b/benchmark/bm_so_random.rb
index a66b9e8e63..a66b9e8e63 100644
--- a/benchmark/so_random.rb
+++ b/benchmark/bm_so_random.rb
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..82ea666994
--- /dev/null
+++ b/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/benchmark/so_sieve.rb b/benchmark/bm_so_sieve.rb
index 43dc302648..43dc302648 100644
--- a/benchmark/so_sieve.rb
+++ b/benchmark/bm_so_sieve.rb
diff --git a/benchmark/so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
index 6b97206689..6b97206689 100644
--- a/benchmark/so_spectralnorm.rb
+++ b/benchmark/bm_so_spectralnorm.rb
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
new file mode 100644
index 0000000000..16906f3605
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar.rb
@@ -0,0 +1,14 @@
+class C
+  attr_reader :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = obj.a
+  k = obj.b
+end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
new file mode 100644
index 0000000000..7e7a6b48c0
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar_set.rb
@@ -0,0 +1,14 @@
+class C
+  attr_accessor :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  obj.a = 1
+  obj.b = 2
+end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
new file mode 100644
index 0000000000..a9f56b15ea
--- /dev/null
+++ b/benchmark/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+  yield
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m{
+  }
+end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
new file mode 100644
index 0000000000..ac59ebccf1
--- /dev/null
+++ b/benchmark/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = Const
+  k = Const
+end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
new file mode 100644
index 0000000000..a1596145f2
--- /dev/null
+++ b/benchmark/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+  begin
+    begin
+    ensure
+    end
+  ensure
+  end
+end
+
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
new file mode 100644
index 0000000000..d4581439ff
--- /dev/null
+++ b/benchmark/bm_vm1_float_simple.rb
@@ -0,0 +1,7 @@
+i = 0.0; f = 0.0
+while i<30_000_000
+  i += 1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
new file mode 100644
index 0000000000..e78bca5668
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_lived.rb
@@ -0,0 +1,10 @@
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
new file mode 100644
index 0000000000..b66052dee0
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_complex_long.rb
@@ -0,0 +1,27 @@
+def nested_hash h, n
+  if n == 0
+    ''
+  else
+    10.times{
+      h[Object.new] = nested_hash(h, n-1)
+    }
+  end
+end
+
+long_lived = Hash.new
+nested_hash long_lived, 6
+
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
+
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
new file mode 100644
index 0000000000..298dbc845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_long.rb
@@ -0,0 +1,13 @@
+long_lived = Array.new(1_000_000){|i| "#{i}"}
+GC.start
+GC.start
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
new file mode 100644
index 0000000000..6b15c1b7bf
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_symbol.rb
@@ -0,0 +1,15 @@
+# make many symbols
+50_000.times{|i| sym = "sym#{i}".to_sym}
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
new file mode 100644
index 0000000000..881528845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary.rb
@@ -0,0 +1,12 @@
+short_lived_ary = []
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_ary[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
new file mode 100644
index 0000000000..3c8279c956
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
@@ -0,0 +1,14 @@
+long_lived = []
+
+if RUBY_VERSION > "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
new file mode 100644
index 0000000000..a4067af36b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj.rb
@@ -0,0 +1,15 @@
+class C
+  attr_accessor :foo
+end
+short_lived_obj = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_obj.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
new file mode 100644
index 0000000000..eee07a0248
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
@@ -0,0 +1,17 @@
+class C
+  attr_accessor :foo
+end
+long_lived = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
new file mode 100644
index 0000000000..68a73cf92f
--- /dev/null
+++ b/benchmark/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = @a
+  k = @a
+end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
new file mode 100644
index 0000000000..bd81b06c34
--- /dev/null
+++ b/benchmark/bm_vm1_ivar_set.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  @a = 1
+  @b = 2
+end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
new file mode 100644
index 0000000000..353de3ab0e
--- /dev/null
+++ b/benchmark/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a.length
+  b.length
+end
+
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
new file mode 100644
index 0000000000..36f2068811
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_init.rb
@@ -0,0 +1,18 @@
+def m v
+  unless v
+    # unreachable code
+    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+  end
+end
+
+i = 0
+
+while i<30_000_000 # while loop 1
+  i += 1
+  m i
+end
+
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
new file mode 100644
index 0000000000..222e864134
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_set.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
new file mode 100644
index 0000000000..bbb4ae07a4
--- /dev/null
+++ b/benchmark/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  obj1 != obj2
+end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
new file mode 100644
index 0000000000..b09ecdcc21
--- /dev/null
+++ b/benchmark/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  !obj
+end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
new file mode 100644
index 0000000000..b0d3e2bdfa
--- /dev/null
+++ b/benchmark/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  begin
+  rescue
+  end
+end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
new file mode 100644
index 0000000000..63f9f21675
--- /dev/null
+++ b/benchmark/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+  return 1
+end
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m
+end
+
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
new file mode 100644
index 0000000000..918f8b2112
--- /dev/null
+++ b/benchmark/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a, b = b, a
+end
+
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
new file mode 100644
index 0000000000..775597cea6
--- /dev/null
+++ b/benchmark/bm_vm1_yield.rb
@@ -0,0 +1,10 @@
+def m
+  i = 0
+  while i<30_000_000 # while loop 1
+    i += 1
+    yield
+  end
+end
+
+m{}
+
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
new file mode 100644
index 0000000000..df9037c83c
--- /dev/null
+++ b/benchmark/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
new file mode 100644
index 0000000000..b02509d6a2
--- /dev/null
+++ b/benchmark/bm_vm2_bigarray.rb
@@ -0,0 +1,106 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+  ]
+end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
new file mode 100644
index 0000000000..5e3f437bb8
--- /dev/null
+++ b/benchmark/bm_vm2_bighash.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<60_000 # benchmark loop 2
+  i += 1
+  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
new file mode 100644
index 0000000000..adc6e4df0a
--- /dev/null
+++ b/benchmark/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i = 0
+while i<6_000_000 # while loop 2
+  case :foo
+  when :bar
+    raise
+  when :baz
+    raise
+  when :boo
+    raise
+  when :foo
+    i += 1
+  end
+end
+
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
new file mode 100644
index 0000000000..c62b294e0e
--- /dev/null
+++ b/benchmark/bm_vm2_case_lit.rb
@@ -0,0 +1,19 @@
+i = 0
+@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+def foo(i)
+  @ret[i % @ret.size]
+end
+
+while i<6_000_000 # while loop 2
+  case foo(i)
+  when "foo" then :foo
+  when true then true
+  when false then false
+  when :sym then :sym
+  when 6 then :fix
+  when nil then nil
+  when 0.1 then :float
+  when 0xffffffffffffffff then :big
+  end
+  i += 1
+end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
new file mode 100644
index 0000000000..053ed6c912
--- /dev/null
+++ b/benchmark/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+  define_method(:m){}
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
new file mode 100644
index 0000000000..58c0f7bbc3
--- /dev/null
+++ b/benchmark/bm_vm2_dstr.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = 'z'
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
new file mode 100644
index 0000000000..307cfc28ef
--- /dev/null
+++ b/benchmark/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  eval("1")
+end
+
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
new file mode 100644
index 0000000000..a8ccff7138
--- /dev/null
+++ b/benchmark/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
new file mode 100644
index 0000000000..2badc73101
--- /dev/null
+++ b/benchmark/bm_vm2_method_missing.rb
@@ -0,0 +1,12 @@
+class C
+  def method_missing mid
+  end
+end
+
+obj = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
new file mode 100644
index 0000000000..b4efb4f520
--- /dev/null
+++ b/benchmark/bm_vm2_method_with_block.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
new file mode 100644
index 0000000000..7362f738c5
--- /dev/null
+++ b/benchmark/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Mutex.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m.synchronize{}
+end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
new file mode 100644
index 0000000000..6422c9b0d0
--- /dev/null
+++ b/benchmark/bm_vm2_newlambda.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  lambda {}
+end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
new file mode 100644
index 0000000000..c82c0e4bce
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
new file mode 100644
index 0000000000..aa5fd1dd38
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method_ov.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
new file mode 100644
index 0000000000..65e5217371
--- /dev/null
+++ b/benchmark/bm_vm2_proc.rb
@@ -0,0 +1,14 @@
+def m &b
+  b
+end
+
+pr = m{
+  a = 1
+}
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  pr.call
+end
+
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
new file mode 100644
index 0000000000..aa5387987f
--- /dev/null
+++ b/benchmark/bm_vm2_raise1.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 1
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
new file mode 100644
index 0000000000..1f61c63157
--- /dev/null
+++ b/benchmark/bm_vm2_raise2.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 10
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
new file mode 100644
index 0000000000..55f9e957a3
--- /dev/null
+++ b/benchmark/bm_vm2_regexp.rb
@@ -0,0 +1,6 @@
+i = 0
+str = 'xxxhogexxx'
+while i<6_000_000 # benchmark loop 2
+  /hoge/ =~ str
+  i += 1
+end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
new file mode 100644
index 0000000000..6a3ab6fdab
--- /dev/null
+++ b/benchmark/bm_vm2_send.rb
@@ -0,0 +1,12 @@
+class C
+  def m
+  end
+end
+
+o = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  o.__send__ :m
+end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
new file mode 100644
index 0000000000..1d73036849
--- /dev/null
+++ b/benchmark/bm_vm2_string_literal.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
new file mode 100644
index 0000000000..22cb26b0a5
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.z # x[25]
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
new file mode 100644
index 0000000000..5e61a7087e
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k # x[10]
+end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
new file mode 100644
index 0000000000..5a1c3d16f3
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k = i # x[10] = i
+end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
new file mode 100644
index 0000000000..fff940a80a
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:z]
+end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
new file mode 100644
index 0000000000..5e4085d59d
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k]
+end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
new file mode 100644
index 0000000000..9c0cee4141
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k] = i
+end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
new file mode 100644
index 0000000000..8eaa555b41
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aref.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a
+end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
new file mode 100644
index 0000000000..ecd0f95669
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a = i
+end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
new file mode 100644
index 0000000000..2c88fee6bf
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_href.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a]
+end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
new file mode 100644
index 0000000000..33c36d20f1
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a] = 1
+end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
new file mode 100644
index 0000000000..afd8579e7b
--- /dev/null
+++ b/benchmark/bm_vm2_super.rb
@@ -0,0 +1,20 @@
+
+class C
+  def m
+    1
+  end
+end
+
+class CC < C
+  def m
+    super()
+  end
+end
+
+obj = CC.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  obj.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
new file mode 100644
index 0000000000..1774625942
--- /dev/null
+++ b/benchmark/bm_vm2_unif1.rb
@@ -0,0 +1,8 @@
+i = 0
+def m a, b
+end
+
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m 100, 200
+end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
new file mode 100644
index 0000000000..2a43e62217
--- /dev/null
+++ b/benchmark/bm_vm2_zsuper.rb
@@ -0,0 +1,20 @@
+i = 0
+
+class C
+  def m a
+    1
+  end
+end
+
+class CC < C
+  def m a
+    super
+  end
+end
+
+obj = CC.new
+
+while i<6_000_000 # benchmark loop 2
+  obj.m 10
+  i += 1
+end
diff --git a/benchmark/vm_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
index 0fbf73e1ca..0fbf73e1ca 100644
--- a/benchmark/vm_backtrace.rb
+++ b/benchmark/bm_vm3_backtrace.rb
diff --git a/benchmark/vm_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
index 9661323cd2..9661323cd2 100644
--- a/benchmark/vm_clearmethodcache.rb
+++ b/benchmark/bm_vm3_clearmethodcache.rb
diff --git a/benchmark/vm_gc.rb b/benchmark/bm_vm3_gc.rb
index e668026915..e668026915 100644
--- a/benchmark/vm_gc.rb
+++ b/benchmark/bm_vm3_gc.rb
diff --git a/benchmark/vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb
index 1d433353e1..1d433353e1 100644
--- a/benchmark/vm_symbol_block_pass.rb
+++ b/benchmark/bm_vm_symbol_block_pass.rb
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
new file mode 100644
index 0000000000..c993accdda
--- /dev/null
+++ b/benchmark/bm_vm_thread_alive_check1.rb
@@ -0,0 +1,6 @@
+5_000.times{
+  t = Thread.new{}
+  while t.alive?
+    Thread.pass
+  end
+}
diff --git a/benchmark/vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb
index 3e9a265ce8..3e9a265ce8 100644
--- a/benchmark/vm_thread_close.rb
+++ b/benchmark/bm_vm_thread_close.rb
diff --git a/benchmark/vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
index 393cd45df9..393cd45df9 100644
--- a/benchmark/vm_thread_create_join.rb
+++ b/benchmark/bm_vm_thread_create_join.rb
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
new file mode 100644
index 0000000000..5c9f85dfb7
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
new file mode 100644
index 0000000000..10de59054f
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
new file mode 100644
index 0000000000..7f9a44b39d
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+  Thread.new{
+    i = 0
+    while i<max
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
new file mode 100644
index 0000000000..b5b3c0bc85
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thtread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 2).to_i
+lmax = 200_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..27157d1a6f
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass_flood.rb
@@ -0,0 +1,8 @@
+1000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10000
+  i += 1
+end
diff --git a/benchmark/vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
index 112a621905..112a621905 100644
--- a/benchmark/vm_thread_pipe.rb
+++ b/benchmark/bm_vm_thread_pipe.rb
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
new file mode 100644
index 0000000000..37381ae62b
--- /dev/null
+++ b/benchmark/bm_vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 1_000_000
+q = Queue.new
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  n.times{
+    q.push true
+  }
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/buffer_each.yml b/benchmark/buffer_each.yml
deleted file mode 100644
index 417941104e..0000000000
--- a/benchmark/buffer_each.yml
+++ /dev/null
@@ -1,27 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  Warning[:experimental] = false
-  string = "The quick brown fox jumped over the lazy dog."
-  array = string.bytes
-  buffer = IO::Buffer.for(string)
-benchmark:
-  string.each_byte: |
-    upcased = String.new
-    string.each_byte do |byte|
-      upcased << (byte ^ 32)
-    end
-  array.each: |
-    upcased = String.new
-    array.each do |byte|
-      upcased << (byte ^ 32)
-    end
-  buffer.each: |
-    upcased = String.new
-    buffer.each(:U8) do |offset, byte|
-      upcased << (byte ^ 32)
-    end
-  buffer.each_byte: |
-    upcased = String.new
-    buffer.each_byte do |byte|
-      upcased << (byte ^ 32)
-    end
diff --git a/benchmark/buffer_get.yml b/benchmark/buffer_get.yml
deleted file mode 100644
index 9e1f99d64e..0000000000
--- a/benchmark/buffer_get.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  Warning[:experimental] = false
-  string = "The quick brown fox jumped over the lazy dog."
-  buffer = IO::Buffer.for(string)
-  format = [:U32, :U32, :U32, :U32]
-benchmark:
-  string.unpack1: |
-    [
-      string.unpack1("N"),
-      string.unpack1("N", offset: 4),
-      string.unpack1("N", offset: 8),
-      string.unpack1("N", offset: 12),
-    ]
-  buffer.get_value: |
-    [
-      buffer.get_value(:U32, 0),
-      buffer.get_value(:U32, 4),
-      buffer.get_value(:U32, 8),
-      buffer.get_value(:U32, 12),
-    ]
-  buffer.get_values: |
-    buffer.get_values(format, 0)
-  string.unpack: |
-    string.unpack("NNNN")
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
deleted file mode 100644
index 655be9d7d8..0000000000
--- a/benchmark/cgi_escape_html.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  require 'cgi/escape'
-benchmark:
-  - script: CGI.escapeHTML("")
-    loop_count: 20000000
-  - script: CGI.escapeHTML("abcde")
-    loop_count: 20000000
-  - script: CGI.escapeHTML("abcd<")
-    loop_count: 20000000
-  - script: CGI.escapeHTML("'&\"<>")
-    loop_count: 5000000
-  - prelude: long_no_escape = "abcde" * 300
-    script: CGI.escapeHTML(long_no_escape)
-    loop_count: 1000000
-  - prelude: long_all_escape = "'&\"<>" * 10
-    script: CGI.escapeHTML(long_all_escape)
-    loop_count: 1000000
-  - prelude: | # http://example.com/
-      example_html = <<~HTML
-        <body>
-        <div>
-            <h1>Example Domain</h1>
-            <p>This domain is established to be used for illustrative examples in documents. You may use this
-            domain in examples without prior coordination or asking for permission.</p>
-            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
-        </div>
-        </body>
-      HTML
-    script: CGI.escapeHTML(example_html)
-    loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
deleted file mode 100644
index d0150c5e5b..0000000000
--- a/benchmark/complex_float_add.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_add: c = a + b
-loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
deleted file mode 100644
index b9f5e1d51c..0000000000
--- a/benchmark/complex_float_div.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_div: c = a / b
-loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
deleted file mode 100644
index 59b096a6dc..0000000000
--- a/benchmark/complex_float_mul.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_mul: c = a * b
-loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
deleted file mode 100644
index 6fcde3125b..0000000000
--- a/benchmark/complex_float_new.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_new: c = Complex(a, b)
-loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
deleted file mode 100644
index c40a31ab55..0000000000
--- a/benchmark/complex_float_power.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_power: c = a ** b
-loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
deleted file mode 100644
index 3fafe7cdbe..0000000000
--- a/benchmark/complex_float_sub.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  max, min = 1000.0, -1000.0
-  a = Complex(rand(max)+min, rand(max)+min)
-  b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
-  complex_float_sub: c = a - b
-loop_count: 1000000
diff --git a/benchmark/constant_invalidation.rb b/benchmark/constant_invalidation.rb
deleted file mode 100644
index a95ec6f37e..0000000000
--- a/benchmark/constant_invalidation.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-$VERBOSE = nil
-
-CONSTANT1 = 1
-CONSTANT2 = 1
-CONSTANT3 = 1
-CONSTANT4 = 1
-CONSTANT5 = 1
-
-def constants
-  [CONSTANT1, CONSTANT2, CONSTANT3, CONSTANT4, CONSTANT5]
-end
-
-500_000.times do
-  constants
-
-  # With previous behavior, this would cause all of the constant caches
-  # associated with the constant lookups listed above to invalidate, meaning
-  # they would all have to be fetched again. With current behavior, it only
-  # invalidates when a name matches, so the following constant set shouldn't
-  # impact the constant lookups listed above.
-  INVALIDATE = true
-end
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
deleted file mode 100644
index 8329c757cf..0000000000
--- a/benchmark/dir_empty_p.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-require 'tmpdir'
-max = 100_000
-Dir.mktmpdir('bm_dir_empty_p') do |dir|
-  max.times { Dir.empty?(dir) }
-end
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
new file mode 100644
index 0000000000..defe3c30be
--- /dev/null
+++ b/benchmark/driver.rb
@@ -0,0 +1,400 @@
+#
+# Ruby Benchmark driver
+#
+
+first = true
+
+begin
+  require 'optparse'
+rescue LoadError
+  if first
+    first = false
+    $:.unshift File.join(File.dirname(__FILE__), '../lib')
+    retry
+  else
+    raise
+  end
+end
+
+require 'benchmark'
+require 'pp'
+
+class BenchmarkDriver
+  def self.benchmark(opt)
+    driver = self.new(opt[:execs], opt[:dir], opt)
+    begin
+      driver.run
+    ensure
+      driver.show_results
+    end
+  end
+
+  def self.load(input, type, opt)
+    attrs = [:executables, :results]
+    case type
+    when 'yaml'
+      require 'yaml'
+      h = YAML.load(input)
+    when 'json'
+      require 'json'
+      h = JSON.load(input)
+    else
+      h = eval(input.read)
+    end
+    obj = allocate
+    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
+    obj.instance_variable_set("@results", h[:results] || h["results"])
+    obj.instance_variable_set("@opt", opt)
+    obj
+  end
+
+  def output *args
+    puts(*args)
+    @output and @output.puts(*args)
+  end
+
+  def message *args
+    output(*args) if @verbose
+  end
+
+  def message_print *args
+    if @verbose
+      print(*args)
+      STDOUT.flush
+      @output and @output.print(*args)
+    end
+  end
+
+  def progress_message *args
+    unless STDOUT.tty?
+      STDERR.print(*args)
+      STDERR.flush
+    end
+  end
+
+  def initialize execs, dir, opt = {}
+    @execs = execs.map{|e|
+      e.strip!
+      next if e.empty?
+
+      if /(.+)::(.+)/ =~ e
+        # ex) ruby-a::/path/to/ruby-a
+        label = $1.strip
+        path = $2
+        version = `#{path} -v`.chomp
+      else
+        path = e
+        version = label = `#{path} -v`.chomp
+      end
+      [path, label, version]
+    }.compact
+
+    @dir = dir
+    @repeat = opt[:repeat] || 1
+    @repeat = 1 if @repeat < 1
+    @pattern = opt[:pattern] || nil
+    @exclude = opt[:exclude] || nil
+    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
+    @output = opt[:output] ? open(opt[:output], 'w') : nil
+    @loop_wl1 = @loop_wl2 = nil
+    @ruby_arg = opt[:ruby_arg] || nil
+    @opt = opt
+
+    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
+    @results = []
+
+    if @verbose
+      @start_time = Time.now
+      message @start_time
+      @execs.each_with_index{|(path, label, version), i|
+        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
+      }
+    end
+  end
+
+  def adjusted_results name, results
+    s = nil
+    results.each_with_index{|e, i|
+      r = e.min
+      case name
+      when /^vm1_/
+        if @loop_wl1
+          r -= @loop_wl1[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      when /^vm2_/
+        if @loop_wl2
+          r -= @loop_wl2[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      end
+      yield r
+    }
+    s
+  end
+
+  def show_results
+    case @opt[:format]
+    when :tsv
+      strformat = "\t%1$s"
+      numformat = "\t%1$*2$.3f"
+      minwidth = 0
+      name_width = 0
+    when :markdown
+      markdown = true
+      strformat = "|%1$-*2$s"
+      numformat = "|%1$*2$.3f"
+    when :plain
+      strformat = " %1$-*2$s"
+      numformat = " %1$*2$.3f"
+    end
+
+    name_width ||= @results.map {|v,*| v.size}.max
+    minwidth ||= 7
+    width = @execs.map{|(_, v)| [v.size, minwidth].max}
+
+    output
+
+    if @verbose
+      message '-----------------------------------------------------------'
+      message 'raw data:'
+      message
+      message PP.pp(@results, "", 79)
+      message
+      message "Elapsed time: #{Time.now - @start_time} (sec)"
+    end
+
+    if rawdata_output = @opt[:rawdata_output]
+      h = {}
+      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
+      h[:executables] = @execs
+      h[:results] = @results
+      if (type = File.extname(rawdata_output)).empty?
+        type = rawdata_output
+        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
+      end
+      case type
+      when 'yaml'
+        require 'yaml'
+        h = YAML.dump(h)
+      when 'json'
+        require 'json'
+        h = JSON.pretty_generate(h)
+      else
+        require 'pp'
+        h = h.pretty_inspect
+      end
+      open(rawdata_output, 'w') {|f| f.puts h}
+    end
+
+    output '-----------------------------------------------------------'
+    output 'benchmark results:'
+
+    if @verbose and @repeat > 1
+      output "minimum results in each #{@repeat} measurements."
+    end
+
+    output "Execution time (sec)"
+    output if markdown
+    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
+    @results.each{|v, result|
+      rets = []
+      s = adjusted_results(v, result){|r|
+        rets << sprintf(numformat, r, width[rets.size])
+      }
+      v += s if s
+      output [v.ljust(name_width), rets].join("")
+    }
+
+    if @execs.size > 1
+      output
+      output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
+      output if markdown
+      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
+      @results.each{|v, result|
+        rets = []
+        first_value = nil
+        s = adjusted_results(v, result){|r|
+          if first_value
+            if r == 0
+              rets << "Error"
+            else
+              rets << sprintf(numformat, first_value/r, width[rets.size+1])
+            end
+          else
+            first_value = r
+          end
+        }
+        v += s if s
+        output [v.ljust(name_width), rets].join("")
+      }
+    end
+
+    if @opt[:output]
+      output
+      output "Log file: #{@opt[:output]}"
+    end
+  end
+
+  def files
+    flag = {}
+    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+      next if @pattern && /#{@pattern}/ !~ File.basename(file)
+      next if @exclude && /#{@exclude}/ =~ File.basename(file)
+      case file
+      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
+        flag[$1] = true
+      end
+      file
+    }.compact
+
+    if flag['vm1'] && !flag['whileloop']
+      @files << File.join(@dir, 'bm_loop_whileloop.rb')
+    elsif flag['vm2'] && !flag['whileloop2']
+      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
+    end
+
+    @files.sort!
+    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
+    @files
+  end
+
+  def run
+    files.each_with_index{|file, i|
+      @i = i
+      r = measure_file(file)
+
+      if /bm_loop_whileloop.rb/ =~ file
+        @loop_wl1 = r[1].map{|e| e.min}
+      elsif /bm_loop_whileloop2.rb/ =~ file
+        @loop_wl2 = r[1].map{|e| e.min}
+      end
+    }
+  end
+
+  def measure_file file
+    name = File.basename(file, '.rb').sub(/^bm_/, '')
+    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
+    load prepare_file if FileTest.exist?(prepare_file)
+
+    if @verbose
+      output
+      output '-----------------------------------------------------------'
+      output name
+      output
+      output File.read(file)
+      output
+    end
+
+    result = [name]
+    result << @execs.map{|(e, v)|
+      (0...@repeat).map{
+        message_print "#{v}\t"
+        progress_message '.'
+
+        m = measure(e, file)
+        message "#{m}"
+        m
+      }
+    }
+    @results << result
+    result
+  end
+
+  unless defined?(File::NULL)
+    if File.exist?('/dev/null')
+      File::NULL = '/dev/null'
+    end
+  end
+
+  def measure executable, file
+    cmd = "#{executable} #{@ruby_arg} #{file}"
+
+    m = Benchmark.measure{
+      system(cmd, out: File::NULL)
+    }
+
+    if $? != 0
+      output "\`#{cmd}\' exited with abnormal status (#{$?})"
+      0
+    else
+      m.real
+    end
+  end
+end
+
+if __FILE__ == $0
+  opt = {
+    :execs => [],
+    :dir => File.dirname(__FILE__),
+    :repeat => 1,
+    :output => nil,
+    :raw_output => nil,
+    :format => :tsv,
+  }
+  formats = {
+    :tsv => ".tsv",
+    :markdown => ".md",
+    :plain => ".txt",
+  }
+
+  parser = OptionParser.new{|o|
+    o.on('-e', '--executables [EXECS]',
+      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
+       e.split(/;/).each{|path|
+         opt[:execs] << path
+       }
+    }
+    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
+      opt[:dir] = d
+    }
+    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
+      opt[:pattern] = p
+    }
+    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
+      opt[:exclude] = e
+    }
+    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
+      opt[:repeat] = n.to_i
+    }
+    o.on('-o', '--output-file [FILE]', "Output file"){|f|
+      opt[:output] = f
+    }
+    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
+      opt[:ruby_arg] = a
+    }
+    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
+      opt[:rawdata_output] = r
+    }
+    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
+      opt[:rawdata_input] = r
+    }
+    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
+      opt[:format] = r
+    }
+    o.on('-v', '--verbose'){|v|
+      opt[:verbose] = v
+    }
+    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
+      opt[:quiet] = q
+      opt[:verbose] = false
+    }
+  }
+
+  parser.parse!(ARGV)
+  opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
+
+  if input = opt[:rawdata_input]
+    b = open(input) {|f|
+      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
+    }
+    b.show_results
+  else
+    BenchmarkDriver.benchmark(opt)
+  end
+end
+
diff --git a/benchmark/enum_lazy_flat_map.yml b/benchmark/enum_lazy_flat_map.yml
deleted file mode 100644
index 0ee390a441..0000000000
--- a/benchmark/enum_lazy_flat_map.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  num = (1..).lazy.take(100)
-  ary2 = [[1,2]].cycle.lazy.take(10)
-  ary10 = [[*1..10]].cycle.lazy.take(10)
-  ary20 = [[*1..20]].cycle.lazy.take(10)
-  ary50 = [[*1..50]].cycle.lazy.take(10)
-  ary100 = [[*1..100]].cycle.lazy.take(10)
-
-benchmark:
-  num3: num.flat_map {|x| x}.take(3).to_a
-  num10: num.flat_map {|x| x}.take(3).to_a
-  ary2:  ary2.flat_map {|x| x}.take(3).to_a
-  ary10: ary10.flat_map {|x| x}.take(3).to_a
-  ary20: ary20.flat_map {|x| x}.take(3).to_a
-  ary50: ary50.flat_map {|x| x}.take(3).to_a
-  ary100: ary100.flat_map {|x| x}.take(3).to_a
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
deleted file mode 100644
index 8832392e65..0000000000
--- a/benchmark/enum_lazy_grep_v_100.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
deleted file mode 100644
index 329509fa8f..0000000000
--- a/benchmark/enum_lazy_grep_v_20.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
deleted file mode 100644
index 02ea4d4e71..0000000000
--- a/benchmark/enum_lazy_grep_v_50.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
deleted file mode 100644
index 2e6434d9c4..0000000000
--- a/benchmark/enum_lazy_uniq_100.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
deleted file mode 100644
index 75e6398fee..0000000000
--- a/benchmark/enum_lazy_uniq_20.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
deleted file mode 100644
index 59a39b78ff..0000000000
--- a/benchmark/enum_lazy_uniq_50.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_zip.yml b/benchmark/enum_lazy_zip.yml
deleted file mode 100644
index 4566ff0261..0000000000
--- a/benchmark/enum_lazy_zip.yml
+++ /dev/null
@@ -1,22 +0,0 @@
-prelude: |
-  a = (1..3).lazy
-  b = a.map {|x| x}
-
-benchmark:
-  first_ary: a.zip(["a", "b", "c"]).first
-  first_nonary: a.zip("a".."c").first
-  first_noarg: a.zip.first
-
-  take3_ary: a.zip(["a", "b", "c"]).take(3).force
-  take3_nonary: a.zip("a".."c").take(3).force
-  take3_noarg: a.zip.take(3).force
-
-  chain-first_ary: b.zip(["a", "b", "c"]).first
-  chain-first_nonary: b.zip("a".."c").first
-  chain-first_noarg: b.zip.first
-
-  chain-take3_ary: b.zip(["a", "b", "c"]).take(3).force
-  chain-take3_nonary: b.zip("a".."c").take(3).force
-  chain-take3_noarg: b.zip.take(3).force
-
-  block: a.zip("a".."c") {|x, y| [x, y]}
diff --git a/benchmark/enum_minmax.yml b/benchmark/enum_minmax.yml
deleted file mode 100644
index 9d01731abb..0000000000
--- a/benchmark/enum_minmax.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
-  set2 = 2.times.to_a.shuffle.to_set
-  set10 = 10.times.to_a.shuffle.to_set
-  set100 = 100.times.to_a.shuffle.to_set
-  set1000 = 1000.times.to_a.shuffle.to_set
-  set10000 = 10000.times.to_a.shuffle.to_set
-
-benchmark:
-  set2.min: set2.min
-  set10.min: set10.min
-  set100.min: set100.min
-  set1000.min: set1000.min
-  set10000.min: set10000.min
-  set2.max: set2.max
-  set10.max: set10.max
-  set100.max: set100.max
-  set1000.max: set1000.max
-  set10000.max: set10000.max
-  set2.minmax: set2.minmax
-  set10.minmax: set10.minmax
-  set100.minmax: set100.minmax
-  set1000.minmax: set1000.minmax
-  set10000.minmax: set10000.minmax
-
-loop_count: 10000
diff --git a/benchmark/enum_sort.yml b/benchmark/enum_sort.yml
deleted file mode 100644
index 6f26e748c6..0000000000
--- a/benchmark/enum_sort.yml
+++ /dev/null
@@ -1,15 +0,0 @@
-prelude: |
-  set2 = 2.times.to_a.shuffle.to_set
-  set10 = 10.times.to_a.shuffle.to_set
-  set100 = 100.times.to_a.shuffle.to_set
-  set1000 = 1000.times.to_a.shuffle.to_set
-  set10000 = 10000.times.to_a.shuffle.to_set
-
-benchmark:
-  set2.sort_by: set2.sort_by { 0 }
-  set10.sort_by: set10.sort_by { 0 }
-  set100.sort_by: set100.sort_by { 0 }
-  set1000.sort_by: set1000.sort_by { 0 }
-  set10000.sort_by: set10000.sort_by { 0 }
-
-loop_count: 10000
diff --git a/benchmark/enum_sort_by.yml b/benchmark/enum_sort_by.yml
deleted file mode 100644
index d386353888..0000000000
--- a/benchmark/enum_sort_by.yml
+++ /dev/null
@@ -1,53 +0,0 @@
-prelude: |
-  array_length = 2
-  fixnum_array2 = array_length.times.to_a.map {rand(10000)}
-  float_array2 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array2 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array2 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array2 =array_length.times.to_a.map {0}
-
-  array_length = 10
-  fixnum_array10 = array_length.times.to_a.map {rand(10000)}
-  float_array10 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array10 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array10 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array10 =array_length.times.to_a.map {0}
-
-  array_length = 1000
-  fixnum_array1000 = array_length.times.to_a.map {rand(10000)}
-  float_array1000 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array1000 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array1000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array1000 =array_length.times.to_a.map {0}
-
-  array_length = 100000
-  fixnum_array100000 = array_length.times.to_a.map {rand(10000)}
-  float_array100000 = array_length.times.to_a.map {rand(10000.0).to_f}
-  string_array100000 = array_length.times.to_a.map {"r" * rand(1..10000)}
-  mix_array100000 = array_length.times.to_a.map {if rand(1..100) <= 50 then rand(1..10000).to_f else rand(1..10000) end}
-  all_zero_array100000 =array_length.times.to_a.map {0}
-
-benchmark:
-  fixnum_array2.sort_by: fixnum_array2.sort_by {|a| a}
-  float_array2.sort_by:  float_array2.sort_by {|a| a}
-  string_length2.sort_by: string_array2.sort_by {|a| a.length}
-  mix_array2.sort_by:  mix_array2.sort_by {|a| a}
-  all_zero2.sort_by: all_zero_array2.sort_by{|a| a}
-
-  fixnum_array10.sort_by: fixnum_array10.sort_by {|a| a}
-  float_array10.sort_by:  float_array10.sort_by {|a| a}
-  string_length10.sort_by: string_array10.sort_by {|a| a.length}
-  mix_array10.sort_by:  mix_array10.sort_by {|a| a}
-  all_zero10.sort_by: all_zero_array10.sort_by{|a| a}
-
-  fixnum_array1000.sort_by: fixnum_array1000.sort_by {|a| a}
-  float_array1000.sort_by:  float_array1000.sort_by {|a| a}
-  string_length1000.sort_by: string_array1000.sort_by {|a| a.length}
-  mix_array1000.sort_by:  mix_array1000.sort_by {|a| a}
-  all_zero1000.sort_by: all_zero_array1000.sort_by{|a| a}
-
-  fixnum_array100000.sort_by: fixnum_array100000.sort_by {|a| a}
-  float_array100000.sort_by:  float_array100000.sort_by {|a| a}
-  string_length100000.sort_by: string_array100000.sort_by {|a| a.length}
-  mix_array100000.sort_by:  mix_array100000.sort_by {|a| a}
-  all_zero100000.sort_by: all_zero_array100000.sort_by{|a| a}
diff --git a/benchmark/enum_tally.yml b/benchmark/enum_tally.yml
deleted file mode 100644
index edd2e040a0..0000000000
--- a/benchmark/enum_tally.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-prelude: |
-  list = ("aaa".."zzz").to_a*10
-benchmark:
-  tally: list.tally
diff --git a/benchmark/erb_escape_html.yml b/benchmark/erb_escape_html.yml
deleted file mode 100644
index ca28d756e7..0000000000
--- a/benchmark/erb_escape_html.yml
+++ /dev/null
@@ -1,31 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  require 'erb'
-benchmark:
-  - script: ERB::Util.html_escape("")
-    loop_count: 20000000
-  - script: ERB::Util.html_escape("abcde")
-    loop_count: 20000000
-  - script: ERB::Util.html_escape("abcd<")
-    loop_count: 20000000
-  - script: ERB::Util.html_escape("'&\"<>")
-    loop_count: 5000000
-  - prelude: long_no_escape = "abcde" * 300
-    script: ERB::Util.html_escape(long_no_escape)
-    loop_count: 1000000
-  - prelude: long_all_escape = "'&\"<>" * 10
-    script: ERB::Util.html_escape(long_all_escape)
-    loop_count: 1000000
-  - prelude: | # http://example.com/
-      example_html = <<~HTML
-        <body>
-        <div>
-            <h1>Example Domain</h1>
-            <p>This domain is established to be used for illustrative examples in documents. You may use this
-            domain in examples without prior coordination or asking for permission.</p>
-            <p><a href="http://www.iana.org/domains/example">More information...</a></p>
-        </div>
-        </body>
-      HTML
-    script: ERB::Util.html_escape(example_html)
-    loop_count: 1000000
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
deleted file mode 100644
index 15f6c3880b..0000000000
--- a/benchmark/erb_render.yml
+++ /dev/null
@@ -1,24 +0,0 @@
-prelude: |
-  require 'erb'
-
-  data = <<erb
-  <html>
-    <head> <%= title %> </head>
-    <body>
-      <h1> <%= title %> </h1>
-      <p>
-        <%= content %>
-      </p>
-    </body>
-  </html>
-  erb
-
-  title = "hello world!"
-  content = "hello world!\n" * 10
-
-  src = "def self.render(title, content); #{ERB.new(data).src}; end"
-  mod = Module.new
-  mod.instance_eval(src, "(ERB)")
-benchmark:
-  erb_render: mod.render(title, content)
-loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
deleted file mode 100644
index a36c759f8e..0000000000
--- a/benchmark/fiber_chain.yml
+++ /dev/null
@@ -1,36 +0,0 @@
-prelude: |
-  def make_link(previous)
-    Fiber.new do
-      while message = previous.resume
-        Fiber.yield(message)
-      end
-    end
-  end
-
-  def make_chain(length = 1000, &block)
-    chain = Fiber.new(&block)
-
-    (length - 1).times do
-      chain = make_link(chain)
-    end
-
-    return chain
-  end
-
-  message = "Hello World!"
-
-  chain = make_chain do
-    while true
-      Fiber.yield(message)
-    end
-  end
-benchmark:
-  make_chain: |
-    make_chain(100) do
-      while true
-        Fiber.yield(message)
-      end
-    end
-  resume_chain: |
-    chain.resume
-loop_count: 5000
diff --git a/benchmark/fiber_locals.yml b/benchmark/fiber_locals.yml
deleted file mode 100644
index 8588686477..0000000000
--- a/benchmark/fiber_locals.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
-  th = Thread.current
-  th[:key] = :val
-benchmark:
-  key?: th.key?(:key)
-  []: th[:key]
-  keys: th.keys
-loop_count: 1_000_000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
deleted file mode 100644
index 1cd4760c9d..0000000000
--- a/benchmark/file_chmod.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# chmod file
-require 'tempfile'
-max = 200_000
-tmp = Tempfile.new('chmod')
-path = tmp.path
-max.times do
-  File.chmod(0777, path)
-end
-tmp.close!
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
deleted file mode 100644
index bbb44aebac..0000000000
--- a/benchmark/file_rename.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-# rename file
-require 'tempfile'
-
-max = 100_000
-tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
-a, b = tmp.map { |x| x.path }
-tmp.each { |t| t.close } # Windows can't rename files without closing them
-max.times do
-  File.rename(a, b)
-  File.rename(b, a)
-end
diff --git a/benchmark/float_methods.yml b/benchmark/float_methods.yml
deleted file mode 100644
index 56ea41effc..0000000000
--- a/benchmark/float_methods.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
-  flo = 4.2
-benchmark:
-  to_f: |
-    flo.to_f
-  abs: |
-    flo.abs
-  magnitude: |
-    flo.magnitude
-  -@: |
-    -flo
-  zero?: |
-    flo.zero?
-loop_count: 20000000
diff --git a/benchmark/float_neg_posi.yml b/benchmark/float_neg_posi.yml
deleted file mode 100644
index 172db1bf6d..0000000000
--- a/benchmark/float_neg_posi.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
-  flo = 4.2
-benchmark:
-  negative?: |
-    flo.negative?
-  positive?: |
-    flo.positive?
-loop_count: 20000000
diff --git a/benchmark/float_to_s.yml b/benchmark/float_to_s.yml
deleted file mode 100644
index 0abae5cdb8..0000000000
--- a/benchmark/float_to_s.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  floats = [*0.0.step(1.0, 0.0001)]
-
-benchmark:
-  to_s: floats.each {|f| f.to_s}
-
-loop_count: 1000
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
index 275f58b924..2eed7abc83 100644
--- a/benchmark/gc/aobench.rb
+++ b/benchmark/gc/aobench.rb
@@ -1 +1 @@
-require_relative '../app_aobench'
+require_relative '../bm_app_aobench.rb'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
index 83347cdd20..af8ea722aa 100644
--- a/benchmark/gc/binary_trees.rb
+++ b/benchmark/gc/binary_trees.rb
@@ -1 +1 @@
-require_relative '../so_binary_trees'
+require_relative '../bm_so_binary_trees.rb'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
index 23d0b91c6c..09a404466a 100644
--- a/benchmark/gc/gcbench.rb
+++ b/benchmark/gc/gcbench.rb
@@ -3,12 +3,11 @@ require 'pp'
 require 'optparse'
 
 $list = true
-$gcprof = false
+$gcprof = true
 
 opt = OptionParser.new
 opt.on('-q'){$list = false}
 opt.on('-d'){$gcprof = false}
-opt.on('-p'){$gcprof = true}
 opt.parse!(ARGV)
 
 script = File.join(File.dirname(__FILE__), ARGV.shift)
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
index 8ebdff7d1d..94ba74be89 100644
--- a/benchmark/gc/pentomino.rb
+++ b/benchmark/gc/pentomino.rb
@@ -1 +1 @@
-require_relative '../app_pentomino'
+require_relative '../bm_app_pentomino.rb'
diff --git a/benchmark/hash_aref_array.rb b/benchmark/hash_aref_array.rb
deleted file mode 100644
index ac7a683d95..0000000000
--- a/benchmark/hash_aref_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-h = {}
-arrays = (0..99).each_slice(10).to_a
-#STDERR.puts arrays.inspect
-arrays.each { |s| h[s] = s }
-200_000.times { arrays.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str_lit.yml b/benchmark/hash_aref_str_lit.yml
deleted file mode 100644
index ed8142bcf1..0000000000
--- a/benchmark/hash_aref_str_lit.yml
+++ /dev/null
@@ -1,20 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  hash = 10.times.to_h do |i|
-    [i, i]
-  end
-  dyn_sym = "dynamic_symbol".to_sym
-  binary = RubyVM::InstructionSequence.compile("# frozen_string_literal: true\n'iseq_load'").to_binary
-  iseq_literal_string = RubyVM::InstructionSequence.load_from_binary(binary).eval
-
-  hash[:some_symbol] = 1
-  hash[dyn_sym] = 2
-  hash["small"] = 3
-  hash["frozen_string_literal"] = 4
-  hash[iseq_literal_string] = 5
-benchmark:
-  symbol: hash[:some_symbol]
-  dyn_symbol: hash[dyn_sym]
-  small_lit: hash["small"]
-  frozen_lit: hash["frozen_string_literal"]
-  iseq_lit: hash[iseq_literal_string]
diff --git a/benchmark/hash_defaults.yml b/benchmark/hash_defaults.yml
deleted file mode 100644
index 833f10e1c7..0000000000
--- a/benchmark/hash_defaults.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
-  h = Hash.new { :foo }
-benchmark:
-  default_aref: h[1]
-  default_method: h.default(1)
-loop_count: 1000000
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
deleted file mode 100644
index 65f521ec94..0000000000
--- a/benchmark/hash_dup.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
-  small_hash = { a: 1 }
-  larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
-
-benchmark:
-  dup_small: small_hash.dup
-  dup_larger: larger_hash.dup
-loop_count: 10000
diff --git a/benchmark/hash_first.yml b/benchmark/hash_first.yml
deleted file mode 100644
index c26df1a7ed..0000000000
--- a/benchmark/hash_first.yml
+++ /dev/null
@@ -1,11 +0,0 @@
-prelude: |
-  hash1 = 1_000_000.times.to_h { [rand, true]}
-  hash2 = hash1.dup
-  hash2.keys[1..100_000].each { hash2.delete _1 }
-  hash2.delete hash2.first[0]
-
-benchmark:
-  hash1: hash1.first
-  hash2: hash2.first
-
-loop_count: 100_000
diff --git a/benchmark/hash_key.yml b/benchmark/hash_key.yml
deleted file mode 100644
index cab4cf9ca4..0000000000
--- a/benchmark/hash_key.yml
+++ /dev/null
@@ -1,5 +0,0 @@
-prelude: |
-  obj = Object.new
-  hash = { obj => true }
-benchmark: hash.key?(obj)
-loop_count: 30000000
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
deleted file mode 100644
index c188529260..0000000000
--- a/benchmark/hash_literal_small2.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz" }  }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
deleted file mode 100644
index 739f71b5b0..0000000000
--- a/benchmark/hash_literal_small4.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
deleted file mode 100644
index 53d80af535..0000000000
--- a/benchmark/hash_literal_small8.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
deleted file mode 100644
index 03d9109602..0000000000
--- a/benchmark/hash_long.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
-k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
-h = {k1 => 0, k2 => 0};
-3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_new.yml b/benchmark/hash_new.yml
deleted file mode 100644
index 9d8e34187f..0000000000
--- a/benchmark/hash_new.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  has_hash_with_capa = Hash.instance_method(:initialize).parameters.include?([:key, :capacity])
-  strings_1k = 1_000.times.map { |i| -i.to_s.freeze }
-  strings_100k = 100_000.times.map { |i| -i.to_s.freeze }
-benchmark:
-  new: Hash.new
-  new_with_capa_1k: |
-    h = has_hash_with_capa ? Hash.new(capacity: strings_1k.size) : {}
-    strings_1k.each do |x|
-      h[x] = true
-    end
-  new_with_capa_100k: |
-    h = has_hash_with_capa ? Hash.new(capacity: strings_100k.size) : {}
-    strings_100k.each do |x|
-      h[x] = true
-    end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
deleted file mode 100644
index 45485d9c71..0000000000
--- a/benchmark/hash_small2.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
deleted file mode 100644
index acd4084334..0000000000
--- a/benchmark/hash_small4.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
deleted file mode 100644
index 9cffcc91b6..0000000000
--- a/benchmark/hash_small8.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
deleted file mode 100644
index e22a3f8c30..0000000000
--- a/benchmark/int_quo.rb
+++ /dev/null
@@ -1 +0,0 @@
-5000000.times { 42.quo(3) }
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
deleted file mode 100644
index 3fd87250a4..0000000000
--- a/benchmark/io_copy_stream_write.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-# The goal of this is to use a synthetic (non-IO) reader
-# to trigger the read/write loop of IO.copy_stream,
-# bypassing in-kernel mechanisms like sendfile for zero copy,
-# so we wrap the /dev/zero IO object:
-
-class Zero
-  def initialize
-    @n = 100000
-    @in = File.open('/dev/zero', 'rb')
-  end
-
-  def read(len, buf)
-    return if (@n -= 1) == 0
-    @in.read(len, buf)
-  end
-end
-
-begin
-  src = Zero.new
-  dst = File.open(IO::NULL, 'wb')
-  n = IO.copy_stream(src, dst)
-rescue Errno::ENOENT
-  # not *nix
-end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
deleted file mode 100644
index 11f369bd0d..0000000000
--- a/benchmark/io_copy_stream_write_socket.rb
+++ /dev/null
@@ -1,35 +0,0 @@
-# The goal of this is to use a synthetic (non-IO) reader
-# to trigger the read/write loop of IO.copy_stream,
-# bypassing in-kernel mechanisms like sendfile for zero copy,
-# so we wrap the /dev/zero IO object:
-class Zero
-  def initialize
-    @n = 100000
-    @in = File.open('/dev/zero', 'rb')
-  end
-
-  def read(len, buf)
-    return if (@n -= 1) == 0
-    @in.read(len, buf)
-  end
-end
-
-begin
-  require 'socket'
-  src = Zero.new
-  rd, wr = UNIXSocket.pair
-  pid = fork do
-    wr.close
-    buf = String.new
-    while rd.read(16384, buf)
-    end
-  end
-  rd.close
-  IO.copy_stream(src, wr)
-rescue Errno::ENOENT, NotImplementedError, NameError
-  # not *nix: missing /dev/zero, fork, or UNIXSocket
-rescue LoadError # no socket?
-ensure
-  wr.close if wr
-  Process.waitpid(pid) if pid
-end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
deleted file mode 100644
index 6862a8ae61..0000000000
--- a/benchmark/io_pipe_rw.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-# Measure uncontended GVL performance via read/write with 1:1 threading
-# If we switch to M:N threading, this will benchmark something else...
-r, w = IO.pipe
-src = '0'.freeze
-dst = String.new
-i = 0
-while i < 1_000_000
-  i += 1
-  w.write(src)
-  r.read(1, dst)
-end
-w.close
-r.close
diff --git a/benchmark/io_write.rb b/benchmark/io_write.rb
deleted file mode 100644
index cdb409948b..0000000000
--- a/benchmark/io_write.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-#!/usr/bin/env ruby
-
-require 'benchmark'
-
-i, o = IO.pipe
-o.sync = true
-
-DOT = ".".freeze
-
-chunks = 100_000.times.collect{DOT}
-
-thread = Thread.new do
-  while i.read(1024)
-  end
-end
-
-100.times do
-  o.write(*chunks)
-end
-
-o.close
-thread.join
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
deleted file mode 100644
index ebdc8d7e8b..0000000000
--- a/benchmark/irb_color.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
-  require 'irb/color'
-  code = <<~'CODE'
-    def self.foo # bar
-      :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
-    end
-  CODE
-benchmark:
-  irb_color_complete: |
-    IRB::Color.colorize_code(code, complete: true)
-  irb_color_incomplete: |
-    IRB::Color.colorize_code(code, complete: false)
-loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
deleted file mode 100644
index 28933f8b38..0000000000
--- a/benchmark/irb_exec.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  require 'rbconfig'
-  irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
-benchmark:
-  irb_exec: |
-    IO.popen(irb_f, 'w') do |io|
-      io.write('exit')
-    end
-loop_count: 30
diff --git a/benchmark/iseq_load_from_binary.yml b/benchmark/iseq_load_from_binary.yml
deleted file mode 100644
index 7e9d73bdd4..0000000000
--- a/benchmark/iseq_load_from_binary.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
-  symbol = RubyVM::InstructionSequence.compile(":foo; :bar; :baz; :egg; :spam").to_binary
-
-  define_method = RubyVM::InstructionSequence.compile(%{
-    def foo; end
-    def bar; end
-    def baz; end
-    def egg; end
-    def spam; end
-  }).to_binary
-
-  all = RubyVM::InstructionSequence.compile(%{
-    module Foo; def foo; :foo; end; end
-    module Bar; def bar; :bar; end; end
-    module Baz; def baz; :baz; end; end
-    class Egg; def egg; :egg; end; end
-    class Spaml; def spam; :spam; end; end
-  }).to_binary
-
-benchmark:
-  symbol: RubyVM::InstructionSequence.load_from_binary(symbol)
-  define_method: RubyVM::InstructionSequence.load_from_binary(define_method)
-  all: RubyVM::InstructionSequence.load_from_binary(all)
-
-loop_count: 100_000
diff --git a/benchmark/ivar_extend.yml b/benchmark/ivar_extend.yml
deleted file mode 100644
index eb9ee923f5..0000000000
--- a/benchmark/ivar_extend.yml
+++ /dev/null
@@ -1,23 +0,0 @@
-prelude: |
-  class Embedded
-    def initialize
-      @a = 1
-      @b = 1
-      @c = 1
-    end
-  end
-
-  class Extended
-    def initialize
-      @a = 1
-      @b = 1
-      @c = 1
-      @d = 1
-      @e = 1
-      @f = 1
-    end
-  end
-benchmark:
-  embedded: Embedded.new
-  extended: Extended.new
-loop_count: 20_000_000
diff --git a/benchmark/kernel_clone.yml b/benchmark/kernel_clone.yml
deleted file mode 100644
index 069b23abcd..0000000000
--- a/benchmark/kernel_clone.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: "object = Object.new"
-benchmark:
-  clone: "object.clone"
-  clone_true: "object.clone(freeze: true)"
-  clone_false: "object.clone(freeze: false)"
-loop_count: 10000
diff --git a/benchmark/kernel_float.yml b/benchmark/kernel_float.yml
deleted file mode 100644
index 215f6750fc..0000000000
--- a/benchmark/kernel_float.yml
+++ /dev/null
@@ -1,5 +0,0 @@
-benchmark:
-  float: "Float(42)"
-  float_true: "Float(42, exception: true)"
-  float_false: "Float(42, exception: false)"
-loop_count: 10000
diff --git a/benchmark/kernel_tap.yml b/benchmark/kernel_tap.yml
deleted file mode 100644
index 4dcbb31b4d..0000000000
--- a/benchmark/kernel_tap.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
-  obj = Object.new
-  x = nil
-benchmark:
-  kernel_tap: obj.tap { |o| x = o }
-loop_count: 20000000
diff --git a/benchmark/kernel_then.yml b/benchmark/kernel_then.yml
deleted file mode 100644
index 85f7341e33..0000000000
--- a/benchmark/kernel_then.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-benchmark:
-  kernel_then: 1.then { |i| i + 1 }
-  kernel_then_enum: 1.then
-  kernel_yield_self: 1.yield_self { |i| i + 1 }
-  kernel_yield_self_enum: 1.yield_self
-loop_count: 20000000
diff --git a/benchmark/keyword_arguments.yml b/benchmark/keyword_arguments.yml
deleted file mode 100644
index fce6bce0b8..0000000000
--- a/benchmark/keyword_arguments.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
-  h = {a: 1}
-  def kw(a: 1) a end
-  def kws(**kw) kw end
-benchmark:
-  kw_to_kw: "kw(a: 1)"
-  kw_splat_to_kw: "kw(**h)"
-  kw_to_kw_splat: "kws(a: 1)"
-  kw_splat_to_kw_splat: "kws(**h)"
-  kw_and_splat_to_kw: "kw(a: 1, **h)"
-  kw_splats_to_kw: "kw(**h, **h)"
-  kw_and_splat_to_kw_splat: "kws(a: 1, **h)"
-  kw_splats_to_kw_splat: "kws(**h, **h)"
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
deleted file mode 100644
index d22236e9fb..0000000000
--- a/benchmark/lib/benchmark_driver/output/driver.rb
+++ /dev/null
@@ -1,36 +0,0 @@
-require 'benchmark_driver/output/simple'
-
-# This replicates the legacy benchmark/driver.rb behavior.
-class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
-  def initialize(*)
-    super
-    @stdout = $stdout
-    @strio  = StringIO.new
-    $stdout = IOMultiplexer.new(@stdout, @strio)
-  end
-
-  def with_benchmark(*)
-    super
-  ensure
-    logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
-    puts "\nLog file: #{logfile}"
-
-    $stdout = @stdout
-    File.write(logfile, @strio.tap(&:rewind).read)
-  end
-
-  class IOMultiplexer
-    def initialize(io1, io2)
-      @io1 = io1
-      @io2 = io2
-    end
-
-    [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
-      define_method(method) do |*args|
-        @io1.send(method, *args)
-        @io2.send(method, *args)
-      end
-    end
-  end
-  private_constant :IOMultiplexer
-end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
deleted file mode 100644
index 3c3453e527..0000000000
--- a/benchmark/lib/benchmark_driver/runner/cstime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :cstime
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
deleted file mode 100644
index e139962ef2..0000000000
--- a/benchmark/lib/benchmark_driver/runner/cutime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :cutime
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
deleted file mode 100644
index d04f2e51ff..0000000000
--- a/benchmark/lib/benchmark_driver/runner/peak.rb
+++ /dev/null
@@ -1,151 +0,0 @@
-require 'benchmark_driver/struct'
-require 'benchmark_driver/metric'
-require 'benchmark_driver/default_job'
-require 'benchmark_driver/default_job_parser'
-require 'tempfile'
-
-class BenchmarkDriver::Runner::Peak
-  METRIC = BenchmarkDriver::Metric.new(
-    name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
-  )
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  # @param [BenchmarkDriver::Config::RunnerConfig] config
-  # @param [BenchmarkDriver::Output] output
-  # @param [BenchmarkDriver::Context] contexts
-  def initialize(config:, output:, contexts:)
-    @config = config
-    @output = output
-    @contexts = contexts
-  end
-
-  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
-  # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
-  def run(jobs)
-    if jobs.any? { |job| job.loop_count.nil? }
-      jobs = jobs.map do |job|
-        job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
-      end
-    end
-
-    @output.with_benchmark do
-      jobs.each do |job|
-        @output.with_job(name: job.name) do
-          job.runnable_contexts(@contexts).each do |context|
-            value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
-              run_benchmark(job, context: context)
-            end
-            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
-              @output.report(values: { metric => value }, loop_count: job.loop_count)
-            end
-          end
-        end
-      end
-    end
-  end
-
-  private
-
-  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
-  # @param [BenchmarkDriver::Context] context
-  # @return [BenchmarkDriver::Metrics]
-  def run_benchmark(job, context:)
-    benchmark = BenchmarkScript.new(
-      preludes:   [context.prelude, job.prelude],
-      script:     job.script,
-      teardown:   job.teardown,
-      loop_count: job.loop_count,
-    )
-
-    memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      with_script(benchmark.render) do |path|
-        output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
-        if $?.success?
-          Integer(f.read)
-        else
-          $stdout.print(output)
-          BenchmarkDriver::Result::ERROR
-        end
-      end
-    end
-  end
-
-  # Overridden by BenchmarkDriver::Runner::Size
-  def target
-    'peak'
-  end
-
-  # Overridden by BenchmarkDriver::Runner::Size
-  def metric
-    METRIC
-  end
-
-  def with_script(script)
-    if @config.verbose >= 2
-      sep = '-' * 30
-      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
-    end
-
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      f.puts script
-      f.close
-      return yield(f.path)
-    end
-  end
-
-  # @param [String] prelude
-  # @param [String] script
-  # @param [String] teardown
-  # @param [Integer] loop_count
-  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
-    def render
-      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
-      <<-RUBY
-#{prelude}
-#{while_loop(script, loop_count)}
-#{teardown}
-
-result_file, target, memory_status = ARGV
-require_relative memory_status
-
-ms = Memory::Status.new
-case target.to_sym
-when :peak
-  key = ms.respond_to?(:hwm) ? :hwm : :peak
-when :size
-  key = ms.respond_to?(:rss) ? :rss : :size
-else
-  raise('unexpected target: ' + target)
-end
-
-File.write(result_file, ms[key])
-      RUBY
-    end
-
-    private
-
-    def while_loop(content, times)
-      if !times.is_a?(Integer) || times <= 0
-        raise ArgumentError.new("Unexpected times: #{times.inspect}")
-      end
-
-      if times > 1
-        <<-RUBY
-__bmdv_i = 0
-while __bmdv_i < #{times}
-  #{content}
-  __bmdv_i += 1
-end
-        RUBY
-      else
-        content
-      end
-    end
-  end
-  private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/ractor.rb b/benchmark/lib/benchmark_driver/runner/ractor.rb
deleted file mode 100644
index c730b8e4a5..0000000000
--- a/benchmark/lib/benchmark_driver/runner/ractor.rb
+++ /dev/null
@@ -1,122 +0,0 @@
-require 'erb'
-
-# A runner to measure performance *inside* Ractor
-class BenchmarkDriver::Runner::Ractor < BenchmarkDriver::Runner::Ips
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob) do
-    attr_accessor :ractor
-  end
-
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC]).extend(Module.new{
-    def parse(ractor: 1, **kwargs)
-      super(**kwargs).each do |job|
-        job.ractor = ractor
-      end
-    end
-  })
-
-  private
-
-  unless private_instance_methods.include?(:run_benchmark)
-    raise "#run_benchmark is no longer defined in BenchmarkDriver::Runner::Ips"
-  end
-
-  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
-  # @param [BenchmarkDriver::Context] context
-  # @return [BenchmarkDriver::Metrics]
-  def run_benchmark(job, context:)
-    benchmark = BenchmarkScript.new(
-      preludes:   [context.prelude, job.prelude],
-      script:     job.script,
-      teardown:   job.teardown,
-      loop_count: job.loop_count,
-    )
-
-    results = job.ractor.times.map do
-      Tempfile.open('benchmark_driver_result')
-    end
-    duration = with_script(benchmark.render(results: results.map(&:path))) do |path|
-      success = execute(*context.executable.command, path, exception: false)
-      if success && ((value = results.map { |f| Float(f.read) }.max) > 0)
-        value
-      else
-        BenchmarkDriver::Result::ERROR
-      end
-    end
-    results.each(&:close)
-
-    value_duration(
-      loop_count: job.loop_count,
-      duration: duration,
-    )
-  end
-
-  # @param [String] prelude
-  # @param [String] script
-  # @param [String] teardown
-  # @param [Integer] loop_count
-  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
-    # @param [String] result - A file to write result
-    def render(results:)
-      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
-      ERB.new(<<-RUBY).result_with_hash(results: results)
-Warning[:experimental] = false
-# shareable-constant-value: experimental_everything
-#{prelude}
-
-if #{loop_count} == 1
-  __bmdv_loop_before = 0
-  __bmdv_loop_after = 0
-else
-  __bmdv_loop_before = Time.new
-  #{while_loop('', loop_count, id: 0)}
-  __bmdv_loop_after = Time.new
-end
-
-__bmdv_ractors = []
-<% results.size.times do %>
-__bmdv_ractors << Ractor.new(__bmdv_loop_after - __bmdv_loop_before) { |__bmdv_loop_time|
-  __bmdv_time = Time
-  __bmdv_script_before = __bmdv_time.new
-  #{while_loop(script, loop_count, id: 1)}
-  __bmdv_script_after = __bmdv_time.new
-
-  (__bmdv_script_after - __bmdv_script_before) - __bmdv_loop_time
-}
-<% end %>
-
-# Wait for all Ractors before executing code to write results
-__bmdv_ractors.map!(&:take)
-
-<% results.each do |result| %>
-File.write(<%= result.dump %>, __bmdv_ractors.shift)
-<% end %>
-
-#{teardown}
-      RUBY
-    end
-
-    private
-
-    # id is to prevent:
-    # can not isolate a Proc because it accesses outer variables (__bmdv_i)
-    def while_loop(content, times, id:)
-      if !times.is_a?(Integer) || times <= 0
-        raise ArgumentError.new("Unexpected times: #{times.inspect}")
-      elsif times == 1
-        return content
-      end
-
-      # TODO: execute in batch
-      <<-RUBY
-__bmdv_i#{id} = 0
-while __bmdv_i#{id} < #{times}
-  #{content}
-  __bmdv_i#{id} += 1
-end
-      RUBY
-    end
-  end
-  private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
deleted file mode 100644
index 1b31f901c7..0000000000
--- a/benchmark/lib/benchmark_driver/runner/size.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require 'benchmark_driver/runner/peak'
-
-# Actually the same as BenchmarkDriver::Runner::Memory
-class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
-  METRIC = BenchmarkDriver::Metric.new(
-    name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
-  )
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Peak#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Peak#target
-  def target
-    'size'
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
deleted file mode 100644
index 4577fb0bf8..0000000000
--- a/benchmark/lib/benchmark_driver/runner/stime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :stime
-  end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
deleted file mode 100644
index 64dc14f84e..0000000000
--- a/benchmark/lib/benchmark_driver/runner/total.rb
+++ /dev/null
@@ -1,137 +0,0 @@
-require 'benchmark_driver/struct'
-require 'benchmark_driver/metric'
-require 'benchmark_driver/default_job'
-require 'benchmark_driver/default_job_parser'
-require 'tempfile'
-
-class BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  # @param [BenchmarkDriver::Config::RunnerConfig] config
-  # @param [BenchmarkDriver::Output] output
-  # @param [BenchmarkDriver::Context] contexts
-  def initialize(config:, output:, contexts:)
-    @config = config
-    @output = output
-    @contexts = contexts
-  end
-
-  # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
-  # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
-  def run(jobs)
-    if jobs.any? { |job| job.loop_count.nil? }
-      raise 'missing loop_count is not supported in Ruby repository'
-    end
-
-    @output.with_benchmark do
-      jobs.each do |job|
-        @output.with_job(name: job.name) do
-          job.runnable_contexts(@contexts).each do |context|
-            duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
-              run_benchmark(job, context: context)
-            end
-            @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
-              @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
-            end
-          end
-        end
-      end
-    end
-  end
-
-  private
-
-  # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
-  # @param [BenchmarkDriver::Context] context
-  # @return [BenchmarkDriver::Metrics]
-  def run_benchmark(job, context:)
-    benchmark = BenchmarkScript.new(
-      preludes:   [context.prelude, job.prelude],
-      script:     job.script,
-      teardown:   job.teardown,
-      loop_count: job.loop_count,
-    )
-
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      with_script(benchmark.render(result: f.path, target: target)) do |path|
-        IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
-        if $?.success?
-          Float(f.read)
-        else
-          BenchmarkDriver::Result::ERROR
-        end
-      end
-    end
-  end
-
-  # This method is overridden by some subclasses
-  def metric
-    METRIC
-  end
-
-  # This method is overridden by some subclasses
-  def target
-    :total
-  end
-
-  def with_script(script)
-    if @config.verbose >= 2
-      sep = '-' * 30
-      $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
-    end
-
-    Tempfile.open(['benchmark_driver-', '.rb']) do |f|
-      f.puts script
-      f.close
-      return yield(f.path)
-    end
-  end
-
-  # @param [String] prelude
-  # @param [String] script
-  # @param [String] teardown
-  # @param [Integer] loop_count
-  BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
-    # @param [String] result - A file to write result
-    def render(result:, target:)
-      prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
-      <<-RUBY
-#{prelude}
-
-require 'benchmark'
-__bmdv_result = Benchmark.measure {
-  #{while_loop(script, loop_count)}
-}
-
-#{teardown}
-
-File.write(#{result.dump}, __bmdv_result.#{target})
-      RUBY
-    end
-
-    private
-
-    def while_loop(content, times)
-      if !times.is_a?(Integer) || times <= 0
-        raise ArgumentError.new("Unexpected times: #{times.inspect}")
-      elsif times == 1
-        return content
-      end
-
-      # TODO: execute in batch
-      <<-RUBY
-__bmdv_i = 0
-while __bmdv_i < #{times}
-  #{content}
-  __bmdv_i += 1
-end
-      RUBY
-    end
-  end
-  private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
deleted file mode 100644
index b61d83a188..0000000000
--- a/benchmark/lib/benchmark_driver/runner/utime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
-  METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
-
-  # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
-  Job = Class.new(BenchmarkDriver::DefaultJob)
-  # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
-  JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
-  private
-
-  # Overriding BenchmarkDriver::Runner::Total#metric
-  def metric
-    METRIC
-  end
-
-  # Overriding BenchmarkDriver::Runner::Total#target
-  def target
-    :utime
-  end
-end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
deleted file mode 100644
index 31b770c484..0000000000
--- a/benchmark/lib/load.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-# How to use this file:
-#   1. write a `$(srcdir)/test.rb` like:
-=begin
-require_relative 'benchmark/lib/load'
-
-Benchmark.driver(repeat_count: 5){|x|
-  x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
-  x.executable name: 'modif-miniruby', command: %w'./miniruby'
-
-  x.report %q{
-    h = {a: 1, b: 2, c: 3, d: 4}
-  }
-}
-=end
-#
-#  2. `make run`
-$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
-require 'benchmark_driver'
diff --git a/benchmark/loop_each.yml b/benchmark/loop_each.yml
deleted file mode 100644
index 1c757185a8..0000000000
--- a/benchmark/loop_each.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-prelude: |
-  arr = [nil] * 30_000_000
-benchmark:
-  loop_each: arr.each{|e|}
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
deleted file mode 100644
index 6a3194b670..0000000000
--- a/benchmark/loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 6000000
-
-if defined? Fiber
-  gen = (1..max).each
-  loop do
-    gen.next
-  end
-else
-  require 'generator'
-  gen = Generator.new((0..max))
-  while gen.next?
-    gen.next
-  end
-end
diff --git a/benchmark/loop_times_megamorphic.yml b/benchmark/loop_times_megamorphic.yml
deleted file mode 100644
index f9343ba897..0000000000
--- a/benchmark/loop_times_megamorphic.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  eval(<<~EOS)
-    def loop_times_megamorphic
-      #{"1.times {|i|};" * 1000}
-    end
-  EOS
-benchmark: loop_times_megamorphic
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..b6d787ae27
--- /dev/null
+++ b/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+  filebase = File.join(File.dirname($0), 'fasta.output')
+  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+  file = "#{filebase}.#{n}"
+
+  unless FileTest.exist?(file)
+    STDERR.puts "preparing #{file}"
+
+    open(file, 'w'){|f|
+      ARGV[0] = n
+      $stdout = f
+      load script
+      $stdout = STDOUT
+    }
+  end
+end
+
diff --git a/benchmark/marshal_dump_load_integer.yml b/benchmark/marshal_dump_load_integer.yml
deleted file mode 100644
index 78ebf823d2..0000000000
--- a/benchmark/marshal_dump_load_integer.yml
+++ /dev/null
@@ -1,22 +0,0 @@
-prelude: |
-  smallint_array = 1000.times.map { |x| x }
-  bigint32_array = 1000.times.map { |x| x + 2**32 }
-  bigint64_array = 1000.times.map { |x| x + 2**64 }
-
-  smallint_dump = Marshal.dump(smallint_array)
-  bigint32_dump = Marshal.dump(bigint32_array)
-  bigint64_dump = Marshal.dump(bigint64_array)
-benchmark:
-  marshal_dump_integer_small: |
-    Marshal.dump(smallint_array)
-  marshal_dump_integer_over_32_bit: |
-    Marshal.dump(bigint32_array)
-  marshal_dump_integer_over_64_bit: |
-    Marshal.dump(bigint64_array)
-  marshal_load_integer_small: |
-    Marshal.load(smallint_dump)
-  marshal_load_integer_over_32_bit: |
-    Marshal.load(bigint32_dump)
-  marshal_load_integer_over_64_bit: |
-    Marshal.load(bigint64_dump)
-loop_count: 4000
diff --git a/benchmark/masgn.yml b/benchmark/masgn.yml
deleted file mode 100644
index 31cb8ee4a3..0000000000
--- a/benchmark/masgn.yml
+++ /dev/null
@@ -1,53 +0,0 @@
-prelude: |
-  a = [nil] * 3
-  b = Class.new{attr_writer :a, :b, :c}.new
-  c = d = e = f = g = h = i = nil
-benchmark:
-  array2_2: "c = (a[0], a[1] = 1, 2)"
-  array2_3: "c = (a[0], a[1] = 1, 2, 3)"
-  array3_2: "c = (a[0], a[1], a[2] = 1, 2)"
-  array3_3: "c = (a[0], a[1], a[2] = 1, 2, 3)"
-  attr2_2: "c = (b.a, b.b = 1, 2)"
-  attr2_3: "c = (b.a, b.b = 1, 2, 3)"
-  attr3_2: "c = (b.a, b.b, b.c = 1, 2)"
-  attr3_3: "c = (b.a, b.b, b.c = 1, 2, 3)"
-  lvar2_2: "c = (d, e = 1, 2)"
-  lvar2_3: "c = (d, e = 1, 2, 3)"
-  lvar3_2: "c = (d, e, f = 1, 2)"
-  lvar3_3: "c = (d, e, f = 1, 2, 3)"
-  array2_2p: "(a[0], a[1] = 1, 2; nil)"
-  array2_3p: "(a[0], a[1] = 1, 2, 3; nil)"
-  array3_2p: "(a[0], a[1], a[2] = 1, 2; nil)"
-  array3_3p: "(a[0], a[1], a[2] = 1, 2, 3; nil)"
-  attr2_2p: "(b.a, b.b = 1, 2; nil)"
-  attr2_3p: "(b.a, b.b = 1, 2, 3; nil)"
-  attr3_2p: "(b.a, b.b, b.c = 1, 2; nil)"
-  attr3_3p: "(b.a, b.b, b.c = 1, 2, 3; nil)"
-  lvar2_2p: "(d, e = 1, 2; nil)"
-  lvar2_3p: "(d, e = 1, 2, 3; nil)"
-  lvar3_2p: "(d, e, f = 1, 2; nil)"
-  lvar3_3p: "(d, e, f = 1, 2, 3; nil)"
-  array2_2lv: "c = (a[0], a[1] = g, h)"
-  array2_ilv: "c = (a[0], a[1] = g, h, i)"
-  arrayi_2lv: "c = (a[0], a[1], a[2] = g, h)"
-  arrayi_ilv: "c = (a[0], a[1], a[2] = g, h, i)"
-  attr2_2lv: "c = (b.a, b.b = g, h)"
-  attr2_ilv: "c = (b.a, b.b = g, h, i)"
-  attri_2lv: "c = (b.a, b.b, b.c = g, h)"
-  attri_ilv: "c = (b.a, b.b, b.c = g, h, i)"
-  lvar2_2lv: "c = (d, e = g, h)"
-  lvar2_ilv: "c = (d, e = g, h, i)"
-  lvari_2lv: "c = (d, e, f = g, h)"
-  lvari_ilv: "c = (d, e, f = g, h, i)"
-  array2_2plv: "(a[0], a[1] = g, h; nil)"
-  array2_iplv: "(a[0], a[1] = g, h, i; nil)"
-  arrayi_2plv: "(a[0], a[1], a[2] = g, h; nil)"
-  arrayi_iplv: "(a[0], a[1], a[2] = g, h, i; nil)"
-  attr2_2plv: "(b.a, b.b = g, h; nil)"
-  attr2_iplv: "(b.a, b.b = g, h, i; nil)"
-  attri_2plv: "(b.a, b.b, b.c = g, h; nil)"
-  attri_iplv: "(b.a, b.b, b.c = g, h, i; nil)"
-  lvar2_2plv: "(d, e = g, h; nil)"
-  lvar2_iplv: "(d, e = g, h, i; nil)"
-  lvari_2plv: "(d, e, f = g, h; nil)"
-  lvari_iplv: "(d, e, f = g, h, i; nil)"
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
deleted file mode 100644
index ffda109912..0000000000
--- a/benchmark/match_gt4.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
deleted file mode 100644
index 3b743d484a..0000000000
--- a/benchmark/match_small.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/method_bind_call.yml b/benchmark/method_bind_call.yml
deleted file mode 100644
index 9e0e046ed4..0000000000
--- a/benchmark/method_bind_call.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  named_module = Kernel
-
-  module FakeName
-    def self.name
-      "NotMyame".freeze
-    end
-  end
-
-  MOD_NAME = Module.instance_method(:name)
-
-benchmark:
-  fastpath: MOD_NAME.bind_call(Kernel)
-  slowpath: MOD_NAME.bind_call(FakeName)
-
-loop_count: 100_000
diff --git a/benchmark/module_eqq.yml b/benchmark/module_eqq.yml
deleted file mode 100644
index a561fb86dc..0000000000
--- a/benchmark/module_eqq.yml
+++ /dev/null
@@ -1,27 +0,0 @@
-prelude: |
-  class SimpleClass; end
-  class MediumClass
-    10.times { include Module.new }
-  end
-  class LargeClass
-    100.times { include Module.new }
-  end
-  class HugeClass
-    300.times { include Module.new }
-  end
-  SimpleObj = SimpleClass.new
-  MediumObj = MediumClass.new
-  LargeObj = LargeClass.new
-  HugeObj = HugeClass.new
-benchmark:
-  simple_class_eqq_simple_obj: |
-    SimpleClass === SimpleObj
-  medium_class_eqq_simple_obj: |
-    MediumClass === SimpleObj
-  simple_class_eqq_medium_obj: |
-    SimpleClass === MediumObj
-  simple_class_eqq_large_obj: |
-    SimpleClass === LargeObj
-  simple_class_eqq_huge_obj: |
-    SimpleClass === HugeObj
-loop_count: 20000000
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
deleted file mode 100644
index 79ba4f2177..0000000000
--- a/benchmark/nil_p.yml
+++ /dev/null
@@ -1,9 +0,0 @@
-prelude: |
-  class Niller; def nil?; true; end; end
-  xnil, notnil = nil, Object.new
-  niller = Niller.new
-benchmark:
-  - xnil.nil?
-  - notnil.nil?
-  - niller.nil?
-loop_count: 10000000
diff --git a/benchmark/nilclass.yml b/benchmark/nilclass.yml
deleted file mode 100644
index da66e71068..0000000000
--- a/benchmark/nilclass.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  def a = nil
-benchmark:
-  to_i: |
-    nil.to_i
-  to_f: |
-    nil.to_f
-  splat: |
-    a(*nil)
-loop_count: 100000
diff --git a/benchmark/num_zero_p.yml b/benchmark/num_zero_p.yml
deleted file mode 100644
index 2195963433..0000000000
--- a/benchmark/num_zero_p.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-benchmark:
-  - 0.zero?
-  - 1.zero?
-  - 0r.zero?
-  - 1r.zero?
-  - 0i.zero?
-  - 1i.zero?
-loop_count: 50000000
diff --git a/benchmark/numeric_methods.yml b/benchmark/numeric_methods.yml
deleted file mode 100644
index 1384902935..0000000000
--- a/benchmark/numeric_methods.yml
+++ /dev/null
@@ -1,29 +0,0 @@
-prelude: |
-  int = 42
-  flo = 4.2
-benchmark:
-  real?: |
-    int.real?
-  integer?: |
-    flo.integer?
-  finite?: |
-    int.finite?
-  infinite?: |
-    int.infinite?
-  integer_real: |
-    int.real
-  float_real: |
-    flo.real
-  integr_imag: |
-    int.imag
-  float_imag: |
-    flo.imag
-  integer_conj: |
-    int.conj
-  float_conj: |
-    flo.conj
-  integer_numerator: |
-    int.numerator
-  integer_denominator: |
-    int.denominator
-loop_count: 20000000
diff --git a/benchmark/object_allocate.yml b/benchmark/object_allocate.yml
deleted file mode 100644
index bdbd4536db..0000000000
--- a/benchmark/object_allocate.yml
+++ /dev/null
@@ -1,48 +0,0 @@
-prelude: |
-  class Eight
-    8.times { include(Module.new) }
-  end
-  class ThirtyTwo
-    32.times { include(Module.new) }
-  end
-  class SixtyFour
-    64.times { include(Module.new) }
-  end
-  class OneTwentyEight
-    128.times { include(Module.new) }
-  end
-  class OnePositional
-    def initialize a; end
-  end
-  class TwoPositional
-    def initialize a, b; end
-  end
-  class ThreePositional
-    def initialize a, b, c; end
-  end
-  class FourPositional
-    def initialize a, b, c, d; end
-  end
-  class KWArg
-    def initialize a:, b:, c:, d:
-    end
-  end
-  class Mixed
-    def initialize a, b, c:, d:
-    end
-  end
-  # Disable GC to see raw throughput:
-  GC.disable
-benchmark:
-  allocate_8_deep: Eight.new
-  allocate_32_deep: ThirtyTwo.new
-  allocate_64_deep: SixtyFour.new
-  allocate_128_deep: OneTwentyEight.new
-  allocate_1_positional_params: OnePositional.new(1)
-  allocate_2_positional_params: TwoPositional.new(1, 2)
-  allocate_3_positional_params: ThreePositional.new(1, 2, 3)
-  allocate_4_positional_params: FourPositional.new(1, 2, 3, 4)
-  allocate_kwarg_params: "KWArg.new(a: 1, b: 2, c: 3, d: 4)"
-  allocate_mixed_params: "Mixed.new(1, 2, c: 3, d: 4)"
-  allocate_no_params: "Object.new"
-loop_count: 100000
diff --git a/benchmark/object_id.yml b/benchmark/object_id.yml
deleted file mode 100644
index 2bd52b923f..0000000000
--- a/benchmark/object_id.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
-  baseline: "Object.new"
-  object_id: "Object.new.object_id"
-# loop_count: 100000
diff --git a/benchmark/objspace_dump_all.yml b/benchmark/objspace_dump_all.yml
deleted file mode 100644
index ebab562d2e..0000000000
--- a/benchmark/objspace_dump_all.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
-  require 'objspace'
-  require 'tempfile'
-  $objs = 1_000.times.map { Object.new }
-  $strings = 1_000.times.map { |i| "string #{i}" }
-  $file = Tempfile.new('heap')
-  $dev_null = File.open(File::NULL, 'w+')
-
-benchmark:
-  dump_all_string: "ObjectSpace.dump_all(output: :string)"
-  dump_all_file: "ObjectSpace.dump_all(output: $file)"
-  dump_all_dev_null: "ObjectSpace.dump_all(output: $dev_null)"
-loop_count: 1
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
index 1ce9f76275..01593965d9 100644
--- a/benchmark/other-lang/fact.py
+++ b/benchmark/other-lang/fact.py
@@ -3,7 +3,7 @@
 
 def factL(n):
 	r = 1
-	for x in range(2, n+1):
+	for x in range(2, n):
 		r *= x
 	return r
 
diff --git a/benchmark/pm_array.yml b/benchmark/pm_array.yml
deleted file mode 100644
index babb65a289..0000000000
--- a/benchmark/pm_array.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  def call(*val)
-    case val
-      in [String => body]
-        [200, {}, [body]]
-      in [Integer => status]
-        [status, {}, [""]]
-      in [Integer, String] => response
-        [response[0], {}, [response[1]]]
-      in [Integer, Hash, String] => response
-        [response[0], response[1], [response[2]]]
-    end
-  end
-
-benchmark:
-  first_match: call("ok")
-  second_match: call(401)
-  third_match: call(200, "ok")
-  fourth_match: call(201, {}, "created")
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
new file mode 100644
index 0000000000..c4786f04ad
--- /dev/null
+++ b/benchmark/prepare_require.rb
@@ -0,0 +1,25 @@
+require "fileutils"
+
+def prepare
+  num_files = 10000
+
+  basename = File.dirname($0)
+  data_dir = File.join(basename, "bm_require.data")
+
+  # skip if all of files exists
+  if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+    return
+  end
+
+  FileUtils.mkdir_p(data_dir)
+
+  1.upto(num_files) do |i|
+    f = File.open("#{data_dir}/c#{i}.rb", "w")
+    f.puts <<-END
+      class C#{i}
+      end
+    END
+  end
+end
+
+prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
new file mode 100644
index 0000000000..339ecb8b39
--- /dev/null
+++ b/benchmark/prepare_require_thread.rb
@@ -0,0 +1,2 @@
+load File.join(File.dirname(__FILE__), "prepare_require.rb")
+
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
new file mode 100644
index 0000000000..ee2138cdb2
--- /dev/null
+++ b/benchmark/prepare_so_count_words.rb
@@ -0,0 +1,15 @@
+# prepare 'wc.input'
+
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
new file mode 100644
index 0000000000..d83aeb7a7e
--- /dev/null
+++ b/benchmark/prepare_so_k_nucleotide.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
new file mode 100644
index 0000000000..da3ec2df14
--- /dev/null
+++ b/benchmark/prepare_so_reverse_complement.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(2_500_000)
diff --git a/benchmark/ractor_const.yml b/benchmark/ractor_const.yml
deleted file mode 100644
index d7ab74bdca..0000000000
--- a/benchmark/ractor_const.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-type: lib/benchmark_driver/runner/ractor
-benchmark:
-  ractor_const: Object
-ractor: 1
diff --git a/benchmark/ractor_float_to_s.yml b/benchmark/ractor_float_to_s.yml
deleted file mode 100644
index 8f492be668..0000000000
--- a/benchmark/ractor_float_to_s.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-type: lib/benchmark_driver/runner/ractor
-prelude: |
-  FLOATS = [*0.0.step(1.0, 0.001)]
-benchmark:
-  ractor_float_to_s: |
-    FLOATS.each {|f| f.to_s}
-loop_count: 100
-ractor: 2
diff --git a/benchmark/range_bsearch_bignum.yml b/benchmark/range_bsearch_bignum.yml
deleted file mode 100644
index 5730c93fcf..0000000000
--- a/benchmark/range_bsearch_bignum.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  first = 2**100
-  last = 2**1000
-  mid = (first + last) / 2
-  r = first..last
-
-benchmark:
-  first: r.bsearch { |x| x >= first }
-  mid: r.bsearch { |x| x >= mid }
-  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_bsearch_endpointless.yml b/benchmark/range_bsearch_endpointless.yml
deleted file mode 100644
index 8d7bedb662..0000000000
--- a/benchmark/range_bsearch_endpointless.yml
+++ /dev/null
@@ -1,21 +0,0 @@
-prelude: |
-  re = (1..)
-  rb = (..0)
-
-benchmark:
-  'endless 10**0': re.bsearch { |x| x >= 1 }
-  'endless 10**1': re.bsearch { |x| x >= 10 }
-  'endless 10**2': re.bsearch { |x| x >= 100 }
-  'endless 10**3': re.bsearch { |x| x >= 1000 }
-  'endless 10**4': re.bsearch { |x| x >= 10000 }
-  'endless 10**5': re.bsearch { |x| x >= 100000 }
-  'endless 10**10': re.bsearch { |x| x >= 10000000000 }
-  'endless 10**100': re.bsearch { |x| x >= 10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
-  'beginless -10**0': rb.bsearch { |x| x >= -1 }
-  'beginless -10**1': rb.bsearch { |x| x >= -10 }
-  'beginless -10**2': rb.bsearch { |x| x >= -100 }
-  'beginless -10**3': rb.bsearch { |x| x >= -1000 }
-  'beginless -10**4': rb.bsearch { |x| x >= -10000 }
-  'beginless -10**5': rb.bsearch { |x| x >= -100000 }
-  'beginless -10**10': rb.bsearch { |x| x >= -10000000000 }
-  'beginless -10**100': rb.bsearch { |x| x >= -10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 }
diff --git a/benchmark/range_bsearch_fixnum.yml b/benchmark/range_bsearch_fixnum.yml
deleted file mode 100644
index 59416531b9..0000000000
--- a/benchmark/range_bsearch_fixnum.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  first = 1
-  last = 10000
-  mid = (first + last) / 2
-  r = first..last
-
-benchmark:
-  first: r.bsearch { |x| x >= first }
-  mid: r.bsearch { |x| x >= mid }
-  last: r.bsearch { |x| x >= last }
diff --git a/benchmark/range_count.yml b/benchmark/range_count.yml
deleted file mode 100644
index 58f53a0236..0000000000
--- a/benchmark/range_count.yml
+++ /dev/null
@@ -1,11 +0,0 @@
-prelude: |
-  r_1 = 1..1
-  r_1k = 1..1000
-  r_1m = 1..1000000
-  r_str = 'a'..'z'
-
-benchmark:
-  'int 1': r_1.count
-  'int 1K': r_1k.count
-  'int 1M': r_1m.count
-  string: r_str.count
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
deleted file mode 100644
index a6674f82ee..0000000000
--- a/benchmark/range_last.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
-  - (1..1_000_000).last(100)
-  - (1..1_000_000).last(1000)
-  - (1..1_000_000).last(10000)
diff --git a/benchmark/range_min.yml b/benchmark/range_min.yml
deleted file mode 100644
index 9e60dd7308..0000000000
--- a/benchmark/range_min.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-benchmark:
-  - (1..10).min
diff --git a/benchmark/range_overlap.yml b/benchmark/range_overlap.yml
deleted file mode 100644
index 700a00053c..0000000000
--- a/benchmark/range_overlap.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
-  class Range
-    unless method_defined?(:overlap?)
-      def overlap?(other)
-        other.begin == self.begin || cover?(other.begin) || other.cover?(self.begin)
-      end
-    end
-  end
-
-benchmark:
-  - (2..3).overlap?(1..1)
-  - (2..3).overlap?(2..4)
-  - (2..3).overlap?(4..5)
-  - (2..3).overlap?(2..1)
-  - (2..3).overlap?(0..1)
-  - (2..3).overlap?(...1)
-  - (2...3).overlap?(..2)
-  - (2...3).overlap?(3...)
-  - (2..3).overlap?('a'..'d')
diff --git a/benchmark/range_reverse_each.yml b/benchmark/range_reverse_each.yml
deleted file mode 100644
index a32efeccc6..0000000000
--- a/benchmark/range_reverse_each.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  rf_1 = 0..1
-  rf_1k = 0..1000
-  rf_1m = 0..1000000
-  big = 2**1000
-  rb_1 = big..big+1
-  rb_1k = big..big+1000
-  rb_1m = big..big+1000000
-
-benchmark:
-  "Fixnum 1": rf_1.reverse_each { _1 }
-  "Fixnum 1K": rf_1k.reverse_each { _1 }
-  "Fixnum 1M": rf_1m.reverse_each { _1 }
-  "Bignum 1": rb_1.reverse_each { _1 }
-  "Bignum 1K": rb_1k.reverse_each { _1 }
-  "Bignum 1M": rb_1m.reverse_each { _1 }
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
deleted file mode 100644
index 6b6a4836b0..0000000000
--- a/benchmark/realpath.yml
+++ /dev/null
@@ -1,33 +0,0 @@
-prelude: |
-  f = File
-  pwd = Dir.pwd
-  Dir.mkdir('b') unless f.directory?('b')
-  f.write('b/a', '') unless f.file?('b/a')
-
-  relative = 'b/a'
-  absolute = File.join(pwd, relative)
-  dir = 'b'
-  file = 'a'
-
-  relative_dir = 'b/c'
-  absolute_dir = File.join(pwd, relative_dir)
-  file_dir = 'c'
-teardown: |
-  require 'fileutils'
-  FileUtils.rm_rf('b')
-benchmark:
-  relative_nil: "f.realpath(relative, nil)"
-  absolute_nil: "f.realpath(absolute, nil)"
-  relative_relative: "f.realpath(file, dir)"
-  absolute_relative: "f.realpath(absolute, dir)"
-  relative_absolute: "f.realpath(relative, pwd)"
-  relative_nil_dir: "f.realdirpath(relative_dir, nil)"
-  absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
-  relative_relative_dir: "f.realdirpath(file_dir, dir)"
-  absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
-  relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
-  relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
-  absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
-  relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
-  absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
-  relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/regexp_dup.yml b/benchmark/regexp_dup.yml
deleted file mode 100644
index 52f89991cd..0000000000
--- a/benchmark/regexp_dup.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
-  str = "a" * 1000
-  re = Regexp.new(str)
-
-benchmark:
-  dup: re.dup
diff --git a/benchmark/regexp_new.yml b/benchmark/regexp_new.yml
deleted file mode 100644
index bc9ab3ca21..0000000000
--- a/benchmark/regexp_new.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  str = "a" * 1000
-  re = Regexp.new(str)
-
-benchmark:
-  string: Regexp.new(str)
-  regexp: Regexp.new(re)
diff --git a/benchmark/report.rb b/benchmark/report.rb
new file mode 100644
index 0000000000..d2dc56b1e1
--- /dev/null
+++ b/benchmark/report.rb
@@ -0,0 +1,79 @@
+#
+# YARV benchmark driver
+#
+
+require 'yarvutil'
+require 'benchmark'
+require 'rbconfig'
+
+def exec_command type, file, w
+  <<-EOP
+  $DRIVER_PATH = '#{File.dirname($0)}'
+  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
+  require 'benchmark'
+  require 'yarvutil'
+#  print '#{type}'
+  begin
+    puts Benchmark.measure{
+      #{w}('#{file}')
+    }.utime
+  rescue Exception => exec_command_error_variable
+    puts "\t" + exec_command_error_variable.message
+  end
+  EOP
+end
+
+def benchmark cmd
+  rubybin = ENV['RUBY'] || RbConfig.ruby
+
+  IO.popen(rubybin, 'r+'){|io|
+    io.write cmd
+    io.close_write
+    return io.gets
+  }
+end
+
+def ruby_exec file
+  prog = exec_command 'ruby', file, 'load'
+  benchmark prog
+end
+
+def yarv_exec file
+  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
+  benchmark prog
+end
+
+$wr = $wy = nil
+
+def measure bench
+  file = File.dirname($0) + "/bm_#{bench}.rb"
+  r = ruby_exec(file).to_f
+  y = yarv_exec(file).to_f
+  puts "#{bench}\t#{r}\t#{y}"
+end
+
+def measure2
+  r = ruby_exec.to_f
+  y = yarv_exec.to_f
+  puts r/y
+end
+
+if $0 == __FILE__
+  %w{
+    whileloop
+    whileloop2
+    times
+    const
+    method
+    poly_method
+    block
+    rescue
+    rescue2
+  }.each{|bench|
+    measure bench
+  }
+end
+
+
+
+
diff --git a/benchmark/require.yml b/benchmark/require.yml
deleted file mode 100644
index 09f218cf08..0000000000
--- a/benchmark/require.yml
+++ /dev/null
@@ -1,32 +0,0 @@
-prelude: |
-  require "fileutils"
-
-  def prepare
-    num_files = 10000
-
-    basename = File.dirname($0)
-    data_dir = File.join(basename, "bm_require.data")
-
-    # skip if all of files exists
-    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
-      return
-    end
-
-    FileUtils.mkdir_p(data_dir)
-
-    1.upto(num_files) do |i|
-      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
-    end
-  end
-
-  prepare
-benchmark:
-  require: |
-    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-    1.upto(10000) do |i|
-      require "c#{i}"
-    end
-
-    $:.pop
-loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
deleted file mode 100644
index 0c63257106..0000000000
--- a/benchmark/require_thread.yml
+++ /dev/null
@@ -1,40 +0,0 @@
-prelude: |
-  require "fileutils"
-
-  def prepare
-    num_files = 10000
-
-    basename = File.dirname($0)
-    data_dir = File.join(basename, "bm_require.data")
-
-    # skip if all of files exists
-    if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
-      return
-    end
-
-    FileUtils.mkdir_p(data_dir)
-
-    1.upto(num_files) do |i|
-      File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
-    end
-  end
-
-  prepare
-benchmark:
-  require_thread: |
-    $:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-    i=0
-    t = Thread.new do
-      while true
-        i = i+1 # dummy loop
-      end
-    end
-
-    1.upto(100) do |i|
-      require "c#{i}"
-    end
-
-    $:.pop
-    t.kill
-loop_count: 1
diff --git a/benchmark/run.rb b/benchmark/run.rb
new file mode 100644
index 0000000000..0cd2363849
--- /dev/null
+++ b/benchmark/run.rb
@@ -0,0 +1,127 @@
+#
+# Ruby benchmark driver
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$matzrubyonly = false
+$rubyonly = false
+
+$results  = []
+
+# prepare 'wc.input'
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
+
+def bm file
+  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
+  return if prog.empty?
+
+  /[a-z]+_(.+)\.rb/ =~ file
+  bm_name = $1
+  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
+  puts "#{bm_name}: "
+
+
+puts <<EOS unless $matzrubyonly || $rubyonly
+#{prog}
+--
+EOS
+  begin
+    result = [bm_name]
+    result << matzruby_exec(file) unless $rubyonly
+    result << ruby_exec(file) unless $matzrubyonly
+    $results << result
+
+  rescue Exception => e
+    puts
+    puts "** benchmark failure: #{e}"
+    puts e.backtrace
+  end
+end
+
+def benchmark file, bin
+  m = Benchmark.measure{
+    `#{bin} #{$opts} #{file}`
+  }
+  sec = '%.3f' % m.real
+  puts " #{sec}"
+  sec
+end
+
+def ruby_exec file
+  print 'ruby'
+  benchmark file, $ruby_program
+end
+
+def matzruby_exec file
+  print 'matz'
+  rubylib = ENV['RUBYLIB']
+  ENV['RUBYLIB'] = ''
+  r = benchmark file, $matzruby_program
+  ENV['RUBYLIB'] = rubylib
+  r
+end
+
+if $0 == __FILE__
+  ARGV.each{|arg|
+    case arg
+    when /\A--ruby=(.+)/
+      $ruby_program = $1
+    when /\A--matzruby=(.+)/
+      $matzruby_program = $1
+    when /\A--opts=(.+)/
+      $opts = $1
+    when /\A(-r|--only-ruby)\z/
+      $rubyonly = true
+    when /\A(-m|--only-matzruby)\z/
+      $matzrubyonly = true
+    end
+  }
+  ARGV.delete_if{|arg|
+    /\A-/ =~ arg
+  }
+
+  puts "MatzRuby:"
+  system("#{$matzruby_program} -v")
+  puts "Ruby:"
+  system("#{$ruby_program} -v")
+  puts
+
+  if ARGV.empty?
+    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
+      bm file
+    }
+  else
+    ARGV.each{|file|
+      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
+        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
+        bm ef
+      }
+    }
+  end
+
+  puts
+  puts "-- benchmark summary ---------------------------"
+  $results.each{|res|
+    print res.shift, "\t"
+    (res||[]).each{|result|
+      /([\d\.]+)/ =~ result
+      print $1 + "\t" if $1
+    }
+    puts
+  }
+end
+
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
new file mode 100644
index 0000000000..97c5cef045
--- /dev/null
+++ b/benchmark/runc.rb
@@ -0,0 +1,27 @@
+#
+#
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$rubybin = ENV['RUBY'] || RbConfig.ruby
+
+def runfile file
+  puts file
+  file = File.join(File.dirname($0), 'contrib', file)
+  Benchmark.bm{|x|
+    x.report('ruby'){
+      system("#{$rubybin} #{file}")
+    }
+    x.report('yarv'){
+      system("#{$rubybin} -rite -I.. #{file}")
+    }
+  }
+end
+
+ARGV.each{|file|
+  runfile file
+}
+
+
diff --git a/benchmark/scan.yaml b/benchmark/scan.yaml
deleted file mode 100644
index 62ad1d6862..0000000000
--- a/benchmark/scan.yaml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  $LOAD_PATH.unshift(File.expand_path("lib"))
-  require "strscan"
-  str = "test string"
-  scanner = StringScanner.new(str)
-  str = "test"
-  reg = /test/
-benchmark:
-  check(reg): |
-    scanner.check(reg)
-  check(str): |
-    scanner.check(str)
-  match?(reg): |
-    scanner.match?(reg)
-  match?(str): |
-    scanner.match?(str)
diff --git a/benchmark/search.yaml b/benchmark/search.yaml
deleted file mode 100644
index 42a50c90e6..0000000000
--- a/benchmark/search.yaml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
-  $LOAD_PATH.unshift(File.expand_path("lib"))
-  require "strscan"
-  str = "test string"
-  scanner = StringScanner.new(str)
-  str = "string"
-  reg = /string/
-benchmark:
-  check_until(reg): |
-    scanner.check_until(reg)
-  check_until(str): |
-    scanner.check_until(str)
-  exist?(reg): |
-    scanner.exist?(reg)
-  exist?(str): |
-    scanner.exist?(str)
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
deleted file mode 100644
index 4effa1ecaf..0000000000
--- a/benchmark/so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
deleted file mode 100644
index 767e03db5f..0000000000
--- a/benchmark/so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
-  x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
-  (n-1).step(0,-1) do |bi|
-    y[bi] += x.at(bi)
-  end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
deleted file mode 100644
index 4468e20ac8..0000000000
--- a/benchmark/so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
-  i += 1
-  hello = ''
-  4_000_000.times do |e|
-    hello << STUFF
-  end
-end
-# puts hello.length
-
-
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
deleted file mode 100644
index f7322a8541..0000000000
--- a/benchmark/so_count_words.yml
+++ /dev/null
@@ -1,66 +0,0 @@
-prelude: |
-  #!/usr/bin/ruby
-
-  wc_input_base = <<EOS
-  Subject:      Re: Who was Izchak Miller?
-  From:         "Jane D. Anonymous" <nobody@yale.edu>
-  Date:         1996/04/28
-  Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
-  References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-  To:           75176.2330@compuserve.com
-  Content-Type: text/plain; charset=us-ascii
-  Organization: Yale University
-  X-Url:        news:4lk6vl$gde@ns.oar.net
-  Mime-Version: 1.0
-  Newsgroups:   rec.games.roguelike.nethack
-  X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
-
-  Hello there,  Izchak Miller was my  father.  When I was  younger I spent
-  many  a night,  hunched over  the keyboard  with a  cup of  tea, playing
-  nethack with him and my brother.  my dad was a philosopher with a strong
-  weakness for fantasy/sci fi.  I remember when he started to get involved
-  with the  Nethack team- my  brother's Dungeons and Dragons  monster book
-  found a regular place beside my dad's  desk. it's nice to see him living
-  on in the game he loved so much :-).
-                                                                    Tamar Miller
-
-  The following is a really long word of 5000 characters:
-
-  wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
-  EOS
-
-  # prepare 'wc.input'
-
-  def prepare_wc_input(wcbase)
-    wcinput = File.join(File.dirname($0), 'wc.input')
-    unless FileTest.exist?(wcinput)
-      data = wcbase.dup
-      13.times{
-        data << data
-      }
-      File.write(wcinput, data)
-    end
-    at_exit {File.unlink(wcinput) rescue nil}
-  end
-
-  prepare_wc_input(wc_input_base)
-
-benchmark:
-  so_count_words: |
-    # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-    # http://www.bagley.org/~doug/shootout/
-    # with help from Paul Brannan
-
-    nl = nw = nc = 0
-    File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|
-      while tmp = input.read(4096)
-        data = tmp << (input.gets || "")
-        nc += data.length
-        nl += data.count("\n")
-        ((data.strip! || data).tr!("\n", " ") || data).squeeze!
-        nw += data.count(" ") + 1
-      end
-    end
-    # STDERR.puts "#{nl} #{nw} #{nc}"
-
-loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
deleted file mode 100644
index eb205b4df1..0000000000
--- a/benchmark/so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-class Hi_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-def some_function(num)
-  begin
-    hi_function(num)
-  rescue
-    print "We shouldn't get here, exception is: #{$!.type}\n"
-  end
-end
-
-def hi_function(num)
-  begin
-    lo_function(num)
-  rescue Hi_Exception
-    $HI = $HI + 1
-  end
-end
-
-def lo_function(num)
-  begin
-    blowup(num)
-  rescue Lo_Exception
-    $LO = $LO + 1
-  end
-end
-
-def blowup(num)
-  if num % 2 == 0
-    raise Lo_Exception.new(num)
-  else
-    raise Hi_Exception.new(num)
-  end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
-  i += 1
-  some_function(i+1)
-end
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
deleted file mode 100644
index dcc6b39507..0000000000
--- a/benchmark/so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random(max, im=139968, ia=3877, ic=29573)
-    (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
-    ["a", 0.27],
-    ["c", 0.12],
-    ["g", 0.12],
-    ["t", 0.27],
-
-    ["B", 0.02],
-    ["D", 0.02],
-    ["H", 0.02],
-    ["K", 0.02],
-    ["M", 0.02],
-    ["N", 0.02],
-    ["R", 0.02],
-    ["S", 0.02],
-    ["V", 0.02],
-    ["W", 0.02],
-    ["Y", 0.02],
-]
-homosapiens = [
-    ["a", 0.3029549426680],
-    ["c", 0.1979883004921],
-    ["g", 0.1975473066391],
-    ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
-    puts ">#{id} #{desc}"
-    v = nil
-    width = 60
-    l = src.length
-    s = src * ((n / l) + 1)
-    s.slice!(n, l)
-    puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
-    puts ">#{id} #{desc}"
-    rand, v = nil,nil
-    width = 60
-    chunk = 1 * width
-    prob = 0.0
-    table.each{|v| v[1]= (prob += v[1])}
-    for i in 1..(n/width)
-        puts((1..width).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-    if n%width != 0
-        puts((1..(n%width)).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
deleted file mode 100644
index d7df086c39..0000000000
--- a/benchmark/so_k_nucleotide.yml
+++ /dev/null
@@ -1,155 +0,0 @@
-prelude: |
-  bm_so_fasta = <<'EOS'
-  # The Computer Language Shootout
-  # http://shootout.alioth.debian.org/
-  # Contributed by Sokolov Yura
-
-  $last = 42.0
-  def gen_random(max, im=139968, ia=3877, ic=29573)
-      (max * ($last = ($last * ia + ic) % im)) / im
-  end
-
-  alu =
-     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-  iub = [
-      ["a", 0.27],
-      ["c", 0.12],
-      ["g", 0.12],
-      ["t", 0.27],
-
-      ["B", 0.02],
-      ["D", 0.02],
-      ["H", 0.02],
-      ["K", 0.02],
-      ["M", 0.02],
-      ["N", 0.02],
-      ["R", 0.02],
-      ["S", 0.02],
-      ["V", 0.02],
-      ["W", 0.02],
-      ["Y", 0.02],
-  ]
-  homosapiens = [
-      ["a", 0.3029549426680],
-      ["c", 0.1979883004921],
-      ["g", 0.1975473066391],
-      ["t", 0.3015094502008],
-  ]
-
-  def make_repeat_fasta(id, desc, src, n)
-      puts ">#{id} #{desc}"
-      v = nil
-      width = 60
-      l = src.length
-      s = src * ((n / l) + 1)
-      s.slice!(n, l)
-      puts(s.scan(/.{1,#{width}}/).join("\n"))
-  end
-
-  def make_random_fasta(id, desc, table, n)
-      puts ">#{id} #{desc}"
-      rand, v = nil,nil
-      width = 60
-      chunk = 1 * width
-      prob = 0.0
-      table.each{|v| v[1]= (prob += v[1])}
-      for i in 1..(n/width)
-          puts((1..width).collect{
-              rand = gen_random(1.0)
-              table.find{|v| v[1]>rand}[0]
-          }.join)
-      end
-      if n%width != 0
-          puts((1..(n%width)).collect{
-              rand = gen_random(1.0)
-              table.find{|v| v[1]>rand}[0]
-          }.join)
-      end
-  end
-
-
-  n = (ARGV[0] or 250_000).to_i
-
-  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-  EOS
-benchmark:
-  - name: so_k_nucleotide
-    prelude: |
-      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-      File.write(script, bm_so_fasta)
-
-      def prepare_fasta_output n
-        filebase = File.join(File.dirname($0), 'fasta.output')
-        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-        file = "#{filebase}.#{n}"
-
-        unless FileTest.exist?(file)
-          STDERR.puts "preparing #{file}"
-
-          open(file, 'w'){|f|
-            ARGV[0] = n
-            $stdout = f
-            load script
-            $stdout = STDOUT
-          }
-        end
-      end
-      prepare_fasta_output(100_000)
-    script: |
-      # The Computer Language Shootout
-      # http://shootout.alioth.debian.org
-      #
-      # contributed by jose fco. gonzalez
-      # modified by Sokolov Yura
-
-      seq = String.new
-
-      def frecuency( seq,length )
-          n, table = seq.length - length + 1, Hash.new(0)
-          f, i = nil, nil
-          (0 ... length).each do |f|
-              (f ... n).step(length) do |i|
-                  table[seq[i,length]] += 1
-              end
-          end
-          [n,table]
-
-      end
-
-      def sort_by_freq( seq,length )
-          n,table = frecuency( seq,length )
-          a, b, v = nil, nil, nil
-          table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-              puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-          end
-          puts
-      end
-
-      def find_seq( seq,s )
-          n,table = frecuency( seq,s.length )
-          puts "#{table[s].to_s}\t#{s.upcase}"
-      end
-
-      input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-      line = input.gets while line !~ /^>THREE/
-      line = input.gets
-
-      while (line !~ /^>/) & line do
-          seq << line.chomp
-          line = input.gets
-      end
-
-      [1,2].each {|i| sort_by_freq( seq,i ) }
-
-      %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-    loop_count: 1
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
deleted file mode 100644
index 2d1e72bda9..0000000000
--- a/benchmark/so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
-    count = 1
-    mx = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            row[j] = count
-            count += 1
-        end
-        mx[bi] = row
-    end
-    mx
-end
-
-def mmult(rows, cols, m1, m2)
-    m3 = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            val = 0
-            (0 .. (cols - 1)).each do |k|
-                val += m1.at(bi).at(k) * m2.at(k).at(j)
-            end
-            row[j] = val
-        end
-        m3[bi] = row
-    end
-    m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
-    mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
deleted file mode 100644
index d8c8e3ab9c..0000000000
--- a/benchmark/so_meteor_contest.rb
+++ /dev/null
@@ -1,563 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-#   http://shootout.alioth.debian.org
-#   contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM:  the main body is at the bottom.
-#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-#   2) see how I represent a board as a bitmask by reading the blank_board comments
-#   3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
-  # an array (by location) containing a bit mask for how the piece maps at the given location.
-  # if the rotation is invalid at that location the mask will contain false
-  attr_reader :start_masks
-
-  # maps a direction to a relative location.  these differ depending on whether it is an even or
-  # odd row being mapped from
-  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
-  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
-  def initialize( directions )
-    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
-    @even_mask = mask_for_offsets( @even_offsets)
-    @odd_mask = mask_for_offsets( @odd_offsets)
-
-    @start_masks = Array.new(60)
-
-    # create the rotational masks by placing the base mask at the location and seeing if
-    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
-    # is true the piece cannot be placed
-    0.upto(59) do | offset |
-      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
-      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
-        imask = compute_required( mask, offset)
-        @start_masks[offset] = [ mask, imask, imask | mask ]
-      else
-        @start_masks[offset] = false
-      end
-    end
-  end
-
-  def compute_required( mask, offset )
-    board = blank_board
-    0.upto(offset) { | i | board |= 1 << i }
-    board |= mask
-    return 0 if (!prunable(board | mask, offset))
-    board = flood_fill(board,58)
-    count = 0
-    imask = 0
-    0.upto(59) do | i |
-      if (board[i] == 0) then
-        imask |= (1 << i)
-        count += 1
-      end
-    end
-    (count > 0 && count < 5) ? imask : 0
-  end
-
-  def flood_fill( board, location)
-    return board if (board[location] == 1)
-    board |= 1 << location
-    row, col = location.divmod(6)
-    board = flood_fill( board, location - 1) if (col > 0)
-    board = flood_fill( board, location + 1) if (col < 4)
-    if (row % 2 == 0) then
-      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
-    else
-      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
-    end
-    board
-  end
-
-  # given a location, produces a list of relative locations covered by the piece at this rotation
-  def offsets( location)
-    if is_even( location) then
-      @even_offsets.collect { | value | value + location }
-    else
-      @odd_offsets.collect { | value | value + location }
-    end
-  end
-
-  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
-  # this is hard to explain. imagine we have this partial board:
-  #   0 0 0 0 0 x        [positions 0-5]
-  #    0 0 1 1 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 1 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # The top-left of the piece is at position 8, the
-  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
-  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
-  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
-  #   0 0 0 1 1 x        [positions 0-5]
-  #    0 0 1 0 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 0 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
-  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
-  # this function would return
-  def normalize_offsets( values)
-    min = values.min
-    even_min = is_even(min)
-    other_min = even_min ? min + 6 : min + 7
-    other_values = values.collect do | value |
-      if is_even(value) then
-        value + 6 - other_min
-      else
-        value + 7 - other_min
-      end
-    end
-    values.collect! { | value | value - min }
-
-    if even_min then
-      [values, other_values]
-    else
-      [other_values, values]
-    end
-  end
-
-  # produce a bitmask representation of an array of offset locations
-  def mask_for_offsets( offsets )
-    mask = 0
-    offsets.each { | value | mask = mask + ( 1 << value ) }
-    mask
-  end
-
-  # finds a "safe" position that a position as described by a list of directions can be placed
-  # without falling off any edge of the board.  the values returned a location to place the first piece
-  # at so it will fit after making the described moves
-  def start_adjust( directions )
-    south = east = 0;
-    directions.each do | direction |
-      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
-      south += 1 if ( direction == :nw || direction == :ne )
-    end
-    south * 6 + east
-  end
-
-  # given a set of directions places the piece (as defined by a set of directions) on the board at
-  # a location that will not take it off the edge
-  def get_values( directions )
-    start = start_adjust(directions)
-    values = [ start ]
-    directions.each do | direction |
-      if (start % 12 >= 6) then
-        start += @@rotation_odd_adder[direction]
-      else
-        start += @@rotation_even_adder[direction]
-      end
-      values += [ start ]
-    end
-
-    # some moves take you back to an existing location, we'll strip duplicates
-    values.uniq
-  end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-#   rotations -- all the rotations of the piece
-#   type -- a numeic "name" of the piece
-#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
-#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
-  attr_reader :rotations, :type, :masks
-  attr_accessor :placed
-
-  # transform hashes that change one direction into another when you either flip or rotate a set of directions
-  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
-  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
-  def initialize( directions, type )
-    @type = type
-    @rotations = Array.new();
-    @map = {}
-
-    generate_rotations( directions )
-    directions.collect! { | value | @@flip_converter[value] }
-    generate_rotations( directions )
-
-    # creates the masks AND a map that returns [location, rotation] for any given mask
-    # this is used when a board is found and we want to draw it, otherwise the map is unused
-    @masks = Array.new();
-    0.upto(59) do | i |
-      even = true
-      @masks[i] = @rotations.collect do | rotation |
-        mask = rotation.start_masks[i]
-        @map[mask[0]] = [ i, rotation ] if (mask)
-        mask || nil
-      end
-      @masks[i].compact!
-    end
-  end
-
-  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
-  def generate_rotations( directions )
-    6.times do
-      rotations.push( Rotation.new(directions))
-      directions.collect! { | value | @@rotate_converter[value] }
-    end
-  end
-
-  # given a board string, adds this piece to the board at whatever location/rotation
-  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
-  def fill_string( board_string)
-    location, rotation = @map[@placed]
-    rotation.offsets(location).each do | offset |
-      row, col = offset.divmod(6)
-      board_string[ row*5 + col, 1 ] = @type.to_s
-    end
-  end
-end
-
-# a blank bit board having this form:
-#
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
-  0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
-  0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
-  (location % 12) < 6
-end
-
-# support function that create three utility maps:
-#  $converter -- for each row an array that maps a five bit row (via array mapping)
-#                to the a five bit representation of the bits below it
-#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-#                   a region array has three values the first is a mask of bits in the region,
-#                   the second is the count of those bits and the third is identical to the first
-#                   examples:
-#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-#                           0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
-  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
-  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
-  all_odds = Array.new(0b100000)
-  all_evens = Array.new(0b100000)
-  bit_counts = Array.new(0b100000)
-  new_regions = Array.new(0b100000)
-  0.upto(0b11111) do | i |
-    bit_count = odd = even = 0
-    0.upto(4) do | bit |
-      if (i[bit] == 1) then
-        bit_count += 1
-        odd |= odd_map[bit]
-        even |= even_map[bit]
-      end
-    end
-    all_odds[i] = odd
-    all_evens[i] = even
-    bit_counts[i] = bit_count
-    new_regions[i] = create_regions( i)
-  end
-
-  $converter = []
-  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
-  $bit_counts = bit_counts
-  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five.  The following board is an example of a prunable board:
-#    0 0 1 0 0
-#     0 1 0 0 0
-#    1 1 0 0 0
-#     0 1 0 0 0
-#    0 0 0 0 0
-#       ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
-#   location -- starting location, everything above and to the left is already full
-#   slotting -- set to true only when testing initial pieces, when filling normally
-#               additional assumptions are possible
-#
-# Algorithm:
-#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
-#    maintainng counts of active open areas (kept in the collector array) each collector contains
-#    three values at the start of an iteration:
-#          0: mask of bits that would be adjacent to the collector in this row
-#          1: the number of bits collected so far
-#          2: a scratch space starting as zero, but used during the computation to represent
-#             the empty bits in the new row that are adjacent (position 0)
-#  The exact procedure is described in-code
-def prunable( board, location, slotting = false)
-  collectors = []
-  # loop across the rows
-  (location / 6).to_i.upto(9) do | row_on |
-    # obtain a set of regions representing the bits of the current row.
-    regions = $regions[(board >> (row_on * 6)) & 0b11111]
-    converter = $converter[row_on]
-
-    # track the number of collectors at the start of the cycle so that
-    # we don't compute against newly created collectors, only existing collectors
-    initial_collector_count = collectors.length
-
-    # loop against the regions.  For each region of the row
-    # we will see if it connects to one or more existing collectors.
-    # if it connects to 1 collector, the bits from the region are added to the
-    # bits of the collector and the mask is placed in collector[2]
-    # If the region overlaps more than one collector then all the collectors
-    # it overlaps with are merged into the first one (the others are set to nil in the array)
-    # if NO collectors are found then the region is copied as a new collector
-    regions.each do | region |
-      collector_found = nil
-      region_mask = region[2]
-      initial_collector_count.times do | collector_num |
-        collector = collectors[collector_num]
-        if (collector) then
-          collector_mask = collector[0]
-          if (collector_mask & region_mask != 0) then
-            if (collector_found) then
-              collector_found[0] |= collector_mask
-              collector_found[1] += collector[1]
-              collector_found[2] |= collector[2]
-              collectors[collector_num] = nil
-            else
-              collector_found = collector
-              collector[1] += region[1]
-              collector[2] |= region_mask
-            end
-          end
-        end
-      end
-      if (collector_found == nil) then
-        collectors.push(Array.new(region))
-      end
-    end
-
-    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
-    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
-    # the board is prunable.  if it is a multiple of five it is removed.
-    # Collector that are still active have a new adjacent value [0] set based n the matched bits
-    # and have [2] cleared out for the next cycle.
-    collectors.length.times do | collector_num |
-      collector = collectors[collector_num]
-      if (collector) then
-        if (collector[2] == 0) then
-          return true if (collector[1] % 5 != 0)
-          collectors[collector_num] = nil
-        else
-          # if a collector matches all bits in the row then we can return unprunable early for the
-          # following reasons:
-          #    1) there can be no more unavailable bits bince we fill from the top left downward
-          #    2) all previous regions have been closed or joined so only this region can fail
-          #    3) this region must be good since there can never be only 1 region that is nuot
-          #       a multiple of five
-          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
-          # in pieces to see what configurations work for them (the only other time this algorithm is used).
-          return false if (collector[2] == 0b11111 && !slotting)
-          collector[0] = converter[collector[2]]
-          collector[2] = 0
-        end
-      end
-    end
-
-    # get rid of all the empty converters for the next round
-    collectors.compact!
-  end
-  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
-  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask.  see prunable for what a "region" is
-def create_regions( value )
-  regions = []
-  cur_region = 0
-  5.times do | bit |
-    if (value[bit] == 0) then
-      cur_region |= 1 << bit
-    else
-      if (cur_region != 0 ) then
-        regions.push( cur_region)
-        cur_region = 0;
-      end
-    end
-  end
-  regions.push(cur_region) if (cur_region != 0)
-  regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
-  find_top( 1)
-  find_top( 0)
-  print_results
-end
-
-# show the board
-def print_results
-  print "#{@boards_found} solutions found\n\n"
-  print_full_board( @min_board)
-  print "\n"
-  print_full_board( @max_board)
-  print "\n"
-end
-
-# finds solutions.  This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece.  It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
-#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
-#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
-#   diminish over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
-#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-#   maximum number
-def find_top( rotation_skip)
-  board = blank_board
-  (@pieces.length-1).times do
-    piece = @pieces.shift
-    piece.masks[0].each do | mask, imask, cmask |
-      if ((rotation_skip += 1) % 2 == 0) then
-        piece.placed = mask
-        find( 1, 1, board | mask)
-      end
-    end
-    @pieces.push(piece)
-  end
-  piece = @pieces.shift
-  @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-#  start_location -- where to start looking for place for the next piece at
-#  placed -- number of pieces placed
-#  board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
-  # find the next location to place a piece by looking for an empty bit
-  while board[start_location] == 1
-    start_location += 1
-  end
-
-  @pieces.length.times do
-    piece = @pieces.shift
-    piece.masks[start_location].each do | mask, imask, cmask |
-      if ( board & cmask == imask) then
-        piece.placed = mask
-        if (placed == 9) then
-          add_board
-        else
-          find( start_location + 1, placed + 1, board | mask)
-        end
-      end
-    end
-    @pieces.push(piece)
-  end
-end
-
-# print the board
-def print_full_board( board_string)
-  10.times do | row |
-    print " " if (row % 2 == 1)
-    5.times do | col |
-      print "#{board_string[row*5 + col,1]} "
-    end
-    print "\n"
-  end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
-  board_string = "99999999999999999999999999999999999999999999999999"
-  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
-  save( board_string)
-  save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
-  if (@all_boards[board_string] == nil) then
-    @min_board = board_string if (board_string < @min_board)
-    @max_board = board_string if (board_string > @max_board)
-    @all_boards.store(board_string,true)
-    @boards_found += 1
-
-    # the exit motif is a time saver.  Ideally the function should return, but those tests
-    # take noticeable time (performance).
-    if (@boards_found == @stop_count) then
-      print_results
-      exit(0)
-    end
-  end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
-  Piece.new( [ :nw, :ne, :east, :east ], 2),
-  Piece.new( [ :ne, :se, :east, :ne ], 7),
-  Piece.new( [ :ne, :east, :ne, :nw ], 1),
-  Piece.new( [ :east, :sw, :sw, :se ], 6),
-  Piece.new( [ :east, :ne, :se, :ne ], 5),
-  Piece.new( [ :east, :east, :east, :se ], 0),
-  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
-  Piece.new( [ :se, :se, :se, :west ], 9),
-  Piece.new( [ :se, :se, :east, :se ], 8),
-  Piece.new( [ :east, :east, :sw, :se ], 3)
-  ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
deleted file mode 100644
index 9884fc4edc..0000000000
--- a/benchmark/so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
-  attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
-  def initialize(x, y, z, vx, vy, vz, mass)
-    @x, @y, @z = x, y, z
-    @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-    @mass = mass * SOLAR_MASS
-  end
-
-  def move_from_i(bodies, nbodies, dt, i)
-    while i < nbodies
-      b2 = bodies[i]
-      dx = @x - b2.x
-      dy = @y - b2.y
-      dz = @z - b2.z
-
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      mag = dt / (distance * distance * distance)
-      b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-      @vx -= dx * b2_mass_mag
-      @vy -= dy * b2_mass_mag
-      @vz -= dz * b2_mass_mag
-      b2.vx += dx * b_mass_mag
-      b2.vy += dy * b_mass_mag
-      b2.vz += dz * b_mass_mag
-      i += 1
-    end
-
-    @x += dt * @vx
-    @y += dt * @vy
-    @z += dt * @vz
-  end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
deleted file mode 100644
index 766fcf7b84..0000000000
--- a/benchmark/so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
-    n.times do
-        n.times do
-            n.times do
-                n.times do
-                    n.times do
-                        x += 1
-                    end
-                end
-            end
-        end
-    end
-end
-# puts x
-
-
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
deleted file mode 100644
index 131f44624c..0000000000
--- a/benchmark/so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
-    def initialize(start_state)
-        @bool = start_state
-    end
-
-    def value
-        @bool
-    end
-
-    def activate
-        @bool = !@bool
-        self
-    end
-end
-
-class NthToggle < Toggle
-    def initialize(start_state, max_counter)
-        super start_state
-        @count_max = max_counter
-        @counter = 0
-    end
-
-    def activate
-        @counter += 1
-        if @counter >= @count_max
-            @bool = !@bool
-            @counter = 0
-        end
-        self
-    end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
-    toggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
-    ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
deleted file mode 100644
index 9a537b2d1c..0000000000
--- a/benchmark/so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
-    def initialize()
-        @z = Transformation.new 1,0,0,1
-        @x = Transformation.new 0,0,0,0
-        @inverse = Transformation.new 0,0,0,0
-    end
-
-    def next!
-        @y = @z.extract(3)
-        if safe? @y
-            @z = produce(@y)
-            @y
-        else
-            @z = consume @x.next!()
-            next!()
-        end
-    end
-
-    def safe?(digit)
-        digit == @z.extract(4)
-    end
-
-    def produce(i)
-        @inverse.qrst(10,-10*i,0,1).compose(@z)
-    end
-
-    def consume(a)
-        @z.compose(a)
-    end
-end
-
-
-class Transformation
-    attr_reader :q, :r, :s, :t
-    def initialize(q, r, s, t)
-        @q,@r,@s,@t,@k = q,r,s,t,0
-    end
-
-    def next!()
-        @q = @k = @k + 1
-        @r = 4 * @k + 2
-        @s = 0
-        @t = 2 * @k + 1
-        self
-    end
-
-    def extract(j)
-        (@q * j + @r) / (@s * j + @t)
-    end
-
-    def compose(a)
-        self.class.new( @q * a.q,
-                        @q * a.r + r * a.t,
-                        @s * a.q + t * a.s,
-                        @s * a.r + t * a.t
-                    )
-    end
-
-    def qrst *args
-        initialize *args
-        self
-    end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
-    if n >= WIDTH
-        WIDTH.times {print digits.next!}
-        j += WIDTH
-    else
-        n.times {print digits.next!}
-        (WIDTH-n).times {print " "}
-        j += n
-    end
-    puts "\t:"+j.to_s
-    n -= WIDTH
-end
-
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
deleted file mode 100644
index de05eedfc4..0000000000
--- a/benchmark/so_reverse_complement.yml
+++ /dev/null
@@ -1,137 +0,0 @@
-prelude: |
-  bm_so_fasta = <<'EOS'
-  # The Computer Language Shootout
-  # http://shootout.alioth.debian.org/
-  # Contributed by Sokolov Yura
-
-  $last = 42.0
-  def gen_random(max, im=139968, ia=3877, ic=29573)
-      (max * ($last = ($last * ia + ic) % im)) / im
-  end
-
-  alu =
-     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-     "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-     "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-     "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-     "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-     "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-     "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-  iub = [
-      ["a", 0.27],
-      ["c", 0.12],
-      ["g", 0.12],
-      ["t", 0.27],
-
-      ["B", 0.02],
-      ["D", 0.02],
-      ["H", 0.02],
-      ["K", 0.02],
-      ["M", 0.02],
-      ["N", 0.02],
-      ["R", 0.02],
-      ["S", 0.02],
-      ["V", 0.02],
-      ["W", 0.02],
-      ["Y", 0.02],
-  ]
-  homosapiens = [
-      ["a", 0.3029549426680],
-      ["c", 0.1979883004921],
-      ["g", 0.1975473066391],
-      ["t", 0.3015094502008],
-  ]
-
-  def make_repeat_fasta(id, desc, src, n)
-      puts ">#{id} #{desc}"
-      v = nil
-      width = 60
-      l = src.length
-      s = src * ((n / l) + 1)
-      s.slice!(n, l)
-      puts(s.scan(/.{1,#{width}}/).join("\n"))
-  end
-
-  def make_random_fasta(id, desc, table, n)
-      puts ">#{id} #{desc}"
-      rand, v = nil,nil
-      width = 60
-      chunk = 1 * width
-      prob = 0.0
-      table.each{|v| v[1]= (prob += v[1])}
-      for i in 1..(n/width)
-          puts((1..width).collect{
-              rand = gen_random(1.0)
-              table.find{|v| v[1]>rand}[0]
-          }.join)
-      end
-      if n%width != 0
-          puts((1..(n%width)).collect{
-              rand = gen_random(1.0)
-              table.find{|v| v[1]>rand}[0]
-          }.join)
-      end
-  end
-
-
-  n = (ARGV[0] or 250_000).to_i
-
-  make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-  make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-  make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-  EOS
-benchmark:
-  - name: so_reverse_complement
-    prelude: |
-      script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-      File.write(script, bm_so_fasta)
-
-      def prepare_fasta_output n
-        filebase = File.join(File.dirname($0), 'fasta.output')
-        script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-        file = "#{filebase}.#{n}"
-
-        unless FileTest.exist?(file)
-          STDERR.puts "preparing #{file}"
-
-          open(file, 'w'){|f|
-            ARGV[0] = n
-            $stdout = f
-            load script
-            $stdout = STDOUT
-          }
-        end
-      end
-      prepare_fasta_output(2_500_000)
-    script: |
-      # The Great Computer Language Shootout
-      # http://shootout.alioth.debian.org/
-      #
-      # Contributed by Peter Bjarke Olsen
-      # Modified by Doug King
-
-      seq=Array.new
-
-      def revcomp(seq)
-        seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
-        stringlen=seq.length
-        0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-      end
-
-      input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-      while input.gets
-        if $_ =~ />/
-          if seq.length != 0
-            revcomp(seq.join)
-            seq=Array.new
-          end
-          puts $_
-        else
-          $_.sub(/\n/,'')
-          seq.push $_
-        end
-      end
-      revcomp(seq.join)
-    loop_count: 1
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
deleted file mode 100644
index 7d23fd3d35..0000000000
--- a/benchmark/string_capitalize.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
-  str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
-  str10 = str1 * 10
-  str100 = str10 * 10
-  str1000 = str100 * 10
-benchmark:
-  capitalize-1: str1.capitalize
-  capitalize-10: str10.capitalize
-  capitalize-100: str100.capitalize
-  capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_casecmp.yml b/benchmark/string_casecmp.yml
deleted file mode 100644
index 2354040a04..0000000000
--- a/benchmark/string_casecmp.yml
+++ /dev/null
@@ -1,26 +0,0 @@
-prelude: |
-  lstr1 = [*"a".."z",*"0".."9"].join("")
-  lstr10 = lstr1 * 10
-  lstr100 = lstr10 * 10
-  lstr1000 = lstr100 * 10
-  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
-  lnonascii10 = lnonascii1 * 10
-  lnonascii100 = lnonascii10 * 10
-  lnonascii1000 = lnonascii100 * 10
-  ustr1 = [*"A".."Z",*"0".."9"].join("")
-  ustr10 = ustr1 * 10
-  ustr100 = ustr10 * 10
-  ustr1000 = ustr100 * 10
-  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
-  unonascii10 = unonascii1 * 10
-  unonascii100 = unonascii10 * 10
-  unonascii1000 = unonascii100 * 10
-benchmark:
-  casecmp-1: lstr1.casecmp(ustr1)
-  casecmp-10: lstr10.casecmp(ustr10)
-  casecmp-100: lstr100.casecmp(ustr100)
-  casecmp-1000: lstr1000.casecmp(ustr1000)
-  casecmp-nonascii1: lnonascii1.casecmp(unonascii1)
-  casecmp-nonascii10: lnonascii10.casecmp(unonascii10)
-  casecmp-nonascii100: lnonascii100.casecmp(unonascii100)
-  casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)
diff --git a/benchmark/string_casecmp_p.yml b/benchmark/string_casecmp_p.yml
deleted file mode 100644
index a790ce7d55..0000000000
--- a/benchmark/string_casecmp_p.yml
+++ /dev/null
@@ -1,26 +0,0 @@
-prelude: |
-  lstr1 = [*"a".."z",*"0".."9"].join("")
-  lstr10 = lstr1 * 10
-  lstr100 = lstr10 * 10
-  lstr1000 = lstr100 * 10
-  lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")
-  lnonascii10 = lnonascii1 * 10
-  lnonascii100 = lnonascii10 * 10
-  lnonascii1000 = lnonascii100 * 10
-  ustr1 = [*"A".."Z",*"0".."9"].join("")
-  ustr10 = ustr1 * 10
-  ustr100 = ustr10 * 10
-  ustr1000 = ustr100 * 10
-  unonascii1 = [*"\u{c0}".."\u{df}"].join("")
-  unonascii10 = unonascii1 * 10
-  unonascii100 = unonascii10 * 10
-  unonascii1000 = unonascii100 * 10
-benchmark:
-  casecmp_p-1: lstr1.casecmp?(ustr1)
-  casecmp_p-10: lstr10.casecmp?(ustr10)
-  casecmp_p-100: lstr100.casecmp?(ustr100)
-  casecmp_p-1000: lstr1000.casecmp?(ustr1000)
-  casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)
-  casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)
-  casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)
-  casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)
diff --git a/benchmark/string_concat.yml b/benchmark/string_concat.yml
deleted file mode 100644
index f11f95ee9a..0000000000
--- a/benchmark/string_concat.yml
+++ /dev/null
@@ -1,51 +0,0 @@
-prelude: |
-  CHUNK = "a" * 64
-  UCHUNK = "é" * 32
-  SHORT = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] / 2)
-  LONG = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] * 2)
-  GC.disable # GC causes a lot of variance
-benchmark:
-  binary_concat_7bit: |
-    buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-  utf8_concat_7bit: |
-    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-    buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK
-  utf8_concat_UTF8: |
-    buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-    buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK
-  interpolation: |
-    buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \
-      "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"
-  interpolation_same_heap: |
-    buffer = "#{SHORT}#{SHORT}"
-  interpolation_switching_heaps: |
-    buffer = "#{SHORT}#{LONG}"
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
deleted file mode 100644
index 1fea6afbec..0000000000
--- a/benchmark/string_downcase.yml
+++ /dev/null
@@ -1,18 +0,0 @@
-prelude: |
-  str1 = [*"A".."Z",*"0".."9"].join("")
-  str10 = str1 * 10
-  str100 = str10 * 10
-  str1000 = str100 * 10
-  nonascii1 = [*"\u{c0}".."\u{df}"].join("")
-  nonascii10 = nonascii1 * 10
-  nonascii100 = nonascii10 * 10
-  nonascii1000 = nonascii100 * 10
-benchmark:
-  downcase-1: str1.upcase
-  downcase-10: str10.upcase
-  downcase-100: str100.upcase
-  downcase-1000: str1000.upcase
-  downcase-nonascii1: nonascii1.downcase
-  downcase-nonascii10: nonascii10.downcase
-  downcase-nonascii100: nonascii100.downcase
-  downcase-nonascii1000: nonascii1000.downcase
diff --git a/benchmark/string_dup.yml b/benchmark/string_dup.yml
deleted file mode 100644
index 90793f9f2a..0000000000
--- a/benchmark/string_dup.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-benchmark:
-  uplus: |
-    +"A"
-  dup: |
-    "A".dup
diff --git a/benchmark/string_gsub.yml b/benchmark/string_gsub.yml
deleted file mode 100644
index 0f964337dd..0000000000
--- a/benchmark/string_gsub.yml
+++ /dev/null
@@ -1,43 +0,0 @@
-prelude: |
-  # frozen_string_literal: true
-  STR = ((("a" * 31) + "<") * 1000).freeze
-  STR_UNICODE = ((("a" * 30) + "\u2028") * 1000).freeze
-  ESCAPED_CHARS_BINARY = {
-    "\u2028".b => '\u2028'.b,
-    "\u2029".b => '\u2029'.b,
-    ">".b => '\u003e'.b.freeze,
-    "<".b => '\u003c'.b.freeze,
-    "&".b => '\u0026'.b.freeze,
-  }
-  BINARY_PATTERN = Regexp.union(ESCAPED_CHARS_BINARY.keys)
-
-  ESCAPED_CHARS = {
-    "\u2028" => '\u2028',
-    "\u2029" => '\u2029',
-    ">" => '\u003e',
-    "<" => '\u003c',
-    "&" => '\u0026',
-  }
-  ESCAPE_PATTERN = Regexp.union(ESCAPED_CHARS.keys)
-
-
-benchmark:
-  escape: |
-    str = STR.dup
-    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
-    str
-
-  escape_bin: |
-    str = STR.b
-    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
-    str.force_encoding(Encoding::UTF_8)
-
-  escape_utf8: |
-    str = STR_UNICODE.dup
-    str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)
-    str
-
-  escape_utf8_bin: |
-    str = STR_UNICODE.b
-    str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)
-    str.force_encoding(Encoding::UTF_8)
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
deleted file mode 100644
index 7783111082..0000000000
--- a/benchmark/string_index.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-str1 = "あ" * 1024 + "い" # not single byte optimizable
-str2 = "い"