summaryrefslogtreecommitdiff
path: root/tool/m4/ruby_defint.m4
diff options
context:
space:
mode:
Diffstat (limited to 'tool/m4/ruby_defint.m4')
0 files changed, 0 insertions, 0 deletions
ls.el37
-rw-r--r--.document32
-rw-r--r--.editorconfig30
-rw-r--r--.gdbinit1346
-rw-r--r--.gitattributes8
-rw-r--r--.github/SECURITY.md9
-rw-r--r--.github/workflows/check_branch.yml22
-rw-r--r--.github/workflows/cygwin.yml79
-rw-r--r--.github/workflows/macos.yml81
-rw-r--r--.github/workflows/mjit.yml79
-rw-r--r--.github/workflows/ubuntu.yml115
-rw-r--r--.github/workflows/windows.yml90
-rw-r--r--.gitignore225
-rw-r--r--.rspec_parallel2
-rw-r--r--.travis.yml550
-rw-r--r--BSDL22
-rw-r--r--CONTRIBUTING.md4
-rw-r--r--COPYING80
-rw-r--r--COPYING.ja72
-rw-r--r--ChangeLog18771
-rw-r--r--GPL39
-rw-r--r--KNOWNBUGS.rb7
-rw-r--r--LEGAL831
-rw-r--r--LGPL504
-rw-r--r--Makefile.in178
-rw-r--r--NEWS826
-rw-r--r--README114
-rw-r--r--README.EXT1134
-rw-r--r--README.EXT.ja1259
-rw-r--r--README.ja160
-rw-r--r--README.ja.md185
-rw-r--r--README.md176
-rw-r--r--ToDo126
-rw-r--r--aclocal.m447
-rw-r--r--addr2line.c2663
-rw-r--r--addr2line.h21
-rw-r--r--appveyor.yml147
-rw-r--r--array.c7157
-rw-r--r--ast.c691
-rw-r--r--ast.rb144
-rwxr-xr-xbasictest/runner.rb33
-rwxr-xr-xbasictest/test.rb2360
-rw-r--r--bcc32/Makefile.sub490
-rw-r--r--bcc32/README.bcc32137
-rwxr-xr-xbcc32/configure.bat92
-rw-r--r--bcc32/mkexports.rb25
-rw-r--r--bcc32/setup.mak133
-rw-r--r--benchmark/README.md72
-rw-r--r--benchmark/app_answer.rb15
-rw-r--r--benchmark/app_aobench.rb297
-rw-r--r--benchmark/app_erb.yml23
-rw-r--r--benchmark/app_factorial.rb11
-rw-r--r--benchmark/app_fib.rb10
-rw-r--r--benchmark/app_lc_fizzbuzz.rb52
-rw-r--r--benchmark/app_mandelbrot.rb23
-rw-r--r--benchmark/app_pentomino.rb130
-rw-r--r--benchmark/app_raise.rb8
-rw-r--r--benchmark/app_strconcat.rb5
-rw-r--r--benchmark/app_tak.rb13
-rw-r--r--benchmark/app_tarai.rb10
-rw-r--r--benchmark/app_uri.rb8
-rw-r--r--benchmark/array_flatten.yml19
-rw-r--r--benchmark/array_intersection.yml14
-rw-r--r--benchmark/array_sample_100k_10.rb2
-rw-r--r--benchmark/array_sample_100k_11.rb2
-rw-r--r--benchmark/array_sample_100k__100.rb2
-rw-r--r--benchmark/array_sample_100k__1k.rb2
-rw-r--r--benchmark/array_sample_100k__6k.rb2
-rw-r--r--benchmark/array_sample_100k___10k.rb2
-rw-r--r--benchmark/array_sample_100k___50k.rb2
-rw-r--r--benchmark/array_shift.rb14
-rw-r--r--benchmark/array_small_and.rb17
-rw-r--r--benchmark/array_small_diff.rb17
-rw-r--r--benchmark/array_small_or.rb17
-rw-r--r--benchmark/array_sort_block.rb2
-rw-r--r--benchmark/array_sort_float.rb2
-rw-r--r--benchmark/array_values_at_int.rb2
-rw-r--r--benchmark/array_values_at_range.rb2
-rw-r--r--benchmark/bighash.rb1
-rw-r--r--benchmark/cgi_escape_html.yml40
-rw-r--r--benchmark/complex_float_add.yml7
-rw-r--r--benchmark/complex_float_div.yml7
-rw-r--r--benchmark/complex_float_mul.yml7
-rw-r--r--benchmark/complex_float_new.yml7
-rw-r--r--benchmark/complex_float_power.yml7
-rw-r--r--benchmark/complex_float_sub.yml7
-rw-r--r--benchmark/dir_empty_p.rb5
-rw-r--r--benchmark/enum_lazy_grep_v_100.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_20.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_50.rb4
-rw-r--r--benchmark/enum_lazy_uniq_100.rb4
-rw-r--r--benchmark/enum_lazy_uniq_20.rb4
-rw-r--r--benchmark/enum_lazy_uniq_50.rb4
-rw-r--r--benchmark/erb_render.yml24
-rwxr-xr-xbenchmark/fiber_chain.yml36
-rw-r--r--benchmark/file_chmod.rb9
-rw-r--r--benchmark/file_rename.rb11
-rw-r--r--benchmark/gc/aobench.rb1
-rw-r--r--benchmark/gc/binary_trees.rb1
-rw-r--r--benchmark/gc/gcbench.rb57
-rw-r--r--benchmark/gc/hash1.rb11
-rw-r--r--benchmark/gc/hash2.rb7
-rw-r--r--benchmark/gc/null.rb1
-rw-r--r--benchmark/gc/pentomino.rb1
-rw-r--r--benchmark/gc/rdoc.rb13
-rw-r--r--benchmark/gc/redblack.rb366
-rw-r--r--benchmark/gc/ring.rb29
-rw-r--r--benchmark/hash_aref_dsym.rb4
-rw-r--r--benchmark/hash_aref_dsym_long.rb21
-rw-r--r--benchmark/hash_aref_fix.rb4
-rw-r--r--benchmark/hash_aref_flo.rb4
-rw-r--r--benchmark/hash_aref_miss.rb5
-rw-r--r--benchmark/hash_aref_str.rb4
-rw-r--r--benchmark/hash_aref_sym.rb9
-rw-r--r--benchmark/hash_aref_sym_long.rb13
-rw-r--r--benchmark/hash_dup.yml8
-rw-r--r--benchmark/hash_flatten.rb9
-rw-r--r--benchmark/hash_ident_flo.rb4
-rw-r--r--benchmark/hash_ident_num.rb4
-rw-r--r--benchmark/hash_ident_obj.rb4
-rw-r--r--benchmark/hash_ident_str.rb4
-rw-r--r--benchmark/hash_ident_sym.rb4
-rw-r--r--benchmark/hash_keys.rb9
-rw-r--r--benchmark/hash_literal_small2.rb3
-rw-r--r--benchmark/hash_literal_small4.rb3
-rw-r--r--benchmark/hash_literal_small8.rb3
-rw-r--r--benchmark/hash_long.rb4
-rw-r--r--benchmark/hash_shift.rb10
-rw-r--r--benchmark/hash_shift_u16.rb10
-rw-r--r--benchmark/hash_shift_u24.rb10
-rw-r--r--benchmark/hash_shift_u32.rb10
-rw-r--r--benchmark/hash_small2.rb1
-rw-r--r--benchmark/hash_small4.rb1
-rw-r--r--benchmark/hash_small8.rb1
-rw-r--r--benchmark/hash_to_proc.rb9
-rw-r--r--benchmark/hash_values.rb9
-rw-r--r--benchmark/int_quo.rb1
-rw-r--r--benchmark/io_copy_stream_write.rb24
-rw-r--r--benchmark/io_copy_stream_write_socket.rb35
-rw-r--r--benchmark/io_file_create.rb13
-rw-r--r--benchmark/io_file_read.rb15
-rw-r--r--benchmark/io_file_write.rb14
-rw-r--r--benchmark/io_nonblock_noex.rb22
-rw-r--r--benchmark/io_nonblock_noex2.rb21
-rw-r--r--benchmark/io_pipe_rw.rb13
-rw-r--r--benchmark/io_select.rb9
-rw-r--r--benchmark/io_select2.rb22
-rw-r--r--benchmark/io_select3.rb21
-rw-r--r--benchmark/irb_color.yml13
-rw-r--r--benchmark/irb_exec.yml10
-rw-r--r--benchmark/lib/benchmark_driver/output/driver.rb36
-rw-r--r--benchmark/lib/benchmark_driver/runner/cstime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/cutime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit_exec.rb237
-rw-r--r--benchmark/lib/benchmark_driver/runner/peak.rb151
-rw-r--r--benchmark/lib/benchmark_driver/runner/size.rb25
-rw-r--r--benchmark/lib/benchmark_driver/runner/stime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/total.rb137
-rw-r--r--benchmark/lib/benchmark_driver/runner/utime.rb22
-rw-r--r--benchmark/lib/load.rb18
-rw-r--r--benchmark/loop_for.rb3
-rw-r--r--benchmark/loop_generator.rb14
-rw-r--r--benchmark/loop_times.rb1
-rw-r--r--benchmark/loop_whileloop.rb4
-rw-r--r--benchmark/loop_whileloop2.rb4
-rw-r--r--benchmark/marshal_dump_flo.rb2
-rw-r--r--benchmark/marshal_dump_load_geniv.rb10
-rw-r--r--benchmark/marshal_dump_load_time.rb1
-rw-r--r--benchmark/match_gt4.rb1
-rw-r--r--benchmark/match_small.rb1
-rw-r--r--benchmark/mjit_exec_jt2jt.yml8
-rw-r--r--benchmark/mjit_exec_vm2jt.yml8
-rw-r--r--benchmark/mjit_exec_vm2vm.yml8
-rw-r--r--benchmark/nil_p.yml9
-rw-r--r--benchmark/other-lang/ack.pl11
-rw-r--r--benchmark/other-lang/ack.py16
-rw-r--r--benchmark/other-lang/ack.rb12
-rw-r--r--benchmark/other-lang/ack.scm7
-rw-r--r--benchmark/other-lang/eval.rb66
-rw-r--r--benchmark/other-lang/fact.pl13
-rw-r--r--benchmark/other-lang/fact.py18
-rw-r--r--benchmark/other-lang/fact.rb13
-rw-r--r--benchmark/other-lang/fact.scm8
-rw-r--r--benchmark/other-lang/fib.pl11
-rw-r--r--benchmark/other-lang/fib.py7
-rw-r--r--benchmark/other-lang/fib.rb9
-rw-r--r--benchmark/other-lang/fib.scm7
-rw-r--r--benchmark/other-lang/loop.pl3
-rw-r--r--benchmark/other-lang/loop.py2
-rw-r--r--benchmark/other-lang/loop.rb4
-rw-r--r--benchmark/other-lang/loop.scm1
-rw-r--r--benchmark/other-lang/loop2.rb1
-rw-r--r--benchmark/other-lang/tak.pl11
-rw-r--r--benchmark/other-lang/tak.py8
-rw-r--r--benchmark/other-lang/tak.rb13
-rw-r--r--benchmark/other-lang/tak.scm10
-rw-r--r--benchmark/range_last.yml4
-rw-r--r--benchmark/realpath.yml30
-rw-r--r--benchmark/require.yml32
-rw-r--r--benchmark/require_thread.yml40
-rw-r--r--benchmark/securerandom.rb5
-rw-r--r--benchmark/so_ackermann.rb19
-rw-r--r--benchmark/so_array.rb23
-rw-r--r--benchmark/so_binary_trees.rb62
-rw-r--r--benchmark/so_concatenate.rb18
-rw-r--r--benchmark/so_count_words.yml65
-rw-r--r--benchmark/so_exception.rb61
-rw-r--r--benchmark/so_fannkuch.rb45
-rw-r--r--benchmark/so_fasta.rb81
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_lists.rb47
-rw-r--r--benchmark/so_mandelbrot.rb57
-rw-r--r--benchmark/so_matrix.rb48
-rw-r--r--benchmark/so_meteor_contest.rb563
-rw-r--r--benchmark/so_nbody.rb148
-rw-r--r--benchmark/so_nested_loop.rb24
-rw-r--r--benchmark/so_nsieve.rb35
-rw-r--r--benchmark/so_nsieve_bits.rb43
-rw-r--r--benchmark/so_object.rb56
-rw-r--r--benchmark/so_partial_sums.rb31
-rw-r--r--benchmark/so_pidigits.rb92
-rw-r--r--benchmark/so_random.rb20
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--benchmark/so_sieve.rb24
-rw-r--r--benchmark/so_spectralnorm.rb50
-rw-r--r--benchmark/string_capitalize.yml10
-rw-r--r--benchmark/string_downcase.yml10
-rw-r--r--benchmark/string_index.rb3
-rw-r--r--benchmark/string_scan_re.rb2
-rw-r--r--benchmark/string_scan_str.rb2
-rw-r--r--benchmark/string_split.yml7
-rw-r--r--benchmark/string_swapcase.yml10
-rw-r--r--benchmark/string_upcase.yml10
-rw-r--r--benchmark/time_strptime.yml13
-rw-r--r--benchmark/time_subsec.rb2
-rw-r--r--benchmark/vm1_attr_ivar.yml14
-rw-r--r--benchmark/vm1_attr_ivar_set.yml14
-rw-r--r--benchmark/vm1_block.yml9
-rw-r--r--benchmark/vm1_blockparam.yml7
-rw-r--r--benchmark/vm1_blockparam_call.yml8
-rw-r--r--benchmark/vm1_blockparam_pass.yml12
-rw-r--r--benchmark/vm1_blockparam_yield.yml8
-rw-r--r--benchmark/vm1_const.yml7
-rw-r--r--benchmark/vm1_ensure.yml14
-rw-r--r--benchmark/vm1_float_simple.yml8
-rw-r--r--benchmark/vm1_gc_short_lived.yml9
-rw-r--r--benchmark/vm1_gc_short_with_complex_long.yml25
-rw-r--r--benchmark/vm1_gc_short_with_long.yml13
-rw-r--r--benchmark/vm1_gc_short_with_symbol.yml13
-rw-r--r--benchmark/vm1_gc_wb_ary.yml12
-rw-r--r--benchmark/vm1_gc_wb_ary_promoted.yml15
-rw-r--r--benchmark/vm1_gc_wb_obj.yml15
-rw-r--r--benchmark/vm1_gc_wb_obj_promoted.yml17
-rw-r--r--benchmark/vm1_ivar.yml6
-rw-r--r--benchmark/vm1_ivar_set.yml5
-rw-r--r--benchmark/vm1_length.yml8
-rw-r--r--benchmark/vm1_lvar_init.yml21
-rw-r--r--benchmark/vm1_lvar_set.yml4
-rw-r--r--benchmark/vm1_neq.yml7
-rw-r--r--benchmark/vm1_not.yml6
-rw-r--r--benchmark/vm1_rescue.yml6
-rw-r--r--benchmark/vm1_simplereturn.yml7
-rw-r--r--benchmark/vm1_swap.yml7
-rw-r--r--benchmark/vm1_yield.yml13
-rw-r--r--benchmark/vm2_array.yml4
-rw-r--r--benchmark/vm2_bigarray.yml105
-rw-r--r--benchmark/vm2_bighash.yml4
-rw-r--r--benchmark/vm2_case.yml13
-rw-r--r--benchmark/vm2_case_lit.yml23
-rw-r--r--benchmark/vm2_defined_method.yml8
-rw-r--r--benchmark/vm2_dstr.yml6
-rw-r--r--benchmark/vm2_eval.yml4
-rw-r--r--benchmark/vm2_fiber_allocate.yml8
-rw-r--r--benchmark/vm2_fiber_count.yml10
-rw-r--r--benchmark/vm2_fiber_reuse.yml14
-rw-r--r--benchmark/vm2_fiber_reuse_gc.yml12
-rw-r--r--benchmark/vm2_fiber_switch.yml9
-rw-r--r--benchmark/vm2_freezestring.yml10
-rw-r--r--benchmark/vm2_method.yml8
-rw-r--r--benchmark/vm2_method_missing.yml11
-rw-r--r--benchmark/vm2_method_with_block.yml8
-rw-r--r--benchmark/vm2_module_ann_const_set.yml4
-rw-r--r--benchmark/vm2_module_const_set.yml8
-rw-r--r--benchmark/vm2_mutex.yml8
-rw-r--r--benchmark/vm2_newlambda.yml4
-rw-r--r--benchmark/vm2_poly_method.yml24
-rw-r--r--benchmark/vm2_poly_method_ov.yml24
-rw-r--r--benchmark/vm2_poly_same_method.yml25
-rw-r--r--benchmark/vm2_poly_singleton.yml18
-rw-r--r--benchmark/vm2_proc.yml12
-rw-r--r--benchmark/vm2_raise1.yml16
-rw-r--r--benchmark/vm2_raise2.yml16
-rw-r--r--benchmark/vm2_regexp.yml8
-rw-r--r--benchmark/vm2_send.yml11
-rw-r--r--benchmark/vm2_string_literal.yml4
-rw-r--r--benchmark/vm2_struct_big_aref_hi.yml7
-rw-r--r--benchmark/vm2_struct_big_aref_lo.yml7
-rw-r--r--benchmark/vm2_struct_big_aset.yml11
-rw-r--r--benchmark/vm2_struct_big_href_hi.yml7
-rw-r--r--benchmark/vm2_struct_big_href_lo.yml7
-rw-r--r--benchmark/vm2_struct_big_hset.yml11
-rw-r--r--benchmark/vm2_struct_small_aref.yml7
-rw-r--r--benchmark/vm2_struct_small_aset.yml11
-rw-r--r--benchmark/vm2_struct_small_href.yml7
-rw-r--r--benchmark/vm2_struct_small_hset.yml7
-rw-r--r--benchmark/vm2_super.yml17
-rw-r--r--benchmark/vm2_unif1.yml7
-rw-r--r--benchmark/vm2_zsuper.yml18
-rw-r--r--benchmark/vm3_backtrace.rb22
-rw-r--r--benchmark/vm3_clearmethodcache.rb8
-rw-r--r--benchmark/vm3_gc.rb6
-rw-r--r--benchmark/vm3_gc_old_full.rb4
-rw-r--r--benchmark/vm3_gc_old_immediate.rb4
-rw-r--r--benchmark/vm3_gc_old_lazy.rb4
-rw-r--r--benchmark/vm_symbol_block_pass.rb13
-rw-r--r--benchmark/vm_thread_alive_check.yml8
-rw-r--r--benchmark/vm_thread_close.rb6
-rw-r--r--benchmark/vm_thread_condvar1.rb28
-rw-r--r--benchmark/vm_thread_condvar2.rb35
-rw-r--r--benchmark/vm_thread_create_join.rb6
-rw-r--r--benchmark/vm_thread_mutex1.rb21
-rw-r--r--benchmark/vm_thread_mutex2.rb21
-rw-r--r--benchmark/vm_thread_mutex3.rb20
-rw-r--r--benchmark/vm_thread_pass.rb15
-rw-r--r--benchmark/vm_thread_pass_flood.rb10
-rw-r--r--benchmark/vm_thread_pipe.rb17
-rw-r--r--benchmark/vm_thread_queue.rb18
-rw-r--r--benchmark/vm_thread_sized_queue.rb20
-rw-r--r--benchmark/vm_thread_sized_queue2.rb23
-rw-r--r--benchmark/vm_thread_sized_queue3.rb22
-rw-r--r--benchmark/vm_thread_sized_queue4.rb26
-rw-r--r--benchmark/vm_thread_sleep.yml4
-rw-r--r--bignum.c7931
-rwxr-xr-xbin/bundle27
-rwxr-xr-xbin/bundler27
-rwxr-xr-xbin/erb109
-rwxr-xr-xbin/gem25
-rwxr-xr-x[-rw-r--r--]bin/irb34
-rwxr-xr-xbin/racc27
-rwxr-xr-xbin/racc2y27
-rwxr-xr-x[-rw-r--r--]bin/rdoc72
-rwxr-xr-xbin/ri60
-rwxr-xr-xbin/testrb5
-rwxr-xr-xbin/y2racc27
-rw-r--r--bootstraptest/pending.rb44
-rwxr-xr-xbootstraptest/runner.rb530
-rw-r--r--bootstraptest/test_attr.rb36
-rw-r--r--bootstraptest/test_autoload.rb70
-rw-r--r--bootstraptest/test_block.rb613
-rw-r--r--bootstraptest/test_class.rb169
-rw-r--r--bootstraptest/test_env.rb12
-rw-r--r--bootstraptest/test_eval.rb325
-rw-r--r--bootstraptest/test_exception.rb432
-rw-r--r--bootstraptest/test_fiber.rb39
-rw-r--r--bootstraptest/test_finalizer.rb8
-rw-r--r--bootstraptest/test_flip.rb1
-rw-r--r--bootstraptest/test_flow.rb601
-rw-r--r--bootstraptest/test_fork.rb77
-rw-r--r--bootstraptest/test_gc.rb34
-rw-r--r--bootstraptest/test_insns.rb440
-rw-r--r--bootstraptest/test_io.rb112
-rw-r--r--bootstraptest/test_jump.rb309
-rw-r--r--bootstraptest/test_literal.rb247
-rw-r--r--bootstraptest/test_literal_suffix.rb54
-rw-r--r--bootstraptest/test_load.rb27
-rw-r--r--bootstraptest/test_marshal.rb5
-rw-r--r--bootstraptest/test_massign.rb183
-rw-r--r--bootstraptest/test_method.rb1192
-rw-r--r--bootstraptest/test_objectspace.rb55
-rw-r--r--bootstraptest/test_proc.rb483
-rw-r--r--bootstraptest/test_string.rb3
-rw-r--r--bootstraptest/test_struct.rb5
-rw-r--r--bootstraptest/test_syntax.rb904
-rw-r--r--bootstraptest/test_thread.rb485
-rw-r--r--builtin.c69
-rw-r--r--builtin.h78
-rw-r--r--ccan/build_assert/build_assert.h40
-rw-r--r--ccan/check_type/check_type.h63
-rw-r--r--ccan/container_of/container_of.h142
-rw-r--r--ccan/licenses/BSD-MIT17
-rw-r--r--ccan/licenses/CC028
-rw-r--r--ccan/list/list.h788
-rw-r--r--ccan/str/str.h16
-rw-r--r--class.c2261
-rw-r--r--common.mk3390
-rw-r--r--compar.c288
-rw-r--r--compile.c11640
-rw-r--r--complex.c2449
-rw-r--r--config.guess1459
-rw-r--r--config.sub1537
-rw-r--r--configure.ac4089
-rw-r--r--configure.in1645
-rw-r--r--constant.h50
-rw-r--r--cont.c2468
-rw-r--r--coroutine/amd64/Context.S46
-rw-r--r--coroutine/amd64/Context.h52
-rw-r--r--coroutine/arm32/Context.S22
-rw-r--r--coroutine/arm32/Context.h51
-rw-r--r--coroutine/arm64/Context.S59
-rw-r--r--coroutine/arm64/Context.h50
-rw-r--r--coroutine/copy/Context.c141
-rw-r--r--coroutine/copy/Context.h86
-rw-r--r--coroutine/ppc64le/Context.S72
-rw-r--r--coroutine/ppc64le/Context.h49
-rw-r--r--coroutine/ucontext/Context.c22
-rw-r--r--coroutine/ucontext/Context.h70
-rw-r--r--coroutine/win32/Context.S47
-rw-r--r--coroutine/win32/Context.asm55
-rw-r--r--coroutine/win32/Context.h57
-rw-r--r--coroutine/win64/Context.S77
-rw-r--r--coroutine/win64/Context.asm79
-rw-r--r--coroutine/win64/Context.h67
-rw-r--r--coroutine/x86/Context.S42
-rw-r--r--coroutine/x86/Context.h53
-rw-r--r--coverage/README17
-rw-r--r--cygwin/GNUmakefile.in66
-rw-r--r--debug.c229
-rw-r--r--debug_counter.c135
-rw-r--r--debug_counter.h390
-rw-r--r--defines.h273
-rw-r--r--defs/gmake.mk350
-rw-r--r--defs/id.def206
-rw-r--r--defs/keywords53
-rw-r--r--defs/known_errors.def157
-rw-r--r--defs/lex.c.src53
-rw-r--r--defs/opt_insn_unif.def27
-rw-r--r--defs/opt_operand.def22
-rw-r--r--defs/separated_version.mk38
-rw-r--r--defs/universal.mk5
-rw-r--r--dir.c3554
-rw-r--r--distruby.rb59
-rw-r--r--djgpp/GNUmakefile.in2
-rw-r--r--djgpp/README.djgpp21
-rw-r--r--djgpp/config.hin114
-rw-r--r--djgpp/config.sed128
-rwxr-xr-xdjgpp/configure.bat20
-rw-r--r--djgpp/mkver.sed1
-rw-r--r--dln.c926
-rw-r--r--dln.h23
-rw-r--r--dln_find.c290
-rw-r--r--dmydln.c12
-rw-r--r--dmyenc.c10
-rw-r--r--dmyext.c2
-rw-r--r--doc/.document3
-rw-r--r--doc/ChangeLog-0.06_to_0.521147
-rw-r--r--doc/ChangeLog-0.50_to_0.60462
-rw-r--r--doc/ChangeLog-0.60_to_1.13955
-rw-r--r--doc/ChangeLog-1.8.0167
-rw-r--r--doc/ChangeLog-1.9.392772
-rw-r--r--doc/ChangeLog-2.0.024015
-rw-r--r--doc/ChangeLog-2.1.018060
-rw-r--r--doc/ChangeLog-2.2.012157
-rw-r--r--doc/ChangeLog-2.3.012187
-rw-r--r--doc/ChangeLog-2.4.09492
-rw-r--r--doc/ChangeLog-YARV6917
-rw-r--r--doc/NEWS837
-rw-r--r--doc/NEWS-1.8.7669
-rw-r--r--doc/NEWS-1.9.1429
-rw-r--r--doc/NEWS-1.9.2509
-rw-r--r--doc/NEWS-1.9.3341
-rw-r--r--doc/NEWS-2.0.0530
-rw-r--r--doc/NEWS-2.1.0376
-rw-r--r--doc/NEWS-2.2.0361
-rw-r--r--doc/NEWS-2.3.0404
-rw-r--r--doc/NEWS-2.4.0397
-rw-r--r--doc/NEWS-2.5.0565
-rw-r--r--doc/NEWS-2.6.0662
-rw-r--r--doc/bug_triaging.rdoc79
-rw-r--r--doc/contributing.rdoc447
-rw-r--r--doc/contributors.rdoc793
-rw-r--r--doc/dtrace_probes.rdoc178
-rw-r--r--doc/extension.ja.rdoc1834
-rw-r--r--doc/extension.rdoc2105
-rw-r--r--doc/forwardable.rd84
-rw-r--r--doc/forwardable.rd.ja49
-rw-r--r--doc/globals.rdoc72
-rw-r--r--doc/images/boottime-classes.pngbin0 -> 28677 bytes-rw-r--r--doc/irb/irb-tools.rd.ja119
-rw-r--r--doc/irb/irb.rd392
-rw-r--r--doc/irb/irb.rd.ja405
-rw-r--r--doc/keywords.rdoc160
-rw-r--r--doc/maintainers.rdoc359
-rw-r--r--doc/marshal.rdoc313
-rw-r--r--doc/pty/README.expect.ja21
-rw-r--r--doc/pty/README.ja76
-rw-r--r--doc/regexp.rdoc724
-rw-r--r--doc/security.rdoc139
-rw-r--r--doc/shell.rd348
-rw-r--r--doc/shell.rd.ja336
-rw-r--r--doc/signals.rdoc106
-rw-r--r--doc/standard_library.rdoc121
-rw-r--r--doc/syntax.rdoc36
-rw-r--r--doc/syntax/assignment.rdoc477
-rw-r--r--doc/syntax/calling_methods.rdoc377
-rw-r--r--doc/syntax/comments.rdoc37
-rw-r--r--doc/syntax/control_expressions.rdoc557
-rw-r--r--doc/syntax/exceptions.rdoc102
-rw-r--r--doc/syntax/literals.rdoc400
-rw-r--r--doc/syntax/methods.rdoc600
-rw-r--r--doc/syntax/miscellaneous.rdoc106
-rw-r--r--doc/syntax/modules_and_classes.rdoc376
-rw-r--r--doc/syntax/precedence.rdoc64
-rw-r--r--doc/syntax/refinements.rdoc283
-rw-r--r--doc/yarvarch.en7
-rw-r--r--doc/yarvarch.ja454
-rw-r--r--enc/Makefile.in84
-rw-r--r--enc/ascii.c104
-rw-r--r--enc/big5.c376
-rw-r--r--enc/cesu_8.c454
-rw-r--r--enc/cp949.c222
-rw-r--r--enc/depend722
-rw-r--r--enc/ebcdic.h11
-rw-r--r--enc/emacs_mule.c342
-rw-r--r--enc/encdb.c26
-rw-r--r--enc/encinit.c.erb37
-rw-r--r--enc/euc_jp.c616
-rw-r--r--enc/euc_kr.c220
-rw-r--r--enc/euc_tw.c228
-rw-r--r--enc/gb18030.c603
-rw-r--r--enc/gb2312.c11
-rw-r--r--enc/gbk.c225
-rw-r--r--enc/iso_2022_jp.h47
-rw-r--r--enc/iso_8859.h1
-rw-r--r--enc/iso_8859_1.c322
-rw-r--r--enc/iso_8859_10.c294
-rw-r--r--enc/iso_8859_11.c114
-rw-r--r--enc/iso_8859_13.c289
-rw-r--r--enc/iso_8859_14.c305
-rw-r--r--enc/iso_8859_15.c296
-rw-r--r--enc/iso_8859_16.c300
-rw-r--r--enc/iso_8859_2.c291
-rw-r--r--enc/iso_8859_3.c301
-rw-r--r--enc/iso_8859_4.c297
-rw-r--r--enc/iso_8859_5.c265
-rw-r--r--enc/iso_8859_6.c110
-rw-r--r--enc/iso_8859_7.c284
-rw-r--r--enc/iso_8859_8.c110
-rw-r--r--enc/iso_8859_9.c290
-rw-r--r--enc/jis/props.h.blt217
-rw-r--r--enc/jis/props.kwd52
-rw-r--r--enc/jis/props.src52
-rw-r--r--enc/koi8_r.c221
-rw-r--r--enc/koi8_u.c224
-rwxr-xr-xenc/make_encmake.rb159
-rw-r--r--enc/mktable.c1184
-rw-r--r--enc/shift_jis.c67
-rw-r--r--enc/shift_jis.h546
-rw-r--r--enc/trans/CP/CP932UDA%UCS.src1912
-rw-r--r--enc/trans/CP/CP932VDC@IBM%UCS.src420
-rw-r--r--enc/trans/CP/CP932VDC@NEC_IBM%UCS.src406
-rw-r--r--enc/trans/CP/UCS%CP932UDA.src1912
-rw-r--r--enc/trans/CP/UCS%CP932VDC@IBM.src420
-rw-r--r--enc/trans/CP/UCS%CP932VDC@NEC_IBM.src406
-rw-r--r--enc/trans/EMOJI/EMOJI_ISO-2022-JP-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-DOCOMO%UCS.src293
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI-UNDOC%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-SOFTBANK%UCS.src496
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-DOCOMO.src293
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-SOFTBANK.src496
-rw-r--r--enc/trans/GB/GB12345%UCS.src7567
-rw-r--r--enc/trans/GB/GB2312%UCS.src7470
-rw-r--r--enc/trans/GB/UCS%GB12345.src7569
-rw-r--r--enc/trans/GB/UCS%GB2312.src7466
-rw-r--r--enc/trans/JIS/JISX0201-KANA%UCS.src124
-rw-r--r--enc/trans/JIS/JISX0208@1990%UCS.src6964
-rw-r--r--enc/trans/JIS/JISX0208@MS%UCS.src6893
-rw-r--r--enc/trans/JIS/JISX0208UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0208VDC@NEC%UCS.src97
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src6159
-rw-r--r--enc/trans/JIS/JISX0212@MS%UCS.src6081
-rw-r--r--enc/trans/JIS/JISX0212UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0212VDC@IBM%UCS.src120
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@BMP.src1926
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@SIP.src60
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@BMP.src2193
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@SIP.src311
-rw-r--r--enc/trans/JIS/UCS%JISX0201-KANA.src125
-rw-r--r--enc/trans/JIS/UCS%JISX0208@1990.src6965
-rw-r--r--enc/trans/JIS/UCS%JISX0208@MS.src6894
-rw-r--r--enc/trans/JIS/UCS%JISX0208UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0208VDC@NEC.src98
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src6163
-rw-r--r--enc/trans/JIS/UCS%JISX0212@MS.src6082
-rw-r--r--enc/trans/JIS/UCS%JISX0212UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0212VDC@IBM.src121
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-1.src1922
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-2.src2189
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-1.src56
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-2.src307
-rw-r--r--enc/trans/big5-hkscs-tbl.rb37302
-rw-r--r--enc/trans/big5-uao-tbl.rb19784
-rw-r--r--enc/trans/big5.trans32
-rw-r--r--enc/trans/cesu_8.trans85
-rw-r--r--enc/trans/chinese.trans31
-rw-r--r--enc/trans/cp850-tbl.rb130
-rw-r--r--enc/trans/cp852-tbl.rb130
-rw-r--r--enc/trans/cp855-tbl.rb130
-rw-r--r--enc/trans/cp949-tbl.rb8831
-rw-r--r--enc/trans/ebcdic.trans278
-rw-r--r--enc/trans/emoji-exchange-tbl.rb8407
-rw-r--r--enc/trans/emoji.trans36
-rw-r--r--enc/trans/emoji_iso2022_kddi.trans216
-rw-r--r--enc/trans/emoji_sjis_docomo.trans32
-rw-r--r--enc/trans/emoji_sjis_kddi.trans33
-rw-r--r--enc/trans/emoji_sjis_softbank.trans32
-rw-r--r--enc/trans/escape.trans93
-rw-r--r--enc/trans/euckr-tbl.rb8230
-rw-r--r--enc/trans/gb18030-tbl.rb63362
-rw-r--r--enc/trans/gb18030.trans183
-rw-r--r--enc/trans/gbk-tbl.rb21794
-rw-r--r--enc/trans/gbk.trans15
-rw-r--r--enc/trans/ibm437-tbl.rb130
-rw-r--r--enc/trans/ibm737-tbl.rb130
-rw-r--r--enc/trans/ibm775-tbl.rb130
-rw-r--r--enc/trans/ibm852-tbl.rb130
-rw-r--r--enc/trans/ibm855-tbl.rb130
-rw-r--r--enc/trans/ibm857-tbl.rb127
-rw-r--r--enc/trans/ibm860-tbl.rb130
-rw-r--r--enc/trans/ibm861-tbl.rb130
-rw-r--r--enc/trans/ibm862-tbl.rb130
-rw-r--r--enc/trans/ibm863-tbl.rb130
-rw-r--r--enc/trans/ibm865-tbl.rb130
-rw-r--r--enc/trans/ibm866-tbl.rb130
-rw-r--r--enc/trans/ibm869-tbl.rb121
-rw-r--r--enc/trans/iso-8859-1-tbl.rb98
-rw-r--r--enc/trans/iso-8859-10-tbl.rb98
-rw-r--r--enc/trans/iso-8859-11-tbl.rb90
-rw-r--r--enc/trans/iso-8859-13-tbl.rb98
-rw-r--r--enc/trans/iso-8859-14-tbl.rb98
-rw-r--r--enc/trans/iso-8859-15-tbl.rb98
-rw-r--r--enc/trans/iso-8859-16-tbl.rb98
-rw-r--r--enc/trans/iso-8859-2-tbl.rb98
-rw-r--r--enc/trans/iso-8859-3-tbl.rb91
-rw-r--r--enc/trans/iso-8859-4-tbl.rb98
-rw-r--r--enc/trans/iso-8859-5-tbl.rb98
-rw-r--r--enc/trans/iso-8859-6-tbl.rb53
-rw-r--r--enc/trans/iso-8859-7-tbl.rb95
-rw-r--r--enc/trans/iso-8859-8-tbl.rb62
-rw-r--r--enc/trans/iso-8859-9-tbl.rb98
-rw-r--r--enc/trans/iso2022.trans567
-rw-r--r--enc/trans/japanese.trans97
-rw-r--r--enc/trans/japanese_euc.trans57
-rw-r--r--enc/trans/japanese_sjis.trans33
-rw-r--r--enc/trans/koi8-r-tbl.rb130
-rw-r--r--enc/trans/koi8-u-tbl.rb130
-rw-r--r--enc/trans/korean.trans18
-rw-r--r--enc/trans/maccroatian-tbl.rb129
-rw-r--r--enc/trans/maccyrillic-tbl.rb130
-rw-r--r--enc/trans/macgreek-tbl.rb129
-rw-r--r--enc/trans/maciceland-tbl.rb129
-rw-r--r--enc/trans/macroman-tbl.rb129
-rw-r--r--enc/trans/macromania-tbl.rb129
-rw-r--r--enc/trans/macturkish-tbl.rb128
-rw-r--r--enc/trans/macukraine-tbl.rb130
-rw-r--r--enc/trans/newline.trans135
-rw-r--r--enc/trans/single_byte.trans88
-rw-r--r--enc/trans/tis-620-tbl.rb89
-rw-r--r--enc/trans/transdb.c18
-rw-r--r--enc/trans/ucm/glibc-BIG5-2.3.3.ucm14087
-rw-r--r--enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm18332
-rw-r--r--enc/trans/ucm/windows-950-2000.ucm20379
-rw-r--r--enc/trans/ucm/windows-950_hkscs-2001.ucm23446
-rw-r--r--enc/trans/utf8_mac-tbl.rb23154
-rw-r--r--enc/trans/utf8_mac.trans256
-rw-r--r--enc/trans/utf_16_32.trans556
-rw-r--r--enc/trans/windows-1250-tbl.rb125
-rw-r--r--enc/trans/windows-1251-tbl.rb129
-rw-r--r--enc/trans/windows-1252-tbl.rb125
-rw-r--r--enc/trans/windows-1253-tbl.rb113
-rw-r--r--enc/trans/windows-1254-tbl.rb123
-rw-r--r--enc/trans/windows-1255-tbl.rb142
-rw-r--r--enc/trans/windows-1256-tbl.rb130
-rw-r--r--enc/trans/windows-1257-tbl.rb118
-rw-r--r--enc/trans/windows-874-tbl.rb99
-rw-r--r--enc/unicode.c816
-rw-r--r--enc/unicode/12.1.0/casefold.h7428
-rw-r--r--enc/unicode/12.1.0/name2ctype.h41810
-rwxr-xr-xenc/unicode/case-folding.rb418
-rw-r--r--enc/us_ascii.c41
-rw-r--r--enc/utf_16_32.h5
-rw-r--r--enc/utf_16be.c256
-rw-r--r--enc/utf_16le.c248
-rw-r--r--enc/utf_32be.c206
-rw-r--r--enc/utf_32le.c206
-rw-r--r--enc/utf_7.h5
-rw-r--r--enc/utf_8.c449
-rw-r--r--enc/windows_1250.c271
-rw-r--r--enc/windows_1251.c253
-rw-r--r--enc/windows_1252.c260
-rw-r--r--enc/windows_1253.c297
-rw-r--r--enc/windows_1254.c302
-rw-r--r--enc/windows_1257.c304
-rw-r--r--enc/windows_31j.c81
-rw-r--r--enc/x_emoji.h26
-rw-r--r--encindex.h69
-rw-r--r--encoding.c1975
-rw-r--r--enum.c4260
-rw-r--r--enumerator.c4110
-rw-r--r--env.h60
-rw-r--r--error.c3375
-rw-r--r--eval.c13688
-rw-r--r--eval_error.c491
-rw-r--r--eval_intern.h312
-rw-r--r--eval_jump.c138
-rw-r--r--ext/-test-/arith_seq/extract/depend13
-rw-r--r--ext/-test-/arith_seq/extract/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/extract.c27
-rw-r--r--ext/-test-/array/resize/depend13
-rw-r--r--ext/-test-/array/resize/extconf.rb2
-rw-r--r--ext/-test-/array/resize/resize.c14
-rw-r--r--ext/-test-/auto_ext.rb10
-rw-r--r--ext/-test-/bignum/big2str.c53
-rw-r--r--ext/-test-/bignum/bigzero.c26
-rw-r--r--ext/-test-/bignum/depend92
-rw-r--r--ext/-test-/bignum/div.c35
-rw-r--r--ext/-test-/bignum/extconf.rb3
-rw-r--r--ext/-test-/bignum/init.c11
-rw-r--r--ext/-test-/bignum/intpack.c87
-rw-r--r--ext/-test-/bignum/mul.c65
-rw-r--r--ext/-test-/bignum/str2big.c38
-rw-r--r--ext/-test-/bug-14834/bug-14384.c39
-rw-r--r--ext/-test-/bug-14834/depend14
-rw-r--r--ext/-test-/bug-14834/extconf.rb2
-rw-r--r--ext/-test-/bug-3571/bug.c23
-rw-r--r--ext/-test-/bug-3571/depend14
-rw-r--r--ext/-test-/bug-3571/extconf.rb2
-rw-r--r--ext/-test-/bug-5832/bug.c14
-rw-r--r--ext/-test-/bug-5832/depend14
-rw-r--r--ext/-test-/bug-5832/extconf.rb2
-rw-r--r--ext/-test-/bug_reporter/bug_reporter.c24
-rw-r--r--ext/-test-/bug_reporter/depend14
-rw-r--r--ext/-test-/bug_reporter/extconf.rb2
-rw-r--r--ext/-test-/class/class2name.c14
-rw-r--r--ext/-test-/class/depend25
-rw-r--r--ext/-test-/class/extconf.rb3
-rw-r--r--ext/-test-/class/init.c11
-rw-r--r--ext/-test-/cxxanyargs/cxxanyargs.cpp619
-rw-r--r--ext/-test-/cxxanyargs/depend25
-rw-r--r--ext/-test-/cxxanyargs/extconf.rb31
-rw-r--r--ext/-test-/cxxanyargs/failure.cpp13
-rw-r--r--ext/-test-/cxxanyargs/failurem1.cpp13
-rw-r--r--ext/-test-/debug/depend38
-rw-r--r--ext/-test-/debug/extconf.rb3
-rw-r--r--ext/-test-/debug/init.c11
-rw-r--r--ext/-test-/debug/inspector.c32
-rw-r--r--ext/-test-/debug/profile_frames.c43
-rw-r--r--ext/-test-/dln/empty/depend3
-rw-r--r--ext/-test-/dln/empty/empty.c4
-rw-r--r--ext/-test-/dln/empty/extconf.rb2
-rw-r--r--ext/-test-/enumerator_kw/depend14
-rw-r--r--ext/-test-/enumerator_kw/enumerator_kw.c21
-rw-r--r--ext/-test-/enumerator_kw/extconf.rb1
-rw-r--r--ext/-test-/exception/dataerror.c31
-rw-r--r--ext/-test-/exception/depend52
-rw-r--r--ext/-test-/exception/enc_raise.c15
-rw-r--r--ext/-test-/exception/ensured.c39
-rw-r--r--ext/-test-/exception/extconf.rb3
-rw-r--r--ext/-test-/exception/init.c11
-rw-r--r--ext/-test-/fatal/depend14
-rw-r--r--ext/-test-/fatal/extconf.rb2
-rw-r--r--ext/-test-/fatal/rb_fatal.c19
-rw-r--r--ext/-test-/file/depend44
-rw-r--r--ext/-test-/file/extconf.rb18
-rw-r--r--ext/-test-/file/fs.c111
-rw-r--r--ext/-test-/file/init.c11
-rw-r--r--ext/-test-/file/stat.c27
-rw-r--r--ext/-test-/float/depend30
-rw-r--r--ext/-test-/float/extconf.rb3
-rw-r--r--ext/-test-/float/init.c11
-rw-r--r--ext/-test-/float/nextafter.c36
-rw-r--r--ext/-test-/funcall/depend14
-rw-r--r--ext/-test-/funcall/extconf.rb3
-rw-r--r--ext/-test-/funcall/funcall.c72
-rw-r--r--ext/-test-/gvl/call_without_gvl/call_without_gvl.c76
-rw-r--r--ext/-test-/gvl/call_without_gvl/depend14
-rw-r--r--ext/-test-/gvl/call_without_gvl/extconf.rb2
-rw-r--r--ext/-test-/hash/delete.c16
-rw-r--r--ext/-test-/hash/depend26
-rw-r--r--ext/-test-/hash/extconf.rb3
-rw-r--r--ext/-test-/hash/init.c11
-rw-r--r--ext/-test-/integer/core_ext.c36
-rw-r--r--ext/-test-/integer/depend39
-rw-r--r--ext/-test-/integer/extconf.rb3
-rw-r--r--ext/-test-/integer/init.c11
-rw-r--r--ext/-test-/integer/my_integer.c16
-rw-r--r--ext/-test-/iseq_load/depend14
-rw-r--r--ext/-test-/iseq_load/extconf.rb2
-rw-r--r--ext/-test-/iseq_load/iseq_load.c21
-rw-r--r--ext/-test-/iter/break.c25
-rw-r--r--ext/-test-/iter/depend38
-rw-r--r--ext/-test-/iter/extconf.rb3
-rw-r--r--ext/-test-/iter/init.c11
-rw-r--r--ext/-test-/iter/yield.c16
-rw-r--r--ext/-test-/load/dot.dot/depend3
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c1
-rw-r--r--ext/-test-/load/dot.dot/extconf.rb2
-rw-r--r--ext/-test-/load/protect/depend14
-rw-r--r--ext/-test-/load/protect/extconf.rb1
-rw-r--r--ext/-test-/load/protect/protect.c19
-rw-r--r--ext/-test-/marshal/compat/depend14
-rw-r--r--ext/-test-/marshal/compat/extconf.rb2
-rw-r--r--ext/-test-/marshal/compat/usrcompat.c32
-rw-r--r--ext/-test-/marshal/internal_ivar/depend14
-rw-r--r--ext/-test-/marshal/internal_ivar/extconf.rb2
-rw-r--r--ext/-test-/marshal/internal_ivar/internal_ivar.c48
-rw-r--r--ext/-test-/marshal/usr/depend14
-rw-r--r--ext/-test-/marshal/usr/extconf.rb2
-rw-r--r--ext/-test-/marshal/usr/usrmarshal.c50
-rw-r--r--ext/-test-/memory_status/depend14
-rw-r--r--ext/-test-/memory_status/extconf.rb12
-rw-r--r--ext/-test-/memory_status/memory_status.c69
-rw-r--r--ext/-test-/method/arity.c22
-rw-r--r--ext/-test-/method/depend26
-rw-r--r--ext/-test-/method/extconf.rb3
-rw-r--r--ext/-test-/method/init.c11
-rw-r--r--ext/-test-/notimplement/bug.c18
-rw-r--r--ext/-test-/notimplement/depend14
-rw-r--r--ext/-test-/notimplement/extconf.rb2
-rw-r--r--ext/-test-/num2int/depend14
-rw-r--r--ext/-test-/num2int/extconf.rb2
-rw-r--r--ext/-test-/num2int/num2int.c136
-rw-r--r--ext/-test-/path_to_class/depend14
-rw-r--r--ext/-test-/path_to_class/extconf.rb7
-rw-r--r--ext/-test-/path_to_class/path_to_class.c15
-rw-r--r--ext/-test-/popen_deadlock/depend14
-rw-r--r--ext/-test-/popen_deadlock/extconf.rb5
-rw-r--r--ext/-test-/popen_deadlock/infinite_loop_dlsym.c50
-rw-r--r--ext/-test-/postponed_job/depend15
-rw-r--r--ext/-test-/postponed_job/extconf.rb2
-rw-r--r--ext/-test-/postponed_job/postponed_job.c69
-rw-r--r--ext/-test-/printf/depend17
-rw-r--r--ext/-test-/printf/extconf.rb2
-rw-r--r--ext/-test-/printf/printf.c109
-rw-r--r--ext/-test-/proc/depend38
-rw-r--r--ext/-test-/proc/extconf.rb3
-rw-r--r--ext/-test-/proc/init.c11
-rw-r--r--ext/-test-/proc/receiver.c21
-rw-r--r--ext/-test-/proc/super.c27
-rw-r--r--ext/-test-/rational/depend19
-rw-r--r--ext/-test-/rational/extconf.rb8
-rw-r--r--ext/-test-/rational/rat.c37
-rw-r--r--ext/-test-/rb_call_super_kw/depend14
-rw-r--r--ext/-test-/rb_call_super_kw/extconf.rb1
-rw-r--r--ext/-test-/rb_call_super_kw/rb_call_super_kw.c14
-rw-r--r--ext/-test-/recursion/depend14
-rw-r--r--ext/-test-/recursion/extconf.rb3
-rw-r--r--ext/-test-/recursion/recursion.c28
-rw-r--r--ext/-test-/regexp/depend27
-rw-r--r--ext/-test-/regexp/extconf.rb3
-rw-r--r--ext/-test-/regexp/init.c11
-rw-r--r--ext/-test-/regexp/parse_depth_limit.c23
-rw-r--r--ext/-test-/scan_args/depend14
-rw-r--r--ext/-test-/scan_args/extconf.rb1
-rw-r--r--ext/-test-/scan_args/scan_args.c315
-rw-r--r--ext/-test-/st/foreach/depend14
-rw-r--r--ext/-test-/st/foreach/extconf.rb2
-rw-r--r--ext/-test-/st/foreach/foreach.c175
-rw-r--r--ext/-test-/st/numhash/depend14
-rw-r--r--ext/-test-/st/numhash/extconf.rb2
-rw-r--r--ext/-test-/st/numhash/numhash.c137
-rw-r--r--ext/-test-/st/update/depend14
-rw-r--r--ext/-test-/st/update/extconf.rb2
-rw-r--r--ext/-test-/st/update/update.c34
-rw-r--r--ext/-test-/string/capacity.c17
-rw-r--r--ext/-test-/string/coderange.c47
-rw-r--r--ext/-test-/string/cstr.c147
-rw-r--r--ext/-test-/string/depend202
-rw-r--r--ext/-test-/string/ellipsize.c13
-rw-r--r--ext/-test-/string/enc_associate.c22
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c14
-rw-r--r--ext/-test-/string/extconf.rb3
-rw-r--r--ext/-test-/string/fstring.c15
-rw-r--r--ext/-test-/string/init.c11
-rw-r--r--ext/-test-/string/modify.c22
-rw-r--r--ext/-test-/string/new.c21
-rw-r--r--ext/-test-/string/nofree.c13
-rw-r--r--ext/-test-/string/normalize.c17
-rw-r--r--ext/-test-/string/qsort.c61
-rw-r--r--ext/-test-/string/rb_str_dup.c35
-rw-r--r--ext/-test-/string/set_len.c14
-rw-r--r--ext/-test-/struct/depend50
-rw-r--r--ext/-test-/struct/duplicate.c24
-rw-r--r--ext/-test-/struct/extconf.rb3
-rw-r--r--ext/-test-/struct/init.c11
-rw-r--r--ext/-test-/struct/len.c13
-rw-r--r--ext/-test-/struct/member.c18
-rw-r--r--ext/-test-/symbol/depend26
-rw-r--r--ext/-test-/symbol/extconf.rb4
-rw-r--r--ext/-test-/symbol/init.c39
-rw-r--r--ext/-test-/symbol/type.c78
-rw-r--r--ext/-test-/thread_fd_close/depend13
-rw-r--r--ext/-test-/thread_fd_close/extconf.rb2
-rw-r--r--ext/-test-/thread_fd_close/thread_fd_close.c14
-rw-r--r--ext/-test-/time/depend38
-rw-r--r--ext/-test-/time/extconf.rb3
-rw-r--r--ext/-test-/time/init.c11
-rw-r--r--ext/-test-/time/leap_second.c15
-rw-r--r--ext/-test-/time/new.c34
-rw-r--r--ext/-test-/tracepoint/depend26
-rw-r--r--ext/-test-/tracepoint/extconf.rb2
-rw-r--r--ext/-test-/tracepoint/gc_hook.c80
-rw-r--r--ext/-test-/tracepoint/tracepoint.c96
-rw-r--r--ext/-test-/typeddata/depend14
-rw-r--r--ext/-test-/typeddata/extconf.rb2
-rw-r--r--ext/-test-/typeddata/typeddata.c44
-rw-r--r--ext/-test-/vm/at_exit.c44
-rw-r--r--ext/-test-/vm/depend14
-rw-r--r--ext/-test-/vm/extconf.rb1
-rw-r--r--ext/-test-/wait_for_single_fd/depend17
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb4
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c94
-rw-r--r--ext/-test-/win32/console/attribute.c69
-rw-r--r--ext/-test-/win32/console/depend1
-rw-r--r--ext/-test-/win32/console/extconf.rb5
-rw-r--r--ext/-test-/win32/console/init.c11
-rw-r--r--ext/-test-/win32/dln/depend9
-rw-r--r--ext/-test-/win32/dln/dlntest.c17
-rw-r--r--ext/-test-/win32/dln/extconf.rb33
-rw-r--r--ext/-test-/win32/dln/libdlntest.c4
-rw-r--r--ext/-test-/win32/dln/libdlntest.def2
-rw-r--r--ext/-test-/win32/fd_setsize/depend1
-rw-r--r--ext/-test-/win32/fd_setsize/extconf.rb4
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c55
-rw-r--r--ext/.cvsignore2
-rw-r--r--ext/.document90
-rw-r--r--ext/Setup28
-rw-r--r--ext/Setup.atheos10
-rw-r--r--ext/Setup.dj33
-rw-r--r--ext/Setup.emx33
-rw-r--r--ext/Setup.nt11
-rw-r--r--ext/Setup.x6833
-rw-r--r--ext/Win32API/.cvsignore3
-rw-r--r--ext/Win32API/Win32API.c215
-rw-r--r--ext/Win32API/depend1
-rw-r--r--ext/Win32API/extconf.rb6
-rw-r--r--ext/Win32API/getch.rb5
-rw-r--r--ext/Win32API/lib/win32/registry.rb831
-rw-r--r--ext/Win32API/lib/win32/resolv.rb366
-rw-r--r--ext/Win32API/point.rb18
-rw-r--r--ext/bigdecimal/.cvsignore3
-rw-r--r--ext/bigdecimal/README60
-rw-r--r--ext/bigdecimal/bigdecimal.c7481
-rw-r--r--ext/bigdecimal/bigdecimal.def2
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec39
-rw-r--r--ext/bigdecimal/bigdecimal.h314
-rw-r--r--ext/bigdecimal/bigdecimal_en.html797
-rw-r--r--ext/bigdecimal/bigdecimal_ja.html798
-rw-r--r--ext/bigdecimal/depend18
-rw-r--r--ext/bigdecimal/extconf.rb56
-rw-r--r--ext/bigdecimal/lib/bigdecimal.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb41
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb45
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb177
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb17
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb169
-rw-r--r--ext/bigdecimal/sample/linear.rb27
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb24
-rw-r--r--ext/bigdecimal/sample/pi.rb1
-rw-r--r--ext/bigdecimal/util/depend14
-rw-r--r--ext/cgi/escape/depend17
-rw-r--r--ext/cgi/escape/escape.c407
-rw-r--r--ext/cgi/escape/extconf.rb3
-rw-r--r--ext/continuation/continuation.c13
-rw-r--r--ext/continuation/depend13
-rw-r--r--ext/continuation/extconf.rb4
-rw-r--r--ext/coverage/coverage.c341
-rw-r--r--ext/coverage/depend29
-rw-r--r--ext/coverage/extconf.rb5
-rw-r--r--ext/coverage/lib/coverage.rb14
-rw-r--r--ext/curses/.cvsignore3
-rw-r--r--ext/curses/curses.c2102
-rw-r--r--ext/curses/depend1
-rw-r--r--ext/curses/extconf.rb31
-rw-r--r--ext/curses/hello.rb30
-rw-r--r--ext/curses/mouse.rb53
-rw-r--r--ext/curses/rain.rb76
-rw-r--r--ext/curses/view.rb91
-rw-r--r--ext/curses/view2.rb115
-rw-r--r--ext/date/date.gemspec21
-rw-r--r--ext/date/date_core.c9742
-rw-r--r--ext/date/date_parse.c3035
-rw-r--r--ext/date/date_strftime.c638
-rw-r--r--ext/date/date_strptime.c702
-rw-r--r--ext/date/date_tmx.h56
-rw-r--r--ext/date/depend67
-rw-r--r--ext/date/extconf.rb9
-rw-r--r--ext/date/lib/date.rb65
-rw-r--r--ext/date/prereq.mk12
-rw-r--r--ext/date/update-abbr35
-rw-r--r--ext/date/zonetab.h1562
-rw-r--r--ext/date/zonetab.list327
-rw-r--r--ext/dbm/.cvsignore3
-rw-r--r--ext/dbm/dbm.c810
-rw-r--r--ext/dbm/dbm.gemspec20
-rw-r--r--ext/dbm/depend15
-rw-r--r--ext/dbm/extconf.rb303
-rw-r--r--ext/digest/.cvsignore3
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c147
-rw-r--r--ext/digest/bubblebabble/depend15
-rw-r--r--ext/digest/bubblebabble/extconf.rb6
-rw-r--r--ext/digest/defs.h20
-rw-r--r--ext/digest/depend17
-rw-r--r--ext/digest/digest.c887
-rw-r--r--ext/digest/digest.h62
-rw-r--r--ext/digest/digest.txt113
-rw-r--r--ext/digest/digest.txt.ja111
-rw-r--r--ext/digest/digest_conf.rb84
-rw-r--r--ext/digest/extconf.rb7
-rw-r--r--ext/digest/lib/digest.rb109
-rw-r--r--ext/digest/lib/md5.rb14
-rw-r--r--ext/digest/lib/sha1.rb14
-rw-r--r--ext/digest/md5/.cvsignore3
-rw-r--r--ext/digest/md5/depend25
-rw-r--r--ext/digest/md5/extconf.rb20
-rw-r--r--ext/digest/md5/md5.c42
-rw-r--r--ext/digest/md5/md5.h15
-rw-r--r--ext/digest/md5/md5cc.h19
-rw-r--r--ext/digest/md5/md5init.c61
-rw-r--r--ext/digest/md5/md5ossl.c30
-rw-r--r--ext/digest/md5/md5ossl.h9
-rw-r--r--ext/digest/rmd160/.cvsignore3
-rw-r--r--ext/digest/rmd160/depend27
-rw-r--r--ext/digest/rmd160/extconf.rb19
-rw-r--r--ext/digest/rmd160/rmd160.c27
-rw-r--r--ext/digest/rmd160/rmd160.h24
-rw-r--r--ext/digest/rmd160/rmd160hl.c96
-rw-r--r--ext/digest/rmd160/rmd160init.c62
-rw-r--r--ext/digest/rmd160/rmd160ossl.c45
-rw-r--r--ext/digest/rmd160/rmd160ossl.h7
-rw-r--r--ext/digest/sha1/.cvsignore3
-rw-r--r--ext/digest/sha1/depend27
-rw-r--r--ext/digest/sha1/extconf.rb19
-rw-r--r--ext/digest/sha1/sha1.c26
-rw-r--r--ext/digest/sha1/sha1.h27
-rw-r--r--ext/digest/sha1/sha1cc.h14
-rw-r--r--ext/digest/sha1/sha1hl.c102
-rw-r--r--ext/digest/sha1/sha1init.c66
-rw-r--r--ext/digest/sha1/sha1ossl.c45
-rw-r--r--ext/digest/sha1/sha1ossl.h11
-rw-r--r--ext/digest/sha2/.cvsignore3
-rw-r--r--ext/digest/sha2/depend26
-rw-r--r--ext/digest/sha2/extconf.rb24
-rw-r--r--ext/digest/sha2/lib/sha2.rb142
-rw-r--r--ext/digest/sha2/sha2.c318
-rw-r--r--ext/digest/sha2/sha2.h194
-rw-r--r--ext/digest/sha2/sha2cc.h31
-rw-r--r--ext/digest/sha2/sha2hl.c252
-rw-r--r--ext/digest/sha2/sha2init.c46
-rw-r--r--ext/digest/sha2/sha2ossl.h27
-rw-r--r--ext/digest/test.sh7
-rw-r--r--ext/dl/.cvsignore8
-rw-r--r--ext/dl/depend46
-rw-r--r--ext/dl/dl.c728
-rw-r--r--ext/dl/dl.def59
-rw-r--r--ext/dl/dl.h313
-rw-r--r--ext/dl/doc/dl.txt266
-rw-r--r--ext/dl/extconf.rb193
-rw-r--r--ext/dl/h2rb500
-rw-r--r--ext/dl/handle.c215
-rw-r--r--ext/dl/install.rb49
-rw-r--r--ext/dl/lib/dl/import.rb225
-rw-r--r--ext/dl/lib/dl/struct.rb149
-rw-r--r--ext/dl/lib/dl/types.rb245
-rw-r--r--ext/dl/lib/dl/win32.rb25
-rw-r--r--ext/dl/mkcall.rb62
-rw-r--r--ext/dl/mkcallback.rb56
-rw-r--r--ext/dl/mkcbtable.rb18
-rw-r--r--ext/dl/ptr.c1058
-rw-r--r--ext/dl/sample/c++sample.C35
-rw-r--r--ext/dl/sample/c++sample.rb60
-rw-r--r--ext/dl/sample/drives.rb70
-rw-r--r--ext/dl/sample/getch.rb5
-rw-r--r--ext/dl/sample/libc.rb69
-rw-r--r--ext/dl/sample/msgbox.rb19
-rw-r--r--ext/dl/sample/msgbox2.rb18
-rw-r--r--ext/dl/sample/stream.rb87
-rw-r--r--ext/dl/sym.c992
-rw-r--r--ext/dl/test/libtest.def28
-rw-r--r--ext/dl/test/test.c247
-rw-r--r--ext/dl/test/test.rb306
-rw-r--r--ext/dl/type.rb115
-rw-r--r--ext/enumerator/.cvsignore2
-rw-r--r--ext/enumerator/enumerator.c298
-rw-r--r--ext/enumerator/enumerator.txt102
-rw-r--r--ext/enumerator/extconf.rb2
-rw-r--r--ext/etc/.cvsignore3
-rw-r--r--ext/etc/depend24
-rw-r--r--ext/etc/etc.c1059
-rw-r--r--ext/etc/etc.gemspec45
-rw-r--r--ext/etc/etc.txt72
-rw-r--r--ext/etc/etc.txt.ja72
-rw-r--r--ext/etc/extconf.rb83
-rw-r--r--ext/etc/mkconstants.rb340
-rwxr-xr-x[-rw-r--r--]ext/extmk.rb623
-rw-r--r--ext/fcntl/.cvsignore3
-rw-r--r--ext/fcntl/depend15
-rw-r--r--ext/fcntl/extconf.rb1
-rw-r--r--ext/fcntl/fcntl.c194
-rw-r--r--ext/fcntl/fcntl.gemspec25
-rw-r--r--ext/fiber/depend3
-rw-r--r--ext/fiber/extconf.rb4
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c345
-rw-r--r--ext/fiddle/closure.h8
-rw-r--r--ext/fiddle/conversions.c141
-rw-r--r--ext/fiddle/conversions.h44
-rw-r--r--ext/fiddle/depend157
-rw-r--r--ext/fiddle/extconf.rb193
-rw-r--r--ext/fiddle/extlibs5
-rw-r--r--ext/fiddle/fiddle.c454
-rw-r--r--ext/fiddle/fiddle.gemspec23
-rw-r--r--ext/fiddle/fiddle.h138
-rw-r--r--ext/fiddle/function.c308
-rw-r--r--ext/fiddle/function.h8
-rw-r--r--ext/fiddle/handle.c477
-rw-r--r--ext/fiddle/lib/fiddle.rb56
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb49
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb197
-rw-r--r--ext/fiddle/lib/fiddle/function.rb18
-rw-r--r--ext/fiddle/lib/fiddle/import.rb322
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb136
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb244
-rw-r--r--ext/fiddle/lib/fiddle/types.rb72
-rw-r--r--ext/fiddle/lib/fiddle/value.rb122
-rw-r--r--ext/fiddle/pointer.c720
-rwxr-xr-xext/fiddle/win32/fficonfig.h29
-rw-r--r--ext/fiddle/win32/libffi-3.2.1-mswin.patch191
-rwxr-xr-xext/fiddle/win32/libffi-config.rb48
-rwxr-xr-xext/fiddle/win32/libffi.mk.tmpl96
-rw-r--r--ext/gdbm/.cvsignore3
-rw-r--r--ext/gdbm/depend15
-rw-r--r--ext/gdbm/extconf.rb12
-rw-r--r--ext/gdbm/gdbm.c928
-rw-r--r--ext/gdbm/gdbm.gemspec21
-rw-r--r--ext/iconv/.cvsignore5
-rw-r--r--ext/iconv/charset_alias.rb103
-rw-r--r--ext/iconv/depend2
-rw-r--r--ext/iconv/extconf.rb51
-rw-r--r--ext/iconv/iconv.c913
-rwxr-xr-xext/io/console/buildgem.sh5
-rw-r--r--ext/io/console/console.c1653
-rw-r--r--ext/io/console/depend39
-rw-r--r--ext/io/console/extconf.rb30
-rw-r--r--ext/io/console/io-console.gemspec27
-rw-r--r--ext/io/console/lib/console/size.rb23
-rw-r--r--ext/io/console/win32_vk.chksum1
-rw-r--r--ext/io/console/win32_vk.inc1391
-rw-r--r--ext/io/console/win32_vk.list166
-rw-r--r--ext/io/nonblock/depend18
-rw-r--r--ext/io/nonblock/extconf.rb9
-rw-r--r--ext/io/nonblock/nonblock.c140
-rw-r--r--ext/io/wait/.cvsignore2
-rw-r--r--ext/io/wait/depend18
-rw-r--r--ext/io/wait/extconf.rb6
-rw-r--r--ext/io/wait/lib/nonblock.rb23
-rw-r--r--ext/io/wait/wait.c249
-rw-r--r--ext/json/depend2
-rw-r--r--ext/json/extconf.rb2
-rw-r--r--ext/json/fbuffer/fbuffer.h187
-rw-r--r--ext/json/generator/depend24
-rw-r--r--ext/json/generator/extconf.rb4
-rw-r--r--ext/json/generator/generator.c1499
-rw-r--r--ext/json/generator/generator.h171
-rw-r--r--ext/json/json.gemspec133
-rw-r--r--ext/json/lib/json.rb63
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb29
-rw-r--r--ext/json/lib/json/add/complex.rb29
-rw-r--r--ext/json/lib/json/add/core.rb12
-rw-r--r--ext/json/lib/json/add/date.rb34
-rw-r--r--ext/json/lib/json/add/date_time.rb50
-rw-r--r--ext/json/lib/json/add/exception.rb31
-rw-r--r--ext/json/lib/json/add/ostruct.rb31
-rw-r--r--ext/json/lib/json/add/range.rb29
-rw-r--r--ext/json/lib/json/add/rational.rb28
-rw-r--r--ext/json/lib/json/add/regexp.rb30
-rw-r--r--ext/json/lib/json/add/set.rb29
-rw-r--r--ext/json/lib/json/add/struct.rb30
-rw-r--r--ext/json/lib/json/add/symbol.rb25
-rw-r--r--ext/json/lib/json/add/time.rb38
-rw-r--r--ext/json/lib/json/common.rb456
-rw-r--r--ext/json/lib/json/ext.rb15
-rw-r--r--ext/json/lib/json/generic_object.rb71
-rw-r--r--ext/json/lib/json/version.rb9
-rw-r--r--ext/json/parser/depend23
-rw-r--r--ext/json/parser/extconf.rb6
-rw-r--r--ext/json/parser/parser.c2136
-rw-r--r--ext/json/parser/parser.h91
-rw-r--r--ext/json/parser/parser.rl896
-rw-r--r--ext/json/parser/prereq.mk11
-rw-r--r--ext/monitor/depend13
-rw-r--r--ext/monitor/extconf.rb2
-rw-r--r--ext/monitor/lib/monitor.rb284
-rw-r--r--ext/monitor/monitor.c221
-rw-r--r--ext/nkf/.cvsignore3
-rw-r--r--ext/nkf/depend26
-rw-r--r--ext/nkf/extconf.rb1
-rw-r--r--ext/nkf/lib/kconv.rb288
-rw-r--r--ext/nkf/nkf-utf8/config.h77
-rw-r--r--ext/nkf/nkf-utf8/nkf.c9752
-rw-r--r--ext/nkf/nkf-utf8/nkf.h189
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c7358
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h38
-rw-r--r--ext/nkf/nkf.c405
-rw-r--r--ext/objspace/depend73
-rw-r--r--ext/objspace/extconf.rb4
-rw-r--r--ext/objspace/object_tracing.c500
-rw-r--r--ext/objspace/objspace.c983
-rw-r--r--ext/objspace/objspace.h20
-rw-r--r--ext/objspace/objspace_dump.c517
-rw-r--r--ext/openssl/.cvsignore5
-rw-r--r--ext/openssl/History.md339
-rw-r--r--ext/openssl/depend1185
-rw-r--r--ext/openssl/deprecation.rb27
-rw-r--r--ext/openssl/extconf.rb223
-rw-r--r--ext/openssl/lib/net/ftptls.rb53
-rw-r--r--ext/openssl/lib/net/telnets.rb251
-rw-r--r--ext/openssl/lib/openssl.rb14
-rw-r--r--ext/openssl/lib/openssl/bn.rb47
-rw-r--r--ext/openssl/lib/openssl/buffering.rb298
-rw-r--r--ext/openssl/lib/openssl/cipher.rb81
-rw-r--r--ext/openssl/lib/openssl/config.rb474
-rw-r--r--ext/openssl/lib/openssl/digest.rb94
-rw-r--r--ext/openssl/lib/openssl/pkcs5.rb22
-rw-r--r--ext/openssl/lib/openssl/pkey.rb25
-rw-r--r--ext/openssl/lib/openssl/ssl.rb453
-rw-r--r--ext/openssl/lib/openssl/x509.rb115
-rw-r--r--ext/openssl/openssl.gemspec29
-rw-r--r--ext/openssl/openssl_missing.c371
-rw-r--r--ext/openssl/openssl_missing.h242
-rw-r--r--ext/openssl/ossl.c1239
-rw-r--r--ext/openssl/ossl.h169
-rw-r--r--ext/openssl/ossl_asn1.c1587
-rw-r--r--ext/openssl/ossl_asn1.h19
-rw-r--r--ext/openssl/ossl_bio.c61
-rw-r--r--ext/openssl/ossl_bio.h9
-rw-r--r--ext/openssl/ossl_bn.c736
-rw-r--r--ext/openssl/ossl_bn.h13
-rw-r--r--ext/openssl/ossl_cipher.c884
-rw-r--r--ext/openssl/ossl_cipher.h7
-rw-r--r--ext/openssl/ossl_config.c451
-rw-r--r--ext/openssl/ossl_config.h5
-rw-r--r--ext/openssl/ossl_digest.c458
-rw-r--r--ext/openssl/ossl_digest.h7
-rw-r--r--ext/openssl/ossl_engine.c388
-rw-r--r--ext/openssl/ossl_engine.h3
-rw-r--r--ext/openssl/ossl_hmac.c333
-rw-r--r--ext/openssl/ossl_hmac.h3
-rw-r--r--ext/openssl/ossl_kdf.c319
-rw-r--r--ext/openssl/ossl_kdf.h6
-rw-r--r--ext/openssl/ossl_ns_spki.c255
-rw-r--r--ext/openssl/ossl_ns_spki.h4
-rw-r--r--ext/openssl/ossl_ocsp.c1649
-rw-r--r--ext/openssl/ossl_ocsp.h5
-rw-r--r--ext/openssl/ossl_pkcs12.c185
-rw-r--r--ext/openssl/ossl_pkcs12.h5
-rw-r--r--ext/openssl/ossl_pkcs5.h6
-rw-r--r--ext/openssl/ossl_pkcs7.c359
-rw-r--r--ext/openssl/ossl_pkcs7.h5
-rw-r--r--ext/openssl/ossl_pkey.c427
-rw-r--r--ext/openssl/ossl_pkey.h193
-rw-r--r--ext/openssl/ossl_pkey_dh.c520
-rw-r--r--ext/openssl/ossl_pkey_dsa.c473
-rw-r--r--ext/openssl/ossl_pkey_ec.c1798
-rw-r--r--ext/openssl/ossl_pkey_rsa.c749
-rw-r--r--ext/openssl/ossl_rand.c190
-rw-r--r--ext/openssl/ossl_rand.h4
-rw-r--r--ext/openssl/ossl_ssl.c2934
-rw-r--r--ext/openssl/ossl_ssl.h23
-rw-r--r--ext/openssl/ossl_ssl_session.c332
-rw-r--r--ext/openssl/ossl_version.h5
-rw-r--r--ext/openssl/ossl_x509.c95
-rw-r--r--ext/openssl/ossl_x509.h29
-rw-r--r--ext/openssl/ossl_x509attr.c227
-rw-r--r--ext/openssl/ossl_x509cert.c539
-rw-r--r--ext/openssl/ossl_x509crl.c269
-rw-r--r--ext/openssl/ossl_x509ext.c259
-rw-r--r--ext/openssl/ossl_x509name.c386
-rw-r--r--ext/openssl/ossl_x509req.c231
-rw-r--r--ext/openssl/ossl_x509revoked.c161
-rw-r--r--ext/openssl/ossl_x509store.c596
-rw-r--r--ext/openssl/ruby_missing.h18
-rw-r--r--ext/pathname/depend17
-rw-r--r--ext/pathname/extconf.rb4
-rw-r--r--ext/pathname/lib/pathname.rb593
-rw-r--r--ext/pathname/pathname.c1670
-rw-r--r--ext/psych/depend104
-rw-r--r--ext/psych/extconf.rb43
-rw-r--r--ext/psych/lib/psych.rb641
-rw-r--r--ext/psych/lib/psych/class_loader.rb102
-rw-r--r--ext/psych/lib/psych/coder.rb95
-rw-r--r--ext/psych/lib/psych/core_ext.rb19
-rw-r--r--ext/psych/lib/psych/exception.rb14
-rw-r--r--ext/psych/lib/psych/handler.rb255
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb23
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb40
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb20
-rw-r--r--ext/psych/lib/psych/json/stream.rb17
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb13
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb30
-rw-r--r--ext/psych/lib/psych/nodes.rb78
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb21
-rw-r--r--ext/psych/lib/psych/nodes/document.rb63
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb59
-rw-r--r--ext/psych/lib/psych/nodes/node.rb75
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb70
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb84
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb40
-rw-r--r--ext/psych/lib/psych/omap.rb5
-rw-r--r--ext/psych/lib/psych/parser.rb52
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb136
-rw-r--r--ext/psych/lib/psych/set.rb5
-rw-r--r--ext/psych/lib/psych/stream.rb38
-rw-r--r--ext/psych/lib/psych/streaming.rb28
-rw-r--r--ext/psych/lib/psych/syntax_error.rb22
-rw-r--r--ext/psych/lib/psych/tree_builder.rb137
-rw-r--r--ext/psych/lib/psych/versions.rb10
-rw-r--r--ext/psych/lib/psych/visitors.rb7
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb27
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb52
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb25
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb421
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb20
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb539
-rw-r--r--ext/psych/lib/psych/y.rb10
-rw-r--r--ext/psych/psych.c34
-rw-r--r--ext/psych/psych.gemspec70
-rw-r--r--ext/psych/psych.h17
-rw-r--r--ext/psych/psych_emitter.c555
-rw-r--r--ext/psych/psych_emitter.h8
-rw-r--r--ext/psych/psych_parser.c579
-rw-r--r--ext/psych/psych_parser.h6
-rw-r--r--ext/psych/psych_to_ruby.c39
-rw-r--r--ext/psych/psych_to_ruby.h8
-rw-r--r--ext/psych/psych_yaml_tree.c24
-rw-r--r--ext/psych/psych_yaml_tree.h8
-rw-r--r--ext/psych/yaml/api.c1395
-rw-r--r--ext/psych/yaml/config.h10
-rw-r--r--ext/psych/yaml/dumper.c394
-rw-r--r--ext/psych/yaml/emitter.c2324
-rw-r--r--ext/psych/yaml/loader.c444
-rw-r--r--ext/psych/yaml/parser.c1370
-rw-r--r--ext/psych/yaml/reader.c469
-rw-r--r--ext/psych/yaml/scanner.c3578
-rw-r--r--ext/psych/yaml/writer.c141
-rw-r--r--ext/psych/yaml/yaml.h1971
-rw-r--r--ext/psych/yaml/yaml_private.h688
-rw-r--r--ext/pty/.cvsignore3
-rw-r--r--ext/pty/README65
-rw-r--r--ext/pty/README.expect22
-rw-r--r--ext/pty/README.expect.ja21
-rw-r--r--ext/pty/README.ja89
-rw-r--r--ext/pty/depend21
-rw-r--r--ext/pty/expect_sample.rb55
-rw-r--r--ext/pty/extconf.rb10
-rw-r--r--ext/pty/lib/expect.rb45
-rw-r--r--ext/pty/pty.c865
-rw-r--r--ext/pty/script.rb37
-rw-r--r--ext/pty/shl.rb92
-rw-r--r--ext/racc/cparse/.cvsignore3
-rw-r--r--ext/racc/cparse/README11
-rw-r--r--ext/racc/cparse/cparse.c173
-rw-r--r--ext/racc/cparse/depend15
-rw-r--r--ext/racc/cparse/extconf.rb6
-rw-r--r--ext/rbconfig/sizeof/depend39
-rw-r--r--ext/rbconfig/sizeof/extconf.rb36
-rw-r--r--ext/readline/.cvsignore3
-rw-r--r--ext/readline/.gitignore1
-rw-r--r--ext/readline/README68
-rw-r--r--ext/readline/README.ja393
-rw-r--r--ext/readline/depend19
-rw-r--r--ext/readline/extconf.rb115
-rw-r--r--ext/readline/readline-ext.gemspec21
-rw-r--r--ext/readline/readline.c2078
-rw-r--r--ext/ripper/README30
-rw-r--r--ext/ripper/depend81
-rw-r--r--ext/ripper/eventids2.c305
-rw-r--r--ext/ripper/extconf.rb26
-rw-r--r--ext/ripper/lib/ripper.rb74
-rw-r--r--ext/ripper/lib/ripper/core.rb74
-rw-r--r--ext/ripper/lib/ripper/filter.rb86
-rw-r--r--ext/ripper/lib/ripper/lexer.rb303
-rw-r--r--ext/ripper/lib/ripper/sexp.rb158
-rw-r--r--ext/ripper/tools/dsl.rb85
-rw-r--r--ext/ripper/tools/generate-param-macros.rb15
-rw-r--r--ext/ripper/tools/generate.rb171
-rw-r--r--ext/ripper/tools/preproc.rb107
-rw-r--r--ext/ripper/tools/strip.rb12
-rw-r--r--ext/rubyvm/depend2
-rw-r--r--ext/rubyvm/extconf.rb1
-rw-r--r--ext/rubyvm/lib/forwardable/impl.rb16
-rw-r--r--ext/sdbm/.cvsignore3
-rw-r--r--ext/sdbm/_sdbm.c283
-rw-r--r--ext/sdbm/depend29
-rw-r--r--ext/sdbm/extconf.rb2
-rw-r--r--ext/sdbm/init.c769
-rw-r--r--ext/sdbm/sdbm.gemspec21
-rw-r--r--ext/sdbm/sdbm.h10
-rw-r--r--ext/socket/.cvsignore3
-rw-r--r--ext/socket/.document17
-rw-r--r--ext/socket/addrinfo.h49
-rw-r--r--ext/socket/ancdata.c1736
-rw-r--r--ext/socket/basicsocket.c757
-rw-r--r--ext/socket/constants.c144
-rw-r--r--ext/socket/depend347
-rw-r--r--ext/socket/extconf.rb709
-rw-r--r--ext/socket/getaddrinfo.c125
-rw-r--r--ext/socket/getnameinfo.c70
-rw-r--r--ext/socket/ifaddr.c477
-rw-r--r--ext/socket/init.c844
-rw-r--r--ext/socket/ipsocket.c388
-rw-r--r--ext/socket/lib/socket.rb1357
-rw-r--r--ext/socket/mkconstants.rb814
-rw-r--r--ext/socket/option.c1477
-rw-r--r--ext/socket/raddrinfo.c2750
-rw-r--r--ext/socket/rubysocket.h452
-rw-r--r--ext/socket/socket.c5209
-rw-r--r--ext/socket/sockport.h86
-rw-r--r--ext/socket/sockssocket.c74
-rw-r--r--ext/socket/tcpserver.c146
-rw-r--r--ext/socket/tcpsocket.c91
-rw-r--r--ext/socket/udpsocket.c247
-rw-r--r--ext/socket/unixserver.c128
-rw-r--r--ext/socket/unixsocket.c595
-rw-r--r--ext/stringio/.cvsignore3
-rw-r--r--ext/stringio/README19
-rw-r--r--ext/stringio/README.md10
-rw-r--r--ext/stringio/depend20
-rw-r--r--ext/stringio/extconf.rb2
-rw-r--r--ext/stringio/stringio.c1519
-rw-r--r--ext/stringio/stringio.gemspec34
-rw-r--r--ext/strscan/.cvsignore3
-rw-r--r--ext/strscan/depend19
-rw-r--r--ext/strscan/extconf.rb3
-rw-r--r--ext/strscan/strscan.c733
-rw-r--r--ext/strscan/strscan.gemspec20
-rw-r--r--ext/syck/.cvsignore3
-rw-r--r--ext/syck/bytecode.c1166
-rw-r--r--ext/syck/depend12
-rw-r--r--ext/syck/emitter.c1242
-rw-r--r--ext/syck/extconf.rb5
-rw-r--r--ext/syck/gram.c1894
-rw-r--r--ext/syck/gram.h79
-rw-r--r--ext/syck/handler.c174
-rw-r--r--ext/syck/implicit.c2990
-rw-r--r--ext/syck/node.c408
-rw-r--r--ext/syck/rubyext.c2366
-rw-r--r--ext/syck/syck.c504
-rw-r--r--ext/syck/syck.h458
-rw-r--r--ext/syck/token.c2725
-rw-r--r--ext/syck/yaml2byte.c257
-rw-r--r--ext/syck/yamlbyte.h170
-rw-r--r--ext/syslog/.cvsignore3
-rw-r--r--ext/syslog/depend16
-rw-r--r--ext/syslog/extconf.rb5
-rw-r--r--ext/syslog/lib/syslog/logger.rb209
-rw-r--r--ext/syslog/syslog.c396
-rw-r--r--ext/syslog/syslog.txt11
-rw-r--r--ext/syslog/test.rb164
-rw-r--r--ext/tk/.cvsignore3
-rw-r--r--ext/tk/ChangeLog.tkextlib858
-rw-r--r--ext/tk/MANUAL_tcltklib.eng445
-rw-r--r--ext/tk/MANUAL_tcltklib.eucj557
-rw-r--r--ext/tk/README.1st22
-rw-r--r--ext/tk/README.ActiveTcl49
-rw-r--r--ext/tk/README.fork34
-rw-r--r--ext/tk/README.macosx-aqua67
-rw-r--r--ext/tk/README.tcltklib72
-rw-r--r--ext/tk/depend2
-rw-r--r--ext/tk/extconf.rb309
-rw-r--r--ext/tk/lib/README30
-rw-r--r--ext/tk/lib/multi-tk.rb3233
-rw-r--r--ext/tk/lib/remote-tk.rb526
-rw-r--r--ext/tk/lib/tcltk.rb367
-rw-r--r--ext/tk/lib/tk.rb4615
-rw-r--r--ext/tk/lib/tk/after.rb6
-rw-r--r--ext/tk/lib/tk/autoload.rb196
-rw-r--r--ext/tk/lib/tk/bgerror.rb29
-rw-r--r--ext/tk/lib/tk/bindtag.rb81
-rw-r--r--ext/tk/lib/tk/button.rb27
-rw-r--r--ext/tk/lib/tk/canvas.rb759
-rw-r--r--ext/tk/lib/tk/canvastag.rb375
-rw-r--r--ext/tk/lib/tk/checkbutton.rb25
-rw-r--r--ext/tk/lib/tk/clipboard.rb75
-rw-r--r--ext/tk/lib/tk/clock.rb71
-rw-r--r--ext/tk/lib/tk/composite.rb394
-rw-r--r--ext/tk/lib/tk/console.rb52
-rw-r--r--ext/tk/lib/tk/dialog.rb326
-rw-r--r--ext/tk/lib/tk/encodedstr.rb111
-rw-r--r--ext/tk/lib/tk/entry.rb117
-rw-r--r--ext/tk/lib/tk/event.rb488
-rw-r--r--ext/tk/lib/tk/font.rb1762
-rw-r--r--ext/tk/lib/tk/frame.rb128
-rw-r--r--ext/tk/lib/tk/grid.rb220
-rw-r--r--ext/tk/lib/tk/image.rb237
-rw-r--r--ext/tk/lib/tk/itemconfig.rb1056
-rw-r--r--ext/tk/lib/tk/itemfont.rb300
-rw-r--r--ext/tk/lib/tk/kinput.rb71
-rw-r--r--ext/tk/lib/tk/label.rb18
-rw-r--r--ext/tk/lib/tk/labelframe.rb25
-rw-r--r--ext/tk/lib/tk/listbox.rb279
-rw-r--r--ext/tk/lib/tk/macpkg.rb73
-rw-r--r--ext/tk/lib/tk/menu.rb632
-rw-r--r--ext/tk/lib/tk/menubar.rb131
-rw-r--r--ext/tk/lib/tk/menuspec.rb269
-rw-r--r--ext/tk/lib/tk/message.rb19
-rw-r--r--ext/tk/lib/tk/mngfocus.rb33
-rw-r--r--ext/tk/lib/tk/msgcat.rb292
-rw-r--r--ext/tk/lib/tk/namespace.rb500
-rw-r--r--ext/tk/lib/tk/optiondb.rb371
-rw-r--r--ext/tk/lib/tk/optionobj.rb212
-rw-r--r--ext/tk/lib/tk/pack.rb90
-rw-r--r--ext/tk/lib/tk/package.rb139
-rw-r--r--ext/tk/lib/tk/palette.rb55
-rw-r--r--ext/tk/lib/tk/panedwindow.rb232
-rw-r--r--ext/tk/lib/tk/place.rb128
-rw-r--r--ext/tk/lib/tk/radiobutton.rb66
-rw-r--r--ext/tk/lib/tk/root.rb108
-rw-r--r--ext/tk/lib/tk/scale.rb86
-rw-r--r--ext/tk/lib/tk/scrollable.rb79
-rw-r--r--ext/tk/lib/tk/scrollbar.rb124
-rw-r--r--ext/tk/lib/tk/scrollbox.rb36
-rw-r--r--ext/tk/lib/tk/selection.rb86
-rw-r--r--ext/tk/lib/tk/spinbox.rb99
-rw-r--r--ext/tk/lib/tk/tagfont.rb43
-rw-r--r--ext/tk/lib/tk/text.rb1550
-rw-r--r--ext/tk/lib/tk/textimage.rb82
-rw-r--r--ext/tk/lib/tk/textmark.rb166
-rw-r--r--ext/tk/lib/tk/texttag.rb279
-rw-r--r--ext/tk/lib/tk/textwindow.rb149
-rw-r--r--ext/tk/lib/tk/timer.rb634
-rw-r--r--ext/tk/lib/tk/toplevel.rb257
-rw-r--r--ext/tk/lib/tk/txtwin_abst.rb39
-rw-r--r--ext/tk/lib/tk/validation.rb376
-rw-r--r--ext/tk/lib/tk/variable.rb1651
-rw-r--r--ext/tk/lib/tk/virtevent.rb106
-rw-r--r--ext/tk/lib/tk/winfo.rb392
-rw-r--r--ext/tk/lib/tk/winpkg.rb143
-rw-r--r--ext/tk/lib/tk/wm.rb360
-rw-r--r--ext/tk/lib/tk/xim.rb122
-rw-r--r--ext/tk/lib/tkafter.rb4
-rw-r--r--ext/tk/lib/tkbgerror.rb4
-rw-r--r--ext/tk/lib/tkcanvas.rb4
-rw-r--r--ext/tk/lib/tkclass.rb47
-rw-r--r--ext/tk/lib/tkconsole.rb4
-rw-r--r--ext/tk/lib/tkdialog.rb4
-rw-r--r--ext/tk/lib/tkentry.rb4
-rw-r--r--ext/tk/lib/tkextlib/ICONS.rb13
-rw-r--r--ext/tk/lib/tkextlib/ICONS/icons.rb129
-rw-r--r--ext/tk/lib/tkextlib/ICONS/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/SUPPORT_STATUS196
-rw-r--r--ext/tk/lib/tkextlib/blt.rb187
-rw-r--r--ext/tk/lib/tkextlib/blt/barchart.rb79
-rw-r--r--ext/tk/lib/tkextlib/blt/bitmap.rb99
-rw-r--r--ext/tk/lib/tkextlib/blt/busy.rb82
-rw-r--r--ext/tk/lib/tkextlib/blt/component.rb1835
-rw-r--r--ext/tk/lib/tkextlib/blt/container.rb28
-rw-r--r--ext/tk/lib/tkextlib/blt/cutbuffer.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/dragdrop.rb214
-rw-r--r--ext/tk/lib/tkextlib/blt/eps.rb32
-rw-r--r--ext/tk/lib/tkextlib/blt/graph.rb67
-rw-r--r--ext/tk/lib/tkextlib/blt/htext.rb110
-rw-r--r--ext/tk/lib/tkextlib/blt/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/blt/spline.rb23
-rw-r--r--ext/tk/lib/tkextlib/blt/stripchart.rb74
-rw-r--r--ext/tk/lib/tkextlib/blt/table.rb344
-rw-r--r--ext/tk/lib/tkextlib/blt/tabnotebook.rb21
-rw-r--r--ext/tk/lib/tkextlib/blt/tabset.rb401
-rw-r--r--ext/tk/lib/tkextlib/blt/ted.rb62
-rw-r--r--ext/tk/lib/tkextlib/blt/tile.rb21
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/button.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/checkbutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/frame.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/label.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/radiobutton.rb17
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/scrollbar.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tile/toplevel.rb16
-rw-r--r--ext/tk/lib/tkextlib/blt/tree.rb923
-rw-r--r--ext/tk/lib/tkextlib/blt/treeview.rb1146
-rw-r--r--ext/tk/lib/tkextlib/blt/unix_dnd.rb129
-rw-r--r--ext/tk/lib/tkextlib/blt/vector.rb243
-rw-r--r--ext/tk/lib/tkextlib/blt/watch.rb142
-rw-r--r--ext/tk/lib/tkextlib/blt/win_printer.rb61
-rw-r--r--ext/tk/lib/tkextlib/blt/winop.rb107
-rw-r--r--ext/tk/lib/tkextlib/bwidget.rb151
-rw-r--r--ext/tk/lib/tkextlib/bwidget/arrowbutton.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/bitmap.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/button.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/buttonbox.rb78
-rw-r--r--ext/tk/lib/tkextlib/bwidget/combobox.rb45
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dialog.rb157
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dragsite.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dropsite.rb39
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dynamichelp.rb56
-rw-r--r--ext/tk/lib/tkextlib/bwidget/entry.rb43
-rw-r--r--ext/tk/lib/tkextlib/bwidget/label.rb41
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelentry.rb80
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelframe.rb46
-rw-r--r--ext/tk/lib/tkextlib/bwidget/listbox.rb339
-rw-r--r--ext/tk/lib/tkextlib/bwidget/mainframe.rb92
-rw-r--r--ext/tk/lib/tkextlib/bwidget/messagedlg.rb178
-rw-r--r--ext/tk/lib/tkextlib/bwidget/notebook.rb148
-rw-r--r--ext/tk/lib/tkextlib/bwidget/pagesmanager.rb61
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panedwindow.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panelframe.rb51
-rw-r--r--ext/tk/lib/tkextlib/bwidget/passwddlg.rb44
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressbar.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressdlg.rb54
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollableframe.rb34
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrolledwindow.rb32
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollview.rb25
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectcolor.rb45
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectfont.rb85
-rw-r--r--ext/tk/lib/tkextlib/bwidget/separator.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/bwidget/spinbox.rb98
-rw-r--r--ext/tk/lib/tkextlib/bwidget/statusbar.rb46
-rw-r--r--ext/tk/lib/tkextlib/bwidget/titleframe.rb27
-rw-r--r--ext/tk/lib/tkextlib/bwidget/tree.rb434
-rw-r--r--ext/tk/lib/tkextlib/bwidget/widget.rb113
-rw-r--r--ext/tk/lib/tkextlib/itcl.rb13
-rw-r--r--ext/tk/lib/tkextlib/itcl/incr_tcl.rb172
-rw-r--r--ext/tk/lib/tkextlib/itcl/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk/incr_tk.rb428
-rw-r--r--ext/tk/lib/tkextlib/itk/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/iwidgets.rb94
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/buttonbox.rb119
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/calendar.rb106
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintbox.rb53
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintdialog.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/checkbox.rb116
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/combobox.rb104
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dateentry.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/datefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialogshell.rb119
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/disjointlistbox.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/entryfield.rb166
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extbutton.rb40
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/feedback.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectionbox.rb46
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/finddialog.rb42
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hierarchy.rb309
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hyperhelp.rb50
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledframe.rb39
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledwidget.rb45
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/mainwindow.rb67
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/menubar.rb210
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagebox.rb91
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagedialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/notebook.rb168
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/optionmenu.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/panedwindow.rb132
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/promptdialog.rb131
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/pushbutton.rb35
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/radiobox.rb116
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scopedobject.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb347
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledframe.rb59
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledhtml.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb207
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb538
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledwidget.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectionbox.rb102
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectiondialog.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/shell.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spindate.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinint.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinner.rb150
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spintime.rb48
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabnotebook.rb169
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabset.rb99
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timeentry.rb25
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timefield.rb58
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/toolbar.rb112
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/watch.rb56
-rwxr-xr-xext/tk/lib/tkextlib/pkg_checker.rb184
-rw-r--r--ext/tk/lib/tkextlib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib.rb90
-rw-r--r--ext/tk/lib/tkextlib/tcllib/README135
-rw-r--r--ext/tk/lib/tkextlib/tcllib/autoscroll.rb158
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ctext.rb160
-rw-r--r--ext/tk/lib/tkextlib/tcllib/cursor.rb97
-rw-r--r--ext/tk/lib/tkextlib/tcllib/datefield.rb57
-rw-r--r--ext/tk/lib/tkextlib/tcllib/dialog.rb84
-rw-r--r--ext/tk/lib/tkextlib/tcllib/getstring.rb131
-rw-r--r--ext/tk/lib/tkextlib/tcllib/history.rb73
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ico.rb114
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ip_entry.rb66
-rw-r--r--ext/tk/lib/tkextlib/tcllib/panelframe.rb72
-rw-r--r--ext/tk/lib/tkextlib/tcllib/plotchart.rb865
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ruler.rb65
-rw-r--r--ext/tk/lib/tkextlib/tcllib/screenruler.rb68
-rw-r--r--ext/tk/lib/tkextlib/tcllib/scrollwin.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib/style.rb61
-rw-r--r--ext/tk/lib/tkextlib/tcllib/superframe.rb51
-rw-r--r--ext/tk/lib/tkextlib/tcllib/swaplist.rb147
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist.rb27
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_core.rb770
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb25
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tkpiechart.rb308
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tooltip.rb95
-rw-r--r--ext/tk/lib/tkextlib/tcllib/widget.rb48
-rw-r--r--ext/tk/lib/tkextlib/tclx.rb13
-rw-r--r--ext/tk/lib/tkextlib/tclx/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tclx/tclx.rb74
-rw-r--r--ext/tk/lib/tkextlib/tile.rb225
-rw-r--r--ext/tk/lib/tkextlib/tile/dialog.rb84
-rw-r--r--ext/tk/lib/tkextlib/tile/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tile/style.rb103
-rw-r--r--ext/tk/lib/tkextlib/tile/tbutton.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tcheckbutton.rb32
-rw-r--r--ext/tk/lib/tkextlib/tile/tcombobox.rb55
-rw-r--r--ext/tk/lib/tkextlib/tile/tentry.rb40
-rw-r--r--ext/tk/lib/tkextlib/tile/tframe.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabel.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabelframe.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tmenubutton.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tnotebook.rb110
-rw-r--r--ext/tk/lib/tkextlib/tile/tpaned.rb188
-rw-r--r--ext/tk/lib/tkextlib/tile/tprogressbar.rb53
-rw-r--r--ext/tk/lib/tkextlib/tile/tradiobutton.rb32
-rw-r--r--ext/tk/lib/tkextlib/tile/treeview.rb280
-rw-r--r--ext/tk/lib/tkextlib/tile/tscale.rb50
-rw-r--r--ext/tk/lib/tkextlib/tile/tscrollbar.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tseparator.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tsquare.rb30
-rw-r--r--ext/tk/lib/tkextlib/tkDND.rb18
-rw-r--r--ext/tk/lib/tkextlib/tkDND/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkDND/shape.rb123
-rw-r--r--ext/tk/lib/tkextlib/tkDND/tkdnd.rb164
-rw-r--r--ext/tk/lib/tkextlib/tkHTML.rb13
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/htmlwidget.rb444
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg.rb36
-rw-r--r--ext/tk/lib/tkextlib/tkimg/README26
-rw-r--r--ext/tk/lib/tkextlib/tkimg/bmp.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/gif.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ico.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/jpeg.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pcx.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pixmap.rb44
-rw-r--r--ext/tk/lib/tkextlib/tkimg/png.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ppm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ps.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sgi.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sun.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tga.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tiff.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/window.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xbm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xpm.rb33
-rw-r--r--ext/tk/lib/tkextlib/tktable.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktable/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktable/tktable.rb839
-rw-r--r--ext/tk/lib/tkextlib/tktrans.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktrans/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktrans/tktrans.rb64
-rw-r--r--ext/tk/lib/tkextlib/treectrl.rb13
-rw-r--r--ext/tk/lib/tkextlib/treectrl/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/treectrl/tktreectrl.rb2311
-rw-r--r--ext/tk/lib/tkextlib/trofs.rb13
-rw-r--r--ext/tk/lib/tkextlib/trofs/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/trofs/trofs.rb51
-rw-r--r--ext/tk/lib/tkextlib/vu.rb48
-rw-r--r--ext/tk/lib/tkextlib/vu/bargraph.rb61
-rw-r--r--ext/tk/lib/tkextlib/vu/charts.rb53
-rw-r--r--ext/tk/lib/tkextlib/vu/dial.rb102
-rw-r--r--ext/tk/lib/tkextlib/vu/pie.rb235
-rw-r--r--ext/tk/lib/tkextlib/vu/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/vu/spinbox.rb22
-rw-r--r--ext/tk/lib/tkextlib/winico.rb14
-rw-r--r--ext/tk/lib/tkextlib/winico/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/winico/winico.rb189
-rw-r--r--ext/tk/lib/tkfont.rb4
-rw-r--r--ext/tk/lib/tkmacpkg.rb4
-rw-r--r--ext/tk/lib/tkmenubar.rb4
-rw-r--r--ext/tk/lib/tkmngfocus.rb4
-rw-r--r--ext/tk/lib/tkpalette.rb4
-rw-r--r--ext/tk/lib/tkscrollbox.rb4
-rw-r--r--ext/tk/lib/tktext.rb4
-rw-r--r--ext/tk/lib/tkvirtevent.rb4
-rw-r--r--ext/tk/lib/tkwinpkg.rb4
-rw-r--r--ext/tk/old-README.tcltklib.eucj159
-rw-r--r--ext/tk/sample/24hr_clock.rb286
-rw-r--r--ext/tk/sample/binding_sample.rb87
-rw-r--r--ext/tk/sample/bindtag_sample.rb127
-rw-r--r--ext/tk/sample/binstr_usage.rb39
-rw-r--r--ext/tk/sample/btn_with_frame.rb20
-rw-r--r--ext/tk/sample/cd_timer.rb81
-rw-r--r--ext/tk/sample/cmd_res_test.rb17
-rw-r--r--ext/tk/sample/cmd_resource5
-rw-r--r--ext/tk/sample/demos-en/ChangeLog64
-rw-r--r--ext/tk/sample/demos-en/ChangeLog.prev9
-rw-r--r--ext/tk/sample/demos-en/README138
-rw-r--r--ext/tk/sample/demos-en/README.1st18
-rw-r--r--ext/tk/sample/demos-en/README.tkencoding29
-rw-r--r--ext/tk/sample/demos-en/anilabel.rb172
-rw-r--r--ext/tk/sample/demos-en/aniwave.rb115
-rw-r--r--ext/tk/sample/demos-en/arrow.rb239
-rw-r--r--ext/tk/sample/demos-en/bind.rb128
-rw-r--r--ext/tk/sample/demos-en/bitmap.rb73
-rw-r--r--ext/tk/sample/demos-en/browse163
-rw-r--r--ext/tk/sample/demos-en/browse282
-rw-r--r--ext/tk/sample/demos-en/button.rb84
-rw-r--r--ext/tk/sample/demos-en/check.rb70
-rw-r--r--ext/tk/sample/demos-en/check2.rb107
-rw-r--r--ext/tk/sample/demos-en/clrpick.rb77
-rw-r--r--ext/tk/sample/demos-en/colors.rb148
-rw-r--r--ext/tk/sample/demos-en/cscroll.rb134
-rw-r--r--ext/tk/sample/demos-en/ctext.rb186
-rw-r--r--ext/tk/sample/demos-en/dialog1.rb38
-rw-r--r--ext/tk/sample/demos-en/dialog2.rb41
-rw-r--r--ext/tk/sample/demos-en/doc.org/README7
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-en/entry1.rb56
-rw-r--r--ext/tk/sample/demos-en/entry2.rb91
-rw-r--r--ext/tk/sample/demos-en/entry3.rb200
-rw-r--r--ext/tk/sample/demos-en/filebox.rb97
-rw-r--r--ext/tk/sample/demos-en/floor.rb1721
-rw-r--r--ext/tk/sample/demos-en/floor2.rb1720
-rw-r--r--ext/tk/sample/demos-en/form.rb62
-rw-r--r--ext/tk/sample/demos-en/goldberg.rb1999
-rw-r--r--ext/tk/sample/demos-en/hello14
-rw-r--r--ext/tk/sample/demos-en/hscale.rb74
-rw-r--r--ext/tk/sample/demos-en/icon.rb99
-rw-r--r--ext/tk/sample/demos-en/image1.rb60
-rw-r--r--ext/tk/sample/demos-en/image2.rb105
-rw-r--r--ext/tk/sample/demos-en/image3.rb122
-rw-r--r--ext/tk/sample/demos-en/items.rb374
-rw-r--r--ext/tk/sample/demos-en/ixset333
-rw-r--r--ext/tk/sample/demos-en/ixset2367
-rw-r--r--ext/tk/sample/demos-en/label.rb69
-rw-r--r--ext/tk/sample/demos-en/labelframe.rb93
-rw-r--r--ext/tk/sample/demos-en/menu.rb194
-rw-r--r--ext/tk/sample/demos-en/menu84.rb213
-rw-r--r--ext/tk/sample/demos-en/menubu.rb235
-rw-r--r--ext/tk/sample/demos-en/msgbox.rb88
-rw-r--r--ext/tk/sample/demos-en/paned1.rb45
-rw-r--r--ext/tk/sample/demos-en/paned2.rb92
-rw-r--r--ext/tk/sample/demos-en/patch_1.1c193
-rw-r--r--ext/tk/sample/demos-en/pendulum.rb223
-rw-r--r--ext/tk/sample/demos-en/plot.rb122
-rw-r--r--ext/tk/sample/demos-en/puzzle.rb120
-rw-r--r--ext/tk/sample/demos-en/radio.rb84
-rw-r--r--ext/tk/sample/demos-en/radio2.rb106
-rw-r--r--ext/tk/sample/demos-en/radio3.rb114
-rw-r--r--ext/tk/sample/demos-en/rmt268
-rw-r--r--ext/tk/sample/demos-en/rolodex320
-rw-r--r--ext/tk/sample/demos-en/rolodex-j323
-rw-r--r--ext/tk/sample/demos-en/ruler.rb203
-rw-r--r--ext/tk/sample/demos-en/sayings.rb104
-rw-r--r--ext/tk/sample/demos-en/search.rb180
-rw-r--r--ext/tk/sample/demos-en/spin.rb63
-rw-r--r--ext/tk/sample/demos-en/square81
-rw-r--r--ext/tk/sample/demos-en/states.rb78
-rw-r--r--ext/tk/sample/demos-en/style.rb211
-rw-r--r--ext/tk/sample/demos-en/tcolor526
-rw-r--r--ext/tk/sample/demos-en/text.rb126
-rw-r--r--ext/tk/sample/demos-en/timer136
-rw-r--r--ext/tk/sample/demos-en/tkencoding.rb42
-rw-r--r--ext/tk/sample/demos-en/twind.rb285
-rw-r--r--ext/tk/sample/demos-en/twind2.rb382
-rw-r--r--ext/tk/sample/demos-en/unicodeout.rb112
-rw-r--r--ext/tk/sample/demos-en/vscale.rb78
-rw-r--r--ext/tk/sample/demos-en/widget944
-rw-r--r--ext/tk/sample/demos-jp/README54
-rw-r--r--ext/tk/sample/demos-jp/README.1st20
-rw-r--r--ext/tk/sample/demos-jp/anilabel.rb174
-rw-r--r--ext/tk/sample/demos-jp/aniwave.rb116
-rw-r--r--ext/tk/sample/demos-jp/arrow.rb236
-rw-r--r--ext/tk/sample/demos-jp/bind.rb125
-rw-r--r--ext/tk/sample/demos-jp/bitmap.rb71
-rw-r--r--ext/tk/sample/demos-jp/browse163
-rw-r--r--ext/tk/sample/demos-jp/browse282
-rw-r--r--ext/tk/sample/demos-jp/button.rb81
-rw-r--r--ext/tk/sample/demos-jp/check.rb67
-rw-r--r--ext/tk/sample/demos-jp/check2.rb107
-rw-r--r--ext/tk/sample/demos-jp/clrpick.rb75
-rw-r--r--ext/tk/sample/demos-jp/colors.rb144
-rw-r--r--ext/tk/sample/demos-jp/cscroll.rb131
-rw-r--r--ext/tk/sample/demos-jp/ctext.rb182
-rw-r--r--ext/tk/sample/demos-jp/dialog1.rb38
-rw-r--r--ext/tk/sample/demos-jp/dialog2.rb42
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README7
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-jp/entry1.rb57
-rw-r--r--ext/tk/sample/demos-jp/entry2.rb88
-rw-r--r--ext/tk/sample/demos-jp/entry3.rb204
-rw-r--r--ext/tk/sample/demos-jp/filebox.rb96
-rw-r--r--ext/tk/sample/demos-jp/floor.rb1718
-rw-r--r--ext/tk/sample/demos-jp/floor2.rb1716
-rw-r--r--ext/tk/sample/demos-jp/form.rb63
-rw-r--r--ext/tk/sample/demos-jp/goldberg.rb2003
-rw-r--r--ext/tk/sample/demos-jp/hello9
-rw-r--r--ext/tk/sample/demos-jp/hscale.rb77
-rw-r--r--ext/tk/sample/demos-jp/icon.rb96
-rw-r--r--ext/tk/sample/demos-jp/image1.rb58
-rw-r--r--ext/tk/sample/demos-jp/image2.rb102
-rw-r--r--ext/tk/sample/demos-jp/image3.rb123
-rw-r--r--ext/tk/sample/demos-jp/items.rb371
-rw-r--r--ext/tk/sample/demos-jp/ixset333
-rw-r--r--ext/tk/sample/demos-jp/ixset2368
-rw-r--r--ext/tk/sample/demos-jp/label.rb65
-rw-r--r--ext/tk/sample/demos-jp/labelframe.rb98
-rw-r--r--ext/tk/sample/demos-jp/menu.rb196
-rw-r--r--ext/tk/sample/demos-jp/menu84.rb210
-rw-r--r--ext/tk/sample/demos-jp/menu8x.rb230
-rw-r--r--ext/tk/sample/demos-jp/menubu.rb235
-rw-r--r--ext/tk/sample/demos-jp/msgbox.rb86
-rw-r--r--ext/tk/sample/demos-jp/paned1.rb48
-rw-r--r--ext/tk/sample/demos-jp/paned2.rb96
-rw-r--r--ext/tk/sample/demos-jp/pendulum.rb224
-rw-r--r--ext/tk/sample/demos-jp/plot.rb119
-rw-r--r--ext/tk/sample/demos-jp/puzzle.rb116
-rw-r--r--ext/tk/sample/demos-jp/radio.rb81
-rw-r--r--ext/tk/sample/demos-jp/radio2.rb107
-rw-r--r--ext/tk/sample/demos-jp/radio3.rb114
-rw-r--r--ext/tk/sample/demos-jp/rmt268
-rw-r--r--ext/tk/sample/demos-jp/rolodex320
-rw-r--r--ext/tk/sample/demos-jp/rolodex-j299
-rw-r--r--ext/tk/sample/demos-jp/ruler.rb200
-rw-r--r--ext/tk/sample/demos-jp/sayings.rb100
-rw-r--r--ext/tk/sample/demos-jp/search.rb176
-rw-r--r--ext/tk/sample/demos-jp/spin.rb67
-rw-r--r--ext/tk/sample/demos-jp/square81
-rw-r--r--ext/tk/sample/demos-jp/states.rb71
-rw-r--r--ext/tk/sample/demos-jp/style.rb248
-rw-r--r--ext/tk/sample/demos-jp/tcolor533
-rw-r--r--ext/tk/sample/demos-jp/text.rb117
-rw-r--r--ext/tk/sample/demos-jp/timer136
-rw-r--r--ext/tk/sample/demos-jp/twind.rb285
-rw-r--r--ext/tk/sample/demos-jp/twind2.rb381
-rw-r--r--ext/tk/sample/demos-jp/unicodeout.rb115
-rw-r--r--ext/tk/sample/demos-jp/vscale.rb78
-rw-r--r--ext/tk/sample/demos-jp/widget973
-rw-r--r--ext/tk/sample/encstr_usage.rb29
-rw-r--r--ext/tk/sample/images/earth.gifbin51712 -> 0 bytes-rw-r--r--ext/tk/sample/images/earthris.gifbin6343 -> 0 bytes-rw-r--r--ext/tk/sample/images/face.xbm173
-rw-r--r--ext/tk/sample/images/flagdown.xbm27
-rw-r--r--ext/tk/sample/images/flagup.xbm27
-rw-r--r--ext/tk/sample/images/gray25.xbm6
-rw-r--r--ext/tk/sample/images/grey.256
-rw-r--r--ext/tk/sample/images/grey.56
-rw-r--r--ext/tk/sample/images/letters.xbm27
-rw-r--r--ext/tk/sample/images/noletter.xbm27
-rw-r--r--ext/tk/sample/images/pattern.xbm6
-rw-r--r--ext/tk/sample/images/tcllogo.gifbin2341 -> 0 bytes-rw-r--r--ext/tk/sample/images/teapot.ppm56
-rw-r--r--ext/tk/sample/irbtk.rb30
-rw-r--r--ext/tk/sample/iso2022-kr.txt2
-rw-r--r--ext/tk/sample/menubar1.rb51
-rw-r--r--ext/tk/sample/menubar2.rb56
-rw-r--r--ext/tk/sample/msgs_rb/README3
-rw-r--r--ext/tk/sample/msgs_rb/cs.msg84
-rw-r--r--ext/tk/sample/msgs_rb/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb/el.msg98
-rw-r--r--ext/tk/sample/msgs_rb/en.msg83
-rw-r--r--ext/tk/sample/msgs_rb/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_rb/eo.msg87
-rw-r--r--ext/tk/sample/msgs_rb/es.msg84
-rw-r--r--ext/tk/sample/msgs_rb/fr.msg84
-rw-r--r--ext/tk/sample/msgs_rb/it.msg84
-rw-r--r--ext/tk/sample/msgs_rb/ja.msg13
-rw-r--r--ext/tk/sample/msgs_rb/nl.msg123
-rw-r--r--ext/tk/sample/msgs_rb/pl.msg87
-rw-r--r--ext/tk/sample/msgs_rb/ru.msg87
-rw-r--r--ext/tk/sample/msgs_rb2/README5
-rw-r--r--ext/tk/sample/msgs_rb2/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb2/ja.msg85
-rw-r--r--ext/tk/sample/msgs_tk/README4
-rw-r--r--ext/tk/sample/msgs_tk/cs.msg84
-rw-r--r--ext/tk/sample/msgs_tk/de.msg88
-rw-r--r--ext/tk/sample/msgs_tk/el.msg103
-rw-r--r--ext/tk/sample/msgs_tk/en.msg83
-rw-r--r--ext/tk/sample/msgs_tk/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_tk/eo.msg87
-rw-r--r--ext/tk/sample/msgs_tk/es.msg84
-rw-r--r--ext/tk/sample/msgs_tk/fr.msg84
-rw-r--r--ext/tk/sample/msgs_tk/it.msg84
-rw-r--r--ext/tk/sample/msgs_tk/ja.msg13
-rw-r--r--ext/tk/sample/msgs_tk/license.terms39
-rw-r--r--ext/tk/sample/msgs_tk/nl.msg123
-rw-r--r--ext/tk/sample/msgs_tk/pl.msg87
-rw-r--r--ext/tk/sample/msgs_tk/ru.msg87
-rw-r--r--ext/tk/sample/multi-ip_sample.rb102
-rw-r--r--ext/tk/sample/multi-ip_sample2.rb29
-rw-r--r--ext/tk/sample/optobj_sample.rb67
-rw-r--r--ext/tk/sample/propagate.rb30
-rw-r--r--ext/tk/sample/remote-ip_sample.rb33
-rw-r--r--ext/tk/sample/remote-ip_sample2.rb56
-rw-r--r--ext/tk/sample/resource.en13
-rw-r--r--ext/tk/sample/resource.ja13
-rw-r--r--ext/tk/sample/safe-tk.rb115
-rw-r--r--ext/tk/sample/scrollframe.rb237
-rw-r--r--ext/tk/sample/tcltklib/batsu.gifbin538 -> 0 bytes-rw-r--r--ext/tk/sample/tcltklib/lines0.tcl42
-rw-r--r--ext/tk/sample/tcltklib/lines1.rb50
-rw-r--r--ext/tk/sample/tcltklib/lines2.rb54
-rw-r--r--ext/tk/sample/tcltklib/lines3.rb54
-rw-r--r--ext/tk/sample/tcltklib/lines4.rb54
-rw-r--r--ext/tk/sample/tcltklib/maru.gifbin481 -> 0 bytes-rw-r--r--ext/tk/sample/tcltklib/safeTk.rb22
-rw-r--r--ext/tk/sample/tcltklib/sample0.rb39
-rw-r--r--ext/tk/sample/tcltklib/sample1.rb634
-rw-r--r--ext/tk/sample/tcltklib/sample2.rb451
-rw-r--r--ext/tk/sample/tkalignbox.rb225
-rw-r--r--ext/tk/sample/tkballoonhelp.rb194
-rw-r--r--ext/tk/sample/tkbiff.rb155
-rw-r--r--ext/tk/sample/tkbrowse.rb79
-rw-r--r--ext/tk/sample/tkcombobox.rb426
-rw-r--r--ext/tk/sample/tkdialog.rb61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/Orig_LICENSE.txt61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons-sample.kde658
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons.kde195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/viewIcons.rb329
-rw-r--r--ext/tk/sample/tkextlib/blt/barchart5.rb101
-rw-r--r--ext/tk/sample/tkextlib/blt/calendar.rb117
-rw-r--r--ext/tk/sample/tkextlib/blt/graph6.rb2222
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7a.rb63
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7b.rb41
-rw-r--r--ext/tk/sample/tkextlib/blt/graph7c.rb45
-rw-r--r--ext/tk/sample/tkextlib/blt/images/buckskin.gifbin7561 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/chalk.gifbin4378 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/qv100.t.gifbin2694 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/rain.gifbin3785 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/images/sample.gifbin186103 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/blt/pareto.rb90
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1.rb9
-rw-r--r--ext/tk/sample/tkextlib/blt/plot1b.rb10
-rw-r--r--ext/tk/sample/tkextlib/blt/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/blt/scripts/stipples.rb156
-rw-r--r--ext/tk/sample/tkextlib/blt/winop1.rb40
-rw-r--r--ext/tk/sample/tkextlib/blt/winop2.rb28
-rw-r--r--ext/tk/sample/tkextlib/bwidget/Orig_LICENSE.txt53
-rw-r--r--ext/tk/sample/tkextlib/bwidget/basic.rb198
-rw-r--r--ext/tk/sample/tkextlib/bwidget/bwidget.xbm46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/demo.rb243
-rw-r--r--ext/tk/sample/tkextlib/bwidget/dnd.rb46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/manager.rb150
-rw-r--r--ext/tk/sample/tkextlib/bwidget/select.rb82
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tmpldlg.rb221
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tree.rb289
-rw-r--r--ext/tk/sample/tkextlib/bwidget/x1.xbm2258
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/Orig_LICENSE.txt42
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/box.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/clear.gifbin279 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/close.gifbin249 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/copy.gifbin269 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/cut.gifbin179 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/exit.gifbin396 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/find.gifbin386 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/help.gifbin591 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/line.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/mag.gifbin183 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/new.gifbin212 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/open.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/oval.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/paste.gifbin376 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/points.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/poly.gifbin141 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/print.gifbin263 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/ruler.gifbin174 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/save.gifbin270 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/select.gifbin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/text.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/buttonbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/calendar.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintdialog.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/checkbox.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/combobox.rb32
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dateentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/datefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialog.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialogshell.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/disjointlistbox.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-1.rb39
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-2.rb40
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-3.rb40
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extbutton.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectiondialog.rb29
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/feedback.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectiondialog.rb28
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/finddialog.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hierarchy.rb25
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hyperhelp.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledframe.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledwidget.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/mainwindow.rb64
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar.rb124
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox1.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox2.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagedialog.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/optionmenu.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow2.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/promptdialog.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/pushbutton.rb9
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/radiobox.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledcanvas.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledframe.rb18
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledhtml.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledlistbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledtext.rb11
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectionbox.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectiondialog.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/shell.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spindate.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinint.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinner.rb33
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spintime.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook.rb26
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabset.rb34
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timeentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/toolbar.rb152
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/watch.rb18
-rw-r--r--ext/tk/sample/tkextlib/tcllib/Orig_LICENSE.txt46
-rw-r--r--ext/tk/sample/tkextlib/tcllib/datefield.rb29
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos1.rb158
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos2.rb71
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos3.rb83
-rw-r--r--ext/tk/sample/tkextlib/tcllib/xyplot.rb17
-rw-r--r--ext/tk/sample/tkextlib/tile/Orig_LICENSE.txt30
-rw-r--r--ext/tk/sample/tkextlib/tile/demo.rb972
-rw-r--r--ext/tk/sample/tkextlib/tile/iconlib.tcl110
-rw-r--r--ext/tk/sample/tkextlib/tile/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/tile/repeater.tcl117
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue.tcl149
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-h.gifbin315 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown-p.gifbin312 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowdown.gifbin313 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-h.gifbin329 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft-p.gifbin327 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowleft.gifbin323 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-h.gifbin330 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright-p.gifbin327 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowright.gifbin324 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-h.gifbin309 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup-p.gifbin313 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/arrowup.gifbin314 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-h.gifbin696 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.gifbin770 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-n.xcfbin1942 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/button-p.gifbin769 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hc.gifbin254 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-hu.gifbin234 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nc.gifbin249 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/check-nu.gifbin229 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hc.gifbin1098 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-hu.gifbin626 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nc.gifbin389 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/radio-nu.gifbin401 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb-p.gifbin343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-thumb.gifbin316 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb-p.gifbin333 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/sb-vthumb.gifbin308 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider-p.gifbin182 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/slider.gifbin182 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider-p.gifbin183 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/blue/vslider.gifbin283 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/blue/pkgIndex.tcl6
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik.tcl194
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-n.gifbin273 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowdown-p.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-n.gifbin292 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowleft-p.gifbin272 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-n.gifbin274 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowright-p.gifbin258 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-n.gifbin286 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/arrowup-p.gifbin271 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-d.gifbin1266 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-h.gifbin896 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-n.gifbin881 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-p.gifbin625 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/button-s.gifbin859 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-c.gifbin434 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/check-u.gifbin423 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-n.gifbin401 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hsb-p.gifbin395 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/hslider-n.gifbin592 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-a.gifbin1116 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-arrow-n.gifbin61 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-d.gifbin1057 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/mbut-n.gifbin1095 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-c.gifbin695 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/radio-u.gifbin686 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-n.gifbin383 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tab-p.gifbin878 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-a.gifbin907 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-n.gifbin238 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/tbar-p.gifbin927 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-n.gifbin405 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vsb-p.gifbin399 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/keramik/vslider-n.gifbin587 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/keramik/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc.rb200
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc.tcl163
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-h.gifbin522 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-n.gifbin554 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/button-p.gifbin548 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hc.gifbin281 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-hu.gifbin273 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nc.gifbin303 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/check-nu.gifbin294 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hc.gifbin652 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-hu.gifbin644 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nc.gifbin632 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/kroc/radio-nu.gifbin621 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/kroc/pkgIndex.tcl15
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/pkgIndex.tcl16
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik.tcl125
-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-n.gifbin362 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowdown-p.gifbin250 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-n.gifbin378 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowleft-p.gifbin267 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-n.gifbin379 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowright-p.gifbin266 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-n.gifbin363 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/arrowup-p.gifbin251 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-h.gifbin439 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-n.gifbin443 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/button-p.gifbin302 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hc.gifbin169 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-hu.gifbin170 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nc.gifbin235 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-nu.gifbin226 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/check-pc.gifbin169 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hsb-n.gifbin269 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/hslider-n.gifbin342 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hc.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-hu.gifbin179 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nc.gifbin236 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-nu.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/radio-pc.gifbin178 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vsb-n.gifbin366 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/themes/plastik/plastik/vslider-n.gifbin336 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tile/toolbutton.tcl152
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/Orig_COPYRIGHT.txt12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/README12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/hv.rb313
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image1bin8995 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image10bin3095 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image11bin1425 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image12bin2468 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image13bin4073 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image14bin53 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image2bin42 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image3bin3473 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image4bin1988 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image5bin973 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image6bin2184 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image7bin2022 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image8bin1186 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image9bin139 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/index.html115
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image1bin1966 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image10bin255 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image11bin590 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image12bin254 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image13bin493 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image14bin195 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image15bin68 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image16bin157 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image17bin81 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image18bin545 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image19bin53 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image2bin49 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image20bin533 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image21bin564 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image22bin81 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image23bin539 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image24bin151 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image25bin453 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image26bin520 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image27bin565 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image28bin416 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image29bin121 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image3bin10835 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image30bin663 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image31bin78 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image32bin556 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image33bin598 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image34bin496 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image35bin724 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image36bin404 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image37bin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image38bin8330 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image39bin369 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image4bin268 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image5bin492 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image6bin246 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image7bin551 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image8bin497 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image9bin492 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/index.html433
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image1bin113 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image10bin5088 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image11bin4485 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image12bin3579 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image13bin5119 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image14bin3603 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image2bin74 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image3bin681 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image4bin3056 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image5bin2297 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image6bin79 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image7bin1613 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image8bin864 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image9bin2379 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/index.html2787
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image1bin42 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image2bin14343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image3bin17750 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image4bin61 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image5bin201 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image6bin214 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image7bin149 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image8bin203 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image9bin1504 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/index.html768
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/ss.rb436
-rw-r--r--ext/tk/sample/tkextlib/tkimg/demo.rb1478
-rw-r--r--ext/tk/sample/tkextlib/tkimg/license_terms_of_Img_extension41
-rw-r--r--ext/tk/sample/tkextlib/tkimg/readme.txt3
-rw-r--r--ext/tk/sample/tkextlib/tktable/Orig_LICENSE.txt52
-rw-r--r--ext/tk/sample/tkextlib/tktable/basic.rb60
-rw-r--r--ext/tk/sample/tkextlib/tktable/buttons.rb76
-rw-r--r--ext/tk/sample/tkextlib/tktable/command.rb89
-rw-r--r--ext/tk/sample/tkextlib/tktable/debug.rb101
-rw-r--r--ext/tk/sample/tkextlib/tktable/dynarows.rb99
-rw-r--r--ext/tk/sample/tkextlib/tktable/maxsize.rb67
-rw-r--r--ext/tk/sample/tkextlib/tktable/spreadsheet.rb137
-rwxr-xr-xext/tk/sample/tkextlib/tktable/tcllogo.gifbin2341 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/tktable/valid.rb88
-rw-r--r--ext/tk/sample/tkextlib/treectrl/bitmaps.rb76
-rw-r--r--ext/tk/sample/tkextlib/treectrl/demo.rb1310
-rw-r--r--ext/tk/sample/tkextlib/treectrl/explorer.rb430
-rw-r--r--ext/tk/sample/tkextlib/treectrl/help.rb404
-rw-r--r--ext/tk/sample/tkextlib/treectrl/imovie.rb130
-rw-r--r--ext/tk/sample/tkextlib/treectrl/layout.rb159
-rw-r--r--ext/tk/sample/tkextlib/treectrl/mailwasher.rb269
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-folders.rb124
-rw-r--r--ext/tk/sample/tkextlib/treectrl/outlook-newgroup.rb448
-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-dll.gifbin437 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-exe.gifbin368 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-file.gifbin466 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-folder.gifbin459 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/big-txt.gifbin392 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/checked.gifbin78 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/file.gifbin279 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-closed.gifbin111 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/folder-open.gifbin120 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-closed.gifbin115 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-book-open.gifbin128 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/help-page.gifbin132 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-01.gifbin5406 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-02.gifbin5912 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-03.gifbin4696 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-04.gifbin5783 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-05.gifbin3238 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-06.gifbin3509 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/imovie-07.gifbin2091 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-off.gifbin70 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-check-on.gifbin76 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-print.gifbin124 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-off.gifbin68 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-radio-on.gifbin71 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-search.gifbin114 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/internet-security.gifbin108 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-collapse.gifbin275 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/mac-expand.gifbin277 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-arrow.gifbin73 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-clip.gifbin73 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-deleted.gifbin138 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-draft.gifbin134 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-folder.gifbin133 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-group.gifbin144 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-inbox.gifbin133 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-local.gifbin146 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-main.gifbin174 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-outbox.gifbin136 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read-2.gifbin343 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-read.gifbin304 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-sent.gifbin132 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-server.gifbin163 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-unread.gifbin303 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/outlook-watch.gifbin98 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/sky.gifbin6454 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-dll.gifbin311 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-exe.gifbin115 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-file.gifbin338 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-folder.gifbin307 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/small-txt.gifbin302 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/pics/unchecked.gifbin72 -> 0 bytes-rw-r--r--ext/tk/sample/tkextlib/treectrl/random.rb508
-rw-r--r--ext/tk/sample/tkextlib/treectrl/readme.txt2
-rw-r--r--ext/tk/sample/tkextlib/treectrl/www-options.rb303
-rw-r--r--ext/tk/sample/tkextlib/vu/Orig_LICENSE.txt51
-rw-r--r--ext/tk/sample/tkextlib/vu/README.txt50
-rw-r--r--ext/tk/sample/tkextlib/vu/canvItems.rb90
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker.rb82
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker2.rb99
-rw-r--r--ext/tk/sample/tkextlib/vu/dial_demo.rb113
-rw-r--r--ext/tk/sample/tkextlib/vu/m128_000.xbm174
-rw-r--r--ext/tk/sample/tkextlib/vu/oscilloscope.rb68
-rw-r--r--ext/tk/sample/tkextlib/vu/pie.rb56
-rw-r--r--ext/tk/sample/tkextlib/vu/vu_demo.rb67
-rw-r--r--ext/tk/sample/tkfrom.rb132
-rw-r--r--ext/tk/sample/tkhello.rb10
-rw-r--r--ext/tk/sample/tkline.rb47
-rw-r--r--ext/tk/sample/tkmenubutton.rb135
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb2.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_tk.rb118
-rw-r--r--ext/tk/sample/tkmulticolumnlist.rb743
-rw-r--r--ext/tk/sample/tkmultilistbox.rb654
-rw-r--r--ext/tk/sample/tkmultilistframe.rb940
-rw-r--r--ext/tk/sample/tkoptdb-safeTk.rb73
-rw-r--r--ext/tk/sample/tkoptdb.rb106
-rw-r--r--ext/tk/sample/tkrttimer.rb68
-rw-r--r--ext/tk/sample/tktextframe.rb162
-rw-r--r--ext/tk/sample/tktextio.rb603
-rw-r--r--ext/tk/sample/tktimer.rb50
-rw-r--r--ext/tk/sample/tktimer2.rb47
-rw-r--r--ext/tk/sample/tktimer3.rb59
-rw-r--r--ext/tk/sample/tktree.rb103
-rw-r--r--ext/tk/sample/tktree.tcl305
-rw-r--r--ext/tk/stubs.c516
-rw-r--r--ext/tk/stubs.h33
-rw-r--r--ext/tk/tcltklib.c8152
-rw-r--r--ext/tk/tkutil/.cvsignore3
-rw-r--r--ext/tk/tkutil/depend1
-rw-r--r--ext/tk/tkutil/extconf.rb4
-rw-r--r--ext/tk/tkutil/tkutil.c1639
-rw-r--r--ext/win32/depend2
-rw-r--r--ext/win32/extconf.rb4
-rw-r--r--ext/win32/lib/Win32API.rb47
-rw-r--r--ext/win32/lib/win32/importer.rb9
-rw-r--r--ext/win32/lib/win32/registry.rb913
-rw-r--r--ext/win32/lib/win32/resolv.rb148
-rw-r--r--ext/win32/lib/win32/resolv9x.rb253
-rw-r--r--ext/win32/lib/win32/sspi.rb331
-rw-r--r--ext/win32/resolv/depend17
-rw-r--r--ext/win32/resolv/extconf.rb3
-rw-r--r--ext/win32/resolv/resolv.c65
-rw-r--r--ext/win32ole/.cvsignore4
-rw-r--r--ext/win32ole/depend13
-rw-r--r--ext/win32ole/doc/win32ole.rd294
-rw-r--r--ext/win32ole/extconf.rb44
-rw-r--r--ext/win32ole/lib/win32ole.rb33
-rw-r--r--ext/win32ole/lib/win32ole/property.rb1
-rw-r--r--ext/win32ole/sample/excel1.rb21
-rw-r--r--ext/win32ole/sample/excel2.rb21
-rw-r--r--ext/win32ole/sample/excel3.rb10
-rw-r--r--ext/win32ole/sample/ie.rb3
-rw-r--r--ext/win32ole/sample/ieconst.rb3
-rw-r--r--ext/win32ole/sample/ienavi.rb9
-rw-r--r--ext/win32ole/sample/ienavi2.rb41
-rw-r--r--ext/win32ole/sample/oledirs.rb3
-rw-r--r--ext/win32ole/sample/olegen.rb36
-rw-r--r--ext/win32ole/sample/xml.rb37
-rw-r--r--ext/win32ole/tests/oleserver.rb10
-rw-r--r--ext/win32ole/tests/testNIL2VTEMPTY.rb28
-rw-r--r--ext/win32ole/tests/testOLEEVENT.rb91
-rw-r--r--ext/win32ole/tests/testOLEMETHOD.rb92
-rw-r--r--ext/win32ole/tests/testOLEPARAM.rb65
-rw-r--r--ext/win32ole/tests/testOLETYPE.rb96
-rw-r--r--ext/win32ole/tests/testOLEVARIABLE.rb49
-rw-r--r--ext/win32ole/tests/testVARIANT.rb32
-rw-r--r--ext/win32ole/tests/testWIN32OLE.rb372
-rw-r--r--ext/win32ole/tests/test_ole_methods.rb36
-rw-r--r--ext/win32ole/tests/test_propertyputref.rb19
-rw-r--r--ext/win32ole/tests/test_word.rb37
-rw-r--r--ext/win32ole/tests/testall.rb15
-rw-r--r--ext/win32ole/win32ole.c6513
-rw-r--r--ext/win32ole/win32ole.h155
-rw-r--r--ext/win32ole/win32ole_error.c84
-rw-r--r--ext/win32ole/win32ole_error.h9
-rw-r--r--ext/win32ole/win32ole_event.c1277
-rw-r--r--ext/win32ole/win32ole_event.h6
-rw-r--r--ext/win32ole/win32ole_method.c950
-rw-r--r--ext/win32ole/win32ole_method.h16
-rw-r--r--ext/win32ole/win32ole_param.c438
-rw-r--r--ext/win32ole/win32ole_param.h8
-rw-r--r--ext/win32ole/win32ole_record.c604
-rw-r--r--ext/win32ole/win32ole_record.h10
-rw-r--r--ext/win32ole/win32ole_type.c915
-rw-r--r--ext/win32ole/win32ole_type.h8
-rw-r--r--ext/win32ole/win32ole_typelib.c844
-rw-r--r--ext/win32ole/win32ole_typelib.h11
-rw-r--r--ext/win32ole/win32ole_variable.c380
-rw-r--r--ext/win32ole/win32ole_variable.h8
-rw-r--r--ext/win32ole/win32ole_variant.c733
-rw-r--r--ext/win32ole/win32ole_variant.h9
-rw-r--r--ext/win32ole/win32ole_variant_m.c149
-rw-r--r--ext/win32ole/win32ole_variant_m.h7
-rw-r--r--ext/zlib/.cvsignore3
-rw-r--r--ext/zlib/.gitignore1
-rw-r--r--ext/zlib/depend19
-rw-r--r--ext/zlib/doc/zlib.rd911
-rw-r--r--ext/zlib/extconf.rb93
-rw-r--r--ext/zlib/zlib.c3400
-rw-r--r--ext/zlib/zlib.gemspec35
-rw-r--r--file.c5738
-rw-r--r--gc.c12745
-rw-r--r--gc.h131
-rw-r--r--gc.rb169
-rw-r--r--gem_prelude.rb2
-rw-r--r--gems/bundled_gems6
-rw-r--r--golf_prelude.rb130
-rw-r--r--goruby.c66
-rw-r--r--hash.c6297
-rw-r--r--hrtime.h168
-rw-r--r--id_table.c325
-rw-r--r--id_table.h34
-rw-r--r--include/ruby.h35
-rw-r--r--include/ruby/assert.h54
-rw-r--r--include/ruby/backward.h79
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/cxxanyargs.hpp439
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h47
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/debug.h115
-rw-r--r--include/ruby/defines.h540
-rw-r--r--include/ruby/encoding.h429
-rw-r--r--include/ruby/intern.h1230
-rw-r--r--include/ruby/io.h185
-rw-r--r--include/ruby/missing.h278
-rw-r--r--include/ruby/onigmo.h941
-rw-r--r--include/ruby/oniguruma.h8
-rw-r--r--include/ruby/re.h71
-rw-r--r--include/ruby/regex.h46
-rw-r--r--include/ruby/ruby.h2871
-rw-r--r--include/ruby/st.h197
-rw-r--r--include/ruby/subst.h19
-rw-r--r--include/ruby/thread.h57
-rw-r--r--include/ruby/thread_native.h56
-rw-r--r--include/ruby/util.h89
-rw-r--r--include/ruby/version.h74
-rw-r--r--include/ruby/vm.h63
-rw-r--r--include/ruby/win32.h825
-rw-r--r--inits.c138
-rw-r--r--insns.def1543
-rw-r--r--instruby.rb244
-rw-r--r--intern.h500
-rw-r--r--internal.h2697
-rw-r--r--io.c13835
-rw-r--r--io.rb123
-rw-r--r--iseq.c3585
-rw-r--r--iseq.h312
-rw-r--r--keywords42
-rw-r--r--lex.c136
-rw-r--r--lex.c.blt303
-rw-r--r--lib/.document96
-rw-r--r--lib/English.rb109
-rw-r--r--lib/Env.rb18
-rw-r--r--lib/README96
-rw-r--r--lib/abbrev.rb137
-rw-r--r--lib/base64.rb155
-rw-r--r--lib/benchmark.rb489
-rw-r--r--lib/benchmark/benchmark.gemspec29
-rw-r--r--lib/benchmark/version.rb3
-rw-r--r--lib/bundler.rb682
-rw-r--r--lib/bundler/build_metadata.rb51
-rw-r--r--lib/bundler/bundler.gemspec44
-rw-r--r--lib/bundler/capistrano.rb22
-rw-r--r--lib/bundler/cli.rb828
-rw-r--r--lib/bundler/cli/add.rb47
-rw-r--r--lib/bundler/cli/binstubs.rb49
-rw-r--r--lib/bundler/cli/cache.rb48
-rw-r--r--lib/bundler/cli/check.rb38
-rw-r--r--lib/bundler/cli/clean.rb25
-rw-r--r--lib/bundler/cli/common.rb101
-rw-r--r--lib/bundler/cli/config.rb194
-rw-r--r--lib/bundler/cli/console.rb43
-rw-r--r--lib/bundler/cli/doctor.rb140
-rw-r--r--lib/bundler/cli/exec.rb93
-rw-r--r--lib/bundler/cli/gem.rb252
-rw-r--r--lib/bundler/cli/info.rb62
-rw-r--r--lib/bundler/cli/init.rb47
-rw-r--r--lib/bundler/cli/inject.rb60
-rw-r--r--lib/bundler/cli/install.rb218
-rw-r--r--lib/bundler/cli/issue.rb40
-rw-r--r--lib/bundler/cli/list.rb58
-rw-r--r--lib/bundler/cli/lock.rb63
-rw-r--r--lib/bundler/cli/open.rb30
-rw-r--r--lib/bundler/cli/outdated.rb270
-rw-r--r--lib/bundler/cli/package.rb48
-rw-r--r--lib/bundler/cli/platform.rb46
-rw-r--r--lib/bundler/cli/plugin.rb31
-rw-r--r--lib/bundler/cli/pristine.rb47
-rw-r--r--lib/bundler/cli/remove.rb18
-rw-r--r--lib/bundler/cli/show.rb75
-rw-r--r--lib/bundler/cli/update.rb111
-rw-r--r--lib/bundler/cli/viz.rb31
-rw-r--r--lib/bundler/compact_index_client.rb125
-rw-r--r--lib/bundler/compact_index_client/cache.rb118
-rw-r--r--lib/bundler/compact_index_client/updater.rb112
-rw-r--r--lib/bundler/constants.rb7
-rw-r--r--lib/bundler/current_ruby.rb95
-rw-r--r--lib/bundler/definition.rb1002
-rw-r--r--lib/bundler/dep_proxy.rb48
-rw-r--r--lib/bundler/dependency.rb151
-rw-r--r--lib/bundler/deployment.rb69
-rw-r--r--lib/bundler/deprecate.rb44
-rw-r--r--lib/bundler/dsl.rb591
-rw-r--r--lib/bundler/endpoint_specification.rb141
-rw-r--r--lib/bundler/env.rb150
-rw-r--r--lib/bundler/environment_preserver.rb58
-rw-r--r--lib/bundler/errors.rb158
-rw-r--r--lib/bundler/feature_flag.rb63
-rw-r--r--lib/bundler/fetcher.rb315
-rw-r--r--lib/bundler/fetcher/base.rb52
-rw-r--r--lib/bundler/fetcher/compact_index.rb140
-rw-r--r--lib/bundler/fetcher/dependency.rb82
-rw-r--r--lib/bundler/fetcher/downloader.rb87
-rw-r--r--lib/bundler/fetcher/index.rb54
-rw-r--r--lib/bundler/friendly_errors.rb130
-rw-r--r--lib/bundler/gem_helper.rb217
-rw-r--r--lib/bundler/gem_helpers.rb99
-rw-r--r--lib/bundler/gem_remote_fetcher.rb43
-rw-r--r--lib/bundler/gem_tasks.rb7
-rw-r--r--lib/bundler/gem_version_promoter.rb190
-rw-r--r--lib/bundler/gemdeps.rb29
-rw-r--r--lib/bundler/graph.rb152
-rw-r--r--lib/bundler/index.rb213
-rw-r--r--lib/bundler/injector.rb255
-rw-r--r--lib/bundler/inline.rb84
-rw-r--r--lib/bundler/installer.rb311
-rw-r--r--lib/bundler/installer/gem_installer.rb89
-rw-r--r--lib/bundler/installer/parallel_installer.rb229
-rw-r--r--lib/bundler/installer/standalone.rb52
-rw-r--r--lib/bundler/lazy_specification.rb122
-rw-r--r--lib/bundler/lockfile_generator.rb95
-rw-r--r--lib/bundler/lockfile_parser.rb249
-rw-r--r--lib/bundler/match_platform.rb24
-rw-r--r--lib/bundler/mirror.rb223
-rw-r--r--lib/bundler/plugin.rb305
-rw-r--r--lib/bundler/plugin/api.rb81
-rw-r--r--lib/bundler/plugin/api/source.rb304
-rw-r--r--lib/bundler/plugin/dsl.rb53
-rw-r--r--lib/bundler/plugin/events.rb61
-rw-r--r--lib/bundler/plugin/index.rb173
-rw-r--r--lib/bundler/plugin/installer.rb109
-rw-r--r--lib/bundler/plugin/installer/git.rb38
-rw-r--r--lib/bundler/plugin/installer/rubygems.rb27
-rw-r--r--lib/bundler/plugin/source_list.rb27
-rw-r--r--lib/bundler/process_lock.rb24
-rw-r--r--lib/bundler/psyched_yaml.rb37
-rw-r--r--lib/bundler/remote_specification.rb112
-rw-r--r--lib/bundler/resolver.rb421
-rw-r--r--lib/bundler/resolver/spec_group.rb107
-rw-r--r--lib/bundler/retry.rb66
-rw-r--r--lib/bundler/ruby_dsl.rb18
-rw-r--r--lib/bundler/ruby_version.rb137
-rw-r--r--lib/bundler/rubygems_ext.rb154
-rw-r--r--lib/bundler/rubygems_gem_installer.rb99
-rw-r--r--lib/bundler/rubygems_integration.rb648
-rw-r--r--lib/bundler/runtime.rb315
-rw-r--r--lib/bundler/settings.rb434
-rw-r--r--lib/bundler/settings/validator.rb102
-rw-r--r--lib/bundler/setup.rb27
-rw-r--r--lib/bundler/shared_helpers.rb358
-rw-r--r--lib/bundler/similarity_detector.rb63
-rw-r--r--lib/bundler/source.rb94
-rw-r--r--lib/bundler/source/gemspec.rb18
-rw-r--r--lib/bundler/source/git.rb336
-rw-r--r--lib/bundler/source/git/git_proxy.rb259
-rw-r--r--lib/bundler/source/metadata.rb67
-rw-r--r--lib/bundler/source/path.rb254
-rw-r--r--lib/bundler/source/path/installer.rb74
-rw-r--r--lib/bundler/source/rubygems.rb545
-rw-r--r--lib/bundler/source/rubygems/remote.rb68
-rw-r--r--lib/bundler/source_list.rb183
-rw-r--r--lib/bundler/spec_set.rb203
-rw-r--r--lib/bundler/stub_specification.rb96
-rw-r--r--lib/bundler/templates/.document1
-rw-r--r--lib/bundler/templates/Executable29
-rw-r--r--lib/bundler/templates/Executable.bundler114
-rw-r--r--lib/bundler/templates/Executable.standalone14
-rw-r--r--lib/bundler/templates/Gemfile7
-rw-r--r--lib/bundler/templates/gems.rb8
-rw-r--r--lib/bundler/templates/newgem/CODE_OF_CONDUCT.md.tt74
-rw-r--r--lib/bundler/templates/newgem/Gemfile.tt12
-rw-r--r--lib/bundler/templates/newgem/LICENSE.txt.tt21
-rw-r--r--lib/bundler/templates/newgem/README.md.tt48
-rw-r--r--lib/bundler/templates/newgem/Rakefile.tt29
-rw-r--r--lib/bundler/templates/newgem/bin/console.tt14
-rw-r--r--lib/bundler/templates/newgem/bin/setup.tt8
-rw-r--r--lib/bundler/templates/newgem/exe/newgem.tt3
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf.rb.tt3
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.c.tt9
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.h.tt6
-rw-r--r--lib/bundler/templates/newgem/gitignore.tt20
-rw-r--r--lib/bundler/templates/newgem/lib/newgem.rb.tt13
-rw-r--r--lib/bundler/templates/newgem/lib/newgem/version.rb.tt7
-rw-r--r--lib/bundler/templates/newgem/newgem.gemspec.tt34
-rw-r--r--lib/bundler/templates/newgem/rspec.tt3
-rw-r--r--lib/bundler/templates/newgem/spec/newgem_spec.rb.tt9
-rw-r--r--lib/bundler/templates/newgem/spec/spec_helper.rb.tt14
-rw-r--r--lib/bundler/templates/newgem/test/newgem_test.rb.tt11
-rw-r--r--lib/bundler/templates/newgem/test/test_helper.rb.tt4
-rw-r--r--lib/bundler/templates/newgem/travis.yml.tt6
-rw-r--r--lib/bundler/ui.rb9
-rw-r--r--lib/bundler/ui/rg_proxy.rb19
-rw-r--r--lib/bundler/ui/shell.rb142
-rw-r--r--lib/bundler/ui/silent.rb69
-rw-r--r--lib/bundler/uri_credentials_filter.rb41
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool.rb161
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/monotonic_time.rb66
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/timed_stack.rb176
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/version.rb3
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils.rb1764
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils/version.rb5
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo.rb12
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/compatibility.rb26
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/resolution_state.rb57
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/specification_provider.rb81
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph.rb223
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/action.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb66
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_vertex.rb62
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb61
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/log.rb126
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/set_payload.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/tag.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/vertex.rb158
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/errors.rb143
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/gem_metadata.rb6
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/specification_provider.rb101
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/ui.rb67
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolution.rb837
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolver.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/state.rb58
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent.rb1202
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/connection.rb40
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/pool.rb53
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/timed_stack_multi.rb79
-rw-r--r--lib/bundler/vendor/thor/lib/thor.rb524
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions.rb336
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_file.rb104
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_link.rb60
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/directory.rb108
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/empty_directory.rb143
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/file_manipulation.rb373
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/inject_into_file.rb120
-rw-r--r--lib/bundler/vendor/thor/lib/thor/base.rb690
-rw-r--r--lib/bundler/vendor/thor/lib/thor/command.rb142
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/hash_with_indifferent_access.rb97
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/io_binary_read.rb12
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/ordered_hash.rb129
-rw-r--r--lib/bundler/vendor/thor/lib/thor/error.rb110
-rw-r--r--lib/bundler/vendor/thor/lib/thor/group.rb281
-rw-r--r--lib/bundler/vendor/thor/lib/thor/invocation.rb178
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor.rb17
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/basic.rb37
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/readline.rb88
-rw-r--r--lib/bundler/vendor/thor/lib/thor/nested_context.rb29
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/argument.rb70
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/arguments.rb175
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/option.rb159
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/options.rb236
-rw-r--r--lib/bundler/vendor/thor/lib/thor/rake_compat.rb72
-rw-r--r--lib/bundler/vendor/thor/lib/thor/runner.rb325
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell.rb81
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/basic.rb491
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/color.rb153
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/html.rb126
-rw-r--r--lib/bundler/vendor/thor/lib/thor/util.rb284
-rw-r--r--lib/bundler/vendor/thor/lib/thor/version.rb3
-rw-r--r--lib/bundler/vendor/uri/lib/uri.rb104
-rw-r--r--lib/bundler/vendor/uri/lib/uri/common.rb744
-rw-r--r--lib/bundler/vendor/uri/lib/uri/file.rb94
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ftp.rb267
-rw-r--r--lib/bundler/vendor/uri/lib/uri/generic.rb1568
-rw-r--r--lib/bundler/vendor/uri/lib/uri/http.rb88
-rw-r--r--lib/bundler/vendor/uri/lib/uri/https.rb23
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldap.rb261
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldaps.rb21
-rw-r--r--lib/bundler/vendor/uri/lib/uri/mailto.rb294
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc2396_parser.rb546
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb125
-rw-r--r--lib/bundler/vendor/uri/lib/uri/version.rb6
-rw-r--r--lib/bundler/vendored_fileutils.rb4
-rw-r--r--lib/bundler/vendored_molinillo.rb4
-rw-r--r--lib/bundler/vendored_persistent.rb54
-rw-r--r--lib/bundler/vendored_thor.rb8
-rw-r--r--lib/bundler/vendored_uri.rb4
-rw-r--r--lib/bundler/version.rb9
-rw-r--r--lib/bundler/version_ranges.rb122
-rw-r--r--lib/bundler/vlad.rb17
-rw-r--r--lib/bundler/worker.rb104
-rw-r--r--lib/bundler/yaml_serializer.rb89
-rw-r--r--lib/cgi-lib.rb272
-rw-r--r--lib/cgi.rb2215
-rw-r--r--lib/cgi/.document2
-rw-r--r--lib/cgi/cgi.gemspec27
-rw-r--r--lib/cgi/cookie.rb182
-rw-r--r--lib/cgi/core.rb889
-rw-r--r--lib/cgi/html.rb1035
-rw-r--r--lib/cgi/session.rb294
-rw-r--r--lib/cgi/session/pstore.rb75
-rw-r--r--lib/cgi/util.rb223
-rw-r--r--lib/cgi/version.rb3
-rw-r--r--lib/complex.rb631
-rw-r--r--lib/csv.rb2261
-rw-r--r--lib/csv/core_ext/array.rb9
-rw-r--r--lib/csv/core_ext/string.rb9
-rw-r--r--lib/csv/csv.gemspec44
-rw-r--r--lib/csv/delete_suffix.rb18
-rw-r--r--lib/csv/fields_converter.rb84
-rw-r--r--lib/csv/match_p.rb20
-rw-r--r--lib/csv/parser.rb1136
-rw-r--r--lib/csv/row.rb390
-rw-r--r--lib/csv/table.rb402
-rw-r--r--lib/csv/version.rb6
-rw-r--r--lib/csv/writer.rb168
-rw-r--r--lib/date.rb1328
-rw-r--r--lib/date/format.rb603
-rw-r--r--lib/date2.rb5
-rw-r--r--lib/debug.rb1733
-rw-r--r--lib/delegate.rb560
-rw-r--r--lib/delegate/delegate.gemspec27
-rw-r--r--lib/delegate/version.rb3
-rw-r--r--lib/did_you_mean.rb110
-rw-r--r--lib/did_you_mean/core_ext/name_error.rb25
-rw-r--r--lib/did_you_mean/did_you_mean.gemspec27
-rw-r--r--lib/did_you_mean/experimental.rb2
-rw-r--r--lib/did_you_mean/experimental/initializer_name_correction.rb20
-rw-r--r--lib/did_you_mean/experimental/ivar_name_correction.rb76
-rw-r--r--lib/did_you_mean/formatters/plain_formatter.rb33
-rw-r--r--lib/did_you_mean/formatters/verbose_formatter.rb49
-rw-r--r--lib/did_you_mean/jaro_winkler.rb87
-rw-r--r--lib/did_you_mean/levenshtein.rb57
-rw-r--r--lib/did_you_mean/spell_checker.rb46
-rw-r--r--lib/did_you_mean/spell_checkers/key_error_checker.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/method_name_checker.rb64
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/class_name_checker.rb49
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/variable_name_checker.rb82
-rw-r--r--lib/did_you_mean/spell_checkers/null_checker.rb6
-rw-r--r--lib/did_you_mean/tree_spell_checker.rb137
-rw-r--r--lib/did_you_mean/verbose.rb4
-rw-r--r--lib/did_you_mean/version.rb3
-rw-r--r--lib/drb.rb1
-rw-r--r--lib/drb/acl.rb179
-rw-r--r--lib/drb/drb.rb935
-rw-r--r--lib/drb/eq.rb5
-rw-r--r--lib/drb/extserv.rb52
-rw-r--r--lib/drb/extservm.rb76
-rw-r--r--lib/drb/gw.rb45
-rw-r--r--lib/drb/invokemethod.rb15
-rw-r--r--lib/drb/observer.rb24
-rw-r--r--lib/drb/ssl.rb348
-rw-r--r--lib/drb/timeridconv.rb112
-rw-r--r--lib/drb/unix.rb68
-rw-r--r--lib/drb/weakidconv.rb59
-rw-r--r--lib/e2mmap.rb195
-rw-r--r--lib/erb.rb1025
-rw-r--r--lib/eregex.rb37
-rw-r--r--lib/fileutils.gemspec31
-rw-r--r--lib/fileutils.rb1402
-rw-r--r--lib/finalize.rb193
-rw-r--r--lib/find.rb65
-rw-r--r--lib/forwardable.rb342
-rw-r--r--lib/forwardable/forwardable.gemspec23
-rw-r--r--lib/forwardable/impl.rb16
-rw-r--r--lib/forwardable/version.rb5
-rw-r--r--lib/ftools.rb261
-rw-r--r--lib/generator.rb380
-rw-r--r--lib/getoptlong.rb312
-rw-r--r--lib/getoptlong/getoptlong.gemspec29
-rw-r--r--lib/getoptlong/version.rb3
-rw-r--r--lib/getopts.rb127
-rw-r--r--lib/gserver.rb253
-rw-r--r--lib/importenv.rb33
-rw-r--r--lib/ipaddr.gemspec28
-rw-r--r--lib/ipaddr.rb782
-rw-r--r--lib/irb.rb893
-rw-r--r--lib/irb/cmd/chws.rb27
-rw-r--r--lib/irb/cmd/fork.rb46
-rw-r--r--lib/irb/cmd/help.rb36
-rw-r--r--lib/irb/cmd/load.rb74
-rw-r--r--lib/irb/cmd/nop.rb26
-rw-r--r--lib/irb/cmd/pushws.rb32
-rw-r--r--lib/irb/cmd/subirb.rb34
-rw-r--r--lib/irb/color.rb233
-rw-r--r--lib/irb/completion.rb460
-rw-r--r--lib/irb/context.rb414
-rw-r--r--lib/irb/ext/change-ws.rb60
-rw-r--r--lib/irb/ext/history.rb131
-rw-r--r--lib/irb/ext/loader.rb147
-rw-r--r--lib/irb/ext/math-mode.rb37
-rw-r--r--lib/irb/ext/multi-irb.rb252
-rw-r--r--lib/irb/ext/save-history.rb114
-rw-r--r--lib/irb/ext/tracer.rb64
-rw-r--r--lib/irb/ext/use-loader.rb56
-rw-r--r--lib/irb/ext/workspaces.rb49
-rw-r--r--lib/irb/extend-command.rb328
-rw-r--r--lib/irb/frame.rb47
-rw-r--r--lib/irb/help.rb38
-rw-r--r--lib/irb/init.rb297
-rw-r--r--lib/irb/input-method.rb255
-rw-r--r--lib/irb/inspector.rb142
-rw-r--r--lib/irb/irb.gemspec83
-rw-r--r--lib/irb/lc/.document4
-rw-r--r--lib/irb/lc/error.rb83
-rw-r--r--lib/irb/lc/help-message57
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb11
-rw-r--r--lib/irb/lc/ja/error.rb83
-rw-r--r--lib/irb/lc/ja/help-message75
-rw-r--r--lib/irb/locale.rb200
-rw-r--r--lib/irb/magic-file.rb38
-rw-r--r--lib/irb/notifier.rb211
-rw-r--r--lib/irb/output-method.rb83
-rw-r--r--lib/irb/ruby-lex.rb1445
-rw-r--r--lib/irb/ruby-token.rb273
-rw-r--r--lib/irb/ruby_logo.aa38
-rw-r--r--lib/irb/slex.rb285
-rw-r--r--lib/irb/src_encoding.rb7
-rw-r--r--lib/irb/version.rb15
-rw-r--r--lib/irb/workspace.rb212
-rw-r--r--lib/irb/ws-for-case-2.rb12
-rw-r--r--lib/irb/xmp.rb120
-rw-r--r--lib/jcode.rb220
-rw-r--r--lib/logger.rb676
-rw-r--r--lib/logger/errors.rb9
-rw-r--r--lib/logger/formatter.rb36
-rw-r--r--lib/logger/log_device.rb205
-rw-r--r--lib/logger/logger.gemspec29
-rw-r--r--lib/logger/period.rb47
-rw-r--r--lib/logger/severity.rb19
-rw-r--r--lib/logger/version.rb5
-rw-r--r--lib/mailread.rb62
-rw-r--r--lib/mathn.rb308
-rw-r--r--lib/matrix.rb2391
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb882
-rw-r--r--lib/matrix/lup_decomposition.rb219
-rw-r--r--lib/matrix/matrix.gemspec28
-rw-r--r--lib/matrix/version.rb5
-rw-r--r--lib/mkmf.rb3734
-rw-r--r--lib/monitor.rb352
-rw-r--r--lib/mutex_m.gemspec27
-rw-r--r--lib/mutex_m.rb134
-rw-r--r--lib/net/ftp.rb1476
-rw-r--r--lib/net/http.rb2790
-rw-r--r--lib/net/http/backward.rb26
-rw-r--r--lib/net/http/exceptions.rb33
-rw-r--r--lib/net/http/generic_request.rb339
-rw-r--r--lib/net/http/header.rb496
-rw-r--r--lib/net/http/proxy_delta.rb17
-rw-r--r--lib/net/http/request.rb21
-rw-r--r--lib/net/http/requests.rb123
-rw-r--r--lib/net/http/response.rb426
-rw-r--r--lib/net/http/responses.rb307
-rw-r--r--lib/net/http/status.rb83
-rw-r--r--lib/net/https.rb168
-rw-r--r--lib/net/imap.rb1747
-rw-r--r--lib/net/pop.rb394
-rw-r--r--lib/net/pop/net-pop.gemspec27
-rw-r--r--lib/net/pop/version.rb6
-rw-r--r--lib/net/protocol.rb202
-rw-r--r--lib/net/smtp.rb847
-rw-r--r--lib/net/smtp/net-smtp.gemspec27
-rw-r--r--lib/net/smtp/version.rb6
-rw-r--r--lib/net/telnet.rb749
-rw-r--r--lib/observer.rb108
-rw-r--r--lib/observer/observer.gemspec29
-rw-r--r--lib/observer/version.rb3
-rw-r--r--lib/open-uri.rb507
-rw-r--r--lib/open3.rb792
-rw-r--r--lib/open3/open3.gemspec29
-rw-r--r--lib/open3/version.rb3
-rw-r--r--lib/optionparser.rb2
-rw-r--r--lib/optparse.rb1048
-rw-r--r--lib/optparse/ac.rb54
-rw-r--r--lib/optparse/date.rb1
-rw-r--r--lib/optparse/kwargs.rb17
-rw-r--r--lib/optparse/shellwords.rb1
-rw-r--r--lib/optparse/time.rb1
-rw-r--r--lib/optparse/uri.rb1
-rw-r--r--lib/optparse/version.rb13
-rw-r--r--lib/ostruct.rb367
-rw-r--r--lib/ostruct/ostruct.gemspec28
-rw-r--r--lib/ostruct/version.rb5
-rw-r--r--lib/parsearg.rb87
-rw-r--r--lib/parsedate.rb15
-rw-r--r--lib/pathname.rb1062
-rw-r--r--lib/ping.rb53
-rw-r--r--lib/pp.rb518
-rw-r--r--lib/prettyprint.rb780
-rw-r--r--lib/prime.gemspec27
-rw-r--r--lib/prime.rb463
-rw-r--r--lib/profile.rb6
-rw-r--r--lib/profiler.rb59
-rw-r--r--lib/pstore.rb407
-rw-r--r--lib/pstore/pstore.gemspec29
-rw-r--r--lib/pstore/version.rb3
-rw-r--r--lib/racc.rb6
-rw-r--r--lib/racc/compat.rb32
-rw-r--r--lib/racc/debugflags.rb59
-rw-r--r--lib/racc/exception.rb13
-rw-r--r--lib/racc/grammar.rb1113
-rw-r--r--lib/racc/grammarfileparser.rb560
-rw-r--r--lib/racc/info.rb14
-rw-r--r--lib/racc/iset.rb91
-rw-r--r--lib/racc/logfilegenerator.rb211
-rw-r--r--lib/racc/parser-text.rb643
-rw-r--r--lib/racc/parser.rb312
-rw-r--r--lib/racc/parserfilegenerator.rb510
-rw-r--r--lib/racc/pre-setup13
-rw-r--r--lib/racc/racc.gemspec105
-rw-r--r--lib/racc/rdoc/grammar.en.rdoc219
-rw-r--r--lib/racc/sourcetext.rb34
-rw-r--r--lib/racc/state.rb969
-rw-r--r--lib/racc/statetransitiontable.rb316
-rw-r--r--lib/racc/static.rb5
-rw-r--r--lib/rational.rb530
-rw-r--r--lib/rdoc.rb180
-rw-r--r--lib/rdoc/.document2
-rw-r--r--lib/rdoc/README489
-rw-r--r--lib/rdoc/alias.rb112
-rw-r--r--lib/rdoc/anon_class.rb11
-rw-r--r--lib/rdoc/any_method.rb316
-rw-r--r--lib/rdoc/attr.rb176
-rw-r--r--lib/rdoc/class_module.rb802
-rw-r--r--lib/rdoc/code_object.rb421
-rw-r--r--lib/rdoc/code_objects.rb767
-rw-r--r--lib/rdoc/comment.rb250
-rw-r--r--lib/rdoc/constant.rb187
-rw-r--r--lib/rdoc/context.rb1258
-rw-r--r--lib/rdoc/context/section.rb245
-rw-r--r--lib/rdoc/cross_reference.rb202
-rw-r--r--lib/rdoc/diagram.rb335
-rw-r--r--lib/rdoc/dot/dot.rb255
-rw-r--r--lib/rdoc/encoding.rb136
-rw-r--r--lib/rdoc/erb_partial.rb19
-rw-r--r--lib/rdoc/erbio.rb42
-rw-r--r--lib/rdoc/extend.rb10
-rw-r--r--lib/rdoc/generator.rb51
-rw-r--r--lib/rdoc/generator/darkfish.rb790
-rw-r--r--lib/rdoc/generator/json_index.rb300
-rw-r--r--lib/rdoc/generator/markup.rb160
-rw-r--r--lib/rdoc/generator/pot.rb98
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb68
-rw-r--r--lib/rdoc/generator/pot/po.rb84
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb141
-rw-r--r--lib/rdoc/generator/ri.rb31
-rw-r--r--lib/rdoc/generator/template/darkfish/.document (renamed from install-sh)0
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml5
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml23
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_navigation.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_search.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml172
-rw-r--r--lib/rdoc/generator/template/darkfish/css/fonts.css167
-rw-r--r--lib/rdoc/generator/template/darkfish/css/rdoc.css619
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Light.ttfbin0 -> 94668 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-LightItalic.ttfbin0 -> 94196 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Regular.ttfbin0 -> 96184 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-RegularItalic.ttfbin0 -> 95316 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Bold.ttfbin0 -> 71200 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Regular.ttfbin0 -> 71692 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/add.pngbin0 -> 733 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/arrow_up.pngbin0 -> 372 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick.pngbin0 -> 452 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick_link.pngbin0 -> 764 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bug.pngbin0 -> 774 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_black.pngbin0 -> 211 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_minus.pngbin0 -> 207 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_plus.pngbin0 -> 209 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/date.pngbin0 -> 626 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/delete.pngbin0 -> 715 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/find.pngbin0 -> 659 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/loadingAnimation.gifbin0 -> 5886 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/macFFBgHack.pngbin0 -> 207 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/package.pngbin0 -> 853 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_green.pngbin0 -> 621 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_text.pngbin0 -> 342 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_width.pngbin0 -> 309 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/plugin.pngbin0 -> 591 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/ruby.pngbin0 -> 592 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_blue.pngbin0 -> 1880 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_green.pngbin0 -> 613 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/transparent.pngbin0 -> 97 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench.pngbin0 -> 610 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench_orange.pngbin0 -> 584 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/zoom.pngbin0 -> 692 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml23
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js84
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js110
-rw-r--r--lib/rdoc/generator/template/darkfish/page.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_not_found.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml63
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml58
-rw-r--r--lib/rdoc/generator/template/json_index/.document1
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js105
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js229
-rw-r--r--lib/rdoc/generators/chm_generator.rb112
-rw-r--r--lib/rdoc/generators/html_generator.rb1509
-rw-r--r--lib/rdoc/generators/ri_generator.rb268
-rw-r--r--lib/rdoc/generators/template/chm/chm.rb87
-rw-r--r--lib/rdoc/generators/template/html/hefss.rb418
-rw-r--r--lib/rdoc/generators/template/html/html.rb711
-rw-r--r--lib/rdoc/generators/template/html/kilmer.rb435
-rw-r--r--lib/rdoc/generators/template/html/old_html.rb728
-rw-r--r--lib/rdoc/generators/template/html/one_page_html.rb122
-rw-r--r--lib/rdoc/generators/template/xml/rdf.rb112
-rw-r--r--lib/rdoc/generators/template/xml/xml.rb112
-rw-r--r--lib/rdoc/generators/xml_generator.rb130
-rw-r--r--lib/rdoc/ghost_method.rb7
-rw-r--r--lib/rdoc/i18n.rb10
-rw-r--r--lib/rdoc/i18n/locale.rb102
-rw-r--r--lib/rdoc/i18n/text.rb126
-rw-r--r--lib/rdoc/include.rb10
-rw-r--r--lib/rdoc/known_classes.rb73
-rw-r--r--lib/rdoc/markdown.rb16287
-rw-r--r--lib/rdoc/markdown/entities.rb2132
-rw-r--r--lib/rdoc/markdown/literals.rb417
-rw-r--r--lib/rdoc/markup.rb866
-rw-r--r--lib/rdoc/markup/.document2
-rw-r--r--lib/rdoc/markup/attr_changer.rb23
-rw-r--r--lib/rdoc/markup/attr_span.rb30
-rw-r--r--lib/rdoc/markup/attribute_manager.rb344
-rw-r--r--lib/rdoc/markup/attributes.rb71
-rw-r--r--lib/rdoc/markup/blank_line.rb28
-rw-r--r--lib/rdoc/markup/block_quote.rb15
-rw-r--r--lib/rdoc/markup/document.rb165
-rw-r--r--lib/rdoc/markup/formatter.rb266
-rw-r--r--lib/rdoc/markup/hard_break.rb32
-rw-r--r--lib/rdoc/markup/heading.rb79
-rw-r--r--lib/rdoc/markup/include.rb43
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb48
-rw-r--r--lib/rdoc/markup/list.rb102
-rw-r--r--lib/rdoc/markup/list_item.rb100
-rw-r--r--lib/rdoc/markup/paragraph.rb29
-rw-r--r--lib/rdoc/markup/parser.rb575
-rw-r--r--lib/rdoc/markup/pre_process.rb296
-rw-r--r--lib/rdoc/markup/raw.rb70
-rw-r--r--lib/rdoc/markup/regexp_handling.rb41
-rw-r--r--lib/rdoc/markup/rule.rb21
-rw-r--r--lib/rdoc/markup/sample/rdoc2latex.rb16
-rw-r--r--lib/rdoc/markup/sample/sample.rb42
-rw-r--r--lib/rdoc/markup/simple_markup.rb476
-rw-r--r--lib/rdoc/markup/simple_markup/fragments.rb328
-rw-r--r--lib/rdoc/markup/simple_markup/inline.rb340
-rw-r--r--lib/rdoc/markup/simple_markup/lines.rb151
-rw-r--r--lib/rdoc/markup/simple_markup/preprocess.rb73
-rw-r--r--lib/rdoc/markup/simple_markup/to_flow.rb188
-rw-r--r--lib/rdoc/markup/simple_markup/to_html.rb289
-rw-r--r--lib/rdoc/markup/simple_markup/to_latex.rb333
-rw-r--r--lib/rdoc/markup/test/AllTests.rb2
-rw-r--r--lib/rdoc/markup/test/TestInline.rb154
-rw-r--r--lib/rdoc/markup/test/TestParse.rb503
-rw-r--r--lib/rdoc/markup/to_ansi.rb94
-rw-r--r--lib/rdoc/markup/to_bs.rb77
-rw-r--r--lib/rdoc/markup/to_html.rb404
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb168
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb285
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb46
-rw-r--r--lib/rdoc/markup/to_label.rb75
-rw-r--r--lib/rdoc/markup/to_markdown.rb192
-rw-r--r--lib/rdoc/markup/to_rdoc.rb334
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb88
-rw-r--r--lib/rdoc/markup/to_test.rb70
-rw-r--r--lib/rdoc/markup/to_tt_only.rb121
-rw-r--r--lib/rdoc/markup/verbatim.rb84
-rw-r--r--lib/rdoc/meta_method.rb7
-rw-r--r--lib/rdoc/method_attr.rb419
-rw-r--r--lib/rdoc/mixin.rb121
-rw-r--r--lib/rdoc/normal_class.rb93
-rw-r--r--lib/rdoc/normal_module.rb74
-rw-r--r--lib/rdoc/options.rb1652
-rw-r--r--lib/rdoc/parser.rb277
-rw-r--r--lib/rdoc/parser/c.rb1259
-rw-r--r--lib/rdoc/parser/changelog.rb204
-rw-r--r--lib/rdoc/parser/markdown.rb24
-rw-r--r--lib/rdoc/parser/rd.rb23
-rw-r--r--lib/rdoc/parser/ripper_state_lex.rb590
-rw-r--r--lib/rdoc/parser/ruby.rb2327
-rw-r--r--lib/rdoc/parser/ruby_tools.rb167
-rw-r--r--lib/rdoc/parser/simple.rb61
-rw-r--r--lib/rdoc/parser/text.rb12
-rw-r--r--lib/rdoc/parsers/parse_c.rb697
-rw-r--r--lib/rdoc/parsers/parse_f95.rb1841
-rw-r--r--lib/rdoc/parsers/parse_rb.rb2605
-rw-r--r--lib/rdoc/parsers/parse_simple.rb41
-rw-r--r--lib/rdoc/parsers/parserfactory.rb99
-rw-r--r--lib/rdoc/rd.rb100
-rw-r--r--lib/rdoc/rd/block_parser.rb1056
-rw-r--r--lib/rdoc/rd/inline.rb72
-rw-r--r--lib/rdoc/rd/inline_parser.rb1208
-rw-r--r--lib/rdoc/rdoc.gemspec246
-rw-r--r--lib/rdoc/rdoc.rb720
-rw-r--r--lib/rdoc/require.rb52
-rw-r--r--lib/rdoc/ri.rb21
-rw-r--r--lib/rdoc/ri/driver.rb1568
-rw-r--r--lib/rdoc/ri/formatter.rb6
-rw-r--r--lib/rdoc/ri/paths.rb185
-rw-r--r--lib/rdoc/ri/ri_cache.rb187
-rw-r--r--lib/rdoc/ri/ri_descriptions.rb154
-rw-r--r--lib/rdoc/ri/ri_display.rb255
-rw-r--r--lib/rdoc/ri/ri_driver.rb143
-rw-r--r--lib/rdoc/ri/ri_formatter.rb674
-rw-r--r--lib/rdoc/ri/ri_options.rb313
-rw-r--r--lib/rdoc/ri/ri_paths.rb80
-rw-r--r--lib/rdoc/ri/ri_reader.rb100
-rw-r--r--lib/rdoc/ri/ri_util.rb75
-rw-r--r--lib/rdoc/ri/ri_writer.rb62
-rw-r--r--lib/rdoc/ri/store.rb7
-rw-r--r--lib/rdoc/ri/task.rb71
-rw-r--r--lib/rdoc/rubygems_hook.rb246
-rw-r--r--lib/rdoc/servlet.rb446
-rw-r--r--lib/rdoc/single_class.rb26
-rw-r--r--lib/rdoc/stats.rb462
-rw-r--r--lib/rdoc/stats/normal.rb58
-rw-r--r--lib/rdoc/stats/quiet.rb60
-rw-r--r--lib/rdoc/stats/verbose.rb46
-rw-r--r--lib/rdoc/store.rb979
-rw-r--r--lib/rdoc/task.rb329
-rw-r--r--lib/rdoc/template.rb234
-rw-r--r--lib/rdoc/text.rb304
-rw-r--r--lib/rdoc/token_stream.rb119
-rw-r--r--lib/rdoc/tokenstream.rb25
-rw-r--r--lib/rdoc/tom_doc.rb263
-rw-r--r--lib/rdoc/top_level.rb289
-rw-r--r--lib/rdoc/usage.rb210
-rw-r--r--lib/rdoc/version.rb8
-rw-r--r--lib/readbytes.rb41
-rw-r--r--lib/readline.gemspec35
-rw-r--r--lib/readline.rb6
-rw-r--r--lib/reline.rb425
-rw-r--r--lib/reline/ansi.rb141
-rw-r--r--lib/reline/config.rb286
-rw-r--r--lib/reline/general_io.rb67
-rw-r--r--lib/reline/history.rb56
-rw-r--r--lib/reline/key_actor.rb7
-rw-r--r--lib/reline/key_actor/base.rb7
-rw-r--r--lib/reline/key_actor/emacs.rb517
-rw-r--r--lib/reline/key_actor/vi_command.rb518
-rw-r--r--lib/reline/key_actor/vi_insert.rb517
-rw-r--r--lib/reline/key_stroke.rb53
-rw-r--r--lib/reline/kill_ring.rb113
-rw-r--r--lib/reline/line_editor.rb2129
-rw-r--r--lib/reline/reline.gemspec26
-rw-r--r--lib/reline/unicode.rb527
-rw-r--r--lib/reline/unicode/east_asian_width.rb1145
-rw-r--r--lib/reline/version.rb3
-rw-r--r--lib/reline/windows.rb236
-rw-r--r--lib/resolv-replace.rb26
-rw-r--r--lib/resolv.rb2039
-rw-r--r--lib/rexml/attlistdecl.rb117
-rw-r--r--lib/rexml/attribute.rb328
-rw-r--r--lib/rexml/cdata.rb118
-rw-r--r--lib/rexml/child.rb167
-rw-r--r--lib/rexml/comment.rb136
-rw-r--r--lib/rexml/doctype.rb107
-rw-r--r--lib/rexml/document.rb416
-rw-r--r--lib/rexml/dtd/attlistdecl.rb17
-rw-r--r--lib/rexml/dtd/dtd.rb90
-rw-r--r--lib/rexml/dtd/elementdecl.rb29
-rw-r--r--lib/rexml/dtd/entitydecl.rb101
-rw-r--r--lib/rexml/dtd/notationdecl.rb67
-rw-r--r--lib/rexml/element.rb2326
-rw-r--r--lib/rexml/encoding.rb93
-rw-r--r--lib/rexml/encodings/CP-1252.rb98
-rw-r--r--lib/rexml/encodings/EUC-JP.rb35
-rw-r--r--lib/rexml/encodings/ICONV.rb22
-rw-r--r--lib/rexml/encodings/ISO-8859-1.rb7
-rw-r--r--lib/rexml/encodings/ISO-8859-15.rb69
-rw-r--r--lib/rexml/encodings/SHIFT-JIS.rb37
-rw-r--r--lib/rexml/encodings/SHIFT_JIS.rb1
-rw-r--r--lib/rexml/encodings/UNILE.rb34
-rw-r--r--lib/rexml/encodings/US-ASCII.rb30
-rw-r--r--lib/rexml/encodings/UTF-16.rb34
-rw-r--r--lib/rexml/encodings/UTF-8.rb18
-rw-r--r--lib/rexml/entity.rb304
-rw-r--r--lib/rexml/formatters/default.rb116
-rw-r--r--lib/rexml/formatters/pretty.rb142
-rw-r--r--lib/rexml/formatters/transitive.rb58
-rw-r--r--lib/rexml/functions.rb212
-rw-r--r--lib/rexml/instruction.rb115
-rw-r--r--lib/rexml/light/node.rb384
-rw-r--r--lib/rexml/namespace.rb92
-rw-r--r--lib/rexml/node.rb102
-rw-r--r--lib/rexml/output.rb32
-rw-r--r--lib/rexml/parent.rb56
-rw-r--r--lib/rexml/parseexception.rb9
-rw-r--r--lib/rexml/parsers/baseparser.rb306
-rw-r--r--lib/rexml/parsers/lightparser.rb91
-rw-r--r--lib/rexml/parsers/pullparser.rb9
-rw-r--r--lib/rexml/parsers/sax2parser.rb447
-rw-r--r--lib/rexml/parsers/streamparser.rb19
-rw-r--r--lib/rexml/parsers/treeparser.rb19
-rw-r--r--lib/rexml/parsers/ultralightparser.rb85
-rw-r--r--lib/rexml/parsers/xpathparser.rb227
-rw-r--r--lib/rexml/quickpath.rb500
-rw-r--r--lib/rexml/rexml.gemspec84
-rw-r--r--lib/rexml/rexml.rb21
-rw-r--r--lib/rexml/sax2listener.rb185
-rw-r--r--lib/rexml/security.rb28
-rw-r--r--lib/rexml/source.rb461
-rw-r--r--lib/rexml/streamlistener.rb181
-rw-r--r--lib/rexml/syncenumerator.rb33
-rw-r--r--lib/rexml/text.rb332
-rw-r--r--lib/rexml/undefinednamespaceexception.rb9
-rw-r--r--lib/rexml/validation/relaxng.rb62
-rw-r--r--lib/rexml/validation/validation.rb25
-rw-r--r--lib/rexml/validation/validationexception.rb1
-rw-r--r--lib/rexml/xmldecl.rb152
-rw-r--r--lib/rexml/xmltokens.rb95
-rw-r--r--lib/rexml/xpath.rb135
-rw-r--r--lib/rexml/xpath_parser.rb1131
-rw-r--r--lib/rinda/rinda.rb70
-rw-r--r--lib/rinda/ring.rb369
-rw-r--r--lib/rinda/tuplespace.rb123
-rw-r--r--lib/rss.rb88
-rw-r--r--lib/rss/0.9.rb99
-rw-r--r--lib/rss/1.0.rb96
-rw-r--r--lib/rss/2.0.rb40
-rw-r--r--lib/rss/atom.rb1025
-rw-r--r--lib/rss/content.rb28
-rw-r--r--lib/rss/content/1.0.rb10
-rw-r--r--lib/rss/content/2.0.rb12
-rw-r--r--lib/rss/converter.rb47
-rw-r--r--lib/rss/dublincore.rb58
-rw-r--r--lib/rss/dublincore/1.0.rb13
-rw-r--r--lib/rss/dublincore/2.0.rb13
-rw-r--r--lib/rss/dublincore/atom.rb17
-rw-r--r--lib/rss/image.rb35
-rw-r--r--lib/rss/itunes.rb425
-rw-r--r--lib/rss/maker.rb78
-rw-r--r--lib/rss/maker/0.9.rb455
-rw-r--r--lib/rss/maker/1.0.rb348
-rw-r--r--lib/rss/maker/2.0.rb174
-rw-r--r--lib/rss/maker/atom.rb173
-rw-r--r--lib/rss/maker/base.rb971
-rw-r--r--lib/rss/maker/content.rb19
-rw-r--r--lib/rss/maker/dublincore.rb155
-rw-r--r--lib/rss/maker/entry.rb164
-rw-r--r--lib/rss/maker/feed.rb427
-rw-r--r--lib/rss/maker/image.rb125
-rw-r--r--lib/rss/maker/itunes.rb243
-rw-r--r--lib/rss/maker/slash.rb34
-rw-r--r--lib/rss/maker/syndication.rb18
-rw-r--r--lib/rss/maker/taxonomy.rb133
-rw-r--r--lib/rss/maker/trackback.rb124
-rw-r--r--lib/rss/parser.rb253
-rw-r--r--lib/rss/rexmlparser.rb16
-rw-r--r--lib/rss/rss.gemspec80
-rw-r--r--lib/rss/rss.rb821
-rw-r--r--lib/rss/slash.rb52
-rw-r--r--lib/rss/syndication.rb21
-rw-r--r--lib/rss/taxonomy.rb27
-rw-r--r--lib/rss/trackback.rb41
-rw-r--r--lib/rss/utils.rb175
-rw-r--r--lib/rss/version.rb4
-rw-r--r--lib/rss/xml-stylesheet.rb11
-rw-r--r--lib/rss/xml.rb72
-rw-r--r--lib/rss/xmlparser.rb18
-rw-r--r--lib/rss/xmlscanner.rb11
-rw-r--r--lib/rubygems.rb1417
-rw-r--r--lib/rubygems/available_set.rb166
-rw-r--r--lib/rubygems/basic_specification.rb343
-rw-r--r--lib/rubygems/bundler_version_finder.rb104
-rw-r--r--lib/rubygems/command.rb660
-rw-r--r--lib/rubygems/command_manager.rb234
-rw-r--r--lib/rubygems/commands/build_command.rb112
-rw-r--r--lib/rubygems/commands/cert_command.rb322
-rw-r--r--lib/rubygems/commands/check_command.rb94
-rw-r--r--lib/rubygems/commands/cleanup_command.rb185
-rw-r--r--lib/rubygems/commands/contents_command.rb190
-rw-r--r--lib/rubygems/commands/dependency_command.rb219
-rw-r--r--lib/rubygems/commands/environment_command.rb176
-rw-r--r--lib/rubygems/commands/fetch_command.rb77
-rw-r--r--lib/rubygems/commands/generate_index_command.rb87
-rw-r--r--lib/rubygems/commands/help_command.rb374
-rw-r--r--lib/rubygems/commands/info_command.rb35
-rw-r--r--lib/rubygems/commands/install_command.rb274
-rw-r--r--lib/rubygems/commands/list_command.rb40
-rw-r--r--lib/rubygems/commands/lock_command.rb110
-rw-r--r--lib/rubygems/commands/mirror_command.rb27
-rw-r--r--lib/rubygems/commands/open_command.rb88
-rw-r--r--lib/rubygems/commands/outdated_command.rb34
-rw-r--r--lib/rubygems/commands/owner_command.rb113
-rw-r--r--lib/rubygems/commands/pristine_command.rb184
-rw-r--r--lib/rubygems/commands/push_command.rb146
-rw-r--r--lib/rubygems/commands/query_command.rb373
-rw-r--r--lib/rubygems/commands/rdoc_command.rb97
-rw-r--r--lib/rubygems/commands/search_command.rb40
-rw-r--r--lib/rubygems/commands/server_command.rb86
-rw-r--r--lib/rubygems/commands/setup_command.rb644
-rw-r--r--lib/rubygems/commands/signin_command.rb35
-rw-r--r--lib/rubygems/commands/signout_command.rb33
-rw-r--r--lib/rubygems/commands/sources_command.rb224
-rw-r--r--lib/rubygems/commands/specification_command.rb147
-rw-r--r--lib/rubygems/commands/stale_command.rb41
-rw-r--r--lib/rubygems/commands/uninstall_command.rb199
-rw-r--r--lib/rubygems/commands/unpack_command.rb177
-rw-r--r--lib/rubygems/commands/update_command.rb284
-rw-r--r--lib/rubygems/commands/which_command.rb89
-rw-r--r--lib/rubygems/commands/yank_command.rb101
-rw-r--r--lib/rubygems/compatibility.rb40
-rw-r--r--lib/rubygems/config_file.rb492
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb75
-rw-r--r--lib/rubygems/core_ext/kernel_require.rb182
-rw-r--r--lib/rubygems/core_ext/kernel_warn.rb55
-rw-r--r--lib/rubygems/defaults.rb201
-rw-r--r--lib/rubygems/dependency.rb351
-rw-r--r--lib/rubygems/dependency_installer.rb411
-rw-r--r--lib/rubygems/dependency_list.rb244
-rw-r--r--lib/rubygems/deprecate.rb70
-rw-r--r--lib/rubygems/doctor.rb131
-rw-r--r--lib/rubygems/errors.rb194
-rw-r--r--lib/rubygems/exceptions.rb292
-rw-r--r--lib/rubygems/ext.rb18
-rw-r--r--lib/rubygems/ext/build_error.rb6
-rw-r--r--lib/rubygems/ext/builder.rb229
-rw-r--r--lib/rubygems/ext/cmake_builder.rb19
-rw-r--r--lib/rubygems/ext/configure_builder.rb23
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb97
-rw-r--r--lib/rubygems/ext/rake_builder.rb35
-rw-r--r--lib/rubygems/gem_runner.rb86
-rw-r--r--lib/rubygems/gemcutter_utilities.rb198
-rw-r--r--lib/rubygems/indexer.rb446
-rw-r--r--lib/rubygems/install_default_message.rb12
-rw-r--r--lib/rubygems/install_message.rb12
-rw-r--r--lib/rubygems/install_update_options.rb190
-rw-r--r--lib/rubygems/installer.rb962
-rw-r--r--lib/rubygems/installer_test_case.rb233
-rw-r--r--lib/rubygems/local_remote_options.rb150
-rw-r--r--lib/rubygems/mock_gem_ui.rb91
-rw-r--r--lib/rubygems/name_tuple.rb125
-rw-r--r--lib/rubygems/package.rb731
-rw-r--r--lib/rubygems/package/digest_io.rb64
-rw-r--r--lib/rubygems/package/file_source.rb33
-rw-r--r--lib/rubygems/package/io_source.rb45
-rw-r--r--lib/rubygems/package/old.rb170
-rw-r--r--lib/rubygems/package/source.rb3
-rw-r--r--lib/rubygems/package/tar_header.rb245
-rw-r--r--lib/rubygems/package/tar_reader.rb127
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb170
-rw-r--r--lib/rubygems/package/tar_test_case.rb141
-rw-r--r--lib/rubygems/package/tar_writer.rb338
-rw-r--r--lib/rubygems/package_task.rb128
-rw-r--r--lib/rubygems/path_support.rb92
-rw-r--r--lib/rubygems/platform.rb206
-rw-r--r--lib/rubygems/psych_additions.rb10
-rw-r--r--lib/rubygems/psych_tree.rb34
-rw-r--r--lib/rubygems/rdoc.rb24
-rw-r--r--lib/rubygems/remote_fetcher.rb359
-rw-r--r--lib/rubygems/request.rb299
-rw-r--r--lib/rubygems/request/connection_pools.rb99
-rw-r--r--lib/rubygems/request/http_pool.rb48
-rw-r--r--lib/rubygems/request/https_pool.rb11
-rw-r--r--lib/rubygems/request_set.rb479
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb846
-rw-r--r--lib/rubygems/request_set/lockfile.rb243
-rw-r--r--lib/rubygems/request_set/lockfile/parser.rb345
-rw-r--r--lib/rubygems/request_set/lockfile/tokenizer.rb114
-rw-r--r--lib/rubygems/requirement.rb313
-rw-r--r--lib/rubygems/resolver.rb345
-rw-r--r--lib/rubygems/resolver/activation_request.rb156
-rw-r--r--lib/rubygems/resolver/api_set.rb125
-rw-r--r--lib/rubygems/resolver/api_specification.rb90
-rw-r--r--lib/rubygems/resolver/best_set.rb78
-rw-r--r--lib/rubygems/resolver/composed_set.rb66
-rw-r--r--lib/rubygems/resolver/conflict.rb155
-rw-r--r--lib/rubygems/resolver/current_set.rb13
-rw-r--r--lib/rubygems/resolver/dependency_request.rb120
-rw-r--r--lib/rubygems/resolver/git_set.rb122
-rw-r--r--lib/rubygems/resolver/git_specification.rb58
-rw-r--r--lib/rubygems/resolver/index_set.rb80
-rw-r--r--lib/rubygems/resolver/index_specification.rb69
-rw-r--r--lib/rubygems/resolver/installed_specification.rb58
-rw-r--r--lib/rubygems/resolver/installer_set.rb227
-rw-r--r--lib/rubygems/resolver/local_specification.rb41
-rw-r--r--lib/rubygems/resolver/lock_set.rb82
-rw-r--r--lib/rubygems/resolver/lock_specification.rb87
-rw-r--r--lib/rubygems/resolver/molinillo.rb2
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo.rb10
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/resolution_state.rb50
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/specification_provider.rb80
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph.rb222
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/action.rb35
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb65
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_vertex.rb61
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/delete_edge.rb62
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb60
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/log.rb125
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/set_payload.rb45
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/tag.rb35
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/vertex.rb125
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/errors.rb75
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/gem_metadata.rb5
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/specification_provider.rb100
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/ui.rb65
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolution.rb494
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolver.rb45
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/state.rb54
-rw-r--r--lib/rubygems/resolver/requirement_list.rb83
-rw-r--r--lib/rubygems/resolver/set.rb57
-rw-r--r--lib/rubygems/resolver/source_set.rb47
-rw-r--r--lib/rubygems/resolver/spec_specification.rb56
-rw-r--r--lib/rubygems/resolver/specification.rb115
-rw-r--r--lib/rubygems/resolver/stats.rb47
-rw-r--r--lib/rubygems/resolver/vendor_set.rb87
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb24
-rw-r--r--lib/rubygems/s3_uri_signer.rb183
-rw-r--r--lib/rubygems/safe_yaml.rb59
-rw-r--r--lib/rubygems/security.rb607
-rw-r--r--lib/rubygems/security/policies.rb115
-rw-r--r--lib/rubygems/security/policy.rb295
-rw-r--r--lib/rubygems/security/signer.rb206
-rw-r--r--lib/rubygems/security/trust_dir.rb119
-rw-r--r--lib/rubygems/security_option.rb42
-rw-r--r--lib/rubygems/server.rb879
-rw-r--r--lib/rubygems/source.rb235
-rw-r--r--lib/rubygems/source/git.rb241
-rw-r--r--lib/rubygems/source/installed.rb40
-rw-r--r--lib/rubygems/source/local.rb133
-rw-r--r--lib/rubygems/source/lock.rb52
-rw-r--r--lib/rubygems/source/specific_file.rb73
-rw-r--r--lib/rubygems/source/vendor.rb27
-rw-r--r--lib/rubygems/source_list.rb153
-rw-r--r--lib/rubygems/source_local.rb7
-rw-r--r--lib/rubygems/source_specific_file.rb6
-rw-r--r--lib/rubygems/spec_fetcher.rb260
-rw-r--r--lib/rubygems/specification.rb2684
-rw-r--r--lib/rubygems/specification_policy.rb427
-rw-r--r--lib/rubygems/ssl_certs/.document1
-rw-r--r--lib/rubygems/ssl_certs/index.rubygems.org/GlobalSignRootCA.pem21
-rw-r--r--lib/rubygems/ssl_certs/rubygems.global.ssl.fastly.net/DigiCertHighAssuranceEVRootCA.pem23
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/AddTrustExternalCARoot.pem25
-rw-r--r--lib/rubygems/stub_specification.rb216
-rw-r--r--lib/rubygems/syck_hack.rb79
-rw-r--r--lib/rubygems/test_case.rb1537
-rw-r--r--lib/rubygems/test_utilities.rb380
-rw-r--r--lib/rubygems/text.rb85
-rw-r--r--lib/rubygems/uninstaller.rb357
-rw-r--r--lib/rubygems/uri_formatter.rb48
-rw-r--r--lib/rubygems/uri_parser.rb36
-rw-r--r--lib/rubygems/uri_parsing.rb23
-rw-r--r--lib/rubygems/user_interaction.rb665
-rw-r--r--lib/rubygems/util.rb107
-rw-r--r--lib/rubygems/util/licenses.rb439
-rw-r--r--lib/rubygems/util/list.rb39
-rw-r--r--lib/rubygems/validator.rb145
-rw-r--r--lib/rubygems/version.rb408
-rw-r--r--lib/rubygems/version_option.rb76
-rw-r--r--lib/rubyunit.rb6
-rw-r--r--lib/runit/assert.rb73
-rw-r--r--lib/runit/cui/testrunner.rb51
-rw-r--r--lib/runit/error.rb9
-rw-r--r--lib/runit/testcase.rb45
-rw-r--r--lib/runit/testresult.rb44
-rw-r--r--lib/runit/testsuite.rb26
-rw-r--r--lib/runit/topublic.rb8
-rw-r--r--lib/scanf.rb702
-rw-r--r--lib/securerandom.rb333
-rw-r--r--lib/set.rb1400
-rw-r--r--lib/shell.rb269
-rw-r--r--lib/shell/builtin-command.rb154
-rw-r--r--lib/shell/command-processor.rb592
-rw-r--r--lib/shell/error.rb26
-rw-r--r--lib/shell/filter.rb110
-rw-r--r--lib/shell/process-controller.rb260
-rw-r--r--lib/shell/system-command.rb168
-rw-r--r--lib/shell/version.rb16
-rw-r--r--lib/shellwords.rb251
-rw-r--r--lib/singleton.rb421
-rw-r--r--lib/singleton/singleton.gemspec27
-rw-r--r--lib/singleton/version.rb3
-rw-r--r--lib/soap/attachment.rb107
-rw-r--r--lib/soap/baseData.rb942
-rw-r--r--lib/soap/element.rb258
-rw-r--r--lib/soap/encodingstyle/aspDotNetHandler.rb213
-rw-r--r--lib/soap/encodingstyle/handler.rb100
-rw-r--r--lib/soap/encodingstyle/literalHandler.rb226
-rw-r--r--lib/soap/encodingstyle/soapHandler.rb582
-rw-r--r--lib/soap/generator.rb268
-rw-r--r--lib/soap/header/handler.rb57
-rw-r--r--lib/soap/header/handlerset.rb70
-rw-r--r--lib/soap/header/simplehandler.rb44
-rw-r--r--lib/soap/httpconfigloader.rb119
-rw-r--r--lib/soap/mapping.rb10
-rw-r--r--lib/soap/mapping/factory.rb355
-rw-r--r--lib/soap/mapping/mapping.rb381
-rw-r--r--lib/soap/mapping/registry.rb541
-rw-r--r--lib/soap/mapping/rubytypeFactory.rb475
-rw-r--r--lib/soap/mapping/typeMap.rb50
-rw-r--r--lib/soap/mapping/wsdlencodedregistry.rb280
-rw-r--r--lib/soap/mapping/wsdlliteralregistry.rb418
-rw-r--r--lib/soap/marshal.rb59
-rw-r--r--lib/soap/mimemessage.rb240
-rw-r--r--lib/soap/netHttpClient.rb190
-rw-r--r--lib/soap/parser.rb251
-rw-r--r--lib/soap/processor.rb66
-rw-r--r--lib/soap/property.rb333
-rw-r--r--lib/soap/rpc/cgistub.rb206
-rw-r--r--lib/soap/rpc/driver.rb254
-rw-r--r--lib/soap/rpc/element.rb325
-rw-r--r--lib/soap/rpc/httpserver.rb129
-rw-r--r--lib/soap/rpc/proxy.rb497
-rw-r--r--lib/soap/rpc/router.rb594
-rw-r--r--lib/soap/rpc/rpc.rb25
-rw-r--r--lib/soap/rpc/soaplet.rb162
-rw-r--r--lib/soap/rpc/standaloneServer.rb43
-rw-r--r--lib/soap/soap.rb140
-rw-r--r--lib/soap/streamHandler.rb229
-rw-r--r--lib/soap/wsdlDriver.rb575
-rw-r--r--lib/sync.rb311
-rw-r--r--lib/tempfile.rb409
-rw-r--r--lib/test/unit.rb280
-rw-r--r--lib/test/unit/assertionfailederror.rb14
-rw-r--r--lib/test/unit/assertions.rb622
-rw-r--r--lib/test/unit/autorunner.rb204
-rw-r--r--lib/test/unit/collector.rb43
-rw-r--r--lib/test/unit/collector/dir.rb92
-rw-r--r--lib/test/unit/collector/objectspace.rb34
-rw-r--r--lib/test/unit/error.rb56
-rw-r--r--lib/test/unit/failure.rb51
-rw-r--r--lib/test/unit/testcase.rb152
-rw-r--r--lib/test/unit/testresult.rb80
-rw-r--r--lib/test/unit/testsuite.rb76
-rw-r--r--lib/test/unit/ui/console/testrunner.rb127
-rw-r--r--lib/test/unit/ui/fox/testrunner.rb268
-rw-r--r--lib/test/unit/ui/gtk/testrunner.rb416
-rw-r--r--lib/test/unit/ui/gtk2/testrunner.rb465
-rw-r--r--lib/test/unit/ui/testrunnermediator.rb68
-rw-r--r--lib/test/unit/ui/testrunnerutilities.rb46
-rw-r--r--lib/test/unit/ui/tk/testrunner.rb260
-rw-r--r--lib/test/unit/util/backtracefilter.rb40
-rw-r--r--lib/test/unit/util/observable.rb90
-rw-r--r--lib/test/unit/util/procwrapper.rb48
-rw-r--r--lib/thread.rb484
-rw-r--r--lib/thwait.rb169
-rw-r--r--lib/time.rb907
-rw-r--r--lib/timeout.rb196
-rw-r--r--lib/timeout/timeout.gemspec27
-rw-r--r--lib/timeout/version.rb3
-rw-r--r--lib/tmpdir.rb152
-rw-r--r--lib/tracer.rb252
-rw-r--r--lib/tracer/tracer.gemspec23
-rw-r--r--lib/tracer/version.rb5
-rw-r--r--lib/tsort.rb318
-rw-r--r--lib/un.rb273
-rw-r--r--lib/unicode_normalize/normalize.rb175
-rw-r--r--lib/unicode_normalize/tables.rb9039
-rw-r--r--lib/uri.rb98
-rw-r--r--lib/uri/common.rb881
-rw-r--r--lib/uri/file.rb94
-rw-r--r--lib/uri/ftp.rb189
-rw-r--r--lib/uri/generic.rb1187
-rw-r--r--lib/uri/http.rb79
-rw-r--r--lib/uri/https.rb13
-rw-r--r--lib/uri/ldap.rb87
-rw-r--r--lib/uri/ldaps.rb21
-rw-r--r--lib/uri/mailto.rb225
-rw-r--r--lib/uri/rfc2396_parser.rb546
-rw-r--r--lib/uri/rfc3986_parser.rb125
-rw-r--r--lib/uri/uri.gemspec29
-rw-r--r--lib/uri/version.rb6
-rw-r--r--lib/weakref.rb118
-rw-r--r--lib/webrick.rb204
-rw-r--r--lib/webrick/.document6
-rw-r--r--lib/webrick/accesslog.rb100
-rw-r--r--lib/webrick/cgi.rb120
-rw-r--r--lib/webrick/compat.rb21
-rw-r--r--lib/webrick/config.rb87
-rw-r--r--lib/webrick/cookie.rb82
-rw-r--r--lib/webrick/htmlutils.rb11
-rw-r--r--lib/webrick/httpauth.rb67
-rw-r--r--lib/webrick/httpauth/authenticator.rb70
-rw-r--r--lib/webrick/httpauth/basicauth.rb63
-rw-r--r--lib/webrick/httpauth/digestauth.rb134
-rw-r--r--lib/webrick/httpauth/htdigest.rb59
-rw-r--r--lib/webrick/httpauth/htgroup.rb48
-rw-r--r--lib/webrick/httpauth/htpasswd.rb97
-rw-r--r--lib/webrick/httpauth/userdb.rb32
-rw-r--r--lib/webrick/httpproxy.rb340
-rw-r--r--lib/webrick/httprequest.rb386
-rw-r--r--lib/webrick/httpresponse.rb391
-rw-r--r--lib/webrick/https.rb97
-rw-r--r--lib/webrick/httpserver.rb124
-rw-r--r--lib/webrick/httpservlet.rb11
-rw-r--r--lib/webrick/httpservlet/abstract.rb101
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb10
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb74
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb54
-rw-r--r--lib/webrick/httpservlet/filehandler.rb224
-rw-r--r--lib/webrick/httpservlet/prochandler.rb24
-rw-r--r--lib/webrick/httpstatus.rb182
-rw-r--r--lib/webrick/httputils.rb192
-rw-r--r--lib/webrick/httpversion.rb31
-rw-r--r--lib/webrick/log.rb84
-rw-r--r--lib/webrick/server.rb306
-rw-r--r--lib/webrick/ssl.rb123
-rw-r--r--lib/webrick/utils.rb252
-rw-r--r--lib/webrick/version.rb9
-rw-r--r--lib/webrick/webrick.gemspec76
-rw-r--r--lib/wsdl/binding.rb65
-rw-r--r--lib/wsdl/data.rb64
-rw-r--r--lib/wsdl/definitions.rb250
-rw-r--r--lib/wsdl/documentation.rb32
-rw-r--r--lib/wsdl/import.rb80
-rw-r--r--lib/wsdl/importer.rb38
-rw-r--r--lib/wsdl/info.rb39
-rw-r--r--lib/wsdl/message.rb54
-rw-r--r--lib/wsdl/operation.rb130
-rw-r--r--lib/wsdl/operationBinding.rb108
-rw-r--r--lib/wsdl/param.rb85
-rw-r--r--lib/wsdl/parser.rb163
-rw-r--r--lib/wsdl/part.rb52
-rw-r--r--lib/wsdl/port.rb84
-rw-r--r--lib/wsdl/portType.rb73
-rw-r--r--lib/wsdl/service.rb61
-rw-r--r--lib/wsdl/soap/address.rb40
-rw-r--r--lib/wsdl/soap/binding.rb49
-rw-r--r--lib/wsdl/soap/body.rb56
-rw-r--r--lib/wsdl/soap/cgiStubCreator.rb76
-rw-r--r--lib/wsdl/soap/classDefCreator.rb314
-rw-r--r--lib/wsdl/soap/classDefCreatorSupport.rb126
-rw-r--r--lib/wsdl/soap/clientSkeltonCreator.rb78
-rw-r--r--lib/wsdl/soap/complexType.rb161
-rw-r--r--lib/wsdl/soap/data.rb42
-rw-r--r--lib/wsdl/soap/definitions.rb149
-rw-r--r--lib/wsdl/soap/driverCreator.rb95
-rw-r--r--lib/wsdl/soap/element.rb28
-rw-r--r--lib/wsdl/soap/fault.rb56
-rw-r--r--lib/wsdl/soap/header.rb86
-rw-r--r--lib/wsdl/soap/headerfault.rb56
-rw-r--r--lib/wsdl/soap/mappingRegistryCreator.rb92
-rw-r--r--lib/wsdl/soap/methodDefCreator.rb228
-rw-r--r--lib/wsdl/soap/operation.rb122
-rw-r--r--lib/wsdl/soap/servantSkeltonCreator.rb67
-rw-r--r--lib/wsdl/soap/standaloneServerStubCreator.rb85
-rw-r--r--lib/wsdl/soap/wsdl2ruby.rb176
-rw-r--r--lib/wsdl/types.rb43
-rw-r--r--lib/wsdl/wsdl.rb23
-rw-r--r--lib/wsdl/xmlSchema/all.rb69
-rw-r--r--lib/wsdl/xmlSchema/annotation.rb34
-rw-r--r--lib/wsdl/xmlSchema/any.rb56
-rw-r--r--lib/wsdl/xmlSchema/attribute.rb127
-rw-r--r--lib/wsdl/xmlSchema/choice.rb69
-rw-r--r--lib/wsdl/xmlSchema/complexContent.rb92
-rw-r--r--lib/wsdl/xmlSchema/complexType.rb139
-rw-r--r--lib/wsdl/xmlSchema/content.rb96
-rw-r--r--lib/wsdl/xmlSchema/data.rb80
-rw-r--r--lib/wsdl/xmlSchema/element.rb154
-rw-r--r--lib/wsdl/xmlSchema/enumeration.rb36
-rw-r--r--lib/wsdl/xmlSchema/import.rb65
-rw-r--r--lib/wsdl/xmlSchema/importer.rb87
-rw-r--r--lib/wsdl/xmlSchema/include.rb54
-rw-r--r--lib/wsdl/xmlSchema/length.rb35
-rw-r--r--lib/wsdl/xmlSchema/parser.rb166
-rw-r--r--lib/wsdl/xmlSchema/pattern.rb36
-rw-r--r--lib/wsdl/xmlSchema/schema.rb143
-rw-r--r--lib/wsdl/xmlSchema/sequence.rb69
-rw-r--r--lib/wsdl/xmlSchema/simpleContent.rb65
-rw-r--r--lib/wsdl/xmlSchema/simpleExtension.rb54
-rw-r--r--lib/wsdl/xmlSchema/simpleRestriction.rb73
-rw-r--r--lib/wsdl/xmlSchema/simpleType.rb73
-rw-r--r--lib/wsdl/xmlSchema/unique.rb34
-rw-r--r--lib/wsdl/xmlSchema/xsd2ruby.rb107
-rw-r--r--lib/xmlrpc/.document1
-rw-r--r--lib/xmlrpc/README.txt31
-rw-r--r--lib/xmlrpc/base64.rb81
-rw-r--r--lib/xmlrpc/client.rb619
-rw-r--r--lib/xmlrpc/config.rb40
-rw-r--r--lib/xmlrpc/create.rb290
-rw-r--r--lib/xmlrpc/datetime.rb142
-rw-r--r--lib/xmlrpc/httpserver.rb178
-rw-r--r--lib/xmlrpc/marshal.rb76
-rw-r--r--lib/xmlrpc/parser.rb813
-rw-r--r--lib/xmlrpc/server.rb780
-rw-r--r--lib/xmlrpc/utils.rb165
-rw-r--r--lib/xsd/charset.rb187
-rw-r--r--lib/xsd/codegen.rb12
-rw-r--r--lib/xsd/codegen/classdef.rb203
-rw-r--r--lib/xsd/codegen/commentdef.rb34
-rw-r--r--lib/xsd/codegen/gensupport.rb166
-rw-r--r--lib/xsd/codegen/methoddef.rb63
-rw-r--r--lib/xsd/codegen/moduledef.rb191
-rw-r--r--lib/xsd/datatypes.rb1269
-rw-r--r--lib/xsd/datatypes1999.rb20
-rw-r--r--lib/xsd/iconvcharset.rb33
-rw-r--r--lib/xsd/mapping.rb42
-rw-r--r--lib/xsd/namedelements.rb95
-rw-r--r--lib/xsd/ns.rb140
-rw-r--r--lib/xsd/qname.rb78
-rw-r--r--lib/xsd/xmlparser.rb61
-rw-r--r--lib/xsd/xmlparser/parser.rb96
-rw-r--r--lib/xsd/xmlparser/rexmlparser.rb54
-rw-r--r--lib/xsd/xmlparser/xmlparser.rb50
-rw-r--r--lib/xsd/xmlparser/xmlscanner.rb147
-rw-r--r--lib/yaml.rb471
-rw-r--r--lib/yaml/baseemitter.rb247
-rw-r--r--lib/yaml/basenode.rb216
-rw-r--r--lib/yaml/constants.rb45
-rw-r--r--lib/yaml/dbm.rb201
-rw-r--r--lib/yaml/encoding.rb33
-rw-r--r--lib/yaml/error.rb34
-rw-r--r--lib/yaml/loader.rb14
-rw-r--r--lib/yaml/rubytypes.rb408
-rw-r--r--lib/yaml/store.rb73
-rw-r--r--lib/yaml/stream.rb40
-rw-r--r--lib/yaml/stringio.rb83
-rw-r--r--lib/yaml/syck.rb19
-rw-r--r--lib/yaml/tag.rb91
-rw-r--r--lib/yaml/types.rb192
-rw-r--r--lib/yaml/yaml.gemspec23
-rw-r--r--lib/yaml/yamlnode.rb54
-rw-r--r--lib/yaml/ypath.rb52
-rwxr-xr-xlibexec/bundle47
-rwxr-xr-xlibexec/bundler4
-rwxr-xr-xlibexec/irb11
-rwxr-xr-xlibexec/racc306
-rwxr-xr-xlibexec/racc2y195
-rwxr-xr-xlibexec/rdoc44
-rwxr-xr-xlibexec/ri12
-rwxr-xr-xlibexec/y2racc339
-rw-r--r--load.c1288
-rw-r--r--loadpath.c91
-rw-r--r--localeinit.c137
-rw-r--r--main.c58
-rw-r--r--man/bundle-add.166
-rw-r--r--man/bundle-add.1.txt58
-rw-r--r--man/bundle-add.ronn46
-rw-r--r--man/bundle-binstubs.140
-rw-r--r--man/bundle-binstubs.1.txt48
-rw-r--r--man/bundle-binstubs.ronn43
-rw-r--r--man/bundle-cache.155
-rw-r--r--man/bundle-cache.1.txt78
-rw-r--r--man/bundle-cache.ronn72
-rw-r--r--man/bundle-check.131
-rw-r--r--man/bundle-check.1.txt33
-rw-r--r--man/bundle-check.ronn26
-rw-r--r--man/bundle-clean.124
-rw-r--r--man/bundle-clean.1.txt26
-rw-r--r--man/bundle-clean.ronn18
-rw-r--r--man/bundle-config.1497
-rw-r--r--man/bundle-config.1.txt528
-rw-r--r--man/bundle-config.ronn399
-rw-r--r--man/bundle-doctor.144
-rw-r--r--man/bundle-doctor.1.txt44
-rw-r--r--man/bundle-doctor.ronn33
-rw-r--r--man/bundle-exec.1165
-rw-r--r--man/bundle-exec.1.txt178
-rw-r--r--man/bundle-exec.ronn152
-rw-r--r--man/bundle-gem.180
-rw-r--r--man/bundle-gem.1.txt91
-rw-r--r--man/bundle-gem.ronn78
-rw-r--r--man/bundle-info.120
-rw-r--r--man/bundle-info.1.txt21
-rw-r--r--man/bundle-info.ronn17
-rw-r--r--man/bundle-init.125
-rw-r--r--man/bundle-init.1.txt34
-rw-r--r--man/bundle-init.ronn29
-rw-r--r--man/bundle-inject.133
-rw-r--r--man/bundle-inject.1.txt32
-rw-r--r--man/bundle-inject.ronn22
-rw-r--r--man/bundle-install.1311
-rw-r--r--man/bundle-install.1.txt401
-rw-r--r--man/bundle-install.ronn383
-rw-r--r--man/bundle-list.150
-rw-r--r--man/bundle-list.1.txt43
-rw-r--r--man/bundle-list.ronn33
-rw-r--r--man/bundle-lock.184
-rw-r--r--man/bundle-lock.1.txt93
-rw-r--r--man/bundle-lock.ronn94
-rw-r--r--man/bundle-open.132
-rw-r--r--man/bundle-open.1.txt29
-rw-r--r--man/bundle-open.ronn19
-rw-r--r--man/bundle-outdated.1155
-rw-r--r--man/bundle-outdated.1.txt131
-rw-r--r--man/bundle-outdated.ronn111
-rw-r--r--man/bundle-package.155
-rw-r--r--man/bundle-package.1.txt79
-rw-r--r--man/bundle-package.ronn72
-rw-r--r--man/bundle-platform.161
-rw-r--r--man/bundle-platform.1.txt57
-rw-r--r--man/bundle-platform.ronn42
-rw-r--r--man/bundle-pristine.134
-rw-r--r--man/bundle-pristine.1.txt44
-rw-r--r--man/bundle-pristine.ronn34
-rw-r--r--man/bundle-remove.131
-rw-r--r--man/bundle-remove.1.txt34
-rw-r--r--man/bundle-remove.ronn23
-rw-r--r--man/bundle-show.123
-rw-r--r--man/bundle-show.1.txt27
-rw-r--r--man/bundle-show.ronn21
-rw-r--r--man/bundle-update.1394
-rw-r--r--man/bundle-update.1.txt390
-rw-r--r--man/bundle-update.ronn350
-rw-r--r--man/bundle-viz.139
-rw-r--r--man/bundle-viz.1.txt39
-rw-r--r--man/bundle-viz.ronn30
-rw-r--r--man/bundle.1136
-rw-r--r--man/bundle.1.txt116
-rw-r--r--man/bundle.ronn111
-rw-r--r--man/erb.1160
-rw-r--r--man/gemfile.5686
-rw-r--r--man/gemfile.5.ronn517
-rw-r--r--man/gemfile.5.txt649
-rw-r--r--man/goruby.139
-rw-r--r--man/index.txt25
-rw-r--r--man/irb.1207
-rw-r--r--man/ri.1247
-rw-r--r--man/ruby.1664
-rw-r--r--marshal.c2063
-rw-r--r--math.c980
-rwxr-xr-xmdoc2man.rb465
-rw-r--r--method.h229
-rw-r--r--mini_builtin.c83
-rw-r--r--miniinit.c51
-rw-r--r--misc/README13
-rwxr-xr-xmisc/expand_tabs.rb169
-rw-r--r--misc/inf-ruby.el417
-rwxr-xr-xmisc/lldb_cruby.py279
-rw-r--r--misc/rb_optparse.bash20
-rwxr-xr-xmisc/rb_optparse.zsh38
-rw-r--r--misc/rdebug.el136
-rw-r--r--misc/ruby-electric.el200
-rw-r--r--misc/ruby-mode.el1205
-rw-r--r--misc/ruby-style.el94
-rw-r--r--misc/rubydb2x.el104
-rw-r--r--misc/rubydb3x.el115
-rw-r--r--misc/test_lldb_cruby.rb40
-rw-r--r--missing.h142
-rw-r--r--missing/acosh.c21
-rw-r--r--missing/alloca.c13
-rw-r--r--missing/cbrt.c11
-rw-r--r--missing/close.c72
-rw-r--r--missing/crt_externs.h8
-rw-r--r--missing/crypt.c651
-rw-r--r--missing/crypt.h248
-rw-r--r--missing/des_tables.c1616
-rw-r--r--missing/dtoa.c3417
-rw-r--r--missing/dup2.c5
-rw-r--r--missing/erf.c13
-rw-r--r--missing/explicit_bzero.c94
-rw-r--r--missing/ffs.c49
-rw-r--r--missing/file.h2
-rw-r--r--missing/finite.c5
-rw-r--r--missing/flock.c28
-rw-r--r--missing/hypot.c4
-rw-r--r--missing/isinf.c19
-rw-r--r--missing/isnan.c25
-rw-r--r--missing/langinfo.c148
-rw-r--r--missing/lgamma_r.c80
-rw-r--r--missing/memcmp.c13
-rw-r--r--missing/memmove.c18
-rw-r--r--missing/mt19937.c158
-rw-r--r--missing/nan.c28
-rw-r--r--missing/nextafter.c77
-rw-r--r--missing/os2.c113
-rw-r--r--missing/procstat_vm.c85
-rw-r--r--missing/setproctitle.c175
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/stdbool.h20
-rw-r--r--missing/strcasecmp.c16
-rw-r--r--missing/strchr.c22
-rw-r--r--missing/strerror.c7
-rw-r--r--missing/strftime.c903
-rw-r--r--missing/strlcat.c56
-rw-r--r--missing/strlcpy.c51
-rw-r--r--missing/strncasecmp.c21
-rw-r--r--missing/strstr.c15
-rw-r--r--missing/strtod.c271
-rw-r--r--missing/strtol.c29
-rw-r--r--missing/strtoul.c184
-rw-r--r--missing/tgamma.c97
-rw-r--r--missing/vsnprintf.c1135
-rw-r--r--missing/x68.c40
-rw-r--r--missing/x86_64-chkstk.S10
-rw-r--r--mjit.c1036
-rw-r--r--mjit.h177
-rw-r--r--mjit_compile.c478
-rw-r--r--mjit_worker.c1258
-rw-r--r--mkconfig.rb164
-rw-r--r--node.c1401
-rw-r--r--node.h486
-rw-r--r--numeric.c5806
-rw-r--r--object.c4806
-rw-r--r--pack.c1956
-rw-r--r--pack.rb283
-rw-r--r--parse.y14594
-rw-r--r--prec.c141
-rw-r--r--prelude.rb37
-rw-r--r--probes.d234
-rw-r--r--probes_helper.h42
-rw-r--r--proc.c4060
-rw-r--r--process.c7796
-rw-r--r--random.c1810
-rw-r--r--range.c1860
-rw-r--r--rational.c2802
-rw-r--r--re.c4245
-rw-r--r--re.h42
-rw-r--r--regcomp.c6743
-rw-r--r--regenc.c1012
-rw-r--r--regenc.h254
-rw-r--r--regerror.c387
-rw-r--r--regex.c4661
-rw-r--r--regex.h221
-rw-r--r--regexec.c4621
-rw-r--r--regint.h938
-rw-r--r--regparse.c6643
-rw-r--r--regparse.h370
-rw-r--r--regsyntax.c388
-rw-r--r--ruby-runner.c98
-rw-r--r--ruby.1351
-rw-r--r--ruby.c2678
-rw-r--r--ruby.h734
-rw-r--r--ruby_assert.h15
-rw-r--r--ruby_atomic.h244
-rw-r--r--rubyio.h88
-rw-r--r--rubysig.h105
-rw-r--r--rubystub.c60
-rw-r--r--rubytest.rb49
-rwxr-xr-xrunruby.rb59
-rw-r--r--safe.c145
-rw-r--r--sample/README17
-rw-r--r--sample/benchmark.rb19
-rw-r--r--sample/biorhythm.rb145
-rw-r--r--sample/cal.rb86
-rw-r--r--sample/cbreak.rb12
-rw-r--r--sample/cgi-session-pstore.rb11
-rw-r--r--sample/coverage.rb62
-rw-r--r--sample/dbmtest.rb14
-rw-r--r--sample/delegate.rb31
-rw-r--r--sample/dir.rb2
-rw-r--r--sample/drb/README.ja.rdoc59
-rw-r--r--sample/drb/README.rd56
-rw-r--r--sample/drb/README.rd.ja59
-rw-r--r--sample/drb/README.rdoc56
-rw-r--r--sample/drb/acl.rb15
-rw-r--r--sample/drb/darray.rb2
-rw-r--r--sample/drb/darrayc.rb16
-rw-r--r--sample/drb/dbiff.rb24
-rw-r--r--sample/drb/dchatc.rb4
-rw-r--r--sample/drb/dchats.rb23
-rw-r--r--sample/drb/dhasen.rb7
-rw-r--r--sample/drb/dhasenc.rb7
-rw-r--r--sample/drb/dlogc.rb2
-rw-r--r--sample/drb/dlogd.rb9
-rw-r--r--sample/drb/dqin.rb2
-rw-r--r--sample/drb/dqout.rb2
-rw-r--r--sample/drb/dqueue.rb5
-rw-r--r--sample/drb/drbc.rb2
-rw-r--r--sample/drb/drbch.rb2
-rw-r--r--sample/drb/drbm.rb6
-rw-r--r--sample/drb/drbmc.rb2
-rw-r--r--sample/drb/drbs-acl.rb6
-rw-r--r--sample/drb/drbs.rb4
-rw-r--r--sample/drb/extserv_test.rb12
-rw-r--r--sample/drb/gw_cu.rb2
-rw-r--r--sample/drb/holderc.rb2
-rw-r--r--sample/drb/holders.rb6
-rw-r--r--sample/drb/http0.rb64
-rw-r--r--sample/drb/http0serv.rb125
-rw-r--r--sample/drb/name.rb21
-rw-r--r--sample/drb/namec.rb2
-rw-r--r--sample/drb/old_tuplespace.rb84
-rw-r--r--sample/drb/ring_echo.rb3
-rw-r--r--sample/drb/ring_place.rb6
-rw-r--r--sample/drb/simpletuple.rb16
-rw-r--r--sample/drb/speedc.rb2
-rw-r--r--sample/drb/speeds.rb4
-rw-r--r--sample/dualstack-fetch.rb2
-rw-r--r--sample/dualstack-httpd.rb37
-rw-r--r--sample/eval.rb2
-rw-r--r--sample/export.rb2
-rw-r--r--sample/exyacc.rb34
-rw-r--r--sample/fact.rb4
-rw-r--r--sample/fib.awk8
-rw-r--r--sample/fib.pl4
-rw-r--r--sample/fib.py2
-rw-r--r--sample/fib.scm4
-rw-r--r--sample/freq.rb12
-rw-r--r--sample/from.rb161
-rw-r--r--sample/fullpath.rb2
-rw-r--r--sample/getopts.test36
-rw-r--r--sample/goodfriday.rb48
-rw-r--r--sample/iseq_loader.rb243
-rw-r--r--sample/list.rb3
-rw-r--r--sample/list2.rb2
-rw-r--r--sample/list3.rb4
-rw-r--r--sample/logger/app.rb2
-rwxr-xr-x[-rw-r--r--]sample/mine.rb39
-rw-r--r--sample/mkproto.rb24
-rw-r--r--sample/mrshtest.rb13
-rw-r--r--sample/net-imap.rb167
-rw-r--r--sample/observ.rb11
-rw-r--r--sample/occur.pl8
-rw-r--r--sample/occur.rb6
-rw-r--r--sample/occur2.rb16
-rw-r--r--sample/open3.rb12
-rw-r--r--sample/openssl/c_rehash.rb42
-rw-r--r--sample/openssl/cert_store_view.rb911
-rw-r--r--sample/openssl/certstore.rb54
-rw-r--r--sample/openssl/cipher.rb73
-rw-r--r--sample/openssl/crlstore.rb32
-rw-r--r--sample/openssl/echo_cli.rb21
-rw-r--r--sample/openssl/echo_svr.rb15
-rw-r--r--sample/openssl/gen_csr.rb13
-rw-r--r--sample/openssl/smime_read.rb10
-rw-r--r--sample/openssl/smime_write.rb12
-rw-r--r--sample/openssl/wget.rb17
-rwxr-xr-x[-rw-r--r--]sample/optparse/opttest.rb76
-rw-r--r--sample/philos.rb5
-rw-r--r--sample/pstore.rb19
-rw-r--r--sample/pty/expect_sample.rb58
-rw-r--r--sample/pty/script.rb37
-rw-r--r--sample/pty/shl.rb93
-rw-r--r--sample/rcs.awk54
-rw-r--r--sample/rdoc/markup/rdoc2latex.rb15
-rw-r--r--sample/rdoc/markup/sample.rb40
-rw-r--r--sample/regx.rb23
-rw-r--r--sample/rinda-ring.rb22
-rw-r--r--sample/ripper/ruby2html.rb116
-rw-r--r--sample/ripper/strip-comment.rb19
-rwxr-xr-xsample/rss/blend.rb6
-rwxr-xr-xsample/rss/convert.rb2
-rwxr-xr-x[-rw-r--r--]sample/rss/list_description.rb17
-rwxr-xr-xsample/rss/re_read.rb14
-rwxr-xr-x[-rw-r--r--]sample/rss/rss_recent.rb24
-rw-r--r--sample/simple-bench.rb140
-rw-r--r--sample/svr.rb4
-rw-r--r--sample/tempfile.rb8
-rw-r--r--sample/test.rb2041
-rw-r--r--sample/time.rb16
-rw-r--r--sample/timeout.rb42
-rw-r--r--sample/trick2013/README.md15
-rw-r--r--sample/trick2013/kinaba/authors.markdown3
-rw-r--r--sample/trick2013/kinaba/entry.rb1
-rw-r--r--sample/trick2013/kinaba/remarks.markdown37
-rw-r--r--sample/trick2013/mame/authors.markdown3
-rw-r--r--sample/trick2013/mame/entry.rb97
-rw-r--r--sample/trick2013/mame/remarks.markdown47
-rw-r--r--sample/trick2013/shinh/authors.markdown2
-rw-r--r--sample/trick2013/shinh/entry.rb10
-rw-r--r--sample/trick2013/shinh/remarks.markdown4
-rw-r--r--sample/trick2013/yhara/authors.markdown3
-rw-r--r--sample/trick2013/yhara/entry.rb28
-rw-r--r--sample/trick2013/yhara/remarks.en.markdown23
-rw-r--r--sample/trick2013/yhara/remarks.markdown24
-rw-r--r--sample/trick2015/README.md16
-rw-r--r--sample/trick2015/eregon/authors.markdown3
-rw-r--r--sample/trick2015/eregon/entry.rb16
-rw-r--r--sample/trick2015/eregon/remarks.markdown70
-rw-r--r--sample/trick2015/kinaba/authors.markdown4
-rw-r--r--sample/trick2015/kinaba/entry.rb150
-rw-r--r--sample/trick2015/kinaba/remarks.markdown85
-rw-r--r--sample/trick2015/ksk_1/authors.markdown3
-rw-r--r--sample/trick2015/ksk_1/entry.rb1
-rw-r--r--sample/trick2015/ksk_1/remarks.markdown120
-rw-r--r--sample/trick2015/ksk_2/abnormal.cnf6
-rw-r--r--sample/trick2015/ksk_2/authors.markdown3
-rw-r--r--sample/trick2015/ksk_2/entry.rb1
-rw-r--r--sample/trick2015/ksk_2/quinn.cnf21
-rw-r--r--sample/trick2015/ksk_2/remarks.markdown204
-rw-r--r--sample/trick2015/ksk_2/sample.cnf9
-rw-r--r--sample/trick2015/ksk_2/uf20-01.cnf99
-rw-r--r--sample/trick2015/ksk_2/unsat.cnf11
-rw-r--r--sample/trick2015/monae/authors.markdown1
-rw-r--r--sample/trick2015/monae/entry.rb26
-rw-r--r--sample/trick2015/monae/remarks.markdown25
-rw-r--r--sample/trick2018/01-kinaba/authors.markdown3
-rw-r--r--sample/trick2018/01-kinaba/entry.rb8
-rw-r--r--sample/trick2018/01-kinaba/remarks.markdown55
-rw-r--r--sample/trick2018/02-mame/authors.markdown3
-rw-r--r--sample/trick2018/02-mame/entry.rb15
-rw-r--r--sample/trick2018/02-mame/remarks.markdown16
-rw-r--r--sample/trick2018/03-tompng/Gemfile2
-rw-r--r--sample/trick2018/03-tompng/Gemfile.lock13
-rw-r--r--sample/trick2018/03-tompng/authors.markdown3
-rw-r--r--sample/trick2018/03-tompng/entry.rb31
-rw-r--r--sample/trick2018/03-tompng/output.txt44
-rw-r--r--sample/trick2018/03-tompng/remarks.markdown19
-rw-r--r--sample/trick2018/03-tompng/trick.pngbin0 -> 5661 bytes-rw-r--r--sample/trick2018/04-colin/authors.markdown3
-rw-r--r--sample/trick2018/04-colin/entry.rb2
-rw-r--r--sample/trick2018/04-colin/remarks.markdown62
-rw-r--r--sample/trick2018/05-tompng/authors.markdown3
-rw-r--r--sample/trick2018/05-tompng/entry.rb41
-rw-r--r--sample/trick2018/05-tompng/preview_of_output.pngbin0 -> 66800 bytes-rw-r--r--sample/trick2018/05-tompng/remarks.markdown31
-rw-r--r--sample/trick2018/README.md16
-rw-r--r--sample/trojan.rb4
-rw-r--r--sample/tsvr.rb2
-rw-r--r--sample/weakref.rb9
-rw-r--r--sample/webrick/httpproxy.rb7
-rw-r--r--signal.c1710
-rw-r--r--siphash.c482
-rw-r--r--siphash.h48
-rw-r--r--sparc.c40
-rw-r--r--spec/README.md130
-rw-r--r--spec/bundler/bundler/build_metadata_spec.rb49
-rw-r--r--spec/bundler/bundler/bundler_spec.rb460
-rw-r--r--spec/bundler/bundler/cli_spec.rb223
-rw-r--r--spec/bundler/bundler/compact_index_client/updater_spec.rb55
-rw-r--r--spec/bundler/bundler/definition_spec.rb351
-rw-r--r--spec/bundler/bundler/dep_proxy_spec.rb22
-rw-r--r--spec/bundler/bundler/dsl_spec.rb302
-rw-r--r--spec/bundler/bundler/endpoint_specification_spec.rb71
-rw-r--r--spec/bundler/bundler/env_spec.rb200
-rw-r--r--spec/bundler/bundler/environment_preserver_spec.rb79
-rw-r--r--spec/bundler/bundler/fetcher/base_spec.rb76
-rw-r--r--spec/bundler/bundler/fetcher/compact_index_spec.rb106
-rw-r--r--spec/bundler/bundler/fetcher/dependency_spec.rb287
-rw-r--r--spec/bundler/bundler/fetcher/downloader_spec.rb269
-rw-r--r--spec/bundler/bundler/fetcher/index_spec.rb116
-rw-r--r--spec/bundler/bundler/fetcher_spec.rb161
-rw-r--r--spec/bundler/bundler/friendly_errors_spec.rb255
-rw-r--r--spec/bundler/bundler/gem_helper_spec.rb348
-rw-r--r--spec/bundler/bundler/gem_version_promoter_spec.rb179
-rw-r--r--spec/bundler/bundler/index_spec.rb36
-rw-r--r--spec/bundler/bundler/installer/gem_installer_spec.rb40
-rw-r--r--spec/bundler/bundler/installer/parallel_installer_spec.rb47
-rw-r--r--spec/bundler/bundler/installer/spec_installation_spec.rb62
-rw-r--r--spec/bundler/bundler/lockfile_parser_spec.rb153
-rw-r--r--spec/bundler/bundler/mirror_spec.rb329
-rw-r--r--spec/bundler/bundler/plugin/api/source_spec.rb82
-rw-r--r--spec/bundler/bundler/plugin/api_spec.rb83
-rw-r--r--spec/bundler/bundler/plugin/dsl_spec.rb38
-rw-r--r--spec/bundler/bundler/plugin/events_spec.rb22
-rw-r--r--spec/bundler/bundler/plugin/index_spec.rb197
-rw-r--r--spec/bundler/bundler/plugin/installer_spec.rb131
-rw-r--r--spec/bundler/bundler/plugin/source_list_spec.rb25
-rw-r--r--spec/bundler/bundler/plugin_spec.rb334
-rw-r--r--spec/bundler/bundler/psyched_yaml_spec.rb9
-rw-r--r--spec/bundler/bundler/remote_specification_spec.rb187
-rw-r--r--spec/bundler/bundler/retry_spec.rb81
-rw-r--r--spec/bundler/bundler/ruby_dsl_spec.rb95
-rw-r--r--spec/bundler/bundler/ruby_version_spec.rb528
-rw-r--r--spec/bundler/bundler/rubygems_integration_spec.rb102
-rw-r--r--spec/bundler/bundler/settings/validator_spec.rb111
-rw-r--r--spec/bundler/bundler/settings_spec.rb328
-rw-r--r--spec/bundler/bundler/shared_helpers_spec.rb515
-rw-r--r--spec/bundler/bundler/source/git/git_proxy_spec.rb148
-rw-r--r--spec/bundler/bundler/source/git_spec.rb28
-rw-r--r--spec/bundler/bundler/source/path_spec.rb31
-rw-r--r--spec/bundler/bundler/source/rubygems/remote_spec.rb172
-rw-r--r--spec/bundler/bundler/source/rubygems_spec.rb33
-rw-r--r--spec/bundler/bundler/source_list_spec.rb463
-rw-r--r--spec/bundler/bundler/source_spec.rb200
-rw-r--r--spec/bundler/bundler/spec_set_spec.rb77
-rw-r--r--spec/bundler/bundler/stub_specification_spec.rb22
-rw-r--r--spec/bundler/bundler/ui/shell_spec.rb53
-rw-r--r--spec/bundler/bundler/ui_spec.rb41
-rw-r--r--spec/bundler/bundler/uri_credentials_filter_spec.rb127
-rw-r--r--spec/bundler/bundler/vendored_persistent_spec.rb77
-rw-r--r--spec/bundler/bundler/version_ranges_spec.rb40
-rw-r--r--spec/bundler/bundler/worker_spec.rb22
-rw-r--r--spec/bundler/bundler/yaml_serializer_spec.rb194
-rw-r--r--spec/bundler/cache/cache_path_spec.rb32
-rw-r--r--spec/bundler/cache/gems_spec.rb304
-rw-r--r--spec/bundler/cache/git_spec.rb239
-rw-r--r--spec/bundler/cache/path_spec.rb144
-rw-r--r--spec/bundler/cache/platform_spec.rb49
-rw-r--r--spec/bundler/commands/add_spec.rb251
-rw-r--r--spec/bundler/commands/binstubs_spec.rb465
-rw-r--r--spec/bundler/commands/cache_spec.rb351
-rw-r--r--spec/bundler/commands/check_spec.rb359
-rw-r--r--spec/bundler/commands/clean_spec.rb892
-rw-r--r--spec/bundler/commands/config_spec.rb493
-rw-r--r--spec/bundler/commands/console_spec.rb106
-rw-r--r--spec/bundler/commands/doctor_spec.rb116
-rw-r--r--spec/bundler/commands/exec_spec.rb913
-rw-r--r--spec/bundler/commands/help_spec.rb89
-rw-r--r--spec/bundler/commands/info_spec.rb145
-rw-r--r--spec/bundler/commands/init_spec.rb177
-rw-r--r--spec/bundler/commands/inject_spec.rb117
-rw-r--r--spec/bundler/commands/install_spec.rb589
-rw-r--r--spec/bundler/commands/issue_spec.rb16
-rw-r--r--spec/bundler/commands/licenses_spec.rb31
-rw-r--r--spec/bundler/commands/list_spec.rb168
-rw-r--r--spec/bundler/commands/lock_spec.rb362
-rw-r--r--spec/bundler/commands/newgem_spec.rb732
-rw-r--r--spec/bundler/commands/open_spec.rb117
-rw-r--r--spec/bundler/commands/outdated_spec.rb780
-rw-r--r--spec/bundler/commands/post_bundle_message_spec.rb210
-rw-r--r--spec/bundler/commands/pristine_spec.rb191
-rw-r--r--spec/bundler/commands/remove_spec.rb595
-rw-r--r--spec/bundler/commands/show_spec.rb225
-rw-r--r--spec/bundler/commands/update_spec.rb1021
-rw-r--r--spec/bundler/commands/version_spec.rb47
-rw-r--r--spec/bundler/commands/viz_spec.rb149
-rw-r--r--spec/bundler/install/allow_offline_install_spec.rb92
-rw-r--r--spec/bundler/install/binstubs_spec.rb51
-rw-r--r--spec/bundler/install/bundler_spec.rb182
-rw-r--r--spec/bundler/install/deploy_spec.rb409
-rw-r--r--spec/bundler/install/failure_spec.rb144
-rw-r--r--spec/bundler/install/gemfile/eval_gemfile_spec.rb82
-rw-r--r--spec/bundler/install/gemfile/gemspec_spec.rb583
-rw-r--r--spec/bundler/install/gemfile/git_spec.rb1455
-rw-r--r--spec/bundler/install/gemfile/groups_spec.rb384
-rw-r--r--spec/bundler/install/gemfile/install_if.rb44
-rw-r--r--spec/bundler/install/gemfile/lockfile_spec.rb48
-rw-r--r--spec/bundler/install/gemfile/path_spec.rb747
-rw-r--r--spec/bundler/install/gemfile/platform_spec.rb425
-rw-r--r--spec/bundler/install/gemfile/ruby_spec.rb108
-rw-r--r--spec/bundler/install/gemfile/sources_spec.rb647
-rw-r--r--spec/bundler/install/gemfile/specific_platform_spec.rb114
-rw-r--r--spec/bundler/install/gemfile_spec.rb124
-rw-r--r--spec/bundler/install/gems/compact_index_spec.rb940
-rw-r--r--spec/bundler/install/gems/dependency_api_spec.rb760
-rw-r--r--spec/bundler/install/gems/env_spec.rb107
-rw-r--r--spec/bundler/install/gems/flex_spec.rb353
-rw-r--r--spec/bundler/install/gems/mirror_spec.rb39
-rw-r--r--spec/bundler/install/gems/native_extensions_spec.rb131
-rw-r--r--spec/bundler/install/gems/post_install_spec.rb150
-rw-r--r--spec/bundler/install/gems/resolving_spec.rb214
-rw-r--r--spec/bundler/install/gems/standalone_spec.rb337
-rw-r--r--spec/bundler/install/gems/sudo_spec.rb187
-rw-r--r--spec/bundler/install/gems/win32_spec.rb26
-rw-r--r--spec/bundler/install/gemspecs_spec.rb151
-rw-r--r--spec/bundler/install/git_spec.rb85
-rw-r--r--spec/bundler/install/global_cache_spec.rb235
-rw-r--r--spec/bundler/install/path_spec.rb221
-rw-r--r--spec/bundler/install/prereleases_spec.rb41
-rw-r--r--spec/bundler/install/process_lock_spec.rb35
-rw-r--r--spec/bundler/install/redownload_spec.rb90
-rw-r--r--spec/bundler/install/security_policy_spec.rb76
-rw-r--r--spec/bundler/install/yanked_spec.rb73
-rw-r--r--spec/bundler/lock/git_spec.rb34
-rw-r--r--spec/bundler/lock/lockfile_spec.rb1489
-rw-r--r--spec/bundler/other/cli_dispatch_spec.rb20
-rw-r--r--spec/bundler/other/ext_spec.rb61
-rw-r--r--spec/bundler/other/major_deprecation_spec.rb562
-rw-r--r--spec/bundler/other/platform_spec.rb1306
-rw-r--r--spec/bundler/plugins/command_spec.rb80
-rw-r--r--spec/bundler/plugins/hook_spec.rb109
-rw-r--r--spec/bundler/plugins/install_spec.rb309
-rw-r--r--spec/bundler/plugins/list_spec.rb60
-rw-r--r--spec/bundler/plugins/source/example_spec.rb508
-rw-r--r--spec/bundler/plugins/source_spec.rb108
-rw-r--r--spec/bundler/quality_es_spec.rb65
-rw-r--r--spec/bundler/quality_spec.rb289
-rw-r--r--spec/bundler/realworld/dependency_api_spec.rb46
-rw-r--r--spec/bundler/realworld/double_check_spec.rb40
-rw-r--r--spec/bundler/realworld/edgecases_spec.rb347
-rw-r--r--spec/bundler/realworld/gemfile_source_header_spec.rb53
-rw-r--r--spec/bundler/realworld/mirror_probe_spec.rb144
-rw-r--r--spec/bundler/realworld/parallel_spec.rb66
-rw-r--r--spec/bundler/resolver/basic_spec.rb308
-rw-r--r--spec/bundler/resolver/platform_spec.rb100
-rw-r--r--spec/bundler/runtime/executable_spec.rb173
-rw-r--r--spec/bundler/runtime/gem_tasks_spec.rb66
-rw-r--r--spec/bundler/runtime/inline_spec.rb336
-rw-r--r--spec/bundler/runtime/load_spec.rb111
-rw-r--r--spec/bundler/runtime/platform_spec.rb169
-rw-r--r--spec/bundler/runtime/require_spec.rb452
-rw-r--r--spec/bundler/runtime/setup_spec.rb1354
-rw-r--r--spec/bundler/runtime/with_unbundled_env_spec.rb270
-rw-r--r--spec/bundler/spec_helper.rb130
-rw-r--r--spec/bundler/support/artifice/compact_index.rb118
-rw-r--r--spec/bundler/support/artifice/compact_index_api_missing.rb18
-rw-r--r--spec/bundler/support/artifice/compact_index_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/compact_index_checksum_mismatch.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index_concurrent_download.rb32
-rw-r--r--spec/bundler/support/artifice/compact_index_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/compact_index_extra.rb37
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api.rb52
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_host_redirect.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_no_gem.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update.rb38
-rw-r--r--spec/bundler/support/artifice/compact_index_range_not_satisfiable.rb34
-rw-r--r--spec/bundler/support/artifice/compact_index_rate_limited.rb48
-rw-r--r--spec/bundler/support/artifice/compact_index_redirects.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_dependencies.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_gem_checksum.rb20
-rw-r--r--spec/bundler/support/artifice/endopint_marshal_fail_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint.rb100
-rw-r--r--spec/bundler/support/artifice/endpoint_500.rb19
-rw-r--r--spec/bundler/support/artifice/endpoint_api_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_api_missing.rb18
-rw-r--r--spec/bundler/support/artifice/endpoint_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/endpoint_extra.rb33
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_api.rb34
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_fallback.rb19
-rw-r--r--spec/bundler/support/artifice/endpoint_host_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_mirror_source.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint_timeout.rb15
-rw-r--r--spec/bundler/support/artifice/fail.rb39
-rw-r--r--spec/bundler/support/artifice/vcr.rb152
-rw-r--r--spec/bundler/support/artifice/windows.rb47
-rw-r--r--spec/bundler/support/builders.rb815
-rw-r--r--spec/bundler/support/command_execution.rb44
-rw-r--r--spec/bundler/support/filters.rb45
-rw-r--r--spec/bundler/support/hax.rb68
-rw-r--r--spec/bundler/support/helpers.rb585
-rw-r--r--spec/bundler/support/indexes.rb421
-rw-r--r--spec/bundler/support/matchers.rb224
-rw-r--r--spec/bundler/support/parallel.rb5
-rw-r--r--spec/bundler/support/path.rb191
-rw-r--r--spec/bundler/support/permissions.rb12
-rw-r--r--spec/bundler/support/platforms.rb106
-rw-r--r--spec/bundler/support/rubygems_ext.rb107
-rw-r--r--spec/bundler/support/rubygems_version_manager.rb103
-rw-r--r--spec/bundler/support/silent_logger.rb10
-rw-r--r--spec/bundler/support/sometimes.rb57
-rw-r--r--spec/bundler/support/streams.rb19
-rw-r--r--spec/bundler/support/sudo.rb18
-rw-r--r--spec/bundler/support/the_bundle.rb35
-rw-r--r--spec/bundler/update/gemfile_spec.rb49
-rw-r--r--spec/bundler/update/gems/post_install_spec.rb76
-rw-r--r--spec/bundler/update/git_spec.rb374
-rw-r--r--spec/bundler/update/path_spec.rb18
-rw-r--r--spec/bundler/update/redownload_spec.rb34
-rw-r--r--spec/default.mspec67
-rw-r--r--spec/mspec/Gemfile4
-rw-r--r--spec/mspec/Gemfile.lock21
-rw-r--r--spec/mspec/LICENSE22
-rw-r--r--spec/mspec/README.md86
-rw-r--r--spec/mspec/Rakefile6
-rwxr-xr-xspec/mspec/bin/mkspec7
-rwxr-xr-xspec/mspec/bin/mkspec.bat1
-rwxr-xr-xspec/mspec/bin/mspec7
-rwxr-xr-xspec/mspec/bin/mspec-ci7
-rwxr-xr-xspec/mspec/bin/mspec-ci.bat1
-rwxr-xr-xspec/mspec/bin/mspec-run7
-rwxr-xr-xspec/mspec/bin/mspec-run.bat1
-rwxr-xr-xspec/mspec/bin/mspec-tag7
-rwxr-xr-xspec/mspec/bin/mspec-tag.bat1
-rwxr-xr-xspec/mspec/bin/mspec.bat1
-rw-r--r--spec/mspec/lib/mspec.rb8
-rwxr-xr-xspec/mspec/lib/mspec/commands/mkspec.rb155
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-ci.rb79
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-run.rb87
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-tag.rb133
-rwxr-xr-xspec/mspec/lib/mspec/commands/mspec.rb118
-rw-r--r--spec/mspec/lib/mspec/expectations.rb2
-rw-r--r--spec/mspec/lib/mspec/expectations/expectations.rb35
-rw-r--r--spec/mspec/lib/mspec/expectations/should.rb29
-rw-r--r--spec/mspec/lib/mspec/guards.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/block_device.rb16
-rw-r--r--spec/mspec/lib/mspec/guards/bug.rb28
-rw-r--r--spec/mspec/lib/mspec/guards/conflict.rb23
-rw-r--r--spec/mspec/lib/mspec/guards/endian.rb25
-rw-r--r--spec/mspec/lib/mspec/guards/feature.rb45
-rw-r--r--spec/mspec/lib/mspec/guards/guard.rb141
-rw-r--r--spec/mspec/lib/mspec/guards/platform.rb89
-rw-r--r--spec/mspec/lib/mspec/guards/quarantine.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/superuser.rb15
-rw-r--r--spec/mspec/lib/mspec/guards/support.rb14
-rw-r--r--spec/mspec/lib/mspec/guards/version.rb37
-rw-r--r--spec/mspec/lib/mspec/helpers.rb14
-rw-r--r--spec/mspec/lib/mspec/helpers/argf.rb35
-rw-r--r--spec/mspec/lib/mspec/helpers/argv.rb44
-rw-r--r--spec/mspec/lib/mspec/helpers/datetime.rb47
-rw-r--r--spec/mspec/lib/mspec/helpers/fixture.rb24
-rw-r--r--spec/mspec/lib/mspec/helpers/flunk.rb3
-rw-r--r--spec/mspec/lib/mspec/helpers/frozen_error_class.rb17
-rw-r--r--spec/mspec/lib/mspec/helpers/fs.rb64
-rw-r--r--spec/mspec/lib/mspec/helpers/io.rb91
-rw-r--r--spec/mspec/lib/mspec/helpers/mock_to_path.rb6
-rw-r--r--spec/mspec/lib/mspec/helpers/numeric.rb70
-rw-r--r--spec/mspec/lib/mspec/helpers/ruby_exe.rb157
-rw-r--r--spec/mspec/lib/mspec/helpers/scratch.rb17
-rw-r--r--spec/mspec/lib/mspec/helpers/tmp.rb43
-rw-r--r--spec/mspec/lib/mspec/helpers/warning.rb19
-rw-r--r--spec/mspec/lib/mspec/matchers.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/base.rb61
-rw-r--r--spec/mspec/lib/mspec/matchers/be_an_instance_of.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/be_ancestor_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_close.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/be_computed_by.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/be_empty.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_kind_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nan.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nil.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true_or_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/block_caller.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/complain.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/eql.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal_element.rb78
-rw-r--r--spec/mspec/lib/mspec/matchers/have_class_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_constant.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_protected_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_public_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_singleton_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/include.rb31
-rw-r--r--spec/mspec/lib/mspec/matchers/include_any_of.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/infinity.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/match_yaml.rb46
-rw-r--r--spec/mspec/lib/mspec/matchers/method.rb10
-rw-r--r--spec/mspec/lib/mspec/matchers/output.rb67
-rw-r--r--spec/mspec/lib/mspec/matchers/output_to_fd.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/raise_error.rb80
-rw-r--r--spec/mspec/lib/mspec/matchers/respond_to.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/signed_zero.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/skip.rb5
-rw-r--r--spec/mspec/lib/mspec/matchers/variable.rb24
-rw-r--r--spec/mspec/lib/mspec/mocks.rb3
-rw-r--r--spec/mspec/lib/mspec/mocks/mock.rb212
-rw-r--r--spec/mspec/lib/mspec/mocks/object.rb28
-rw-r--r--spec/mspec/lib/mspec/mocks/proxy.rb186
-rw-r--r--spec/mspec/lib/mspec/runner.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/actions.rb6
-rw-r--r--spec/mspec/lib/mspec/runner/actions/constants_leak_checker.rb79
-rw-r--r--spec/mspec/lib/mspec/runner/actions/filter.rb40
-rw-r--r--spec/mspec/lib/mspec/runner/actions/leakchecker.rb294
-rw-r--r--spec/mspec/lib/mspec/runner/actions/profile.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tag.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/taglist.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tagpurge.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tally.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timeout.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timer.rb22
-rw-r--r--spec/mspec/lib/mspec/runner/context.rb239
-rw-r--r--spec/mspec/lib/mspec/runner/evaluate.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/example.rb34
-rw-r--r--spec/mspec/lib/mspec/runner/exception.rb43
-rw-r--r--spec/mspec/lib/mspec/runner/filters.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/filters/match.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/filters/profile.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters/regexp.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/filters/tag.rb29
-rw-r--r--spec/mspec/lib/mspec/runner/formatters.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/base.rb128
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/describe.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/dotted.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/file.rb24
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/html.rb81
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/junit.rb87
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/method.rb95
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/multi.rb47
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/profile.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/specdoc.rb41
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/spinner.rb111
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/summary.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/unit.rb20
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/yaml.rb38
-rw-r--r--spec/mspec/lib/mspec/runner/mspec.rb410
-rw-r--r--spec/mspec/lib/mspec/runner/object.rb26
-rw-r--r--spec/mspec/lib/mspec/runner/parallel.rb98
-rw-r--r--spec/mspec/lib/mspec/runner/shared.rb10
-rw-r--r--spec/mspec/lib/mspec/runner/tag.rb38
-rw-r--r--spec/mspec/lib/mspec/utils/deprecate.rb6
-rw-r--r--spec/mspec/lib/mspec/utils/format.rb20
-rw-r--r--spec/mspec/lib/mspec/utils/name_map.rb121
-rw-r--r--spec/mspec/lib/mspec/utils/options.rb489
-rw-r--r--spec/mspec/lib/mspec/utils/script.rb284
-rw-r--r--spec/mspec/lib/mspec/utils/version.rb52
-rw-r--r--spec/mspec/lib/mspec/utils/warnings.rb61
-rw-r--r--spec/mspec/lib/mspec/version.rb5
-rw-r--r--spec/mspec/spec/commands/fixtures/four.txt (renamed from test/wsdl/datetime/datetime.rb)0
-rw-r--r--spec/mspec/spec/commands/fixtures/level2/three_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/one_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/three.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/two_spec.rb1
-rw-r--r--spec/mspec/spec/commands/mkspec_spec.rb363
-rw-r--r--spec/mspec/spec/commands/mspec_ci_spec.rb150
-rw-r--r--spec/mspec/spec/commands/mspec_run_spec.rb173
-rw-r--r--spec/mspec/spec/commands/mspec_spec.rb207
-rw-r--r--spec/mspec/spec/commands/mspec_tag_spec.rb414
-rw-r--r--spec/mspec/spec/expectations/expectations_spec.rb29
-rw-r--r--spec/mspec/spec/expectations/should.rb73
-rw-r--r--spec/mspec/spec/expectations/should_spec.rb61
-rw-r--r--spec/mspec/spec/fixtures/a_spec.rb15
-rw-r--r--spec/mspec/spec/fixtures/b_spec.rb7
-rw-r--r--spec/mspec/spec/fixtures/chatty_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/config.mspec10
-rw-r--r--spec/mspec/spec/fixtures/die_spec.rb7
-rwxr-xr-xspec/mspec/spec/fixtures/my_ruby4
-rw-r--r--spec/mspec/spec/fixtures/object_methods_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/print_interpreter_spec.rb4
-rw-r--r--spec/mspec/spec/fixtures/tagging_spec.rb16
-rw-r--r--spec/mspec/spec/guards/block_device_spec.rb46
-rw-r--r--spec/mspec/spec/guards/bug_spec.rb151
-rw-r--r--spec/mspec/spec/guards/conflict_spec.rb53
-rw-r--r--spec/mspec/spec/guards/endian_spec.rb55
-rw-r--r--spec/mspec/spec/guards/feature_spec.rb120
-rw-r--r--spec/mspec/spec/guards/guard_spec.rb421
-rw-r--r--spec/mspec/spec/guards/platform_spec.rb337
-rw-r--r--spec/mspec/spec/guards/quarantine_spec.rb35
-rw-r--r--spec/mspec/spec/guards/superuser_spec.rb35
-rw-r--r--spec/mspec/spec/guards/support_spec.rb54
-rw-r--r--spec/mspec/spec/guards/user_spec.rb20
-rw-r--r--spec/mspec/spec/guards/version_spec.rb90
-rw-r--r--spec/mspec/spec/helpers/argf_spec.rb37
-rw-r--r--spec/mspec/spec/helpers/argv_spec.rb27
-rw-r--r--spec/mspec/spec/helpers/datetime_spec.rb44
-rw-r--r--spec/mspec/spec/helpers/fixture_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/flunk_spec.rb20
-rw-r--r--spec/mspec/spec/helpers/fs_spec.rb195
-rw-r--r--spec/mspec/spec/helpers/io_spec.rb136
-rw-r--r--spec/mspec/spec/helpers/mock_to_path_spec.rb17
-rw-r--r--spec/mspec/spec/helpers/numeric_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/ruby_exe_spec.rb197
-rw-r--r--spec/mspec/spec/helpers/scratch_spec.rb24
-rw-r--r--spec/mspec/spec/helpers/suppress_warning_spec.rb19
-rw-r--r--spec/mspec/spec/helpers/tmp_spec.rb27
-rw-r--r--spec/mspec/spec/integration/interpreter_spec.rb18
-rw-r--r--spec/mspec/spec/integration/object_methods_spec.rb18
-rw-r--r--spec/mspec/spec/integration/run_spec.rb73
-rw-r--r--spec/mspec/spec/integration/tag_spec.rb61
-rw-r--r--spec/mspec/spec/matchers/base_spec.rb228
-rw-r--r--spec/mspec/spec/matchers/be_an_instance_of_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/be_ancestor_of_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_close_spec.rb48
-rw-r--r--spec/mspec/spec/matchers/be_computed_by_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/be_empty_spec.rb26
-rw-r--r--spec/mspec/spec/matchers/be_false_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_kind_of_spec.rb31
-rw-r--r--spec/mspec/spec/matchers/be_nan_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_nil_spec.rb27
-rw-r--r--spec/mspec/spec/matchers/be_true_or_false_spec.rb19
-rw-r--r--spec/mspec/spec/matchers/be_true_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/block_caller_spec.rb13
-rw-r--r--spec/mspec/spec/matchers/complain_spec.rb97
-rw-r--r--spec/mspec/spec/matchers/eql_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/equal_element_spec.rb75
-rw-r--r--spec/mspec/spec/matchers/equal_spec.rb32
-rw-r--r--spec/mspec/spec/matchers/have_class_variable_spec.rb49
-rw-r--r--spec/mspec/spec/matchers/have_constant_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/have_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_instance_variable_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/have_method_spec.rb55
-rw-r--r--spec/mspec/spec/matchers/have_private_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_private_method_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/have_protected_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_public_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_singleton_method_spec.rb45
-rw-r--r--spec/mspec/spec/matchers/include_any_of_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/include_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/infinity_spec.rb34
-rw-r--r--spec/mspec/spec/matchers/match_yaml_spec.rb39
-rw-r--r--spec/mspec/spec/matchers/output_spec.rb74
-rw-r--r--spec/mspec/spec/matchers/output_to_fd_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/raise_error_spec.rb132
-rw-r--r--spec/mspec/spec/matchers/respond_to_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/signed_zero_spec.rb32
-rw-r--r--spec/mspec/spec/mocks/mock_spec.rb530
-rw-r--r--spec/mspec/spec/mocks/proxy_spec.rb405
-rw-r--r--spec/mspec/spec/runner/actions/filter_spec.rb84
-rw-r--r--spec/mspec/spec/runner/actions/tag_spec.rb315
-rw-r--r--spec/mspec/spec/runner/actions/taglist_spec.rb152
-rw-r--r--spec/mspec/spec/runner/actions/tagpurge_spec.rb154
-rw-r--r--spec/mspec/spec/runner/actions/tally_spec.rb352
-rw-r--r--spec/mspec/spec/runner/actions/timer_spec.rb44
-rw-r--r--spec/mspec/spec/runner/context_spec.rb1041
-rw-r--r--spec/mspec/spec/runner/example_spec.rb117
-rw-r--r--spec/mspec/spec/runner/exception_spec.rb146
-rw-r--r--spec/mspec/spec/runner/filters/a.yaml4
-rw-r--r--spec/mspec/spec/runner/filters/b.yaml11
-rw-r--r--spec/mspec/spec/runner/filters/match_spec.rb34
-rw-r--r--spec/mspec/spec/runner/filters/profile_spec.rb117
-rw-r--r--spec/mspec/spec/runner/filters/regexp_spec.rb31
-rw-r--r--spec/mspec/spec/runner/filters/tag_spec.rb92
-rw-r--r--spec/mspec/spec/runner/formatters/describe_spec.rb67
-rw-r--r--spec/mspec/spec/runner/formatters/dotted_spec.rb285
-rw-r--r--spec/mspec/spec/runner/formatters/file_spec.rb84
-rw-r--r--spec/mspec/spec/runner/formatters/html_spec.rb216
-rw-r--r--spec/mspec/spec/runner/formatters/junit_spec.rb147
-rw-r--r--spec/mspec/spec/runner/formatters/method_spec.rb178
-rw-r--r--spec/mspec/spec/runner/formatters/multi_spec.rb70
-rw-r--r--spec/mspec/spec/runner/formatters/specdoc_spec.rb106
-rw-r--r--spec/mspec/spec/runner/formatters/spinner_spec.rb83
-rw-r--r--spec/mspec/spec/runner/formatters/summary_spec.rb26
-rw-r--r--spec/mspec/spec/runner/formatters/unit_spec.rb74
-rw-r--r--spec/mspec/spec/runner/formatters/yaml_spec.rb125
-rw-r--r--spec/mspec/spec/runner/mspec_spec.rb595
-rw-r--r--spec/mspec/spec/runner/shared_spec.rb90
-rw-r--r--spec/mspec/spec/runner/tag_spec.rb123
-rw-r--r--spec/mspec/spec/runner/tags.txt4
-rw-r--r--spec/mspec/spec/spec_helper.rb55
-rw-r--r--spec/mspec/spec/utils/deprecate_spec.rb17
-rw-r--r--spec/mspec/spec/utils/name_map_spec.rb175
-rw-r--r--spec/mspec/spec/utils/options_spec.rb1285
-rw-r--r--spec/mspec/spec/utils/script_spec.rb475
-rw-r--r--spec/mspec/spec/utils/version_spec.rb45
-rwxr-xr-xspec/mspec/tool/find.rb10
-rwxr-xr-xspec/mspec/tool/pull-latest-mspec-spec26
-rw-r--r--spec/mspec/tool/remove_old_guards.rb65
-rw-r--r--spec/mspec/tool/sync/.gitignore4
-rw-r--r--spec/mspec/tool/sync/sync-rubyspec.rb230
-rwxr-xr-xspec/mspec/tool/tag_from_output.rb42
-rw-r--r--spec/ruby/.gitignore5
-rw-r--r--spec/ruby/.mspec.constants225
-rw-r--r--spec/ruby/.rubocop.yml124
-rw-r--r--spec/ruby/.rubocop_todo.yml149
-rw-r--r--spec/ruby/CONTRIBUTING.md251
-rw-r--r--spec/ruby/LICENSE22
-rw-r--r--spec/ruby/README.md137
-rw-r--r--spec/ruby/TODO8
-rw-r--r--spec/ruby/command_line/dash_a_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_c_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_d_spec.rb22
-rw-r--r--spec/ruby/command_line/dash_e_spec.rb41
-rw-r--r--spec/ruby/command_line/dash_encoding_spec.rb30
-rw-r--r--spec/ruby/command_line/dash_external_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_internal_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_n_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_p_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_r_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_s_spec.rb52
-rw-r--r--spec/ruby/command_line/dash_upper_c_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_upper_e_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_upper_f_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_upper_i_spec.rb51
-rw-r--r--spec/ruby/command_line/dash_upper_k_spec.rb65
-rw-r--r--spec/ruby/command_line/dash_upper_s_spec.rb29
-rw-r--r--spec/ruby/command_line/dash_upper_u_spec.rb43
-rw-r--r--spec/ruby/command_line/dash_upper_w_spec.rb20
-rw-r--r--spec/ruby/command_line/dash_upper_x_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_v_spec.rb12
-rw-r--r--spec/ruby/command_line/dash_w_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_x_spec.rb21
-rw-r--r--spec/ruby/command_line/error_message_spec.rb11
-rw-r--r--spec/ruby/command_line/feature_spec.rb56
-rw-r--r--spec/ruby/command_line/fixtures/bad_syntax.rb1
-rw-r--r--spec/ruby/command_line/fixtures/bin/bad_embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/dash_s_fail1
-rw-r--r--spec/ruby/command_line/fixtures/bin/embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/hybrid_launcher.sh4
-rwxr-xr-xspec/ruby/command_line/fixtures/bin/launcher.rb2
-rw-r--r--spec/ruby/command_line/fixtures/change_directory_script.rb1
-rw-r--r--spec/ruby/command_line/fixtures/conditional_range.txt5
-rw-r--r--spec/ruby/command_line/fixtures/dash_s_script.rb12
-rw-r--r--spec/ruby/command_line/fixtures/debug.rb10
-rw-r--r--spec/ruby/command_line/fixtures/debug_info.rb11
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files_diff_enc.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_one_literal.rb2
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required.rb1
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required_diff_enc.rbbin0 -> 121 bytes-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_two_literals.rb1
-rw-r--r--spec/ruby/command_line/fixtures/full_names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/loadpath.rb1
-rw-r--r--spec/ruby/command_line/fixtures/names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/passwd_file.txt3
-rw-r--r--spec/ruby/command_line/fixtures/require.rb1
-rw-r--r--spec/ruby/command_line/fixtures/rubyopt.rb1
-rw-r--r--spec/ruby/command_line/fixtures/test_file.rb1
-rw-r--r--spec/ruby/command_line/fixtures/verbose.rb1
-rw-r--r--spec/ruby/command_line/frozen_strings_spec.rb29
-rw-r--r--spec/ruby/command_line/rubylib_spec.rb69
-rw-r--r--spec/ruby/command_line/rubyopt_spec.rb167
-rw-r--r--spec/ruby/command_line/shared/change_directory.rb21
-rw-r--r--spec/ruby/command_line/shared/verbose.rb9
-rw-r--r--spec/ruby/command_line/syntax_error_spec.rb13
-rw-r--r--spec/ruby/core/argf/argf_spec.rb11
-rw-r--r--spec/ruby/core/argf/argv_spec.rb19
-rw-r--r--spec/ruby/core/argf/binmode_spec.rb43
-rw-r--r--spec/ruby/core/argf/bytes_spec.rb6
-rw-r--r--spec/ruby/core/argf/chars_spec.rb6
-rw-r--r--spec/ruby/core/argf/close_spec.rb35
-rw-r--r--spec/ruby/core/argf/closed_spec.rb18
-rw-r--r--spec/ruby/core/argf/codepoints_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_byte_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_char_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_codepoint_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_line_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_spec.rb6
-rw-r--r--spec/ruby/core/argf/eof_spec.rb10
-rw-r--r--spec/ruby/core/argf/file_spec.rb21
-rw-r--r--spec/ruby/core/argf/filename_spec.rb6
-rw-r--r--spec/ruby/core/argf/fileno_spec.rb6
-rw-r--r--spec/ruby/core/argf/fixtures/bin_file.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file1.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file2.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/filename.rb3
-rw-r--r--spec/ruby/core/argf/fixtures/lineno.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/rewind.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/stdin.txt2
-rw-r--r--spec/ruby/core/argf/getc_spec.rb20
-rw-r--r--spec/ruby/core/argf/gets_spec.rb49
-rw-r--r--spec/ruby/core/argf/lineno_spec.rb30
-rw-r--r--spec/ruby/core/argf/lines_spec.rb6
-rw-r--r--spec/ruby/core/argf/path_spec.rb6
-rw-r--r--spec/ruby/core/argf/pos_spec.rb38
-rw-r--r--spec/ruby/core/argf/read_nonblock_spec.rb80
-rw-r--r--spec/ruby/core/argf/read_spec.rb85
-rw-r--r--spec/ruby/core/argf/readchar_spec.rb19
-rw-r--r--spec/ruby/core/argf/readline_spec.rb23
-rw-r--r--spec/ruby/core/argf/readlines_spec.rb6
-rw-r--r--spec/ruby/core/argf/readpartial_spec.rb75
-rw-r--r--spec/ruby/core/argf/rewind_spec.rb39
-rw-r--r--spec/ruby/core/argf/seek_spec.rb63
-rw-r--r--spec/ruby/core/argf/set_encoding_spec.rb41
-rw-r--r--spec/ruby/core/argf/shared/each_byte.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_char.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_codepoint.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_line.rb62
-rw-r--r--spec/ruby/core/argf/shared/eof.rb24
-rw-r--r--spec/ruby/core/argf/shared/filename.rb28
-rw-r--r--spec/ruby/core/argf/shared/fileno.rb24
-rw-r--r--spec/ruby/core/argf/shared/getc.rb17
-rw-r--r--spec/ruby/core/argf/shared/gets.rb99
-rw-r--r--spec/ruby/core/argf/shared/pos.rb31
-rw-r--r--spec/ruby/core/argf/shared/read.rb58
-rw-r--r--spec/ruby/core/argf/shared/readlines.rb22
-rw-r--r--spec/ruby/core/argf/skip_spec.rb42
-rw-r--r--spec/ruby/core/argf/tell_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_a_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_i_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_io_spec.rb23
-rw-r--r--spec/ruby/core/argf/to_s_spec.rb14
-rw-r--r--spec/ruby/core/array/allocate_spec.rb19
-rw-r--r--spec/ruby/core/array/any_spec.rb37
-rw-r--r--spec/ruby/core/array/append_spec.rb42
-rw-r--r--spec/ruby/core/array/array_spec.rb7
-rw-r--r--spec/ruby/core/array/assoc_spec.rb40
-rw-r--r--spec/ruby/core/array/at_spec.rb56
-rw-r--r--spec/ruby/core/array/bsearch_index_spec.rb85
-rw-r--r--spec/ruby/core/array/bsearch_spec.rb84
-rw-r--r--spec/ruby/core/array/clear_spec.rb52
-rw-r--r--spec/ruby/core/array/clone_spec.rb31
-rw-r--r--spec/ruby/core/array/collect_spec.rb11
-rw-r--r--spec/ruby/core/array/combination_spec.rb74
-rw-r--r--spec/ruby/core/array/compact_spec.rb81
-rw-r--r--spec/ruby/core/array/comparison_spec.rb97
-rw-r--r--spec/ruby/core/array/concat_spec.rb132
-rw-r--r--spec/ruby/core/array/constructor_spec.rb24
-rw-r--r--spec/ruby/core/array/count_spec.rb15
-rw-r--r--spec/ruby/core/array/cycle_spec.rb101
-rw-r--r--spec/ruby/core/array/delete_at_spec.rb63
-rw-r--r--spec/ruby/core/array/delete_if_spec.rb68
-rw-r--r--spec/ruby/core/array/delete_spec.rb68
-rw-r--r--spec/ruby/core/array/difference_spec.rb24
-rw-r--r--spec/ruby/core/array/dig_spec.rb52
-rw-r--r--spec/ruby/core/array/drop_spec.rb51
-rw-r--r--spec/ruby/core/array/drop_while_spec.rb15
-rw-r--r--spec/ruby/core/array/dup_spec.rb31
-rw-r--r--spec/ruby/core/array/each_index_spec.rb42
-rw-r--r--spec/ruby/core/array/each_spec.rb48
-rw-r--r--spec/ruby/core/array/element_reference_spec.rb50
-rw-r--r--spec/ruby/core/array/element_set_spec.rb436
-rw-r--r--spec/ruby/core/array/empty_spec.rb10
-rw-r--r--spec/ruby/core/array/eql_spec.rb19
-rw-r--r--spec/ruby/core/array/equal_value_spec.rb51
-rw-r--r--spec/ruby/core/array/fetch_spec.rb55
-rw-r--r--spec/ruby/core/array/fill_spec.rb317
-rw-r--r--spec/ruby/core/array/filter_spec.rb16
-rw-r--r--spec/ruby/core/array/find_index_spec.rb6
-rw-r--r--spec/ruby/core/array/first_spec.rb93
-rw-r--r--spec/ruby/core/array/fixtures/classes.rb522
-rw-r--r--spec/ruby/core/array/fixtures/encoded_strings.rb69
-rw-r--r--spec/ruby/core/array/flatten_spec.rb286
-rw-r--r--spec/ruby/core/array/frozen_spec.rb16
-rw-r--r--spec/ruby/core/array/hash_spec.rb83
-rw-r--r--spec/ruby/core/array/include_spec.rb33
-rw-r--r--spec/ruby/core/array/index_spec.rb6
-rw-r--r--spec/ruby/core/array/initialize_spec.rb156
-rw-r--r--spec/ruby/core/array/insert_spec.rb78
-rw-r--r--spec/ruby/core/array/inspect_spec.rb7
-rw-r--r--spec/ruby/core/array/intersection_spec.rb87
-rw-r--r--spec/ruby/core/array/join_spec.rb50
-rw-r--r--spec/ruby/core/array/keep_if_spec.rb10
-rw-r--r--spec/ruby/core/array/last_spec.rb87
-rw-r--r--spec/ruby/core/array/length_spec.rb7
-rw-r--r--spec/ruby/core/array/map_spec.rb11
-rw-r--r--spec/ruby/core/array/max_spec.rb116
-rw-r--r--spec/ruby/core/array/min_spec.rb121
-rw-r--r--spec/ruby/core/array/minus_spec.rb7
-rw-r--r--spec/ruby/core/array/multiply_spec.rb134
-rw-r--r--spec/ruby/core/array/new_spec.rb122
-rw-r--r--spec/ruby/core/array/pack/a_spec.rb62
-rw-r--r--spec/ruby/core/array/pack/at_spec.rb30
-rw-r--r--spec/ruby/core/array/pack/b_spec.rb108
-rw-r--r--spec/ruby/core/array/pack/buffer_spec.rb50
-rw-r--r--spec/ruby/core/array/pack/c_spec.rb75
-rw-r--r--spec/ruby/core/array/pack/comment_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/d_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/e_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/empty_spec.rb11
-rw-r--r--spec/ruby/core/array/pack/f_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/g_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/h_spec.rb200
-rw-r--r--spec/ruby/core/array/pack/i_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/j_spec.rb217
-rw-r--r--spec/ruby/core/array/pack/l_spec.rb221
-rw-r--r--spec/ruby/core/array/pack/m_spec.rb309
-rw-r--r--spec/ruby/core/array/pack/n_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/p_spec.rb62
-rw-r--r--spec/ruby/core/array/pack/percent_spec.rb7
-rw-r--r--spec/ruby/core/array/pack/q_spec.rb61
-rw-r--r--spec/ruby/core/array/pack/s_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/shared/basic.rb69
-rw-r--r--spec/ruby/core/array/pack/shared/encodings.rb16
-rw-r--r--spec/ruby/core/array/pack/shared/float.rb229
-rw-r--r--spec/ruby/core/array/pack/shared/integer.rb381
-rw-r--r--spec/ruby/core/array/pack/shared/numeric_basic.rb44
-rw-r--r--spec/ruby/core/array/pack/shared/string.rb48
-rw-r--r--spec/ruby/core/array/pack/shared/taint.rb35
-rw-r--r--spec/ruby/core/array/pack/shared/unicode.rb94
-rw-r--r--spec/ruby/core/array/pack/u_spec.rb130
-rw-r--r--spec/ruby/core/array/pack/v_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/w_spec.rb42
-rw-r--r--spec/ruby/core/array/pack/x_spec.rb64
-rw-r--r--spec/ruby/core/array/pack/z_spec.rb34
-rw-r--r--spec/ruby/core/array/partition_spec.rb43
-rw-r--r--spec/ruby/core/array/permutation_spec.rb138
-rw-r--r--spec/ruby/core/array/plus_spec.rb59
-rw-r--r--spec/ruby/core/array/pop_spec.rb176
-rw-r--r--spec/ruby/core/array/prepend_spec.rb9
-rw-r--r--spec/ruby/core/array/product_spec.rb68
-rw-r--r--spec/ruby/core/array/push_spec.rb7
-rw-r--r--spec/ruby/core/array/rassoc_spec.rb38
-rw-r--r--spec/ruby/core/array/reject_spec.rb143
-rw-r--r--spec/ruby/core/array/repeated_combination_spec.rb84
-rw-r--r--spec/ruby/core/array/repeated_permutation_spec.rb94
-rw-r--r--spec/ruby/core/array/replace_spec.rb7
-rw-r--r--spec/ruby/core/array/reverse_each_spec.rb43
-rw-r--r--spec/ruby/core/array/reverse_spec.rb42
-rw-r--r--spec/ruby/core/array/rindex_spec.rb80
-rw-r--r--spec/ruby/core/array/rotate_spec.rb129
-rw-r--r--spec/ruby/core/array/sample_spec.rb155
-rw-r--r--spec/ruby/core/array/select_spec.rb14
-rw-r--r--spec/ruby/core/array/shared/clone.rb44
-rw-r--r--spec/ruby/core/array/shared/collect.rb140
-rw-r--r--spec/ruby/core/array/shared/delete_if.rb13
-rw-r--r--spec/ruby/core/array/shared/difference.rb78
-rw-r--r--spec/ruby/core/array/shared/enumeratorize.rb5
-rw-r--r--spec/ruby/core/array/shared/eql.rb92
-rw-r--r--spec/ruby/core/array/shared/index.rb37
-rw-r--r--spec/ruby/core/array/shared/inspect.rb133
-rw-r--r--spec/ruby/core/array/shared/join.rb167
-rw-r--r--spec/ruby/core/array/shared/keep_if.rb60
-rw-r--r--spec/ruby/core/array/shared/length.rb11
-rw-r--r--spec/ruby/core/array/shared/push.rb33
-rw-r--r--spec/ruby/core/array/shared/replace.rb60
-rw-r--r--spec/ruby/core/array/shared/select.rb32
-rw-r--r--spec/ruby/core/array/shared/slice.rb480
-rw-r--r--spec/ruby/core/array/shared/union.rb79
-rw-r--r--spec/ruby/core/array/shared/unshift.rb46
-rw-r--r--spec/ruby/core/array/shift_spec.rb136
-rw-r--r--spec/ruby/core/array/shuffle_spec.rb102
-rw-r--r--spec/ruby/core/array/size_spec.rb7
-rw-r--r--spec/ruby/core/array/slice_spec.rb160
-rw-r--r--spec/ruby/core/array/sort_by_spec.rb52
-rw-r--r--spec/ruby/core/array/sort_spec.rb252
-rw-r--r--spec/ruby/core/array/sum_spec.rb42
-rw-r--r--spec/ruby/core/array/take_spec.rb27
-rw-r--r--spec/ruby/core/array/take_while_spec.rb15
-rw-r--r--spec/ruby/core/array/to_a_spec.rb24
-rw-r--r--spec/ruby/core/array/to_ary_spec.rb20
-rw-r--r--spec/ruby/core/array/to_h_spec.rb81
-rw-r--r--spec/ruby/core/array/to_s_spec.rb8
-rw-r--r--spec/ruby/core/array/transpose_spec.rb53
-rw-r--r--spec/ruby/core/array/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/array/union_spec.rb27
-rw-r--r--spec/ruby/core/array/uniq_spec.rb253
-rw-r--r--spec/ruby/core/array/unshift_spec.rb7
-rw-r--r--spec/ruby/core/array/values_at_spec.rb63
-rw-r--r--spec/ruby/core/array/zip_spec.rb65
-rw-r--r--spec/ruby/core/basicobject/__id__spec.rb6
-rw-r--r--spec/ruby/core/basicobject/__send___spec.rb10
-rw-r--r--spec/ruby/core/basicobject/basicobject_spec.rb91
-rw-r--r--spec/ruby/core/basicobject/equal_spec.rb52
-rw-r--r--spec/ruby/core/basicobject/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/basicobject/fixtures/classes.rb33
-rw-r--r--spec/ruby/core/basicobject/fixtures/common.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/remove_method_missing.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/singleton_method.rb10
-rw-r--r--spec/ruby/core/basicobject/initialize_spec.rb13
-rw-r--r--spec/ruby/core/basicobject/instance_eval_spec.rb188
-rw-r--r--spec/ruby/core/basicobject/instance_exec_spec.rb107
-rw-r--r--spec/ruby/core/basicobject/method_missing_spec.rb39
-rw-r--r--spec/ruby/core/basicobject/not_equal_spec.rb53
-rw-r--r--spec/ruby/core/basicobject/not_spec.rb11
-rw-r--r--spec/ruby/core/basicobject/singleton_method_added_spec.rb86
-rw-r--r--spec/ruby/core/basicobject/singleton_method_removed_spec.rb24
-rw-r--r--spec/ruby/core/basicobject/singleton_method_undefined_spec.rb24
-rw-r--r--spec/ruby/core/binding/clone_spec.rb7
-rw-r--r--spec/ruby/core/binding/dup_spec.rb7
-rw-r--r--spec/ruby/core/binding/eval_spec.rb95
-rw-r--r--spec/ruby/core/binding/fixtures/classes.rb52
-rw-r--r--spec/ruby/core/binding/fixtures/irb.rb3
-rw-r--r--spec/ruby/core/binding/fixtures/irbrc1
-rw-r--r--spec/ruby/core/binding/fixtures/location.rb6
-rw-r--r--spec/ruby/core/binding/irb_spec.rb18
-rw-r--r--spec/ruby/core/binding/local_variable_defined_spec.rb46
-rw-r--r--spec/ruby/core/binding/local_variable_get_spec.rb56
-rw-r--r--spec/ruby/core/binding/local_variable_set_spec.rb71
-rw-r--r--spec/ruby/core/binding/local_variables_spec.rb35
-rw-r--r--spec/ruby/core/binding/receiver_spec.rb11
-rw-r--r--spec/ruby/core/binding/shared/clone.rb34
-rw-r--r--spec/ruby/core/binding/source_location_spec.rb11
-rw-r--r--spec/ruby/core/builtin_constants/builtin_constants_spec.rb57
-rw-r--r--spec/ruby/core/class/allocate_spec.rb41
-rw-r--r--spec/ruby/core/class/dup_spec.rb64
-rw-r--r--spec/ruby/core/class/fixtures/classes.rb47
-rw-r--r--spec/ruby/core/class/inherited_spec.rb101
-rw-r--r--spec/ruby/core/class/initialize_spec.rb34
-rw-r--r--spec/ruby/core/class/new_spec.rb154
-rw-r--r--spec/ruby/core/class/superclass_spec.rb27
-rw-r--r--spec/ruby/core/comparable/between_spec.rb25
-rw-r--r--spec/ruby/core/comparable/clamp_spec.rb88
-rw-r--r--spec/ruby/core/comparable/equal_value_spec.rb114
-rw-r--r--spec/ruby/core/comparable/fixtures/classes.rb36
-rw-r--r--spec/ruby/core/comparable/gt_spec.rb43
-rw-r--r--spec/ruby/core/comparable/gte_spec.rb47
-rw-r--r--spec/ruby/core/comparable/lt_spec.rb43
-rw-r--r--spec/ruby/core/comparable/lte_spec.rb46
-rw-r--r--spec/ruby/core/complex/abs2_spec.rb9
-rw-r--r--spec/ruby/core/complex/abs_spec.rb6
-rw-r--r--spec/ruby/core/complex/angle_spec.rb6
-rw-r--r--spec/ruby/core/complex/arg_spec.rb6
-rw-r--r--spec/ruby/core/complex/coerce_spec.rb70
-rw-r--r--spec/ruby/core/complex/conj_spec.rb6
-rw-r--r--spec/ruby/core/complex/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/complex/constants_spec.rb7
-rw-r--r--spec/ruby/core/complex/denominator_spec.rb13
-rw-r--r--spec/ruby/core/complex/divide_spec.rb6
-rw-r--r--spec/ruby/core/complex/eql_spec.rb31
-rw-r--r--spec/ruby/core/complex/equal_value_spec.rb93
-rw-r--r--spec/ruby/core/complex/exponent_spec.rb61
-rw-r--r--spec/ruby/core/complex/fdiv_spec.rb129
-rw-r--r--spec/ruby/core/complex/finite_spec.rb32
-rw-r--r--spec/ruby/core/complex/hash_spec.rb16
-rw-r--r--spec/ruby/core/complex/imag_spec.rb6
-rw-r--r--spec/ruby/core/complex/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/complex/infinite_spec.rb32
-rw-r--r--spec/ruby/core/complex/inspect_spec.rb16
-rw-r--r--spec/ruby/core/complex/integer_spec.rb11
-rw-r--r--spec/ruby/core/complex/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/complex/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/complex/minus_spec.rb45
-rw-r--r--spec/ruby/core/complex/multiply_spec.rb49
-rw-r--r--spec/ruby/core/complex/negative_spec.rb13
-rw-r--r--spec/ruby/core/complex/numerator_spec.rb19
-rw-r--r--spec/ruby/core/complex/phase_spec.rb6
-rw-r--r--spec/ruby/core/complex/plus_spec.rb45
-rw-r--r--spec/ruby/core/complex/polar_spec.rb27
-rw-r--r--spec/ruby/core/complex/positive_spec.rb13
-rw-r--r--spec/ruby/core/complex/quo_spec.rb6
-rw-r--r--spec/ruby/core/complex/rationalize_spec.rb31
-rw-r--r--spec/ruby/core/complex/real_spec.rb28
-rw-r--r--spec/ruby/core/complex/rect_spec.rb10
-rw-r--r--spec/ruby/core/complex/rectangular_spec.rb10
-rw-r--r--spec/ruby/core/complex/shared/abs.rb10
-rw-r--r--spec/ruby/core/complex/shared/arg.rb9
-rw-r--r--spec/ruby/core/complex/shared/conjugate.rb8
-rw-r--r--spec/ruby/core/complex/shared/divide.rb82
-rw-r--r--spec/ruby/core/complex/shared/image.rb8
-rw-r--r--spec/ruby/core/complex/shared/rect.rb94
-rw-r--r--spec/ruby/core/complex/spaceship_spec.rb27
-rw-r--r--spec/ruby/core/complex/to_f_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_i_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_r_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_s_spec.rb44
-rw-r--r--spec/ruby/core/complex/uminus_spec.rb11
-rw-r--r--spec/ruby/core/data/constants_spec.rb15
-rw-r--r--spec/ruby/core/dir/chdir_spec.rb124
-rw-r--r--spec/ruby/core/dir/children_spec.rb138
-rw-r--r--spec/ruby/core/dir/chroot_spec.rb47
-rw-r--r--spec/ruby/core/dir/close_spec.rb19
-rw-r--r--spec/ruby/core/dir/delete_spec.rb15
-rw-r--r--spec/ruby/core/dir/dir_spec.rb7
-rw-r--r--spec/ruby/core/dir/each_child_spec.rb105
-rw-r--r--spec/ruby/core/dir/each_spec.rb64
-rw-r--r--spec/ruby/core/dir/element_reference_spec.rb33
-rw-r--r--spec/ruby/core/dir/empty_spec.rb31
-rw-r--r--spec/ruby/core/dir/entries_spec.rb70
-rw-r--r--spec/ruby/core/dir/exist_spec.rb15
-rw-r--r--spec/ruby/core/dir/exists_spec.rb15
-rw-r--r--spec/ruby/core/dir/fileno_spec.rb37
-rw-r--r--spec/ruby/core/dir/fixtures/common.rb169
-rw-r--r--spec/ruby/core/dir/foreach_spec.rb56
-rw-r--r--spec/ruby/core/dir/getwd_spec.rb15
-rw-r--r--spec/ruby/core/dir/glob_spec.rb168
-rw-r--r--spec/ruby/core/dir/home_spec.rb45
-rw-r--r--spec/ruby/core/dir/initialize_spec.rb23
-rw-r--r--spec/ruby/core/dir/inspect_spec.rb24
-rw-r--r--spec/ruby/core/dir/mkdir_spec.rb87
-rw-r--r--spec/ruby/core/dir/open_spec.rb15
-rw-r--r--spec/ruby/core/dir/path_spec.rb15
-rw-r--r--spec/ruby/core/dir/pos_spec.rb40
-rw-r--r--spec/ruby/core/dir/pwd_spec.rb39
-rw-r--r--spec/ruby/core/dir/read_spec.rb43
-rw-r--r--spec/ruby/core/dir/rewind_spec.rb36
-rw-r--r--spec/ruby/core/dir/rmdir_spec.rb15
-rw-r--r--spec/ruby/core/dir/seek_spec.rb19
-rw-r--r--spec/ruby/core/dir/shared/chroot.rb41
-rw-r--r--spec/ruby/core/dir/shared/closed.rb9
-rw-r--r--spec/ruby/core/dir/shared/delete.rb63
-rw-r--r--spec/ruby/core/dir/shared/exist.rb56
-rw-r--r--spec/ruby/core/dir/shared/glob.rb415
-rw-r--r--spec/ruby/core/dir/shared/open.rb73
-rw-r--r--spec/ruby/core/dir/shared/path.rb30
-rw-r--r--spec/ruby/core/dir/shared/pos.rb51
-rw-r--r--spec/ruby/core/dir/shared/pwd.rb45
-rw-r--r--spec/ruby/core/dir/tell_spec.rb18
-rw-r--r--spec/ruby/core/dir/to_path_spec.rb15
-rw-r--r--spec/ruby/core/dir/unlink_spec.rb15
-rw-r--r--spec/ruby/core/encoding/_dump_spec.rb5
-rw-r--r--spec/ruby/core/encoding/_load_spec.rb5
-rw-r--r--spec/ruby/core/encoding/aliases_spec.rb43
-rw-r--r--spec/ruby/core/encoding/ascii_compatible_spec.rb11
-rw-r--r--spec/ruby/core/encoding/compatible_spec.rb379
-rw-r--r--spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb37
-rw-r--r--spec/ruby/core/encoding/converter/constants_spec.rb131
-rw-r--r--spec/ruby/core/encoding/converter/convert_spec.rb45
-rw-r--r--spec/ruby/core/encoding/converter/convpath_spec.rb24
-rw-r--r--spec/ruby/core/encoding/converter/destination_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/converter/finish_spec.rb36
-rw-r--r--spec/ruby/core/encoding/converter/insert_output_spec.rb5
-rw-r--r--spec/ruby/core/encoding/converter/inspect_spec.rb13
-rw-r--r--spec/ruby/core/encoding/converter/last_error_spec.rb91
-rw-r--r--spec/ruby/core/encoding/converter/new_spec.rb119
-rw-r--r--spec/ruby/core/encoding/converter/primitive_convert_spec.rb211
-rw-r--r--spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb68
-rw-r--r--spec/ruby/core/encoding/converter/putback_spec.rb47
-rw-r--r--spec/ruby/core/encoding/converter/replacement_spec.rb72
-rw-r--r--spec/ruby/core/encoding/converter/search_convpath_spec.rb30
-rw-r--r--spec/ruby/core/encoding/converter/source_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/default_external_spec.rb63
-rw-r--r--spec/ruby/core/encoding/default_internal_spec.rb74
-rw-r--r--spec/ruby/core/encoding/dummy_spec.rb14
-rw-r--r--spec/ruby/core/encoding/find_spec.rb82
-rw-r--r--spec/ruby/core/encoding/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/encoding/inspect_spec.rb19
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb29
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb33
-rw-r--r--spec/ruby/core/encoding/list_spec.rb41
-rw-r--r--spec/ruby/core/encoding/locale_charmap_spec.rb45
-rw-r--r--spec/ruby/core/encoding/name_list_spec.rb23
-rw-r--r--spec/ruby/core/encoding/name_spec.rb5
-rw-r--r--spec/ruby/core/encoding/names_spec.rb35
-rw-r--r--spec/ruby/core/encoding/replicate_spec.rb46
-rw-r--r--spec/ruby/core/encoding/shared/name.rb15
-rw-r--r--spec/ruby/core/encoding/to_s_spec.rb5
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb27
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb29
-rw-r--r--spec/ruby/core/enumerable/all_spec.rb201
-rw-r--r--spec/ruby/core/enumerable/any_spec.rb214
-rw-r--r--spec/ruby/core/enumerable/chain_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerable/chunk_while_spec.rb42
-rw-r--r--spec/ruby/core/enumerable/collect_concat_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/collect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/count_spec.rb59
-rw-r--r--spec/ruby/core/enumerable/cycle_spec.rb104
-rw-r--r--spec/ruby/core/enumerable/detect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/drop_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/drop_while_spec.rb50
-rw-r--r--spec/ruby/core/enumerable/each_cons_spec.rb99
-rw-r--r--spec/ruby/core/enumerable/each_entry_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/each_slice_spec.rb101
-rw-r--r--spec/ruby/core/enumerable/each_with_index_spec.rb53
-rw-r--r--spec/ruby/core/enumerable/each_with_object_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/entries_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/filter_map_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/filter_spec.rb9
-rw-r--r--spec/ruby/core/enumerable/find_all_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/find_index_spec.rb89
-rw-r--r--spec/ruby/core/enumerable/find_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/first_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/fixtures/classes.rb345
-rw-r--r--spec/ruby/core/enumerable/flat_map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/grep_spec.rb74
-rw-r--r--spec/ruby/core/enumerable/grep_v_spec.rb63
-rw-r--r--spec/ruby/core/enumerable/group_by_spec.rb47
-rw-r--r--spec/ruby/core/enumerable/include_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/inject_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/lazy_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/max_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/max_spec.rb119
-rw-r--r--spec/ruby/core/enumerable/member_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/min_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/min_spec.rb123
-rw-r--r--spec/ruby/core/enumerable/minmax_by_spec.rb44
-rw-r--r--spec/ruby/core/enumerable/minmax_spec.rb44
-rw-r--r--spec/ruby/core/enumerable/none_spec.rb167
-rw-r--r--spec/ruby/core/enumerable/one_spec.rb169
-rw-r--r--spec/ruby/core/enumerable/partition_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/reduce_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/reject_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/reverse_each_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/select_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/shared/collect.rb38
-rw-r--r--spec/ruby/core/enumerable/shared/collect_concat.rb54
-rw-r--r--spec/ruby/core/enumerable/shared/entries.rb26
-rw-r--r--spec/ruby/core/enumerable/shared/enumerable_enumeratorized.rb33
-rw-r--r--spec/ruby/core/enumerable/shared/enumeratorized.rb42
-rw-r--r--spec/ruby/core/enumerable/shared/find.rb77
-rw-r--r--spec/ruby/core/enumerable/shared/find_all.rb31
-rw-r--r--spec/ruby/core/enumerable/shared/include.rb34
-rw-r--r--spec/ruby/core/enumerable/shared/inject.rb69
-rw-r--r--spec/ruby/core/enumerable/shared/take.rb63
-rw-r--r--spec/ruby/core/enumerable/slice_after_spec.rb61
-rw-r--r--spec/ruby/core/enumerable/slice_before_spec.rb64
-rw-r--r--spec/ruby/core/enumerable/slice_when_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sort_by_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/sort_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sum_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/take_spec.rb13
-rw-r--r--spec/ruby/core/enumerable/take_while_spec.rb51
-rw-r--r--spec/ruby/core/enumerable/tally_spec.rb35
-rw-r--r--spec/ruby/core/enumerable/to_a_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/to_h_spec.rb90
-rw-r--r--spec/ruby/core/enumerable/uniq_spec.rb122
-rw-r--r--spec/ruby/core/enumerable/zip_spec.rb41
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/begin_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/each_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/end_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/eq_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/first_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/hash_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/inspect_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/last_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/new_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/size_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/step_spec.rb15
-rw-r--r--spec/ruby/core/enumerator/chain/each_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/chain/initialize_spec.rb33
-rw-r--r--spec/ruby/core/enumerator/chain/inspect_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/chain/rewind_spec.rb53
-rw-r--r--spec/ruby/core/enumerator/chain/size_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/each_spec.rb89
-rw-r--r--spec/ruby/core/enumerator/each_with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/each_with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enum_for_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enumerator_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/feed_spec.rb52
-rw-r--r--spec/ruby/core/enumerator/first_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/fixtures/common.rb9
-rw-r--r--spec/ruby/core/enumerator/generator/each_spec.rb40
-rw-r--r--spec/ruby/core/enumerator/generator/initialize_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/initialize_spec.rb61
-rw-r--r--spec/ruby/core/enumerator/inspect_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_while_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_concat_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_spec.rb58
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_while_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/enum_for_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/find_all_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/fixtures/classes.rb54
-rw-r--r--spec/ruby/core/enumerator/lazy/flat_map_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/lazy/force_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_spec.rb121
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_v_spec.rb123
-rw-r--r--spec/ruby/core/enumerator/lazy/initialize_spec.rb63
-rw-r--r--spec/ruby/core/enumerator/lazy/lazy_spec.rb28
-rw-r--r--spec/ruby/core/enumerator/lazy/map_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/lazy/reject_spec.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/select_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect.rb62
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect_concat.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/select.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/to_enum.rb55
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_after_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_before_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_when_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/take_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/take_while_spec.rb60
-rw-r--r--spec/ruby/core/enumerator/lazy/to_enum_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/uniq_spec.rb74
-rw-r--r--spec/ruby/core/enumerator/lazy/zip_spec.rb86
-rw-r--r--spec/ruby/core/enumerator/new_spec.rb41
-rw-r--r--spec/ruby/core/enumerator/next_spec.rb27
-rw-r--r--spec/ruby/core/enumerator/next_values_spec.rb55
-rw-r--r--spec/ruby/core/enumerator/peek_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/peek_values_spec.rb57
-rw-r--r--spec/ruby/core/enumerator/plus_spec.rb35
-rw-r--r--spec/ruby/core/enumerator/rewind_spec.rb70
-rw-r--r--spec/ruby/core/enumerator/size_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/to_enum_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/with_index_spec.rb72
-rw-r--r--spec/ruby/core/enumerator/with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/yielder/append_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/yielder/initialize_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/yield_spec.rb23
-rw-r--r--spec/ruby/core/env/assoc_spec.rb31
-rw-r--r--spec/ruby/core/env/clear_spec.rb20
-rw-r--r--spec/ruby/core/env/delete_if_spec.rb54
-rw-r--r--spec/ruby/core/env/delete_spec.rb42
-rw-r--r--spec/ruby/core/env/each_key_spec.rb34
-rw-r--r--spec/ruby/core/env/each_pair_spec.rb6
-rw-r--r--spec/ruby/core/env/each_spec.rb6
-rw-r--r--spec/ruby/core/env/each_value_spec.rb34
-rw-r--r--spec/ruby/core/env/element_reference_spec.rb75
-rw-r--r--spec/ruby/core/env/element_set_spec.rb6
-rw-r--r--spec/ruby/core/env/empty_spec.rb23
-rw-r--r--spec/ruby/core/env/fetch_spec.rb62
-rw-r--r--spec/ruby/core/env/filter_spec.rb15
-rw-r--r--spec/ruby/core/env/has_key_spec.rb6
-rw-r--r--spec/ruby/core/env/has_value_spec.rb6
-rw-r--r--spec/ruby/core/env/include_spec.rb6
-rw-r--r--spec/ruby/core/env/index_spec.rb12
-rw-r--r--spec/ruby/core/env/indexes_spec.rb1
-rw-r--r--spec/ruby/core/env/indices_spec.rb1
-rw-r--r--spec/ruby/core/env/inspect_spec.rb11
-rw-r--r--spec/ruby/core/env/invert_spec.rb16
-rw-r--r--spec/ruby/core/env/keep_if_spec.rb54
-rw-r--r--spec/ruby/core/env/key_spec.rb11
-rw-r--r--spec/ruby/core/env/keys_spec.rb14
-rw-r--r--spec/ruby/core/env/length_spec.rb6
-rw-r--r--spec/ruby/core/env/member_spec.rb6
-rw-r--r--spec/ruby/core/env/merge_spec.rb8
-rw-r--r--spec/ruby/core/env/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/env/rehash_spec.rb7
-rw-r--r--spec/ruby/core/env/reject_spec.rb101
-rw-r--r--spec/ruby/core/env/replace_spec.rb51
-rw-r--r--spec/ruby/core/env/select_spec.rb13
-rw-r--r--spec/ruby/core/env/shared/each.rb65
-rw-r--r--spec/ruby/core/env/shared/include.rb23
-rw-r--r--spec/ruby/core/env/shared/key.rb23
-rw-r--r--spec/ruby/core/env/shared/length.rb13
-rw-r--r--spec/ruby/core/env/shared/select.rb61
-rw-r--r--spec/ruby/core/env/shared/store.rb60
-rw-r--r--spec/ruby/core/env/shared/to_hash.rb33
-rw-r--r--spec/ruby/core/env/shared/update.rb100
-rw-r--r--spec/ruby/core/env/shared/value.rb22
-rw-r--r--spec/ruby/core/env/shift_spec.rb57
-rw-r--r--spec/ruby/core/env/size_spec.rb6
-rw-r--r--spec/ruby/core/env/slice_spec.rb29
-rw-r--r--spec/ruby/core/env/spec_helper.rb26
-rw-r--r--spec/ruby/core/env/store_spec.rb6
-rw-r--r--spec/ruby/core/env/to_a_spec.rb18
-rw-r--r--spec/ruby/core/env/to_h_spec.rb60
-rw-r--r--spec/ruby/core/env/to_hash_spec.rb6
-rw-r--r--spec/ruby/core/env/to_s_spec.rb7
-rw-r--r--spec/ruby/core/env/update_spec.rb6
-rw-r--r--spec/ruby/core/env/value_spec.rb6
-rw-r--r--spec/ruby/core/env/values_at_spec.rb37
-rw-r--r--spec/ruby/core/env/values_spec.rb14
-rw-r--r--spec/ruby/core/exception/backtrace_locations_spec.rb39
-rw-r--r--spec/ruby/core/exception/backtrace_spec.rb93
-rw-r--r--spec/ruby/core/exception/case_compare_spec.rb39
-rw-r--r--spec/ruby/core/exception/cause_spec.rb56
-rw-r--r--spec/ruby/core/exception/destination_encoding_name_spec.rb23
-rw-r--r--spec/ruby/core/exception/destination_encoding_spec.rb23
-rw-r--r--spec/ruby/core/exception/dup_spec.rb74
-rw-r--r--spec/ruby/core/exception/equal_value_spec.rb68
-rw-r--r--spec/ruby/core/exception/errno_spec.rb48
-rw-r--r--spec/ruby/core/exception/error_bytes_spec.rb12
-rw-r--r--spec/ruby/core/exception/error_char_spec.rb12
-rw-r--r--spec/ruby/core/exception/exception_spec.rb69
-rw-r--r--spec/ruby/core/exception/exit_value_spec.rb5
-rw-r--r--spec/ruby/core/exception/fixtures/common.rb95
-rw-r--r--spec/ruby/core/exception/frozen_error_spec.rb34
-rw-r--r--spec/ruby/core/exception/full_message_spec.rb94
-rw-r--r--spec/ruby/core/exception/hierarchy_spec.rb62
-rw-r--r--spec/ruby/core/exception/incomplete_input_spec.rb5
-rw-r--r--spec/ruby/core/exception/initialize_spec.rb1
-rw-r--r--spec/ruby/core/exception/inspect_spec.rb24
-rw-r--r--spec/ruby/core/exception/interrupt_spec.rb35
-rw-r--r--spec/ruby/core/exception/io_error_spec.rb51
-rw-r--r--spec/ruby/core/exception/key_error_spec.rb15
-rw-r--r--spec/ruby/core/exception/load_error_spec.rb21
-rw-r--r--spec/ruby/core/exception/message_spec.rb27
-rw-r--r--spec/ruby/core/exception/name_error_spec.rb24
-rw-r--r--spec/ruby/core/exception/name_spec.rb45
-rw-r--r--spec/ruby/core/exception/new_spec.rb7
-rw-r--r--spec/ruby/core/exception/no_method_error_spec.rb106
-rw-r--r--spec/ruby/core/exception/range_error_spec.rb7
-rw-r--r--spec/ruby/core/exception/readagain_bytes_spec.rb12
-rw-r--r--spec/ruby/core/exception/reason_spec.rb5
-rw-r--r--spec/ruby/core/exception/receiver_spec.rb60
-rw-r--r--spec/ruby/core/exception/result_spec.rb29
-rw-r--r--spec/ruby/core/exception/set_backtrace_spec.rb56
-rw-r--r--spec/ruby/core/exception/shared/new.rb18
-rw-r--r--spec/ruby/core/exception/signal_exception_spec.rb125
-rw-r--r--spec/ruby/core/exception/signm_spec.rb5
-rw-r--r--spec/ruby/core/exception/signo_spec.rb5
-rw-r--r--spec/ruby/core/exception/source_encoding_name_spec.rb23
-rw-r--r--spec/ruby/core/exception/source_encoding_spec.rb23
-rw-r--r--spec/ruby/core/exception/standard_error_spec.rb23
-rw-r--r--spec/ruby/core/exception/status_spec.rb5
-rw-r--r--spec/ruby/core/exception/success_spec.rb5
-rw-r--r--spec/ruby/core/exception/system_call_error_spec.rb130
-rw-r--r--spec/ruby/core/exception/system_stack_error_spec.rb7
-rw-r--r--spec/ruby/core/exception/to_s_spec.rb37
-rw-r--r--spec/ruby/core/exception/uncaught_throw_error_spec.rb18
-rw-r--r--spec/ruby/core/false/and_spec.rb11
-rw-r--r--spec/ruby/core/false/dup_spec.rb7
-rw-r--r--spec/ruby/core/false/falseclass_spec.rb15
-rw-r--r--spec/ruby/core/false/inspect_spec.rb7
-rw-r--r--spec/ruby/core/false/or_spec.rb11
-rw-r--r--spec/ruby/core/false/to_s_spec.rb17
-rw-r--r--spec/ruby/core/false/xor_spec.rb11
-rw-r--r--spec/ruby/core/fiber/new_spec.rb39
-rw-r--r--spec/ruby/core/fiber/resume_spec.rb48
-rw-r--r--spec/ruby/core/fiber/yield_spec.rb49
-rw-r--r--spec/ruby/core/file/absolute_path_spec.rb90
-rw-r--r--spec/ruby/core/file/atime_spec.rb55
-rw-r--r--spec/ruby/core/file/basename_spec.rb168
-rw-r--r--spec/ruby/core/file/birthtime_spec.rb60
-rw-r--r--spec/ruby/core/file/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/file/chardev_spec.rb6
-rw-r--r--spec/ruby/core/file/chmod_spec.rb185
-rw-r--r--spec/ruby/core/file/chown_spec.rb144
-rw-r--r--spec/ruby/core/file/constants/constants_spec.rb31
-rw-r--r--spec/ruby/core/file/constants_spec.rb141
-rw-r--r--spec/ruby/core/file/ctime_spec.rb51
-rw-r--r--spec/ruby/core/file/delete_spec.rb6
-rw-r--r--spec/ruby/core/file/directory_spec.rb10
-rw-r--r--spec/ruby/core/file/dirname_spec.rb108
-rw-r--r--spec/ruby/core/file/empty_spec.rb13
-rw-r--r--spec/ruby/core/file/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/exist_spec.rb6
-rw-r--r--spec/ruby/core/file/exists_spec.rb6
-rw-r--r--spec/ruby/core/file/expand_path_spec.rb265
-rw-r--r--spec/ruby/core/file/extname_spec.rb66
-rw-r--r--spec/ruby/core/file/file_spec.rb16
-rw-r--r--spec/ruby/core/file/fixtures/common.rb22
-rw-r--r--spec/ruby/core/file/fixtures/do_not_remove1
-rw-r--r--spec/ruby/core/file/fixtures/file_types.rb66
-rw-r--r--spec/ruby/core/file/flock_spec.rb106
-rw-r--r--spec/ruby/core/file/fnmatch_spec.rb10
-rw-r--r--spec/ruby/core/file/ftype_spec.rb74
-rw-r--r--spec/ruby/core/file/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/file/identical_spec.rb6
-rw-r--r--spec/ruby/core/file/initialize_spec.rb19
-rw-r--r--spec/ruby/core/file/inspect_spec.rb17
-rw-r--r--spec/ruby/core/file/join_spec.rb139
-rw-r--r--spec/ruby/core/file/lchmod_spec.rb42
-rw-r--r--spec/ruby/core/file/lchown_spec.rb59
-rw-r--r--spec/ruby/core/file/link_spec.rb39
-rw-r--r--spec/ruby/core/file/lstat_spec.rb33
-rw-r--r--spec/ruby/core/file/lutime_spec.rb40
-rw-r--r--spec/ruby/core/file/mkfifo_spec.rb51
-rw-r--r--spec/ruby/core/file/mtime_spec.rb51
-rw-r--r--spec/ruby/core/file/new_spec.rb162
-rw-r--r--spec/ruby/core/file/null_spec.rb15
-rw-r--r--spec/ruby/core/file/open_spec.rb700
-rw-r--r--spec/ruby/core/file/owned_spec.rb35
-rw-r--r--spec/ruby/core/file/path_spec.rb40
-rw-r--r--spec/ruby/core/file/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/printf_spec.rb18
-rw-r--r--spec/ruby/core/file/read_spec.rb6
-rw-r--r--spec/ruby/core/file/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/readlink_spec.rb86
-rw-r--r--spec/ruby/core/file/realdirpath_spec.rb104
-rw-r--r--spec/ruby/core/file/realpath_spec.rb88
-rw-r--r--spec/ruby/core/file/rename_spec.rb37
-rw-r--r--spec/ruby/core/file/reopen_spec.rb32
-rw-r--r--spec/ruby/core/file/setgid_spec.rb36
-rw-r--r--spec/ruby/core/file/setuid_spec.rb38
-rw-r--r--spec/ruby/core/file/shared/fnmatch.rb241
-rw-r--r--spec/ruby/core/file/shared/open.rb12
-rw-r--r--spec/ruby/core/file/shared/path.rb77
-rw-r--r--spec/ruby/core/file/shared/read.rb15
-rw-r--r--spec/ruby/core/file/shared/stat.rb32
-rw-r--r--spec/ruby/core/file/shared/unlink.rb61
-rw-r--r--spec/ruby/core/file/size_spec.rb119
-rw-r--r--spec/ruby/core/file/socket_spec.rb42
-rw-r--r--spec/ruby/core/file/split_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/atime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/birthtime_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blksize_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blockdev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/blocks_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/chardev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/comparison_spec.rb66
-rw-r--r--spec/ruby/core/file/stat/ctime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/dev_major_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_minor_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/directory_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/file_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/fixtures/classes.rb5
-rw-r--r--spec/ruby/core/file/stat/ftype_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/gid_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/grpowned_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/ino_spec.rb28
-rw-r--r--spec/ruby/core/file/stat/inspect_spec.rb26
-rw-r--r--spec/ruby/core/file/stat/mode_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/mtime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/new_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/nlink_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/owned_spec.rb33
-rw-r--r--spec/ruby/core/file/stat/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/rdev_major_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_minor_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setgid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setuid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/size_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/socket_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/sticky_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/symlink_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/uid_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/world_readable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/world_writable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/zero_spec.rb7
-rw-r--r--spec/ruby/core/file/stat_spec.rb45
-rw-r--r--spec/ruby/core/file/sticky_spec.rb50
-rw-r--r--spec/ruby/core/file/symlink_spec.rb57
-rw-r--r--spec/ruby/core/file/to_path_spec.rb6
-rw-r--r--spec/ruby/core/file/truncate_spec.rb177
-rw-r--r--spec/ruby/core/file/umask_spec.rb57
-rw-r--r--spec/ruby/core/file/unlink_spec.rb6
-rw-r--r--spec/ruby/core/file/utime_spec.rb83
-rw-r--r--spec/ruby/core/file/world_readable_spec.rb12
-rw-r--r--spec/ruby/core/file/world_writable_spec.rb12
-rw-r--r--spec/ruby/core/file/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/zero_spec.rb13
-rw-r--r--spec/ruby/core/filetest/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/chardev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/directory_spec.rb10
-rw-r--r--spec/ruby/core/filetest/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/executable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/exist_spec.rb6
-rw-r--r--spec/ruby/core/filetest/exists_spec.rb6
-rw-r--r--spec/ruby/core/filetest/file_spec.rb10
-rw-r--r--spec/ruby/core/filetest/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/filetest/identical_spec.rb6
-rw-r--r--spec/ruby/core/filetest/owned_spec.rb6
-rw-r--r--spec/ruby/core/filetest/pipe_spec.rb6
-rw-r--r--spec/ruby/core/filetest/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/readable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/setgid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/setuid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/size_spec.rb34
-rw-r--r--spec/ruby/core/filetest/socket_spec.rb6
-rw-r--r--spec/ruby/core/filetest/sticky_spec.rb7
-rw-r--r--spec/ruby/core/filetest/symlink_spec.rb10
-rw-r--r--spec/ruby/core/filetest/world_readable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/world_writable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/writable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/zero_spec.rb13
-rw-r--r--spec/ruby/core/float/abs_spec.rb6
-rw-r--r--spec/ruby/core/float/angle_spec.rb6
-rw-r--r--spec/ruby/core/float/arg_spec.rb6
-rw-r--r--spec/ruby/core/float/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/float/ceil_spec.rb21
-rw-r--r--spec/ruby/core/float/coerce_spec.rb18
-rw-r--r--spec/ruby/core/float/comparison_spec.rb68
-rw-r--r--spec/ruby/core/float/constants_spec.rb55
-rw-r--r--spec/ruby/core/float/denominator_spec.rb29
-rw-r--r--spec/ruby/core/float/divide_spec.rb39
-rw-r--r--spec/ruby/core/float/divmod_spec.rb43
-rw-r--r--spec/ruby/core/float/dup_spec.rb8
-rw-r--r--spec/ruby/core/float/eql_spec.rb16
-rw-r--r--spec/ruby/core/float/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/float/exponent_spec.rb15
-rw-r--r--spec/ruby/core/float/fdiv_spec.rb6
-rw-r--r--spec/ruby/core/float/finite_spec.rb19
-rw-r--r--spec/ruby/core/float/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/float/fixtures/coerce.rb15
-rw-r--r--spec/ruby/core/float/float_spec.rb19
-rw-r--r--spec/ruby/core/float/floor_spec.rb21
-rw-r--r--spec/ruby/core/float/gt_spec.rb17
-rw-r--r--spec/ruby/core/float/gte_spec.rb17
-rw-r--r--spec/ruby/core/float/hash_spec.rb11
-rw-r--r--spec/ruby/core/float/infinite_spec.rb19
-rw-r--r--spec/ruby/core/float/lt_spec.rb17
-rw-r--r--spec/ruby/core/float/lte_spec.rb18
-rw-r--r--spec/ruby/core/float/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/float/minus_spec.rb12
-rw-r--r--spec/ruby/core/float/modulo_spec.rb10
-rw-r--r--spec/ruby/core/float/multiply_spec.rb17
-rw-r--r--spec/ruby/core/float/nan_spec.rb9
-rw-r--r--spec/ruby/core/float/next_float_spec.rb49
-rw-r--r--spec/ruby/core/float/numerator_spec.rb39
-rw-r--r--spec/ruby/core/float/phase_spec.rb6
-rw-r--r--spec/ruby/core/float/plus_spec.rb12
-rw-r--r--spec/ruby/core/float/prev_float_spec.rb49
-rw-r--r--spec/ruby/core/float/quo_spec.rb6
-rw-r--r--spec/ruby/core/float/rationalize_spec.rb43
-rw-r--r--spec/ruby/core/float/round_spec.rb117
-rw-r--r--spec/ruby/core/float/shared/abs.rb21
-rw-r--r--spec/ruby/core/float/shared/arg.rb36
-rw-r--r--spec/ruby/core/float/shared/arithmetic_exception_in_coerce.rb33
-rw-r--r--spec/ruby/core/float/shared/comparison_exception_in_coerce.rb35
-rw-r--r--spec/ruby/core/float/shared/equal.rb17
-rw-r--r--spec/ruby/core/float/shared/modulo.rb48
-rw-r--r--spec/ruby/core/float/shared/quo.rb59
-rw-r--r--spec/ruby/core/float/shared/to_i.rb10
-rw-r--r--spec/ruby/core/float/to_f_spec.rb9
-rw-r--r--spec/ruby/core/float/to_i_spec.rb6
-rw-r--r--spec/ruby/core/float/to_int_spec.rb6
-rw-r--r--spec/ruby/core/float/to_r_spec.rb5
-rw-r--r--spec/ruby/core/float/to_s_spec.rb310
-rw-r--r--spec/ruby/core/float/truncate_spec.rb14
-rw-r--r--spec/ruby/core/float/uminus_spec.rb28
-rw-r--r--spec/ruby/core/float/uplus_spec.rb9
-rw-r--r--spec/ruby/core/float/zero_spec.rb9
-rw-r--r--spec/ruby/core/gc/count_spec.rb17
-rw-r--r--spec/ruby/core/gc/disable_spec.rb18
-rw-r--r--spec/ruby/core/gc/enable_spec.rb13
-rw-r--r--spec/ruby/core/gc/garbage_collect_spec.rb15
-rw-r--r--spec/ruby/core/gc/profiler/clear_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/disable_spec.rb16
-rw-r--r--spec/ruby/core/gc/profiler/enable_spec.rb17
-rw-r--r--spec/ruby/core/gc/profiler/enabled_spec.rb21
-rw-r--r--spec/ruby/core/gc/profiler/report_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/result_spec.rb7
-rw-r--r--spec/ruby/core/gc/profiler/total_time_spec.rb7
-rw-r--r--spec/ruby/core/gc/start_spec.rb8
-rw-r--r--spec/ruby/core/gc/stat_spec.rb16
-rw-r--r--spec/ruby/core/gc/stress_spec.rb27
-rw-r--r--spec/ruby/core/hash/allocate_spec.rb15
-rw-r--r--spec/ruby/core/hash/any_spec.rb30
-rw-r--r--spec/ruby/core/hash/assoc_spec.rb50
-rw-r--r--spec/ruby/core/hash/clear_spec.rb32
-rw-r--r--spec/ruby/core/hash/clone_spec.rb12
-rw-r--r--spec/ruby/core/hash/compact_spec.rb59
-rw-r--r--spec/ruby/core/hash/compare_by_identity_spec.rb138
-rw-r--r--spec/ruby/core/hash/constructor_spec.rb123
-rw-r--r--spec/ruby/core/hash/default_proc_spec.rb80
-rw-r--r--spec/ruby/core/hash/default_spec.rb46
-rw-r--r--spec/ruby/core/hash/delete_if_spec.rb44
-rw-r--r--spec/ruby/core/hash/delete_spec.rb44
-rw-r--r--spec/ruby/core/hash/dig_spec.rb66
-rw-r--r--spec/ruby/core/hash/each_key_spec.rb23
-rw-r--r--spec/ruby/core/hash/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_value_spec.rb23
-rw-r--r--spec/ruby/core/hash/element_reference_spec.rb120
-rw-r--r--spec/ruby/core/hash/element_set_spec.rb7
-rw-r--r--spec/ruby/core/hash/empty_spec.rb15
-rw-r--r--spec/ruby/core/hash/eql_spec.rb9
-rw-r--r--spec/ruby/core/hash/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/hash/fetch_spec.rb44
-rw-r--r--spec/ruby/core/hash/fetch_values_spec.rb35
-rw-r--r--spec/ruby/core/hash/filter_spec.rb12
-rw-r--r--spec/ruby/core/hash/fixtures/classes.rb75
-rw-r--r--spec/ruby/core/hash/flatten_spec.rb62
-rw-r--r--spec/ruby/core/hash/gt_spec.rb42
-rw-r--r--spec/ruby/core/hash/gte_spec.rb42
-rw-r--r--spec/ruby/core/hash/has_key_spec.rb7
-rw-r--r--spec/ruby/core/hash/has_value_spec.rb7
-rw-r--r--spec/ruby/core/hash/hash_spec.rb44
-rw-r--r--spec/ruby/core/hash/include_spec.rb7
-rw-r--r--spec/ruby/core/hash/index_spec.rb7
-rw-r--r--spec/ruby/core/hash/initialize_spec.rb61
-rw-r--r--spec/ruby/core/hash/inspect_spec.rb7
-rw-r--r--spec/ruby/core/hash/invert_spec.rb27
-rw-r--r--spec/ruby/core/hash/keep_if_spec.rb37
-rw-r--r--spec/ruby/core/hash/key_spec.rb12
-rw-r--r--spec/ruby/core/hash/keys_spec.rb23
-rw-r--r--spec/ruby/core/hash/length_spec.rb7
-rw-r--r--spec/ruby/core/hash/lt_spec.rb42
-rw-r--r--spec/ruby/core/hash/lte_spec.rb42
-rw-r--r--spec/ruby/core/hash/member_spec.rb7
-rw-r--r--spec/ruby/core/hash/merge_spec.rb102
-rw-r--r--spec/ruby/core/hash/new_spec.rb36
-rw-r--r--spec/ruby/core/hash/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/hash/rehash_spec.rb66
-rw-r--r--spec/ruby/core/hash/reject_spec.rb102
-rw-r--r--spec/ruby/core/hash/replace_spec.rb7
-rw-r--r--spec/ruby/core/hash/select_spec.rb10
-rw-r--r--spec/ruby/core/hash/shared/comparison.rb15
-rw-r--r--spec/ruby/core/hash/shared/each.rb85
-rw-r--r--spec/ruby/core/hash/shared/eql.rb250
-rw-r--r--spec/ruby/core/hash/shared/equal.rb90
-rw-r--r--spec/ruby/core/hash/shared/greater_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/index.rb27
-rw-r--r--spec/ruby/core/hash/shared/iteration.rb19
-rw-r--r--spec/ruby/core/hash/shared/key.rb38
-rw-r--r--spec/ruby/core/hash/shared/length.rb12
-rw-r--r--spec/ruby/core/hash/shared/less_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/replace.rb51
-rw-r--r--spec/ruby/core/hash/shared/select.rb91
-rw-r--r--spec/ruby/core/hash/shared/store.rb98
-rw-r--r--spec/ruby/core/hash/shared/to_s.rb98
-rw-r--r--spec/ruby/core/hash/shared/update.rb78
-rw-r--r--spec/ruby/core/hash/shared/value.rb14
-rw-r--r--spec/ruby/core/hash/shared/values_at.rb9
-rw-r--r--spec/ruby/core/hash/shift_spec.rb79
-rw-r--r--spec/ruby/core/hash/size_spec.rb7
-rw-r--r--spec/ruby/core/hash/slice_spec.rb55
-rw-r--r--spec/ruby/core/hash/sort_spec.rb17
-rw-r--r--spec/ruby/core/hash/store_spec.rb7
-rw-r--r--spec/ruby/core/hash/to_a_spec.rb39
-rw-r--r--spec/ruby/core/hash/to_h_spec.rb74
-rw-r--r--spec/ruby/core/hash/to_hash_spec.rb14
-rw-r--r--spec/ruby/core/hash/to_proc_spec.rb87
-rw-r--r--spec/ruby/core/hash/to_s_spec.rb7
-rw-r--r--spec/ruby/core/hash/transform_keys_spec.rb132
-rw-r--r--spec/ruby/core/hash/transform_values_spec.rb97
-rw-r--r--spec/ruby/core/hash/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/hash/update_spec.rb7
-rw-r--r--spec/ruby/core/hash/value_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_at_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_spec.rb10
-rw-r--r--spec/ruby/core/integer/abs_spec.rb6
-rw-r--r--spec/ruby/core/integer/allbits_spec.rb39
-rw-r--r--spec/ruby/core/integer/anybits_spec.rb38
-rw-r--r--spec/ruby/core/integer/bit_and_spec.rb97
-rw-r--r--spec/ruby/core/integer/bit_length_spec.rb76
-rw-r--r--spec/ruby/core/integer/bit_or_spec.rb68
-rw-r--r--spec/ruby/core/integer/bit_xor_spec.rb72
-rw-r--r--spec/ruby/core/integer/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/integer/ceil_spec.rb19
-rw-r--r--spec/ruby/core/integer/chr_spec.rb243
-rw-r--r--spec/ruby/core/integer/coerce_spec.rb104
-rw-r--r--spec/ruby/core/integer/comparison_spec.rb189
-rw-r--r--spec/ruby/core/integer/complement_spec.rb20
-rw-r--r--spec/ruby/core/integer/constants_spec.rb25
-rw-r--r--spec/ruby/core/integer/denominator_spec.rb20
-rw-r--r--spec/ruby/core/integer/digits_spec.rb32
-rw-r--r--spec/ruby/core/integer/div_spec.rb146
-rw-r--r--spec/ruby/core/integer/divide_spec.rb95
-rw-r--r--spec/ruby/core/integer/divmod_spec.rb117
-rw-r--r--spec/ruby/core/integer/downto_spec.rb69
-rw-r--r--spec/ruby/core/integer/dup_spec.rb13
-rw-r--r--spec/ruby/core/integer/element_reference_spec.rb111
-rw-r--r--spec/ruby/core/integer/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/integer/even_spec.rb40
-rw-r--r--spec/ruby/core/integer/exponent_spec.rb7
-rw-r--r--spec/ruby/core/integer/fdiv_spec.rb49
-rw-r--r--spec/ruby/core/integer/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/integer/floor_spec.rb19
-rw-r--r--spec/ruby/core/integer/gcd_spec.rb69
-rw-r--r--spec/ruby/core/integer/gcdlcm_spec.rb53
-rw-r--r--spec/ruby/core/integer/gt_spec.rb49
-rw-r--r--spec/ruby/core/integer/gte_spec.rb49
-rw-r--r--spec/ruby/core/integer/integer_spec.rb20
-rw-r--r--spec/ruby/core/integer/lcm_spec.rb58
-rw-r--r--spec/ruby/core/integer/left_shift_spec.rb165
-rw-r--r--spec/ruby/core/integer/lt_spec.rb51
-rw-r--r--spec/ruby/core/integer/lte_spec.rb54
-rw-r--r--spec/ruby/core/integer/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/integer/minus_spec.rb49
-rw-r--r--spec/ruby/core/integer/modulo_spec.rb10
-rw-r--r--spec/ruby/core/integer/multiply_spec.rb51
-rw-r--r--spec/ruby/core/integer/next_spec.rb6
-rw-r--r--spec/ruby/core/integer/nobits_spec.rb38
-rw-r--r--spec/ruby/core/integer/numerator_spec.rb18
-rw-r--r--spec/ruby/core/integer/odd_spec.rb38
-rw-r--r--spec/ruby/core/integer/ord_spec.rb17
-rw-r--r--spec/ruby/core/integer/plus_spec.rb49
-rw-r--r--spec/ruby/core/integer/pow_spec.rb49
-rw-r--r--spec/ruby/core/integer/pred_spec.rb11
-rw-r--r--spec/ruby/core/integer/rationalize_spec.rb39
-rw-r--r--spec/ruby/core/integer/remainder_spec.rb51
-rw-r--r--spec/ruby/core/integer/right_shift_spec.rb191
-rw-r--r--spec/ruby/core/integer/round_spec.rb101
-rw-r--r--spec/ruby/core/integer/shared/abs.rb18
-rw-r--r--spec/ruby/core/integer/shared/arithmetic_coerce.rb31
-rw-r--r--spec/ruby/core/integer/shared/comparison_coerce.rb33
-rw-r--r--spec/ruby/core/integer/shared/equal.rb58
-rw-r--r--spec/ruby/core/integer/shared/exponent.rb118
-rw-r--r--spec/ruby/core/integer/shared/integer_rounding.rb29
-rw-r--r--spec/ruby/core/integer/shared/modulo.rb74
-rw-r--r--spec/ruby/core/integer/shared/next.rb25
-rw-r--r--spec/ruby/core/integer/shared/to_i.rb8
-rw-r--r--spec/ruby/core/integer/size_spec.rb34
-rw-r--r--spec/ruby/core/integer/sqrt_spec.rb33
-rw-r--r--spec/ruby/core/integer/succ_spec.rb6
-rw-r--r--spec/ruby/core/integer/times_spec.rb79
-rw-r--r--spec/ruby/core/integer/to_f_spec.rb23
-rw-r--r--spec/ruby/core/integer/to_i_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_int_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_r_spec.rb26
-rw-r--r--spec/ruby/core/integer/to_s_spec.rb95
-rw-r--r--spec/ruby/core/integer/truncate_spec.rb19
-rw-r--r--spec/ruby/core/integer/uminus_spec.rb30
-rw-r--r--spec/ruby/core/integer/upto_spec.rb69
-rw-r--r--spec/ruby/core/io/advise_spec.rb96
-rw-r--r--spec/ruby/core/io/binmode_spec.rb60
-rw-r--r--spec/ruby/core/io/binread_spec.rb47
-rw-r--r--spec/ruby/core/io/binwrite_spec.rb6
-rw-r--r--spec/ruby/core/io/bytes_spec.rb43
-rw-r--r--spec/ruby/core/io/chars_spec.rb12
-rw-r--r--spec/ruby/core/io/close_on_exec_spec.rb80
-rw-r--r--spec/ruby/core/io/close_read_spec.rb60
-rw-r--r--spec/ruby/core/io/close_spec.rb97
-rw-r--r--spec/ruby/core/io/close_write_spec.rb64
-rw-r--r--spec/ruby/core/io/closed_spec.rb20
-rw-r--r--spec/ruby/core/io/codepoints_spec.rb25
-rw-r--r--spec/ruby/core/io/constants_spec.rb19
-rw-r--r--spec/ruby/core/io/copy_stream_spec.rb282
-rw-r--r--spec/ruby/core/io/dup_spec.rb87
-rw-r--r--spec/ruby/core/io/each_byte_spec.rb57
-rw-r--r--spec/ruby/core/io/each_char_spec.rb12
-rw-r--r--spec/ruby/core/io/each_codepoint_spec.rb43
-rw-r--r--spec/ruby/core/io/each_line_spec.rb11
-rw-r--r--spec/ruby/core/io/each_spec.rb11
-rw-r--r--spec/ruby/core/io/eof_spec.rb107
-rw-r--r--spec/ruby/core/io/external_encoding_spec.rb216
-rw-r--r--spec/ruby/core/io/fcntl_spec.rb8
-rw-r--r--spec/ruby/core/io/fdatasync_spec.rb5
-rw-r--r--spec/ruby/core/io/fileno_spec.rb12
-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16BE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16LE.txtbin0 -> 20 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32BE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32LE.txtbin0 -> 40 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/classes.rb189
-rw-r--r--spec/ruby/core/io/fixtures/copy_stream.txt6
-rw-r--r--spec/ruby/core/io/fixtures/empty.txt (renamed from test/wsdl/qualified/lp.rb)0
-rw-r--r--spec/ruby/core/io/fixtures/incomplete.txt1
-rw-r--r--spec/ruby/core/io/fixtures/lines.txt9
-rw-r--r--spec/ruby/core/io/fixtures/no_bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/numbered_lines.txt5
-rw-r--r--spec/ruby/core/io/fixtures/one_byte.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_binary.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_euc_jp.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_text.txt1
-rw-r--r--spec/ruby/core/io/fixtures/reopen_stdout.rb3
-rw-r--r--spec/ruby/core/io/flush_spec.rb37
-rw-r--r--spec/ruby/core/io/for_fd_spec.rb10
-rw-r--r--spec/ruby/core/io/foreach_spec.rb81
-rw-r--r--spec/ruby/core/io/fsync_spec.rb24
-rw-r--r--spec/ruby/core/io/getbyte_spec.rb42
-rw-r--r--spec/ruby/core/io/getc_spec.rb42
-rw-r--r--spec/ruby/core/io/gets_spec.rb327
-rw-r--r--spec/ruby/core/io/initialize_spec.rb49
-rw-r--r--spec/ruby/core/io/inspect_spec.rb23
-rw-r--r--spec/ruby/core/io/internal_encoding_spec.rb138
-rw-r--r--spec/ruby/core/io/io_spec.rb11
-rw-r--r--spec/ruby/core/io/ioctl_spec.rb32
-rw-r--r--spec/ruby/core/io/isatty_spec.rb6
-rw-r--r--spec/ruby/core/io/lineno_spec.rb95
-rw-r--r--spec/ruby/core/io/lines_spec.rb42
-rw-r--r--spec/ruby/core/io/new_spec.rb10
-rw-r--r--spec/ruby/core/io/open_spec.rb86
-rw-r--r--spec/ruby/core/io/output_spec.rb27
-rw-r--r--spec/ruby/core/io/pid_spec.rb35
-rw-r--r--spec/ruby/core/io/pipe_spec.rb214
-rw-r--r--spec/ruby/core/io/popen_spec.rb271
-rw-r--r--spec/ruby/core/io/pos_spec.rb11
-rw-r--r--spec/ruby/core/io/pread_spec.rb52
-rw-r--r--spec/ruby/core/io/print_spec.rb53
-rw-r--r--spec/ruby/core/io/printf_spec.rb32
-rw-r--r--spec/ruby/core/io/putc_spec.rb11
-rw-r--r--spec/ruby/core/io/puts_spec.rb139
-rw-r--r--spec/ruby/core/io/pwrite_spec.rb45
-rw-r--r--spec/ruby/core/io/read_nonblock_spec.rb99
-rw-r--r--spec/ruby/core/io/read_spec.rb616
-rw-r--r--spec/ruby/core/io/readbyte_spec.rb24
-rw-r--r--spec/ruby/core/io/readchar_spec.rb44
-rw-r--r--spec/ruby/core/io/readline_spec.rb51
-rw-r--r--spec/ruby/core/io/readlines_spec.rb210
-rw-r--r--spec/ruby/core/io/readpartial_spec.rb96
-rw-r--r--spec/ruby/core/io/reopen_spec.rb313
-rw-r--r--spec/ruby/core/io/rewind_spec.rb38
-rw-r--r--spec/ruby/core/io/seek_spec.rb79
-rw-r--r--spec/ruby/core/io/select_spec.rb120
-rw-r--r--spec/ruby/core/io/set_encoding_spec.rb191
-rw-r--r--spec/ruby/core/io/shared/binwrite.rb78
-rw-r--r--spec/ruby/core/io/shared/chars.rb73
-rw-r--r--spec/ruby/core/io/shared/codepoints.rb54
-rw-r--r--spec/ruby/core/io/shared/each.rb183
-rw-r--r--spec/ruby/core/io/shared/gets_ascii.rb19
-rw-r--r--spec/ruby/core/io/shared/new.rb382
-rw-r--r--spec/ruby/core/io/shared/pos.rb72
-rw-r--r--spec/ruby/core/io/shared/readlines.rb209
-rw-r--r--spec/ruby/core/io/shared/tty.rb24
-rw-r--r--spec/ruby/core/io/shared/write.rb109
-rw-r--r--spec/ruby/core/io/stat_spec.rb24
-rw-r--r--spec/ruby/core/io/sync_spec.rb64
-rw-r--r--spec/ruby/core/io/sysopen_spec.rb50
-rw-r--r--spec/ruby/core/io/sysread_spec.rb98
-rw-r--r--spec/ruby/core/io/sysseek_spec.rb44
-rw-r--r--spec/ruby/core/io/syswrite_spec.rb71
-rw-r--r--spec/ruby/core/io/tell_spec.rb7
-rw-r--r--spec/ruby/core/io/to_i_spec.rb12
-rw-r--r--spec/ruby/core/io/to_io_spec.rb21
-rw-r--r--spec/ruby/core/io/try_convert_spec.rb49
-rw-r--r--spec/ruby/core/io/tty_spec.rb6
-rw-r--r--spec/ruby/core/io/ungetbyte_spec.rb73
-rw-r--r--spec/ruby/core/io/ungetc_spec.rb135
-rw-r--r--spec/ruby/core/io/write_nonblock_spec.rb85
-rw-r--r--spec/ruby/core/io/write_spec.rb166
-rw-r--r--spec/ruby/core/kernel/Array_spec.rb97
-rw-r--r--spec/ruby/core/kernel/Complex_spec.rb187
-rw-r--r--spec/ruby/core/kernel/Float_spec.rb341
-rw-r--r--spec/ruby/core/kernel/Hash_spec.rb63
-rw-r--r--spec/ruby/core/kernel/Integer_spec.rb818
-rw-r--r--spec/ruby/core/kernel/Rational_spec.rb6
-rw-r--r--spec/ruby/core/kernel/String_spec.rb106
-rw-r--r--spec/ruby/core/kernel/__callee___spec.rb48
-rw-r--r--spec/ruby/core/kernel/__dir___spec.rb20
-rw-r--r--spec/ruby/core/kernel/__method___spec.rb40
-rw-r--r--spec/ruby/core/kernel/abort_spec.rb15
-rw-r--r--spec/ruby/core/kernel/at_exit_spec.rb44
-rw-r--r--spec/ruby/core/kernel/autoload_spec.rb160
-rw-r--r--spec/ruby/core/kernel/backtick_spec.rb80
-rw-r--r--spec/ruby/core/kernel/binding_spec.rb51
-rw-r--r--spec/ruby/core/kernel/block_given_spec.rb38
-rw-r--r--spec/ruby/core/kernel/caller_locations_spec.rb32
-rw-r--r--spec/ruby/core/kernel/caller_spec.rb46
-rw-r--r--spec/ruby/core/kernel/case_compare_spec.rb135
-rw-r--r--spec/ruby/core/kernel/catch_spec.rb127
-rw-r--r--spec/ruby/core/kernel/chomp_spec.rb65
-rw-r--r--spec/ruby/core/kernel/chop_spec.rb53
-rw-r--r--spec/ruby/core/kernel/class_spec.rb26
-rw-r--r--spec/ruby/core/kernel/clone_spec.rb122
-rw-r--r--spec/ruby/core/kernel/comparison_spec.rb31
-rw-r--r--spec/ruby/core/kernel/define_singleton_method_spec.rb99
-rw-r--r--spec/ruby/core/kernel/display_spec.rb6
-rw-r--r--spec/ruby/core/kernel/dup_spec.rb67
-rw-r--r--spec/ruby/core/kernel/enum_for_spec.rb5
-rw-r--r--spec/ruby/core/kernel/eql_spec.rb10
-rw-r--r--spec/ruby/core/kernel/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/kernel/eval_spec.rb362
-rw-r--r--spec/ruby/core/kernel/exec_spec.rb18
-rw-r--r--spec/ruby/core/kernel/exit_spec.rb27
-rw-r--r--spec/ruby/core/kernel/extend_spec.rb79
-rw-r--r--spec/ruby/core/kernel/fail_spec.rb42
-rw-r--r--spec/ruby/core/kernel/fixtures/__callee__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/__method__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_b.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_d.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module2.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_frozen.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_at_exit.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_locations.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/classes.rb492
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_locals.rb6
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_with_lambda.rb12
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_without_lambda.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/singleton_methods.rb13
-rw-r--r--spec/ruby/core/kernel/fixtures/test.rb362
-rw-r--r--spec/ruby/core/kernel/fork_spec.rb15
-rw-r--r--spec/ruby/core/kernel/format_spec.rb14
-rw-r--r--spec/ruby/core/kernel/freeze_spec.rb85
-rw-r--r--spec/ruby/core/kernel/frozen_spec.rb78
-rw-r--r--spec/ruby/core/kernel/gets_spec.rb17
-rw-r--r--spec/ruby/core/kernel/global_variables_spec.rb26
-rw-r--r--spec/ruby/core/kernel/gsub_spec.rb96
-rw-r--r--spec/ruby/core/kernel/inspect_spec.rb33
-rw-r--r--spec/ruby/core/kernel/instance_of_spec.rb40
-rw-r--r--spec/ruby/core/kernel/instance_variable_defined_spec.rb41
-rw-r--r--spec/ruby/core/kernel/instance_variable_get_spec.rb105
-rw-r--r--spec/ruby/core/kernel/instance_variable_set_spec.rb93
-rw-r--r--spec/ruby/core/kernel/instance_variables_spec.rb27
-rw-r--r--spec/ruby/core/kernel/is_a_spec.rb6
-rw-r--r--spec/ruby/core/kernel/iterator_spec.rb12
-rw-r--r--spec/ruby/core/kernel/itself_spec.rb9
-rw-r--r--spec/ruby/core/kernel/kind_of_spec.rb6
-rw-r--r--spec/ruby/core/kernel/lambda_spec.rb122
-rw-r--r--spec/ruby/core/kernel/load_spec.rb40
-rw-r--r--spec/ruby/core/kernel/local_variables_spec.rb48
-rw-r--r--spec/ruby/core/kernel/loop_spec.rb79
-rw-r--r--spec/ruby/core/kernel/match_spec.rb24
-rw-r--r--spec/ruby/core/kernel/method_spec.rb37
-rw-r--r--spec/ruby/core/kernel/methods_spec.rb101
-rw-r--r--spec/ruby/core/kernel/nil_spec.rb6
-rw-r--r--spec/ruby/core/kernel/not_match_spec.rb21
-rw-r--r--spec/ruby/core/kernel/object_id_spec.rb6
-rw-r--r--spec/ruby/core/kernel/open_spec.rb144
-rw-r--r--spec/ruby/core/kernel/p_spec.rb83
-rw-r--r--spec/ruby/core/kernel/pp_spec.rb11
-rw-r--r--spec/ruby/core/kernel/print_spec.rb12
-rw-r--r--spec/ruby/core/kernel/printf_spec.rb60
-rw-r--r--spec/ruby/core/kernel/private_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/proc_spec.rb62
-rw-r--r--spec/ruby/core/kernel/protected_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/public_method_spec.rb32
-rw-r--r--spec/ruby/core/kernel/public_methods_spec.rb76
-rw-r--r--spec/ruby/core/kernel/public_send_spec.rb108
-rw-r--r--spec/ruby/core/kernel/putc_spec.rb39
-rw-r--r--spec/ruby/core/kernel/puts_spec.rb29
-rw-r--r--spec/ruby/core/kernel/raise_spec.rb17
-rw-r--r--spec/ruby/core/kernel/rand_spec.rb155
-rw-r--r--spec/ruby/core/kernel/readline_spec.rb12
-rw-r--r--spec/ruby/core/kernel/readlines_spec.rb12
-rw-r--r--spec/ruby/core/kernel/remove_instance_variable_spec.rb59
-rw-r--r--spec/ruby/core/kernel/require_relative_spec.rb427
-rw-r--r--spec/ruby/core/kernel/require_spec.rb34
-rw-r--r--spec/ruby/core/kernel/respond_to_missing_spec.rb100
-rw-r--r--spec/ruby/core/kernel/respond_to_spec.rb73
-rw-r--r--spec/ruby/core/kernel/select_spec.rb18
-rw-r--r--spec/ruby/core/kernel/send_spec.rb68
-rw-r--r--spec/ruby/core/kernel/set_trace_func_spec.rb12
-rw-r--r--spec/ruby/core/kernel/shared/dup_clone.rb129
-rw-r--r--spec/ruby/core/kernel/shared/kind_of.rb55
-rw-r--r--spec/ruby/core/kernel/shared/lambda.rb9
-rw-r--r--spec/ruby/core/kernel/shared/load.rb172
-rw-r--r--spec/ruby/core/kernel/shared/method.rb50
-rw-r--r--spec/ruby/core/kernel/shared/require.rb773
-rw-r--r--spec/ruby/core/kernel/shared/sprintf.rb877
-rw-r--r--spec/ruby/core/kernel/shared/sprintf_encoding.rb28
-rw-r--r--spec/ruby/core/kernel/shared/then.rb20
-rw-r--r--spec/ruby/core/kernel/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/kernel/singleton_method_spec.rb41
-rw-r--r--spec/ruby/core/kernel/singleton_methods_spec.rb192
-rw-r--r--spec/ruby/core/kernel/sleep_spec.rb56
-rw-r--r--spec/ruby/core/kernel/spawn_spec.rb25
-rw-r--r--spec/ruby/core/kernel/sprintf_spec.rb24
-rw-r--r--spec/ruby/core/kernel/srand_spec.rb61
-rw-r--r--spec/ruby/core/kernel/sub_spec.rb26
-rw-r--r--spec/ruby/core/kernel/syscall_spec.rb12
-rw-r--r--spec/ruby/core/kernel/system_spec.rb117
-rw-r--r--spec/ruby/core/kernel/taint_spec.rb47
-rw-r--r--spec/ruby/core/kernel/tainted_spec.rb14
-rw-r--r--spec/ruby/core/kernel/tap_spec.rb13
-rw-r--r--spec/ruby/core/kernel/test_spec.rb109
-rw-r--r--spec/ruby/core/kernel/then_spec.rb8
-rw-r--r--spec/ruby/core/kernel/throw_spec.rb80
-rw-r--r--spec/ruby/core/kernel/to_enum_spec.rb5
-rw-r--r--spec/ruby/core/kernel/to_s_spec.rb18
-rw-r--r--spec/ruby/core/kernel/trace_var_spec.rb54
-rw-r--r--spec/ruby/core/kernel/trap_spec.rb12
-rw-r--r--spec/ruby/core/kernel/trust_spec.rb27
-rw-r--r--spec/ruby/core/kernel/untaint_spec.rb27
-rw-r--r--spec/ruby/core/kernel/untrace_var_spec.rb12
-rw-r--r--spec/ruby/core/kernel/untrust_spec.rb27
-rw-r--r--spec/ruby/core/kernel/untrusted_spec.rb30
-rw-r--r--spec/ruby/core/kernel/warn_spec.rb156
-rw-r--r--spec/ruby/core/kernel/yield_self_spec.rb8
-rw-r--r--spec/ruby/core/main/define_method_spec.rb28
-rw-r--r--spec/ruby/core/main/fixtures/classes.rb18
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement.rb7
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement_user.rb11
-rw-r--r--spec/ruby/core/main/fixtures/wrapped_include.rb1
-rw-r--r--spec/ruby/core/main/include_spec.rb16
-rw-r--r--spec/ruby/core/main/private_spec.rb23
-rw-r--r--spec/ruby/core/main/public_spec.rb23
-rw-r--r--spec/ruby/core/main/to_s_spec.rb7
-rw-r--r--spec/ruby/core/main/using_spec.rb132
-rw-r--r--spec/ruby/core/marshal/dump_spec.rb615
-rw-r--r--spec/ruby/core/marshal/fixtures/marshal_data.rb420
-rw-r--r--spec/ruby/core/marshal/fixtures/random.dumpbin0 -> 2520 bytes-rw-r--r--spec/ruby/core/marshal/float_spec.rb77
-rw-r--r--spec/ruby/core/marshal/load_spec.rb6
-rw-r--r--spec/ruby/core/marshal/major_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/minor_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/restore_spec.rb6
-rw-r--r--spec/ruby/core/marshal/shared/load.rb900
-rw-r--r--spec/ruby/core/matchdata/allocate_spec.rb10
-rw-r--r--spec/ruby/core/matchdata/begin_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/captures_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/dup_spec.rb14
-rw-r--r--spec/ruby/core/matchdata/element_reference_spec.rb87
-rw-r--r--spec/ruby/core/matchdata/end_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/eql_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/hash_spec.rb5
-rw-r--r--spec/ruby/core/matchdata/inspect_spec.rb23
-rw-r--r--spec/ruby/core/matchdata/length_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/named_captures_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/names_spec.rb33
-rw-r--r--spec/ruby/core/matchdata/offset_spec.rb30
-rw-r--r--spec/ruby/core/matchdata/post_match_spec.rb36
-rw-r--r--spec/ruby/core/matchdata/pre_match_spec.rb36
-rw-r--r--spec/ruby/core/matchdata/regexp_spec.rb24
-rw-r--r--spec/ruby/core/matchdata/shared/eql.rb26
-rw-r--r--spec/ruby/core/matchdata/shared/length.rb5
-rw-r--r--spec/ruby/core/matchdata/size_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/string_spec.rb25
-rw-r--r--spec/ruby/core/matchdata/to_a_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/to_s_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/values_at_spec.rb21
-rw-r--r--spec/ruby/core/math/acos_spec.rb56
-rw-r--r--spec/ruby/core/math/acosh_spec.rb41
-rw-r--r--spec/ruby/core/math/asin_spec.rb48
-rw-r--r--spec/ruby/core/math/asinh_spec.rb42
-rw-r--r--spec/ruby/core/math/atan2_spec.rb54
-rw-r--r--spec/ruby/core/math/atan_spec.rb40
-rw-r--r--spec/ruby/core/math/atanh_spec.rb14
-rw-r--r--spec/ruby/core/math/cbrt_spec.rb27
-rw-r--r--spec/ruby/core/math/constants_spec.rb22
-rw-r--r--spec/ruby/core/math/cos_spec.rb42
-rw-r--r--spec/ruby/core/math/cosh_spec.rb37
-rw-r--r--spec/ruby/core/math/erf_spec.rb44
-rw-r--r--spec/ruby/core/math/erfc_spec.rb43
-rw-r--r--spec/ruby/core/math/exp_spec.rb37
-rw-r--r--spec/ruby/core/math/fixtures/classes.rb28
-rw-r--r--spec/ruby/core/math/frexp_spec.rb37
-rw-r--r--spec/ruby/core/math/gamma_spec.rb69
-rw-r--r--spec/ruby/core/math/hypot_spec.rb41
-rw-r--r--spec/ruby/core/math/ldexp_spec.rb54
-rw-r--r--spec/ruby/core/math/lgamma_spec.rb54
-rw-r--r--spec/ruby/core/math/log10_spec.rb43
-rw-r--r--spec/ruby/core/math/log2_spec.rb41
-rw-r--r--spec/ruby/core/math/log_spec.rb57
-rw-r--r--spec/ruby/core/math/sin_spec.rb39
-rw-r--r--spec/ruby/core/math/sinh_spec.rb37
-rw-r--r--spec/ruby/core/math/sqrt_spec.rb36
-rw-r--r--spec/ruby/core/math/tan_spec.rb42
-rw-r--r--spec/ruby/core/math/tanh_spec.rb39
-rw-r--r--spec/ruby/core/method/arity_spec.rb222
-rw-r--r--spec/ruby/core/method/call_spec.rb7
-rw-r--r--spec/ruby/core/method/case_compare_spec.rb9
-rw-r--r--spec/ruby/core/method/clone_spec.rb14
-rw-r--r--spec/ruby/core/method/compose_spec.rb101
-rw-r--r--spec/ruby/core/method/curry_spec.rb36
-rw-r--r--spec/ruby/core/method/element_reference_spec.rb7
-rw-r--r--spec/ruby/core/method/eql_spec.rb6
-rw-r--r--spec/ruby/core/method/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/method/fixtures/classes.rb210
-rw-r--r--spec/ruby/core/method/hash_spec.rb15
-rw-r--r--spec/ruby/core/method/inspect_spec.rb6
-rw-r--r--spec/ruby/core/method/name_spec.rb22
-rw-r--r--spec/ruby/core/method/original_name_spec.rb22
-rw-r--r--spec/ruby/core/method/owner_spec.rb26
-rw-r--r--spec/ruby/core/method/parameters_spec.rb261
-rw-r--r--spec/ruby/core/method/receiver_spec.rb22
-rw-r--r--spec/ruby/core/method/shared/call.rb51
-rw-r--r--spec/ruby/core/method/shared/eql.rb94
-rw-r--r--spec/ruby/core/method/shared/to_s.rb34
-rw-r--r--spec/ruby/core/method/source_location_spec.rb95
-rw-r--r--spec/ruby/core/method/super_method_spec.rb45
-rw-r--r--spec/ruby/core/method/to_proc_spec.rb104
-rw-r--r--spec/ruby/core/method/to_s_spec.rb6
-rw-r--r--spec/ruby/core/method/unbind_spec.rb37
-rw-r--r--spec/ruby/core/module/alias_method_spec.rb157
-rw-r--r--spec/ruby/core/module/allocate_spec.rb14
-rw-r--r--spec/ruby/core/module/ancestors_spec.rb70
-rw-r--r--spec/ruby/core/module/append_features_spec.rb75
-rw-r--r--spec/ruby/core/module/attr_accessor_spec.rb97
-rw-r--r--spec/ruby/core/module/attr_reader_spec.rb71
-rw-r--r--spec/ruby/core/module/attr_spec.rb155
-rw-r--r--spec/ruby/core/module/attr_writer_spec.rb71
-rw-r--r--spec/ruby/core/module/autoload_spec.rb915
-rw-r--r--spec/ruby/core/module/case_compare_spec.rb31
-rw-r--r--spec/ruby/core/module/class_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/class_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/class_variable_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/class_variable_get_spec.rb76
-rw-r--r--spec/ruby/core/module/class_variable_set_spec.rb62
-rw-r--r--spec/ruby/core/module/class_variables_spec.rb26
-rw-r--r--spec/ruby/core/module/comparison_spec.rb36
-rw-r--r--spec/ruby/core/module/const_defined_spec.rb144
-rw-r--r--spec/ruby/core/module/const_get_spec.rb229
-rw-r--r--spec/ruby/core/module/const_missing_spec.rb36
-rw-r--r--spec/ruby/core/module/const_set_spec.rb133
-rw-r--r--spec/ruby/core/module/constants_spec.rb91
-rw-r--r--spec/ruby/core/module/define_method_spec.rb678
-rw-r--r--spec/ruby/core/module/define_singleton_method_spec.rb15
-rw-r--r--spec/ruby/core/module/deprecate_constant_spec.rb50
-rw-r--r--spec/ruby/core/module/eql_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/module/extend_object_spec.rb70
-rw-r--r--spec/ruby/core/module/extended_spec.rb44
-rw-r--r--spec/ruby/core/module/fixtures/autoload.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_abc.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_c.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_callback.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_concur.rb9
-rw-r--r--spec/ruby/core/module/fixtures/autoload_d.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_autoload.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_e.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_empty.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_ex1.rb16
-rw-r--r--spec/ruby/core/module/fixtures/autoload_exception.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_f.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_g.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_h.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_i.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_j.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_k.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_lm.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_nested.rb8
-rw-r--r--spec/ruby/core/module/fixtures/autoload_never_set.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_o.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_overridden.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_r.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_raise.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_nested.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_s.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_self_during_require.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_subclass.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_t.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_v.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w2.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_x.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_z.rb5
-rw-r--r--spec/ruby/core/module/fixtures/classes.rb614
-rw-r--r--spec/ruby/core/module/fixtures/constant_unicode.rb5
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload.rb6
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_a.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_b.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_c.rb3
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_d.rb4
-rw-r--r--spec/ruby/core/module/fixtures/module.rb4
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo.rb6
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo/bar_baz.rb11
-rw-r--r--spec/ruby/core/module/fixtures/name.rb10
-rw-r--r--spec/ruby/core/module/fixtures/path1/load_path.rb9
-rw-r--r--spec/ruby/core/module/fixtures/path2/load_path.rb1
-rw-r--r--spec/ruby/core/module/fixtures/refine.rb13
-rw-r--r--spec/ruby/core/module/fixtures/repeated_concurrent_autoload.rb8
-rw-r--r--spec/ruby/core/module/freeze_spec.rb6
-rw-r--r--spec/ruby/core/module/gt_spec.rb36
-rw-r--r--spec/ruby/core/module/gte_spec.rb33
-rw-r--r--spec/ruby/core/module/include_spec.rb258
-rw-r--r--spec/ruby/core/module/included_modules_spec.rb12
-rw-r--r--spec/ruby/core/module/included_spec.rb44
-rw-r--r--spec/ruby/core/module/initialize_copy_spec.rb18
-rw-r--r--spec/ruby/core/module/initialize_spec.rb18
-rw-r--r--spec/ruby/core/module/instance_method_spec.rb85
-rw-r--r--spec/ruby/core/module/instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/lt_spec.rb36
-rw-r--r--spec/ruby/core/module/lte_spec.rb33
-rw-r--r--spec/ruby/core/module/method_added_spec.rb62
-rw-r--r--spec/ruby/core/module/method_defined_spec.rb100
-rw-r--r--spec/ruby/core/module/method_removed_spec.rb33
-rw-r--r--spec/ruby/core/module/method_undefined_spec.rb33
-rw-r--r--spec/ruby/core/module/module_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/module_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/module_function_spec.rb269
-rw-r--r--spec/ruby/core/module/name_spec.rb128
-rw-r--r--spec/ruby/core/module/nesting_spec.rb31
-rw-r--r--spec/ruby/core/module/new_spec.rb31
-rw-r--r--spec/ruby/core/module/prepend_features_spec.rb78
-rw-r--r--spec/ruby/core/module/prepend_spec.rb361
-rw-r--r--spec/ruby/core/module/prepended_spec.rb25
-rw-r--r--spec/ruby/core/module/private_class_method_spec.rb81
-rw-r--r--spec/ruby/core/module/private_constant_spec.rb32
-rw-r--r--spec/ruby/core/module/private_instance_methods_spec.rb54
-rw-r--r--spec/ruby/core/module/private_method_defined_spec.rb122
-rw-r--r--spec/ruby/core/module/private_spec.rb93
-rw-r--r--spec/ruby/core/module/protected_instance_methods_spec.rb57
-rw-r--r--spec/ruby/core/module/protected_method_defined_spec.rb122
-rw-r--r--spec/ruby/core/module/protected_spec.rb55
-rw-r--r--spec/ruby/core/module/public_class_method_spec.rb80
-rw-r--r--spec/ruby/core/module/public_constant_spec.rb38
-rw-r--r--spec/ruby/core/module/public_instance_method_spec.rb65
-rw-r--r--spec/ruby/core/module/public_instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/public_method_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/public_spec.rb44
-rw-r--r--spec/ruby/core/module/refine_spec.rb782
-rw-r--r--spec/ruby/core/module/remove_class_variable_spec.rb44
-rw-r--r--spec/ruby/core/module/remove_const_spec.rb84
-rw-r--r--spec/ruby/core/module/remove_method_spec.rb116
-rw-r--r--spec/ruby/core/module/shared/class_eval.rb115
-rw-r--r--spec/ruby/core/module/shared/class_exec.rb29
-rw-r--r--spec/ruby/core/module/shared/equal_value.rb14
-rw-r--r--spec/ruby/core/module/shared/set_visibility.rb152
-rw-r--r--spec/ruby/core/module/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/module/to_s_spec.rb45
-rw-r--r--spec/ruby/core/module/undef_method_spec.rb188
-rw-r--r--spec/ruby/core/module/using_spec.rb287
-rw-r--r--spec/ruby/core/mutex/lock_spec.rb34
-rw-r--r--spec/ruby/core/mutex/locked_spec.rb36
-rw-r--r--spec/ruby/core/mutex/owned_spec.rb43
-rw-r--r--spec/ruby/core/mutex/sleep_spec.rb95
-rw-r--r--spec/ruby/core/mutex/synchronize_spec.rb66
-rw-r--r--spec/ruby/core/mutex/try_lock_spec.rb32
-rw-r--r--spec/ruby/core/mutex/unlock_spec.rb38
-rw-r--r--spec/ruby/core/nil/and_spec.rb11
-rw-r--r--spec/ruby/core/nil/dup_spec.rb7
-rw-r--r--spec/ruby/core/nil/inspect_spec.rb7
-rw-r--r--spec/ruby/core/nil/match_spec.rb19
-rw-r--r--spec/ruby/core/nil/nil_spec.rb7
-rw-r--r--spec/ruby/core/nil/nilclass_spec.rb15
-rw-r--r--spec/ruby/core/nil/or_spec.rb11
-rw-r--r--spec/ruby/core/nil/rationalize_spec.rb16
-rw-r--r--spec/ruby/core/nil/to_a_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_c_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_f_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_h_spec.rb8
-rw-r--r--spec/ruby/core/nil/to_i_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_r_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_s_spec.rb17
-rw-r--r--spec/ruby/core/nil/xor_spec.rb11
-rw-r--r--spec/ruby/core/numeric/abs2_spec.rb34
-rw-r--r--spec/ruby/core/numeric/abs_spec.rb6
-rw-r--r--spec/ruby/core/numeric/angle_spec.rb6
-rw-r--r--spec/ruby/core/numeric/arg_spec.rb6
-rw-r--r--spec/ruby/core/numeric/ceil_spec.rb15
-rw-r--r--spec/ruby/core/numeric/coerce_spec.rb59
-rw-r--r--spec/ruby/core/numeric/comparison_spec.rb48
-rw-r--r--spec/ruby/core/numeric/conj_spec.rb6
-rw-r--r--spec/ruby/core/numeric/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/numeric/denominator_spec.rb24
-rw-r--r--spec/ruby/core/numeric/div_spec.rb22
-rw-r--r--spec/ruby/core/numeric/divmod_spec.rb15
-rw-r--r--spec/ruby/core/numeric/eql_spec.rb22
-rw-r--r--spec/ruby/core/numeric/fdiv_spec.rb32
-rw-r--r--spec/ruby/core/numeric/finite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/fixtures/classes.rb17
-rw-r--r--spec/ruby/core/numeric/floor_spec.rb14
-rw-r--r--spec/ruby/core/numeric/i_spec.rb15
-rw-r--r--spec/ruby/core/numeric/imag_spec.rb6
-rw-r--r--spec/ruby/core/numeric/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/numeric/infinite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/integer_spec.rb8
-rw-r--r--spec/ruby/core/numeric/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/numeric/modulo_spec.rb24
-rw-r--r--spec/ruby/core/numeric/negative_spec.rb41
-rw-r--r--spec/ruby/core/numeric/nonzero_spec.rb18
-rw-r--r--spec/ruby/core/numeric/numerator_spec.rb33
-rw-r--r--spec/ruby/core/numeric/numeric_spec.rb7
-rw-r--r--spec/ruby/core/numeric/phase_spec.rb6
-rw-r--r--spec/ruby/core/numeric/polar_spec.rb50
-rw-r--r--spec/ruby/core/numeric/positive_spec.rb41
-rw-r--r--spec/ruby/core/numeric/quo_spec.rb55
-rw-r--r--spec/ruby/core/numeric/real_spec.rb37
-rw-r--r--spec/ruby/core/numeric/rect_spec.rb6
-rw-r--r--spec/ruby/core/numeric/rectangular_spec.rb6
-rw-r--r--spec/ruby/core/numeric/remainder_spec.rb67
-rw-r--r--spec/ruby/core/numeric/round_spec.rb14
-rw-r--r--spec/ruby/core/numeric/shared/abs.rb19
-rw-r--r--spec/ruby/core/numeric/shared/arg.rb38
-rw-r--r--spec/ruby/core/numeric/shared/conj.rb20
-rw-r--r--spec/ruby/core/numeric/shared/imag.rb26
-rw-r--r--spec/ruby/core/numeric/shared/quo.rb7
-rw-r--r--spec/ruby/core/numeric/shared/rect.rb48
-rw-r--r--spec/ruby/core/numeric/shared/step.rb433
-rw-r--r--spec/ruby/core/numeric/singleton_method_added_spec.rb41
-rw-r--r--spec/ruby/core/numeric/step_spec.rb200
-rw-r--r--spec/ruby/core/numeric/to_c_spec.rb45
-rw-r--r--spec/ruby/core/numeric/to_int_spec.rb10
-rw-r--r--spec/ruby/core/numeric/truncate_spec.rb14
-rw-r--r--spec/ruby/core/numeric/uminus_spec.rb31
-rw-r--r--spec/ruby/core/numeric/uplus_spec.rb9
-rw-r--r--spec/ruby/core/numeric/zero_spec.rb18
-rw-r--r--spec/ruby/core/objectspace/_id2ref_spec.rb25
-rw-r--r--spec/ruby/core/objectspace/add_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/call_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/count_objects_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/define_finalizer_spec.rb68
-rw-r--r--spec/ruby/core/objectspace/each_object_spec.rb213
-rw-r--r--spec/ruby/core/objectspace/finalizers_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/fixtures/classes.rb64
-rw-r--r--spec/ruby/core/objectspace/garbage_collect_spec.rb22
-rw-r--r--spec/ruby/core/objectspace/remove_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/undefine_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/proc/allocate_spec.rb9
-rw-r--r--spec/ruby/core/proc/arity_spec.rb640
-rw-r--r--spec/ruby/core/proc/binding_spec.rb21
-rw-r--r--spec/ruby/core/proc/block_pass_spec.rb43
-rw-r--r--spec/ruby/core/proc/call_spec.rb16
-rw-r--r--spec/ruby/core/proc/case_compare_spec.rb16
-rw-r--r--spec/ruby/core/proc/clone_spec.rb6
-rw-r--r--spec/ruby/core/proc/compose_spec.rb110
-rw-r--r--spec/ruby/core/proc/curry_spec.rb180
-rw-r--r--spec/ruby/core/proc/dup_spec.rb6
-rw-r--r--spec/ruby/core/proc/element_reference_spec.rb27
-rw-r--r--spec/ruby/core/proc/eql_spec.rb6
-rw-r--r--spec/ruby/core/proc/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/proc/fixtures/common.rb51
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref.rb9
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref_frozen.rb10
-rw-r--r--spec/ruby/core/proc/fixtures/source_location.rb55
-rw-r--r--spec/ruby/core/proc/hash_spec.rb17
-rw-r--r--spec/ruby/core/proc/inspect_spec.rb6
-rw-r--r--spec/ruby/core/proc/lambda_spec.rb60
-rw-r--r--spec/ruby/core/proc/new_spec.rb226
-rw-r--r--spec/ruby/core/proc/parameters_spec.rb95
-rw-r--r--spec/ruby/core/proc/shared/call.rb96
-rw-r--r--spec/ruby/core/proc/shared/call_arguments.rb29
-rw-r--r--spec/ruby/core/proc/shared/compose.rb47
-rw-r--r--spec/ruby/core/proc/shared/dup.rb10
-rw-r--r--spec/ruby/core/proc/shared/equal.rb100
-rw-r--r--spec/ruby/core/proc/shared/to_s.rb57
-rw-r--r--spec/ruby/core/proc/source_location_spec.rb86
-rw-r--r--spec/ruby/core/proc/to_proc_spec.rb9
-rw-r--r--spec/ruby/core/proc/to_s_spec.rb6
-rw-r--r--spec/ruby/core/proc/yield_spec.rb16
-rw-r--r--spec/ruby/core/process/abort_spec.rb6
-rw-r--r--spec/ruby/core/process/clock_getres_spec.rb61
-rw-r--r--spec/ruby/core/process/clock_gettime_spec.rb137
-rw-r--r--spec/ruby/core/process/constants_spec.rb63
-rw-r--r--spec/ruby/core/process/daemon_spec.rb115
-rw-r--r--spec/ruby/core/process/detach_spec.rb46
-rw-r--r--spec/ruby/core/process/egid_spec.rb19
-rw-r--r--spec/ruby/core/process/euid_spec.rb46
-rw-r--r--spec/ruby/core/process/exec_spec.rb247
-rw-r--r--spec/ruby/core/process/exit_spec.rb10
-rw-r--r--spec/ruby/core/process/fixtures/clocks.rb60
-rw-r--r--spec/ruby/core/process/fixtures/common.rb88
-rw-r--r--spec/ruby/core/process/fixtures/daemon.rb111
-rw-r--r--spec/ruby/core/process/fixtures/in.txt1
-rw-r--r--spec/ruby/core/process/fixtures/kill.rb45
-rw-r--r--spec/ruby/core/process/fixtures/map_fd.rb9
-rw-r--r--spec/ruby/core/process/fixtures/setpriority.rb12
-rw-r--r--spec/ruby/core/process/fork_spec.rb6
-rw-r--r--spec/ruby/core/process/getpgid_spec.rb17
-rw-r--r--spec/ruby/core/process/getpgrp_spec.rb7
-rw-r--r--spec/ruby/core/process/getpriority_spec.rb23
-rw-r--r--spec/ruby/core/process/getrlimit_spec.rb91
-rw-r--r--spec/ruby/core/process/gid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/gid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/gid_spec.rb22
-rw-r--r--spec/ruby/core/process/groups_spec.rb63
-rw-r--r--spec/ruby/core/process/initgroups_spec.rb22
-rw-r--r--spec/ruby/core/process/kill_spec.rb132
-rw-r--r--spec/ruby/core/process/last_status_spec.rb20
-rw-r--r--spec/ruby/core/process/maxgroups_spec.rb19
-rw-r--r--spec/ruby/core/process/pid_spec.rb9
-rw-r--r--spec/ruby/core/process/ppid_spec.rb9
-rw-r--r--spec/ruby/core/process/set_proctitle_spec.rb23
-rw-r--r--spec/ruby/core/process/setpgid_spec.rb29
-rw-r--r--spec/ruby/core/process/setpgrp_spec.rb37
-rw-r--r--spec/ruby/core/process/setpriority_spec.rb60
-rw-r--r--spec/ruby/core/process/setrlimit_spec.rb232
-rw-r--r--spec/ruby/core/process/setsid_spec.rb16
-rw-r--r--spec/ruby/core/process/spawn_spec.rb712
-rw-r--r--spec/ruby/core/process/status/bit_and_spec.rb5
-rw-r--r--spec/ruby/core/process/status/coredump_spec.rb5
-rw-r--r--spec/ruby/core/process/status/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/process/status/exited_spec.rb37
-rw-r--r--spec/ruby/core/process/status/exitstatus_spec.rb25
-rw-r--r--spec/ruby/core/process/status/inspect_spec.rb5
-rw-r--r--spec/ruby/core/process/status/pid_spec.rb15
-rw-r--r--spec/ruby/core/process/status/right_shift_spec.rb5
-rw-r--r--spec/ruby/core/process/status/signaled_spec.rb35
-rw-r--r--spec/ruby/core/process/status/stopped_spec.rb5
-rw-r--r--spec/ruby/core/process/status/stopsig_spec.rb5
-rw-r--r--spec/ruby/core/process/status/success_spec.rb51
-rw-r--r--spec/ruby/core/process/status/termsig_spec.rb43
-rw-r--r--spec/ruby/core/process/status/to_i_spec.rb13
-rw-r--r--spec/ruby/core/process/status/to_int_spec.rb5
-rw-r--r--spec/ruby/core/process/status/to_s_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/geteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/issetugid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/seteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setregid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setreuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setrgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setruid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setuid_spec.rb5
-rw-r--r--spec/ruby/core/process/times_spec.rb30
-rw-r--r--spec/ruby/core/process/uid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/uid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/uid_spec.rb57
-rw-r--r--spec/ruby/core/process/wait2_spec.rb36
-rw-r--r--spec/ruby/core/process/wait_spec.rb92
-rw-r--r--spec/ruby/core/process/waitall_spec.rb48
-rw-r--r--spec/ruby/core/process/waitpid2_spec.rb5
-rw-r--r--spec/ruby/core/process/waitpid_spec.rb13
-rw-r--r--spec/ruby/core/queue/append_spec.rb6
-rw-r--r--spec/ruby/core/queue/clear_spec.rb6
-rw-r--r--spec/ruby/core/queue/close_spec.rb6
-rw-r--r--spec/ruby/core/queue/closed_spec.rb6
-rw-r--r--spec/ruby/core/queue/deq_spec.rb6
-rw-r--r--spec/ruby/core/queue/empty_spec.rb6
-rw-r--r--spec/ruby/core/queue/enq_spec.rb6
-rw-r--r--spec/ruby/core/queue/length_spec.rb6
-rw-r--r--spec/ruby/core/queue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/queue/pop_spec.rb6
-rw-r--r--spec/ruby/core/queue/push_spec.rb6
-rw-r--r--spec/ruby/core/queue/shift_spec.rb6
-rw-r--r--spec/ruby/core/queue/size_spec.rb6
-rw-r--r--spec/ruby/core/random/bytes_spec.rb32
-rw-r--r--spec/ruby/core/random/default_spec.rb7
-rw-r--r--spec/ruby/core/random/equal_value_spec.rb37
-rw-r--r--spec/ruby/core/random/fixtures/classes.rb15
-rw-r--r--spec/ruby/core/random/new_seed_spec.rb24
-rw-r--r--spec/ruby/core/random/new_spec.rb37
-rw-r--r--spec/ruby/core/random/rand_spec.rb219
-rw-r--r--spec/ruby/core/random/random_number_spec.rb10
-rw-r--r--spec/ruby/core/random/raw_seed_spec.rb9
-rw-r--r--spec/ruby/core/random/seed_spec.rb29
-rw-r--r--spec/ruby/core/random/shared/bytes.rb17
-rw-r--r--spec/ruby/core/random/shared/rand.rb9
-rw-r--r--spec/ruby/core/random/shared/urandom.rb23
-rw-r--r--spec/ruby/core/random/srand_spec.rb39
-rw-r--r--spec/ruby/core/random/urandom_spec.rb9
-rw-r--r--spec/ruby/core/range/begin_spec.rb6
-rw-r--r--spec/ruby/core/range/bsearch_spec.rb137
-rw-r--r--spec/ruby/core/range/case_compare_spec.rb28
-rw-r--r--spec/ruby/core/range/cover_spec.rb9
-rw-r--r--spec/ruby/core/range/dup_spec.rb15
-rw-r--r--spec/ruby/core/range/each_spec.rb66
-rw-r--r--spec/ruby/core/range/end_spec.rb6
-rw-r--r--spec/ruby/core/range/eql_spec.rb10
-rw-r--r--spec/ruby/core/range/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/range/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/range/first_spec.rb49
-rw-r--r--spec/ruby/core/range/fixtures/classes.rb90
-rw-r--r--spec/ruby/core/range/hash_spec.rb24
-rw-r--r--spec/ruby/core/range/include_spec.rb10
-rw-r--r--spec/ruby/core/range/initialize_spec.rb41
-rw-r--r--spec/ruby/core/range/inspect_spec.rb28
-rw-r--r--spec/ruby/core/range/last_spec.rb49
-rw-r--r--spec/ruby/core/range/max_spec.rb82
-rw-r--r--spec/ruby/core/range/member_spec.rb10
-rw-r--r--spec/ruby/core/range/min_spec.rb75
-rw-r--r--spec/ruby/core/range/new_spec.rb87
-rw-r--r--spec/ruby/core/range/percent_spec.rb18
-rw-r--r--spec/ruby/core/range/range_spec.rb7
-rw-r--r--spec/ruby/core/range/shared/begin.rb10
-rw-r--r--spec/ruby/core/range/shared/cover.rb153
-rw-r--r--spec/ruby/core/range/shared/cover_and_include.rb66
-rw-r--r--spec/ruby/core/range/shared/end.rb10
-rw-r--r--spec/ruby/core/range/shared/equal_value.rb45
-rw-r--r--spec/ruby/core/range/shared/include.rb91
-rw-r--r--spec/ruby/core/range/size_spec.rb31
-rw-r--r--spec/ruby/core/range/step_spec.rb397
-rw-r--r--spec/ruby/core/range/to_a_spec.rb22
-rw-r--r--spec/ruby/core/range/to_s_spec.rb27
-rw-r--r--spec/ruby/core/rational/abs_spec.rb5
-rw-r--r--spec/ruby/core/rational/ceil_spec.rb5
-rw-r--r--spec/ruby/core/rational/coerce_spec.rb5
-rw-r--r--spec/ruby/core/rational/comparison_spec.rb22
-rw-r--r--spec/ruby/core/rational/denominator_spec.rb5
-rw-r--r--spec/ruby/core/rational/div_spec.rb17
-rw-r--r--spec/ruby/core/rational/divide_spec.rb19
-rw-r--r--spec/ruby/core/rational/divmod_spec.rb13
-rw-r--r--spec/ruby/core/rational/equal_value_spec.rb17
-rw-r--r--spec/ruby/core/rational/exponent_spec.rb5
-rw-r--r--spec/ruby/core/rational/fdiv_spec.rb5
-rw-r--r--spec/ruby/core/rational/floor_spec.rb5
-rw-r--r--spec/ruby/core/rational/hash_spec.rb5
-rw-r--r--spec/ruby/core/rational/inspect_spec.rb5
-rw-r--r--spec/ruby/core/rational/integer_spec.rb12
-rw-r--r--spec/ruby/core/rational/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/rational/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/rational/minus_spec.rb7
-rw-r--r--spec/ruby/core/rational/modulo_spec.rb5
-rw-r--r--spec/ruby/core/rational/multiply_spec.rb19
-rw-r--r--spec/ruby/core/rational/numerator_spec.rb5
-rw-r--r--spec/ruby/core/rational/plus_spec.rb18
-rw-r--r--spec/ruby/core/rational/quo_spec.rb5
-rw-r--r--spec/ruby/core/rational/rational_spec.rb7
-rw-r--r--spec/ruby/core/rational/rationalize_spec.rb36
-rw-r--r--spec/ruby/core/rational/remainder_spec.rb5
-rw-r--r--spec/ruby/core/rational/round_spec.rb6
-rw-r--r--spec/ruby/core/rational/to_f_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_i_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_r_spec.rb20
-rw-r--r--spec/ruby/core/rational/to_s_spec.rb5
-rw-r--r--spec/ruby/core/rational/truncate_spec.rb5
-rw-r--r--spec/ruby/core/rational/zero_spec.rb13
-rw-r--r--spec/ruby/core/regexp/case_compare_spec.rb25
-rw-r--r--spec/ruby/core/regexp/casefold_spec.rb8
-rw-r--r--spec/ruby/core/regexp/compile_spec.rb15
-rw-r--r--spec/ruby/core/regexp/encoding_spec.rb62
-rw-r--r--spec/ruby/core/regexp/eql_spec.rb6
-rw-r--r--spec/ruby/core/regexp/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/regexp/escape_spec.rb6
-rw-r--r--spec/ruby/core/regexp/fixed_encoding_spec.rb36
-rw-r--r--spec/ruby/core/regexp/hash_spec.rb20
-rw-r--r--spec/ruby/core/regexp/initialize_spec.rb15
-rw-r--r--spec/ruby/core/regexp/inspect_spec.rb44
-rw-r--r--spec/ruby/core/regexp/last_match_spec.rb14
-rw-r--r--spec/ruby/core/regexp/match_spec.rb146
-rw-r--r--spec/ruby/core/regexp/named_captures_spec.rb35
-rw-r--r--spec/ruby/core/regexp/names_spec.rb29
-rw-r--r--spec/ruby/core/regexp/new_spec.rb27
-rw-r--r--spec/ruby/core/regexp/options_spec.rb54
-rw-r--r--spec/ruby/core/regexp/quote_spec.rb6
-rw-r--r--spec/ruby/core/regexp/shared/equal_value.rb31
-rw-r--r--spec/ruby/core/regexp/shared/new.rb505
-rw-r--r--spec/ruby/core/regexp/shared/quote.rb31
-rw-r--r--spec/ruby/core/regexp/source_spec.rb29
-rw-r--r--spec/ruby/core/regexp/to_s_spec.rb62
-rw-r--r--spec/ruby/core/regexp/try_convert_spec.rb21
-rw-r--r--spec/ruby/core/regexp/union_spec.rb149
-rw-r--r--spec/ruby/core/signal/fixtures/trap_all.rb15
-rw-r--r--spec/ruby/core/signal/list_spec.rb68
-rw-r--r--spec/ruby/core/signal/signame_spec.rb22
-rw-r--r--spec/ruby/core/signal/trap_spec.rb182
-rw-r--r--spec/ruby/core/sizedqueue/append_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/clear_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/close_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/closed_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/deq_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/empty_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/enq_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/length_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/max_spec.rb10
-rw-r--r--spec/ruby/core/sizedqueue/new_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/pop_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/push_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/shift_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/size_spec.rb6
-rw-r--r--spec/ruby/core/string/allocate_spec.rb19
-rw-r--r--spec/ruby/core/string/append_spec.rb8
-rw-r--r--spec/ruby/core/string/ascii_only_spec.rb83
-rw-r--r--spec/ruby/core/string/b_spec.rb24
-rw-r--r--spec/ruby/core/string/bytes_spec.rb55
-rw-r--r--spec/ruby/core/string/bytesize_spec.rb33
-rw-r--r--spec/ruby/core/string/byteslice_spec.rb27
-rw-r--r--spec/ruby/core/string/capitalize_spec.rb187
-rw-r--r--spec/ruby/core/string/case_compare_spec.rb8
-rw-r--r--spec/ruby/core/string/casecmp_spec.rb210
-rw-r--r--spec/ruby/core/string/center_spec.rb135
-rw-r--r--spec/ruby/core/string/chars_spec.rb10
-rw-r--r--spec/ruby/core/string/chomp_spec.rb407
-rw-r--r--spec/ruby/core/string/chop_spec.rb126
-rw-r--r--spec/ruby/core/string/chr_spec.rb42
-rw-r--r--spec/ruby/core/string/clear_spec.rb37
-rw-r--r--spec/ruby/core/string/clone_spec.rb57
-rw-r--r--spec/ruby/core/string/codepoints_spec.rb18
-rw-r--r--spec/ruby/core/string/comparison_spec.rb108
-rw-r--r--spec/ruby/core/string/concat_spec.rb26
-rw-r--r--spec/ruby/core/string/count_spec.rb105
-rw-r--r--spec/ruby/core/string/crypt_spec.rb122
-rw-r--r--spec/ruby/core/string/delete_prefix_spec.rb83
-rw-r--r--spec/ruby/core/string/delete_spec.rb121
-rw-r--r--spec/ruby/core/string/delete_suffix_spec.rb83
-rw-r--r--spec/ruby/core/string/downcase_spec.rb182
-rw-r--r--spec/ruby/core/string/dump_spec.rb402
-rw-r--r--spec/ruby/core/string/dup_spec.rb52
-rw-r--r--spec/ruby/core/string/each_byte_spec.rb61
-rw-r--r--spec/ruby/core/string/each_char_spec.rb7
-rw-r--r--spec/ruby/core/string/each_codepoint_spec.rb8
-rw-r--r--spec/ruby/core/string/each_grapheme_cluster_spec.rb11
-rw-r--r--spec/ruby/core/string/each_line_spec.rb9
-rw-r--r--spec/ruby/core/string/element_reference_spec.rb35
-rw-r--r--spec/ruby/core/string/element_set_spec.rb606
-rw-r--r--spec/ruby/core/string/empty_spec.rb12
-rw-r--r--spec/ruby/core/string/encode_spec.rb163
-rw-r--r--spec/ruby/core/string/encoding_spec.rb187
-rw-r--r--spec/ruby/core/string/end_with_spec.rb56
-rw-r--r--spec/ruby/core/string/eql_spec.rb21
-rw-r--r--spec/ruby/core/string/equal_value_spec.rb8
-rw-r--r--spec/ruby/core/string/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/string/fixtures/freeze_magic_comment.rb3
-rw-r--r--spec/ruby/core/string/fixtures/iso-8859-9-encoding.rb9
-rw-r--r--spec/ruby/core/string/fixtures/utf-8-encoding.rb7
-rw-r--r--spec/ruby/core/string/force_encoding_spec.rb71
-rw-r--r--spec/ruby/core/string/freeze_spec.rb17
-rw-r--r--spec/ruby/core/string/getbyte_spec.rb69
-rw-r--r--spec/ruby/core/string/grapheme_clusters_spec.rb15
-rw-r--r--spec/ruby/core/string/gsub_spec.rb708
-rw-r--r--spec/ruby/core/string/hash_spec.rb9
-rw-r--r--spec/ruby/core/string/hex_spec.rb49
-rw-r--r--spec/ruby/core/string/include_spec.rb35
-rw-r--r--spec/ruby/core/string/index_spec.rb312
-rw-r--r--spec/ruby/core/string/initialize_spec.rb26
-rw-r--r--spec/ruby/core/string/insert_spec.rb84
-rw-r--r--spec/ruby/core/string/inspect_spec.rb502
-rw-r--r--spec/ruby/core/string/intern_spec.rb7
-rw-r--r--spec/ruby/core/string/length_spec.rb7
-rw-r--r--spec/ruby/core/string/lines_spec.rb20
-rw-r--r--spec/ruby/core/string/ljust_spec.rb118
-rw-r--r--spec/ruby/core/string/lstrip_spec.rb52
-rw-r--r--spec/ruby/core/string/match_spec.rb167
-rw-r--r--spec/ruby/core/string/modulo_spec.rb815
-rw-r--r--spec/ruby/core/string/multiply_spec.rb7
-rw-r--r--spec/ruby/core/string/new_spec.rb61
-rw-r--r--spec/ruby/core/string/next_spec.rb11
-rw-r--r--spec/ruby/core/string/oct_spec.rb88
-rw-r--r--spec/ruby/core/string/ord_spec.rb28
-rw-r--r--spec/ruby/core/string/partition_spec.rb38
-rw-r--r--spec/ruby/core/string/percent_spec.rb13
-rw-r--r--spec/ruby/core/string/plus_spec.rb49
-rw-r--r--spec/ruby/core/string/prepend_spec.rb64
-rw-r--r--spec/ruby/core/string/replace_spec.rb7
-rw-r--r--spec/ruby/core/string/reverse_spec.rb50
-rw-r--r--spec/ruby/core/string/rindex_spec.rb366
-rw-r--r--spec/ruby/core/string/rjust_spec.rb118
-rw-r--r--spec/ruby/core/string/rpartition_spec.rb33
-rw-r--r--spec/ruby/core/string/rstrip_spec.rb54
-rw-r--r--spec/ruby/core/string/scan_spec.rb201
-rw-r--r--spec/ruby/core/string/scrub_spec.rb101
-rw-r--r--spec/ruby/core/string/setbyte_spec.rb105
-rw-r--r--spec/ruby/core/string/shared/chars.rb80
-rw-r--r--spec/ruby/core/string/shared/codepoints.rb62
-rw-r--r--spec/ruby/core/string/shared/concat.rb162
-rw-r--r--spec/ruby/core/string/shared/each_char_without_block.rb26
-rw-r--r--spec/ruby/core/string/shared/each_codepoint_without_block.rb33
-rw-r--r--spec/ruby/core/string/shared/each_line.rb178
-rw-r--r--spec/ruby/core/string/shared/each_line_without_block.rb17
-rw-r--r--spec/ruby/core/string/shared/encode.rb247
-rw-r--r--spec/ruby/core/string/shared/eql.rb34
-rw-r--r--spec/ruby/core/string/shared/equal_value.rb29
-rw-r--r--spec/ruby/core/string/shared/grapheme_clusters.rb16
-rw-r--r--spec/ruby/core/string/shared/length.rb26
-rw-r--r--spec/ruby/core/string/shared/replace.rb77
-rw-r--r--spec/ruby/core/string/shared/slice.rb569
-rw-r--r--spec/ruby/core/string/shared/succ.rb90
-rw-r--r--spec/ruby/core/string/shared/to_a.rb9
-rw-r--r--spec/ruby/core/string/shared/to_s.rb20
-rw-r--r--spec/ruby/core/string/shared/to_sym.rb63
-rw-r--r--spec/ruby/core/string/size_spec.rb7
-rw-r--r--spec/ruby/core/string/slice_spec.rb476
-rw-r--r--spec/ruby/core/string/split_spec.rb433
-rw-r--r--spec/ruby/core/string/squeeze_spec.rb115
-rw-r--r--spec/ruby/core/string/start_with_spec.rb76
-rw-r--r--spec/ruby/core/string/string_spec.rb7
-rw-r--r--spec/ruby/core/string/strip_spec.rb62
-rw-r--r--spec/ruby/core/string/sub_spec.rb583
-rw-r--r--spec/ruby/core/string/succ_spec.rb11
-rw-r--r--spec/ruby/core/string/sum_spec.rb22
-rw-r--r--spec/ruby/core/string/swapcase_spec.rb173
-rw-r--r--spec/ruby/core/string/to_c_spec.rb99
-rw-r--r--spec/ruby/core/string/to_f_spec.rb70
-rw-r--r--spec/ruby/core/string/to_i_spec.rb337
-rw-r--r--spec/ruby/core/string/to_r_spec.rb58
-rw-r--r--spec/ruby/core/string/to_s_spec.rb7
-rw-r--r--spec/ruby/core/string/to_str_spec.rb7
-rw-r--r--spec/ruby/core/string/to_sym_spec.rb7
-rw-r--r--spec/ruby/core/string/tr_s_spec.rb136
-rw-r--r--spec/ruby/core/string/tr_spec.rb131
-rw-r--r--spec/ruby/core/string/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/string/uminus_spec.rb74
-rw-r--r--spec/ruby/core/string/undump_spec.rb453
-rw-r--r--spec/ruby/core/string/unicode_normalize_spec.rb115
-rw-r--r--spec/ruby/core/string/unicode_normalized_spec.rb74
-rw-r--r--spec/ruby/core/string/unpack/a_spec.rb66
-rw-r--r--spec/ruby/core/string/unpack/at_spec.rb29
-rw-r--r--spec/ruby/core/string/unpack/b_spec.rb193
-rw-r--r--spec/ruby/core/string/unpack/c_spec.rb63
-rw-r--r--spec/ruby/core/string/unpack/comment_spec.rb25
-rw-r--r--spec/ruby/core/string/unpack/d_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/e_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/f_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/g_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/h_spec.rb135
-rw-r--r--spec/ruby/core/string/unpack/i_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/j_spec.rb272
-rw-r--r--spec/ruby/core/string/unpack/l_spec.rb265
-rw-r--r--spec/ruby/core/string/unpack/m_spec.rb173
-rw-r--r--spec/ruby/core/string/unpack/n_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/p_spec.rb56
-rw-r--r--spec/ruby/core/string/unpack/percent_spec.rb7
-rw-r--r--spec/ruby/core/string/unpack/q_spec.rb64
-rw-r--r--spec/ruby/core/string/unpack/s_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/shared/basic.rb29
-rw-r--r--spec/ruby/core/string/unpack/shared/float.rb271
-rw-r--r--spec/ruby/core/string/unpack/shared/integer.rb339
-rw-r--r--spec/ruby/core/string/unpack/shared/string.rb51
-rw-r--r--spec/ruby/core/string/unpack/shared/taint.rb83
-rw-r--r--spec/ruby/core/string/unpack/shared/unicode.rb60
-rw-r--r--spec/ruby/core/string/unpack/u_spec.rb97
-rw-r--r--spec/ruby/core/string/unpack/v_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/w_spec.rb25
-rw-r--r--spec/ruby/core/string/unpack/x_spec.rb62
-rw-r--r--spec/ruby/core/string/unpack/z_spec.rb23
-rw-r--r--spec/ruby/core/string/unpack1_spec.rb10
-rw-r--r--spec/ruby/core/string/upcase_spec.rb168
-rw-r--r--spec/ruby/core/string/uplus_spec.rb22
-rw-r--r--spec/ruby/core/string/upto_spec.rb98
-rw-r--r--spec/ruby/core/string/valid_encoding_spec.rb127
-rw-r--r--spec/ruby/core/struct/clone_spec.rb7
-rw-r--r--spec/ruby/core/struct/dig_spec.rb42
-rw-r--r--spec/ruby/core/struct/dup_spec.rb23
-rw-r--r--spec/ruby/core/struct/each_pair_spec.rb33
-rw-r--r--spec/ruby/core/struct/each_spec.rb27
-rw-r--r--spec/ruby/core/struct/element_reference_spec.rb52
-rw-r--r--spec/ruby/core/struct/element_set_spec.rb29
-rw-r--r--spec/ruby/core/struct/eql_spec.rb13
-rw-r--r--spec/ruby/core/struct/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/struct/filter_spec.rb12
-rw-r--r--spec/ruby/core/struct/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/struct/hash_spec.rb46
-rw-r--r--spec/ruby/core/struct/initialize_spec.rb43
-rw-r--r--spec/ruby/core/struct/inspect_spec.rb12
-rw-r--r--spec/ruby/core/struct/instance_variable_get_spec.rb16
-rw-r--r--spec/ruby/core/struct/instance_variables_spec.rb16
-rw-r--r--spec/ruby/core/struct/length_spec.rb12
-rw-r--r--spec/ruby/core/struct/members_spec.rb13
-rw-r--r--spec/ruby/core/struct/new_spec.rb217
-rw-r--r--spec/ruby/core/struct/select_spec.rb10
-rw-r--r--spec/ruby/core/struct/shared/accessor.rb7
-rw-r--r--spec/ruby/core/struct/shared/dup.rb9
-rw-r--r--spec/ruby/core/struct/shared/equal_value.rb37
-rw-r--r--spec/ruby/core/struct/shared/inspect.rb5
-rw-r--r--spec/ruby/core/struct/shared/select.rb26
-rw-r--r--spec/ruby/core/struct/size_spec.rb11
-rw-r--r--spec/ruby/core/struct/struct_spec.rb43
-rw-r--r--spec/ruby/core/struct/to_a_spec.rb12
-rw-r--r--spec/ruby/core/struct/to_h_spec.rb58
-rw-r--r--spec/ruby/core/struct/to_s_spec.rb12
-rw-r--r--spec/ruby/core/struct/values_at_spec.rb16
-rw-r--r--spec/ruby/core/struct/values_spec.rb11
-rw-r--r--spec/ruby/core/symbol/all_symbols_spec.rb14
-rw-r--r--spec/ruby/core/symbol/capitalize_spec.rb41
-rw-r--r--spec/ruby/core/symbol/case_compare_spec.rb11
-rw-r--r--spec/ruby/core/symbol/casecmp_spec.rb144
-rw-r--r--spec/ruby/core/symbol/comparison_spec.rb51
-rw-r--r--spec/ruby/core/symbol/downcase_spec.rb25
-rw-r--r--spec/ruby/core/symbol/dup_spec.rb7
-rw-r--r--spec/ruby/core/symbol/element_reference_spec.rb6
-rw-r--r--spec/ruby/core/symbol/empty_spec.rb11
-rw-r--r--spec/ruby/core/symbol/encoding_spec.rb23
-rw-r--r--spec/ruby/core/symbol/equal_value_spec.rb14
-rw-r--r--spec/ruby/core/symbol/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/symbol/id2name_spec.rb6
-rw-r--r--spec/ruby/core/symbol/inspect_spec.rb105
-rw-r--r--spec/ruby/core/symbol/intern_spec.rb11
-rw-r--r--spec/ruby/core/symbol/length_spec.rb6
-rw-r--r--spec/ruby/core/symbol/match_spec.rb60
-rw-r--r--spec/ruby/core/symbol/next_spec.rb6
-rw-r--r--spec/ruby/core/symbol/shared/id2name.rb9
-rw-r--r--spec/ruby/core/symbol/shared/length.rb23
-rw-r--r--spec/ruby/core/symbol/shared/slice.rb282
-rw-r--r--spec/ruby/core/symbol/shared/succ.rb18
-rw-r--r--spec/ruby/core/symbol/size_spec.rb6
-rw-r--r--spec/ruby/core/symbol/slice_spec.rb6
-rw-r--r--spec/ruby/core/symbol/succ_spec.rb6
-rw-r--r--spec/ruby/core/symbol/swapcase_spec.rb29
-rw-r--r--spec/ruby/core/symbol/symbol_spec.rb19
-rw-r--r--spec/ruby/core/symbol/to_proc_spec.rb41
-rw-r--r--spec/ruby/core/symbol/to_s_spec.rb6
-rw-r--r--spec/ruby/core/symbol/to_sym_spec.rb9
-rw-r--r--spec/ruby/core/symbol/upcase_spec.rb21
-rw-r--r--spec/ruby/core/systemexit/initialize_spec.rb26
-rw-r--r--spec/ruby/core/systemexit/success_spec.rb13
-rw-r--r--spec/ruby/core/thread/abort_on_exception_spec.rb106
-rw-r--r--spec/ruby/core/thread/add_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/alive_spec.rb58
-rw-r--r--spec/ruby/core/thread/allocate_spec.rb9
-rw-r--r--spec/ruby/core/thread/backtrace/location/absolute_path_spec.rb61
-rw-r--r--spec/ruby/core/thread/backtrace/location/base_label_spec.rb22
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path.rb4
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_method_added.rb10
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/classes.rb35
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_required.rb3
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/inspect_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/label_spec.rb37
-rw-r--r--spec/ruby/core/thread/backtrace/location/lineno_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/path_spec.rb89
-rw-r--r--spec/ruby/core/thread/backtrace/location/to_s_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace_locations_spec.rb33
-rw-r--r--spec/ruby/core/thread/backtrace_spec.rb35
-rw-r--r--spec/ruby/core/thread/current_spec.rb31
-rw-r--r--spec/ruby/core/thread/element_reference_spec.rb44
-rw-r--r--spec/ruby/core/thread/element_set_spec.rb51
-rw-r--r--spec/ruby/core/thread/exclusive_spec.rb47
-rw-r--r--spec/ruby/core/thread/exit_spec.rb15
-rw-r--r--spec/ruby/core/thread/fetch_spec.rb38
-rw-r--r--spec/ruby/core/thread/fixtures/classes.rb297
-rw-r--r--spec/ruby/core/thread/fork_spec.rb9
-rw-r--r--spec/ruby/core/thread/group_spec.rb5
-rw-r--r--spec/ruby/core/thread/initialize_spec.rb27
-rw-r--r--spec/ruby/core/thread/inspect_spec.rb6
-rw-r--r--spec/ruby/core/thread/join_spec.rb65
-rw-r--r--spec/ruby/core/thread/key_spec.rb53
-rw-r--r--spec/ruby/core/thread/keys_spec.rb44
-rw-r--r--spec/ruby/core/thread/kill_spec.rb25
-rw-r--r--spec/ruby/core/thread/list_spec.rb55
-rw-r--r--spec/ruby/core/thread/main_spec.rb10
-rw-r--r--spec/ruby/core/thread/name_spec.rb54
-rw-r--r--spec/ruby/core/thread/new_spec.rb83
-rw-r--r--spec/ruby/core/thread/pass_spec.rb8
-rw-r--r--spec/ruby/core/thread/priority_spec.rb72
-rw-r--r--spec/ruby/core/thread/raise_spec.rb208
-rw-r--r--spec/ruby/core/thread/report_on_exception_spec.rb116
-rw-r--r--spec/ruby/core/thread/run_spec.rb8
-rw-r--r--spec/ruby/core/thread/set_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/shared/exit.rb180
-rw-r--r--spec/ruby/core/thread/shared/start.rb41
-rw-r--r--spec/ruby/core/thread/shared/to_s.rb53
-rw-r--r--spec/ruby/core/thread/shared/wakeup.rb61
-rw-r--r--spec/ruby/core/thread/start_spec.rb9
-rw-r--r--spec/ruby/core/thread/status_spec.rb60
-rw-r--r--spec/ruby/core/thread/stop_spec.rb54
-rw-r--r--spec/ruby/core/thread/terminate_spec.rb7
-rw-r--r--spec/ruby/core/thread/thread_variable_get_spec.rb25
-rw-r--r--spec/ruby/core/thread/thread_variable_set_spec.rb26
-rw-r--r--spec/ruby/core/thread/thread_variable_spec.rb21
-rw-r--r--spec/ruby/core/thread/thread_variables_spec.rb29
-rw-r--r--spec/ruby/core/thread/to_s_spec.rb8
-rw-r--r--spec/ruby/core/thread/value_spec.rb31
-rw-r--r--spec/ruby/core/thread/wakeup_spec.rb7
-rw-r--r--spec/ruby/core/threadgroup/add_spec.rb39
-rw-r--r--spec/ruby/core/threadgroup/default_spec.rb11
-rw-r--r--spec/ruby/core/threadgroup/enclose_spec.rb24
-rw-r--r--spec/ruby/core/threadgroup/enclosed_spec.rb14
-rw-r--r--spec/ruby/core/threadgroup/list_spec.rb23
-rw-r--r--spec/ruby/core/time/_dump_spec.rb55
-rw-r--r--spec/ruby/core/time/_load_spec.rb52
-rw-r--r--spec/ruby/core/time/asctime_spec.rb6
-rw-r--r--spec/ruby/core/time/at_spec.rb254
-rw-r--r--spec/ruby/core/time/ceil_spec.rb45
-rw-r--r--spec/ruby/core/time/comparison_spec.rb104
-rw-r--r--spec/ruby/core/time/ctime_spec.rb6
-rw-r--r--spec/ruby/core/time/day_spec.rb6
-rw-r--r--spec/ruby/core/time/dst_spec.rb6
-rw-r--r--spec/ruby/core/time/dup_spec.rb46
-rw-r--r--spec/ruby/core/time/eql_spec.rb29
-rw-r--r--spec/ruby/core/time/fixtures/classes.rb106
-rw-r--r--spec/ruby/core/time/floor_spec.rb37
-rw-r--r--spec/ruby/core/time/friday_spec.rb11
-rw-r--r--spec/ruby/core/time/getgm_spec.rb6
-rw-r--r--spec/ruby/core/time/getlocal_spec.rb169
-rw-r--r--spec/ruby/core/time/getutc_spec.rb6
-rw-r--r--spec/ruby/core/time/gm_spec.rb10
-rw-r--r--spec/ruby/core/time/gmt_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/gmt_spec.rb8
-rw-r--r--spec/ruby/core/time/gmtime_spec.rb6
-rw-r--r--spec/ruby/core/time/gmtoff_spec.rb6
-rw-r--r--spec/ruby/core/time/hash_spec.rb11
-rw-r--r--spec/ruby/core/time/hour_spec.rb17
-rw-r--r--spec/ruby/core/time/inspect_spec.rb6
-rw-r--r--spec/ruby/core/time/isdst_spec.rb6
-rw-r--r--spec/ruby/core/time/local_spec.rb11
-rw-r--r--spec/ruby/core/time/localtime_spec.rb140
-rw-r--r--spec/ruby/core/time/mday_spec.rb6
-rw-r--r--spec/ruby/core/time/min_spec.rb17
-rw-r--r--spec/ruby/core/time/minus_spec.rb123
-rw-r--r--spec/ruby/core/time/mktime_spec.rb11
-rw-r--r--spec/ruby/core/time/mon_spec.rb6
-rw-r--r--spec/ruby/core/time/monday_spec.rb11
-rw-r--r--spec/ruby/core/time/month_spec.rb6
-rw-r--r--spec/ruby/core/time/new_spec.rb333
-rw-r--r--spec/ruby/core/time/now_spec.rb6
-rw-r--r--spec/ruby/core/time/nsec_spec.rb31
-rw-r--r--spec/ruby/core/time/plus_spec.rb120
-rw-r--r--spec/ruby/core/time/round_spec.rb35
-rw-r--r--spec/ruby/core/time/saturday_spec.rb11
-rw-r--r--spec/ruby/core/time/sec_spec.rb7
-rw-r--r--spec/ruby/core/time/shared/asctime.rb6
-rw-r--r--spec/ruby/core/time/shared/day.rb15
-rw-r--r--spec/ruby/core/time/shared/getgm.rb9
-rw-r--r--spec/ruby/core/time/shared/gm.rb70
-rw-r--r--spec/ruby/core/time/shared/gmt_offset.rb59
-rw-r--r--spec/ruby/core/time/shared/gmtime.rb33
-rw-r--r--spec/ruby/core/time/shared/inspect.rb21
-rw-r--r--spec/ruby/core/time/shared/isdst.rb8
-rw-r--r--spec/ruby/core/time/shared/local.rb45
-rw-r--r--spec/ruby/core/time/shared/month.rb15
-rw-r--r--spec/ruby/core/time/shared/now.rb35
-rw-r--r--spec/ruby/core/time/shared/time_params.rb262
-rw-r--r--spec/ruby/core/time/shared/to_i.rb9
-rw-r--r--spec/ruby/core/time/strftime_spec.rb52
-rw-r--r--spec/ruby/core/time/subsec_spec.rb27
-rw-r--r--spec/ruby/core/time/succ_spec.rb39
-rw-r--r--spec/ruby/core/time/sunday_spec.rb11
-rw-r--r--spec/ruby/core/time/thursday_spec.rb11
-rw-r--r--spec/ruby/core/time/time_spec.rb7
-rw-r--r--spec/ruby/core/time/to_a_spec.rb12
-rw-r--r--spec/ruby/core/time/to_f_spec.rb7
-rw-r--r--spec/ruby/core/time/to_i_spec.rb6
-rw-r--r--spec/ruby/core/time/to_r_spec.rb11
-rw-r--r--spec/ruby/core/time/to_s_spec.rb6
-rw-r--r--spec/ruby/core/time/tuesday_spec.rb11
-rw-r--r--spec/ruby/core/time/tv_nsec_spec.rb5
-rw-r--r--spec/ruby/core/time/tv_sec_spec.rb6
-rw-r--r--spec/ruby/core/time/tv_usec_spec.rb5
-rw-r--r--spec/ruby/core/time/usec_spec.rb43
-rw-r--r--spec/ruby/core/time/utc_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/utc_spec.rb21
-rw-r--r--spec/ruby/core/time/wday_spec.rb9
-rw-r--r--spec/ruby/core/time/wednesday_spec.rb11
-rw-r--r--spec/ruby/core/time/yday_spec.rb21
-rw-r--r--spec/ruby/core/time/year_spec.rb17
-rw-r--r--spec/ruby/core/time/zone_spec.rb90
-rw-r--r--spec/ruby/core/tracepoint/binding_spec.rb19
-rw-r--r--spec/ruby/core/tracepoint/callee_id_spec.rb17
-rw-r--r--spec/ruby/core/tracepoint/defined_class_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/disable_spec.rb73
-rw-r--r--spec/ruby/core/tracepoint/enable_spec.rb480
-rw-r--r--spec/ruby/core/tracepoint/enabled_spec.rb14
-rw-r--r--spec/ruby/core/tracepoint/eval_script_spec.rb24
-rw-r--r--spec/ruby/core/tracepoint/event_spec.rb21
-rw-r--r--spec/ruby/core/tracepoint/fixtures/classes.rb34
-rw-r--r--spec/ruby/core/tracepoint/inspect_spec.rb28
-rw-r--r--spec/ruby/core/tracepoint/lineno_spec.rb10
-rw-r--r--spec/ruby/core/tracepoint/method_id_spec.rb13
-rw-r--r--spec/ruby/core/tracepoint/new_spec.rb67
-rw-r--r--spec/ruby/core/tracepoint/parameters_spec.rb23
-rw-r--r--spec/ruby/core/tracepoint/path_spec.rb18
-rw-r--r--spec/ruby/core/tracepoint/raised_exception_spec.rb16
-rw-r--r--spec/ruby/core/tracepoint/return_value_spec.rb13
-rw-r--r--spec/ruby/core/tracepoint/self_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/trace_spec.rb9
-rw-r--r--spec/ruby/core/true/and_spec.rb11
-rw-r--r--spec/ruby/core/true/dup_spec.rb7
-rw-r--r--spec/ruby/core/true/inspect_spec.rb7
-rw-r--r--spec/ruby/core/true/or_spec.rb11
-rw-r--r--spec/ruby/core/true/to_s_spec.rb17
-rw-r--r--spec/ruby/core/true/trueclass_spec.rb15
-rw-r--r--spec/ruby/core/true/xor_spec.rb11
-rw-r--r--spec/ruby/core/unboundmethod/arity_spec.rb207
-rw-r--r--spec/ruby/core/unboundmethod/bind_call_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/bind_spec.rb61
-rw-r--r--spec/ruby/core/unboundmethod/clone_spec.rb12
-rw-r--r--spec/ruby/core/unboundmethod/eql_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/equal_value_spec.rb101
-rw-r--r--spec/ruby/core/unboundmethod/fixtures/classes.rb87
-rw-r--r--spec/ruby/core/unboundmethod/hash_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/inspect_spec.rb7
-rw-r--r--spec/ruby/core/unboundmethod/name_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/original_name_spec.rb22
-rw-r--r--spec/ruby/core/unboundmethod/owner_spec.rb26
-rw-r--r--spec/ruby/core/unboundmethod/parameters_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/shared/to_s.rb25
-rw-r--r--spec/ruby/core/unboundmethod/source_location_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/super_method_spec.rb28
-rw-r--r--spec/ruby/core/unboundmethod/to_s_spec.rb7
-rw-r--r--spec/ruby/core/warning/warn_spec.rb66
-rw-r--r--spec/ruby/default.mspec49
-rw-r--r--spec/ruby/fixtures/basicobject/method_missing.rb55
-rw-r--r--spec/ruby/fixtures/class.rb138
-rw-r--r--spec/ruby/fixtures/class_variables.rb58
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/b/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/concurrent.rb12
-rw-r--r--spec/ruby/fixtures/code/concurrent2.rb8
-rw-r--r--spec/ruby/fixtures/code/concurrent3.rb2
-rw-r--r--spec/ruby/fixtures/code/file_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/gem/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/line_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/load_ext_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture_and__FILE__.rb1
-rw-r--r--spec/ruby/fixtures/code/load_wrap_method_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code/methods_fixture.rb364
-rw-r--r--spec/ruby/fixtures/code/raise_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/recursive_load_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/recursive_require_fixture.rb3
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink1.rb1
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink2/symlink2.rb1
-rw-r--r--spec/ruby/fixtures/code/wrap_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code_loading.rb26
-rw-r--r--spec/ruby/fixtures/constants.rb288
-rw-r--r--spec/ruby/fixtures/enumerator/classes.rb15
-rw-r--r--spec/ruby/fixtures/math/common.rb3
-rw-r--r--spec/ruby/fixtures/rational.rb14
-rw-r--r--spec/ruby/fixtures/reflection.rb352
-rw-r--r--spec/ruby/language/BEGIN_spec.rb36
-rw-r--r--spec/ruby/language/README30
-rw-r--r--spec/ruby/language/alias_spec.rb258
-rw-r--r--spec/ruby/language/and_spec.rb80
-rw-r--r--spec/ruby/language/array_spec.rb162
-rw-r--r--spec/ruby/language/block_spec.rb933
-rw-r--r--spec/ruby/language/break_spec.rb365
-rw-r--r--spec/ruby/language/case_spec.rb427
-rw-r--r--spec/ruby/language/class_spec.rb332
-rw-r--r--spec/ruby/language/class_variable_spec.rb84
-rw-r--r--spec/ruby/language/constants_spec.rb745
-rw-r--r--spec/ruby/language/def_spec.rb776
-rw-r--r--spec/ruby/language/defined_spec.rb1130
-rw-r--r--spec/ruby/language/encoding_spec.rb36
-rw-r--r--spec/ruby/language/ensure_spec.rb333
-rw-r--r--spec/ruby/language/execution_spec.rb15
-rw-r--r--spec/ruby/language/file_spec.rb29
-rw-r--r--spec/ruby/language/fixtures/argv_encoding.rb1
-rw-r--r--spec/ruby/language/fixtures/array.rb32
-rw-r--r--spec/ruby/language/fixtures/begin_file.rb3
-rw-r--r--spec/ruby/language/fixtures/binary_symbol.rb4
-rw-r--r--spec/ruby/language/fixtures/block.rb61
-rw-r--r--spec/ruby/language/fixtures/break.rb291
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel.rb9
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_block.rb23
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_method.rb17
-rw-r--r--spec/ruby/language/fixtures/bytes_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/case_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/classes.rb31
-rw-r--r--spec/ruby/language/fixtures/coding_us_ascii.rb11
-rw-r--r--spec/ruby/language/fixtures/coding_utf_8.rb11
-rw-r--r--spec/ruby/language/fixtures/constant_visibility.rb98
-rw-r--r--spec/ruby/language/fixtures/constants_sclass.rb54
-rw-r--r--spec/ruby/language/fixtures/def.rb14
-rw-r--r--spec/ruby/language/fixtures/defined.rb303
-rw-r--r--spec/ruby/language/fixtures/dollar_zero.rb6
-rw-r--r--spec/ruby/language/fixtures/emacs_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/ensure.rb121
-rw-r--r--spec/ruby/language/fixtures/file.rb1
-rw-r--r--spec/ruby/language/fixtures/for_scope.rb15
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_diff_enc.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_no_comment.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_one_literal.rb4
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_diff_enc.rbbin0 -> 181 bytes-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_no_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_two_literals.rb3
-rw-r--r--spec/ruby/language/fixtures/hash_strings_binary.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_usascii.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_utf8.rb7
-rw-r--r--spec/ruby/language/fixtures/magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/match_operators.rb9
-rw-r--r--spec/ruby/language/fixtures/metaclass.rb33
-rw-r--r--spec/ruby/language/fixtures/module.rb24
-rw-r--r--spec/ruby/language/fixtures/next.rb134
-rw-r--r--spec/ruby/language/fixtures/no_magic_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/precedence.rb16
-rw-r--r--spec/ruby/language/fixtures/print_magic_comment_result_at_exit.rb3
-rw-r--r--spec/ruby/language/fixtures/private.rb59
-rw-r--r--spec/ruby/language/fixtures/rescue.rb67
-rw-r--r--spec/ruby/language/fixtures/return.rb139
-rw-r--r--spec/ruby/language/fixtures/second_line_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/second_token_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/send.rb141
-rwxr-xr-xspec/ruby/language/fixtures/shebang_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/squiggly_heredoc.rb39
-rw-r--r--spec/ruby/language/fixtures/super.rb696
-rw-r--r--spec/ruby/language/fixtures/utf16-be-nobom.rbbin0 -> 68 bytes-rw-r--r--spec/ruby/language/fixtures/utf16-le-nobom.rbbin0 -> 69 bytes-rw-r--r--spec/ruby/language/fixtures/utf8-bom.rb2
-rw-r--r--spec/ruby/language/fixtures/utf8-nobom.rb2
-rw-r--r--spec/ruby/language/fixtures/variables.rb85
-rw-r--r--spec/ruby/language/fixtures/vim_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/yield.rb41
-rw-r--r--spec/ruby/language/for_spec.rb182
-rw-r--r--spec/ruby/language/hash_spec.rb163
-rw-r--r--spec/ruby/language/heredoc_spec.rb91
-rw-r--r--spec/ruby/language/if_spec.rb371
-rw-r--r--spec/ruby/language/lambda_spec.rb623
-rw-r--r--spec/ruby/language/line_spec.rb45
-rw-r--r--spec/ruby/language/loop_spec.rb67
-rw-r--r--spec/ruby/language/magic_comment_spec.rb92
-rw-r--r--spec/ruby/language/match_spec.rb81
-rw-r--r--spec/ruby/language/metaclass_spec.rb143
-rw-r--r--spec/ruby/language/method_spec.rb1487
-rw-r--r--spec/ruby/language/module_spec.rb91
-rw-r--r--spec/ruby/language/next_spec.rb410
-rw-r--r--spec/ruby/language/not_spec.rb51
-rw-r--r--spec/ruby/language/numbers_spec.rb97
-rw-r--r--spec/ruby/language/optional_assignments_spec.rb353
-rw-r--r--spec/ruby/language/or_spec.rb90
-rw-r--r--spec/ruby/language/order_spec.rb75
-rw-r--r--spec/ruby/language/precedence_spec.rb447
-rw-r--r--spec/ruby/language/predefined/data_spec.rb48
-rw-r--r--spec/ruby/language/predefined/fixtures/data1.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data2.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/data3.rb6
-rw-r--r--spec/ruby/language/predefined/fixtures/data4.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data5.rb5
-rw-r--r--spec/ruby/language/predefined/fixtures/data_offset.rb12
-rw-r--r--spec/ruby/language/predefined/fixtures/data_only.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/empty_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/print_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic_required.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id_required.rb1
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_required_before.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_values.rb9
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables_required.rb2
-rw-r--r--spec/ruby/language/predefined/toplevel_binding_spec.rb34
-rw-r--r--spec/ruby/language/predefined_spec.rb1234
-rw-r--r--spec/ruby/language/private_spec.rb67
-rw-r--r--spec/ruby/language/proc_spec.rb220
-rw-r--r--spec/ruby/language/range_spec.rb19
-rw-r--r--spec/ruby/language/redo_spec.rb66
-rw-r--r--spec/ruby/language/regexp/anchors_spec.rb179
-rw-r--r--spec/ruby/language/regexp/back-references_spec.rb53
-rw-r--r--spec/ruby/language/regexp/character_classes_spec.rb631
-rw-r--r--spec/ruby/language/regexp/encoding_spec.rb119
-rw-r--r--spec/ruby/language/regexp/escapes_spec.rb81
-rw-r--r--spec/ruby/language/regexp/grouping_spec.rb23
-rw-r--r--spec/ruby/language/regexp/interpolation_spec.rb58
-rw-r--r--spec/ruby/language/regexp/modifiers_spec.rb115
-rw-r--r--spec/ruby/language/regexp/repetition_spec.rb48
-rw-r--r--spec/ruby/language/regexp_spec.rb177
-rw-r--r--spec/ruby/language/rescue_spec.rb485
-rw-r--r--spec/ruby/language/retry_spec.rb52
-rw-r--r--spec/ruby/language/return_spec.rb511
-rw-r--r--spec/ruby/language/safe_navigator_spec.rb99
-rw-r--r--spec/ruby/language/safe_spec.rb138
-rw-r--r--spec/ruby/language/send_spec.rb562
-rw-r--r--spec/ruby/language/shared/__FILE__.rb23
-rw-r--r--spec/ruby/language/shared/__LINE__.rb15
-rw-r--r--spec/ruby/language/singleton_class_spec.rb293
-rw-r--r--spec/ruby/language/source_encoding_spec.rb61
-rw-r--r--spec/ruby/language/string_spec.rb289
-rw-r--r--spec/ruby/language/super_spec.rb388
-rw-r--r--spec/ruby/language/symbol_spec.rb106
-rw-r--r--spec/ruby/language/throw_spec.rb81
-rw-r--r--spec/ruby/language/undef_spec.rb72
-rw-r--r--spec/ruby/language/unless_spec.rb43
-rw-r--r--spec/ruby/language/until_spec.rb234
-rw-r--r--spec/ruby/language/variables_spec.rb788
-rw-r--r--spec/ruby/language/while_spec.rb344
-rw-r--r--spec/ruby/language/yield_spec.rb187
-rw-r--r--spec/ruby/library/English/English_spec.rb171
-rw-r--r--spec/ruby/library/abbrev/abbrev_spec.rb31
-rw-r--r--spec/ruby/library/base64/decode64_spec.rb25
-rw-r--r--spec/ruby/library/base64/encode64_spec.rb23
-rw-r--r--spec/ruby/library/base64/strict_decode64_spec.rb41
-rw-r--r--spec/ruby/library/base64/strict_encode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_decode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_encode64_spec.rb20
-rw-r--r--spec/ruby/library/bigdecimal/BigDecimal_spec.rb257
-rw-r--r--spec/ruby/library/bigdecimal/abs_spec.rb50
-rw-r--r--spec/ruby/library/bigdecimal/add_spec.rb193
-rw-r--r--spec/ruby/library/bigdecimal/case_compare_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/ceil_spec.rb104
-rw-r--r--spec/ruby/library/bigdecimal/clone_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/coerce_spec.rb26
-rw-r--r--spec/ruby/library/bigdecimal/comparison_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/constants_spec.rb72
-rw-r--r--spec/ruby/library/bigdecimal/div_spec.rb110
-rw-r--r--spec/ruby/library/bigdecimal/divide_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/divmod_spec.rb180
-rw-r--r--spec/ruby/library/bigdecimal/double_fig_spec.rb9
-rw-r--r--spec/ruby/library/bigdecimal/dup_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/eql_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/equal_value_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/exponent_spec.rb38
-rw-r--r--spec/ruby/library/bigdecimal/finite_spec.rb34
-rw-r--r--spec/ruby/library/bigdecimal/fix_spec.rb57
-rw-r--r--spec/ruby/library/bigdecimal/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/bigdecimal/floor_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/frac_spec.rb48
-rw-r--r--spec/ruby/library/bigdecimal/gt_spec.rb96
-rw-r--r--spec/ruby/library/bigdecimal/gte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/hash_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/infinite_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/inspect_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/limit_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/lt_spec.rb94
-rw-r--r--spec/ruby/library/bigdecimal/lte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/minus_spec.rb66
-rw-r--r--spec/ruby/library/bigdecimal/mode_spec.rb36
-rw-r--r--spec/ruby/library/bigdecimal/modulo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/mult_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/multiply_spec.rb41
-rw-r--r--spec/ruby/library/bigdecimal/nan_spec.rb23
-rw-r--r--spec/ruby/library/bigdecimal/nonzero_spec.rb29
-rw-r--r--spec/ruby/library/bigdecimal/plus_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/power_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/precs_spec.rb48
-rw-r--r--spec/ruby/library/bigdecimal/quo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/remainder_spec.rb92
-rw-r--r--spec/ruby/library/bigdecimal/round_spec.rb234
-rw-r--r--spec/ruby/library/bigdecimal/shared/clone.rb24
-rw-r--r--spec/ruby/library/bigdecimal/shared/eql.rb61
-rw-r--r--spec/ruby/library/bigdecimal/shared/modulo.rb125
-rw-r--r--spec/ruby/library/bigdecimal/shared/mult.rb97
-rw-r--r--spec/ruby/library/bigdecimal/shared/power.rb72
-rw-r--r--spec/ruby/library/bigdecimal/shared/quo.rb67
-rw-r--r--spec/ruby/library/bigdecimal/shared/to_int.rb16
-rw-r--r--spec/ruby/library/bigdecimal/sign_spec.rb46
-rw-r--r--spec/ruby/library/bigdecimal/split_spec.rb86
-rw-r--r--spec/ruby/library/bigdecimal/sqrt_spec.rb112
-rw-r--r--spec/ruby/library/bigdecimal/sub_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/to_d_spec.rb10
-rw-r--r--spec/ruby/library/bigdecimal/to_f_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/to_i_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/to_int_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/to_r_spec.rb16
-rw-r--r--spec/ruby/library/bigdecimal/to_s_spec.rb80
-rw-r--r--spec/ruby/library/bigdecimal/truncate_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/uminus_spec.rb58
-rw-r--r--spec/ruby/library/bigdecimal/uplus_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/util_spec.rb42
-rw-r--r--spec/ruby/library/bigdecimal/zero_spec.rb27
-rw-r--r--spec/ruby/library/bigmath/log_spec.rb10
-rw-r--r--spec/ruby/library/cgi/cookie/domain_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/expires_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/initialize_spec.rb147
-rw-r--r--spec/ruby/library/cgi/cookie/name_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/parse_spec.rb26
-rw-r--r--spec/ruby/library/cgi/cookie/path_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/secure_spec.rb70
-rw-r--r--spec/ruby/library/cgi/cookie/to_s_spec.rb42
-rw-r--r--spec/ruby/library/cgi/cookie/value_spec.rb76
-rw-r--r--spec/ruby/library/cgi/escapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/escapeHTML_spec.rb13
-rw-r--r--spec/ruby/library/cgi/escape_spec.rb26
-rw-r--r--spec/ruby/library/cgi/htmlextension/a_spec.rb49
-rw-r--r--spec/ruby/library/cgi/htmlextension/base_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/blockquote_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/br_spec.rb22
-rw-r--r--spec/ruby/library/cgi/htmlextension/caption_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_group_spec.rb76
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/doctype_spec.rb27
-rw-r--r--spec/ruby/library/cgi/htmlextension/file_field_spec.rb72
-rw-r--r--spec/ruby/library/cgi/htmlextension/fixtures/common.rb15
-rw-r--r--spec/ruby/library/cgi/htmlextension/form_spec.rb58
-rw-r--r--spec/ruby/library/cgi/htmlextension/frame_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/frameset_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/hidden_spec.rb59
-rw-r--r--spec/ruby/library/cgi/htmlextension/html_spec.rb66
-rw-r--r--spec/ruby/library/cgi/htmlextension/image_button_spec.rb69
-rw-r--r--spec/ruby/library/cgi/htmlextension/img_spec.rb83
-rw-r--r--spec/ruby/library/cgi/htmlextension/multipart_form_spec.rb64
-rw-r--r--spec/ruby/library/cgi/htmlextension/password_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/popup_menu_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_button_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_group_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/reset_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/scrolling_list_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/shared/popup_menu.rb94
-rw-r--r--spec/ruby/library/cgi/htmlextension/submit_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/text_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/textarea_spec.rb73
-rw-r--r--spec/ruby/library/cgi/http_header_spec.rb8
-rw-r--r--spec/ruby/library/cgi/initialize_spec.rb133
-rw-r--r--spec/ruby/library/cgi/out_spec.rb51
-rw-r--r--spec/ruby/library/cgi/parse_spec.rb24
-rw-r--r--spec/ruby/library/cgi/pretty_spec.rb24
-rw-r--r--spec/ruby/library/cgi/print_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_charset_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_encoding_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_language_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/auth_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cache_control_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/content_length_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/content_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cookies_spec.rb10
-rw-r--r--spec/ruby/library/cgi/queryextension/element_reference_spec.rb27
-rw-r--r--spec/ruby/library/cgi/queryextension/from_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/gateway_interface_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/has_key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/include_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/keys_spec.rb20
-rw-r--r--spec/ruby/library/cgi/queryextension/multipart_spec.rb40
-rw-r--r--spec/ruby/library/cgi/queryextension/negotiate_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/params_spec.rb37
-rw-r--r--spec/ruby/library/cgi/queryextension/path_info_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/path_translated_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/pragma_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/query_string_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie2_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/referer_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_addr_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_ident_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_user_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/request_method_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/script_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_port_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/server_protocol_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_software_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/shared/has_key.rb19
-rw-r--r--spec/ruby/library/cgi/queryextension/user_agent_spec.rb22
-rw-r--r--spec/ruby/library/cgi/rfc1123_date_spec.rb10
-rw-r--r--spec/ruby/library/cgi/shared/http_header.rb112
-rw-r--r--spec/ruby/library/cgi/unescapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/unescapeHTML_spec.rb39
-rw-r--r--spec/ruby/library/cgi/unescape_spec.rb15
-rw-r--r--spec/ruby/library/cmath/math/acos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/acosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan2_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atanh_spec.rb20
-rw-r--r--spec/ruby/library/cmath/math/cos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/cosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/exp_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/cmath/math/log10_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/log_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/shared/acos.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/acosh.rb37
-rw-r--r--spec/ruby/library/cmath/math/shared/asin.rb47
-rw-r--r--spec/ruby/library/cmath/math/shared/asinh.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan2.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/atanh.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cos.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cosh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/exp.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/log.rb39
-rw-r--r--spec/ruby/library/cmath/math/shared/log10.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/sin.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/sinh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/sqrt.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/tan.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/tanh.rb32
-rw-r--r--spec/ruby/library/cmath/math/sin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sqrt_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tanh_spec.rb18
-rw-r--r--spec/ruby/library/conditionvariable/broadcast_spec.rb67
-rw-r--r--spec/ruby/library/conditionvariable/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/conditionvariable/signal_spec.rb104
-rw-r--r--spec/ruby/library/conditionvariable/wait_spec.rb132
-rw-r--r--spec/ruby/library/coverage/fixtures/second_class.rb5
-rw-r--r--spec/ruby/library/coverage/fixtures/some_class.rb16
-rw-r--r--spec/ruby/library/coverage/fixtures/start_coverage.rb3
-rw-r--r--spec/ruby/library/coverage/peek_result_spec.rb64
-rw-r--r--spec/ruby/library/coverage/result_spec.rb78
-rw-r--r--spec/ruby/library/coverage/start_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/data_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/fixtures/one_line.csv1
-rw-r--r--spec/ruby/library/csv/foreach_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_line_spec.rb30
-rw-r--r--spec/ruby/library/csv/generate_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_spec.rb32
-rw-r--r--spec/ruby/library/csv/iobuf/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/liberal_parsing_spec.rb19
-rw-r--r--spec/ruby/library/csv/open_spec.rb6
-rw-r--r--spec/ruby/library/csv/parse_spec.rb93
-rw-r--r--spec/ruby/library/csv/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/readlines_spec.rb35
-rw-r--r--spec/ruby/library/csv/streambuf/add_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/buf_size_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/drop_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/element_reference_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/get_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/idx_is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/rel_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/add_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/append_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/create_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/generate_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/terminate_spec.rb6
-rw-r--r--spec/ruby/library/date/accessor_spec.rb91
-rw-r--r--spec/ruby/library/date/add_month_spec.rb38
-rw-r--r--spec/ruby/library/date/add_spec.rb30
-rw-r--r--spec/ruby/library/date/ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/append_spec.rb6
-rw-r--r--spec/ruby/library/date/asctime_spec.rb6
-rw-r--r--spec/ruby/library/date/boat_spec.rb24
-rw-r--r--spec/ruby/library/date/case_compare_spec.rb6
-rw-r--r--spec/ruby/library/date/civil_spec.rb12
-rw-r--r--spec/ruby/library/date/commercial_spec.rb17
-rw-r--r--spec/ruby/library/date/commercial_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/constants_spec.rb48
-rw-r--r--spec/ruby/library/date/conversions_spec.rb43
-rw-r--r--spec/ruby/library/date/ctime_spec.rb6
-rw-r--r--spec/ruby/library/date/cwday_spec.rb6
-rw-r--r--spec/ruby/library/date/cweek_spec.rb6
-rw-r--r--spec/ruby/library/date/cwyear_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_to_time_spec.rb6
-rw-r--r--spec/ruby/library/date/day_spec.rb9
-rw-r--r--spec/ruby/library/date/downto_spec.rb18
-rw-r--r--spec/ruby/library/date/england_spec.rb6
-rw-r--r--spec/ruby/library/date/eql_spec.rb12
-rw-r--r--spec/ruby/library/date/format/bag/method_missing_spec.rb6
-rw-r--r--spec/ruby/library/date/format/bag/to_hash_spec.rb6
-rw-r--r--spec/ruby/library/date/friday_spec.rb12
-rw-r--r--spec/ruby/library/date/gregorian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/gregorian_spec.rb16
-rw-r--r--spec/ruby/library/date/hash_spec.rb8
-rw-r--r--spec/ruby/library/date/infinity/abs_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/coerce_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/d_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/finite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/infinite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/nan_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uminus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uplus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/zero_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity_spec.rb67
-rw-r--r--spec/ruby/library/date/inspect_spec.rb6
-rw-r--r--spec/ruby/library/date/iso8601_spec.rb44
-rw-r--r--spec/ruby/library/date/italy_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_spec.rb15
-rw-r--r--spec/ruby/library/date/jd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_civil_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_commercial_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ld_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ordinal_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_wday_spec.rb6
-rw-r--r--spec/ruby/library/date/julian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/julian_spec.rb16
-rw-r--r--spec/ruby/library/date/ld_spec.rb6
-rw-r--r--spec/ruby/library/date/ld_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/leap_spec.rb10
-rw-r--r--spec/ruby/library/date/mday_spec.rb6
-rw-r--r--spec/ruby/library/date/minus_month_spec.rb23
-rw-r--r--spec/ruby/library/date/minus_spec.rb30
-rw-r--r--spec/ruby/library/date/mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/mjd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/mon_spec.rb6
-rw-r--r--spec/ruby/library/date/monday_spec.rb8
-rw-r--r--spec/ruby/library/date/month_spec.rb9
-rw-r--r--spec/ruby/library/date/new_spec.rb8
-rw-r--r--spec/ruby/library/date/new_start_spec.rb6
-rw-r--r--spec/ruby/library/date/next_day_spec.rb14
-rw-r--r--spec/ruby/library/date/next_month_spec.rb29
-rw-r--r--spec/ruby/library/date/next_spec.rb6
-rw-r--r--spec/ruby/library/date/next_year_spec.rb12
-rw-r--r--spec/ruby/library/date/ordinal_spec.rb7
-rw-r--r--spec/ruby/library/date/ordinal_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/parse_spec.rb142
-rw-r--r--spec/ruby/library/date/plus_spec.rb20
-rw-r--r--spec/ruby/library/date/prev_day_spec.rb14
-rw-r--r--spec/ruby/library/date/prev_month_spec.rb29
-rw-r--r--spec/ruby/library/date/prev_year_spec.rb12
-rw-r--r--spec/ruby/library/date/relationship_spec.rb20
-rw-r--r--spec/ruby/library/date/rfc3339_spec.rb13
-rw-r--r--spec/ruby/library/date/right_shift_spec.rb6
-rw-r--r--spec/ruby/library/date/saturday_spec.rb8
-rw-r--r--spec/ruby/library/date/shared/civil.rb57
-rw-r--r--spec/ruby/library/date/shared/commercial.rb39
-rw-r--r--spec/ruby/library/date/shared/jd.rb14
-rw-r--r--spec/ruby/library/date/shared/new_bang.rb14
-rw-r--r--spec/ruby/library/date/shared/ordinal.rb22
-rw-r--r--spec/ruby/library/date/shared/parse.rb54
-rw-r--r--spec/ruby/library/date/shared/parse_eu.rb37
-rw-r--r--spec/ruby/library/date/shared/parse_us.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_civil.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_commercial.rb34
-rw-r--r--spec/ruby/library/date/shared/valid_jd.rb32
-rw-r--r--spec/ruby/library/date/shared/valid_ordinal.rb26
-rw-r--r--spec/ruby/library/date/start_spec.rb6
-rw-r--r--spec/ruby/library/date/step_spec.rb56
-rw-r--r--spec/ruby/library/date/strftime_spec.rb40
-rw-r--r--spec/ruby/library/date/strptime_spec.rb149
-rw-r--r--spec/ruby/library/date/succ_spec.rb6
-rw-r--r--spec/ruby/library/date/sunday_spec.rb8
-rw-r--r--spec/ruby/library/date/thursday_spec.rb8
-rw-r--r--spec/ruby/library/date/time_to_day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/to_s_spec.rb6
-rw-r--r--spec/ruby/library/date/today_spec.rb14
-rw-r--r--spec/ruby/library/date/tuesday_spec.rb8
-rw-r--r--spec/ruby/library/date/upto_spec.rb16
-rw-r--r--spec/ruby/library/date/valid_civil_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_commercial_spec.rb8
-rw-r--r--spec/ruby/library/date/valid_date_spec.rb7
-rw-r--r--spec/ruby/library/date/valid_jd_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_ordinal_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_time_spec.rb6
-rw-r--r--spec/ruby/library/date/wday_spec.rb9
-rw-r--r--spec/ruby/library/date/wednesday_spec.rb8
-rw-r--r--spec/ruby/library/date/yday_spec.rb6
-rw-r--r--spec/ruby/library/date/year_spec.rb9
-rw-r--r--spec/ruby/library/date/zone_to_diff_spec.rb6
-rw-r--r--spec/ruby/library/datetime/_strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/add_spec.rb9
-rw-r--r--spec/ruby/library/datetime/civil_spec.rb6
-rw-r--r--spec/ruby/library/datetime/commercial_spec.rb6
-rw-r--r--spec/ruby/library/datetime/hour_spec.rb47
-rw-r--r--spec/ruby/library/datetime/httpdate_spec.rb6
-rw-r--r--spec/ruby/library/datetime/iso8601_spec.rb10
-rw-r--r--spec/ruby/library/datetime/jd_spec.rb6
-rw-r--r--spec/ruby/library/datetime/jisx0301_spec.rb10
-rw-r--r--spec/ruby/library/datetime/min_spec.rb6
-rw-r--r--spec/ruby/library/datetime/minute_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_spec.rb52
-rw-r--r--spec/ruby/library/datetime/now_spec.rb25
-rw-r--r--spec/ruby/library/datetime/offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/ordinal_spec.rb6
-rw-r--r--spec/ruby/library/datetime/parse_spec.rb127
-rw-r--r--spec/ruby/library/datetime/rfc2822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/rfc3339_spec.rb10
-rw-r--r--spec/ruby/library/datetime/rfc822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_spec.rb6
-rw-r--r--spec/ruby/library/datetime/shared/min.rb40
-rw-r--r--spec/ruby/library/datetime/shared/sec.rb45
-rw-r--r--spec/ruby/library/datetime/strftime_spec.rb51
-rw-r--r--spec/ruby/library/datetime/strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/subtract_spec.rb19
-rw-r--r--spec/ruby/library/datetime/to_date_spec.rb37
-rw-r--r--spec/ruby/library/datetime/to_datetime_spec.rb9
-rw-r--r--spec/ruby/library/datetime/to_s_spec.rb17
-rw-r--r--spec/ruby/library/datetime/to_time_spec.rb36
-rw-r--r--spec/ruby/library/datetime/xmlschema_spec.rb10
-rw-r--r--spec/ruby/library/datetime/zone_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_method_spec.rb52
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_methods_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegate_class/private_instance_methods_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegate_class/protected_instance_methods_spec.rb29
-rw-r--r--spec/ruby/library/delegate/delegate_class/public_instance_methods_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegate_class/respond_to_missing_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegator/case_compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/complement_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/eql_spec.rb46
-rw-r--r--spec/ruby/library/delegate/delegator/equal_spec.rb13
-rw-r--r--spec/ruby/library/delegate/delegator/equal_value_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/frozen_spec.rb39
-rw-r--r--spec/ruby/library/delegate/delegator/hash_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/marshal_spec.rb21
-rw-r--r--spec/ruby/library/delegate/delegator/method_spec.rb69
-rw-r--r--spec/ruby/library/delegate/delegator/methods_spec.rb37
-rw-r--r--spec/ruby/library/delegate/delegator/not_equal_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/not_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/private_methods_spec.rb20
-rw-r--r--spec/ruby/library/delegate/delegator/protected_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/public_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/send_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/taint_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegator/tap_spec.rb16
-rw-r--r--spec/ruby/library/delegate/delegator/trust_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/untaint_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/untrust_spec.rb25
-rw-r--r--spec/ruby/library/delegate/fixtures/classes.rb60
-rw-r--r--spec/ruby/library/digest/bubblebabble_spec.rb29
-rw-r--r--spec/ruby/library/digest/hexencode_spec.rb31
-rw-r--r--spec/ruby/library/digest/md5/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/md5/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/equal_spec.rb37
-rw-r--r--spec/ruby/library/digest/md5/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/shared/constants.rb16
-rw-r--r--spec/ruby/library/digest/md5/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/md5/shared/sample.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/md5/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/to_s_spec.rb24
-rw-r--r--spec/ruby/library/digest/md5/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha1/digest_spec.rb20
-rw-r--r--spec/ruby/library/digest/sha1/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha1/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/sha256/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha256/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha256/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/sha256/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha256/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha256/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha256/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha384/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha384/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha384/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha384/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha384/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha384/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha512/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha512/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/sha512/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha512/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha512/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha512/update_spec.rb7
-rw-r--r--spec/ruby/library/drb/fixtures/test_server.rb8
-rw-r--r--spec/ruby/library/drb/start_service_spec.rb28
-rw-r--r--spec/ruby/library/erb/def_class_spec.rb29
-rw-r--r--spec/ruby/library/erb/def_method_spec.rb26
-rw-r--r--spec/ruby/library/erb/def_module_spec.rb27
-rw-r--r--spec/ruby/library/erb/defmethod/def_erb_method_spec.rb64
-rw-r--r--spec/ruby/library/erb/filename_spec.rb40
-rw-r--r--spec/ruby/library/erb/fixtures/classes.rb9
-rw-r--r--spec/ruby/library/erb/new_spec.rb148
-rw-r--r--spec/ruby/library/erb/result_spec.rb86
-rw-r--r--spec/ruby/library/erb/run_spec.rb96
-rw-r--r--spec/ruby/library/erb/src_spec.rb33
-rw-r--r--spec/ruby/library/erb/util/h_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/html_escape_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/shared/html_escape.rb42
-rw-r--r--spec/ruby/library/erb/util/shared/url_encode.rb50
-rw-r--r--spec/ruby/library/erb/util/u_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/url_encode_spec.rb7
-rw-r--r--spec/ruby/library/etc/confstr_spec.rb14
-rw-r--r--spec/ruby/library/etc/endgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/endpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrgid_spec.rb76
-rw-r--r--spec/ruby/library/etc/getgrnam_spec.rb30
-rw-r--r--spec/ruby/library/etc/getlogin_spec.rb43
-rw-r--r--spec/ruby/library/etc/getpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getpwnam_spec.rb28
-rw-r--r--spec/ruby/library/etc/getpwuid_spec.rb36
-rw-r--r--spec/ruby/library/etc/group_spec.rb27
-rw-r--r--spec/ruby/library/etc/nprocessors_spec.rb9
-rw-r--r--spec/ruby/library/etc/passwd_spec.rb15
-rw-r--r--spec/ruby/library/etc/shared/windows.rb7
-rw-r--r--spec/ruby/library/etc/struct_group_spec.rb35
-rw-r--r--spec/ruby/library/etc/struct_passwd_spec.rb43
-rw-r--r--spec/ruby/library/etc/sysconf_spec.rb22
-rw-r--r--spec/ruby/library/etc/sysconfdir_spec.rb8
-rw-r--r--spec/ruby/library/etc/systmpdir_spec.rb8
-rw-r--r--spec/ruby/library/expect/expect_spec.rb62
-rw-r--r--spec/ruby/library/fiber/alive_spec.rb46
-rw-r--r--spec/ruby/library/fiber/current_spec.rb51
-rw-r--r--spec/ruby/library/fiber/resume_spec.rb12
-rw-r--r--spec/ruby/library/fiber/transfer_spec.rb86
-rw-r--r--spec/ruby/library/find/find_spec.rb30
-rw-r--r--spec/ruby/library/find/fixtures/common.rb174
-rw-r--r--spec/ruby/library/find/prune_spec.rb12
-rw-r--r--spec/ruby/library/getoptlong/each_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/each_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/error_message_spec.rb23
-rw-r--r--spec/ruby/library/getoptlong/get_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/get_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/initialize_spec.rb28
-rw-r--r--spec/ruby/library/getoptlong/ordering_spec.rb38
-rw-r--r--spec/ruby/library/getoptlong/set_options_spec.rb98
-rw-r--r--spec/ruby/library/getoptlong/shared/each.rb18
-rw-r--r--spec/ruby/library/getoptlong/shared/get.rb64
-rw-r--r--spec/ruby/library/getoptlong/terminate_spec.rb30
-rw-r--r--spec/ruby/library/getoptlong/terminated_spec.rb17
-rw-r--r--spec/ruby/library/ipaddr/hton_spec.rb30
-rw-r--r--spec/ruby/library/ipaddr/ipv4_conversion_spec.rb44
-rw-r--r--spec/ruby/library/ipaddr/new_spec.rb93
-rw-r--r--spec/ruby/library/ipaddr/operator_spec.rb82
-rw-r--r--spec/ruby/library/ipaddr/reverse_spec.rb27
-rw-r--r--spec/ruby/library/ipaddr/to_s_spec.rb20
-rw-r--r--spec/ruby/library/logger/device/close_spec.rb31
-rw-r--r--spec/ruby/library/logger/device/new_spec.rb47
-rw-r--r--spec/ruby/library/logger/device/write_spec.rb51
-rw-r--r--spec/ruby/library/logger/fixtures/common.rb9
-rw-r--r--spec/ruby/library/logger/logger/add_spec.rb81
-rw-r--r--spec/ruby/library/logger/logger/close_spec.rb20
-rw-r--r--spec/ruby/library/logger/logger/datetime_format_spec.rb60
-rw-r--r--spec/ruby/library/logger/logger/debug_spec.rb52
-rw-r--r--spec/ruby/library/logger/logger/error_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/fatal_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/info_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/new_spec.rb118
-rw-r--r--spec/ruby/library/logger/logger/unknown_spec.rb36
-rw-r--r--spec/ruby/library/logger/logger/warn_spec.rb53
-rw-r--r--spec/ruby/library/logger/severity_spec.rb13
-rw-r--r--spec/ruby/library/mathn/bignum/exponent_spec.rb21
-rw-r--r--spec/ruby/library/mathn/complex/Complex_spec.rb14
-rw-r--r--spec/ruby/library/mathn/fixnum/exponent_spec.rb17
-rw-r--r--spec/ruby/library/mathn/float/exponent_spec.rb17
-rw-r--r--spec/ruby/library/mathn/integer/from_prime_division_spec.rb11
-rw-r--r--spec/ruby/library/mathn/integer/prime_division_spec.rb21
-rw-r--r--spec/ruby/library/mathn/math/fixtures/classes.rb3
-rw-r--r--spec/ruby/library/mathn/math/rsqrt_spec.rb17
-rw-r--r--spec/ruby/library/mathn/math/shared/rsqrt.rb21
-rw-r--r--spec/ruby/library/mathn/math/shared/sqrt.rb25
-rw-r--r--spec/ruby/library/mathn/math/sqrt_spec.rb17
-rw-r--r--spec/ruby/library/mathn/mathn_spec.rb13
-rw-r--r--spec/ruby/library/mathn/rational/Rational_spec.rb14
-rw-r--r--spec/ruby/library/mathn/rational/inspect_spec.rb15
-rw-r--r--spec/ruby/library/matrix/I_spec.rb6
-rw-r--r--spec/ruby/library/matrix/antisymmetric_spec.rb37
-rw-r--r--spec/ruby/library/matrix/build_spec.rb73
-rw-r--r--spec/ruby/library/matrix/clone_spec.rb25
-rw-r--r--spec/ruby/library/matrix/coerce_spec.rb8
-rw-r--r--spec/ruby/library/matrix/collect_spec.rb6
-rw-r--r--spec/ruby/library/matrix/column_size_spec.rb13
-rw-r--r--spec/ruby/library/matrix/column_spec.rb35
-rw-r--r--spec/ruby/library/matrix/column_vector_spec.rb25
-rw-r--r--spec/ruby/library/matrix/column_vectors_spec.rb26
-rw-r--r--spec/ruby/library/matrix/columns_spec.rb42
-rw-r--r--spec/ruby/library/matrix/conj_spec.rb6
-rw-r--r--spec/ruby/library/matrix/conjugate_spec.rb6
-rw-r--r--spec/ruby/library/matrix/constructor_spec.rb65
-rw-r--r--spec/ruby/library/matrix/det_spec.rb7
-rw-r--r--spec/ruby/library/matrix/determinant_spec.rb7
-rw-r--r--spec/ruby/library/matrix/diagonal_spec.rb72
-rw-r--r--spec/ruby/library/matrix/divide_spec.rb54
-rw-r--r--spec/ruby/library/matrix/each_spec.rb74
-rw-r--r--spec/ruby/library/matrix/each_with_index_spec.rb81
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalue_matrix_spec.rb9
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalues_spec.rb22
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvector_matrix_spec.rb20
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvectors_spec.rb22
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/initialize_spec.rb24
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/to_a_spec.rb18
-rw-r--r--spec/ruby/library/matrix/element_reference_spec.rb23
-rw-r--r--spec/ruby/library/matrix/empty_spec.rb68
-rw-r--r--spec/ruby/library/matrix/eql_spec.rb11
-rw-r--r--spec/ruby/library/matrix/equal_value_spec.rb11
-rw-r--r--spec/ruby/library/matrix/exponent_spec.rb51
-rw-r--r--spec/ruby/library/matrix/find_index_spec.rb146
-rw-r--r--spec/ruby/library/matrix/fixtures/classes.rb7
-rw-r--r--spec/ruby/library/matrix/hash_spec.rb15
-rw-r--r--spec/ruby/library/matrix/hermitian_spec.rb34
-rw-r--r--spec/ruby/library/matrix/identity_spec.rb6
-rw-r--r--spec/ruby/library/matrix/imag_spec.rb6
-rw-r--r--spec/ruby/library/matrix/imaginary_spec.rb6
-rw-r--r--spec/ruby/library/matrix/inspect_spec.rb27
-rw-r--r--spec/ruby/library/matrix/inv_spec.rb7
-rw-r--r--spec/ruby/library/matrix/inverse_from_spec.rb6
-rw-r--r--spec/ruby/library/matrix/inverse_spec.rb7
-rw-r--r--spec/ruby/library/matrix/lower_triangular_spec.rb24
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/determinant_spec.rb21
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/initialize_spec.rb13
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/l_spec.rb18
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/p_spec.rb18
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/solve_spec.rb53
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/to_a_spec.rb33
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/u_spec.rb18
-rw-r--r--spec/ruby/library/matrix/map_spec.rb6
-rw-r--r--spec/ruby/library/matrix/minor_spec.rb85
-rw-r--r--spec/ruby/library/matrix/minus_spec.rb42
-rw-r--r--spec/ruby/library/matrix/multiply_spec.rb68
-rw-r--r--spec/ruby/library/matrix/new_spec.rb8
-rw-r--r--spec/ruby/library/matrix/normal_spec.rb26
-rw-r--r--spec/ruby/library/matrix/orthogonal_spec.rb26
-rw-r--r--spec/ruby/library/matrix/permutation_spec.rb32
-rw-r--r--spec/ruby/library/matrix/plus_spec.rb42
-rw-r--r--spec/ruby/library/matrix/rank_spec.rb19
-rw-r--r--spec/ruby/library/matrix/real_spec.rb43
-rw-r--r--spec/ruby/library/matrix/rect_spec.rb6
-rw-r--r--spec/ruby/library/matrix/rectangular_spec.rb6
-rw-r--r--spec/ruby/library/matrix/regular_spec.rb31
-rw-r--r--spec/ruby/library/matrix/round_spec.rb21
-rw-r--r--spec/ruby/library/matrix/row_size_spec.rb13
-rw-r--r--spec/ruby/library/matrix/row_spec.rb36
-rw-r--r--spec/ruby/library/matrix/row_vector_spec.rb24
-rw-r--r--spec/ruby/library/matrix/row_vectors_spec.rb26
-rw-r--r--spec/ruby/library/matrix/rows_spec.rb41
-rw-r--r--spec/ruby/library/matrix/scalar/Fail_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/Raise_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/divide_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/exponent_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/included_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/initialize_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/minus_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/multiply_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/plus_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar_spec.rb67
-rw-r--r--spec/ruby/library/matrix/shared/collect.rb26
-rw-r--r--spec/ruby/library/matrix/shared/conjugate.rb20
-rw-r--r--spec/ruby/library/matrix/shared/determinant.rb38
-rw-r--r--spec/ruby/library/matrix/shared/equal_value.rb33
-rw-r--r--spec/ruby/library/matrix/shared/identity.rb19
-rw-r--r--spec/ruby/library/matrix/shared/imaginary.rb20
-rw-r--r--spec/ruby/library/matrix/shared/inverse.rb38
-rw-r--r--spec/ruby/library/matrix/shared/rectangular.rb18
-rw-r--r--spec/ruby/library/matrix/shared/trace.rb12
-rw-r--r--spec/ruby/library/matrix/shared/transpose.rb19
-rw-r--r--spec/ruby/library/matrix/singular_spec.rb31
-rw-r--r--spec/ruby/library/matrix/spec_helper.rb35
-rw-r--r--spec/ruby/library/matrix/square_spec.rb28
-rw-r--r--spec/ruby/library/matrix/symmetric_spec.rb29
-rw-r--r--spec/ruby/library/matrix/t_spec.rb6
-rw-r--r--spec/ruby/library/matrix/to_a_spec.rb11
-rw-r--r--spec/ruby/library/matrix/to_s_spec.rb6
-rw-r--r--spec/ruby/library/matrix/tr_spec.rb7
-rw-r--r--spec/ruby/library/matrix/trace_spec.rb7
-rw-r--r--spec/ruby/library/matrix/transpose_spec.rb6
-rw-r--r--spec/ruby/library/matrix/unit_spec.rb6
-rw-r--r--spec/ruby/library/matrix/unitary_spec.rb28
-rw-r--r--spec/ruby/library/matrix/upper_triangular_spec.rb24
-rw-r--r--spec/ruby/library/matrix/vector/cross_product_spec.rb14
-rw-r--r--spec/ruby/library/matrix/vector/each2_spec.rb49
-rw-r--r--spec/ruby/library/matrix/vector/eql_spec.rb16
-rw-r--r--spec/ruby/library/matrix/vector/inner_product_spec.rb22
-rw-r--r--spec/ruby/library/matrix/vector/normalize_spec.rb18
-rw-r--r--spec/ruby/library/matrix/zero_spec.rb52
-rw-r--r--spec/ruby/library/mkmf/mkmf_spec.rb7
-rw-r--r--spec/ruby/library/monitor/mon_initialize_spec.rb31
-rw-r--r--spec/ruby/library/net/FTPError_spec.rb8
-rw-r--r--spec/ruby/library/net/FTPPermError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPProtoError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPReplyError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPTempError_spec.rb12
-rw-r--r--spec/ruby/library/net/ftp/abort_spec.rb62
-rw-r--r--spec/ruby/library/net/ftp/acct_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/binary_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/chdir_spec.rb99
-rw-r--r--spec/ruby/library/net/ftp/close_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/closed_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/connect_spec.rb49
-rw-r--r--spec/ruby/library/net/ftp/debug_mode_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/default_passive_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/delete_spec.rb59
-rw-r--r--spec/ruby/library/net/ftp/dir_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/fixtures/default_passive.rb3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/passive.rb2
-rw-r--r--spec/ruby/library/net/ftp/fixtures/putbinaryfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/puttextfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/server.rb277
-rw-r--r--spec/ruby/library/net/ftp/get_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/getbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/getdir_spec.rb7
-rw-r--r--spec/ruby/library/net/ftp/gettextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/help_spec.rb66
-rw-r--r--spec/ruby/library/net/ftp/initialize_spec.rb407
-rw-r--r--spec/ruby/library/net/ftp/last_response_code_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/last_response_spec.rb25
-rw-r--r--spec/ruby/library/net/ftp/lastresp_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/list_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/login_spec.rb195
-rw-r--r--spec/ruby/library/net/ftp/ls_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/mdtm_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/mkdir_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/mtime_spec.rb50
-rw-r--r--spec/ruby/library/net/ftp/nlst_spec.rb92
-rw-r--r--spec/ruby/library/net/ftp/noop_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/open_spec.rb55
-rw-r--r--spec/ruby/library/net/ftp/passive_spec.rb28
-rw-r--r--spec/ruby/library/net/ftp/put_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/putbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/puttextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/pwd_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/quit_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/rename_spec.rb94
-rw-r--r--spec/ruby/library/net/ftp/resume_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/retrbinary_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/retrlines_spec.rb34
-rw-r--r--spec/ruby/library/net/ftp/return_code_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/rmdir_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/sendcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/set_socket_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/shared/getbinaryfile.rb150
-rw-r--r--spec/ruby/library/net/ftp/shared/gettextfile.rb100
-rw-r--r--spec/ruby/library/net/ftp/shared/last_response_code.rb25
-rw-r--r--spec/ruby/library/net/ftp/shared/list.rb104
-rw-r--r--spec/ruby/library/net/ftp/shared/putbinaryfile.rb167
-rw-r--r--spec/ruby/library/net/ftp/shared/puttextfile.rb120
-rw-r--r--spec/ruby/library/net/ftp/shared/pwd.rb3
-rw-r--r--spec/ruby/library/net/ftp/site_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/size_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/spec_helper.rb5
-rw-r--r--spec/ruby/library/net/ftp/status_spec.rb67
-rw-r--r--spec/ruby/library/net/ftp/storbinary_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/storlines_spec.rb43
-rw-r--r--spec/ruby/library/net/ftp/system_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/voidcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/welcome_spec.rb25
-rw-r--r--spec/ruby/library/net/http/HTTPBadResponse_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPClientExcepton_spec.rb14
-rw-r--r--spec/ruby/library/net/http/HTTPError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPFatalError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPHeaderSyntaxError_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPRetriableError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPServerException_spec.rb26
-rw-r--r--spec/ruby/library/net/http/http/Proxy_spec.rb35
-rw-r--r--spec/ruby/library/net/http/http/active_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/address_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/close_on_empty_response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/http/copy_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/delete_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/finish_spec.rb29
-rw-r--r--spec/ruby/library/net/http/http/fixtures/http_server.rb105
-rw-r--r--spec/ruby/library/net/http/http/get2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/get_print_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_response_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_spec.rb26
-rw-r--r--spec/ruby/library/net/http/http/head2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/head_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/http_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/https_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/initialize_spec.rb46
-rw-r--r--spec/ruby/library/net/http/http/inspect_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_2_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/lock_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/mkcol_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/move_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/new_spec.rb86
-rw-r--r--spec/ruby/library/net/http/http/newobj_spec.rb48
-rw-r--r--spec/ruby/library/net/http/http/open_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/options_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/port_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/post2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/post_form_spec.rb22
-rw-r--r--spec/ruby/library/net/http/http/post_spec.rb74
-rw-r--r--spec/ruby/library/net/http/http/propfind_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proppatch_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proxy_address_spec.rb31
-rw-r--r--spec/ruby/library/net/http/http/proxy_class_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/proxy_pass_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_port_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_user_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/put2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/put_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/read_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/request_get_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_head_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_post_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_put_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_spec.rb109
-rw-r--r--spec/ruby/library/net/http/http/request_types_spec.rb254
-rw-r--r--spec/ruby/library/net/http/http/send_request_spec.rb61
-rw-r--r--spec/ruby/library/net/http/http/set_debug_output_spec.rb33
-rw-r--r--spec/ruby/library/net/http/http/shared/request_get.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_head.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_post.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_put.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/started.rb26
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_1.rb6
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_2.rb6
-rw-r--r--spec/ruby/library/net/http/http/socket_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/start_spec.rb111
-rw-r--r--spec/ruby/library/net/http/http/started_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/trace_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/unlock_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/use_ssl_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/version_1_2_spec.rb20
-rw-r--r--spec/ruby/library/net/http/httpexceptions/fixtures/classes.rb5
-rw-r--r--spec/ruby/library/net/http/httpexceptions/initialize_spec.rb17
-rw-r--r--spec/ruby/library/net/http/httpexceptions/response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_exist_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_stream_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/exec_spec.rb131
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/inspect_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/method_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/path_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/request_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/response_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/set_body_internal_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/add_field_spec.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/canonical_each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/chunked_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpheader/content_length_spec.rb54
-rw-r--r--spec/ruby/library/net/http/httpheader/content_range_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/content_type_spec.rb26
-rw-r--r--spec/ruby/library/net/http/httpheader/delete_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_name_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_header_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_key_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_name_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_value_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/element_reference_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/element_set_spec.rb41
-rw-r--r--spec/ruby/library/net/http/httpheader/fetch_spec.rb68
-rw-r--r--spec/ruby/library/net/http/httpheader/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/net/http/httpheader/form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/get_fields_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/initialize_http_header_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/key_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/length_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/main_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpheader/proxy_basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/range_length_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/range_spec.rb48
-rw-r--r--spec/ruby/library/net/http/httpheader/set_content_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_range_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_capitalized.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_header.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_name.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_content_type.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_form_data.rb27
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_range.rb89
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/size.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/size_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/sub_type_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/to_hash_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpheader/type_params_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httprequest/initialize_spec.rb45
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_permitted_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/entity_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_type_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/exception_type_spec.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/http_version_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpresponse/initialize_spec.rb11
-rw-r--r--spec/ruby/library/net/http/httpresponse/inspect_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpresponse/message_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/msg_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_body_spec.rb85
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_new_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpresponse/reading_body_spec.rb58
-rw-r--r--spec/ruby/library/net/http/httpresponse/response_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/shared/body.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/value_spec.rb29
-rw-r--r--spec/ruby/library/objectspace/memsize_of_spec.rb30
-rw-r--r--spec/ruby/library/objectspace/reachable_objects_from_spec.rb61
-rw-r--r--spec/ruby/library/observer/add_observer_spec.rb23
-rw-r--r--spec/ruby/library/observer/count_observers_spec.rb23
-rw-r--r--spec/ruby/library/observer/delete_observer_spec.rb19
-rw-r--r--spec/ruby/library/observer/delete_observers_spec.rb19
-rw-r--r--spec/ruby/library/observer/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/observer/notify_observers_spec.rb31
-rw-r--r--spec/ruby/library/open3/capture2_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture3_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_r_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_rw_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_start_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_w_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen3_spec.rb41
-rw-r--r--spec/ruby/library/openssl/cipher_spec.rb9
-rw-r--r--spec/ruby/library/openssl/config/freeze_spec.rb20
-rw-r--r--spec/ruby/library/openssl/hmac/digest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/hmac/hexdigest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/random/pseudo_bytes_spec.rb8
-rw-r--r--spec/ruby/library/openssl/random/random_bytes_spec.rb6
-rw-r--r--spec/ruby/library/openssl/random/shared/random_bytes.rb29
-rw-r--r--spec/ruby/library/openssl/shared/constants.rb11
-rw-r--r--spec/ruby/library/openssl/x509/name/parse_spec.rb48
-rw-r--r--spec/ruby/library/openstruct/delete_field_spec.rb19
-rw-r--r--spec/ruby/library/openstruct/element_reference_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/element_set_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/equal_value_spec.rb28
-rw-r--r--spec/ruby/library/openstruct/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/openstruct/frozen_spec.rb38
-rw-r--r--spec/ruby/library/openstruct/initialize_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/inspect_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/openstruct/marshal_load_spec.rb12
-rw-r--r--spec/ruby/library/openstruct/method_missing_spec.rb49
-rw-r--r--spec/ruby/library/openstruct/new_spec.rb20
-rw-r--r--spec/ruby/library/openstruct/shared/inspect.rb20
-rw-r--r--spec/ruby/library/openstruct/to_h_spec.rb70
-rw-r--r--spec/ruby/library/openstruct/to_s_spec.rb8
-rw-r--r--spec/ruby/library/optionparser/order_spec.rb28
-rw-r--r--spec/ruby/library/optionparser/parse_spec.rb28
-rw-r--r--spec/ruby/library/pathname/absolute_spec.rb22
-rw-r--r--spec/ruby/library/pathname/empty_spec.rb32
-rw-r--r--spec/ruby/library/pathname/equal_value_spec.rb14
-rw-r--r--spec/ruby/library/pathname/hash_spec.rb14
-rw-r--r--spec/ruby/library/pathname/join_spec.rb40
-rw-r--r--spec/ruby/library/pathname/new_spec.rb30
-rw-r--r--spec/ruby/library/pathname/parent_spec.rb18
-rw-r--r--spec/ruby/library/pathname/realdirpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/realpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/relative_path_from_spec.rb51
-rw-r--r--spec/ruby/library/pathname/relative_spec.rb22
-rw-r--r--spec/ruby/library/pathname/root_spec.rb26
-rw-r--r--spec/ruby/library/pathname/sub_spec.rb15
-rw-r--r--spec/ruby/library/pp/pp_spec.rb23
-rw-r--r--spec/ruby/library/prime/each_spec.rb167
-rw-r--r--spec/ruby/library/prime/instance_spec.rb21
-rw-r--r--spec/ruby/library/prime/int_from_prime_division_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/each_prime_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/from_prime_division_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/prime_division_spec.rb19
-rw-r--r--spec/ruby/library/prime/integer/prime_spec.rb17
-rw-r--r--spec/ruby/library/prime/next_spec.rb7
-rw-r--r--spec/ruby/library/prime/prime_division_spec.rb25
-rw-r--r--spec/ruby/library/prime/prime_spec.rb17
-rw-r--r--spec/ruby/library/prime/shared/next.rb8
-rw-r--r--spec/ruby/library/prime/succ_spec.rb7
-rw-r--r--spec/ruby/library/rbconfig/rbconfig_spec.rb48
-rw-r--r--spec/ruby/library/rbconfig/sizeof/limits_spec.rb42
-rw-r--r--spec/ruby/library/rbconfig/sizeof/sizeof_spec.rb30
-rw-r--r--spec/ruby/library/rbconfig/unicode_emoji_version_spec.rb22
-rw-r--r--spec/ruby/library/rbconfig/unicode_version_spec.rb34
-rw-r--r--spec/ruby/library/readline/basic_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/basic_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_quote_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_append_character_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_case_fold_spec.rb18
-rw-r--r--spec/ruby/library/readline/completion_proc_spec.rb22
-rw-r--r--spec/ruby/library/readline/constants_spec.rb18
-rw-r--r--spec/ruby/library/readline/emacs_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/readline/filename_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/history/append_spec.rb28
-rw-r--r--spec/ruby/library/readline/history/delete_at_spec.rb47
-rw-r--r--spec/ruby/library/readline/history/each_spec.rb31
-rw-r--r--spec/ruby/library/readline/history/element_reference_spec.rb42
-rw-r--r--spec/ruby/library/readline/history/element_set_spec.rb35
-rw-r--r--spec/ruby/library/readline/history/empty_spec.rb13
-rw-r--r--spec/ruby/library/readline/history/history_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/length_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/pop_spec.rb32
-rw-r--r--spec/ruby/library/readline/history/push_spec.rb26
-rw-r--r--spec/ruby/library/readline/history/shared/size.rb14
-rw-r--r--spec/ruby/library/readline/history/shift_spec.rb32
-rw-r--r--spec/ruby/library/readline/history/size_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/to_s_spec.rb9
-rw-r--r--spec/ruby/library/readline/readline_spec.rb33
-rw-r--r--spec/ruby/library/readline/spec_helper.rb11
-rw-r--r--spec/ruby/library/readline/vi_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/resolv/fixtures/hosts1
-rw-r--r--spec/ruby/library/resolv/get_address_spec.rb19
-rw-r--r--spec/ruby/library/resolv/get_addresses_spec.rb12
-rw-r--r--spec/ruby/library/resolv/get_name_spec.rb18
-rw-r--r--spec/ruby/library/resolv/get_names_spec.rb11
-rw-r--r--spec/ruby/library/rexml/attribute/clone_spec.rb11
-rw-r--r--spec/ruby/library/rexml/attribute/element_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/equal_value_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attribute/hash_spec.rb13
-rw-r--r--spec/ruby/library/rexml/attribute/initialize_spec.rb29
-rw-r--r--spec/ruby/library/rexml/attribute/inspect_spec.rb19
-rw-r--r--spec/ruby/library/rexml/attribute/namespace_spec.rb24
-rw-r--r--spec/ruby/library/rexml/attribute/node_type_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attribute/prefix_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attribute/remove_spec.rb20
-rw-r--r--spec/ruby/library/rexml/attribute/to_s_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/to_string_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/value_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/write_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/xpath_spec.rb19
-rw-r--r--spec/ruby/library/rexml/attributes/add_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/append_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/delete_all_spec.rb31
-rw-r--r--spec/ruby/library/rexml/attributes/delete_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attributes/each_attribute_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attributes/each_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attributes/element_reference_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attributes/element_set_spec.rb25
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_ns_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_spec.rb29
-rw-r--r--spec/ruby/library/rexml/attributes/initialize_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attributes/length_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/namespaces_spec.rb6
-rw-r--r--spec/ruby/library/rexml/attributes/prefixes_spec.rb24
-rw-r--r--spec/ruby/library/rexml/attributes/shared/add.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/shared/length.rb13
-rw-r--r--spec/ruby/library/rexml/attributes/size_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/to_a_spec.rb19
-rw-r--r--spec/ruby/library/rexml/cdata/clone_spec.rb10
-rw-r--r--spec/ruby/library/rexml/cdata/initialize_spec.rb24
-rw-r--r--spec/ruby/library/rexml/cdata/shared/to_s.rb11
-rw-r--r--spec/ruby/library/rexml/cdata/to_s_spec.rb7
-rw-r--r--spec/ruby/library/rexml/cdata/value_spec.rb7
-rw-r--r--spec/ruby/library/rexml/document/add_element_spec.rb31
-rw-r--r--spec/ruby/library/rexml/document/add_spec.rb57
-rw-r--r--spec/ruby/library/rexml/document/clone_spec.rb20
-rw-r--r--spec/ruby/library/rexml/document/doctype_spec.rb15
-rw-r--r--spec/ruby/library/rexml/document/encoding_spec.rb22
-rw-r--r--spec/ruby/library/rexml/document/expanded_name_spec.rb16
-rw-r--r--spec/ruby/library/rexml/document/new_spec.rb36
-rw-r--r--spec/ruby/library/rexml/document/node_type_spec.rb8
-rw-r--r--spec/ruby/library/rexml/document/root_spec.rb12
-rw-r--r--spec/ruby/library/rexml/document/stand_alone_spec.rb19
-rw-r--r--spec/ruby/library/rexml/document/version_spec.rb14
-rw-r--r--spec/ruby/library/rexml/document/write_spec.rb35
-rw-r--r--spec/ruby/library/rexml/document/xml_decl_spec.rb15
-rw-r--r--spec/ruby/library/rexml/element/add_attribute_spec.rb41
-rw-r--r--spec/ruby/library/rexml/element/add_attributes_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/add_element_spec.rb39
-rw-r--r--spec/ruby/library/rexml/element/add_namespace_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/add_text_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/attribute_spec.rb17
-rw-r--r--spec/ruby/library/rexml/element/attributes_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/cdatas_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/clone_spec.rb29
-rw-r--r--spec/ruby/library/rexml/element/comments_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/delete_attribute_spec.rb39
-rw-r--r--spec/ruby/library/rexml/element/delete_element_spec.rb49
-rw-r--r--spec/ruby/library/rexml/element/delete_namespace_spec.rb25
-rw-r--r--spec/ruby/library/rexml/element/document_spec.rb16
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_attribute_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_text_spec.rb31
-rw-r--r--spec/ruby/library/rexml/element/element_reference_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/get_text_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/has_attributes_spec.rb17
-rw-r--r--spec/ruby/library/rexml/element/has_elements_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/has_text_spec.rb16
-rw-r--r--spec/ruby/library/rexml/element/inspect_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/instructions_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/namespace_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/namespaces_spec.rb32
-rw-r--r--spec/ruby/library/rexml/element/new_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/next_element_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/node_type_spec.rb8
-rw-r--r--spec/ruby/library/rexml/element/prefixes_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/previous_element_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/raw_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/root_spec.rb28
-rw-r--r--spec/ruby/library/rexml/element/text_spec.rb46
-rw-r--r--spec/ruby/library/rexml/element/texts_spec.rb16
-rw-r--r--spec/ruby/library/rexml/element/whitespace_spec.rb23
-rw-r--r--spec/ruby/library/rexml/node/each_recursive_spec.rb21
-rw-r--r--spec/ruby/library/rexml/node/find_first_recursive_spec.rb25
-rw-r--r--spec/ruby/library/rexml/node/index_in_parent_spec.rb15
-rw-r--r--spec/ruby/library/rexml/node/next_sibling_node_spec.rb21
-rw-r--r--spec/ruby/library/rexml/node/parent_spec.rb20
-rw-r--r--spec/ruby/library/rexml/node/previous_sibling_node_spec.rb21
-rw-r--r--spec/ruby/library/rexml/shared/each_element.rb36
-rw-r--r--spec/ruby/library/rexml/shared/elements_to_a.rb34
-rw-r--r--spec/ruby/library/rexml/text/append_spec.rb10
-rw-r--r--spec/ruby/library/rexml/text/clone_spec.rb10
-rw-r--r--spec/ruby/library/rexml/text/comparison_spec.rb25
-rw-r--r--spec/ruby/library/rexml/text/empty_spec.rb12
-rw-r--r--spec/ruby/library/rexml/text/indent_text_spec.rb23
-rw-r--r--spec/ruby/library/rexml/text/inspect_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/new_spec.rb48
-rw-r--r--spec/ruby/library/rexml/text/node_type_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/normalize_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/read_with_substitution_spec.rb12
-rw-r--r--spec/ruby/library/rexml/text/to_s_spec.rb17
-rw-r--r--spec/ruby/library/rexml/text/unnormalize_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/value_spec.rb37
-rw-r--r--spec/ruby/library/rexml/text/wrap_spec.rb20
-rw-r--r--spec/ruby/library/rexml/text/write_with_substitution_spec.rb33
-rw-r--r--spec/ruby/library/rubygems/gem/bin_path_spec.rb34
-rw-r--r--spec/ruby/library/scanf/io/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/io/fixtures/date.txt4
-rw-r--r--spec/ruby/library/scanf/io/fixtures/helloworld.txt1
-rw-r--r--spec/ruby/library/scanf/io/scanf_spec.rb38
-rw-r--r--spec/ruby/library/scanf/io/shared/block_scanf.rb28
-rw-r--r--spec/ruby/library/scanf/string/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/string/scanf_spec.rb56
-rw-r--r--spec/ruby/library/scanf/string/shared/block_scanf.rb25
-rw-r--r--spec/ruby/library/securerandom/base64_spec.rb55
-rw-r--r--spec/ruby/library/securerandom/bytes_spec.rb8
-rw-r--r--spec/ruby/library/securerandom/hex_spec.rb54
-rw-r--r--spec/ruby/library/securerandom/random_bytes_spec.rb53
-rw-r--r--spec/ruby/library/securerandom/random_number_spec.rb97
-rw-r--r--spec/ruby/library/set/add_spec.rb27
-rw-r--r--spec/ruby/library/set/append_spec.rb7
-rw-r--r--spec/ruby/library/set/case_compare_spec.rb14
-rw-r--r--spec/ruby/library/set/case_equality_spec.rb9
-rw-r--r--spec/ruby/library/set/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/compare_by_identity_spec.rb143
-rw-r--r--spec/ruby/library/set/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/disjoint_spec.rb23
-rw-r--r--spec/ruby/library/set/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/each_spec.rb26
-rw-r--r--spec/ruby/library/set/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/enumerable/to_set_spec.rb19
-rw-r--r--spec/ruby/library/set/eql_spec.rb15
-rw-r--r--spec/ruby/library/set/equal_value_spec.rb33
-rw-r--r--spec/ruby/library/set/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/filter_spec.rb8
-rw-r--r--spec/ruby/library/set/fixtures/set_like.rb31
-rw-r--r--spec/ruby/library/set/flatten_merge_spec.rb23
-rw-r--r--spec/ruby/library/set/flatten_spec.rb53
-rw-r--r--spec/ruby/library/set/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/include_spec.rb7
-rw-r--r--spec/ruby/library/set/initialize_spec.rb48
-rw-r--r--spec/ruby/library/set/inspect_spec.rb7
-rw-r--r--spec/ruby/library/set/intersect_spec.rb23
-rw-r--r--spec/ruby/library/set/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/keep_if_spec.rb38
-rw-r--r--spec/ruby/library/set/length_spec.rb7
-rw-r--r--spec/ruby/library/set/map_spec.rb7
-rw-r--r--spec/ruby/library/set/member_spec.rb7
-rw-r--r--spec/ruby/library/set/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/pretty_print_spec.rb17
-rw-r--r--spec/ruby/library/set/proper_subset_spec.rb41
-rw-r--r--spec/ruby/library/set/proper_superset_spec.rb41
-rw-r--r--spec/ruby/library/set/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/select_spec.rb6
-rw-r--r--spec/ruby/library/set/shared/add.rb14
-rw-r--r--spec/ruby/library/set/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/shared/include.rb29
-rw-r--r--spec/ruby/library/set/shared/inspect.rb15
-rw-r--r--spec/ruby/library/set/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/shared/length.rb6
-rw-r--r--spec/ruby/library/set/shared/select.rb42
-rw-r--r--spec/ruby/library/set/shared/union.rb15
-rw-r--r--spec/ruby/library/set/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/add_spec.rb39
-rw-r--r--spec/ruby/library/set/sortedset/append_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/case_equality_spec.rb9
-rw-r--r--spec/ruby/library/set/sortedset/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/sortedset/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/sortedset/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/sortedset/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/sortedset/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/sortedset/each_spec.rb26
-rw-r--r--spec/ruby/library/set/sortedset/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/eql_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/equal_value_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/sortedset/filter_spec.rb9
-rw-r--r--spec/ruby/library/set/sortedset/flatten_merge_spec.rb8
-rw-r--r--spec/ruby/library/set/sortedset/flatten_spec.rb44
-rw-r--r--spec/ruby/library/set/sortedset/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/include_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/initialize_spec.rb30
-rw-r--r--spec/ruby/library/set/sortedset/inspect_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/sortedset/keep_if_spec.rb31
-rw-r--r--spec/ruby/library/set/sortedset/length_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/map_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/member_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/sortedset/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/proper_subset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/proper_superset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/sortedset/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/select_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/add.rb14
-rw-r--r--spec/ruby/library/set/sortedset/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/sortedset/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/include.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/length.rb6
-rw-r--r--spec/ruby/library/set/sortedset/shared/select.rb35
-rw-r--r--spec/ruby/library/set/sortedset/shared/union.rb15
-rw-r--r--spec/ruby/library/set/sortedset/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/subset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/superset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/to_a_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/union_spec.rb11
-rw-r--r--spec/ruby/library/set/subset_spec.rb41
-rw-r--r--spec/ruby/library/set/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/superset_spec.rb41
-rw-r--r--spec/ruby/library/set/to_a_spec.rb8
-rw-r--r--spec/ruby/library/set/to_s_spec.rb13
-rw-r--r--spec/ruby/library/set/union_spec.rb11
-rw-r--r--spec/ruby/library/shellwords/shellwords_spec.rb34
-rw-r--r--spec/ruby/library/singleton/allocate_spec.rb8
-rw-r--r--spec/ruby/library/singleton/clone_spec.rb8
-rw-r--r--spec/ruby/library/singleton/dump_spec.rb14
-rw-r--r--spec/ruby/library/singleton/dup_spec.rb8
-rw-r--r--spec/ruby/library/singleton/fixtures/classes.rb18
-rw-r--r--spec/ruby/library/singleton/instance_spec.rb30
-rw-r--r--spec/ruby/library/singleton/load_spec.rb21
-rw-r--r--spec/ruby/library/singleton/new_spec.rb8
-rw-r--r--spec/ruby/library/socket/addrinfo/afamily_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/bind_spec.rb28
-rw-r--r--spec/ruby/library/socket/addrinfo/canonname_spec.rb27
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_from_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_to_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/family_addrinfo_spec.rb115
-rw-r--r--spec/ruby/library/socket/addrinfo/foreach_spec.rb9
-rw-r--r--spec/ruby/library/socket/addrinfo/getaddrinfo_spec.rb91
-rw-r--r--spec/ruby/library/socket/addrinfo/getnameinfo_spec.rb40
-rw-r--r--spec/ruby/library/socket/addrinfo/initialize_spec.rb587
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_sockaddr_spec.rb50
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_spec.rb65
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_address_spec.rb66
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_port_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_spec.rb64
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_unpack_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_loopback_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_multicast_spec.rb29
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_private_spec.rb47
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_linklocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_loopback_spec.rb45
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_global_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_linklocal_spec.rb19
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_nodelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_orglocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_sitelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_multicast_spec.rb48
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_sitelocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_to_ipv4_spec.rb71
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unique_local_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unspecified_spec.rb15
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4compat_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4mapped_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/listen_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_dump_spec.rb84
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_load_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/pfamily_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/protocol_spec.rb24
-rw-r--r--spec/ruby/library/socket/addrinfo/shared/to_sockaddr.rb51
-rw-r--r--spec/ruby/library/socket/addrinfo/socktype_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/tcp_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/to_s_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/to_sockaddr_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/udp_spec.rb36
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_path_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_spec.rb71
-rw-r--r--spec/ruby/library/socket/ancillarydata/cmsg_is_spec.rb33
-rw-r--r--spec/ruby/library/socket/ancillarydata/data_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/family_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/initialize_spec.rb284
-rw-r--r--spec/ruby/library/socket/ancillarydata/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/ancillarydata/ip_pktinfo_spec.rb145
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_addr_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_ifindex_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_spec.rb89
-rw-r--r--spec/ruby/library/socket/ancillarydata/level_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/type_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/unix_rights_spec.rb61
-rw-r--r--spec/ruby/library/socket/basicsocket/close_read_spec.rb43
-rw-r--r--spec/ruby/library/socket/basicsocket/close_write_spec.rb48
-rw-r--r--spec/ruby/library/socket/basicsocket/connect_address_spec.rb154
-rw-r--r--spec/ruby/library/socket/basicsocket/do_not_reverse_lookup_spec.rb103
-rw-r--r--spec/ruby/library/socket/basicsocket/for_fd_spec.rb38
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeereid_spec.rb36
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeername_spec.rb25
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockname_spec.rb28
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockopt_spec.rb188
-rw-r--r--spec/ruby/library/socket/basicsocket/ioctl_spec.rb42
-rw-r--r--spec/ruby/library/socket/basicsocket/read_nonblock_spec.rb46
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_nonblock_spec.rb70
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_spec.rb159
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_nonblock_spec.rb209
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_spec.rb197
-rw-r--r--spec/ruby/library/socket/basicsocket/send_spec.rb212
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_nonblock_spec.rb113
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_spec.rb111
-rw-r--r--spec/ruby/library/socket/basicsocket/setsockopt_spec.rb336
-rw-r--r--spec/ruby/library/socket/basicsocket/shutdown_spec.rb155
-rw-r--r--spec/ruby/library/socket/basicsocket/write_nonblock_spec.rb45
-rw-r--r--spec/ruby/library/socket/constants/constants_spec.rb108
-rw-r--r--spec/ruby/library/socket/fixtures/classes.rb164
-rw-r--r--spec/ruby/library/socket/fixtures/send_io.txt1
-rw-r--r--spec/ruby/library/socket/ipsocket/addr_spec.rb105
-rw-r--r--spec/ruby/library/socket/ipsocket/getaddress_spec.rb25
-rw-r--r--spec/ruby/library/socket/ipsocket/peeraddr_spec.rb117
-rw-r--r--spec/ruby/library/socket/ipsocket/recvfrom_spec.rb123
-rw-r--r--spec/ruby/library/socket/option/bool_spec.rb27
-rw-r--r--spec/ruby/library/socket/option/initialize_spec.rb83
-rw-r--r--spec/ruby/library/socket/option/inspect_spec.rb19
-rw-r--r--spec/ruby/library/socket/option/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/option/linger_spec.rb76
-rw-r--r--spec/ruby/library/socket/option/new_spec.rb35
-rw-r--r--spec/ruby/library/socket/shared/pack_sockaddr.rb99
-rw-r--r--spec/ruby/library/socket/shared/partially_closable_sockets.rb13
-rw-r--r--spec/ruby/library/socket/shared/socketpair.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_loop_spec.rb84
-rw-r--r--spec/ruby/library/socket/socket/accept_nonblock_spec.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_spec.rb121
-rw-r--r--spec/ruby/library/socket/socket/bind_spec.rb146
-rw-r--r--spec/ruby/library/socket/socket/connect_nonblock_spec.rb149
-rw-r--r--spec/ruby/library/socket/socket/connect_spec.rb56
-rw-r--r--spec/ruby/library/socket/socket/for_fd_spec.rb30
-rw-r--r--spec/ruby/library/socket/socket/getaddrinfo_spec.rb373
-rw-r--r--spec/ruby/library/socket/socket/gethostbyaddr_spec.rb124
-rw-r--r--spec/ruby/library/socket/socket/gethostbyname_spec.rb135
-rw-r--r--spec/ruby/library/socket/socket/gethostname_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/getifaddrs_spec.rb117
-rw-r--r--spec/ruby/library/socket/socket/getnameinfo_spec.rb147
-rw-r--r--spec/ruby/library/socket/socket/getservbyname_spec.rb32
-rw-r--r--spec/ruby/library/socket/socket/getservbyport_spec.rb23
-rw-r--r--spec/ruby/library/socket/socket/initialize_spec.rb87
-rw-r--r--spec/ruby/library/socket/socket/ip_address_list_spec.rb50
-rw-r--r--spec/ruby/library/socket/socket/ipv6only_bang_spec.rb20
-rw-r--r--spec/ruby/library/socket/socket/listen_spec.rb64
-rw-r--r--spec/ruby/library/socket/socket/local_address_spec.rb43
-rw-r--r--spec/ruby/library/socket/socket/new_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_nonblock_spec.rb118
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_spec.rb92
-rw-r--r--spec/ruby/library/socket/socket/remote_address_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/socket_spec.rb38
-rw-r--r--spec/ruby/library/socket/socket/socketpair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sysaccept_spec.rb91
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_loop_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/tcp_spec.rb70
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_on_spec.rb47
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_spec.rb57
-rw-r--r--spec/ruby/library/socket/socket/udp_server_recv_spec.rb35
-rw-r--r--spec/ruby/library/socket/socket/udp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/unix_server_loop_spec.rb58
-rw-r--r--spec/ruby/library/socket/socket/unix_server_socket_spec.rb48
-rw-r--r--spec/ruby/library/socket/socket/unix_spec.rb45
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_in_spec.rb46
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_un_spec.rb26
-rw-r--r--spec/ruby/library/socket/spec_helper.rb13
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_nonblock_spec.rb85
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_spec.rb99
-rw-r--r--spec/ruby/library/socket/tcpserver/gets_spec.rb16
-rw-r--r--spec/ruby/library/socket/tcpserver/initialize_spec.rb101
-rw-r--r--spec/ruby/library/socket/tcpserver/listen_spec.rb22
-rw-r--r--spec/ruby/library/socket/tcpserver/new_spec.rb131
-rw-r--r--spec/ruby/library/socket/tcpserver/sysaccept_spec.rb66
-rw-r--r--spec/ruby/library/socket/tcpsocket/gethostbyname_spec.rb111
-rw-r--r--spec/ruby/library/socket/tcpsocket/initialize_spec.rb61
-rw-r--r--spec/ruby/library/socket/tcpsocket/local_address_spec.rb73
-rw-r--r--spec/ruby/library/socket/tcpsocket/new_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/open_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/partially_closable_spec.rb21
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_nonblock_spec.rb34
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_spec.rb28
-rw-r--r--spec/ruby/library/socket/tcpsocket/remote_address_spec.rb72
-rw-r--r--spec/ruby/library/socket/tcpsocket/setsockopt_spec.rb45
-rw-r--r--spec/ruby/library/socket/tcpsocket/shared/new.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/bind_spec.rb83
-rw-r--r--spec/ruby/library/socket/udpsocket/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/udpsocket/initialize_spec.rb40
-rw-r--r--spec/ruby/library/socket/udpsocket/inspect_spec.rb25
-rw-r--r--spec/ruby/library/socket/udpsocket/local_address_spec.rb80
-rw-r--r--spec/ruby/library/socket/udpsocket/new_spec.rb34
-rw-r--r--spec/ruby/library/socket/udpsocket/open_spec.rb13
-rw-r--r--spec/ruby/library/socket/udpsocket/recvfrom_nonblock_spec.rb95
-rw-r--r--spec/ruby/library/socket/udpsocket/remote_address_spec.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/send_spec.rb154
-rw-r--r--spec/ruby/library/socket/udpsocket/write_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/accept_nonblock_spec.rb92
-rw-r--r--spec/ruby/library/socket/unixserver/accept_spec.rb117
-rw-r--r--spec/ruby/library/socket/unixserver/for_fd_spec.rb23
-rw-r--r--spec/ruby/library/socket/unixserver/initialize_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixserver/listen_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixserver/open_spec.rb26
-rw-r--r--spec/ruby/library/socket/unixserver/shared/new.rb22
-rw-r--r--spec/ruby/library/socket/unixserver/sysaccept_spec.rb52
-rw-r--r--spec/ruby/library/socket/unixsocket/addr_spec.rb36
-rw-r--r--spec/ruby/library/socket/unixsocket/initialize_spec.rb38
-rw-r--r--spec/ruby/library/socket/unixsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/unixsocket/local_address_spec.rb96
-rw-r--r--spec/ruby/library/socket/unixsocket/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixsocket/open_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/pair_spec.rb39
-rw-r--r--spec/ruby/library/socket/unixsocket/partially_closable_spec.rb25
-rw-r--r--spec/ruby/library/socket/unixsocket/path_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/peeraddr_spec.rb30
-rw-r--r--spec/ruby/library/socket/unixsocket/recv_io_spec.rb87
-rw-r--r--spec/ruby/library/socket/unixsocket/recvfrom_spec.rb98
-rw-r--r--spec/ruby/library/socket/unixsocket/remote_address_spec.rb45
-rw-r--r--spec/ruby/library/socket/unixsocket/send_io_spec.rb58
-rw-r--r--spec/ruby/library/socket/unixsocket/shared/new.rb24
-rw-r--r--spec/ruby/library/socket/unixsocket/socketpair_spec.rb40
-rw-r--r--spec/ruby/library/stringio/append_spec.rb86
-rw-r--r--spec/ruby/library/stringio/binmode_spec.rb9
-rw-r--r--spec/ruby/library/stringio/bytes_spec.rb11
-rw-r--r--spec/ruby/library/stringio/chars_spec.rb11
-rw-r--r--spec/ruby/library/stringio/close_read_spec.rb31
-rw-r--r--spec/ruby/library/stringio/close_spec.rb23
-rw-r--r--spec/ruby/library/stringio/close_write_spec.rb31
-rw-r--r--spec/ruby/library/stringio/closed_read_spec.rb12
-rw-r--r--spec/ruby/library/stringio/closed_spec.rb16
-rw-r--r--spec/ruby/library/stringio/closed_write_spec.rb12
-rw-r--r--spec/ruby/library/stringio/codepoints_spec.rb9
-rw-r--r--spec/ruby/library/stringio/each_byte_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_char_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_codepoint_spec.rb9
-rw-r--r--spec/ruby/library/stringio/each_line_spec.rb19
-rw-r--r--spec/ruby/library/stringio/each_spec.rb19
-rw-r--r--spec/ruby/library/stringio/eof_spec.rb11
-rw-r--r--spec/ruby/library/stringio/external_encoding_spec.rb25
-rw-r--r--spec/ruby/library/stringio/fcntl_spec.rb8
-rw-r--r--spec/ruby/library/stringio/fileno_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fixtures/classes.rb15
-rw-r--r--spec/ruby/library/stringio/flush_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fsync_spec.rb9
-rw-r--r--spec/ruby/library/stringio/getbyte_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getc_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getch_spec.rb44
-rw-r--r--spec/ruby/library/stringio/gets_spec.rb245
-rw-r--r--spec/ruby/library/stringio/initialize_spec.rb209
-rw-r--r--spec/ruby/library/stringio/internal_encoding_spec.rb10
-rw-r--r--spec/ruby/library/stringio/isatty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/length_spec.rb7
-rw-r--r--spec/ruby/library/stringio/lineno_spec.rb30
-rw-r--r--spec/ruby/library/stringio/lines_spec.rb19
-rw-r--r--spec/ruby/library/stringio/open_spec.rb207
-rw-r--r--spec/ruby/library/stringio/path_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pid_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pos_spec.rb28
-rw-r--r--spec/ruby/library/stringio/print_spec.rb100
-rw-r--r--spec/ruby/library/stringio/printf_spec.rb70
-rw-r--r--spec/ruby/library/stringio/putc_spec.rb88
-rw-r--r--spec/ruby/library/stringio/puts_spec.rb167
-rw-r--r--spec/ruby/library/stringio/read_nonblock_spec.rb42
-rw-r--r--spec/ruby/library/stringio/read_spec.rb62
-rw-r--r--spec/ruby/library/stringio/readbyte_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readchar_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readline_spec.rb129
-rw-r--r--spec/ruby/library/stringio/readlines_spec.rb99
-rw-r--r--spec/ruby/library/stringio/readpartial_spec.rb80
-rw-r--r--spec/ruby/library/stringio/reopen_spec.rb292
-rw-r--r--spec/ruby/library/stringio/rewind_spec.rb24
-rw-r--r--spec/ruby/library/stringio/seek_spec.rb67
-rw-r--r--spec/ruby/library/stringio/set_encoding_spec.rb20
-rw-r--r--spec/ruby/library/stringio/shared/codepoints.rb45
-rw-r--r--spec/ruby/library/stringio/shared/each.rb114
-rw-r--r--spec/ruby/library/stringio/shared/each_byte.rb48
-rw-r--r--spec/ruby/library/stringio/shared/each_char.rb36
-rw-r--r--spec/ruby/library/stringio/shared/eof.rb24
-rw-r--r--spec/ruby/library/stringio/shared/getc.rb43
-rw-r--r--spec/ruby/library/stringio/shared/isatty.rb5
-rw-r--r--spec/ruby/library/stringio/shared/length.rb5
-rw-r--r--spec/ruby/library/stringio/shared/read.rb121
-rw-r--r--spec/ruby/library/stringio/shared/readchar.rb29
-rw-r--r--spec/ruby/library/stringio/shared/sysread.rb15
-rw-r--r--spec/ruby/library/stringio/shared/tell.rb12
-rw-r--r--spec/ruby/library/stringio/shared/write.rb89
-rw-r--r--spec/ruby/library/stringio/size_spec.rb7
-rw-r--r--spec/ruby/library/stringio/string_spec.rb50
-rw-r--r--spec/ruby/library/stringio/stringio_spec.rb8
-rw-r--r--spec/ruby/library/stringio/sync_spec.rb19
-rw-r--r--spec/ruby/library/stringio/sysread_spec.rb48
-rw-r--r--spec/ruby/library/stringio/syswrite_spec.rb19
-rw-r--r--spec/ruby/library/stringio/tell_spec.rb7
-rw-r--r--spec/ruby/library/stringio/truncate_spec.rb70
-rw-r--r--spec/ruby/library/stringio/tty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/ungetbyte_spec.rb6
-rw-r--r--spec/ruby/library/stringio/ungetc_spec.rb72
-rw-r--r--spec/ruby/library/stringio/write_nonblock_spec.rb19
-rw-r--r--spec/ruby/library/stringio/write_spec.rb19
-rw-r--r--spec/ruby/library/stringscanner/append_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/beginning_of_line_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/bol_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/check_spec.rb16
-rw-r--r--spec/ruby/library/stringscanner/check_until_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/clear_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/concat_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/dup_spec.rb39
-rw-r--r--spec/ruby/library/stringscanner/element_reference_spec.rb60
-rw-r--r--spec/ruby/library/stringscanner/empty_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/eos_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/exist_spec.rb24
-rw-r--r--spec/ruby/library/stringscanner/get_byte_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/getbyte_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/getch_spec.rb35
-rw-r--r--spec/ruby/library/stringscanner/initialize_spec.rb27
-rw-r--r--spec/ruby/library/stringscanner/inspect_spec.rb20
-rw-r--r--spec/ruby/library/stringscanner/match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/matched_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/matched_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/must_C_version_spec.rb8
-rw-r--r--spec/ruby/library/stringscanner/peek_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/peep_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/pointer_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/pos_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/post_match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/pre_match_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/reset_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/rest_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/rest_spec.rb48
-rw-r--r--spec/ruby/library/stringscanner/restsize_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/scan_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/scan_spec.rb97
-rw-r--r--spec/ruby/library/stringscanner/scan_until_spec.rb23
-rw-r--r--spec/ruby/library/stringscanner/search_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/bol.rb25
-rw-r--r--spec/ruby/library/stringscanner/shared/concat.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/eos.rb17
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range.rb24
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range_matched.rb24
-rw-r--r--spec/ruby/library/stringscanner/shared/get_byte.rb29
-rw-r--r--spec/ruby/library/stringscanner/shared/matched_size.rb21
-rw-r--r--spec/ruby/library/stringscanner/shared/peek.rb49
-rw-r--r--spec/ruby/library/stringscanner/shared/pos.rb52
-rw-r--r--spec/ruby/library/stringscanner/shared/rest_size.rb18
-rw-r--r--spec/ruby/library/stringscanner/shared/terminate.rb8
-rw-r--r--spec/ruby/library/stringscanner/skip_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/skip_until_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/string_spec.rb40
-rw-r--r--spec/ruby/library/stringscanner/terminate_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/unscan_spec.rb28
-rw-r--r--spec/ruby/library/syslog/alert_spec.rb10
-rw-r--r--spec/ruby/library/syslog/close_spec.rb58
-rw-r--r--spec/ruby/library/syslog/constants_spec.rb41
-rw-r--r--spec/ruby/library/syslog/crit_spec.rb10
-rw-r--r--spec/ruby/library/syslog/debug_spec.rb10
-rw-r--r--spec/ruby/library/syslog/emerg_spec.rb16
-rw-r--r--spec/ruby/library/syslog/err_spec.rb10
-rw-r--r--spec/ruby/library/syslog/facility_spec.rb48
-rw-r--r--spec/ruby/library/syslog/ident_spec.rb35
-rw-r--r--spec/ruby/library/syslog/info_spec.rb10
-rw-r--r--spec/ruby/library/syslog/inspect_spec.rb39
-rw-r--r--spec/ruby/library/syslog/instance_spec.rb13
-rw-r--r--spec/ruby/library/syslog/log_spec.rb56
-rw-r--r--spec/ruby/library/syslog/mask_spec.rb113
-rw-r--r--spec/ruby/library/syslog/notice_spec.rb10
-rw-r--r--spec/ruby/library/syslog/open_spec.rb92
-rw-r--r--spec/ruby/library/syslog/opened_spec.rb39
-rw-r--r--spec/ruby/library/syslog/options_spec.rb48
-rw-r--r--spec/ruby/library/syslog/reopen_spec.rb10
-rw-r--r--spec/ruby/library/syslog/shared/log.rb40
-rw-r--r--spec/ruby/library/syslog/shared/reopen.rb40
-rw-r--r--spec/ruby/library/syslog/warning_spec.rb10
-rw-r--r--spec/ruby/library/tempfile/_close_spec.rb21
-rw-r--r--spec/ruby/library/tempfile/callback_spec.rb6
-rw-r--r--spec/ruby/library/tempfile/close_spec.rb57
-rw-r--r--spec/ruby/library/tempfile/delete_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/initialize_spec.rb46
-rw-r--r--spec/ruby/library/tempfile/length_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/open_spec.rb97
-rw-r--r--spec/ruby/library/tempfile/path_spec.rb26
-rw-r--r--spec/ruby/library/tempfile/shared/length.rb21
-rw-r--r--spec/ruby/library/tempfile/shared/unlink.rb12
-rw-r--r--spec/ruby/library/tempfile/size_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/unlink_spec.rb7
-rw-r--r--spec/ruby/library/thread/queue_spec.rb8
-rw-r--r--spec/ruby/library/thread/sizedqueue_spec.rb8
-rw-r--r--spec/ruby/library/time/httpdate_spec.rb21
-rw-r--r--spec/ruby/library/time/iso8601_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc2822_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc822_spec.rb7
-rw-r--r--spec/ruby/library/time/shared/rfc2822.rb65
-rw-r--r--spec/ruby/library/time/shared/xmlschema.rb53
-rw-r--r--spec/ruby/library/time/to_date_spec.rb42
-rw-r--r--spec/ruby/library/time/to_datetime_spec.rb27
-rw-r--r--spec/ruby/library/time/to_time_spec.rb15
-rw-r--r--spec/ruby/library/time/xmlschema_spec.rb7
-rw-r--r--spec/ruby/library/timeout/error_spec.rb8
-rw-r--r--spec/ruby/library/timeout/timeout_spec.rb26
-rw-r--r--spec/ruby/library/tmpdir/dir/mktmpdir_spec.rb117
-rw-r--r--spec/ruby/library/tmpdir/dir/tmpdir_spec.rb10
-rw-r--r--spec/ruby/library/uri/decode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/decode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/eql_spec.rb10
-rw-r--r--spec/ruby/library/uri/equality_spec.rb46
-rw-r--r--spec/ruby/library/uri/escape/decode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/encode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/extract_spec.rb86
-rw-r--r--spec/ruby/library/uri/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/uri/fixtures/normalization.rb54
-rw-r--r--spec/ruby/library/uri/ftp/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/merge_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/new2_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/path_spec.rb26
-rw-r--r--spec/ruby/library/uri/ftp/set_typecode_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/to_s_spec.rb15
-rw-r--r--spec/ruby/library/uri/ftp/typecode_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/absolute_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/build2_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/coerce_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_ary_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/default_port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/eql_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/equal_value_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/fragment_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/hash_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/host_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/merge_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/minus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/normalize_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/opaque_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/password_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/path_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/plus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/query_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/registry_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/relative_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_from_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/scheme_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/select_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_fragment_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_host_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_opaque_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_password_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_path_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_port_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_query_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_scheme_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_user_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_userinfo_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/use_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/user_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/userinfo_spec.rb10
-rw-r--r--spec/ruby/library/uri/http/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/http/request_uri_spec.rb16
-rw-r--r--spec/ruby/library/uri/join_spec.rb59
-rw-r--r--spec/ruby/library/uri/ldap/attributes_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/dn_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/extensions_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/filter_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/scope_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/set_attributes_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_dn_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_extensions_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_filter_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_scope_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/build_spec.rb92
-rw-r--r--spec/ruby/library/uri/mailto/headers_spec.rb10
-rw-r--r--spec/ruby/library/uri/mailto/set_headers_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/set_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_mailtext_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_rfc822text_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_spec.rb10
-rw-r--r--spec/ruby/library/uri/merge_spec.rb20
-rw-r--r--spec/ruby/library/uri/normalize_spec.rb35
-rw-r--r--spec/ruby/library/uri/parse_spec.rb203
-rw-r--r--spec/ruby/library/uri/parser/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/extract_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/join_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/make_regexp_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/parse_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/plus_spec.rb459
-rw-r--r--spec/ruby/library/uri/regexp_spec.rb18
-rw-r--r--spec/ruby/library/uri/route_from_spec.rb23
-rw-r--r--spec/ruby/library/uri/route_to_spec.rb26
-rw-r--r--spec/ruby/library/uri/select_spec.rb27
-rw-r--r--spec/ruby/library/uri/set_component_spec.rb45
-rw-r--r--spec/ruby/library/uri/shared/eql.rb17
-rw-r--r--spec/ruby/library/uri/shared/extract.rb83
-rw-r--r--spec/ruby/library/uri/shared/join.rb56
-rw-r--r--spec/ruby/library/uri/shared/parse.rb199
-rw-r--r--spec/ruby/library/uri/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/uri_spec.rb29
-rw-r--r--spec/ruby/library/uri/util/make_components_hash_spec.rb6
-rw-r--r--spec/ruby/library/weakref/__getobj___spec.rb17
-rw-r--r--spec/ruby/library/weakref/allocate_spec.rb8
-rw-r--r--spec/ruby/library/weakref/fixtures/classes.rb24
-rw-r--r--spec/ruby/library/weakref/new_spec.rb13
-rw-r--r--spec/ruby/library/weakref/send_spec.rb37
-rw-r--r--spec/ruby/library/weakref/weakref_alive_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/fixtures/classes.rb22
-rw-r--r--spec/ruby/library/win32ole/fixtures/event.xml4
-rw-r--r--spec/ruby/library/win32ole/win32ole/_getproperty_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/_invoke_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/codepage_spec.rb13
-rw-r--r--spec/ruby/library/win32ole/win32ole/connect_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/win32ole/const_load_spec.rb32
-rw-r--r--spec/ruby/library/win32ole/win32ole/constants_spec.rb42
-rw-r--r--spec/ruby/library/win32ole/win32ole/create_guid_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/invoke_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/locale_spec.rb29
-rw-r--r--spec/ruby/library/win32ole/win32ole/new_spec.rb25
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_func_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_get_methods_spec.rb16
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_help_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_obj_help_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_put_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/setproperty_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/ole_method.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/setproperty.rb23
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/on_event_spec.rb70
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/dispid_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_interface_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpcontext_spec.rb26
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpfile_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpstring_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invkind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invoke_kind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/offset_vtbl_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/params_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_vtype_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/shared/name.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_opt_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/visible_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/default_spec.rb31
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/input_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/optional_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/retval_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/shared/name.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/guid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpcontext_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpfile_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpstring_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/major_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/minor_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/new_spec.rb40
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_classes_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_methods_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progids_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/shared/name.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/src_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typekind_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typelibs_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/variables_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/visible_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_detail_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/shared/name.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/value_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/variable_kind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/varkind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/visible_spec.rb18
-rw-r--r--spec/ruby/library/yaml/add_builtin_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/add_domain_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/add_private_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/add_ruby_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/detect_implicit_spec.rb2
-rw-r--r--spec/ruby/library/yaml/dump_spec.rb51
-rw-r--r--spec/ruby/library/yaml/dump_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/each_node_spec.rb2
-rw-r--r--spec/ruby/library/yaml/emitter_spec.rb2
-rw-r--r--spec/ruby/library/yaml/fixtures/common.rb10
-rw-r--r--spec/ruby/library/yaml/fixtures/example_class.rb7
-rw-r--r--spec/ruby/library/yaml/fixtures/strings.rb36
-rw-r--r--spec/ruby/library/yaml/fixtures/test_yaml.yml2
-rw-r--r--spec/ruby/library/yaml/generic_parser_spec.rb2
-rw-r--r--spec/ruby/library/yaml/load_documents_spec.rb10
-rw-r--r--spec/ruby/library/yaml/load_file_spec.rb13
-rw-r--r--spec/ruby/library/yaml/load_spec.rb137
-rw-r--r--spec/ruby/library/yaml/load_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/object_maker_spec.rb2
-rw-r--r--spec/ruby/library/yaml/parse_documents_spec.rb2
-rw-r--r--spec/ruby/library/yaml/parse_file_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_spec.rb22
-rw-r--r--spec/ruby/library/yaml/parser_spec.rb2
-rw-r--r--spec/ruby/library/yaml/quick_emit_spec.rb2
-rw-r--r--spec/ruby/library/yaml/read_type_class_spec.rb2
-rw-r--r--spec/ruby/library/yaml/shared/each_document.rb18
-rw-r--r--spec/ruby/library/yaml/tagurize_spec.rb11
-rw-r--r--spec/ruby/library/yaml/to_yaml_spec.rb106
-rw-r--r--spec/ruby/library/yaml/transfer_spec.rb2
-rw-r--r--spec/ruby/library/yaml/try_implicit_spec.rb2
-rw-r--r--spec/ruby/library/zlib/adler32_spec.rb46
-rw-r--r--spec/ruby/library/zlib/crc32_spec.rb54
-rw-r--r--spec/ruby/library/zlib/crc_table_spec.rb75
-rw-r--r--spec/ruby/library/zlib/deflate/deflate_spec.rb128
-rw-r--r--spec/ruby/library/zlib/deflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/deflate/params_spec.rb17
-rw-r--r--spec/ruby/library/zlib/deflate/set_dictionary_spec.rb14
-rw-r--r--spec/ruby/library/zlib/deflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/gunzip_spec.rb14
-rw-r--r--spec/ruby/library/zlib/gzip_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipfile/close_spec.rb21
-rw-r--r--spec/ruby/library/zlib/gzipfile/closed_spec.rb16
-rw-r--r--spec/ruby/library/zlib/gzipfile/comment_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipfile/orig_name_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_byte_spec.rb51
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_line_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/eof_spec.rb54
-rw-r--r--spec/ruby/library/zlib/gzipreader/getc_spec.rb39
-rw-r--r--spec/ruby/library/zlib/gzipreader/gets_spec.rb22
-rw-r--r--spec/ruby/library/zlib/gzipreader/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/pos_spec.rb24
-rw-r--r--spec/ruby/library/zlib/gzipreader/read_spec.rb66
-rw-r--r--spec/ruby/library/zlib/gzipreader/readpartial_spec.rb17
-rw-r--r--spec/ruby/library/zlib/gzipreader/rewind_spec.rb47
-rw-r--r--spec/ruby/library/zlib/gzipreader/shared/each.rb49
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetbyte_spec.rb120
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetc_spec.rb284
-rw-r--r--spec/ruby/library/zlib/gzipwriter/append_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipwriter/mtime_spec.rb38
-rw-r--r--spec/ruby/library/zlib/gzipwriter/write_spec.rb36
-rw-r--r--spec/ruby/library/zlib/inflate/append_spec.rb60
-rw-r--r--spec/ruby/library/zlib/inflate/finish_spec.rb28
-rw-r--r--spec/ruby/library/zlib/inflate/inflate_spec.rb152
-rw-r--r--spec/ruby/library/zlib/inflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/inflate/set_dictionary_spec.rb20
-rw-r--r--spec/ruby/library/zlib/inflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zlib_version_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zstream/adler_spec.rb11
-rw-r--r--spec/ruby/library/zlib/zstream/avail_in_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/avail_out_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/data_type_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/flush_next_out_spec.rb14
-rw-r--r--spec/ruby/optional/capi/README16
-rw-r--r--spec/ruby/optional/capi/array_spec.rb471
-rw-r--r--spec/ruby/optional/capi/bignum_spec.rb224
-rw-r--r--spec/ruby/optional/capi/boolean_spec.rb33
-rw-r--r--spec/ruby/optional/capi/class_spec.rb384
-rw-r--r--spec/ruby/optional/capi/complex_spec.rb45
-rw-r--r--spec/ruby/optional/capi/constants_spec.rb258
-rw-r--r--spec/ruby/optional/capi/data_spec.rb45
-rw-r--r--spec/ruby/optional/capi/encoding_spec.rb482
-rw-r--r--spec/ruby/optional/capi/enumerator_spec.rb66
-rw-r--r--spec/ruby/optional/capi/exception_spec.rb58
-rw-r--r--spec/ruby/optional/capi/ext/.gitignore9
-rw-r--r--spec/ruby/optional/capi/ext/array_spec.c285
-rw-r--r--spec/ruby/optional/capi/ext/bignum_spec.c106
-rw-r--r--spec/ruby/optional/capi/ext/boolean_spec.c33
-rw-r--r--spec/ruby/optional/capi/ext/class_id_under_autoload_spec.c5
-rw-r--r--spec/ruby/optional/capi/ext/class_spec.c170
-rw-r--r--spec/ruby/optional/capi/ext/class_under_autoload_spec.c5
-rw-r--r--spec/ruby/optional/capi/ext/complex_spec.c45
-rw-r--r--spec/ruby/optional/capi/ext/constants_spec.c339
-rw-r--r--spec/ruby/optional/capi/ext/data_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/encoding_spec.c249
-rw-r--r--spec/ruby/optional/capi/ext/enumerator_spec.c32
-rw-r--r--spec/ruby/optional/capi/ext/exception_spec.c46
-rw-r--r--spec/ruby/optional/capi/ext/file_spec.c29
-rw-r--r--spec/ruby/optional/capi/ext/fixnum_spec.c26
-rw-r--r--spec/ruby/optional/capi/ext/float_spec.c38
-rw-r--r--spec/ruby/optional/capi/ext/gc_spec.c55
-rw-r--r--spec/ruby/optional/capi/ext/globals_spec.c118
-rw-r--r--spec/ruby/optional/capi/ext/hash_spec.c143
-rw-r--r--spec/ruby/optional/capi/ext/integer_spec.c34
-rw-r--r--spec/ruby/optional/capi/ext/io_spec.c242
-rw-r--r--spec/ruby/optional/capi/ext/kernel_spec.c350
-rw-r--r--spec/ruby/optional/capi/ext/marshal_spec.c24
-rw-r--r--spec/ruby/optional/capi/ext/module_spec.c155
-rw-r--r--spec/ruby/optional/capi/ext/module_under_autoload_spec.c7
-rw-r--r--spec/ruby/optional/capi/ext/mutex_spec.c55
-rw-r--r--spec/ruby/optional/capi/ext/numeric_spec.c125
-rw-r--r--spec/ruby/optional/capi/ext/object_spec.c419
-rw-r--r--spec/ruby/optional/capi/ext/proc_spec.c68
-rw-r--r--spec/ruby/optional/capi/ext/range_spec.c50
-rw-r--r--spec/ruby/optional/capi/ext/rational_spec.c54
-rw-r--r--spec/ruby/optional/capi/ext/regexp_spec.c53
-rw-r--r--spec/ruby/optional/capi/ext/rubyspec.h34
-rw-r--r--spec/ruby/optional/capi/ext/st_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/string_spec.c507
-rw-r--r--spec/ruby/optional/capi/ext/struct_spec.c89
-rw-r--r--spec/ruby/optional/capi/ext/symbol_spec.c90
-rw-r--r--spec/ruby/optional/capi/ext/thread_spec.c148
-rw-r--r--spec/ruby/optional/capi/ext/time_spec.c81
-rw-r--r--spec/ruby/optional/capi/ext/typed_data_spec.c167
-rw-r--r--spec/ruby/optional/capi/ext/util_spec.c108
-rw-r--r--spec/ruby/optional/capi/file_spec.rb89
-rw-r--r--spec/ruby/optional/capi/fixnum_spec.rb101
-rw-r--r--spec/ruby/optional/capi/fixtures/class.rb91
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_at.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_from.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_object.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/encoding.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/foo.rb1
-rw-r--r--spec/ruby/optional/capi/fixtures/module.rb35
-rw-r--r--spec/ruby/optional/capi/fixtures/module_autoload.rb4
-rw-r--r--spec/ruby/optional/capi/fixtures/path_to_class.rb6
-rw-r--r--spec/ruby/optional/capi/fixtures/proc.rb20
-rw-r--r--spec/ruby/optional/capi/float_spec.rb30
-rw-r--r--spec/ruby/optional/capi/gc_spec.rb61
-rw-r--r--spec/ruby/optional/capi/globals_spec.rb224
-rw-r--r--spec/ruby/optional/capi/hash_spec.rb257
-rw-r--r--spec/ruby/optional/capi/integer_spec.rb275
-rw-r--r--spec/ruby/optional/capi/io_spec.rb367
-rw-r--r--spec/ruby/optional/capi/kernel_spec.rb599
-rw-r--r--spec/ruby/optional/capi/marshal_spec.rb46
-rw-r--r--spec/ruby/optional/capi/module_spec.rb378
-rw-r--r--spec/ruby/optional/capi/mutex_spec.rb89
-rw-r--r--spec/ruby/optional/capi/numeric_spec.rb485
-rw-r--r--spec/ruby/optional/capi/object_spec.rb890
-rw-r--r--spec/ruby/optional/capi/proc_spec.rb116
-rw-r--r--spec/ruby/optional/capi/rake_helper.rb22
-rw-r--r--spec/ruby/optional/capi/range_spec.rb95
-rw-r--r--spec/ruby/optional/capi/rational_spec.rb57
-rw-r--r--spec/ruby/optional/capi/regexp_spec.rb71
-rw-r--r--spec/ruby/optional/capi/spec_helper.rb132
-rw-r--r--spec/ruby/optional/capi/st_spec.rb41
-rw-r--r--spec/ruby/optional/capi/string_spec.rb1034
-rw-r--r--spec/ruby/optional/capi/struct_spec.rb211
-rw-r--r--spec/ruby/optional/capi/symbol_spec.rb133
-rw-r--r--spec/ruby/optional/capi/thread_spec.rb143
-rw-r--r--spec/ruby/optional/capi/time_spec.rb300
-rw-r--r--spec/ruby/optional/capi/typed_data_spec.rb60
-rw-r--r--spec/ruby/optional/capi/util_spec.rb263
-rw-r--r--spec/ruby/security/cve_2010_1330_spec.rb21
-rw-r--r--spec/ruby/security/cve_2011_4815_spec.rb47
-rw-r--r--spec/ruby/security/cve_2013_4164_spec.rb19
-rw-r--r--spec/ruby/security/cve_2014_8080_spec.rb32
-rw-r--r--spec/ruby/security/cve_2017_17742_spec.rb34
-rw-r--r--spec/ruby/security/cve_2018_16396_spec.rb25
-rw-r--r--spec/ruby/security/cve_2018_6914_spec.rb55
-rw-r--r--spec/ruby/security/cve_2018_8778_spec.rb12
-rw-r--r--spec/ruby/security/cve_2018_8779_spec.rb30
-rw-r--r--spec/ruby/security/cve_2018_8780_spec.rb45
-rw-r--r--spec/ruby/security/cve_2019_8321_spec.rb22
-rw-r--r--spec/ruby/security/cve_2019_8322_spec.rb23
-rw-r--r--spec/ruby/security/cve_2019_8323_spec.rb38
-rw-r--r--spec/ruby/security/cve_2019_8325_spec.rb38
-rw-r--r--spec/ruby/shared/basicobject/method_missing.rb124
-rw-r--r--spec/ruby/shared/basicobject/send.rb128
-rw-r--r--spec/ruby/shared/enumerator/enum_for.rb50
-rw-r--r--spec/ruby/shared/enumerator/with_index.rb33
-rw-r--r--spec/ruby/shared/enumerator/with_object.rb42
-rw-r--r--spec/ruby/shared/fiber/resume.rb79
-rw-r--r--spec/ruby/shared/file/blockdev.rb9
-rw-r--r--spec/ruby/shared/file/chardev.rb9
-rw-r--r--spec/ruby/shared/file/directory.rb66
-rw-r--r--spec/ruby/shared/file/executable.rb48
-rw-r--r--spec/ruby/shared/file/executable_real.rb46
-rw-r--r--spec/ruby/shared/file/exist.rb24
-rw-r--r--spec/ruby/shared/file/file.rb45
-rw-r--r--spec/ruby/shared/file/grpowned.rb39
-rw-r--r--spec/ruby/shared/file/identical.rb47
-rw-r--r--spec/ruby/shared/file/owned.rb3
-rw-r--r--spec/ruby/shared/file/pipe.rb3
-rw-r--r--spec/ruby/shared/file/readable.rb30
-rw-r--r--spec/ruby/shared/file/readable_real.rb23
-rw-r--r--spec/ruby/shared/file/setgid.rb2
-rw-r--r--spec/ruby/shared/file/setuid.rb2
-rw-r--r--spec/ruby/shared/file/size.rb124
-rw-r--r--spec/ruby/shared/file/socket.rb3
-rw-r--r--spec/ruby/shared/file/sticky.rb29
-rw-r--r--spec/ruby/shared/file/symlink.rb46
-rw-r--r--spec/ruby/shared/file/world_readable.rb49
-rw-r--r--spec/ruby/shared/file/world_writable.rb49
-rw-r--r--spec/ruby/shared/file/writable.rb28
-rw-r--r--spec/ruby/shared/file/writable_real.rb33
-rw-r--r--spec/ruby/shared/file/zero.rb68
-rw-r--r--spec/ruby/shared/hash/key_error.rb25
-rw-r--r--spec/ruby/shared/io/putc.rb57
-rw-r--r--spec/ruby/shared/kernel/equal.rb54
-rw-r--r--spec/ruby/shared/kernel/object_id.rb80
-rw-r--r--spec/ruby/shared/kernel/raise.rb85
-rw-r--r--spec/ruby/shared/math/atanh.rb44
-rw-r--r--spec/ruby/shared/process/abort.rb36
-rw-r--r--spec/ruby/shared/process/exit.rb94
-rw-r--r--spec/ruby/shared/process/fork.rb90
-rw-r--r--spec/ruby/shared/queue/clear.rb12
-rw-r--r--spec/ruby/shared/queue/close.rb14
-rw-r--r--spec/ruby/shared/queue/closed.rb12
-rw-r--r--spec/ruby/shared/queue/deque.rb85
-rw-r--r--spec/ruby/shared/queue/empty.rb12
-rw-r--r--spec/ruby/shared/queue/enque.rb18
-rw-r--r--spec/ruby/shared/queue/length.rb9
-rw-r--r--spec/ruby/shared/queue/num_waiting.rb16
-rw-r--r--spec/ruby/shared/rational/Rational.rb143
-rw-r--r--spec/ruby/shared/rational/abs.rb11
-rw-r--r--spec/ruby/shared/rational/arithmetic_exception_in_coerce.rb33
-rw-r--r--spec/ruby/shared/rational/ceil.rb45
-rw-r--r--spec/ruby/shared/rational/coerce.rb29
-rw-r--r--spec/ruby/shared/rational/comparison.rb117
-rw-r--r--spec/ruby/shared/rational/denominator.rb14
-rw-r--r--spec/ruby/shared/rational/div.rb54
-rw-r--r--spec/ruby/shared/rational/divide.rb71
-rw-r--r--spec/ruby/shared/rational/divmod.rb42
-rw-r--r--spec/ruby/shared/rational/equal_value.rb39
-rw-r--r--spec/ruby/shared/rational/exponent.rb178
-rw-r--r--spec/ruby/shared/rational/fdiv.rb5
-rw-r--r--spec/ruby/shared/rational/floor.rb45
-rw-r--r--spec/ruby/shared/rational/hash.rb9
-rw-r--r--spec/ruby/shared/rational/inspect.rb14
-rw-r--r--spec/ruby/shared/rational/marshal_dump.rb5
-rw-r--r--spec/ruby/shared/rational/marshal_load.rb5
-rw-r--r--spec/ruby/shared/rational/minus.rb48
-rw-r--r--spec/ruby/shared/rational/modulo.rb43
-rw-r--r--spec/ruby/shared/rational/multiply.rb62
-rw-r--r--spec/ruby/shared/rational/numerator.rb10
-rw-r--r--spec/ruby/shared/rational/plus.rb48
-rw-r--r--spec/ruby/shared/rational/quo.rb5
-rw-r--r--spec/ruby/shared/rational/remainder.rb5
-rw-r--r--spec/ruby/shared/rational/round.rb106
-rw-r--r--spec/ruby/shared/rational/to_f.rb10
-rw-r--r--spec/ruby/shared/rational/to_i.rb12
-rw-r--r--spec/ruby/shared/rational/to_r.rb11
-rw-r--r--spec/ruby/shared/rational/to_s.rb14
-rw-r--r--spec/ruby/shared/rational/truncate.rb45
-rw-r--r--spec/ruby/shared/sizedqueue/enque.rb50
-rw-r--r--spec/ruby/shared/sizedqueue/max.rb47
-rw-r--r--spec/ruby/shared/sizedqueue/new.rb18
-rw-r--r--spec/ruby/shared/sizedqueue/num_waiting.rb12
-rw-r--r--spec/ruby/shared/string/times.rb64
-rw-r--r--spec/ruby/shared/time/strftime_for_date.rb273
-rw-r--r--spec/ruby/shared/time/strftime_for_time.rb173
-rw-r--r--spec/ruby/spec_helper.rb32
-rw-r--r--sprintf.c1299
-rw-r--r--st.c2630
-rw-r--r--st.h72
-rw-r--r--strftime.c1271
-rw-r--r--string.c11818
-rw-r--r--struct.c1498
-rw-r--r--symbol.c1073
-rw-r--r--symbol.h119
-rw-r--r--template/Doxyfile.tmpl265
-rw-r--r--template/GNUmakefile.in11
-rw-r--r--template/Makefile.in683
-rw-r--r--template/configure-ext.mk.tmpl44
-rw-r--r--template/depend.tmpl2
-rw-r--r--template/encdb.h.tmpl100
-rw-r--r--template/extinit.c.tmpl17
-rw-r--r--template/exts.mk.tmpl159
-rw-r--r--template/fake.rb.in50
-rw-r--r--template/id.c.tmpl43
-rw-r--r--template/id.h.tmpl97
-rw-r--r--template/known_errors.inc.tmpl14
-rw-r--r--template/limits.c.tmpl97
-rw-r--r--template/prelude.c.tmpl278
-rw-r--r--template/ruby-runner.h.in9
-rw-r--r--template/ruby.pc.in59
-rw-r--r--template/sizes.c.tmpl54
-rw-r--r--template/transdb.h.tmpl60
-rw-r--r--template/unicode_norm_gen.tmpl220
-rw-r--r--template/verconf.h.tmpl63
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_extract.rb40
-rw-r--r--test/-ext-/array/test_resize.rb30
-rw-r--r--test/-ext-/bignum/test_big2str.rb30
-rw-r--r--test/-ext-/bignum/test_bigzero.rb20
-rw-r--r--test/-ext-/bignum/test_div.rb29
-rw-r--r--test/-ext-/bignum/test_mul.rb138
-rw-r--r--test/-ext-/bignum/test_pack.rb399
-rw-r--r--test/-ext-/bignum/test_str2big.rb38
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb26
-rw-r--r--test/-ext-/class/test_class2name.rb19
-rw-r--r--test/-ext-/debug/test_debug.rb75
-rw-r--r--test/-ext-/debug/test_profile_frames.rb122
-rw-r--r--test/-ext-/exception/test_data_error.rb14
-rw-r--r--test/-ext-/exception/test_enc_raise.rb16
-rw-r--r--test/-ext-/exception/test_ensured.rb32
-rw-r--r--test/-ext-/exception/test_exception_at_throwing.rb18
-rw-r--r--test/-ext-/file/test_stat.rb15
-rw-r--r--test/-ext-/float/test_nextafter.rb65
-rw-r--r--test/-ext-/funcall/test_funcall.rb11
-rw-r--r--test/-ext-/funcall/test_passing_block.rb75
-rw-r--r--test/-ext-/gvl/test_last_thread.rb22
-rw-r--r--test/-ext-/gvl/test_ubf_async_safe.rb20
-rw-r--r--test/-ext-/hash/test_delete.rb20
-rw-r--r--test/-ext-/integer/test_integer.rb26
-rw-r--r--test/-ext-/integer/test_my_integer.rb48
-rw-r--r--test/-ext-/iseq_load/test_iseq_load.rb156
-rw-r--r--test/-ext-/iter/test_iter_break.rb16
-rw-r--r--test/-ext-/iter/test_yield_block.rb34
-rw-r--r--test/-ext-/load/script.rb2
-rw-r--r--test/-ext-/load/test_dot_dot.rb11
-rw-r--r--test/-ext-/load/test_protect.rb14
-rw-r--r--test/-ext-/marshal/test_internal_ivar.rb24
-rw-r--r--test/-ext-/marshal/test_usrmarshal.rb33
-rw-r--r--test/-ext-/method/test_arity.rb38
-rw-r--r--test/-ext-/num2int/test_num2int.rb265
-rw-r--r--test/-ext-/path_to_class/test_path_to_class.rb13
-rw-r--r--test/-ext-/popen_deadlock/test_popen_deadlock.rb36
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb28
-rw-r--r--test/-ext-/proc/test_bmethod.rb38
-rw-r--r--test/-ext-/rational/test_rat.rb32
-rw-r--r--test/-ext-/st/test_foreach.rb16
-rw-r--r--test/-ext-/st/test_numhash.rb50
-rw-r--r--test/-ext-/st/test_update.rb51
-rw-r--r--test/-ext-/string/test_capacity.rb59
-rw-r--r--test/-ext-/string/test_coderange.rb60
-rw-r--r--test/-ext-/string/test_cstr.rb164
-rw-r--r--test/-ext-/string/test_ellipsize.rb47
-rw-r--r--test/-ext-/string/test_enc_associate.rb24
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb16
-rw-r--r--test/-ext-/string/test_external_new.rb17
-rw-r--r--test/-ext-/string/test_fstring.rb58
-rw-r--r--test/-ext-/string/test_modify_expand.rb26
-rw-r--r--test/-ext-/string/test_nofree.rb13
-rw-r--r--test/-ext-/string/test_normalize.rb110
-rw-r--r--test/-ext-/string/test_qsort.rb20
-rw-r--r--test/-ext-/string/test_rb_str_dup.rb16
-rw-r--r--test/-ext-/string/test_set_len.rb35
-rw-r--r--test/-ext-/struct/test_duplicate.rb22
-rw-r--r--test/-ext-/struct/test_len.rb10
-rw-r--r--test/-ext-/struct/test_member.rb14
-rw-r--r--test/-ext-/symbol/noninterned_name.rb17
-rw-r--r--test/-ext-/symbol/test_inadvertent_creation.rb495
-rw-r--r--test/-ext-/symbol/test_type.rb139
-rw-r--r--test/-ext-/test_bug-14834.rb12
-rw-r--r--test/-ext-/test_bug-3571.rb21
-rw-r--r--test/-ext-/test_bug-5832.rb22
-rw-r--r--test/-ext-/test_enumerator_kw.rb11
-rw-r--r--test/-ext-/test_notimplement.rb37
-rw-r--r--test/-ext-/test_printf.rb184
-rw-r--r--test/-ext-/test_recursion.rb36
-rw-r--r--test/-ext-/test_scan_args.rb324
-rw-r--r--test/-ext-/thread_fd_close/test_thread_fd_close.rb25
-rw-r--r--test/-ext-/time/test_new.rb44
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb82
-rw-r--r--test/-ext-/typeddata/test_typeddata.rb29
-rw-r--r--test/-ext-/vm/test_at_exit.rb19
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb49
-rw-r--r--test/-ext-/win32/test_console_attr.rb55
-rw-r--r--test/-ext-/win32/test_dln.rb39
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb25
-rw-r--r--test/base64/test_base64.rb115
-rw-r--r--test/benchmark/test_benchmark.rb158
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1910
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb93
-rw-r--r--test/bigdecimal/test_bigmath.rb81
-rw-r--r--test/bigdecimal/testbase.rb28
-rw-r--r--test/cgi/test_cgi_cookie.rb121
-rw-r--r--test/cgi/test_cgi_core.rb303
-rw-r--r--test/cgi/test_cgi_header.rb184
-rw-r--r--test/cgi/test_cgi_modruby.rb149
-rw-r--r--test/cgi/test_cgi_multipart.rb385
-rw-r--r--test/cgi/test_cgi_session.rb169
-rw-r--r--test/cgi/test_cgi_tag_helper.rb355
-rw-r--r--test/cgi/test_cgi_util.rb193
-rw-r--r--test/cgi/testdata/file1.html10
-rw-r--r--test/cgi/testdata/large.pngbin0 -> 156414 bytes-rw-r--r--test/cgi/testdata/small.pngbin0 -> 82 bytes-rw-r--r--test/cgi/update_env.rb9
-rw-r--r--test/coverage/test_coverage.rb743
-rw-r--r--test/csv/helper.rb18
-rw-r--r--test/csv/interface/test_delegation.rb47
-rw-r--r--test/csv/interface/test_read.rb277
-rw-r--r--test/csv/interface/test_read_write.rb50
-rw-r--r--test/csv/interface/test_write.rb174
-rw-r--r--test/csv/line_endings.gzbin0 -> 59 bytes-rw-r--r--test/csv/parse/test_column_separator.rb40
-rw-r--r--test/csv/parse/test_convert.rb110
-rw-r--r--test/csv/parse/test_each.rb23
-rw-r--r--test/csv/parse/test_general.rb255
-rw-r--r--test/csv/parse/test_header.rb335
-rw-r--r--test/csv/parse/test_invalid.rb39
-rw-r--r--test/csv/parse/test_liberal_parsing.rb160
-rw-r--r--test/csv/parse/test_quote_char_nil.rb93
-rw-r--r--test/csv/parse/test_rewind.rb40
-rw-r--r--test/csv/parse/test_row_separator.rb16
-rw-r--r--test/csv/parse/test_skip_lines.rb105
-rw-r--r--test/csv/parse/test_strip.rb78
-rw-r--r--test/csv/parse/test_unconverted_fields.rb117
-rw-r--r--test/csv/test_csv.rb1753
-rw-r--r--test/csv/test_data_converters.rb106
-rw-r--r--test/csv/test_encodings.rb350
-rw-r--r--test/csv/test_features.rb359
-rw-r--r--test/csv/test_row.rb432
-rw-r--r--test/csv/test_table.rb620
-rw-r--r--test/csv/write/test_converters.rb53
-rw-r--r--test/csv/write/test_general.rb258
-rw-r--r--test/csv/write/test_quote_empty.rb70
-rw-r--r--test/date/test_date.rb166
-rw-r--r--test/date/test_date_arith.rb294
-rw-r--r--test/date/test_date_attr.rb103
-rw-r--r--test/date/test_date_compat.rb22
-rw-r--r--test/date/test_date_conv.rb171
-rw-r--r--test/date/test_date_marshal.rb52
-rw-r--r--test/date/test_date_new.rb332
-rw-r--r--test/date/test_date_parse.rb1231
-rw-r--r--test/date/test_date_strftime.rb439
-rw-r--r--test/date/test_date_strptime.rb514
-rw-r--r--test/date/test_switch_hitter.rb637
-rw-r--r--test/dbm/test_dbm.rb223
-rw-r--r--test/did_you_mean/core_ext/test_name_error_extension.rb48
-rw-r--r--test/did_you_mean/edit_distance/test_jaro_winkler.rb36
-rw-r--r--test/did_you_mean/fixtures/book.rb4
-rw-r--r--test/did_you_mean/fixtures/mini_dir.yml15
-rw-r--r--test/did_you_mean/fixtures/rspec_dir.yml112
-rw-r--r--test/did_you_mean/helper.rb29
-rw-r--r--test/did_you_mean/spell_checking/test_class_name_check.rb79
-rw-r--r--test/did_you_mean/spell_checking/test_key_name_check.rb54
-rw-r--r--test/did_you_mean/spell_checking/test_method_name_check.rb140
-rw-r--r--test/did_you_mean/spell_checking/test_uncorrectable_name_check.rb15
-rw-r--r--test/did_you_mean/spell_checking/test_variable_name_check.rb140
-rw-r--r--test/did_you_mean/test_spell_checker.rb77
-rw-r--r--test/did_you_mean/test_tree_spell_checker.rb173
-rw-r--r--test/did_you_mean/test_verbose_formatter.rb21
-rw-r--r--test/did_you_mean/tree_spell/change_word.rb61
-rw-r--r--test/did_you_mean/tree_spell/human_typo.rb89
-rw-r--r--test/did_you_mean/tree_spell/test_change_word.rb38
-rw-r--r--test/did_you_mean/tree_spell/test_human_typo.rb24
-rw-r--r--test/digest/digest/foo.rb11
-rw-r--r--test/digest/test_digest.rb214
-rw-r--r--test/digest/test_digest_extend.rb159
-rw-r--r--test/drb/drbtest.rb241
-rw-r--r--test/drb/ignore_test_drb.rb20
-rw-r--r--test/drb/test_acl.rb106
-rw-r--r--test/drb/test_drb.rb233
-rw-r--r--test/drb/test_drbobject.rb69
-rw-r--r--test/drb/test_drbssl.rb55
-rw-r--r--test/drb/test_drbunix.rb28
-rw-r--r--test/drb/ut_array.rb4
-rw-r--r--test/drb/ut_array_drbssl.rb17
-rw-r--r--test/drb/ut_array_drbunix.rb2
-rw-r--r--test/drb/ut_drb.rb21
-rw-r--r--test/drb/ut_drb_drbssl.rb19
-rw-r--r--test/drb/ut_drb_drbunix.rb4
-rw-r--r--test/drb/ut_eq.rb37
-rw-r--r--test/drb/ut_eval.rb31
-rw-r--r--test/drb/ut_large.rb36
-rw-r--r--test/drb/ut_port.rb2
-rw-r--r--test/drb/ut_safe1.rb4
-rw-r--r--test/drb/ut_timerholder.rb109
-rw-r--r--test/dtrace/dummy.rb2
-rw-r--r--test/dtrace/helper.rb165
-rw-r--r--test/dtrace/test_array_create.rb36
-rw-r--r--test/dtrace/test_cmethod.rb50
-rw-r--r--test/dtrace/test_function_entry.rb89
-rw-r--r--test/dtrace/test_gc.rb27
-rw-r--r--test/dtrace/test_hash_create.rb53
-rw-r--r--test/dtrace/test_load.rb53
-rw-r--r--test/dtrace/test_method_cache.rb29
-rw-r--r--test/dtrace/test_object_create_start.rb36
-rw-r--r--test/dtrace/test_raise.rb30
-rw-r--r--test/dtrace/test_require.rb41
-rw-r--r--test/dtrace/test_singleton_function.rb57
-rw-r--r--test/dtrace/test_string.rb28
-rw-r--r--test/erb/hello.erb4
-rw-r--r--test/erb/test_erb.rb689
-rw-r--r--test/erb/test_erb_command.rb30
-rw-r--r--test/erb/test_erb_m17n.rb124
-rw-r--r--test/etc/test_etc.rb172
-rw-r--r--test/excludes/TestException.rb8
-rw-r--r--test/excludes/TestIO_Console.rb2
-rw-r--r--test/excludes/TestISeq.rb1
-rw-r--r--test/excludes/TestThread.rb2
-rw-r--r--test/excludes/_appveyor/TestArray.rb7
-rw-r--r--test/fiddle/helper.rb142
-rw-r--r--test/fiddle/test_c_struct_entry.rb77
-rw-r--r--test/fiddle/test_c_union_entity.rb35
-rw-r--r--test/fiddle/test_closure.rb85
-rw-r--r--test/fiddle/test_cparser.rb217
-rw-r--r--test/fiddle/test_fiddle.rb17
-rw-r--r--test/fiddle/test_func.rb83
-rw-r--r--test/fiddle/test_function.rb117
-rw-r--r--test/fiddle/test_handle.rb175
-rw-r--r--test/fiddle/test_import.rb155
-rw-r--r--test/fiddle/test_pointer.rb231
-rw-r--r--test/fileutils/clobber.rb92
-rw-r--r--test/fileutils/fileasserts.rb131
-rw-r--r--test/fileutils/test_dryrun.rb23
-rw-r--r--test/fileutils/test_fileutils.rb1098
-rw-r--r--test/fileutils/test_nowrite.rb93
-rw-r--r--test/fileutils/test_verbose.rb21
-rw-r--r--test/fileutils/visibility_tests.rb42
-rw-r--r--test/gdbm/test_gdbm.rb280
-rw-r--r--test/io/console/test_io_console.rb522
-rw-r--r--test/io/nonblock/test_flush.rb69
-rw-r--r--test/io/wait/test_io_wait.rb179
-rw-r--r--test/io/wait/test_io_wait_uncommon.rb78
-rw-r--r--test/irb/test_color.rb193
-rw-r--r--test/irb/test_completion.rb29
-rw-r--r--test/irb/test_context.rb220
-rw-r--r--test/irb/test_init.rb73
-rw-r--r--test/irb/test_option.rb13
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb16
-rw-r--r--test/irb/test_workspace.rb104
-rw-r--r--test/json/fixtures/fail10.json1
-rw-r--r--test/json/fixtures/fail11.json1
-rw-r--r--test/json/fixtures/fail12.json1
-rw-r--r--test/json/fixtures/fail13.json1
-rw-r--r--test/json/fixtures/fail14.json1
-rw-r--r--test/json/fixtures/fail18.json1
-rw-r--r--test/json/fixtures/fail19.json1
-rw-r--r--test/json/fixtures/fail2.json1
-rw-r--r--test/json/fixtures/fail20.json1
-rw-r--r--test/json/fixtures/fail21.json1
-rw-r--r--test/json/fixtures/fail22.json1
-rw-r--r--test/json/fixtures/fail23.json1
-rw-r--r--test/json/fixtures/fail24.json1
-rw-r--r--test/json/fixtures/fail25.json1
-rw-r--r--test/json/fixtures/fail27.json2
-rw-r--r--test/json/fixtures/fail28.json2
-rw-r--r--test/json/fixtures/fail3.json1
-rw-r--r--test/json/fixtures/fail4.json1
-rw-r--r--test/json/fixtures/fail5.json1
-rw-r--r--test/json/fixtures/fail6.json1
-rw-r--r--test/json/fixtures/fail7.json1
-rw-r--r--test/json/fixtures/fail8.json1
-rw-r--r--test/json/fixtures/fail9.json1
-rw-r--r--test/json/fixtures/obsolete_fail1.json1
-rw-r--r--test/json/fixtures/pass1.json56
-rw-r--r--test/json/fixtures/pass15.json1
-rw-r--r--test/json/fixtures/pass16.json1
-rw-r--r--test/json/fixtures/pass17.json1
-rw-r--r--test/json/fixtures/pass2.json1
-rw-r--r--test/json/fixtures/pass26.json1
-rw-r--r--test/json/fixtures/pass3.json6
-rw-r--r--test/json/json_addition_test.rb203
-rw-r--r--test/json/json_common_interface_test.rb126
-rw-r--r--test/json/json_encoding_test.rb107
-rw-r--r--test/json/json_ext_parser_test.rb15
-rw-r--r--test/json/json_fixtures_test.rb32
-rw-r--r--test/json/json_generator_test.rb421
-rw-r--r--test/json/json_generic_object_test.rb82
-rw-r--r--test/json/json_parser_test.rb472
-rw-r--r--test/json/json_string_matching_test.rb38
-rw-r--r--test/json/test_helper.rb17
-rw-r--r--test/lib/jit_support.rb70
-rw-r--r--test/lib/with_different_ofs.rb22
-rw-r--r--test/logger/helper.rb13
-rw-r--r--test/logger/test_logdevice.rb858
-rw-r--r--test/logger/test_logger.rb283
-rw-r--r--test/logger/test_logperiod.rb80
-rw-r--r--test/logger/test_severity.rb26
-rw-r--r--test/matrix/test_matrix.rb795
-rw-r--r--test/matrix/test_vector.rb335
-rw-r--r--test/misc/test_ruby_mode.rb183
-rw-r--r--test/mkmf/base.rb155
-rw-r--r--test/mkmf/test_config.rb17
-rw-r--r--test/mkmf/test_constant.rb38
-rw-r--r--test/mkmf/test_convertible.rb35
-rw-r--r--test/mkmf/test_find_executable.rb58
-rw-r--r--test/mkmf/test_flags.rb57
-rw-r--r--test/mkmf/test_framework.rb49
-rw-r--r--test/mkmf/test_have_func.rb17
-rw-r--r--test/mkmf/test_have_library.rb56
-rw-r--r--test/mkmf/test_have_macro.rb36
-rw-r--r--test/mkmf/test_libs.rb87
-rw-r--r--test/mkmf/test_signedness.rb30
-rw-r--r--test/mkmf/test_sizeof.rb48
-rw-r--r--test/monitor/test_monitor.rb261
-rw-r--r--test/net/fixtures/Makefile15
-rw-r--r--test/net/fixtures/cacert.pem24
-rw-r--r--test/net/fixtures/dhparams.pem29
-rw-r--r--test/net/fixtures/server.crt82
-rw-r--r--test/net/fixtures/server.key28
-rw-r--r--test/net/ftp/test_buffered_socket.rb48
-rw-r--r--test/net/ftp/test_ftp.rb2570
-rw-r--r--test/net/ftp/test_mlsx_entry.rb98
-rw-r--r--test/net/http/test_buffered_io.rb18
-rw-r--r--test/net/http/test_http.rb1207
-rw-r--r--test/net/http/test_http_request.rb93
-rw-r--r--test/net/http/test_httpheader.rb139
-rw-r--r--test/net/http/test_httpresponse.rb467
-rw-r--r--test/net/http/test_httpresponses.rb25
-rw-r--r--test/net/http/test_https.rb287
-rw-r--r--test/net/http/test_https_proxy.rb41
-rw-r--r--test/net/http/utils.rb129
-rw-r--r--test/net/imap/test_imap.rb794
-rw-r--r--test/net/imap/test_imap_response_parser.rb311
-rw-r--r--test/net/pop/test_pop.rb166
-rw-r--r--test/net/protocol/test_protocol.rb122
-rw-r--r--test/net/smtp/test_response.rb100
-rw-r--r--test/net/smtp/test_smtp.rb200
-rw-r--r--test/net/smtp/test_ssl_socket.rb97
-rw-r--r--test/nkf/test_kconv.rb113
-rw-r--r--test/nkf/test_nkf.rb7
-rw-r--r--test/objspace/test_objspace.rb506
-rw-r--r--test/open-uri/test_open-uri.rb912
-rw-r--r--test/open-uri/test_ssl.rb513
-rw-r--r--test/openssl/fixtures/pkey/dh-1.pem13
-rw-r--r--test/openssl/fixtures/pkey/dh1024.pem5
-rw-r--r--test/openssl/fixtures/pkey/dsa1024.pem12
-rw-r--r--test/openssl/fixtures/pkey/dsa256.pem8
-rw-r--r--test/openssl/fixtures/pkey/dsa512.pem8
-rw-r--r--test/openssl/fixtures/pkey/p256.pem5
-rw-r--r--test/openssl/fixtures/pkey/rsa-1.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-2.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-3.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa1024.pem15
-rw-r--r--test/openssl/fixtures/pkey/rsa2048.pem27
-rw-r--r--test/openssl/ssl_server.rb81
-rw-r--r--test/openssl/test_asn1.rb525
-rw-r--r--test/openssl/test_bn.rb282
-rw-r--r--test/openssl/test_buffering.rb90
-rw-r--r--test/openssl/test_cipher.rb358
-rw-r--r--test/openssl/test_config.rb304
-rw-r--r--test/openssl/test_digest.rb125
-rw-r--r--test/openssl/test_engine.rb97
-rw-r--r--test/openssl/test_fips.rb30
-rw-r--r--test/openssl/test_hmac.rb52
-rw-r--r--test/openssl/test_kdf.rb183
-rw-r--r--test/openssl/test_ns_spki.rb20
-rw-r--r--test/openssl/test_ocsp.rb310
-rw-r--r--test/openssl/test_pair.rb499
-rw-r--r--test/openssl/test_pkcs12.rb313
-rw-r--r--test/openssl/test_pkcs7.rb203
-rw-r--r--test/openssl/test_pkey_dh.rb103
-rw-r--r--test/openssl/test_pkey_dsa.rb200
-rw-r--r--test/openssl/test_pkey_ec.rb353
-rw-r--r--test/openssl/test_pkey_rsa.rb277
-rw-r--r--test/openssl/test_random.rb19
-rw-r--r--test/openssl/test_ssl.rb1695
-rw-r--r--test/openssl/test_ssl_session.rb400
-rw-r--r--test/openssl/test_x509attr.rb84
-rw-r--r--test/openssl/test_x509cert.rb196
-rw-r--r--test/openssl/test_x509crl.rb129
-rw-r--r--test/openssl/test_x509ext.rb55
-rw-r--r--test/openssl/test_x509name.rb267
-rw-r--r--test/openssl/test_x509req.rb71
-rw-r--r--test/openssl/test_x509store.rb113
-rw-r--r--test/openssl/ut_eof.rb133
-rw-r--r--test/openssl/utils.rb340
-rw-r--r--test/optparse/test_acceptable.rb199
-rw-r--r--test/optparse/test_autoconf.rb71
-rw-r--r--test/optparse/test_bash_completion.rb48
-rw-r--r--test/optparse/test_cclass.rb18
-rw-r--r--test/optparse/test_did_you_mean.rb52
-rw-r--r--test/optparse/test_getopts.rb35
-rw-r--r--test/optparse/test_kwargs.rb40
-rw-r--r--test/optparse/test_noarg.rb36
-rw-r--r--test/optparse/test_optarg.rb18
-rw-r--r--test/optparse/test_optparse.rb34
-rw-r--r--test/optparse/test_placearg.rb27
-rw-r--r--test/optparse/test_reqarg.rb40
-rw-r--r--test/optparse/test_summary.rb58
-rw-r--r--test/optparse/test_zsh_completion.rb23
-rw-r--r--test/ostruct/test_ostruct.rb206
-rw-r--r--test/pathname/test_pathname.rb1112
-rw-r--r--test/psych/handlers/test_recorder.rb26
-rw-r--r--test/psych/helper.rb128
-rw-r--r--test/psych/json/test_stream.rb110
-rw-r--r--test/psych/nodes/test_enumerable.rb44
-rw-r--r--test/psych/test_alias_and_anchor.rb97
-rw-r--r--test/psych/test_array.rb64
-rw-r--r--test/psych/test_boolean.rb37
-rw-r--r--test/psych/test_class.rb37
-rw-r--r--test/psych/test_coder.rb207
-rw-r--r--test/psych/test_date_time.rb70
-rw-r--r--test/psych/test_deprecated.rb91
-rw-r--r--test/psych/test_document.rb47
-rw-r--r--test/psych/test_emitter.rb112
-rw-r--r--test/psych/test_encoding.rb281
-rw-r--r--test/psych/test_exception.rb183
-rw-r--r--test/psych/test_hash.rb129
-rw-r--r--test/psych/test_json_tree.rb66
-rw-r--r--test/psych/test_marshalable.rb55
-rw-r--r--test/psych/test_merge_keys.rb181
-rw-r--r--test/psych/test_nil.rb19
-rw-r--r--test/psych/test_null.rb20
-rw-r--r--test/psych/test_numeric.rb46
-rw-r--r--test/psych/test_object.rb45
-rw-r--r--test/psych/test_object_references.rb72
-rw-r--r--test/psych/test_omap.rb76
-rw-r--r--test/psych/test_parser.rb392
-rw-r--r--test/psych/test_psych.rb328
-rw-r--r--test/psych/test_safe_load.rb171
-rw-r--r--test/psych/test_scalar.rb17
-rw-r--r--test/psych/test_scalar_scanner.rb134
-rw-r--r--test/psych/test_serialize_subclasses.rb39
-rw-r--r--test/psych/test_set.rb50
-rw-r--r--test/psych/test_stream.rb110
-rw-r--r--test/psych/test_string.rb231
-rw-r--r--test/psych/test_struct.rb50
-rw-r--r--test/psych/test_symbol.rb26
-rw-r--r--test/psych/test_tree_builder.rb94
-rw-r--r--test/psych/test_yaml.rb1293
-rw-r--r--test/psych/test_yaml_special_cases.rb130
-rw-r--r--test/psych/test_yamldbm.rb193
-rw-r--r--test/psych/test_yamlstore.rb86
-rw-r--r--test/psych/visitors/test_depth_first.rb50
-rw-r--r--test/psych/visitors/test_emitter.rb145
-rw-r--r--test/psych/visitors/test_to_ruby.rb332
-rw-r--r--test/psych/visitors/test_yaml_tree.rb197
-rw-r--r--test/racc/assets/cadenza.y170
-rw-r--r--test/racc/assets/cast.y926
-rw-r--r--test/racc/assets/chk.y126
-rw-r--r--test/racc/assets/conf.y16
-rw-r--r--test/racc/assets/csspool.y729
-rw-r--r--test/racc/assets/digraph.y29
-rw-r--r--test/racc/assets/echk.y118
-rw-r--r--test/racc/assets/edtf.y583
-rw-r--r--test/racc/assets/err.y60
-rw-r--r--test/racc/assets/error_recovery.y35
-rw-r--r--test/racc/assets/expect.y7
-rw-r--r--test/racc/assets/firstline.y4
-rw-r--r--test/racc/assets/huia.y318
-rw-r--r--test/racc/assets/ichk.y102
-rw-r--r--test/racc/assets/intp.y546
-rw-r--r--test/racc/assets/journey.y47
-rw-r--r--test/racc/assets/liquor.y313
-rw-r--r--test/racc/assets/machete.y423
-rw-r--r--test/racc/assets/macruby.y2197
-rw-r--r--test/racc/assets/mailp.y437
-rw-r--r--test/racc/assets/mediacloth.y599
-rw-r--r--test/racc/assets/mof.y649
-rw-r--r--test/racc/assets/namae.y302
-rw-r--r--test/racc/assets/nasl.y626
-rw-r--r--test/racc/assets/newsyn.y25
-rw-r--r--test/racc/assets/noend.y4
-rw-r--r--test/racc/assets/nokogiri-css.y255
-rw-r--r--test/racc/assets/nonass.y41
-rw-r--r--test/racc/assets/normal.y27
-rw-r--r--test/racc/assets/norule.y4
-rw-r--r--test/racc/assets/nullbug1.y25
-rw-r--r--test/racc/assets/nullbug2.y15
-rw-r--r--test/racc/assets/opal.y1807
-rw-r--r--test/racc/assets/opt.y123
-rw-r--r--test/racc/assets/percent.y35
-rw-r--r--test/racc/assets/php_serialization.y98
-rw-r--r--test/racc/assets/recv.y97
-rw-r--r--test/racc/assets/riml.y665
-rw-r--r--test/racc/assets/rrconf.y14
-rw-r--r--test/racc/assets/ruby18.y1943
-rw-r--r--test/racc/assets/ruby19.y2174
-rw-r--r--test/racc/assets/ruby20.y2350
-rw-r--r--test/racc/assets/ruby21.y2359
-rw-r--r--test/racc/assets/ruby22.y2381
-rw-r--r--test/racc/assets/scan.y72
-rw-r--r--test/racc/assets/syntax.y50
-rw-r--r--test/racc/assets/tp_plus.y622
-rw-r--r--test/racc/assets/twowaysql.y278
-rw-r--r--test/racc/assets/unterm.y5
-rw-r--r--test/racc/assets/useless.y12
-rw-r--r--test/racc/assets/yyerr.y46
-rw-r--r--test/racc/bench.y36
-rw-r--r--test/racc/helper.rb115
-rw-r--r--test/racc/infini.y8
-rw-r--r--test/racc/regress/README.txt7
-rw-r--r--test/racc/regress/cadenza796
-rw-r--r--test/racc/regress/cast3425
-rw-r--r--test/racc/regress/csspool2318
-rw-r--r--test/racc/regress/edtf1794
-rw-r--r--test/racc/regress/huia1392
-rw-r--r--test/racc/regress/journey222
-rw-r--r--test/racc/regress/liquor885
-rw-r--r--test/racc/regress/machete833
-rw-r--r--test/racc/regress/mediacloth1463
-rw-r--r--test/racc/regress/mof1368
-rw-r--r--test/racc/regress/namae634
-rw-r--r--test/racc/regress/nasl2058
-rw-r--r--test/racc/regress/nokogiri-css836
-rw-r--r--test/racc/regress/opal6429
-rw-r--r--test/racc/regress/php_serialization336
-rw-r--r--test/racc/regress/riml3297
-rw-r--r--test/racc/regress/ruby186351
-rw-r--r--test/racc/regress/ruby227456
-rw-r--r--test/racc/regress/tp_plus1933
-rw-r--r--test/racc/regress/twowaysql556
-rw-r--r--test/racc/scandata/brace7
-rw-r--r--test/racc/scandata/gvar1
-rw-r--r--test/racc/scandata/normal4
-rw-r--r--test/racc/scandata/percent18
-rw-r--r--test/racc/scandata/slash10
-rw-r--r--test/racc/src.intp34
-rw-r--r--test/racc/start.y20
-rw-r--r--test/racc/test_chk_y.rb52
-rw-r--r--test/racc/test_grammar_file_parser.rb15
-rw-r--r--test/racc/test_racc_command.rb322
-rw-r--r--test/racc/test_scan_y.rb52
-rw-r--r--test/racc/testscanner.rb51
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Amps and angle encoding.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Auto links.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Backslash escapes.text120
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Blockquotes with code blocks.text11
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Blocks.text14
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Spans.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Hard-wrapped paragraphs with list-like lines.text8
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Horizontal rules.text67
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Advanced).text15
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Simple).text69
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML comments.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, inline style.text12
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, reference style.text71
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, shortcut references.text20
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Literal quotes in titles.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text306
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text888
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Nested blockquotes.text5
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Ordered and unordered lists.text131
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Strong and em together.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tabs.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tidyness.text5
-rw-r--r--test/rdoc/README1
-rw-r--r--test/rdoc/binary.datbin0 -> 1024 bytes-rw-r--r--test/rdoc/helper.rb5
-rw-r--r--test/rdoc/hidden.zip.txt1
-rw-r--r--test/rdoc/support/formatter_test_case.rb764
-rw-r--r--test/rdoc/support/test_case.rb216
-rw-r--r--test/rdoc/support/text_formatter_test_case.rb115
-rw-r--r--test/rdoc/test.ja.largedoc3
-rw-r--r--test/rdoc/test.ja.rdoc10
-rw-r--r--test/rdoc/test.ja.txt8
-rw-r--r--test/rdoc/test.txt1
-rw-r--r--test/rdoc/test_rdoc_alias.rb14
-rw-r--r--test/rdoc/test_rdoc_any_method.rb509
-rw-r--r--test/rdoc/test_rdoc_attr.rb190
-rw-r--r--test/rdoc/test_rdoc_class_module.rb1504
-rw-r--r--test/rdoc/test_rdoc_code_object.rb440
-rw-r--r--test/rdoc/test_rdoc_comment.rb497
-rw-r--r--test/rdoc/test_rdoc_constant.rb182
-rw-r--r--test/rdoc/test_rdoc_context.rb965
-rw-r--r--test/rdoc/test_rdoc_context_section.rb155
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb207
-rw-r--r--test/rdoc/test_rdoc_encoding.rb184
-rw-r--r--test/rdoc/test_rdoc_extend.rb95
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb246
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb349
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb60
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb92
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb52
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb140
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb76
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb74
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb124
-rw-r--r--test/rdoc/test_rdoc_include.rb109
-rw-r--r--test/rdoc/test_rdoc_markdown.rb1018
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb1883
-rw-r--r--test/rdoc/test_rdoc_markup.rb96
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb375
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb40
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb208
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb175
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb32
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb30
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb20
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb54
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb1684
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb467
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb23
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb370
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb352
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb809
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb242
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb709
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb113
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb390
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb378
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb127
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb247
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb30
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb194
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb48
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb43
-rw-r--r--test/rdoc/test_rdoc_options.rb780
-rw-r--r--test/rdoc/test_rdoc_parser.rb323
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1945
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb316
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb62
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb56
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb4300
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb116
-rw-r--r--test/rdoc/test_rdoc_rd.rb31
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb536
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb64
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb178
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb565
-rw-r--r--test/rdoc/test_rdoc_require.rb26
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1556
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb158
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb256
-rw-r--r--test/rdoc/test_rdoc_servlet.rb549
-rw-r--r--test/rdoc/test_rdoc_single_class.rb21
-rw-r--r--test/rdoc/test_rdoc_stats.rb723
-rw-r--r--test/rdoc/test_rdoc_store.rb998
-rw-r--r--test/rdoc/test_rdoc_task.rb174
-rw-r--r--test/rdoc/test_rdoc_text.rb575
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb58
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb579
-rw-r--r--test/rdoc/test_rdoc_top_level.rb288
-rw-r--r--test/rdoc/xref_data.rb135
-rw-r--r--test/rdoc/xref_test_case.rb86
-rw-r--r--test/readline/helper.rb20
-rw-r--r--test/readline/test_readline.rb778
-rw-r--r--test/readline/test_readline_history.rb278
-rw-r--r--test/reline/helper.rb90
-rw-r--r--test/reline/test_config.rb198
-rw-r--r--test/reline/test_history.rb273
-rw-r--r--test/reline/test_key_actor_emacs.rb1861
-rw-r--r--test/reline/test_key_actor_vi.rb1095
-rw-r--r--test/reline/test_key_stroke.rb38
-rw-r--r--test/reline/test_kill_ring.rb256
-rw-r--r--test/reline/test_macro.rb38
-rw-r--r--test/reline/test_reline.rb270
-rw-r--r--test/reline/test_string_processing.rb23
-rw-r--r--test/reline/test_within_pipe.rb57
-rw-r--r--test/resolv/test_addr.rb41
-rw-r--r--test/resolv/test_dns.rb308
-rw-r--r--test/resolv/test_mdns.rb27
-rw-r--r--test/resolv/test_resource.rb26
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin0 -> 50154 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin0 -> 161690 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/utf16.xmlbin0 -> 207464 bytes-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/formatter/test_default.rb19
-rw-r--r--test/rexml/functions/test_base.rb261
-rw-r--r--test/rexml/functions/test_boolean.rb75
-rw-r--r--test/rexml/functions/test_local_name.rb44
-rw-r--r--test/rexml/functions/test_number.rb38
-rw-r--r--test/rexml/listener.rb51
-rw-r--r--test/rexml/parse/test_document_type_declaration.rb50
-rw-r--r--test/rexml/parse/test_element.rb51
-rw-r--r--test/rexml/parse/test_notation_declaration.rb100
-rw-r--r--test/rexml/parse/test_processing_instruction.rb25
-rw-r--r--test/rexml/parser/test_sax2.rb203
-rw-r--r--test/rexml/parser/test_stream.rb32
-rw-r--r--test/rexml/parser/test_tree.rb43
-rw-r--r--test/rexml/parser/test_ultra_light.rb70
-rw-r--r--test/rexml/rexml_test_utils.rb10
-rw-r--r--test/rexml/test_attribute.rb14
-rw-r--r--test/rexml/test_attributes.rb223
-rw-r--r--test/rexml/test_attributes_mixin.rb32
-rw-r--r--test/rexml/test_changing_encoding.rb45
-rw-r--r--test/rexml/test_comment.rb26
-rw-r--r--test/rexml/test_contrib.rb585
-rw-r--r--test/rexml/test_core.rb1517
-rw-r--r--test/rexml/test_doctype.rb157
-rw-r--r--test/rexml/test_document.rb416
-rw-r--r--test/rexml/test_element.rb18
-rw-r--r--test/rexml/test_elements.rb119
-rw-r--r--test/rexml/test_encoding.rb108
-rw-r--r--test/rexml/test_entity.rb206
-rw-r--r--test/rexml/test_instruction.rb14
-rw-r--r--test/rexml/test_jaxen.rb131
-rw-r--r--test/rexml/test_light.rb107
-rw-r--r--test/rexml/test_lightparser.rb16
-rw-r--r--test/rexml/test_listener.rb131
-rw-r--r--test/rexml/test_martin_fowler.rb40
-rw-r--r--test/rexml/test_namespace.rb41
-rw-r--r--test/rexml/test_order.rb110
-rw-r--r--test/rexml/test_preceding_sibling.rb41
-rw-r--r--test/rexml/test_pullparser.rb103
-rw-r--r--test/rexml/test_rexml_issuezilla.rb19
-rw-r--r--test/rexml/test_sax.rb287
-rw-r--r--test/rexml/test_stream.rb130
-rw-r--r--test/rexml/test_text.rb75
-rw-r--r--test/rexml/test_ticket_80.rb59
-rw-r--r--test/rexml/test_validation_rng.rb793
-rw-r--r--test/rexml/test_xml_declaration.rb48
-rw-r--r--test/rexml/xpath/test_attribute.rb38
-rw-r--r--test/rexml/xpath/test_axis_preceding_sibling.rb40
-rw-r--r--test/rexml/xpath/test_base.rb1125
-rw-r--r--test/rexml/xpath/test_compare.rb256
-rw-r--r--test/rexml/xpath/test_node.rb43
-rw-r--r--test/rexml/xpath/test_predicate.rb83
-rw-r--r--test/rexml/xpath/test_text.rb77
-rw-r--r--test/rinda/test_rinda.rb723
-rw-r--r--test/rinda/test_tuplebag.rb173
-rw-r--r--test/ripper/assert_parse_files.rb32
-rw-r--r--test/ripper/dummyparser.rb284
-rw-r--r--test/ripper/test_files_ext.rb8
-rw-r--r--test/ripper/test_files_lib.rb14
-rw-r--r--test/ripper/test_files_sample.rb8
-rw-r--r--test/ripper/test_files_test.rb8
-rw-r--r--test/ripper/test_files_test_1.rb9
-rw-r--r--test/ripper/test_files_test_2.rb9
-rw-r--r--test/ripper/test_filter.rb95
-rw-r--r--test/ripper/test_lexer.rb141
-rw-r--r--test/ripper/test_parser_events.rb1555
-rw-r--r--test/ripper/test_ripper.rb152
-rw-r--r--test/ripper/test_scanner_events.rb991
-rw-r--r--test/ripper/test_sexp.rb473
-rw-r--r--test/rss/dot.pngbin0 -> 111 bytes-rw-r--r--test/rss/rss-assertions.rb1974
-rw-r--r--test/rss/rss-testcase.rb219
-rw-r--r--test/rss/test_1.0.rb213
-rw-r--r--test/rss/test_2.0.rb148
-rw-r--r--test/rss/test_accessor.rb35
-rw-r--r--test/rss/test_atom.rb684
-rw-r--r--test/rss/test_content.rb79
-rw-r--r--test/rss/test_dublincore.rb321
-rw-r--r--test/rss/test_image.rb52
-rw-r--r--test/rss/test_inherit.rb8
-rw-r--r--test/rss/test_itunes.rb356
-rw-r--r--test/rss/test_maker_0.9.rb220
-rw-r--r--test/rss/test_maker_1.0.rb286
-rw-r--r--test/rss/test_maker_2.0.rb207
-rw-r--r--test/rss/test_maker_atom_entry.rb394
-rw-r--r--test/rss/test_maker_atom_feed.rb455
-rw-r--r--test/rss/test_maker_content.rb18
-rw-r--r--test/rss/test_maker_dc.rb25
-rw-r--r--test/rss/test_maker_image.rb7
-rw-r--r--test/rss/test_maker_itunes.rb487
-rw-r--r--test/rss/test_maker_slash.rb38
-rw-r--r--test/rss/test_maker_sy.rb8
-rw-r--r--test/rss/test_maker_taxo.rb9
-rw-r--r--test/rss/test_maker_trackback.rb5
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb17
-rw-r--r--test/rss/test_parser.rb93
-rw-r--r--test/rss/test_parser_1.0.rb30
-rw-r--r--test/rss/test_parser_2.0.rb3
-rw-r--r--test/rss/test_parser_atom_entry.rb164
-rw-r--r--test/rss/test_parser_atom_feed.rb277
-rw-r--r--test/rss/test_setup_maker_0.9.rb52
-rw-r--r--test/rss/test_setup_maker_1.0.rb113
-rw-r--r--test/rss/test_setup_maker_2.0.rb45
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb410
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb446
-rw-r--r--test/rss/test_setup_maker_itunes.rb144
-rw-r--r--test/rss/test_setup_maker_slash.rb39
-rw-r--r--test/rss/test_slash.rb65
-rw-r--r--test/rss/test_syndication.rb43
-rw-r--r--test/rss/test_taxonomy.rb33
-rw-r--r--test/rss/test_to_s.rb295
-rw-r--r--test/rss/test_trackback.rb31
-rw-r--r--test/rss/test_version.rb9
-rw-r--r--test/rss/test_xml-stylesheet.rb25
-rw-r--r--test/ruby/allpairs.rb103
-rw-r--r--test/ruby/beginmainend.rb7
-rw-r--r--test/ruby/bug-11928.rb14
-rw-r--r--test/ruby/bug-13526.rb22
-rw-r--r--test/ruby/enc/test_big5.rb29
-rw-r--r--test/ruby/enc/test_case_comprehensive.rb307
-rw-r--r--test/ruby/enc/test_case_mapping.rb231
-rw-r--r--test/ruby/enc/test_case_options.rb81
-rw-r--r--test/ruby/enc/test_cesu8.rb109
-rw-r--r--test/ruby/enc/test_cp949.rb29
-rw-r--r--test/ruby/enc/test_emoji.rb443
-rw-r--r--test/ruby/enc/test_emoji_breaks.rb122
-rw-r--r--test/ruby/enc/test_euc_jp.rb25
-rw-r--r--test/ruby/enc/test_euc_kr.rb37
-rw-r--r--test/ruby/enc/test_euc_tw.rb29
-rw-r--r--test/ruby/enc/test_gb18030.rb127
-rw-r--r--test/ruby/enc/test_gbk.rb29
-rw-r--r--test/ruby/enc/test_grapheme_breaks.rb95
-rw-r--r--test/ruby/enc/test_iso_8859.rb166
-rw-r--r--test/ruby/enc/test_koi8.rb23
-rw-r--r--test/ruby/enc/test_regex_casefold.rb120
-rw-r--r--test/ruby/enc/test_shift_jis.rb28
-rw-r--r--test/ruby/enc/test_utf16.rb397
-rw-r--r--test/ruby/enc/test_utf32.rb162
-rw-r--r--test/ruby/enc/test_windows_1251.rb17
-rw-r--r--test/ruby/enc/test_windows_1252.rb26
-rw-r--r--test/ruby/endblockwarn.rb12
-rw-r--r--test/ruby/envutil.rb28
-rw-r--r--test/ruby/lbtest.rb49
-rw-r--r--test/ruby/marshaltestlib.rb191
-rw-r--r--test/ruby/sentence.rb669
-rw-r--r--test/ruby/test_alias.rb222
-rw-r--r--test/ruby/test_argf.rb1077
-rw-r--r--test/ruby/test_arithmetic_sequence.rb489
-rw-r--r--test/ruby/test_arity.rb70
-rw-r--r--test/ruby/test_array.rb3108
-rw-r--r--test/ruby/test_assignment.rb805
-rw-r--r--test/ruby/test_ast.rb315
-rw-r--r--test/ruby/test_autoload.rb449
-rw-r--r--test/ruby/test_backtrace.rb346
-rw-r--r--test/ruby/test_basicinstructions.rb722
-rw-r--r--test/ruby/test_beginendblock.rb200
-rw-r--r--test/ruby/test_bignum.rb716
-rw-r--r--test/ruby/test_call.rb87
-rw-r--r--test/ruby/test_case.rb97
-rw-r--r--test/ruby/test_class.rb686
-rw-r--r--test/ruby/test_clone.rb38
-rw-r--r--test/ruby/test_comparable.rb145
-rw-r--r--test/ruby/test_complex.rb1145
-rw-r--r--test/ruby/test_complex2.rb736
-rw-r--r--test/ruby/test_complexrational.rb408
-rw-r--r--test/ruby/test_condition.rb1
-rw-r--r--test/ruby/test_const.rb62
-rw-r--r--test/ruby/test_continuation.rb145
-rw-r--r--test/ruby/test_default_gems.rb16
-rw-r--r--test/ruby/test_defined.rb221
-rw-r--r--test/ruby/test_dir.rb461
-rw-r--r--test/ruby/test_dir_m17n.rb449
-rw-r--r--test/ruby/test_econv.rb928
-rw-r--r--test/ruby/test_encoding.rb137
-rw-r--r--test/ruby/test_enum.rb1161
-rw-r--r--test/ruby/test_enumerator.rb883
-rw-r--r--test/ruby/test_env.rb536
-rw-r--r--test/ruby/test_eval.rb508
-rw-r--r--test/ruby/test_exception.rb1356
-rw-r--r--test/ruby/test_fiber.rb457
-rw-r--r--test/ruby/test_file.rb543
-rw-r--r--test/ruby/test_file_exhaustive.rb1726
-rw-r--r--test/ruby/test_fixnum.rb352
-rw-r--r--test/ruby/test_flip.rb75
-rw-r--r--test/ruby/test_float.rb898
-rw-r--r--test/ruby/test_fnmatch.rb169
-rw-r--r--test/ruby/test_gc.rb452
-rw-r--r--test/ruby/test_gc_compact.rb63
-rw-r--r--test/ruby/test_hash.rb1275
-rw-r--r--test/ruby/test_ifunless.rb17
-rw-r--r--test/ruby/test_integer.rb662
-rw-r--r--test/ruby/test_integer_comb.rb634
-rw-r--r--test/ruby/test_io.rb3955
-rw-r--r--test/ruby/test_io_m17n.rb2747
-rw-r--r--test/ruby/test_iseq.rb569
-rw-r--r--test/ruby/test_iterator.rb200
-rw-r--r--test/ruby/test_jit.rb1070
-rw-r--r--test/ruby/test_key_error.rb42
-rw-r--r--test/ruby/test_keyword.rb5054
-rw-r--r--test/ruby/test_lambda.rb245
-rw-r--r--test/ruby/test_lazy_enumerator.rb681
-rw-r--r--test/ruby/test_literal.rb603
-rw-r--r--test/ruby/test_m17n.rb1714
-rw-r--r--test/ruby/test_m17n_comb.rb1653
-rw-r--r--test/ruby/test_marshal.rb730
-rw-r--r--test/ruby/test_math.rb343
-rw-r--r--test/ruby/test_metaclass.rb168
-rw-r--r--test/ruby/test_method.rb1232
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb30
-rw-r--r--test/ruby/test_module.rb2507
-rw-r--r--test/ruby/test_not.rb13
-rw-r--r--test/ruby/test_notimp.rb85
-rw-r--r--test/ruby/test_numeric.rb443
-rw-r--r--test/ruby/test_object.rb966
-rw-r--r--test/ruby/test_objectspace.rb192
-rw-r--r--test/ruby/test_optimization.rb848
-rw-r--r--test/ruby/test_pack.rb830
-rw-r--r--test/ruby/test_parse.rb1174
-rw-r--r--test/ruby/test_path.rb65
-rw-r--r--test/ruby/test_pattern_matching.rb1314
-rw-r--r--test/ruby/test_pipe.rb37
-rw-r--r--test/ruby/test_primitive.rb424
-rw-r--r--test/ruby/test_proc.rb1547
-rw-r--r--test/ruby/test_process.rb2431
-rw-r--r--test/ruby/test_rand.rb623
-rw-r--r--test/ruby/test_range.rb946
-rw-r--r--test/ruby/test_rational.rb1062
-rw-r--r--test/ruby/test_rational2.rb1387
-rw-r--r--test/ruby/test_readpartial.rb19
-rw-r--r--test/ruby/test_refinement.rb2390
-rw-r--r--test/ruby/test_regexp.rb1305
-rw-r--r--test/ruby/test_require.rb846
-rw-r--r--test/ruby/test_require_lib.rb28
-rw-r--r--test/ruby/test_rubyoptions.rb1074
-rw-r--r--test/ruby/test_rubyvm.rb18
-rw-r--r--test/ruby/test_rubyvm_mjit.rb91
-rw-r--r--test/ruby/test_settracefunc.rb2377
-rw-r--r--test/ruby/test_signal.rb403
-rw-r--r--test/ruby/test_sleep.rb17
-rw-r--r--test/ruby/test_sprintf.rb546
-rw-r--r--test/ruby/test_sprintf_comb.rb554
-rw-r--r--test/ruby/test_string.rb3171
-rw-r--r--test/ruby/test_stringchar.rb66
-rw-r--r--test/ruby/test_struct.rb447
-rw-r--r--test/ruby/test_super.rb479
-rw-r--r--test/ruby/test_symbol.rb532
-rw-r--r--test/ruby/test_syntax.rb1577
-rw-r--r--test/ruby/test_system.rb223
-rw-r--r--test/ruby/test_thread.rb1391
-rw-r--r--test/ruby/test_thread_cv.rb245
-rw-r--r--test/ruby/test_thread_queue.rb626
-rw-r--r--test/ruby/test_threadgroup.rb57
-rw-r--r--test/ruby/test_time.rb1203
-rw-r--r--test/ruby/test_time_tz.rb788
-rw-r--r--test/ruby/test_trace.rb36
-rw-r--r--test/ruby/test_transcode.rb2253
-rw-r--r--test/ruby/test_undef.rb38
-rw-r--r--test/ruby/test_unicode_escape.rb272
-rw-r--r--test/ruby/test_variable.rb190
-rw-r--r--test/ruby/test_vm_dump.rb21
-rw-r--r--test/ruby/test_weakmap.rb161
-rw-r--r--test/ruby/test_whileuntil.rb114
-rw-r--r--test/ruby/test_yield.rb425
-rw-r--r--test/ruby/ut_eof.rb17
-rw-r--r--test/rubygems/alternate_cert.pem19
-rw-r--r--test/rubygems/alternate_cert_32.pem19
-rw-r--r--test/rubygems/alternate_key.pem27
-rw-r--r--test/rubygems/bad_rake.rb2
-rw-r--r--test/rubygems/bogussources.rb9
-rw-r--r--test/rubygems/ca_cert.pem77
-rw-r--r--test/rubygems/child_cert.pem20
-rw-r--r--test/rubygems/child_cert_32.pem20
-rw-r--r--test/rubygems/child_key.pem27
-rw-r--r--test/rubygems/client.pem107
-rw-r--r--test/rubygems/data/gem-private_key.pem27
-rw-r--r--test/rubygems/data/gem-public_cert.pem20
-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin0 -> 554 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem30
-rw-r--r--test/rubygems/expired_cert.pem19
-rw-r--r--test/rubygems/fake_certlib/openssl.rb8
-rw-r--r--test/rubygems/foo/discover.rb1
-rw-r--r--test/rubygems/future_cert.pem19
-rw-r--r--test/rubygems/future_cert_32.pem19
-rw-r--r--test/rubygems/good_rake.rb2
-rw-r--r--test/rubygems/grandchild_cert.pem20
-rw-r--r--test/rubygems/grandchild_cert_32.pem20
-rw-r--r--test/rubygems/grandchild_key.pem27
-rw-r--r--test/rubygems/invalid_client.pem49
-rw-r--r--test/rubygems/invalid_issuer_cert.pem20
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem20
-rw-r--r--test/rubygems/invalid_key.pem27
-rw-r--r--test/rubygems/invalid_signer_cert.pem19
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem19
-rw-r--r--test/rubygems/invalidchild_cert.pem20
-rw-r--r--test/rubygems/invalidchild_cert_32.pem20
-rw-r--r--test/rubygems/invalidchild_key.pem27
-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb6
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb3
-rw-r--r--test/rubygems/private3072_key.pem40
-rw-r--r--test/rubygems/private_key.pem27
-rw-r--r--test/rubygems/public3072_cert.pem25
-rw-r--r--test/rubygems/public_cert.pem20
-rw-r--r--test/rubygems/public_cert_32.pem19
-rw-r--r--test/rubygems/public_key.pem9
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb6
-rw-r--r--test/rubygems/rubygems_plugin.rb25
-rw-r--r--test/rubygems/sff/discover.rb1
-rw-r--r--test/rubygems/simple_gem.rb67
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec9
-rw-r--r--test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspecbin0 -> 269 bytes-rw-r--r--test/rubygems/ssl_cert.pem80
-rw-r--r--test/rubygems/ssl_key.pem27
-rw-r--r--test/rubygems/test_bundled_ca.rb63
-rw-r--r--test/rubygems/test_config.rb29
-rw-r--r--test/rubygems/test_deprecate.rb80
-rw-r--r--test/rubygems/test_gem.rb1983
-rw-r--r--test/rubygems/test_gem_available_set.rb131
-rw-r--r--test/rubygems/test_gem_bundler_version_finder.rb132
-rw-r--r--test/rubygems/test_gem_command.rb371
-rw-r--r--test/rubygems/test_gem_command_manager.rb271
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb492
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb810
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb69
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb282
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb239
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb229
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb145
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb126
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb86
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb75
-rw-r--r--test/rubygems/test_gem_commands_info_command.rb45
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb1350
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb34
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb68
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb21
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb100
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb272
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb627
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb409
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb857
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb17
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb63
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb372
-rw-r--r--test/rubygems/test_gem_commands_signin_command.rb99
-rw-r--r--test/rubygems/test_gem_commands_signout_command.rb37
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb388
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb250
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb44
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb505
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb225
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb588
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb86
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb144
-rw-r--r--test/rubygems/test_gem_config_file.rb499
-rw-r--r--test/rubygems/test_gem_dependency.rb395
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb1269
-rw-r--r--test/rubygems/test_gem_dependency_list.rb266
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb28
-rw-r--r--test/rubygems/test_gem_doctor.rb168
-rw-r--r--test/rubygems/test_gem_ext_builder.rb332
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb90
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb95
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb245
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb95
-rw-r--r--test/rubygems/test_gem_gem_runner.rb70
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb261
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb61
-rw-r--r--test/rubygems/test_gem_indexer.rb363
-rw-r--r--test/rubygems/test_gem_install_update_options.rb197
-rw-r--r--test/rubygems/test_gem_installer.rb2090
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb134
-rw-r--r--test/rubygems/test_gem_name_tuple.rb44
-rw-r--r--test/rubygems/test_gem_package.rb1170
-rw-r--r--test/rubygems/test_gem_package_old.rb92
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb208
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb89
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb154
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb329
-rw-r--r--test/rubygems/test_gem_package_task.rb84
-rw-r--r--test/rubygems/test_gem_path_support.rb144
-rw-r--r--test/rubygems/test_gem_platform.rb309
-rw-r--r--test/rubygems/test_gem_rdoc.rb138
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb1187
-rw-r--r--test/rubygems/test_gem_request.rb513
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb154
-rw-r--r--test/rubygems/test_gem_request_set.rb620
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb849
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb470
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_parser.rb545
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_tokenizer.rb308
-rw-r--r--test/rubygems/test_gem_requirement.rb425
-rw-r--r--test/rubygems/test_gem_resolver.rb793
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb44
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb208
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb168
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb137
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb45
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb83
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb84
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb189
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb114
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb89
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb94
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb48
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb259
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb45
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb63
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb99
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb20
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb66
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb83
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb83
-rw-r--r--test/rubygems/test_gem_security.rb314
-rw-r--r--test/rubygems/test_gem_security_policy.rb540
-rw-r--r--test/rubygems/test_gem_security_signer.rb219
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb100
-rw-r--r--test/rubygems/test_gem_server.rb612
-rw-r--r--test/rubygems/test_gem_silent_ui.rb118
-rw-r--r--test/rubygems/test_gem_source.rb252
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb28
-rw-r--r--test/rubygems/test_gem_source_git.rb303
-rw-r--r--test/rubygems/test_gem_source_installed.rb36
-rw-r--r--test/rubygems/test_gem_source_list.rb119
-rw-r--r--test/rubygems/test_gem_source_local.rb108
-rw-r--r--test/rubygems/test_gem_source_lock.rb114
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb77
-rw-r--r--test/rubygems/test_gem_source_vendor.rb31
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb330
-rw-r--r--test/rubygems/test_gem_specification.rb3880
-rw-r--r--test/rubygems/test_gem_stream_ui.rb224
-rw-r--r--test/rubygems/test_gem_stub_specification.rb296
-rw-r--r--test/rubygems/test_gem_text.rb98
-rw-r--r--test/rubygems/test_gem_uninstaller.rb545
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb32
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb28
-rw-r--r--test/rubygems/test_gem_util.rb88
-rw-r--r--test/rubygems/test_gem_validator.rb44
-rw-r--r--test/rubygems/test_gem_version.rb302
-rw-r--r--test/rubygems/test_gem_version_option.rb166
-rw-r--r--test/rubygems/test_kernel.rb124
-rw-r--r--test/rubygems/test_project_sanity.rb15
-rw-r--r--test/rubygems/test_remote_fetch_error.rb21
-rw-r--r--test/rubygems/test_require.rb542
-rw-r--r--test/rubygems/wrong_key_cert.pem19
-rw-r--r--test/rubygems/wrong_key_cert_32.pem19
-rw-r--r--test/runner.rb14
-rw-r--r--test/sdbm/test_sdbm.rb150
-rw-r--r--test/soap/asp.net/hello.wsdl96
-rw-r--r--test/soap/asp.net/test_aspdotnet.rb111
-rw-r--r--test/soap/calc/calc.rb17
-rw-r--r--test/soap/calc/calc2.rb29
-rw-r--r--test/soap/calc/server.cgi13
-rw-r--r--test/soap/calc/server.rb17
-rw-r--r--test/soap/calc/server2.rb20
-rw-r--r--test/soap/calc/test_calc.rb49
-rw-r--r--test/soap/calc/test_calc2.rb53
-rw-r--r--test/soap/calc/test_calc_cgi.rb69
-rw-r--r--test/soap/fault/test_customfault.rb58
-rw-r--r--test/soap/header/server.cgi119
-rw-r--r--test/soap/header/test_authheader.rb240
-rw-r--r--test/soap/header/test_authheader_cgi.rb121
-rw-r--r--test/soap/header/test_simplehandler.rb116
-rw-r--r--test/soap/helloworld/hw_s.rb16
-rw-r--r--test/soap/helloworld/test_helloworld.rb40
-rw-r--r--test/soap/marshal/test_digraph.rb56
-rw-r--r--test/soap/marshal/test_marshal.rb26
-rw-r--r--test/soap/marshal/test_struct.rb47
-rw-r--r--test/soap/ssl/README1
-rw-r--r--test/soap/ssl/ca.cert23
-rw-r--r--test/soap/ssl/client.cert19
-rw-r--r--test/soap/ssl/client.key15
-rw-r--r--test/soap/ssl/server.cert19
-rw-r--r--test/soap/ssl/server.key15
-rw-r--r--test/soap/ssl/sslsvr.rb57
-rw-r--r--test/soap/ssl/subca.cert21
-rw-r--r--test/soap/ssl/test_ssl.rb204
-rw-r--r--test/soap/struct/test_struct.rb77
-rw-r--r--test/soap/swa/test_file.rb73
-rw-r--r--test/soap/test_basetype.rb970
-rw-r--r--test/soap/test_envelopenamespace.rb92
-rw-r--r--test/soap/test_httpconfigloader.rb39
-rw-r--r--test/soap/test_mapping.rb59
-rw-r--r--test/soap/test_no_indent.rb86
-rw-r--r--test/soap/test_property.rb424
-rw-r--r--test/soap/test_soapelement.rb122
-rw-r--r--test/soap/test_streamhandler.rb209
-rw-r--r--test/soap/test_styleuse.rb333
-rw-r--r--test/soap/wsdlDriver/README.txt2
-rw-r--r--test/soap/wsdlDriver/calc.wsdl126
-rw-r--r--test/soap/wsdlDriver/document.wsdl54
-rw-r--r--test/soap/wsdlDriver/echo_version.rb20
-rw-r--r--test/soap/wsdlDriver/simpletype.wsdl63
-rw-r--r--test/soap/wsdlDriver/test_calc.rb100
-rw-r--r--test/soap/wsdlDriver/test_document.rb78
-rw-r--r--test/soap/wsdlDriver/test_simpletype.rb87
-rw-r--r--test/socket/test_addrinfo.rb696
-rw-r--r--test/socket/test_ancdata.rb68
-rw-r--r--test/socket/test_basicsocket.rb230
-rw-r--r--test/socket/test_nonblock.rb276
-rw-r--r--test/socket/test_socket.rb773
-rw-r--r--test/socket/test_sockopt.rb80
-rw-r--r--test/socket/test_tcp.rb98
-rw-r--r--test/socket/test_udp.rb116
-rw-r--r--test/socket/test_unix.rb606
-rw-r--r--test/stringio/test_stringio.rb780
-rw-r--r--test/strscan/test_stringscanner.rb512
-rw-r--r--test/syslog/test_syslog_logger.rb588
-rw-r--r--test/test_abbrev.rb55
-rw-r--r--test/test_delegate.rb333
-rw-r--r--test/test_extlibs.rb83
-rw-r--r--test/test_find.rb334
-rw-r--r--test/test_forwardable.rb402
-rw-r--r--test/test_ipaddr.rb391
-rw-r--r--test/test_mutex_m.rb26
-rw-r--r--test/test_observer.rb66
-rw-r--r--test/test_open3.rb325
-rw-r--r--test/test_pp.rb218
-rw-r--r--test/test_prettyprint.rb521
-rw-r--r--test/test_prime.rb280
-rw-r--r--test/test_pstore.rb150
-rw-r--r--test/test_pty.rb239
-rw-r--r--test/test_rbconfig.rb54
-rw-r--r--test/test_securerandom.rb199
-rw-r--r--test/test_set.rb918
-rw-r--r--test/test_shellwords.rb131
-rw-r--r--test/test_singleton.rb104
-rw-r--r--test/test_syslog.rb192
-rw-r--r--test/test_tempfile.rb405
-rw-r--r--test/test_time.rb579
-rw-r--r--test/test_timeout.rb110
-rw-r--r--test/test_tmpdir.rb80
-rw-r--r--test/test_tracer.rb234
-rw-r--r--test/test_tsort.rb115
-rw-r--r--test/test_unicode_normalize.rb212
-rw-r--r--test/test_weakref.rb72
-rw-r--r--test/test_win32api.rb27
-rw-r--r--test/testunit/collector/test_dir.rb389
-rw-r--r--test/testunit/collector/test_objectspace.rb98
-rw-r--r--test/testunit/runit/test_assert.rb402
-rw-r--r--test/testunit/runit/test_testcase.rb91
-rw-r--r--test/testunit/runit/test_testresult.rb144
-rw-r--r--test/testunit/runit/test_testsuite.rb49
-rw-r--r--test/testunit/test_assertions.rb528
-rw-r--r--test/testunit/test_error.rb26
-rw-r--r--test/testunit/test_failure.rb33
-rw-r--r--test/testunit/test_testcase.rb275
-rw-r--r--test/testunit/test_testresult.rb104
-rw-r--r--test/testunit/test_testsuite.rb129
-rw-r--r--test/testunit/util/test_backtracefilter.rb41
-rw-r--r--test/testunit/util/test_observable.rb102
-rw-r--r--test/testunit/util/test_procwrapper.rb36
-rw-r--r--test/uri/test_common.rb176
-rw-r--r--test/uri/test_file.rb67
-rw-r--r--test/uri/test_ftp.rb31
-rw-r--r--test/uri/test_generic.rb509
-rw-r--r--test/uri/test_http.rb11
-rw-r--r--test/uri/test_ldap.rb33
-rw-r--r--test/uri/test_mailto.rb117
-rw-r--r--test/uri/test_parser.rb61
-rw-r--r--test/webrick/test_cgi.rb143
-rw-r--r--test/webrick/test_config.rb17
-rw-r--r--test/webrick/test_cookie.rb68
-rw-r--r--test/webrick/test_do_not_reverse_lookup.rb71
-rw-r--r--test/webrick/test_filehandler.rb247
-rw-r--r--test/webrick/test_htgroup.rb19
-rw-r--r--test/webrick/test_htmlutils.rb21
-rw-r--r--test/webrick/test_httpauth.rb376
-rw-r--r--test/webrick/test_httpproxy.rb466
-rw-r--r--test/webrick/test_httprequest.rb214
-rw-r--r--test/webrick/test_httpresponse.rb282
-rw-r--r--test/webrick/test_https.rb112
-rw-r--r--test/webrick/test_httpserver.rb355
-rw-r--r--test/webrick/test_httpstatus.rb35
-rw-r--r--test/webrick/test_httputils.rb41
-rw-r--r--test/webrick/test_httpversion.rb1
-rw-r--r--test/webrick/test_server.rb131
-rw-r--r--test/webrick/test_ssl_server.rb67
-rw-r--r--test/webrick/test_utils.rb110
-rw-r--r--test/webrick/utils.rb76
-rw-r--r--test/webrick/webrick.cgi6
-rw-r--r--test/webrick/webrick.rhtml4
-rw-r--r--[-rwxr-xr-x]test/webrick/webrick_long_filename.cgi2
-rw-r--r--test/win32ole/available_ole.rb41
-rw-r--r--test/win32ole/err_in_callback.rb10
-rw-r--r--test/win32ole/orig_data.csv5
-rw-r--r--test/win32ole/test_err_in_callback.rb56
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb66
-rw-r--r--test/win32ole/test_nil2vtempty.rb37
-rw-r--r--test/win32ole/test_ole_methods.rb35
-rw-r--r--test/win32ole/test_propertyputref.rb31
-rw-r--r--test/win32ole/test_thread.rb34
-rw-r--r--test/win32ole/test_win32ole.rb534
-rw-r--r--test/win32ole/test_win32ole_event.rb406
-rw-r--r--test/win32ole/test_win32ole_method.rb134
-rw-r--r--test/win32ole/test_win32ole_method_event.rb36
-rw-r--r--test/win32ole/test_win32ole_param.rb98
-rw-r--r--test/win32ole/test_win32ole_param_event.rb30
-rw-r--r--test/win32ole/test_win32ole_record.rb209
-rw-r--r--test/win32ole/test_win32ole_type.rb200
-rw-r--r--test/win32ole/test_win32ole_type_event.rb44
-rw-r--r--test/win32ole/test_win32ole_typelib.rb117
-rw-r--r--test/win32ole/test_win32ole_variable.rb62
-rw-r--r--test/win32ole/test_win32ole_variant.rb722
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb36
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb69
-rw-r--r--test/win32ole/test_word.rb73
-rw-r--r--test/wsdl/any/any.wsdl50
-rw-r--r--test/wsdl/any/expectedDriver.rb54
-rw-r--r--test/wsdl/any/expectedEcho.rb14
-rw-r--r--test/wsdl/any/expectedService.rb52
-rw-r--r--test/wsdl/any/test_any.rb58
-rw-r--r--test/wsdl/axisArray/axisArray.wsdl60
-rw-r--r--test/wsdl/axisArray/itemList.rb27
-rw-r--r--test/wsdl/axisArray/test_axisarray.rb69
-rw-r--r--test/wsdl/datetime/DatetimeService.rb44
-rw-r--r--test/wsdl/datetime/datetime.wsdl45
-rw-r--r--test/wsdl/datetime/datetimeServant.rb21
-rw-r--r--test/wsdl/datetime/test_datetime.rb82
-rw-r--r--test/wsdl/document/document.wsdl74
-rw-r--r--test/wsdl/document/echo.rb92
-rw-r--r--test/wsdl/document/number.wsdl54
-rw-r--r--test/wsdl/document/ping_nosoapaction.wsdl66
-rw-r--r--test/wsdl/document/test_nosoapaction.rb109
-rw-r--r--test/wsdl/document/test_number.rb99
-rw-r--r--test/wsdl/document/test_rpc.rb177
-rw-r--r--test/wsdl/emptycomplextype.wsdl31
-rw-r--r--test/wsdl/map/map.wsdl92
-rw-r--r--test/wsdl/map/map.xml43
-rw-r--r--test/wsdl/map/test_map.rb99
-rw-r--r--test/wsdl/marshal/person.wsdl21
-rw-r--r--test/wsdl/marshal/person_org.rb22
-rw-r--r--test/wsdl/marshal/test_wsdlmarshal.rb80
-rw-r--r--test/wsdl/multiplefault.wsdl68
-rw-r--r--test/wsdl/qualified/lp.wsdl47
-rw-r--r--test/wsdl/qualified/lp.xsd26
-rw-r--r--test/wsdl/qualified/np.wsdl50
-rw-r--r--test/wsdl/qualified/test_qualified.rb154
-rw-r--r--test/wsdl/qualified/test_unqualified.rb143
-rw-r--r--test/wsdl/raa/RAA.rb243
-rw-r--r--test/wsdl/raa/RAAServant.rb99
-rw-r--r--test/wsdl/raa/RAAService.rb100
-rw-r--r--test/wsdl/raa/README.txt8
-rw-r--r--test/wsdl/raa/raa.wsdl264
-rw-r--r--test/wsdl/raa/server.rb103
-rw-r--r--test/wsdl/raa/test_raa.rb71
-rw-r--r--test/wsdl/ref/expectedProduct.rb90
-rw-r--r--test/wsdl/ref/product.wsdl86
-rw-r--r--test/wsdl/ref/test_ref.rb54
-rw-r--r--test/wsdl/rpc/echoDriver.rb55
-rw-r--r--test/wsdl/rpc/echo_serviceClient.rb23
-rw-r--r--test/wsdl/rpc/rpc.wsdl75
-rw-r--r--test/wsdl/rpc/test-rpc-lit.wsdl364
-rw-r--r--test/wsdl/rpc/test-rpc-lit12.wsdl455
-rw-r--r--test/wsdl/rpc/test_rpc.rb118
-rw-r--r--test/wsdl/rpc/test_rpc_lit.rb399
-rw-r--r--test/wsdl/simpletype/rpc/expectedClient.rb34
-rw-r--r--test/wsdl/simpletype/rpc/expectedDriver.rb62
-rw-r--r--test/wsdl/simpletype/rpc/expectedEchoVersion.rb23
-rw-r--r--test/wsdl/simpletype/rpc/expectedServant.rb32
-rw-r--r--test/wsdl/simpletype/rpc/expectedService.rb60
-rw-r--r--test/wsdl/simpletype/rpc/rpc.wsdl80
-rw-r--r--test/wsdl/simpletype/rpc/test_rpc.rb62
-rw-r--r--test/wsdl/simpletype/simpletype.wsdl95
-rw-r--r--test/wsdl/simpletype/test_simpletype.rb99
-rw-r--r--test/wsdl/soap/soapbodyparts.wsdl103
-rw-r--r--test/wsdl/soap/test_soapbodyparts.rb79
-rw-r--r--test/wsdl/test_emptycomplextype.rb21
-rw-r--r--test/wsdl/test_fault.rb51
-rw-r--r--test/wsdl/test_multiplefault.rb39
-rw-r--r--test/xmlrpc/data/bug_bool.expected3
-rw-r--r--test/xmlrpc/data/bug_bool.xml8
-rw-r--r--test/xmlrpc/data/bug_cdata.expected3
-rw-r--r--test/xmlrpc/data/bug_cdata.xml8
-rw-r--r--test/xmlrpc/data/bug_covert.expected10
-rw-r--r--test/xmlrpc/data/bug_covert.xml6
-rw-r--r--test/xmlrpc/data/datetime_iso8601.xml8
-rw-r--r--test/xmlrpc/data/fault.xml16
-rw-r--r--test/xmlrpc/data/value.expected7
-rw-r--r--test/xmlrpc/data/value.xml22
-rw-r--r--test/xmlrpc/data/xml1.expected243
-rw-r--r--test/xmlrpc/data/xml1.xml1
-rw-r--r--test/xmlrpc/test_datetime.rb159
-rw-r--r--test/xmlrpc/test_features.rb48
-rw-r--r--test/xmlrpc/test_marshal.rb93
-rw-r--r--test/xmlrpc/test_parser.rb85
-rw-r--r--test/xmlrpc/test_webrick_server.rb98
-rw-r--r--test/xmlrpc/webrick_testing.rb37
-rw-r--r--test/xsd/codegen/test_classdef.rb214
-rw-r--r--test/xsd/noencoding.xml4
-rw-r--r--test/xsd/test_noencoding.rb32
-rw-r--r--test/xsd/test_xmlschemaparser.rb22
-rw-r--r--test/xsd/test_xsd.rb1511
-rw-r--r--test/xsd/xmlschema.xml12
-rw-r--r--test/yaml/test_store.rb180
-rw-r--r--test/yaml/test_yaml.rb1292
-rw-r--r--test/zlib/test_zlib.rb1214
-rw-r--r--thread.c5564
-rw-r--r--thread_pthread.c2176
-rw-r--r--thread_pthread.h75
-rw-r--r--thread_sync.c1540
-rw-r--r--thread_win32.c845
-rw-r--r--thread_win32.h36
-rw-r--r--time.c6424
-rw-r--r--timev.h56
-rwxr-xr-xtool/actions-commit-info.sh17
-rw-r--r--tool/asm_parse.rb53
-rwxr-xr-xtool/bisect.sh50
-rwxr-xr-xtool/build-transcode16
-rwxr-xr-xtool/checksum.rb72
-rw-r--r--tool/colors3
-rwxr-xr-xtool/darwin-cc6
-rw-r--r--tool/downloader.rb392
-rw-r--r--tool/enc-emoji-citrus-gen.rb131
-rw-r--r--tool/enc-emoji4unicode.rb133
-rwxr-xr-xtool/enc-unicode.rb577
-rw-r--r--tool/eval.rb158
-rwxr-xr-xtool/expand-config.rb33
-rwxr-xr-xtool/extlibs.rb187
-rw-r--r--tool/fake.rb57
-rwxr-xr-xtool/fetch-bundled_gems.rb31
-rwxr-xr-xtool/file2lastrev.rb124
-rwxr-xr-xtool/format-release245
-rw-r--r--tool/gem-unpack.rb18
-rwxr-xr-xtool/gen-mailmap.rb47
-rwxr-xr-xtool/gen_dummy_probes.rb32
-rwxr-xr-xtool/gen_ruby_tapset.rb105
-rw-r--r--tool/generic_erb.rb61
-rwxr-xr-xtool/git-refresh46
-rw-r--r--tool/gperf.sed22
-rwxr-xr-xtool/id2token.rb26
-rwxr-xr-xtool/ifchange90
-rwxr-xr-xtool/insns2vm.rb15
-rw-r--r--tool/install-sh17
-rwxr-xr-xtool/leaked-globals40
-rw-r--r--tool/lib/-test-/integer.rb14
-rw-r--r--tool/lib/colorize.rb51
-rw-r--r--tool/lib/envutil.rb342
-rw-r--r--tool/lib/find_executable.rb22
-rw-r--r--tool/lib/gc_compact_checker.rb10
-rw-r--r--tool/lib/iseq_loader_checker.rb81
-rw-r--r--tool/lib/jisx0208.rb86
-rw-r--r--tool/lib/leakchecker.rb240
-rw-r--r--tool/lib/memory_status.rb149
-rw-r--r--tool/lib/minitest/README.txt457
-rw-r--r--tool/lib/minitest/autorun.rb14
-rw-r--r--tool/lib/minitest/benchmark.rb418
-rw-r--r--tool/lib/minitest/mock.rb196
-rw-r--r--tool/lib/minitest/unit.rb1434
-rw-r--r--tool/lib/profile_test_all.rb91
-rw-r--r--tool/lib/test/unit.rb1219
-rw-r--r--tool/lib/test/unit/assertions.rb583
-rw-r--r--tool/lib/test/unit/core_assertions.rb420
-rw-r--r--tool/lib/test/unit/parallel.rb214
-rw-r--r--tool/lib/test/unit/testcase.rb36
-rw-r--r--tool/lib/tracepointchecker.rb126
-rw-r--r--tool/lib/vcs.rb752
-rw-r--r--tool/lib/vpath.rb87
-rw-r--r--tool/lib/zombie_hunter.rb10
-rw-r--r--tool/m4/_colorize_result_prepare.m433
-rw-r--r--tool/m4/ac_msg_result.m45
-rw-r--r--tool/m4/colorize_result.m49
-rw-r--r--tool/m4/ruby_append_option.m45
-rw-r--r--tool/m4/ruby_append_options.m47
-rw-r--r--tool/m4/ruby_check_builtin_func.m410
-rw-r--r--tool/m4/ruby_check_builtin_setjmp.m427
-rw-r--r--tool/m4/ruby_check_printf_prefix.m430
-rw-r--r--tool/m4/ruby_check_setjmp.m417
-rw-r--r--tool/m4/ruby_check_signedness.m45
-rw-r--r--tool/m4/ruby_check_sizeof.m4108
-rw-r--r--tool/m4/ruby_check_sysconf.m413
-rw-r--r--tool/m4/ruby_cppoutfile.m418
-rw-r--r--tool/m4/ruby_decl_attribute.m445
-rw-r--r--tool/m4/ruby_default_arch.m411
-rw-r--r--tool/m4/ruby_define_if.m412
-rw-r--r--tool/m4/ruby_defint.m440
-rw-r--r--tool/m4/ruby_dtrace_available.m420
-rw-r--r--tool/m4/ruby_dtrace_postprocess.m430
-rw-r--r--tool/m4/ruby_func_attribute.m47
-rw-r--r--tool/m4/ruby_mingw32.m424
-rw-r--r--tool/m4/ruby_prepend_option.m45
-rw-r--r--tool/m4/ruby_prog_gnu_ld.m410
-rw-r--r--tool/m4/ruby_replace_funcs.m413
-rw-r--r--tool/m4/ruby_replace_type.m458
-rw-r--r--tool/m4/ruby_rm_recursive.m418
-rw-r--r--tool/m4/ruby_setjmp_type.m452
-rw-r--r--tool/m4/ruby_stack_grow_direction.m430
-rw-r--r--tool/m4/ruby_try_cflags.m412
-rw-r--r--tool/m4/ruby_try_ldflags.m415
-rw-r--r--tool/m4/ruby_type_attribute.m48
-rw-r--r--tool/m4/ruby_universal_arch.m487
-rw-r--r--tool/m4/ruby_werror_flag.m418
-rwxr-xr-xtool/make-snapshot644
-rw-r--r--tool/make_hgraph.rb95
-rwxr-xr-xtool/mdoc2man.rb505
-rwxr-xr-xtool/merger.rb371
-rw-r--r--tool/mjit_archflag.sh40
-rw-r--r--tool/mk_builtin_binary.rb44
-rw-r--r--tool/mk_builtin_loader.rb201
-rw-r--r--tool/mk_call_iseq_optimized.rb74
-rwxr-xr-xtool/mkconfig.rb380
-rwxr-xr-xtool/mkrunnable.rb135
-rwxr-xr-xtool/node_name.rb8
-rw-r--r--tool/parse.rb16
-rw-r--r--tool/prereq.status44
-rw-r--r--tool/probes_to_wiki.rb16
-rwxr-xr-xtool/pure_parser.rb20
-rwxr-xr-xtool/rbinstall.rb951
-rwxr-xr-xtool/rbuninstall.rb71
-rwxr-xr-xtool/redmine-backporter.rb589
-rwxr-xr-xtool/release.sh19
-rwxr-xr-xtool/rmdirs14
-rw-r--r--tool/ruby_vm/controllers/application_controller.rb25
-rw-r--r--tool/ruby_vm/helpers/c_escape.rb128
-rw-r--r--tool/ruby_vm/helpers/dumper.rb112
-rw-r--r--tool/ruby_vm/helpers/scanner.rb52
-rw-r--r--tool/ruby_vm/loaders/insns_def.rb96
-rw-r--r--tool/ruby_vm/loaders/opt_insn_unif_def.rb34
-rw-r--r--tool/ruby_vm/loaders/opt_operand_def.rb56
-rw-r--r--tool/ruby_vm/loaders/vm_opts_h.rb37
-rw-r--r--tool/ruby_vm/models/attribute.rb59
-rwxr-xr-xtool/ruby_vm/models/bare_instructions.rb236
-rw-r--r--tool/ruby_vm/models/c_expr.rb41
-rw-r--r--tool/ruby_vm/models/instructions.rb22
-rw-r--r--tool/ruby_vm/models/instructions_unifications.rb43
-rw-r--r--tool/ruby_vm/models/operands_unifications.rb142
-rw-r--r--tool/ruby_vm/models/trace_instructions.rb71
-rw-r--r--tool/ruby_vm/models/typemap.rb63
-rw-r--r--tool/ruby_vm/scripts/converter.rb29
-rw-r--r--tool/ruby_vm/scripts/insns2vm.rb93
-rw-r--r--tool/ruby_vm/tests/.gitkeep0
-rw-r--r--tool/ruby_vm/views/_attributes.erb35
-rw-r--r--tool/ruby_vm/views/_c_expr.erb17
-rw-r--r--tool/ruby_vm/views/_comptime_insn_stack_increase.erb62
-rw-r--r--tool/ruby_vm/views/_copyright.erb31
-rw-r--r--tool/ruby_vm/views/_insn_entry.erb76
-rw-r--r--tool/ruby_vm/views/_insn_len_info.erb21
-rw-r--r--tool/ruby_vm/views/_insn_name_info.erb38
-rw-r--r--tool/ruby_vm/views/_insn_operand_info.erb46
-rw-r--r--tool/ruby_vm/views/_insn_sp_pc_dependency.erb27
-rw-r--r--tool/ruby_vm/views/_insn_type_chars.erb13
-rw-r--r--tool/ruby_vm/views/_leaf_helpers.erb108
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn.erb87
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn_body.erb115
-rw-r--r--tool/ruby_vm/views/_mjit_compile_ivar.erb54
-rw-r--r--tool/ruby_vm/views/_mjit_compile_pc_and_sp.erb36
-rw-r--r--tool/ruby_vm/views/_mjit_compile_send.erb107
-rw-r--r--tool/ruby_vm/views/_notice.erb22
-rw-r--r--tool/ruby_vm/views/_sp_inc_helpers.erb37
-rw-r--r--tool/ruby_vm/views/_trace_instruction.erb16
-rw-r--r--tool/ruby_vm/views/insns.inc.erb26
-rw-r--r--tool/ruby_vm/views/insns_info.inc.erb22
-rw-r--r--tool/ruby_vm/views/mjit_compile.inc.erb93
-rw-r--r--tool/ruby_vm/views/opt_sc.inc.erb40
-rw-r--r--tool/ruby_vm/views/optinsn.inc.erb71
-rw-r--r--tool/ruby_vm/views/optunifs.inc.erb21
-rw-r--r--tool/ruby_vm/views/vm.inc.erb30
-rw-r--r--tool/ruby_vm/views/vmtc.inc.erb21
-rw-r--r--tool/run-gcov.rb54
-rw-r--r--tool/run-lcov.rb164
-rwxr-xr-xtool/runruby.rb175
-rwxr-xr-xtool/strip-rdoc.rb26
-rw-r--r--tool/sync_default_gems.rb407
-rw-r--r--tool/test-bundled-gems.rb28
-rw-r--r--tool/test-coverage.rb118
-rw-r--r--tool/test/minitest/metametameta.rb71
-rw-r--r--tool/test/minitest/test_minitest_benchmark.rb131
-rw-r--r--tool/test/minitest/test_minitest_mock.rb404
-rw-r--r--tool/test/minitest/test_minitest_unit.rb1790
-rw-r--r--tool/test/runner.rb23
-rw-r--r--tool/test/test_jisx0208.rb40
-rw-r--r--tool/test/testunit/test4test_hideskip.rb10
-rw-r--r--tool/test/testunit/test4test_redefinition.rb14
-rw-r--r--tool/test/testunit/test4test_sorting.rb18
-rw-r--r--tool/test/testunit/test_assertion.rb29
-rw-r--r--tool/test/testunit/test_hideskip.rb21
-rw-r--r--tool/test/testunit/test_parallel.rb204
-rw-r--r--tool/test/testunit/test_redefinition.rb16
-rw-r--r--tool/test/testunit/test_sorting.rb18
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_first.rb8
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_forth.rb30
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_second.rb12
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_third.rb11
-rw-r--r--tool/test/testunit/tests_for_parallel/runner.rb14
-rw-r--r--tool/transcode-tblgen.rb1118
-rw-r--r--tool/transform_mjit_header.rb298
-rwxr-xr-xtool/travis_retry.sh13
-rwxr-xr-xtool/update-deps637
-rw-r--r--tool/vtlh.rb17
-rwxr-xr-xtool/ytab.sed79
-rw-r--r--trace_point.rb348
-rw-r--r--transcode.c4567
-rw-r--r--transcode_data.h139
-rw-r--r--transient_heap.c940
-rw-r--r--transient_heap.h62
-rw-r--r--util.c3843
-rw-r--r--util.h67
-rw-r--r--variable.c3551
-rw-r--r--variable.h9
-rw-r--r--version.c136
-rw-r--r--version.h94
-rw-r--r--vm.c3704
-rw-r--r--vm_args.c1247
-rw-r--r--vm_backtrace.c1497
-rw-r--r--vm_core.h1968
-rw-r--r--vm_debug.h34
-rw-r--r--vm_dump.c1094
-rw-r--r--vm_eval.c2513
-rw-r--r--vm_exec.c167
-rw-r--r--vm_exec.h193
-rw-r--r--vm_insnhelper.c5064
-rw-r--r--vm_insnhelper.h267
-rw-r--r--vm_method.c2322
-rw-r--r--vm_opts.h72
-rw-r--r--vm_trace.c1706
-rw-r--r--vms/config.h102
-rw-r--r--vms/vms.h10
-rw-r--r--vms/vmsruby_private.c52
-rw-r--r--vms/vmsruby_private.h7
-rw-r--r--vsnprintf.c1314
-rw-r--r--warning.rb45
-rw-r--r--win32/.document1
-rw-r--r--win32/Makefile.sub1219
-rw-r--r--win32/README.win32133
-rwxr-xr-xwin32/configure.bat246
-rw-r--r--win32/dir.h42
-rw-r--r--win32/enc-setup.mak10
-rw-r--r--win32/file.c726
-rw-r--r--win32/file.h48
-rwxr-xr-xwin32/ifchange.bat94
-rwxr-xr-xwin32/makedirs.bat3
-rwxr-xr-x[-rw-r--r--]win32/mkexports.rb204
-rwxr-xr-x[-rw-r--r--]win32/resource.rb47
-rwxr-xr-xwin32/rm.bat12
-rwxr-xr-xwin32/rmdirs.bat30
-rwxr-xr-xwin32/rtname.cmd35
-rw-r--r--win32/setup.mak258
-rw-r--r--win32/win32.c7629
-rw-r--r--win32/win32.h558
-rw-r--r--win32/winmain.c4
-rw-r--r--wince/Makefile.sub505
-rw-r--r--wince/README.wince121
-rw-r--r--wince/assert.c11
-rw-r--r--wince/assert.h6
-rwxr-xr-xwince/configure.bat102
-rw-r--r--wince/direct.c54
-rw-r--r--wince/direct.h22
-rw-r--r--wince/errno.c11
-rw-r--r--wince/errno.h55
-rw-r--r--wince/fcntl.h42
-rw-r--r--wince/io.h76
-rw-r--r--wince/io_wce.c230
-rw-r--r--wince/mkconfig_wce.rb7
-rw-r--r--wince/mkexports.rb35
-rw-r--r--wince/process.h46
-rw-r--r--wince/process_wce.c47
-rw-r--r--wince/resource.rb96
-rw-r--r--wince/setup.mak245
-rw-r--r--wince/signal.h71
-rw-r--r--wince/signal_wce.c26
-rw-r--r--wince/stddef.h5
-rw-r--r--wince/stdio.c36
-rw-r--r--wince/stdlib.c57
-rw-r--r--wince/string_wce.c89
-rw-r--r--wince/sys/stat.c102
-rw-r--r--wince/sys/stat.h68
-rw-r--r--wince/sys/timeb.c25
-rw-r--r--wince/sys/timeb.h26
-rw-r--r--wince/sys/types.h60
-rw-r--r--wince/sys/utime.c44
-rw-r--r--wince/sys/utime.h27
-rw-r--r--wince/time.h63
-rw-r--r--wince/time_wce.c301
-rw-r--r--wince/varargs.h34
-rw-r--r--wince/wince.c583
-rw-r--r--wince/wince.h191
-rw-r--r--wince/wincemain.c19
-rw-r--r--wince/wincon.h7
-rw-r--r--wince/winsock2.c338
-rw-r--r--x68/_dtos18.c250
-rw-r--r--x68/_round.c45
-rw-r--r--x68/fconvert.c81
-rw-r--r--x68/select.c167
11096 files changed, 1958354 insertions, 408130 deletions
diff --git a/.cvsignore b/.cvsignore
deleted file mode 100644
index 9fd96ca149..0000000000
--- a/.cvsignore
+++ /dev/null
@@ -1,58 +0,0 @@
-*.bak
-*.orig
-*.rej
-*.sav
-*~
-.ccmalloc
-.ppack
-.ext
-.git
-.svn
-.rbconfig.time
-COPYING.LIB
-ChangeLog.pre-alpha
-ChangeLog.pre1_1
-Makefile
-README.fat-patch
-README.v6
-README.atheos
-archive
-autom4te*.cache
-automake
-beos
-config.cache
-config.h
-config.h.in
-config.log
-config.status
-configure
-foo.rb
-libruby.so.*
-miniruby
-miniruby.elhash
-miniruby.elhash2
-miniruby.orig2
-miniruby.plhash
-miniruby.plhash2
-modex.rb
-newdate.rb
-newver.rb
-parse.c
-parse.y.try
-pitest.rb
-ppack
-preview
-rbconfig.rb
-rename2.h
-repack
-riscos
-rubicon
-ruby
-ruby-man.rd.gz
-rubyunit
-st.c.power
-this that
-tmp
-web
-y.output
-y.tab.c
diff --git a/.dir-locals.el b/.dir-locals.el
new file mode 100644
index 0000000000..7c32d1f7ee
--- /dev/null
+++ b/.dir-locals.el
@@ -0,0 +1,37 @@
+;; Copyright (c) 2018 Urabe, Shyouhei. All rights reserved.
+;;
+;; This file is a part of the programming language Ruby. Permission is hereby
+;; granted, to either redistribute and/or modify this file, provided that the
+;; conditions mentioned in the file COPYING are met. Consult the file for
+;; details.
+
+((nil .
+ ((indent-tabs-mode . nil)
+ (require-final-newline . t)
+ (tab-width . 8)
+ (show-trailing-whitespace . t)
+ (whitespace-line-column . 80))) ;; See also [Misc #12277]
+
+ ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
+
+ (ruby-mode . ((ruby-indent-level . 2)))
+
+ (rdoc-mode . ((fill-column . 74)))
+
+ (yaml-mode . ((yaml-indent-offset . 2)))
+
+ (makefile-mode . ((indent-tabs-mode . t)))
+
+ (c-mode . ((c-file-style . "ruby")))
+
+ (change-log-mode .
+ ((buffer-file-coding-system . us-ascii)
+ (indent-tabs-mode . t)
+ (change-log-indent-text . 2)
+ (add-log-time-format . (lambda (&optional x y)
+ (let* ((time (or x (current-time)))
+ (system-time-locale "C")
+ (diff (+ (cadr time) 32400))
+ (lo (% diff 65536))
+ (hi (+ (car time) (/ diff 65536))))
+ (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index 230c50e387..8a418e5d4a 100644
--- a/.document
+++ b/.document
@@ -5,12 +5,38 @@
# Process all the C source files
*.c
+*.y
-# the lib/ directory (which has its own .document file)
+# prelude
+prelude.rb
+rbconfig.rb
-lib
+ast.rb
+gc.rb
+io.rb
+pack.rb
+trace_point.rb
+warning.rb
+# the lib/ directory (which has its own .document file)
+lib
# and some of the ext/ directory (which has its own .document file)
-
ext
+
+# rdoc files
+NEWS
+
+README.md
+README.ja.md
+
+COPYING
+COPYING.ja
+CONTRIBUTING.md
+
+LEGAL
+
+# win32/README.win32 linked from README.md
+win32
+
+doc
diff --git a/.editorconfig b/.editorconfig
new file mode 100644
index 0000000000..4633a7acae
--- /dev/null
+++ b/.editorconfig
@@ -0,0 +1,30 @@
+root = true
+
+[*]
+end_of_line = lf
+indent_size = 4
+indent_style = space
+insert_final_newline = true
+tab_width = 8
+trim_trailing_whitespace = true
+
+[*.bat]
+end_of_line = crlf
+
+[*.gemspec]
+indent_size = 2
+
+[*.rb]
+indent_size = 2
+
+[*.yml]
+indent_size = 2
+
+[{*[Mm]akefile*,*.mak,*.mk,depend}]
+indent_style = tab
+
+[enc/*]
+indent_size = 2
+
+[reg*.[ch]]
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..0d44622691
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,1346 @@
+set startup-with-shell off
+
+define hook-run
+ set $color_type = 0
+ set $color_highlite = 0
+ set $color_end = 0
+end
+
+define ruby_gdb_init
+ if !$color_type
+ set $color_type = "\033[31m"
+ end
+ if !$color_highlite
+ set $color_highlite = "\033[36m"
+ end
+ if !$color_end
+ set $color_end = "\033[m"
+ end
+ if ruby_dummy_gdb_enums.special_consts
+ end
+end
+
+# set prompt \033[36m(gdb)\033[m\040
+
+define rp
+ ruby_gdb_init
+ if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+ printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+ else
+ if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+ set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+ printf "%sSYMBOL%s: ", $color_type, $color_end
+ rp_id $id
+ else
+ if ($arg0) == RUBY_Qfalse
+ echo false\n
+ else
+ if ($arg0) == RUBY_Qtrue
+ echo true\n
+ else
+ if ($arg0) == RUBY_Qnil
+ echo nil\n
+ else
+ if ($arg0) == RUBY_Qundef
+ echo undef\n
+ else
+ if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+ if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
+ printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
+ else
+ echo immediate\n
+ end
+ else
+ set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
+ printf "[PROMOTED] "
+ end
+ if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+ printf "%sT_NONE%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+ printf "%sT_NIL%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+ printf "%sT_OBJECT%s: ", $color_type, $color_end
+ print ((struct RObject *)($arg0))->basic
+ if ($flags & ROBJECT_EMBED)
+ print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
+ else
+ print (((struct RObject *)($arg0))->as.heap)
+ if (((struct RObject*)($arg0))->as.heap.numiv) > 0
+ print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
+ end
+ end
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+ printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
+ rp_class $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+ printf "%sT_ICLASS%s: ", $color_type, $color_end
+ rp_class $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+ printf "%sT_MODULE%s: ", $color_type, $color_end
+ rp_class $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+ printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
+ print (struct RFloat *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+ printf "%sT_STRING%s: ", $color_type, $color_end
+ rp_string $arg0 $flags
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+ set $regsrc = ((struct RRegexp*)($arg0))->src
+ set $rsflags = ((struct RBasic*)$regsrc)->flags
+ printf "%sT_REGEXP%s: ", $color_type, $color_end
+ set $len = ($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.len : \
+ (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ set print address off
+ output *(char *)(($rsflags & RUBY_FL_USER1) ? \
+ ((struct RString*)$regsrc)->as.heap.ptr : \
+ ((struct RString*)$regsrc)->as.ary) @ $len
+ set print address on
+ printf " len:%ld ", $len
+ if $flags & RUBY_FL_USER6
+ printf "(none) "
+ end
+ if $flags & RUBY_FL_USER5
+ printf "(literal) "
+ end
+ if $flags & RUBY_FL_USER4
+ printf "(fixed) "
+ end
+ printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+ print (struct RRegexp *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+ if ($flags & RUBY_FL_USER1)
+ set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+ printf "(embed) "
+ if ($len == 0)
+ printf "{(empty)} "
+ else
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+ printf " "
+ end
+ else
+ set $len = ((struct RArray*)($arg0))->as.heap.len
+ printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+ if ($flags & RUBY_FL_USER2)
+ printf "(shared) shared="
+ output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+ printf " "
+ else
+ printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+ end
+ if ($len == 0)
+ printf "{(empty)} "
+ else
+ print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+ printf " "
+ end
+ end
+ print (struct RArray *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+ printf "%sT_FIXNUM%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+ printf "%sT_HASH%s: ", $color_type, $color_end,
+ if (((struct RHash *)($arg0))->basic->flags & RHASH_ST_TABLE_FLAG)
+ printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
+ else
+ printf "li len=%ld bound=%ld ", \
+ ((((struct RHash *)($arg0))->basic->flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
+ ((((struct RHash *)($arg0))->basic->flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
+ end
+ print (struct RHash *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+ set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+ ((struct RStruct *)($arg0))->as.heap.len)
+ printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
+ print (struct RStruct *)($arg0)
+ output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+ ((struct RStruct *)($arg0))->as.ary : \
+ ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+ rp_bignum $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+ printf "%sT_RATIONAL%s: ", $color_type, $color_end
+ print (struct RRational *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+ printf "%sT_COMPLEX%s: ", $color_type, $color_end
+ print (struct RComplex *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+ printf "%sT_FILE%s: ", $color_type, $color_end
+ print (struct RFile *)($arg0)
+ output *((struct RFile *)($arg0))->fptr
+ printf "\n"
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+ printf "%sT_TRUE%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+ printf "%sT_FALSE%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+ if ((struct RTypedData *)($arg0))->typed_flag == 1
+ printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
+ print (struct RTypedData *)($arg0)
+ else
+ printf "%sT_DATA%s: ", $color_type, $color_end
+ print (struct RData *)($arg0)
+ end
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+ printf "%sT_MATCH%s: ", $color_type, $color_end
+ print (struct RMatch *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+ printf "%sT_SYMBOL%s: ", $color_type, $color_end
+ print (struct RSymbol *)($arg0)
+ set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
+ if $id_type == RUBY_ID_LOCAL
+ printf "l"
+ else
+ if $id_type == RUBY_ID_INSTANCE
+ printf "i"
+ else
+ if $id_type == RUBY_ID_GLOBAL
+ printf "G"
+ else
+ if $id_type == RUBY_ID_ATTRSET
+ printf "a"
+ else
+ if $id_type == RUBY_ID_CONST
+ printf "C"
+ else
+ if $id_type == RUBY_ID_CLASS
+ printf "c"
+ else
+ printf "j"
+ end
+ end
+ end
+ end
+ end
+ end
+ set $id_fstr = ((struct RSymbol *)($arg0))->fstr
+ rp_string $id_fstr
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+ printf "%sT_UNDEF%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
+ printf "%sT_IMEMO%s(", $color_type, $color_end
+ output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
+ printf "): "
+ rp_imemo $arg0
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+ printf "%sT_NODE%s(", $color_type, $color_end
+ output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+ printf "): "
+ print *(NODE *)($arg0)
+ else
+ if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+ printf "%sT_ZOMBIE%s: ", $color_type, $color_end
+ print (struct RData *)($arg0)
+ else
+ printf "%sunknown%s: ", $color_type, $color_end
+ print (struct RBasic *)($arg0)
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp
+ Print a Ruby's VALUE.
+end
+
+define rp_id
+ set $id = (ID)$arg0
+ if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+ printf "(:%c)\n", $id
+ else
+ if $id == idDot2
+ printf "(:..)\n"
+ else
+ if $id == idDot3
+ printf "(:...)\n"
+ else
+ if $id == idUPlus
+ printf "(:+@)\n"
+ else
+ if $id == idUMinus
+ printf "(:-@)\n"
+ else
+ if $id == idPow
+ printf "(:**)\n"
+ else
+ if $id == idCmp
+ printf "(:<=>)\n"
+ else
+ if $id == idLTLT
+ printf "(:<<)\n"
+ else
+ if $id == idGTGT
+ printf "(:>>)\n"
+ else
+ if $id == idLE
+ printf "(:<=)\n"
+ else
+ if $id == idGE
+ printf "(:>=)\n"
+ else
+ if $id == idEq
+ printf "(:==)\n"
+ else
+ if $id == idEqq
+ printf "(:===)\n"
+ else
+ if $id == idNeq
+ printf "(:!=)\n"
+ else
+ if $id == idEqTilde
+ printf "(:=~)\n"
+ else
+ if $id == idNeqTilde
+ printf "(:!~)\n"
+ else
+ if $id == idAREF
+ printf "(:[])\n"
+ else
+ if $id == idASET
+ printf "(:[]=)\n"
+ else
+ if $id == idCOLON2
+ printf "(:'::')\n"
+ else
+ if $id == idANDOP
+ printf "(:&&)\n"
+ else
+ if $id == idOROP
+ printf "(:||)\n"
+ else
+ if $id == idANDDOT
+ printf "(:&.)\n"
+ else
+ if $id <= tLAST_OP_ID
+ printf "O"
+ else
+ set $id_type = $id & RUBY_ID_SCOPE_MASK
+ if $id_type == RUBY_ID_LOCAL
+ printf "l"
+ else
+ if $id_type == RUBY_ID_INSTANCE
+ printf "i"
+ else
+ if $id_type == RUBY_ID_GLOBAL
+ printf "G"
+ else
+ if $id_type == RUBY_ID_ATTRSET
+ printf "a"
+ else
+ if $id_type == RUBY_ID_CONST
+ printf "C"
+ else
+ if $id_type == RUBY_ID_CLASS
+ printf "c"
+ else
+ printf "j"
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ printf "(%ld): ", $id
+ print_id $id
+ echo \n
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp_id
+ Print an ID.
+end
+
+define output_string
+ set $flags = ((struct RBasic*)($arg0))->flags
+ set $len = ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ output *(char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary) @ $len
+ else
+ output ""
+ end
+end
+
+define print_string
+ set $flags = ((struct RBasic*)($arg0))->flags
+ set $len = ($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.len : \
+ (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+ if $len > 0
+ printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)($arg0))->as.heap.ptr : \
+ ((struct RString*)($arg0))->as.ary) @ $len
+ end
+end
+
+define rp_string
+ output_string $arg0
+ printf " bytesize:%ld ", $len
+ if !($flags & RUBY_FL_USER1)
+ printf "(embed) "
+ else
+ if ($flags & RUBY_FL_USER2)
+ printf "(shared) "
+ end
+ if ($flags & RUBY_FL_USER3)
+ printf "(assoc) "
+ end
+ end
+ printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+ printf "coderange:unknown "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+ printf "coderange:7bit "
+ else
+ if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+ printf "coderange:valid "
+ else
+ printf "coderange:broken "
+ end
+ end
+ end
+ print (struct RString *)($arg0)
+end
+document rp_string
+ Print the content of a String.
+end
+
+define rp_bignum
+ set $flags = ((struct RBignum*)($arg0))->basic.flags
+ set $len = (($flags & RUBY_FL_USER2) ? \
+ ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+ ((struct RBignum*)($arg0))->as.heap.len)
+ printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+ (($flags & RUBY_FL_USER1) != 0), $len
+ if $flags & RUBY_FL_USER2
+ printf "(embed) "
+ end
+ print (struct RBignum *)($arg0)
+ set $ptr = (($flags & RUBY_FL_USER2) ? \
+ ((struct RBignum*)($arg0))->as.ary : \
+ ((struct RBignum*)($arg0))->as.heap.digits)
+ set $len = $len-1
+ printf "0x%x", $ptr[$len]
+ while $len > 0
+ set $len = $len-1
+ set $val = $ptr[$len]
+ set $w = sizeof($ptr[0])
+ printf "_"
+ if $w > 8
+ printf "%.32x", $val
+ else
+ if $w > 4
+ printf "%.16x", $val
+ else
+ if $w > 2
+ printf "%.8x", $val
+ else
+ if $w > 1
+ printf "%.4x", $val
+ else
+ printf "%.2x", $val
+ end
+ end
+ end
+ end
+ end
+ printf "\n"
+end
+document rp_bignum
+ Print the content of a Bignum.
+end
+
+define rp_class
+ printf "(struct RClass *) %p", (void*)$arg0
+ if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
+ printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+ end
+ printf "\n"
+ rb_classname $arg0
+ print/x *(struct RClass *)($arg0)
+ print *((struct RClass *)($arg0))->ptr
+end
+document rp_class
+ Print the content of a Class/Module.
+end
+
+define rp_imemo
+ set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
+ if $flags == imemo_cref
+ printf "(rb_cref_t *) %p\n", (void*)$arg0
+ print *(rb_cref_t *)$arg0
+ else
+ if $flags == imemo_svar
+ printf "(struct vm_svar *) %p\n", (void*)$arg0
+ print *(struct vm_svar *)$arg0
+ else
+ if $flags == imemo_throw_data
+ printf "(struct vm_throw_data *) %p\n", (void*)$arg0
+ print *(struct vm_throw_data *)$arg0
+ else
+ if $flags == imemo_ifunc
+ printf "(struct vm_ifunc *) %p\n", (void*)$arg0
+ print *(struct vm_ifunc *)$arg0
+ else
+ if $flags == imemo_memo
+ printf "(struct MEMO *) %p\n", (void*)$arg0
+ print *(struct MEMO *)$arg0
+ else
+ if $flags == imemo_ment
+ printf "(rb_method_entry_t *) %p\n", (void*)$arg0
+ print *(rb_method_entry_t *)$arg0
+ else
+ if $flags == imemo_iseq
+ printf "(rb_iseq_t *) %p\n", (void*)$arg0
+ print *(rb_iseq_t *)$arg0
+ else
+ printf "(struct RIMemo *) %p\n", (void*)$arg0
+ print *(struct RIMemo *)$arg0
+ end
+ end
+ end
+ end
+ end
+ end
+ end
+end
+document rp_imemo
+ Print the content of a memo
+end
+
+define nd_type
+ print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+ Print a Ruby' node type.
+end
+
+define nd_file
+ print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+ Print the source file name of a node.
+end
+
+define nd_line
+ print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+ Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_alen
+ printf "%su2.argc%s: ", $color_highlite, $color_end
+ p ($arg0).u2.argc
+end
+
+define nd_next
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_cond
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_body
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_else
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_orig
+ printf "%su3.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.value
+end
+
+
+define nd_resq
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_ensr
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_1st
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_2nd
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+
+define nd_stts
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+
+define nd_entry
+ printf "%su3.entry%s: ", $color_highlite, $color_end
+ p ($arg0).u3.entry
+end
+
+define nd_vid
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_cflag
+ printf "%su2.id%s: ", $color_highlite, $color_end
+ p ($arg0).u2.id
+end
+
+define nd_cval
+ printf "%su3.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.value
+end
+
+define nd_tbl
+ printf "%su1.tbl%s: ", $color_highlite, $color_end
+ p ($arg0).u1.tbl
+end
+
+
+define nd_var
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_ibdy
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_iter
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_value
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_aid
+ printf "%su3.id%s: ", $color_highlite, $color_end
+ p ($arg0).u3.id
+end
+
+
+define nd_lit
+ printf "%su1.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.value
+end
+
+define nd_rest
+ printf "%su2.argc%s: ", $color_highlite, $color_end
+ p ($arg0).u2.argc
+end
+
+define nd_opt
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+
+define nd_recv
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_mid
+ printf "%su2.id%s: ", $color_highlite, $color_end
+ p ($arg0).u2.id
+end
+
+define nd_args
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+define nd_defn
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_old
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_new
+ printf "%su2.id%s: ", $color_highlite, $color_end
+ p ($arg0).u2.id
+end
+
+
+define nd_cname
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_super
+ printf "%su3.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u3.node
+end
+
+
+define nd_modl
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_clss
+ printf "%su1.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.value
+end
+
+
+define nd_beg
+ printf "%su1.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u1.node
+end
+
+define nd_end
+ printf "%su2.node%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.node
+end
+
+define nd_state
+ printf "%su3.state%s: ", $color_highlite, $color_end
+ p ($arg0).u3.state
+end
+
+define nd_rval
+ printf "%su2.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.value
+end
+
+
+define nd_nth
+ printf "%su2.argc%s: ", $color_highlite, $color_end
+ p ($arg0).u2.argc
+end
+
+
+define nd_tag
+ printf "%su1.id%s: ", $color_highlite, $color_end
+ p ($arg0).u1.id
+end
+
+define nd_tval
+ printf "%su2.value%s: ", $color_highlite, $color_end
+ rp ($arg0).u2.value
+end
+
+define nd_tree
+ set $buf = (struct RString *)rb_str_buf_new(0)
+ call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
+ printf "%s\n", $buf->as.heap.ptr
+end
+
+define rb_p
+ call rb_p($arg0)
+end
+
+define rb_numtable_entry
+ set $rb_numtable_tbl = $arg0
+ set $rb_numtable_id = (st_data_t)$arg1
+ set $rb_numtable_key = 0
+ set $rb_numtable_rec = 0
+ if $rb_numtable_tbl->entries_packed
+ set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
+ while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
+ if $rb_numtable_p.k == $rb_numtable_id
+ set $rb_numtable_key = $rb_numtable_p.k
+ set $rb_numtable_rec = $rb_numtable_p.v
+ set $rb_numtable_p = 0
+ else
+ set $rb_numtable_p = $rb_numtable_p + 1
+ end
+ end
+ else
+ set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
+ while $rb_numtable_p
+ if $rb_numtable_p->key == $rb_numtable_id
+ set $rb_numtable_key = $rb_numtable_p->key
+ set $rb_numtable_rec = $rb_numtable_p->record
+ set $rb_numtable_p = 0
+ else
+ set $rb_numtable_p = $rb_numtable_p->next
+ end
+ end
+ end
+end
+
+define rb_id2name
+ ruby_gdb_init
+ printf "%sID%s: ", $color_type, $color_end
+ rp_id $arg0
+end
+document rb_id2name
+ Print the name of id
+end
+
+define rb_method_entry
+ set $rb_method_entry_klass = (struct RClass *)$arg0
+ set $rb_method_entry_id = (ID)$arg1
+ set $rb_method_entry_me = (rb_method_entry_t *)0
+ while !$rb_method_entry_me && $rb_method_entry_klass
+ rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
+ set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+ if !$rb_method_entry_me
+ set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
+ end
+ end
+ if $rb_method_entry_me
+ print *$rb_method_entry_klass
+ print *$rb_method_entry_me
+ else
+ echo method not found\n
+ end
+end
+document rb_method_entry
+ Search method entry by class and id
+end
+
+define rb_classname
+ # up to 128bit int
+ set $rb_classname = rb_mod_name($arg0)
+ if $rb_classname != RUBY_Qnil
+ rp $rb_classname
+ else
+ echo anonymous class/module\n
+ end
+end
+
+define rb_ancestors
+ set $rb_ancestors_module = $arg0
+ while $rb_ancestors_module
+ rp_class $rb_ancestors_module
+ set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
+ end
+end
+document rb_ancestors
+ Print ancestors.
+end
+
+define rb_backtrace
+ call rb_backtrace()
+end
+
+define iseq
+ if ruby_dummy_gdb_enums.special_consts
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_NONE
+ echo [none]\n
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_LABEL
+ print *(LABEL*)($arg0)
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_INSN
+ print *(INSN*)($arg0)
+ if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+ set $i = 0
+ set $operand_size = ((INSN*)($arg0))->operand_size
+ set $operands = ((INSN*)($arg0))->operands
+ while $i < $operand_size
+ rp $operands[$i++]
+ end
+ end
+ end
+ if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+ print *(ADJUST*)($arg0)
+ end
+end
+
+define rb_ps
+ rb_ps_vm ruby_current_vm_ptr
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+ print $ps_vm = (rb_vm_t*)$arg0
+ set $ps_thread_ln = $ps_vm->living_threads.n.next
+ set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
+ while 1
+ set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+ set $ps_thread = (VALUE)($ps_thread_th->self)
+ rb_ps_thread $ps_thread
+ if $ps_thread_ln == $ps_thread_ln_last
+ loop_break
+ end
+ set $ps_thread_ln = $ps_thread_ln->next
+ end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define print_lineno
+ set $cfp = $arg0
+ set $iseq = $cfp->iseq
+ set $pos = $cfp->pc - $iseq->body->iseq_encoded
+ if $pos != 0
+ set $pos = $pos - 1
+ end
+
+ set $index = 0
+ set $size = $iseq->body->insns_info.size
+ set $table = $iseq->body->insns_info.body
+ set $positions = $iseq->body->insns_info.positions
+ #printf "size: %d\n", $size
+ if $size == 0
+ else
+ if $size == 1
+ printf "%d", $table[0].line_no
+ else
+ if $positions
+ # get_insn_info_linear_search
+ set $index = 1
+ while $index < $size
+ #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
+ if $positions[$index] > $pos
+ loop_break
+ end
+ set $index = $index + 1
+ if $positions[$index] == $pos
+ loop_break
+ end
+ end
+ else
+ # get_insn_info_succinct_bitvector
+ set $sd = $iseq->body->insns_info.succ_index_table
+ set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
+ if $pos < $immediate_table_size
+ set $i = $pos / 9
+ set $j = $pos % 9
+ set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
+ else
+ set $block_index = ($pos - $immediate_table_size) / 512
+ set $block = &$sd->succ_part[$block_index]
+ set $block_bit_index = ($pos - $immediate_table_size) % 512
+ set $small_block_index = $block_bit_index / 64
+ set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
+ set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
+ set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
+ set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
+ set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
+ set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
+ set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
+ set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
+ set $index = $block->rank + $small_block_popcount + $popcnt
+ end
+ end
+ printf "%d", $table[$index-1].line_no
+ end
+ end
+end
+
+define check_method_entry
+ set $imemo = (struct RBasic *)$arg0
+ if $imemo != RUBY_Qfalse
+ set $type = ($imemo->flags >> 12) & 0x07
+ if $type == imemo_ment
+ set $me = (rb_callable_method_entry_t *)$imemo
+ else
+ if $type == imemo_svar
+ set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
+ check_method_entry $imemo
+ end
+ end
+ end
+end
+
+define print_id
+ set $id = $arg0
+ # rb_id_to_serial
+ if $id > tLAST_OP_ID
+ set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
+ else
+ set $serial = (rb_id_serial_t)$id
+ end
+ if $serial && $serial <= ruby_global_symbols.last_id
+ set $idx = $serial / ID_ENTRY_UNIT
+ set $ids = (struct RArray *)ruby_global_symbols.ids
+ set $flags = $ids->basic.flags
+ if ($flags & RUBY_FL_USER1)
+ set $idsptr = $ids->as.ary
+ set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ else
+ set $idsptr = $ids->as.heap.ptr
+ set $idslen = $ids->as.heap.len
+ end
+ if $idx < $idslen
+ set $t = 0
+ set $ary = (struct RArray *)$idsptr[$idx]
+ if $ary != RUBY_Qnil
+ set $flags = $ary->basic.flags
+ if ($flags & RUBY_FL_USER1)
+ set $aryptr = $ary->as.ary
+ set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+ else
+ set $aryptr = $ary->as.heap.ptr
+ set $arylen = $ary->as.heap.len
+ end
+ set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
+ if $result != RUBY_Qnil
+ print_string $result
+ else
+ echo undef
+ end
+ end
+ end
+ end
+end
+
+define print_pathobj
+ set $flags = ((struct RBasic*)($arg0))->flags
+ if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+ print_string $arg0
+ end
+ if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+ if $flags & RUBY_FL_USER1
+ set $str = ((struct RArray*)($arg0))->as.ary[0]
+ else
+ set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
+ end
+ print_string $str
+ end
+end
+
+define rb_ps_thread
+ set $ps_thread = (struct RTypedData*)$arg0
+ set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+ printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+ $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+ set $cfp = $ps_thread_th->ec->cfp
+ set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
+ while $cfp < $cfpend
+ if $cfp->iseq
+ if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
+ printf "%d:ifunc ", $cfpend-$cfp
+ set print symbol-filename on
+ output/a $cfp->iseq.body
+ set print symbol-filename off
+ printf "\n"
+ else
+ if $cfp->pc
+ set $location = $cfp->iseq->body->location
+ printf "%d:", $cfpend-$cfp
+ print_pathobj $location.pathobj
+ printf ":"
+ print_lineno $cfp
+ printf ":in `"
+ print_string $location.label
+ printf "'\n"
+ else
+ printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
+ end
+ end
+ else
+ # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
+ set $ep = $cfp->ep
+ if ($ep[0] & 0xffff0001) == 0x55550001
+ #define VM_ENV_FLAG_LOCAL 0x02
+ #define VM_ENV_PREV_EP(ep) GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
+ set $me = 0
+ set $env_specval = $ep[-1]
+ set $env_me_cref = $ep[-2]
+ while ($env_specval & 0x02) != 0
+ check_method_entry $env_me_cref
+ if $me != 0
+ loop_break
+ end
+ set $ep = $ep[0]
+ set $env_specval = $ep[-1]
+ set $env_me_cref = $ep[-2]
+ end
+ if $me == 0
+ check_method_entry $env_me_cref
+ end
+ printf "%d:", $cfpend-$cfp
+ set print symbol-filename on
+ output/a $me->def->body.cfunc.func
+ set print symbol-filename off
+ set $mid = $me->def->original_id
+ printf ":in `"
+ print_id $mid
+ printf "'\n"
+ else
+ printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
+ end
+ end
+ set $cfp = $cfp + 1
+ end
+end
+
+define rb_count_objects
+ set $objspace = ruby_current_vm_ptr->objspace
+ set $counts_00 = 0
+ set $counts_01 = 0
+ set $counts_02 = 0
+ set $counts_03 = 0
+ set $counts_04 = 0
+ set $counts_05 = 0
+ set $counts_06 = 0
+ set $counts_07 = 0
+ set $counts_08 = 0
+ set $counts_09 = 0
+ set $counts_0a = 0
+ set $counts_0b = 0
+ set $counts_0c = 0
+ set $counts_0d = 0
+ set $counts_0e = 0
+ set $counts_0f = 0
+ set $counts_10 = 0
+ set $counts_11 = 0
+ set $counts_12 = 0
+ set $counts_13 = 0
+ set $counts_14 = 0
+ set $counts_15 = 0
+ set $counts_16 = 0
+ set $counts_17 = 0
+ set $counts_18 = 0
+ set $counts_19 = 0
+ set $counts_1a = 0
+ set $counts_1b = 0
+ set $counts_1c = 0
+ set $counts_1d = 0
+ set $counts_1e = 0
+ set $counts_1f = 0
+ set $total = 0
+ set $i = 0
+ while $i < $objspace->heap_pages.allocated_pages
+ printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
+ set $page = $objspace->heap_pages.sorted[$i]
+ set $p = $page->start
+ set $pend = $p + $page->total_slots
+ while $p < $pend
+ set $flags = $p->as.basic.flags & 0x1f
+ eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
+ set $p = $p + 1
+ end
+ set $total = $total + $page->total_slots
+ set $i = $i + 1
+ end
+ printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
+ printf "T_OBJECT: %d\n", $counts_01
+ printf "T_CLASS: %d\n", $counts_02
+ printf "T_MODULE: %d\n", $counts_03
+ printf "T_FLOAT: %d\n", $counts_04
+ printf "T_STRING: %d\n", $counts_05
+ printf "T_REGEXP: %d\n", $counts_06
+ printf "T_ARRAY: %d\n", $counts_07
+ printf "T_HASH: %d\n", $counts_08
+ printf "T_STRUCT: %d\n", $counts_09
+ printf "T_BIGNUM: %d\n", $counts_0a
+ printf "T_FILE: %d\n", $counts_0b
+ printf "T_DATA: %d\n", $counts_0c
+ printf "T_MATCH: %d\n", $counts_0d
+ printf "T_COMPLEX: %d\n", $counts_0e
+ printf "T_RATIONAL: %d\n", $counts_0f
+ #printf "UNKNOWN_10: %d\n", $counts_10
+ printf "T_NIL: %d\n", $counts_11
+ printf "T_TRUE: %d\n", $counts_12
+ printf "T_FALSE: %d\n", $counts_13
+ printf "T_SYMBOL: %d\n", $counts_14
+ printf "T_FIXNUM: %d\n", $counts_15
+ printf "T_UNDEF: %d\n", $counts_16
+ #printf "UNKNOWN_17: %d\n", $counts_17
+ #printf "UNKNOWN_18: %d\n", $counts_18
+ #printf "UNKNOWN_19: %d\n", $counts_19
+ printf "T_IMEMO: %d\n", $counts_1a
+ printf "T_NODE: %d\n", $counts_1b
+ printf "T_ICLASS: %d\n", $counts_1c
+ printf "T_ZOMBIE: %d\n", $counts_1d
+ #printf "UNKNOWN_1E: %d\n", $counts_1e
+ printf "T_MASK: %d\n", $counts_1f
+end
+document rb_count_objects
+ Counts all objects grouped by type.
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+define trace_machine_instructions
+ set logging on
+ set height 0
+ set width 0
+ display/i $pc
+ while !$exit_code
+ info line *$pc
+ si
+ end
+end
+
+define SDR
+ call rb_vmdebug_stack_dump_raw_current()
+end
+
+define rbi
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+ p *(LABEL*)$arg0
+ else
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+ p *(INSN*)$arg0
+ else
+ if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+ p *(ADJUST*)$arg0
+ else
+ print *$arg0
+ end
+ end
+ end
+end
+
+define dump_node
+ set $str = rb_parser_dump_tree($arg0, 0)
+ set $flags = ((struct RBasic*)($str))->flags
+ printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
+ ((struct RString*)$str)->as.heap.ptr : \
+ ((struct RString*)$str)->as.ary)
+end
+
+define print_flags
+ printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
+ printf "RUBY_FL_PROMOTED0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
+ printf "RUBY_FL_PROMOTED1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
+ printf "RUBY_FL_FINALIZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
+ printf "RUBY_FL_TAINT : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_TAINT ? "1" : "0"
+ printf "RUBY_FL_UNTRUSTED : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_UNTRUSTED ? "1" : "0"
+ printf "RUBY_FL_EXIVAR : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
+ printf "RUBY_FL_FREEZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
+
+ printf "RUBY_FL_USER0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
+ printf "RUBY_FL_USER1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
+ printf "RUBY_FL_USER2 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
+ printf "RUBY_FL_USER3 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
+ printf "RUBY_FL_USER4 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
+ printf "RUBY_FL_USER5 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
+ printf "RUBY_FL_USER6 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
+ printf "RUBY_FL_USER7 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
+ printf "RUBY_FL_USER8 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
+ printf "RUBY_FL_USER9 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
+ printf "RUBY_FL_USER10 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
+ printf "RUBY_FL_USER11 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
+ printf "RUBY_FL_USER12 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
+ printf "RUBY_FL_USER13 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
+ printf "RUBY_FL_USER14 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
+ printf "RUBY_FL_USER15 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
+ printf "RUBY_FL_USER16 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
+ printf "RUBY_FL_USER17 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
+ printf "RUBY_FL_USER18 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
+end
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..d0c2d266b4
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,8 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+bin svn-properties=svn:ignore=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
+tool/format-release diff=ruby
+tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
new file mode 100644
index 0000000000..56baa29942
--- /dev/null
+++ b/.github/SECURITY.md
@@ -0,0 +1,9 @@
+# Security Policy
+
+## Supported Versions
+
+See <https://www.ruby-lang.org/en/downloads/branches/>.
+
+## Reporting a Vulnerability
+
+See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/workflows/check_branch.yml b/.github/workflows/check_branch.yml
new file mode 100644
index 0000000000..37cf3a9a8f
--- /dev/null
+++ b/.github/workflows/check_branch.yml
@@ -0,0 +1,22 @@
+# We bidirectionally synchronize github.com/ruby/ruby.git's master branch and
+# git.ruby-lang.org/ruby.git's master branch.
+# We can use a pull request's merge button only on the master branch.
+#
+# Therefore, we require to pass this "check_branch" on all protected branches
+# to prevent us from accidentally pushing commits to GitHub directly.
+#
+# Details: https://bugs.ruby-lang.org/issues/16094
+name: Pull Request
+on: [pull_request]
+jobs:
+ check_branch:
+ runs-on: ubuntu-latest
+ steps:
+ - name: Check if branch is master
+ run: |
+ if [ "$BASE_REF" != master ]; then
+ echo "Only master branch accepts a pull request, but it's '$BASE_REF'."
+ exit 1
+ fi
+ env:
+ BASE_REF: ${{ github.base_ref }}
diff --git a/.github/workflows/cygwin.yml b/.github/workflows/cygwin.yml
new file mode 100644
index 0000000000..515b47e141
--- /dev/null
+++ b/.github/workflows/cygwin.yml
@@ -0,0 +1,79 @@
+name: Cygwin
+on:
+ push:
+ branches:
+ - master
+ pull_request:
+ branches:
+ - '*'
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [test]
+ os: [windows-2019]
+ vs: [2019]
+ fail-fast: false
+ runs-on: ${{ matrix.os }}
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - uses: actions/cache@v1
+ with:
+ path: C:\Users\runneradmin\AppData\Local\Temp\chocolatey
+ key: ${{ runner.os }}-cygwin-chocolatey-${{ matrix.os }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-cygwin-chocolatey-${{ matrix.os }}-
+ ${{ runner.os }}-cygwin-chocolatey-
+ - name: Install cygwin base packages with chocolatey
+ run: |
+ choco install --no-progress cygwin
+ - uses: actions/cache@v1
+ with:
+ path: C:\tools\cygwin\package
+ key: ${{ runner.os }}-cygwin-package-${{ matrix.os }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-cygwin-package-${{ matrix.os }}-
+ ${{ runner.os }}-cygwin-package-
+ - name: Install cygwin additional packages
+ run: |
+ C:\tools\cygwin\cygwinsetup.exe -qgnNdO -R C:/tools/cygwin -l C:/tools/cygwin/package -s http://mirrors.kernel.org/sourceware/cygwin/ -P autoconf,bison,gcc-core,git,libffi-devel,libgdbm-devel,libgmp-devel,libreadline-devel,libssl-devel,make,patch,ruby,zlib-devel
+ shell: cmd
+ - name: Set ENV
+ run: |
+ echo '::set-env name=PATH::C:\tools\cygwin\bin;C:\tools\cygwin\usr\bin'
+ # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
+ - name: Checkout ruby/ruby
+ run: |
+ git clone --single-branch --shallow-since=yesterday https://github.com/ruby/ruby src
+ git -C src reset --hard ${{ github.sha }}
+ if: github.event_name == 'push'
+ shell: cmd
+ - name: Checkout a pull request
+ run: |
+ git clone --single-branch --shallow-since=yesterday --branch=${{ github.event.pull_request.head.ref }} https://github.com/${{ github.event.pull_request.head.repo.full_name }} src
+ git -C src reset --hard ${{ github.event.pull_request.head.sha }}
+ if: github.event_name == 'pull_request'
+ shell: cmd
+ - run: ./src/tool/actions-commit-info.sh
+ shell: bash
+ id: commit_info
+ - name: Autoconf
+ run: |
+ cd src
+ bash /usr/bin/autoconf
+ shell: cmd
+ - name: Configure
+ run: |
+ md build
+ cd build
+ bash ../src/configure
+ shell: cmd
+ - name: make
+ run: |
+ make -C build
+ shell: cmd
+ # TODO: Fix test fail on cygwin environment on GitHub Actions
+ # - name: make btest
+ # run: |
+ # make -C build btest
+ # shell: cmd
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
new file mode 100644
index 0000000000..724081d9dc
--- /dev/null
+++ b/.github/workflows/macos.yml
@@ -0,0 +1,81 @@
+name: macOS
+on:
+ push:
+ branches:
+ - master
+ pull_request:
+ branches:
+ - '*'
+jobs:
+ make:
+ runs-on: macos-latest
+ strategy:
+ matrix:
+ test_task: [ "check", "test-bundler", "test-bundled-gems" ]
+ fail-fast: false
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - name: Disable Firewall
+ run: |
+ sudo /usr/libexec/ApplicationFirewall/socketfilterfw --setglobalstate off
+ sudo /usr/libexec/ApplicationFirewall/socketfilterfw --getglobalstate
+ # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
+ - name: Checkout ruby/ruby
+ run: |
+ git clone --single-branch --shallow-since=yesterday https://github.com/ruby/ruby src
+ git -C src reset --hard "$GITHUB_SHA"
+ if: github.event_name == 'push'
+ - name: Checkout a pull request
+ run: |
+ git clone --single-branch --shallow-since=yesterday "--branch=$GITHUB_BRANCH" "https://github.com/${GITHUB_REPO}" src
+ git -C src reset --hard "$GITHUB_REV"
+ env:
+ GITHUB_REV: ${{ github.event.pull_request.head.sha }}
+ GITHUB_BRANCH: ${{ github.event.pull_request.head.ref }}
+ GITHUB_REPO: ${{ github.event.pull_request.head.repo.full_name }}
+ if: github.event_name == 'pull_request'
+ - run: ./src/tool/actions-commit-info.sh
+ id: commit_info
+ - name: Install libraries
+ run: |
+ export WAITS='5 60'
+ cd src
+ tool/travis_retry.sh brew update
+ tool/travis_retry.sh brew install gdbm gmp libffi openssl@1.1 zlib autoconf automake libtool readline
+ - name: Set ENV
+ run: |
+ echo '::set-env name=JOBS::'-j$((1 + $(sysctl -n hw.activecpu)))
+ - name: Autoconf
+ run: |
+ cd src
+ autoconf
+ - name: Configure
+ run: |
+ mkdir build
+ cd build
+ ../src/configure -C --disable-install-doc --with-openssl-dir=$(brew --prefix openssl@1.1) --with-readline-dir=$(brew --prefix readline)
+ - name: Make
+ run: make -C build $JOBS
+ - name: Extract gems
+ run: make -C build update-gems extract-gems
+ if: matrix.test_task == 'check'
+ - name: Tests
+ run: make -C build $JOBS -s ${{ matrix.test_task }}
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ - name: Leaked Globals
+ run: make -C build -s leaked-globals
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "attachments": [{
+ "text": "${{ job.status }}: ${{ github.workflow }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
+ "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
+ "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }}",
+ "color": "danger"
+ }]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
+ if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/mjit.yml b/.github/workflows/mjit.yml
new file mode 100644
index 0000000000..d23c136619
--- /dev/null
+++ b/.github/workflows/mjit.yml
@@ -0,0 +1,79 @@
+name: MJIT
+on:
+ push:
+ branches:
+ - master
+ pull_request:
+ branches:
+ - '*'
+jobs:
+ test:
+ strategy:
+ matrix:
+ jit_opts: [ "--jit", "--jit-wait" ]
+ fail-fast: false
+ runs-on: ubuntu-latest
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
+ # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
+ - name: Checkout ruby/ruby
+ run: |
+ git clone --single-branch --shallow-since=yesterday https://github.com/ruby/ruby src
+ git -C src reset --hard "$GITHUB_SHA"
+ if: github.event_name == 'push'
+ - name: Checkout a pull request
+ run: |
+ git clone --single-branch --shallow-since=yesterday "--branch=$GITHUB_BRANCH" "https://github.com/${GITHUB_REPO}" src
+ git -C src reset --hard "$GITHUB_REV"
+ env:
+ GITHUB_REV: ${{ github.event.pull_request.head.sha }}
+ GITHUB_BRANCH: ${{ github.event.pull_request.head.ref }}
+ GITHUB_REPO: ${{ github.event.pull_request.head.repo.full_name }}
+ if: github.event_name == 'pull_request'
+ - run: ./src/tool/actions-commit-info.sh
+ id: commit_info
+ - name: Fixed world writable dirs
+ run: |
+ chmod go-w $HOME
+ sudo chmod -R go-w /usr/share
+ - name: Set ENV
+ run: |
+ echo '::set-env name=JOBS::'-j$((1 + $(nproc --all)))
+ - name: Autoconf
+ run: cd src && exec autoconf
+ - name: configure
+ run: |
+ mkdir build
+ cd build
+ ../src/configure -C --disable-install-doc
+ - name: make all
+ run: make -C build $JOBS
+ - name: make install
+ run: sudo make -C build $JOBS install
+ - name: make test
+ run: "make -C build $JOBS -s test TESTOPTS='-q --tty=no' RUN_OPTS='--disable-gems --jit-warnings ${{ matrix.jit_opts }}'"
+ - name: make test-all
+ run: "make -C build $JOBS -s test-all TESTOPTS='-q --tty=no' RUN_OPTS='--disable-gems --jit-warnings ${{ matrix.jit_opts }}'"
+ - name: make test-spec
+ run: "make -C build $JOBS -s test-spec RUN_OPTS='--disable-gems --jit-warnings ${{ matrix.jit_opts }}'"
+ - name: Leaked Globals
+ run: make -C build -s leaked-globals
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "attachments": [{
+ "text": "${{ job.status }}: ${{ github.workflow }} / ${{ matrix.jit_opts }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
+ "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
+ "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }}",
+ "color": "danger"
+ }]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
+ if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
new file mode 100644
index 0000000000..885f078f07
--- /dev/null
+++ b/.github/workflows/ubuntu.yml
@@ -0,0 +1,115 @@
+name: Ubuntu
+on:
+ push:
+ branches:
+ - master
+ pull_request:
+ branches:
+ - '*'
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [ "check", "test-bundler", "test-bundled-gems" ]
+ os: [ubuntu-latest, ubuntu-16.04]
+ exclude:
+ - test_task: test-bundler
+ os: ubuntu-16.04
+ - test_task: test-bundled-gems
+ os: ubuntu-16.04
+ fail-fast: false
+ runs-on: ${{ matrix.os }}
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - run: env | sort
+ - name: Dump GitHub context
+ env:
+ GITHUB_CONTEXT: ${{ toJson(github) }}
+ run: echo "$GITHUB_CONTEXT"
+ - name: Dump job context
+ env:
+ JOB_CONTEXT: ${{ toJson(job) }}
+ run: echo "$JOB_CONTEXT"
+ - name: Dump steps context
+ env:
+ STEPS_CONTEXT: ${{ toJson(steps) }}
+ run: echo "$STEPS_CONTEXT"
+ - name: Dump runner context
+ env:
+ RUNNER_CONTEXT: ${{ toJson(runner) }}
+ run: echo "$RUNNER_CONTEXT"
+ - name: Dump strategy context
+ env:
+ STRATEGY_CONTEXT: ${{ toJson(strategy) }}
+ run: echo "$STRATEGY_CONTEXT"
+ - name: Dump matrix context
+ env:
+ MATRIX_CONTEXT: ${{ toJson(matrix) }}
+ run: echo "$MATRIX_CONTEXT"
+
+ - name: Install libraries
+ run: |
+ set -x
+ sudo apt-get update -q || :
+ sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
+ # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
+ - name: Checkout ruby/ruby
+ run: |
+ git clone --single-branch --shallow-since=yesterday https://github.com/ruby/ruby src
+ git -C src reset --hard "$GITHUB_SHA"
+ if: github.event_name == 'push'
+ - name: Checkout a pull request
+ run: |
+ git clone --single-branch --shallow-since=yesterday "--branch=$GITHUB_BRANCH" "https://github.com/${GITHUB_REPO}" src
+ git -C src reset --hard "$GITHUB_REV"
+ env:
+ GITHUB_REV: ${{ github.event.pull_request.head.sha }}
+ GITHUB_BRANCH: ${{ github.event.pull_request.head.ref }}
+ GITHUB_REPO: ${{ github.event.pull_request.head.repo.full_name }}
+ if: github.event_name == 'pull_request'
+ - run: ./src/tool/actions-commit-info.sh
+ id: commit_info
+ - name: Fixed world writable dirs
+ run: |
+ chmod go-w $HOME
+ sudo chmod -R go-w /usr/share
+ - name: Set ENV
+ run: |
+ echo '::set-env name=JOBS::'-j$((1 + $(nproc --all)))
+ - name: Autoconf
+ run: cd src && exec autoconf
+ - name: configure
+ run: |
+ mkdir build
+ cd build
+ ../src/configure -C --disable-install-doc
+ - name: Make
+ run: make -C build $JOBS
+ - name: Extract gems
+ run: make -C build update-gems extract-gems
+ if: matrix.test_task == 'check'
+ - name: Create dummy files in build dir
+ run: |
+ cd build
+ ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
+ if: matrix.test_task == 'check'
+ - name: Tests
+ run: make -C build $JOBS -s ${{ matrix.test_task }}
+ env:
+ RUBY_TESTOPTS: "-q --tty=no"
+ - name: Leaked Globals
+ run: make -C build -s leaked-globals
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "attachments": [{
+ "text": "${{ job.status }}: ${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
+ "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
+ "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }}",
+ "color": "danger"
+ }]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
+ if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
new file mode 100644
index 0000000000..09e588784c
--- /dev/null
+++ b/.github/workflows/windows.yml
@@ -0,0 +1,90 @@
+name: Windows
+on:
+ push:
+ branches:
+ - master
+ pull_request:
+ branches:
+ - '*'
+jobs:
+ make:
+ strategy:
+ matrix:
+ test_task: [test]
+ os: [windows-2019]
+ vs: [2019]
+ fail-fast: false
+ runs-on: ${{ matrix.os }}
+ if: "!contains(github.event.head_commit.message, '[ci skip]')"
+ steps:
+ - uses: actions/cache@v1
+ with:
+ path: C:\vcpkg\downloads
+ key: ${{ runner.os }}-vcpkg-download-${{ matrix.os }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-vcpkg-download-${{ matrix.os }}-
+ ${{ runner.os }}-vcpkg-download-
+ - name: Install libraries with vcpkg
+ run: |
+ vcpkg --triplet x64-windows install readline zlib
+ - uses: actions/cache@v1
+ with:
+ path: C:\Users\runneradmin\AppData\Local\Temp\chocolatey
+ key: ${{ runner.os }}-chocolatey-${{ matrix.os }}-${{ github.sha }}
+ restore-keys: |
+ ${{ runner.os }}-chocolatey-${{ matrix.os }}-
+ ${{ runner.os }}-chocolatey-
+ - name: Install libraries with chocolatey
+ run: |
+ choco install --no-progress openssl winflexbison3
+ # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
+ - name: Checkout ruby/ruby
+ run: |
+ git clone --single-branch --shallow-since=yesterday https://github.com/ruby/ruby src
+ git -C src reset --hard ${{ github.sha }}
+ if: github.event_name == 'push'
+ - name: Checkout a pull request
+ run: |
+ git clone --single-branch --shallow-since=yesterday --branch=${{ github.event.pull_request.head.ref }} https://github.com/${{ github.event.pull_request.head.repo.full_name }} src
+ git -C src reset --hard ${{ github.event.pull_request.head.sha }}
+ if: github.event_name == 'pull_request'
+ - run: ./src/tool/actions-commit-info.sh
+ shell: bash
+ id: commit_info
+ - name: Configure
+ run: |
+ md build
+ cd build
+ call "C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+ ../src/win32/configure.bat --disable-install-doc --without-ext=+,dbm,gdbm --enable-bundled-libffi --with-opt-dir=C:/vcpkg/installed/x64-windows --with-openssl-dir="C:/Program Files/OpenSSL-Win64"
+ shell: cmd
+ - name: nmake
+ run: |
+ call "C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+ set YACC=win_bison
+ cd build
+ echo on
+ nmake up
+ nmake extract-gems
+ nmake
+ shell: cmd
+ - name: nmake test
+ run: |
+ call "C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
+ cd build
+ nmake ${{ matrix.test_task }}
+ shell: cmd
+ - uses: k0kubun/action-slack@v2.0.0
+ with:
+ payload: |
+ {
+ "attachments": [{
+ "text": "${{ job.status }}: ${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
+ "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
+ "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }}",
+ "color": "danger"
+ }]
+ }
+ env:
+ SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
+ if: failure() && github.event_name == 'push'
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..487af950f3
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,225 @@
+*-*-*.def
+*-*-*.exp
+*-*-*.lib
+*.a
+*.bak
+*.bc
+*.bundle
+*.dSYM
+*.dmyh
+*.dylib
+*.elc
+*.i
+*.inc
+*.log
+*.o
+*.obj
+*.old
+*.orig
+*.pch
+*.pdb
+*.rbinc
+*.rej
+*.s
+*.sav
+*.sl
+*.so
+*.swp
+*.yarb
+*~
+.*-*
+.*.list
+.*.time
+.DS_Store
+.bundle
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+.time
+Makefile
+cygruby*.def
+extconf.h
+y.output
+y.tab.c
+*.gcda
+*.gcno
+*.gcov
+*.vscode
+lcov*.info
+
+# /
+/*-fake.rb
+/*.dll
+/*.exe
+/*.res
+/*.pc
+/*.rc
+/*_prelude.c
+/build*/
+/COPYING.LIB
+/ChangeLog
+/Doxyfile
+/GNUmakefile
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/benchmark/benchmark-driver
+/beos
+/bmlog-*
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
+/coverage/.last_run.json
+/coverage/.resultset.json*
+/coverage/assets
+/coverage/index.html
+/doc/capi
+/enc.mk
+/encdb.h
+/exts.mk
+/goruby
+/id.[ch]
+/largefile.h
+/lcov-c-out
+/lcov-rb-out
+/lcov-out
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/probes.dmyh
+/probes.h
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/riscos
+/rubicon
+/ruby
+/ruby-runner
+/ruby-runner.h
+/ruby-man.rd.gz
+/run.gdb
+/sizes.c
+/test.rb
+/test-coverage.dat
+/tmp
+/transdb.h
+/uncommon.mk
+/verconf.h
+/verconf.mk
+/web
+/yasmdata.rb
+
+# /bin/
+
+/bin/*.exe
+/bin/*.dll
+
+# /benchmark/
+/benchmark/bm_require.data
+/benchmark/bmx_*.rb
+/benchmark/fasta.output.*
+/benchmark/wc.input
+
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/jis/props.h
+/enc/unicode/data
+
+# /coroutine/
+!/coroutine/**/*.s
+
+# /enc/trans/
+/enc/trans/*.c
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+
+# /exe/
+/exe/goruby
+/exe/ruby
+
+# /ext/
+/ext/extinit.c
+/ext/configure-ext.mk
+/ext/*/exts.mk
+
+# /ext/-test-/cxxanyargs
+/ext/-test-/cxxanyargs/failure*.failed
+
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.dll
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
+
+# /ext/etc/
+/ext/etc/constdefs.h
+
+# /ext/fiddle/
+/ext/fiddle/libffi-*
+
+# /ext/rbconfig/
+/ext/rbconfig/sizeof/sizes.c
+/ext/rbconfig/sizeof/limits.c
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /gems
+/gems/*.gem
+/gems/src
+/gems/*-*
+
+# /lib/
+/lib/ruby/[1-9]*.*
+/lib/ruby/vendor_ruby
+
+# /spec/bundler
+/.rspec_status
+
+# /tool/
+/tool/config.guess
+/tool/config.sub
+
+# /win32/
+/win32/*.ico
+
+# MJIT
+/rb_mjit_header.h
+/mjit_config.h
+/include/ruby-*/*/rb_mjit_min_header-*.h
diff --git a/.rspec_parallel b/.rspec_parallel
new file mode 100644
index 0000000000..aaff198a32
--- /dev/null
+++ b/.rspec_parallel
@@ -0,0 +1,2 @@
+--format progress
+--format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..71945e349e
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,550 @@
+# -*- YAML -*-
+# Copyright (C) 2011 Urabe, Shyouhei. All rights reserved.
+#
+# This file is a part of the programming language Ruby. Permission is hereby
+# granted, to either redistribute or modify this file, provided that the
+# conditions mentioned in the file COPYING are met. Consult the file for
+# details.
+
+# This is a Travis-CI build configuration file. The list of configurations
+# available is located in
+#
+# http://about.travis-ci.org/docs/user/build-configuration/
+#
+# and as Ruby itself is a project written in C language,
+#
+# http://about.travis-ci.org/docs/user/languages/c/
+#
+# is also a good place to look at.
+
+language: c
+
+os: linux
+
+dist: xenial
+
+git:
+ quiet: true
+
+cache:
+ ccache: true
+ directories:
+ - $HOME/config_2nd
+ - $HOME/.downloaded-cache
+
+env:
+ global:
+ # Reset timestamps early
+ - _=$(touch NEWS && find . -type f -exec touch -r NEWS {} +)
+ - CONFIGURE_TTY=no
+ - CCACHE_COMPILERCHECK=none
+ - CCACHE_NOCOMPRESS=1
+ - CCACHE_MAXSIZE=512Mi
+ - NPROC="`nproc`"
+ # JOBS and SETARCH are overridden when necessary; see below.
+ - JOBS=-j$((1+${NPROC}))
+ - SETARCH=
+ - RUBY_PREFIX=/tmp/ruby-prefix
+ - GEMS_FOR_TEST='timezone tzinfo'
+ - UPDATE_UNICODE="UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+ # https://github.com/travis-ci/travis-build/blob/e411371dda21430a60f61b8f3f57943d2fe4d344/lib/travis/build/bash/travis_apt_get_options.bash#L7
+ - travis_apt_get_options='--allow-downgrades --allow-remove-essential --allow-change-held-packages'
+ - travis_apt_get_options="-yq --no-install-suggests --no-install-recommends $travis_apt_get_options"
+
+.org.ruby-lang.ci.matrix-definitions:
+
+ - &cron-only
+ if: (type = cron) AND (branch = master) AND (fork = false)
+
+ - &make-test-only
+ script:
+ - $SETARCH make -s test TESTOPTS="${TESTOPTS=$JOBS -q --tty=no}"
+
+ - &gcc-8
+ compiler: gcc-8
+ # # Not using addon to control retries
+ # addons:
+ # apt:
+ # sources:
+ # - ubuntu-toolchain-r-test
+ before_install:
+ - tool/travis_retry.sh sudo -E apt-add-repository -y "ppa:ubuntu-toolchain-r/test"
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - |-
+ ${BEFORE_INSTALL}
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
+ ccache \
+ gcc-8 \
+ g++-8 \
+ libffi-dev \
+ libgdbm-dev \
+ libgmp-dev \
+ libjemalloc-dev \
+ libncurses5-dev \
+ libncursesw5-dev \
+ libreadline6-dev \
+ libssl-dev \
+ libyaml-dev \
+ openssl \
+ valgrind \
+ zlib1g-dev
+
+ - &clang-8
+ compiler: clang-8
+ addons:
+ apt:
+ # Not doing this manually unlike other sources, because it has been stable.
+ sources:
+ - llvm-toolchain-xenial-8
+ config:
+ retries: true
+ before_install:
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - |-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
+ clang-8 \
+ llvm-8-tools \
+ libffi-dev \
+ libgdbm-dev \
+ libgmp-dev \
+ libjemalloc-dev \
+ libncurses5-dev \
+ libncursesw5-dev \
+ libreadline6-dev \
+ libssl-dev \
+ libyaml-dev \
+ openssl \
+ valgrind \
+ zlib1g-dev
+
+ # --------
+
+ - &x86_64-linux
+ name: x86_64-linux
+ <<: *gcc-8
+
+ - &arm64-linux
+ name: arm64-linux
+ arch: arm64
+ <<: *gcc-8
+
+ - &s390x-linux
+ name: s390x-linux
+ arch: s390x
+ <<: *gcc-8
+
+ - &jemalloc
+ name: --with-jemalloc
+ <<: *gcc-8
+ <<: *cron-only
+ env:
+ - CONFIG_FLAG='--with-gmp --with-jemalloc --with-valgrind'
+
+ - &assertions
+ name: RUBY_DEBUG=1
+ <<: *gcc-8
+ #<<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - cppflags='-DRUBY_DEBUG -DVM_CHECK_MODE=1 -DTRANSIENT_HEAP_CHECK_MODE -DRGENGC_CHECK_MODE -DENC_DEBUG'
+
+ - &VM_CHECK_MODE
+ name: VM_CHECK_MODE=3
+ <<: *gcc-8
+ <<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - cppflags=-DVM_CHECK_MODE=0x0003
+
+ - &SUPPORT_JOKE
+ name: SUPPORT_JOKE
+ <<: *gcc-8
+ <<: *cron-only
+ <<: *make-test-only
+ env:
+ - BEFORE_INSTALL="sed vm_opts.h -e 's/OPT_SUPPORT_JOKE *0/OPT_SUPPORT_JOKE 1/' -i"
+
+ - &CPDEBUG
+ name: CPDEBUG
+ <<: *gcc-8
+ <<: *cron-only
+ <<: *make-test-only
+ env:
+ - cppflags=-DCPDEBUG
+
+ - &WITH_COROUTINE_UCONTEXT
+ name: COROUTINE=ucontext
+ <<: *gcc-8
+ <<: *cron-only
+ env:
+ - CONFIG_FLAG='--with-coroutine=ucontext'
+
+ - &WITH_COROUTINE_COPY
+ name: COROUTINE=copy
+ <<: *gcc-8
+ <<: *cron-only
+ env:
+ - CONFIG_FLAG='--with-coroutine=copy'
+
+ - &TOKEN_THREADED_CODE
+ name: TOKEN_THREADED_CODE
+ <<: *gcc-8
+ <<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - cppflags=-DOPT_THREADED_CODE=1
+
+ - &CALL_THREADED_CODE
+ name: CALL_THREADED_CODE
+ <<: *gcc-8
+ <<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - cppflags=-DOPT_THREADED_CODE=2
+
+ - &NO_THREADED_CODE
+ name: NO_THREADED_CODE
+ <<: *gcc-8
+ <<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - cppflags=-DOPT_THREADED_CODE=3
+
+ - &ASAN
+ name: -fsanitize=address
+ <<: *clang-8
+ #<<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - ASAN_OPTIONS=detect_leaks=0
+ - cflags='-U_FORTIFY_SOURCE -march=native -fsanitize=address -fno-omit-frame-pointer -fPIC'
+ - debugflags=-ggdb3
+ - optflags=-O1
+ - LD=clang-8
+ - LDFLAGS='-fsanitize=address -fPIC'
+ - CONFIG_FLAG='--with-out-ext=openssl --without-gmp --without-jemalloc --without-valgrind'
+
+ - &MSAN
+ name: -fsanitize=memory
+ <<: *clang-8
+ #<<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - cflags='-U_FORTIFY_SOURCE -fsanitize=memory -fsanitize-memory-track-origins=2 -fno-omit-frame-pointer -fPIC'
+ - optflags=-O1
+ - LD=clang-8
+ - LDFLAGS='-fsanitize=memory -fPIC'
+ - CONFIG_FLAG='--with-out-ext=openssl --without-gmp --without-jemalloc --without-valgrind'
+
+ - &UBSAN
+ name: -fsanitize=undefined
+ <<: *clang-8
+ #<<: *cron-only
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - cflags='-U_FORTIFY_SOURCE -fsanitize=undefined,integer,nullability -fno-sanitize=implicit-integer-sign-change,unsigned-integer-overflow'
+ - cppflags=-DUNALIGNED_WORD_ACCESS=0
+ - debugflags=-ggdb3
+ - optflags='-O1 -march=native'
+ - LD=clang-8
+ - LDFLAGS='-fsanitize=undefined,integer,nullability -fno-sanitize=implicit-integer-sign-change,unsigned-integer-overflow'
+
+ - &i686-linux
+ name: i686-linux
+ compiler: gcc-8
+ env:
+ - GCC_FLAGS=-m32
+ - CXX='g++-8 -m32'
+ - debugflags=-g0
+ - SETARCH='setarch i686 --verbose --3gb'
+ # # Not using addon to control retries
+ # addons:
+ # apt:
+ # sources:
+ # - ubuntu-toolchain-r-test
+ before_install:
+ - tool/travis_retry.sh sudo -E apt-add-repository -y "ppa:ubuntu-toolchain-r/test"
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - |-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
+ gcc-8-multilib \
+ g++-8 \
+ g++-8-multilib \
+ libstdc++-8-dev:i386 \
+ libffi-dev:i386 \
+ libffi6:i386 \
+ libgdbm-dev:i386 \
+ libgdbm3:i386 \
+ libncurses5-dev:i386 \
+ libncurses5:i386 \
+ libncursesw5-dev:i386 \
+ libreadline6-dev:i386 \
+ libreadline6:i386 \
+ libssl-dev:i386 \
+ libssl1.0.0:i386 \
+ linux-libc-dev:i386 \
+ zlib1g-dev:i386 \
+ zlib1g:i386
+
+ - &arm32-linux
+ name: arm32-linux
+ arch: arm64
+ # https://packages.ubuntu.com/xenial/crossbuild-essential-armhf
+ compiler: arm-linux-gnueabihf-gcc
+ env:
+ - debugflags=-g0
+ - SETARCH='setarch linux32 --verbose --32bit'
+ before_install:
+ - sudo dpkg --add-architecture armhf
+ - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
+ - |-
+ tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
+ ccache \
+ crossbuild-essential-armhf \
+ libc6:armhf \
+ libstdc++-5-dev:armhf \
+ libffi-dev:armhf \
+ libffi6:armhf \
+ libgdbm-dev:armhf \
+ libgdbm3:armhf \
+ libncurses5-dev:armhf \
+ libncurses5:armhf \
+ libncursesw5-dev:armhf \
+ libreadline6-dev:armhf \
+ libreadline6:armhf \
+ libssl-dev:armhf \
+ libssl1.0.0:armhf \
+ linux-libc-dev:armhf \
+ zlib1g-dev:armhf \
+ zlib1g:armhf
+
+ - &pedanticism
+ name: -std=c99 -pedantic
+ compiler: clang
+ <<: *make-test-only
+ env:
+ - GEMS_FOR_TEST=
+ - GCC_FLAGS='-std=c99 -Werror=pedantic -pedantic-errors'
+ - CONFIG_FLAG=
+ - JOBS=
+ - >-
+ warnflags='
+ -Wall
+ -Wextra
+ -Werror=deprecated-declarations
+ -Werror=division-by-zero
+ -Werror=extra-tokens
+ -Werror=implicit-function-declaration
+ -Werror=implicit-int
+ -Werror=pointer-arith
+ -Werror=shorten-64-to-32
+ -Werror=write-strings
+ -Wmissing-noreturn
+ -Wno-constant-logical-operand
+ -Wno-missing-field-initializers
+ -Wno-overlength-strings
+ -Wno-parentheses-equality
+ -Wno-self-assign
+ -Wno-tautological-compare
+ -Wno-unused-local-typedef
+ -Wno-unused-parameter
+ -Wunused-variable'
+ - LDFLAGS=-Wno-unused-command-line-argument
+
+ - &rubyspec
+ name: Check ruby/spec version guards on Ruby 2.4
+ language: ruby
+ rvm: 2.4.6
+ before_install:
+ install:
+ before_script: chmod -R u+w spec/ruby
+ # -j randomly hangs.
+ script: ruby -C spec/ruby ../mspec/bin/mspec .
+ after_failure:
+ - echo "ruby/spec failed on Ruby 2.4. This is likely because of a missing ruby_version_is guard, please add it. See spec/README.md."
+
+ - &baseruby
+ name: "BASERUBY: Ruby 2.2"
+ <<: *gcc-8
+ <<: *make-test-only
+ language: ruby
+ rvm: 2.2
+
+ - &dependency
+ name: Check dependencies in makefiles
+ language: ruby
+ before_install:
+ install:
+ before_script:
+ - |-
+ ruby -e 'new = []
+ Dir.glob("ext/**/extconf.rb") {|ex|
+ unless File.exist?(dep = File.dirname(ex)+"/depend")
+ puts "Adding "+dep
+ File.copy_stream("template/depend.tmpl", dep)
+ new << dep
+ end
+ }
+ exec("git", "add", *new) unless new.empty?'
+ - git diff --cached
+ - "> config.status"
+ - "> .rbconfig.time"
+ - sed -f tool/prereq.status template/Makefile.in common.mk > Makefile
+ - make touch-unicode-files
+ - make -s $JOBS $UPDATE_UNICODE up
+ - make -s $JOBS srcs
+ - rm -f config.status Makefile rbconfig.rb .rbconfig.time
+ - $SETARCH ./configure -C --disable-install-doc --prefix=$RUBY_PREFIX --disable-rubygems 'optflags=-O0' 'debugflags=-save-temps=obj -g'
+ - ruby tool/update-deps --fix
+ script:
+ - git diff --no-ext-diff --ignore-submodules --exit-code
+ after_failure:
+ - echo "Dependencies need to update"
+ env:
+ - CONFIG_FLAG=
+
+matrix:
+ include:
+ # Build every commit:
+ - <<: *x86_64-linux
+ - <<: *arm64-linux
+ - <<: *i686-linux
+ - <<: *arm32-linux
+ - <<: *s390x-linux
+ - <<: *pedanticism
+ - <<: *assertions
+ - <<: *baseruby
+ - <<: *rubyspec
+ - <<: *dependency
+ # Build every commit (Allowed Failures):
+ - <<: *ASAN
+ - <<: *MSAN
+ - <<: *UBSAN
+ # Cron only:
+ - <<: *jemalloc
+ - <<: *VM_CHECK_MODE
+ - <<: *SUPPORT_JOKE
+ - <<: *CPDEBUG
+ - <<: *WITH_COROUTINE_UCONTEXT
+ - <<: *WITH_COROUTINE_COPY
+ - <<: *TOKEN_THREADED_CODE
+ - <<: *CALL_THREADED_CODE
+ - <<: *NO_THREADED_CODE
+ allow_failures:
+ - name: s390x-linux
+ - name: -fsanitize=address
+ - name: -fsanitize=memory
+ - name: -fsanitize=undefined
+ fast_finish: true
+
+before_script:
+ - date # Debugging "Permission defined" failure on darwin like https://travis-ci.org/ruby/ruby/jobs/508683759
+ - dpkg --print-architecture
+ - dpkg --print-foreign-architectures
+ - setarch --list
+ - echo JOBS=${JOBS} SETARCH=${SETARCH}
+ - $SETARCH uname -a
+ - $SETARCH uname -r
+ - rm -fr .ext autom4te.cache
+ - echo $TERM
+ - |-
+ [ -d ~/.downloaded-cache ] ||
+ mkdir ~/.downloaded-cache
+ - ln -s ~/.downloaded-cache
+ - "> config.status"
+ - "> .rbconfig.time"
+ - sed -f tool/prereq.status template/Makefile.in common.mk > Makefile
+ - date; make touch-unicode-files
+ - date; make -s $JOBS $UPDATE_UNICODE up
+ - date; make -s $JOBS srcs
+ - rm -f config.status Makefile rbconfig.rb .rbconfig.time
+ - |-
+ if [ -d ~/config_2nd ]; then
+ cp -pr ~/config_2nd build
+ else
+ mkdir build
+ fi
+ - mkdir config_1st config_2nd
+ - chmod -R a-w .
+ - chmod -R u+w build config_1st config_2nd
+ - cd build
+ - ccache --show-stats
+ - |-
+ case "$CC" in
+ gcc*) CC="ccache $CC${GCC_FLAGS:+ }$GCC_FLAGS -fno-diagnostics-color";;
+ clang*) CC="ccache $CC${GCC_FLAGS:+ }$GCC_FLAGS -fno-color-diagnostics";;
+ esac
+ - |-
+ [ ! -f config.cache ] ||
+ [ "$CC" = "`sed -n s/^ac_cv_prog_CC=//p config.cache`" ] ||
+ (set -x; exec rm config.cache)
+ - $SETARCH ../configure -C --disable-install-doc --prefix=$RUBY_PREFIX $CONFIG_FLAG
+ - cp -pr config.cache config.status .ext/include ../config_1st
+ - $SETARCH make reconfig
+ - cp -pr config.cache config.status .ext/include ../config_2nd
+ - (cd .. && exec diff -ru config_1st config_2nd)
+ - chmod u+w ..
+ - rm -rf ~/config_2nd
+ - mv ../config_2nd ~
+ - chmod u-w ..
+ - $SETARCH make -s $JOBS
+ - |-
+ date; : # Debugging "Permission defined" failure on darwin like https://travis-ci.org/ruby/ruby/jobs/508683759
+ if ! make install; then
+ if [ "$(uname)" = Darwin ]; then
+ # Debugging "Permission defined" failure on darwin like https://travis-ci.org/ruby/ruby/jobs/508683759
+ set -x
+ date
+ ./miniruby -e 'ARGV.map{|path|[path,File.stat(path)]}.sort_by{|path,st|st.mtime}.each{|path,st|p mtime:st.mtime.to_f, ctime:st.ctime.to_f, path:path}' .ext/.timestamp/.RUBYCOMMONDIR*time .ext/common/bigdecimal/*.rb ../ext/bigdecimal/lib/bigdecimal/*.rb . .. .ext .ext/common .ext/common/bigdecimal ext/bigdecimal ../ext ../ext/bigdecimal ../ext/bigdecimal/lib ../ext/bigdecimal/lib/bigdecimal
+ make COPY='cp -f' install
+ else
+ exit 1
+ fi
+ fi
+ - ccache --show-stats
+ - |-
+ [ -z "${GEMS_FOR_TEST}" ] ||
+ $RUBY_PREFIX/bin/gem install --no-document $GEMS_FOR_TEST
+ - echo "raise 'do not load ~/.irbrc in test'" > ~/.irbrc
+
+script:
+ - $SETARCH make -s test -o showflags TESTOPTS="${TESTOPTS=$JOBS -q --tty=no}"
+ - travis_wait 50 $SETARCH make -s test-all -o exts TESTOPTS="${TESTOPTS} ${TEST_ALL_OPTS}" RUBYOPT="-w"
+ - $SETARCH make -s test-spec MSPECOPT=-ff # not using `-j` because sometimes `mspec -j` silently dies
+ - $SETARCH make -s -o showflags leaked-globals
+
+# Branch matrix. Not all branches are Travis-ready so we limit branches here.
+branches:
+ only:
+ - master
+ - ruby_2_4
+ - ruby_2_5
+ - ruby_2_6
+
+# We want to be notified when something happens.
+notifications:
+ irc:
+ channels:
+ - "chat.freenode.net#ruby-core"
+ on_success: change # [always|never|change] # default: always
+ on_failure: always # [always|never|change] # default: always
+ template:
+ - "%{message} by @%{author}: See %{build_url}"
+
+ slack:
+ rooms:
+ - secure: ah7UEHBvncXT7bM5mvYIQAO+tIyV/wl7nXLb7wQD16dO2v8Gragy0mWjB79Q09hrrMGmp6H9bCDpdGS80boIA5EHaHoG4QaP0i9bsSt8U2AMWgZtfyIgQKJ4H2kXkGlrjO+AXTgnIkP7LNjdgAVUUTGQPb26T3QmoN2Splt+fIQ= # ruby:<token>#alerts
+ on_pull_requests: false
+ on_success: change
+ on_failure: always
+
+ email:
+ - ko1c-failure@atdot.net
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..a009caefea
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
new file mode 100644
index 0000000000..ffdf2dd4b8
--- /dev/null
+++ b/CONTRIBUTING.md
@@ -0,0 +1,4 @@
+Please see the [official issue tracker] and wiki [HowToContribute].
+
+[official issue tracker]: https://bugs.ruby-lang.org
+[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index 9043404a83..48e5a96de7 100644
--- a/COPYING
+++ b/COPYING
@@ -1,56 +1,56 @@
Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the GPL
-version 2 (see the file GPL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
- 1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
+1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
- 2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
+2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
- a) place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
- b) use the modified software only within your corporation or
- organization.
+ b. use the modified software only within your corporation or
+ organization.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 3. You may distribute the software in object code or binary form,
- provided that you do at least ONE of the following:
+3. You may distribute the software in object code or binary form,
+ provided that you do at least ONE of the following:
- a) distribute the binaries and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
+ a. distribute the binaries and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
- b) accompany the distribution with the machine-readable source of
- the software.
+ b. accompany the distribution with the machine-readable source of
+ the software.
- c) give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c. give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d) make other distribution arrangements with the author.
+ d. make other distribution arrangements with the author.
- 4. You may modify and include the part of the software into any other
- software (possibly commercial). But some files in the distribution
- are not written by the author, so that they are not under these terms.
+4. You may modify and include the part of the software into any other
+ software (possibly commercial). But some files in the distribution
+ are not written by the author, so that they are not under these terms.
- For the list of those files and their copying conditions, see the
- file LEGAL.
+ For the list of those files and their copying conditions, see the
+ file LEGAL.
- 5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
+5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
- 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
+6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index 933cc7cb9a..230376bc60 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,51 @@
-$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
-Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
-$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+本プログラムã¯ãƒ•リーソフトウェアã§ã™ï¼Ž2-clause BSDL
+ã¾ãŸã¯ä»¥ä¸‹ã«ç¤ºã™æ¡ä»¶ã§æœ¬ãƒ—ログラムをå†é…布ã§ãã¾ã™
+2-clause BSDLã«ã¤ã„ã¦ã¯BSDLファイルをå‚ç…§ã—ã¦ä¸‹ã•ã„.
- 1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
+1. 複製ã¯åˆ¶é™ãªã自由ã§ã™ï¼Ž
- 2. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$N%=!<%9$r(B
- $B<+M3$KJQ99$G$-$^$9!%(B
+2. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムã®ã‚½ãƒ¼ã‚¹ã‚’
+ 自由ã«å¤‰æ›´ã§ãã¾ã™ï¼Ž
- (a) $B%M%C%H%K%e!<%:$K%]%9%H$7$?$j!$:n<T$KJQ99$rAwIU$9$k(B
- $B$J$I$NJ}K!$G!$JQ99$r8x3+$9$k!%(B
+ a. ãƒãƒƒãƒˆãƒ‹ãƒ¥ãƒ¼ã‚ºã«ãƒã‚¹ãƒˆã—ãŸã‚Šï¼Œä½œè€…ã«å¤‰æ›´ã‚’é€ä»˜ã™ã‚‹
+ ãªã©ã®æ–¹æ³•ã§ï¼Œå¤‰æ›´ã‚’公開ã™ã‚‹ï¼Ž
- (b) $BJQ99$7$?K\%W%m%0%i%`$r<+J,$N=jB0$9$kAH?%FbIt$@$1$G(B
- $B;H$&!%(B
+ b. 変更ã—ãŸæœ¬ãƒ—ãƒ­ã‚°ãƒ©ãƒ ã‚’è‡ªåˆ†ã®æ‰€å±žã™ã‚‹çµ„織内部ã ã‘ã§
+ 使ã†ï¼Ž
- (c) $BJQ99E@$rL@<($7$?$&$(!$%=%U%H%&%'%"$NL>A0$rJQ99$9$k!%(B
- $B$=$N%=%U%H%&%'%"$rG[I[$9$k;~$K$OJQ99A0$NK\%W%m%0%i(B
- $B%`$bF1;~$KG[I[$9$k!%$^$?$OJQ99A0$NK\%W%m%0%i%`$N%=!<(B
- $B%9$NF~<jK!$rL@<($9$k!%(B
+ c. 変更点を明示ã—ãŸã†ãˆï¼Œã‚½ãƒ•トウェアã®åå‰ã‚’変更ã™ã‚‹ï¼Ž
+ ãã®ã‚½ãƒ•トウェアをé…布ã™ã‚‹æ™‚ã«ã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラ
+ ãƒ ã‚‚åŒæ™‚ã«é…布ã™ã‚‹ï¼Žã¾ãŸã¯å¤‰æ›´å‰ã®æœ¬ãƒ—ログラムã®ã‚½ãƒ¼
+ スã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (d) $B$=$NB>$NJQ99>r7o$r:n<T$H9g0U$9$k!%(B
+ d. ãã®ä»–ã®å¤‰æ›´æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
- 3. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$r%3%s%Q%$(B
- $B%k$7$?%*%V%8%'%/%H%3!<%I$d<B9T7A<0$G$bG[I[$G$-$^$9!%(B
+3. ä»¥ä¸‹ã®æ¡ä»¶ã®ã„ãšã‚Œã‹ã‚’満ãŸã™æ™‚ã«æœ¬ãƒ—ログラムをコンパイ
+ ルã—ãŸã‚ªãƒ–ジェクトコードや実行形å¼ã§ã‚‚é…布ã§ãã¾ã™ï¼Ž
- (a) $B%P%$%J%j$r<u$1<h$C$??M$,%=!<%9$rF~<j$G$-$k$h$&$K!$(B
- $B%=!<%9$NF~<jK!$rL@<($9$k!%(B
+ a. ãƒã‚¤ãƒŠãƒªã‚’å—ã‘å–ã£ãŸäººãŒã‚½ãƒ¼ã‚¹ã‚’入手ã§ãるよã†ã«ï¼Œ
+ ソースã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (b) $B5!3#2DFI$J%=!<%9%3!<%I$rE:IU$9$k!%(B
+ b. 機械å¯èª­ãªã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã‚’添付ã™ã‚‹ï¼Ž
- (c) $BJQ99$r9T$C$?%P%$%J%j$OL>A0$rJQ99$7$?$&$(!$%*%j%8%J(B
- $B%k$N%=!<%9%3!<%I$NF~<jK!$rL@<($9$k!%(B
+ c. 変更を行ã£ãŸãƒã‚¤ãƒŠãƒªã¯åå‰ã‚’変更ã—ãŸã†ãˆï¼Œã‚ªãƒªã‚¸ãƒŠ
+ ルã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã®å…¥æ‰‹æ³•を明示ã™ã‚‹ï¼Ž
- (d) $B$=$NB>$NG[I[>r7o$r:n<T$H9g0U$9$k!%(B
+ d. ãã®ä»–ã®é…布æ¡ä»¶ã‚’作者ã¨åˆæ„ã™ã‚‹ï¼Ž
- 4. $BB>$N%W%m%0%i%`$X$N0zMQ$O$$$+$J$kL\E*$G$"$l<+M3$G$9!%$?(B
- $B$@$7!$K\%W%m%0%i%`$K4^$^$l$kB>$N:n<T$K$h$k%3!<%I$O!$$=(B
- $B$l$>$l$N:n<T$N0U8~$K$h$k@)8B$,2C$($i$l$k>l9g$,$"$j$^$9!%(B
+4. ä»–ã®ãƒ—ログラムã¸ã®å¼•用ã¯ã„ã‹ãªã‚‹ç›®çš„ã§ã‚れ自由ã§ã™ï¼ŽãŸ
+ ã ã—,本プログラムã«å«ã¾ã‚Œã‚‹ä»–ã®ä½œè€…ã«ã‚ˆã‚‹ã‚³ãƒ¼ãƒ‰ã¯ï¼Œã
+ れãžã‚Œã®ä½œè€…ã®æ„å‘ã«ã‚ˆã‚‹åˆ¶é™ãŒåŠ ãˆã‚‰ã‚Œã‚‹å ´åˆãŒã‚りã¾ã™ï¼Ž
- $B$=$l$i%U%!%$%k$N0lMw$H$=$l$>$l$NG[I[>r7o$J$I$KIU$$$F$O(B
- LEGAL$B%U%!%$%k$r;2>H$7$F$/$@$5$$!%(B
+ ãれらファイルã®ä¸€è¦§ã¨ãれãžã‚Œã®é…布æ¡ä»¶ãªã©ã«ä»˜ã„ã¦ã¯
+ LEGALファイルをå‚ç…§ã—ã¦ãã ã•ã„.
- 5. $BK\%W%m%0%i%`$X$NF~NO$H$J$k%9%/%j%W%H$*$h$S!$K\%W%m%0%i(B
- $B%`$+$i$N=PNO$N8"Mx$OK\%W%m%0%i%`$N:n<T$G$O$J$/!$$=$l$>(B
- $B$l$NF~=PNO$r@8@.$7$??M$KB0$7$^$9!%$^$?!$K\%W%m%0%i%`$K(B
- $BAH$_9~$^$l$k$?$a$N3HD%%i%$%V%i%j$K$D$$$F$bF1MM$G$9!%(B
+5. 本プログラムã¸ã®å…¥åŠ›ã¨ãªã‚‹ã‚¹ã‚¯ãƒªãƒ—トãŠã‚ˆã³ï¼Œæœ¬ãƒ—ログラ
+ ムã‹ã‚‰ã®å‡ºåŠ›ã®æ¨©åˆ©ã¯æœ¬ãƒ—ログラムã®ä½œè€…ã§ã¯ãªã,ãれãž
+ れã®å…¥å‡ºåŠ›ã‚’ç”Ÿæˆã—ãŸäººã«å±žã—ã¾ã™ï¼Žã¾ãŸï¼Œæœ¬ãƒ—ログラムã«
+ 組ã¿è¾¼ã¾ã‚Œã‚‹ãŸã‚ã®æ‹¡å¼µãƒ©ã‚¤ãƒ–ラリã«ã¤ã„ã¦ã‚‚åŒæ§˜ã§ã™ï¼Ž
- 6. $BK\%W%m%0%i%`$OL5J]>Z$G$9!%:n<T$OK\%W%m%0%i%`$r%5%]!<%H(B
- $B$9$k0U;V$O$"$j$^$9$,!$%W%m%0%i%`<+?H$N%P%0$"$k$$$OK\%W(B
- $B%m%0%i%`$N<B9T$J$I$+$iH/@8$9$k$$$+$J$kB;32$KBP$7$F$b@U(B
- $BG$$r;}$A$^$;$s!%(B
+6. 本プログラムã¯ç„¡ä¿è¨¼ã§ã™ï¼Žä½œè€…ã¯æœ¬ãƒ—ログラムをサãƒãƒ¼ãƒˆ
+ ã™ã‚‹æ„å¿—ã¯ã‚りã¾ã™ãŒï¼Œãƒ—ログラム自身ã®ãƒã‚°ã‚ã‚‹ã„ã¯æœ¬ãƒ—
+ ログラムã®å®Ÿè¡Œãªã©ã‹ã‚‰ç™ºç”Ÿã™ã‚‹ã„ã‹ãªã‚‹æå®³ã«å¯¾ã—ã¦ã‚‚責
+ 任をæŒã¡ã¾ã›ã‚“.
diff --git a/ChangeLog b/ChangeLog
deleted file mode 100644
index 116d413318..0000000000
--- a/ChangeLog
+++ /dev/null
@@ -1,18771 +0,0 @@
-Sun Jun 15 22:52:24 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_cat): fixed buffer overrun reported by
- Christopher Thompson <cthompson at nexopia.com> in [ruby-core:16746]
-
-Sun Jun 15 22:50:34 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (is_defined): add NODE_OP_ASGN_{OR,AND}. "defined?(a||=1)"
- should not operate assignment. [ruby-dev:34645]
-
-Sun Jun 15 22:49:12 2008 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_select): backport from trunk.
- [ruby-talk:300743]
-
-Sun Jun 15 22:47:37 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/delegate.rb (SimpleDelegator::dup): removed needless argument.
- [ruby-list:44910]
-
- * lib/delegate.rb (clone, dup): keep relationship with the target
- object.
-
-Sun Jun 15 22:45:19 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * util.c (ruby_strtod): backported from 1.9. a patch from Satoshi
- Nakagawa <psychs at limechat.net> in [ruby-dev:34625].
- fixed: [ruby-dev:34623]
-
-Sun Jun 15 22:43:39 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * struct.c (rb_struct_s_def): to_str should be called only once.
- [ruby-core:16647]
-
-Sun Jun 15 22:41:49 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/zlib/zlib.c (gzreader_gets): may cause infinite loop.
- a patch from Kouya <kouyataifu4 at gmail.com> in
- [ruby-reference-manual:762].
-
-Sun Jun 15 22:32:39 2008 James Edward Gray II <jeg2@ruby-lang.org>
-
- Merged 16241 from trunk.
-
- * lib/net/telnet.rb: Fixing a bug where line endings would not be properly
- escaped when the two character ending was broken up into separate TCP
- packets. Issue reported and patched by Brian Candler.
-
-Sun Jun 15 22:30:30 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (rb_reg_search): use local variable. a patch from wanabe
- <s.wanabe AT gmail.com> in [ruby-dev:34537]. [ruby-dev:34492]
-
-Sun Jun 15 22:21:07 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dln.c (dln_find_1): prior files with extensions to files sans
- extensions. [ruby-core:16517]
-
-Sun Jun 15 22:19:33 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): should protect temporary string from
- GC. [ruby-dev:34480]
-
-Sun Jun 15 22:17:35 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * regex.c (re_search): string might be NULL. [ruby-core:16478]
-
-Sun Jun 15 22:13:13 2008 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * time.c (rb_strftime): check errno to detect strftime(3)'s error.
- this is workaround for recent version of MSVCRT.
- [ruby-dev:34456]
-
-Sun Jun 15 22:10:14 2008 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/yaml/types.rb: Likewise, pass self to YAML::quick_emit;
- merged from 1.9.
-
- * lib/yaml.rb (quick_emit): use combination of object_id and hash to
- identify repeated object references, since GC will reuse memory of
- objects during output of YAML. [ruby-Bugs-8548] [ruby-Bugs-3698];
- merged from 1.9.
-
-Sun Jun 15 22:05:45 2008 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/syck/rubyext.c: Node#value defined twice.
-
- * lib/yaml/: several method redefinitions causing warnings.
-
-Sun Jun 15 22:03:36 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_object): add volatile to avoid potential GC bug. a
- patch from Tomoyuki Chikanaga <chikanag at nippon-control-system.co.jp>
- in [ruby-dev:34311].
-
-Sun Jun 15 21:57:19 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * re.c (rb_reg_quote): should always copy the quoting string.
- [ruby-core:16235]
-
-Sun Jun 15 21:26:54 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/net/pop.rb (Net::POP3::do_finish): clear @n_mails and
- @n_bytes as well. [ruby-core:16144]
-
-Sun Jun 15 21:07:37 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/resolv.rb (Resolv::Config.default_config_hash): requires
- win32/resolv to use Win32::Resolv. [ruby-dev:34138]
-
-Sun Jun 15 20:52:45 2008 Akinori MUSHA <knu@iDaemons.org>
-
- * parse.y (yycompile): Always prepare a new array for each file's
- SCRIPT_LINES__ storage, instead of appending source lines every
- time a file is re-loaded; submitted by Rocky Bernstein in
- #18517.
-
-Sun Jun 15 20:28:45 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/resolv.rb (Resolv::Hosts): should not use win32/resolv on cygwin.
- [ruby-dev:29945], [ruby-dev:34095]
-
- * lib/win32/registry.rb (Win32::Registry.expand_environ): try upcased
- name too for cygwin. [ruby-dev:29945]
-
- * lib/win32/resolv.rb (Win32::Resolv.get_hosts_path): use expand_path.
-
-Sun Jun 15 20:27:21 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-mode): should use `run-mode-hooks' instead
- of calling `run-hooks' directly to run the mode hook. patch from
- Chiyuan Zhang <pluskid AT gmail.com> in [ruby-core:15915]
-
-Sun Jun 15 20:07:30 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (fix_coerce): try conversion before type check.
- [ruby-core:15838]
-
-Sun Jun 15 19:55:46 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (BIGZEROP): fix for longer Bignum zeros. [ruby-Bugs-17454]
-
-Sun Jun 15 19:53:16 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (big2str_find_n1): check integer overflow.
-
-Sun Jun 15 19:51:37 2008 Tanaka Akira <akr@fsij.org>
-
- * gc.c (STACK_LENGTH) [SPARC] : 0x80 offset removed. [ruby-dev:33857]
-
-Sun Jun 15 19:49:10 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/readline/readline.c (readline_event): prevent polling. based on
- a patch from error errorsson in [ruby-Bugs-17675].
-
-Sun Jun 15 19:24:42 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (yycompile): clear ruby_eval_tree_begin if parse failed.
-
-Sun Jun 15 19:23:23 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (yycompile): clear ruby_eval_tree_begin too before parse.
-
-Sun Jun 15 19:21:26 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/pty/lib/expect.rb (IO#expect): check if peer is closed.
- [ruby-Bugs-17940]
-
-Sun Jun 15 19:19:21 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (iconv_convert): check upper bound. a patch from
- Daniel Luz at [ruby-Bugs-17910].
-
-Sun Jun 15 19:07:41 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ftruncate): check if available.
-
- * file.c (rb_file_truncate): check if ftruncate instead of truncate.
-
-Sun Jun 15 18:59:04 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (sigsetmask): check when signal semantics is not POSIX.
-
- * signal.c (USE_TRAP_MASK): set true if sigprocmask or sigsetmask is
- available.
-
-Sat Jun 14 16:12:17 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/timeout.rb (Timeout::timeout): made sensitive to location on the
- stack. [ruby-core:15458]
-
-Fri Jun 13 13:10:12 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/dl/ptr.c (dlmem_each_i): typo fixed. a patch from IKOMA
-Sun Jun 15 21:01:56 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * class.c (clone_method): should copy cref as well.
- [ruby-core:15833]
-
- Yoshiki <ikoma@mb.i-chubu.ne.jp> in [ruby-dev:33776].
-
-Fri Jun 13 12:10:58 2008 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-
- * gc.c (rb_newobj): prohibit call of rb_newobj() during gc.
- Submitted by Sylvain Joyeux [ruby-core:12099].
-
- * ext/dl/ptr.c: do not use LONG2NUM() inside dlptr_free().
- Slightly modified fix bassed on a patch by Sylvain Joyeux
- [ruby-core:12099] [ ruby-bugs-11859 ] [ ruby-bugs-11882 ]
- [ ruby-patches-13151 ].
-
-Fri Jun 13 12:09:02 2008 NARUSE, Yui <naruse@ruby-lang.org>
-
- * lib/benchmark.rb (Job::Benchmark#item): fix typo.
-
-Fri Jun 13 12:03:31 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_to_f): use strtod() for more
- precision. [ruby-talk:290296]
-
- * ext/bigdecimal/bigdecimal.c (BASE_FIG): made constant.
-
- * ext/bigdecimal/extconf.rb: ditto. [ruby-dev:33658]
-
-Fri Jun 13 11:58:34 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/irb.rb (IRB::Irb::eval_input): rescues Interrupt and other than
- SystemExit and SignalException. [ruby-core:15359]
-
-Fri Jun 13 11:56:28 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/benchmark.rb (Benchmark::realtime): make Benchmark#realtime
- a bit faster. a patch from Alexander Dymo <dymo@ukrpost.ua> in
- [ruby-core:15337].
-
-Fri Jun 13 11:42:52 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_open_file): should check NUL in path.
- <http://www.rubyist.net/~matz/20080125.html#c01>.
-
- * io.c (rb_io_s_popen): ditto.
-
- * io.c (rb_io_reopen): ditto.
-
- * io.c (next_argv): ditto.
-
- * io.c (rb_io_s_foreach): ditto.
-
- * io.c (rb_io_s_readlines): ditto.
-
- * io.c (rb_io_s_read): ditto.
-
-Wed Jun 11 15:06:00 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic::inspect): use Kernel#to_s instead
- object_id with printf. [ruby-dev:33347]
-
-Wed Jun 11 14:58:49 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: Remove wrong assumptions about Cygwin. a patch from
- Corinna Vinschen in [ruby-Bugs-17018].
-
-Mon Jun 9 18:03:32 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (eval): check if backtrace is empty. [ruby-core:15040]
-
-Sun Jun 8 06:07:02 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_define_alloc_func, rb_undef_alloc_func): should
- define/undef on a signleton class. [ruby-core:09959]
-
-Sun Jun 8 06:03:45 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (time_arg): use converted object. [ruby-core:14759]
-
-Sun Jun 8 06:01:25 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (fptr_finalize): clear errno first. [ruby-talk:284492]
-
-Sun Jun 8 05:53:46 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (TIMEZONE_VOID): check whether timezone requires zero
- arguments. [ruby-dev:32631]
-
-Sun Jun 8 05:35:32 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (f_rest_arg): check if duplicated. [ruby-core:14140]
-
-Sun Jun 8 05:21:46 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_CHECK_VARTYPE): check if a variable is defined
- and its type.
-
- * configure.in (timezone, altzone): check for recent cygwin.
-
- * missing/strftime.c (strftime): fix for timezone. [ruby-dev:32536]
-
- * lib/mkmf.rb (try_var): should fail for functions.
-
- * ext/readline/extconf.rb: should use have_func for functions instead
- of have_var.
-
-Sun Jun 8 05:09:29 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/uri/common.rb (URI::REGEXP::PATTERN): typo in REG_NAME
- regular expression. a patch from Ueda Satoshi
- <s-ueda AT livedoor.jp>. [ruby-dev:32514]
-
-Sun Jun 8 05:05:05 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/cgi.rb (read_multipart): exclude blanks from header values.
- [ruby-list:44327]
-
-Sun Jun 8 05:00:44 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (rb_cstr_to_inum): trailing spaces may exist at sqeezing
- preceeding 0s. [ruby-core:13873]
-
-Sun Jun 8 04:56:55 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (error_print): put newline unless multiple line message ends
- with a newline. [ruby-dev:32429]
-
-Sun Jun 8 04:54:36 2008 James Edward Gray II <jeg2@ruby-lang.org>
-
- Merged 14070 from trunk.
-
- * lib/xmlrpc/server.rb (XMLRPC::Server#server): Improve signal handling so
- pressing control-c in the controlling terminal or sending SIGTERM stops
- the XML-RPC server.
-
-Sun Jun 8 04:46:45 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (newline_node): set line from outermost node before removing
- NODE_BEGIN. [ruby-dev:32406]
-
-Sun Jun 8 04:37:34 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt): remove unnecessary NODE_BEGIN. [ruby-core:13814]
-
-Sun Jun 8 04:18:50 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (nil_plus): remove unused function. [ruby-core:13737]
-
-Sun Jun 8 04:15:40 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_alias): do not call hook functions until initialization
- finishes. [ruby-talk:279538]
-
-Sun Jun 8 04:12:50 2008 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_invoke): bug fix. [ruby-talk:279100]
-
-Sun Jun 8 03:54:52 2008 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/curses/extconf.rb: check macro if cannot find func.
- [ruby-list:44224]
-
-Sun Jun 8 03:50:40 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session::FileStore::restore): use
- lockfile for exclusive locks. a patch from <tommy AT tmtm.org>.
- [ruby-dev:32296]
-
-Sun Jun 8 03:46:55 2008 Tanaka Akira <akr@fsij.org>
-
- * missing/isinf.c (isinf): don't define if the macro is defined.
-
-Sun Jun 8 03:34:23 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (round): fallback definition.
-
- * numeric.c (flo_divmod, flo_round): use round() always.
- [ruby-dev:32269]
-
-Sun Jun 8 03:34:23 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (flodivmod): work around for infinity.
-
- * numeric.c (flo_divmod): work around for platforms have no round().
- [ruby-dev:32247]
-
-Sun Jun 8 03:34:23 2008 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-
- * numeric.c (flo_divmod): round to the nearest integer.
- [ ruby-Bugs-14540 ]
-
-Sun Jun 8 03:08:11 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rexml/encodings/SHIFT-JIS.rb (REXML::Encoding): place -x for
- nkf conversion. a patch from <moonwolf AT moonwolf.com>.
- [ruby-dev:32183]
-
-Sun Jun 8 03:05:59 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Switch::summarize): fix for long form
- option with very long argument. a patch from Kobayashi Noritada
- <nori1 AT dolphin.c.u-tokyo.ac.jp> in [ruby-list:44179].
-
-Sun Jun 8 03:03:27 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * numeric.c (fix_pow): returns infinity for 0**-1. [ruby-dev:32084]
-
-Sun Jun 8 02:57:32 2008 James Edward Gray II <jeg2@ruby-lang.org>
-
- Merged 13781 from trunk.
-
- * lib/net/telnet.rb (Net::Telnet#login): Allowing "passphrase" in
- addition to "password" for Telnet login prompts. [ruby-Bugs-10746]
-
-Wed Oct 25 06:46:21 2007 James Edward Gray II <jeg2@ruby-lang.org>
-
- Merged 13779 from trunk.
-
- * lib/net/telnet.rb (Net::Telnet#login): Making the password prompt
- pattern case insensitive. [ruby-Bugs-10746]
-
-Sun Jun 8 02:54:30 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_tell, rb_io_seek): check errno too. [ruby-dev:32093]
-
-Sun Jun 8 01:51:52 2008 James Edward Gray II <jeg2@ruby-lang.org>
-
- Merged 13767, 13768, 13769, and 13770 from trunk.
-
- * lib/xmlrpc/parser.rb (XMLRPC::Convert::dateTime): Fixing a bug that
- caused time zone conversion to fail for some ISO 8601 date formats.
- [ruby-Bugs-12677]
-
- * lib/xmlrpc/client.rb (XMLRPC::Client#do_rpc): Explicitly start
- the HTTP connection to support keepalive requests. [ruby-Bugs-9353]
-
- * lib/xmlrpc/client.rb (XMLRPC::Client#do_rpc): Improving the error
- message for Content-Type check failures. [ruby-core:12163]
-
- * lib/xmlrpc/utils.rb (XMLRPC::ParseContentType#parse_content_type):
- Making Content-Type checks case insensitive. [ruby-Bugs-3367]
-
-Sun Jun 8 01:45:27 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (r_bytes0): refined length check. [ruby-dev:32059]
-
-Sun Jun 8 01:45:27 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (r_bytes0): check if source has enough data.
- [ruby-dev:32054]
-
-Sun Jun 8 01:37:58 2008 Tanaka Akira <akr@fsij.org>
-
- * ext/socket/socket.c (s_accept_nonblock): make accepted fd
- nonblocking. [ruby-talk:274079]
-
-Sun Jun 8 01:28:42 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/mkexports.rb: deal with __fastcall name decorations.
- [ruby-list:44111]
-
-Sun Jun 8 01:23:29 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rexml/source.rb (REXML::SourceFactory::SourceFactory): typo
- fixed. [ruby-list:44099]
-
-Sun Jun 8 01:17:45 2008 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * {bcc32,win32}/Makefile.sub (COMMON_MACROS): workaround for old SDK's
- bug. [ruby-core:12584]
-
-Sun Jun 8 00:56:44 2008 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/net/http.rb, lib/open-uri.rb: remove
- Net::HTTP#enable_post_connection_check. [ruby-dev:31960]
-
- * lib/net/imap.rb: hostname should be verified against server's
- indentity as persented in the server's certificate. [ruby-dev:31960]
-
- * ext/openssl/lib/net/telnets.rb, ext/openssl/lib/net/ftptls.rb: ditto.
-
-Thu Jun 5 16:19:27 2008 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (make_cmdvector): adjust escaped successive
- double-quote handling. (merge from trunk)
-
-Thu Jun 5 12:24:25 2008 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (init_env): initialize HOME and USER environment
- variables unless set. [ruby-core:12328] (merge from trunk)
-
- * win32/win32.c (NtInitialize, getlogin): ditto.
-
- * configure.in, win32/Makefile.sub (LIBS): need to link shell32
- library for SH* functions on mswin32 and mingw32.
-
-Thu Jun 5 12:21:06 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (id2ref): valid id should not refer T_VALUE nor T_ICLASS.
- [ruby-dev:31911]
-
-Wed Jun 4 16:39:56 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (ext/extinit.o): use $(OUTFLAG) as well as other
- objects. [ruby-Bugs-14228]
-
-Tue Jun 3 16:13:40 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (yyerror): limit error message length. [ruby-dev:31848]
-
- * regex.c (re_mbc_startpos): separated from re_adjust_startpos.
-
-Tue Jun 3 15:27:11 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (os_obj_of, os_each_obj): hide objects to be finalized.
- [ruby-dev:31810]
-
-Wed Jun 4 19:15:57 2008 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (remove_method): should not remove undef place holder.
- [ruby-dev:31817]
-
-Tue Jun 3 15:05:48 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (struct rb_exec_arg): proc should be a VALUE.
-
- * process.c (rb_f_exec): suppress a warning.
-
- * process.c (rb_detach_process): cast for the platforms where size of
- pointer differs from size of int.
-
- * process.c (rb_f_exec, rb_f_system): should not exceptions after
- fork. [ruby-core:08262]
-
-Wed May 21 01:32:56 2008 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpservlet/filehandler.rb: should normalize path
- name in path_info to prevent script disclosure vulnerability on
- DOSISH filesystems. (fix: CVE-2008-1891)
- Note: NTFS/FAT filesystem should not be published by the platforms
- other than Windows. Pathname interpretation (including short
- filename) is less than perfect.
-
- * lib/webrick/httpservlet/abstract.rb
- (WEBrick::HTTPServlet::AbstracServlet#redirect_to_directory_uri):
- should escape the value of Location: header.
-
- * lib/webrick/httpservlet/cgi_runner.rb: accept interpreter
- command line arguments.
-
-Sun May 18 01:57:44 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (isdirsep): backslash is valid path separator on cygwin too.
- backported from 1.8 HEAD.
-
-Sat May 17 23:53:57 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (file_expand_path): fix for short file name on Cygwin.
-
-Sat May 17 23:50:29 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (OpenFile): prevent conflict on Windows.
-
- * file.c (USE_NTFS): fixed merge miss.
-
-Sat May 17 12:36:46 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (file_expand_path): rb_str_set_len is not backported.
-
-Sat May 17 12:15:48 2008 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (file_expand_path): support for alternative data stream
- and ignored trailing garbages of NTFS.
-
- * file.c (rb_file_s_basename): ditto.
-
- * file.c (rb_file_s_extname): ditto.
-
-Mon Mar 3 23:36:41 2008 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpservlet/filehandler.rb: should normalize path
- separators in path_info to prevent directory traversal attacks
- on DOSISH platforms.
- reported by Digital Security Research Group [DSECRG-08-026].
-
- * lib/webrick/httpservlet/filehandler.rb: pathnames which have
- not to be published should be checked case-insensitively.
-
-Sun Sep 23 21:57:25 2007 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/net/http.rb: an SSL verification (the server hostname should
- be matched with its certificate's commonName) is added.
- this verification can be skipped by
- "Net::HTTP#enable_post_connection_check=(false)".
- suggested by Chris Clark <cclark at isecpartners.com>
-
- * lib/net/open-uri.rb: use Net::HTTP#enable_post_connection_check to
- perform SSL post connection check.
-
- * ext/openssl/lib/openssl/ssl.c
- (OpenSSL::SSL::SSLSocket#post_connection_check): refine error message.
-
-Sun Sep 23 06:08:38 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_init): separate from strio_initialize
- to share with strio_reopen properly. [ruby-Bugs-13919]
-
-Sun Sep 23 05:42:35 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * lib/rdoc/options.rb (Options::check_diagram): dot -V output
- changed. [ ruby-Bugs-11978 ], Thanks Florian Frank.
-
-Mon Sep 17 04:47:02 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.c (proc_options): -W should be allowed in RUBYOPT
- environment variable. [ruby-core:12118]
-
-Mon Sep 17 04:31:46 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * range.c (range_step): fixed integer overflow. [ruby-dev:31763]
-
-Fri Sep 7 14:57:36 2007 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-
- * ruby.c (rubylib_mangled_path): eliminate RSTRING_PTR
- [ruby-dev:31679]
-
- * ruby.c(push_include_cygwin): ditto.
-
-Fri Sep 7 14:32:38 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_subseq): need integer overflow check.
- [ruby-dev:31736]
-
- * array.c (rb_ary_splice): ditto. [ruby-dev:31737]
-
- * array.c (rb_ary_fill): ditto. [ruby-dev:31738]
-
- * string.c (rb_str_splice): integer overflow for length.
- [ruby-dev:31739]
-
-Fri Sep 7 14:27:33 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (mnew): should preserve noex as safe_level.
-
- * eval.c (rb_call0): tighten security check condition..
-
-Fri Sep 7 14:19:16 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (group_member): check if presents.
-
- * configure.in (XCFLAGS): add _GNU_SOURCE on linux.
-
- * file.c (group_member): use system routine if available.
-
-Fri Sep 7 14:14:19 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * include/ruby/defines.h (flush_register_windows): call "ta 0x03"
- even on Linux/Sparc. [ruby-dev:31674]
-
-Fri Sep 7 14:12:37 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_type_progid, reg_enum_key,
- reg_get_val, ole_wc2mb): fix the bug. Thanks, arton.
- [ruby-dev:31576]
-
-Fri Sep 7 14:02:10 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (detach_process_watcher): should not pass the pointer
- to an auto variable to the thread to be created. pointed and
- fix by KUBO Takehiro <kubo at jiubao.org> [ruby-dev:30618]
-
-Fri Sep 7 13:52:36 2007 Tanaka Akira <akr@fsij.org>
-
- * bignum.c (big_lshift): make shift offset long type.
- (big_rshift): ditto.
- (rb_big_lshift): ditto.
- (big_rshift): ditto.
- [ruby-dev:31434]
-
-Thu Aug 16 08:44:55 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_hash_delete_key): delete the entry without calling block.
-
- * hash.c (rb_hash_shift): should consider iter_lev too.
-
- * hash.c (delete_if_i): use rb_hash_delete_key() so that the block
- isn't called twice. [ruby-core:11556]
-
-Thu Aug 16 08:43:50 2007 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/tuplespace.rb: fix Rinda::TupleSpace keeper thread bug.
- the thread is started too early. [ruby-talk:264062]
-
- * test/rinda/test_rinda.rb: ditto.
-
-Thu Aug 16 08:40:38 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/pty/pty.c (establishShell): handshaking before close slave
- device. [ruby-talk:263410]
-
-Thu Aug 16 08:29:39 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_cv_func_isinf): set yes also on OpenSolaris.
- [ruby-Bugs-12859]
-
-Thu Aug 16 08:28:16 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rexml/encodings/{ISO-8859-15,CP-1252}.rb: fixed invalid syntax.
-
-Thu Aug 16 08:26:08 2007 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/README: fixed a typo.
-
-Thu Aug 16 08:20:50 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): save all CONFIG values.
-
- * ext/extmk.rb (extmake): remove mkmf.log at clean, and extconf.h at
- distclean, respectively.
-
- * ext/extmk.rb: remove rdoc at clean, and installed list file at
- distclean, respectively.
-
-Thu Aug 16 07:58:18 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): should not check positional number as
- width. [ruby-core:11838]
-
-Thu Aug 16 07:52:24 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dln.c (conv_to_posix_path): removed.
-
- * ruby.c (rubylib_mangled_path, rubylib_mangled_path2): return
- VALUE instead of a pointer to static buffer.
-
- * ruby.c (push_include_cygwin): fixed buffer overflow.
- [ruby-dev:31297]
-
- * ruby.c (ruby_init_loadpath): not convert built-in paths.
-
-Thu Aug 16 07:51:37 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * defines.h: Pull the RUBY_MBCHAR_MAXSIZE definition from trunk,
- which is necessary for dir.c to compile on djgpp and emx.
-
-Thu Aug 16 07:42:10 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * intern.h (is_ruby_native_thread): removed since declared as an int
- function in ruby.h already.
-
-Thu Aug 16 07:40:41 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_rename): deleted code to get rid of a bug of
- old Cygwin.
-
- * file.c (rb_file_truncate): added prototype of GetLastError()
- on cygwin. [ruby-dev:31239]
-
- * intern.h (is_ruby_native_thread): prototype.
-
- * missing/strftime.c (strftime): fix printf format and actual
- arguments.
-
- * ext/Win32API/Win32API.c (Win32API_initialize): ditto.
-
- * ext/tk/tcltklib.c (ip_finalize): ditto.
-
- * ext/dl/ptr.c (rb_dlptr_inspect): ditto. [ruby-dev:31268]
-
- * ext/dl/sym.c (rb_dlsym_inspect): ditto.
-
- * ext/socket/getnameinfo.c: include stdio.h always.
-
- * ext/win32ole/win32ole.c (ole_hresult2msg, folevariable_name,
- folevariable_ole_type, folevariable_ole_type_detail,
- folevariable_value, folemethod_visible): missing return value.
-
-Thu Aug 16 07:32:13 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): make OBJS depend on RUBY_EXTCONF_H
- only if extconf.h is created.
-
-Thu Aug 16 07:29:33 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * {win32,wince,bcc32}/setup.mak (-version-): no RUBY_EXTERN magic.
-
-Thu Aug 16 06:43:03 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (init_mkmf): should remove mkmf.log too.
-
-Thu Aug 16 06:40:58 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/openssl/ossl_config.c (ossl_config_set_section): do not
- initialize aggregations with dynamic values. [ruby-talk:259306]
-
-Thu Aug 16 06:39:19 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (get_backtrace): check the result more.
- [ruby-dev:31261] [ruby-bugs-12398]
-
-Thu Aug 16 06:32:25 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (rb_big_lshift, rb_big_rshift): separated functions
- to get rid of infinite recursion. fixed calculation in edge
- cases. [ruby-dev:31244]
-
- * numeric.c (rb_fix_lshift, rb_fix_rshift): ditto.
-
-Thu Aug 16 06:26:58 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (rb_big_pow): refine overflow check. [ruby-dev:31242]
-
-Thu Aug 16 06:25:48 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_succ): Time#succ should return a time object in the
- same timezone mode to the original. [ruby-talk:260256]
-
-Thu Aug 16 06:24:39 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * numeric.c (fix_pow): integer power calculation: 0**n => 0,
- 1**n => 1, -1**n => 1 (n: even) / -1 (n: odd).
-
-Thu Aug 16 06:11:34 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/base64.rb (Base64::b64encode): should not specify /o option
- for regular expression. [ruby-dev:31221]
-
-Thu Aug 16 06:08:53 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): more checks for format argument.
- [ruby-core:11569], [ruby-core:11570], [ruby-core:11571],
- [ruby-core:11573]
-
-Thu Aug 16 05:39:31 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (bignorm): do not empty Bignum. [ruby-dev:31229]
-
-Thu Aug 16 05:12:05 2007 pegacorn <subscriber.jp AT gmail.com>
-
- * ext/openssl/ossl.h: include ossl_pkcs5.h. [ruby-dev:31231]
-
- * ext/openssl/ossl_pkcs5.h: new file for PKCS5. [ruby-dev:31231]
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_s): use ossl_raise()
- instead of rb_raise(). [ruby-dev:31222]
-
- * ext/sdbm/_sdbm.c: DOSISH platforms need io.h. [ruby-dev:31232]
-
- * ext/syck/syck.h: include stdlib.h for malloc() and free().
- [ruby-dev:31232]
-
- * ext/syck/syck.h (syck_parser_set_input_type): prototype added.
- [ruby-dev:31231]
-
- * win32/win32.c: include mbstring.h for _mbspbrk(). [ruby-dev:31232]
-
- * win32.h (rb_w32_getcwd): prototype added. [ruby-dev:31232]
-
-Thu Aug 16 05:02:39 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bignum.c (rb_cstr_to_inum): check leading non-digits.
- [ruby-core:11691]
-
-Thu Aug 16 05:00:01 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * numeric.c (fix_pow): 0**2 should not raise floating point
- exception. [ruby-dev:31216]
-
-Thu Aug 16 04:56:35 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (CreateChild): enclose command line except for
- command.com which can not handle quotes. [ruby-talk:258939]
-
-Thu Aug 16 04:54:45 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (link_command, cc_command, cpp_command): do not expand
- ::CONFIG which is an alias of MAKEFILE_CONFIG.
-
-Thu Aug 16 04:53:21 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * struct.c (rb_struct_init_copy): disallow changing the size.
- [ruby-dev:31168]
-
-Thu Aug 16 04:52:11 2007 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * random.c: documentation fix. srand(0) initializes PRNG with '0',
- not with random_seed.
-
-Thu Aug 16 04:49:10 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bcc32/{Makefile.sub,setup.mak}: remove surplus slash from srcdir.
-
-Thu Aug 16 04:40:37 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): sign bit extension should not be done
- if FPLUS flag is specified. [ruby-list:39224]
-
-Thu Aug 16 04:39:15 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_initialize): should call rb_ary_modify() first.
- [ruby-core:11562]
-
-Thu Aug 16 04:38:39 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (yylex): return non-valid token for an invalid
- instance/class variable name. a patch from from Yusuke ENDOH
- <mame AT tsg.ne.jp>. [ruby-dev:31095]
-
-Thu Aug 16 04:36:41 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (dsym): return non-null NODE even if yyerror(). based on a
- patch from from Yusuke ENDOH <mame AT tsg.ne.jp>. [ruby-dev:31085]
-
-Thu Aug 16 04:34:56 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (proc_exec_v, rb_proc_exec): preserve errno.
-
-Thu Aug 16 04:30:45 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_path2class): get rid of dangling pointer caused by
- optimized out value.
-
-Thu Aug 16 04:24:28 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/dl/lib/dl/win32.rb: seems that dl doesn't accept void argument.
- fixed [ruby-bugs:PR#5489].
-
-Thu Aug 16 04:23:44 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser): handle more
- extensions. [ruby-dev:30972]
-
-Thu Aug 16 04:14:17 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (ruby_setreuid, ruby_setregid): rename to get rid of name
- clash.
-Thu Aug 16 04:11:17 2007 Ryan Davis <ryand@zenspider.com>
-
- * lib/rexml/dtd/dtd.rb: Fixed typo in code. Fixes bug #10420
-
-Thu Aug 16 04:08:20 2007 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (ResponseParser#next_token): fixed
- error message. (backported from HEAD)
-
- * lib/net/imap.rb (ResponseParser#parse_error): fixed
- the condition not to refer @token.symbol unexpectedly.
- Thanks, Dick Monahan. (backported from HEAD)
-
-Thu Aug 16 04:05:20 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_extended): erroneous check condition when dump
- method is defined. [ruby-core:10646]
-
-Sat Jun 9 10:40:00 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * stable version 1.8.5-p52 released.
-
-Thu Jun 7 14:53:46 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * eval.c (method_inspect): show proper class name.
- [ruby-talk:248647], Thanks Calamitas.
-
-Mon May 28 19:37:24 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (move_to_next_entry): revert r12338. not necessary
- on ruby_1_8_5.
-
-Sun May 27 05:52:37 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * eval.c (mnew): call of super via a method object should work again.
- [ruby-talk:248647], Thanks Calamitas.
-
- * test/ruby/test_method.rb (TestMethod::test_method_super): test for
- above fix.
-
-Wed May 23 06:51:46 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * lib/cgi.rb (CGI#[]): get rid of exceptions being raised.
- [ruby-dev:30740], Thanks Kentaro KAWAMOTO.
-
-Wed May 23 06:14:15 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (move_to_next_entry): loc also must move forward.
- [ruby-talk:251987]
-
-Wed May 23 05:55:04 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (init_stdhandle): stderr should be without buffering,
- but mswin32 use buffering when stderr is not connected to tty.
-
-Wed May 23 03:33:55 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/monitor.rb (ConditionVariable#wait, mon_enter, mon_exit_for_cond):
- ensures Thread.critical to be false. [ruby-talk:248300]
-
-Wed May 23 03:25:13 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (ruby_strtod): exponent is radix 10. [ruby-talk:248272]
-
-Wed May 23 02:09:32 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_yield_0): should not clear state on TAG_NEXT when
- it's invoked from within lambda body. [ruby-talk:248136]
-
- * eval.c (proc_invoke): handle TAG_NEXT which would be caused by
- next in the lambda body as well.
-
-Wed May 23 01:55:49 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_fclose, rb_w32_close): need to save errno
- before calling original fclose()/close().
-
-Wed May 23 01:42:29 2007 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (disconnect): call shutdown for
- SSLSocket. Thanks, Technorama Ltd.
-
-Wed May 23 01:28:14 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (rb_notimplement), io.c (pipe_open): removed definite
- articles and UNIX manual section from messages. [ruby-dev:30690]
-
- * io.c (pipe_open): raise NotImplementedError for command "-" on
- platforms where fork(2) is not available. [ruby-dev:30681]
-
-Wed May 23 00:06:19 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/socket.c (s_recv, s_recvfrom): some systems (such as
- windows) doesn't set fromlen if the socket is connection-oriented.
- reported by Bram Whillock in [ruby-core:10512] [ruby-Bugs#9061]
-
-Tue Mar 20 15:37:24 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * distruby.rb: Add zip generation.
-
-Fri Mar 16 21:48:11 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/dl/dl.c (rb_ary2cary): Fix a bug in type validation;
- submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
- in [ruby-dev:30554].
-
-Fri Mar 16 18:28:06 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/etc/etc.c (etc_getgrgid): Fix a bug in Etc::getgrgid()
- always returning the (real) group entry of the running process;
- reported by: UEDA Hiroyuki <ueda AT netforest.ad.jp>
- in [ruby-dev:30586].
-
-Wed Mar 14 12:30:00 2007 Shigeo Kobayashi <shigeo@tinyforest.jp>
-
- * ext/bigdecimal/bigdecimal.c: BigDecimal("-.31") is now
- treated as ("-0.31") not as ("0.31").
-
-Fri Mar 16 18:05:40 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/cgi.rb (CGI::header): IIS >= 5.0 does not need the nph
- assumption any more; submitted by MIYASAKA Masaru <alkaid AT
- coral.ocn.ne.jp> in [ruby-dev:30537].
-
-Tue Mar 13 17:29:43 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * stable version 1.8.5-p35 released.
-
-Tue Mar 13 14:42:10 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * test/fileutils/fileasserts.rb: Fix wrong error message.
-
- * lib/fileutils.rb (FileUtils::mv): Type Error; should utilize
- Strings instead of Symbols here.
-
-Mon Mar 12 17:22:44 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/fileutils.rb (FileUtils::mv): fix incomplete backport of
- FileUtils.mv changes at r11988
-
-Mon Mar 12 16:09:28 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * mkconfig.rb (patchlevel): read from version.h.
-
-Sun Mar 11 18:57:50 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * misc/README: Add a note about ruby-electric.el.
-
- * misc/ruby-mode.el (ruby-non-block-do-re): Fix
- ruby-non-block-do-re. [ruby-core:03719]
-
- * misc/inf-ruby.el: Synchronize the comment section with trunk.
-
- * misc/README, misc/rdebug.el: Add rdebug.el, Emacs ruby-debug
- interface based on rubydb3x.el; submitted by Martin Nordholts
- <enselic AT gmail.com> in [ruby-bugs:PR#9023].
-
-Sun Mar 11 17:45:51 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/dl/mkcallback.rb (mkfunc): Make sure that a callback
- function is found in the function table before trying to call
- it; submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
- in [ruby-dev:30524].
-
-Tue Mar 6 18:58:37 2007 Keiju Ishitsuka <keiju@ruby-lang.org>
-
- * lib/shell/process-controller.rb: fix thread synchronization
- problem for [ruby-dev:30477].
-
-Sun Mar 4 23:53:27 2007 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mv): could not move a directory between
- different filesystems. [ruby-dev:30411]
-
-Sat Mar 3 21:41:31 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * eval.c (stack_check): Unset inline to fix build with GCC 3.4.6;
- submitted by: NISHIMATSU Takeshi <t_nissie AT yahoo.co.jp> in
- [ruby-list:43218].
- cf. http://gcc.gnu.org/bugzilla/show_bug.cgi?id=24556
-
-Sat Mar 3 16:30:39 2007 Akinori MUSHA <knu@iDaemons.org>
-
- * env.h (SCOPE_CLONE): Introduce a new scope flag to prevent a
- local_tbl region from getting freed many times; submitted by
- Chikanaga Tomoyuki <chikanag AT nippon-control-system.co.jp> in
- [ruby-dev:30460].
-
- * eval.c (proc_invoke): Ditto.
-
- * gc.c (obj_free): Ditto.
-
- * parse.y (top_local_setup_gen): Ditto.
-
-Sat Mar 3 15:41:33 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt, arg): should not omit lhs of OP_ASGN1 even if
- empty. [ruby-dev:30452]
-
-Wed Feb 28 20:51:32 2007 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * pack.c (pack_unpack): properly ignore non-base64 octets such as
- UTF-8 encoded BOMs; submitted by SOUMA Yutaka <holon@radastery.jp>
- to fix [ruby-core:10437]
-
-Wed Feb 28 00:08:11 2007 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-
- * mkconfig.rb (RbConfig): add CONFIG['PATCHLEVEL']
-
- * common.mk: new target dist
-
- * distruby.rb: new file
-
-Tue Feb 27 21:19:35 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (set_pioinfo_extra): new function for VC++8 SP1
- workaround. [ruby-core:10259]
-
- * win32/win32.c (NtInitialize): call above function.
-
-Mon Feb 26 09:57:58 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * signal.c (ruby_signal): don't set SA_RESTART. a backport from
- the HEAD. [ruby-talk:220937] [ruby-talk:147220]
-
-Tue Feb 13 02:21:12 2007 Sam Roberts <sroberts@uniserve.com>
-
- * io.c (rb_f_syscall): Fix buffer overflow with syscall
- arguments. [ruby-bugs:PR#8541]
-
-Sat Feb 10 09:33:47 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_variant2val): sorry, fix the enbug.
-
-Sat Feb 10 09:08:01 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_variant2val): fix compile error
- on VC++.
-
-Sat Feb 10 08:38:30 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_variant2val): fix the bug when
- SAFEARRAY pointer is NULL.
-
-Tue Feb 6 20:41:39 2007 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c (rb_str_sub_bang): calling rb_str_modify() should be just
- before actually modifying the string.
- fixed: [ruby-dev:30211] (originally reported by zunda)
-
-Sat Jan 27 15:20:11 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (dyna_var_lookup): should not alter dvar->val not to
- destroy living value. [ruby-core:10076]
-
- * parse.y (dyna_init): ditto.
-
-Wed Jan 24 18:05:39 2007 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): fix
- regexp font-lock bug. [ruby-talk:235758]
-
-Sun Jan 14 07:26:44 2007 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_free, ole_type_free,
- olemethod_free, olevariable_free, oleparam_free,
- ole_event_free): fix memory leak. [ruby-core:09846]
-
-Tue Jan 9 12:29:20 2007 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (etc_getpwuid, etc_getgrgid): fix to correctly
- convert uid/gid from VALUE.
-
- * ext/etc/etc.c (etc_getpwuid): ditto.
-
-Mon Dec 25 20:08:28 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * ext/openssl/ossl.h: fixed compilation problem on gcc 3.2.
- [ruby-talk:214786]
-
-Mon Dec 25 10:40:40 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * stable version 1.8.5-p12 released.
-
-Sat Dec 16 04:02:10 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c: shouldn't run the killed thread at callback.
- [ruby-talk: 227408]
-
-Fri Dec 15 17:21:14 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rdoc/ri/ri_options.rb: prevent NameError. [ruby-dev:29597]
-
-Thu Dec 14 23:37:38 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): get rid of possible memory leak.
-
- * win32/win32.c (cmdglob, rb_w32_cmdvector, rb_w32_opendir,
- rb_w32_get_environ): not to use GC before initialization.
-
-Wed Dec 6 19:53:41 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (SITE_DIR): fixed to emtpy RUBY_SITE_LIB in config.h on
- NetBSD. fixed: [ruby-dev:29358]
-
-Mon Dec 4 10:43:46 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (dyna_init_gen): dvar initialization only if dvar is
- assigned inner block. [ruby-talk:227402]
-
-Mon Dec 4 10:22:26 2006 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-
- * stable version 1.8.5-p2 released.
-
-Sun Dec 3 17:11:12 2006 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): should quote
- boundary. JVN#84798830
-
-Sun Nov 26 16:36:46 2006 URABE Shyouhei <shyouhei@ruby-lang.org>
-
- * version.h: addition of RUBY_PATCHLEVEL.
- * version.c: ditto.
-
-Fri Nov 24 10:17:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (bignorm): avoid segmentation. a patch from Hiroyuki
- Ito <ZXB01226@nifty.com>. [ruby-list:43012]
-
-Thu Nov 2 15:43:39 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * parse.y (primary): should set NODE even when compstmt is NULL.
- merge from trunk. fixed: [ruby-dev:29732]
-
-Sat Sep 23 21:34:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): CGI content
- may be empty. a patch from Jamis Buck <jamis at 37signals.com>.
-
-Mon Sep 4 21:43:57 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/dbm/extconf.rb: create makefile according to the result of check
- for dbm header. fixed: [ruby-dev:29445]
-
-Tue Aug 29 19:10:10 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (rb_hash_s_create): fixed memory leak, based on the patch
- by Kent Sibilev <ksruby at gmail.com>. fixed: [ruby-talk:211233]
-
-Fri Aug 25 17:15:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * stable version 1.8.5 released.
-
-Fri Aug 25 17:02:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_sweep): typo fixed.
-
-Tue Aug 22 18:47:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_method):
- rdoc documents C module methods as instance methods. a patch in
- [ruby-core:08536].
-
-Sat Aug 19 14:15:02 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (config.status): include winsock2.h instead of
- winsock.h when --with-winsock2 is specified.
- fixed: [ruby-dev:29296]
-
-Sat Aug 19 11:28:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_rename): use errno if set properly.
- fixed: [ruby-dev:29293]
-
-Sat Aug 19 11:09:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (then): remove semicolon warning. [ruby-dev:29299]
-
-Thu Aug 17 19:15:16 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_stat_[rRwWxX]): check for super user.
- fixed: [ruby-core:08616]
-
-Thu Aug 17 14:47:06 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb: added rdoc by Daniel Berger. [ruby-core:08177]
-
-Thu Aug 17 00:39:05 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/ring.rb (do_reply): Fix for RingServer fails to find a
- TupleSpace when TupleSpace resides in the same ruby process with
- RingServer. a patch from Kent Sibilev. [ruby-core:08453]
-
-Wed Aug 16 11:45:36 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (proc_setuid, proc_setgid, proc_seteuid, proc_setegid):
- get rid of bogus implementations on Mac OS X.
-
-Tue Aug 15 19:10:18 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment): Fix
- broken class-level documentation.
-
-Wed Aug 16 11:09:26 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (set_arg0): fill argv other than the first with an empty
- string instead of NULL.
-
-Wed Aug 16 11:08:00 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.h: removed an excess macro. fixed: [ruby-dev:29258]
-
-Tue Aug 8 23:49:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/extend-command.rb (IRB::ExtendCommandBundle): pacify
- RDoc. a patch from Eric Hodel <drbrain at segment7.net>.
- [ruby-core:08522]
-
-Tue Aug 8 11:32:54 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * Makefile.in, common.mk, configure.in: fix for platforms without
- rm. patches from Yutaka kanemoto <kinpoco at gmail.com>.
- [ruby-dev:29215]
-
-Mon Aug 7 17:56:59 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c, ext/digest/rmd160/rmd160ossl.c,
- ext/digest/sha1/sha1ossl.c, ext/readline/readline.c: move
- incluion of config.h to pacify AIX. a patch from Yutaka
- Kanemoto <kinpoco at gmail.com>. [ruby-dev:29197]
-
-Mon Aug 7 15:55:08 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/syck/syck.c (syck_move_tokens): should avoid negative
- memmove. [ruby-list:42625]
-
-Mon Aug 7 14:37:48 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in, common.mk: AIX link issue. a patch from Yutaka
- Kanemoto <kinpoco at gmail.com>. [ruby-dev:29190]
-
- * ext/socket/socket.c: AIX socket support. [ruby-dev:29190]
-
-Mon Aug 7 12:05:28 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dln.c, eval.c, gc.c, regex.c, ruby.h: shut up AIX alloca
- warning. a patch from Yutaka Kanemoto <kinpoco at gmail.com>.
- [ruby-dev:29191]
-
-Sun Aug 6 20:40:41 2006 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date/format.rb (str[fp]time): %[EO]U didn't denote %U.
-
-Sat Aug 5 17:07:43 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (top_local_setup): local_vars[-1] should point
- ruby_scope itself to protect local_tbl from garbage collection.
- [ruby-dev:29049]
-
-Sat Aug 5 13:54:03 2006 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date/format.rb (str[fp]time): "%\n" means "\n".
-
-Fri Aug 4 15:21:00 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib: Merge RDoc and .document from HEAD.
- * lib/drb/ssl.rb: Close socket on SSLError [ruby-core:7197]
-
-Fri Aug 4 19:13:41 2006 Keiju Ishitsuka <keiju@ruby-lang.org>
-
- * lib/irb/{init.rb,ruby-lex.rb,slex.rb}: can't input '\c' for
- [ruby-core: 7122].
-
-Fri Aug 4 14:02:14 2006 James Edward Gray II <james@grayproductions.net>
-
- * lib/date/format.rb (__strptime, strftime): allow multi-line patterns
- in Date#strftime the same as Time#strftime accepts.
- fixed: [ruby-core:08466]
-
-Fri Aug 4 13:56:51 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * pack.c (pack_pack): check argument overrun for 'P'. based on a
- patch by rucila <rucila at yahoo.cojp>. fixed: [ruby-dev:29182]
-
-Tue Aug 1 17:44:03 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (init_stdhandle): assign standard file handles.
-
-Tue Aug 1 12:24:58 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (Init_Binding): fix old commit miss.
-
-Mon Jul 31 17:08:20 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (exit_handler): new function; release winsock and
- environment work area.
-
- * win32/win32.c (NTInitialize): setup exit_handler.
-
- * win32/win32.c (StartSockets): use exit_handler.
-
- * win32/win32.c (rb_w32_getenv): use GetEnvironmentStrings() instead
- of GetEnvironmentVariable(), because the latter cannot distinguish
- wheather a null environment variable exists or not.
- fixed: [ruby-talk:205123]
-
-Mon Jul 31 16:15:13 2006 Tanaka Akira <akr@fsij.org>
-
- * test/ruby/test_process.rb (TestProcess#test_rlimit_nofile):
- setrlimit may fail with EINVAL.
- reported by MIYAMUKO Katsuyuki. [ruby-dev:29174]
-
-Mon Jul 31 13:38:22 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httprequest.rb (WEBrick::HTTPReuqest#parse_uri): improve
- for the value of IPv6 address in the Host: header field.
-
-Mon Jul 31 09:22:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.h: use ifdef (or defined) for macro constants that may or
- may not be defined to shut up gcc's -Wundef warnings.
- [ruby-core:08447]
-
-Sun Jul 30 23:26:22 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_call0): trace call/return of method defined from block.
- fixed: [ruby-core:08329]
-
- * eval.c (rb_trap_eval): make the current thread runnable to deal with
- exceptions which occurred within the trap. fixed: [ruby-dev:27729]
-
- * lib/cgi/session.rb, lib/cgi/session/pstore.rb: suppress warnings.
- fixed: [ruby-talk:204896]
-
-Sat Jul 29 06:12:06 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: freeze ip_name for security reason.
-
-Sat Jul 29 01:23:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/logger.rb: improves the amount of documentation that Rdoc
- picks up when processing logger.rb by moving the require
- statement back before the comment block. a patch from Hugh
- Sasse <hgs at dmu.ac.uk>. [ruby-core:08422]
-
-Thu Jul 27 22:21:52 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (time_to_s): fixed format mismatch.
-
-Thu Jul 27 21:19:54 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * math.c (domain_check): a new function to check domain error
- explicitly for systems that return NaN like FreeBSD.
- [ruby-core:07019]
-
- * math.c (math_acos, math_asin, math_acosh, math_atanh, math_log,
- math_log10, math_sqrt): use domain_check().
-
- * math.c (math_sqrt): fix documentation flaw.
-
-Thu Jul 27 18:12:12 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * time.c: need to declare time_utc_offset.
-
-Thu Jul 27 17:01:01 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_close): always calls "close" method of the receiver.
- [ruby-core:6911] [ruby-core:8112]
-
-Thu Jul 27 16:49:01 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_to_s): use +0900 style timezone string for local time.
- [ruby-dev:29143]
-
-Thu Jul 27 16:41:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/openssl/ossl.h: move <ruby.h> inclusion point to shut up
- Solaris compiler. [ruby-core:08114]
-
-Wed Jul 26 22:20:59 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: add support for as and ASFLAGS. [ruby-dev:29138]
-
-Wed Jul 26 22:13:45 2006 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: sync with HEAD (rev 1.132).
-
- * lib/net/http.rb (Net::HTTP#post, request_post, request): should
- set Content-Type: x-www-form-urlencoded by default.
-
- * lib/net/http.rb (Net::HTTPHeader#content_type): should return
- nil when there's no Content-Type.
-
- * lib/net/http.rb (Net::HTTPHeader#sub_type): should return nil
- when there's no sub Content-Type (e.g. "Content-Type: text").
-
- * lib/net/http.rb (Net::HTTPHeader#type_params): wrongly failed
- when there's no Content-Type.
-
-Wed Jul 26 18:35:38 2006 Minero Aoki <aamine@loveruby.net>
-
- * ext/strscan/strscan.c: sync with HEAD (rev 1.25).
-
- * ext/strscan/strscan.c (strscan_do_scan):
- StringScanner.new("").scan(//) should return "". [ruby-Bugs:4361]
-
-Wed Jul 26 18:14:19 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/pty/pty.c (getDevice): retry once after GC on failure.
- [ruby-core:08282]
-
-Wed Jul 26 17:28:16 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): prepend ".." to %u for negative bignum,
- but not "-". fixed: [ruby-core:08167]
-
-Wed Jul 26 16:39:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_scan): add string modification check.
- [ruby-core:7216]
-
-Wed Jul 26 16:06:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): check
- multipart boundary end. a patch from Fujioka <fuj at rabbix.jp>
- [ruby-dev:28470]
-
-Wed Jul 26 01:02:59 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: suppress warnings by automake 1.8 or later.
-
-Tue Jul 25 00:30:06 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/prettyprint.rb: RD to RDoc conversion by Hugh Sasse.
-
-Tue Jul 25 14:49:51 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (configuration): typo.
-
-Tue Jul 25 13:14:32 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_proc_times): rename hz to hertz to avoid name
- crash on AIX. [ruby-dev:29126]
-
-Mon Jul 24 22:03:40 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (backtrace): skip frames successive on node and method name.
-
-Mon Jul 24 17:55:55 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_f_system): add security check. [ruby-talk:202947]
-
- * process.c (rb_f_system): move signal right before fork to avoid
- signal handler intervention.
-
-Mon Jul 24 15:51:52 2006 Tanaka Akira <akr@fsij.org>
-
- * ext/readline/readline.c (readline_readline): rl_deprep_term_function
- may be NULL with libedit. reported by Ryan Davis. [ruby-dev:29070]
-
-Mon Jul 24 15:19:55 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): revert last change. [ruby-dev:29112]
- [ruby-core:08374]
-
-Sun Jul 23 22:59:49 2006 Tanaka Akira <akr@fsij.org>
-
- * test/socket/test_unix.rb: disabled on cygwin.
- reported by Kouhei Yanagita. [ruby-dev:29080]
-
-Fri Jul 21 21:21:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_call0): include funcalled methods in caller list.
- fixed: [ruby-core:08290]
-
-Fri Jul 21 12:11:00 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb, lib/mkmf.rb (with_destdir): remove drive letter before
- prepending destdir on DOSISH.
-
-Thu Jul 20 15:07:14 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.h: export classes/modules to implement sandbox.
- [ruby-core:08283]
-
-Thu Jul 20 00:06:29 2006 Keiju Ishitsuka <keiju@ishitsuka.com>
-
- * lib/irb/completion.rb: support for completion of numeric
- number. [ruby-dev: 29038]
-
-Wed Jul 19 23:53:05 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb, lib/rss/utils.rb: added documents.
-
-Tue Jul 18 22:10:13 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_f_system): block SIGCHLD during the process
- execution, like glibc system(3) does. [ruby-talk:202361]
-
-Tue Jul 18 23:12:14 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (open_ifs_socket): should not use plain malloc.
-
- * win32/win32.c (rb_w32_opendir): should not use plain realloc.
-
-Tue Jul 18 18:05:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * test/ruby/test_float.rb (TestFloat::test_strtod): update test to
- conform strtod change.
-
-Tue Jul 18 15:49:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (pack_unpack): propagate association array to copied
- string. [ruby-core:08223]
-
- * pack.c (pack_unpack): return referenced string itself if it has
- same length as specified. a patch from <nobu at ruby-lang.org>
- in [ruby-core:08225].
-
- * pack.c (pack_pack): taint 'p' packed strings.
-
-Tue Jul 18 14:03:02 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer::unmount): remove
- inpect argument from sprintf. [ruby-dev:29039]
-
-Tue Jul 18 10:53:37 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_cstr_to_dbl): limit out-of-range message.
-
- * util.c (ruby_strtod): return end pointer even if ERANGE occurred.
- fixed: [ruby-dev:29041]
-
-Mon Jul 18 00:43:05 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (ruby_strtod): stop at dot not followed by digits.
- fixed: [ruby-dev:29035]
-
-Tue Jul 18 00:01:27 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: remove LIBRUBY_SO if static linked extensions exist.
-
-Mon Jul 17 23:30:46 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (rb_cv_msvcrt): defaulted to msvcrt. Workaround for a
- bug of cygwin 1.5.20.
-
-Mon Jul 17 13:43:05 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (define_swapx): should not use plain malloc.
-
-Mon Jul 17 12:58:41 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: should use ac_cv_lib_dl_dlopen=no on MinGW.
-
-Sat Jul 15 23:50:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_require_safe): wait for another thread requiring the same
- feature. fixed: [ruby-core:08229]
-
-Sat Jul 15 01:27:13 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (has_magic): glob names contain alphabets to enable case fold
- search also for directories. fixed: [ruby-talk:201917]
-
-Sat Jul 15 01:09:22 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * st.c (malloc): use xmalloc/xcalloc instead of plain
- malloc/calloc, to detect memory allocation failure. see
- <http://www.nongnu.org/failmalloc/>.
-
- * gc.c (rb_memerror): should not raise empty nomem_error.
-
-Fri Jul 14 13:08:13 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add methods for new features of latest Tcl/Tk8.5.
-
- * ext/tk/lib/tk/namespace.rb: ditto.
-
-Fri Jul 14 02:30:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/monitor.rb: document patch from Hugh Sasse <hgs at dmu.ac.uk>.
- [ruby-core:08205]
-
-Fri Jul 14 01:09:46 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (then): error in warning action.
-
-Fri Jul 14 00:10:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_pop): may cause realloc oscillation. a patch
- from MORITA Naoyuki <mlgetter at kidou.sakura.ne.jp>.
- [ruby-dev:29028]
-
-Thu Jul 13 22:23:56 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/composite.rb: improve handling of the classname on the
- option database for the widget class which includes TkComposite.
-
-Thu Jul 13 20:32:19 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb: updated documents by a patch from
- Hugh Sasse <hgs at dmu.ac.uk>. [ruby-core:8194]
-
-Wed Jul 12 13:54:09 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (then): we'd like to reserve colon here for the future.
- warning added.
-
-Tue Jul 11 20:58:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.h: export rb_cMethod. [ruby-talk:201259]
-
-Tue Jul 11 19:13:33 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: remove restriction on the class of
- pseudo-toplevel.
-
-Tue Jul 11 18:00:57 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: security fix.
-
-Tue Jul 11 17:33:39 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c (rb_str_dump): need to extend len for \b.
-
-Mon Jul 10 22:00:00 2006 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c: Allows '_' to appear within
- digits. [ruby-dev:28872]
-
- * ext/bigdecimal/lib/bigdecimal/util.rb: Bug in to_r reported by
- [ruby-list:42533] fixed.
-
-Mon Jul 10 19:22:19 2006 Tanaka Akira <akr@fsij.org>
-
- * gc.c (gc_sweep): expand heap earlier.
- reported by MORITA Naoyuki. [ruby-dev:28960]
-
-Mon Jul 10 18:59:34 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/font.rb: sorry. mistaken to patch.
-
-Mon Jul 10 18:46:52 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c: make SEGV risk lower at exit.
-
- * ext/tk/lib/tk.rb: ditto.
-
- * ext/tk/lib/multi-tk.rb: fail to call function-style methods on slave
- interpreters. The strategy (MultiTkIp_PseudoToplevel_Evaluable) to
- fix the problem is a little tricky. You may have to take care of
- conflicting with it.
-
- * ext/tk/lib/tk.rb: a little change for the pseudo-toplevel strategy.
-
- * ext/tk/lib/tk/font.rb: ditto.
-
- * ext/tk/lib/tk/msgcat.rb: ditto.
-
- * ext/tk/lib/tkextlib/itk/incr_tk.rb: ditto.
-
- * ext/tk/sample/demos-en/widget: fail to call function-style methods
- on sample scripts. To fix it, a strategy which similar to the way
- on MultiTiIp is used. Please take care when re-write and re-run a
- demo script on the Widget-Demo code viewer.
-
- * ext/tk/sample/demos-jp/widget: ditto.
-
-Mon Jul 10 13:58:40 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * signal.c (ruby_nativethread_signal, posix_nativethread_signal,
- sigsend_to_ruby_thread, install_nativethread_sighandler):
- nativethread-support on signal handler. RE-backport from 1.9.
-
- * ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
-
- * eval.c (ruby_native_thread_kill): ditto.
-
-Mon Jul 10 10:54:14 2006 Ryan Davis <ryand@zenspider.com>
-
- * lib/rdoc/parsers/parse_f95.rb: massive overhaul from Yasuhiro
- Morikawa including new file suffixes, function support, public
- variables and constants, derived-types, defined operators and
- assignments, namelists, and subroutine and function
- arguments. Truly massive.
-
- * lib/rdoc/diagram.rb: diagrams are now cached.
-
- * lib/irb/completion.rb: fixed a crasher when completing against
- an unnamed class/module.
-
- * lib/rdoc/parsers/parse_c.rb: private comment (--/++) support in
- C-file rdoc.
-
- * lib/debug.rb: minor clarification in help.
-
- * lib/pp.rb: minor clarification on exception.
-
-Mon Jul 10 09:29:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_clear_cache_for_undef): clear entries for included
- module. fixed: [ruby-core:08180]
-
-Mon Jul 10 01:48:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * st.h (st_data_t): use pointer sized integer for st_data_t.
- [ruby-dev:28988]
-
-Sun Jul 9 18:06:47 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (try_constant): fix for value 1 at cross compiling.
-
- * lib/mkmf.rb (create_makefile): prevent substitution of macro
- definition. fixed: http://www.yotabanana.com/lab/20060624.html#p02
-
-Sun Jul 9 00:54:34 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (next_jump): deal with destination of next.
- fixed: [ruby-core:08169]
-
-Fri Jul 7 00:38:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * hash.c (rb_hash_default): should not call default procedure if
- no key is given. [ruby-list:42541]
-
-Fri Jul 7 00:29:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_mload): a patch from Daniel Berger
- <Daniel.Berger at qwest.com>. [ruby-core:08128]
-
-Thu Jul 6 22:21:57 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (rb_proc_times): use sysconf(_SC_CLK_TCK) value prior to
- HZ and CLK_TCK. fixed: [ruby-talk:200293]
-
-Thu Jul 6 22:17:21 2006 Minero Aoki <aamine@loveruby.net>
-
- * ext/racc/cparse/cparse.c: sync with original code, rev 1.8.
-
- * ext/racc/cparse/cparse.c: should mark CparseParams objects.
-
- * lib/racc/parser.rb: sync with original code, rev 1.8.
-
- * lib/racc/parser.rb: update coding style.
-
-Mon Jul 3 19:04:38 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c (ip_make_menu_embeddable): help to make a menu
- widget embeddable (pack, grid, and so on) like as a general widget.
- However, an embeddable menu may require to be definied some event
- bindings for general use.
-
- * ext/tk/lib/tk/event.rb: [bug fix] Tk.callback_break and
- Tk.callback_continue don't work on MultiTkIp.
-
- * ext/tk/lib/multi-tk.rb: ditto.
-
- * ext/tk/lib/tk.rb: lack of Tk.callback_return.
-
- * ext/tk/lib/tk/menu.rb: improve creating clone menus.
-
-Mon Jul 3 14:42:06 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/extconf.rb (PW_UID2VAL, PW_GID2VAL): defaulted to conversion
- from int, and sys/types.h needs to be included before grp.h.
- fixed: [ruby-dev:28938]
-
-Mon Jul 3 01:14:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_inspect): encode \b (\010) for escape.
- [ruby-dev:28927]
-
- * string.c (rb_str_dump): ditto.
-
-Sun Jul 2 19:17:56 2006 Minero Aoki <aamine@loveruby.net>
-
- * ext/racc/cparse/cparse.c: sync with original code (rev 1.7).
-
- * ext/racc/cparse/cparse.c: use rb_catch instead of rb_iterate.
- Giving a block to a Ruby-level method by rb_iterate is obsolete on
- Ruby 1.9. Note that current cparse.c still includes one
- rb_iterate call on Ruby 1.8, but it is not a problem (at least
- just now).
-
-Sat Jul 1 15:15:49 2006 Tanaka Akira <akr@m17n.org>
-
- * test/socket/test_nonblock.rb: add timeout to send/receive
- an empty UDP packet.
- [ruby-dev:28820]
-
-Fri Jun 30 23:46:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: should test isinf for Solaris with GCC compiler.
- a patch from <ville.mattila at stonesoft.com>. [ruby-core:07791]
-
- * configure.in: -shared patch from Andrew Morrow
- <andrew.c.morrow at gmail.com>. [ruby-core:08100]
-
-Thu Jun 29 18:58:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_version): fix patch
- failure.
-
-Thu Jun 29 18:00:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c: add RDoc document. a patch from
- mathew <meta at pobox.com>. [ruby-core:07050]
-
-Wed Jun 28 15:47:14 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/optparse.rb: RDoc patch from Robin Stocker <robin@nibor.org>
- [ruby-core:08087]
-
-Wed Jun 28 19:04:34 2006 Tanaka Akira <akr@m17n.org>
-
- * test/socket/test_unix.rb: test_seqpacket_pair removed.
- [ruby-dev:28846]
-
-Tue Jun 27 23:03:49 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c: RDoc update for =~ method. a patch from Alex Young
- <alex at blackkettle.org>. [ruby-core:08068]
-
-Tue Jun 27 22:47:18 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c: forgot to update TCLTKLIB_RELEASE_DATE.
-
- * ext/tk/lib/tk.rb (tk_tcl2ruby): [bug fix] sometimes fail to convert
- a tcl string to a ruby object if the tcl string includes "\n".
-
-Tue Jun 27 16:04:05 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * win32/win32.h: define isascii on MinGW for msvcrt compatibility.
-
- * configure.in: set ac_cv_header_sys_time_h=no on MinGW
- for msvcrt compatibility.
-
-Tue Jun 27 11:36:02 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/etc/etc.c (setup_passwd, setup_group): allow bignum uid, gid and
- so on. [ruby-talk:199102]
-
-Mon Jun 26 13:37:27 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc: Merge from HEAD.
- Add options to limit the ri search path.
-
-Tue Jun 27 00:54:08 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * util.c (powersOf10): constified.
-
-Mon Jun 26 18:37:44 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c (ip_delete): fix SEGV when a slave-ip is
- deleted on callback.
-
-Mon Jun 26 10:47:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (pipe_open): avoid closing uninitialized file descriptors.
- a patch from <tommy at tmtm.org> [ruby-dev:28600]
-
-Mon Jun 26 09:56:22 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.[ch] (rb_w32_send, rb_w32_sendto): constified.
-
-Sun Jun 25 23:02:12 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in, mkconfig.rb: catch-up for latest autoconf.
-
-Sat Jun 24 06:35:00 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * signal.c: revert last change.
-
- * ruby.h: ditto.
-
- * eval.c: ditto.
-
-Thu Jun 22 11:52:02 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/net/http.rb (Net::HTTPResponse): duplicated error 501;
- HTTPInternalServerError should be error 500. [ruby-core:08037]
-
-Thu Jun 22 05:15:58 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (sock_s_socketpair): try GC only once.
- [ruby-dev:28778]
-
-Wed Jun 21 21:28:32 2006 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb (jd_to_commercial): now works fine even if in
- mathn-ized context.
-
-Wed Jun 21 17:32:31 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * signal.c (ruby_nativethread_signal, posix_nativethread_signal,
- sigsend_to_ruby_thread, install_nativethread_sighandler):
- nativethread-support on signal handler (backport from 1.9).
-
- * ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
-
- * eval.c (ruby_native_thread_kill): ditto.
-
-Wed Jun 21 08:39:54 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): merge Date
- and Time processing. [ruby-core:08033]
-
-Wed Jun 21 01:40:25 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (yylex, reswords): modifier token is no longer returned in
- fname state. [ruby-dev:28775]
-
-Wed Jun 21 01:12:46 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: RSS::Element.def_corresponded_attr_writer
- supported date type.
-
-Tue Jun 20 22:08:36 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rss/test_parser.rb: split parser tests into ...
- * test/rss/test_parser_1.0.rb: ... RSS 1.0 parsing tests and ...
- * test/rss/test_parser_2.0.rb: ... RSS 2.0 parsing tests.
-
-Tue Jun 20 21:19:06 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: provided default RSS::Element#children.
-
- * lib/rss/0.9.rb: used default RSS::Element#children.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
-
-Tue Jun 20 21:04:33 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: provided default RSS::Element#_tags.
-
- * lib/rss/0.9.rb: used default RSS::Element#_tags.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
-
-Tue Jun 20 20:47:07 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: hide RSS::Element.install_model.
- (RSS::Element.install_have_child_element,
- RSS::Element.install_have_children_element,
- RSS::Element.install_text_element,
- RSS::Element.install_date_element): call
- RSS::Element.install_model internally.
-
- * lib/rss/0.9.rb: followed new API.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/content.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
-Tue Jun 20 20:18:05 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: add check for OBJ_NAME_do_all_sorted.
-
- * ext/openssl/ossl_cipher.c (ossl_s_ciphers): new method
- OpenSSL::Cipher.ciphers. it returns all the cipher names.
-
- * ext/openssl/lib/openssl/cipher.rb:
- - add constants AES128, AES192, AES256. [ruby-dev:28610]
- - reimplement without eval()
-
- * ext/openssl/lib/openssl/digest.rb: reimplement without eval().
-
- * test/openssl/test_cipher.rb, test_digest: fix about reimplemented
- features.
-
- * sample/openssl/cipher.rb: rewrite all.
-
-Sat Jun 19 11:21:46 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/test/unit/assertions.rb: Merge RDoc from HEAD.
-
-Tue Jun 20 01:06:57 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb:
- - cleanup validation mechanism. Now, #XXX_validation is
- needless.
- - changed internal variable name RSS::Element::MODEL to
- RSS::Element::MODELS.
- - RSS::Element.install_model requires uri.
-
- * lib/rss/0.9.rb: followed new validation API.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/content.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
-Mon Jun 19 23:40:59 2006 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/lib/kconv.rb: remove default -m0 and fix document.
-
- * ext/nkf/nkf-8/{nkf.c, config.h, utf8tbl.c, utf8tbl.h}:
- imported nkf 2.0.7.
-
-Mon Jun 19 22:31:59 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb:
- - provided default #to_s as RSS::Element#to_s.
- - removed RSS::Element#other_element.
- - RSS::Element#tag requires attributes as Hash instead of Array.
-
- * lib/rss/0.9.rb: removed #to_s to use RSS::Element#to_s.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * lib/rss/2.0.rb: removed #other_element.
-
-Mon Jun 19 22:09:16 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c(ole_invoke): support some kind of
- method of word. [ruby-Bugs#3237]
-
- * ext/win32ole/tests/test_word.rb: ditto.
-
- * ext/win32ole/tests/testall.rb: ditto.
-
-Mon Jun 19 00:02:17 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: automatically detected attributes.
-
- * lib/rss/0.9.rb: removed #_attrs.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * lib/rss/parser.rb: followed new internal API.
-
-Mon Jun 19 00:00:17 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: fix bug: initialize improper tables.
-
-Sun Jun 18 22:36:13 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: RSS::Element#initialize accepts initial
- attributes.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * lib/rss/utils.rb: added Utils.element_initialize_arguments? to
- detect backward compatibility initial arguments.
-
- * lib/rss/parser.rb: user initial attributes to initialize
- RSS::Element.
-
-Sun Jun 18 18:24:42 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/converter.rb: use NKF for Uconv fallback.
-
-Sun Jun 18 18:22:04 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rss/test_image.rb: shared name space configuration.
-
-Sun Jun 18 18:13:25 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: improved ignore_unknown_element
- handling. RSS::NotExpectedTagError provides tag URI.
- * lib/rss/parser.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/content.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * test/rss/rss-assertions.rb: checked URI of not expected tag too.
- * test/rss/test_parser.rb: ditto.
-
-Sun Jun 18 18:08:36 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: changed empty namespace URI representation to ""
- from nil.
- * lib/rss/parser.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
-
-Sun Jun 18 18:03:50 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb: removed a guard for requiring open-uri.
-
-Sun Jun 18 18:01:26 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: fixed typo: except -> expect
- * lib/rss/parser.rb: ditto.
- * test/rss/rss-assertions.rb: ditto.
- * test/rss/test_parser.rb: ditto.
-
-Sun Jun 18 17:52:39 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: RSS::Element#calc_indent became to be deprecated.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/taxonomy.rb: ditto.
- * lib/rss/trackback.rb: ditto.
-
- * test/rss/test_1.0.rb: removed RSS::Element.indent_size tests.
- * test/rss/test_2.0.rb: ditto.
-
-Sun Jun 18 00:49:11 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (bsock_recv_nonblock): new method
- BasicSocket#recv_nonblock.
- (udp_recvfrom_nonblock): renamed from ip_recvfrom_nonblock.
- IPSocket#recvfrom_nonblock is moved to UDPSocket#recvfrom_nonblock.
- (unix_recvfrom_nonblock): removed.
- UNIXSocket#recvfrom_nonblock is removed.
-
-Sat Jun 17 22:17:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/mathn.rb (Integer::prime_division): raise ZeroDivisionError
- on zeros. [ruby-dev:28739]
-
-Sat Jun 17 14:53:32 2006 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb: backport from 1.9.
- (Kernel#Pathname): new method.
-
-Sat Jun 17 10:30:41 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb (Hash#merge, Enumerable#sort_by): removed.
-
- * lib/rss/rss.rb (RSS::RootElementMixin#to_xml): added.
- [ruby-talk:197284]
-
- We can convert RSS version easily like the following:
- rss10 = RSS::Parser.parse(File.read("1.0.rdf"))
- File.open("2.0.rss", "w") {|f| f.print(rss10.to_xml("2.0"))}
-
- * test/rss/test_1.0.rb: added #to_xml test.
- * test/rss/test_2.0.rb: ditto.
-
- * test/rss/rss-testcase.rb: added some helper methods that
- generates sample RSS 2.0.
-
- * sample/rss/convert.rb: added a sample script to convert RSS format.
-
-Sat Jun 17 10:23:22 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb (Kernel#funcall): removed.
- * lib/rss/parser.rb (Kernel.URI): removed.
-
- * lib/rss/maker/: supported
- xxx.new_yyy do |yyy|
- yyy.zzz = zzz
- ...
- end
- style and this style became the style of the recommendation.
-
- Old style
- yyy = xxx.new_yyy
- yyy.zzz = zzz
- ...
- is supported too but this style isn't recommended.
- [ruby-talk:197284]
-
- * test/rss/test_*maker*.rb: used new recommended style.
-
-Sat Jun 17 09:03:47 2006 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss, test/rss: backported from trunk. (2005-11-16 - now)
-
- * lib/rss/rss.rb (RSS::VERSION): 0.1.5 -> 0.1.6.
- * test/rss/test_version.rb (RSS::TestVersion#test_version): ditto.
-
- * lib/rss/trackback.rb: added TrackBack prefix.
- * lib/rss/maker/trackback.rb: ditto.
-
- * lib/rss/rss.rb : removed needless argument 'prefix'.
- * lib/rss/parser.rb: ditto.
-
- * lib/rss/1.0.rb: added rdf:Bag.
-
- * lib/rss/taxonomy.rb: implemented taxonomy module.
- * test/rss/test_taxonomy.rb: added tests for taxonomy support.
-
- * lib/rss/1.0.rb: added convenience method 'resources'.
- * lib/rss/taxonomy.rb: ditto.
- * test/rss/rss-assertions.rb: added test for 'resources'.
- * test/rss/test_taxonomy.rb: ditto.
-
- * lib/rss/rss.rb: fixed a indentation bug.
- * lib/rss/taxonomy.rb: fixed <taxo:topic> #to_s bug.
- * test/rss/test_taxonomy.rb: added a #to_s test.
-
- * lib/rss/maker/taxonomy.rb: implemented taxonomy module for RSS
- Maker.
- * lib/rss/taxonomy.rb: supported RSS Maker.
- * lib/rss/maker.rb: added taxonomy module support.
-
- * lib/rss/rss.rb: adjusted to other element API.
- * lib/rss/1.0.rb: adjusted to other element API but backward
- compatibility is reserved.
- * lib/rss/0.9.rb: ditto.
-
- * test/rss/test_maker_taxo.rb: added test case for taxonomy module
- for RSS Maker.
- * test/rss/test_setup_maker_1.0.rb: added tests for taxo:topic.
-
- * test/rss/test_setup_maker_1.0.rb: added backward compatibility
- test.
- * test/rss/test_setup_maker_0.9.rb: ditto.
- * test/rss/test_setup_maker_2.0.rb: ditto.
-
- * test/rss/rss-testcase.rb: added convenience method for setting
- up taxo:topic.
- * test/rss/rss-assertions.rb: added assertion for taxo:topic.
-
- * sample/rss/blend.rb: followed new API.
-
- * lib/rss/taxonomy.rb: changed class or module prefix to
- Taxonomy from Taxo.
- * lib/rss/maker/taxonomy.rb: ditto.
-
- * test/rss/test_taxonomy.rb: use #reject directory.
-
- * lib/rss/: use #__send__ instead of #send.
- * test/rss/: ditto.
-
- * lib/rss/parser.rb: added entity handling type predicate.
- * lib/rss/rexmlparser.rb: ditto.
- * lib/rss/xmlparser.rb: ditto.
- * lib/rss/xmlscanner.rb: ditto.
-
- * lib/rss/xmlscanner.rb: more robust entity handling.
-
- * test/rss/test_parser.rb: added an entity handling test.
-
- * test/rss/test_2.0.rb: added RSS 2.0 tests.
- * test/rss/rss-assertions.rb: extended XML stylesheet assertion.
- * lib/rss/0.9.rb: added initialize method.
- * test/rss/test_1.0.rb: cleanup.
-
- * lib/rss/image.rb: added Image prefix.
- * lib/rss/maker/image.rb: ditto.
-
- * lib/rss/rss.rb: improved type conversion.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
-
- * test/rss/test_2.0.rb: added type conversion tests.
- * test/rss/test_accessor.rb: ditto.
- * test/rss/test_to_s.rb: ditto.
- * test/rss/test_syndication.rb: ditto.
- * test/rss/test_setup_maker_2.0.rb: ditto.
- * test/rss/test_setup_maker_1.0.rb: ditto.
- * test/rss/test_setup_maker_0.9.rb: ditto.
- * test/rss/test_maker_sy.rb: ditto.
- * test/rss/test_maker_image.rb: ditto.
- * test/rss/test_maker_2.0.rb: ditto.
- * test/rss/test_maker_0.9.rb: ditto.
- * test/rss/test_image.rb: ditto.
-
- * test/rss/test_maker_1.0.rb: use assert instead of assert_equal.
-
- * test/rss/rss-assertions.rb: improved type conversion assertions.
-
- * lib/rss/rss.rb: added backward compatibility codes.
- * lib/rss/parser.rb: ditto.
- * test/rss/test_parser.rb: ditto.
- * test/rss/test_2.0.rb: ditto.
-
-Sat Jun 17 02:01:00 2006 Tanaka Akira <akr@m17n.org>
-
- * lib/pp.rb (Kernel#pretty_inspect): defined for pretty printed
- string.
-
-Sat Jun 17 00:23:58 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (reswords): kDO_BLOCK was missing. fixed: [ruby-core:7995]
-
-Sat Jun 17 00:02:15 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_propertyput): support
- PROPERTYPUTREF. [ruby-talk:183042]
-
- * ext/win32ole/tests/test_propertyputref.rb: ditto.
-
-Thu Jun 15 23:02:47 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (fole_methods): The return value
- of WIN32OLE#ole_methods should include PROPERTYPUTREF methods.
-
- * ext/win32ole/win32ole.c (fole_put_methods): The return value
- of WIN32OLE#ole_put_methods should include PROPERTYPUTREF methods.
-
- * ext/win32ole/tests/test_ole_methods.rb: ditto.
-
- * ext/win32ole/tests/testall.rb : ditto.
-
-Wed Jun 14 18:23:28 2006 Eric Hodel <drbrain@segment7.net>
-
- * enum.c (enum_any): Documentation typo.
-
-Wed Jun 14 15:01:09 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser#warn): Don't print
- warnings when -q is set.
-
-Wed Jun 14 23:03:53 2006 Tanaka Akira <akr@m17n.org>
-
- * configure.in: check sizeof(rlim_t).
- check setrlimit.
-
- * process.c (proc_getrlimit): new method Process.getrlimit.
- (proc_setrlimit): new method Process.setrlimit.
-
- * ruby.h (NUM2ULL): new macro.
-
-Mon Jun 12 22:25:09 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): adjust precision length to prevent
- splitting multi-byte characters. [ruby-list:42389]
-
-Sun Jun 11 23:20:07 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Arguable#getopts): pass self to the
- parser.
-
-Sun Jun 11 10:00:57 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.h (write): not need to define on bcc.
-
-Sun Jun 11 08:30:33 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#getopts): new methods.
-
-Sat Jun 10 18:02:40 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/bigdecimal/lib/bigdecimal/newton.rb (Newton::nlsolve): typo
- fixed: raize -> raise. [ruby-talk:196608]
-
-Thu Jun 8 14:19:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.[ch] (rb_w32_read, rb_w32_write): new functions.
- use recv() and send() when fd is socket. fixed: [ruby-dev:28694]
-
-Wed Jun 7 16:22:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/tempfile.rb (Tempfile::make_tmpname): put dot between
- basename and pid. [ruby-talk:196272]
-
-Wed Jun 7 14:53:04 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (errmap): add some winsock errors.
-
-Wed Jun 7 11:34:38 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * configure.in: add new configure option `--with-winsock2' for mingw.
-
- * win32/Makefile.sub (config.h): define USE_WINSOCK2 in config.h
- instead of in CPPFLAGS.
-
- * ext/socket/extconf.rb: determine whether to use winsock2 or not
- by using with_config.
-
-Wed Jun 7 10:45:10 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/{configure.bat, setup.mak, Makefile.sub, win32.h}: add
- new configure option `--with-winsock2'.
-
- * win32/win32.c (StartSockets): ditto.
-
- * ext/socket/extconf.rb: ditto.
-
- * win32/win32.c (open_ifs_socket): new function.
-
- * win32/win32.c (StartSockets, rb_w32_socket): use open_ifs_socket()
- instead of socket().
- ifs socket support is backported from trunk.
-
-Wed Jun 7 09:14:44 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): binding for the return event hook should have
- consistent scope. [ruby-core:07928]
-
- * eval.c (EXEC_EVENT_HOOK): trace_func may remove itself from
- event_hooks. no guarantee for arbitrary hook deletion.
- [ruby-dev:28632]
-
-Mon Jun 5 18:12:12 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (sock_s_unpack_sockaddr_in): reject
- non-AF_INET/AF_INET6 sockaddr.
- (sock_s_unpack_sockaddr_un): reject non-AF_UNIX sockaddr.
- [ruby-dev:28691]
-
-Sun Jun 4 20:40:19 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c: fix sockaddr_un handling.
- [ruby-dev:28677]
-
-Fri Jun 2 22:08:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/forwardable.rb: RDoc typo fix from Jan Svitok
- <jan.svitok at gmail.com>. [ruby-core:07943]
-
-Fri Jun 2 19:02:09 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: use create_header.
-
- * ext/openssl/ossl.h, ext/openssl/openssl_missing.h:
- include RUBY_EXTCONF_H.
-
-Fri Jun 2 17:16:52 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (CLEANINGS): remove extconf.h by distclean if created.
-
-Fri Jun 2 00:11:19 2006 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (s_recvfrom): alen may be zero with UNIXSocket
- too. (tested on NetBSD 3.0)
- (s_recvfrom_nonblock): extracted from sock_recvfrom_nonblock.
- (sock_recvfrom_nonblock): use s_recvfrom_nonblock.
- (ip_recvfrom_nonblock): new method: IPSocket#recvfrom_nonblock
- (unix_recvfrom_nonblock): new method: UNIXSocket#recvfrom_nonblock
- (s_accept_nonblock): extracted from sock_accept_nonblock.
- (sock_accept_nonblock): use s_accept_nonblock.
- (tcp_accept_nonblock): new method: TCPServer#accept_nonblock
- (unix_accept_nonblock): new method: UNIXServer#accept_nonblock
-
-Thu Jun 1 19:12:37 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (rb_w32_cmdvector): backslashes inside single-quotes
- no longer has special meanings. fixed: [ruby-list:42311]
-
-Thu Jun 1 16:14:41 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_getcwd): runtime's getcwd() will not success
- if the length of the cwd is longer than MAX_PATH.
- fixed [ruby-list:42335]
-
-Thu Jun 1 11:29:14 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_getcwd): set errno if not set.
- fixed [ruby-list:42346]
-
-Sat May 27 11:29:46 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): remove extinit files if no statically linked
- extensions.
-
-Fri May 26 09:05:11 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * ruby.h, lib/mkmf.rb (create_header): clear command line options for
- macros moved to extconf.h.
-
- * ext/extmk.rb (extract_makefile, extmk): made RUBY_EXTCONF_H and
- EXTSTATIC permanent.
-
- * ext/{dbm,digest/*,socket,zlib}/extconf.rb: used $defs and $INCFLAGS.
-
- * {bcc32,win32,wince}/Makefile.sub (COMPILE_C, COMPILE_CXX): added
- $(INCFLAGS).
-
- * lib/mkmf.rb (configuration): add $defs unless extconf.h was created.
-
-Thu May 25 01:52:07 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (pkg_config): particular config commands support.
-
- * ext/extmk.rb: deal with $static set in extconf.rb.
-
- * mkconfig.rb: merge multiple entries to an entry with multiple lines.
-
- * lib/mkmf.rb: allow a series of commands to link.
-
- * win32/Makefile.sub: embed manifests.
-
- * win32/setup.mak: suffix OS name by runtime version.
-
-Wed May 24 23:52:11 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_install_sh): ignore dummy install-sh.
- [ruby-talk:193876]
-
-Wed May 24 03:10:48 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/ssl.rb
- (OpenSSL::SSL::SocketForwarder#setsockopt,getsockopt): typo fixed.
-
-Mon May 22 17:54:12 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/socket.c (sock_recvfrom_nonblock): use rb_read_pending
- instead of rb_io_read_pending.
- [ruby-dev:28663]
-
-Mon May 22 17:30:04 2006 Tanaka Akira <akr@m17n.org>
-
- * rubyio.h (rb_io_set_nonblock): declared.
-
- * io.c (rb_io_set_nonblock): new function.
- (io_getpartial): nonblocking read support.
- (io_read_nonblock): new method: IO#read_nonblock.
- (io_write_nonblock): new method: IO#write_nonblock.
-
- * ext/socket/socket.c
- (sock_connect_nonblock): new method: Socket#connect_nonblock.
- (sock_accept_nonblock): new method: Socket#accept_nonblock.
- (sock_recvfrom_nonblock): new method: Socket#recvfrom_nonblock.
-
- [ruby-core:7917]
-
-Mon May 22 15:57:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (umethod_bind): should not update original class.
- [ruby-dev:28636]
-
-Mon May 22 13:38:57 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (ev_const_get): should support constant access from
- within instance_eval(). [ruby-dev:28327]
-
-Thu May 18 17:51:32 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_timeval): should round for usec floating
- number. [ruby-core:07896]
-
- * time.c (time_add): ditto.
-
-Thu May 18 17:11:45 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::out): support utf-8. a patch from Fujioka
- <fuj at rabbix.jp>. [ruby-dev:28649]
-
-Thu May 18 00:42:12 2006 nobuyoshi nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb, lib/mkmf.rb: use BUILD_FILE_SEPARATOR in Makefiles.
-
-Wed May 17 17:55:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (sys_warning): should not call a vararg function
- rb_sys_warning() indirectly. [ruby-core:07886]
-
-Wed May 17 08:17:15 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * util.c (ruby_strtod): try to reduce errors using powersOf10
- table. [ruby-dev:28644]
-
-Tue May 16 15:34:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * re.c (rb_reg_initialize): should not allow modifying literal
- regexps. frozen check moved from rb_reg_initialize_m as well.
-
-Tue May 16 09:20:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * re.c (rb_reg_initialize): should not modify untainted objects in
- safe levels higher than 3.
-
- * re.c (rb_memcmp): type change from char* to const void*.
-
- * dir.c (dir_close): should not close untainted dir stream.
-
- * dir.c (GetDIR): add tainted/frozen check for each dir operation.
-
-Mon May 15 17:42:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_symbol_arg):
- typo fixed. a patch from Florian Gross <florg at florg.net>.
-
-Sat May 13 16:14:05 2006 Tanaka Akira <akr@m17n.org>
-
- * lib/pp.rb (PP.mcall): new method.
- (Struct#pretty_print): call Kernel#class and Struct#members even if
- overridden.
- (Struct#pretty_print_cycle): ditto.
- [ruby-core:7865]
-
-Thu May 11 19:57:00 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * util.c (ruby_strtod): differ addition to minimize error.
- [ruby-dev:28619]
-
-Fri Aug 11 15:39:25 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
- documented.
-
-Thu May 11 18:10:43 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * util.c (ruby_strtod): should not raise ERANGE when the input
- string does not have any digits. [ruby-dev:28629]
-
-Sun May 7 03:09:51 2006 Stephan Maka <stephan@spaceboyz.net>
-
- * lib/resolv.rb (Resolv::DNS::Requester::ConnectedUDP#initialize):
- Use AF_INET6 for nameservers containing colons.
-
-Sat May 6 00:38:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * signal.c (trap): sig should be less then NSIG. Coverity found
- this bug. a patch from Kevin Tew <tewk at tewk.com>.
- [ruby-core:07823]
-
-Thu May 4 02:24:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/syck/emitter.c (syck_scan_scalar): avoid accessing
- uninitialized array element. a patch from Pat Eyler
- <rubypate at gmail.com>. [ruby-core:07809]
-
- * array.c (rb_ary_fill): initialize local variables first. a
- patch from Pat Eyler <rubypate at gmail.com>. [ruby-core:07810]
-
- * ext/syck/yaml2byte.c (syck_yaml2byte_handler): need to free
- type_tag. a patch from Pat Eyler <rubypate at gmail.com>.
- [ruby-core:07808]
-
-Wed May 3 02:12:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (make_hostent_internal): accept ai_family
- check from Sam Roberts <sroberts at uniserve.com>.
- [ruby-core:07691]
-
-Mon May 1 12:23:19 2006 <sinara@blade.nagaokaut.ac.jp>
-
- * numeric.c (num_div): use floor rather than rb_Integer().
- [ruby-dev:28589]
-
- * numeric.c (flo_divmod): the first element of Float#divmod should
- be an integer. [ruby-dev:28589]
-
- * test/ruby/test_float.rb: add tests for divmod, div, modulo and remainder.
-
-Sat Apr 29 22:42:08 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode0): should initialize
- flag. [ruby-core:07785]
-
-Fri Apr 28 10:53:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * util.c (ruby_strtod): should not cut off 18 digits for no
- reason. [ruby-core:07796]
-
- * util.c (ruby_strtod): fixed wrong conversion.
-
-Thu Apr 27 01:38:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_fill): internalize local variable "beg" to
- pacify Coverity. [ruby-core:07770]
-
-Wed Apr 26 16:59:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (pack_unpack): now supports CRLF newlines. a patch from
- <tommy at tmtm.org>. [ruby-dev:28601]
-
-Tue Apr 25 18:00:05 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c (delete_slaves): maybe increment the reference
- count of a NULL Tcl_Obj [ruby-core:07759].
-
-Tue Apr 25 07:55:31 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/jcode.rb (String::tr_s): should have translated non
- squeezing character sequence (i.e. a character) as well. thanks
- to Hiroshi Ichikawa <gimite at gimite.ddo.jp> [ruby-list:42090]
-
-Tue Apr 25 00:08:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * regex.c (re_compile_pattern): should check if c is not a
- multibyte character. a patch from KIMURA Koichi
- <kimura.koichi at canon.co.jp>. [ruby-dev:28598]
-
-Fri Apr 21 15:19:13 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c (lib_eventloop_ensure): refer freed pointer
- [ruby-core:07744] and memory leak.
-
-Fri Apr 21 12:14:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c: document update patch from Sam Roberts
- <sroberts at uniserve.com>. [ruby-core:07701]
-
-Wed Apr 19 13:55:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (arg): too much NEW_LIST()
-
- * eval.c (SETUP_ARGS0): remove unnecessary access to nd_alen.
-
-Wed Apr 19 11:57:04 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): use ARGSCAT for NODE_OP_ASGN1.
- [ruby-dev:28585]
-
- * parse.y (list_concat): revert last change.
-
- * parse.y (arg): use NODE_ARGSCAT for placeholder.
-
-Wed Apr 19 11:13:17 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/getoptlong.rb (GetoptLong::get): RDoc update patch from
- mathew <meta at pobox.com>. [ruby-core:07738]
-
-Wed Apr 19 10:13:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * variable.c (rb_const_set): raise error when no target klass is
- supplied. [ruby-dev:28582]
-
-Wed Apr 19 09:49:36 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (list_concat): should not modify nodes other than
- NODE_ARRAY. [ruby-dev:28583]
-
-Tue Apr 18 17:40:37 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: add a binding to a container for a slave IP.
-
- * ext/tk/lib/tk.rb: update RELEASE_DATE.
-
- * ext/tk/tcltklib.c: forget to reset a Tcl interpreter.
-
- * ext/tk/stubs.c: fix potential bugs about handling rb_argv0.
-
-Tue Apr 18 00:11:21 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c: block_unique should be 1, not frame_unique.
- [ruby-dev:28577]
-
-Fri Aug 11 15:39:25 2006 Eric Hodel <drbrain@segment7.net>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_body): Make RDoc
- ignore C function prototypes. Patch by Tilman Sauerbeck
- <tilman at code-monkey.de>. [ruby-core:8574]
- * lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
- documented.
-
-Mon Apr 10 01:03:10 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * prec.c (prec_prec_f): documentation patch from
- <gerardo.santana at gmail.com>. [ruby-core:07689]
-
-Sat Apr 8 02:34:34 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (rb_big_pow): second operand may be too big even if
- it's a Fixnum. [ruby-talk:187984]
-
-Sat Apr 8 02:12:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * README.EXT: update symbol description. [ruby-talk:188104]
-
-Thu Apr 6 23:28:47 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * COPYING: explicitly note GPLv2. [ruby-talk:187922]
-
-Thu Apr 6 11:18:37 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/panedwindow.rb: lack of arguments. [ruby-core:7681]
-
-Thu Apr 6 01:04:47 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tcltklib.c: fix SEGV when embedding to an application.
- [ruby-core:7600]
-
- * ext/tk/tcltklib.c: fix SEGV at exit. [ruby-talk:186489]
-
- * ext/tk/tkutil/tkutil.c: follow to changing specification of
- instance_eval on ruby-1.9.x.
-
- * ext/tk/lib/tk.rb: ditto.
-
- * ext/tk/lib/multi-tk.rb: ditto.
-
- * ext/tk/lib/tk.rb: remove warning about redefinition of methods.
-
- * ext/tk/lib/tk/variable.rb: remove warning about unseting Tcl
- variables.
-
-Wed Mar 29 20:54:44 2006 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (fole_getproperty): WIN32OLE#[] should accept
- multi arguments.
-
- * ext/win32ole/tests/testWIN32OLE.rb (test_setproperty_bracket): ditto.
-
-Wed Mar 29 10:07:44 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c (nkf_each_char_to_hex, encode_fallback_subchar,
- e2w_conv): support C90 compiler.
-
-Wed Mar 29 06:48:40 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (backtrace): reports aliased method names in a generated
- backtrace. a patch from "U.Nakamura" <usa at garbagecollect.jp>.
- [ruby-dev:28471]
-
-Mon Mar 27 22:19:09 2006 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/{nkf.c, utf8tbl.c, config.h}: imported nkf 2.0.6.
- * Add --ic / --oc option and mapping tables.
- * Add fallback option.
- * Add --no-best-fit-chars option.
- * Fix some bugs.
-
- * ext/nkf/nkf.c (nkf_split_options): added for parse option string.
-
- * ext/nkf/lib/kconv.rb (Kconv.to*): add -m0.
- Note that Kconv.to* still imply -X.
-
-Mon Mar 27 03:17:21 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): insecure calling should be checked for non
- NODE_SCOPE method invocations too.
-
- * eval.c (rb_alias): should preserve the current safe level as
- well as method definition.
-
-Fri Mar 24 23:14:30 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (yield_under_i): pass self again for instance_eval().
- [ruby-dev:28466]
-
-Fri Mar 24 17:20:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_f_sleep): remove description about SIGALRM which
- is not valid on the current implementation. [ruby-dev:28464]
-
-Thu Mar 23 10:47:03 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (method_missing): should support argument splat in
- super. [ruby-talk:185438]
-
-Mon Mar 20 12:05:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: Solaris SunPro compiler -rapth patch from
- <kuwa at labs.fujitsu.com>. [ruby-dev:28443]
-
-Mon Mar 20 09:40:23 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: remove enable_rpath=no for Solaris.
- [ruby-dev:28440]
-
-Fri Mar 17 19:08:49 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: fix typo.
- [ruby-core:07571]
-
-Wed Mar 15 16:54:21 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): support libraries without *.so.
-
-Wed Mar 15 16:35:43 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: should use
- "rb_str_new(0, 0)" to make empty string.
-
-Sat Mar 11 14:24:06 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::wrap): removed
- space before argument parenthesis. [ruby-talk:183630]
-
- * ruby.1: a clarification patch from David Lutterkort
- <dlutter at redhat.com>. [ruby-core:7508]
-
-Sat Mar 4 15:26:40 2006 Tanaka Akira <akr@m17n.org>
-
- * gc.c (id2ref): fix symbol test.
-
-Sat Mar 4 01:08:07 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rdoc/ri/ri_paths.rb (RI::Paths): adding paths from rubygems
- directories. a patch from Eric Hodel <drbrain at segment7.net>.
- [ruby-core:07423]
-
-Thu Mar 2 19:44:18 2006 Tanaka Akira <akr@m17n.org>
-
- * gc.c: align VALUE with sizeof(RVALUE) globally.
- (is_pointer_to_heap): check alignment out of loop.
- (id2ref): avoid collision between symbols and objects.
- (rb_obj_id): ditto. moved from object.c.
- [ruby-talk:178364] [ruby-core:7305]
-
-Thu Mar 2 18:58:18 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_thread_fd_writable): should not re-schedule output
- from KILLED thread (must be error printing).
-
-Thu Mar 2 17:57:49 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * gc.c: commited magic for reducing RVALUE size on windows. (24->20byte)
- [ruby-core:7474]
-
-Thu Mar 2 12:59:14 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (filetime_to_unixtime): should set tm_isdst to -1.
- stat() didn't treat daylight saving time property on WinNT.
- [ruby-talk:182100]
-
-Thu Mar 2 08:02:42 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (add_heap): heap_slots may overflow. a patch from Stefan
- Weil <weil at mail.berlios.de>.
-
-Wed Mar 1 00:24:31 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/rdoc/parsers/parse_rb.rb (read_escape): could not handle /\^/.
- merged Mr. Ishizuka's lib/irb/ruby-lex.rb 's patch rev 1.29.
- [ruby-talk:181631] [ruby-dev:28404]
-
-Tue Feb 28 09:32:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/drb/extservm.rb (invoke_service_command): cannot invoke command
- if command name is quoted on mswin32. [ruby-dev:28400]
-
-Mon Feb 27 00:19:16 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.h (SYM2ID): should not cast to signed long.
- [ruby-core:07414]
-
-Fri Feb 24 20:07:23 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/drb/drbtest.rb (add_service_command): quote pathnames in the
- server's command line for space contained directory names.
- Thanks, arton. [ruby-dev:28386]
-
-Fri Feb 24 12:11:08 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * instruby.rb: install *.exe.manifest and *.dll.manifest if exist.
- It's for VC++8.
-
-Fri Feb 24 11:33:52 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub (HAVE_HYPOT): bcc32 has hypot().
-
-Fri Feb 24 11:19:58 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * time.c (time_new_internal): add prototype to tell the compiler
- arugments types.
-
- * win32/win32.c (NtInitialize): need to set a handler for VC++8.
-
-Fri Feb 24 08:19:16 2006 NARUSE, Yui <naruse@ruby-lang.org>
-
- * test.rb: Removed. Obsolete by test/nkf.
-
- * ext/.document: enabled documents in nkf and kconv
-
- * ext/nkf/nkf.c ext/nkf/lib/kconv.rb: Add rdoc.
-
-Thu Feb 23 22:39:59 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: use borlndmm.dll if possible. bcc32's RTL internal
- memory manager cannot handle large memory block properly.
- ex: 10000.times { "" << "." * 529671; GC.start } # crash
- [ruby-dev:28230]
-
-Thu Feb 23 13:20:28 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * eval.c (SETUP_ARGS0): fixed memory corruption. [ruby-dev:28360]
-
-Tue Feb 21 02:18:46 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * configure.in (mingw): have link. [ruby-list:41838]
-
- * win32/Makefile.sub (config.h): ditto.
-
-Tue Feb 21 02:07:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (f_arglist): should set command_start = Qtrue for
- command body. [ruby-talk:180648]
-
-Mon Feb 20 17:37:26 2006 Tanaka Akira <akr@m17n.org>
-
- * mkconfig.rb: alias RbConfig for Config.
-
-Mon Feb 20 12:27:53 2006 Kent Sibilev <ksruby@gmail.com>
-
- * lib/rational.rb (Integer::gcd): small typo fix.
- [ruby-core:07395]
-
-Mon Feb 20 01:05:27 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rational.rb (Integer::gcd): replaced by gcd4 in
- [ruby-core:07390]. [ruby-core:07377]
-
-Mon Feb 20 00:57:02 2006 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.h (OSSL_Debug): should not use __func__.
- [ruby-dev:28339]
-
-Sun Feb 19 04:46:29 2006 Guy Decoux <ts@moulon.inra.fr>
-
- * eval.c: initial value for block_unique must be 1.
- [ruby-talk:180420]
-
-Sat Feb 18 23:58:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/tracer.rb (Tracer::Tracer.add_filter): turn on tracer mode
- only when caller() level size is one. [ruby-core:07389]
-
- * lib/rdoc/parsers/parse_rb.rb: need not to require "tracer".
- [ruby-core:07389]
-
- * sample/rtags.rb: ditto.
-
-Sat Feb 18 12:18:26 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/fileutils.rb (FileUtils::fu_world_writable): make it
- private. [ruby-core:07383]
-
-Sat Feb 18 00:22:39 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/tracer.rb: merged a minor clarification patch from Daniel
- Berger <Daniel.Berger at qwest.com>. [ruby-core:07376]
-
-Fri Feb 17 11:18:42 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * util.c (ruby_strtod): Float("1e") should fail. [ruby-core:7330]
-
- * pack.c (EXTEND32): unpack("l") did not work where sizeof(long) != 4.
- [ruby-talk:180024]
-
- * pack.c (pack_unpack): fixed integer overflow on template "w".
- [ruby-talk:180126]
-
-Fri Feb 17 09:39:29 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_thread_wait_for): sleep should always sleep for
- specified amount of time. [ruby-talk:180067]
-
-Thu Feb 16 01:10:48 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (backtrace): frame->orig_func may not be initialized.
- [ruby-core:07367]
-
-Wed Feb 15 16:52:52 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): NODE_OP_ASGN1 should allow splat in its
- argument list. [ruby-core:07366]
-
- * parse.y (arg): avoid unnecessary extra argument.
- [ruby-core:07366]
-
- * eval.c (rb_eval): honor visibility on OP_ASGN1 and
- OP_ASGN2. [ruby-core:07366]
-
-Wed Feb 15 10:09:51 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (yield_under_i): should not pass self as an argument to
- the block for instance_eval. [ruby-core:07364]
-
-Wed Feb 15 09:20:35 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_obj_instance_eval): should be no singleton classes for
- true, false, and nil. [ruby-dev:28186]
-
-Tue Feb 14 18:48:33 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (DMETHOD_P): accessing wrong frame. [ruby-dev:28181]
-
- * eval.c (proc_invoke): preserve FRAME_DMETH flag.
-
-Tue Feb 14 15:13:51 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/zlib/zlib.c: supress warning on test/zlib. [ruby-dev:28323]
-
-Tue Feb 14 14:01:17 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * time.c (search_time_t): support non 32bit time_t environments.
-
- * win32/Makefile.sub (config.h): VC++8 has ``long long'' type.
-
- * win32/Makefile.sub (config.h): VC++8's time_t is 64bit value.
-
- * win32/win32.c (rb_w32_utime): drop read-only attribute before
- changing file time.
-
- all changes are backported from CVS HEAD.
-
-Tue Feb 14 11:21:38 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (argf_forward): should not use frame->argv.
- [ruby-core:07358]
-
-Mon Feb 13 18:08:12 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): argument update propagation. [ruby-dev:28044]
-
- * env.h: remove argv member from struct FRAME.
-
-Mon Feb 13 13:27:00 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (eval): should push class from binding if supplied.
- [ruby-core:07347]
-
-Mon Feb 13 00:04:00 2006 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/erb.rb (ERB::Compiler): add instance variable @insert_cmd to
- change <%='s behavior. (backported 1.15 - 1.16)
-
-Sat Feb 11 02:04:11 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (eval): no need to push ruby_class. [ruby-dev:28176]
-
-Sat Feb 11 01:57:44 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_f_autoload): check if ruby_cbase is nil (during
- instance_eval for objects cannot have singleton classes,
- e.g. fixnums and symbols). [ruby-dev:28178]
-
-Tue Feb 7 23:03:24 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/zlib/zlib.c: should not access ruby objects in finalizer.
- [ruby-dev:28286]
-
-Mon Feb 6 16:02:51 2006 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * file.c (rb_thread_flock): ERROR_NOT_LOCKED is not an error on Cygwin.
- In such situation, flock() should return 0.
-
-Mon Feb 6 00:41:08 2006 Tanaka Akira <akr@m17n.org>
-
- * ruby.h (RSTRUCT_LEN, RSTRUCT_PTR): defined for source level
- compatibility with ruby 1.9.
-
-Sun Feb 5 21:05:34 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * numeric.c (fix_to_s): removed workaround for radix 2. Historically,
- rb_fix2str could only handle radix 8, 10, 16. (Rev1.37) But for now,
- it can handle radix 2..36. [ruby-Bugs#3438] [ruby-core:7300]
-
-Sun Feb 5 18:55:08 2006 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: imported from trunk, rev 1.129
-
- * lib/net/http.rb (add_field, get_fields): keep 1.8.2 backward
- compatibility.
-
- * lib/net/https.rb: imported from trunk, rev 1.3.
-
- * lib/net/https.rb: #use_ssl? definition moved from net/http.rb.
-
-Sun Feb 5 14:22:15 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/pstore.rb: should return default value if name is not found.
- [ruby-core:7304]
-
- * lib/pstore.rb: should raise PStore::Error if not in transaction.
-
-Sat Feb 4 22:51:43 2006 Tanaka Akira <akr@m17n.org>
-
- * eval.c: apply the FreeBSD getcontext/setcontext workaround
- only before FreeBSD 7-CURRENT.
-
-Sat Feb 4 21:19:23 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (LK_ERR): ERROR_NOT_LOCKED is not an error.
- In such situation, flock() should return 0.
-
-Sat Feb 4 15:56:37 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * numeric.c (fix_to_s): (2**32).to_s(2) fails with exception where
- sizeof(int) == 4 < sizeof(long). [ruby-core:7300]
-
-Fri Feb 3 15:06:50 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/syck/syck.c (syck_move_tokens): should reset p->cursor or etc
- even if skip == 0. This causes buffer overrun.
- (ex: YAML.load('--- "..' + '\x82\xA0' * 511 + '"'))
-
-Thu Feb 2 23:51:18 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/syck/emitter.c (syck_emitter_write): should not set '\0' on
- emitter's marker. if marker points to the end of buffer, this causes
- buffer overrun. (ex: YAML.dump("." * 12288))
-
-Thu Feb 2 16:01:24 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (eval): need not to protect $SAFE value.
- [ruby-core:07177]
-
-Thu Feb 2 14:45:53 2006 Ville Mattila <ville.mattila@stonesoft.com>
-
- * configure.in: The isinf is not regognized by autoconf
- library guesser on solaris 10. [ruby-core:7138]
-
-Wed Feb 1 22:01:47 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * configure.in, hash.c (ruby_setenv): use setenv(3) and unsetenv(3)
- where they are supported. modifing environ variable seems to
- segfault solaris 10. [ruby-core:7276] [ruby-dev:28270]
-
- * ruby.c (set_arg0): if use setenv(3), environ space cannot be used
- for altering argv[0].
-
-Tue Jan 31 14:46:28 2006 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * struct.c (rb_struct_select): update RDoc description.
- [ruby-core:7254]
-
-Tue Jan 31 11:58:51 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#eval and bg_eval.
-
- * ext/tk/lib/tk/namespace.rb: TkNamespace#eval was enbugged at the
- last commit. Now it will return a proper object.
-
-Tue Jan 31 00:10:26 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/syck/rubyext.c (syck_resolver_transfer): workaround for SEGV.
- ex: ruby -ryaml -e 'YAML.load("!map:B {}")' [ruby-core:7217]
-
-Sat Jan 28 07:56:57 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/rdoc/usage.rb: support "a:0:33" style caller[-1]. In this case
- file name is "a:0". I don't know this really happens though...
- [ruby-Bugs:3344]
-
-Wed Jan 25 22:29:04 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in, dln.c, file.c, intern.h, missing.h (eaccess): use
- system routine if provided. fixed: [ruby-core:07195]
-
-Sun Jan 22 23:27:13 2006 Go Noguchi <gonoguti@yahoo.co.jp>
-
- * lib/test/unit/autorunner.rb (process_args): ignore arguments after
- '--' so that test scripts can handle them. fixed: [ruby-dev:28258]
-
-Sun Jan 22 22:09:52 2006 Tanaka Akira <akr@m17n.org>
-
- * eval.c (POST_GETCONTEXT): define separately from PRE_GETCONTEXT on
- IA64 to avoid reusing variable address.
-
-Sun Jan 22 20:03:35 2006 Tanaka Akira <akr@m17n.org>
-
- * eval.c (ruby_setjmp): define PRE_GETCONTEXT and POST_GETCONTEXT
- instead of FUNCTION_CALL_MAY_RETURN_TWICE.
- define PRE_GETCONTEXT to clear carry flag for workaround of
- FreeBSD/i386 getcontext/setcontext bug.
- [ruby-dev:28263]
-
-Sat Jan 21 00:36:47 2006 Tanaka Akira <akr@m17n.org>
-
- * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): use only on SPARC and IA64
- before gcc 4.0.3.
- [ruby-dev:28247]
-
-Thu Jan 19 22:21:23 2006 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mv): should remove file after copying.
- [ruby-dev:28223]
-
-Wed Jan 18 23:37:06 2006 Tanaka Akira <akr@m17n.org>
-
- * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): don't clobber %l7 of SPARC
- if enable-shared.
- (ruby_setjmp): call FUNCTION_CALL_MAY_RETURN_TWICE after getcontext
- too.
- reported by Pav Lucistnik and Marius Strobl.
- http://lists.freebsd.org/pipermail/freebsd-sparc64/2006-January/003739.html
-
-Tue Jan 17 11:32:46 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/setup.mak (MAKE): workaround for nmake 8.
-
-Tue Jan 17 11:10:21 2006 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/{Makefile.sub,setup.mak}: invoke .bat via shell. workaround
- for nmake 8.
-
-Mon Jan 16 10:26:23 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/syck/emitter.c (syck_emit_seq, syck_emit_map, syck_emit_item):
- should output complex key mark even if map's key is empty seq/map.
- [ruby-core:7129]
-
-Sat Jan 14 05:37:06 2006 Tanaka Akira <akr@m17n.org>
-
- * io.c (READ_DATA_PENDING, READ_DATA_PENDING_COUNT): defined
- for DragonFly BSD 1.4.0.
-
-Sat Jan 14 03:43:24 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * file.c (rb_file_s_chmod): avoid warning where sizeof(int) !=
- sizeof(void*).
-
-Fri Jan 13 19:14:56 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/rdoc/diagram.rb:
- - properly quote bare element attributes
- - terminates dangling elements (e.g. <img>, <br>, <link>, etc)
- - converts "CVS" to the more HTML-friendly acronym element
- - adds missing type attributes to style elements
-
- based on Paul Duncan's patch <pabs@pablotron.org> [ruby-core:7028]
-
- * lib/rdoc/generators/html_generator.rb: ditto.
- * lib/rdoc/generators/template/html/hefss.rb: ditto.
- * lib/rdoc/generators/template/html/html.rb: ditto.
- * lib/rdoc/generators/template/html/kilmer.rb: ditto.
-
-Thu Jan 12 11:53:08 2006 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tkballoonhelp.rb: [bug fix] couldn't add to a widget
- which is constructed with TkComposite module.
- [new feature] support 'command' option which is called just before
- popping up the balloon help.
-
-Wed Jan 11 15:00:00 2006 Ville Mattila <mulperi@iki.fi>
-
- * io.c (READ_PENDING*): Support solaris 64-bit environments.
- Solaris defines a opaque FILE struct when compiling 64 bit
- binaries. This means that we dont have access to _ptr etc.
- members anymore. The solution by Steven Lumos is to define
- FILE64 that has needed members available. I've modified
- the origanal patch a bit so that it compiles both with gcc
- and now free sun studio 11 compiler and both amd64 and sparc.
- NOTE! We have to 64 bit solaris FILE structure time to time
- otherwise we'll get breakage.
- [ruby-core:7106]
-
-Tue Jan 10 19:42:33 2006 Tanaka Akira <akr@m17n.org>
-
- * gc.c (garbage_collect): mark ruby_current_node.
- if an exception is raised in a finalizer called written in C by
- rb_gc_call_finalizer_at_exit, ruby_set_current_source may use
- collected ruby_current_node and mark_source_filename may corrupt
- memory.
-
-Tue Jan 10 13:30:34 2006 akira yamada <akira@ruby-lang.org>
-
- * ext/syck/rubyext.c (syck_resolver_transfer): should be able to load
- !ruby/object:Bignum syntax 1.8.3 dumped. [ruby-core:6159]
-
-Tue Jan 10 12:47:41 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/yaml/rubytypes.rb (Fixnum): Bignum could not be loaded in
- ruby 1.8.3/1.8.4. [ruby-core:6115]
-
- * lib/yaml/rubytypes.rb (Numeric): Subclass of Numeric could not
- be dumped properly. [ruby-core:7047]
-
-Tue Jan 10 12:00:48 2006 Aaron Schrab <aaron @nospam@ schrab.com>
-
- * lib/yaml/rubytypes.rb (Symbol#yaml_new): YAML loading of quoted
- Symbols broken. [ruby-Bugs:2535]
-
-Mon Jan 9 19:54:35 2006 arton <artonx@yahoo.co.jp>
-
- * ext/zlib/extconf.rb: zlib compiled DLL version 1.2.3 distributed by
- http://www.zlib.net/ has zdll.lib. [ruby-dev:28209]
-
-Mon Jan 9 14:17:12 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/Makefile.sub (OPTFLAGS): I have experienced trouble on y- flag,
- (VisualC++6) so use -O2b2xg- if $(MSC_VER) < 1400. [ruby-core:7040]
-
-Mon Jan 9 14:17:12 2006 Kero van Gelder <rubyforge @nospam@ kero.tmfweb.nl>
-
- * lib/webrick/httpservlet/filehandler.rb: fixed typo. [ruby-core:7075]
-
-Sat Jan 7 15:40:07 2006 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (singleton): get rid of segfault on syntax error.
- fixed: [ruby-core:07070]
-
-Fri Jan 6 10:16:20 2006 Steven Lumos <steven@lumos.us>
-
- * io.c (READ_DATA_PENDING): defined for 64bit Solaris on SPARC.
- [ruby-core:7057]
- (READ_DATA_PENDING_COUNT): ditto.
- (READ_DATA_PENDING_PTR): ditto.
-
-Sun Jan 1 17:07:59 2006 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (rb_w32_seekdir): should not segfault even if passed
- the location which rb_w32_telldir didn't return. [ruby-core:7035]
- (I think HEAD implementation is better. but binary compatibility)
-
- * test/ruby/test_dir.rb: added.
-
-Sat Dec 31 22:57:00 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_save_context): should not recycle scope object used
- in a thread. fixed: [ruby-dev:28177]
-
-Fri Dec 30 18:22:42 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (garbage_collect): mark objects refered from aborting threads.
- [ruby-dev:28190]
-
- * win32/Makefile.sub: VC++8 support.
-
-Fri Dec 30 14:24:53 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * dir.c (glob_helper): do not use TRUE for djgpp.
-
-Fri Dec 30 04:54:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * file.c (eaccess): workaround for VC++8 runtime.
-
- * win32/win32.c (ioinfo): VC++8 support.
-
-Thu Dec 29 23:59:37 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_gc_mark_threads): leave unmarked threads which won't wake
- up alone, and mark threads in the loading table. [ruby-dev:28154]
-
- * eval.c (rb_gc_abort_threads), gc.c (gc_sweep): kill unmarked
- threads. [ruby-dev:28172]
-
-Thu Dec 29 17:02:07 2005 Tanaka Akira <akr@m17n.org>
-
- * test/ruby/envutil.rb (EnvUtil.rubybin): search "ruby" instead of
- "miniruby". [ruby-dev:28140]
-
-Tue Dec 27 16:59:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * test/drb/drbtest.rb (DRbService::self.ext_service): increase
- timeout limit. a patch from Kazuhiro NISHIYAMA
- <zn at mbf.nifty.com>. [ruby-dev:28132]
-
-Tue Dec 27 08:29:18 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket#post_connection_chech):
- treat wildcard character in commonName. [ruby-dev:28121]
-
-Mon Dec 26 22:32:47 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval), gc.c (gc_mark_children), node.h (NEW_ALIAS,
- NEW_VALIAS), parse.y (fitem): allow dynamic symbols to
- NODE_UNDEF and NODE_ALIAS.
- backported from trunk. fixed: [ruby-dev:28105]
-
-Mon Dec 26 08:50:36 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (ev_const_get): fixed a bug in constant reference during
- instance_eval. [yarv-dev:707]
-
- * eval.c (ev_const_defined): ditto.
-
- * lib/yaml.rb (YAML::add_domain_type): typo fixed. a patch from
- Joel VanderWerf <vjoel at path.berkeley.edu>.
- [ruby-talk:165285] [ruby-core:6995]
-
-Sat Dec 24 18:58:14 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * stable version 1.8.4 released.
-
-Fri Dec 23 10:30:23 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/digest/sha2/sha2.c (ULL): support AIX C. a patch from
- Kailden <kailden at gmail.com>. [ruby-core:06984]
-
-Wed Dec 21 16:53:06 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * file.c (w32_io_info): should return handle because FileIndex is
- valid only while file is open. [ruby-dev:28088]
-
-Wed Dec 21 14:53:26 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (test_kernel_open): use File.identical?.
- [ruby-talk:171804]
-
-Tue Dec 20 22:41:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (eval_under_i): evaluate source in caller's frame.
- [ruby-dev:28076]
-
- * eval.c (rb_call_super): use original method name on exception.
- [ruby-dev:28078]
-
-Tue Dec 20 13:11:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/syck/rubyext.c: fixed GC problem (backported HEAD 1.55 - 1.62)
- [ruby-dev:27839]
-
- * ext/syck/syck.h (S_FREE): small hack. no need to check if pointer is
- NULL or not before S_FREE.
-
- * st.c: uses malloc instead of xmalloc to avoid GC. syck uses st_insert
- in gram.c to insert node from rb_syck_bad_anchor_handler into
- SyckParser's hash table. if GC occurs in st_insert, it's not under
- SyckParser's mark system yet. so RString can be released wrongly.
- [ruby-dev:28057]
-
-Tue Dec 20 12:53:23 2005 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/rubyext.c (syck_emitter_reset): to ensure compatibility
- with previous Ruby versions, documents are no longer headless.
-
-Tue Dec 20 01:46:48 2005 Tanaka Akira <akr@m17n.org>
-
- * io.c (rb_f_backquote): fix a GC problem on
- IA64 with gcc 4.0.3 20051216 (prerelease) -O3.
-
-Mon Dec 19 23:32:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (rb_symname_p): fixed wrong validation. [ruby-dev:28047]
-
-Sat Dec 17 03:57:01 2005 Tanaka Akira <akr@m17n.org>
-
- * bignum.c (rb_big_rshift): fix a GC problem on
- IA64 with gcc 4.0.3 20051216 (prerelease).
-
-Sat Dec 17 03:30:23 2005 Tanaka Akira <akr@m17n.org>
-
- * eval.c (bmcall): fix a GC problem by tail call on
- IA64 with gcc 4.0.3 20051216 (prerelease).
-
-Fri Dec 16 00:54:06 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * signal.c (Init_signal): revert C++ style comment.
- [ruby-dev:28041]
-
-Thu Dec 15 12:35:14 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/tmpdir.rb: merged RDoc patch from Eric Hodel <drbrain at
- segment7.net>. [ruby-core:06894]
-
-Thu Dec 15 01:33:31 2005 Tanaka Akira <akr@m17n.org>
-
- * ext/zlib/zlib.c (zstream_run): fix a GC problem by tail call on
- x86_64 with gcc 4.0.3 20051111 (prerelease) (Debian 4.0.2-4)
-
-Wed Dec 14 12:11:46 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * test/gdbm/test_gdbm.rb: specify pid for the argument of
- Process.wait. workaround for Cygwin.
-
-Wed Dec 14 12:01:26 2005 Tanaka Akira <akr@m17n.org>
-
- * marshal.c (r_object0): fix a GC problem for reading a bignum on
- IA64 with gcc 3.3.5 (Debian 1:3.3.5-13).
-
-Tue Dec 13 12:23:47 2005 Tanaka Akira <akr@m17n.org>
-
- * re.c (rb_reg_regcomp): fix a GC problem on x86_64 with
- gcc 3.3.5 (Debian 1:3.3.5-13).
-
-Tue Dec 13 01:44:16 2005 Tanaka Akira <akr@m17n.org>
-
- * array.c (rb_ary_diff): fix a GC problem on IA64 with
- gcc 3.3.5 (Debian 1:3.3.5-13).
- When rb_ary_push is called, there was no register which contains
- `hash' but `&RHASH(hash)->tbl' instead.
-
-Tue Dec 13 00:08:09 2005 Tanaka Akira <akr@m17n.org>
-
- * sprintf.c (rb_str_format): fix a GC problem.
- [ruby-dev:28001]
-
-Mon Dec 12 15:54:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * test/openssl/test_ssl.rb (test_parallel): call GC.start to close
- unused files. [ruby-dev:27981]
-
-Mon Dec 12 00:33:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/digest/digest.c (rb_digest_base_s_digest): add volatile to
- protect temporary context object. [ruby-dev:27979]
-
- * ext/iconv/iconv.c (Init_iconv): rb_gc_register_address() should
- be called before actual variable initialization.
- [ruby-dev:27986]
-
-Fri Dec 9 23:31:02 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rexml/encoding.rb (encoding=): give priority to particular
- conversion to iconv. [ruby-core:06520]
-
-Thu Dec 8 02:07:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (umethod_bind): adjust invoking class for module method.
- [ruby-dev:27964]
-
-Thu Dec 8 00:40:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (call_trace_func): klass parameter should be a
- class/module that defines calling method. [ruby-talk:169307]
-
-Wed Dec 7 17:10:27 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * sprintf.c (rb_f_sprintf): [ruby-dev:27967]
-
-Wed Dec 7 15:31:35 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_str_format): integer overflow check added.
-
- * sprintf.c (GETASTER): ditto.
-
-Wed Dec 7 01:02:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/README.macosx-aqua: [new document] tips to avoid the known
- bug on platform specific dialogs of Tcl/Tk Aqua on MacOS X.
-
- * ext/tk/tcltklib.c: fix bug on switching threads and waiting on the
- deleted interpreter on vwait and tkwait command.
-
- * ext/tk/lib/multi-tk.rb: kill the meaningless loop for the deleted Tk
- interpreter.
-
- * ext/tk/sample/demos-jp/image3.rb: [bug fix] wrong argument.
-
- * ext/tk/sample/demos-en/image3.rb: ditto.
-
- * ext/tk/sample/demos-jp/menu.rb: fix message for MacOS X.
-
- * ext/tk/sample/demos-jp/menu8x.rb: ditto.
-
- * ext/tk/sample/demos-en/menu.rb: ditto.
-
-Tue Dec 6 16:37:57 2005 Yuya Nishida <yuya@j96.org>
-
- * eval.c (exec_under): avoid accessing ruby_frame->prev.
- [ruby-dev:27948]
-
-Thu Dec 1 00:50:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_funcall2): allow to call protected methods.
- fixed: [ruby-dev:27890]
-
-Wed Nov 30 23:52:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (NEWHEAP, ADD2HEAP): set count after pointer was set.
- fixed: [ruby-dev:27896]
-
-Wed Nov 30 13:43:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-expr-beg): support $! at the end of
- expression. [ruby-dev:27868]
-
-Mon Nov 28 18:55:43 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/socket.c (init_inetsock_internal): remove setting
- SO_REUSEADDR option on server socket on Cygwin.
- fixed: [ruby-core:6765] ([ ruby-Bugs-2872 ])
-
-Mon Nov 28 13:08:54 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (rb_w32_strerror): remove all CR and LF. (avoid broken
- error message on bccwin32 + winsock)
-
-Mon Nov 28 09:21:49 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/mkmf.rb (create_makefile): should not change sodir with
- dir.gsub!. (bccwin32 failed to install third party exntesions)
- [ruby-dev:27834]
-
-Sun Nov 27 00:56:13 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/wsdl/xmlSchema/complexContent.rb: missing
- ComplexContent#elementformdefault method.
-
-Sat Nov 26 19:57:45 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * dln.c (conv_to_posix_path): should initialize posix.
-
-Thu Nov 24 21:05:58 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * configure.in (AC_CHECK_FUNCS): need to check link().
- fixed: [ruby-dev:27814]
-
-Thu Nov 24 01:22:25 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * file.c (w32_io_info): CreateFile failed on Win9x if file was already
- opened. (FILE_SHARE_READ was needed, but actually I don't understand
- the flags of CreateFile well...)
-
-Wed Nov 23 20:59:01 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add Tk.pkgconfig_list and Tk.pkgconfig_get
- [Tk8.5 feature].
-
- * ext/tk/lib/tk/text.rb: supports new indices modifires on a Text
- widget [Tk8.5 feature].
-
- * ext/tk/lib/tk/virtevent.rb: add TkNamedVirtualEvent.
-
- * ext/tk/lib/tk/autoload.rb: ditto.
-
- * ext/tk/lib/tk/event.rb: add :data key for virtual events [Tk8.5
- feature].
-
-Wed Nov 23 18:55:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * file.c (w32_io_info): should not call GetFileInformationByHandle
- for pipe.
-
- * file.c (w32_io_info): checks return value from rb_w32_get_osfhandle.
-
- * file.c (w32_io_info): now can identify directory on WinNT.
-
-Wed Nov 23 03:40:49 2005 Guy Decoux <ts@moulon.inra.fr>
-
- * re.c (KR_REHASH): should cast to unsigned for 64bit CPU.
- [ruby-core:06721]
-
-Wed Nov 23 11:01:33 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * intern.h, file.c: failed to compile on windows.
-
-Wed Nov 23 07:26:44 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: check for X509V3_EXT_nconf_nid.
-
- * ext/openssl/ossl_x509ext.c (MakeX509ExtFactory): should use
- OPENSSL_malloc to allocate X509V3_CTX.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext): use
- X509V3_EXT_nconf_nid to avoid SEGV (and to build extensions which
- values are placed in separate section).
-
- * test/openssl/test_x509ext.rb: new file.
-
-Wed Nov 23 01:22:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (test_identical): test if two files are identical.
-
- * file.c (rb_f_test): support DOSISH systems where st_ino is not
- reliable. fixed: [ruby-core:06672]
-
- * win32.h, win32.c (rb_w32_osid): check the running platform.
-
-Tue Nov 22 23:52:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb: match incomplete (in current enconding) multibyte
- string. http://inamode6.tokuhirom.dnsalias.org/show/1551
-
-Tue Nov 22 18:36:11 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (winnt_stat): set mapped errno instead of ENOENT.
-
-Tue Nov 22 14:46:57 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * file.c (rb_file_s_basename): skip slashes just after UNC top slashes.
-
- * test/ruby/test_path.rb (test_dirname, test_basename): follow new
- spec. and add new tests.
-
-Tue Nov 22 13:18:32 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (rb_w32_stat): Dir.chdir('//server/shared');
- p Dir.glob('*') should work on WinNT. (implemented our own
- stat(2) on WinNT) [ruby-list:41552] [ruby-dev:27711]
-
-Tue Nov 22 02:31:53 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tkextlib/tile.rb: bug fix (Tk::Tile::USE_TTK_NAMESPACE
- is not defined).
-
-Tue Nov 22 01:45:21 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_basename): DOSISH_UNC is defined on cygwin but
- DOSISH is not. fixed: [ruby-dev:27797]
-
-Mon Nov 21 22:50:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_path_skip_prefix, rb_file_s_basename): UNC without path
- should not be splitted. fixed: [ruby-dev:27776] [ruby-dev:27786]
-
- * parse.y (dsym): prohibit empty symbol literal by interpolation.
- fixed: [ruby-talk:166529]
-
-Mon Nov 21 16:03:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/setup.mk: findstr doesn't exist on win9x.
- fixed: [ruby-dev:27756]
-
-Sun Nov 20 22:34:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (rb_symname_p): [ not followed by ] is not valid symbol.
- fixed: [ruby-talk:166520]
-
-Sat Nov 19 19:57:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/fileutils.rb (FileUtils::ln): ln documentation fix.
- [ruby-core:06661]
-
-Sat Nov 19 07:34:32 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/font.rb: remove dependency on Ruby's version (1.8
- or 1.9).
-
- * ext/tk/lib/tkextlib/ICONS/icons.rb: ditto.
-
- * ext/tk/sample/tkextlib/treectrl/demo.rb: ditto.
-
-Fri Nov 18 17:57:08 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * file.c (rb_file_s_dirname): should use skipprefix for UNC path.
- pointed out by nobu ([ruby-dev:27744]). fixed: [ruby-core:5076]
-
-Fri Nov 18 17:35:09 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: add restriction to access the entried
- command table and manipulate other IPs (for reason of security).
- Now, a IP object can be controlled by only its master IP or the
- default IP.
-
- * ext/tk/lib/remote-tk.rb: add restriction to manipulate.
-
- * ext/tk/tcltklib.c (ip_is_slave_of_p): add TclTkIp#slave_of?(ip)
- to check manipulability.
-
- * ext/tk/lib/tk.rb: bug fix on handling of Tcl's namespaces.
-
- * ext/tk/lib/tk/namespace.rb: ditto.
-
-Fri Nov 18 17:26:06 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * file.c (rb_file_s_dirname): added checks for some patterns with drive
- letter. fixed: [ruby-dev:27738]
-
- * test/ruby/test_path.rb (test_dirname): added tests for above
- patterns.
-
-Fri Nov 18 12:18:02 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.h (S_IFIFO): r,w = IO.pipe; r.stat.pipe? now
- returns true on VisualC++6.
-
-Wed Nov 16 23:24:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (static-ruby): overridable.
-
- * ext/extmk.rb (parse_args): force to link extensions statically only
- if static is given for extstatic.
-
- * ext/extmk.rb (RUBY, RUBYW): overridable.
-
-Tue Nov 15 23:46:35 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/find.rb (Find::find): should not ignore symbolic links to
- non-existing files. [ruby-talk:165866]
-
-Tue Nov 15 16:23:26 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * array.c (rb_ary_fill): previous commit disabled this usage:
-
- a = [0,1,2,3,4,5,6,7,8,9]
- a.fill {|i| a[i] * 10} #=> [nil, nil, ...., nil]
-
- previous commit has the advantage of early garbage collection, but
- potensially this would break some script. so I reverted behavior.
-
-Tue Nov 15 16:04:10 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * array.c (rb_ary_fill): tail elements were vanished when the middle
- part of array was filled. (ie: [0,1,2,3,4].fill(-1,2,1) => [0,1,-1])
-
- * test/ruby/test_array.rb (test_fill): added.
-
-Tue Nov 15 14:39:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_fill): should adjust array length correctly when
- an array is expanded in the fill process. [ruby-core:06625]
-
-Mon Nov 14 23:49:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_readlink): ERANGE will occur only on GPFS.
- [ruby-dev:27699]
-
-Mon Nov 14 17:36:22 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_first): RDoc update from Daniel Berger
- <djberg96@yahoo.com>. [ruby-core:06577].
-
-Fri Nov 11 10:31:44 2005 Zach Dennis <zdennis@mktec.com>
-
- * ext/socket/socket.c: Socket Documentation. [ruby-core:6552]
-
-Fri Nov 11 08:20:56 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (OUTFLAG): keep trailing spaces. [ruby-dev:27666]
-
- * mkconfig.rb: substitution refereces added.
-
-Fri Nov 11 07:44:18 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * configure.in: undef HAVE_LINK on BeOS. (link(2) always returns
- EINVAL, and this causes error in test/fileutils.)
-
- * file.c: overwride chown(2) and fchown(2) on BeOS. (these functions
- should not change user/group id if -1 is passed as corresponding
- argument, and this causes error in test/fileutils too)
- [ruby-dev:27672]
-
- * file.c (rb_file_s_link): checks HAVE_LINK.
-
-Tue Nov 8 15:32:27 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/drb/ssl.rb (DRb::SSLConfig#accept): fixed typo.
- [ruby-dev:27560] [ruby-core:4627]
-
-Mon Nov 7 13:43:51 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/stubs.c (_nativethread_consistency_check): use simpler
- (low cost) way to check whether the Tcl interpreter was compiled
- with threads enabled of not.
-
- * ext/tk/tcltklib.c: reduce warnings.
-
- * ext/tk/tkutil/tkutil.c: ditto.
-
-Mon Nov 7 00:06:58 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/yaml.rb: removed :nodoc: to generate Kernel doc. [ruby-core:6324]
-
-Sun Nov 6 23:39:13 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (Iconv::BrokenLibrary): exception when detected a
- bug of underlying library.
-
-Sun Nov 6 21:46:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tk/stubs.c (ruby_tcl_create_ip_and_stubs_init): should touch
- interpreter after initialization is done. [ruby-dev:27638]
-
-Sun Nov 6 20:13:27 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_readlink): readlink(2) on AIX fails with ERANGE if
- buffer size is less than required. fixed: [ruby-dev:27634]
-
-Wed Nov 2 20:25:28 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/extconf.rb: ext/tk/extconf.rb: change the check parameter
- for Win32.
-
-Wed Nov 2 20:14:53 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib: merge into ext/tk and remove.
-
-Wed Nov 2 19:03:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_rbUpdateObjCmd,
- ip_rb_threadUpdateObjCmd): passed improper flags to DoOneEvent().
-
- * ext/tk/tkutil.c: use rb_obj_respond_to() instead of rb_respond_to().
-
-Tue Nov 1 14:20:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call_super): should call method_missing if super is
- called from Kernel method.
-
- * eval.c (exec_under): frame during eval should preserve external
- information.
-
-Tue Nov 1 10:50:17 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: should check ERR_peek_last_error().
- [ruby-dev:27597]
-
- * ext/openssl/ossl.c (ossl_raise): ditto.
-
-Mon Oct 31 17:34:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: use proper option for Sun linker. A patch from
- Shinya Kuwamura <kuwa at labs.fujitsu.com>. [ruby-dev:27603]
-
-Mon Oct 31 11:27:22 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb (test_s_open_error):
- skip on Win32/DOS platforms.
-
-Mon Oct 31 05:49:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_update): input data must
- not be empty. [ruby-talk:161220]
-
- * test/openssl/test_cipher.rb: add test for Cipher#update("").
-
-Mon Oct 31 05:37:20 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpservlet/cgihandler.rb
- (WEBrick::HTTPServlet::CGIHandler#do_GET): the value of Set-Cookie:
- header field should be splited into each cookie. [ruby-Bugs:2199]
-
- * lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookie): new method
- to parse the value of Set-Cookie: header field.
-
- * test/webrick/test_cookie.rb, test/webrick/test_cgi.rb,
- test/webrick/webrick.cgi: add some test for cookie.
-
-Mon Oct 31 03:19:36 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/readline/readline.c (readline_readline): type check.
- [ruby-core:6089]
-
- * numeric.c (fix_rshift): RDoc fix. [ruby-core:6351]
-
- * util.h (strtod): add #undef for platforms defines strtod()
- macro. [ruby-dev:27563]
-
-Mon Oct 31 02:35:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * test/ruby/test_float.rb (test_precision): test by assert_in_delta.
- [ruby-dev:27575]
-
-Sat Oct 29 01:58:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/etc/etc.c: document update from mathew <meta@pobox.com>.
- [ruby-core:06473]
-
- * ext/fcntl/fcntl.c: ditto.
-
-Thu Oct 27 16:45:31 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (scan_once): wrong condition to use mbclen2().
- [ruby-dev:27535]
-
-Wed Oct 26 09:27:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/syck/implicit.c (syck_type_id_to_uri): should return
- newly allocated memory. otherwise, type_id will be freed
- twice. [ruby-dev:27384] [ruby-core:6385]
-
-Wed Oct 26 09:04:51 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ruby.h (Qfalse, Qtrue, Qnil, Qundef): make sure these immediate
- values have VALUE type. there is an environment where sizeof(VALUE)
- != sizeof(int) like IA64. if 32bit integer (Qtrue) is passed to ANYARGS
- and received by 64bit integer (VALUE), upper bits may have garbage value.
- [ruby-dev:27513]
-
-Wed Oct 26 01:58:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_EXTERN): macro to export symbols in shared
- library. [ruby-core:05528]
-
- * defines.h, {bcc32,win32,wince}/Makefile.sub (RUBY_EXTERN): moved to
- configuration pass.
-
- * ext/extmk.rb (extmake): RUBY_EXTERN for static linked extensions.
-
-Tue Oct 25 15:32:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/rational.rb: applied documentation patch from Gavin Sinclair
- <gsinclair@gmail.com>. [ruby-core:06364]
-
- * lib/irb.rb (IRB::Irb::eval_input): handle prompts with newlines
- in irb auto-indentation mode. [ruby-core:06358]
-
-Tue Oct 25 02:12:08 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::LABEL_LIST_RE):
- reduce redundant backtrack. [ruby-talk:161771]
-
-Tue Oct 25 00:27:35 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/*: RDoc documentation from Eric Hodel
- <drbrain@segment7.net> added.
-
-Mon Oct 24 21:14:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in, io.c: use sys/syscall.h if syscall.h is not available.
- [ruby-core:06247]
-
-Mon Oct 24 20:49:45 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/Win32API/lib/win32/resolv.rb (get_info): support multiple DNS.
- fixed: [ruby-list:40058], [ruby-dev:27479]
-
-Mon Oct 24 07:57:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/tk/lib/tk/canvas.rb (TkCanvasItemConfig::__item_val2ruby_optkeys):
- typo fixed. [ruby-talk:162187]
-
- * ext/tk/lib/tk/menu.rb (TkMenuEntryConfig::__item_val2ruby_optkeys):
- ditto. [ruby-core:06359]
-
-Sun Oct 23 21:50:15 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/enumerator/enumerator.c: applied documentation patch from
- James Edward Gray II <james@grayproductions.net>.
- [ruby-core:06348]
-
-Sun Oct 23 07:11:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/extconf.rb: improve messages [ruby-core:06325].
-
- * ext/tk/lib/tk.rb, ext/tk/lib/tk/canvas.rb, ext/tk/lib/tk/entry.rb,
- ext/tk/lib/tk/frame.rb, ext/tk/lib/tk/image.rb,
- ext/tk/lib/tk/itemconfig.rb, ext/tk/lib/tk/labelframe.rb,
- ext/tk/lib/tk/listbox.rb, ext/tk/lib/tk/menu.rb,
- ext/tk/lib/tk/radiobutton.rb, ext/tk/lib/tk/scale.rb,
- ext/tk/lib/tk/spinbox.rb, ext/tk/lib/tk/text.rb,
- ext/tk/lib/tk/toplevel.rb: improve conversion of option values.
-
- * ext/tk/lib/tkextlib/*: ditto.
-
- * ext/tk/lib/tkextlib/*: update to support ActiveTcl8.4.11.2.
-
- * ext/tk/lib/tkextlib/trofs/*: support Trofs 0.4.3.
-
- * ext/tk/lib/tkextlib/tile/*: support Tile 0.7.2.
-
- * ext/tk/lib/tkextlib/vu/*: support vu 2.3.0.
-
- * ext/tk/lib/tkextlib/tcllib/*: support Tcllib 1.8 (Tklib 0.3).
-
-Sat Oct 22 23:54:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb, lib/mkmf.rb (with_config): support --with-extension
- options. [ruby-dev:27449]
-
-Sat Oct 22 13:26:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (sym_inspect), parse.y (parser_yylex, rb_symname_p): check
- if valid as a symbol name more strictly. [ruby-dev:27478]
-
- * test/ruby/test_symbol.rb: tests for [ruby-core:03573].
-
- * time.c (rb_strftime): removed meaningless volatile modifiers, and
- concatenate successive nul characters at once. [ruby-dev:27472]
-
-Fri Oct 21 19:21:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * rubysig.h (CHECK_INTS): fixed typo. (I believe bit-or is improper)
-
-Fri Oct 21 17:49:32 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bin/erb (ERB::Main::run): typo fixed. [ruby-core:06337]
-
-Fri Oct 21 15:27:17 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bignum.c (bignew_1): convertion from `int' to `char' discards
- upper bits, (ie. (char)0xff00 -> 0) so it's better to test if
- nonzero and set 0 or 1 instead of simply casting ... as a flag usage.
- (but I believe this won't cause actual bug in current implementation)
- [ruby-dev:27055]
-
- * time.c: should use LONG_LONG instead of `long long'.
-
-Thu Oct 20 09:37:15 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/mkmf.rb (create_makefile): Borland make seems not to allow
- empty dependency list. If this change is not good, please correct
- it.
-
-Thu Oct 20 07:55:09 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): get rid of a restriction
- of Borland make. fixed: [ruby-dev:27460]
-
-Thu Oct 20 00:13:18 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * rubysig.h (CHECK_INTS): fix typo.
-
-Wed Oct 19 23:58:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): do not create unnecessary empty
- directories. fixed: [ruby-dev:27451]
-
-Wed Oct 19 19:26:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (rb_gc_mark_parser): get rid of segfault with old yacc.
- fixed: [ruby-dev:27439]
-
-Wed Oct 19 08:28:32 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_join): elements may contain null pointer strings.
- report and fixed by Lloyd Zusman (hippoman): [ruby-core:06326]
-
-Wed Oct 19 02:34:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c, gc.c, time.c: made internal symbols static. [ruby-dev:27435]
-
-Wed Oct 19 01:27:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * regex.c (re_compile_pattern): numeric literal inside character class
- disabled succeeding backtrack. fixed: [ruby-list:41328]
-
-Mon Oct 17 21:18:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_heap): byacc never free parser stack.
- fixed: [ruby-dev:27428]
-
-Mon Oct 17 16:04:47 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * file.c (chmod_internal, lchmod_internal): fixed type of 2nd argument.
-
-Sun Oct 16 22:16:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: omit non-existing directories.
-
-Sun Oct 16 14:30:05 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/rinda.rb (Rinda::Tuple#initialize): check remote hash
- tuple. fixed: [ruby-list:41227]
-
- * test/rinda/test_rinda.rb: test it.
-
-Sun Oct 16 03:38:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * rubysig.h (CHECK_INTS): prevent signal handler to run during
- critical section. [ruby-core:04039]
-
- * eval.c (load_wait): need not to call rb_thread_schedule()
- explicitly. [ruby-core:04039]
-
- * eval.c (rb_thread_schedule): clear rb_thread_critical.
- [ruby-core:04039]
-
-Sat Oct 15 19:56:38 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * bin/erb: typo fixed, again. thanks, Doug Kearns.
-
-Fri Oct 14 22:08:26 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (ioctl): should set errno.
-
-Fri Oct 14 16:57:32 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/config.rb (Config::FileHandler): :UserDir should be nil.
- It is harmful to permit the access to ~/public_html by default.
- suggested by Hiroyuki Iwatsuki.
-
-Thu Oct 13 23:29:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (HEAPCNT): bison allocates indivisible size.
- fixed: [ruby-core:06261]
-
- * io.c, pack.c, ext/syck/rubyext.c, ext/syck/syck.h, missing/isinf.c:
- get rid of warnings. fixed: [ruby-core:06247]
-
-Wed Oct 12 12:52:57 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.c (Init_openssl): should call
- OpenSSL_add_ssl_algorithms().
-
-Wed Oct 12 11:08:54 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * file.c (rb_f_test): typo in RDoc comments.
-
-Tue Oct 11 21:41:58 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_obj_respond_to): check if obj responds to the given
- method with the given visibility. [ruby-dev:27408]
-
- * eval.c (rb_respond_to): conform to Object#respond_to?. [ruby-dev:27411]
-
-Tue Oct 11 00:01:21 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * st.c (st_free_table): do not call free() but xfree().
- [ruby-core:06205]
-
-Sat Oct 8 20:04:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (Init_Binding): add Binding#dup method. [yarv-dev:666]
-
- * parse.y (rb_parser_malloc, rb_parser_free): manage parser stack on
- heap. [ruby-list:41199]
-
- * ext/iconv/charset_alias.rb: parse config.charset_alias file directly.
-
-Fri Oct 7 09:54:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::Cookie::parse): Cookies from Nokia devices may
- not be parsed correctly. A patch from August Z. Flatby
- (augustzf) in [ruby-Patches-2595]. [ruby-core:06183]
-
-Thu Oct 6 20:12:16 2005 Minero Aoki <aamine@loveruby.net>
-
- * ext/strscan/strscan.c (strscan_free): remove useless code.
- [ruby-dev:26368] [ruby-dev:27389]
- (backported from trunk, rev 1.22)
-
-Wed Oct 5 04:42:38 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/xmlrpc/server.rb (XMLRPC::Server#initialize): should mount the
- servlet on "/".
-
-Wed Oct 5 03:59:09 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/xmlrpc/server.rb (XMLRPC::Server#serve): delete wrong call
- of "join".
-
-Mon Oct 3 00:04:00 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * pack.c (EXTEND16): [ruby-dev:27383]
-
-Thu Sep 29 10:26:18 2005 Tanaka Akira <akr@m17n.org>
-
- * ext/dl/dl.c (rb_io_to_ptr): abolish sizeof(FILE).
- [ruby-dev:27317]
-
-Thu Sep 29 07:22:05 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * evalc. (rb_f_send): underscores need to be escaped.
- fixed by Doug Kearns. [ruby-core:06053]
-
-Thu Sep 29 00:57:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (ev_const_get), variable.c (rb_const_get_0): retry only when
- autoload succeeded.
-
- * variable.c (rb_autoload_load): now return true if autoload
- succeeded. fixed: [ruby-dev:27331]
-
-Wed Sep 28 23:42:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (apply2files): add prototype.
-
- * file.c (rb_stat_inspect): constified.
-
- * class.c (rb_mod_init_copy, rb_class_init_copy), file.c (rb_stat_init_copy),
- numeric.c (num_init_copy), object.c (rb_obj_init_copy, Init_Object),
- re.c (match_init_copy, rb_reg_init_copy), time.c (time_init_copy):
- undocumented.
-
-Wed Sep 28 23:09:23 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/delegate.rb: document update from James Edward Gray II
- <james@grayproductions.net>. [ruby-core:06027]
-
-Wed Sep 28 15:14:19 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (WEBrick::CGI#start): req.query_string should
- refer the value of QUERY_STRING. [ruby-list:41186]
-
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#query_string=):
- add new method.
-
-Wed Sep 28 10:45:44 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: cannot compile with Tcl/Tk8.0.x
- [ruby-dev:27335].
-
-Wed Sep 28 08:12:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (read_buffered_data): check if reached EOF. fixed: [ruby-dev:27334]
-
-Wed Sep 28 07:56:52 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/yaml/basenode.rb (YAML::BaseNode::match_segment): fix typo.
- [ruby-dev:27237], [ruby-core:05854]
-
- * lib/yaml/tag.rb (Module#yaml_as): suppress warnings.
-
- * lib/yaml/types.rb (YAML::PrivateType, YAML::DomainType): ditto.
-
-Wed Sep 28 03:23:35 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * rubysig.h: fixed build problem with --enable-pthread on platforms
- which don't have setitimer().
-
-Mon Sep 26 22:32:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (set_trace_func): add rb_secure(4) to prevent adding
- tracing function.
-
-Sun Sep 25 12:05:10 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * bin/erb: typo fixed.
-
-Sun Sep 25 01:46:43 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-calculate-indent): arrange deep-indent
- closing parenthesis at same column as the opening.
-
-Sun Sep 25 00:42:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-expr-beg): deal with heredoc separately.
- fixed: [ruby-list:41168]
-
- * misc/ruby-mode.el (ruby-calculate-indent): not to deepen indent
- level for continuous line inside parentheses.
- http://nabeken.tdiary.net/20050915.html#p02
-
-Sun Sep 25 00:18:11 2005 Tanaka Akira <akr@m17n.org>
-
- * eval.c (unknown_node): show more information. [ruby-dev:26196]
-
-Sat Sep 24 08:56:01 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (cd): no longer accept :noop option, related
- code is useless (backported from trunk, rev 1.67).
- [ruby-core:05858] [ruby-Bugs:2494]
-
-Sat Sep 24 08:38:07 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb: fix visibility of FileUtils::NoWrite, Verbose,
- DryRun (backported from trunk, rev 1.66). [ruby-core:05954]
-
- * test/fileutils/test_nowrite.rb: test it.
-
- * test/fileutils/test_dryrun.rb: new file.
-
- * test/fileutils/test_verbose.rb: new file.
-
-Sat Sep 24 02:40:20 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/delegate.rb: document update from James Edward Gray II
- <james@grayproductions.net>. [ruby-core:05942]
-
-Thu Sep 22 23:36:24 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (find_executable0): default path if environment is not
- set. [ruby-dev:27281]
-
-Thu Sep 22 16:33:12 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/readline/test_readline.rb (TestReadline::replace_stdio):
- merged the patch of [ruby-dev:25232] instead of [ruby-dev:25223].
-
-Wed Sep 21 23:30:44 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (configuration): generalized nmake dependent code.
-
-Wed Sep 21 09:07:55 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * stable version 1.8.3 released.
-
-Wed Sep 21 08:52:25 2005 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/token.c: correctly compute identation of a block
- scalar's parent node. [ruby-talk:150620]
-
-Wed Sep 21 08:20:24 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * README.EXT, README.EXT.ja: add new features.
-
-Wed Sep 21 07:43:58 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (default_argv, Arguable#options): defaults strings
- to be parsed to Arguable instance.
-
-Wed Sep 21 02:44:09 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * file.c (path_check_0): disallow sticky world writable directory
- in PATH (and $LOAD_PATH). [ruby-dev:27226]
-
- * file.c (fpath_check): typo fixed.
-
-Tue Sep 20 22:29:49 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/wsdl/simpletype/rpc/test_rpc.rb, test/wsdl/ref/test_ref.rb,
- test/wsdl/any/test_any.rb test/soap/wsdlDriver/test_calc.rb:
- suppress deliberate warnings with $VERBOSE = nil.
-
-Tue Sep 20 21:26:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/wait/lib/nonblock.rb: disable on platforms non-blocking flag
- is not available. fixed: [ruby-dev:27187]
-
-Tue Sep 20 18:23:04 2005 Tanaka Akira <akr@m17n.org>
-
- * eval.c (thread_mark): mark th->last_status. [ruby-dev:27179]
-
-Tue Sep 20 18:20:33 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/yaml.rb: require 'yaml/constants'. [ruby-core:5776]
-
-Tue Sep 20 17:48:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): add charset
- information to content-type header.[ruby-core:5127]
-
- * lib/xmlrpc/server.rb (CGIServer::serve): ditto.
-
- * lib/xmlrpc/server.rb (ModRubyServer::serve): ditto.
-
- * lib/xmlrpc/server.rb (WEBrickServlet::service): ditto.
-
-Tue Sep 20 17:34:46 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * test/webrick/test_cgi.rb: set ENV["PATH"] to CGIEnvPath on
- windows. bcc32's runtime is not installed into system directory,
- so it cannot be found without this setting. [ruby-dev:27166]
-
-Tue Sep 20 17:10:38 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * test/dbm/test_dbm.rb (TestDBM::test_s_open_error): remove
- test_s_open_error test to detect duplicate open.
- [ruby-dev:27202]
-
-Tue Sep 20 17:08:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * io.c: PIPE_BUF is not defined on BeOS. use _POSIX_PIPE_BUF instead.
- [ruby-dev:27185]
-
-Tue Sep 20 16:53:53 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * test/readline/test_readline.rb (TestReadline::replace_stdio):
- BSD seek support from [ruby-dev:25223]. fixed: [ruby-dev:27150]
-
-Tue Sep 20 15:39:40 2005 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/emitter.c (syck_scan_scalar): prevent indicators from
- appearing alone or at the end of plain scalars. [ruby-core:5826]
-
- * ext/syck/emitter.c (syck_emit_scalar): treat typed scalar nodes
- as complex keys.
-
- * lib/syck.h: version 0.60.
-
- * lib/yaml/basenode.rb (YAML::BaseNode#at): transform keys during
- key searches.
-
- * ext/syck/rubyext.c: loading of binary-typed nodes. prevent
- emission of plain strings that look like symbols, but which aren't.
-
-Tue Sep 20 05:50:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * test/xmlrpc/test_webrick_server.rb (setup_http_server):
- should not include 'webrick/https' unless 'use_ssl' because
- it fails where openssl is not installed.
-
-Tue Sep 20 00:34:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_close): call rb_io_close() directly if io is a T_FILE
- object. [ruby-dev:27156]
-
-Mon Sep 19 19:09:08 2005 Minero Aoki <aamine@loveruby.net>
-
- * file.c (rb_file_chown): should accept nil. [ruby-dev:27171]
- (backport from trunk, rev 1.208)
-
-Mon Sep 19 18:35:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/dl/dl.c (rb_io_to_ptr): fix DragonFlyBSD support.
- [ruby-dev:27151]
-
-Mon Sep 19 14:17:04 2005 Minero Aoki <aamine@loveruby.net>
-
- * ext/syck/emitter.c (syck_emit): passing an int* value to the
- long* parameter causes unaligned access on LP64 systems.
- [ruby-dev:27161]
-
-Mon Sep 19 13:44:03 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: avoid core dump with WIN32OLE_EVENT.
- [ruby-dev:27133]
-
-Mon Sep 19 10:36:06 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (cp_r): default is :dereference_root=>true for
- backward compatibility. [ruby-dev:27145]
-
- * test/fileutils/test_fileutils.rb (test_cp_r): test it.
-
-Mon Sep 19 09:57:39 2005 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb: backported from trunk (1.36).
- (again) [ruby-dev:27145]
-
-Mon Sep 19 07:45:37 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_pkey.h, ossl_pkey_rsa.c, ossl_pkey_dsa.c:
- an instance variable "private" is added to OpenSSL::PKey class.
- this ivar is a flag that shows whether there is a private key
- in the instance.
-
- * ext/openssl/ossl_engine.c: (ossl_engine_load_privkey): set private
- key flag.
-
-Mon Sep 19 06:41:32 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb: backported from trunk (rev 1.65):
-
- * lib/fileutils.rb (rm_r): new option :secure.
-
- * lib/fileutils.rb (rm_rf): new option :secure.
-
- * lib/fileutils.rb: new method #remove_entry_secure.
-
- * lib/fileutils.rb (cd): remove option :noop.
-
- * lib/fileutils.rb (cp_r): new option :dereference_root.
-
- * lib/fileutils.rb (cp_r): new option :dereference_root.
-
- * lib/fileutils.rb: new method #remove_entry.
-
- * lib/fileutils.rb: new method #chmod_R.
-
- * lib/fileutils.rb: new method #chown.
-
- * lib/fileutils.rb: new method #chown_R.
-
- * lib/fileutils.rb: new method .commands.
-
- * lib/fileutils.rb: new method .options.
-
- * lib/fileutils.rb: new method .have_option?.
-
- * lib/fileutils.rb: new method .options_of.
-
- * lib/fileutils.rb: new method .collect_method.
-
- * lib/fileutils.rb: use module_function instead of single extend.
-
- * test/fileutils/test_fileutils.rb: backported from trunk (1.36).
-
-Mon Sep 19 03:17:48 2005 Tanaka Akira <akr@m17n.org>
-
- * file.c (rb_thread_flock): wrap the flock system call by
- TRAP_BEG/TRAP_END to enable signals. [ruby-dev:27122]
-
- * ext/socket/socket.c (bsock_send): wrap the sendto and send system
- call by TRAP_BEG/TRAP_END to enable signals when writing to a socket
- which is full. [ruby-dev:27132]
-
- * io.c (rb_io_syswrite): wrap the write system call by
- TRAP_BEG/TRAP_END to enable signals when writing to a pipe which is
- full. [ruby-dev:27134]
-
-Mon Sep 19 03:02:08 2005 Tanaka Akira <akr@m17n.org>
-
- * io.c (io_fwrite): wrap the write system call by TRAP_BEG/TRAP_END to
- enable signals when writing to a pipe which is full.
-
-Sun Sep 18 02:10:47 2005 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml/rubytypes.rb: remove comments that are bungling up
- the rdoc and ri output. output symbols as plain scalars.
-
- * ext/syck/rubyext.c (syck_emitter_reset): emit headless
- documents always.
-
- * ext/syck/emitter.c (syck_scan_scalar): quote scalars with any
- kind of surrounding line space, tabs or spaces alike.
-
- * ext/syck/token.c: accept tabs as whitespace, not for indentation,
- but strip from plain scalars.
-
- * test/yaml/test_yaml.rb: remove outdated tests.
-
-Sat Sep 17 23:25:04 2005 sheepman <sheepman@sheepman.sakura.ne.jp>
-
- * lib/mathn.rb (Rational::inspect): should preserve original
- operand. [ruby-core:05806]
-
-Sat Sep 17 23:20:27 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::Cookie): should handle multiple values for a
- cookie name. [ruby-talk:156140]
-
-Sat Sep 17 10:42:13 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
- should call Kernel.eval on caller's safe-level instead of slave's
- safe-level (Of course, the given script should be evaluated on
- slave's safe-level).
-
-Sat Sep 17 09:45:26 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_substr): should propagate taintness even for
- empty strings. [ruby-dev:27121]
-
- * string.c (rb_str_aref): should infect result if range argument
- is tainted. [ruby-dev:27121]
-
-Sat Sep 17 08:35:39 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/maker/base.rb (RSS::Maker::ItemsBase#normalize): fixed
- strange RSS::Maker::Item#max_size behavior.
- Thanks to Kazuhiko <kazuhiko@fdiary.net>.
-
- * test/rss/test_maker_1.0.rb (RSS::TestMaker10#test_items): ditto.
-
-Fri Sep 16 23:09:20 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_search_event_at): bug fix
- in ext/win32ole/sample/ienavi.rb.
-
- * ext/win32ole/win32ole/tests/testOLEEVENT.rb: ditto.
-
-Fri Sep 16 22:41:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_s_extname): empty string for path name ending with a
- period. fixed: [ruby-core:05651]
-
- * file.c (rb_file_join): smarter behavior at edge cases.
- fixed: [ruby-core:05706]
-
-Fri Sep 16 18:34:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/syck/node.c (syck_replace_str): was using return from the
- void function. a patch from MIYAMUKO Katsuyuki
- <miyamuko at mtb.biglobe.ne.jp>. [ruby-dev:27111]
-
-Fri Sep 16 14:48:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: fix typo on MultiTkIp#bg_eval_string
-
-Fri Sep 16 12:02:12 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/syck/rubyext.c (syck_resolver_transfer): remove C++ style
- comment (//). [ruby-core:05793]
-
-Fri Sep 16 00:14:14 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/logger/test_logger.rb: unintentionally overwritten changes by
- Usa. reverted.
-
-Fri Sep 16 00:06:18 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#initialize): should set
- $stdout.binmode.
-
-Thu Sep 15 23:25:21 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.5.
-
- #nnn is a ticket number at http://dev.ctor.org/soap4r
-
- * SOAP
-
- * allow to configure an envelope namespace of SOAP request. (#124)
- TemporaryNamespace = 'http://www.w3.org/2003/05/soap-envelope'
- @client.options["soap.envelope.requestnamespace"] =
- TemporaryNamespace
- @client.options["soap.envelope.responsenamespace"] =
- TemporaryNamespace
- @client.do_proc(...)
-
- * let SOAP request XML indent space configuable. see
- "soap.envelope.no_indent" option. (#130)
-
- * let external CES configuable.
- ex. client["soap.mapping.external_ces"] = 'SJIS'. $KCODE is used
- by default. (#133)
- external CES ::= CES used in Ruby object of client and server
- internal CES ::= CES used in SOAP/OM
-
- * add iso-8859-1 external CES support. (#106)
-
- * fixed illegal 'qualified' handling of elements. it caused
- ASP.NET inteoperability problem. (#144)
-
- * added 'soap.envelope.use_numeric_character_reference' (boolean)
- option to let query XML use numeric character reference in XML,
- not plain UTF-8 character. !GoogleSearch server seems to not
- allow plain UTF-8 character since 2005-08-15 update. (#147)
-
- * SOAP::Header::SimpleHeader (de)serialization throws an exception
- on !SimpleHeader.on_(in|out)bound when header is a String. so we
- could not use a simple single element headerItem. fixed. thanks
- to emil. (#129)
-
- * out parameter of rpc operation did not work. (#132)
-
- * follow HTTP redirect only if using http-access2. (#125) (#145)
-
- * add a workaround for importing an WSDL whose path begins with
- drive letter. (#115)
-
- * WSDL
-
- * SOAP Data which is defined as a simpletype was not mapped
- correctly to Ruby obj when using wsdl2ruby.rb generated classdef
- file. (#123)
-
- * rpc/literal support. (#118)
-
- * re-implemented local element qualify/unqualify control. handles
- elementFormDefault and form in WSDL. (#119)
-
- * Array of an element which has simpleType causes a crash. (#128)
-
- * prarmeterOrder may not contain return part so it can be shorter
- than parts size. Thanks to Hugh. (#139)
-
- * Samples
-
- * added !BasicAuth client sample. (#117)
-
- * added Base64 client/server sample.
-
- * added Flickr SOAP interface client sample. (#122)
-
- * added !SalesForce client sample. (#135)
-
- * updated Thawte CA certificate for !GoogleAdWords sample.
-
- * updated a client script with the newer version made by Johan.
- thanks!
-
- * shortened long file names. (#120)
-
- * fixed typo in authheader sample. (#129)
-
- * updated deprecated method usage. (#138)
-
-Thu Sep 15 23:02:57 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.h (rb_w32_stat): added prototype.
-
-Thu Sep 15 22:35:55 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_signal.rb (test_exit_action): skip the test using
- fork on fork-less platforms.
-
-Thu Sep 15 11:39:18 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/dialog.rb: If a dialog does not show up yet,
- TkDialogObj#name raises an exception. [ruby-talk:156109]
-
-Thu Sep 15 01:39:19 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/tuplespace.rb (Rinda::TemplateEntry::initialize): pull
- up method. Tabs converted to spaces.
-
-Thu Sep 15 00:18:24 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/net/telnet.rb (Net::Telnet::waitfor): replace sysread with
- readpartial. [ruby-talk:127641]
-
-Wed Sep 14 22:40:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (ruby_glob): glob function not using ruby exception system.
-
-Wed Sep 14 01:26:03 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/https.rb: backported from trunk, rev 1.3.
- [ruby-dev:25673] (again), [ruby-dev:26617] (again),
- [ruby-dev:27062]
-
- * ext/openssl/lib/net/https.rb: removed.
-
- * ext/openssl/lib/net/protocols.rb: removed.
-
- * lib/net/http.rb: #use_ssl?, #use_ssl are moved from net/https.
-
-Tue Sep 13 22:09:40 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb (Logger): added formatter accessor to logger for
- dictating the way in which the logger should format the messages it
- displays. Thanks to Nicholas Seckar (cf. [ruby-talk:153391]) and
- Daniel Berger.
-
- * lib/logger.rb (Logger): added VERSION constant.
-
- * lib/logger.rb: removed document for LogDevice. It is an
- implementation detail and is not a public interface.
-
- * test/logger/test_logger.rb: added tests.
-
-Tue Sep 13 21:47:17 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (BEGIN_CALLARGS): pop halfly pushed status.
- fixed: [ruby-dev:26881]
-
-Tue Sep 13 16:26:45 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: backported from trunk, rev 1.128.
- [ruby-dev:25673] [ruby-dev:26617]
-
- * lib/net/protocol.rb: backported from trunk, rev 1.78.
-
- * lib/net/protocol.rb: new method #old_open to support net/smtp
- and net/pop.
-
- * lib/net/smtp.rb: use #old_open.
-
- * lib/net/pop.rb: ditto.
-
-Tue Sep 13 12:33:05 2005 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml.rb: reworking YAML::Stream to use the new
- emitter.
-
- * lib/yaml/stream.rb: ditto.
-
- * lib/yaml/rubytypes.rb: added Object#yaml_new.
-
- * lib/yaml/tag.rb: the tag_subclasses? method now
- shows up in the class. allow taguri to be set using an accessor.
- continue support of Object#to_yaml_type.
-
- * ext/syck/rubyext.c: new emitter code. yaml_new and yaml_initialize
- get called, should they be present. consolidated all the diaspora of internal
- node types into the family below YAML::Syck::Node -- Map,
- Seq, Scalar -- all of whom are SyckNode structs pointing to
- Ruby data. moved Object#yaml_new into the node_import and made it the
- default behavior. the target_class is always called wih yaml_new, prepended
- a parameter, which is the klass. loaded nodes through GenericResolver show their style.
- new Resolver#tagurize converts type ids to taguris.
-
- * ext/syck/implicit.re: were 'y' and 'n' seriously omitted??
-
- * ext/syck/emitter.c: renovated emitter, walks the tree in advance.
- consolidated redundant block_styles struct into
- the scalar_style struct. (this means loaded nodes can now
- be sent back to emitter and preserve at least its very basic
- formatting.)
-
- * ext/syck/gram.c: headless documents of any kind allowed.
-
- * ext/syck/node.c: new syck_replace_str methods and syck_empty_*
- methods for rewriting node contents, while keeping the ID
- and other setup info. added syck_seq_assign.
-
- * ext/syck/syck.h: reflect block_styles and new node functions.
-
-Mon Sep 12 20:53:06 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * test/openssl/test_pkcs7.rb (test_enveloped): skip this test
- to avoid a bug of PKCS7_enctypt() (only if ext/openssl is
- compiled with OpenSSL-0.9.7d or earlier versions).
- http://www.mail-archive.com/openssl-dev@openssl.org/msg17376.html
-
-Mon Sep 12 14:03:33 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * test/dbm/test_dbm.rb: remove locking test, which may not be
- supported on some platforms. [ruby-dev:27030]
-
-Mon Sep 12 10:45:58 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/dl/dl.c (rb_io_to_ptr): merged a patch for DragonFly BSD
- from Takahiro Kambe <taca at back-street.net>. [ruby-dev:27023]
-
-Sun Sep 11 22:05:51 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * bin/erb (ERB::Main#run): set ERB#filename so that it is used
- when reporting syntax/runtime errors. Tabs converted to spaces.
-
-Sat Sep 10 10:17:03 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_engine.c (ossl_engine_s_by_id):
- OpenSSL::Engine.by_id calls given block before calling
- ENGINE_init (block parameter is the return value of this method
- itself). this functionality is useful to load dynamic shared
- engines. the following code is a sample of loading a key using
- OpenSC PKCS #11 module.
-
- require "openssl"
- pkcs11 = OpenSSL::Engine.by_id("dynamic"){|e|
- e.ctrl_cmd("SO_PATH", "/usr/lib/opensc/engine_pkcs11.so")
- e.ctrl_cmd("LIST_ADD", "1")
- e.ctrl_cmd("LOAD")
- }
- pkcs11.ctrl_cmd("PIN", "secret")
- key = pkcs11.load_private_key
-
- * ext/openssl/ossl_engine.c (ossl_engine_ctrl_cmd): new method
- OpenSSL::Engine#ctrl_cmd. it wraps ENGINE_ctrl_cmd_string.
-
- * ext/openssl/ossl_engine.c (ossl_engine_get_cmds): new method
- OpenSSL::Engine#cmds. it returms engine command definitions.
-
-Sat Sep 10 10:09:47 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (asn1str_to_str): new function.
-
- * ext/openssl/ossl_pkcs7.c: new class OpenSSL::PKCS7::RecipientInfo.
- this class wraps PKCS7_RECIP_INFO struct.
-
- * ext/openssl/ossl_pkcs7.c: OpenSSL::PKCS7::Signer is renamed to
- OpenSSL::PKCS7::SignerInfo. ("Signer" remains as an alias of
- SignerInfo.)
-
- * test/openssl/test_pkcs7.rb: new file.
-
-Sat Sep 10 10:05:51 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): assume that
- the argument is a DER string if Base64 decoding failed.
-
- * ext/openssl/ossl_ns_pki.c (ossl_spki_to_der): new method.
-
- * test/openssl/test_ns_spki.rb: add new file.
-
-Sat Sep 10 09:56:24 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/digest.rb: added SHA224, SHA256, SHA384 and SHA512.
- these features are enabled if this library is compiled with
- OpenSSL 0.9.8 or later.
-
- * test/openssl/test_digest.rb: add test for new digests.
-
-Sat Sep 10 09:51:30 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.c (ossl_raise): should use ERR_peek_last_error
- to get last error on the current thread. And should report
- errors on the stack while OpenSSL.debug is true.
-
- * ext/openssl/ossl.c (ossl_get_errors): new method for debugging
- this library.
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): fix error message.
-
- * ext/openssl/ossl_x509req.c (ossl_x509req_set_attributes): get rid
- of unused variable.
-
- * ext/openssl/ossl_x509store.c (ossl_x509store_initialize): should
- set @time to avoid warning.
-
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths,
- X509_STORE_add_cert, X509_STORE_add_crl): should raise error if
- wrapped functions failed.
-
- * test/openssl/test_x509store.rb: add test for errors.
-
-Fri Sep 9 22:13:19 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): prohibit calling tainted method (>2) when
- $SAFE == 0.
-
-Fri Sep 9 16:45:25 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_times): make empty strings to keep taintness,
- and a little improvement. [ruby-dev:26900]
-
- * ext/iconv/iconv.c (iconv_try), ext/iconv/extconf.rb: get rid of meta
- characters in command line option. fixed: [ruby-talk:155369]
-
-Thu Sep 8 14:58:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * merged a patch from Takahiro Kambe <taca at back-street.net> to
- support DragonFly BSD. [ruby-dev:26984]
-
-Wed Sep 7 12:55:08 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb: abolish mod === tempfile to avoid a problem
- [ruby-dev:26967].
-
-Wed Sep 7 10:45:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_switch): convert all exceptions to
- SystemExit. fixed: [ruby-core:05724]
-
- * eval.c (rb_thread_terminated): show backtrace before propagate
- exceptions to main thread.
-
-Wed Sep 7 08:35:04 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in, configure.in (MINIOBJS): miniruby on HP-UX can not load
- extension libraries.
-
- * bignum.c (bignew_1, bigadd): K&R style argument actually can't be
- defined as char.
-
- * missing/vsnprintf.c: ANSI compiler supports const keyword.
-
- * ext/digest/sha2/extconf.rb: reject platforms which has inttypes.h
- but no 64bit integer.
-
- * lib/mkmf.rb (what_type?): guesstimate type.
-
- * ext/etc/etc.c (setup_passwd), ext/etc/extconf.rb: pw_age might be
- char*. fixed: [ruby-core:05470]
-
-Wed Sep 7 08:32:47 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (rb_mod_cvar_get, rb_mod_cvar_set): document fix from
- sheepman <sheepman@sheepman.sakura.ne.jp>; a bug in visibility
- description. [ruby-dev:26965]
-
- * sprintf.c (rb_f_sprintf): warn "too many argument" on verbose
- mode (-v/-w); backported from 1.9. [ruby-dev:26963]
-
-Mon Sep 5 17:03:07 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/ostruct.rb: a patch from Florian Gross <florgro at gmail.com>
- merged to allow recursive inspect (and to_s) for OpenStruct.
- [ruby-core:05532]
-
-Mon Sep 5 07:01:12 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/openssl/lib/openssl/buffering.rb (Buffering#do_write):
- should clear data from the buffer which already been output.
-
-Fri Sep 2 23:51:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib: do not use __send__ to access private methods. [ruby-dev:26935]
-
-Fri Sep 2 03:29:00 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
-
- * lib/irb/init.rb: make IRB -I option that is same befavior for ruby.
- [ruby-dev:26872], [ruby-dev: 26920]
-
- * lib/irb/locale.rb: support to print help message when OS locale is
- ja_JP.utf-8. [ruby-dev:26872]
-
-Thu Sep 1 17:11:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): wrong condition for $SAFE restoration.
-
-Thu Sep 1 14:12:45 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: On Tcl8.5, MultiTkIp#invoke_hidden doesn't
- work (gives wrong order of arguments).
-
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#invoke_hidden_on_namespace
- to support '-namespace' option of 'interp invokehidden' command
- on Tcl8.5.
-
-Wed Aug 31 14:43:15 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (OPTFLAGS): default global optimization to
- disabled for all VC++ versions. fixed: [ruby-dev:26897]
-
-Wed Aug 31 11:35:43 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/gdbm/test_gdbm.rb (teardown): should remove GDBM temporary
- file.
-
-Wed Aug 31 10:30:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * process.c (proc_detach, proc_setmaxgroups): missing argument type
- declaration. (I recommend ANSI-style function)
-
-Tue Aug 30 23:20:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_rescue2): initialization miss. fixed: [ruby-dev:26917]
-
- * lib/mkmf.rb (xsystem, xpopen): no longer expand by Config.
-
- * lib/mkmf.rb (link_command, cc_command, cpp_command): expand
- variables at once, and quote hdrdir. fixed: [ruby-core:05680]
-
- * lib/mkmf.rb (libpathflag): quote paths.
-
-Tue Aug 30 19:34:27 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/digest/md5/md5ossl.h, ext/digest/rmd160/rmd160ossl.h,
- ext/digest/sha1/sha1ossl.h: include <stddef.h> to avoid
- error in compilation with OpenSSL-0.9.8. [ruby-list:41068]
-
-Mon Aug 29 19:54:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/rdoc/usage.rb: improper exceptions. [ruby-dev:26870]
-
- * lib/rdoc/usage.rb: support the case when non-ruby code exists before
- shebang. (this is needed when ri.bat is executed on windows)
-
-Mon Aug 29 17:48:17 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (method_arity): should return proper arity value.
- [ruby-dev:26390]
-
-Mon Aug 29 01:19:57 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/time.rb (Time.parse): extract fractional seconds using
- Date._parse. [ruby-talk:153859]
-
-Sat Aug 27 20:20:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/curses/curses.c ({curses,window}_clrtoeol): added. suggested
- by Reyn Vlietstra.
-
- * ext/curses/curses.c: chtype in curses is not `char', rahter `long'.
- [ruby-Bugs:2298]
-
- * ext/curses/view.rb: String =~ String is deprecated.
-
-Wed Aug 24 10:53:28 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/logger/test_logger.rb (test_shifting_size): should close log
- device before unlink, since some platform cannot unlink opened
- file.
-
-Sun Aug 21 00:13:27 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/wsdl/xmlSchema/importer.rb (WSDL::XMLSchema::Importer#fetch): add
- a workaround for importing an WSDL whose path begins with drive
- letter. [ruby-dev:26242]
-
-Sat Aug 20 22:37:13 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb (write, shift_log?, shift_log): file shifting race
- condition bug fixed. [ruby-dev:26764]
-
- * test/logger/test_logger.rb: tests.
-
-Fri Aug 19 18:13:39 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/time.rb (Time.apply_offset): fix a problem with last day of
- month. reported by Lucas Nussbaum. [ruby-talk:152866]
-
-Thu Aug 18 12:46:28 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub (COMMON_HEADERS): reverted 1.42.2.24.
- I misunderstood, bccwin32 on ruby_1_8 uses winsock2 originally.
- [ruby-dev:26806]
-
- * win32/win32.h: include winsock2.h instead of winsock.h. (bcc32)
-
-Wed Aug 17 23:58:05 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_to_integer): argument constified.
-
- * eval.c (terminate_process): take String message.
-
- * eval.c (rb_thread_switch): propagate the exception caused thread
- termination directly. fixed: [ruby-core:05552]
-
-Wed Aug 17 00:05:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_add_method): preserve safe level in the environment
- where a method is defined .
-
- * eval.c (rb_call0): restore preserved safe level in the method
- execution.
-
-Mon Aug 15 00:38:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_rescue2): reduce PUSH_TAG() as well as NODE_RESCUE.
- [ruby-dev:26800]
-
- * range.c (range_check, range_init): reduce useless exceptions.
-
-Sat Aug 13 18:51:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_block_pass): distinguish current block from others.
- fixed: [ruby-dev:26274]
-
- * ext/stringio/stringio.c (strio_set_string): disallow nil.
- http://www.rubyist.net/~nobu/t/20050811.html#c05
-
-Thu Aug 11 23:29:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c: keep holding string after closed.
-
-Thu Aug 11 13:01:48 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss: fixed sort bug. [ruby-list:41018]
-
- * lib/rss/1.0.rb (RSS::RDF::Channel#setup_maker_attributes):
- removed self.
-
- * lib/rss/maker/base.rb (RSS::Maker::ItemsBase#<=>): use #date
- instead of @date.
- (RSS::Maker::Base::self.def_array_element): added #size.
-
- * lib/rss/maker/1.0.rb
- (RSS::Maker::RSS10::Channel#to_rss,
- RSS::Maker::RSS10::Items::Item#to_rss): cleared dc_dates set
- upped by using #date.
-
- * lib/rss/maker/dublincore.rb
- (RSS::Maker::ChannelBase, RSS::Maker::ItemsBase::ItemBase):
- fixed opposite alias.
-
- * test/rss/test_setup_maker_1.0.rb
- (RSS::TestSetupMaker10::test_setup_maker_items_sort): added some
- tests for RSS::Maker::ItemsBase#do_sort.
-
-Wed Aug 10 10:29:40 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: fix bug on handling __ruby2val_optkeys().
-
- * ext/tk/lib/tk/itemconfig.rb: fix bug on handling
- __item_ruby2val_optkeys().
-
- * ext/tk/lib/tk/canvas.rb: didn't check __item_ruby2val_optkeys().
-
- * ext/tk/lib/tkextlib/blt/component.rb: ditto.
-
-Tue Aug 9 15:12:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: remove dangerous 'rb_jump_tag's.
-
- * ext/tk/lib/tk.rb: add __val2ruby_optkeys and __ruby2val_optkeys to
- help to convert option values between ruby and tcl.
-
- * ext/tk/lib/tk/itemconfig.rb: add __item_val2ruby_optkeys and
- __item_ruby2val_optkeys to help to convert option values between
- ruby and tcl.
-
- * ext/tk/lib/tk/radiobutton.rb: use __ruby2val_optkeys for 'variable'
- option (for the reason of backward compatibility).
-
- * ext/tk/lib/tk/composite.rb: clarify the arguments of super().
-
- * ext/tk/lib/tk/spinbox.rb: ditto.
-
- * ext/tk/lib/tk/text.rb: ditto.
-
- * ext/tk/lib/tk/validation.rb: ditto.
-
- * ext/tk/lib/tkextlib/*: support to treat tkvariable-type
- configure options.
-
-Tue Aug 9 20:30:19 2005 Tadashi Saito <shiba@mail2.accsnet.ne.jp>
-
- * bignum.c (rb_big_coerce): allow bignum x bignum coercing.
- [ruby-dev:26778]
-
-Mon Aug 8 20:43:02 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_method.rb: added. [ruby-dev:26761]
-
-Sun Aug 7 23:50:14 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_super.rb: added from HEAD. [ruby-dev:26743]
-
-Sun Aug 7 01:31:15 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (WIN32OLE_EVENT#on_event): should set
- only one event handler.
-
- * ext/win32ole/tests/testOLEEVENT.rb: ditto.
-
- * ext/win32ole/tests/testOLEPARAM.rb: remove re-defined
- test_ole_type_detail method.
-
-Sat Aug 6 12:35:24 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/{tk.rb,tk/itemconfig.rb}: configure creates
- TkVariable if key name is 'variable' or 'textvariable'
- by default. [ruby-dev:26749]
-
- * ext/tk/lib/tk/{label,radiobutton}.rb: removed its own
- {variable,textvariable} function.
-
- * ext/tk/lib/tk/variable.rb: retains backward conpatibility.
-
-Fri Aug 5 12:50:32 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c: fixed memory leak when tk_funcall raised
- exception. (copies argv into heap in tk_funcall instead of
- caller)
-
-Fri Aug 5 12:42:57 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): need to convert path separetor
- before invoking install command.
-
-Fri Aug 5 00:27:04 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c: refactoring - extract ruby string <->
- tcl object conversion as get_str_from_obj and get_obj_from_str.
-
-Fri Aug 5 00:19:33 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * extmk.rb (extmake): needs to be wrapped in an Array.
-
-Thu Aug 4 18:38:36 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: cannot compile for Tcl7.6/Tk4.2.
-
- * ext/tcltklib/tcltklib.c: add nativethread consistency check.
-
- * ext/tcltklib/stubs.c: ditto.
-
- * ext/tk/lib/tk.rb: forgot to define TclTkIp.encoding and encoding=
- when Tcl is 7.6 or 8.0.
-
- * ext/tk/lib/tk/wm.rb: support to make some methods as options of
- root or toplevel widget. [ruby-talk:150336]
-
- * ext/tk/lib/tk/root.rb: ditto.
-
- * ext/tk/lib/tk/toplevel.rb: ditto.
-
- * ext/tk/lib/tkextlib/SUPPRT_STATUS: update RELEASE_DATE
-
-Thu Aug 4 08:03:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): should not modify $mflags for each
- extentions.
-
-Thu Aug 4 00:25:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk, Makefile.in, {bcc32,win32,wince}/Makefile.sub: integrated
- macro definitions.
-
- * bcc32/Makefile.sub: LIBRUBY_SO should use DLDOBJS, not EXTOBJS.
-
- * {win32,wince}/Makefile.sub: separate config.h for compiler versions.
-
-Wed Aug 3 21:59:16 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/variable.rb: TkVariable#trace didn't work on
- TkVariable retrived from TkVariable.new_hash.ref. [ruby-dev:26721]
-
-Wed Aug 3 08:22:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (ruby_connect): revert [ruby-talk:111654]
- changes at 2004-09-07. [ruby-dev:26656]
-
-Tue Aug 2 10:20:54 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c: use Tcl_[GS]etVar2Ex instead of
- Tcl_Obj[GS]etVar2. (avoid Tcl_NewStringObj on supported platforms)
-
- * ext/tcltklib/tcltklib.c: use ip_{get,set,unset}_variable2_core from
- ip_{get,set,unset}_variable.
-
- * ext/tcltklib/tcltklib.c: replaced Tcl_Panic with rb_bug.
-
-Tue Aug 2 01:41:28 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/ping.rb (Ping.pingecho): should rescue StandardError.
- [ruby-dev:26677]
-
-Mon Aug 1 19:09:41 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c: refactoring - replaced rb_ivar_defined &
- rb_ivar_get with single rb_attr_get call.
-
-Mon Aug 1 18:45:07 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c (Tcl_GetStringResult): refactoring - define
- alternative macro on Tcl7.x or earlier.
-
-Mon Aug 1 13:57:35 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c (deleted_ip): refactoring - interpreter
- deletion check. [ruby-dev:26664]
-
-Mon Aug 1 01:17:40 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (check_insecure_method): use private_methods and
- protected_methods instead of respond_to? to check method visibility.
- [ruby-dev:26616]
-
- * test/drb/drbtest.rb: ditto.
-
- * test/drb/ut_drb.rb: ditto.
-
-Mon Aug 1 00:07:32 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
- * lib/irb/context.rb: fix `irb --readline` option. [ruby-list:40955]
-
-Fri Jul 29 09:59:38 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_yield_0): push yielded node instead of yielding.
- fixed: [yarv-dev:549]
-
-Thu Jul 28 18:09:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/stubs.c: When --enable-tcltk-stubs, the initialize
- routine creates a Tcl/Tk interpreter and deletes it. However,
- init cost of Tk's MainWindow is not so small. And that makes it
- impossible to use libraries written with Tcl functions only on
- an environment without a graphical display. This changes support
- delaying initalization of Tk_Stubs until the script needs Tk.
-
- * ext/tcltklib/stubs.h: New file. Define prototypes and return
- codes of functions on stubs.c.
-
- * ext/tcltklib/tcltklib.c: Support delaying initalization of
- Tk_Stubs until the script needs Tk.
-
- * ext/tcltklib/tcltklib.c: Show friendly error messages for errors
- on initialization.
-
- * ext/tcltklib/tcltklib.c: Avoid SEGV on ip_finalize() when ruby is
- exiting and $DEBUG is true. (Not fix. If you know the reason of
- why, please fix it.)
-
- * ext/tk/tkutil.c (ary2list, ary2list2): bug fix on handling of
- encoding.
-
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
- don't work propery.
-
- * ext/tk/lib/tk.rb: Forget extending Tk::Encoding module to Tk.
- * ext/tk/lib/tk/variable.rb: TkVarAccess fails to initialize the
- object for an element of a Tcl's array variable.
-
-Wed Jul 27 23:23:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (obj_free): make message format consistent with one from
- gc_mark(). [ruby-talk:149668]
-
-Wed Jul 27 22:11:37 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * sample/rss/tdiary_plugin: removed. because the plugin
- is imported in the tDiary plugin packages.
-
-Wed Jul 27 10:59:02 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (dir_each): rewinddir(3) before iteration.
- [ruby-talk:149628]
-
-Tue Jul 26 12:57:49 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/openssl_missin.c: include <openssl/engine.h> before
- <openssl/x509_vfy.h> to avoid compilation error of mswin32.
- suggested by NAKAMURA Usaku.
-
-Mon Jul 25 21:30:46 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * {bcc32,win32,wince}/Makefile.sub: moved CPPFLAGS only for ruby
- source to XCFLAGS.
-
-Mon Jul 25 13:45:18 2005 NAJIMA Hiroki <najima@mickey.ai.kyutech.ac.jp>
-
- * io.c: check HAVE_SYS_IOCTL_H before including the header.
- [ruby-dev:26610]
-
-Mon Jul 25 14:10:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: fix en-bugged part in the last commit.
-
-Sat Jul 23 16:49:04 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_engine.c (ossl_engine_s_load): should check
- OPENSSL_NO_STATIC_ENGINE.
-
-Fri Jul 22 21:06:08 2005 Tadashi Saito <shiba@mail2.accsnet.ne.jp>
-
- * bignum.c (rb_big_eq): reduce isnan(). [ruby-dev:26600]
-
- * numeric.c (flo_eq, flo_gt, flo_ge, flo_lt, flo_le): ditto.
-
-Fri Jul 22 15:02:39 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: moved copyright description to lib/rss.rb.
-
- * lib/rss.rb: added for convenience.
-
- * sample/rss/re_read.rb: added #to_s sample.
-
- * sample/rss/blend.rb: use 'require "rss"' instead of
- 'require "rss/*"'.
- * sample/rss/list_description.rb: ditto.
- * sample/rss/rss_recent.rb: ditto.
- * sample/rss/tdiary-plugin/rss-recent.rb: ditto.
-
- * sample/rss/tdiary-plugin/rss-recent.rb: 0.0.6 -> 0.0.7.
-
-Fri Jul 22 14:37:43 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb (RSS::Parser#initialize): accept HTTP/FTP
- URI and local file path too.
-
- * test/rss/test_parser.rb (RSS::TestParser#test_parse): test
- for the above.
-
-Fri Jul 22 07:01:42 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c (tk_conv_args): forget to revert thread_critical
- and gc_disable when raise ArgumentError.
-
- * ext/tk/lib/remote-tk.rb: RemoteTkIp doesn't need to include TkUtil.
-
- * ext/tcltklib/tcltklib.c: add TclTkIp#has_mainwindow? method.
-
- * ext/tk/lib/tk.rb: add Tk.has_mainwindow? method.
-
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#has_mainwindow? method.
-
- * ext/tk/lib/remote-tk.rb: add RemoteTkIp#has_mainwindow? method.
-
- * ext/tk/lib/multi-tk.rb: slave IP fail to exit itself when $SAFE==4.
-
- * ext/tk/lib/multi-tk.rb: remove constants from MultiTkIp module to
- avoid access from external.
-
- * ext/tk/lib/multi-tk.rb: check_root flag is ignored on slave IPs'
- mainloop.
-
- * ext/tk/lib/multi-tk.rb: hang-up Tk.mainloop called on a slave IP
- with $SAFE==4.
-
- * ext/tk/lib/multi-tk.rb: MultiTkIp#bg_eval_proc doesn't work
- properly.
-
- * ext/tk/lib/multi-tk.rb: add MultiTkIp#set_cb_error(proc) and
- cb_error(exc) to log errors at callbacks on safe slave IPs.
-
- * ext/tk/lib/multi-tk.rb: fail to get an available slave IP object
- when call Tk.mainloop in the block which is given to new_* method,
- because cannot finish initialize while the root widget is alive.
-
- * ext/tk/lib/multi-tk.rb: fail to control a slave IP when Tk.mainloop
- runs on the IP.
-
-Wed Jul 20 19:20:37 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * io.c (S_ISREG): need to define S_ISREG before it is used first.
-
-Wed Jul 20 18:40:50 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * io.c (wsplit_p): patch for the environment where
- fcntl(F_GETFL, O_NONBLOCK) is not supported. in that case,
- set FMODE_WSPLIT without fcntl check. [ruby-dev:26566]
-
-Wed Jul 20 18:07:11 2005 Tanaka Akira <akr@m17n.org>
-
- * io.c (rb_io_ctl): update FMODE_WSPLIT_INITIALIZED and FMODE_WSPLIT
- by F_SETFL.
-
-Wed Jul 20 10:04:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * variable.c (rb_class_path): need to adjust snprintf() len for
- teminating NUL. [ruby-dev:26581]
-
-Wed Jul 20 04:01:55 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/socket/socket.c: sorry, BeOS also uses HAVE_CLOSESOCKET,
- so reverted.
-
- * ext/socket/extconf.rb: should not define HAVE_CLOSESOCKET
- on windows.
-
-Wed Jul 20 03:16:43 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/socket/socket.c: should not undef close() on win32.
- it's defined to rb_w32_close(), otherwise handle leaks.
- [ruby-Bugs-2131]
-
-Wed Jul 20 00:48:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * error.c (syserr_initialize): don't use str before StringValue()
- check. [ruby-dev:26579]
-
-Tue Jul 19 22:47:29 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * error.c (syserr_initialize): add 1 byte for snprintf() size for
- NUL at the end. [ruby-dev:26574]
-
-Tue Jul 19 16:39:46 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_inspect): replace sprintf() with "%s" format all
- over the place by snprintf() to avoid integer overflow.
-
-Tue Jul 19 14:08:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c: rbtk_eventloop_depth is used as int.
-
- * ext/tcltklib/tcltklib.c: rbtk_pending_exception is tested with
- NIL_P, so should assign Qnil instead of 0 (Qfalse).
-
- * ext/tcltklib/tcltklib.c (ip_invoke_real): fixed memory leak when
- ip is deleted.
-
-Tue Jul 19 13:19:46 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/variable.rb: For symmetry, add TkVariable#string. It
- returns a string even if the default value type of the TkVariable
- object is not "string".
-
-Mon Jul 18 21:40:20 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * eval.c (rb_call0): make the pointer to NODE volatile
- instead of NODE itself.
-
-Mon Jul 18 14:32:21 2005 Tanaka Akira <akr@m17n.org>
-
- * eval.c (rb_call0): make body volatile to avoid optimization problem.
- [ruby-dev:26195]
-
-Mon Jul 18 12:23:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/io/wait/wait.c: wrong backport from trunk. fixed: [ruby-dev:26562]
-
-Mon Jul 18 09:36:25 2005 Tanaka Akira <akr@m17n.org>
-
- * rubyio.h (FMODE_WSPLIT, FMODE_WSPLIT_INITIALIZED): new constant.
-
- * io.c (wsplit_p): new function.
- (io_fwrite): split writing data by PIPE_BUF if wsplit_p is true in
- multi-threaded mode.
- [ruby-dev:26540]
-
-Sun Jul 17 13:46:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/io/wait/extconf.rb, ext/io/wait/wait.c: Win32 platforms support.
-
-Fri Jul 15 23:59:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/parsers/parse_c.rb (handle_class_module): handle a
- module enclosed in a built-in module. fixed: [ruby-talk:148239]
-
- * lib/rdoc/parsers/parse_c.rb (find_body): allow macros as methods.
-
- * lib/rdoc/parsers/parse_c.rb (find_call_seq): allow :nodoc: modifier
- in C. [ruby-core:04572]
-
-Fri Jul 15 18:00:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub (COMMON_HEADERS): ruby_1_8 is using winsock.h.
- failed to compile ext/socket on bcc5.6.4. [ruby-dev:26193]
-
-Fri Jul 15 07:58:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/server.rb (WEBrick::GenericServer#accept_client):
- sockets should be non-blocking mode. [ruby-dev:26405]
-
- * lib/webrick/utils.rb (WEBrick::Utils.set_non_blocking): new method.
-
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#read_chunked):
- should call sock.read repeatedly until the preferred size data
- is obtained.
-
-Thu Jul 14 18:27:16 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (rb_w32_strerror): should return correct message
- for ENAMETOOLONG and ENOTEMPTY. (bcc32) [ruby-dev:26533]
-
- * win32/win32.c (rb_w32_strerror): stripped CR LF on the tail.
- (bcc32) [ruby-dev:26533]
-
-Thu Jul 14 00:45:42 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * LEGAL (ext/nkf/nkf-utf8): updated from nkf1.7 to nkf-utf8.
-
-Wed Jul 13 19:37:47 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (rb_w32_mkdir): should set EEXIST (not EACCES)
- if file or directory already exists. (bcc32) [ruby-dev:26508]
-
- * win32/win32.c (rb_w32_rmdir): should set ENOTDIR (not EINVAL)
- if it is not directory. (bcc32, win32)
-
- * win32/win32.c (rb_w32_rmdir, rb_w32_unlink): restore
- FILE_ATTRIBUTE_READONLY flag on function failure.
-
-Wed Jul 13 12:40:00 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: TclTkLib.do_one_event doesn't work.
-
- * ext/tk/lib/tk.rb: Tk.thread_update is available.
-
-Tue Jul 12 23:32:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb: keep curdir unexpanded.
-
-Mon Jul 11 08:31:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * regex.c (read_special): fix parsing backslashes following \c in
- regexp. fixed: [ruby-dev:26500]
-
-Mon Jul 11 02:53:00 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
- mistook in merging the patch of [ruby-dev:26235] at
- revision 1.4.2.6.
-
-Sun Jul 10 23:58:04 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#unlink): try Dir.unlink first to
- avoid unlink a directory by root.
- cf. [ruby-dev:26237]
-
-Sun Jul 11 05:18:17 2005 Michael Neumann <mneumann@ruby-lang.org>
-
- * lib/xmlrpc/server.rb (XMLRPC::Server): Switch from GServer over to
- WEBrick. This makes file lib/xmlrpc/httpserver.rb obsolete (at least it is
- no further used by the XML-RPC library).
-
-Sun Jul 10 12:47:01 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/debug.rb (debug_command): added a deficient format specifier.
- fixed: [ruby-core:05419]
-
-Sat Jul 9 21:28:46 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_method_dispid): convert dispid
- in Ruby and C by INT2NUM and NUM2INT.
-
- * ext/win32ole/win32ole.c (ole_invoke2): ditto.
-
- * ext/win32ole/test/testWIN32OLE.rb: ditto.
-
- * ext/win32ole/test/testOLEMETHOD.rb: ditto.
-
-Fri Jul 8 15:45:04 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb (RSS::VERSION): 0.1.4 -> 0.1.5.
-
- * test/rss/test_version.rb (RSS::TestVersion#test_version):
- ditto.
-
- * lib/rss/0.9.rb (RSS::Rss::Channel::Item::Category):
- domain attribute of <category> is optional. Thanks to
- Chris Lee <clee@kde.org>.
-
- * test/rss/test_parser.rb (RSS::TestParser#test_category20):
- adjusted test case.
-
-Tue Jul 5 23:44:06 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * instruby.rb: expand source library path.
-
-Tue Jul 5 23:27:14 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * array.c (sort_2): get rid of yet another bcc's bug.
- fixed: [ruby-core:05152]
-
- * eval.c (rb_thread_save_context): must not switch contexts during
- re-allocating stack. fixed: [ruby-core:05219]
-
-Tue Jul 5 15:15:10 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c: fix typo.
-
-Tue Jul 5 14:51:35 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: bug fix on treating Unicode strings.
-
- * ext/tcltklib/tcltklib.c: add methods to treat encoding mode.
-
- * ext/tcltklib/MANUAL.eng: add description of TclTkLib#encoding,
- encoding_system, and so on.
-
- * ext/tcltklib/MANUAL.euc: ditto.
-
- * ext/tk/tkutil.c: fail to create a Tcl's list string from an
- array including multiple kind of encoded strings.
-
- * ext/tk/lib/tk.rb: ditto.
-
- * ext/tk/lib/multi-tk.rb: 2nd arg of _{to|from}UTF8 is omissible.
-
- * ext/tk/lib/remote-tk.rb: ditto.
-
- * ext/tk/lib/tk.rb: override TclTkLib#encoding and encoding= to
- use TkCore::INTERP.encoding and encoding=.
-
- * ext/tk/lib/tk.rb: when "require 'tk'" and $KCODE=='NONE', check
- DEFAULT_TK_ENCODING to decide Ruby/Tk's system encoding mode.
-
- * ext/tk/lib/tk/encodedstr.rb: check both of Tk.encoding and
- Tk.encoding_system. Tk.encoding has higher priority.
-
- * ext/tk/lib/tk/optiondb.rb: ditto.
-
- * ext/tk/lib/tk/spinbox.rb: ditto.
-
- * ext/tk/lib/tk/validation.rb: ditto.
-
- * ext/tk/lib/tk/namespace.rb: arguemnts for TclTkIp#_merge_tklist
- should be UTF-8 strings.
-
-Mon Jul 4 14:35:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sample/svr.rb: service can be stopped by ill-behaved client; use
- tsvr.rb instead.
-
-Mon Jul 4 13:25:21 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * missing/erf.c: original erf.c by prof. Okumura is confirmed to
- be public domain. reverted BSD implementation.
-
-Mon Jul 4 11:15:37 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/{dbm,gdbm,sdbm}/test_{dbm,gdbm,sdbm}.rb: skip some tests
- which using fork on fork-less platforms.
-
-Sun Jul 3 23:26:30 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/wsdl/document/test_rpc.rb: compare formatted time string of
- Time objects instead of comparing Time objects itself to avoid
- unintended conflict of usec part. [ruby-dev:26220]
-
-Sat Jul 2 22:41:04 2005 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c (unix_send_io, unix_recv_io): support x86-64 and
- IA64.
-
-Sat Jul 2 17:06:23 2005 Tanaka Akira <akr@m17n.org>
-
- * defines.h (FLUSH_REGISTER_WINDOWS): defined for IA64.
- (flush_register_windows): declare flush_register_windows.
-
- * eval.c (flush_register_windows): new function.
-
-Fri Jul 1 17:48:52 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (get2comp): revert all prior changes, and calculate
- proper 2's complement for negative numbers. backported from
- HEAD.
-
-Fri Jul 1 15:50:12 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * missing/erf.c: need to include some headers for some platforms.
-
- * win32/win32.h (copysign, scalb): define for compatibility with
- other platforms. [ruby-dev:26430]
-
-Fri Jul 1 15:37:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * missing/crypt.c: modified to make it compilable on platforms
- other than BSD. [ruby-dev:26430]
-
- * missing/erf.c: ditto. code from <exp.c> merged.
-
-Fri Jul 1 12:44:56 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (OpenURI.open_http): refine post_connection_check
- call.
-
-Fri Jul 1 11:34:08 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * missing/crypt.c: replaced with 4.4BSD version.
-
- * missing/erf.c: ditto.
-
- * missing/vsnprintf.c: removed the third provision from the old
- BSD license. [ruby-core:05177]
-
-Fri Jul 1 01:45:21 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enum.c (enum_min, enum_max): must not return Qundef.
- fixed: [ruby-core:05299]
-
-Fri Jul 1 00:18:40 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/delegate.rb (Delegator::respond_to): respond_to? must check
- destination object. [ruby-talk:146894]
-
-Thu Jun 30 19:00:21 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
- * lib/irb/ruby-lex.rb (RubyLex::identify_number): alternative implements
- for [ruby-dev:26410]. And support a numeric form of 0d99999.
-
-Thu Jun 30 17:28:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/ruby-lex.rb (RubyLex::identify_number): should not treat
- plain zero as an octal number. [ruby-dev:26410]
-
-Thu Jun 30 15:13:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): pre-evaluate argument for unambiguous
- evaluation order. [ruby-dev:26383]
-
-Thu Jun 30 09:53:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/delegate.rb (Delegator::method_missing): forward unknown
- method to the destination. suggested by
- <christophe.poucet@gmail.com>. [ruby-talk:146776]
-
-Tue Jun 28 21:59:29 2005 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * dir.c, eval.c, hash.c, process.c, ruby.c: avoid warning "unused
- variable" [ruby-dev:26387]
-
-Sat Jun 25 17:15:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_query): should
- discard if key=val pair is empty. patch from Gary Wright.
-
-Sat Jun 25 23:30:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (detach_process_watcher): terminate process watcher
- thread right after rb_waitpid() succeed. [ruby-talk:146430]
-
-Sat Jun 25 15:49:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enum.c (enum_min, enum_max): do not ignore nil as the first element.
-
-Sat Jun 25 14:40:17 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/sdbm/init.c (fsdbm_select): SDBM#select had returned the array
- which contained each elements twice. [ruby-dev:26358]
-
-Fri Jun 25 05:06:47 2005 Michael Neumann <mneumann@ruby-lang.org>
-
- * lib/xmlrpc/*, test/xmlrpc/*: backported changes from HEAD into 1.8
-
-Fri Jun 24 17:00:00 2005 Shigeo Kobayashi <shigeo@tinyforest.jp>
-
- * ext/bigdecimal/bigdecimal.c: patch from "NATORI Shin"
- (u-tokyo.ac.jp) applied to fix rounding bug.
-
-Fri Jun 24 13:06:45 2005 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/common.rb, lib/uri/generic.rb: fixed typo in documents and
- replaced some existent domain name with "example.com".
-
-Fri Jun 24 12:23:19 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: fix typo on Tk.grid_propagate.
-
- * ext/tk/lib/tk.rb: Tk.event_generate and TkWindow#event_generate
- accept TkEvent::Event object as context argument.
-
- * ext/tk/lib/tk/event.rb: add TkEvent::Event#valid_fields and
- valid_for_generate to get field parameters of event_generate.
-
-Thu Jun 23 23:55:59 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * runruby.rb: should load built rbconfig.rb.
-
-Thu Jun 23 16:53:15 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/canvastag.rb: TkcGroup.new cannot include given items.
- TkcGroup#exclude calls wrong method.
- Add alias TkcGroup#add [ruby-talk:146049].
-
- * ext/tk/lib/tk/canvas.rb: TkCanvas#dtag and some subcommands of
- TkCanvas#addtag fail to treat a TkcTag argument.
-
- * ext/tk/lib/tk/event.rb: add TkEvent::Event#generate to help to send
- current event to other widgets.
-
-Mon Jun 20 18:44:04 2005 Tanaka Akira <akr@m17n.org>
-
- * eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): DUMMY_SETJMP is replaced
- because setjmp is not enough to fix getcontext and SPARC register
- window problem.
-
-Mon Jun 20 16:48:36 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/dbm/dbm.c (fdbm_closed): new method DBM#closed?
-
- * ext/gdbm/gdbm.c (fgdbm_closed): new method GDBM#closed?
-
- * ext/sdbm/init.c (fsdbm_closed): new method SDBM#closed?
-
- * test/dbm/test_dbm.rb, test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb
- (teardown): close all db objects before deleting data files.
-
- * win32/win32.{ch} (unlink): hook runtime function to change
- file attribute before unlinking.
- fixed: [ruby-dev:26360]
-
-Mon Jun 20 02:15:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (define_final): document fix: finalizers never get called
- before target object is destroyed.
-
-Mon Jun 20 01:26:49 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/openssl_missing.c, ext/openssl/ossl.h,
- ext/openssl/ossl_asn1.c, ext/openssl/ossl_bio.c,
- ext/openssl/ossl_pkcs12.h, ext/openssl/ossl_x509req.c: avoid
- compiler warnings. suggested by Michal Rokos.
-
-Sun Jun 19 14:09:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (run_final): reduce unnecessary object allocation during
- finalization.
-
- * gc.c (rb_gc_call_finalizer_at_exit): deferred finalizers list should
- be cleared before calling them. fixed: [ruby-talk:145790]
-
-Fri Jun 17 13:01:40 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/time.rb (Time.parse): fix previous leap seconds support.
- (Time.rfc2822): ditto.
- (Time.xmlschema): ditto.
-
-Thu Jun 16 15:06:55 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c (ip_rb_threadVwaitCommand): Tcl_Release
- was missing.
-
-Thu Jun 16 13:34:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add Tk.getMultiple{Open|Save}File() which return
- an Array of selected files.
-
-Thu Jun 16 12:53:24 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/time.rb (Time.parse): "Fri Jan 1 08:59:60 +0900 1999" was
- parsed as "Fri Jan 01 09:00:00 JST 1999" even on an environment
- which supports leap seconds.
- (Time.rfc2822): ditto.
- (Time.xmlschema): ditto.
-
-Thu Jun 16 08:29:22 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/dl/sym.c (rb_dlsym_call): needs FREE_ARGS before return.
- fixed memory leak. [ruby-Bugs-2034]
-
-Wed Jun 15 18:26:39 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: support "tk inactive" sub-command [for Tcl/Tk8.5a3]
-
- * ext/tk/lib/tk/namespace.rb: support "namespace path" sub-command and
- 'namespace ensemble' sub-command [for Tcl/Tk8.5a3]
-
-Tue Jun 14 02:02:43 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c: add TkUtil::CallbackSubst.subst_arg(m, ...) &
- _define_attribute_aliases(hash) to get substitution-argument from
- attributes (e.g. subst_arg(:x,:y,:num,:button) --> "%x %y %b %b ").
-
- * ext/tk/lib/tk/event.rb: use _define_attribute_aliases().
-
-Mon Jun 13 13:01:05 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * hash.c (ruby_setenv): fixed SEGV. [ruby-dev:26186]
-
-Mon Jun 13 01:54:20 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * signal.c (sigexit): call rb_thread_signal_exit() instead of
- rb_exit(). [ruby-dev:26347]
-
- * eval.c (rb_thread_signal_exit): a new function to exit on main
- thread.
-
- * eval.c (rb_thread_switch): exit status should be retrieved from
- ruby_errinfo.
-
- * eval.c (rb_f_exit): ensure exit(0) should call
- exit(EXIT_SUCCESS).
-
-Mon Jun 13 01:20:02 2005 Tanaka Akira <akr@m17n.org>
-
- * eval.c (rb_gc_mark_threads): curr_thread may not be part of the
- thread list. [ruby-dev:26312]
-
-Fri Jun 10 23:35:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * missing/mkdir.c: remove. [ruby-core:05177]
-
-Fri Jun 10 22:54:26 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * missing.h: fd_set stuffs need sys/types.h. fixed: [ruby-core:05179]
-
-Thu Jun 9 23:58:12 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/Win32API/Win32API.c (Win32API_Call): disable global
- optimization. fixed: [ruby-core:05143]
-
-Thu Jun 9 23:35:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enum.c (enum_inject): default the result value to Qundef to use
- first element as initial value if not given.
-
-Thu Jun 9 19:55:41 2005 Tanaka Akira <akr@m17n.org>
-
- * eval.c (ruby_longjmp): new macro to call longjmp, setcontext, etc.
- (ruby_setjmp): new macro to call setjmp, getcontext, etc.
- (ruby_setjmp): call setjmp before getcontext to avoid IA64 register
- stack problem.
- [ruby-talk:144939]
-
- * gc.c (Init_stack): remove IA64_MAGIC_STACK_LIMIT.
-
-Thu Jun 9 11:55:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/delegate.rb (SimpleDelegator::__setobj__): need check for
- recursive delegation. [ruby-core:04940]
-
-Wed Jun 8 18:47:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-expr-beg): fix looking point drift.
-
-Wed Jun 8 11:11:34 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (get2comp): calculate proper 2's complement for
- negative numbers. a bug in normalizing negative numbers
- reported from Honda Hiroki <hhonda@ipflex.com>.
-
-Wed Jun 8 08:33:10 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enum.c (enum_min_by, enum_max_by): return nil if no iteration.
- fixed: [ruby-dev:26245]
-
- * eval.c (rb_need_block): ensure a block is given.
-
- * eval.c (backtrace): skip successive frames sharing same node.
-
-Wed Jun 8 00:15:08 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (ruby_getaddrinfo__aix): merged a patch from
- KUBO Takehiro <kubo at jiubao.org> to support AIX. [ruby-list:40832]
-
-Wed Jun 8 00:09:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/yaml/rubytypes.rb (Array::to_yaml): merged a patch from
- Tilman Sauerbeck <tilman at code-monkey.de>. [ruby-core:05055]
-
- * lib/yaml/rubytypes.rb (Hash::to_yaml): ditto.
-
-Wed Jun 8 00:00:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/curses/curses.c (curses_insertln): merged a patch from
- TAKAHASHI Tamotsu <ttakah at lapis.plala.or.jp>. [ruby-ext:02305]
-
-Tue Jun 7 19:34:15 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/init.rb (IRB::IRB.rc_file_generators): more flexible
- IRB.rc_file_generators. [ruby-core:05163]
-
-Tue Jun 7 18:39:31 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/thread.rb: RDoc documentation from Eric Hodel
- <drbrain at segment7.net> added. [ruby-core:05148]
-
-Tue Jun 7 18:30:04 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): add .SUFFIXES from depend file.
- fixed: [ruby-dev:26294]
-
-Tue Jun 7 17:39:54 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (rb_mod_cvar_get): Module#class_variable_get(): back
- ported from CVS HEAD. [ruby-talk:144741]
-
- * object.c (rb_mod_cvar_set): Module#class_variable_set().
- [ruby-talk:144741]
-
-Tue Jun 7 16:32:53 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): raise exception on debug mode (-d),
- not verbose mode (-v/-w). [ruby-core:05123]
-
-Tue Jun 7 10:30:49 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: slave-ip fails to call procedures
- delegated by master-ip.
-
-Sun Jun 5 23:00:35 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/console.rb: create console when required
-
- * ext/tk/sample/tkextlib/tile/demo.rb: fix TypeError & create Console
-
-Sat Jun 4 14:55:18 2005 Tanaka Akira <akr@m17n.org>
-
- * test/dbm/test_dbm.rb: merged from ext/dbm/testdbm.rb.
-
- * test/gdbm/test_gdbm.rb: merged from ext/gdbm/testgdbm.rb.
-
- * test/sdbm/test_sdbm.rb: renamed from ext/sdbm/testsdbm.rb with
- modification to use test/unit.
-
-Fri Jun 3 14:06:12 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: fix typo.
-
-Wed Jun 1 11:32:42 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: can use single quote character in DESTDIR.
- [ruby-dev:26205]
-
-Mon May 30 23:48:29 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/macpkg.rb: add PACKAGE_NAME information of Tcl/Tk
- Extension.
-
- * ext/tk/lib/tk/msgcat.rb: ditto.
-
- * ext/tk/lib/tk/winpkg.rb: ditto.
-
- * ext/tk/lib/tkextlib/*: ditto.
-
-Sat May 28 16:40:15 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * test/openssl/test_x509store.rb: add test for expired CRL
- and refine some assertions.
-
-Sat May 28 05:15:51 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509store.c (ossl_x509stctx_set_time): should
- not set internal flag directry.
-
-Sat May 28 02:00:11 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
- ENV["REQUEST_URI"] is better to get correct Request-URI
- than ENV["SCRIPT_NAME"] + ENV["PATH_INFO"]. [ruby-dev:26235]
-
-Fri May 27 16:32:04 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/mkmf.rb: use the semicolon as the path separator
- in the environment of MSYS. fixed: [ruby-dev:26232]
-
-Thu May 26 06:08:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add shortcut-methods of tk_call + tk_split_list
-
-Wed May 25 22:52:42 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/irb/input-method.rb: do not use Readline::HISTORY.pop.
- (backported from HEAD)
-
-Wed May 25 21:55:40 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * ext/readline/readline.c: supported libedit. (backported from HEAD)
-
- * ext/readline/extconf.rb: ditto.
-
- * test/readline/test_readline.rb: ditto.
-
-Wed May 25 20:06:27 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: TkComm#tk_split_*list fail to split a kind of SJIS
- strings. To avoid the trouble, add arguments to control converting
- encoding, and do split on a UTF8 string.
-
- * ext/tk/lib/multi-tk.rb: modify to attend encoding.
-
- * ext/tk/lib/remote-tk.rb: ditto.
-
- * ext/tk/lib/tk/itemconfig.rb: ditto.
-
- * ext/tk/lib/tk/listbox.rb: ditto.
-
- * ext/tk/lib/tk/namespace.rb: ditto.
-
- * ext/tk/lib/tk/panedwindow.rb: ditto.
-
- * ext/tk/lib/tk/text.rb: ditto.
-
- * ext/tk/lib/tk/textmark.rb: ditto.
-
- * ext/tk/lib/tk/texttag.rb: ditto.
-
- * ext/tk/lib/tk/variable.rb: ditto.
-
- * ext/tk/lib/tk/winfo.rb: ditto.
-
- * ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb: ditto.
-
- * ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb: ditto.
-
- * ext/tk/lib/tk.rb: add TkWindow#lower_window/raise_window and
- Tk#lower_window/raise_window by reason of method-name conflict
-
- * ext/tk/lib/tk/canvas.rb: bug fix on TkCanvas#delete when given
- non-TkcItem arguments.
-
- * ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb: ditto.
-
-Wed May 25 12:59:48 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (OpenURI::Meta::RE_QUOTED_STRING): a content of
- quoted-string should be zero or more characters.
-
-Tue May 24 23:42:16 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * numeric.c (fix_pow): support Fixnum ** Float case directly
- without coercing. [ruby-talk:142697] [ruby-talk:143054]
-
-Tue May 24 16:57:24 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ruby.c (require_libraries): caused SEGV when continuation jumped
- in to the required library code.
-
-Tue May 24 11:56:25 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/getopts.rb: should warn only if verbose mode.
- fixed: [ruby-dev:26201]
-
-Tue May 24 06:45:31 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): string
- literals to be matched non-greedy.
-
-Tue May 24 00:34:32 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/calc: method name 'set' was able to crash with a class Set.
- [ruby-dev:26210]
-
- * test/wsdl/document/test_rpc.rb: dateTime comparison failed under
- TZ=right/Asia/Tokyo (with leap second.) [ruby-dev:26208]
-
-Mon May 23 16:24:05 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/extconf.rb: Framework support on MacOS X Tiger.
-
- * ext/tcltklib/README.1st: add description of Framework support options.
-
-Mon May 23 12:21:37 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * re.c (make_regexp): should not return junk address during
- compile time. [ruby-dev:26206]
-
-Sun May 22 21:54:06 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.4.
-
- == SOAP client and server ==
-
- === for both client side and server side ===
-
- * improved document/literal service support.
- style(rpc,document)/use(encoding, literal) combination are all
- supported. for the detail about combination, see
- test/soap/test_style.rb.
-
- * let WSDLEncodedRegistry#soap2obj map SOAP/OM to Ruby according to
- WSDL as well as obj2soap. closes #70.
-
- * let SOAP::Mapping::Object handle XML attribute for doc/lit service.
- you can set/get XML attribute via accessor methods which as a name
- 'xmlattr_' prefixed (<foo name="bar"/> -> Foo#xmlattr_name).
-
- === client side ===
-
- * WSDLDriver capitalized name operation bug fixed. from
- 1.5.3-ruby1.8.2, operation which has capitalized name (such as
- KeywordSearchRequest in AWS) is defined as a method having
- uncapitalized name. (converted with GenSupport.safemethodname
- to handle operation name 'foo-bar'). it introduced serious
- incompatibility; in the past, it was defined as a capitalized.
- define capitalized method as well under that circumstance.
-
- * added new factory interface 'WSDLDriverFactory#create_rpc_driver'
- to create RPC::Driver, not WSDLDriver (RPC::Driver and WSDLDriver
- are merged). 'WSDLDriverFactory#create_driver' still creates
- WSDLDriver for compatibility but it warns that the method is
- deprecated. please use create_rpc_driver instead of create_driver.
-
- * allow to use an URI object as an endpoint_url even with net/http,
- not http-access2.
-
- === server side ===
-
- * added mod_ruby support to SOAP::CGIStub. rename a CGI script
- server.cgi to server.rb and let mod_ruby's RubyHandler handles the
- script. CGIStub detects if it's running under mod_ruby environment
- or not.
-
- * added fcgi support to SOAP::CGIStub. see the sample at
- sample/soap/calc/server.fcgi. (almost same as server.cgi but has
- fcgi handler at the bottom.)
-
- * allow to return a SOAPFault object to respond customized SOAP fault.
-
- * added the interface 'generate_explicit_type' for server side
- (CGIStub, HTTPServer). call 'self.generate_explicit_type = true'
- if you want to return simplified XML even if it's rpc/encoded
- service.
-
- == WSDL ==
-
- === WSDL definition ===
-
- * improved XML Schema support such as extension, restriction,
- simpleType, complexType + simpleContent, ref, length, import,
- include.
-
- * reduced "unknown element/attribute" warnings (warn only 1 time for
- each QName).
-
- * importing XSD file at schemaLocation with xsd:import.
-
- === code generation from WSDL ===
-
- * generator crashed when there's '-' in defined element/attribute
- name.
-
- * added ApacheMap WSDL definition.
-
- * sample/{soap,wsdl}: removed.
-
-Sun May 22 19:11:35 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#intialize):
- should initialize session id context. [ruby-core:4663]
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): add session id support.
-
-Sat May 21 10:24:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: tds files were not deleted when DESTDIR
- included '\' path delimiter. [ruby-dev:26193]
-
-Thu May 19 19:04:29 2005 speakillof <speakillof@yahoo.co.jp>
-
- * lib/rexml/encodings/SHIFT-JIS.rb: encoding and decoding were
- swapped. [ruby-core:4772]
-
-Wed May 18 23:42:25 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (exc_exception): reverted to call Exception#initialize
- directly. fixed: [ruby-dev:26177]
-
-Wed May 18 23:39:09 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): get rid of using String. [ruby-dev:26180]
-
- * dir.c (push_braces): should skip balanced braces.
-
- * eval.c (ruby_options), win32/win32.c (NtInitialize): move argument
- intialization back. [ruby-dev:26180]
-
-Tue May 17 15:31:31 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should
- break the loop if the socket reached to EOF. [ruby-talk:142285]
-
-Tue May 17 11:52:18 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (unixtime_to_filetime): use localtime() instead of
- gmtime() when using FileLocalTimeToFileTime().
-
-Mon May 16 22:28:43 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.h, {bcc32,win32,wince}/Makefile.sub: moved rb_[ugp]id_t
- to get rid of redefinition warnings on mingw.
-
- * class.c (rb_class_init_copy): singleton class is disallowed to copy,
- from its definition. fixed: [ruby-talk:142749]
-
-Mon May 16 08:52:29 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.{h,c}: define rb_[pgu]id_t.
-
-Mon May 16 00:21:02 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#unlink): use SystemCallError instead of
- Errno::EISDIR because EISDIR is not portable.
- [ruby-core:5001]
-
-Sun May 15 22:11:33 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (DRbObject#method_missing): use raise(exception).
- [ruby-dev:26164]
-
-Sun May 15 18:56:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in, ruby.h: define rb_[pgu]id_t macros instead of typedefs
- to get rid of types which might not be defined yet. [ruby-dev:26165]
-
-Sun May 15 14:35:46 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#unlink): unlink a symlink to a directory
- was failed. [ruby-core:4992]
-
-Sun May 15 09:57:30 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/win32.c (unixtime_to_filetime): deal with DST.
- [ruby-talk:141817]
-
-Sat May 14 23:59:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (exc_exception, {exit,name_err,syserr}_initialize): call
- Execption#initialize. fixed: [ruby-talk:142593]
-
-Sat May 14 23:57:26 2005 Erik Huelsmann <ehuels@gmail.com>
-
- * configure.in: Check for the availability of pid_t, gid_t and uid_t and
- remove AC_TYPE_UID_T. fixed: [ruby-core:04745]
-
- * defines.h: Remove pid_t typedef.
-
- * ruby.h: Define rb_pid_t, rb_gid_t and rb_uid_t in accordance with
- the available system types.
-
- * process.c: Change instances of pid_t and gid_t to their rb_*
- counterparts.
-
- * ext/pty/pty.c: Change pid_t to rb_pid_t.
-
- * vms/config.h: Define HAVE_{P,G,U}ID_T to 1.
-
- * win32/Makefile.sub: Remove #define for {g,u}id_t.
-
- * win32/win32.c: Change pid_t to rb_pid_t.
-
- * wince/Makefile.sub: Remove #define for {g,u}id_t.
-
- * wince/sys/types.h: Remove definitions of {p,g,u}id_t.
-
-Fri May 13 23:44:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: keep srcdir unexpanded.
-
- * lib/mkmf.rb (create_makefile): quote topdir and hdrdir if necessary.
- fixed: [ruby-core:04932]
-
- * lib/mkmf.rb (configuration), {bcc32,win32,wince}/Makefile.sub: make
- also INSTALL_PROG and INSTALL_DATA system dependent.
- fixed: [ruby-core:04931]
-
-Fri May 13 17:54:39 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * variable.c (generic_ivar_get): rb_attr_get should not warn.
- [ruby-dev:26010]
-
-Fri May 13 12:28:43 2005 Daniel Berger <djberge@qwest.com>
-
- * array.c (rb_ary_select): can remove argc check. [ruby-core:4911]
-
- * test/ruby/test_array.rb: add test for find_all.
-
-Fri May 13 11:29:00 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval.c (unknown_node): add volatile directive to prototype.
-
-Thu May 12 17:08:48 2005 Tanaka Akira <akr@m17n.org>
-
- * io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
- (swallow, rb_io_each_byte, rb_io_getc): revert previous change.
-
- * io.c (rb_io_eof, io_fread, appendline, swallow, rb_io_each_byte)
- (rb_io_getc, rb_getc): call clearerr before getc to avoid
- stdio incompatibility.
-
-Thu May 12 16:52:20 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/rdoc/parsers/parse_c.rb: more readability for mixing
- progress "c..." and warning message.
-
-Thu May 12 16:31:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 2.0.5
-
-Thu May 12 16:15:01 2005 Tanaka Akira <akr@m17n.org>
-
- * io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
- (swallow, rb_io_each_byte, rb_io_getc): don't rely EOF flag.
- [ruby-talk:141527]
-
-Thu May 12 15:56:20 2005 Tilman Sauerbeck <tilman@code-monkey.de>
-
- * lib/rdoc/parsers/parse_c.rb: show parsing progress for C files.
- [ruby-core:4341]
-
-Thu May 12 13:47:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * test/drb/test_drb{ssl,unix}.rb: can test drb
- before install. (backported from HEAD) [ruby-dev:26146]
-
-Thu May 12 09:53:57 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * version.c (ruby_show_version): flush for non-tty stdout.
-
-Thu May 12 09:07:07 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * test/ruby/envutil.rb, test/drb/drbtest.rb: can test drb
- before install. (backported from HEAD) [ruby-Bugs-1672]
-
-Thu May 12 01:23:55 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval), parse.y (arg): reduce fixnum range literal at
- parser. fixed: [ruby-dev:26113]
-
- * eval.c (unknown_node): ignore broken NODE to get rid of accessing
- possibly inaccessible address. fixed: [ruby-dev:26122]
- should emit more useful information like [ruby-dev:26126], though.
-
-Wed May 11 16:20:01 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb: new methods WEBrick::CGI#[], WEBrick::CGI#logger
- and WEBrick::CGI#config. (backported from HEAD)
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape_path): should
- not use String#split("/"). (backported from HEAD)
-
-Wed May 11 15:58:39 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (break_jump): break should not cross functions.
- [ruby-list:40818]
-
-Wed May 11 10:39:37 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/tempfile.rb (Tempfile#unlink): fixed typo.
-
-Wed May 11 01:03:36 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (TMP_ALLOC): use macro NEW_NODE() to get rid of warnings on
- platforms which have no alloca(). fixed: [ruby-talk:141301]
-
-Sun May 8 23:17:47 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/timer.rb: fix typo.
-
-Sun May 8 16:52:56 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/profiler.rb: fixed "undefined method `[]' for nil:NilClass"
- [ruby-core:4775] [ruby-talk:140401] [ruby-dev:26118]
-
-Sat May 7 22:58:00 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (have_var): no libs argument is given.
-
-Sun May 1 09:58:11 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (process_sflag): replace '-' in variable names with '_'.
- [ruby-dev:26107]
-
- * ruby.c (set_arg0): use also environment variable space for setting
- $0. [ruby-core:04774]
-
-Wed Apr 27 23:42:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/Makefile.sub (OPTFLAGS): default global optimization to
- disabled only for VC++6.
-
-Tue Apr 26 22:58:00 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_invoke_core): call Tcl's "::unknown"
- command when can't get information of target command.
-
-Mon Apr 25 01:18:43 2005 Tanaka Akira <akr@m17n.org>
-
- * regex.c: declare rb_warn to have variadic argument. [ruby-core:4751]
-
-Sat Apr 23 19:45:59 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c (ip_RubyExitCommand): exit with status code
- via TclTkIp#_eval didn't work. [ruby-talk:139390]
-
-Fri Apr 22 16:41:50 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c (ip_set_exc_message): fixed memory leak.
-
- * ext/tcltklib/tcltklib.c: eTkCallbackReturn was not initialized.
-
-Thu Apr 21 00:07:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): support platforms have file separator
- other than /.
-
- * {bcc32,win32,wince}/Makefile.sub (BUILD_FILE_SEPARATOR): separator
- of building platform.
-
- * {bcc32,win32,wince}/Makefile.sub (CP, INSTALL): use COPY command.
-
-Wed Apr 20 23:22:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in, common.mk: miniruby depens on MINIOBJS.
-
- * dmydln.c (dln_load): dummy function to raise LoadError.
-
- * cygwin/GNUmakefile.in, {bcc32,win32,wince}/Makefile.sub: miniruby
- can't load extensions on Windows.
-
-Wed Apr 20 23:01:35 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * win32/ifchange.bat: delete testing files.
-
-Wed Apr 20 07:27:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * {bcc32,win32,wince}/configure.bat, {bcc32,win32,wince}/setup.mak:
- add extout option.
-
- * bcc32/setup.mak: make configuration variables overridable.
-
-Wed Apr 20 04:15:27 2005 Keiju Ishitsuka <keiju@ruby-lang.org>
-
- * lib/irb.rb lib/irb/* doc/irb: IRB 0.9.5
-
-Tue Apr 19 23:37:09 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/ftools.rb (File.safe_unlink): do not modify a symlinked file.
-
-Tue Apr 19 00:06:20 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: expand path for ext/**/extconf.rb.
-
-Mon Apr 18 11:25:14 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/zlib/zlib.c (zstream_run): fixed SEGV. [ruby-core:4712]
-
-Sun Apr 17 23:57:49 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake, parse_args): do not expand destdir.
-
- * ext/extmk.rb (relative_from): treat mere drive letter as an absolute
- path.
-
-Sat Apr 16 17:01:16 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * sample/rss/tdiary_plugin/rss-recent.rb (rss_recent_cache_rss):
- use the first date information of items as site date information
- if channel doesn't have date information.
-
-Sat Apr 16 15:27:03 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (RUBY_PROG_INSTALL): not add -p option to INSTALL.
- files need timestamps to be kept are only ar-archive on a few
- platforms, and be installed by instruby.rb but not INSTALL.
- fixed: [ruby-core:04721]
-
- * mkconfig.rb: purge autoconf value variables.
-
-Sat Apr 16 10:36:01 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: quick hack... prepend DESTDIR.
- still have restriction on DESTDIR ("", "/", "e:")
-
-Sat Apr 16 03:59:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: check for OPENSSL_cleanse.
-
- * ext/openssl/openssl_missing.h: ditto.
-
-Thu Apr 14 19:18:30 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (remove_file): ignore exceptions caused by
- chmod.
-
- * lib/fileutils.rb (remove_dir): try to get rights to rmdir.
- [ruby-Bugs:1502] (2 items backportted from HEAD, rev 1.53-54)
-
-Thu Apr 14 16:57:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bcc32/Makefile.sub: failed to remove debug information files.
- fixed: [ruby-dev:26034]
-
-Wed Apr 13 23:40:21 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb (RSS::VERSION): 0.1.3 -> 0.1.4.
-
- * lib/rss/rss.rb (RSS::Element#converter): fixed converter
- transmission bug.
-
-Wed Apr 13 21:20:35 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (mingw32): extract msvcr*.dll from objdump result.
-
-Wed Apr 13 20:24:30 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (mingw32): use actual runtime DLL name as ruby DLL
- name and default load path.
-
- * win32/Makefile.sub, win32/setup.mak: ditto.
-
-Tue Apr 12 15:33:09 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_finalize): better modification than the
- previous commit [ruby-dev:26029].
-
-Tue Apr 12 12:38:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_finalize): fix SEGV when Tcl_GlobalEval()
- modifies the argument string to eval.
-
-Tue Apr 12 02:21:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_finalize): add existence check of
- Tcl commands before calling Tcl_GlobalEval().
-
-Mon Apr 11 23:47:21 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: [druby-ja:123] fix: When reference of my object is
- loaded, the object is tainted.
-
- * test/drb/test_drb.rb: ditto.
-
-Mon Apr 11 22:18:23 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * dir.c, file.c (lstat): avoid warnings for mingw.
-
-Mon Apr 11 20:11:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_finalize): adhoc patch to avoid SEGV
- when exit on Tcl/Tk8.3.x.
-
-Mon Apr 11 15:26:25 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (configuration): shouldn't output hdrdir twice.
-
-Mon Apr 11 12:09:05 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * {bcc32,win32,wince}/Makefile.sub: ri data was not installed
- into correct path. [ruby-dev:26011]
-
- * bcc32/Makefile.sub: defaulted install-nodoc. [ruby-dev:26011]
-
-Sun Apr 10 10:12:42 2005 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c(ole_invoke): retry after converting Qnil
- to VT_EMPTY.
-
- * ext/win32ole/win32ole/tests/testWIN32OLE.rb: correct error
- message string "Unknown" => "unknown".
-
-Sat Apr 9 18:20:31 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/image.rb: support to create TkImage object without
- creating a new image object on Tk.
-
- * ext/tk/lib/tk/menu.rb: use TkCommandNames on create_self()
-
- * ext/tk/lib/tk/root.rb: TkRoot.to_eval() returns '.'.
-
- * ext/tk/lib/tk/text.rb: add methods to create a TkText::IndexString
- from (x, y) coords.
-
- * ext/tk/lib/tkextlib/tile/: add demo and update support status.
-
-Sat Apr 9 14:42:29 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * sample/rss/tdiary_plugin/rss-recent.rb: supported configuration
- via Web browser.
-
-Sat Apr 9 11:59:57 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss: backoported from HEAD.
-
- * lib/rss: refactored.
- - gave a name to 'x'.
- - undef_method -> remove_method for avoiding a warning in ruby 1.6.
-
-
- * lib/rss/parser.rb: @@setter -> @@setters.
-
- * lib/rss/parser.rb
- (RSS::BaseListener.register_uri)
- (RSS::BaseListener.uri_registered?)
- (RSS::BaseListener.install_get_text_element):
- swapped the first argument and the second argument.
-
- * lib/rss/taxonomy.rb: swapped the first argument and the second
- argument for RSS::BaseListener.install_get_text_element.
- * lib/rss/image.rb: ditto.
- * lib/rss/syndication.rb: ditto.
- * lib/rss/dublincore.rb: ditto.
- * lib/rss/parser.rb: ditto.
- * lib/rss/1.0.rb: ditto.
- * lib/rss/2.0.rb: ditto.
- * lib/rss/0.9.rb: ditto.
- * lib/rss/content.rb: ditto.
-
- * lib/rss/parser.rb
- (RSS::BaseListener.install_setter)
- (RSS::BaseListener.register_uri): changed fallback way.
-
- * lib/rss/parser.rb: added class name registry for complex model
- elements. (ex. have childlen elements, have some attributes and
- a child element and so on.)
-
-
- * lib/rss/dublincore.rb: supported multiple Dublin Core items.
- * lib/rss/maker/dublincore.rb: ditto.
-
- * lib/rss/maker/image.rb: supproted new Dublin Core API.
-
-
- * lib/rss/maker/base.rb: added default current_element implementation.
-
-
- * lib/rss/trackback.rb (RSS::TrackBackUtils.new_with_value_if_need):
- moved to RSS::Utils.
-
- * lib/rss/utils.rb (RSS::Utils.new_with_value_if_need):
- moved from RSS::TrackBackUtils.
-
-
- * lib/rss/maker/image.rb: fixed invalid argument of
- add_need_initialize_variable bug.
- * lib/rss/maker/trackback.rb: ditto.
-
-
- * lib/rss/rss.rb (Hash#merge): added for ruby 1.6.
-
- * lib/rss/rss.rb (RSS::BaseModel.date_writer): changed to accept nil
- for date value.
-
-
- * test/test_dublincore.rb: added tests for plural accessor and
- multiple Dublin Core items.
-
- * test/test_setup_maker_1.0.rb: fixed swapped actual and expected
- values.
-
- * test/rss/rss-assertions.rb (assert_multiple_dublin_core): added
- an assertion for testing multiple Dublin Core items.
-
- * test/rss/test_maker_dc.rb (test_rss10_multiple): added a test
- for making multiple Dublin Core items.
-
- * test/rss/test_maker_dc.rb (test_date): added a test for #date=
- and #dc_date=.
-
-
- * sample/rss/tdiary_plugin/rss-recent.rb:
- new option: @options['rss-recent.use-image-link']:
- use image as link instread of text if available.
-
- * sample/rss/tdiary_plugin/rss-recent.rb (RSS_RECENT_VERSION):
- 0.0.5 -> 0.0.6.
-
-Fri Apr 8 20:17:48 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): hdrdir needs to be defined also in
- Config::CONFIG.
-
- * lib/mkmf.rb (configuration, create_makefile): get rid of recursive
- macro reference.
-
-Fri Apr 8 18:26:56 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c: add callbacks to OpenSSL::SSL::SSLContexts.
- - SSLContext#client_cert_cb=(aProc). it is called when a client
- certificate is requested by a server and no certificate was not
- set for the SSLContext. it must return an Array which includes
- OpenSSL::X509::Certificate and OpenSSL::PKey::RSA/DSA objects.
- - SSLContext#tmp_dh_callback=(aProc). it is called in key
- exchange with DH algorithm. it must return an OpenSSL::PKey::DH
- object.
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): ignore the
- argument if it's nil.
-
- * ext/openssl/ossl_pkey.c
- (GetPrivPKeyPtr, ossl_pkey_sign): should call rb_funcall first.
- (DupPrivPKeyPtr): new function.
-
- * ext/openssl/ossl_pkey_dh.c: add default DH parameters.
-
- * ext/openssl/ossl_pkey.h: ditto.
-
-Fri Apr 8 01:55:20 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/demos-{en,jp}/goldberg.rb: reduced window size.
- [ruby-dev:25992]
-
-Thu Apr 7 23:58:40 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): keep directory names in Makefile as macros.
-
- * lib/mkmf.rb (configuration, create_makefile): ditto.
-
- * lib/mkmf.rb (CXX_EXT): separate C++ extensions.
-
-Thu Apr 7 17:43:25 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * eval.c (rb_call0): "return" event hook should be always executed
- if event_hooks is set. fixed: [ruby-core:04662]
- (backported from HEAD)
-
-Mon Apr 4 23:17:52 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb (TkComm#array2tk_list): accept enc-mode argument to
- decide whether convert encoding of each element or not.
-
- * ext/tk/lib/tk/variable.rb (TkVariable#value=): fail to convert the
- encoding of array elements when assign an array to an TkVariable
- object.
-
-Mon Apr 4 10:26:48 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tk/lib/tk/dialog.rb: fixed typo.
-
-Sun Apr 3 17:16:33 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.{h,c} (rb_w32_fdopen): avoid warning on bcc32.
- (backported from HEAD)
-
-Sat Apr 2 23:38:54 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (CP, INSTALL): get rid of less portable options.
-
- * lib/mkmf.rb (configuration, create_makefile): correct configuration
- variable.
-
- * {bcc32,win32,wince}/{Makefile.sub,setup.mak}: leave prefix empty in
- config.status for backward compatibility. fixed: [ruby-core:04649]
-
- * lib/mkmf.rb (create_makefile): ensure library directories get made
- before copying libraries there.
-
-Sat Apr 2 16:59:46 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: forgot to update RELEASE_DATE
-
- * ext/tk/lib/tk/variable.rb: fix namespace trouble when autoloading
-
- * ext/tk/lib/tk/palette.rb: define Tcl variable 'tkPalette' as global
-
- * ext/tk/lib/tk/dialog.rb: use array2tk_list method when calling
- Tk.ip_eval.
-
- * ext/tk/lib/tk/autoload.rb: add autoload entry 'TkDialogObj' and
- 'TkWarningObj'
-
-Sat Apr 2 02:19:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb (TkWindow.initialize): accept 'without_creating'
- option without 'widgetname' option to allow creating a widget object
- which is used as an argument of Tcl/Tk's widget allocation commands.
-
- * ext/tk/lib/tk/image.rb (TkImage.initialize): accept 'imagename'
- option to create a image object by the given name.
-
-Thu Mar 31 22:23:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (SRC_EXT): exclude just case different suffixes on case
- insensitive file system platforms.
-
- * README.EXT, README.EXT.ja (Appendix C): utility functions.
-
-Thu Mar 31 14:15:44 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_engine.c (ossl_engine_s_load): should return
- value. [ruby-dev:25971]
-
-Thu Mar 31 08:25:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * common.mk (RUBYOPT): clear for the environment RubyGems installed.
-
- * common.mk (clean-local): keep $(PREP) files till distclean.
-
- * common.mk (check): do all tests.
-
-Thu Mar 31 06:00:20 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_engine.c (ossl_engine_s_load): should not raise
- error even if the specified engine could not be loaded. (Dynamic
- engines don't have fixed name to load.)
-
-Thu Mar 31 00:18:27 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/ifchange.bat, win32/rm.bat: backported from HEAD.
-
-Wed Mar 30 23:44:50 2005 Nobuyoshi Nakada <nobu.nokada@softhome.net>
-
- * Makefile.in, */Makefile.sub, */configure.bat,
- cygwin/GNUmakefile.in, common.mk, configure.in, ext/extmk.rb,
- lib/mkmf.rb, instruby.rb, runruby.rb: backport extout.
- [ruby-dev:25963]
-
-Wed Mar 30 17:41:48 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: add TclTkIp#_create_console() method to
- create a Tcl/Tk's console window.
-
- * ext/tk/lib/multi-tk.rb: support TclTkIp#_create_console() method.
-
- * ext/tk/lib/remote-tk.rb: ditto.
-
- * ext/tk/lib/tk/console.rb: ditto.
-
- * ext/tk/lib/tk.rb: update RELEASE_DATE
-
- * ext/tk/sample/demo-*/check2.rb: use 'return' in the Proc object.
-
- * ext/tk/sample/tkextlib/**: ditto.
-
-Tue Mar 29 22:11:56 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/rinda/test_rinda.rb: use DRbObject.new_with instead of reinit.
- [ruby-dev:25961]
-
-Mon Mar 28 23:40:40 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: move method DRbObject#reinit to DRbObject.new_with.
- extract method DRbObject.prepare_backtrace. add DRb.regist_server,
- remove_server, fetch_server. change server in thread variable if
- in-proc server. [druby-ja:113]
-
- * lib/drb/gw.rb: ditto.
-
-Mon Mar 28 20:43:34 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/syck/rubyext.c: get rid of warnings caused by a bug of VC.
-
-Mon Mar 28 08:39:49 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (iconv_create): Iconv::Failure requires 3
- arguments. (pointed out by NaHi)
-
-Sat Mar 26 22:51:33 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb (_callback_entry_class?): add for checking whether
- a class is available for a callback entry.
-
- * ext/tk/lib/tk.rb (after_cancel): add Tk.after_cancel(afterID) method.
-
- * ext/tk/lib/tk.rb (array2tk_list): change from private module method
- of TkComm to public module method.
-
- * ext/tk/lib/tk.rb (cget): add check that slot argument is not
- empty string.
-
- * ext/tk/lib/tk.rb (configinfo): ditto.
-
- * ext/tk/lib/tk/itemconfig.rb (itemcget): add check that slot argument
- is not empty string.
-
- * ext/tk/lib/tk/itemconfig.rb (itemconfiginfo): ditto.
-
- * ext/tk/lib/tk/entry.rb: add TkEntry#icursor and icursor= (alias of
- cursor and cursor= method).
-
- * ext/tk/lib/tk/font.rb: improve font treatment when the font name is
- empty string.
-
- * ext/tk/lib/tk/variable.rb: add :variable, :window and :procedure
- type.
-
- * ext/tk/lib/tk/variable.rb: improve treatment of array-type
- tkvariable.
-
- * ext/tk/lib/tkextlib/blt.rb: add commands for zooming.
-
- * ext/tk/lib/tkextlib/blt/*: bug fix.
-
- * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and add methods
- to call TreeCtrl commands for bindings.
-
- * ext/tk/sample/tkextlib/blt/*: new sample scripts.
-
- * ext/tk/sample/tkextlib/treectrl/*: ditto.
-
-Fri Mar 25 10:53:16 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (WIN32_LEAN_AND_MEAN): removed because a lot of
- troubles. [ruby-list:40721]
-
-Thu Mar 24 23:10:44 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (macro_defined?): try to compile for an old compiler
- which doesn't bail out at #error directive. [ruby-dev:25818]
-
- * lib/mkmf.rb (check_sizeof): refine logging messages.
-
-Thu Mar 24 03:57:48 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/utils.rb (WEBrick::Utils.create_listeners):
- - should raise ArgumentError if no port is specified.
- - even if the specified port is 0, all TCPServers should be
- initialized with the port given to the first one.
-
- * lib/webrick/server.rb (WEBrick::GenericServer#initialize): if :Port
- parameter is 0, it should be updated with the port number which
- actually listened.
-
-Wed Mar 23 00:35:10 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/ruby/test_settracefunc.rb (test_event): added tests for
- "class" and "end" and "raise".
-
-Tue Mar 22 22:40:18 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * eval.c (rb_call0): check event_hooks instead of trace_func.
-
-Tue Mar 22 17:30:44 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * eval.c (rb_add_event_hook): new function to add a hook function for
- interpreter events. (backported form HEAD)
-
-Sun Mar 20 22:51:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (mkmf_failed): check if Makefile is created without
- create_makefile.
-
-Sat Mar 19 23:48:10 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-expr-beg): returned true always.
- fixed: [ruby-list:40683]
-
-Sat Mar 19 00:41:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/font.rb: add some TkFont class methods to get font
- information without creating a TkFont object.
-
- * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and define some
- classes for components of Tk::TreeCtrl
-
-Thu Mar 17 17:42:13 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * struct.c (make_struct): allow non local-id field
- names. [ruby-core:04575]
-
- * struct.c (inspect_struct): ditto.
-
-Wed Mar 16 23:36:02 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * eval.c (rb_call0): call_cfunc() should be protected.
-
- * test/ruby/test_settracefunc.rb: added test for c-return.
-
-Wed Mar 16 22:20:25 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * object.c (str_to_id): fixed typo.
-
-Wed Mar 16 18:08:32 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): reorganize "return" event post.
-
-Tue Mar 15 23:49:19 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (Init_iconv): InvalidEncoding also should include
- Iconv::Failure.
-
-Tue Mar 15 16:38:11 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c (ary2list): give wrong arguments to hash2kv()
-
-Mon Mar 14 19:39:33 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/timer.rb (TkTimer): forgot to clear @return_value
- when restarting
-
- * ext/tk/lib/tk/sample/cd_timer.rb: new sample of TkRTTimer
-
-Mon Mar 14 12:21:03 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/timer.rb (TkRTTimer): forgot to reset the callback
- time. So, 'continue' do all callbacks between 'stop' and 'continue'.
-
-Mon Mar 14 08:14:56 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (str_to_id): warn for NUL containing strings.
-
-Mon Mar 14 00:13:49 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/timer.rb (TkRTTimer): correct calculation of offset
- value. get a little better accuracy.
-
- * ext/tk/sample/demos-en/widget: use a binding with no local variables
- when eval a sample script.
-
- * ext/tk/sample/demos-en/bind.rb: ditto.
-
- * ext/tk/sample/demos-en/tcolor: ditto.
-
- * ext/tk/sample/demos-jp/widget: ditto.
-
- * ext/tk/sample/demos-jp/bind.rb: ditto.
-
- * ext/tk/sample/demos-jp/tcolor: ditto.
-
-Sun Mar 13 10:04:17 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/rinda/test_rinda.rb: remove test_gc. [ruby-dev:25871]
-
-Thu Mar 10 19:12:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (lib_eventloop_ensure): mis-delete a timer
- handler when exit from a recursive called eventloop
-
- * ext/tk/lib/tk/timer.rb: new TkRTTimer class, which can works for a
- realtime operation
-
- * ext/tk/sample/tkrttimer.rb: sample of TkRTTimer class
-
- * ext/tk/lib/tk/textmark.rb: move TkTextMark#+ and TkTextMark#- to
- TkText::IndexModMethods
-
- * ext/tk/lib/tk/text.rb: improve TkTextMark#+ and TkTextMark#-, and
- add them to TkText::IndexModMethods module
-
- * ext/tk/sample/tktextio.rb: add test part of "seek by text index
- modifiers"
-
-Thu Mar 10 08:10:11 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * re.c (make_regexp): need to free internal regexp structure when
- compilation fails. [ruby-talk:133228]
-
-Wed Mar 9 20:25:58 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_write): call
- rb_sys_fail if errno isn't 0. [ruby-dev:25831]
-
- * ext/openssl/lib/openssl/cipher.rb: fix typo. [ruby-dev:24285]
-
-Wed Mar 9 15:46:35 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/server.rb (WEBrick::GenericServer#start): should
- restore @token if accept failure. suggested by Dominique Brezinski.
- [ruby-core:04518]
-
-Wed Mar 9 13:37:57 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tktextio.rb: fix bug of handling 'end' position.
- support initial text, overwrite setting and pos_gravity control.
-
-Tue Mar 8 18:16:55 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tktextio.rb: New sample script. TkTextIO class in this
- sample supports to use a text widget as if it is a I/O stream (such
- like as StringIO class).
-
-Tue Mar 8 13:54:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/socket.c: workaround for some of 4.4BSD-Lite derived OSs.
-
-Tue Mar 8 12:36:17 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c: document from Sam Roberts
- <sroberts@uniserve.com> for getsockopt and setsockopt is merged.
- [ruby-doc:824]
-
-Tue Mar 8 01:27:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.66
- fixed: [ruby-dev:25828]
-
-Mon Mar 7 21:35:02 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * sample/webrick/httpsd.rb: fix typo in comment. suggested by
- Kazuhiko Shiozaki.
-
-Mon Mar 7 14:55:43 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (block_pass): should not push unique number if a block is
- not an orphan. [ruby-dev:25808]
-
-Wed Feb 16 02:55:21 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_read,
- ossl_ssl_write):
- - need to set errno on Win32 platform.
- - should call rb_sys_fail instead of rasing SSLError if
- SSL_ERROR_SYSCALL occured.
- - should wait for that the underlying IO become readable or
- writable if the error was SSL_ERROR_WANT_READ or
- SSL_ERROR_WANT_WRITE. [ruby-dev:25795]
-
- * ext/openssl/lib/openssl/buffering.rb
- (Buffering#initialize): should set @eof and @rbuffer.
- (Buffering#fill_rbuff): should rescue Errno::EAGAIN.
- (Buffering#consume_rbuf): pointless eof flag resetting is deleted.
- (Buffering#read): should return an empty string if the specified
- size is zero.
- (Buffering#readpartial): new method.
- (Buffering#readline): fix typo.
- (Buffering#getc): return the first character of string correctly.
- (Buffering#each): fix typo. suggested by Brian Ollenberger.
- (Buffering#readchar): fix typo.
- (Buffering#eof?): should read again it the input buffer is empty.
- (Buffering#do_write): should rescue Errno::EAGAIN.
- (Buffering#puts): use "\n" as the output field separator.
-
- * ext/openssl/lib/openssl/ssl.rb: set non-blocking flag to the
- underlying IO.
-
- * ext/openssl/extconf.rb: get rid of GNUmakefile generation.
-
- * text/openssl/test_pair.rb: test for IO like methods.
-
- * test/ruby/ut_eof.rb: test about empty file.
-
-Mon Mar 7 10:22:06 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/un.rb: should use OptionParser. (backported form HEAD)
-
-Mon Mar 7 09:18:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_cmp_m): should not return false but nil.
- fixed: [ruby-dev:25811]
-
-Mon Mar 7 01:22:14 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c: remove the some codes which depend on the
- difference between Ruby1.8 and 1.9, because st.c on Ruby1.9
- was changed.
-
-Mon Mar 7 00:01:04 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fail to call TclTkLib.mainloop when $SAFE==4
-
-Sun Mar 6 16:41:33 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: HTTPHeader holds its header fields as an array
- (backport from CVS HEAD rev 1.112-1.123). [ruby-list:40629]
-
- * test/net/http/test_httpheader.rb: new file.
-
-Sun Mar 6 11:47:10 2005 Sam Roberts <sroberts@uniserve.com>
-
- * lib/pp.rb: rdoced. [ruby-core:4490]
-
-Sun Mar 6 11:36:37 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/pp.rb (File::Stat#pretty_print): Etc.getpwuid and Etc.getgrgid
- may return nil. [ruby-talk:129826]
- reported by Daniel Berger.
-
-Sat Mar 5 18:06:21 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * dir.c (fnmatch): removed unnecessary code. (ruby_1_8 didn't have
- String#clear, so [ruby-dev:24749] didn't affect it)
-
- * win32/win32.c (NtInitialize): ditto. (by numeric.c 1.101.2.14)
-
-Sat Mar 5 16:29:26 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: freeze callback-entry objects
-
- * ext/tk/lib/tkextlib/tile.rb: support tile-0.6
-
-Fri Mar 4 19:39:28 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#do_includes): replace
- also locally defined modules.
-
- * ext/iconv/iconv.c: backport Iconv::InvalidEncoding from CVS HEAD.
-
- * ext/strscan/strscan.c: moved misplaced rdoc.
-
-Fri Mar 4 15:58:12 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi-lib.rb: add deprecation warning. [ruby-dev:25499]
- getopts.rb, parsearg.rb, importenv.rb as well.
-
-Fri Mar 4 11:17:06 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_rbUpdateCommand): get rid of
- warnings with Tcl/Tk 8.3 or former (backport from CVS_HEAD).
-
- * ext/tcltklib/tcltklib.c (ip_rb_threadUpdateCommand): ditto.
-
-Fri Mar 4 10:15:30 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/set.rb (SortedSet::setup): a hack to shut up warning.
- [ruby-talk:132866]
-
-Fri Mar 4 07:07:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.63
-
-Thu Mar 3 23:49:00 2005 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: follow nkf 1.62
-
-Thu Mar 3 11:49:51 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * sample/rss/tdiary_plugin/rss-recent.rb: added site information.
-
-Wed Mar 2 19:53:07 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (parse_args): add DESTDIR only when not directed
- already. fixed: [ruby-dev:25781]
-
-Wed Mar 2 17:14:18 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (lib_eventloop_core): fix typo
-
-Wed Mar 2 16:00:02 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: enforce thread-check and exception-handling
- to avoid SEGV trouble.
- [KNOWN BUG] When supports pthread and running multiple Tk
- interpreters, an interrupt signal causes SEGV frequently. That
- may be a trouble of Ruby's signal handler.
-
- * ext/tk/tkutil/tkutil.c; fix a bug on converting a SJIS string array
- to a Tcl's list string.
-
- * ext/tk/tcltklib.c: wrap Tcl's original "namespace" command to
- protect from namespace crash.
-
- * ext/tk/lib/multi-tk.rb: enforce exception-handling.
-
- * ext/tk/lib/multi-tk.rb: catch IRB_EXIT to work on irb.
-
- * ext/tk/lib/tk.rb: ditto.
-
- * ext/tk/tcltklib.c: add TclTkLib.mainloop_thread?
-
- * ext/tk/lib/multi-tk.rb: (bug fix) callback returns a value.
-
- * ext/tk/lib/tk/canvas.rb (delete): bug fix when multiple arguments.
-
- * ext/tk/lib/clock.rb: fix 'no method error'.
-
- * ext/tk/lib/clock.rb (self.clicks): accept a Symbol argument.
-
- * ext/tk/lib/variable.rb: be able to set default_value_type; :numeric,
- :bool, :string, :symbol, :list, :numlist or nil (default; same to
- :string). If set a type, TkVariable#value returns a value of the
- type.
-
- * ext/tk/lib/tkextlib/tclx/tclx.rb: add Tk::TclX.signal to warn the
- risk of using TclX extension's 'signal' command.
-
- * ext/tk/sample/irbtk.rb: irb with Ruby/Tk.
-
- * ext/tk/sample/demos-*/anilabel.rb: bug fix on 'show code'
-
- * ext/tk/sample/demos-*/aniwave.rb: new Ruby/Tk animation demo.
-
- * ext/tk/sample/demos-*/pendulum.rb: ditto.
-
- * ext/tk/sample/demos-*/goldberg.rb: ditto.
-
- * ext/tk/sample/demos-*/widget: add entries of animation demos.
-
-Tue Mar 1 00:47:43 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/rinda/test_rinda.rb: backport from CVS_HEAD. use
- MockClock.sleep instead of Kernel.sleep [ruby-dev:25387]
-
-Tue Mar 1 00:34:24 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/tuplespace.rb (Rinda::TupleSpace): improved keeper thread.
-
- * test/rinda/test_rinda.rb: ditto.
-
-Mon Feb 28 11:42:23 2005 Ian Macdonald <ian@caliban.org>
-
- * exception error messages updated. [ruby-core:04497]
-
-Mon Feb 28 09:03:09 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (Init_socket): add bunch of Socket
- constants. Patch from Sam Roberts <sroberts@uniserve.com>.
- [ruby-core:04409]
-
-Wed Feb 23 15:04:32 2005 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (split_userinfo): should split ":pass" into ""
- and "pass". [ruby-dev:25667]
-
-Wed Feb 23 08:00:18 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_s_create): no need for negative argc check.
- [ruby-core:04463]
-
- * array.c (rb_ary_unshift_m): ditto.
-
-Wed Feb 23 01:57:46 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (initialize): handle certs correctly. Thanks,
- NABEYA Kenichi. (backported from CVS HEAD)
-
-Tue Feb 22 07:25:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (parser_yylex): identfier after dot must not be a variable.
-
-Mon Feb 21 10:04:49 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * {bcc32,win32,wince}/Makefile.sub (config.h): add fcntl.
-
- * win32/win32.[ch] (fcntl): ditto.
-
- * win32/win32.c (rb_w32_connect): support nonblocking mode.
-
- * ext/socket/socket.c (wait_connectable, ruby_connect): support
- nonblocking connect on various platforms.
- all changes are backported from CVS HEAD. [ruby-core:3154],
- [ruby-core:4364].
-
-Sun Feb 20 00:48:48 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::FTP#buffer_open): access mechanism
- re-implemented according to RFC 1738.
- reported by Guillaume Marcais. [ruby-talk:131650]
-
-Sat Feb 19 18:11:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (DRbObject#respond_to?): take two arguments.
- [ruby-dev:25722]
-
- * test/drb/drbtest.rb: ditto.
-
-Sat Feb 19 13:52:02 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb: call OpenSSL::SSL::SSLSocket#post_connection_check
- after connection is made.
-
-Sat Feb 19 01:32:03 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/bigdecimal/lib/bigdecimal/newton.rb: resolved LoadError.
- [ruby-dev:25685]
-
- * ext/bigdecimal/sample/linear.rb: ditto.
-
- * ext/bigdecimal/sample/nlsolve.rb: ditto.
-
- * ext/bigdecimal/lib/bigdecimal/nlsolve.rb: removed because this file
- is sample script and same file exists in ext/bigdecimal/sample.
-
-Fri Feb 18 17:14:00 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/xmlrpc/parser.rb (XMLRPC::FaultException): make it subclass
- of StandardError class, not Exception class. [ruby-core:04429]
-
-Thu Feb 17 20:11:18 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/drb/drb.rb (DRbServer.default_safe_level): fix typo.
-
-Thu Feb 17 20:11:18 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/digest/test_digest.rb: separate test case for each algorithms.
- [ruby-dev:25412]
-
-Thu Feb 17 11:54:00 2005 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/collector.rb (collect_file): now deletes paths added
- to $LOAD_PATH instead of restoring it verbatim.
-
- * lib/test/unit/autorunner.rb (AutoRunner.run): fixed so that
- 'ruby -rtest/unit -rtest1 -rtest2 -e0' will use the objectspace
- collector again. Also tried to simplify the calling convention.
-
- * test/runner.rb: adjusted for new AutoRunner semantics.
-
- * lib/test/unit.rb: ditto.
-
-Thu Feb 17 04:21:47 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/open3.rb (Open3::popen3): $? should not be EXIT_FAILURE.
- fixed: [ruby-core:04444]
-
-Thu Feb 17 00:09:45 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/drb/ignore_test_drb.rb: move TestDRbReusePort to new file
- [ruby-dev:25238]
-
- * test/drb/test_drb.rb: add method DRbService.ext_service, move
- TestDRbReusePort to new file [ruby-dev:25238]
-
- * test/drb/test_drb.rb: ditto.
-
- * test/drb/test_drbssl.rb: ditto.
-
- * test/drb/test_drbunix.rb: ditto.
-
- * test/drb/ut_drb.rb: reduce sleep.
-
-Thu Feb 17 00:02:27 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (is_defined): NODE_IASGN is an assignment.
-
-Wed Feb 16 23:34:30 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: add lazy stop_service. ([druby-ja:109])
-
- * lib/drb/extserv.rb: ditto.
-
-Wed Feb 16 17:07:57 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c: Follow the change of st.c (st_foreach)
- [ruby-list:40623].
- Sometimes mis-convert from a Ruby's Array of SJIS Strings, which
- includes some kind of SJIS characters, to a Tcl's UTF8 list string.
-
-Mon Feb 14 23:58:17 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/parser.rb (RSS::ListenerMixin::tag_end):
- fixed invalid namespace handling bug.
-
-Mon Feb 14 13:12:38 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/ssl.rb
- (OpenSSL::SSL::SSLSocket#post_connection_check): new method.
-
-Mon Feb 14 00:40:49 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (InvokeMethod.perform): pass DRb info to sub thread.
-
- * test/drb/test_drb.rb (test_01_safe1_safe4_eval): fix test case.
-
-Sun Feb 13 23:13:46 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/dublincore.rb (RSS::DublicCoreModel#date{,=}): added
- convenient methods.
-
- * lib/rss/0.9.rb (RSS::Rss::Channel#date{,=}): ditto.
-
- * lib/rss/2.0.rb (RSS::Rss::Channel::Item#date{,=}): ditto.
-
- * test/rss/: added tests for the convenient methods.
-
-Sun Feb 13 22:43:03 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (DRbServer): add default_safe_level, safe_level,
- config[:safe_level] ([druby-ja:120])
-
- * test/drb/test_drb.rb, ut_eval.rb, ut_safe1.rb: ditto.
-
-Sun Feb 13 16:56:52 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (WEBrick::CGI.start): should set reason-phrase
- to the value of status header field. ([ruby-dev:40617])
-
-Sun Feb 13 00:52:33 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/erb.rb (ERB::Util.h, u): make it module_function.
-
-Sat Feb 12 17:29:19 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (OpenURI.open_loop): send authentication only for
- the URI directly specified.
-
-Sat Feb 12 15:07:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * random.c (rand_init): suppress warning.
-
-Sat Feb 12 13:54:03 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb: support https if the platform provides CA
- certificates.
-
-Sat Feb 12 06:18:28 2005 URABE Shyouhei <shyouhei@ice.uec.ac.jp>
-
- * ext/etc/etc.c (Init_etc): sGroup needs HAVE_ST_GR_PASSWD check.
- [ruby-dev:25675]
-
-Fri Feb 11 17:40:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths):
- new method OpenSSL::X509::Store#set_default_paths.
-
-Fri Feb 11 11:33:53 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::HTTP#proxy_open): new option supported:
- :http_basic_authentication.
- suggested by Kent Sibilev. [ruby-core:4392]
-
-Fri Feb 11 06:30:07 2005 George Ogata <g_ogata@optushome.com.au>
-
- * misc/ruby-mode.el: ignore parenthesis inside heredoc.
- [ruby-core:04415]
-
-Fri Feb 11 04:54:13 2005 Tilman Sauerbeck <tilman@code-monkey.de>
-
- * lib/rdoc/generators/html_generator.rb: [ruby-core:04412]
-
- * lib/rdoc/generators/ri_generator.rb: ditto.
-
-Thu Feb 10 11:14:17 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub (COMMON_HEADERS): shouldn't include winsock2.h.
-
- * ext/socket/extconf.rb (sockaddr_storage): remove workaround for
- mswin32.
-
-Thu Feb 10 10:29:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/curses/curses.c: don't need to check HAVE_WCOLOR_SET excluding
- window_color_set().
-
-Thu Feb 10 00:47:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * struct.c (make_struct): fixed: [ruby-core:04402]
-
-Wed Feb 9 08:07:08 2005 Paul Duncan <pabs@pablotron.org>
-
- * ext/curses/curses.c (window_color_set): [ruby-core:04393]
-
-Tue Feb 8 23:51:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: reject :instance_eval, :class_eval, :module_eval
- [druby-ja:117]
-
-Tue Feb 8 13:06:12 2005 Sam Roberts <sroberts@uniserve.com>
-
- * ext/socket/socket.c (Init_socket): SO_REUSEPORT added.
- [ruby-talk:130092]
-
-Tue Feb 8 09:30:01 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::Cookie): [ruby-talk:130040]
-
-Tue Feb 8 00:19:02 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/resolv.rb (Resolv::DNS::Name#subdomain_of?): new method.
- (Resolv::DNS::Name#inspect): ditto.
- Suggested by Sam Roberts. [ruby-talk:129086]
-
-Mon Feb 7 10:06:30 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c: [ruby-doc:818]
-
-Mon Feb 7 01:56:20 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * instruby.rb, rubytest.rb (srcdir): no longer embed srcdir into
- rbconfig.rb. (backported from CVS HEAD)
-
- * ext/socket/extconf.rb (sockaddr_storage): winsock2.h have the
- definition of struct sockaddr_storage, but socket.c doesn't
- include it because this version of ruby still has binary level
- compatibility with winsock1.
-
- * lib/mkmf.rb (create_makefile): should support header files in
- depend file.
-
-Mon Feb 7 01:21:50 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/extconf.rb: check if getaddrinfo() works fine only when
- wide-getaddrinfo option is not given. fixed: [ruby-dev:25422]
-
- * lib/mkmf.rb ($extmk): check if under ext directory.
-
- * lib/mkmf.rb (Logging.postpone): allow recursive operation.
-
- * lib/mkmf.rb (try_constant): make sure if really a constant, reduce
- the number of times of compile.
-
- * lib/mkmf.rb (have_macro, have_var, byte_order): new functions.
-
- * lib/mkmf.rb (find_library): allow directory list with separators.
-
- * lib/mkmf.rb (arg_config): manage provided configuration options.
-
- * lib/mkmf.rb (dir_config): accept arrays of directory names as
- default values.
-
- * mkconfig.rb: no longer embed srcdir and compile_dir into
- rbconfig.rb.
-
- * lib/mkmf.rb (create_makefile): fix unbalanced parens.
-
-Sun Feb 6 19:23:01 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval.c (stack_extend): add prototype because VC++8 doesn't
- accept __declspec(noinline) with K&R style function definitions.
- (backported from CVS HEAD)
-
-Sun Feb 6 14:14:26 2005 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb (new_with_hash): changed messages of exception.
-
- * lib/date/format.rb (str[fp]time): undocumented conversion
- specifications %[1-3] are now deprecated.
-
-Sun Feb 6 12:20:11 2005 Akinori MUSHA <knu@iDaemons.org>
-
- * bignum.c (rb_big2ulong_pack): One too many arguments are passed
- to big2ulong().
-
- * re.c (rb_reg_init_copy, rb_reg_initialize_m): One too many
- arguments are passed to rb_reg_initialize().
-
-Sun Feb 6 03:24:20 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/resolv.rb (Resolv::DNS::Resource::TXT): multiple strings was not
- handled.
- (Resolv::DNS::Resource::TXT#strings): new method to return all
- strings.
- (Resolv::DNS::Message::MessageEncoder#put_string_list): new method.
- (Resolv::DNS::Message::MessageDecoder#get_string_list): ditto.
- based on [ruby-talk:129732] by Sam Roberts.
-
-Fri Feb 4 00:30:45 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss: supported Image module.
- http://web.resource.org/rss/1.0/modules/image/
-
-Thu Feb 3 23:42:36 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_close, strio_close_read, strio_close_write):
- should return nil instead of self as well as IO. [ruby-dev:25623]
-
- * ext/stringio/stringio.c (strio_extend, strio_putc): fill with zero
- extended portion. [ruby-dev:25626]
-
-Wed Feb 2 23:52:53 2005 sheepman <sheepman@tcn.zaq.ne.jp>
-
- * ext/stringio/stringio.c (strio_truncate): should MEMZERO an extended
- part. [ruby-dev:25618]
-
-Wed Feb 2 21:56:01 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb (RSS::Element#convert): added.
-
- * lib/rss/rss.rb: convert -> need_convert.
-
- * lib/rss/1.0.rb: ditto.
-
- * lib/rss/0.9.rb: ditto.
-
- * lib/rss/2.0.rb: ditto.
-
- * lib/rss/trackback.rb: ditto.
-
-Tue Feb 1 22:48:48 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (DRb::DRbObject#respond_to?): check marshal_dump and
- _dump.
-
-Tue Feb 1 00:20:23 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (aix): fix linker flags on AIX. [ruby-talk:125460]
-
-Mon Jan 31 13:33:21 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: add invalid namespace check
-
- * ext/tk/lib/multi-tk.rb: add invalid_namespace? method
-
- * ext/tk/lib/remote-tk.rb: ditto
-
-Mon Jan 31 10:29:18 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/context.rb (IRB::Context::initialize): [ruby-core:04330]
-
-Sat Jan 29 09:42:12 2005 Sam Roberts <sroberts@uniserve.com>
-
- * lib/resolv.rb (Resolv::DNS::Resource::IN::SRV): Added RFC2782 SRV
- resource record for specifying location of services.
-
-Fri Jan 28 17:16:55 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf):
- parse options line for ndots option.
- (Resolv::Hosts#lazy_initialize): return self.
- (Resolv::DNS#lazy_initialize): ditto.
- (Resolv::DNS::Config#lazy_initialize): ditto.
- Suggested by Sam Roberts.
-
-Thu Jan 27 13:18:03 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * st.c (st_foreach): report success/failure by return value.
- [ruby-Bugs-1396]
-
-Thu Jan 27 00:15:29 2005 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb (setup): support BSD-style
- directory group inheritance. (backport from HEAD, rev 1.32)
-
- * test/fileutils/fileasserts.rb (assert_same_entry): show entry
- difference. (backport from HEAD, rev 1.4)
-
-Wed Jan 26 23:09:11 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/protocol.rb (WriteAdapter#puts): should append \n, not
- prepend. [ruby-talk:128302] (backport from HEAD, rev 1.75)
-
-Wed Jan 26 10:51:50 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (flock_winnt, flock_win95): unlock file even if
- LOCK_NB is specified. (backported from CVS HEAD)
-
-Tue Jan 25 17:11:51 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ruby.c (proc_options): correct -T option in RUBYOPT. (backported
- from CVS HEAD)
-
-Tue Jan 25 14:05:52 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fix SEGV bug; trouble on canceling remained
- after scripts [ruby-dev:25479]: NULL current namespace when deleting
- Tk interpreter [ruby-talk:126225]
-
- * ext/tcltklib/extconf.rb: bug fix; TCL_ENABLE_THREAD flag is inverted
- [ruby-talk:126360]
-
- * ext/tcltklib/extconf.rb: add yet another native-thread check
-
- * ext/tk/tkutil.c: fix SEGV bug; NULL string pointer when finalize
- Ruby interpreter
-
- * ext/tk/lib/multi-tk.rb: avoid warning for deleted safeTk ip frame
-
- * ext/tk/lib/tk/bindtag.rb: bug fix; new method of named bindtag
- doesn't return the created object [ruby-dev:25479]
-
- * ext/tk/lib/tk/menu.rb: bug on treating arguments [ruby-dev:25479]
-
- * ext/tk/lib/tk.rb: bug fix; cannot accept a callback ID string for
- a command argument [ruby-dev:25479]
-
- * ext/tk/lib/multi-tk.rb: ditto
-
- * ext/tk/lib/tk/*.rb: ditto
-
- * ext/tk/lib/tkextlib/*.rb: ditto
-
- * ext/tk/sample/demos-jp/anilabel.rb: new demo script
-
- * ext/tk/sample/demos-en/anilabel.rb: ditto
-
- * ext/tk/sample/tkHTML/ss.rb: local variable scope bug fix
- [ruby-dev:25479]
-
-Mon Jan 24 15:44:25 2005 Tilman Sauerbeck <tilman@code-monkey.de>
-
- * lib/rdoc/parsers/parse_c.rb: allow whitespace after function names.
- [ruby-core:4296]
-
- * lib/rdoc/parsers/parse_simple.rb: adds support for private comments
- in the "simple" parser. [ruby-core:4301]
-
-Mon Jan 24 15:44:25 2005 Charles Mills <cmills@freeshell.org>
-
- * lib/rdoc/parsers/parse_c.rb: adds support for constants
- (rb_define_const), accessors (rb_define_attr), and makes a
- couple fixes. [ruby-core:4307]
-
-Mon Jan 24 15:44:25 2005 Florian Gro <florgro@gmail.com>
-
- * lib/rdoc/parsers/parse_rb.rb: Logic for def Builtin.method() end
- [ruby-core:4302]
-
-Mon Jan 24 15:44:25 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * document updates - [ruby-core:04296], [ruby-core:04301],
- [ruby-core:04302], [ruby-core:04307]
-
-Sun Jan 23 12:41:16 2005 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/wsdlDriver.rb: from 1.5.3-ruby1.8.2, operation which has
- capitalized name (such as KeywordSearchRequest in AWS) is defined as
- a method having uncapitalized name. (converted with
- GenSupport.safemethodname to handle operation name 'foo-bar'). it
- introduced serious incompatibility; in the past, it was defined as a
- capitalized.
-
- define capitalized method as well under that circumstance.
-
-Sun Jan 23 05:24:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_to_der): should call
- GetOCSPReq at first.
-
-Sat Jan 22 23:09:47 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/ssl.rb (accept): rescue SSLError. [druby-ja:110]
-
-Sat Jan 22 22:35:03 2005 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/unix.rb: fail if UNIXFileOwner is set. [druby-ja:111]
-
-Fri Jan 21 23:58:42 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_set_pos): clear EOF flag.
- [ruby-talk:127511]
-
-Fri Jan 21 20:07:02 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/resolv.rb (Resolv::DNS::Config.resolv): don't raise ResolvError.
- reported by Sam Roberts. [ruby-talk:127133]
-
-Fri Jan 21 16:58:10 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (rb_push_glob): should work for NUL delimited patterns.
-
-Fri Jan 21 13:58:37 2005 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (u8tou16): fixed typo. fixed: [ruby-list:40546]
- (backported from CVS HEAD)
-
-Fri Jan 21 09:30:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * rubyio.h (rb_eof_error): should mark as NORETURN. (backported
- from CVS HEAD)
-
-Fri Jan 21 00:31:36 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/syck/rubyext.c (syck_parser_bufsize_set): avoid VC++ warning
- "local variable 'size' used without having been initialized".
-
-Thu Jan 20 19:03:24 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/extmk.rb (extmake): shouldn't set $extflags on mswin32.
-
- * win32/Makefile.sub (LIBRUBY_SO): should use $DLDOBJS instead of
- $EXTOBJS.
- fixed: [ruby-core:04290] (backported from CVS HEAD)
-
-Thu Jan 20 11:42:02 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_new4): should propagate taintedness.
-
- * struct.c (rb_struct_set): use original method name, not callee
- name, to retrieve member slot. [ruby-core:04268]
-
- * time.c (time_strftime): protect from format modification from GC
- finalizers.
-
-Wed Jan 19 18:06:40 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/ipaddr.rb (to_s, test_to_s): too many colons with some cases.
- (backported from CVS HEAD)
-
-Wed Jan 19 01:16:30 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf): ignore
- domain and search directive without an argument.
- reported by Sam Roberts. [ruby-talk:126781]
-
-Tue Jan 18 15:03:05 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/ssl.rb (WEBrick::Config::SSL): the default value
- of :SSLEnable is false.
-
- * lib/webrick/server.rb (WEBrick::Daemon.start): prepared stdio
- don't allow changing its mode.
-
- * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_service):
- should delete trailing LF from the result of pack("m*").
-
- * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
- - should delete trailing LF from the result of pack("m*").
- - clear Request-Line not to send the response by HTTPServer#run.
-
- * lib/webrick/httputils (WEBrick::HTTPUtils.parse_qvalues):
- refine regexp (and change the name of a local variable).
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils#escape_path): add
- new method to escape URI path component.
-
- * lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line): should
- escape SCRIPT_NAME and PATH_INFO before being parsed as a URI.
-
- * test/webrick/*, sample/webrick/httpproxy.rb: add new file.
-
-Mon Jan 17 23:33:46 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (aix): fix typo. [ruby-talk:126401]
-
-Mon Jan 17 07:08:51 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/readline/readline.c: suppress warnings.
-
- * lib/irb/extend-command.rb (IRB::ContextExtender.def_extend_command):
- ditto.
-
- * lib/irb/ext/history.rb (IRB::Context::set_last_value): ditto.
-
- * lib/irb/ext/history.rb (IRB::Context::eval_history): ditto.
-
- * lib/irb/locale.rb (IRB::Locale::real_load): ditto.
-
- * lib/irb/slex.rb (SLex::Node::create_subnode): remove garbage.
-
-Mon Jan 17 00:09:42 2005 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/uri/common.rb (PORT): typo fix. fixed: [ruby-core:04256]
-
-Sat Jan 15 14:57:22 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (proc_options): ignore trailing CRs at the end of short
- options as well as long options. fixed: [ruby-core:04232]
-
-Sat Jan 15 13:35:16 2005 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb (RSS::VERSION): 0.1.2 -> 0.1.3.
-
- * lib/rss/rss.rb: accept inheritance. [ruby-talk:126104]
-
-Thu Jan 13 04:48:53 2005 Tanaka Akira <akr@m17n.org>
-
- * io.c (io_fread): don't warn nonblocking behavior by default.
-
-Wed Jan 12 00:36:29 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_class_superclass): superclass of singleton class also
- should be a singleton class. fixed: [ruby-list:40519]
-
-Tue Jan 11 09:44:40 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * numeric.c (Init_Numeric): turn off floating point exceptions
- on bcc32. "1e300".to_f had crashed by overflow.
-
-Tue Jan 11 03:10:10 2005 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (copy_entry): could not copy symbolic link.
- [ruby-talk:125733]
-
- * lib/fileutils.rb (copy_stream): use read/write instead of
- sysread/syswrite.
-
-Mon Jan 10 23:08:15 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_autoload): hide internal data from ruby level.
- fixed: [ruby-dev:25435], [ruby-list:40498]
-
-Mon Jan 10 01:22:55 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (rb_data_object_alloc): klass may be NULL.
- [ruby-list:40498]
-
-Sun Jan 9 03:12:58 2005 Tanaka Akira <akr@m17n.org>
-
- * io.c (io_fread): warn nonblocking behavior.
- (io_readpartial): new method IO#readpartial.
-
-Sat Jan 8 04:38:47 2005 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml.rb: Kernel#y requires an argument.
-
-Fri Jan 7 21:12:29 2005 TAMURA Takashi <sheepman@tcn.zaq.ne.jp>
-
- * random.c (rand_init): use ALLOC_N instead of ALLOCA_N
- [ruby-dev:25426]
-
-Fri Jan 7 18:03:35 2005 Tanaka Akira <akr@m17n.org>
-
- * gc.c (mark_locations_array): avoid core dump with -O3.
- [ruby-dev:25424]
-
-Thu Jan 6 20:31:07 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/zlib/zlib.c (zstream_end): should return value. (backported
- from CVS HEAD)
-
-Thu Jan 6 19:55:13 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.c (rb_w32_close): didn't close socket handle.
- [ruby-dev:25414]
-
- * win32/win32.c (rb_w32_open_osfhandle): bcc32's _open_osfhandle
- never set EMFILE.
-
-Thu Jan 6 17:14:31 2005 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * random.c (random_seed): O_NONBLOCK isn't defined on some
- platforms. [ruby-dev:25417]
-
-Thu Jan 6 13:45:35 2005 Tanaka Akira <akr@m17n.org>
-
- * lib/time.rb: recognize +00:00 and GMT as a localtime.
-
-Thu Jan 6 07:58:28 2005 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/usage.rb (RDoc::RDoc.usage_no_exit): Allow for colons
- in path names on DOS machines. (thanks to Johan Nilsson)
-
-Wed Jan 5 20:16:32 2005 Tanaka Akira <akr@m17n.org>
-
- * random.c (limited_big_rand): didn't work if SIZEOF_BDIGITS == 2.
- [ruby-dev:25408]
-
- * random.c (random_seed): refined.
-
-Wed Jan 5 12:49:39 2005 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_initialize): Thread objects cannot be initialized
- again. fixed: [ruby-core:04067]
-
-Wed Jan 5 10:48:16 2005 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * dir.c (dir_s_mkdir): win32 special processing doesn't need any
- longer. (backported from CVS HEAD)
-
- * win32/win32.[ch] (rb_w32_mkdir): new function. POSIX.1 compatible
- interface. (backported from CVS HEAD)
-
- * win32/win32.[ch] (rb_w32_rmdir): new function. (backported from CVS
- HEAD)
-
-Wed Jan 5 02:30:11 2005 Tanaka Akira <akr@m17n.org>
-
- * random.c (init_by_array): imported from mt19937ar-cok.tgz.
- (genrand_int32): ditto.
- (genrand_real): replaced with genrand_res53 in mt19937ar-cok.
- (rand_init): support bignum for longer seed.
- (random_seed): generate longer seed.
- (make_mask): new function.
- (limited_rand): ditto.
- (limited_big_rand): ditto.
- (rb_f_rand): call limited_rand and limited_big_rand.
- [ruby-dev:25403]
-
-Tue Jan 4 23:25:29 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (rb_big_rand): should return positive random number.
- [ruby-dev:25401]
-
-Tue Jan 4 11:15:29 2005 TAMURA Takashi <sheepman@tcn.zaq.ne.jp>
-
- * bignum.c (rb_big_rand): do not use rb_big_modulo to generate
- random bignums. [ruby-dev:25396]
-
-Mon Jan 3 14:01:54 2005 Tanaka Akira <akr@m17n.org>
-
- * random.c (random_seed): don't use /dev/urandom if it is not
- character device.
-
-Mon Jan 3 11:37:42 2005 Tanaka Akira <akr@m17n.org>
-
- * random.c (random_seed): use /dev/urandom if available.
- [ruby-dev:25392]
-
-Mon Jan 3 07:46:42 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpauth/htpasswd.rb (WEBrick::Htpasswd#reload):
- raise NotImplementedError if password is encrypted by digest
- algorithms. This patch is contributed by sheepman. [ruby-list:40467]
-
- * lib/webrick/httpauth/digestauth.rb
- (WEBrick::HTTPAuth::DigestAuth#_authenticate): fix digest calculation.
- This patch is contributed by sheepman. [ruby-list:40482]
-
- * lib/webrick/{httpauth.rb,httpauth/basicauth.rb,httpproxy.rb}: use
- pack/unpack-template char "m" instead of lib/base64.rb to do base64
- encoding/decoding. fixed: [ruby-dev:25336]
-
- * test/webrick/test_httpauth.rb: new file.
-
-Sat Jan 1 04:20:23 2005 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ns_spki.c (ossl_spki_set_challenge): should call
- StringValue before GetSPKI. fixed: [ruby-dev:25359].
-
-Sat Jan 1 01:13:28 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * variable.c (rb_autoload): [ruby-dev:25373]
-
-Fri Dec 31 14:10:43 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item): Fix problem
- if heading contains formatting.
-
-Thu Dec 30 00:41:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (svalue_to_avalue): [ruby-dev:25366]
-
- * string.c (rb_str_justify): [ruby-dev:25367]
-
-Wed Dec 29 11:07:07 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/template/html/kilmer.rb: Update to use new
- sections.
-
-Tue Dec 28 22:31:46 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_justify): create buffer string after argument type
- conversion. fixed: [ruby-dev:25341]
-
-Tue Dec 28 15:41:48 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c (reinit): should initialize all static
- variables. fixed: [ruby-list:40445]
-
-Tue Dec 28 15:25:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): second byte is up to
- 0xfe.
-
- * ext/nkf/lib/kconv.rb (Kconv#kconv): should handle UTF8 and UTF16
- properly.
-
-Tue Dec 28 13:35:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate): ensure
- freeing internal zstreams. fixed: [ruby-dev:25309]
-
- * ext/zlib/zlib.c (rb_deflate_init_copy): replace rb_deflate_clone.
-
-Tue Dec 28 12:26:45 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub, win32/setup.mak (RDOCTARGET, install,
- install-nodoc, install-doc): rdoc support for mswin32.
-
- * win32/configure.bat (--enable-install-doc, --disable-install-doc):
- ditto.
-
-Mon Dec 27 20:02:14 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fix SEGV bug when deleting Tk interp
-
- * ext/tk/lib/multi-tk.rb: ditto
-
-Mon Dec 27 16:55:17 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509name.c (Init_ossl_x509name): should use
- rb_hash_new to get exactly a Hash. fix [ruby-dev:25325].
-
-Mon Dec 27 16:29:56 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_justify): [ruby-dev:25341]
-
-Mon Dec 27 15:47:48 2004 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/fileasserts.rb: sync with HEAD.
-
- * test/fileutils/test_fileutils.rb: ditto.
-
- * test/fileutils/test_nowrite.rb: ditto.
-
-Mon Dec 27 15:21:07 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mv): should raise error when moving a
- directory to the (empty) directory. [ruby-talk:124368]
- (backport from HEAD 1.48)
-
- * lib/fileutils.rb (mv): wrongly did not overwrite file on Win32
- platforms. (backport from HEAD 1.48)
-
-Sat Dec 25 11:11:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * stable version 1.8.2 released.
-
-Sat Dec 25 04:23:49 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mkdir, mkdir_p): should ensure directory
- permission. (backportted from HEAD, 1.47)
-
- * lib/fileutils.rb (traverse, remove_dir): untaint trasted
- objects. (backportted from HEAD, 1.46)
-
-Sat Dec 25 01:28:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c: cancel io_reopen() change on Dec. 24th.
-
- * dln.c: use <dlfcn.h> for NetBSD. [ruby-dev:25313]
-
- * io.c (rb_f_select): IO list could be altered. [ruby-dev:25312]
-
-Fri Dec 24 23:51:48 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: bcc32 should use RTL dll (backport from HEAD)
- [ruby-dev:25306]
-
- * win32/win32.[ch]: ditto.
-
-Fri Dec 24 23:27:18 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/image.rb: TkPhotoImage#cget bug fix
-
-Fri Dec 24 18:39:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.[ch]: failed to compile on bcc32 (and probably wince)
- [ruby-dev:25306]
-
-Fri Dec 24 02:52:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (io_reopen, rb_io_reopen): prohibit to change access mode for
- special IO ports. [ruby-dev:25225]
-
-Fri Dec 24 02:22:53 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/syck/rubyext.c (rb_syck_io_str_read): [ruby-core:03973]
-
- * ext/syck/rubyext.c (syck_loader_transfer): check type conversion.
-
- * ext/syck/rubyext.c (syck_parser_assign_io, rb_new_syck_node): duck
- typing.
-
- * ext/syck/rubyext.c (syck_parser_s_alloc, syck_parser_initialize):
- allocation framework.
-
- * ext/syck/rubyext.c (syck_emitter_s_alloc, syck_emitter_initialize):
- ditto.
-
-Fri Dec 24 01:21:00 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tkextlib/blt.rb: add BLT extension support
-
- * ext/tk/lib/tkextlib/blt/*.rb: ditto
-
- * ext/tk/lib/tkextlib/blt/tile/*.rb: ditto
-
-Thu Dec 23 23:36:28 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (proc_setgroups): check if the argument lenght is
- modified. fixed: [ruby-dev:25285]
-
-Thu Dec 23 13:13:33 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: define TclTkLib::COMPILE_INFO and
- RELEASE_DATE
-
- * ext/tcltklib/extconf.rb: ditto
-
- * ext/tk/tkutil.c: define TkUtil::RELEASE_DATE
-
- * ext/tk/lib/tk.rb: define Tk::RELEASE_DATE
-
-Thu Dec 23 09:38:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (io_reopen): restore exact mode. fixed: [ruby-core:04003]
-
-Thu Dec 23 00:16:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (bsdi): use $(CC) for LDSHARED. fixed [ruby-dev:25270]
-
-Wed Dec 22 11:14:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_mode_modenum): replace O_ACCMODE with O_RDWR.
- fixed: [ruby-dev:25273]
-
-Wed Dec 22 08:34:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/dl/sym.c (rb_dlsym_initialize): extract internal pointers after
- all argument conversion. fixed: [ruby-dev:25271]
-
-Wed Dec 22 00:08:01 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/*, test/soap/*, sample/soap/authheader/*: eval cleanup.
-
-Tue Dec 21 22:07:33 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
- ossl_asn1_decode_all): temporary value should be marked volatile.
-
-Tue Dec 21 14:40:02 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
- ossl_asn1_decode_all): use rb_str_new4 to avoid SEGV.
- fix [ruby-dev:25261]
-
- * test/openssl/test_asn1.rb: add tests for OpenSSL::ASN1.
-
-Tue Dec 21 12:22:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (io_reopen): keep duplex pipe in correct mode for exception
- safeness. fixed: [ruby-dev:25152]
-
-Tue Dec 21 12:10:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/grid.rb: rescue bug of 'grid configure' on Tcl/Tk8.3-
-
-Tue Dec 21 00:53:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_traverse): [ruby-dev:25261]
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode): ditto.
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_decode_all): ditto.
-
-Mon Dec 20 23:22:26 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * added files:
- * lib/soap/mapping/wsdl*.rb
- * lib/wsdl/soap/element.rb
- * lib/wsdl/xmlSchema/simpleContent.rb
-
- * modified files:
- * lib/soap/*
- * lib/wsdl/*
- * lib/xsd/*
- * test/soap/*
- * test/wsdl/*
- * test/xsd/*
- * sample/soap/*
- * sample/sdl/*
-
- * summary
- * imported from the soap4r repository. Version: 1.5.3-ruby1.8.2
-
- * added several XSD basetype support: nonPositiveInteger,
- negativeInteger, nonNegativeInteger, unsignedLong, unsignedInt,
- unsignedShort, unsignedByte, positiveInteger
-
- * HTTP client connection/send/receive timeout support.
-
- * HTTP client/server gzipped content encoding support.
-
- * improved WSDL schema definition support; still is far from
- complete, but is making step by step improovement.
-
-Mon Dec 20 22:56:39 2004 Tanaka Akira <akr@m17n.org>
-
- * gc.c (stack_end_address): gcc noinline attribute is available since
- gcc-3.1.
-
-Mon Dec 20 14:07:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: supports new features of Tcl/Tk8.5a2
-
- * ext/tk/lib/tk/clock.rb: ditto
-
- * ext/tk/lib/tk/text.rb: ditto
-
- * ext/tk/lib/tk/panedwindow.rb: ditto
-
-Mon Dec 20 12:47:13 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/net/https.rb,protocols.rb,telnets.rb: delete
- doc and code about SSLContext#{key_file,cert_file}.
- fixed: [ruby-dev:25243]
-
-Mon Dec 20 12:42:17 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * io.c (io_fwrite): workaround for MSVCRT's bug.
- fixed: [ruby-core:03982]
-
-Mon Dec 20 11:21:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_eof): check if closed before clearerr().
- fixed: [ruby-dev:25251]
-
-Mon Dec 20 03:30:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session#initialize): empty session id was
- used if request had no session key. fixed: [ruby-core:03981]
-
-Mon Dec 20 01:51:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * struct.c (make_struct): [ruby-dev:25249]
-
-Mon Dec 20 00:28:20 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rexml/encodings/SHIFT-JIS.rb: backported from CVS HEAD.
-
- * lib/rexml/encodings/SHIFT_JIS.rb: ditto.
-
-Sun Dec 19 17:19:48 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509store.c
- (ossl_x509store_set_time): add OpenSSL::X509::Store#time=.
- (ossl_x509stctx_set_time): add OpenSSL::X509::StoreContext#time=.
-
- * test/openssl/ossl_x509store.rb: test certificate validity times.
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_s): add optional
- second argument to specify the output format (see also
- X509_NAME_print_ex).
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_init): new constants:
- OpenSSL::X509::Name::COMPAT, OpenSSL::X509::Name::RFC2253,
- OpenSSL::X509::ONELINE, OpenSSL::X509::MULTILINE.
-
- * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name::RFC2253DN):
- new module to provide the parse for RFC2253 DN format.
-
- * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name.parse_rfc2253):
- new method to parse RFC2253 DN format.
-
- * test/openssl/ossl_x509name.rb: add tests about RFC2253 DN.
-
- * text/openssl/ssl_server.rb: try to listen ports from 20443 to 20542
- while EADDRINUSE is raised.
-
- * all changes in this entry are backport from 1.9.
-
-Sun Dec 19 17:24:59 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (enable_rpath): use rpath flag to embed the library
- path into extensions on ELF environment. [ruby-dev:25035]
-
-Sun Dec 19 11:01:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit.rb: use standalone runner for -e.
-
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): accept
- multiple -p and -x options.
-
- * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#recursive_collect):
- ditto.
-
-Sat Dec 18 16:36:23 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate):
- disallow interrupt by type conversion. fixed: [ruby-dev:25226]
-
-Sat Dec 18 15:16:41 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/webrick/httpauth.rb,
- lib/webrick/httpauth/{basicauth.rb,digestauth.rb}: use
- pack/unpack-template char "m" instead of lib/base64.rb to do base64
- encoding/decoding.
-
-Sat Dec 18 10:51:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (dir_open_dir): new function. [ruby-dev:25242]
-
-Fri Dec 17 18:07:01 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/readline/test_readline.rb: fix for BSD. Thanks, GOTOU Yuuzou.
- fixed: [ruby-dev:25218]
-
-Fri Dec 17 16:28:12 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: fix bug on setting up system encoding
-
- * ext/tk/lib/tk/event.rb: fix error on require process
-
- * ext/tk/lib/tk/font.rb: fix abnormal termination error on Windows
-
- * ext/tk/lib/tk/virtevent.rb: TkVirtualEvent::PreDefVirtEvent.new()
- accepts event-sequence arguments
-
- * ext/tk/lib/tk/text.rb: fail to dump embedded images
-
- * ext/tk/lib/tk/text.rb: tag_nextrange and tag_prevrange returns wrong
- types of values
-
- * ext/tk/lib/tk/texttag.rb: nextrange and prevrange returns wrong
- types of values
-
- * ext/tk/lib/tk/text.rb: add TkText::IndexModMethods module and
- TkText::IndexString class to treat text index modifiers
-
- * ext/tk/lib/tk/texttag.rb: use TkText::IndexModMethods module
-
- * ext/tk/lib/tk/textmark.rb: ditto
-
- * ext/tk/lib/tk/textimage.rb: ditto
-
- * ext/tk/lib/tk/textwindow.rb: ditto
-
- * ext/tk/lib/tk/textimage.rb: wrong gravity of text mark for embedded
- image
-
- * ext/tk/lib/tk/textwindow.rb: wrong gravity of text mark for
- embedded window
-
-Fri Dec 17 13:50:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
-
- * vms/vmsruby_private.c, vms/vmsruby_private.h: private routines
- for VMS port are added.
-
- * eval.c (ruby_init): change to call VMS private intialization routine.
-
-Fri Dec 17 13:33:58 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session#initialize): control adding
- session_id hidden fields. fixed: [ruby-talk:123850]
-
-Thu Dec 16 23:25:25 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb, lib/drb/ssl.rb: backported from CVS HEAD.
- [druby-ja:101]
-
- * test/drb/test_drb.rb: adjust and reduce sleep (backported from
- CVS HEAD.)
-
-Thu Dec 16 18:44:58 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should wait
- for reading request till data arrive. [ruby-talk:121068]
-
- * lib/webrick/server.rb (WEBrick::GenericServer#start_thread):
- should log about all accepted socket. [ruby-core:03962]
-
- * lib/webrick/accesslog.rb (WEBrick::AccessLog#setup_params):
- "%%" and "%u" are supported. [webricken:135]
-
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#check_filename):
- :NondisclosureName is acceptable if it is Enumerable.
-
- * lib/webrick/config.rb (WEBrick::Config::FileHandler):
- default value of :NondisclosureName is [".ht*", "*~"].
-
-Thu Dec 16 18:36:52 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.c (ossl_raise): refine message format.
-
-Thu Dec 16 16:29:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/demos-en/widget: modify version check for
- supporting features
-
-Thu Dec 16 16:03:50 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/bindtag.rb: bug fix [ruby-talk: 123667]
-
- * ext/tk/lib/tk/timer.rb: accept :idle for the interval argument
-
- * ext/tk/lib/tk.rb: add TkComm._callback_entry?()
-
- * ext/tk/lib/multi-tk.rb: add MultiTkIp.cb_entry_class
-
- * ext/tk/lib/tk/canvas.rb: use TkComm._callback_entry?()
-
- * ext/tk/lib/tk/canvastag.rb: ditto
-
- * ext/tk/lib/tk/dialog.rb: ditto
-
- * ext/tk/lib/tk/optiondb.rb: ditto
-
- * ext/tk/lib/tk/text.rb: ditto
-
- * ext/tk/lib/tk/texttag.rb: ditto
-
- * ext/tk/lib/tk/textwindow.rb: ditto
-
- * ext/tk/lib/tk/timer.rb: ditto
-
- * ext/tk/lib/tk/validation.rb: ditto
-
- * ext/tk/lib/tkextlib/*: ditto
-
-Thu Dec 16 03:14:28 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb (basic_encode): return value of pack('m') may
- include multiple CR/LFs. Backported from main trunk (rev 1.112).
- [ruby-dev:25212]
-
-Thu Dec 16 00:33:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * hash.c (Init_Hash): remove custom "hash" and "eql?".
-
-Wed Dec 15 18:57:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/set.rb (Set::eql): wrong definition. [ruby-dev:25207]
-
-Wed Dec 15 18:48:42 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * ext/curses/curses.c (window_subwin): call NUM2INT() before
- GetWINDOW(). (backported from CVS HEAD)
-
-Wed Dec 15 17:03:50 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.[ch] (rb_w32_isatty): new function to replace MSVCRT's
- isatty because it never sets errno. (backported from CVS HEAD)
-
-Wed Dec 15 15:39:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_a): avoid SEGV
- (rollback the previous commit).
-
-Wed Dec 15 16:10:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (rb_obj_id_obsolete): warn always.
-
- * eval.c (rb_enable_super): ditto.
-
-Wed Dec 15 15:31:02 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/set.rb (Set#==): [ruby-dev:25206]
-
-Wed Dec 15 14:22:10 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_fdisset): check whether the handle is valid.
- fixed: [ruby-core:03959]
-
-Wed Dec 15 10:30:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/openssl/ossl_digest.c (ossl_digest_initialize): [ruby-dev:25198]
-
-Tue Dec 14 17:10:09 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_close): need to reset osfhnd().
-
-Tue Dec 14 14:03:57 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.c (ossl_raise): avoid buffer overrun.
- [ruby-dev:25187]
-
-Tue Dec 14 12:36:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session::initialize): generate new
- session if given session_id does not exist. [ruby-list:40368]
-
-Mon Dec 13 18:13:52 2004 Tanaka Akira <akr@m17n.org>
-
- * gc.c (stack_end_address): new function to obtain stack end address.
- stack_end_address calls __builtin_frame_address(0) to obtain the
- frame pointer of a stack frame of stack_end_address. The address
- is the stack pointer of the caller's stack frame.
- (SET_STACK_END): use stack_end_address.
- This makes the conservative garbage collector to scan a stack frame
- of the garbage_collect function itself. This is required because
- callee-save registers may be stored in the frame.
- [ruby-dev:25158]
-
-Mon Dec 13 00:58:02 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (cleanpath_aggressive): make it private.
- (cleanpath_conservative): ditto.
- Suggested by Daniel Berger. [ruby-core:3914]
-
-Sun Dec 12 20:06:38 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: backported from CVS HEAD.
-
-Sun Dec 12 10:35:10 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Don't
- show an accessor's r/w flag if none was specified
-
-Sun Dec 12 10:14:03 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/rdoc.rb (RDoc::RDoc::parse_files): Never exclude files
- explicitly given on the command line.
-
-Sun Dec 11 23:54:07 2005 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/*: update to support libraries in ActiveTcl8.4.12.0
- (see ext/tk/ChangeLog.tkextlib).
-
- * ext/tk/sample/scrollframe.rb: add a new sample.
-
-Sat Dec 11 20:12:21 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: add DRbRemoteError. [ruby-list:40348],
- [ruby-list:40390]
-
- * test/drb/drbtest.rb: ditto.
-
- * test/drb/ut_drb.rb: ditto.
-
-Sat Dec 11 15:38:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/jcode.rb (String::succ): [ruby-dev:25156]
-
-Sat Dec 11 12:41:55 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval.c (run_trap_eval): prototype; avoid VC++ warnings.
-
- * ext/socket/getaddrinfo.c: fix typo. fixed: [ruby-core:03947]
-
- * win32/win32.c: need to include dln.h.
-
-Sat Dec 11 00:10:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_reopen): [ruby-dev:25150]
-
-Fri Dec 10 08:39:27 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/socket.c (sock_listen): get OpenFile just before calling
- listen(2). fixed: [ruby-dev:25149]
-
-Thu Dec 9 17:00:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
-
- * ext/socket/socket.c, ext/socket/getaddrinfo.c: port to VMS
-
-Thu Dec 9 16:31:02 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/sdbm/init.c (GetDBM): typo.
-
-Thu Dec 9 16:05:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
-
- * defines.h: change path of vms.h
- * vms/vms.h: delete reference for snprintf()
- * vms/config.h: new file
- * vms/config.h_in: deleted
-
-Thu Dec 9 14:38:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_inspect): escape # which starts an expression
- substitution. fixed: [ruby-core:03922]
-
- * string.c (rb_str_dump): not escape # which isn't a substitution.
-
-Thu Dec 9 10:54:36 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/dbm/dbm.c (fdbm_select): [ruby-dev:25132]
-
- * ext/sdbm/init.c: ditto.
-
- * ext/gdbm/gdbm.c: ditto.
-
-Thu Dec 9 03:08:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_init): set root-win title to "ruby" when
- the running script is '-e one-liner' or '-' (stdin).
-
- * ext/tcltklib/extconf.rb: add find_library("#{lib}#{ver}",..) for
- stub libs
-
- * ext/tk/lib/tk/textmark.rb: TkTextMarkCurrent and TkTextMarkAnchor
- have a wrong parent class.
-
- * ext/tk/lib/tk/dialog.rb: rename TkDialog2 --> TkDialogObj and
- TkWarning2 --> TkWarningObj (old names are changed to alias names)
-
- * ext/tk/lib/tk/dialog.rb: bug fix of treatment of 'prev_command'
- option and hashes for configuration
-
- * ext/tk/lib/tk/dialog.rb: add TkDialogObj#name to return the
- button name
-
- * ext/tk/lib/tk/radiobutton.rb: rename enbugged method value() ==>
- get_value() and value=(val) ==> set_value(val).
-
- * ext/tk/lib/tk/menu.rb: add TkMenu.new_menuspec
-
- * ext/tk/lib/tk/menu.rb: add alias (TkMenuButton = TkMenubutton,
- TkOptionMenuButton = TkOptionMenubutton)
-
- * ext/tk/lib/tk/event.rb: new method aliases (same as option keys of
- event_generate) for Event object
-
- * ext/tk/lib/tk/font.rb: configinfo returns proper types of values
-
- * ext/tk/lib/tk.rb: bind methods accept subst_args + block
-
- * ext/tk/lib/tk/canvas.rb: ditto
-
- * ext/tk/lib/tk/canvastag.rb: ditto
-
- * ext/tk/lib/tk/frame.rb: ditto
-
- * ext/tk/lib/tk/text.rb: ditto
-
- * ext/tk/lib/tk/texttag.rb: ditto
-
- * ext/tk/lib/tk/toplevel.rb: ditto
-
- * ext/tk/lib/tkextlib/*: ditto and bug fix
-
-Wed Dec 8 23:54:29 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Typo
- meant that h2 tag was invisible.
-
-Wed Dec 8 21:56:31 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss, test/rss, sample/rss: backported from CVS HEAD.
-
-Wed Dec 8 14:31:36 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_fwrite): change dereference for cosmetic reason.
-
- * sprintf.c (rb_f_sprintf): [ruby-dev:25104]
-
-Tue Dec 7 19:08:00 2004 Akiyoshi, Masamichi <akiyoshi@hp.com>
-
- * io.c (io_fwrite): fix offset incrementation (for VMS and Human68k)
-
-Tue Dec 7 00:27:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (proc_setgroups): [ruby-dev:25081]
-
-Mon Dec 6 18:08:10 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * re.c (rb_reg_eqq): document fix. [ruby-talk:122541]
-
-Mon Dec 6 17:19:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * rubysig.h (TRAP_BEG, TRAP_END): safe errno around CHECK_INTS.
- (backported from CVS HEAD) [ruby-dev:24993]
-
-Mon Dec 6 10:18:17 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in):
- Oops - 1.8 doesn't have String#clear
-
-Mon Dec 6 09:59:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (sock_connect): use rb_str_new4().
- [ruby-dev:25052]
-
-Mon Dec 6 01:42:08 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
- ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
- ossl_rsa_private_decrypt): should take an optional argument
- to specify padding mode. [ruby-talk:122539]
-
- * ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): add new constants
- PKCS1_PADDING, SSLV23_PADDING, NO_PADDING and PKCS1_OAEP_PADDING
- under OpenSSL::PKey::RSA.
-
- * test/openssl/test_pkey_rsa.rb: new file.
-
-Sun Dec 5 19:39:17 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Completion#complete): new parameter
- to direct case insensitiveness.
-
- * lib/optparse.rb (OptionParser#order!): ignore case only for long
- option. [ruby-dev:25048]
-
-Sat Dec 4 22:54:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_write): remove rb_str_locktmp(). [ruby-dev:25050]
-
- * io.c (io_fwrite): takes VALUE string as an argument.
- [ruby-dev:25050]
-
- * ext/socket/socket.c (sock_connect): remove rb_str_locktmp().
- [ruby-dev:25050]
-
- * ext/socket/socket.c (udp_connect): [ruby-dev:25045]
-
- * ext/socket/socket.c (udp_bind): ditto.
-
- * ext/socket/socket.c (udp_send): ditto.
-
- * ext/socket/socket.c (bsock_send): ditto.
-
- * ext/socket/socket.c (s_recvfrom): ditto.
-
- * hash.c (rb_hash_hash): should provide "hash" method where "eql?"
- is redefined. [ruby-talk:122482]
-
-Sat Dec 4 14:54:52 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * eval.c (proc_invoke): use volatile `tmp' rather than `args'.
- [ruby-core:03882]
-
-Sat Dec 4 14:28:56 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/code_objects.rb (RDoc::Context::Section::set_comment):
- Section comments may now be bracketed by lines which are
- ignored. You can now write
- # -----------
- # :section: Dave's Section
- # comment material
- # -----------
- The lines before :section: are removed, and identical lines at the end are
- also removed if present.
-
-Sat Dec 4 03:33:45 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * ext/readline/readline.c: check $SAFE. (backported from CVS HEAD)
-
- * test/readline/test_readline.rb: added tests for readline.
- (backported from CVS HEAD)
-
-Sat Dec 4 02:24:00 2004 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf.c: add constant NKF::VERSION
-
- * ext/nkf/nkf.c(guess): this becomes an alias of guess2
-
- * ext/nkf/test.rb(mime_out2): add --no-cp932
-
- * ext/nkf/nkf-utf8/nkf.c: original nkf2 revision 1.47
-
-Sat Dec 4 00:35:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (bsock_setsockopt): [ruby-dev:25039]
-
-Fri Dec 3 18:57:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/ostruct.rb: 1.9 marshaling support back-ported.
- [ruby-core:03871]
-
-Fri Dec 3 13:45:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_invoke): copy arguments to frame.argv.
- [ruby-core:03861]
-
-Fri Dec 3 12:25:41 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * st.h: fix prototypes.
-
-Fri Dec 3 00:21:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (convert_type): use rb_respond_to() again.
- [ruby-dev:25021]
-
- * eval.c (rb_respond_to): funcall respond_to? if it's redefined.
- [ruby-dev:25021]
-
-Fri Dec 3 01:55:24 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: widget configuration by TkWindow#method_missing
- returns proper object. "widget.option = val" returns val, and
- "widget.option(val)" returns self.
-
- * ext/tk/lib/tk/font.rb: TkFont#replace accepts only one font argument.
-
- * ext/tk/lib/tk/radiobutton.rb: add TkRadiobutton#value and
- TkRadiobutton#value=(val).
-
- * ext/tk/lib/tk/spinbox.rb: callback substitution support on
- command option.
-
- * ext/tk/sample/demos-en/widget: bug fix (wrong image height)
-
- * ext/tk/sample/demos-jp/widget: ditto.
-
-Fri Dec 3 00:11:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_file_initialize): [ruby-dev:25032]
-
-Thu Dec 2 16:41:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_protect): prevent continuations created inside from being
- called from the outside. [ruby-dev:25003]
-
- * eval.c (rb_callcc, rb_cont_call): prohibit calling from different
- signal contexts. [ruby-dev:25022]
-
-Thu Dec 2 09:57:24 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/ostruct.rb (OpenStruct::Marshaler): OpenStruct can be
- marshaled again. [ruby-core:03862]
-
-Thu Dec 2 09:30:06 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (thread_mark): mark thread group. [ruby-dev:25020]
-
- * eval.c (thgroup_add): check whether the argument is really a Thread.
-
-Thu Dec 2 07:57:16 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_ctl): [ruby-dev:25019]
-
-Wed Dec 1 02:21:02 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * signal.c (sighandler): call handler immediately only for default
- handlers. [ruby-dev:25003]
-
-Tue Nov 30 23:38:18 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (io_fread): need not to null terminate. [ruby-dev:24998]
-
- * io.c (read_all): remove unnecessary rb_str_resize().
- [ruby-dev:24996] (backported from CVS HEAD)
-
- * io.c (io_readpartial): ditto.
-
- * io.c (io_read): ditto.
-
-Tue Nov 30 16:18:50 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_fread): need not to null terminate. [ruby-dev:24998]
-
- * io.c (read_all): remove unnecessary rb_str_resize().
- [ruby-dev:24996]
-
- * io.c (io_read): ditto.
-
-Tue Nov 30 00:49:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_sysread): use temporary lock. [ruby-dev:24992]
-
-Mon Nov 29 16:06:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_write): insufficiently filled string
- being extended when overwriting. [ruby-core:03836]
-
-Mon Nov 29 15:59:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/ostruct.rb (OpenStruct::method_missing): check method
- duplication for -d.
-
- * lib/ostruct.rb (OpenStruct::initialize): ditto.
-
-Mon Nov 29 15:22:28 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/io/nonblock/test_flush.rb: abandon tests when io/nonblock is
- not supported.
-
-Mon Nov 29 03:08:30 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (convert_type): direct call conversion methods for the
- performance. [ruby-core:03845]
-
- * eval.c (rb_funcall_rescue): new function.
-
- * object.c (rb_Array): avoid using rb_respond_to().
-
- * object.c (rb_Integer): ditto.
-
- * parse.y (reduce_nodes): empty body should return nil.
-
- * string.c (rb_str_aset): the original string should not be
- affected by modifying duplicated string. [ruby-dev:24981]
-
-Mon Nov 29 13:57:38 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (CreateChild): search executable file if no program
- name given. (backported from CVS HEAD)
-
-Mon Nov 29 13:37:54 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (fptr_finalize): must not use FILE after fclose().
- [ruby-dev:24985]
-
-Mon Nov 29 13:16:31 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (CreateChild): push back the last space before next
- loop because CharNext() eats it.
-
-Mon Nov 29 01:18:18 2004 Tanaka Akira <akr@m17n.org>
-
- * io.c (rb_io_check_writable): call io_seek regardless of
- NEED_IO_SEEK_BETWEEN_RW. [ruby-dev:24986]
-
-Sat Nov 27 21:43:39 2004 Tanaka Akira <akr@m17n.org>
-
- * io.c: avoid data lost with nonblocking fd and
- stdio buffering in sync mode. [ruby-dev:24966]
- based on matz's patch [ruby-dev:24967]
- (io_fwrite): new primitive writing function which writes
- directly if sync mode.
- (rb_io_fwrite): wrapper for io_fwrite now.
- (io_write): call io_fwrite instead of rb_io_fwrite.
-
-Sat Nov 27 14:44:15 2004 Kent Sibilev <ksibilev@bellsouth.net>
-
- * lib/cgi/session.rb (CGI::Session::initialize): create_new_id is
- now a instance method. [ruby-core:03832]
-
-Sat Nov 27 09:41:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_fread): old rb_io_fread with file closing checking.
- (rb_io_fread): wrapper for io_fread now.
- [ruby-dev:24964]
-
-Fri Nov 26 18:02:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: Tk.destroy uses TkWindow#epath
-
- * ext/tk/lib/tk/image.rb: bug fix
-
- * ext/tk/lib/tk/wm.rb: add 'iconphoto' method(Windows only)
-
- * ext/tk/lib/tkextlib/*: some methods uses TkWindow#epath
-
-Fri Nov 26 13:49:06 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (method_missing): raise TypeError for classes do not
- have allocators. [ruby-core:03752]
-
- * lib/erb.rb: add RDoc by James Edward Gray II. [ruby-core:03786]
-
-Fri Nov 26 13:29:02 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in): Break
- out of preprocessing when we find a :section: directive (previously cleared out the
- comment, but this apparently now generates an error in gsub!)
-
-Fri Nov 26 00:17:40 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_read): move StringValue() check before GetOpenFile().
- [ruby-dev:24959]
-
-Thu Nov 25 20:14:57 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/thwait.rb (ThreadsWait#join_nowait): abnormally terminated
- threads should be also processed. [ruby-talk:121320]
-
-Thu Nov 25 10:14:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (push_braces): do not reuse buffer strings. [ruby-core:03806]
-
-Thu Nov 25 07:59:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (read_all): stringify non-nil buffer argument, and always
- taint the result. [ruby-dev:24955]
-
-Wed Nov 24 01:01:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_read): integer conversion should be prior to
- GetOpenFile(). [ruby-dev:24952]
-
- * configure.in, io.c: cancel [ ruby-Patches-1074 ].
-
-Tue Nov 23 08:09:50 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/menu.rb: improve usability of TkOptionMenubutton
-
-Tue Nov 23 02:00:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * file.c (rb_file_chown): integer conversion should be prior to
- GetOpenFile(). [ruby-dev:24949]
-
-Tue Nov 23 00:10:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * file.c (rb_file_chown): integer conversion should be prior to
- GetOpenFile(). [ruby-dev:24947]
-
- * file.c (rb_file_truncate): ditto.
-
- * file.c (rb_file_s_truncate): ditto.
-
- * dir.c (dir_seek): use NUM2OFFT().
-
- * misc/ruby-mode.el (ruby-non-block-do-re): should not match words
- start with block keyword and underscore. [ruby-core:03719]
-
-Mon Nov 22 22:33:02 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Don't use names
- of variables or constants when oarsing 'require'
-
-Mon Nov 22 00:13:35 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (dir_seek): should retrieve dir_data after NUM2INT().
- [ruby-dev:24941]
-
-Sat Nov 20 23:57:33 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/README (et al): Add a new directive, :section:, and
- change the output format to accomodate. :section: allows to to
- group together methods, attributes, constants, etc under
- headings in the output. If used, a table of contents is
- generated.
-
-Sat Nov 20 23:56:54 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/options.rb (Options::parse): Force --inline-source if
- --one-file option given
-
-Sat Nov 20 23:55:19 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_splice): should place index wrapping after
- possible modification. [ruby-dev:24940]
-
-Sat Nov 20 13:26:03 2004 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/utf8tbl.c: original revision 1.7
-
-Sat Nov 20 05:34:24 2004 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf/nkf-utf8/nkf.c: original nkf.c rev:1.40
-
- * ext/nkf/test.rb: add test for mime encode/decode
-
-Sat Nov 20 01:37:34 2004 Johan Holmberg <holmberg@iar.se>
-
- * eval.c (error_print): nicer traceback at interrupt.
- [ruby-core:03774]
-
-Sat Nov 20 00:07:16 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_gsub): internal buffer should not be listed by
- ObjectSpace.each_object() by String#gsub. [ruby-dev:24931]
-
-Fri Nov 19 01:20:22 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session::FileStore::initialize): raise
- exception if data corresponding to session specified from the
- client does not exist.
-
-Fri Nov 19 00:59:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_gsub): internal buffer should not be listed by
- ObjectSpace.each_object(). [ruby-dev:24919]
-
-Thu Nov 18 18:41:08 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * test/ruby/test_stringchar.rb (test_bang): added.
-
- * string.c (rb_str_upcase_bang, rb_str_capitalize_bang)
- (rb_str_swapcase_bang): missing rb_str_modify(). [ruby-dev:24915]
-
-Thu Nov 18 00:21:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (proc_getpgrp): prohibit for $SAFE=2.
- [ruby-dev:24899]
-
- * process.c (get_pid): ditto. [ruby-dev:24904]
-
- * process.c (get_ppid): ditto.
-
- * array.c (rb_ary_delete): defer rb_ary_modify() until actual
- modification. [ruby-dev:24901]
-
-Thu Nov 18 10:10:14 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c, rubyio.h (rb_io_modenum_flags): exported.
-
- * ext/stringio/stringio.c (strio_initialize): allow Fixnum as mode as
- well as IO.new does. [ruby-dev:24896]
-
-Wed Nov 17 23:42:40 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_settracefunc.rb: added. [ruby-dev:24884]
-
-Wed Nov 17 13:56:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (newline_node): should not use FL_SET. [ruby-dev:24874]
-
- * parse.y (string_content): should not use FL_UNSET.
-
- * node.h (NODE_NEWLINE): remove unused bit to utilize flag field
- in nodes.
-
-Wed Nov 17 13:09:40 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * {bcc32,win32,wince}/Makefile.sub (test): should build ruby.exe
- before running test. [ruby-core:03756]
-
-Wed Nov 17 04:33:01 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * pack.c: all features are backport from 1.9. [ruby-dev:24826]
-
- * bignum.c (rb_big2ulong_pack): new function to pack Bignums.
-
-Wed Nov 17 03:42:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_splice): move rb_str_modify() after
- StringValue(), which may alter the receiver. [ruby-dev:24878]
-
-Tue Nov 16 23:45:07 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * numeric.c (flo_divmod): protect float values from GC by
- assignment to local variables. [ruby-dev:24873]
-
-Tue Nov 16 16:30:21 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * {bcc32,win32,wince}/setup.mak (-epilogue-): remove config.h and
- config.status to force updating them.
-
-Tue Nov 16 16:20:45 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): position was ignored when a
- buffer was passed. http://www.yo.rim.or.jp/~nov/d/?date=20041116#p03
-
-Tue Nov 16 11:19:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): use
- Regexp conversion.
-
-Tue Nov 16 01:41:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_mod_check): frozen check should be separated.
- [ruby-core:3742]
-
- * array.c (rb_ary_update): pedantic check to detect
- rb_ary_to_ary() to modify the receiver. [ruby-dev:24861]
-
-Mon Nov 15 13:50:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_justify): typo fixed. [ruby-dev:24851]
-
-Mon Nov 15 11:50:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-special-char-p, ruby-parse-partial): handle
- operator symbols. [ruby-talk:120177]
-
-Sun Nov 14 13:27:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/pp.rb (PP#object_address_group): remove odd number of 'f'
- prefixed to negative address.
-
-Sun Nov 14 08:51:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/logger/test_logger.rb: Logger just expects
- Logger#datetime_format to be used for Time#strftime independently of
- locale. [ruby-dev:24828]
-
-Fri Nov 12 15:03:26 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval.c (ruby_options): now we cannot call rb_glob() before
- ruby_init(), so call rb_w32_cmdvector() at ruby_options().
-
- * win32.{c,h} (rb_w32_cmdvector): rename make_cmdvector() and
- export it.
-
-Fri Nov 12 14:08:01 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/event.rb: remove $LOADED_FEATURES trick
-
- * ext/tk/lib/tk.rb: ditto
-
-Fri Nov 12 00:31:05 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/gdbm/gdbm.c (fgdbm_store): StringValue() may alter string
- pointer. [ruby-dev:24783]
-
-Thu Nov 11 17:36:12 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (rb_globi): also should call back via rb_glob_caller().
- [ruby-dev:24775]
-
-Thu Nov 11 16:47:21 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_file.rb (test_truncate_wbuf): we want to test
- only File#truncate, not behaviour of seek(2).
-
-Thu Nov 11 09:41:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (push_braces): was confusing VALUE and char*.
-
- * dir.c (rb_push_glob): Dir.glob should have called its block.
-
-Thu Nov 11 01:52:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (syserr_initialize): use stringified object.
- [ruby-dev:24768]
-
-Wed Nov 10 22:49:01 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/delegate.rb (SimpleDelegator::dup): wrong number of
- arguments.
-
- * lib/delegate.rb (DelegateClass::dup): ditto.
-
-Wed Nov 10 12:31:21 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * README.EXT (Example): extconf.rb is indispensable now.
-
-Wed Nov 10 03:33:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fix SEGV when compiled with Tcl/Tk8.3.x
- or older
-
- * ext/tk/lib/tkextlib/tile/style.rb: bug fix
-
-Tue Nov 9 14:27:18 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Officious): moved from DefaultList.
-
-Tue Nov 9 01:05:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (rb_glob2): do not allocate buffer from heap to avoid
- memory leaks. use string object for buffering instead.
- [ruby-dev:24738]
-
- * dir.c (join_path): ditto.
-
- * io.c (io_read): external input buffer may be modified even after
- rb_str_locktmp(). [ruby-dev:24735]
-
- * dir.c (fnmatch): p or s may be NULL. [ruby-dev:24749]
-
-Tue Nov 9 00:53:53 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * regex.c (slow_match): avoid GCC 3.4.x warnings.
-
-Tue Nov 9 00:50:06 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/rdoc.rb: Change version numbering of RDoc and ri
-
-Mon Nov 8 23:38:35 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/extservm.rb: add DRb::ExtServManager#uri=.
- [ruby-dev:24743]
-
-Mon Nov 8 22:20:19 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
- Fix bug where parent class wasn't being detected if the
- child class was defined using the A::B notation.
-
-Mon Nov 8 00:14:13 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: add setup for mignw32 cross compiling.
- [ruby-talk:119413]
-
-Sun Nov 7 23:49:26 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: bind-event methods accept multi substitution
- arguments.
-
- * ext/tk/lib/tk/canvas.rb: ditto.
-
- * ext/tk/lib/tk/canvastag.rb: ditto.
-
- * ext/tk/lib/tk/text.rb: ditto.
-
- * ext/tk/lib/tk/texttag.rb: ditto.
-
- * ext/tk/lib/tkextlib: ditto.
-
-Sat Nov 6 14:58:44 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/server.rb (WEBrick::HTTPServer#start): remove
- :DoNotReverseLookup option. (Socket#do_not_reverse_lookup is a
- ruby 1.9 feature)
-
-Sat Nov 6 11:31:04 2004 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb (_parse): checks whether zone was given.
-
-Sat Nov 6 00:46:27 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_locktmp): check STR_TMPLOCK flag before
- locking. [ruby-dev:24727]
-
-Fri Nov 5 18:12:42 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/scrollable.rb: divide Scrollable module into
- X_Scrollable and Y_Scrollable
-
- * ext/tk/lib/tk/entry.rb: include X_Scrollable instead of Scrollable
-
- * ext/tk/lib/tk/autoload.rb: define autoload for X_Scrollable and
- Y_Scrollable
-
-Fri Nov 5 16:05:32 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: TkComm._at() supprts both of "@x,y" and "@x"
-
-Fri Nov 5 13:22:58 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/text.rb: sorry. bug fix again.
-
-Fri Nov 5 13:17:54 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/text.rb: bug fix
-
-Fri Nov 5 08:52:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_mark): stricter GC stack check.
-
-Fri Nov 5 08:52:48 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_mark): stricter GC stack check.
-
-Fri Nov 5 08:34:43 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_gsub): should have removed rb_str_unlocktmp(str).
- [ruby-dev:24708]
-
-Thu Nov 4 21:25:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_gsub): string modify check no longer based on
- tmplock. [ruby-dev:24706]
-
-Thu Nov 4 19:27:46 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * io.c (rb_f_open): fix typo.
-
-Thu Nov 4 15:02:14 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/variable.rb: forget to initialize instance_variables
- of TkVarAccess objects
-
-Thu Nov 4 09:11:35 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_mark): enable GC stack checking.
-
-Thu Nov 4 03:11:33 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_gsub): lock strings temporarily. [ruby-dev:24687]
-
- * ext/socket/socket.c (s_recvfrom): tmplock input buffer.
- [ruby-dev:24705]
-
-Wed Nov 3 22:32:12 2004 NARUSE, Yui <naruse@ruby-lang.org>
-
- * process.c: On NetBSD don't use setruid() and setrgid().
-
-Wed Nov 3 22:24:17 2004 Daigo Moriwaki <techml@sgtpepper.net>
-
- * lib/webrick/httpauth/digestauth.rb: use Base64.encode64 to
- avoid warnings.
-
-Wed Nov 3 17:19:59 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_uniq_bang): do not push frozen string from hash
- table. [ruby-dev:24695]
-
- * array.c (rb_ary_and): ditto.
-
- * array.c (rb_ary_or): ditto.
-
-Wed Nov 3 17:13:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * io.c (pipe_open): fix compile error
-
-Wed Nov 3 16:58:07 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: support to use different Tcl commands between
- configure and configinfo
-
- * ext/tk/lib/font.rb: ditto.
-
- * ext/tk/lib/itemconfig.rb: support to use different Tcl commands
- between item_configure and item_configinfo
-
- * ext/tk/lib/itemfont.rb: ditto.
-
- * ext/tk/extconf.rb: install SUPPORT_STATUS
-
- * ext/tk/lib/tkextlib: some bug fixes (see ext/tk/ChangeLog.tkextlib)
-
-Wed Nov 3 16:30:41 2004 NARUSE, Yui <naruse@ruby-lang.org>
-
- * ext/nkf: follow nkf 2.0.4
-
-Wed Nov 3 15:53:34 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * test/rss/test_maker_*.rb: added tests for RSS Maker.
-
- * lib/rss/maker.rb: added RSS Maker.
-
- * lib/rss/maker/*.rb: ditto.
-
-Tue Nov 2 16:35:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/enumerator/enumerator.c (each_cons_i): pass copy of an
- internal consequent array. [ruby-talk:118691]
-
-Tue Nov 2 16:05:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (rb_f_fork): need to flush stdout and stderr before
- fork(2). [ruby-talk:117715]
-
-Tue Nov 2 01:20:09 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_invoke): nail down dyna_var node when Proc object
- or continuation is created. [ruby-dev:24671]
-
-Mon Nov 1 13:59:28 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/extmk.rb (MANIFEST): do not use anymore, use extconf.rb instead.
-
- * ext/enumerator/extconf.rb, ext/fcntl/extconf.rb,
- ext/stringio/extconf.rb: added.
-
- * MANIFEST, ext/**/MANIFEST: removed.
-
- * README.EXT, README.EXT.ja: remove MANIFEST stuff.
-
-Mon Nov 1 01:14:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_f_open): create copy of popen specifier. [ruby-dev:24656]
-
-Mon Nov 1 00:36:48 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * main.c (_stklen): move to gc.c.
-
-Sun Oct 31 00:22:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_locktmp): lock string temporarily.
-
- * string.c (str_independent): add tmplock check.
-
- * io.c (io_write): lock output string temporarily.
- [ruby-dev:24649]
-
- * io.c (io_write): use rb_str_locktmp().
-
- * io.c (read_all): ditto.
-
-Sat Oct 30 06:53:24 2004 Peter Vanbroekhoven <peter.vanbroekhoven@cs.kuleuven.ac.be>
-
- * eval.c (rb_eval): NODE_XSTR should pass copy of literal string.
-
-Sat Oct 30 00:19:40 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * enum.c (enum_sort_by): protect continuation jump in.
- [ruby-dev:24642]
-
-Fri Oct 29 21:27:51 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_check_initialized): new function to check uninitialized
- object. [ruby-talk:118234]
-
- * file.c (rb_file_path), io.c (rb_io_closed): check if initialized.
-
-Fri Oct 29 10:00:30 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_thread_start_0): forget to free some memory chunks.
- [ruby-core:03611]
-
- * eval.c (ruby_cleanup): ruby_finalize_1 may cause exception,
- should be wrapped by PUSH_TAG/POP_TAG(). [ruby-dev:24627]
-
-Thu Oct 28 08:42:02 2004 Tanaka Akira <akr@m17n.org>
-
- * io.c (argf_forward): use ANSI style.
- (argf_read): call argf_forward with argv argument.
- [ruby-dev:24624]
-
-Thu Oct 28 23:32:54 2004 akira yamada <akira@ruby-lang.org>
-
- * ext/zlib/zlib.c (zstream_detach_input): resets klass of z->input if
- z->input isn't nil.
-
-Thu Oct 28 23:19:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: prefer relative path. [ruby-talk:93037]
-
-Wed Oct 27 18:49:11 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * gc.c: prototype; rb_io_fptr_finalize() doesn't return any value
- at this version.
-
-Wed Oct 27 17:27:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_sweep): recover ruby_in_compile variable.
-
-Wed Oct 27 09:17:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (str_gsub): use a string object for exception safeness.
- [ruby-dev:24601]
-
-Tue Oct 26 23:52:32 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_getline): rs modification check should not interfere in the loop.
-
-Tue Oct 26 23:30:39 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/code_objects.rb (RDoc::Context::add_class_or_module):
- Restore correct :nopdoc: behavior with nested classes and modules.
-
-Tue Oct 26 18:21:29 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (RESIZE_CAPA): check string attribute before modifying
- capacity member of string structure. [ruby-dev:24594]
-
-Tue Oct 26 11:33:26 2004 David G. Andersen <dga@lcs.mit.edu>
-
- * ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
- performance. [ruby-talk:117701]
-
-Tue Oct 26 10:56:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): raise ArgumentError for extra
- arguments, unless (digit)$ style used.
-
-Tue Oct 26 11:33:26 2004 David G. Andersen <dga@lcs.mit.edu>
-
- * ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
- performance. [ruby-talk:117701]
-
-Tue Oct 26 10:56:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): raise ArgumentError for extra
- arguments, unless (digit)$ style used.
-
-Mon Oct 25 18:35:39 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * win32/win32.c (isUNCRoot): should check NUL after '.'.
- [ruby-dev:24590]
-
- * win32/win32.c (isUNCRoot): fixed buffer overrun.
-
-Mon Oct 25 08:03:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (get_backtrace): ignore illegal backtrace. [ruby-dev:24587]
-
-Sun Oct 24 00:41:09 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_load, search_required, rb_require_safe, rb_require): use
- frozen shared string to avoid outside modification. [ruby-dev:24580]
-
-Sat Oct 23 22:18:32 2004 Guy Decoux <ts@moulon.inra.fr>
-
- * eval.c (frame_free): Guy Decoux solved the leak problem.
- Thanks. [ruby-core:03549]
-
-Sat Oct 23 00:20:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/zlib/zlib.c (zstream_append_input): clear klass for z->input
- to avoid potential vulnerability.
-
- * ext/zlib/zlib.c (zstream_run): always use zstream_append_input()
- to avoid SEGV. [ruby-dev:24568]
-
-Fri Oct 22 12:02:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_alias): was warning for wrong condition.
- [ruby-dev:24565]
-
-Fri Oct 22 10:36:37 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httprequest.rb (WEBrick::HTTPRequest#meta_vars):
- should check if path_info is not nil.
-
-Fri Oct 22 00:22:31 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/zlib/zlib.c (zstream_shift_buffer): should restore class
- field of a buffer. [ruby-dev:24562]
-
-Fri Oct 22 00:20:33 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_include): should not treat char as negative value.
- [ruby-dev:24558]
-
-Thu Oct 21 21:32:30 2004 IWATSUKI Hiroyuki <don@na.rim.or.jp>
-
- * lib/pstore.rb (PStore#transaction): Use the empty content when a
- file is not found. [ruby-dev:24561]
-
-Thu Oct 21 19:06:15 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpresponse.rb (WEBrick::HTTPResponse#send_body_io):
- ensure to close @body. (http://bugs.debian.org/277520)
-
-Thu Oct 21 00:36:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_alias): should warn on method discarding.
- [ruby-dev:24546]
-
- * ext/zlib/zlib.c (zstream_expand_buffer_into): hide internal
- string buffer by clearing klass. [ruby-dev:24548]
-
-Wed Oct 20 19:45:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_gsub): reentrant check. [ruby-dev:24432]
-
- * backport all SEGV bug fixes from CVS HEAD. [ruby-dev:24536]
-
-Wed Oct 20 04:17:55 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/dbm/dbm.c (fdbm_delete_if): should check if deleting element
- is a string. [ruby-dev:24490]
-
- * ext/sdbm/init.c (fsdbm_delete_if): ditto.
-
-Wed Oct 20 01:37:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_times): Array#* should return an instance of
- the class of right operand. [ruby-dev:24526]
-
- * ext/zlib/zlib.c (zstream_detach_buffer): should not expose
- class-less object to Ruby world. [ruby-dev:24530]
-
- * eval.c (proc_dup): provide Proc#dup as well. [ruby-talk:116915]
-
- * eval.c (ruby_exec): stack marking position may be higher than
- expected. thanks to Guy Decoux. [ruby-core:03527]
-
-Tue Oct 19 22:43:12 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_attr): If
- we come across 'attr' in a context where it isn't
- followed by a symbol, just issue a warning.
-
-Tue Oct 19 20:41:37 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole.c(ole_invoke): retrieve the result value when
- retrying the IDispatch::invoke.
-
-Tue Oct 19 17:24:11 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (read_all): block string buffer modification during
- rb_io_fread() by freezing it temporarily. [ruby-dev:24479]
-
- * dir.c (rb_push_glob): block call at once the end of method.
- [ruby-dev:24487]
-
- * ext/enumerator/enumerator.c (enum_each_slice): remove
- rb_gc_force_recycle() to prevent potential SEGV.
- [ruby-dev:24499]
-
- * ext/zlib/zlib.c (zstream_expand_buffer): hide internal string
- buffer by clearing klass. [ruby-dev:24510]
-
-Tue Oct 19 16:12:18 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c: backport from CVS HEAD
-
-Tue Oct 19 08:54:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * intern.h, object.c (rb_class_inherited_p): export.
-
-Tue Oct 19 08:46:57 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_upto): method result must be checked. [ruby-dev:24504]
-
- * eval.c (error_print): ditto. [ruby-dev:24519]
-
-Mon Oct 18 23:37:05 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (r_object0): check inheritance by the internal function.
- [ruby-dev:24515]
-
-Mon Oct 18 15:58:01 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * range.c (range_step, range_each): need cast.
-
-Fri Oct 29 16:34:19 2004 Daiki Ueno <ueno@unixuser.org>
-
- * misc/ruby-mode.el (ruby-parse-partial): Parse the rest of the
- line after opening heredoc identifier. [ruby-dev:24635]
-
-Mon Oct 18 07:26:21 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (rb_file_truncate): discard read buffer before truncation.
- [ruby-dev:24197]
-
-Mon Oct 18 02:11:21 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/config.rb (WEBrick::Config::General): add default values:
- - WEBrick::Config[:DoNotReverseLookup]
- - WEBrick::Config[:RequestCallback] (it used as an alias of
- :RequestHandler in WEBrick::HTTPServer#run)
- - WEBrick::Config::FileHandler[:AcceptableLanguages]
-
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#set_filename): search files
- having suffix of language-name which Accept-Language header field
- includes if :AcceptableLanguages options is present.
-
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#get_servlet): new method to
- search servlet correspond to the suffix of filename.
-
- * lib/webrick/httprequest.rb: add attributes access methods: accept,
- accept_charset, accept_encoding, accept_language, content_length
- and content_type.
-
- * lib/webrick/httpresponse.rb: add attribute access methods:
- content_length, content_length=, content_type and content_type=.
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.mime_types):
- use the second suffix to detect media type. (the first suffix
- may be a language name.)
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_qvalues):
- add method to parse Accept header field. it returns an Array of
- values sorted by the qvalues.
-
-Mon Oct 18 02:04:11 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host): new
- method to register virtual hosting servers.
-
- * lib/webrick/server.rb (WEBrick::GenericServer#accept): call
- do_not_reverse_lookup for each socket if :DoNotReverseLookup
- is set. [ruby-core:02357]
-
-Mon Oct 18 00:42:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (sock_s_getservbyaname): protocol string
- might be altered. [ruby-dev:24503]
-
- * string.c (rb_str_upto): check if return value from succ is a
- string. [ruby-dev:24504]
-
-Sun Oct 17 23:03:48 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/timer.rb: TkTimer#start and restart accept a block
-
-Sun Oct 17 13:05:04 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (fole_func_methods): correct argument mismatch.
- * ext/win32ole/win32ole.c (fole_get_methods): ditto.
- * ext/win32ole/win32ole.c (fole_put_methods): ditto.
- * ext/win32ole/tests/testWIN32OLE.rb: add test for WIN32OLE#ole_func_methods
- WIN32OLE#ole_get_methods, WIN32OLE#ole_put_methods
-
-Sat Oct 16 14:45:28 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/0.9.rb (RSS::Rss#to_s): removed garbage.
-
-Sat Oct 16 13:42:49 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/: untabified.
- * test/rss/: untabified.
- * lib/rss/0.9.rb (RSS::Rss#to_s): inent -> indent.
-
-Sat Oct 16 13:34:56 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss: supported prety print.
- * test/rss/test_1.0.rb: added test for calculating default indent size.
-
-Fri Oct 15 18:04:35 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/timer.rb: TkTimer.new(interval, loop){ ... } is
- acceptable. Add TkTimer.start ( == new + start ).
-
-Fri Oct 15 12:43:09 2004 Tanaka Akira <akr@m17n.org>
-
- * eval.c (Init_stack): make prototype declaration consistent with
- the definition in gc.c.
-
-Thu Oct 14 14:34:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * io.c (MODE_BINMODE, MODE_BINARY): fixed reversed condition.
-
-Thu Oct 14 13:33:59 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: added link to Tutorial.
-
-Mon Oct 11 13:48:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/*: untabify
-
-Sun Oct 10 12:32:08 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Allow 'require'
- to be used as a variable name
-
-Sat Oct 9 21:23:37 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/converter.rb: changed to try to use Iconv for default
- conversion.
-
- * lib/rss/rss.rb: 0.0.9 -> 0.1.0.
-
-Sat Oct 9 19:50:36 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_getline): should not treat char as negative value.
- [ruby-dev:24460]
-
-Fri Oct 8 09:49:32 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (pack_pack): pointer modification check before each
- iteration. [ruby-dev:24445]
-
-Fri Oct 8 01:13:05 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/optiondb.rb: make it more secure
-
-Thu Oct 7 23:47:57 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/scrollbar.rb: When 'set' operation, a scrollbar
- cannot propagate view port information from the source widget
- (that calls 'set') to other assigned widgets.
-
-Thu Oct 7 17:36:25 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: When CHILDKILLED and so on, Tk.errorCode returns
- a Fixnum for 2nd element (it's pid) of the return value.
-
-Thu Oct 7 12:55:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (io_read): should freeze buffer before thread context
- switch. [ruby-dev:24442]
-
- * pack.c (pack_unpack): string conversion should at the top of the
- method. [ruby-dev:24439]
-
- * io.c (io_read): buffer should be frozen only after the length
- check. [ruby-dev:24440]
-
-Thu Oct 7 02:56:43 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c: use FMODE_APPEND.
-
-Thu Oct 7 01:05:33 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add Tk.errorInfo and Tk.errorCode
-
-Thu Oct 7 00:08:37 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_s_sysopen): preserve path in the buffer allocated by
- ALLOCA_N() to prevent modification. [ruby-dev:24438]
-
-Wed Oct 6 09:21:00 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_mode_flags): preserve append mode flag.
- [ruby-dev:24436]
-
- * io.c (rb_io_modenum_mode): do not use external output buffer.
-
- * string.c (rb_str_justify): differ pointer retrieval to prevent
- padding string modification. [ruby-dev:24434]
-
- * range.c (range_each_func): allow func to terminate loop by
- returning RANGE_EACH_BREAK.
-
- * range.c (member_i): use RANGE_EACH_BREAK. [ruby-talk:114959]
-
-Mon Oct 4 14:04:14 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_file_open_internal, rb_io_reopen): fname might be altered
- while GC. [ruby-dev:24408]
-
-Mon Oct 4 12:53:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/optiondb.rb: support definition of command
- resources on widgets
-
- * ext/tk/lib/tk/image.rb: bug fix
-
-Sun Oct 3 21:20:03 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (TEXT_REGEXP): allow 8-bit characters for the german
- version of Microsoft Exchange Server. (backported from HEAD)
-
- * lib/net/imap.rb (RTEXT_REGEXP): ditto.
-
- * lib/net/imap.rb (CTEXT_REGEXP): ditto.
-
-Sat Oct 2 20:34:22 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * node.h (NEW_DVAR): extra semicolon.
-
-Sat Oct 2 00:42:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (r_byte): retrieve pointer from string value for each
- time. [ruby-dev:24404]
-
- * marshal.c (r_bytes0): ditto.
-
- * enum.c (sort_by_i): re-entrance check added. [ruby-dev:24399]
-
- * io.c (io_read): should freeze all reading buffer.
- [ruby-dev:24400]
-
- * string.c (rb_str_sum): should use bignums when bits is greater
- than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
-
- * eval.c (specific_eval): defer pointer retrieval to prevent
- unsafe sourcefile string modification. [ruby-dev:24382]
-
- * eval.c (specific_eval): defer pointer retrieval to prevent
- unsafe sourcefile string modification. [ruby-dev:24382]
-
- * string.c (rb_str_sum): wrong cast caused wrong result.
- [ruby-dev:24385]
-
- * enum.c (enum_sort_by): hide temporary array from
- ObjectSpace.each_object. [ruby-dev:24386]
-
- * string.c (rb_str_sum): check was done with false pointer.
- [ruby-dev:24383]
-
- * string.c (rb_str_sum): string may be altered. [ruby-dev:24381]
-
-Mon Oct 11 17:51:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_popen): get mode string via rb_io_flags_mode() to
- avoid mode string modification. [ruby-dev:24454]
-
- * io.c (rb_io_getline_fast): should take delim as unsigned char to
- distinguish EOF and '\377'. [ruby-dev:24460]
-
- * io.c (rb_io_getline): add check for RS modification.
- [ruby-dev:24461]
-
- * enum.c (enum_sort_by): use qsort() directly instead using
- rb_iterate(). [ruby-dev:24462]
-
- * enum.c (enum_each_with_index): remove rb_gc_force_recycle() to
- prevent access to recycled object (via continuation for
- example). [ruby-dev:24463]
-
-Fri Oct 1 11:40:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_f_eval): defer pointer retrieval to prevent unsafe
- sourcefile string modification. [ruby-dev:24373]
-
- * io.c (io_read): block string buffer modification during
- rb_io_fread() by freezing it temporarily. [ruby-dev:24366]
-
- * io.c (rb_io_s_popen): mode argument may be altered.
- [ruby-dev:24375]
-
- * file.c (rb_file_s_basename): ext argument may be altered.
- [ruby-dev:24377]
-
- * enum.c (enum_sort_by): use NODE instead of 2 element arrays.
- [ruby-dev:24378]
-
- * string.c (rb_str_chomp_bang): StringValue() may change the
- receiver. [ruby-dev:24371]
-
-Fri Oct 1 11:25:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/grid.rb: revive TkGrid.grid
-
- * ext/tk/lib/tk/pack.rb: revive TkPack.pack
-
- * ext/tk/lib/tk/place.rb: revive TkPlace.place
-
-Thu Sep 30 00:50:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_init): bug fix
-
- * ext/tk/tkutil.c (get_eval_string_core): accept a Regexp object
-
- * ext/tk/lib/multi-tk.rb: fix bug on 'exit' operation
-
- * ext/tk/lib/tk/text.rb: 'tksearch' accepts a Regexp object as a
- matting pattern argument
-
-Wed Sep 29 10:58:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * enum.c (sort_by_i): internally used object must not be changed
- outside. [ruby-dev:24368]
-
-Mon Sep 27 13:46:45 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * intern.h, struct.c (rb_struct_s_members, rb_struct_members): public
- accessors. [ruby-dev:24342]
-
- * marshal.c (w_object, r_object0): use accessors.
-
-Mon Sep 27 09:14:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
- [ruby-talk:113807]
-
-Fri Sep 24 16:09:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_invoke): propagate DVAR_DONT_RECYCLE on termination
- to avoid double call to rb_gc_force_recycle(). [ruby-dev:24311]
-
-Fri Sep 24 08:29:45 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_subseq): original object might be modified after
- sharing data creation. [ruby-dev:24327]
-
- * array.c (rb_ary_replace): ditto.
-
- * array.c (ary_make_shared): freeze shared array. [ruby-dev:24325]
-
- * struct.c (struct_members): always check struct size and size of
- members list in the class. [ruby-dev:24320]
-
-Thu Sep 23 09:29:14 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_sub_bang): check if string is not modified
- during iteration. [ruby-dev:24315]
-
- * hash.c (rb_hash_rehash): replace st_foreach() by its deep
- checking counterpart. [ruby-dev:24310]
-
-Wed Sep 22 13:38:12 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * hash.c (rb_hash_rehash): add iteration check. [ruby-dev:24301]
-
- * st.c (st_foreach): add deep check.
-
-Wed Sep 22 13:06:14 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_call_handler): workaround for Ctrl-C.
- merge from HEAD.
-
-Wed Sep 22 00:11:12 2004 Dave Thomas <dave@pragprog.com>
-
- * process.c: Add documentation for fork()
-
-Wed Sep 22 09:04:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_collect_bang): element size might change during
- comparison. [ruby-dev:24300]
-
- * array.c (rb_ary_reject_bang): ditto. [ruby-dev:24300]
-
- * array.c (rb_ary_eql): ditto. [ruby-dev:24300]
-
-Tue Sep 21 18:29:49 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_equal): merge miss.
-
- * array.c (rb_ary_uniq_bang): element size might change during
- comparison. [ruby-dev:24298]
-
-Mon Sep 20 00:24:19 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * enum.c (enum_sort_by): do not use qsort directly. use
- rb_ary_sort_bang() instead. [ruby-dev:24291]
-
- * enum.c (enum_sort_by): pedantic type check added.
- [ruby-dev:24291]
-
- * hash.c (rb_hash_foreach_iter): check iter_lev after each
- iteration. [ruby-dev:24289]
-
- * array.c (rb_ary_and): element size might change during
- comparison. [ruby-dev:24290]
-
- * array.c (rb_ary_or): ditto. [ruby-dev:24292]
-
- * array.c (rb_ary_equal): wrong fix. [ruby-dev:24286]
-
-Sat Sep 18 15:02:22 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_equal): element size might change during
- comparison. [ruby-dev:24254]
-
- * array.c (rb_ary_diff): ditto. [ruby-dev:24274]
-
- * array.c (rb_ary_select): ditto. [ruby-dev:24278]
-
- * array.c (rb_ary_delete): ditto. [ruby-dev:24283]
-
- * array.c (rb_ary_rindex): ditto. [ruby-dev:24275]
-
- * array.c (rb_ary_initialize): element size might change during
- initializing block. [ruby-dev:24284]
-
-Sat Sep 18 14:10:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (dir_s_chdir): avoid memory leak and unnecessary chdir to
- the original directory when exception has caused in changing
- direcotry or within block. thanks to Johan Holmberg
- <holmberg@iar.se> [ruby-core:03446]
-
-Fri Sep 17 20:20:27 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mkdir_p): backport from CVS HEAD 1.45. [ruby-core:03420]
-
-Fri Sep 17 17:11:08 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_delete): element comparison might change array
- size. [ruby-dev:24273]
-
- * file.c (rb_file_truncate): clear stdio buffer before truncating
- the file. [ruby-dev:24191]
-
- * ext/digest/digest.c: use rb_obj_class() instead of CLASS_OF
- which might return singleton class. [ruby-dev:24202]
-
-Fri Sep 17 16:07:09 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: improve exit operation
-
-Fri Sep 17 15:01:57 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fix SEGV when (thread_)vwait or
- (thread_)tkwait
-
- * ext/tk/lib/tk.rb: add alias wait_window to wait_destroy
-
- * ext/tk/lib/multi-tk.rb: support calling 'mainloop' on slave
- interpreters (however, the 'real' eventloop must be run on the
- Default Master IP)
-
- * ext/tk/lib/remote-tk.rb: follow the changes of ext/tk/lib/multi-tk.rb
-
- * ext/tk/sample/remote-ip_sample2.rb: ditto
-
- * ext/tk/sample/tkoptdb-safeTk.rb: ditto
-
-Thu Sep 16 18:12:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (WEBrick::CGI#start): should set REMOTE_USER
- to request.user attribute.
-
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::FileHandler#initialize): should expand
- the pathname of document root directory.
-
-Thu Sep 16 15:49:28 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_intern): protect string argument from GC.
- [ruby-core:03411]
-
-Wed Sep 15 20:22:23 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tkoptdb-safeTk.rb: fix a bug depend on the changes
- of MultiTkIp
-
-Tue Sep 14 23:54:11 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string was en-bugged by
- the previous changes.
-
-Tue Sep 14 23:45:44 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::TextFormatter.for):
- Add Eric Hodel's simpleformatter.
-
-Tue Sep 14 16:59:37 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fix SEGV
-
- * ext/tk/lib/multi-tk.rb: improve safe-level handling of argument proc
-
- * ext/tk/sample/multi-ip_sample.rb: rename of old 'safe-tk.rb'
-
- * ext/tk/sample/safe-tk.rb: new sample script
-
-Tue Sep 14 00:15:15 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/zlib/zlib.c: backported from HEAD.
-
-Mon Sep 13 19:16:33 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * eval.c (blk_copy_prev): need frame_dup(). [ruby-dev:24103]
-
-Mon Sep 13 16:23:27 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: MultiTkIp.new_master and new_slave accept
- safe-level value argument
-
-Mon Sep 13 10:20:45 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * object.c (nil_inspect): fix typo.
-
-Mon Sep 13 01:03:02 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: improve control of preserv/release tcltkip
-
- * ext/tcltklib/tcltklib.c: store original 'exit' command
-
- * ext/tk/tkutil.c: fix(?) SEGV
-
-Sun Sep 12 23:46:23 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * util.c (ruby_strdup): remove unnecessary code. (xmalloc never
- returns NULL.)
-
- * util.c (ruby_getcwd): fix memory leak on failure.
-
-Sun Sep 12 02:41:58 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: add TclTkIp#allow_ruby_exit? and
- allow_ruby_exit=
-
-
- * ext/tk/lib/multi-tk.rb: ditto.
-
- * ext/tk/lib/remote-tk.rb: ditto.
-
- * ext/tcltklib/MANUAL.euc: ditto.
-
- * ext/tcltklib/MANUAL.eng: ditto.
-
- * ext/tcltklib/tcltklib.c: fix some reasons of SEGV
-
- * ext/tk/tkutil.c: ditto.
-
- * ext/tk/lib/multi-tk.rb: ditto.
-
- * ext/tk/lib/tk/timer.rb: ditto.
-
-Sat Sep 11 16:09:46 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb: Fix up cross-file class merging.
-
-Fri Sep 10 20:20:53 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tcltklib/tcltklib.c (lib_merge_tklist): fix suspicious
- pointer conversion.
-
-Fri Sep 10 02:43:54 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/template/kilmer.rb: James Buck's
- patch for call-seq.
-
-Thu Sep 9 13:58:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_init): change flag value for setting
- 'argv' and 'argv0' variable
-
- * ext/tk/lib/remote-tk.rb: follow changes of multi-tk.rb
-
-Thu Sep 9 11:46:18 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_classes): Allow
- spaces aroun parameter to define_method_under (James Buck)
-
-Wed Sep 8 18:44:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_write): zero fill a gap if exsts.
- [ruby-dev:24190]
-
-Wed Sep 8 15:19:49 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_init): cannot create a IP at level 4
-
- * ext/tk/lib/multi-tk.rb: improve 'exit' operation, security check,
- and error treatment
-
- * ext/tk/lib/multi-tk.rb: allow a trusted slave IP to create slave IPs
-
- * ext/tk/lib/tk/listbox.rb: add TkListbox#value, value=, clear, and
- erase
-
- * ext/tk/lib/tk/text.rb: add TkText#clear and erase
-
-Tue Sep 7 15:17:49 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/socket.c (ruby_connect): break immediately if a
- socket is non-blocking. [ruby-talk:111654]
-
-Mon Sep 6 11:08:50 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tk/lib/tk/menu.rb(TkOptionMenubutton#insert): call correct method
-
-Mon Sep 6 11:00:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (dir_s_chdir): the patch to shut up false warning when
- exception occurred within a block. a patch was given from Johan
- Holmberg <holmberg at iar.se>. [ruby-core:03292]
-
-Mon Sep 6 07:51:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (cvar_cbase): singletons should refer outer cvar scope.
- [ruby-dev:24223]
-
- * eval.c (rb_load): should preserve previous ruby_wrapper value.
- [ruby-dev:24226]
-
-Sat Sep 4 01:14:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (cvar_cbase): class variables cause SEGV in
- instance_eval() for fixnums and symbols. [ruby-dev:24213]
-
-Fri Sep 3 17:47:58 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * struct.c (make_struct): remove redefining constant when
- conflict. [ruby-dev:24210]
-
-Fri Sep 3 11:31:44 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: Tk.after makes TkCore::INTERP.tk_cmd_tbl grow
- [ruby-dev:24207]
-
-Fri Sep 3 02:12:48 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fix typo [ruby-talk:111266]
-
- * ext/tk/lib/tk/text.rb: fix typo
-
- * ext/tk/lib/multi-tk.rb: improve safe-level treatment on slave IPs
-
-Fri Sep 3 01:54:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: already built-in libraries satisfy dependencies.
- [ruby-dev:24028]
-
-Thu Sep 2 11:36:20 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * eval.c (rb_obj_instance_eval): backported from HEAD.
-
-Wed Sep 1 21:18:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tk/lib/tk/spinbox.rb: fix typo
-
-Tue Aug 31 18:24:04 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/tk/tkutil.c (cbsubst_init): fix memory leak
-
- * ext/tk/tkutil.c (cbsubst_get_all_subst_keys): fix SEGV
-
-Tue Aug 31 16:04:22 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_delete): when a tcltkip is deleted,
- destroy its root widget
-
-Tue Aug 31 12:30:36 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (del_root): fix SEGV
-
-Mon Aug 30 23:11:06 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_driver.rb (and others): ri now merges documentation
- if it finds the same class in multiple places.
-
-Mon Aug 30 22:40:30 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: 'restart' method accepts arguments
-
-Mon Aug 30 21:50:14 2004 Dave Thomas <dave@pragprog.com>
-
- * object.c: Add RDoc for Module.included.
-
-Mon Aug 30 15:10:46 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (GNU/k*BSD): fixed FTBFS on GNU/k*BSD. [ruby-dev:24051]
-
-Mon Aug 30 11:29:35 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (CreateChild): strip trailing spaces. [ruby-dev:24143]
- merge from HEAD.
-
-Sun Aug 29 14:08:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: compile error on bcc32 [ruby-dev:24081]
-
- * ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string does not work
-
-Sat Aug 28 23:04:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (rb_big_and): protect parameters from GC.
- [ruby-talk:110664]
-
-Thu Aug 26 04:38:29 2004 Dave Thomas <dave@pragprog.com>
-
- * eval.c (return_jump): Minor typo in error message. Now reads
- "return can't jump across threads".
-
-Tue Aug 24 17:30:00 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session::FileStore#initialize): do not
- use a session id as a filename. (backported from HEAD)
-
- * lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): ditto.
-
- * lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): use
- Dir::tmpdir. (backported from HEAD)
-
-Tue Aug 24 14:40:16 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session::FileStore#initialize): untaint
- session id after check. (backported from HEAD)
-
-Tue Aug 24 09:09:01 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): d2i
- functions may replace the pointer indicated by the first argument.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
-
-Mon Aug 23 14:04:51 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_read):
- - should return an empty string if specified length to read is 0.
- - should check for pending data and wait for fd before reading.
- - call underlying IO's sysread if SSL session is not started.
- [ruby-dev:24072], [ruby-dev:24075]
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_write):
- - call underlying IO's syswrite if SSL session is not started.
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_pending): new method
- OpenSSL::SSL#pending.
-
- * ext/openssl/lib/openssl/buffering.rb: should not use select.
-
-Mon Aug 23 12:40:56 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/resolv.rb (Config.default_config_hash): when multiple domains
- are set, Win32::Resolv.get_resolv_info returns Array.
-
-Sun Aug 22 01:15:31 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
- should call :ProxyContentHandler before finishing CONNECT.
-
-Sat Aug 21 06:41:16 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/tcltklib/extconf.rb (find_tcl, find_tk): find stub library.
-
- * lib/mkmf.rb (arg_config, with_config): deal with '-' and '_'
- uniformly. [ruby-dev:24118]
-
-Thu Aug 19 16:29:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: Fail to treat a hash value of 'font' option.
-
- * ext/tk/lib/tk.rb: bindinfo cannot return '%' substiturion infomation.
-
- * ext/tk/lib/menu.rb: typo bug.
-
-Thu Aug 19 15:15:24 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * dir.c (free_dir): fix memory leak. reported by yamamoto
- madoka.
-
-Thu Aug 19 11:00:00 2004 Akiyoshi, Masamichi <masamichi.akiyoshi@hp.com>
-
- * dln.c (dln_load): Modify to call lib$find_image_symbol for VMS.
- * io.c (rb_io_fwrite): Use fputc() for VMS non-stream file.
-
-Thu Aug 19 06:07:45 2004 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/token.c: re2c no longer compiled with bit vectors. caused
- problems for non-ascii characters. [ruby-core:03280]
- * ext/syck/implicit.c: ditto.
- * ext/syck/bytecode.c: ditto.
-
- * lib/yaml/baseemitter.rb: folding now handles double-quoted strings,
- fixed problem with extra line feeds at end of folding, whitespace
- opening scalar blocks.
-
- * lib/yaml/rubytypes.rb: subtelties in handling strings with
- non-printable characters and odd whitespace patterns.
-
-Wed Aug 18 23:41:33 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/protocol.rb (rbuf_fill): OpenSSL::SSL::SSLSocket has its own
- buffer, select(2) might not work. [ruby-dev:24072]
-
-Wed Aug 18 17:10:12 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/tcltklib/stubs.c (ruby_tcltk_stubs): need to call
- Tcl_FindExecutable() for Tcl/Tk 8.4.
-
-Wed Aug 18 12:52:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_obj_instance_eval): evaluates under special singleton
- classes as for special constants.
-
-Tue Aug 17 17:20:59 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_reopen): should clear allocated OpenFile. pointed
- out by Guy Decoux. [ruby-core:03288]
-
-Tue Aug 17 01:36:32 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/usage.rb: Remove extra indent. Tidy 'ri' option
- parsing so RDoc::usage plays better with OptionParser.
-
-Sat Aug 14 13:09:10 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb: backport from CVS HEAD (rev1.44).
-
- * lib/fileutils.rb: cp_r should copy symlink itself, except cp_r
- root.
-
- * lib/fileutils.rb: new option mv :force.
-
- * lib/fileutils.rb: new module FileUtils::DryRun.
-
-Sat Aug 14 02:48:16 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/usage.rb: Added. Allows command line programs
- to report usage using their initial RDoc comment.
-
-Fri Aug 13 13:23:17 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_range_header):
- fix regex for range-spec.
-
- * lib/webrick/httpservlet/filehandler.rb
- (WEBrick::HTTPServlet::DefaultFileHandler#make_partial_content):
- multipart/byteranges response was broken.
-
- * lib/webrick/httpservlet/erbhandler.rb
- (WEBrick::HTTPServlet::ERBHandler#do_GET): should select media type
- by suffix of script filename.
-
- * lib/xmlrpc/server.rb: refine example code.
-
-Wed Aug 11 17:17:50 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (RPATHFLAG): stop setting RPATHFLAG on Interix.
-
-Sun Aug 8 00:43:31 2004 why the lucky stiff <why@ruby-lang.org>
-
- * lib/implicit.c: added sexagecimal float#base60.
-
- * ext/syck/rubyext.c (yaml_org_handler): ditto.
-
- * lib/token.c: indentation absolutely ignored when processing flow
- collections. plain scalars are trimmed if indentation follows in
- an ambiguous flow collection.
-
-Sat Aug 7 00:50:01 2004 Tanaka Akira <akr@m17n.org>
-
- * ext/zlib/zlib.c: Zlib::GzipReader#read(0) returns "" instead of nil.
-
-Tue Aug 3 13:49:20 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/namespace.rb: bug fix
-
- * ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: add Tk::TreeCtrl.loupe
-
-Mon Aug 2 18:04:21 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/msgcat.rb (set_translation): bug fix (fail to set
- trans_str to the same as src_str when trans_str is not given.)
-
-Mon Aug 2 11:53:06 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): Fix infinite recursion
- looking up some top level symbols (batsman)
-
-Mon Aug 2 11:48:29 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Allow '.'s in
- variable names to support SWIG generated files (Hans Fugal)
-
-Sat Jul 31 17:40:16 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial,
- ruby-calculate-indent, ruby-move-to-block, ruby-forward-sexp,
- ruby-backward-sexp): keywords must match word-wise.
-
-Sat Jul 31 05:47:37 2004 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml.rb (YAML::load_file, YAML::parse_file): added.
-
- * lib/yaml/rubytypes.rb: exceptions were using an older
- YAML.object_maker. [ruby-core:03080]
-
- * ext/syck/token.c (sycklex_yaml_utf8): using newline_len to
- handline CR-LFs. "\000" was showing up on folded blocks which
- stopped at EOF.
-
- * ext/syck/token.c: re2c compiled with bit vectors now.
- * ext/syck/implicit.c: ditto.
- * ext/syck/bytecode.c: ditto.
-
-Fri Jul 30 16:10:54 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (lib_fromUTF8_core): raise ArgumentError when
- the unknown encoding name is given.
-
- * ext/tcltklib/tcltklib.c (lib_toUTF8_core): ditto.
-
- * ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertfrom): bug fix.
-
- * ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertto): ditto.
-
-Wed Jul 28 18:59:17 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::initialize): remove at_exit code for CGI_PARAMS
- and CGI_COOKIES. they will no longer be used.
-
-Wed Jul 28 01:04:44 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (run_final): wrong order of data. [ruby-dev:23984]
-
-Tue Jul 27 07:05:04 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): copy on write for argument local variable
- assignment.
-
- * eval.c (assign): ditto.
-
- * eval.c (rb_call0): update ruby_frame->argv with the default
- value used for the optional arguments.
-
- * object.c (Init_Object): "===" calls rb_obj_equal() directly.
- [ruby-list:39937]
-
-Mon Jul 26 11:22:55 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape): should
- escape space.
-
-Sun Jul 25 11:05:21 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * win32/win32.{h,c} (rb_w32_{f,fd,fs}open): workaround for bcc32's
- {f,fd,fs}open bug. set errno EMFILE and EBADF. [ruby-dev:23963]
-
-Sat Jul 24 13:32:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * range.c (rb_range_beg_len): returns Qnil only when "beg" points
- outside of a range. No boundary check for "end".
-
-Fri Jul 23 16:40:25 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (define_final): should not disclose NODE* to Ruby world.
- [ruby-dev:23957]
-
-Fri Jul 23 09:03:16 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (disconnected?): new method. (backported from HEAD)
-
-Thu Jul 22 16:41:54 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi/session.rb (CGI::Session::FileStore#update): sets the
- permission of the session data file to 0600.
-
- * lib/cgi/session/pstore.rb (CGI::Session::Pstore#initialize):
- ditto.
-
-Thu Jul 22 00:02:21 2004 Masahiro Kitajima <katonbo@katontech.com>
-
- * process.c (rb_f_system): not need to call last_status_set() any
- longer on _WIN32.
-
-Tue Jul 20 09:15:17 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * test/fileutils/test_fileutils.rb: File.link raises EINVAL on BeOS.
-
-Mon Jul 19 01:15:07 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpservlet/cgihandler.rb
- (WEBrick::HTTPServlet::CGIhandler#do_GET): set SystemRoot environment
- variable to CGI process on Windows native platforms. [ruby-dev:23936]
-
- * lib/webrick/httpservlet/cgihandler.rb
- (WEBrick::HTTPServlet::CGIhandler#do_GET): use $?.exitstatus and
- refine log message.
-
-Sun Jul 18 16:14:29 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/msgcat.rb (TkMsgCatalog.callback): bug fix
- ( wrong number of argument )
-
-Sun Jul 18 08:13:58 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): remove extra sign digit.
-
-Sun Jul 18 03:21:42 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * dir.c (range): use NULL instead of 0.
-
- * dir.c (range): get rid of a gcc 3.4 warning.
-
-Sun Jul 18 03:12:11 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (receive_responses): return if a LOGOUT response
- received. (backported from HEAD)
- * lib/net/imap.rb (send_string_data): wait command continuation
- requests before sending octet data of literals. (backported from HEAD)
-
-Sat Jul 17 23:54:59 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/variable.rb: TkVariable#ref returns a TkVariable object
-
-Sat Jul 17 22:04:44 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/ldap.rb: method hierarchical? should be in URI::LDAP.
-
-Sat Jul 17 18:29:07 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt): not to show same error messages twice.
-
-Sat Jul 17 13:13:32 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/ruby-lex.rb (RubyLex::identify_string): %s string do not
- process expression interpolation. [ruby-talk:106691]
-
-Sat Jul 17 05:26:27 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/diagram.rb: Incorporate Micheal Neuman's
- client-side imagemao patch
-
-Sat Jul 17 01:57:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (THREAD_ALLOC): th->thread should be initialized to NULL.
- [ruby-talk:106657] The solution was found by Guy Decoux.
-
-Fri Jul 16 22:30:28 2004 Michael Neumann <mneumann@ntecs.de>
-
- * file.c (rb_stat_dev_major): new methods File::Stat#dev_major and
- #dev_minor. [ruby-core:03195]
-
-Fri Jul 16 15:23:53 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (return_jump, break_jump): raise unexpceted local jump
- exception directly. [ruby-dev:23740]
-
- * lib/base64.rb (Deprecated): super in bound method calls original
- name method in stable version. [ruby-dev:23916]
-
-Fri Jul 16 11:31:49 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/test/unit/ui/{fox,gtk,gtk2}/testrunner.rb: remove
- garbage (patch from akira yamada) [ruby-dev:23911]
-
-Fri Jul 16 11:20:00 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): fix output of NaN, Inf and -Inf with
- "%f" or etc on MSVCRT platforms. (backported from HEAD)
-
-Fri Jul 16 11:17:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
- [ruby-dev:23913]
-
- * error.c (exit_success_p): new method SystemExit#success?.
- [ruby-dev:23912]
-
- * error.c (syserr_initialize): initialization for subclasses.
- [ruby-dev:23912]
-
-Thu Jul 15 23:53:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
- no longer has to_str method.
-
-Thu Jul 15 22:59:48 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * ext/readline/extconf.rb: added dir_config for curses, ncurses,
- termcap. (backported from HEAD)
-
-Thu Jul 15 20:29:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * class.c, error.c, eval.c, intern.h, object.c, variable.c:
- do not set path if it is a singleton class. [ruby-dev:22588]
- (backport from 1.9)
-
-Thu Jul 15 10:15:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/, ext/tcltklib/: bug fix
-
- * ext/tk/lib/tk.rb: better operation for SIGINT when processing
- callbacks.
- * ext/tk/lib/tk/msgcat.rb: ditto.
- * ext/tk/lib/tk/variable.rb: ditto.
- * ext/tk/lib/tk/timer.rb: ditto.
-
- * ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
- to define validatecommand methods easier
-
- * ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
- classes
-
- * ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
- check for items (e.g. canvas items; depends on the class) to
- avoid some troubles on Tk extension widget class definition.
-
- * ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
-
- * ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
-
-
-Wed Jul 14 18:08:37 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
- argument. [ruby-dev:23891]
-
- * test/openssl/test_x509store.rb: prune tests for CRL checking
- unless X509::V_FLAG_CRL_CHECK is defined.
-
-Wed Jul 14 12:29:07 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * util.c (ruby_strtod): should not convert string in the form of
- "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
-
- * test/ruby/test_float.rb (test_strtod): add test for bug fix.
-
-Wed Jul 14 00:31:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * array.c: rdoc patch. merged patch from Johan Holmberg
- <holmberg@iar.se> [ruby-core:3170]
-
-Tue Jul 13 19:39:12 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#merge_path):
- "URI('http://www.example.com/foo/..') + './'" should return
- "URI('http://www.example.com/')". [ruby-list:39838]
- "URI('http://www.example.com/') + './foo/bar/..'" should return
- "URI('http://www.example.com/foo/')". [ruby-list:39844]
-
- * test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
-
-Tue Jul 13 15:51:45 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
- extmk mode.
-
- * lib/mkmf.rb (dir_config): Prepend a new library path instead of
- appending so it is tried first.
-
-Tue Jul 13 00:50:48 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
-
-Mon Jul 12 21:20:36 2004 Dave Thomas <dave@pragprog.com>
-
- * html_generator.rb: Support hyperlinks of the form {any text}[xxx]
- as well as stuff[xxx]
-
-Sat Jul 10 09:30:24 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/marshal/test_struct.rb: use qualified build-tin class name
- (::Struct) to avoid name crash.
-
-Sat Jul 10 04:21:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: better operation for SIGINT when processing
- callbacks.
- * ext/tk/lib/tk/msgcat.rb: ditto.
- * ext/tk/lib/tk/variable.rb: ditto.
- * ext/tk/lib/tk/timer.rb: ditto.
-
- * ext/tk/lib/tk/validation.rb (__def_validcmd): add a module
- function of Tk::ValidateConfigure to define validatecommand
- methods easier
-
-Fri Jul 9 22:36:36 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
- <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
-
- * numeric.c: rdoc patch.
-
-Fri Jul 9 19:26:39 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
- notice https is not supported.
-
-Fri Jul 9 14:28:54 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_raise): accept third argument as well as
- Kernel#raise, and evaluate the arguments to create an exception in
- the caller's context. [ruby-talk:105507]
-
-Fri Jul 9 01:47:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib : bug fix
- * ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
- * ext/tk/lib/tkextlib/itk : add [incr Tk] support
- * ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
- * ext/tk/sample/tkextlib/iwidgets : very simple examples of
- [incr Widgets]
-
-Thu Jul 8 22:52:19 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
- validation and validation which disregard order of elements.
- * test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
- validation.
- * test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
- name.
-
-Thu Jul 8 00:05:23 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/tempfile.rb (Tempfile::initialize): got out code of
- generating tmpname. [ruby-dev:23832][ruby-dev:23837]
-
-Wed Jul 7 15:53:14 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c (rb_str_match): raise TypeError when both arguments are
- strings. [ruby-dev:22869] (backported from HEAD)
-
- * string.c (rb_str_match2): removed.
-
- * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
- wince/Makefile.sub (string.c): now not depend on version.h.
-
-Wed Jul 7 00:48:34 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tktrans.rb,
- ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
-
-Tue Jul 6 18:38:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib : improve framework of developping Tcl/Tk extension
- wrappers
-
-Mon Jul 5 23:56:42 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/{trackback,syndication,dublincore,content}.rb: worked
- with ruby 1.6 again.
-
- * test/rss/rss-assertions.rb: ditto.
-
-Mon Jul 5 22:54:39 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
-
-Mon Jul 5 09:02:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
- is a set of bit flags. [ruby-dev:23859]
-
-Mon Jul 5 01:27:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
- the socket whose last-access-time is oldest. (and add new one)
- [ruby-dev:23860]
-
-Sun Jul 4 12:24:50 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * lib/rss/rss.rb: added copyright header.
-
-Sun Jul 4 00:24:40 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * added files
- * lib/soap/attachment.rb
- * lib/soap/header
- * lib/soap/mimemessage.rb
- * lib/soap/rpc/httpserver.rb
- * lib/wsdl/soap/cgiStubCreator.rb
- * lib/wsdl/soap/classDefCreator.rb
- * lib/wsdl/soap/classDefCreatorSupport.rb
- * lib/wsdl/soap/clientSkeltonCreator.rb
- * lib/wsdl/soap/driverCreator.rb
- * lib/wsdl/soap/mappingRegistryCreator.rb
- * lib/wsdl/soap/methodDefCreator.rb
- * lib/wsdl/soap/servantSkeltonCreator.rb
- * lib/wsdl/soap/standaloneServerStubCreator.rb
- * lib/wsdl/xmlSchema/enumeration.rb
- * lib/wsdl/xmlSchema/simpleRestriction.rb
- * lib/wsdl/xmlSchema/simpleType.rb
- * lib/xsd/codegen
- * lib/xsd/codegen.rb
- * sample/soap/authheader
- * sample/soap/raa2.4
- * sample/soap/ssl
- * sample/soap/swa
- * sample/soap/whois.rb
- * sample/soap/calc/samplehttpd.conf
- * sample/soap/exchange/samplehttpd.conf
- * sample/soap/sampleStruct/samplehttpd.conf
- * sample/wsdl/raa2.4
- * sample/wsdl/googleSearch/samplehttpd.conf
- * test/openssl/_test_ssl.rb
- * test/soap/header
- * test/soap/ssl
- * test/soap/struct
- * test/soap/swa
- * test/soap/wsdlDriver
- * test/wsdl/multiplefault.wsdl
- * test/wsdl/simpletype
- * test/wsdl/test_multiplefault.rb
-
- * modified files
- * lib/soap/baseData.rb
- * lib/soap/element.rb
- * lib/soap/generator.rb
- * lib/soap/marshal.rb
- * lib/soap/netHttpClient.rb
- * lib/soap/parser.rb
- * lib/soap/processor.rb
- * lib/soap/property.rb
- * lib/soap/soap.rb
- * lib/soap/streamHandler.rb
- * lib/soap/wsdlDriver.rb
- * lib/soap/encodingstyle/handler.rb
- * lib/soap/encodingstyle/literalHandler.rb
- * lib/soap/encodingstyle/soapHandler.rb
- * lib/soap/mapping/factory.rb
- * lib/soap/mapping/mapping.rb
- * lib/soap/mapping/registry.rb
- * lib/soap/mapping/rubytypeFactory.rb
- * lib/soap/mapping/wsdlRegistry.rb
- * lib/soap/rpc/cgistub.rb
- * lib/soap/rpc/driver.rb
- * lib/soap/rpc/element.rb
- * lib/soap/rpc/proxy.rb
- * lib/soap/rpc/router.rb
- * lib/soap/rpc/soaplet.rb
- * lib/soap/rpc/standaloneServer.rb
- * lib/wsdl/data.rb
- * lib/wsdl/definitions.rb
- * lib/wsdl/operation.rb
- * lib/wsdl/parser.rb
- * lib/wsdl/soap/definitions.rb
- * lib/wsdl/xmlSchema/complexContent.rb
- * lib/wsdl/xmlSchema/complexType.rb
- * lib/wsdl/xmlSchema/data.rb
- * lib/wsdl/xmlSchema/parser.rb
- * lib/wsdl/xmlSchema/schema.rb
- * lib/xsd/datatypes.rb
- * lib/xsd/qname.rb
- * sample/soap/calc/httpd.rb
- * sample/soap/exchange/httpd.rb
- * sample/soap/sampleStruct/httpd.rb
- * sample/soap/sampleStruct/server.rb
- * sample/wsdl/amazon/AmazonSearch.rb
- * sample/wsdl/amazon/AmazonSearchDriver.rb
- * sample/wsdl/googleSearch/httpd.rb
- * test/soap/test_basetype.rb
- * test/soap/test_property.rb
- * test/soap/test_streamhandler.rb
- * test/soap/calc/test_calc.rb
- * test/soap/calc/test_calc2.rb
- * test/soap/calc/test_calc_cgi.rb
- * test/soap/helloworld/test_helloworld.rb
- * test/wsdl/test_emptycomplextype.rb
- * test/wsdl/axisArray/test_axisarray.rb
- * test/wsdl/datetime/test_datetime.rb
- * test/wsdl/raa/test_raa.rb
- * test/xsd/test_xmlschemaparser.rb
- * test/xsd/test_xsd.rb
-
- * summary
- * add SOAP Header mustUnderstand support.
-
- * add HTTP client SSL configuration and Cookies support (works
- completely with http-access2).
-
- * add header handler for handling sending/receiving SOAP Header.
-
- * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
- Model. it caused error.
-
- * add WSDL simpleType support to restrict lexical value space.
-
- * add SOAP with Attachment support.
-
-Sat Jul 3 17:19:44 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
-
-Thu Jul 1 23:15:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/pstore.rb (transaction): safer backup scheme. [ruby-list:39102]
-
- * lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
- [ruby-dev:23157]
-
- * lib/pstore.rb (transaction): allow overriding dump and load.
- [ruby-dev:23567]
-
- * lib/pstore.rb (PStore#transaction): get rid of opening in write mode
- when read only transaction. [ruby-dev:23842]
-
- * lib/yaml/store.rb: follow lib/pstore.rb's change.
-
-Thu Jul 1 18:36:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tcltklib : bug fix
-
- * ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
-
-Thu Jul 1 11:59:45 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
- EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
- EVP_DigestFinal_ex and EVP_DigestInit_ex.
-
- * ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
-
- * ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
- EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
- OpenSSL 0.9.6.
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
- re-implemnt (the arguments for this method is ).
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
- OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
- ossl_cipher_copy, ossl_cipher_reset ossl_cipher_final,
- ossl_cipher_set_key, ossl_cipher_set_iv): replace all EVP_CipherInit
- and EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
- and EVP_CIPHER_CTX_init should only be called once.
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
- OpenSSL::Cipher::Cipher#key_len=.
-
- * ext/openssl/ossl_cipher.c (ossl_cipher_init_deprecated): new
- finction; print warning for Cipher#<<.
-
- * ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
- EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
- and EVP_MD_CTX_init should only be called once.
-
- * ext/openssl/ossl_digest.c (digest_final): should call
- EVP_MD_CTX_cleanup to avoid memory leak.
-
- * ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
- into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
-
- * ext/openssl/ossl_hmac.c (hmac_final): should call
- HMAC_CTX_cleanup to avoid memory leak.
-
- * test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
- test/openssl/test_hmac.rb: new file.
-
-Thu Jul 1 04:08:30 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
- workaround for the versions earlier than OpenSSL-0.9.7.
-
-Thu Jul 1 03:33:55 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
- empty pkey object if no argument is passed. [ruby-talk:103328]
-
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
-
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
-
- * ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
- OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
- OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
- OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
-
- * ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
- OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
- OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
- OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
- OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
-
-Thu Jul 1 03:16:09 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_read): take optional second argument
- to specify a string to be written.
-
- * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#read):
- take optional second argument to specify a string to be written.
-
- * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#gets):
- refine regexp for end-of-line.
-
- * ext/opnessl/lib/openssl/ssl.rb
- (OpenSSL::SSL::SocketForwarder#listen): fix typo.
-
-Wed Jun 30 11:38:51 2004 Mikael Brockman <phubuh@phubuh.org>
-
- * parse.y (primary): should not be NULL. [ruby-core:03098]
-
-Wed Jun 30 02:53:24 2004 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/rubyext.c (syck_emitter_new): set buffer after
- Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
-
-Tue Jun 29 10:31:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
-
- * gc.c (define_final, run_final): preserve and restore safe level for
- finalizers. [ruby-core:03058]
-
- * signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
- safe level for signal handlers. [ruby-dev:23829]
-
-Mon Jun 28 14:57:56 2004 Jeff Mitchell <quixoticsycophant@yahoo.com>
-
- * configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
- DOSISH compilers. [ruby-core:03107]
-
-Mon Jun 28 00:30:19 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
-
-Sun Jun 27 22:39:51 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
-
-Sun Jun 27 12:19:46 2004 Kouhei Sutou <kou@cozmixng.org>
-
- * {lib,sample,test}/rss: added RSS Parser. [ruby-dev:23780]
-
-Sat Jun 26 11:07:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (aix): -b must come at the start of the command line,
- and -e must not appear while testing libraries. [ruby-talk:104501]
-
- * lib/mkmf.rb (dir_config): quote directory names if necessary.
- [ruby-talk:104505]
-
-Fri Jun 25 15:33:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/extconf.rb: check stricter. [ruby-talk:104501]
-
- * ext/iconv/extconf.rb: include iconv.h for libiconv. [ruby-dev:22715]
-
-Fri Jun 25 08:31:29 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_thread_atfork): remove "fork terminates thread"
- warning. [ruby-dev:23768]
-
- * object.c (rb_obj_clone): backport FL_FINALIZE patch from 1.9.
- [ruby-core:02786][ruby-core:03067]
-
- * ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
- should give us packed address, not struct sockaddr.
- [ruby-core:03053]
-
-Fri Jun 25 02:04:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
- including version.h. [ruby-talk:104456] (backported from HEAD)
-
-Thu Jun 24 14:23:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_fread): return already read data when system call is
- interrupted. [ruby-talk:97206]
-
-Thu Jun 24 01:32:43 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * version.h: added declarations of ruby_version,
- ruby_release_date, ruby_platform.
- (backported from HEAD)
-
-Wed Jun 23 22:23:37 2004 Dave Thomas <dave@pragprog.com>
-
- * ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
- with OS X not returning 'from' parameter to recvfrom for
- connection-oriented sockets.
-
-Wed Jun 23 01:45:27 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
- Fix problem with the 'r' being dropped from %r{xxx}
-
-Wed Jun 23 00:20:20 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
- CRs and LFs. (doesn't depend on CR+LF) [ruby-dev:23749]
-
-Wed Jun 23 00:00:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_initialize): should check fcntl result. [ruby-dev:23742]
-
-Tue Jun 22 21:11:36 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
- dLibraries().
-
- * ext/win32ole/win32ole.c (ole_event_free): ditto.
-
- * ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
- before CR.
-
-Tue Jun 22 16:47:42 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
- Thanks, Rutger Nijlunsing.
-
-Mon Jun 21 10:19:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (rb_w32_opendir): use FindFirstFile()/FindNextFile()/
- FindClose() instead of _findfirst()/_findnext()/_findclose().
- merge from HEAD.
-
-Sat Jun 19 13:24:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (method_call): allow changing $SAFE. [ruby-dev:23713]
-
-Fri Jun 18 23:12:22 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
- safe level.
-
-Wed Jun 16 23:05:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * object.c (rb_mod_freeze): prepare string representation before
- freezing. [ruby-talk:103646]
-
-Wed Jun 16 16:04:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * object.c (rb_mod_le): singleton class inherits Class rather than its
- object's class. [ruby-dev:23690]
-
-Wed Jun 16 16:01:17 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (stack_grow_direction): memoize the direction.
-
- * gc.c (Init_stack): should always move to end of VALUE.
-
-Tue Jun 15 12:10:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
-
-Mon Jun 14 18:23:27 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/remote-tk.rb: bug fix
-
-Sun Jun 13 00:23:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
-
- * ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
- eliminate warning about instance variable access
-
- * ext/tk/lib/tk/menubar.rb: improve supported menu_spec
-
- * ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
-
- * ext/tk/lib/tk/root.rb: add menu_spec support
-
- * ext/tk/lib/tk/text.rb: bug fix
-
- * ext/tk/lib/tk/toplevel.rb: add menu_spec support
-
- * ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
-
-Sat Jun 12 11:15:53 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (target_os): strip -gnu suffix on Linux.
-
-Fri Jun 11 17:08:21 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * config.guess: Restore a wrongly removed hyphen.
-
-Fri Jun 11 14:30:08 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * config.guess: Attempt to avoid system name change on
- Darwin platforms also.
-
-Fri Jun 11 14:22:45 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * config.guess, config.sub: Attempt to avoid system name change on
- Linux platforms. We have been using "linux" instead of
- "linux-gnu" on this branch.
-
-Thu Jun 10 19:19:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
- [ruby-talk:103062]
-
-Wed Jun 9 18:04:14 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic::merge,
- URI::Generic::route_from): accepts non-hierarchical URI.
- [ruby-dev:23631]
-
- * test/uri/test_generic.rb (TestGeneric::test_route,
- TestGeneric::test_merge): added tests for above changes.
-
-Wed Jun 9 17:39:37 2004 Akinori MUSHA <knu@iDaemons.org>
-
- * config.guess, config.sub: Update to a more recent version as of
- 2004-01-20.
-
- * configure.in: Add support for DragonFly BSD.
-
-Wed Jun 2 20:16:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (str_new4): should share shared instance if it already
- exists. [ruby-dev:23665]
-
-Wed Jun 2 12:41:53 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_gets_m): set lastline ($_) even when read line is
- nil. [ruby-dev:23663]
-
-Fri May 28 11:20:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval): bad influence on frame node.
-
- * eval.c (eval): reverted wrongly removed condition. [ruby-dev:23638]
-
-Thu May 27 23:15:18 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb: leading 0 padding of timestamp usec part.
-
- * lib/csv.rb (CSV.parse): [CAUTION] behavior changed. in the past,
- CSV.parse accepts a filename to be read-opened (it was just a
- shortcut of CSV.open(filename, 'r')). now CSV.parse accepts a
- string or a stream to be parsed e.g.
- CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
-
- * lib/csv.rb: CSV::Row and CSV::Cell are deprecated. these classes
- are removed in the future. in the new csv.rb, row is represented
- as just an Array. since CSV::Row was a subclass of Array, it won't
- hurt almost all programs except one which depended CSV::Row#match.
- and a cell is represented as just a String or nil(NULL). this
- change will cause widespread destruction.
-
- CSV.open("foo.csv", "r") do |row|
- row.each do |cell|
- if cell.is_null # using Cell#is_null
- p "(NULL)"
- else
- p cell.data # using Cell#data
- end
- end
- end
-
- must be just;
-
- CSV.open("foo.csv", "r") do |row|
- row.each do |cell|
- if cell.nil?
- p "(NULL)"
- else
- p cell
- end
- end
- end
-
- * lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
- change. CSV.open, CSV.parse, and CSV,generate now do not force
- opened file binmode. formerly it set binmode explicitly.
-
- with CSV.open, binmode of opened file depends the given mode
- parameter "r", "w", "rb", and "wb". CSV.parse and CSV.generate open
- file with "r" and "w".
-
- setting mode properly is user's responsibility now.
-
- * lib/csv.rb: accepts String as a fs (field separator/column separator)
- and rs (record separator/row separator)
-
- * lib/csv.rb (CSV.read, CSV.readlines): added. works as IO.read and
- IO.readlines in CSV format.
-
- * lib/csv.rb: added CSV.foreach(path, rs = nil, &block). CSV.foreach
- now does not handle "| cmd" as a path different from IO.foreach.
- needed?
-
- * test/csv/test_csv.rb: updated.
-
- * test/ruby/test_float.rb: added test_strtod to test Float("0").
-
-Thu May 27 21:37:50 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#initialize): refine pathname initialization
- by pathname.
-
-Thu May 27 20:22:05 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
-
-Thu May 27 14:53:13 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
- add errno checking. [ruby-dev:23627]
-
-Wed May 26 14:19:42 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval, eval): make line number consistent on eval with
- Proc. [ruby-talk:101253]
-
-Wed May 26 13:59:17 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
- 'do' after for statement
-
-Wed May 26 13:56:03 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
- relative path to code CSS file
-
-Wed May 26 13:14:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_init_copy): copy also positions. [ruby-talk:100910]
-
-Wed May 26 00:00:00 2004 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/syck.c (syck_new_parser): clear parser on init.
- thanks, ts. [ruby-core:02931]
-
- * ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
- thanks, ts. [ruby-core:02929]
-
- * lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
-
- * lib/yaml.rb: added rdoc to beginning of lib.
-
-Mon May 24 10:46:26 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
- must be absolute URIs
-
-Sat May 22 12:00:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * MANIFEST: add new encodings in rexml.
-
- * ext/tk/MANIFEST: add recent files.
-
-Sat May 22 05:37:11 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
- on the other processes by Tcl/Tk's 'send' command
-
-Fri May 21 09:22:05 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
- Add ()'s around parameters that don't have them
-
-Thu May 20 17:02:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (check_sizeof): define result size. [ruby-core:02911]
-
- * lib/mkmf.rb (create_header): macro name should not include equal
- sign.
-
-Thu May 20 15:59:50 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * ext/socket/socket.c: fix SEGV. [ruby-dev:23550]
-
-Thu May 20 14:35:52 2004 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/socket.c: check SCM_RIGHTS macro addition to
- the msg_control field to test existence of file descriptor passing
- by msg_control.
-
-Thu May 20 12:38:06 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * numeric.c (flo_eq): always check if operands are NaN.
- [ruby-list:39685]
-
-Thu May 20 12:34:39 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
- At Ryan Davis' suggestion, honor visibility modifers if guarded by a
- statement modifier
-
-Thu May 20 12:22:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (have_type): do not check pointer to incomplete type,
- which always get compiled. [ruby-list:39683]
-
-Wed May 19 11:09:00 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
- private to public
-
-Tue May 18 14:00:46 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * node.h (NEW_DSTR): adjust list length.
-
- * parse.y (literal_concat): ditto.
-
-Mon May 17 16:14:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * numeric.c (flo_to_s): it's preferable that "p 0.0" outputs "0.0"
- instead of "0.0e+00". [ruby-dev:23480]
-
- * numeric.c (flo_to_s): it's preferable that "p 0.00000000000000000001"
- outputs "1.0e-20" instead of "9.999999999999999e-21". (the precision
- is considered, but there is assumption DBL_DIG == 15 in current
- implementation)
-
-Mon May 17 10:13:33 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (setup_domain_and_type): honor duck typing.
- [ruby-dev:23522]
-
- * ext/socket/socket.c (sock_s_getnameinfo): ditto.
-
-Mon May 17 01:15:23 2004 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml.rb: removed fallback to pure Ruby parser.
-
- * lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
- of zero at times, which kept some blocks from getting indentation.
-
- * lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
-
- * ext/syck/syck.h: reports style of scalars now, be they plain, block
- single-, or double-quoted.
-
- * ext/syck/syck.c: ditto.
-
- * ext/syck/gram.c: ditto.
-
- * ext/syck/node.c: ditto.
-
- * ext/syck/token.c: ditto.
-
- * ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
- if scalar style is plain.
-
- * ext/syck/rubyext.c (yaml_org_handler): some empty strings were
- loaded as symbols.
-
- * test/yaml/test_yaml.rb (test_perl_regexp): updated test to
- match new regexp serialization.
-
-Mon May 17 00:03:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/drb/drb.rb: Cosmetic documentation changes.
-
-Sun May 16 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/test/unit.rb: Removed :nodoc: directive (it prevented effective
- RDoc operation), and added file-level comment.
-
-Sun May 16 20:55:49 2004 Tanaka Akira <akr@m17n.org>
-
- * ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
- specify an open flag.
- (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
- and DBM::NEWDB.
-
-Sun May 16 13:10:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/test/unit/**/*.rb: Removed :nodoc: directives (many were
- generating warnings, many were on private methods).
-
-Sat May 15 01:41:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (eval): forgot to restore $SAFE value before evaluating
- compiled node. [ruby-core:02872]
-
-Sat May 15 01:33:12 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * range.c (range_each_func): terminates loop if generating value
- is same to @end. [ruby-talk:100269]
-
-Fri May 14 22:08:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_new4): should not reuse frozen shared string if
- the original is not an instance of String. [ruby-talk:100193]
-
-Fri May 14 18:39:25 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/canvas.rb: improve coords support for canvas items.
- Now, supports all of the followings.
- TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
- TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
- TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
- TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
- TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
- TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
-
-Fri May 14 12:11:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
- [ruby-dev:23498]
-
-Thu May 13 15:47:30 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/net/telnet.rb (Net::Telnet::login): "options" can specify
- regexps for login prompt and/or password prompt.
-
-Thu May 13 14:23:45 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * hash.c (delete_if_i): use st_delete_safe() (via
- rb_hash_delete()) instead of returning ST_DELETE.
- backport from HEAD. [ruby-dev:23487]
-
-Thu May 13 13:01:30 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
-
-Thu May 13 11:04:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * pack.c (pack_pack): always add with null for 'Z'.
-
- * pack.c (pack_unpack): terminated by null for 'Z'. [ruby-talk:98281]
-
-Wed May 12 19:59:43 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
- [ruby-talk:99788]
-
-Wed May 12 17:41:42 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/resolv.rb (Resolv::DNS::Config): make it configurable without
- external file such as /etc/resolv.conf.
-
-Wed May 12 14:37:27 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509name.c: attribute value of DC (short name of
- domainComponent) should be IA5String.
-
-Wed May 12 13:20:19 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk/composite.rb: improve configure methods (based on
- the proposal of [ruby-talk:99671]).
-
-Wed May 12 11:51:08 2004 Dave Thomas <dave@pragprog.com>
-
- * class.c (rb_obj_singleton_methods): fix rdoc
-
-Mon May 10 21:44:42 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Change scheme for
- looking up symbols in HTML generator.
-
-Mon May 10 16:45:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (eval): warning during eval should not cause deadlock.
- [ruby-talk:98651]
-
- * eval.c (rb_eval): raise TypeError exception for superclass
- mismatch. [ruby-list:39567]
-
-Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Hack to search parents
- for unqualified constant names.
-
-Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Hack to search parents
- for unqualified constant names.
-
-Sun May 9 22:37:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/net/ftp.rb: improved documentation
- * lib/net/imap.rb: ditto
- * lib/net/pop.rb: ditto
- * lib/net/smtp.rb: ditto
- * lib/net/telnet.rb: ditto
-
-Fri May 7 21:50:21 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
- multiple arguments to 'include'
-
-Fri May 7 21:31:56 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
- [ruby-core:02843]
-
-Fri May 7 11:25:53 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * util.c (ruby_strtod): "0.0000000000000000001" should be converted
- to 1.0e-19 instead of 0.0. (leading zeros aren't significant digits)
- [ruby-talk:99318] [ruby-dev:23465]
-
-Fri May 7 10:00:05 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
-
-Thu May 6 22:13:17 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
- hostname.
-
-Thu May 6 14:22:29 2004 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
- for Ranges, Strings, Structs, Regexps.
-
- * lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
- String's flow style.
-
- * lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
-
- * ext/syck/gram.c: fixed transfer methods on structs, broke it
- last commit.
-
-Thu May 6 11:40:28 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (string): accept NIL.
-
- * lib/net/imap.rb (body_type_basic): allow body-fields omissions.
-
-Thu May 6 01:59:04 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
- Don't include the &block parameter if we have explicit
- yield parameters.
-
-Wed May 5 03:40:29 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/ring.rb: use recv instead of recvfrom.
-
-Tue May 4 23:52:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/gserver.rb: documented
-
-Tue May 4 23:46:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/xmlrpc/README.txt: introduced for documentation purposes
-
-Mon May 3 09:47:24 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
- Fix parsing bug if yield called within 1 line block
-
-Sun May 2 01:04:38 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib, ext/tk: renewal Ruby/Tk
-
-Fri Apr 30 20:08:41 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
-
-Tue Apr 27 13:12:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): too many line trace call. (ruby-bugs PR#1320)
-
-Tue Apr 27 08:41:28 2004 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml/rubytypes.rb: passing Range tests.
-
- * ext/syck/syck.h: version 0.44.
-
- * ext/syck/gram.c: transfers no longer open an indentation.
- fixed transfers which precede blocks.
-
- * ext/syck/token.c: ditto.
-
- * ext/syck/syck.c: fixed segfault if an anchor has been released already.
-
- * ext/syck/node.c (syck_free_members): organized order of free'd nodes.
-
- * ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
- StringValue.
-
-Mon Apr 26 23:56:54 2004 Daniel Kelley <news-1082945587@dkelley.gmp.san-jose.ca.us>
-
- * README.EXT, README.EXT.ja: fixed wrong function signature.
- [ruby-talk:98349]
-
-Mon Apr 26 21:40:09 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
- to instance methods.
-
-Sat Apr 24 10:38:31 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
- Fix bug where consecutive headings are merged.
-
-Fri Apr 23 23:26:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb: $hdrdir should not contain macros for backward
- compatibility. [bruby-dev:28]
-
- * version.c (ruby_show_copyright): obtain copyright year from
- RUBY_RELEASE_YEAR.
-
- * win32/resource.rb: ditto.
-
- * win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
- include them.
-
- * win32/resource.rb: include winver.h for older WindowsCE.
-
-Fri Apr 23 16:38:46 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb: sync taint/freeze flag between
- a pathname object and its internal string object.
-
-Fri Apr 23 14:52:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt, arg, aref_args): should not make sole splat into
- array, in aref_args other than aref with op_asgn.
-
-Fri Apr 23 14:14:38 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/resolv.rb: don't use Regexp#source to embed regexps.
- [ruby-dev:23432]
-
-Thu Apr 22 04:15:36 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (aref_args): should pass expanded list. [ruby-core:02793]
-
-Thu Apr 22 01:12:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * numeric.c (flo_to_s): tweak output string based to preserve
- decimal point and to remove trailing zeros. [ruby-talk:97891]
-
- * string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
- search. [ruby-talk:97342]
-
-Wed Apr 21 22:57:27 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
-
-Wed Apr 21 20:05:00 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
- [ruby-list:39542]
-
-Mon Apr 19 18:11:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * hash.c (rb_hash_equal): returns true if two hashes have same set
- of key-value set. [ruby-talk:97559]
-
- * hash.c (rb_hash_eql): returns true if two hashes are equal and
- have same default values.
-
-Mon Apr 19 08:19:58 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
-
- * dln.c, io.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb, lib/date.rb,
- lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb, lib/matrix.rb,
- lib/monitor.rb, lib/set.rb, lib/thwait.rb, lib/timeout.rb,
- lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb, lib/net/ftp.rb,
- lib/net/http.rb, lib/net/imap.rb, lib/net/telnet.rb,
- lib/racc/parser.rb, lib/rinda/rinda.rb, lib/rinda/tuplespace.rb,
- lib/shell/command-processor.rb, lib/soap/rpc/soaplet.rb,
- lib/test/unit/testcase.rb, lib/test/unit/testsuite.rb: typo fix.
-
-Mon Apr 19 08:14:18 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
- #ifdef HAVE_PROTOTYPES
-
-Fri Apr 16 22:33:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * ext/iconv/iconv.c: nearly finished RDoc comments.
-
-Fri Apr 16 17:04:07 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_equal): always returns true or false, never
- returns nil. [ruby-dev:23404]
-
-Fri Apr 16 08:27:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: skip linking when libraries to be preloaded not
- compiled. [ruby-list:39561]
-
-Thu Apr 15 23:21:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * process.c (pst_success_p): new method Process::Status#success?.
- [ruby-dev:23385]
-
-Thu Apr 15 17:12:13 2004 Tanaka Akira <akr@m17n.org>
-
- * ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
- GDBM::WRCREAT and GDBM::NEWDB.
- (fgdbm_initialize): use specified read/write flag.
-
-Wed Apr 14 11:29:56 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * numeric.c (flo_eq): workaround for bcc32's bug.
- (ruby-bugs-ja:PR#594)
-
-Wed Apr 14 13:06:35 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
-
- * array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
- process.c, re.c, string.c: typos in RDoc comments. [ruby-core:02783]
-
-Wed Apr 14 11:06:38 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
- behavior of :enddoc: -- it now unconditionally terminates
- processing of the current file.
-
-Wed Apr 14 11:03:22 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * defines.h: include <net/socket.h> to get fd_set definition in BeOS.
-
-Tue Apr 13 23:06:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/rinda.rb: change pattern matching.
- a === b -> a == b || a === b. [druby-ja:98]
-
- * test/rinda/test_rinda.rb: ditto.
-
-Tue Apr 13 19:54:29 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: should not overwrite HTTP request header.
- [ruby-list:39543]
-
-Tue Apr 13 01:30:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * ext/iconv/iconv.c: RDoc documentation (from RD; nearly finished).
- * ext/iconv/charset_alias.rb: Prevent from RDoc'ing.
-
-Mon Apr 12 19:11:29 2004 Eric Hodel <drbrain@segment7.net>
-
- * gc.c (rb_gc_copy_finalizer): typo. [ruby-core:02774]
-
-Mon Apr 12 18:52:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
- a value.
-
-Mon Apr 12 10:43:47 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * dir.c (rb_glob2, rb_glob, rb_globi, push_globs, push_braces,
- rb_push_glob): fix memory leak. (leaked when block was interrupted)
-
-Mon Apr 12 10:27:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: backport SIZEOF_TIME_T definition from 1.9.
-
- * win32/Makefile.sub: ditto.
-
- * wince/Makefile.sub: ditto.
-
-Sun Apr 11 19:12:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ruby.c (require_libraries): restore source file/line after
- statically linked extensions initialized. [ruby-dev:23357]
-
-Sun Apr 11 10:47:04 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
- classes and modules are a special case too... (handle extending existing
- classes with or without :enddoc:)
-
-Sat Apr 10 23:51:13 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
- made one too many assumptions...
-
-Sat Apr 10 00:00:19 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/markup/simple_markup/inline.rb: Fix problem
- with \_cat_<b>dog</b>
-
-Wed Apr 7 00:19:50 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/rinda.rb: fix hash tuple bug.
-
- * lib/rinda/tuplespace.rb: ditto.
-
- * test/rinda/test_rinda.rb
-
-Tue Apr 6 18:24:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_reopen): should use rb_io_check_io().
-
-Tue Apr 6 16:46:09 2004 Tanaka Akira <akr@m17n.org>
-
- * configure.in: check the size of time_t.
-
- * time.c (time_add): new function.
- (time_plus): use time_add.
- (time_minus): use time_add.
-
-Tue Apr 6 13:21:30 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/socket.c (make_hostent): must return value.
-
-Tue Apr 6 00:05:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/rinda.rb: add require 'drb/drb'
-
-Mon Apr 5 08:18:23 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
- references work properly.
-
-Sun Apr 4 20:33:42 2004 Minero Aoki <aamine@loveruby.net>
-
- * eval.c (Init_load): make $LOADED_FEATURES built-in.
- [ruby-dev:23299]
-
- * ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
-
- * lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
-
-Sun Apr 4 14:01:20 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/options.rb (Options::parse): Allow multiple -x options to RDoc.
- Fix bug where files weren't being excluded properly
-
-Sat Apr 3 17:11:05 2004 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/syck.h: version 0.43.
-
- * ext/syck/lib/gram.c: allow root-level inline collections.
- [ruby-talk:94922]
-
- * lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
- [ruby-talk:94930]
-
- * ext/syck/bytecode.c: turn off default implicit typing.
-
- * ext/syck/implicit.c: detect base60 integers.
-
- * ext/syck/rubyext.c: handle base60, as well as hex and octal
- with commas. implicit typing of ruby symbols.
-
-Fri Apr 2 17:27:17 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (top_include): include in the wrapped load is done for
- the wrapper, not for a singleton class for wrapped main.
- [ruby-dev:23305]
-
-Fri Apr 2 15:13:44 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (rb_big_eq): use temporary double variable to save the
- result (internal float register may be bigger than 64 bits, for
- example, 80 bits on x86). [ruby-dev:23311]
-
-Fri Apr 2 14:35:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (block_pass): should generate unique identifier of the
- pushing block. [ruby-talk:96363]
-
-Fri Apr 2 07:31:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/socket.c (make_hostent): fix memory leak, based on
- the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
-
-Thu Apr 1 22:55:33 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
- =begin rdoc/=end
-
- * lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
- top-level method being taken as file comment.
-
-Thu Apr 1 22:55:04 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
-
-Thu Apr 1 19:58:37 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
- object with soap/marshal.
- added URIFactory class for URI mapping. BasetypeFactory checks
- instance_variables when original mapping is not allowed (ivar must
- be empty). Instance of URI have instance_variables but it must be
- llowed whenever original mapping is allowed or not.
-
- * lib/xsd/datatypes.rb: check the smallest positive non-zero
- single-precision float exactly instead of packing with "f".
- [ruby-talk:88822]
-
- * lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
- [ruby-dev:22588]
- c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
-
-Wed Mar 31 19:06:23 2004 Tanaka Akira <akr@m17n.org>
-
- * time.c (year_leap_p): new function.
- (timegm_noleapsecond): ditto.
- (search_time_t): use timegm_noleapsecond instead of
- mktime for first guess.
-
-Wed Mar 31 12:04:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/delegate.rb (DelegateClass): define internal methods of the
- result class, but not metaclass of the caller. [ruby-talk:96156]
-
- * intern.h: provide proper prototypes. [ruby-core:02724]
-
- * ruby.h: missing.h is now prerequisite to intern.h.
-
-Tue Mar 30 20:25:34 2004 Tanaka Akira <akr@m17n.org>
-
- * time.c (search_time_t): limit guess range by mktime if it is
- available. [ruby-dev:23274]
-
-Sun Mar 28 14:16:59 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/pop.rb (auth): failed when account/password include "%".
- [ruby-talk:95933]
-
-Sat Mar 27 21:40:41 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb: permit extra semicolon in content-type field.
-
-Sat Mar 27 10:40:48 2004 Tanaka Akira <akr@m17n.org>
-
- * (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
- instead of PrettyPrint.
-
-Thu Mar 25 23:28:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_overflow_p): backport 1.9 usec overflow function.
- (ruby-bugs PR#1307)
-
-Thu Mar 25 23:15:24 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
- Add --version option
-
-Thu Mar 25 04:16:18 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
- which dumps our all known names
-
-Thu Mar 25 03:57:47 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
- allow nested classes to be designated using "."--you must
- now use "::"
-
-Thu Mar 25 02:00:18 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/template/html/one_page_html.rb (Page):
- Fix to work with C modules.
-
-Wed Mar 24 21:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
- * lib/uri/common.rb: Ditto.
- * lib/uri/ftp.rb: Ditto.
- * lib/uri/generic.rb: Ditto.
- * lib/uri/http.rb: Ditto.
- * lib/uri/https.rb: Ditto.
- * lib/uri/ldap.rb: Ditto.
- * lib/uri/mailto.rb: Ditto.
- (All backported from 1.9)
-
-Wed Mar 24 18:48:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
- DESTDIR after installed.
-
- * lib/mkmf.rb (RUBY): / is not recognized as path separator on
- nmake/bmake. [ruby-list:39388]
-
- * lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
-
-Wed Mar 24 12:32:56 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
- Don't document methods if we don't know for sure the
- class or module.
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
- Don't store documentation for singleton classes if we
- don't know the real class.
-
-Wed Mar 24 11:11:26 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
- Allow non-RDoc templates by putting a slash in the template name
-
-Mon Mar 22 16:19:57 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ruby.1: add -width option to .Bl for old groff.
-
-Sun Mar 21 21:11:16 2004 Keiju Ishitsuka <keiju@ishitsuka.com>
-
- * lib/shell/*: bug fix for Shell#system(command_line_string).
-
-Sat Mar 20 20:57:10 2004 David Black <dblack@wobblini.net>
-
- * lib/scanf.rb: Backported 1.9 branch
- modifications/corrections to 1.8 branch
-
-Sat Mar 20 23:51:03 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * eval.c (rb_require_safe): preserve old ruby_errinfo.
- [ruby-talk:95409]
-
- * eval.c (rb_f_raise): should not clear backtrace information if
- exception object already have one.
-
-Sat Mar 20 15:25:36 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
- page background to white.
-
-Sat Mar 20 09:52:33 2004 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
- part of second minute that follows a comma or a full stop.
-
-Fri Mar 19 01:55:57 2004 Mauricio Fernandez <batsman.geo@yahoo.com>
-
- * io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
-
-Thu Mar 18 21:44:38 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: backport drb.rb 1.16.
-
-Fri Mar 18 17:49:51 2005 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * struct.c (make_struct): allow const_id for accessor names.
- [ruby-core:04585]
-
- * eval.c (rb_attr): check if attribute name is local_id or
- const_id.
-
-Thu Mar 18 16:22:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_eq): avoid false positive by using scope and
- dyna_vars. no longer use frame.uniq.
-
-Wed Mar 17 14:44:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * dir.c (range): fix possible "\0" overrun. (in case of "\0-")
-
-Mon Mar 15 07:39:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
- yield is not break destination. [ruby-dev:23197]
-
-Sat Mar 13 14:28:16 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/drb/test_drbssl.rb: rescue LoadError. (Barkport from main
- trunk)
-
- * test/drb/test_drbunix.rb: ditto.
-
-Wed Mar 10 22:28:09 2004 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (remove_dir): should handle symlink correctly.
- This patch is contributed by Christian Loew. [ruby-talk:94635]
- (Backport from main trunk)
-
-Wed Mar 10 16:28:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (return_jump): set return value to the return
- destination. separated from localjump_destination().
-
- * eval.c (break_jump): break innermost loop (or thread or proc).
-
- * eval.c (rb_yield_0): set exit_value for block break.
-
-Wed Mar 10 15:58:43 2004 Ryan Davis <ryand@zenspider.com>
-
- * eval.c (eval): Only print backtrace if generating the backtrace
- doesn't generate an exception. [ruby-core:02621]
-
-Tue Mar 9 13:04:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_ungetc): raise IOError instead of calling
- rb_sys_fail(). [ruby-talk:23181]
-
-Mon Mar 8 19:32:28 2004 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
- -> (?::#{PORT}). [ruby-dev:23170]
-
-Mon Mar 8 15:31:41 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * dir.c (range): treat incomplete '[' as ordinary character (like
- has_magic does).
-
- * dir.c (range): Cancel above change. More discussion is needed.
-
-Sun Mar 7 22:37:46 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
-
- * test/drb/ut_eval.rb: ditto.
-
- * test/drb/ut_large.rb: ditto.
-
- * test/drb/ut_safe1.rb: ditto.
-
- * test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
-
-Sun Mar 7 16:22:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * Makefile.in (lex.c): use $? instead of $<.
-
-Fri Mar 5 00:54:14 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/test/unit.rb: MOve RDoc documentation so that you can
- now say 'ri Test::Unit'
-
-Tue Mar 2 12:32:59 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
- defined? NORETURN. [ruby-dev:23100]
-
-Mon Mar 1 12:24:10 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
- Allow aliases to have parentheses
-
-Sun Feb 29 23:14:53 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
- Handle :nodoc: on singleton classes.
-
-Sat Feb 28 10:58:49 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * MANIFEST: add test_erb.rb
-
- * lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
- if both filename and safe_level given. [ruby-dev:23050]
-
-Fri Feb 27 01:00:09 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
-
-Wed Feb 25 21:16:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * instruby.rb (with_destdir): should return the given argument if no
- DESTDIR is given.
-
- * instruby.rb: use path name expansion of cmd.exe.
-
-Wed Feb 25 09:35:22 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * error.c (NameError::Message): new class for lazy evaluation of
- message to ensure replaced before marshalling. merge from HEAD.
- (ruby-bugs-ja:PR#588)
-
- * eval.c (rb_method_missing): use NameError::Message. merge from
- HEAD. (ruby-bugs-ja:PR#588)
-
-Tue Feb 24 18:59:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * dir.c (glob_helper): '**/' should not match leading period
- unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
-
-Tue Feb 24 13:22:21 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
- heuristics on which files to include and exclude. Now only include
- non-standard files if they are explicitly named in ARGV.
-
-Tue Feb 24 07:23:30 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
- choosing a default main page to display (ie. don't select a page
- if we don't have documentation for it).
-
-Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
- class variables in code listings
-
-Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
- class variables in code listings
-
-Tue Feb 24 06:32:27 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
- aliases in C files.
-
-Tue Feb 24 06:16:22 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
- parsing files.
-
-Tue Feb 24 06:08:47 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
- Start collecting text of constant values earlier: was missing
- values in output if there was no space after '='
-
-Tue Feb 24 06:08:25 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Escape contant values.
-
-Tue Feb 24 03:45:06 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_config.c (ossl_config_each): add new method
- OpenSSL::Config#each. it iterates with section name, field name
- and value.
-
- * ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
-
-Mon Feb 23 09:16:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * instruby.rb (DOSISH): embedded path in batch files should not be
- prefixed by DESTDIR. [ruby-core:02186]
-
-Sun Feb 22 09:54:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * re.c: corrected documentation format (again)
-
-Sun Feb 22 09:43:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * re.c: corrected documentation format (rb_reg_initialize_m)
-
-Sat Feb 21 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * ext/zlib/zlib.c: documented, but needs more effort.
-
-Sat Feb 21 11:12:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * missing/os2.c, missing/x68.c: typo fix. pointed out by greentea.
-
-Fri Feb 20 18:59:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
- irb. [ruby-dev:39243]
-
-Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
- Support visibility modifiers for attributes
-
-Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
- Support visibility modifiers for attributes
-
-Thu Feb 19 22:39:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
- DRb.start_service could handle this.
-
-Thu Feb 19 22:19:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/ostruct.rb: documented
-
-Thu Feb 19 21:28:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * ext/strscan/strscan.c: improved documentation
-
-Thu Feb 19 03:10:52 2004 Minero Aoki <aamine@loveruby.net>
-
- * ext/strscan/strscan.c: synchronized with main trunk (rev 1.11).
-
-Thu Feb 19 02:30:34 2004 Minero Aoki <aamine@loveruby.net>
-
- * ext/strscan/strscan.c: documentation checked.
-
-Thu Feb 19 00:11:05 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
- Strip extraneous space from filenames in :include:
-
-Wed Feb 18 22:52:00 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/unix.rb: remove O_NONBLOCK, thanks \ay
-
-Wed Feb 18 22:47:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * ext/strscan/strscan.c: documented
-
-Wed Feb 18 22:03:11 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/*: should not depend on $KCODE.
-
-Wed Feb 18 17:18:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
-
-Wed Feb 18 10:40:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * sprintf.c (rb_f_sprintf): do not prepend dots for negative
- numbers if FZERO is specified. [ruby-list:39218]
-
-Tue Feb 17 23:40:34 2004 Guy Decoux <ts@moulon.inra.fr>
-
- * sprintf.c (rb_f_sprintf): preserve original val for
- format_integer. [ruby-talk:92975]
-
-Tue Feb 17 23:28:45 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/marshaltestlib.rb: common marshal testcase added.
-
- * test/ruby/test_marshal.rb: use above testsuite.
-
- * test/soap/marshal/test_marshal.rb: ditto.
-
- * test/soap/marshal/cmarshal.rb: removed (not used).
-
-Tue Feb 17 10:51:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
-
-Tue Feb 17 01:35:28 2004 Tanaka Akira <akr@m17n.org>
-
- * eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
- to NODE_LIT. [ruby-dev:22920]
-
-Tue Feb 17 01:24:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bcc32/Makefile.sub, win32/Makefile.sub (config.h): define
- STACK_GROW_DIRECTION. [ruby-dev:22910]
-
- * bcc32/Makefile.sub (config.h): add newer checks.
-
- * wince/Makefile.sub (config.h): define NEED_IO_SEEK_BETWEEN_RW.
-
-Tue Feb 17 00:38:10 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/tuplespace.rb: TupleSpace#initialize, stop doubling timeout
-
-Tue Feb 17 00:18:03 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/rinda/test_rinda.rb: import test_rinda.rb
-
-Tue Feb 17 00:14:30 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: avoid warning "Redefinition of macro
- 'HAVE_GETLOGIN'".
-
- * vms/config.h_in: ditto.
-
-Mon Feb 16 23:28:14 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/csv.rb: document reduction. [ruby-core:02429]
-
-Mon Feb 16 22:08:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/generator.rb: corrected doc format
- * lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
- * lib/rinda/tuplespace.rb: ditto
-
-Mon Feb 16 20:41:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: show more warnings. (refering to mingw)
-
- * bcc32/setup.mak: ditto.
-
-Mon Feb 16 13:39:44 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * dir.c (rb_glob, rb_globi): add const.
-
- * ruby.h: ditto.
-
-Mon Feb 16 02:16:33 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * bcc32/Makefile.sub: should warn suspicious pointer conversion.
-
- * bcc32/setup.mak: ditto.
-
-Sun Feb 15 19:06:42 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/tuplespace.rb: TupleSpace#read(tpl, 0), raise
- RequestExpiredError if not found.
-
-Sun Feb 15 15:56:46 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
- Thanks, arton.
-
-Sun Feb 15 01:46:05 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
- [ruby-dev:22870]
-
-Sat Feb 14 11:29:41 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * sample/drb/*: import lib/drb/sample
-
-Sat Feb 14 11:08:23 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: add pretty_print, thanks gotoken.
-
-Fri Feb 13 12:35:08 2004 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb: File.link may raise EINVAL and
- EACCES on Windows.
-
-Thu Feb 12 21:45:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/ftools.rb: documented
-
-Thu Feb 12 21:25:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/base64.rb: backported from HEAD (modularised and documented)
-
-Thu Feb 12 20:31:48 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
- directives in DOS line-ending files at all.
-
-Thu Feb 12 02:23:56 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb: use assert_raise instead of assert_raises.
-
- * lib/pp.rb: ditto.
-
- * lib/time.rb: ditto.
-
- * lib/tsort.rb: ditto.
- use TSortHash and TSortArray instead of Hash and Array in test.
-
-Wed Feb 11 20:01:12 2004 akira yamada <akira@ruby-lang.org>
-
- * test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
- File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
-
- * test/ruby/test_proc.rb (TestProc::test_eq): added a
- test. [ruby-dev:22599]
-
- * test/ruby/test_proc.rb (TestProc::test_eq): added tests for
- Proc#==. [ruby-dev:22592], [ruby-dev:22601]
-
-Tue Feb 10 16:43:56 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (umethod_bind): purge unused check. [ruby-dev:22850]
-
-Mon Feb 9 17:16:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
-
-Mon Feb 9 13:00:55 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
-
- * dir.c (fnmatch): File.fnmatch('*?', 'a') should return true.
- [ruby-dev:22815]
-
- * dir.c (fnmatch): File.fnmatch('\[1\]' , '[1]') should return true.
- [ruby-dev:22819]
-
-Sun Feb 8 16:46:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
- sign for higher heap areas.
-
-Fri Feb 6 22:48:16 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb (gen_url): Support
- https in RDoc hyperlinks
-
-Fri Feb 6 22:41:22 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
- commit. [ruby-dev:22813]
-
-Fri Feb 6 22:22:50 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
- variable which is defined in the test.
-
-Fri Feb 6 00:48:37 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
-
-Thu Feb 5 23:56:55 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/prettyprint.rb (PrettyPrint#seplist): added.
-
- * lib/pp.rb (PPMethods#pp_object): use seplist.
- (PPMethods#pp_hash): ditto.
- (Array#pretty_print): ditto.
- (Struct#pretty_print): ditto.
- (MatchData#pretty_print): ditto.
-
- * lib/set.rb (Set#pretty_print): use seplist.
-
-Wed Feb 4 02:12:06 2004 Tanaka Akira <akr@m17n.org>
-
- * file.c (test_l): fix wrong method name in document.
- (test_S): ditto.
- (test_b): ditto.
- (test_c): ditto.
- (test_suid): ditto.
- (test_sgid): ditto.
- (test_sticky): ditto.
-
-Tue Feb 3 08:04:57 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
-
-Mon Feb 2 19:33:49 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: backport from 1.9 for Interix.
-
- * dln.c (dln_load): ditto.
-
-Mon Feb 2 13:31:51 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/net/http.rb (canonical_each): fix merge miss.
-
-Mon Feb 2 01:54:00 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/pp.rb (Struct#pretty_print): make it 1.8 style.
- (Numeric#pretty_print, FalseClass#pretty_print)
- (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
- with instance variables. [ruby-talk:91157]
-
- * lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
- address.
-
- * lib/resolv-replace.rb (BasicSocket#send): don't replace because
- it has no hostname argument.
- (IPSocket.getaddress): raise SocketError instead of
- Resolv::ResolvError for errors.
- (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
- (SOCKSSocket#initialize): use IPSocket.getaddress instead of
- Resolv.getaddress.
- (UDPSocket#send): recognize 3 arguments form. try all addresses on
- 4 arguments form.
-
-Sun Feb 1 18:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/net/http.rb: merged coding style changes from HEAD.
-
-Sun Feb 1 16:15:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/test/unit.rb: rearranged documentation for RDoc's sake.
- * lib/matrix.rb: improved documentation.
- * lib/net/http.rb: slight documentation formatting improvement.
-
-Sun Feb 1 05:30:06 2004 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
- raise an errror on non-http proxy URI.
- (OpenURI::Buffer#<<): make a tempfile binmode. [ruby-talk:90793]
-
-Sat Jan 31 09:20:32 2004 NAKAMURA, Hiroshi <nakahiro@sairon.co.jp>
-
- * sample/openssl/gen_csr.rb: wrong usage string.
-
-Sat Jan 31 01:00:32 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
- "parts" attribute of soap:body element in WSDL.
-
- * lib/wsdl/xmlSchema/schema.rb: friendly warning message for
- simpleType element which is not supported for now.
-
- * lib/soap/mapping/factory.rb: deleted unused methods.
-
- * lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
- string <-> Ruby class name matching.
-
- * test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
- files.
-
-Thu Jan 29 23:56:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * util.c (mblen): fix overrun. [ruby-dev:22672]
-
-Thu Jan 29 22:41:53 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
- THis means you can write "see f1[link:files/f1_rb.html]".
-
-Thu Jan 29 15:33:23 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
- second argument. it expected to be a Hash not an Integer.
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
- function for OpenSSL::X509::Name#add_entry.
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_a): append ASN.1
- tag number to each element of return value.
-
- * ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
- OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
-
- * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
- second argument takes OBJECT_TYPE_TEMPLATE by default.
-
- * sample/openssl/gen_csr.rb: use OpenSSL::X509::Name.parse.
-
-Wed Jan 28 04:29:41 2004 Eric Schwartz <emschwar@fc.hp.com>
-
- * lib/cgi/session.rb: use LOCK_SH to read, and a few other
- improvements. [ruby-core:02328]
-
-Tue Jan 27 11:09:29 2004 FUKUMOTO Atsushi <fukumoto@nospam.imasy.or.jp>
-
- * ext/socket/socket.c (s_recvfrom): sending length should be an
- invariant while retrying on EAGAIN. [ruby-talk:89962]
-
-Tue Jan 27 10:35:18 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/win32ole/win32ole.c (set_argv): fix condition.
-
-Tue Jan 27 02:26:31 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
- refine regex for header-name.
-
-Tue Jan 27 00:30:11 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/Makefile.sub: rollback.
-
-Mon Jan 26 22:53:04 2004 Dave Thomas <dave@pragprog.com>
-
- * io.c: Remove documentation references to $defout.
-
-Mon Jan 26 15:11:47 2004 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * sample/exyacc.rb: escape '}' to avoid warning.
-
-Mon Jan 26 14:41:46 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/delegate.rb (Delegator::initialize): preserve
- singleton_method_added method [ruby-dev:22685]
-
- * lib/delegate.rb (Delegator::initialize): use Kernel::raise
- instead of mere raise. [ruby-dev:22681]
-
-Mon Jan 26 12:47:17 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
-
-Mon Jan 26 11:35:23 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
- (ruby-bugs:PR#1256)
-
- * ext/win32ole/win32ole.c (set_argv): set real arguments to
- WIN32OLE::ARGV. [ruby-list:39073]
-
-Thu Jan 22 22:54:53 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
- strings for Novell GroupWise Internet Agent.
- * lib/net/imap.rb (DATA_REGEXP): ditto.
-
-Thu Jan 22 16:21:33 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (string_content): reset lexical states at the beginning of
- string contents. [ruby-list:39061]
-
-Wed Jan 21 21:55:51 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
- * lib/drb/extserv.rb: typo
-
-Wed Jan 21 17:57:56 2004 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (envelope): allow NIL.
- * lib/net/imap.rb (body): ditto.
- * lib/net/imap.rb (number): ditto.
- * lib/net/imap.rb (ensure_nz_number): show a detailed error
- message.
-
-Wed Jan 21 16:44:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (merge_libs): squeeze successive same libraries.
- [ruby-dev:22652]
-
-Wed Jan 21 16:01:37 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/digest/rmd160/extconf.rb: have_library appends found library.
-
-Wed Jan 21 11:36:00 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (block_append): update nd_end for "real" head node.
- [ruby-list:39058]
-
-Tue Jan 20 14:48:13 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
- of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
-
-Tue Jan 20 14:43:17 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/base64.rb: Add RDoc
-
-Tue Jan 20 14:25:51 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/abbrev.rb: Add RDoc
-
-Tue Jan 20 13:22:39 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Document aliases at
- top-most level.
-
- * lib/English.rb: Document English.rb.
-
-Tue Jan 20 02:49:22 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: add check for OpenSSL version.
- [ruby-list:39054]
-
-Tue Jan 20 02:38:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_class): should not dump singleton class.
- [ruby-dev:22631]
-
-Tue Jan 20 01:31:36 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * io.c (lineno): typo fix(FIX2INT -> INT2FIX).
-
-Mon Jan 19 21:53:38 2004 akira yamada <akira@ruby-lang.org>
-
- * io.c, re.c, string.c, time.c: fixed up positions of RDocs.
-
-Mon Jan 19 07:09:20 2004 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date.rb: zone was wrong when it was behind UTC.
- Thanks Mark J. Reed.
-
- * lib/date/format.rb: %z is now always replaced by four digits
- with a leading plus or minus sign.
-
- * sample/cal.rb: added a class, anyway.
-
-Sun Jan 18 20:47:35 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ruby.c: use translate_char() on Cygwin.
-
-Sun Jan 18 02:33:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
-
-Sun Jan 18 00:23:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (class2path): check anonymous class/module before
- checking referable, and allow singleton classes.
-
-Fri Jan 16 14:33:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (class2path): get class path and check referable.
- [ruby-dev:22588]
-
-Fri Jan 16 09:52:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_eq): Proc with empty body may not be equal.
- [ruby-dev:22590]
-
-Thu Jan 15 13:03:10 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (argf_read): do not append EOF. (ruby-bugs-ja:PR#585)
-
- * io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
- weird behavior. [ruby-dev:22424]
-
-Wed Jan 14 13:31:06 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
-
-Tue Jan 13 18:54:28 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb(Logger#msg2str): no special treatment for the object
- which responds to :to_str. commited at 2004-01-11T21:46:27 by
- gsinclair.
-
- * lib/logger.rb(LogDevice#initialize): remove type checking if the
- given object is a String. Kernel.open handles it correctly.
- commited at 2004-01-11T21:46:27 by gsinclair.
-
- * test/logger/test_logger.rb: follow above change (ArgumentError ->
- TypeError.) follow above commit.
-
-Tue Jan 13 14:27:13 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
-
- * lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
- moved run method which allows output level. [ruby-dev:22554]
-
-Tue Jan 13 04:29:52 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
- Show fully-qualified class names in class list.
-
-Tue Jan 13 01:04:37 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
- incorporating DESTDIR in the rdoc installation.
-
-Mon Jan 12 23:27:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (primary): fix position after FCALL. [ruby-dev:22574]
-
-Mon Jan 12 12:07:22 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
- Someone changed the "// in eval.c" comments to "/*...*/" style,
- so the parsing of the source file name broke.
-
- * object.c: Remove spurious space in TrueClass documentation.
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
- bad regexp: if the code before a documented method contained
- a comment that wasn't terminated by whitespace, that comment
- and all intervening code was included in the following
- method's documentation.
-
- * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
- HTML formats need explicit line breaks.
-
-Mon Jan 12 11:46:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
- quotes. [ruby-dev:22564]
-
- * lib/mkmf.rb (libpathflag): do not enclose with quotes always.
-
- * {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
-
-Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
- generation support to ri (Elliot Hughes)
-
-Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
- generation support to ri (Elliot Hughes)
-
-Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
- Also accept command line options via the 'RI' environment variable.
-
-Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
- Also accept command line options via the 'RI' environment variable.
-
-Sat Jan 10 21:27:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (eval): need to add message delimiter. [ruby-dev:22561]
-
-Sat Jan 10 01:54:50 2004 Eric Sunshine <sunshine@sunshineco.com>
-
- * defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
- S_IRWXO, etc. macros are defined since future code might require
- them (even though present code only requires a subset).
-
- * defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
- correctly on Rhapsody when -arch compiler flag was used (via
- configure's --enable-fat-binary option).
-
-Fri Jan 9 10:05:14 2004 Siena. <siena@faculty.chiba-u.jp>
-
- * lib/mkmf.rb (libpathflag): use single quotes. [ruby-dev:22440]
-
-Thu Jan 8 23:49:21 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (RDOCTARGET): new macro. if you want to install
- rdoc documentation, you need to run configure with
- --enable-install-doc.
-
-Thu Jan 8 21:29:43 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
- public key only.
-
- * ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
- OpenSSL::PKey::DH#to_der.
-
- * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
- OpenSSL::PKey::DSA#to_der.
-
- * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
- OpenSSL::PKey::RSA#to_der.
-
-Thu Jan 8 16:51:04 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
- dumps "E" at month-end.
-
-Thu Jan 8 11:20:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * eval.c, object.c, process.c, re.c: don't use C++ style comments.
-
-Thu Jan 8 04:36:21 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
- @config[:Logger] if it was not given.
-
- * sample/webrick/*: new files.
-
- * MANIFEST: add sample/webrick/*
-
-Wed Jan 7 13:00:18 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
- being too eager to find matches of ambiguous method
- names (such as "ri Thread.join" would return both
- Thread.join and ThreadsWait.join)
-
-Wed Jan 7 12:35:41 2004 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/debug.rb: revert command parse regexps. [ruby-list:39014] by
- Shirai,Kaoru.
-
-Wed Jan 7 08:21:04 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parserfactory.rb: Check for shebang
- line in files that would otherwise be treated as
- plain text.
-
-Tue Jan 6 22:13:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_mod_modfunc): should break if m has no super class.
- [ruby-dev:22498]
-
-Tue Jan 6 21:55:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (fptr_finalize): should save errno just after failure.
- [ruby-dev:22492]
-
-Tue Jan 6 14:53:14 2004 Dave Thomas <dave@pragprog.com>
-
- * bin/ri: split out the display side, making it pluggable. Added
- new ri_driver and ri_display files in lib/rdoc/ri.
-
-Tue Jan 6 06:37:53 2004 Dave Thomas <dave@pragprog.com>
-
- * bin/rdoc: Add --ri-system switch
-
- * lib/.document: Update with list of files that seem to have
- documentation
-
- * lib/test/unit.rb: Reorder comment to make it RDoc friendly.
-
- * Makefile.in: add install-nodoc target, and make it
- generate RDoc on default install.
-
- * lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
- --doc-dir option to ri.
-
-Tue Jan 6 00:04:40 2004 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
- fix parsing if there are braces in a method parameter list
-
-Fri Jan 2 14:54:11 2004 Dave Thomas <dave@pragprog.com>
-
- * bin/ri: Add new --classes option, and arrange for
- help messages to be paged too.
-
- * bin/rdoc: Add statistics.
-
- * process.c: (MG) Added Process documentation
-
- * lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
- Fix problem with labels not displaying in RI labeled
- lists using BS and ANSI modes.
-
-Fri Jan 2 01:50:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (argf_eof): ARGF.eof? should not have any side effect.
- [ruby-dev:22469]
-
-Wed Dec 31 17:25:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (argf_each_byte): should return self. [ruby-dev:22465]
-
-Wed Dec 31 11:20:34 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
- file referenced in "// in sss.c" relative to current file.
-
-Wed Dec 31 11:17:37 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/generators/html_generator.rb: Fix problem when
- a public method was aliased, but the alias is then
- made private, and hence doesn't appear in RDoc output.
-
-Wed Dec 31 01:33:05 2003 Dave Thomas <dave@pragprog.com>
-
- * array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
- string.c, time.c: Add RDoc for Kernel functions, and tidy.
-
-Tue Dec 30 19:39:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_f_readline): should raise EOFError at the end of
- files. [ruby-dev:22458]
-
- * io.c (argf_read): should concatenate input files when length
- argument is nil. [ruby-dev:22450]
-
- * io.c (argf_read): should update supplied string buffer (2nd
- argument) even when IO#read is called multiple times.
-
- * io.c: should initialize lineno by zero. [ruby-dev:22460]
-
-Tue Dec 30 12:30:30 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
- class and a method have the same name, finding Xxx.abc was trying
- to find 'abc' in method 'Xxx', not class 'Xxx'.
-
-
-Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
- Handle undoing nesting of yield parameters correctly for:
-
- def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
-
-
-Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
- Handle undoing nesting of yield parameters correctly for:
-
- def each_entry(&block) Dir.foreach(@path) {|f| yield Pathname.new(f) } end
-
-Mon Dec 29 12:51:02 2003 Dave Thomas <dave@pragprog.com>
-
- * eval.c: Add RDoc for Kernel global functions.
-
-Mon Dec 29 11:00:16 2003 Dave Thomas <dave@pragprog.com>
-
- * array.c: Tidy up RDoc loose ends.
-
-Mon Dec 29 05:05:51 2003 Dave Thomas <dave@pragprog.com>
-
- * struct.c, random: Add RDoc comments
-
-Mon Dec 29 02:20:54 2003 Dave Thomas <dave@pragprog.com>
-
- * eval.c: Add RDoc for class Proc, Method, UnboundMethod
-
-Mon Dec 29 00:41:44 2003 Dave Thomas <dave@pragprog.com>
-
- * math.c: Add RDoc comments
-
-Sun Dec 28 20:19:11 2003 Tanaka Akira <akr@m17n.org>
-
- * ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
- raise EOFError.
-
- * ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
- gzfile_read_all returns "".
-
-Sun Dec 28 15:25:08 2003 Dave Thomas <dave@pragprog.com>
-
- * class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
- Object, Module, etc...
-
-Sun Dec 28 11:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
- [ruby-talk:88852]
-
- * test/csv/{bom.csv,mac.csv}: removed.
-
-Sun Dec 28 08:56:51 2003 Dave Thomas <dave@pragprog.com>
-
- * eval.c: Thead[Group] RDoc (thanks to MG)
-
-Sun Dec 28 03:50:05 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
- Escape method names used in regexp
-
-Sun Dec 28 01:46:02 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
- Add support for rules in 'ri' output.
-
-Sun Dec 28 01:35:35 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
- Sometimes the Ruby source aliases two otherwise
- unrelated methods (for example Kernel#object_id and
- Kernel#hash are both the same C function). Provide a
- facility to allow the methods to be documented
- separately.
-
-Sun Dec 28 01:05:31 2003 Dave Thomas <dave@pragprog.com>
-
- * marshal.c, signal.c: RDoc collemts added by Elliott Hughes
-
-Sun Dec 28 00:48:47 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
- Some source files use lower case class or module names
- when naming the Init_XXX function in C.
-
-Sat Dec 27 23:41:46 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: fix "test: too many arguments" error.
-
-Sat Dec 27 15:32:19 2003 Dave Thomas <dave@wireless_3.local.thomases.com>
-
- * time.c: RDoc comments added
-
-Sat Dec 27 15:07:57 2003 Dave Thomas <dave@pragprog.com>
-
- * object.c: Add RDoc comments for Symbol class.
-
-Sat Dec 27 14:42:30 2003 Dave Thomas <dave@pragprog.com>
-
- * numeric.c: Add RDoc comments.
-
-Sat Dec 27 00:44:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (next_argv): warn always for stdin on inplace edit mode.
-
- * io.c (read_all): need to check string value.
-
- * io.c (argf_read): allow ARGF.read(nil). [ruby-dev:22433]
-
-Fri Dec 26 23:02:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_f_backquote): need not to check nil result.
- [ruby-core:02078]
-
- * io.c (rb_io_getline): should return nil when read_all gives
- empty string, even when nil rs is specified. [ruby-core:02077]
-
-Fri Dec 26 18:50:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check if getcontext and setcontext are available.
-
- * eval.c: use presence of getcontext/setcontext.
-
-Fri Dec 26 16:40:53 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
-
-Fri Dec 26 09:26:58 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (pack_pack): add sign check for 'i', and 'l'.
- [ruby-dev:22427]
-
- * bignum.c (rb_quad_pack): add range check for 'quad int'.
-
-Thu Dec 25 22:39:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c (rb_str_update): don't return any value.
-
-Thu Dec 25 15:30:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_update): call rb_str_modify().
-
-Thu Dec 25 05:08:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (search_required): search actual file name once when no
- extension specified.
-
-Thu Dec 25 04:00:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * stable version 1.8.1 released.
-
-Thu Dec 25 00:17:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * configure.in: check for nanosleep, -lrt if required.
- [ruby-core:02059]
-
- * eval.c (thread_timer): use select(2) if nanosleep(2) is not
- available.
-
- * eval.c: check __stub_getcontext for glibc on some platforms.
- [ruby-list:38984]
-
-Wed Dec 24 23:48:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
- test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
- to express -0.0. [ruby-talk:88786]
-
-Wed Dec 24 23:29:30 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/tsort.rb (test_orphaned_break): removed.
-
-Wed Dec 24 20:53:06 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tkmulticolumnlist.rb: new sample
-
- * ext/tk/sample/tkmultilistframe.rb: bug fix
-
-Wed Dec 24 20:37:37 2003 Eric Sunshine <sunshine@sunshineco.com>
-
- * configure.in (LDSHARED): Fixed typographical error in assignment of
- LDSHARED for Rhapsody which caused linking of extension modules to
- fail.
-
-Wed Dec 24 17:51:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * file.c (rb_thread_flock): enable thread support again.
-
-Wed Dec 24 16:46:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (catch_timer): do not call rb_thread_schedule() inside to
- avoid pthread_mutex_lock() deadlock. interrupts to system calls
- are detected by TRAP_END via EINTR error.
-
- * eval.c (thread_timer): do not post signal unless it is
- absolutely necessary.
-
- * rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
-
- * regex.c (re_compile_pattern): check if nextp is smaller than
- pend. [ruby-dev:22372]
-
- * eval.c (umethod_bind): remove method overridden check.
- [ruby-dev:22366]
-
-Wed Dec 24 16:13:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
- status by SSL_get_error().
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
-
-Wed Dec 24 14:23:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): clear the buffer argument
- when returning nil. [ruby-dev:22363]
-
- * test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
- add buffer argument tests.
-
-Wed Dec 24 14:07:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: Modules are allowed to rescue.
-
- * lib/test/unit/autorunner.rb: show output_level in order.
-
- * lib/test/unit/collector/dir.rb: get rid of successive same
- directories in load path.
-
- * test/testunit/test_assertions.rb (test_assert_nothing_raised,
- test_assert_raise): test for modules.
-
-Wed Dec 24 13:43:34 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
- strings.
-
-Wed Dec 24 11:26:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/fileutils/test_fileutils.rb: should not create any
- files or directories in current directory. [ruby-talk:88724]
-
-Wed Dec 24 10:29:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): never return nil at
- unlimited read. [ruby-dev:22334]
-
- * ext/stringio/stringio.c (strio_read): support second
- argument. [ruby-dev:22350]
-
-Wed Dec 24 09:38:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (arg): should return 0 after error. [ruby-dev:22360]
-
-Wed Dec 24 00:56:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (read_all): do not return nil at the end of file.
- [ruby-dev:22334]
-
- * io.c (argf_read): do not depend on nil at eof behavior of
- IO#read().
-
- * eval.c (rb_thread_join): dup exception before re-raising it.
-
- * io.c (rb_io_eof): call clearerr() to prevent side effect. this
- patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
- [ruby-dev:22234]
-
- * pack.c (OFF16): get offset for big endian machines.
-
- * pack.c (pack_pack): use OFF16 instead of OFF16B.
- [ruby-dev:22344]
-
- * pack.c (pack_unpack): ditto.
-
-Tue Dec 23 22:47:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_io_check_readable): set FMODE_RBUF always, even if
- NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
-
- * io.c (rb_io_check_writable): clear FMODE_RBUF before writing
- something.
-
-Tue Dec 23 22:25:00 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/optparse.rb: incomplete RDoc documentation added in place of
- existing RD comments. Tabs converted to spaces.
-
-Tue Dec 23 19:44:47 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/test_streamhandler.rb (test_basic_auth): removed.
- soap4r + basic_auth is not officially supported in ruby/1.8.1 even
- though soap4r + basic_auth + http-access2 should run fine.
-
-Tue Dec 23 19:42:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_ungetc): raise an exception at unread stream to
- avoid unspecified behavior. [ruby-dev:22330]
-
- * test/ruby/test_system.rb (test_syntax): glob relatively from
- __FILE__.
-
-Tue Dec 23 18:09:40 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (pack_pack): remove unnecessary negative value check.
- [ruby-dev:22329]
-
-Tue Dec 23 17:26:55 2003 KONISHI Hiromasa <konishih@fd6.so-net.ne.jp>
-
- * bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
-
-Tue Dec 23 16:08:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/rexml/encodings/US-ASCII.rb: typo. [ruby-talk:88650]
-
- * test/ruby/test_system.rb: num of asserts depended on running dir.
-
- * test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
- handle euc-jp. install iconv, uconv or xmlscan.
-
-Tue Dec 23 14:13:51 2003 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic::check_userinfo,
- URI::Generic::check_user, URI::Generic::check_password): tests
- conflicts/depends with other components closely.
-
- * test/uri/test_generic.rb (TestGeneric::test_set_component):
- added tets.
-
-Tue Dec 23 11:08:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
- "euc-jp" might not be in supported encoding name list.
- [ruby-talk:88650]
-
-Tue Dec 23 06:10:31 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb (CGI): add support for mod_ruby.
-
- * lib/webrick/cgi.rb (CGI::Socket): add check for existence of
- OpenSSL module in all HTTPS related methods.
-
- * lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
- value to OpenSSL::SSLSocket#cipher.
-
- * lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
- set "connection: close" if @keep_alive is false.
-
- * lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
- SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
-
-Mon Dec 22 23:00:05 2003 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
-
-Mon Dec 22 21:59:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (map_charset): always ensure code is a String.
-
-Mon Dec 22 21:15:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_mod_init_copy): always copy singleton class.
- [ruby-dev:22325]
-
-Mon Dec 22 20:44:36 2003 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
- has no host-part.
-
- * test/uri/test_generic.rb (TestGeneric::test_route): added a test.
-
-Mon Dec 22 20:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/cgi.rb: reduce eval.
-
- * lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
- local_path. [ruby-list:38883]
-
-Mon Dec 22 20:09:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/test_property.rb: remove duplicated test method.
-
-Mon Dec 22 18:22:04 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
- HAVE_ISINF definition to follow previous commits of missing.h
- and win32/win32.h.
-
-Mon Dec 22 17:23:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ac_cv_func_setitimer): moved from defines.h
-
- * defines.h, rubysig.h, signal.c: removed macro handling which
- should be done in configure.
-
- * configure.in (intrinsics.h): check if present.
-
- * ruby.h: include intrinsics.h if available.
-
- * bignum.c, marshal.c: include ieeefp.h if available.
-
- * missing.h (isinf): define as a macro if finite() and isnan()
- are available. [ruby-core:02032]
-
-Mon Dec 22 17:07:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in (mingw): set isnan, finite and isinf to yes.
-
-Mon Dec 22 13:40:19 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/property.rb: passing block by reference.
-
-Mon Dec 22 00:32:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
- ALLOW_INTS which may switch context. [ruby-dev:22319]
-
- * ext/syck/emitter.c (syck_emitter_write): str bigger than
- e->bufsize causes buffer overflow. [ruby-dev:22307]
-
-Sun Dec 21 17:29:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * class.c (rb_check_inheritable): new function. [ruby-dev:22316]
-
- * intern.h: add prototype.
-
- * eval.c (superclass): use rb_check_inheritable().
-
- * object.c (rb_class_initialize): check argument validity.
-
-Sun Dec 21 16:25:10 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
- beginning of the argument.
- (Pathname#join): concatenate from the last argument.
- (Pathname#parent): just use Pathname#+.
-
-Sun Dec 21 00:12:37 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
-
- * ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
-
-Sat Dec 20 21:59:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
-
- * lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
- instead of Status: header field.
-
- * lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
-
-Sat Dec 20 16:07:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Completion::complete): wrong
- Regexp for word boundary. pointed out by Gavin Sinclair.
-
- * lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
- missing.
-
-Sat Dec 20 11:40:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/yaml.rb (YAML::YAML): adjust Marshal version.
-
-Sat Dec 20 03:56:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_with_disable_interrupt): prohibit thread context
- switch during proc execution. [ruby-dev:21899]
-
-Sat Dec 20 02:41:02 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/cgi.rb: add file. (yet another CGI library)
-
- * MANIFEST: add lib/webrick/cgi.rb.
-
-Sat Dec 20 02:18:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-calculate-indent): proper indentation
- inside of parentheses. [ruby-dev:22308]
-
-Fri Dec 19 21:24:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
- HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
-
- * lib/webrick/https.rb (HTTPRequest#parse): should check presence
- of cert() method to detect SSLSocket.
-
-Fri Dec 19 22:56:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/property.rb (SOAP::Property#load): new method for loading
- property value into existing property tree.
-
- * test/soap/test_property.rb: add test.
-
-Fri Dec 19 19:21:49 2003 akira yamada <akira@ruby-lang.org>
-
- * lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
- should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
-
-Fri Dec 19 17:36:49 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tkmultilistbox.rb: bug fix
-
- * ext/tk/sample/tkmultilistframe.rb: new sample script
-
-Fri Dec 19 03:44:27 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (parse_form_data): should return an
- empty Hash if the body is empty.
-
-Thu Dec 18 21:47:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/mkmf.rb (create_makefile): should remove deffile if it's
- made by miniruby. based on nobu's patch.
-
-Thu Dec 18 21:44:21 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval.c (stack_extend): ignore inline optimization on VC7.
-
- * win32/Makefile.sub (OS, RT): can override.
-
- * win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
- option. based on Tietew's patch [ruby-dev:22289]
-
-Thu Dec 18 16:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
- return NULL.
-
-Thu Dec 18 15:27:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
- [ruby-dev:21678]
-
-Wed Dec 17 15:15:30 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
- String#[] if more than one arguments are specified.
-
- * lib/delegate.rb: avoid using common instance name as "@obj".
-
- * lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
- subclass of String, but DelegateClass(String).
-
- * ext/curses/extconf.rb: restore function check for init_color.
- [ruby-list:38905]
-
- * Makefile.in: need to specify $(MAINLIBS) for the miniruby
- generation rule.
-
- * configure.in: better FreeBSD -lc_r support.
-
-Wed Dec 17 00:16:14 2003 Minero Aoki <aamine@loveruby.net>
-
- * ext/strscan/strscan.c: new method
- StringScanner#beginning_of_line? (alias #bol?)
-
- * ext/strscan/strscan.c: new method StringScanner#concat and #<<.
-
- * ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
- nor freeze STR (allow destructive modification).
-
- * test/strscan/test_stringscanner.rb: test new methods above.
-
- * test/strscan/test_stringscanner.rb: test destructive string
- modification.
-
-Tue Dec 16 21:20:47 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pp.rb: don't use local variable `pp'.
-
- * lib/prettyprint.rb: ditto.
-
-Tue Dec 16 13:20:43 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: condition bug of if statement on
- {pack,grid}_propagate methods
-
-Tue Dec 16 03:17:29 2003 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
-
- * test/yaml/test_yaml.rb: add test.
-
-Tue Dec 16 01:14:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (catch_timer): check rb_thread_crtical in main native
- thread.
-
- * eval.c (thread_timer): just sends signals periodically, to
- prevent main native thread from receiving them in critical
- section. [ruby-core:01959]
-
-Mon Dec 15 13:32:22 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (check_dirname): check string safety and remove extraneous
- trailing directory separators. [ruby-dev:22279]
-
- * file.c: renamed and externalized rb_path_next,
- rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
-
- * intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
- rb_path_last_separator, rb_path_end.
-
-Mon Dec 15 09:27:46 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
- of rb_protect should take an argument of VALUE.
-
-Sun Dec 14 18:46:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/socket/socket.c (Init_socket): IPv6 is not supported although
- AF_INET6 is defined on MinGW.
-
- * lib/ipaddr.rb (AF_INET6): workaround in the environment which does
- not support IPv6.
-
-Sat Dec 13 18:55:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/charset_alias.rb: preserve original order.
-
- * ext/iconv/extconf.rb: remove wrapper file at clean.
-
-Sat Dec 13 18:09:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (thread_timer): use timer by sub-thread and nanosleep.
- [ruby-talk:87519]
-
- * gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
-
-Sat Dec 13 17:17:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (proc_alloc): cache the created object at first time.
- [ruby-talk:61288], [ruby-dev:22240]
-
-Sat Dec 13 09:01:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in: check ucontext.h.
-
- * eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
- on ia64 or with native thread enabled. [ruby-core:01932]
-
-Sat Dec 13 03:09:14 2003 why the lucky stiff <why@ruby-lang.org>
-
- * lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
-
- * test/yaml/test_yaml.rb: add test.
-
-Fri Dec 12 22:36:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
- "#{aCell}" and so on.
-
- * test/csv/test_csv.rb: add tests.
-
-Fri Dec 12 19:33:06 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
-
- * lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
-
- * lib/fileutils.rb (rmdir_r): ditto.
-
- * lib/fileutils.rb (fu_copy_dir): check if it is a directory after
- mkdir(2).
-
-Fri Dec 12 06:06:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (proc_invoke): fix class name in warning message for
- define_method. [ruby-dev:22235]
-
-Thu Dec 11 21:24:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
-
- * ext/openssl/ossl.[ch]: ditto.
-
- * ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
-
-Thu Dec 11 20:54:28 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
- mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
-
- * lib/fileutils.rb (fu_list): call to_str for all arguments.
-
-Thu Dec 11 20:07:01 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/ftools.rb (makedirs): sync with fileutils.
-
-Thu Dec 11 19:53:03 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
- (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
-
-Thu Dec 11 19:08:02 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (mkdir_p): check if it is a directory after
- mkdir(2) instead of before mkdir(2), to avoid race condition.
- [ruby-talk:87730]
- Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
-
-Thu Dec 11 18:49:30 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb: def m( arg ) -> def m(arg).
-
-Thu Dec 11 11:39:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (ieeefp.h), numeric.c: needed for finite() on
- Solaris. [ruby-core:01921]
-
- * file.c (rb_stat_inspect): adjust format specifier.
-
- * parse.c (arg_prepend): nodetype() is for debug use.
-
- * ruby.h (ISASCII, etc): cast to int to get rid of warning.
-
- * ruby.h (alloca.h): include even in GCC. [ruby-core:01925]
-
- * ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
- specifier.
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
- BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
-
- * ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
-
- * ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
- volatile.
-
- * ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
- format specifier.
-
- * ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
- define unless used.
-
- * ext/pty/pty.c (getDevice): get rid of warning.
-
- * ext/socket/socket.c (port_str, sock_s_getaddrinfo,
- sock_s_getnameinfo): FIX2INT() now returns long.
-
- * ext/socket/socket.c (init_inetsock_internal): uninitialized
- variable.
-
- * ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
-
- * ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
- ISDIGIT() instead of isdigit() to avoid warnings and for
- platforms which don't support non-ascii charater.
-
-Wed Dec 10 19:28:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): set EOF flag at short read.
- [ruby-dev:22223], [ruby-dev:22224]
-
-Wed Dec 10 18:07:25 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
-
-Wed Dec 10 17:54:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): do not set EOF flag when
- requested length is zero. [ruby-dev:22214]
-
-Wed Dec 10 17:17:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (read_all): should return given string even if data read is
- empty. [ruby-dev:22207]
-
-Wed Dec 10 17:16:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): adjust behavior at reading
- beyond EOF to IO. [ruby-dev:22205]
-
- * test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
- beyond EOF.
-
- * test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
- TestEOF::Seek test case.
-
-Wed Dec 10 15:01:19 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/monitor/test_monitor.rb (test_cond): use Queue#deq
- instead of sleep.
-
-Wed Dec 10 14:45:39 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
- for TIOCSCTTY on *BSD. based on gotoyuzo's patch.
- (ruby-bugs:PR#1211)
-
- * ext/pty/pty.c (establishShell): should close descriptors if fork
- failed.
-
-Wed Dec 10 12:53:05 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * win32/win32.h: define execv() using do_aspawn().
-
- * process.c (proc_exec_v): remove #ifdef's which stopped needing.
-
-Tue Dec 9 23:32:23 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
- ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
- ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
- ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
- ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
- ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
- overrided instance methods, which are private methods on the super
- class, are changed to 'private'
-
-Tue Dec 9 19:53:02 2003 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
- for host-part.
-
- * test/uri/test_generic.rb (test_route): added tests for the above
- change.
-
-Tue Dec 9 14:10:48 2003 Tanaka Akira <akr@m17n.org>
-
- * io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
- to avoid clearing EOF flag.
- (rb_io_check_writable): ditto.
-
-Tue Dec 9 02:53:55 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tkalignbox.rb: new sample script
-
-Tue Dec 9 00:45:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
- and made the former call the latter. [ruby-core:01890]
-
- * test/testunit/test_assertions.rb: ditto.
-
-Tue Dec 9 00:07:35 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
- methods as delegates to WEBrick.
-
- * test/soap/calc/{test_calc.rb,test_calc2.rb},
- test/soap/helloworld/test_helloworld.rb,
- test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
- follow the change.
-
-Mon Dec 8 22:48:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/autorunner.rb: remove dependency to a particular
- runner. [ruby-core:01901], [ruby-list:38869]
-
- * lib/test/unit/ui/testrunnerutilities.rb: moved output level
- constants from Console.
-
- * lib/test/unit/ui/console/testrunner.rb: ditto.
-
- * lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
- accept output_level.
-
-Mon Dec 8 15:03:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
-
-Mon Dec 8 13:02:11 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
-
- * test/uri/test_common.rb: add test for URI.regexp.
-
-Mon Dec 8 12:44:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c: define swap16 and swap32 only if they are not
- defined. OpenBSD defines these macros. [ruby-dev:22181]
-
-Sun Dec 7 20:54:17 2003 Tanaka Akira <akr@m17n.org>
-
- * ext/iconv/iconv.c (map_charset): make case sensitive.
- ext/iconv/charset_alias.rb (charset_alias): don't ignore
- config.charset's information. sort aliases.
-
-Sat Dec 6 22:58:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
- SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
- but not finished the handshake process, we should retry it.
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
-
-Sat Dec 6 21:45:10 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * io.c (flush_before_seek): flush before seek on any platform.
-
- * configure.in: ditto.
-
-Sat Dec 6 17:23:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
- as well as downcase one.
-
- * lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
-
-Fri Dec 5 23:22:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
- Test::Unit::Assertions::assert_nothing_raised): use the last
- argument as message unless class object.
-
- * test/testunit/test_assertions.rb (test_assert_raises): test for
- multiple exception list. [ruby-core:01891]
-
- * test/testunit/test_assertions.rb (test_assert_nothing_raised): test
- for non-exception classes.
-
-Fri Dec 5 22:23:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/netHttpClient.rb: proxy support did not work. fixed.
-
- * lib/soap/property.rb: add class methods for loading property from
- stream/file/propertyfile. propertyfile is a file which is located at
- somedir in $:.
-
- * lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
- lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
- e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
-
- * test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
-
-Fri Dec 5 17:26:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_exec_end_proc): maintain tmp_end_procs.
- [ruby-dev:22154]
-
-Fri Dec 5 13:36:59 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_exec_end_proc): should not clear end_procs and
- ephemeral_end_procs before execution. [ruby-dev:22144]
-
- * eval.c (rb_obj_extend): call Module#extended hook after
- extended_object. [ruby-list:38866]
-
- * object.c (Init_Object): Module#extended defined.
-
-Fri Dec 5 13:17:30 2003 Tanaka Akira <akr@m17n.org>
-
- * test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
-
-Fri Dec 5 11:54:45 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): follow IO#read.
-
- * test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
- test/stringio/test_stringio.rb: add EOF test.
-
-Fri Dec 5 02:49:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
- allow multiple exception list. [ruby-core:01884]
-
- * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
- check whether arguments are subclass of Exception.
-
-Thu Dec 4 23:54:00 2003 Rick Ohnemus <rick.ohnemus@systemware.com>
-
- * dln.c (aix_loaderror): should not use member named 'errno' which
- might be a macro (e.g. on AIX).
-
-Thu Dec 4 23:32:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (read_all): do not depend on lseek position.
- [ruby-dev:22026]
-
-Thu Dec 4 22:37:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval): preserve $! value when retry happens in the
- rescue clause. [ruby-talk:86697]
-
-Thu Dec 4 21:50:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
- should rescue errors and re-raise DRbConnError on write too.
- [ruby-dev:22132]
-
-Thu Dec 4 16:41:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (exc_list): allow expanding list. [ruby-dev:22134]
-
-Thu Dec 4 14:09:24 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb (test_cp): test if the error is
- kind of SystemCallError. It is needless details that which errno
- is set on each systems.
-
-Thu Dec 4 13:24:13 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/monitor.rb: use Object#__send__ instead of Object#send.
-
-Thu Dec 4 13:17:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/streamHandler.rb: support latest released version of
- http-access2.
-
-Thu Dec 4 13:04:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/soap.rb: add SOAP::Env module for environment repository
- such as HTTP_PROXY.
-
- * lib/soap/property.rb: property implementation.
-
- * lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
- lib/soap/rpc/driver.rb: use soap/property.rb.
-
- * lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
- use SOAP::Env.
-
- * lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
- management interface, but ignored for now.
-
- * lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
- wiredump charset explicitly. it was fixed to 'utf-8' when iconv or
- uconv module was found.
-
-Thu Dec 4 10:43:58 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
- feature.
-
-Thu Dec 4 10:27:12 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: update hyperlink to the Japanese document.
-
-Thu Dec 4 09:12:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
- the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
-
-Thu Dec 4 08:29:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/server.rb (GenericServer#start): should rescue
- Exception to avoid unexpected aborting. [ruby-core:01853]
-
- * lib/webrick/server.rb (GenericServer#start_thread): should check
- that peeraddr isn't nil before printing.
-
- * lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
- rescue Exception to avoid unexpected aborting of thread.
-
-Thu Dec 4 03:48:59 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
- (Pathname#make_link, Pathname#make_symlink): new method.
-
-Thu Dec 4 01:45:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (argf_read): should not terminate on empty string; wait
- until real EOF. [ruby-dev:21969]
-
- * io.c (argf_read): should adjust length to read, when length is
- specified and read spans command line argument files.
-
-Wed Dec 3 19:38:36 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
-
-Wed Dec 3 13:49:07 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
-
- * ext/tk/lib/tkafter.rb: ditto.
-
- * ext/tk/lib/tkcanvas.rb: ditto.
-
- * ext/tk/lib/tkdialog.rb: ditto.
-
- * ext/tk/lib/tktext.rb: ditto.
-
-Wed Dec 3 13:28:13 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in (lex.c): try gperf first, and copy from the source
- directory if failed. [ruby-dev:22123]
-
- * ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
-
- * lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
-
-Tue Dec 2 23:18:12 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: wrote the warning about HTTP_PROXY environment
- variable.
-
-Tue Dec 2 21:31:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * bin/testrb: new test runner. [ruby-core:01845]
-
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
- Test::Unit::AutoRunner#process_args): take test list to run and
- options.
-
- * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
- Test::Unit::AutoRunner#run): should not exit inside a library,
- just return the result instead.
-
- * lib/test/unit.rb: ditto.
-
- * test/runner.rb: exit with the test result.
-
-Tue Dec 2 20:18:48 2003 Eric Sunshine <sunshine@sunshineco.com>
-
- * configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
- instead of Bison or byacc.
-
- * parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
- 10000 (Bison's default) since some old versions of Yacc define it as
- low as 150 by default, which is too low for Ruby to parse some files,
- such as date/format.rb. Among other issues, the parse problem causes
- "make test" to fail.
-
-Tue Dec 2 20:03:20 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb: check if Pathnames are usable
- for arguments.
-
-Tue Dec 2 04:22:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: fixed #assert_no_match message.
-
- * test/testunit/test_assertions.rb: ditto.
-
-Tue Dec 2 00:43:00 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/syck.c: string buffering bug. decrementing by full
- max_size now. [ruby-core:01834]
-
-Mon Dec 1 21:33:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * numeric.c (num_sadded): prohibit singleton method definition for
- Numerics. fill yet another gap between Fixnum and Bignum.
-
-Mon Dec 1 17:33:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (htov16): converts endian using swap16. htov32(), hton16,
- hton32 as well. [ruby-talk:85377]
-
- * pack.c (swap16): swap 2 bytes no matter how big short is on the
- platform. swap32() is also prepared.
-
- * numeric.c (rb_num2int): returns long to preserve information.
- rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
- [ruby-talk:85377]
-
- * numeric.c (rb_num2uint): should not check for value range if the
- source value is negative.
-
-Mon Dec 1 17:14:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * sample/optparse/opttest.rb: added.
-
-Mon Dec 1 16:10:52 2003 Dave Thomas <dave@pragprog.com>
-
- * lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
-
-Mon Dec 1 14:17:49 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
- Pathname for arguments. [ruby-core:01795]
-
- * test/fileutils/test_fileutils.rb: does much strict test on
- "same" files detecting.
-
-Mon Dec 1 09:28:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (XCFLAGS): re-export $(XCFLAGS).
-
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
-
-Mon Dec 1 01:03:27 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
- and ARCH_FLAG. [ruby-dev:22085]
-
-Sun Nov 30 20:18:07 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
- [ruby-core:01819]
-
- * Makefile.in: add ARCH_FLAG to CFLAGS.
-
- * Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
-
- * lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
-
- * lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
-
- * Makefile.in: add ARCH_FLAG to DLDFLAGS.
-
- * configure.in: should put getcwd in AC_CHECK_FUNCS, not
- AC_REPLACE_FUNCS. [ruby-core:01826]
-
-Sun Nov 30 18:22:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
- DLDFLAGS and LDSHARED.
-
- * configure.in: XCFLAGS for compiling ruby itself. ARCH_FLAG is
- reflected in CFLAGS.
-
- * lib/mkmf.rb: ditto. do not import XCFLAGS from config.status.
-
-Sun Nov 30 17:37:36 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
-
-Sun Nov 30 13:02:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
- Conditional Expressions.
-
- * lib/wsdl/soap/definitions.rb: refactoring - Move Method.
-
- * test/xsd/{test_noencoding.rb,noencoding.xml}: new files. test for
- encoding unspecified XML file parsing.
-
- * test/wsdl/{test_fault.rb,map,datetime}: new files. test of
- SOAPFault, dateTime and Apache's Map.
-
-Sun Nov 30 09:35:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * string.c (rb_str_update): get rid of SEGV at just allocated String.
- [ruby-core:01812]
-
-Fri Nov 28 23:19:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_mark): explicitly check mark recursion levels, instead
- of unreliable stack length.
-
-Fri Nov 28 22:49:56 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
-
-Fri Nov 28 21:44:40 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
- a directory for FreeBSD.
-
-Fri Nov 28 19:37:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * hash.c (env_has_value, env_index): must match exactly.
-
- * test/ruby/test_env.rb (test_has_value, test_index): condition for
- aboves.
-
-Fri Nov 28 17:59:20 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_env.rb: add tests for ENV.
-
-Fri Nov 28 17:47:46 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
- DRbConnError.
-
-Fri Nov 28 15:41:15 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
- argument.
-
-Fri Nov 28 14:41:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/streamHandler.rb: drop unused http parameters.
-
- * lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
- lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
- lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
- under WSDL dynanic client environment. fixed.
-
- * test/wsdl/raa/*: add tests.
-
- * lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
- bug of soap4r. XSDDateTimeImple.to_time passed a Float to
- Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
- causes rounding error.
-
- * test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
-
-Fri Nov 28 04:15:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (method_arity): used wrong Proc object. [ruby-talk:86504]
-
-Fri Nov 28 00:47:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
- success, false as failure. [ruby-dev:22067]
-
- * eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
- ANSI macro instead of hard coded value.
-
- * eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
- TYPEs.
-
-Thu Nov 27 22:05:48 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
- process to get the base address for the RSE backing store, so
- hardcode it for the moment.
- [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
-
-Thu Nov 27 17:36:42 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
- TkTimer#wait recieves the exception of the callback.
- The exception is kept on @return_value.
-
-Thu Nov 27 16:58:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
-
-Wed Nov 26 15:38:47 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * test/fileutils/test_fileutils.rb (test_ln_s): should take the
- existing symbolic link for OpenBSD.
-
-Wed Nov 26 04:48:42 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/token.c: removed YYTOKTMP references which
- were causing buffer overflows on large block scalars,
- comments, quoted scalars and plain scalars.
-
- * ext/syck/rubyext.c: dynamic changing of buffer size.
-
- * ext/syck/syck.h: default buffer size of 4k.
-
-Wed Nov 26 00:55:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
-
- * lib/webrick/httpserver.rb (HTTPServer#run): should pass the
- request's keep_alive flag to the response.
-
-Tue Nov 25 21:41:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * defines.h (ENV_IGNORECASE): should define when DOSISH without
- human68k. [ruby-dev:22047]
-
- * hash.c (env_has_value, env_index): don't ignore case of value.
- [ruby-dev:22048]
-
-Tue Nov 25 21:39:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * file.c (path_check_1): honor sticky bits always.
- [ruby-talk:86273]
-
-Tue Nov 25 20:02:14 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb: do test in more deep
- directory.
-
- * test/fileutils/test_nowrite.rb: ditto.
-
-Tue Nov 25 19:04:23 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
- refined.
-
-Tue Nov 25 18:13:30 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
- test. [ruby-dev:22045]
-
- * test/fileutils/test_nowrite.rb: ditto.
-
-Tue Nov 25 17:52:11 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
- if the environment variable is case sensitive.
-
-Tue Nov 25 16:41:33 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
- removed. this test requires extra libraries in soap4r/1.5.*.
-
-Tue Nov 25 16:24:42 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
- GPL2 -> Ruby's.
-
- * lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
- lib/soap/streamHandler.rb: add interface to streamhandler.
-
- * lib/soap/marshal.rb: raise error if parse fails.
-
- * lib/soap/netHttpClient.rb: add https support. Patched by
- Oliver M. Bolzer.
-
- * lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
-
- * lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
- lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
- using charset for parsing response from buggy server.
-
- * lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
- typed multi-ref array.
-
- * lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
- SOAPStruct which has multi-accessors which name are the same, to an
- array.
-
- * lib/soap/rpc/element.rb: fixed illegal parameter order.
-
- * lib/soap/rpc/element.rb: element name of response message could have
- the name other than 'return'.
-
- * lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
- lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
- lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
- fault definition in a operation. [ruby-talk:84948]
-
- * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
- test for above fix.
-
- * lib/wsdl/soap/complexType.rb: support WSDL array definition with
- maxOccures="unbound".
-
- * lib/xsd/charset.rb: use cp932 under emx. Patched by
- Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
-
- * lib/xsd/xmlparser/parser.rb: set @charset nil by default. Nil means
- 'follow encoding declaration in XML'.
-
- * sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
- sample/wsdl/googleSearch/sampleClient.rb,
- sample/wsdl/googleSearch/wsdlDriver.rb,
- test/wsdl/test_emptycomplextype.rb,
- test/wsdl/marshal/test_wsdlmarshal.rb,
- test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
- instead of File.open(...).read. [ruby-dev:21964]
-
- * test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
- simplify the test case.
-
- * test/wsdl/axisArray/*: add tests for axis's array encoding.
-
-Tue Nov 25 16:15:29 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ruby.h: don't treat Cygwin as Windows.
-
-Tue Nov 25 15:18:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * configure.in: change default value of --enable-pthread (default: no)
-
-Tue Nov 25 07:31:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (primary): allow newlines just before right argument
- parenthesis. (ruby-bugs:PR#1221)
-
-Mon Nov 24 23:32:06 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
- catch/throw for redirection instead of exception.
- (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
-
-Mon Nov 24 19:59:48 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
- instead of HTTP_PROXY in the CGI environment.
-
-Mon Nov 24 19:32:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/etc/extconf.rb: check for pw_passwd in struct passwd and
- gr_passwd in struct group for DJGPP.
-
- * ext/etc/etc.c: ditto.
-
- * ext/Setup.dj: support for curses, etc, zlib.
-
-Mon Nov 24 17:00:00 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb: validate option names.
- :content_length_proc and :progress_proc option implemented.
-
-Mon Nov 24 14:53:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
-
-Sat Nov 22 23:09:45 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: set enable_pthread to no on MinGW.
-
-Sat Nov 22 22:56:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * configure.in: add --enable-pthread option (default: yes)
-
-Sat Nov 22 22:48:46 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
-
- * ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
-
- * ext/tk/sample/tkcombobox.rb: new sample script
-
- * ext/tcltklib/tcltklib.c: add native thread check
-
-Sat Nov 22 18:49:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
- libcruses returns no value, just like keypad().
-
-Sat Nov 22 17:36:36 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (HAVE_GETCWD): output to config.h.
-
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
- (XCFLAGS): output to config.status.
-
-Sat Nov 22 13:10:10 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
-
-Sat Nov 22 11:28:48 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (Init_stack): stack region is far smaller than usual if
- pthread is used.
-
-Sat Nov 22 07:30:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
- when an exception had no backtrace.
-
- * test/testunit/util/test_backtracefilter.rb: ditto.
-
-Fri Nov 21 16:44:18 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
- substitutions on validatecommand option of TkEntry widget
-
- * ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
-
-Fri Nov 21 16:12:11 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * ruby.1: Fix markups and grammar.
-
-Fri Nov 21 14:49:42 2003 Minero Aoki <aamine@loveruby.net>
-
- * ruby.1: wrote about ruby related environment variables.
-
-Fri Nov 21 12:28:03 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_extended): singleton methods should not be checked
- when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
-
-Fri Nov 21 01:40:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * configure.in: check <pthread.h>
-
- * ruby.h: include pthread.h if existence.
- define is_ruby_native() macro when not HAVE_NATIVETHREAD
-
- * eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
-
-Fri Nov 21 00:43:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: use #__send__ instead of #send.
-
- * lib/test/unit/testcase.rb: ditto.
-
-Thu Nov 20 19:19:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in: don't find the Cygwin's pthread library on MinGW.
-
-Thu Nov 20 19:15:50 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
- have st_ino (always 0). [ruby-dev:21972]
-
- * lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
- allow overwriting files by rename(2).
-
- * test/fileutils/test_fileutils.rb: windows? ->
- have_drive_letter?, have_file_perm?
-
-Thu Nov 20 17:50:58 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/tkballoonhelp.rb: new sample script
-
- * ext/tk/sample/tkmultilistbox.rb: ditto
-
- * ext/tk/sample/tktextframe.rb: ditto
-
-Thu Nov 20 13:37:34 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ruby.h: define is_ruby_native_thread() for no native thread
- environment
-
- * eval.c: ditto
-
-Thu Nov 20 12:42:47 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * configure.in: always check existence of the pthread library
-
- * ruby.h: define macros for ruby's native thread check
-
- * eval.c: add ruby's native thread check
-
- * gc.c: ditto
-
-Wed Nov 19 14:45:18 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb (to_ary): print more friendly warning message.
-
-Wed Nov 19 14:32:08 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (fu_same?): add djgpp and wince.
-
- * lib/fileutils.rb (cannot_overwrite_file?): add wince.
-
-Wed Nov 19 11:04:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
- is same as mswin32.
-
-Wed Nov 19 07:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit.rb: do not run tests if $! is set.
-
- * lib/test/unit/assertionfailederror.rb: extend StandardError instead
- Exception (irb catches the former but not the latter).
-
-Tue Nov 18 23:31:36 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * missing/memmove.c (memmove): take void *, not char *.
-
- * missing.h (memmove): ditto.
-
- * missing.h (strchr, strrchr): return char *, not int.
-
-Tue Nov 18 22:20:10 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (fu_same?): temporal fix for windows.
-
-Tue Nov 18 19:05:04 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (fu_same?): check by inode instead of path
- name, to detect two hard links pointing to the same content.
-
- * test/fileutils.rb: did not create correctly looped symlinks.
-
-Tue Nov 18 18:23:05 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_read): behave as IO at empty string.
- [ruby-dev:21939], [ruby-dev:21941]
-
- * ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
-
- * ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
- clear EOF flag.
-
- * test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
-
-Tue Nov 18 14:06:35 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
- [ruby-talk:85344] [ruby-core:01699]
-
- * lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
- e.g. remote objects for receivers.
-
- * lib/fileutils.rb: FileTest -> File.
-
- * lib/fileutils.rb: put parentheses for arguments of File.xxxx?
-
- * test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
-
- * test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
-
- * test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
-
- * test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
-
- * test/fileutils/test_fileutils.rb (test_install): test "install a a".
-
- * test/fileutils/fileasserts.rb: new method assert_symlink.
-
- * test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
-
-Mon Nov 17 19:38:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * file.c (getcwdofdrv): avoid using getcwd() directly, use
- my_getcwd() instead.
-
- * merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
- <sunshine@sunshineco.com>. [ruby-core:01596]
-
-Mon Nov 17 10:50:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Completion::complete): allow least
- common completion for three or more candidates.
-
-Mon Nov 17 09:41:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/ui/tk/testrunner.rb,
- lib/test/unit/ui/gtk/testrunner.rb:
- run GUI main loop in sub thread.
-
- * lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
-
- * lib/test/unit/autorunner.rb (keyword_display): sort keywords.
-
-Sun Nov 16 18:10:57 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval): iterator should return value from next inside
- begin/rescue/end. (ruby-bugs:PR#1218)
-
-Sun Nov 16 13:26:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_object): LINK check earlier than anything else,
- i.e. do not dump TYPE_IVAR for already dumped objects.
- (ruby-bugs:PR#1220)
-
- * eval.c (rb_eval): call "inherited" only when a new class is
- generated; not on reopening.
-
- * eval.c (eval): prepend error position in evaluating string to
- "mesg" attribute string only when it's available and is a
- string.
-
-Sun Nov 16 12:16:10 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/protocol.rb: logging response body. [experimental]
- [ruby-list:38800]
-
-Sun Nov 16 10:49:38 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
-
- * lib/thread.rb (Thread.exclusive): wrap method definition in
- class Thread to enable rdoc to process.
-
-Sun Nov 16 09:45:23 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb (set_debug_output): warn if method is called
- after #start. [ruby-dev:38798]
-
-Sun Nov 16 04:41:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (eval): do not re-raise exception to avoid unnecessary
- exception copying, instead modify exception and internal
- information to adjust eval().
-
- * eval.c (backtrace): can return the current frame information
- only if lev < -1.
-
-Sat Nov 15 22:16:42 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
- refine error message.
-
-Sat Nov 15 10:05:40 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
- refactored to support options.
- (Buffer): maintain size by this class.
-
-Sat Nov 15 07:40:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_method_node): new API to retrieve method body.
-
-Fri Nov 14 13:21:30 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
-
- * ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
- argument [ruby-talk:85066]
-
-Thu Nov 13 20:53:35 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
- [ruby-ext:02251]
-
-Thu Nov 13 19:17:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
- (if available)
-
-Thu Nov 13 17:56:41 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
- reported by Take_tk <ggb03124@nifty.ne.jp>.
- [ruby-ext:02245]
-
-Thu Nov 13 16:45:53 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
- X509::Request#to_der.
-
-Thu Nov 13 11:31:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Completion#complete): prior shorter
- name to containing longer name.
-
-Thu Nov 13 06:08:54 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: stop freezing some classes
-
- * ext/tk/lib/multi-tk.rb: ditto.
-
-Wed Nov 12 17:32:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
- uncaught throw in sub thread raises ThreadError.
-
- * lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
- necessary.
-
-Wed Nov 12 14:09:43 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/monitor/test_monitor.rb: fix the timing problem by Queue.
-
-Wed Nov 12 12:59:44 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * test/monitor/test_monitor.rb: added.
-
-Wed Nov 12 10:14:28 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
-
-Wed Nov 12 06:11:39 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
- add functions to convert STACK into Array.
-
- * ext/openssl/ossl.h: add prototypes.
-
- * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
- ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
- ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
- PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
-
-Wed Nov 12 00:47:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
-
-Tue Nov 11 23:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
- the case when the requested font is not available.
-
-Tue Nov 11 22:44:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (appendline): file may not end with newline. a bug if
- READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
-
-Tue Nov 11 10:42:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: raise an exception when creating TkWindow
- object, because TkWindow class is an abstract class.
-
-Tue Nov 11 03:30:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
- if the specified value doesn't exist.
-
- * lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
- a empty hash if the specified section doesn't exist.
-
-Mon Nov 10 11:40:29 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/monitor.rb (wait): return true on signal/broadcastfalse and
- false on timeout. Thanks Gennady Bystritsky.
-
-Mon Nov 10 00:07:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (primary): primary_value may be 0 when syntax error.
- [ruby-talk:84893]
-
-Sun Nov 9 02:05:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
- maintain symmetry with #assert_nil. Also added better output for
- #assert_kind_of.
-
- * test/testunit/tc_assertions.rb: ditto.
-
-Sat Nov 8 18:50:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
- reading.
-
- * test/soap/marshal/*: backport from soap4r/1.5.1. all differences are
- for ruby/1.6.
-
- * lib/soap/*: backport from soap4r/1.5.1. all differences are for
- ruby/1.6.
-
- * lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
- ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
- [ruby-talk:84813]
-
- * lib/wsdl/soap/definitions.rb: element name typo in custom exception
- struct definition which is needed for wsdlDriver; camelCase ->
- underscore_name.
-
-Sat Nov 8 13:49:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * configure.in: improvement of pthread check
-
-Sat Nov 8 13:28:46 2003 Takaaki Tateishi <ttate@ttsky.net>
- * ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
- Thanks, Kaoru Shirai.
-
-Sat Nov 8 06:19:38 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
- TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
- (queueing a handler to the EventQueue).
-
- * ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
-
-Fri Nov 7 23:23:04 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (Pathname#+): if self or the argument is `.', return
- another.
- (Pathname#parent): if self is `.', return `..'.
- (Pathname#children): if self is `.', don't prepend self for a
- pathname in a result.
- (Pathname#join): re-implemented using Pathname#+.
- (Pathname#find): if self is `.', remove `./' prefix of yielding
- pathname.
-
-Fri Nov 7 10:23:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
- lookup failure. (ruby-bugs:PR#1215)
-
-Fri Nov 7 04:08:05 2003 UENO Katsuhiro <katsu@blue.sky.or.jp>
-
- * ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
- an alias of Zlib::GzipReader#each.
-
-Fri Nov 7 01:03:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_load): save and restore rb_prohibit_interrupt.
- [ruby-dev:21857]
-
-Thu Nov 6 18:05:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * io.c (rb_io_inspect): show the path also at a closed file.
- [ruby-dev:21851]
-
-Thu Nov 6 11:42:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/stringio/stringio.c (strio_set_string, strio_reopen): check
- tainted.
-
- * ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
- strio_putc): add infection.
-
- * ext/stringio/stringio.c (strio_path): just nil. [ruby-dev:21846]
-
- * ruby.c (proc_options): reserve searched script path in the
- source file name table. [ruby-list:38765]
-
- * lib/optparse.rb (OptionParser::Completion#complete): default not to
- ignore case on completion. [ruby-talk:84726]
-
- * win32/win32.c (make_cmdvector): process backslashes even if a quote
- is not enclosed.
-
-Wed Nov 5 23:49:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * sample/openssl/gen_csr.rb: there (at least) is a CA which does not
- accept DN in UTF8STRING format. it's a sample.
-
-Wed Nov 5 22:55:16 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * configure.in, eval.c, signal.c: : add '--with-pthread-ext'
- option to fix the pthread trouble on 'tcltklib'
-
- * ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
-
- * ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
- to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
-
- * ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
- tk_menuSetFocus
-
-Wed Nov 5 17:33:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_load): allow interrupt during loaded program
- evaluation. [ruby-dev:21834]
-
- * hash.c (rb_hash_fetch): always warn if default argument and a
- block are supplied at the same time. [ruby-dev:21842]
-
- * hash.c (env_fetch): ditto.
-
- * array.c (rb_ary_fetch): ditto.
-
-Wed Nov 5 19:08:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
- do not remove next argument if empty value is placed.
-
- * test/optparse: added.
-
-Wed Nov 5 17:05:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/ui/gtk/testrunner.rb: typo.
-
-Wed Nov 5 11:13:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * string.c: add #include "version.h". this file still depends on it.
-
- * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
- wince/Makefile.sub: add version.h dependency to string.c.
-
-Wed Nov 5 09:14:23 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/monitor.rb: revert to the previous revision.
-
-Wed Nov 5 08:39:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
-
- * lib/webrick/https.rb (HTTPRequest#meta_vars): create
- SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
- if no cert-chain was given.
-
-Tue Nov 4 23:44:48 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
- remove needless version.h dependency.
-
-Tue Nov 4 23:38:43 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * class.c, hash.c, string.c: remove #include "version.h".
-
- * Makefile.in: remove needless version.h dependency.
-
-Tue Nov 4 06:54:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (read_all): fptr->f may be NULL, if IO is closed in the
- signal handler.
-
- * io.c (io_read): ditto.
-
- * string.c (get_pat): remove 1.8.0 warning code.
-
- * string.c (rb_str_match): extend warning until 1.8.2.
-
- * string.c (rb_str_match2): ditto.
-
- * class.c (class_instance_method_list): remove 1.8.0 warnings.
- method_list now recurs. [ruby-dev:21816]
-
- * class.c (rb_obj_singleton_methods): ditto.
-
- * array.c (rb_ary_select): remove select with block.
- [ruby-dev:21824]
-
- * hash.c (rb_hash_select): ditto.
-
- * hash.c (env_select): ditto.
-
- * re.c (match_select): ditto.
-
- * struct.c (rb_struct_select): ditto.
-
-Mon Nov 3 22:53:21 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/racc/parser.rb: synchronize with Racc 1.4.4.
-
- * ext/racc/cparse/cparse.c: ditto.
-
- * ext/racc/cparse/cparse.c (parse_main): should abort when
- the length of LR state stack <=1, not ==0.
-
-Mon Nov 3 08:50:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * process.c (check_uid_switch): remove duplicated error messages.
-
- * process.c (check_gid_switch): ditto.
-
-Sun Nov 2 02:28:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/ssl.rb: new option :SSLExtraChainCert.
-
-Sun Nov 2 01:02:04 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * string.c (rb_str_hash): Update the HASH_PERL alternative hash
- algorithm in sync with Perl 5.8.
-
- * st.c (strhash): Ditto.
-
-Sat Nov 1 18:21:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
- SSLSocket#peer_cert_chain.
-
- * ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
- which returns underlying X509_REQ.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
- ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
- ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
- use underlying C struct without duplication not to leak momory.
-
-Sat Nov 1 01:49:03 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/mapping/factory.rb: mark marshalled basetype objects when
- @allow_original_mapping is true. multi-referencing basetype node is
- prohibited in SOAP/1.1 encoding but soap4r's original ruby object
- mapping requires basetype to be marked to detect self referencing
- loop. e.g. o = 1; o.instance_eval { @iv = o } soap4r's original
- mapping is only used through soap/marshal API.
-
- * test/soap/marshal/test_marshal.rb: add tests for self referencing
- immutable objects.
-
- * test/soap/calc/test_calc_cgi.rb: fix test name.
-
-Fri Oct 31 22:26:29 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-
- * wince/string_wce.c (strrchr): should decrement pointer.
-
- * wince/Makefile.sub: correct a range of isdigit().
-
-Fri Oct 31 12:55:24 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
- [ruby-dev:21791]
-
- * bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
-
-Fri Oct 31 01:38:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
- at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
-
-Fri Oct 31 01:02:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * compar.c (cmp_equal): protect exceptions from <=> comparison
- again. returns nil if any exception or error happened during
- comparison.
-
- * eval.c (search_required): should update *featurep when DLEXT2 is
- defined. (ruby-bugs-ja:PR#581)
-
-Thu Oct 30 23:41:04 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/drb.rb: add DRbArray
-
- * lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
-
- * lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
-
-Thu Oct 30 23:19:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/generator.rb: better XML pretty printing.
-
- * lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
- assignment in the element which has "encodingStyle" attribute, and
- add necessary namespace assignment for "arrayType" attribute.
-
- * test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
- through CGI.
-
-Thu Oct 30 22:59:39 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/yaml2byte.c: HASH const too long. Thanks, matz.
-
-Thu Oct 30 19:13:53 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/syck/MANIFEST: Add yamlbyte.h.
-
-Thu Oct 30 14:25:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
- buffer filled.
-
- * io.c (rb_io_fptr_cleanup): move path deallocation to
- rb_io_fptr_finalize (finalizer called by GC).
-
-Thu Oct 30 13:23:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (logop): left may be NULL. [ruby-talk:84539]
-
- * eval.c (rb_eval): NODE_CASE nd_head may be NULL.
-
-Thu Oct 30 10:14:51 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/test/unit/autorunner.rb: make fox runner work.
-
-Thu Oct 30 09:32:26 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * process.c (rb_f_system): fixed lack of security check before
- calling do_spawn() on win32. [ruby-talk:84555]
-
-Thu Oct 30 02:46:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_invoke): single array value to normal Proc#call
- (i.e. not via lambda call), should be treated just like yield.
- [ruby-dev:21726]
-
-Thu Oct 30 02:25:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
- add new method to inherit @sync from @io.sync.
-
- * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
- set sync flag explicitly.
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
- certificates in @extra_chain_cert.
-
-Wed Oct 29 22:02:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
- interpreter to exec, instead of test/ruby/envutil.rb,
-
-Wed Oct 29 19:58:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
- defined and TCL_MAJOR_VERSION >= 8.
-
- * ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
- rb_threadVwaitProc): use CONST84 instead of CONST.
-
- * ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
- ip_rb_threadTkWaitCommand): use CONST84 always.
-
-Wed Oct 29 17:27:05 2003 Tanaka Akira <akr@m17n.org>
-
- * re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
-
- * lib/pathname.rb (realpath): examine Dir.pwd because it may have
- symlinks.
-
-Wed Oct 29 17:16:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_longjmp): must not disturb original jump.
- [ruby-dev:21733]
-
-Wed Oct 29 15:28:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (Init_Proc): taint preallocated exception object
- sysstack_error. [ruby-talk:84534]
-
-Wed Oct 29 11:27:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (ret_args): node may be NULL. [ruby-talk:84530]
-
-Tue Oct 28 15:20:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
- WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
- ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
- rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
- ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
- avoid VC++ warnings.
-
-Mon Oct 27 19:19:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_longjmp): ignore reentering error while warning.
- [ruby-dev:21730]
-
-Mon Oct 27 00:23:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
- calling 'exit' in the Tk callback procedure. [ruby-list:38656]
-
-Sat Oct 25 09:18:04 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_method_missing): protect exception from within
- "inspect". (ruby-bugs:PR#1204)
-
-Fri Oct 24 23:26:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * hash.c (rb_hash_each): Hash#each should yield single value.
- [ruby-talk:84420]
-
- * hash.c (env_each): ditto for ENV.each.
-
-Thu Oct 23 20:25:32 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/server.rb (GenericServer#start): should rescue
- IOError from IO::accept. [ruby-dev:21692]
-
-Thu Oct 23 17:59:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (ruby_cleanup): initialize stack bottom for embedding.
- [ruby-dev:21686]
-
- * ext/dl/extconf.rb: move list of files to clean from DEPEND file,
- to get rid of macro redefinitions.
-
-Thu Oct 23 13:44:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y: integrate operations for stack_type. [ruby-dev:21681]
-
-Thu Oct 23 00:41:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/calc/*, test/soap/helloworld/*: set logging threshold
- to ERROR.
-
-Wed Oct 22 12:53:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
- ignore tests which raised LoadError.
-
- * test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
- test/ruby/test_system.rb: avoid requiring same file twice.
-
- * test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
- ARGV unless invoked directly. do not create test cases unless
- required libraries are available.
-
-Wed Oct 22 02:31:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (ruby_cleanup): should not ignore exit_value in END
- execution. [ruby-dev:21670]
-
-Tue Oct 21 23:16:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (ruby_cleanup): call finalizers and exit procs before
- terminating threads.
-
- * eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
-
-Tue Oct 21 15:57:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
- prepend the directory of target file to the load path.
-
-Tue Oct 21 15:08:53 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (do_spawn, do_aspawn): should wait child process even
- if callded with P_OVERLAY.
-
- * win32/win32.c (do_spawn, do_aspawn): should return child's exit
- status to parent.
-
-Tue Oct 21 00:35:02 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/calc/*, test/soap/helloworld/*: catch the exception from
- test server thread and recover.
-
-Tue Oct 21 00:22:57 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * test/drb/*: import drb/runit.
-
-Mon Oct 20 23:55:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval): set current node after arguments evaluation.
- [ruby-dev:21632]
-
- * eval.c (rb_yield_0): set current node and keep it at local jump.
-
-Mon Oct 20 22:01:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_cleanup): keep thread group for main thread.
- [ruby-dev:21644]
-
-Mon Oct 20 18:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_catch): backout.
-
-Mon Oct 20 17:31:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
- destination.
-
- * eval.c (localjump_destination): use unique number in ruby_frame
- for localjump destination.
-
-Mon Oct 20 11:31:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_signal.rb (test_signal): restore old trap.
-
-Mon Oct 20 11:00:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (gc_sweep): loosen page free condition to avoid add_heap()
- race condition. [ruby-dev:21633]
-
- * gc.c (gc_sweep): do not update malloc_limit when malloc_increase
- is smaller than malloc_limit.
-
-Mon Oct 20 09:45:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * lib/debug.rb (debug_command): remove debug print.
-
-Wed Oct 20 00:25:41 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (search_required): required name must not be changed before
- loading. [ruby-dev:24492]
-
-Sun Oct 19 13:12:30 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
-
-Sun Oct 19 00:14:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
- server. (17171)
-
-Sat Oct 18 23:01:32 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
-
-Sat Oct 18 05:48:59 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/rubyext.c: YAML::Syck::compile method.
-
- * ext/syck/syck.c: Buffer edge bug.
-
- * ext/syck/yaml2byte.c: YAML to bytecode converter.
-
- * ext/syck/yamlbyte.h: Ditto.
-
- * ext/syck/bytecode.c: Bytecode parser fixes to empty collections
- and empty strings.
-
- * ext/syck/token.c: Ditto.
-
-Fri Oct 17 23:07:38 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
- Provide Kernel#to_enum as an alias for Kernel#enum_for. Maybe
- this is a better name.
-
-Fri Oct 17 23:00:30 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/generator.rb: Add rdoc documentation.
-
-Fri Oct 17 22:16:42 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/set.rb: Reword and fix Overview.
-
- * lib/set.rb: It is not necessary to require
- 'test/unit/ui/console/testrunner'.
-
-Fri Oct 17 11:15:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * test/ruby/test_range.rb: added.
-
- * MANIFEST: add test/ruby/test_range.rb.
-
-Fri Oct 17 03:21:23 2003 William Sobel <will.sobel@barra.com>
-
- * ext/socket/socket.c (make_hostent): h_aliases may be NULL.
- (ruby-bugs:PR#1195)
-
- * ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
-
-Fri Oct 17 00:12:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
- without initializing on TkComposite module.
-
-Thu Oct 16 23:51:04 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
- in a callback operation, Ruby/Tk shows a (verbose) backtrace
- information on the callback process.
-
-Thu Oct 16 17:09:19 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
- debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
-
-Thu Oct 16 16:54:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (rb_str_upto): ("a"..."a").to_a should return [].
- [ruby-core:01634]
-
-Thu Oct 16 16:40:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb:
- Add Tk::EncodedString and Tk::UTF8_String class to support
- characters using the \uXXXX escape to the UNICODE string.
-
- * ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
- new demo-scripts (samples of Tk::UTF8_String)
-
- * ext/tk/sample/{demos-en,demos-jp}/widget
- add entries for 'unicodeout.rb'
-
-Thu Oct 16 08:38:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/digest/test_digest.rb (test_eq): show failed class.
-
- * test/ruby/test_iterator.rb (test_break, test_return_trace_func):
- test localjump destination.
-
-Wed Oct 15 20:22:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
- instance_eval('path_query'). [ruby-list:38575]
-
-Wed Oct 15 17:24:45 2003 URABE Shyouhei <root@mput.dip.jp>
-
- * lib/cgi.rb (CGI::Cookie): tiny typo fix.
-
-Wed Oct 15 15:00:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (ruby_run): just return FAILURE instead of parse error
- count. [ruby-list:38569]
-
-Wed Oct 15 13:17:02 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/digest/digest.c (rb_digest_base_alloc): need to initialize
- buffer. [ruby-dev:21622]
-
-Wed Oct 15 11:23:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_object): dump extended modules as well.
-
- * marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
- modules before invoking marshal_load. these two fixes are done
- by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
-
-Wed Oct 15 09:30:34 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
-
- * ext/syck/syck.h: include stdio.h for definition of FILE.
-
-Wed Oct 15 08:09:07 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/bytecode.c: Checkin of YAML bytecode support.
-
- * ext/syck/gram.c: Ditto.
-
- * ext/syck/syck.c: Ditto.
-
- * ext/syck/token.c: Ditto.
-
- * ext/syck/handler.c: Ditto.
-
- * ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
-
- * ext/syck/rubyext.c: Ditto (on both counts).
-
-Wed Oct 15 05:05:53 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * lib/generator.rb: A new library which converts an internal
- iterator to an external iterator.
-
- * lib/abbrev.rb: A new library which creates an abbreviation table
- from a list.
-
-Wed Oct 15 04:31:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
- new demo-scripts
-
- * ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
- add entries for 'entry3.rb'
-
-Wed Oct 15 04:31:47 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * test/digest/test_digest.rb: Moved from ext/digest/test.rb.
-
-Wed Oct 15 03:53:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
- on the last commit).
-
-Wed Oct 15 00:25:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (yylex): argument parentheses preceded by spaces should
- be warned; not error. [ruby-talk:84103]
-
-Wed Oct 15 00:20:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
- switch on threads smoothly and avoid seg-fault.
-
- * ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
- _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
- and tkwait command wait on an eventloop.)
-
- * ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
- _thread_tkwait.
-
- * ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
- If 1st argument is true, waits on a thread. If false, waits on
- an eventloop. If 2nd argument is true, checks existence of
- rootwidgets. If false, doesn't. Default is wait(true, false).
-
- * ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
- TkVariable#wait(arg, true). wait_visibility and wait_destroy
- have an argument for waiting on a thread or an eventloop.
-
- * ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
-
- * ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
- an eventloop'.
-
-Wed Oct 15 00:10:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
- SOAPBasetype and SOAPCompoundtype.
-
- * lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
- Encoding methods signature change. Pass SOAPGenerator as a parameter.
-
- * lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
- for better marshalling/unmarshalling support. Now I think SOAP
- marshaller supports all kind of object graph which is supported by
- Ruby's original marshaller. Of course there could be bugs as always.
- Find it. :-)
-
- * lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
- DEBUG is too noisy.
-
- * lib/xsd/datatypes.rb: DateTime#of is obsoleted. Use DateTime#offset.
-
- * test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
- useless warning.
-
-Tue Oct 14 19:09:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (ruby_finalize_0): return the given exit status unless
- SystemExit got raised.
-
-Tue Oct 14 11:53:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * intern.h (ruby_stop): never return.
-
- * ruby.h (ruby_run): ditto.
-
-Tue Oct 14 04:43:55 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (realpath): make ELOOP check bit more robust.
- (children): prepend self by default.
- (chroot): obsoleted.
-
-Tue Oct 14 02:29:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_require_safe): segfault after loading .so.
-
-Tue Oct 14 02:05:23 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
- module for the Enumerable interface.
-
-Mon Oct 13 23:55:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
- not "ruby".
-
-Mon Oct 13 23:57:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_feature_p): match by classified suffix.
-
- * eval.c (rb_require_safe): require library in the specified safe
- level.
-
- * variable.c (rb_autoload, rb_autoload_load): restore safe level
- when autoload was called. [ruby-dev:21338]
-
- * intern.h: prototypes; rb_require_safe.
-
- * test/runner.rb: accept non-option arguments.
-
-Mon Oct 13 20:49:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_new4): should not preserve FL_TAINT status in the
- internal shared string. [ruby-dev:21601]
-
- * string.c (rb_str_new4): ditto.
-
- * eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
-
- * process.c: ditto. [ruby-list:38521]
-
-Mon Oct 13 19:51:02 2003 Koji Arai <jca02266@nifty.ne.jp>
-
- * lib/debug.rb (debug_command): should enter emacs mode when
- assigned any value to the environment variable "EMACS".
- On Meadow, (getenv "EMACS") is "meadow".
-
-Sun Oct 12 14:45:03 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/win32ole/extconf.rb: check "windows.h", not "windows".
- [ruby-talk:84051]
-
-Sat Oct 11 20:41:03 2003 Corinna Vinschen <corinna@vinschen.de>
-
- * file.c (eaccess): Use access(2) on Cygwin.
-
-Sat Oct 11 17:09:21 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/rexml/quickpath.rb (REXML::QuickPath::match):
- escape '[' to avoid warning.
-
-Sat Oct 11 16:08:41 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (realpath): check existence of the file.
-
- * lib/pathname.rb (realpath): re-implemented.
- (realpath_root?, realpath_rec): removed
-
-Sat Oct 11 10:19:39 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
- Bystritsky.
-
-Fri Oct 10 07:50:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (is_defined): inheritance line adjustment as like as
- rb_call_super().
-
-Fri Oct 10 01:19:00 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
- optional argument to specify the DirectoryString type
- (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
- for DirectoryString, and strongly requires to use UTF8String for
- all certificates issued after December, 31 2003.
-
- * ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
-
-Thu Oct 9 23:50:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_start_0): prevent thread from GC.
- [ruby-dev:21572]
-
-Thu Oct 9 19:11:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_start_0): non-volatile should be restored from
- volatile.
-
-Thu Oct 9 17:43:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (proc_save_safe_level, proc_get_safe_level,
- proc_set_safe_level): save/restore safe level 1..4.
-
-Thu Oct 9 16:33:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (r_object0): remove unnecessary iv restoration for
- USRMARSHAL. [ruby-dev:21582]
-
- * marshal.c (w_object): dump generic instance variables from
- a string from '_dump'.
-
- * variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
- is not set.
-
- * time.c (time_dump): copy instance variables to dumped string, to
- be included in the marshaled data.
-
- * bignum.c (rb_big2ulong): add range check to ensure round trip.
-
-Thu Oct 9 15:45:27 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * pack.c (uv_to_utf8): change message to "out of range", since
- negative values are not "too big". [ruby-dev:21567]
-
-Thu Oct 9 14:05:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
- [ruby-dev:21557]
-
-Thu Oct 9 10:51:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_yield_0): no error if block is empty.
-
-Thu Oct 9 06:43:33 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (localjump_error): id should be ID.
-
- * eval.c (rb_eval): nd_rval is set in copy_node_scope().
-
- * eval.c (rb_yield_0): unused variable.
-
- * eval.c (rb_yield_0): nothing to do for empty node.
-
- * eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
- [ruby-dev:21551]
-
- * eval.c (rb_thread_start_0): set the value by break as the result.
- [ruby-dev:21552]
-
- * eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
- variables across THREAD_SAVE_CONTEXT.
-
-Thu Oct 9 12:05:46 2003 Eric Sunshine <sunshine@sunshineco.com>
-
- * configure.in: revived NextStep, OpenStep, and Rhapsody ports which
- had become unbuildable; enhanced --enable-fat-binary option so that
- it accepts a list of desired architectures (rather than assuming a
- fixed list), or defaults to a platform-appropriate list if user does
- not provide an explicit list; made the default list of architectures
- for MAB (fat binary) more comprehensive; now uses -fno-common even
- when building the interpreter (in addition to using it for
- extensions), thus allowing the interpreter to be embedded into a
- plugin module of an external project (in addition to allowing
- embedding directly into an application); added checks for
- <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
- ensures that -I/usr/local/include is employed when extensions'
- extconf.rb scripts invoke have_header() since extension checks on
- NextStep and OpenStep will fail without it if the desired resource
- resides in the /usr/local tree; fixed formatting of --help message.
-
- * Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
- invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
- (see configure's --enable-fat-binary option); added rule for new
- missing/getcwd.c.
-
- * defines.h: fixed endian handling during MAB build (see configure's
- --enable-fat-binary option) to ensure that all portions of the
- project see the correct WORDS_BIGENDIAN value (some extension modules
- were getting the wrong endian setting); added missing constants
- GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
- and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
- define in NeXT section.
-
- * dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
- NextStep since, on some installations, this value always resolves
- uselessly to zero.
-
- * dln.c: added error reporting to NextStep extension loader since the
- previous behavior of failing silently was not useful; now ensures
- that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
- for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
- on Rhapsody since this header lacks multiple-include protection,
- which resulted in "redefinition" compilation errors.
-
- * main.c: also create hard reference to objc_msgSend() on NeXT
- platforms (in addition to Apple platforms).
-
- * lib/mkmf.rb: now exports XCFLAGS from configure script to extension
- makefiles so that extensions can be built MAB (see configure's
- --enable-fat-binary option); also utilize XCFLAGS in cc_command()
- (but not cpp_command() because MAB flags are incompatible with
- direct invocation of `cpp').
-
- * ext/curses/extconf.rb: now additionally checks for presence of these
- curses functions which are not present on NextStep or Openstep:
- bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
- setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
- wscrl(), wsetscrreg()
-
- * ext/curses/curses.c: added appropriate #ifdef's for additional set of
- curses functions now checked by extconf.rb; fixed curses_bkgd() and
- window_bkgd() to correctly return boolean result rather than numeric
- result; fixed window_getbkgd() to correctly signal an error by
- returning nil rather than -1.
-
- * ext/etc/etc.c: setup_passwd() and setup_group() now check for null
- pointers before invoking rb_tainted_str_new2() upon fields extracted
- from `struct passwd' and `struct group' since null pointers in some
- fields are common on NextStep/OpenStep (especially so for the
- `pw_comment' field) and rb_tainted_str_new2() throws an exception
- when it receives a null pointer.
-
- * ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
- platforms such as NextStep and OpenStep which lack strdup().
-
- * ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
- gethostbyaddr(), and gethostbyname() from (const char*) to non-const
- (char*) for older platforms such as NextStep and OpenStep.
-
- * ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
- platforms such as NextStep and OpenStep which lack strdup(); include
- <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
- argument of gethostbyaddr() and getservbyname() from (const char*) to
- non-const (char*) for older platforms.
-
- * ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
- platforms such as NextStep and OpenStep which lack strdup().
-
-Wed Oct 8 22:19:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit.rb: removed installation instructions.
-
- * lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
- central location.
-
- * lib/test/unit.rb: ditto.
-
- * lib/test/unit.rb: extracted the running code in to AutoRunner.
-
- * lib/test/unit/autorunner.rb: added.
-
- * lib/test/unit/collector/objectspace.rb: extracted common test
- collection functionality in to a module.
-
- * lib/test/unit/collector.rb: ditto; added.
-
- * test/testunit/collector/test_objectspace.rb: ditto.
-
- * lib/test/unit/collector/dir.rb: added. Supports collecting tests out
- of a directory structure.
-
- * test/testunit/collector/test_dir.rb: added.
-
- * test/runner.rb: simplified to use the new capabilities.
-
-Tue Oct 7 15:23:09 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
-
- * test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
-
- * test/ruby/endblockwarn.rb: new file added to test of END-in-method
- warning.
-
-Tue Oct 7 12:23:47 2003 Tanaka Akira <akr@m17n.org>
-
- * ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
-
- * ext/socket/extconf.rb: useless assignment removed.
-
-Tue Oct 7 09:13:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
- allowed in eval.
-
-Tue Oct 7 04:15:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (stmt): should not expand mrhs if lhs is solely starred.
-
-Tue Oct 7 02:57:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (stmt): rhs of multiple assignment should not be
- expanded using "to_a". [ruby-dev:21527]
-
-Tue Oct 7 01:42:34 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
- free function for ASN1_OBJECT.
-
- * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
- ASN1::ObjectId#sn; it returns short name text representation of OID.
-
- * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
- ASN1::ObjectId#ln; it returns long name text representation of OID.
-
- * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
- ASN1::ObjectId#oid; it returns numerical representation of OID.
-
-Mon Oct 6 22:59:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
- respond_to?(:binmode). record separator was wrong when you gave
- text mode IO to Reader.parse and Writer.generate.
-
- * test/csv/test_csv.rb: add tests for above change.
-
-Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
-
- * ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
-
- * ext/socket/socket.c (thread_read_select): restored.
-
-Mon Oct 6 16:23:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (w_object): wrong method name in the message.
-
-Mon Oct 6 16:02:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (stmt): END in method should cause warning.
- [ruby-dev:21519]
-
-Mon Oct 6 15:17:23 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_iterator.rb (test_block_argument_without_paren):
- added. (follows sample/test.rb)
-
-Mon Oct 6 11:57:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
- test for eval-ed BEGIN END order.
-
-Mon Oct 6 09:19:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_object): should pass "weak" value to next level.
- [ruby-dev:21496]
-
- * eval.c (proc_alloc): should not use cached object if klass is
- different. [ruby-talk:83685]
-
-Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb: version information is added in document.
-
-Sun Oct 5 23:07:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_f_END): block should be given. [ruby-dev:21497]
-
-Sun Oct 5 22:51:23 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/ext/openssl/extconf.rb: add check for some engine functions
- unavailable in OpenSSL-0.9.6.
-
- * lib/ext/openssl/ossl_engine.c: ditto.
-
-Sun Oct 5 17:56:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval): fix evaluation order. [ruby-list:38431]
-
-Sun Oct 5 15:05:06 2003 akira yamada <akira@ruby-lang.org>
-
- * test/uri/*: translated RUNIT to Test::Unit.
-
-Sun Oct 5 14:37:39 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
-
- * test/soap/marshal/test_marshal.rb: ditto.
-
- * test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
- RUBYBIN.
-
-Sun Oct 5 13:47:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
- about scope, order and allowed syntax.
-
-Sun Oct 5 11:54:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/envutil.rb: added. split "rubybin" from test_system.rb.
-
- * test/ruby/test_system.rb: use envutil.rb
-
- * test/ruby/test_beginendblock.rb: added.
-
- * test/ruby/beginmainend.rb: added. used in test_beginendblock.rb.
-
-Sun Oct 5 11:23:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * test/testunit/runit/test_testresult.rb: removed some unnecessary
- cruft.
-
-Sun Oct 5 11:14:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/rubyunit.rb: aliasing TestCase into the top level is
- problematic.
-
- * lib/runit/assert.rb: fixed a couple of bugs caused by recent
- refactoring in Test::Unit.
-
- * test/testunit/runit/*: added.
-
-Sun Oct 5 10:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
- work. [ruby-dev:21484]
-
-Sun Oct 5 09:52:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: will use pp for output if available.
- Can be disabled by setting Assertions.use_pp = false.
-
- * test/testunit/test_assertions.rb: made a small change to exception
- formatting.
-
-Sun Oct 5 07:42:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: made small improvements to assertion
- messages. Deprecated Assertions#assert_not_nil; use #assert instead.
-
- * test/testunit/test_assertions.rb: ditto.
-
- * test/testunit/util/test_procwrapper.rb: use #assert instead of
- #assert_not_nil.
-
-Sun Oct 5 04:10:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: refactored message building.
-
-Sun Oct 5 03:40:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.h: global symbols should be declared
- as external.
-
-Sun Oct 5 03:03:20 2003 akira yamada <akira@ruby-lang.org>
-
- * test/ruby/test_exception.rb (test_else): added.
-
-Sun Oct 5 02:12:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: changed assertion messages to rely more
- heavily on #inspect. Added backtrace filtering for exceptions in
- assertion messages.
-
- * test/testunit/test_assertions.rb: ditto.
-
-Sun Oct 5 02:12:00 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
-
- * lib/drb/acl.rb, lib/drb/ssl.rb: added.
-
- * lib/drb/drb.rb: exit from a thread using 'break'.
-
-Sat Oct 4 21:49:14 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * gc.c (Init_stack): the type of space is changed to unsigned int
- from double. [ruby-dev:21483]
-
-Sat Oct 4 17:52:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/netHttpClient.rb: follow http-access2. hosts which matches
- ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
- - [,:] separated. ("ruby-lang.org:rubyist.net")
- - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
- - if you want specify host by IP address, give full address.
- ("192.168.1.1, 192.168.1.2")
-
- * lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
-
- * test/runner.rb: give testsuite name.
-
-Sat Oct 4 15:16:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_object): instance variable dump do not cause error
- for objects that cannot be dumped, if they traversed from
- marshal_dump. they are just ignored.
-
- * gc.c (Init_stack): cast "space" (doble value) into unsigned
- int. should run on PowerPC.
-
- * eval.c (rb_eval): should not execute else part if any exception
- is caught. [ruby-dev:21482]
-
- * parse.y (f_args): should allow unparenthesized block argument.
-
- * parse.y (f_rest_arg): should allow unparenthesized rest
- argument.
-
-Sat Oct 4 14:59:51 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (initialize): raise ArgumentError if argument has
- '\0' character.
- (relative_path_from): new method.
- (each_entry): new method for replacement of dir_foreach.
- (foreach, foreachline, dir_foreach, chdir): obsoleted.
-
-Sat Oct 4 12:58:48 2003 akira yamada <akira@ruby-lang.org>
-
- * test/uri/* (6 files): added.
-
-Sat Oct 4 12:44:45 2003 akira yamada <akira@ruby-lang.org>
-
- * lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
-
-Sat Oct 4 07:33:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/testsuite.rb: changed #<< to return self, and added
- #delete.
-
- * test/testunit/test_testsuite.rb: ditto. Also slightly refactored
- #test_size.
-
- * lib/test/unit/collector/objectspace.rb: collector now preserves the
- hierarchy of suites.
-
- * test/testunit/collector/test_objectspace.rb: ditto.
-
-Sat Oct 4 04:48:49 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/rubyext.c: default keys handled.
-
- * ext/syck/syck.h: lowered default buffer size to 16k for increased
- performance.
-
- * test/yaml: checkin of basic unit tests.
-
-Sat Oct 4 04:24:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/extconf.rb: add check for X509V3_set_nconf.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
- cannot implement if X509V3_set_nconf doesn't exist.
-
-Sat Oct 4 02:12:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/xsd/datatypes.rb: dump sign by itself. under the problematic
- platform, sprintf("%+.10g", -0.0) => +0. sigh.
-
- * sample/wsdl/amazon/*: update schema ver2 to ver3.
-
-Sat Oct 4 01:33:46 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb (initialize): duplicate and freeze argument.
- (to_s): return duplicated string.
- (children): new method.
- (each_line): new alias to foreachline.
-
-Fri Oct 3 16:13:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_asn1.c: add DER encoder and decoder.
-
- * ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
-
- * ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
-
- * ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
-
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
- DER encoded data argument.
-
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
- DER encoded data in OpenSSL::ASN1 types.
-
-Fri Oct 3 13:02:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit.rb: refactored to use optparse.
-
- * lib/test/unit.rb: added support for selecting the output
- level from the command-line.
-
- * lib/test/unit.rb: added a command-line switch to stop processing
- the command-line, allowing arguments to be passed to tests.
-
- * lib/test/unit.rb: changed the method for specifying a runner or a
- filter from the command-line.
-
- * lib/test/unit/collector/objectspace.rb: fixed a bug causing all
- tests to be excluded when the filter was set to an empty array.
-
- * test/testunit/collector/test_objectspace.rb: ditto.
-
-Fri Oct 3 08:14:32 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
- 'class ::Foo' syntax. [ruby-talk:83514]
-
-Fri Oct 3 08:01:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: added a default message for #assert,
- #assert_block, and #flunk.
-
- * test/testunit/test_assertions.rb: ditto.
-
- * lib/test/unit/failure.rb: failures now show a better trace of where
- they occurred.
-
- * test/testunit/test_failure.rb: ditto (added).
-
- * lib/test/unit/testcase.rb: ditto.
-
- * test/testunit/test_testcase.rb: ditto.
-
- * lib/test/unit/util/backtracefilter.rb: added.
-
- * test/testunit/util/test_backtracefilter.rb: added.
-
- * lib/test/unit/error.rb: changed to use BacktraceFilter and improved
- output.
-
- * test/testunit/test_error.rb: ditto.
-
-Thu Oct 2 20:33:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (iconv_failure_initialize): conform with
- orthodox initialization method.
-
- * ext/iconv/iconv.c (iconv_fail): initialize exception instance
- from the class, and do not share instance variables with the
- others. [ruby-dev:21470]
-
-Thu Oct 2 18:20:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * time.c (Init_Time): define initialize. [ruby-dev:21469]
-
-Thu Oct 2 17:39:38 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
- it supports OpenSSL hardware cryptographic engine interface.
-
- * ext/openssl/ossl_engine.h: ditto.
-
- * ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
-
- * ext/openssl/extconf.rb: add check for openssl/engine.h.
-
- * ext/openssl/ossl.c: call Init_ossl_engine().
-
- * ext/openssl/ossl.h: include openssl/engine.h.
-
- * ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
- EVP_PKEY referes engine.
-
-Thu Oct 2 17:22:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_load): restore instance variables (if any) before
- loading from marshaled data.
-
-Thu Oct 2 14:19:15 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
- set error object to $!.
-
- * ext/iconv/iconv.c (iconv_convert): error handler block should
- return appended part and the rest. if rest is nil, the
- conversion stops.
-
-Thu Oct 2 12:00:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * variable.c (rb_const_defined_0): look up constants in Object as
- well. [ruby-dev:21458]
-
- * test/ruby/test_defined.rb (TestDefined::test_defined): test for
- constants.
-
-Thu Oct 2 11:17:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/assertions.rb: should not capture an
- AssertionFailedError unless explicitly requested.
-
- * test/testunit/test_assertions.rb: ditto.
-
- * test/testunit/collector/test_objectspace.rb: fixed a test failure
- caused by methods being returned in different orders on different
- platforms by moving test sorting from TestSuite into the locations
- where suites are constructed. [ruby-talk:83156]
-
- * lib/test/unit/testcase.rb: ditto.
-
- * lib/test/unit/testsuite.rb: ditto.
-
- * lib/test/unit/collector/objectspace.rb: ditto.
-
-Thu Oct 2 03:25:01 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * eval.c (rb_thread_raise): prototype; avoid VC++ warning.
-
-Thu Oct 2 01:37:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * time.c (time_mdump): new marshal dumper. _dump is still
- available for compatibility.
-
- * time.c (time_mload): new marshal loader.
-
- * marshal.c (w_object): preserve instance variables for objects
- with marshal_dump.
-
- * marshal.c (r_object0): restore instance variables before calling
- marshal_load.
-
- * error.c (rb_warn_m): always return nil.
-
-Thu Oct 2 01:32:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_f_block_given_p): real required condition is
- ruby_frame->prev->iter == ITER_CUR.
-
- * eval.c (rb_block_given_p): ditto.
-
- * eval.c (block_pass): update ruby_frame->iter only when previous
- value is ITER_NOT.
-
-Thu Oct 2 01:02:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * variable.c (rb_const_defined_at): should exclude constants from
- Object when TYPE(klass) == T_MODULE *and* exclude is on.
- [ruby-dev:21458]
-
- * variable.c (rb_const_get_0): do not lookup constants from Object
- when TYPE(klass) == T_MODULE *and* exclude is on.
-
-Thu Oct 2 00:21:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/logger/test_logger.rb: unlinking file before close causes
- problem under win32 box.
-
- * lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
- when stringified and embedded into XML instance. Ruby's sprintf may
- format -0.0 as "0.0" (no minus sign) depending on underlying C
- sprintf implementation.
-
- * test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
-
- * test/soap/calc/*: give httpd config param "CGIInterpreter".
- "/usr/bin/env ruby" thing does not work under non-Unix boxes.
-
-Sat Oct 2 00:42:20 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (r_byte): retrieve pointer from string value for each
- time. [ruby-dev:24404]
-
- * marshal.c (r_bytes0): ditto.
-
- * enum.c (sort_by_i): re-entrance check added. [ruby-dev:24399]
-
- * io.c (io_read): should freeze all reading buffer.
- [ruby-dev:24400]
-
- * string.c (rb_str_sum): should use bignums when bits is greater
- than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
-
- * eval.c (specific_eval): defer pointer retrieval to prevent
- unsafe sourcefile string modification. [ruby-dev:24382]
-
- * string.c (rb_str_sum): wrong cast caused wrong result.
- [ruby-dev:24385]
-
- * enum.c (enum_sort_by): hide temporary array from
- ObjectSpace.each_object. [ruby-dev:24386]
-
- * string.c (rb_str_sum): check was done with false pointer.
- [ruby-dev:24383]
-
- * string.c (rb_str_sum): string may be altered. [ruby-dev:24381]
-
-Thu Oct 2 00:25:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * signal.c (ruby_signal_name): adjust to the prototype.
-
- * process.c (pst_inspect): ditto.
-
- * ext/etc/etc.c (etc_getgrent, Init_etc): typo.
-
-Wed Oct 1 20:49:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * gc.c (heaps): manage slots and limits together. [ruby-dev:21453]
-
- * gc.c (add_heap): should not clear heaps slot even if realloc()
- failed.
-
-Wed Oct 1 20:36:49 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * MANIFEST: add wince/mkconfig_wce.rb.
-
-Wed Oct 1 17:22:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
- setgrent, getgrent, endgrent.
-
- * ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
-
-Wed Oct 1 17:01:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_load): Object scope had priority over required file
- scope. [ruby-dev:21415]
-
-Wed Oct 1 14:09:53 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-
- * wince/mkconfig_wce.rb: sorry, forget to commit.
-
-Wed Oct 1 10:08:42 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-
- * wince/setup.mak: add sigmarionIII SDK support.
-
- * wince/Makefile.sub: ditto.
-
- * wince/mkexports.rb: fix linker error in SH4.
-
- * wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
-
-Wed Oct 1 08:02:52 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
-
- * wince/time_wce.c (time): add zero check.
-
-Tue Sep 30 16:11:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * Makefile.in: copy lex.c from $(srcdir) if it's not the current
- directory. [ruby-dev:21437]
-
-Tue Sep 30 11:29:23 2003 Tanaka Akira <akr@m17n.org>
-
- * process.c (pst_inspect): describe stopped process "stopped".
-
-Tue Sep 30 09:31:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/runner.rb: glob for directories.
-
-Tue Sep 30 09:11:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): while/until should not capture break unless
- they are destination of the break.
-
-Tue Sep 30 03:12:02 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb (finish): revert to 1.93.
-
- * lib/net/pop.rb (finish): revert to 1.60.
-
- * lib/net/smtp.rb (finish): revert to 1.67.
-
- * lib/net/http.rb (do_start): ensure to close socket if failed to
- start session.
-
- * lib/net/pop.rb (do_start): ditto.
-
- * lib/net/smtp.rb (do_start): ditto.
-
- * lib/net/smtp.rb: SMTP#started? wrongly returned false always.
-
-Tue Sep 30 02:54:49 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/ruby/test_iterator.rb: new test
- test_break__nested_loop[123].
-
-Mon Sep 29 23:39:13 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb (finish): does not raise IOError even if
- !started?, to allow closing socket which was opened before
- session started.
-
- * lib/net/pop.rb (finish): ditto.
-
- * lib/net/smtp.rb (finish): ditto.
-
-Mon Sep 29 19:06:51 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * ext/win32ole/extconf.rb: add windows.h checking.
- (ruby-bugs:PR#1185)
-
-Mon Sep 29 16:18:30 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb: check if the given logdevice object respond_to :write
- and :close, not is_a? IO. duck duck.
-
- * test/logger/test_logger.rb: self IO.pipe reading/writing may be
- locked by the flood. use tempfile.
-
- * lib/wsdl/xmlSchema/data.rb: wrong constant reference.
-
-Mon Sep 29 16:11:23 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb: clean up temporary symlink.
- Patched by NaHi. [ruby-dev:21420]
-
-Mon Sep 29 11:16:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_thread_atfork): wrong format specifier.
- [ruby-dev:21428]
-
- * process.c (pst_inspect): better description.
-
-Mon Sep 29 02:31:44 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/utils.rb (Utils::su): use setgid and setuid to
- set real and effective IDs. and setup group access list by
- initgroups.
-
-Sun Sep 28 11:14:19 2003 Koji Arai <jca02266@nifty.ne.jp>
-
- * ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
- `initialize_copy' should be defined.
-
- * ext/stringio/stringio.c (Init_stringio): ditto.
-
-Sat Sep 27 18:25:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
- $KCODE = "NONE" environment. check added.
-
- * test/xsd/test_xsd.rb: add tests for above fix.
-
-Sat Sep 27 15:58:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
-
- * lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
- a chance to reset logging severity threshold.
-
- * test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
- silent.
-
-Sat Sep 27 09:44:18 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/test_fileutils.rb: clear all errors on Windows.
- [ruby-dev:21417]
-
- * test/fileutils/test_nowrite.rb: ditto.
-
-Mon Sep 27 09:14:03 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * array.c (rb_ary_delete): comparison may change the capacity.
- [ruby-dev:24348]
-
- * array.c (rb_ary_fill): fill should honor length argument.
- [ruby-dev:24346]
-
- * array.c (rb_ary_replace): should not use ptr from shared array.
- [ruby-dev:24345]
-
- * ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
- [ruby-talk:113807]
-
-Sat Sep 27 04:57:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_file.rb: new file. only asserts unlink-before-close
- behaviour now.
-
- * test/soap/marshal/test_digraph.rb: should close before unlink.
- unlink-before-close pattern is not needed here.
-
-Sat Sep 27 03:32:37 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
- each module namespace. TestMarshal in
- test/soap/marshal/test_marshal.rb crashed with
- test/ruby/test_marshal.rb.
-
-Sat Sep 27 01:30:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/socket/socket.c (ruby_connect): on win32, type of the 4th
- argument of getsockopt is char *.
-
-Fri Sep 26 18:35:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/resolv-replace.rb: 1.8 compliance. [ruby-talk:82946]
-
-Fri Sep 26 17:39:27 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_marshal.rb: add test for ruby's objects.
-
-Fri Sep 26 09:52:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * defines.h (flush_register_windows): use volatile only for gcc on
- Solaris. [ruby-dev:21403]
-
- * lib/mkmf.rb (xsystem): use system directly to honor shell meta
- charaters.
-
-Fri Sep 26 00:10:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/README: updated.
-
-Thu Sep 25 17:48:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
- rb_protect.
-
- * ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
- value.
-
-Thu Sep 25 09:00:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/ostruct.rb: Added OpenStruct#==.
-
- * test/ostruct/test_ostruct.rb: Added.
-
-Thu Sep 25 07:55:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
- ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
- not use C++ or C99 style comment yet. (ruby-bugs:PR#1184)
-
-Thu Sep 25 00:23:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * MANIFEST: add SOAP4R.
-
-Thu Sep 25 00:13:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/soap/* (29 files): SOAP4R added.
-
- * lib/wsdl/* (42 files): WSDL4R added.
-
- * lib/xsd/* (12 files): XSD4R added.
-
- * test/soap/* (16 files): added.
-
- * test/wsdl/* (2 files): added.
-
- * test/xsd/* (3 files): added.
-
- * sample/soap/* (27 files): added.
-
- * sample/wsdl/* (13 files): added.
-
-Wed Sep 24 02:08:11 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
- [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
-
-Tue Sep 23 23:10:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb: add Logger#<<(msg) for writing msg without any
- formatting.
-
- * test/logger/test_logger.rb: ditto.
-
-Tue Sep 23 20:47:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * error.c (rb_warn_m): should not warn if -W0 is specified.
- [ruby-talk:82675]
-
-Mon Sep 22 21:28:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * MANIFEST: updated.
-
-Mon Sep 22 19:22:26 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * configure.in (AC_CHECK_FUNCS): add setuid and setgid.
-
-Mon Sep 22 12:34:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * util.c (ruby_strtod): skip preceding zeros before counting
- digits in the mantissa. (ruby-bugs:PR#1181)
-
-Sun Sep 21 04:12:36 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
- should be a String.
-
- * ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
-
- * ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
-
-Sat Sep 20 11:49:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb: typo fixed.
-
- * test/logger/test_logger.rb: new file.
-
-Fri Sep 19 11:39:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * test/testunit/*: Added.
-
- * lib/test/unit.rb: Documentation update.
-
- * lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
- Ditto.
-
- * lib/test/unit.rb: Factored out an ObjectSpace collector.
-
- * lib/test/unit/collector/objectspace.rb: Ditto.
-
- * sample/testunit/*: Added.
-
-Fri Sep 19 01:00:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
- condition.
-
- * lib/webrick/log.rb (BasicLog#format): add "\n" to message.
-
-Thu Sep 18 22:43:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
-
- * eval.c (proc_invoke): should update "result" for orphans.
-
-Thu Sep 18 20:33:03 2003 Tietew <tietew-ml-ruby-list@tietew.net>
-
- * parse.y (str_xquote): do not prepend escapes in
- backqoute literals. [ruby-list:38409]
-
-Thu Sep 18 20:30:17 2003 Tanaka Akira <akr@m17n.org>
-
- * lib/pathname.rb: update document.
-
-Thu Sep 18 15:27:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/logger.rb: new file. Logger, formerly called devel-logger or
- Devel::Logger.
-
- * sample/logger/*: new file. samples of logger.rb.
-
-Wed Sep 17 23:41:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (localjump_destination): should not raise ThreadError
- exception for "break". [ruby-dev:21348]
-
- * eval.c (proc_invoke): use result instead of prot_tag->retval.
- retval is no longer propagated to the ancestors.
-
-Wed Sep 17 20:34:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (tokadd_string, parse_string, yylex): escaped terminator
- is now interpreted as is. [ruby-talk:82206]
-
-Wed Sep 17 18:52:36 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/fileutils/fileassertions.rb: new file.
-
- * test/fileutils/test_fileutils.rb: new file.
-
- * test/fileutils/test_nowrite.rb: new file.
-
-Wed Sep 17 18:51:02 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/strscan/test_stringscanner.rb: require test/unit.
-
-Wed Sep 17 18:35:34 2003 Minero Aoki <aamine@loveruby.net>
-
- * test/strscan/test_stringscanner.rb: new file.
-
-Wed Sep 17 18:03:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl: all files are reviewed to simplify and avoid memory leak.
-
- * ext/openssl/extconf.rb: add check for assert.h.
-
- * ext/openssl/ossl.c (ossl_buf2str): new function to convert
- C buffer to String and free buffer.
-
- * ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
- Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
-
- * ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
- functions to convert object to DER string.
-
- * ext/openssl/ossl.h: ditto.
-
- * ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
- BIO to String object and free BIO.
-
- * ext/openssl/ossl_bio.h: ditto.
-
- * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
-
- * ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
-
- * ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
- and reimplement in openssl/x509.rb.
-
- * ext/openssl/ossl_x509attr.c: reimplemented and disable some
- method temporarily. this class doesn't work fine without ASN.1
- data support;-) I'll rewrite in near future.
-
- * ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
- unused code.
-
- * ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
-
-Tue Sep 16 22:25:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/csv/test_csv.rb: add negative tests of row_sep.
-
-Tue Sep 16 18:02:36 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * regex.c (re_compile_pattern): should not translate character
- class range edge. [ruby-list:38393]
-
-Tue Sep 16 16:47:56 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * MANIFEST: add test/csv/mac.csv.
-
- * win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
-
-Mon Sep 15 19:02:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * lib/csv.rb: add extra pamameter to specify row(record) separater
- character. To parse Mac's CR separated CSV, do like this.
- CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
- The 3rd parameter in this example ?, is for column separater and the
- 4th ?\r is for row separater. Row separater is nil by default. Nil
- separater means "\r\n" or "\n".
-
- * test/csv/test_csv.rb: add tests for above feature.
-
- * test/csv/mac.csv: added. Sample CR separated CSV file.
-
-Fri Sep 12 22:41:48 2003 Michal Rokos <m.rokos@sh.cvut.cz>
-
- * ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
-
- * ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
-
- * ext/openssl/ossl_asn1.[ch]: new files
-
- * ext/openssl/ossl_bio.[ch]: new files
-
-Fri Sep 12 12:30:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * intern.h (rb_disable_super, rb_enable_super): replace with dummy
- expressions instead of prototypes. the functions remain yet for
- binary compatibility. [ruby-talk:81758]
-
-Fri Sep 12 12:09:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * bignum.c (rb_big_and): convert argument using 'to_int'.
-
- * bignum.c (rb_big_or): ditto.
-
- * bignum.c (rb_big_xor): ditto.
-
-Fri Sep 12 07:06:14 2003 David Black <dblack@superlink.net>
-
- * lib/scanf.rb: Took out useless @matched_item variable; some small
- refactoring.
-
-Thu Sep 11 08:43:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
- name is not tainted.
-
- * lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
- Supports StringIO.
-
-Wed Sep 10 22:47:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.h: add a workaround for win32 platform.
- libeay32.dll doesn't export functions defined in conf_api.h.
-
- * ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
-
- * ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
-
- * ext/openssl/ossl_config.c (set_conf_section_i): should check
- if the argument is Array.
-
-Wed Sep 10 22:41:54 2003 Tietew <tietew@tietew.net>
-
- * eval.c (win32_get_exception_list): avoid VC7 warning.
- [ruby-win32:577]
-
-Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (struct tag): dst should be VALUE.
-
-Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (localjump_destination): stop at the scope where the current
- block was created. [ruby-dev:21353]
-
-Tue Sep 9 05:17:04 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
-
-Tue Sep 9 02:41:35 2003 Michal Rokos <m.rokos@sh.cvut.cz>
-
- * ext/openssl/ossl_config.c: Refine compatibility.
-
-Tue Sep 9 01:50:45 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
- the message.
-
- * lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
-
-Mon Sep 8 22:15:33 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tk/lib/multi-tk.rb: modify security check at creating
- a new interpreter
-
-Mon Sep 8 20:00:12 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb, lib/optparse/version.rb: search also all
- capital versions.
-
-Mon Sep 8 19:26:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
-
- * ext/openssl/ossl_config.c: refine all with backward compatibility.
-
- * ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
-
- * ext/openssl/ossl_x509.c: added new constants under X509 module.
- DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
- DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
- the members of the struct. it's left to GC.
-
- * ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
-
- * ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
- add attr readers: issuer_certificate, subject_certificate,
- subject_request, crl and config.
-
-Mon Sep 8 18:26:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
- instead of config[:Port] or req.request_uri.port.
-
- * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
-
- * lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
-
- * lib/webrick/config.rb: :Listen option never be used.
-
- * lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
- option and add warning message.
-
- * lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
-
- * lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
-
-Sun Sep 7 16:08:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
-
- * ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
-
-Sat Sep 6 02:26:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_*.rb: assert_same, assert_match, and so on.
-
-Sat Sep 6 18:45:46 2003 Mauricio Fernandez <batsman.geo@yahoo.com>
-
- * parse.y (assignable): call rb_compile_error(), not rb_bug().
- [ruby-core:01523]
-
-Sat Sep 6 17:40:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ruby_missing.c: rid of unnecessary backward
- compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
- all sources.
-
- * ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
-
- * ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
-
- * ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
-
- * ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
-
-Sat Sep 6 01:23:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
-
- * win32/win32.c (CreateChild): fix condition about whether to call
- shell or not.
-
-Sat Sep 6 00:36:20 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
-
- * Makefile.in (test): phony target.
-
- * lib/mkmf.rb (have_library, find_library): configure by library
- name.
-
- * lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
- array as argument.
-
- * test/ruby/test_*.rb: moved invariants to left side in
- assert_equal, and use assert_nil, assert_raises and so on.
-
- * win32/win32.c (isInternalCmd): distinguish command.com and
- cmd.exe.
-
- * win32/win32.c (make_cmdvector): a character just after wildcard
- was ignored. [ruby-core:01518]
-
-Fri Sep 5 20:27:08 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
-
-Fri Sep 5 18:00:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
-
- * ext/openssl/ossl_digest.c: add ossl_digest_new().
-
- * ext/openssl/ossl_digest.h: ditto.
-
- * ext/openssl/ossl_cipher.c: add ossl_cipher_new().
-
- * ext/openssl/ossl_cipher.h: ditto.
-
-Fri Sep 5 15:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
- search delimiter forward if found in backward.
-
-Fri Sep 5 13:32:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/runner.rb: arguments should be keys.
-
-Fri Sep 5 12:09:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * test/ruby/test_system.rb (test_system): check existence of ruby
- interpreter.
-
-Fri Sep 5 11:32:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/optparse.rb (--version): fix assignment/reference order.
-
- * lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
- be deprecated in future.
-
- * lib/optparse/version.rb (OptionParser#show_version): hide Object.
-
- * test/runner.rb: fix optparse usage.
-
- * test/runner.rb: glob all testsuits if no tests given.
-
-Fri Sep 5 10:42:58 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/runner.rb: added. gets testcases from command line and runs it.
-
- * test/ruby/test_gc.rb: remove useless part which was for dumping test
- result.
-
-Fri Sep 5 09:28:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby/test_gc.rb: added. splitter.rb which I made to split
- sample/test.rb into test/ruby/test_* kindly removed GC test (the
- last section in the original test) to reduce things to be worried.
-
-Fri Sep 5 03:00:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * test/ruby/test_iterator.rb (test_block_in_arg): add no block
- given tests.
-
- * test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
- test.
-
-Fri Sep 5 01:10:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/ruby: tests for ruby itself.
-
- * test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
- some tests could not be translates... search '!!' mark to see it.
-
- * test/csv/test_csv.rb: should require 'csv', not '../lib/csv'. test
- runner should set load path correctly.
-
-Fri Sep 5 01:03:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
- opened file cannot be removed under win32 box.
-
-Thu Sep 4 23:59:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * parse.y (tokadd_string): newlines have no special meanings in
- %w/%W, otherwise they are ignored only when interpolation is
- enabled. [ruby-dev:21325]
-
-Thu Sep 4 19:38:25 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * ext/io/wait/.cvsignore: added.
-
- * ext/openssl/.cvsignore: added.
-
-Thu Sep 4 19:28:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * sample/openssl: added. Sample of standard distribution library
- should be locate in sample/{module_name}/*.
-
- * ext/openssl/sample/*: removed. move to sample/openssl/*.
-
-Thu Sep 4 18:02:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/csv/test_csv.rb: use remove_const to reduce warnings. use
- Dir.tmpdir to locate working files.
-
-Thu Sep 4 17:41:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
- valid delimiter.
-
- * misc/ruby-mode.el (ruby-here-doc-end-match): must quote
- arbitrary string to use as regexp.
-
- * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
- call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
- matched.
-
-Thu Sep 4 15:40:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test/csv/test_csv.rb: run on test/unit original layer.
-
-Thu Sep 4 12:54:50 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/token.c: headerless documents with root-level spacing now
- honored.
-
-Thu Sep 4 00:06:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (mark_frame_adj): need to adjust argv pointer if using
- system's alloca. [ruby-core:01503]
-
-Wed Sep 3 21:33:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
-
- * test: add test directory. Test::Unit aware testcases and needed
- files should be located in this directory. dir/file name convention;
- test/{module_name}/test_{testcase_name}.rb
- test/{module_name}/{needed_files}
- someday, someone will write testrunner which searches test_*.rb and
- run testcases automatically.
-
- * test/csv/*: add testcase for lib/csv.rb.
-
-Wed Sep 3 01:37:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * io.c (rb_f_gets): should call next_argv() before type check
- current_file. [ruby-list:38336]
-
-Tue Sep 2 20:37:15 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
- for skipping server verification.
-
-Tue Sep 2 23:36:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (proc_invoke): should retrieve retval when pcall is true.
-
-Tue Sep 2 14:09:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
- the patch is submitted by nmu <nmu@users.sourceforge.jp>.
-
- * ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
- some platforms.
-
- * ext/socket/getnameinfo.c (getnameinfo): ditto.
-
-Tue Sep 2 14:02:19 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
-
- * ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
- bug fix and improvement of font control
-
-Tue Sep 2 09:51:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval): should not handle exceptions within rescue
- argument. [ruby-talk:80804]
-
-Tue Sep 2 00:44:37 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * re.c (rb_memsearch): fix overrun. [ruby-talk:80759]
-
-Tue Sep 2 00:41:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/iconv/iconv.c (map_charset): use lower case keys.
-
- * ext/iconv/iconv.c (iconv_fail): just yield error and return the
- result if a block is given.
-
- * ext/iconv/iconv.c (iconv_convert): yield error and append the
- result if a block is given.
-
- * ext/iconv/charset_alias.rb (charset_alias): optional third
- argument.
-
- * ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
- SHIFT_JIS on cygwin.
-
-Mon Sep 1 18:34:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval): make tail recursion in ELSE clause of
- RESCUE a jump.
-
-Mon Sep 1 18:00:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
- Dave Butcher.
-
- * eval.c (Init_Thread): protect thgroup_default. suggested by Guy
- Decoux in [ruby-talk:80623]
-
-Mon Sep 1 16:59:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
- thread termination.
-
- * eval.c (rb_thread_start_0): should not error_print() within
- terminated thread, because $stderr used by it might be
- overriden now. [ruby-dev:21280]
-
-Sun Aug 31 22:46:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * eval.c (TAG_DST()): take no argument.
-
- * process.c (p_gid_sw_ensure): return VALUE.
-
-Sun Aug 31 22:27:10 2003 Hidetoshi NAGAI <nagai@dumbo.ai.kyutech.ac.jp>
-
- * process.c (p_gid_sw_ensure): lack of function type
-
-Sun Aug 31 12:25:06 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
-
- * lib/optparse.rb: --version takes an optional argument; "all" or
- a list of package names.
-
-Sun Aug 31 10:17:02 2003 Tadayoshi Funaba <tadf@dotrb.org>
-
- * lib/date/format.rb: yyyy/mm is not an acceptable format.
-
- * lib/time.rb: follow above.
-
-Sat Aug 30 14:25:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_iter_break): should not call TAG_JUMP directly.
-
-Sat Aug 30 03:58:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
-
- * eval.c (POP_TAG): no longer propagate retval. retval is now set
- directly by localjump_destination().
-
- * eval.c (localjump_destination): new function to cast
- return/break local jump.
-
- * eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
-
-Fri Aug 29 22:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
- then result will be the same as +,-,*,/ respectively.
-
-Fri Aug 29 17:30:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
-
- * process.c: bug fix
-
- * process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
-
- * process.c: deny handling IDs during evaluating the block given to
- the Process::{UID,GID}.switch method
-
- * ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
-
- * ext/tcltklib/tcltklib.c : can create a interpreter without Tk
-
- * ext/tcltklib/tcltklib.c : bug fix on handling exceptions
-
- * ext/tcltklib/MANUAL.euc : modify
-
- * ext/tk/lib/tk.rb : freeze some core modules
-
- * ext/tk/lib/multi-tk.rb : more secure
-
- * ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
- Tk's list
-
- * ext/tk/lib/tk.rb: improve accessibility of TkVariable object
-
- * ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
- ext/tk/lib/tktext.rb : fix bug of font handling
-
- * ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
-
-Thu Aug 28 22:07:12 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * variable.c (rb_autoload_load): call const_missing if autoloading
- constant is not defined to allow hook.
-
- * eval.c (rb_eval): use rb_const_get_from() instead of
- rb_const_get_at().
-
- * eval.c (is_defined): forgot to check NODE_COLON3.
-
-Thu Aug 28 17:30:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * variable.c (rb_const_get_0): should check constants defined in
- included modules, if klass is Object. [ruby-talk:79302]
-
- * numeric.c (check_uint): check should be done using UINT_MAX, not
- INT_MAX. this fix is submitted by Lyle Johnson
- <lyle@knology.net> in [ruby-core:01486]
-
-Thu Aug 28 05:02:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
-
-Thu Aug 28 02:37:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
- consistent with *a = [1], which set [[1]] to a.
-
- * node.h: merge NODE_RESTARY to NODE_SPLAT.
-
- * parse.y: rules simplified a bit by removing NODE_RESTARY.
-
- * sample/test.rb: updated for new assignment behavior.
-
-Wed Aug 27 22:33:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * error.c (rb_bug): should not use other methods; this function is
- not for ordinary use. [ruby-dev:21259]
-
-Wed Aug 27 15:07:57 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
- response. [ruby-list:38279]
-
-Wed Aug 27 05:10:15 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * win32/win32.c (map_errno): support winsock error.
-
- * win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
- kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
- pass errno to map_errno().
-
- * win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
- rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
- rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
- rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
- rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
- rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
- rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
- rb_w32_fclose, rb_w32_close): use map_errno().
-
- * win32/win32.h: add winsock errors.
-
-Tue Aug 26 23:53:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
- frozen OpenStruct. [ruby-talk:80214]
-
-Tue Aug 26 20:03:50 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * lib/mkmf.rb (create_tmpsrc): add the hook for source.
- [ruby-list:38122]
-
-Tue Aug 26 15:59:53 2003 why the lucky stiff <why@ruby-lang.org>
-
- * implicit.c (syck_type_id_to_taguri): corrected detection of
- x-private types.
-
-Sun Aug 24 01:02:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * file.c (file_expand_path): performance improvement.
- [ruby-talk:79748]
-
-Sat Aug 23 23:41:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
- apparent cases. [ruby-talk:79748]
-
-Sat Aug 23 18:56:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
- resize a string, rb_str_cat() disallows NULL. [ruby-dev:21237]
-
-Sat Aug 23 16:48:41 2003 Keiju Ishitsuka <keiju@ishitsuka.com>
-
- * lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
-
-Sat Aug 23 15:59:58 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
- EXEC_TAG() for retry. [ruby-dev:21216]
-
-Sat Aug 23 02:32:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_yield_splat): should check if "values" is array.
-
- * enum.c (each_with_index_i): typo.
-
-Fri Aug 22 17:07:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * enum.c (inject_i): use rb_yield_values.
-
- * enum.c (each_with_index_i): ditto.
-
- * eval.c (rb_yield_splat): new function to call "yield *values".
-
- * string.c (rb_str_scan): use rb_yield_splat().
-
-Fri Aug 22 06:13:22 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/rubyext.c: refactoring of the transfer method
- dispatch. added yaml_org_handler for faster dispatch of
- transfers to base types.
-
- * lib/yaml/rubytypes.rb: removed handling of builtins from
- Ruby library.
-
- * ext/syck/token.c: quoted and block scalars are now implicit !str
-
- * ext/syck/implicit.c: empty string detected as !null.
-
-Fri Aug 22 01:00:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (block_pass): improve passing current block.
-
-Fri Aug 22 00:13:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
- fixed, and VpNmlz() speed up.
-
-Wed Aug 20 16:44:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/socket/socket.c (ruby_connect): many systems seem to have
- a problem in select() after EINPROGRESS. [ruby-list:38080]
-
-Wed Aug 20 01:31:17 2003 why the lucky stiff <why@ruby-lang.org>
-
- * ext/syck/syck.h: Parser definition problems on HP-UX.
- [ruby-talk:79389]
-
- * ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
-
- * ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
-
- * ext/syck/rubyext.c: Tainting issues.
-
-Tue Aug 19 23:20:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
-
- * ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
-
-Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
-
- * lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
-
- * lib/webrick/compat.rb (File::fnmatch): remove old migration code.
-
- * lib/webrick/httpserver.rb (HTTPServer#run): ditto.
-
- * lib/webrick/server.rb (GenericServer#listen): the body of this
- method is pull out as Utils::create_lisnteners.
-
- * lib/webrick/utils.rb (Utils::create_lisnteners): new method.
-
- * lib/webrick/server.rb (GenericServer#start): should rescue
- unknown errors. and refine comments.
-
- * ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
- socket if SSLSocket raises error.
-
-Tue Aug 19 11:19:33 2003 Shugo Maeda <shugo@ruby-lang.org>
-
- * io.c (next_argv): should not call GetOpenFile() if rb_stdout is
- not a IO (T_FILE).
-
-Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
- a builtin.
-
- * ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
-
- * ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
- add a return to the tails of each line.
-
- * ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
-
- * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
-
- * ext/openssl/sample/echo_svr.rb: use SSLServer.
-
- * ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
-
-Tue Aug 19 01:24:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
- headers are inconsistent at this macro. [ruby-core:01432]
-
- * ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
-
- * ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
- winspool.h
-
- * instruby.rb: make list at first instead of iterator.
- [ruby-talk:79347]
-
-Mon Aug 18 11:23:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * dir.c (glob_helper): preserve raw order for **.
-
-Sun Aug 17 23:39:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
-
-Sun Aug 17 17:10:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
- method to specify if the underlying IO will be closed in
- SSLSocket#close.
-
- * ext/openssl/lib/openssl/buffering.rb: add forwarders to
- setsockopt, getsockopt and fcntl.
-
- * ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
-
-Sun Aug 17 11:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): should not force to remake Makefile when
- installation and so on.
-
-Sat Aug 16 23:58:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * marshal.c (w_symbol, w_object): get rid of warnings.
-
- * re.c (rb_memsearch): ditto.
-
- * time.c (time_dump): ditto.
-
- * ext/extmk.rb (extmake): not continue making when extconf.rb
- failed.
-
- * ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
-
- * ext/openssl/ossl.h: remove version.h dependency.
-
- * ext/openssl/ruby_missing.h: ditto.
-
- * lib/mkmf.rb (pkg_config): use --libs output except with
- only-L for other options. [ruby-list:38099]
-
- * lib/mkmf.rb (create_makefile): separate rule for static
- library from shared object.
-
- * win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
- define exec_prefix and libdir.
-
-Fri Aug 15 23:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
- method fixed.
-
- * ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
-
-Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * configure.in (HUGE_ST_INO): check whether struct stat.st_ino
- is larger than long. [ruby-dev:21194]
- http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
-
- * error.c (syserr_eqq): errno might exceed Fixnum limit.
-
- * error.c (Init_Exception): moved base initialization from
- init_syserr().
-
- * inits.c (rb_call_inits): postpone initializing errnos until
- Bignum is available.
-
-Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
- keyname() and so on be declared.
-
- * ext/curses/curses.c (curses_resizeterm, window_resize):
- arguments conflicted with macros in term.h.
-
- * ext/curses/curses.c (Curses module methods): ensure
- initialized. [ruby-dev:21191]
-
-Fri Aug 15 02:08:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * gc.c (id2ref): recycle check should be done by klass == 0.
- [ruby-core:01408]
-
-Fri Aug 15 01:34:23 2003 Michal Rokos <m.rokos@sh.cvut.cz>
-
- * ext/openssl/ossl_pkey.c: move generate_cb here
-
- * ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
-
- * ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
-
- * ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
-
-Fri Aug 15 00:38:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
-
- * ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
-
- * ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
-
-Thu Aug 14 21:19:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (Init_Thread): Continuation#[] added. [ruby-talk:79028]
-
-Thu Aug 14 20:03:34 2003 Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
- * ext/win32ole/win32ole.c (OLE_FREE): should not call
- ole_message_loop.
-
- * ext/win32ole/win32ole.c (ole_event_free): ditto.
-
- * ext/win32ole/win32ole.c (ole_initialize): stop calling
- OleUninitialize at exit.
-
-Thu Aug 14 11:27:37 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * gc.c (rb_data_object_alloc): check type of 1st argument.
- [ruby-dev:21192]
-
-Thu Aug 14 00:21:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
-
- * parse.y (lhs): ditto.
-
- * parse.y (yylex): should return tCOLON3 right after kCLASS.
- [ruby-talk:78918]
-
- * error.c (exc_initialize): was converting argument to string too
- eagerly. Only check was needed. [ruby-talk:78958]
-
-Wed Aug 13 23:31:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
- BigDecimal::limit removed.
-
-Wed Aug 13 19:21:34 2003 Christian Neukirchen <chneukirchen@yahoo.de>
-
- * lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
- to SSLSocket. [ruby-talk:78919]
-
-Wed Aug 13 18:13:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
-
- * eval.c (proc_invoke): unpack return/break destination when block
- is already left.
-
-Wed Aug 13 15:58:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * object.c (rb_class_s_alloc): add function prototype to avoid VC++
- warning.
-
-Wed Aug 13 13:50:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/Win32API/Win32API.c (Win32API_initialize): should pass some
- class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
-
-Tue Aug 12 16:55:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * Makefile.in: static link libraries to LIBRUBY_SO with static linked
- ext. [ruby-dev:21157]
-
- * ext/extmk.rb (extmake): sort extension library initialization order.
-
- * ext/extmk.rb (extmake): compact $extlibs.
-
-Tue Aug 12 02:48:56 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
- flag before calling getcontext(2).
-
- * eval.c (struct thread): add member to save backing store on
- IA64. (ruby-bugs PR1086)
-
- * eval.c (thread_mark): mark IA64 backing store region.
-
- * eval.c (thread_free): free saved IA64 backing store.
-
- * eval.c (rb_thread_save_context): save IA64 backing store as well.
-
- * eval.c (rb_thread_restore_context): restore IA64 backing store.
-
- * eval.c (THREAD_ALLOC): initialize IA64 members.
-
-Mon Aug 11 22:31:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
- * lib/debug.rb(debug_command): inspection command should inspect
- resulting value even if it's nil. [ruby-dev:21180] by OMAE, jun
- <jun66j5@ybb.ne.jp>.
-
- * lib/debug.rb(debug_command): incomplete regexp.
-
-Mon Aug 11 17:33:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call_super): do not use rb_block_given_p() for
- check. [ruby-talk:78656]
-
- * eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
-
-Sun Aug 10 10:43:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
- from 1k to 16k bytes. [ruby-talk:78603]
-
- * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
- partial write to allow interruption in SSLSocket#write.
-
-Sun Aug 10 00:34:16 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
- for ccache.
-
-Sat Aug 9 10:36:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * marshal.c (w_object): do not dump generic instance variable when
- marshal_dump is defined.
-
-Sat Aug 9 00:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal.c: F style output(like 1234.56789) implemented
- to to_s method.
- * ext/bigdecimal_??.html: F style output(like 1234.56789)
- implemented to to_s method.
-
-Fri Aug 8 12:33:17 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
- add the -aa option to WLDFLAGS.
-
-Fri Aug 8 11:29:26 2003 Koji Arai <jca02266@nifty.ne.jp>
-
- * marshal.c (w_object): should set `c_arg' at first.
-
-Fri Aug 8 03:22:28 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
-
- * lib/webrick/httputils.rb (FormData#list): should not take
- a side effect for the receiver.
-
-Thu Aug 7 14:40:37 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * cygwin/GNUmakefile: better --disbale-shared option support.
-
- * cygwin/GNUmakefile: add forwarding DLL target for cygwin.
-
-Thu Aug 7 14:21:05 2003 Corinna Vinschen <vinschen@redhat.com>
-
- * configure.in: Fix Cygwin specific naming of libraries to
- be net distribution compliant. (ruby-bugs:PR#1077)
- cygwin-ruby18.dll -> cygruby18.dll
-
-Thu Aug 7 12:51:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_f_at_exit): should not be called without a block.
- block_given check added.
-
-Thu Aug 7 06:46:06 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_call0): forgot to pop ruby_class.
-
- * eval.c (rb_call0): update ruby_class as well as ruby_cref.
- (ruby-bugs-ja:PR#540)
-
-Thu Aug 7 04:52:50 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
- ruby_cref. [ruby-talk:78141]
-
-Thu Aug 7 04:19:15 2003 Akinori MUSHA <knu@iDaemons.org>
-
- * gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
- Linux/ia64. This makes gc.c compile but miniruby coredumps for
- the moment.
-
-Thu Aug 7 00:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
-
- * ext/bigdecimal.c: Comparison results adjusted to Float's.
- * ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
-
-Wed Aug 6 22:58:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
-
- * lib/test/unit/testcase.rb: Added equality checking.
- * lib/test/unit/testsuite.rb: Added equality checking.
- * lib/test/unit/assertions.rb: Fixed a warning.
-
-Wed Aug 6 17:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * ext/extmk.rb (extmake): pass LIBPATH to make ruby. [ruby-dev:21137]
-
- * ext/extmk.rb (extmake): set library name as source file name in
- Init_ext(). [ruby-dev:21137]
-
- * lib/mkmf.rb (Logging::postpone): postpone logging messages after
- heading message as the result of the block.
-
- * lib/mkmf.rb (macro_defined?): append newline to src unless ended
- with it.
-
- * lib/mkmf.rb (have_library): treat nil function name as "main".
- (ruby-bugs:PR#1083)
-
- * lib/mkmf.rb (pkg_config): should append additional libraries to
- $libs but not $LIBS. [ruby-dev:21137]
-
- * ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
-
- * ext/digest/sha1/extconf.rb: have_library already appends library
- name.
-
-Wed Aug 6 17:23:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c: initialize /* OK */ variables by Qnil to stop warnings.
-
-Wed Aug 6 04:58:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
-
- * ext/Setup*: add io/wait and openssl.
-
-Wed Aug 6 01:13:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
-
- * eval.c (rb_f_autoload_p): ditto.
-
- * class.c (rb_mod_init_copy): no longer implements independent
- clone and dup methods. override "initialize_copy" instead.
- [ruby-core:01352]
-
- * object.c (rb_class_s_alloc): define Class allocation function.
- this makes Classes to follow clone framework that uses
- initialize_copy.
-
- * object.c (rb_class_initialize): separate instantiation and
- initialization.
-
- * object.c (rb_obj_alloc): prohibit instantiation from
- uninitialized class.
-
- * object.c (rb_class_superclass): check uninitialized class.
-
- * array.c (rb_ary_fill): wrong index processing with block. this
- fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
-
- * marshal.c (w_object): should preserve generic ivar for nil,
- true, false, symbols, and fixnums.
-
- * marshal.c (w_uclass): base_klass check should be done after
- rb_class_real().
-
-Wed Aug 6 01:18:50 2003 Minero Aoki <aamine@loveruby.net>
-
- * lib/net/http.rb: update document.
-
- * lib/net/pop.rb: ditto.
-
- * lib/net/protocol.rb: ditto.
-
-Wed Aug 6 00:48:37 2003 Koji Arai <jca02266@nifty.ne.jp>
-
- * marshal.c (w_object): should recommend marshal_dump rather than
- _dump_data.
-
-Tue Aug 5 17:58:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
-
- * lib/fileutils.rb (install): should preserve timestamp only.
-
-Tue Aug 5 17:31:59 2003 Ian Macdonald <ian@caliban.org>
-
- * lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
- simple typo.
-
-Tue Aug 5 15:47:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
-
- * eval.c (rb_load): should preserve current source file/line.
-
-Tue Aug 5 10:04:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * string.c (str_new4): ptr may refer null_str.
-
-Mon Aug 4 17:25:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
-
- * stable version 1.8.0 released.
-
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
-
-Local variables:
-add-log-time-format: (lambda ()
- (let* ((time (current-time))
- (diff (+ (cadr time) 32400))
- (lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
- (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-end:
diff --git a/GPL b/GPL
index 5b6e7c66c2..d159169d10 100644
--- a/GPL
+++ b/GPL
@@ -1,12 +1,12 @@
- GNU GENERAL PUBLIC LICENSE
- Version 2, June 1991
+ GNU GENERAL PUBLIC LICENSE
+ Version 2, June 1991
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
- 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
Everyone is permitted to copy and distribute verbatim copies
of this license document, but changing it is not allowed.
- Preamble
+ Preamble
The licenses for most software are designed to take away your
freedom to share and change it. By contrast, the GNU General Public
@@ -15,7 +15,7 @@ software--to make sure the software is free for all its users. This
General Public License applies to most of the Free Software
Foundation's software and to any other program whose authors commit to
using it. (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.) You can apply it to
+the GNU Lesser General Public License instead.) You can apply it to
your programs, too.
When we speak of free software, we are referring to freedom, not
@@ -55,8 +55,8 @@ patent must be licensed for everyone's free use or not licensed at all.
The precise terms and conditions for copying, distribution and
modification follow.
-
- GNU GENERAL PUBLIC LICENSE
+
+ GNU GENERAL PUBLIC LICENSE
TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
0. This License applies to any program or other work which contains
@@ -110,7 +110,7 @@ above, provided that you also meet all of these conditions:
License. (Exception: if the Program itself is interactive but
does not normally print such an announcement, your work based on
the Program is not required to print an announcement.)
-
+
These requirements apply to the modified work as a whole. If
identifiable sections of that work are not derived from the Program,
and can be reasonably considered independent and separate works in
@@ -168,7 +168,7 @@ access to copy from a designated place, then offering equivalent
access to copy the source code from the same place counts as
distribution of the source code, even though third parties are not
compelled to copy the source along with the object code.
-
+
4. You may not copy, modify, sublicense, or distribute the Program
except as expressly provided under this License. Any attempt
otherwise to copy, modify, sublicense or distribute the Program is
@@ -225,7 +225,7 @@ impose that choice.
This section is intended to make thoroughly clear what is believed to
be a consequence of the rest of this License.
-
+
8. If the distribution and/or use of the Program is restricted in
certain countries either by patents or by copyrighted interfaces, the
original copyright holder who places the Program under this License
@@ -255,7 +255,7 @@ make exceptions for this. Our decision will be guided by the two goals
of preserving the free status of all derivatives of our free software and
of promoting the sharing and reuse of software generally.
- NO WARRANTY
+ NO WARRANTY
11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
@@ -277,9 +277,9 @@ YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
POSSIBILITY OF SUCH DAMAGES.
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Programs
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
If you develop a new program, and you want it to be of the greatest
possible use to the public, the best way to achieve this is to make it
@@ -303,10 +303,9 @@ the "copyright" line and a pointer to where the full notice is found.
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
- You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
-
+ You should have received a copy of the GNU General Public License along
+ with this program; if not, write to the Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
Also add information on how to contact you by electronic and paper mail.
@@ -336,5 +335,5 @@ necessary. Here is a sample; alter the names:
This General Public License does not permit incorporating your program into
proprietary programs. If your program is a subroutine library, you may
consider it more useful to permit linking proprietary applications with the
-library. If this is what you want to do, use the GNU Library General
+library. If this is what you want to do, use the GNU Lesser General
Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..35a8e75876
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,7 @@
+#
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
+# So all tests will cause failure.
+#
diff --git a/LEGAL b/LEGAL
index 908eb270f5..565c4c9cde 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,61 +1,231 @@
-LEGAL NOTICE INFORMATION
-------------------------
+# -*- rdoc -*-
+
+= LEGAL NOTICE INFORMATION
+--------------------------
All the files in this distribution are covered under either the Ruby's
license (see the file COPYING) or public-domain except some files
mentioned below.
-regex.[ch]:
+ccan/build_assert/build_assert.h::
+ccan/check_type/check_type.h::
+ccan/container_of/container_of.h::
+ccan/str/str.h::
+
+ These files are licensed under the CC0.
+
+ >>>
+ https://creativecommons.org/choose/zero/
+
+ccan/list/list.h::
+
+ This file is licensed under the MIT License.
+
+ >>>
+ Permission is hereby granted, free of charge, to any person obtaining a copy
+ of this software and associated documentation files (the "Software"), to deal
+ in the Software without restriction, including without limitation the rights
+ to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+ copies of the Software, and to permit persons to whom the Software is
+ furnished to do so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in
+ all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+ THE SOFTWARE.
+
+include/ruby/onigmo.h::
+include/ruby/oniguruma.h::
+regcomp.c::
+regenc.c::
+regenc.h::
+regerror.c::
+regexec.c::
+regint.h::
+regparse.c::
+regparse.h::
+enc/ascii.c::
+enc/big5.c::
+enc/cp949.c::
+enc/emacs_mule.c::
+enc/encdb.c::
+enc/euc_jp.c::
+enc/euc_kr.c::
+enc/euc_tw.c::
+enc/gb18030.c::
+enc/gb2312.c::
+enc/gbk.c::
+enc/iso_8859_1.c::
+enc/iso_8859_10.c::
+enc/iso_8859_11.c::
+enc/iso_8859_13.c::
+enc/iso_8859_14.c::
+enc/iso_8859_15.c::
+enc/iso_8859_16.c::
+enc/iso_8859_2.c::
+enc/iso_8859_3.c::
+enc/iso_8859_4.c::
+enc/iso_8859_5.c::
+enc/iso_8859_6.c::
+enc/iso_8859_7.c::
+enc/iso_8859_8.c::
+enc/iso_8859_9.c::
+enc/koi8_r.c::
+enc/koi8_u.c::
+enc/shift_jis.c::
+enc/unicode.c::
+enc/us_ascii.c::
+enc/utf_16be.c::
+enc/utf_16le.c::
+enc/utf_32be.c::
+enc/utf_32le.c::
+enc/utf_8.c::
+enc/windows_1251.c::
+
+ Onigmo (Oniguruma-mod) LICENSE
+
+ >>>
+ Copyright (c) 2002-2009 K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ Copyright (c) 2011-2014 K.Takata <kentkt AT csc DOT jp>
+ All rights reserved.
- These files are under LGPL. Treat them as LGPL says. (See the file
- LGPL for details)
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- Extended regular expression matching and search library.
- Copyright (C) 1993, 94, 95, 96, 97, 98 Free Software Foundation, Inc.
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
- The GNU C Library is free software; you can redistribute it and/or
- modify it under the terms of the GNU Library General Public License as
- published by the Free Software Foundation; either version 2 of the
- License, or (at your option) any later version.
+ Oniguruma LICENSE
- The GNU C Library is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
- Library General Public License for more details.
+ >>>
+ Copyright (c) 2002-2009 K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+ * https://github.com/k-takata/Onigmo/
+ * https://github.com/kkos/oniguruma
+ * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+
+ When this software is partly used or it is distributed with Ruby,
+ this of Ruby follows the license of Ruby.
+
+enc/trans/GB/GB12345%UCS.src::
+enc/trans/GB/UCS%GB12345.src::
+enc/trans/GB/GB2312%UCS.src::
+enc/trans/GB/UCS%GB2312.src::
- You should have received a copy of the GNU Library General Public
- License along with the GNU C Library; see the file LGPL. If not,
- write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330,
- Boston, MA 02111-1307, USA. */
+ These files have this explanatory texts.
- Multi-byte extension added May, 1993 by t^2 (Takahiro Tanimoto)
- Last change: May 21, 1993 by t^2
- removed gapped buffer support, multiple syntax support by matz <matz@nts.co.jp>
- Perl5 extension added by matz <matz@caelum.co.jp>
- UTF-8 extension added Jan 16 1999 by Yoshida Masato <yoshidam@tau.bekkoame.ne.jp>
+ >>>
+ This mapping data was created from files provided by Unicode, Inc.
+ (The Unicode Consortium). The files were used to create a product supporting
+ Unicode, as explicitly permitted in the files' copyright notices.
+ Please note that Unicode, Inc. never made any claims as to fitness of these
+ files for any particular purpose, and has ceased to publish the files many
+ years ago.
-configure:
+enc/trans/JIS/JISX0201-KANA%UCS.src::
+enc/trans/JIS/JISX0208\@1990%UCS.src::
+enc/trans/JIS/JISX0212%UCS.src::
+enc/trans/JIS/UCS%JISX0201-KANA.src::
+enc/trans/JIS/UCS%JISX0208@1990.src::
+enc/trans/JIS/UCS%JISX0212.src::
+
+ These files are copyrighted as the following.
+
+ >>>
+ © 2015 Unicode®, Inc.
+
+ For terms of use, see http://www.unicode.org/terms_of_use.html
+
+enc/trans/JIS/JISX0213-1%UCS@BMP.src::
+enc/trans/JIS/JISX0213-1%UCS@SIP.src::
+enc/trans/JIS/JISX0213-2%UCS@BMP.src::
+enc/trans/JIS/JISX0213-2%UCS@SIP.src::
+
+ These files are copyrighted as the following.
+
+ >>>
+ Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001 I'O, All Rights Reserved.
+ Copyright (C) 2006 Project X0213, All Rights Reserved.
+ You can use, modify, distribute this table freely.
+
+enc/trans/JIS/UCS@BMP%JISX0213-1.src::
+enc/trans/JIS/UCS@BMP%JISX0213-2.src::
+enc/trans/JIS/UCS@SIP%JISX0213-1.src::
+enc/trans/JIS/UCS@SIP%JISX0213-2.src::
+
+ These files are copyrighted as the following.
+
+ >>>
+ Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
+ Copyright (C) 2001 I'O, All Rights Reserved.
+ You can use, modify, distribute this table freely.
+
+configure::
This file is free software.
- Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+ >>>
+ Copyright (C) 1992-1996, 1998-2012 Free Software Foundation, Inc.
This configure script is free software; the Free Software Foundation
gives unlimited permission to copy, distribute and modify it.
-config.guess:
-config.sub:
-parse.c:
+tool/config.guess::
+tool/config.sub::
As long as you distribute these files with the file configure, they
are covered under the Ruby's license.
- Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
- Free Software Foundation, Inc.
+ >>>
+ Copyright 1992-2018 Free Software Foundation, Inc.
This file is free software; you can redistribute it and/or modify it
under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 2 of the License, or
+ the Free Software Foundation; either version 3 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful, but
@@ -64,54 +234,134 @@ parse.c:
General Public License for more details.
You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ along with this program; if not, see <https://www.gnu.org/licenses/>.
As a special exception to the GNU General Public License, if you
distribute this file as part of a program that contains a
configuration script generated by Autoconf, you may include it under
- the same distribution terms that you use for the rest of that program.
+ the same distribution terms that you use for the rest of that
+ program. This Exception is an additional permission under section 7
+ of the GNU General Public License, version 3 ("GPLv3").
+
+parse.c::
+
+ This file is licensed under the GPL, but is incorporated into Ruby and
+ redistributed under the terms of the Ruby license, as permitted by the
+ exception to the GPL below.
+
+ >>>
+ Copyright (C) 1984, 1989-1990, 2000-2015, 2018 Free Software Foundation, Inc.
+
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License
+ along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+ As a special exception, you may create a larger work that contains
+ part or all of the Bison parser skeleton and distribute that work
+ under terms of your choice, so long as that work isn't itself a
+ parser generator using the skeleton or a modified version thereof
+ as a parser skeleton. Alternatively, if you modify or redistribute
+ the parser skeleton itself, you may (at your option) remove this
+ special exception, which will cause the skeleton and the resulting
+ Bison output files to be licensed under the GNU General Public
+ License without this special exception.
+
+ This special exception was added by the Free Software Foundation in
+ version 2.2 of Bison.
+
+missing/dtoa.c::
+
+ This file is under these licenses.
+
+ >>>
+ Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+
+ Permission to use, copy, modify, and distribute this software for any
+ purpose without fee is hereby granted, provided that this entire notice
+ is included in all copies of any software which is or includes a copy
+ or modification of this software and in all copies of the supporting
+ documentation for such software.
+
+ THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+ WARRANTY. IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+ REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+ OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
+ >>>
+ Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+ All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
-util.c (partly):
-win32/win32.[ch]:
+win32/win32.{c,h}::
You can apply the Artistic License to these files. (or GPL,
alternatively)
+ >>>
Copyright (c) 1993, Intergraph Corporation
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the perl README file.
-random.c
+missing/mt19937.c::
This file is under the new-style BSD license.
+ >>>
A C-program for MT19937, with initialization improved 2002/2/10.
- Coded by Takuji Nishimura and Makoto Matsumoto.
+ Coded by Takuji Nishimura and Makoto Matsumoto.
This is a faster version by taking Shawn Cokus's optimization,
Matthe Bellew's simplification, Isaku Wada's real version.
- Before using, initialize the state by using init_genrand(seed)
+ Before using, initialize the state by using init_genrand(seed)
or init_by_array(init_key, key_length).
Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
- All rights reserved.
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- 3. The names of its contributors may not be used to endorse or promote
- products derived from this software without specific prior written
- permission.
+ 3. The names of its contributors may not be used to endorse or promote
+ products derived from this software without specific prior written
+ permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -130,69 +380,47 @@ random.c
http://www.math.keio.ac.jp/matumoto/emt.html
email: matumoto@math.keio.ac.jp
-st.[ch]:
-x68/*:
-missing/alloca.c:
-missing/dup2.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strcasecmp.c:
-missing/strchr.c:
-missing/streror.c:
-missing/strftime.c:
-missing/strncasecmp.c:
-missing/strstr.c:
-missing/strtol.c:
-ext/digest/sha1/sha1.[ch]:
-
- These files are all under public domain.
+ The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
-missing/strtod.c:
+missing/procstat_vm.c::
- This file will not be used on most platforms depending on how the
- configure script results. In any case you must not receive any fee
- with the file itself.
-
- Copyright (c) 1988-1993 The Regents of the University of California.
- Copyright (c) 1994 Sun Microsystems, Inc.
-
- Permission to use, copy, modify, and distribute this
- software and its documentation for any purpose and without
- fee is hereby granted, provided that the above copyright
- notice appear in all copies. The University of California
- makes no representations about the suitability of this
- software for any purpose. It is provided "as is" without
- express or implied warranty.
+ This file is under the new-style BSD license.
-missing/strtoul.c:
+ >>>
+ Copyright (c) 2007 Robert N. M. Watson
+ All rights reserved.
- This file will not be used on most platforms depending on how the
- configure script results. In any case you must not receive any fee
- with the file itself.
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- Copyright 1988 Regents of the University of California
+ THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
- Permission to use, copy, modify, and distribute this
- software and its documentation for any purpose and without
- fee is hereby granted, provided that the above copyright
- notice appear in all copies. The University of California
- makes no representations about the suitability of this
- software for any purpose. It is provided "as is" without
- express or implied warranty.
+ $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-missing/erf.c:
-missing/crypt.c:
-missing/vsnprintf.c:
+vsnprintf.c::
This file is under the old-style BSD license. Note that the
paragraph 3 below is now null and void.
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
+ >>>
+ Copyright (c) 1990, 1993
+ The Regents of the University of California. All rights reserved.
This code is derived from software contributed to Berkeley by
Chris Torek.
@@ -226,11 +454,142 @@ missing/vsnprintf.c:
From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
paragraph 3 above is now null and void.
-ext/digest/md5/md5.[ch]:
+st.c::
+strftime.c::
+include/ruby/st.h::
+missing/acosh.c::
+missing/alloca.c::
+missing/dup2.c::
+missing/erf.c::
+missing/finite.c::
+missing/hypot.c::
+missing/isinf.c::
+missing/isnan.c::
+missing/lgamma_r.c::
+missing/memcmp.c::
+missing/memmove.c::
+missing/strchr.c::
+missing/strerror.c::
+missing/strstr.c::
+missing/tgamma.c::
+ext/date/date_strftime.c::
+ext/digest/sha1/sha1.c::
+ext/digest/sha1/sha1.h::
+ext/sdbm/_sdbm.c::
+ext/sdbm/sdbm.h::
+
+ These files are all under public domain.
+
+missing/crypt.c::
+
+ This file is under the old-style BSD license. Note that the
+ paragraph 3 below is now null and void.
+
+ >>>
+ Copyright (c) 1989, 1993
+ The Regents of the University of California. All rights reserved.
+
+ This code is derived from software contributed to Berkeley by
+ Tom Truscott.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+missing/setproctitle.c::
+
+ This file is under the old-style BSD license. Note that the
+ paragraph 3 below is now null and void.
+
+ >>>
+ Copyright 2003 Damien Miller
+ Copyright (c) 1983, 1995-1997 Eric P. Allman
+ Copyright (c) 1988, 1993
+ The Regents of the University of California. All rights reserved.
+
+ Redistribution and use in source and binary forms, with or without
+ modification, are permitted provided that the following conditions
+ are met:
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+ 3. Neither the name of the University nor the names of its contributors
+ may be used to endorse or promote products derived from this software
+ without specific prior written permission.
+
+ THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ SUCH DAMAGE.
+
+missing/strlcat.c::
+missing/strlcpy.c::
+
+ These files are under an ISC-style license.
+
+ >>>
+ Copyright (c) 1998, 2015 Todd C. Miller <Todd.Miller@courtesan.com>
+
+ Permission to use, copy, modify, and distribute this software for any
+ purpose with or without fee is hereby granted, provided that the above
+ copyright notice and this permission notice appear in all copies.
+
+ THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+ WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+ MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+ ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+ WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+ ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+ OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+
+missing/langinfo.c::
+
+ This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+ Ruby uses a modified version. The file contains the following
+ author/copyright notice:
+
+ >>>
+ Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+ Permission to use, copy, modify, and distribute this software
+ for any purpose and without fee is hereby granted. The author
+ disclaims all warranties with regard to this software.
+
+ext/digest/md5/md5.c::
+ext/digest/md5/md5.h::
These files are under the following license. Ruby uses modified
versions of them.
+ >>>
Copyright (C) 1999, 2000 Aladdin Enterprises. All rights reserved.
This software is provided 'as-is', without any express or implied
@@ -252,33 +611,26 @@ ext/digest/md5/md5.[ch]:
L. Peter Deutsch
ghost@aladdin.com
-ext/digest/rmd160/rmd160.[ch]:
+ext/digest/rmd160/rmd160.c::
+ext/digest/rmd160/rmd160.h::
These files have the following copyright information, and by the
author we are allowed to use it under the new-style BSD license.
- AUTHOR: Antoon Bosselaers, ESAT-COSIC
+ >>>
+ AUTHOR:: Antoon Bosselaers, ESAT-COSIC
(Arranged for libc by Todd C. Miller)
- DATE: 1 March 1996
+ DATE:: 1 March 1996
Copyright (c) Katholieke Universiteit Leuven
1996, All Rights Reserved
-ext/digest/rmd160/rmd160hl.c:
-ext/digest/sha1/sha1hl.c:
-
- These files are under the beer-ware license.
-
- "THE BEER-WARE LICENSE" (Revision 42):
- <phk@login.dkuug.dk> wrote this file. As long as you retain this notice you
- can do whatever you want with this stuff. If we meet some day, and you think
- this stuff is worth it, you can buy me a beer in return. Poul-Henning Kamp
-
-ext/digest/sha2/sha2.[ch]:
-ext/digest/sha2/sha2hl.c:
+ext/digest/sha2/sha2.c::
+ext/digest/sha2/sha2.h::
These files are under the new-style BSD license.
+ >>>
Copyright 2000 Aaron D. Gifford. All rights reserved.
Redistribution and use in source and binary forms, with or without
@@ -305,28 +657,108 @@ ext/digest/sha2/sha2hl.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
+ext/json/generator/generator.c::
+
+ The file contains the following copyright notice.
+
+ >>>
+ Copyright 2001-2004 Unicode, Inc.
+
+ Disclaimer::
+
+ This source code is provided as is by Unicode, Inc. No claims are
+ made as to fitness for any particular purpose. No warranties of any
+ kind are expressed or implied. The recipient agrees to determine
+ applicability of information provided. If this file has been
+ purchased on magnetic or optical media from Unicode, Inc., the
+ sole remedy for any claim will be exchange of defective media
+ within 90 days of receipt.
+
+ Limitations on Rights to Redistribute This Code::
+
+ Unicode, Inc. hereby grants the right to freely use the information
+ supplied in this file in the creation of products supporting the
+ Unicode Standard, and to make copies of this file in any form
+ for internal or external distribution as long as this notice
+ remains attached.
+
+ext/nkf/nkf-utf8/config.h::
+ext/nkf/nkf-utf8/nkf.c::
+ext/nkf/nkf-utf8/utf8tbl.c::
These files are under the following license. So to speak, it is
copyrighted semi-public-domain software.
+ >>>
Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
- Everyone is permitted to do anything on this program
- including copying, modifying, improving,
- as long as you don't try to pretend that you wrote it.
- i.e., the above copyright notice has to appear in all copies.
- Binary distribution requires original version messages.
- You don't have to ask before copying, redistribution or publishing.
- THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
-
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
+
+ Everyone is permitted to do anything on this program
+ including copying, modifying, improving,
+ as long as you don't try to pretend that you wrote it.
+ i.e., the above copyright notice has to appear in all copies.
+ Binary distribution requires original version messages.
+ You don't have to ask before copying, redistribution or publishing.
+ THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+ext/psych::
+test/psych::
+
+ The files under these directories are under the following license, except for
+ ext/psych/yaml.
+
+ >>>
+ Copyright 2009 Aaron Patterson, et al.
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the 'Software'), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+ext/psych/yaml::
+
+ The files under this directory are under the following license.
+
+ >>>
+ Copyright (c) 2006 Kirill Simonov
+
+ Permission is hereby granted, free of charge, to any person obtaining a copy of
+ this software and associated documentation files (the "Software"), to deal in
+ the Software without restriction, including without limitation the rights to
+ use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
+ of the Software, and to permit persons to whom the Software is furnished to do
+ so, subject to the following conditions:
+
+ The above copyright notice and this permission notice shall be included in all
+ copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ SOFTWARE.
+
+ext/socket/addrinfo.h::
+ext/socket/getaddrinfo.c::
+ext/socket/getnameinfo.c::
These files are under the new-style BSD license.
+ >>>
Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
All rights reserved.
@@ -354,17 +786,150 @@ ext/socket/getnameinfo.c:
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/win32ole/win32ole.c:
+ext/win32ole/win32ole.c::
You can apply the Artistic License to this file. (or GPL,
alternatively)
+ >>>
(c) 1995 Microsoft Corporation. All rights reserved.
Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
<gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
-
+
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the README file
of the Perl distribution.
+
+ The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
+
+lib/rdoc/generator/template/darkfish/css/fonts.css::
+
+ This file is licensed under the SIL Open Font License.
+
+ >>>
+ http://scripts.sil.org/OFL
+
+spec/mspec::
+spec/ruby::
+
+ The files under these directories are under the following license.
+
+ >>>
+ Copyright (c) 2008 Engine Yard, Inc. All rights reserved.
+
+ Permission is hereby granted, free of charge, to any person
+ obtaining a copy of this software and associated documentation
+ files (the "Software"), to deal in the Software without
+ restriction, including without limitation the rights to use,
+ copy, modify, merge, publish, distribute, sublicense, and/or sell
+ copies of the Software, and to permit persons to whom the
+ Software is furnished to do so, subject to the following
+ conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
+ OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
+ HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
+ WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
+ FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
+ OTHER DEALINGS IN THE SOFTWARE.
+
+lib/rubygems.rb::
+lib/rubygems::
+test/rubygems::
+
+ RubyGems is under the following license.
+
+ >>>
+ RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
+ Weirich and others. You can redistribute it and/or modify it under
+ either the terms of the MIT license (see the file MIT.txt), or the
+ conditions below:
+
+ 1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
+
+ 2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
+
+ a. place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
+
+ b. use the modified software only within your corporation or
+ organization.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
+
+ 3. You may distribute the software in object code or executable
+ form, provided that you do at least ONE of the following:
+
+ a. distribute the executables and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
+
+ b. accompany the distribution with the machine-readable source of
+ the software.
+
+ c. give non-standard executables non-standard names, with
+ instructions on where to get the original software distribution.
+
+ d. make other distribution arrangements with the author.
+
+ 4. You may modify and include the part of the software into any other
+ software (possibly commercial).
+
+ 5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
+
+ 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
+
+lib/bundler::
+lib/bundler.rb::
+lib/bundler.gemspec::
+spec/bundler::
+man/bundle-*,gemfile.*::
+
+ Bundler is under the following license.
+
+ >>>
+ Portions copyright (c) 2010 Andre Arko
+ Portions copyright (c) 2009 Engine Yard
+
+ MIT License::
+
+ Permission is hereby granted, free of charge, to any person obtaining
+ a copy of this software and associated documentation files (the
+ "Software"), to deal in the Software without restriction, including
+ without limitation the rights to use, copy, modify, merge, publish,
+ distribute, sublicense, and/or sell copies of the Software, and to
+ permit persons to whom the Software is furnished to do so, subject to
+ the following conditions:
+
+ The above copyright notice and this permission notice shall be
+ included in all copies or substantial portions of the Software.
+
+ THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+ EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+ MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+ NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+ LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+ OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+ WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
diff --git a/LGPL b/LGPL
deleted file mode 100644
index b1e3f5a263..0000000000
--- a/LGPL
+++ /dev/null
@@ -1,504 +0,0 @@
- GNU LESSER GENERAL PUBLIC LICENSE
- Version 2.1, February 1999
-
- Copyright (C) 1991, 1999 Free Software Foundation, Inc.
- 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
-[This is the first released version of the Lesser GPL. It also counts
- as the successor of the GNU Library Public License, version 2, hence
- the version number 2.1.]
-
- Preamble
-
- The licenses for most software are designed to take away your
-freedom to share and change it. By contrast, the GNU General Public
-Licenses are intended to guarantee your freedom to share and change
-free software--to make sure the software is free for all its users.
-
- This license, the Lesser General Public License, applies to some
-specially designated software packages--typically libraries--of the
-Free Software Foundation and other authors who decide to use it. You
-can use it too, but we suggest you first think carefully about whether
-this license or the ordinary General Public License is the better
-strategy to use in any particular case, based on the explanations below.
-
- When we speak of free software, we are referring to freedom of use,
-not price. Our General Public Licenses are designed to make sure that
-you have the freedom to distribute copies of free software (and charge
-for this service if you wish); that you receive source code or can get
-it if you want it; that you can change the software and use pieces of
-it in new free programs; and that you are informed that you can do
-these things.
-
- To protect your rights, we need to make restrictions that forbid
-distributors to deny you these rights or to ask you to surrender these
-rights. These restrictions translate to certain responsibilities for
-you if you distribute copies of the library or if you modify it.
-
- For example, if you distribute copies of the library, whether gratis
-or for a fee, you must give the recipients all the rights that we gave
-you. You must make sure that they, too, receive or can get the source
-code. If you link other code with the library, you must provide
-complete object files to the recipients, so that they can relink them
-with the library after making changes to the library and recompiling
-it. And you must show them these terms so they know their rights.
-
- We protect your rights with a two-step method: (1) we copyright the
-library, and (2) we offer you this license, which gives you legal
-permission to copy, distribute and/or modify the library.
-
- To protect each distributor, we want to make it very clear that
-there is no warranty for the free library. Also, if the library is
-modified by someone else and passed on, the recipients should know
-that what they have is not the original version, so that the original
-author's reputation will not be affected by problems that might be
-introduced by others.
-
- Finally, software patents pose a constant threat to the existence of
-any free program. We wish to make sure that a company cannot
-effectively restrict the users of a free program by obtaining a
-restrictive license from a patent holder. Therefore, we insist that
-any patent license obtained for a version of the library must be
-consistent with the full freedom of use specified in this license.
-
- Most GNU software, including some libraries, is covered by the
-ordinary GNU General Public License. This license, the GNU Lesser
-General Public License, applies to certain designated libraries, and
-is quite different from the ordinary General Public License. We use
-this license for certain libraries in order to permit linking those
-libraries into non-free programs.
-
- When a program is linked with a library, whether statically or using
-a shared library, the combination of the two is legally speaking a
-combined work, a derivative of the original library. The ordinary
-General Public License therefore permits such linking only if the
-entire combination fits its criteria of freedom. The Lesser General
-Public License permits more lax criteria for linking other code with
-the library.
-
- We call this license the "Lesser" General Public License because it
-does Less to protect the user's freedom than the ordinary General
-Public License. It also provides other free software developers Less
-of an advantage over competing non-free programs. These disadvantages
-are the reason we use the ordinary General Public License for many
-libraries. However, the Lesser license provides advantages in certain
-special circumstances.
-
- For example, on rare occasions, there may be a special need to
-encourage the widest possible use of a certain library, so that it becomes
-a de-facto standard. To achieve this, non-free programs must be
-allowed to use the library. A more frequent case is that a free
-library does the same job as widely used non-free libraries. In this
-case, there is little to gain by limiting the free library to free
-software only, so we use the Lesser General Public License.
-
- In other cases, permission to use a particular library in non-free
-programs enables a greater number of people to use a large body of
-free software. For example, permission to use the GNU C Library in
-non-free programs enables many more people to use the whole GNU
-operating system, as well as its variant, the GNU/Linux operating
-system.
-
- Although the Lesser General Public License is Less protective of the
-users' freedom, it does ensure that the user of a program that is
-linked with the Library has the freedom and the wherewithal to run
-that program using a modified version of the Library.
-
- The precise terms and conditions for copying, distribution and
-modification follow. Pay close attention to the difference between a
-"work based on the library" and a "work that uses the library". The
-former contains code derived from the library, whereas the latter must
-be combined with the library in order to run.
-
- GNU LESSER GENERAL PUBLIC LICENSE
- TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
- 0. This License Agreement applies to any software library or other
-program which contains a notice placed by the copyright holder or
-other authorized party saying it may be distributed under the terms of
-this Lesser General Public License (also called "this License").
-Each licensee is addressed as "you".
-
- A "library" means a collection of software functions and/or data
-prepared so as to be conveniently linked with application programs
-(which use some of those functions and data) to form executables.
-
- The "Library", below, refers to any such software library or work
-which has been distributed under these terms. A "work based on the
-Library" means either the Library or any derivative work under
-copyright law: that is to say, a work containing the Library or a
-portion of it, either verbatim or with modifications and/or translated
-straightforwardly into another language. (Hereinafter, translation is
-included without limitation in the term "modification".)
-
- "Source code" for a work means the preferred form of the work for
-making modifications to it. For a library, complete source code means
-all the source code for all modules it contains, plus any associated
-interface definition files, plus the scripts used to control compilation
-and installation of the library.
-
- Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope. The act of
-running a program using the Library is not restricted, and output from
-such a program is covered only if its contents constitute a work based
-on the Library (independent of the use of the Library in a tool for
-writing it). Whether that is true depends on what the Library does
-and what the program that uses the Library does.
-
- 1. You may copy and distribute verbatim copies of the Library's
-complete source code as you receive it, in any medium, provided that
-you conspicuously and appropriately publish on each copy an
-appropriate copyright notice and disclaimer of warranty; keep intact
-all the notices that refer to this License and to the absence of any
-warranty; and distribute a copy of this License along with the
-Library.
-
- You may charge a fee for the physical act of transferring a copy,
-and you may at your option offer warranty protection in exchange for a
-fee.
-
- 2. You may modify your copy or copies of the Library or any portion
-of it, thus forming a work based on the Library, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
- a) The modified work must itself be a software library.
-
- b) You must cause the files modified to carry prominent notices
- stating that you changed the files and the date of any change.
-
- c) You must cause the whole of the work to be licensed at no
- charge to all third parties under the terms of this License.
-
- d) If a facility in the modified Library refers to a function or a
- table of data to be supplied by an application program that uses
- the facility, other than as an argument passed when the facility
- is invoked, then you must make a good faith effort to ensure that,
- in the event an application does not supply such function or
- table, the facility still operates, and performs whatever part of
- its purpose remains meaningful.
-
- (For example, a function in a library to compute square roots has
- a purpose that is entirely well-defined independent of the
- application. Therefore, Subsection 2d requires that any
- application-supplied function or table used by this function must
- be optional: if the application does not supply it, the square
- root function must still compute square roots.)
-
-These requirements apply to the modified work as a whole. If
-identifiable sections of that work are not derived from the Library,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works. But when you
-distribute the same sections as part of a whole which is a work based
-on the Library, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote
-it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Library.
-
-In addition, mere aggregation of another work not based on the Library
-with the Library (or with a work based on the Library) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
- 3. You may opt to apply the terms of the ordinary GNU General Public
-License instead of this License to a given copy of the Library. To do
-this, you must alter all the notices that refer to this License, so
-that they refer to the ordinary GNU General Public License, version 2,
-instead of to this License. (If a newer version than version 2 of the
-ordinary GNU General Public License has appeared, then you can specify
-that version instead if you wish.) Do not make any other change in
-these notices.
-
- Once this change is made in a given copy, it is irreversible for
-that copy, so the ordinary GNU General Public License applies to all
-subsequent copies and derivative works made from that copy.
-
- This option is useful when you wish to copy part of the code of
-the Library into a program that is not a library.
-
- 4. You may copy and distribute the Library (or a portion or
-derivative of it, under Section 2) in object code or executable form
-under the terms of Sections 1 and 2 above provided that you accompany
-it with the complete corresponding machine-readable source code, which
-must be distributed under the terms of Sections 1 and 2 above on a
-medium customarily used for software interchange.
-
- If distribution of object code is made by offering access to copy
-from a designated place, then offering equivalent access to copy the
-source code from the same place satisfies the requirement to
-distribute the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
- 5. A program that contains no derivative of any portion of the
-Library, but is designed to work with the Library by being compiled or
-linked with it, is called a "work that uses the Library". Such a
-work, in isolation, is not a derivative work of the Library, and
-therefore falls outside the scope of this License.
-
- However, linking a "work that uses the Library" with the Library
-creates an executable that is a derivative of the Library (because it
-contains portions of the Library), rather than a "work that uses the
-library". The executable is therefore covered by this License.
-Section 6 states terms for distribution of such executables.
-
- When a "work that uses the Library" uses material from a header file
-that is part of the Library, the object code for the work may be a
-derivative work of the Library even though the source code is not.
-Whether this is true is especially significant if the work can be
-linked without the Library, or if the work is itself a library. The
-threshold for this to be true is not precisely defined by law.
-
- If such an object file uses only numerical parameters, data
-structure layouts and accessors, and small macros and small inline
-functions (ten lines or less in length), then the use of the object
-file is unrestricted, regardless of whether it is legally a derivative
-work. (Executables containing this object code plus portions of the
-Library will still fall under Section 6.)
-
- Otherwise, if the work is a derivative of the Library, you may
-distribute the object code for the work under the terms of Section 6.
-Any executables containing that work also fall under Section 6,
-whether or not they are linked directly with the Library itself.
-
- 6. As an exception to the Sections above, you may also combine or
-link a "work that uses the Library" with the Library to produce a
-work containing portions of the Library, and distribute that work
-under terms of your choice, provided that the terms permit
-modification of the work for the customer's own use and reverse
-engineering for debugging such modifications.
-
- You must give prominent notice with each copy of the work that the
-Library is used in it and that the Library and its use are covered by
-this License. You must supply a copy of this License. If the work
-during execution displays copyright notices, you must include the
-copyright notice for the Library among them, as well as a reference
-directing the user to the copy of this License. Also, you must do one
-of these things:
-
- a) Accompany the work with the complete corresponding
- machine-readable source code for the Library including whatever
- changes were used in the work (which must be distributed under
- Sections 1 and 2 above); and, if the work is an executable linked
- with the Library, with the complete machine-readable "work that
- uses the Library", as object code and/or source code, so that the
- user can modify the Library and then relink to produce a modified
- executable containing the modified Library. (It is understood
- that the user who changes the contents of definitions files in the
- Library will not necessarily be able to recompile the application
- to use the modified definitions.)
-
- b) Use a suitable shared library mechanism for linking with the
- Library. A suitable mechanism is one that (1) uses at run time a
- copy of the library already present on the user's computer system,
- rather than copying library functions into the executable, and (2)
- will operate properly with a modified version of the library, if
- the user installs one, as long as the modified version is
- interface-compatible with the version that the work was made with.
-
- c) Accompany the work with a written offer, valid for at
- least three years, to give the same user the materials
- specified in Subsection 6a, above, for a charge no more
- than the cost of performing this distribution.
-
- d) If distribution of the work is made by offering access to copy
- from a designated place, offer equivalent access to copy the above
- specified materials from the same place.
-
- e) Verify that the user has already received a copy of these
- materials or that you have already sent this user a copy.
-
- For an executable, the required form of the "work that uses the
-Library" must include any data and utility programs needed for
-reproducing the executable from it. However, as a special exception,
-the materials to be distributed need not include anything that is
-normally distributed (in either source or binary form) with the major
-components (compiler, kernel, and so on) of the operating system on
-which the executable runs, unless that component itself accompanies
-the executable.
-
- It may happen that this requirement contradicts the license
-restrictions of other proprietary libraries that do not normally
-accompany the operating system. Such a contradiction means you cannot
-use both them and the Library together in an executable that you
-distribute.
-
- 7. You may place library facilities that are a work based on the
-Library side-by-side in a single library together with other library
-facilities not covered by this License, and distribute such a combined
-library, provided that the separate distribution of the work based on
-the Library and of the other library facilities is otherwise
-permitted, and provided that you do these two things:
-
- a) Accompany the combined library with a copy of the same work
- based on the Library, uncombined with any other library
- facilities. This must be distributed under the terms of the
- Sections above.
-
- b) Give prominent notice with the combined library of the fact
- that part of it is a work based on the Library, and explaining
- where to find the accompanying uncombined form of the same work.
-
- 8. You may not copy, modify, sublicense, link with, or distribute
-the Library except as expressly provided under this License. Any
-attempt otherwise to copy, modify, sublicense, link with, or
-distribute the Library is void, and will automatically terminate your
-rights under this License. However, parties who have received copies,
-or rights, from you under this License will not have their licenses
-terminated so long as such parties remain in full compliance.
-
- 9. You are not required to accept this License, since you have not
-signed it. However, nothing else grants you permission to modify or
-distribute the Library or its derivative works. These actions are
-prohibited by law if you do not accept this License. Therefore, by
-modifying or distributing the Library (or any work based on the
-Library), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Library or works based on it.
-
- 10. Each time you redistribute the Library (or any work based on the
-Library), the recipient automatically receives a license from the
-original licensor to copy, distribute, link with or modify the Library
-subject to these terms and conditions. You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties with
-this License.
-
- 11. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Library at all. For example, if a patent
-license would not permit royalty-free redistribution of the Library by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Library.
-
-If any portion of this section is held invalid or unenforceable under any
-particular circumstance, the balance of the section is intended to apply,
-and the section as a whole is intended to apply in other circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system which is
-implemented by public license practices. Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
- 12. If the distribution and/or use of the Library is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Library under this License may add
-an explicit geographical distribution limitation excluding those countries,
-so that distribution is permitted only in or among countries not thus
-excluded. In such case, this License incorporates the limitation as if
-written in the body of this License.
-
- 13. The Free Software Foundation may publish revised and/or new
-versions of the Lesser General Public License from time to time.
-Such new versions will be similar in spirit to the present version,
-but may differ in detail to address new problems or concerns.
-
-Each version is given a distinguishing version number. If the Library
-specifies a version number of this License which applies to it and
-"any later version", you have the option of following the terms and
-conditions either of that version or of any later version published by
-the Free Software Foundation. If the Library does not specify a
-license version number, you may choose any version ever published by
-the Free Software Foundation.
-
- 14. If you wish to incorporate parts of the Library into other free
-programs whose distribution conditions are incompatible with these,
-write to the author to ask for permission. For software which is
-copyrighted by the Free Software Foundation, write to the Free
-Software Foundation; we sometimes make exceptions for this. Our
-decision will be guided by the two goals of preserving the free status
-of all derivatives of our free software and of promoting the sharing
-and reuse of software generally.
-
- NO WARRANTY
-
- 15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
-WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
-EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
-OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
-KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
-LIBRARY IS WITH YOU. SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
-THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
-
- 16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
-WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
-AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
-FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
-CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
-LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
-RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
-FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
-SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
-DAMAGES.
-
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Libraries
-
- If you develop a new library, and you want it to be of the greatest
-possible use to the public, we recommend making it free software that
-everyone can redistribute and change. You can do so by permitting
-redistribution under these terms (or, alternatively, under the terms of the
-ordinary General Public License).
-
- To apply these terms, attach the following notices to the library. It is
-safest to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least the
-"copyright" line and a pointer to where the full notice is found.
-
- <one line to give the library's name and a brief idea of what it does.>
- Copyright (C) <year> <name of author>
-
- This library is free software; you can redistribute it and/or
- modify it under the terms of the GNU Lesser General Public
- License as published by the Free Software Foundation; either
- version 2.1 of the License, or (at your option) any later version.
-
- This library is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
- Lesser General Public License for more details.
-
- You should have received a copy of the GNU Lesser General Public
- License along with this library; if not, write to the Free Software
- Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
-
-Also add information on how to contact you by electronic and paper mail.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the library, if
-necessary. Here is a sample; alter the names:
-
- Yoyodyne, Inc., hereby disclaims all copyright interest in the
- library `Frob' (a library for tweaking knobs) written by James Random Hacker.
-
- <signature of Ty Coon>, 1 April 1990
- Ty Coon, President of Vice
-
-That's all there is to it!
-
-
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 8fd59babcd..0000000000
--- a/Makefile.in
+++ /dev/null
@@ -1,178 +0,0 @@
-SHELL = /bin/sh
-
-#### Start of system configuration section. ####
-
-srcdir = @srcdir@
-VPATH = $(srcdir):$(srcdir)/missing
-
-CC = @CC@
-YACC = @YACC@
-PURIFY =
-AUTOCONF = autoconf
-@SET_MAKE@
-MKFILES = @MAKEFILES@
-
-prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-
-TESTUI = console
-TESTS =
-RDOCTARGET = @RDOCTARGET@
-
-EXTOUT = @EXTOUT@
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-
-empty =
-OUTFLAG = @OUTFLAG@$(empty)
-CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
-CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
-LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS =
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
-LIBS = @LIBS@ $(EXTLIBS)
-MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-MINIOBJS = @MINIOBJS@
-
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@
-RUNRUBY = @RUNRUBY@
-
-#### End of system configuration section. ####
-
-MAJOR= @MAJOR@
-MINOR= @MINOR@
-TEENY= @TEENY@
-
-LIBRUBY_A = @LIBRUBY_A@
-LIBRUBY_SO = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY = @LIBRUBY@
-LIBRUBYARG = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-
-PREP = @PREP@
-ARCHFILE = @ARCHFILE@
-SETUP =
-EXTSTATIC = @EXTSTATIC@
-
-RM = rm -f
-NM = @NM@
-AR = @AR@
-ARFLAGS = rcu
-RANLIB = @RANLIB@
-AS = @AS@
-ASFLAGS = @ASFLAGS@
-
-OBJEXT = @OBJEXT@
-MANTYPE = @MANTYPE@
-
-PREINSTALL = @PREINSTALL@
-#### End of variables
-
-all:
-
-.DEFAULT: all
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-
-miniruby$(EXEEXT):
- @$(RM) $@
- $(PURIFY) $(CC) $(MAINOBJ) $(MINIOBJS) $(LIBRUBY_A) $(LIBS) $(OUTFLAG)$@ $(LDFLAGS) $(MAINLIBS)
-
-$(PROGRAM):
- @$(RM) $@
- $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
- @$(RM) $@
- $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
- @-$(RANLIB) $@ 2> /dev/null || true
-
-$(LIBRUBY_SO):
- $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
- @-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
- File.symlink "$(LIBRUBY_SO)", link}' \
- $(LIBRUBY_ALIASES) || true
-
-fake.rb: Makefile
- @echo ' \
- class Object; \
- CROSS_COMPILING = RUBY_PLATFORM; \
- remove_const :RUBY_PLATFORM; \
- remove_const :RUBY_VERSION; \
- RUBY_PLATFORM = "@arch@"; \
- RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
- end; \
- if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
- class File; \
- remove_const :ALT_SEPARATOR; \
- ALT_SEPARATOR = "\\"; \
- end; \
- end; \
- ' > $@
-
-Makefile: $(srcdir)/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/common.mk
- MAKE=$(MAKE) $(SHELL) ./config.status
- @{ \
- echo "all:; -@rm -f conftest.mk"; \
- echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
- echo ".force:"; \
- } > conftest.mk || exit 1; \
- $(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
- { echo "Makefile updated, restart."; exit 1; }
-
-config.status: $(srcdir)/configure
- MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
-
-$(srcdir)/configure: $(srcdir)/configure.in
- cd $(srcdir) && $(AUTOCONF)
-
-lex.c: keywords
- @-$(RM) $@
- gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
- cp "$(srcdir)/$@" .
-
-.y.c:
- $(YACC) $<
- sed '/^#/s|y\.tab\.c|$@|' y.tab.c > $@
- rm -f y.tab.c
-
-.c.@OBJEXT@:
- $(CC) $(CFLAGS) $(CPPFLAGS) -c $<
-
-.s.@OBJEXT@:
- $(AS) $(ASFLAGS) -o $@ $<
-
-clean-local::
- @$(RM) ext/extinit.c ext/extinit.$(OBJEXT)
-
-distclean-local::
- @$(RM) ext/config.cache $(RBCONFIG)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
- $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(OUTFLAG)$@ -c ext/extinit.c
diff --git a/NEWS b/NEWS
new file mode 100644
index 0000000000..e1adb5115d
--- /dev/null
+++ b/NEWS
@@ -0,0 +1,826 @@
+# -*- rdoc -*-
+
+= NEWS for Ruby 2.7.0
+
+This document is a list of user visible feature changes made between
+releases except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or reference
+information is supplied with. For a full list of changes with all
+sufficient information, see the ChangeLog file or Redmine
+(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>).
+
+== Changes since the 2.6.0 release
+
+=== Language changes
+
+==== Pattern matching
+
+* Pattern matching is introduced as an experimental feature. [Feature #14912]
+
+ case [0, [1, 2, 3]]
+ in [a, [b, *c]]
+ p a #=> 0
+ p b #=> 1
+ p c #=> [2, 3]
+ end
+
+ case {a: 0, b: 1}
+ in {a: 0, x: 1}
+ :unreachable
+ in {a: 0, b: var}
+ p var #=> 1
+ end
+
+ case -1
+ in 0 then :unreachable
+ in 1 then :unreachable
+ end #=> NoMatchingPatternError
+
+ json = <<END
+ {
+ "name": "Alice",
+ "age": 30,
+ "children": [{ "name": "Bob", "age": 2 }]
+ }
+ END
+
+ JSON.parse(json, symbolize_names: true) in {name: "Alice", children: [{name: name, age: age}]}
+
+ p name #=> "Bob"
+ p age #=> 2
+
+ JSON.parse(json, symbolize_names: true) in {name: "Alice", children: [{name: "Charlie", age: age}]}
+ #=> NoMatchingPatternError
+
+* See the following slides for more details:
+ * https://speakerdeck.com/k_tsj/pattern-matching-new-feature-in-ruby-2-dot-7
+ * Note that the slides are slightly obsolete.
+
+* The warning against pattern matching can be suppressed with
+ {-W:no-experimental option}[#label-Warning+option].
+
+==== The spec of keyword arguments is changed towards 3.0
+
+* Automatic conversion of keyword arguments and positional arguments is
+ deprecated, and conversion will be removed in Ruby 3. [Feature #14183]
+
+ * When a method call passes a Hash at the last argument, and when it
+ passes no keywords, and when the called method accepts keywords,
+ a warning is emitted. To continue treating the hash as keywords,
+ add a double splat operator to avoid the warning and ensure
+ correct behavior in Ruby 3.
+
+ def foo(key: 42); end; foo({key: 42}) # warned
+ def foo(**kw); end; foo({key: 42}) # warned
+ def foo(key: 42); end; foo(**{key: 42}) # OK
+ def foo(**kw); end; foo(**{key: 42}) # OK
+
+ * When a method call passes keywords to a method that accepts keywords,
+ but it does not pass enough required positional arguments, the
+ keywords are treated as a final required positional argument, and a
+ warning is emitted. Pass the argument as a hash instead of keywords
+ to avoid the warning and ensure correct behavior in Ruby 3.
+
+ def foo(h, **kw); end; foo(key: 42) # warned
+ def foo(h, key: 42); end; foo(key: 42) # warned
+ def foo(h, **kw); end; foo({key: 42}) # OK
+ def foo(h, key: 42); end; foo({key: 42}) # OK
+
+ * When a method accepts specific keywords but not a keyword splat, and
+ a hash or keywords splat is passed to the method that includes both
+ Symbol and non-Symbol keys, the hash will continue to be split, and
+ a warning will be emitted. You will need to update the calling code
+ to pass separate hashes to ensure correct behavior in Ruby 3.
+
+ def foo(h={}, key: 42); end; foo("key" => 43, key: 42) # warned
+ def foo(h={}, key: 42); end; foo({"key" => 43, key: 42}) # warned
+ def foo(h={}, key: 42); end; foo({"key" => 43}, key: 42) # OK
+
+ * If a method does not accept keywords, and is called with keywords,
+ the keywords are still treated as a positional hash, with no warning.
+ This behavior will continue to work in Ruby 3.
+
+ def foo(opt={}); end; foo( key: 42 ) # OK
+
+* Non-symbols are allowed as keyword argument keys if the method accepts
+ arbitrary keywords. [Feature #14183]
+
+ * Non-Symbol keys in a keyword arguments hash were prohibited in 2.6.0,
+ but are now allowed again. [Bug #15658]
+
+ def foo(**kw); p kw; end; foo("str" => 1) #=> {"str"=>1}
+
+* <code>**nil</code> is allowed in method definitions to explicitly mark
+ that the method accepts no keywords. Calling such a method with keywords
+ will result in an ArgumentError. [Feature #14183]
+
+ def foo(h, **nil); end; foo(key: 1) # ArgumentError
+ def foo(h, **nil); end; foo(**{key: 1}) # ArgumentError
+ def foo(h, **nil); end; foo("str" => 1) # ArgumentError
+ def foo(h, **nil); end; foo({key: 1}) # OK
+ def foo(h, **nil); end; foo({"str" => 1}) # OK
+
+* Passing an empty keyword splat to a method that does not accept keywords
+ no longer passes an empty hash, unless the empty hash is necessary for
+ a required parameter, in which case a warning will be emitted. Remove
+ the double splat to continue passing a positional hash. [Feature #14183]
+
+ h = {}; def foo(*a) a end; foo(**h) # []
+ h = {}; def foo(a) a end; foo(**h) # {} and warning
+ h = {}; def foo(*a) a end; foo(h) # [{}]
+ h = {}; def foo(a) a end; foo(h) # {}
+
+* Above warnings can be suppressed also with {-W:no-deprecated option}[#label-Warning+option].
+
+==== Numbered parameters
+
+* Numbered parameters as default block parameters are introduced.
+ [Feature #4475]
+
+ [1, 2, 10].map { _1.to_s(16) } #=> ["1", "2", "a"]
+ [[1, 2], [3, 4]].map { _1 + _2 } #=> [3, 7]
+
+ You can still define a local variable named +_1+ and so on,
+ and that is honored when present, but renders a warning.
+
+ _1 = 0 #=> warning: `_1' is reserved for numbered parameter; consider another name
+ [1].each { p _1 } # prints 0 instead of 1
+
+==== proc/lambda without block is deprecated
+
+* Proc.new and Kernel#proc with no block in a method called with a block is
+ warned now.
+
+ def foo
+ proc
+ end
+ foo { puts "Hello" } #=> warning: Capturing the given block using Kernel#proc is deprecated; use `&block` instead
+
+ This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
+
+* Kernel#lambda with no block in a method called with a block raises an exception.
+
+ def bar
+ lambda
+ end
+ bar { puts "Hello" } #=> tried to create Proc object without a block (ArgumentError)
+
+==== Other miscellaneous changes
+
+* A beginless range is experimentally introduced. It might be useful
+ in +case+, new call-sequence of the <code>Comparable#clamp</code>,
+ constants and DSLs. [Feature #14799]
+
+ ary[..3] # identical to ary[0..3]
+
+ case RUBY_VERSION
+ when ..."2.4" then puts "EOL"
+ # ...
+ end
+
+ age.clamp(..100)
+
+ where(sales: ..100)
+
+* Setting <code>$;</code> to a non-nil value is warned now. [Feature #14240]
+ Use of it in String#split is warned too.
+ This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
+
+* Setting <code>$,</code> to a non-nil value is warned now. [Feature #14240]
+ Use of it in Array#join is warned too.
+ This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
+
+* Quoted here-document identifiers must end within the same line.
+
+ <<"EOS
+ " # This had been warned since 2.4; Now it raises a SyntaxError
+ EOS
+
+* The flip-flop syntax deprecation is reverted. [Feature #5400]
+
+* Comment lines can be placed between fluent dot now.
+
+ foo
+ # .bar
+ .baz # => foo.baz
+
+* Calling a private method with a literal +self+ as the receiver
+ is now allowed. [Feature #11297] [Feature #16123]
+
+* Modifier rescue now operates the same for multiple assignment as single
+ assignment. [Bug #8279]
+
+ a, b = raise rescue [1, 2]
+ # Previously parsed as: (a, b = raise) rescue [1, 2]
+ # Now parsed as: a, b = (raise rescue [1, 2])
+
+* +yield+ in singleton class syntax is warned and will be deprecated later. [Feature #15575].
+
+ def foo
+ class << Object.new
+ yield #=> warning: `yield' in class syntax will not be supported from Ruby 3.0. [Feature #15575]
+ end
+ end
+ foo { p :ok }
+
+ This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
+
+* Argument forwarding by <code>(...)</code> is introduced. [Feature #16253]
+
+ def foo(...)
+ bar(...)
+ end
+
+ All arguments to +foo+ are forwarded to +bar+, including keyword and
+ block arguments.
+ Note that the parentheses are mandatory. <code>bar ...</code> is parsed
+ as an endless range.
+
+* Access and setting of <code>$SAFE</code> is now always warned. <code>$SAFE</code>
+ will become a normal global variable in Ruby 3.0. [Feature #16131]
+
+* <code>Object#{taint,untaint,trust,untrust}</code> and related functions in the C-API
+ no longer have an effect (all objects are always considered untainted), and are now
+ warned in verbose mode. This warning will be disabled even in non-verbose mode in
+ Ruby 3.0, and the methods and C functions will be removed in Ruby 3.2. [Feature #16131]
+
+* Refinements take place at Object#method and Module#instance_method. [Feature #15373]
+
+=== Command line options
+
+==== Warning option
+
+The +-W+ option has been extended with a following +:+, to manage categorized
+warnings. [Feature #16345] [Feature #16420]
+
+* To suppress deprecation warnings:
+
+ $ ruby -e '$; = ""'
+ -e:1: warning: `$;' is deprecated
+
+ $ ruby -W:no-deprecated -e '$; = //'
+
+* It works with the +RUBYOPT+ environment variable:
+
+ $ RUBYOPT=-W:no-deprecated ruby -e '$; = //'
+
+* To suppress experimental feature warnings:
+
+ $ ruby -e '0 in a'
+ -e:1: warning: Pattern matching is experimental, and the behavior may change in future versions of Ruby!
+
+ $ ruby -W:no-experimental -e '0 in a'
+
+* To suppress both by using +RUBYOPT+, set space separated values:
+
+ $ RUBYOPT='-W:no-deprecated -W:no-experimental' ruby -e '($; = "") in a'
+
+See also Warning in {Core classes updates}[#label-Core+classes+updates+-28outstanding+ones+only-29].
+
+=== Core classes updates (outstanding ones only)
+
+Array::
+
+ New methods::
+
+ * Added Array#intersection. [Feature #16155]
+
+ * Added Array#minmax, with a faster implementation than Enumerable#minmax. [Bug #15929]
+
+Comparable::
+
+ Modified method::
+
+ * Comparable#clamp now accepts a Range argument. [Feature #14784]
+
+ -1.clamp(0..2) #=> 0
+ 1.clamp(0..2) #=> 1
+ 3.clamp(0..2) #=> 2
+ # With beginless and endless ranges:
+ -1.clamp(0..) #=> 0
+ 3.clamp(..2) #=> 2
+
+
+Complex::
+
+ New method::
+
+ * Added Complex#<=>.
+ So <code>0 <=> 0i</code> will not raise NoMethodError. [Bug #15857]
+
+Dir::
+
+ Modified methods::
+
+ * Dir.glob and Dir.[] no longer allow NUL-separated glob pattern.
+ Use Array instead. [Feature #14643]
+
+Encoding::
+
+ New encoding::
+
+ * Added new encoding CESU-8. [Feature #15931]
+
+Enumerable::
+
+ New methods::
+
+ * Added Enumerable#filter_map. [Feature #15323]
+
+ [1, 2, 3].filter_map {|x| x.odd? ? x.to_s : nil } #=> ["1", "3"]
+
+ * Added Enumerable#tally. [Feature #11076]
+
+ ["A", "B", "C", "B", "A"].tally #=> {"A"=>2, "B"=>2, "C"=>1}
+
+Enumerator::
+
+ New methods::
+
+ * Added Enumerator.produce to generate an Enumerator from any custom
+ data transformation. [Feature #14781]
+
+ require "date"
+ dates = Enumerator.produce(Date.today, &:succ) #=> infinite sequence of dates
+ dates.detect(&:tuesday?) #=> next Tuesday
+
+ * Added Enumerator::Lazy#eager that generates a non-lazy enumerator
+ from a lazy enumerator. [Feature #15901]
+
+ a = %w(foo bar baz)
+ e = a.lazy.map {|x| x.upcase }.map {|x| x + "!" }.eager
+ p e.class #=> Enumerator
+ p e.map {|x| x + "?" } #=> ["FOO!?", "BAR!?", "BAZ!?"]
+
+ * Added Enumerator::Yielder#to_proc so that a Yielder object
+ can be directly passed to another method as a block
+ argument. [Feature #15618]
+
+Fiber::
+
+ New method::
+
+ * Added Fiber#raise that behaves like Fiber#resume but raises an
+ exception on the resumed fiber. [Feature #10344]
+
+File::
+
+ Modified method::
+
+ * File.extname now returns a dot string for names ending with a dot on
+ non-Windows platforms. [Bug #15267]
+
+ File.extname("foo.") #=> "."
+
+FrozenError::
+
+ New method::
+
+ * Added FrozenError#receiver to return the frozen object on which
+ modification was attempted. To set this object when raising
+ FrozenError in Ruby code, FrozenError.new accepts a +:receiver+
+ option. [Feature #15751]
+
+GC::
+
+ New method::
+
+ * Added GC.compact method for compacting the heap.
+ This function compacts live objects in the heap so that fewer pages may
+ be used, and the heap may be more CoW (copy-on-write) friendly. [Feature #15626]
+
+ Details on the algorithm and caveats can be found here:
+ https://bugs.ruby-lang.org/issues/15626
+
+IO::
+
+ New method::
+
+ * Added IO#set_encoding_by_bom to check the BOM and set the external
+ encoding. [Bug #15210]
+
+Integer::
+
+ Modified method::
+
+ * Integer#[] now supports range operations. [Feature #8842]
+
+ 0b01001101[2, 4] #=> 0b0011
+ 0b01001100[2..5] #=> 0b0011
+ 0b01001100[2...6] #=> 0b0011
+ # ^^^^
+
+Method::
+
+ Modified method::
+
+ * Method#inspect shows more information. [Feature #14145]
+
+Module::
+
+ New methods::
+
+ * Added Module#const_source_location to retrieve the location where a
+ constant is defined. [Feature #10771]
+
+ * Added Module#ruby2_keywords for marking a method as passing keyword
+ arguments through a regular argument splat, useful when delegating
+ all arguments to another method in a way that can be backwards
+ compatible with older Ruby versions. [Bug #16154]
+
+ Modified methods::
+
+ * Module#autoload? now takes an +inherit+ optional argument, like
+ Module#const_defined?. [Feature #15777]
+
+ * Module#name now always returns a frozen String. The returned String is
+ always the same for a given Module. This change is
+ experimental. [Feature #16150]
+
+NilClass / TrueClass / FalseClass::
+
+ Modified methods::
+
+ * NilClass#to_s, TrueClass#to_s, and FalseClass#to_s now always return a
+ frozen String. The returned String is always the same for each of these
+ values. This change is experimental. [Feature #16150]
+
+ObjectSpace::WeakMap::
+
+ Modified method::
+
+ * ObjectSpace::WeakMap#[]= now accepts special objects as either key or
+ values. [Feature #16035]
+
+Proc::
+
+ New method::
+
+ * Added Proc#ruby2_keywords for marking the proc as passing keyword
+ arguments through a regular argument splat, useful when delegating
+ all arguments to another method or proc in a way that can be backwards
+ compatible with older Ruby versions. [Feature #16404]
+
+Range::
+
+ New method::
+
+ * Added Range#minmax, with a faster implementation than Enumerable#minmax.
+ It returns a maximum that now corresponds to Range#max. [Bug #15807]
+
+ Modified method::
+
+ * Range#=== now uses Range#cover? for String arguments, too (in Ruby 2.6, it was
+ changed from Range#include? for all types except strings). [Bug #15449]
+
+
+RubyVM::
+
+ Removed method::
+
+ * +RubyVM.resolve_feature_path+ moved to
+ <code>$LOAD_PATH.resolve_feature_path</code>. [Feature #15903] [Feature #15230]
+
+String::
+
+ Unicode::
+
+ * Update Unicode version and Emoji version from 11.0.0 to
+ 12.0.0. [Feature #15321]
+
+ * Update Unicode version to 12.1.0, adding support for
+ U+32FF SQUARE ERA NAME REIWA. [Feature #15195]
+
+ * Update Unicode Emoji version to 12.1. [Feature #16272]
+
+Symbol::
+
+ New methods::
+
+ * Added Symbol#start_with? and Symbol#end_with? methods. [Feature #16348]
+
+Time::
+
+ New methods::
+
+ * Added Time#ceil method. [Feature #15772]
+
+ * Added Time#floor method. [Feature #15653]
+
+ Modified method::
+
+ * Time#inspect is separated from Time#to_s and it shows
+ the time's sub second. [Feature #15958]
+
+UnboundMethod::
+
+ New method::
+
+ * Added UnboundMethod#bind_call method. [Feature #15955]
+
+ <code>umethod.bind_call(obj, ...)</code> is semantically equivalent
+ to <code>umethod.bind(obj).call(...)</code>. This idiom is used in
+ some libraries to call a method that is overridden. The added
+ method does the same without allocation of an intermediate Method
+ object.
+
+ class Foo
+ def add_1(x)
+ x + 1
+ end
+ end
+ class Bar < Foo
+ def add_1(x) # override
+ x + 2
+ end
+ end
+
+ obj = Bar.new
+ p obj.add_1(1) #=> 3
+ p Foo.instance_method(:add_1).bind(obj).call(1) #=> 2
+ p Foo.instance_method(:add_1).bind_call(obj, 1) #=> 2
+
+Warning::
+
+ New methods::
+
+ * Added Warning.[] and Warning.[]= to manage emitting/suppressing
+ some categories of warnings. [Feature #16345] [Feature #16420]
+
+$LOAD_PATH::
+
+ New method::
+
+ * Added <code>$LOAD_PATH.resolve_feature_path</code>. [Feature #15903] [Feature #15230]
+
+=== Stdlib updates (outstanding ones only)
+
+Bundler::
+
+ * Upgrade to Bundler 2.1.2.
+ See https://github.com/bundler/bundler/releases/tag/v2.1.2
+
+CGI::
+
+ * CGI.escapeHTML becomes 2~5x faster when there is at least one escaped character.
+ See https://github.com/ruby/ruby/pull/2226
+
+CSV::
+
+ * Upgrade to 3.1.2.
+ See https://github.com/ruby/csv/blob/master/NEWS.md.
+
+Date::
+
+ * Date.jisx0301, Date#jisx0301, and Date.parse support the new Japanese
+ era. [Feature #15742]
+
+Delegator::
+
+ * Object#DelegateClass accepts a block and module_evals it in the context
+ of the returned class, similar to Class.new and Struct.new.
+
+ERB::
+
+ * Prohibit marshaling ERB instance.
+
+IRB::
+
+ * Introduce syntax highlighting inspired by the Pry gem to Binding#irb
+ source lines, REPL input, and inspect output of some core-class objects.
+
+ * Introduce multiline editing mode provided by Reline.
+
+ * Show documentation when completion.
+
+ * Enable auto indent and save/load history by default.
+
+JSON::
+
+ * Upgrade to 2.3.0.
+
+Net::FTP::
+
+ * Add Net::FTP#features to check available features, and Net::FTP#option to
+ enable/disable each of them. [Feature #15964]
+
+Net::HTTP::
+
+ * Add +ipaddr+ optional parameter to Net::HTTP#start to replace the address for
+ the TCP/IP connection. [Feature #5180]
+
+Net::IMAP::
+
+ * Add Server Name Indication (SNI) support. [Feature #15594]
+
+open-uri::
+
+ * Warn open-uri's "open" method at Kernel.
+ Use URI.open instead. [Misc #15893]
+
+ * The default charset of "text/*" media type is UTF-8 instead of
+ ISO-8859-1. [Bug #15933]
+
+OptionParser::
+
+ * Now show "Did you mean?" for unknown options. [Feature #16256]
+
+ test.rb:
+
+ require "optparse"
+ OptionParser.new do |opts|
+ opts.on("-f", "--foo", "foo") {|v| }
+ opts.on("-b", "--bar", "bar") {|v| }
+ opts.on("-c", "--baz", "baz") {|v| }
+ end.parse!
+
+ example:
+
+ $ ruby test.rb --baa
+ Traceback (most recent call last):
+ test.rb:7:in `<main>': invalid option: --baa (OptionParser::InvalidOption)
+ Did you mean? baz
+ bar
+
+Pathname::
+
+ * Pathname.glob now delegates 3 arguments to Dir.glob
+ to accept +base+ keyword. [Feature #14405]
+
+Racc::
+
+ * Merge 1.4.15 from upstream repository and added cli of racc.
+
+Reline::
+
+ * New stdlib that is compatible with the readline stdlib but is
+ implemented in pure Ruby. It also provides a multiline editing mode.
+
+REXML::
+
+ * Upgrade to 3.2.3.
+ See https://github.com/ruby/rexml/blob/master/NEWS.md.
+
+RSS::
+
+ * Upgrade to RSS 0.2.8.
+ See https://github.com/ruby/rss/blob/master/NEWS.md.
+
+RubyGems::
+
+ * Upgrade to RubyGems 3.1.2.
+ * https://github.com/rubygems/rubygems/releases/tag/v3.1.0
+ * https://github.com/rubygems/rubygems/releases/tag/v3.1.1
+ * https://github.com/rubygems/rubygems/releases/tag/v3.1.2
+
+StringScanner::
+
+ * Upgrade to 1.0.3.
+ See https://github.com/ruby/strscan/blob/master/NEWS.md.
+
+=== Compatibility issues (excluding feature bug fixes)
+
+* The following libraries are no longer bundled gems.
+ Install corresponding gems to use these features.
+ * CMath (cmath gem)
+ * Scanf (scanf gem)
+ * Shell (shell gem)
+ * Synchronizer (sync gem)
+ * ThreadsWait (thwait gem)
+ * E2MM (e2mmap gem)
+
+Proc::
+ * The Proc#to_s format was changed. [Feature #16101]
+
+Range::
+ * Range#minmax used to iterate on the range to determine the maximum.
+ It now uses the same algorithm as Range#max. In rare cases (e.g.
+ ranges of Floats or Strings), this may yield different results. [Bug #15807]
+
+=== Stdlib compatibility issues (excluding feature bug fixes)
+
+* Promote stdlib to default gems
+ * The following default gems were published on rubygems.org
+ * benchmark
+ * cgi
+ * delegate
+ * getoptlong
+ * net-pop
+ * net-smtp
+ * open3
+ * pstore
+ * readline
+ * readline-ext
+ * singleton
+ * The following default gems were only promoted at ruby-core,
+ but not yet published on rubygems.org.
+ * monitor
+ * observer
+ * timeout
+ * tracer
+ * uri
+ * yaml
+* The <tt>did_you_mean</tt> gem has been promoted up to a default gem from a bundled gem
+
+pathname::
+
+ * Kernel#Pathname when called with a Pathname argument now returns
+ the argument instead of creating a new Pathname. This is more
+ similar to other Kernel methods, but can break code that modifies
+ the return value and expects the argument not to be modified.
+
+profile.rb, Profiler__::
+
+ * Removed from standard library. It was unmaintained since Ruby 2.0.0.
+
+=== C API updates
+
+* Many <code>*_kw</code> functions have been added for setting whether
+ the final argument being passed should be treated as keywords. You
+ may need to switch to these functions to avoid keyword argument
+ separation warnings, and to ensure correct behavior in Ruby 3.
+
+* The <code>:</code> character in rb_scan_args format string is now
+ treated as keyword arguments. Passing a positional hash instead of
+ keyword arguments will emit a deprecation warning.
+
+* C API declarations with +ANYARGS+ are changed not to use +ANYARGS+.
+ See https://github.com/ruby/ruby/pull/2404
+
+=== Implementation improvements
+
+Fiber::
+
+ * Allow selecting different coroutine implementations by using
+ +--with-coroutine=+, e.g.
+
+ $ ./configure --with-coroutine=ucontext
+ $ ./configure --with-coroutine=copy
+
+ * Replace previous stack cache with fiber pool cache. The fiber pool
+ allocates many stacks in a single memory region. Stack allocation
+ becomes O(log N) and fiber creation is amortized O(1). Around 10x
+ performance improvement was measured in micro-benchmarks.
+ https://github.com/ruby/ruby/pull/2224
+
+File::
+ * File.realpath now uses realpath(3) on many platforms, which can
+ significantly improve performance. [Feature #15797]
+
+Hash::
+ * Change data structure of small Hash objects. [Feature #15602]
+
+Monitor::
+ * Monitor class is written in C-extension. [Feature #16255]
+
+Thread::
+
+ * VM stack memory allocation is now combined with native thread stack,
+ improving thread allocation performance and reducing allocation related
+ failures. Around 10x performance improvement was measured in micro-benchmarks.
+
+JIT::
+
+ * JIT-ed code is recompiled to less-optimized code when an optimization assumption is invalidated.
+
+ * Method inlining is performed when a method is considered as pure.
+ This optimization is still experimental and many methods are NOT considered as pure yet.
+
+ * The default value of +--jit-max-cache+ is changed from 1,000 to 100.
+
+ * The default value of +--jit-min-calls+ is changed from 5 to 10,000.
+
+RubyVM::
+
+ * Per-call-site method cache, which has been there since around 1.9, was
+ improved: cache hit rate raised from 89% to 94%.
+ See https://github.com/ruby/ruby/pull/2583
+
+RubyVM::InstructionSequence::
+
+ * RubyVM::InstructionSequence#to_binary method generates compiled binary.
+ The binary size is reduced. [Feature #16163]
+
+=== Miscellaneous changes
+
+* Support for IA64 architecture has been removed. Hardware for testing was
+ difficult to find, native fiber code is difficult to implement, and it added
+ non-trivial complexity to the interpreter. [Feature #15894]
+
+* Require compilers to support C99. [Misc #15347]
+
+ * Details of our dialect: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/C99
+
+* Ruby's upstream repository is changed from Subversion to Git.
+
+ * https://git.ruby-lang.org/ruby.git
+
+ * RUBY_REVISION class is changed from Integer to String.
+
+ * RUBY_DESCRIPTION includes Git revision instead of Subversion's one.
+
+* Support built-in methods in Ruby with the <code>_\_builtin_</code> syntax. [Feature #16254]
+
+ Some methods are defined in *.rb (such as trace_point.rb).
+ For example, it is easy to define a method which accepts keyword arguments.
diff --git a/README b/README
deleted file mode 100644
index cf836415ad..0000000000
--- a/README
+++ /dev/null
@@ -1,114 +0,0 @@
-* What's Ruby
-
-Ruby is the interpreted scripting language for quick and
-easy object-oriented programming. It has many features to
-process text files and to do system management tasks (as in
-Perl). It is simple, straight-forward, and extensible.
-
-
-* Features of Ruby
-
- + Simple Syntax
- + *Normal* Object-Oriented features(ex. class, method calls)
- + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
- + Operator Overloading
- + Exception Handling
- + Iterators and Closures
- + Garbage Collection
- + Dynamic Loading of Object files(on some architecture)
- + Highly Portable(works on many UNIX machines, and on DOS,
- Windows, Mac, BeOS etc.)
-
-
-* How to get Ruby
-
-The Ruby distribution files can be found in the following FTP site:
-
- ftp://ftp.ruby-lang.org/pub/ruby/
-
-The latest source code of this version series can be checked out
-through SVN with the following command:
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
-The trunk of the Ruby source tree can be checked out with the
-following command:
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-There are some other branches under development. Try the following
-command and see the list of branches:
-
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-
-* Ruby home-page
-
-The URL of the Ruby home-page is:
-
- http://www.ruby-lang.org/
-
-
-* Mailing list
-
-There is a mailing list to talk about Ruby.
-To subscribe this list, please send the following phrase
-
- subscribe YourFirstName YourFamilyName
-e.g.
- subscribe Joseph Smith
-
-in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
-
-
-* How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
- 1. If ./configure does not exist or is older than configure.in,
- run autoconf to (re)generate configure.
-
- 2. Run ./configure, which will generate config.h and Makefile.
-
- 3. Edit defines.h if you need. Usually this step will not be needed.
-
- 4. Remove comment mark(#) before the module names from ext/Setup (or
- add module names if not present), if you want to link modules
- statically.
-
- If you don't want to compile non static extension modules
- (probably on architectures which does not allow dynamic loading),
- remove comment mark from the line "#option nodynamic" in
- ext/Setup.
-
- 5. Run make.
-
- 6. Optionally, run 'make test' to check whether the compiled Ruby
- interpreter works well. If you see the message "test succeeded",
- your ruby works as it should (hopefully).
-
- 7. Run 'make install'
-
- You may have to be a super user to install ruby.
-
-If you fail to compile ruby, please send the detailed error report with
-the error log and machine/OS type, to help others.
-
-
-* Copying
-
-See the file COPYING.
-
-
-* The Author
-
-Feel free to send comments and bug reports to the author. Here is the
-author's latest mail address:
-
- matz@netlab.jp
-
--------------------------------------------------------
-created at: Thu Aug 3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.EXT b/README.EXT
index e5d39911ca..48b8d964c4 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1,1133 +1 @@
-.\" README.EXT - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
-
-This document explains how to make extension libraries for Ruby.
-
-1. Basic knowledge
-
-In C, variables have types and data do not have types. In contrast,
-Ruby variables do not have a static type, and data themselves have
-types, so data will need to be converted between the languages.
-
-Data in Ruby are represented by C type `VALUE'. Each VALUE data has
-its data-type.
-
-To retrieve C data from a VALUE, you need to:
-
- (1) Identify the VALUE's data type
- (2) Convert the VALUE into C data
-
-Converting to the wrong data type may cause serious problems.
-
-
-1.1 Data-types
-
-The Ruby interpreter has the following data types:
-
- T_NIL nil
- T_OBJECT ordinary object
- T_CLASS class
- T_MODULE module
- T_FLOAT floating point number
- T_STRING string
- T_REGEXP regular expression
- T_ARRAY array
- T_FIXNUM Fixnum(31bit integer)
- T_HASH associative array
- T_STRUCT (Ruby) structure
- T_BIGNUM multi precision integer
- T_FILE IO
- T_TRUE true
- T_FALSE false
- T_DATA data
- T_SYMBOL symbol
-
-In addition, there are several other types used internally:
-
- T_ICLASS
- T_MATCH
- T_UNDEF
- T_VARMAP
- T_SCOPE
- T_NODE
-
-Most of the types are represented by C structures.
-
-1.2 Check Data Type of the VALUE
-
-The macro TYPE() defined in ruby.h shows the data type of the VALUE.
-TYPE() returns the constant number T_XXXX described above. To handle
-data types, your code will look something like this:
-
- switch (TYPE(obj)) {
- case T_FIXNUM:
- /* process Fixnum */
- break;
- case T_STRING:
- /* process String */
- break;
- case T_ARRAY:
- /* process Array */
- break;
- default:
- /* raise exception */
- rb_raise(rb_eTypeError, "not valid value");
- break;
- }
-
-There is the data-type check function
-
- void Check_Type(VALUE value, int type)
-
-which raises an exception if the VALUE does not have the type specified.
-
-There are also faster check macros for fixnums and nil.
-
- FIXNUM_P(obj)
- NIL_P(obj)
-
-1.3 Convert VALUE into C data
-
-The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
-respectively. They are singletons for the data type.
-
-The T_FIXNUM data is a 31bit length fixed integer (63bit length on
-some machines), which can be convert to a C integer by using the
-FIX2INT() macro. There is also NUM2INT() which converts any Ruby
-numbers into C integers. The NUM2INT() macro includes a type check, so
-an exception will be raised if the conversion failed. NUM2DBL() can
-be used to retrieve the double float value in same way.
-
-To get char* from a VALUE, version 1.7 recommend to use new macros
-StringValue() and StringValuePtr(). StringValue(var) replaces var's
-value to the result of "var.to_str()". StringValuePtr(var) does same
-replacement and returns char* representation of var. These macros
-will skip the replacement if var is a String. Notice that the macros
-requires to take only lvalue as their argument, to change the value
-of var in the replacement.
-
-In version 1.6 or earlier, STR2CSTR() was used to do same thing
-but now it is obsoleted in version 1.7 because of STR2CSTR() has
-a risk of dangling pointer problem in to_str() impliclit conversion.
-
-Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has corresponding structure
-can be cast to retrieve the pointer to the struct. The casting macro
-will be of the form RXXXX for each data type; for instance, RARRAY(obj).
-See "ruby.h".
-
-For example, `RSTRING(str)->len' is the way to get the size of the
-Ruby String object. The allocated region can be accessed by
-`RSTRING(str)->ptr'. For arrays, use `RARRAY(ary)->len' and
-`RARRAY(ary)->ptr' respectively.
-
-Notice: Do not change the value of the structure directly, unless you
-are responsible for the result. This ends up being the cause of interesting
-bugs.
-
-1.4 Convert C data into VALUE
-
-To convert C data to Ruby values:
-
- * FIXNUM
-
- left shift 1 bit, and turn on LSB.
-
- * Other pointer values
-
- cast to VALUE.
-
-You can determine whether a VALUE is pointer or not by checking its LSB.
-
-Notice Ruby does not allow arbitrary pointer values to be a VALUE. They
-should be pointers to the structures which Ruby knows about. The known
-structures are defined in <ruby.h>.
-
-To convert C numbers to Ruby values, use these macros.
-
- INT2FIX() for integers within 31bits.
- INT2NUM() for arbitrary sized integer.
-
-INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
-range, but is a bit slower.
-
-1.5 Manipulating Ruby data
-
-As I already mentioned, it is not recommended to modify an object's internal
-structure. To manipulate objects, use the functions supplied by the Ruby
-interpreter. Some (not all) of the useful functions are listed below:
-
- String functions
-
- rb_str_new(const char *ptr, long len)
-
- Creates a new Ruby string.
-
- rb_str_new2(const char *ptr)
-
- Creates a new Ruby string from a C string. This is equivalent to
- rb_str_new(ptr, strlen(ptr)).
-
- rb_tainted_str_new(const char *ptr, long len)
-
- Creates a new tainted Ruby string. Strings from external data
- sources should be tainted.
-
- rb_tainted_str_new2(const char *ptr)
-
- Creates a new tainted Ruby string from a C string.
-
- rb_str_cat(VALUE str, const char *ptr, long len)
-
- Appends len bytes of data from ptr to the Ruby string.
-
- Array functions
-
- rb_ary_new()
-
- Creates an array with no elements.
-
- rb_ary_new2(long len)
-
- Creates an array with no elements, allocating internal buffer
- for len elements.
-
- rb_ary_new3(long n, ...)
-
- Creates an n-element array from the arguments.
-
- rb_ary_new4(long n, VALUE *elts)
-
- Creates an n-element array from a C array.
-
- rb_ary_push(VALUE ary, VALUE val)
- rb_ary_pop(VALUE ary)
- rb_ary_shift(VALUE ary)
- rb_ary_unshift(VALUE ary, VALUE val)
-
- Array operations. The first argument to each functions must be an
- array. They may dump core if other types given.
-
-2. Extending Ruby with C
-
-2.1 Addding new features to Ruby
-
-You can add new features (classes, methods, etc.) to the Ruby
-interpreter. Ruby provides APIs for defining the following things:
-
- * Classes, Modules
- * Methods, Singleton Methods
- * Constants
-
-2.1.1 Class/module definition
-
-To define a class or module, use the functions below:
-
- VALUE rb_define_class(const char *name, VALUE super)
- VALUE rb_define_module(const char *name)
-
-These functions return the newly created class or module. You may
-want to save this reference into a variable to use later.
-
-To define nested classes or modules, use the functions below:
-
- VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
- VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 Method/singleton method definition
-
-To define methods or singleton methods, use these functions:
-
- void rb_define_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
- void rb_define_singleton_method(VALUE object, const char *name,
- VALUE (*func)(), int argc)
-
-The `argc' represents the number of the arguments to the C function,
-which must be less than 17. But I believe you don't need that much. :-)
-
-If `argc' is negative, it specifies the calling sequence, not number of
-the arguments.
-
-If argc is -1, the function will be called as:
-
- VALUE func(int argc, VALUE *argv, VALUE obj)
-
-where argc is the actual number of arguments, argv is the C array of
-the arguments, and obj is the receiver.
-
-If argc is -2, the arguments are passed in a Ruby array. The function
-will be called like:
-
- VALUE func(VALUE obj, VALUE args)
-
-where obj is the receiver, and args is the Ruby array containing
-actual arguments.
-
-There are two more functions to define methods. One is to define
-private methods:
-
- void rb_define_private_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
-The other is to define module functions, which are private AND singleton
-methods of the module. For example, sqrt is the module function
-defined in Math module. It can be call in the form like:
-
- Math.sqrt(4)
-
-or
-
- include Math
- sqrt(4)
-
-To define module functions, use:
-
- void rb_define_module_function(VALUE module, const char *name,
- VALUE (*func)(), int argc)
-
-Oh, in addition, function-like methods, which are private methods defined
-in the Kernel module, can be defined using:
-
- void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-To define alias to the method,
-
- void rb_define_alias(VALUE module, const char* new, const char* old);
-
-To define and undefine the `allocate' class method,
-
- void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
- void rb_undef_alloc_func(VALUE klass);
-
-func have to take the klass as the argument and return a newly
-allocated instance. This instance should be empty as possible,
-without any expensive (including external) resources.
-
-2.1.3 Constant definition
-
-We have 2 functions to define constants:
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
- void rb_define_global_const(const char *name, VALUE val)
-
-The former is to define a constant under specified class/module. The
-latter is to define a global constant.
-
-2.2 Use Ruby features from C
-
-There are several ways to invoke Ruby's features from C code.
-
-2.2.1 Evaluate Ruby Programs in a String
-
-The easiest way to use Ruby's functionality from a C program is to
-evaluate the string as Ruby program. This function will do the job.
-
- VALUE rb_eval_string(const char *str)
-
-Evaluation is done under the current context, thus current local variables
-of the innermost method (which is defined by Ruby) can be accessed.
-
-2.2.2 ID or Symbol
-
-You can invoke methods directly, without parsing the string. First I need
-to explain about ID. ID is the integer number to represent Ruby's
-identifiers such as variable names. The Ruby data type corresponding to ID
-is Symbol. It can be accessed from Ruby in the form:
-
- :Identifier
-
-You can get the ID value from a string within C code by using
-
- rb_intern(const char *name)
-
-You can retrieve ID from Ruby object (Symbol or String) given as an
-argument by using
-
- rb_to_id(VALUE symbol)
-
-You can convert C ID to Ruby Symbol by using
-
- VALUE ID2SYM(ID id)
-
-and to convert Ruby Symbol object to ID, use
-
- ID SYM2ID(VALUE symbol)
-
-2.2.3 Invoke Ruby method from C
-
-To invoke methods directly, you can use the function below
-
- VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-This function invokes a method on the recv, with the method name
-specified by the symbol mid.
-
-2.2.4 Accessing the variables and constants
-
-You can access class variables and instance variables using access
-functions. Also, global variables can be shared between both environments.
-There's no way to access Ruby's local variables.
-
-The functions to access/modify instance variables are below:
-
- VALUE rb_ivar_get(VALUE obj, ID id)
- VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id must be the symbol, which can be retrieved by rb_intern().
-
-To access the constants of the class/module:
-
- VALUE rb_const_get(VALUE obj, ID id)
-
-See 2.1.3 for defining new constant.
-
-3. Information sharing between Ruby and C
-
-3.1 Ruby constants that C can be accessed from C
-
-The following Ruby constants can be referred from C.
-
- Qtrue
- Qfalse
-
-Boolean values. Qfalse is false in C also (i.e. 0).
-
- Qnil
-
-Ruby nil in C scope.
-
-3.2 Global variables shared between C and Ruby
-
-Information can be shared between the two environments using shared global
-variables. To define them, you can use functions listed below:
-
- void rb_define_variable(const char *name, VALUE *var)
-
-This function defines the variable which is shared by both environments.
-The value of the global variable pointed to by `var' can be accessed
-through Ruby's global variable named `name'.
-
-You can define read-only (from Ruby, of course) variables using the
-function below.
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-You can defined hooked variables. The accessor functions (getter and
-setter) are called on access to the hooked variables.
-
- void rb_define_hooked_variable(constchar *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
-If you need to supply either setter or getter, just supply 0 for the
-hook you don't need. If both hooks are 0, rb_define_hooked_variable()
-works just like rb_define_variable().
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
-This function defines a Ruby global variable without a corresponding C
-variable. The value of the variable will be set/get only by hooks.
-
-The prototypes of the getter and setter functions are as follows:
-
- (*getter)(ID id, void *data, struct global_entry* entry);
- (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 Encapsulate C data into Ruby object
-
-To wrap and objectify a C pointer as a Ruby object (so called
-DATA), use Data_Wrap_Struct().
-
- Data_Wrap_Struct(klass, mark, free, ptr)
-
-Data_Wrap_Struct() returns a created DATA object. The klass argument
-is the class for the DATA object. The mark argument is the function
-to mark Ruby objects pointed by this data. The free argument is the
-function to free the pointer allocation. If this is -1, the pointer
-will be just freed. The functions mark and free will be called from
-garbage collector.
-
-You can allocate and wrap the structure in one step.
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro returns an allocated Data object, wrapping the pointer to
-the structure, which is also allocated. This macro works like:
-
- (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
-
-Arguments klass, mark, and free work like their counterparts in
-Data_Wrap_Struct(). A pointer to the allocated structure will be
-assigned to sval, which should be a pointer of the type specified.
-
-To retrieve the C pointer from the Data object, use the macro
-Data_Get_Struct().
-
- Data_Get_Struct(obj, type, sval)
-
-A pointer to the structure will be assigned to the variable sval.
-
-See the example below for details.
-
-4. Example - Creating dbm extension
-
-OK, here's the example of making an extension library. This is the
-extension to access DBMs. The full source is included in the ext/
-directory in the Ruby's source tree.
-
-(1) make the directory
-
- % mkdir ext/dbm
-
-Make a directory for the extension library under ext directory.
-
-(2) design the library
-
-You need to design the library features, before making it.
-
-(3) write C code.
-
-You need to write C code for your extension library. If your library
-has only one source file, choosing ``LIBRARY.c'' as a file name is
-preferred. On the other hand, in case your library has multiple source
-files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
-with an intermediate file ``LIBRARY.o'' on some platforms.
-
-Ruby will execute the initializing function named ``Init_LIBRARY'' in
-the library. For example, ``Init_dbm()'' will be executed when loading
-the library.
-
-Here's the example of an initializing function.
-
---
-Init_dbm()
-{
- /* define DBM class */
- cDBM = rb_define_class("DBM", rb_cObject);
- /* DBM includes Enumerate module */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBM has class method open(): arguments are received as C array */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBM instance method close(): no args */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBM instance method []: 1 argument */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
- :
-
- /* ID for a instance variable to store DBM data */
- id_dbm = rb_intern("dbm");
-}
---
-
-The dbm extension wraps the dbm struct in the C environment using
-Data_Make_Struct.
-
---
-struct dbmdata {
- int di_size;
- DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-This code wraps the dbmdata structure into a Ruby object. We avoid wrapping
-DBM* directly, because we want to cache size information.
-
-To retrieve the dbmdata structure from a Ruby object, we define the
-following macro:
-
---
-#define GetDBM(obj, dbmp) {\
- Data_Get_Struct(obj, struct dbmdata, dbmp);\
- if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-This sort of complicated macro does the retrieving and close checking for
-the DBM.
-
-There are three kinds of way to receive method arguments. First,
-methods with a fixed number of arguments receive arguments like this:
-
---
-static VALUE
-fdbm_delete(obj, keystr)
- VALUE obj, keystr;
-{
- :
-}
---
-
-The first argument of the C function is the self, the rest are the
-arguments to the method.
-
-Second, methods with an arbitrary number of arguments receive
-arguments like this:
-
---
-static VALUE
-fdbm_s_open(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
-{
- :
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
- :
-}
---
-
-The first argument is the number of method arguments, the second
-argument is the C array of the method arguments, and the third
-argument is the receiver of the method.
-
-You can use the function rb_scan_args() to check and retrieve the
-arguments. For example, "11" means that the method requires at least one
-argument, and at most receives two arguments.
-
-Methods with an arbitrary number of arguments can receive arguments
-by Ruby's array, like this:
-
---
-static VALUE
-fdbm_indexes(obj, args)
- VALUE obj, args;
-{
- :
-}
---
-
-The first argument is the receiver, the second one is the Ruby array
-which contains the arguments to the method.
-
-** Notice
-
-GC should know about global variables which refer to Ruby's objects, but
-are not exported to the Ruby world. You need to protect them by
-
- void rb_global_variable(VALUE *var)
-
-(4) prepare extconf.rb
-
-If the file named extconf.rb exists, it will be executed to generate
-Makefile.
-
-extconf.rb is the file for check compilation conditions etc. You
-need to put
-
- require 'mkmf'
-
-at the top of the file. You can use the functions below to check
-various conditions.
-
- have_library(lib, func): check whether library containing function exists.
- have_func(func, header): check whether function exists
- have_header(header): check whether header file exists
- create_makefile(target): generate Makefile
-
-The value of the variables below will affect the Makefile.
-
- $CFLAGS: included in CFLAGS make variable (such as -O)
- $CPPFLAGS: included in CPPFLAGS make variable (such as -I, -D)
- $LDFLAGS: included in LDFLAGS make variable (such as -L)
- $objs: list of object file names
-
-In normal, object files list is automatically generated by searching
-source files, but you need directs them explicitly if any sources will
-be generated while building.
-
-If a compilation condition is not fulfilled, you should not call
-``create_makefile''. The Makefile will not generated, compilation will
-not be done.
-
-(5) prepare depend (optional)
-
-If the file named depend exists, Makefile will include that file to
-check dependencies. You can make this file by invoking
-
- % gcc -MM *.c > depend
-
-It's no harm. Prepare it.
-
-(6) generate Makefile
-
-Try generating the Makefile by:
-
- ruby extconf.rb
-
-You don't need this step if you put the extension library under the ext
-directory of the ruby source tree. In that case, compilation of the
-interpreter will do this step for you.
-
-(7) make
-
-Type
-
- make
-
-to compile your extension. You don't need this step either if you have
-put extension library under the ext directory of the ruby source tree.
-
-(8) debug
-
-You may need to rb_debug the extension. Extensions can be linked
-statically by the adding directory name in the ext/Setup file so that
-you can inspect the extension with the debugger.
-
-(9) done, now you have the extension library
-
-You can do anything you want with your library. The author of Ruby
-will not claim any restrictions on your code depending on the Ruby API.
-Feel free to use, modify, distribute or sell your program.
-
-Appendix A. Ruby source files overview
-
-ruby language core
-
- class.c
- error.c
- eval.c
- gc.c
- object.c
- parse.y
- variable.c
-
-utility functions
-
- dln.c
- regex.c
- st.c
- util.c
-
-ruby interpreter implementation
-
- dmyext.c
- inits.c
- main.c
- ruby.c
- version.c
-
-class library
-
- array.c
- bignum.c
- compar.c
- dir.c
- enum.c
- file.c
- hash.c
- io.c
- marshal.c
- math.c
- numeric.c
- pack.c
- prec.c
- process.c
- random.c
- range.c
- re.c
- signal.c
- sprintf.c
- string.c
- struct.c
- time.c
-
-Appendix B. Ruby extension API reference
-
-** Types
-
- VALUE
-
-The type for the Ruby object. Actual structures are defined in ruby.h,
-such as struct RString, etc. To refer the values in structures, use
-casting macros like RSTRING(obj).
-
-** Variables and constants
-
- Qnil
-
-const: nil object
-
- Qtrue
-
-const: true object(default true value)
-
- Qfalse
-
-const: false object
-
-** C pointer wrapping
-
- Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
-Wrap a C pointer into a Ruby object. If object has references to other
-Ruby objects, they should be marked by using the mark function during
-the GC process. Otherwise, mark should be 0. When this object is no
-longer referred by anywhere, the pointer will be discarded by free
-function.
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro allocates memory using malloc(), assigns it to the variable
-sval, and returns the DATA encapsulating the pointer to memory region.
-
- Data_Get_Struct(data, type, sval)
-
-This macro retrieves the pointer value from DATA, and assigns it to
-the variable sval.
-
-** Checking data types
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** Data type conversion
-
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
-NUM2DBL(value)
-rb_float_new(f)
-StringValue(value)
-StringValuePtr(value)
-StringValueCStr(value)
-rb_str_new2(s)
-
-** defining class/module
-
- VALUE rb_define_class(const char *name, VALUE super)
-
-Defines a new Ruby class as a subclass of super.
-
- VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
-Creates a new Ruby class as a subclass of super, under the module's
-namespace.
-
- VALUE rb_define_module(const char *name)
-
-Defines a new Ruby module.
-
- VALUE rb_define_module_under(VALUE module, const char *name)
-
-Defines a new Ruby module under the module's namespace.
-
- void rb_include_module(VALUE klass, VALUE module)
-
-Includes module into class. If class already includes it, just
-ignored.
-
- void rb_extend_object(VALUE object, VALUE module)
-
-Extend the object with the module's attributes.
-
-** Defining Global Variables
-
- void rb_define_variable(const char *name, VALUE *var)
-
-Defines a global variable which is shared between C and Ruby. If name
-contains a character which is not allowed to be part of the symbol,
-it can't be seen from Ruby programs.
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-Defines a read-only global variable. Works just like
-rb_define_variable(), except defined variable is read-only.
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), VALUE (*setter)())
-
-Defines a virtual variable, whose behavior is defined by a pair of C
-functions. The getter function is called when the variable is
-referred. The setter function is called when the value is set to the
-variable. The prototype for getter/setter functions are:
-
- VALUE getter(ID id)
- void setter(VALUE val, ID id)
-
-The getter function must return the value for the access.
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), VALUE (*setter)())
-
-Defines hooked variable. It's a virtual variable with a C variable.
-The getter is called as
-
- VALUE getter(ID id, VALUE *var)
-
-returning a new value. The setter is called as
-
- void setter(VALUE val, ID id, VALUE *var)
-
-GC requires C global variables which hold Ruby values to be marked.
-
- void rb_global_variable(VALUE *var)
-
-Tells GC to protect these variables.
-
-** Constant Definition
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
-
-Defines a new constant under the class/module.
-
- void rb_define_global_const(const char *name, VALUE val)
-
-Defines a global constant. This is just the same as
-
- rb_define_const(cKernal, name, val)
-
-** Method Definition
-
- rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a method for the class. func is the function pointer. argc
-is the number of arguments. if argc is -1, the function will receive
-3 arguments: argc, argv, and self. if argc is -2, the function will
-receive 2 arguments, self and args, where args is a Ruby array of
-the method arguments.
-
- rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a private method for the class. Arguments are same as
-rb_define_method().
-
- rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a singleton method. Arguments are same as rb_define_method().
-
- rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
-Retrieve argument from argc, argv. The fmt is the format string for
-the arguments, such as "12" for 1 non-optional argument, 2 optional
-arguments. If `*' appears at the end of fmt, it means the rest of
-the arguments are assigned to the corresponding variable, packed in
-an array.
-
-** Invoking Ruby method
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-Invokes a method. To retrieve mid from a method name, use rb_intern().
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-Invokes a method, passing arguments by an array of values.
-
- VALUE rb_eval_string(const char *str)
-
-Compiles and executes the string as a Ruby program.
-
- ID rb_intern(const char *name)
-
-Returns ID corresponding to the name.
-
- char *rb_id2name(ID id)
-
-Returns the name corresponding ID.
-
- char *rb_class2name(VALUE klass)
-
-Returns the name of the class.
-
- int rb_respond_to(VALUE object, ID id)
-
-Returns true if the object responds to the message specified by id.
-
-** Instance Variables
-
- VALUE rb_iv_get(VALUE obj, const char *name)
-
-Retrieve the value of the instance variable. If the name is not
-prefixed by `@', that variable shall be inaccessible from Ruby.
-
- VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
-Sets the value of the instance variable.
-
-** Control Structure
-
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-Calls the function func1, supplying func2 as the block. func1 will be
-called with the argument arg1. func2 receives the value from yield as
-the first argument, arg2 as the second argument.
-
- VALUE rb_yield(VALUE val)
-
-Evaluates the block with value val.
-
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-Calls the function func1, with arg1 as the argument. If an exception
-occurs during func1, it calls func2 with arg2 as the argument. The
-return value of rb_rescue() is the return value from func1 if no
-exception occurs, from func2 otherwise.
-
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
-
-Calls the function func1 with arg1 as the argument, then calls func2
-with arg2 if execution terminated. The return value from
-rb_ensure() is that of func1.
-
-** Exceptions and Errors
-
- void rb_warn(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format.
-
- void rb_warning(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format, if
-$VERBOSE is true.
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
-Raises RuntimeError. The fmt is a format string just like printf().
-
- void rb_raise(VALUE exception, const char *fmt, ...)
-
-Raises a class exception. The fmt is a format string just like printf().
-
- void rb_fatal(const char *fmt, ...)
-
-Raises a fatal error, terminates the interpreter. No exception handling
-will be done for fatal errors, but ensure blocks will be executed.
-
- void rb_bug(const char *fmt, ...)
-
-Terminates the interpreter immediately. This function should be
-called under the situation caused by the bug in the interpreter. No
-exception handling nor ensure execution will be done.
-
-** Initialize and Starts the Interpreter
-
-The embedding API functions are below (not needed for extension libraries):
-
- void ruby_init()
-
-Initializes the interpreter.
-
- void ruby_options(int argc, char **argv)
-
-Process command line arguments for the interpreter.
-
- void ruby_run()
-
-Starts execution of the interpreter.
-
- void ruby_script(char *name)
-
-Specifies the name of the script ($0).
-
-Appendix C. Functions Available in extconf.rb
-
-These functions are available in extconf.rb:
-
- have_macro(macro, headers)
-
-Checks whether macro is defined with header. Returns true if the macro
-is defined.
-
- have_library(lib, func)
-
-Checks whether the library exists, containing the specified function.
-Returns true if the library exists.
-
- find_library(lib, func, path...)
-
-Checks whether a library which contains the specified function exists in
-path. Returns true if the library exists.
-
- have_func(func, header)
-
-Checks whether func exists with header. Returns true if the function
-exists. To check functions in an additional library, you need to
-check that library first using have_library().
-
- have_var(var, header)
-
-Checks whether var exists with header. Returns true if the variable
-exists. To check variables in an additional library, you need to
-check that library first using have_library().
-
- have_header(header)
-
-Checks whether header exists. Returns true if the header file exists.
-
- find_header(header, path...)
-
-Checks whether header exists in path. Returns true if the header file
-exists.
-
- have_struct_member(type, member, header)
-
-Checks whether type has member with header. Returns true if the type
-is defined and has the member.
-
- have_type(type, header, opt)
-
-Checks whether type is defined with header. Returns true if the type
-is defined.
-
- check_sizeof(type, header)
-
-Checks the size of type in char with header. Returns the size if the
-type is defined, otherwise nil.
-
- create_makefile(target)
-
-Generates the Makefile for the extension library. If you don't invoke
-this method, the compilation will not be done.
-
- find_executable(bin, path)
-
-Finds command in path, which is File::PATH_SEPARATOR-separated list of
-directories. If path is nil or omitted, environment varialbe PATH
-will be used. Returns the path name of the command if it is found,
-otherwise nil.
-
- with_config(withval[, default=nil])
-
-Parses the command line options and returns the value specified by
---with-<withval>.
-
- enable_config(config, *defaults)
- disable_config(config, *defaults)
-
-Parses the command line options for boolean. Returns true if
---enable-<config> is given, or false if --disable-<config> is given.
-Otherwise, yields defaults to the given block and returns the result
-if it is called with a block, or returns defaults.
-
- dir_config(target[, default_dir])
- dir_config(target[, default_include, default_lib])
-
-Parses the command line options and adds the directories specified by
---with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
-to $CFLAGS and/or $LDFLAGS. --with-<target>-dir=/path is equivalent to
---with-<target>-include=/path/include --with-<target>-lib=/path/lib.
-Returns an array of the added directories ([include_dir, lib_dir]).
-
- pkg_config(pkg)
-
-Obtains the information of pkg by pkg-config command. The actual
-command name can be overriden by --with-pkg-config command line
-option.
-
-/*
- * Local variables:
- * fill-column: 70
- * end:
- */
+Moved to doc/extension.rdoc
diff --git a/README.EXT.ja b/README.EXT.ja
index 30c4d520ba..f884ecbb0e 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -1,1258 +1 @@
-.\" README.EXT.ja - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
-
-Ruby¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Îºî¤êÊý¤òÀâÌÀ¤·¤Þ¤¹¡¥
-
-1¡¥´ðÁÃÃμ±
-
-C¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤¢¤ê¡¤¥Ç¡¼¥¿¤Ë¤Ï·¿¤¬¤¢¤ê¤Þ¤»¤ó¡¥¤Ç¤¹¤«¤é¡¤¤¿
-¤È¤¨¤Ð¥Ý¥¤¥ó¥¿¤òint¤ÎÊÑ¿ô¤ËÂåÆþ¤¹¤ë¤È¡¤¤½¤ÎÃͤÏÀ°¿ô¤È¤·¤Æ¼è
-¤ê°·¤ï¤ì¤Þ¤¹¡¥µÕ¤ËRuby¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤Ê¤¯¡¤¥Ç¡¼¥¿¤Ë·¿¤¬¤¢¤ê¤Þ
-¤¹¡¥¤³¤Î°ã¤¤¤Î¤¿¤á¡¤C¤ÈRuby¤ÏÁê¸ß¤ËÊÑ´¹¤·¤Ê¤±¤ì¤Ð¡¤¤ª¸ß¤¤¤Î
-¥Ç¡¼¥¿¤ò¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤»¤ó¡¥
-
-Ruby¤Î¥Ç¡¼¥¿¤ÏVALUE¤È¤¤¤¦C¤Î·¿¤Çɽ¸½¤µ¤ì¤Þ¤¹¡¥VALUE·¿¤Î¥Ç¡¼
-¥¿¤Ï¤½¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¼«Ê¬¤ÇÃΤäƤ¤¤Þ¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤È
-¤¤¤¦¤Î¤Ï¥Ç¡¼¥¿(¥ª¥Ö¥¸¥§¥¯¥È)¤Î¼ÂºÝ¤Î¹½Â¤¤ò°ÕÌ£¤·¤Æ¤¤¤Æ¡¤Ruby
-¤Î¥¯¥é¥¹¤È¤Ï¤Þ¤¿°ã¤Ã¤¿¤â¤Î¤Ç¤¹¡¥
-
-VALUE¤«¤éC¤Ë¤È¤Ã¤Æ°ÕÌ£¤Î¤¢¤ë¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á¤Ë¤Ï
-
- (1) VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤òÃΤë
- (2) VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¤ÎξÊý¤¬É¬ÍפǤ¹¡¥(1)¤ò˺¤ì¤ë¤È´Ö°ã¤Ã¤¿¥Ç¡¼¥¿¤ÎÊÑ´¹¤¬¹Ô¤ï¤ì
-¤Æ¡¤ºÇ°­¥×¥í¥°¥é¥à¤¬core dump¤·¤Þ¤¹¡¥
-
-1.1 ¥Ç¡¼¥¿¥¿¥¤¥×
-
-Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
- T_NIL nil
- T_OBJECT Ä̾ï¤Î¥ª¥Ö¥¸¥§¥¯¥È
- T_CLASS ¥¯¥é¥¹
- T_MODULE ¥â¥¸¥å¡¼¥ë
- T_FLOAT ÉâÆ°¾®¿ôÅÀ¿ô
- T_STRING ʸ»úÎó
- T_REGEXP Àµµ¬É½¸½
- T_ARRAY ÇÛÎó
- T_FIXNUM Fixnum(31bitĹÀ°¿ô)
- T_HASH Ï¢ÁÛÇÛÎó
- T_STRUCT (Ruby¤Î)¹½Â¤ÂÎ
- T_BIGNUM ¿ÇÜĹÀ°¿ô
- T_FILE Æþ½ÐÎÏ
- T_TRUE ¿¿
- T_FALSE µ¶
- T_DATA ¥Ç¡¼¥¿
- T_SYMBOL ¥·¥ó¥Ü¥ë
-
-¤½¤Î¾¤ËÆâÉô¤ÇÍøÍѤµ¤ì¤Æ¤¤¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
-
- T_ICLASS
- T_MATCH
- T_UNDEF
- T_VARMAP
- T_SCOPE
- T_NODE
-
-¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
-1.2 VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤¹¤ë
-
-ruby.h¤Ç¤ÏTYPE()¤È¤¤¤¦¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤VALUE¤Î¥Ç¡¼¥¿
-¥¿¥¤¥×¤òÃΤ뤳¤È¤¬½ÐÍè¤Þ¤¹¡¥TYPE()¥Þ¥¯¥í¤Ï¾å¤Ç¾Ò²ð¤·¤¿T_XXXX
-¤Î·Á¼°¤ÎÄê¿ô¤òÊÖ¤·¤Þ¤¹¡¥VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Ë±þ¤¸¤Æ½èÍý¤¹¤ë
-¾ì¹ç¤Ë¤Ï¡¤TYPE()¤ÎÃͤÇʬ´ô¤¹¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
- switch (TYPE(obj)) {
- case T_FIXNUM:
- /* FIXNUM¤Î½èÍý */
- break;
- case T_STRING:
- /* ʸ»úÎó¤Î½èÍý */
- break;
- case T_ARRAY:
- /* ÇÛÎó¤Î½èÍý */
- break;
- default:
- /* Îã³°¤òȯÀ¸¤µ¤»¤ë */
- rb_raise(rb_eTypeError, "not valid value");
- break;
- }
-
-¤½¤ì¤È¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤·¤Æ¡¤Àµ¤·¤¯¤Ê¤±¤ì¤ÐÎã³°¤òȯÀ¸¤¹
-¤ë´Ø¿ô¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- void Check_Type(VALUE value, int type)
-
-¤³¤Î´Ø¿ô¤Ïvalue¤¬type¤Ç̵¤±¤ì¤Ð¡¤Îã³°¤òȯÀ¸¤µ¤»¤Þ¤¹¡¥°ú¿ô¤È
-¤·¤ÆÍ¿¤¨¤é¤ì¤¿VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤¬Àµ¤·¤¤¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹
-¤ë¤¿¤á¤Ë¤Ï¡¤¤³¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
-FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- FIXNUM_P(obj)
- NIL_P(obj)
-
-1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
-¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
-¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
-
-¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
-¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
-¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
-¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
-¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
-ȯÀ¸¤¹¤ë)¡¥Æ±Íͤ˥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò
-¼è¤ê½Ð¤¹¡ÖNUM2DBL()¡×¤¬¤¢¤ê¤Þ¤¹¡£
-
-char* ¤ò¼è¤ê½Ð¤¹¾ì¹ç¡¢version 1.6 °ÊÁ°¤Ç¤Ï¡ÖSTR2CSTR()¡×¤È
-¤¤¤¦¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤·¤¿¤¬¡¢¤³¤ì¤Ï to_str() ¤Ë¤è¤ë°ÅÌÛ¤Î
-·¿ÊÑ´¹·ë²Ì¤¬ GC ¤µ¤ì¤ë²ÄǽÀ­¤¬¤¢¤ë¤¿¤á¡¢version 1.7 °Ê¹ß¤Ç¤Ï
-obsolete ¤È¤Ê¤ê¡¢Âå¤ï¤ê¤Ë StringValue() ¤È StringValuePtr()
-¤ò»È¤¦»ö¤ò¿ä¾©¤·¤Æ¤¤¤Þ¤¹¡£StringValue(var) ¤Ï var ¤¬ String
- ¤Ç¤¢¤ì¤Ð²¿¤â¤»¤º¡¢¤½¤¦¤Ç¤Ê¤±¤ì¤Ð var ¤ò var.to_str() ¤Î·ë²Ì¤Ë
-ÃÖ¤­´¹¤¨¤ë¥Þ¥¯¥í¡¢StringValuePtr(var) ¤ÏƱÍÍ¤Ë var ¤òÃÖ¤­´¹¤¨
-¤Æ¤«¤é var ¤Îʸ»úÎóɽ¸½¤ËÂФ¹¤ë char* ¤òÊÖ¤¹¥Þ¥¯¥í¤Ç¤¹¡£var ¤Î
-ÆâÍÆ¤òľÀÜÃÖ¤­´¹¤¨¤ë½èÍý¤¬Æþ¤ë¤Î¤Ç¡¢var ¤Ï lvalue ¤Ç¤¢¤ëɬÍפ¬
-¤¢¤ê¤Þ¤¹¡£
-
-¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
-¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
-¥Ý¥¤¥ó¥¿¤ËÊÑ´¹¤Ç¤­¤Þ¤¹¡¥
-
-¹½Â¤ÂΤϡÖstruct RXxxxx¡×¤È¤¤¤¦Ì¾Á°¤Çruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ
-¤¹¡¥Î㤨¤Ðʸ»úÎó¤Ï¡Östruct RString¡×¤Ç¤¹¡¥¼ÂºÝ¤Ë»È¤¦²ÄǽÀ­¤¬
-¤¢¤ë¤Î¤Ïʸ»úÎó¤ÈÇÛÎ󤯤餤¤À¤È»×¤¤¤Þ¤¹¡¥
-
-ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
-»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
-
-Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
-¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
-¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY(ary)->len¡×¡¤
-¡ÖRARRAY(ary)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
-¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
-¤Ê¤¤¤³¤È¤Ç¤¹¡¥Ä¾ÀÜÊѹ¹¤·¤¿¾ì¹ç¡¤¥ª¥Ö¥¸¥§¥¯¥È¤ÎÆâÍÆ¤ÎÀ°¹çÀ­¤¬
-¤È¤ì¤Ê¤¯¤Ê¤Ã¤Æ¡¤»×¤ï¤Ì¥Ð¥°¤Î¸¶°ø¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-1.4 C¤Î¥Ç¡¼¥¿¤òVALUE¤ËÊÑ´¹¤¹¤ë
-
-VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
-
- * FIXNUM¤Î¾ì¹ç
-
- 1bitº¸¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
-
- * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
-
- ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
-
-¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
-¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
-¤¤¤ë)¡¥
-
-¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
-¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
-ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
-¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
-¤Î¤â¤Î)¤À¤±¤Ç¤¹¡¥
-
-FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
-¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
-¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
-
- INT2FIX() ¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®¤¬¤¢¤ë»þ
- INT2NUM() Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
-
-INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
-¤·¤Æ¤¯¤ì¤Þ¤¹(¤¬¡¤¾¯¤·ÃÙ¤¤)¡¥
-
-1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë
-
-ÀèÄø¤â½Ò¤Ù¤¿Ä̤ꡤRuby¤Î¹½Â¤ÂΤò¥¢¥¯¥»¥¹¤¹¤ë»þ¤ËÆâÍÆ¤Î¹¹¿·¤ò
-¹Ô¤¦¤³¤È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥¤Ç¡¤Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë»þ¤Ë¤Ï
-Ruby¤¬ÍѰդ·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
-
-¤³¤³¤Ç¤Ï¤â¤Ã¤È¤â»È¤ï¤ì¤ë¤Ç¤¢¤í¤¦Ê¸»úÎó¤ÈÇÛÎó¤ÎÀ¸À®/Áàºî¤ò¹Ô
-¤¤´Ø¿ô¤ò¤¢¤²¤Þ¤¹(Á´Éô¤Ç¤Ï¤Ê¤¤¤Ç¤¹)¡¥
-
- ʸ»úÎó¤ËÂФ¹¤ë´Ø¿ô
-
- rb_str_new(const char *ptr, long len)
-
- ¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_str_new2(const char *ptr)
-
- C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
- rb_str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
-
- rb_tainted_str_new(const char *ptr, long len)
-
- ±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤줿¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥³°Éô
- ¤«¤é¤Î¥Ç¡¼¥¿¤Ë´ð¤Å¤¯Ê¸»úÎó¤Ë¤Ï±øÀ÷¥Þ¡¼¥¯¤¬Éղ䵤ì¤ë¤Ù¤­
- ¤Ç¤¢¤ë¡¥
-
- rb_tainted_str_new2(const char *ptr)
-
- C¤Îʸ»úÎ󤫤鱸À÷¥Þ¡¼¥¯¤¬Éղ䵤줿Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_str_cat(VALUE str, const char *ptr, long len)
-
- Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
-
- ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
-
- rb_ary_new()
-
- Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_new2(long len)
-
- Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥lenÍ×ÁÇʬ¤ÎÎΰè¤ò¤¢¤é¤«¤¸¤á³ä¤ê
- Åö¤Æ¤Æ¤ª¤¯¡¥
-
- rb_ary_new3(long n, ...)
-
- °ú¿ô¤Ç»ØÄꤷ¤¿nÍ×ÁǤò´Þ¤àÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_new4(long n, VALUE *elts)
-
- ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
-
- rb_ary_push(VALUE ary, VALUE val)
- rb_ary_pop(VALUE ary)
- rb_ary_shift(VALUE ary)
- rb_ary_unshift(VALUE ary, VALUE val)
-
- Array¤ÎƱ̾¤Î¥á¥½¥Ã¥É¤ÈƱ¤¸Æ¯¤­¤ò¤¹¤ë´Ø¿ô¡¥Âè1°ú¿ô¤Ïɬ¤º
- ÇÛÎó¤Ç¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
-
-2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
-
-¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
-½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
-¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
-²ð¤·¤Þ¤¹¡¥
-
-2.1 Ruby¤Ëµ¡Ç½¤òÄɲ乤ë
-
-Ruby¤ÇÄ󶡤µ¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤¨¤ÐRuby¥¤¥ó¥¿¥×¥ê¥¿¤Ë¿·¤·¤¤µ¡Ç½
-¤òÄɲ乤뤳¤È¤¬¤Ç¤­¤Þ¤¹¡¥Ruby¤Ç¤Ï°Ê²¼¤Îµ¡Ç½¤òÄɲä¹¤ë´Ø¿ô¤¬
-Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- * ¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë
- * ¥á¥½¥Ã¥É¡¤ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É
- * Äê¿ô
-
-¤Ç¤Ï½ç¤Ë¾Ò²ð¤·¤Þ¤¹¡¥
-
-2.1.1 ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_define_class(const char *name, VALUE super)
- VALUE rb_define_module(const char *name)
-
-¤³¤ì¤é¤Î´Ø¿ô¤Ï¿·¤·¤¯ÄêµÁ¤µ¤ì¤¿¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÊÖ¤·¤Þ¤¹¡¥
-¥á¥½¥Ã¥É¤äÄê¿ô¤ÎÄêµÁ¤Ë¤³¤ì¤é¤ÎÃͤ¬É¬ÍפʤΤǡ¤¤Û¤È¤ó¤É¤Î¾ì¹ç
-¤ÏÌá¤êÃͤòÊÑ¿ô¤Ë³ÊǼ¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ë¤Ç¤·¤ç¤¦¡¥
-
-¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤ò¾¤Î¥¯¥é¥¹¤ÎÆâÉô¤Ë¥Í¥¹¥È¤·¤ÆÄêµÁ¤¹¤ë»þ¤Ë
-¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
- VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 ¥á¥½¥Ã¥É/ÆÃ°Û¥á¥½¥Ã¥ÉÄêµÁ
-
-¥á¥½¥Ã¥É¤äÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- void rb_define_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
- void rb_define_singleton_method(VALUE object, const char *name,
- VALUE (*func)(), int argc)
-
-
-ǰ¤Î¤¿¤áÀâÌÀ¤¹¤ë¤È¡ÖÆÃ°Û¥á¥½¥Ã¥É¡×¤È¤Ï¡¤¤½¤ÎÆÃÄê¤Î¥ª¥Ö¥¸¥§¥¯
-¥È¤ËÂФ·¤Æ¤À¤±Í­¸ú¤Ê¥á¥½¥Ã¥É¤Ç¤¹¡¥Ruby¤Ç¤Ï¤è¤¯Smalltalk¤Ë¤ª
-¤±¤ë¥¯¥é¥¹¥á¥½¥Ã¥É¤È¤·¤Æ¡¤¥¯¥é¥¹¤ËÂФ¹¤ëÆÃ°Û¥á¥½¥Ã¥É¤¬»È¤ï¤ì
-¤Þ¤¹¡¥
-
-¤³¤ì¤é¤Î´Ø¿ô¤Î argc¤È¤¤¤¦°ú¿ô¤ÏC¤Î´Ø¿ô¤ØÅϤµ¤ì¤ë°ú¿ô¤Î¿ô(¤È
-·Á¼°)¤ò·è¤á¤Þ¤¹¡¥argc¤¬0°Ê¾å¤Î»þ¤Ï´Ø¿ô¤Ë°ú¤­ÅϤ¹°ú¿ô¤Î¿ô¤ò°Õ
-Ì£¤·¤Þ¤¹¡¥16¸Ä°Ê¾å¤Î°ú¿ô¤Ï»È¤¨¤Þ¤»¤ó(¤¬¡¤Íפê¤Þ¤»¤ó¤è¤Í¡¤¤½
-¤ó¤Ê¤Ë)¡¥¼ÂºÝ¤Î´Ø¿ô¤Ë¤ÏÀèÆ¬¤Î°ú¿ô¤È¤·¤Æself¤¬Í¿¤¨¤é¤ì¤Þ¤¹¤Î
-¤Ç¡¤»ØÄꤷ¤¿¿ô¤è¤ê1¿¤¤°ú¿ô¤ò»ý¤Ä¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
-argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
-¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
-
-¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
-¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
-
- void rb_define_private_method(VALUE klass, const char *name,
- VALUE (*func)(), int argc)
-
-private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
-¥É¤Ç¤¹¡¥
-
-¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
-¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆÃ°Û¥á¥½¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
-¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
-¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
-
- Math.sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â
-
- include Math
- sqrt(4)
-
-¤È¤¤¤¦·Á¼°¤Ç¤â»È¤¨¤Þ¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤Î
-Ä̤ê¤Ç¤¹¡¥
-
- void rb_define_module_function(VALUE module, const char *name,
- VALUE (*func)(), int argc)
-
-´Ø¿ôŪ¥á¥½¥Ã¥É(Kernel¥â¥¸¥å¡¼¥ë¤Îprivate method)¤òÄêµÁ¤¹¤ë¤¿
-¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-
-¥á¥½¥Ã¥É¤ÎÊÌ̾¤òÄêµÁ¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
-
- void rb_define_alias(VALUE module, const char* new, const char* old);
-
-¥¯¥é¥¹¥á¥½¥Ã¥Éallocate¤òÄêµÁ¤·¤¿¤êºï½ü¤·¤¿¤ê¤¹¤ë¤¿¤á¤Î´Ø¿ô¤Ï
-°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡£
-
- void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
- void rb_undef_alloc_func(VALUE klass);
-
-func¤Ï¥¯¥é¥¹¤ò°ú¿ô¤È¤·¤Æ¼õ¤±¼è¤Ã¤Æ¡¢¿·¤·¤¯³ä¤êÅö¤Æ¤é¤ì¤¿¥¤¥ó
-¥¹¥¿¥ó¥¹¤òÊÖ¤µ¤Ê¤¯¤Æ¤Ï¤Ê¤ê¤Þ¤»¤ó¡£¤³¤Î¥¤¥ó¥¹¥¿¥ó¥¹¤Ï¡¢³°Éô¥ê
-¥½¡¼¥¹¤Ê¤É¤ò´Þ¤Þ¤Ê¤¤¡¢¤Ç¤­¤ë¤À¤±¡Ö¶õ¡×¤Î¤Þ¤Þ¤Ë¤·¤Æ¤ª¤¤¤¿¤Û¤¦
-¤¬¤è¤¤¤Ç¤·¤ç¤¦¡£
-
-2.1.3 Äê¿ôÄêµÁ
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤¬É¬ÍפÊÄê¿ô¤Ï¤¢¤é¤«¤¸¤áÄêµÁ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤
-¤Ç¤·¤ç¤¦¡¥Äê¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤ÏÆó¤Ä¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
- void rb_define_global_const(const char *name, VALUE val)
-
-Á°¼Ô¤ÏÆÃÄê¤Î¥¯¥é¥¹/¥â¥¸¥å¡¼¥ë¤Ë°¤¹¤ëÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¡¤¸å
-¼Ô¤Ï¥°¥í¡¼¥Ð¥ë¤ÊÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥
-
-2.2 Ruby¤Îµ¡Ç½¤òC¤«¤é¸Æ¤Ó½Ð¤¹
-
-´û¤Ë¡Ø1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë¡Ù¤Ç°ìÉô¾Ò²ð¤·¤¿¤è¤¦¤Ê´Ø¿ô¤ò
-»È¤¨¤Ð¡¤Ruby¤Îµ¡Ç½¤ò¼Â¸½¤·¤Æ¤¤¤ë´Ø¿ô¤òľÀܸƤӽФ¹¤³¤È¤¬½ÐÍè
-¤Þ¤¹¡¥
-
-# ¤³¤Î¤è¤¦¤Ê´Ø¿ô¤Î°ìÍ÷ɽ¤Ï¤¤¤Þ¤Î¤È¤³¤í¤¢¤ê¤Þ¤»¤ó¡¥¥½¡¼¥¹¤ò¸«
-# ¤ë¤·¤«¤Ê¤¤¤Ç¤¹¤Í¡¥
-
-¤½¤ì°Ê³°¤Ë¤âRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹ÊýË¡¤Ï¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹¡¥
-
-2.2.1 Ruby¤Î¥×¥í¥°¥é¥à¤òeval¤¹¤ë
-
-C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
-Í¿¤¨¤é¤ì¤¿Ruby¤Î¥×¥í¥°¥é¥à¤òɾ²Á¤¹¤ë°Ê²¼¤Î´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
-
- VALUE rb_eval_string(const char *str)
-
-¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
-¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
-
-2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
-¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
-»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
-
-ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤Ç¤ÏID¤ËÂбþ¤¹¤ë
-¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¥·¥ó¥Ü¥ë(Symbol)¤¬¤¢¤ê¡¤
-
- :¼±ÊÌ»Ò
-
-¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
-
- rb_intern(const char *name)
-
-¤ò»È¤¤¤Þ¤¹¡¥Ruby¤«¤é°ú¿ô¤È¤·¤ÆÍ¿¤¨¤é¤ì¤¿¥·¥ó¥Ü¥ë(¤Þ¤¿¤Ïʸ»ú
-Îó)¤òID¤ËÊÑ´¹¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- rb_to_id(VALUE symbol)
-
-ID¤«¤é¥·¥ó¥Ü¥ë¤òÆÀ¤ë¤¿¤á¤Ë¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE ID2SYM(ID id)
-
-¥·¥ó¥Ü¥ë¤«¤éID¤òÆÀ¤ë¤¿¤á¤Ë¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
- ID SYM2ID(VALUE symbol)
-
-2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
-
-C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
-¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
-
- VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-¤³¤Î´Ø¿ô¤Ï¥ª¥Ö¥¸¥§¥¯¥Èrecv¤Îmid¤Ç»ØÄꤵ¤ì¤ë¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð
-¤·¤Þ¤¹¡¥¤½¤Î¾¤Ë°ú¿ô¤Î»ØÄê¤Î»ÅÊý¤¬°ã¤¦°Ê²¼¤Î´Ø¿ô¤â¤¢¤ê¤Þ¤¹¡¥
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
- VALUE rb_apply(VALUE recv, ID mid, VALUE args)
-
-apply¤Ë¤Ï°ú¿ô¤È¤·¤ÆRuby¤ÎÇÛÎó¤òÍ¿¤¨¤Þ¤¹¡¥
-
-2.2.4 ÊÑ¿ô/Äê¿ô¤ò»²¾È/¹¹¿·¤¹¤ë
-
-C¤«¤é´Ø¿ô¤ò»È¤Ã¤Æ»²¾È¡¦¹¹¿·¤Ç¤­¤ë¤Î¤Ï¡¤Äê¿ô¡¤¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ
-¿ô¤Ç¤¹¡¥Âç°èÊÑ¿ô¤Ï°ìÉô¤Î¤â¤Î¤ÏC¤ÎÂç°èÊÑ¿ô¤È¤·¤Æ¥¢¥¯¥»¥¹¤Ç¤­
-¤Þ¤¹¡¥¥í¡¼¥«¥ëÊÑ¿ô¤ò»²¾È¤¹¤ëÊýË¡¤Ï¸ø³«¤·¤Æ¤¤¤Þ¤»¤ó¡¥
-
-¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»²¾È¡¦¹¹¿·¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤ÎÄÌ
-¤ê¤Ç¤¹¡¥
-
- VALUE rb_ivar_get(VALUE obj, ID id)
- VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id¤Ïrb_intern()¤ÇÆÀ¤é¤ì¤ë¤â¤Î¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-Äê¿ô¤ò»²¾È¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
- VALUE rb_const_get(VALUE obj, ID id)
-
-Äê¿ô¤ò¿·¤·¤¯ÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡Ø2.1.3 Äê¿ôÄêµÁ¡Ù¤Ç¾Ò²ð¤µ
-¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
-3¡¥Ruby¤ÈC¤È¤Î¾ðÊó¶¦Í­
-
-C¸À¸ì¤ÈRuby¤Î´Ö¤Ç¾ðÊó¤ò¶¦Í­¤¹¤ëÊýË¡¤Ë¤Ä¤¤¤Æ²òÀ⤷¤Þ¤¹¡¥
-
-3.1 C¤«¤é»²¾È¤Ç¤­¤ëRuby¤ÎÄê¿ô
-
-°Ê²¼¤ÎRuby¤ÎÄê¿ô¤ÏC¤Î¥ì¥Ù¥ë¤«¤é»²¾È¤Ç¤­¤Þ¤¹¡¥
-
- Qtrue
- Qfalse
-
- ¿¿µ¶ÃÍ¡¥Qfalse¤ÏC¸À¸ì¤Ç¤âµ¶¤È¤ß¤Ê¤µ¤ì¤Þ¤¹(¤Ä¤Þ¤ê0)¡¥
-
- Qnil
-
- C¸À¸ì¤«¤é¸«¤¿¡Önil¡×¡¥
-
-3.2 C¤ÈRuby¤Ç¶¦Í­¤µ¤ì¤ëÂç°èÊÑ¿ô
-
-C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
-ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
-¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
-
- void rb_define_variable(const char *name, VALUE *var)
-
-¤³¤Î´Ø¿ô¤ÏRuby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëÂç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥ÊÑ¿ô̾¤¬
-`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤ÎÃͤòÊÑ
-¹¹¤¹¤ë¤È¼«Æ°Åª¤ËRuby¤ÎÂбþ¤¹¤ëÊÑ¿ô¤ÎÃͤâÊѤï¤ê¤Þ¤¹¡¥
-
-¤Þ¤¿Ruby¦¤«¤é¤Ï¹¹¿·¤Ç¤­¤Ê¤¤ÊÑ¿ô¤â¤¢¤ê¤Þ¤¹¡¥¤³¤Îread only¤Î
-ÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ÇÄêµÁ¤·¤Þ¤¹¡¥
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
-¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
-Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
-¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
-¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
-¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
-setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
-# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
-
-¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
-´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
-
- void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
-¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
-getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
-
-getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
-
- (*getter)(ID id, void *data, struct global_entry* entry);
- (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
-
-C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
-¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
-Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
-¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤òÀ¸À®¤·¤Æ¹½Â¤ÂΤòRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¥«¥×¥»¥ë
-²½¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
-
- Data_Wrap_Struct(klass, mark, free, ptr)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-klass¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
-¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
-»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
-
-# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
-
-free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
-´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥¤³¤ì¤¬-1¤Î¾ì¹ç¤Ï¡¤Ã±
-½ã¤Ë³«Êü¤µ¤ì¤Þ¤¹¡¥
-
-C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
-¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
-
-klass, mark, free¤ÏData_Wrap_Struct¤ÈƱ¤¸Æ¯¤­¤ò¤·¤Þ¤¹¡¥type
-¤Ï³ä¤êÅö¤Æ¤ëC¹½Â¤ÂΤη¿¤Ç¤¹¡¥³ä¤êÅö¤Æ¤é¤ì¤¿¹½Â¤ÂΤÏÊÑ¿ôsval
-¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤Î·¿¤Ï (type*) ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤é¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤Î¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤òÍѤ¤
-¤Þ¤¹¡¥
-
- Data_Get_Struct(obj, type, sval)
-
-C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤ÏÊÑ¿ôsval¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥
-
-¤³¤ì¤é¤ÎData¤Î»È¤¤Êý¤Ï¤Á¤ç¤Ã¤Èʬ¤«¤ê¤Ë¤¯¤¤¤Î¤Ç¡¤¸å¤ÇÀâÌÀ¤¹¤ë
-ÎãÂê¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-4¡¥ÎãÂê - dbm¥Ñ¥Ã¥±¡¼¥¸¤òºî¤ë
-
-¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
-Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥é¥¤¥Ö¥é¥ê¤òÎã¤Ë
-¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
-
-(1) ¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤ë
-
- % mkdir ext/dbm
-
-Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
-¤ë¤³¤È¤¬¤Ç¤­¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤·¤¿¡¥Ruby¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¾ì¹ç¤Ë
-¤ÏRuby¤òŸ³«¤·¤¿¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¡¤ext¥Ç¥£¥ì¥¯¥È¥ê¤ÎÃæ¤Ë³ÈÄ¥
-¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤òºî¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥Ì¾Á°¤ÏŬÅö¤Ë
-Áª¤ó¤Ç¹½¤¤¤Þ¤»¤ó¡¥
-
-(2) À߷פ¹¤ë
-
-¤Þ¤¢¡¤ÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¤¤É¤¦¤¤¤¦µ¡Ç½¤ò¼Â¸½¤¹¤ë¤«¤É¤¦¤«¤Þ¤ºÀß
-·×¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¤É¤ó¤Ê¥¯¥é¥¹¤ò¤Ä¤¯¤ë¤«¡¤¤½¤Î¥¯¥é¥¹¤Ë¤Ï
-¤É¤ó¤Ê¥á¥½¥Ã¥É¤¬¤¢¤ë¤«¡¤¥¯¥é¥¹¤¬Ä󶡤¹¤ëÄê¿ô¤Ê¤É¤Ë¤Ä¤¤¤ÆÀß·×
-¤·¤Þ¤¹¡¥
-
-(3) C¥³¡¼¥É¤ò½ñ¤¯
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥êËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
-¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
-¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥é¥¤¥Ö¥é¥ê̾.c¡×¤È¤¤¤¦¥Õ¥¡
-¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
-¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥é¥¤¥Ö¥é¥ê̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
-¤È¤¬¾×ÆÍ¤¹¤ë¤«¤é¤Ç¤¹¡¥
-
-Ruby¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥é¥¤¥Ö¥é¥ê̾¡×¤È
-¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤Î¾ì¹ç¡ÖInit_dbm¡×
-¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
-ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
-
---
-Init_dbm()
-{
- /* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
- cDBM = rb_define_class("DBM", rb_cObject);
- /* DBM¤ÏEnumerate¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë */
- rb_include_module(cDBM, rb_mEnumerable);
-
- /* DBM¥¯¥é¥¹¤Î¥¯¥é¥¹¥á¥½¥Ã¥Éopen(): °ú¿ô¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë */
- rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
- /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥Éclose(): °ú¿ô¤Ï¤Ê¤· */
- rb_define_method(cDBM, "close", fdbm_close, 0);
- /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥É[]: °ú¿ô¤Ï1¸Ä */
- rb_define_method(cDBM, "[]", fdbm_fetch, 1);
- :
-
- /* DBM¥Ç¡¼¥¿¤ò³ÊǼ¤¹¤ë¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô̾¤Î¤¿¤á¤ÎID */
- id_dbm = rb_intern("dbm");
-}
---
-
-DBM¥é¥¤¥Ö¥é¥ê¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
-¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
-
-
-dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-struct dbmdata {
- int di_size;
- DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
-¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
-¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
-
-Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
-¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-#define GetDBM(obj, dbmp) {\
- Data_Get_Struct(obj, struct dbmdata, dbmp);\
- if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
-¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
-¤ë¤À¤±¤Ç¤¹¡¥
-
-DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
-°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
-¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
-fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_delete(obj, keystr)
- VALUE obj, keystr;
-{
- :
-}
---
-
-°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
-¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
-
-°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
-¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥é¥¤¥Ö¥é¥ê¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
-¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
-¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
-
---
-static VALUE
-fdbm_s_open(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
-{
- :
- if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
- mode = 0666; /* default value */
- }
- :
-}
---
-
-¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
-¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
-¤¨¤é¤ì¤Þ¤¹¡¥
-
-¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
-¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
-½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
-¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
-¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
-¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
-¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
-¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
-ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
-
-Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
-¤¦¤Ç¤¹¡¥
-
---
-static VALUE
-fdbm_indexes(obj, args)
- VALUE obj, args;
-{
- :
-}
---
-
-Âè1°ú¿ô¤Ïself¡¤Âè2°ú¿ô¤ÏRuby¤ÎÇÛÎó¤Ç¤¹¡¥
-
-** Ãí°Õ»ö¹à
-
-Ruby¤È¶¦Í­¤Ï¤·¤Ê¤¤¤¬Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤ò³ÊǼ¤¹¤ë²ÄǽÀ­¤Î¤¢¤ë
-C¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤ÆRuby¥¤¥ó¥¿¥×¥ê¥¿¤ËÊÑ¿ô¤Î¸ºß
-¤ò¶µ¤¨¤Æ¤¢¤²¤Æ¤¯¤À¤µ¤¤¡¥¤Ç¤Ê¤¤¤ÈGC¤Ç¥È¥é¥Ö¥ë¤òµ¯¤³¤·¤Þ¤¹¡¥
-
- void rb_global_variable(VALUE *var)
-
-(4) extconf.rb¤òÍѰդ¹¤ë
-
-Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
-¤Þ¤¹¡¥extconf.rb¤Ï¥é¥¤¥Ö¥é¥ê¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã
-¥¯¤Ê¤É¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥¤Þ¤º¡¤
-
- require 'mkmf'
-
-¤òextconf.rb¤ÎÀèÆ¬¤ËÃÖ¤­¤Þ¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø
-¿ô¤ò»È¤¦¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
-
- have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
- have_func(func, header): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
- have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
- create_makefile(target): Makefile¤ÎÀ¸À®
-
-°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
-
- $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-O¤Ê¤É)
- $CPPFLAGS: ¥×¥ê¥×¥í¥»¥Ã¥µ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤ä-D¤Ê¤É)
- $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
- $objs: ¥ê¥ó¥¯¤µ¤ì¤ë¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë̾¤Î¥ê¥¹¥È
-
-¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤Î¥ê¥¹¥È¤Ï¡¢Ä̾ï¤Ï¥½¡¼¥¹¥Õ¥¡¥¤¥ë¤ò¸¡º÷¤·
-¤Æ¼«Æ°Åª¤ËÀ¸À®¤µ¤ì¤Þ¤¹¤¬¡¢make¤ÎÅÓÃæ¤Ç¥½¡¼¥¹¤òÀ¸À®¤¹¤ë¤è¤¦¤Ê
-¾ì¹ç¤ÏÌÀ¼¨Åª¤Ë»ØÄꤹ¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡£
-
-¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤º¡¤¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥³¥ó
-¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤ÏÀ¸
-À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
-
-(5) depend¤òÍѰդ¹¤ë
-
-¤â¤·¡¤¥Ç¥£¥ì¥¯¥È¥ê¤Ëdepend¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
-Makefile¤¬°Í¸´Ø·¸¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-
- % gcc -MM *.c > depend
-
-¤Ê¤É¤Çºî¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤¢¤Ã¤ÆÂ»¤Ï̵¤¤¤Ç¤·¤ç¤¦¡¥
-
-(6) Makefile¤òÀ¸À®¤¹¤ë
-
-Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
-
- ruby extconf.rb
-
-¤È¤·¤Þ¤¹¡¥extconf.rb¤Ë require 'mkmf' ¤Î¹Ô¤¬¤Ê¤¤¾ì¹ç¤Ë¤Ï¥¨¥é¡¼
-¤Ë¤Ê¤ê¤Þ¤¹¤Î¤Ç¡¤°ú¿ô¤òÄɲä·¤Æ
-
- ruby -r mkmf extconf.rb
-
-¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍѰդ·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
-¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
-
-(7) make¤¹¤ë
-
-ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤òÀ¸À®¤¹¤ë¾ì¹ç¤Ë¤Ï¤½¤Î¾ì¤Çmake¤·¤Æ¤¯¤À¤µ
-¤¤¡¥É¬ÍפǤ¢¤ì¤Ð make install ¤Ç¥¤¥ó¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-ext°Ê²¼¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤òÍѰդ·¤¿¾ì¹ç¤Ï¡¤Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç
-make¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤É¬Íפˤè¤Ã¤Æ¤Ï¤½¤Î¥â
-¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
-extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®¤¬É¬Íפʻþ¤Ï¤Þ
-¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
-
-³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ïmake install¤ÇRuby¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î
-²¼¤Ë¥³¥Ô¡¼¤µ¤ì¤Þ¤¹¡¥¤â¤·³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤È¶¨Ä´¤·¤Æ»È¤¦Ruby¤Çµ­
-½Ò¤µ¤ì¤¿¥×¥í¥°¥é¥à¤¬¤¢¤ê¡¤Ruby¥é¥¤¥Ö¥é¥ê¤ËÃÖ¤­¤¿¤¤¾ì¹ç¤Ë¤Ï¡¤
-³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤΥǥ£¥ì¥¯¥È¥ê¤Î²¼¤Ë lib ¤È¤¤¤¦¥Ç¥£¥ì¥¯¥È¥ê
-¤òºî¤ê¡¤¤½¤³¤Ë ³ÈÄ¥»Ò .rb ¤Î¥Õ¥¡¥¤¥ë¤òÃÖ¤¤¤Æ¤ª¤±¤ÐƱ»þ¤Ë¥¤¥ó
-¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
-
-(8) ¥Ç¥Ð¥Ã¥°
-
-¤Þ¤¢¡¤¥Ç¥Ð¥Ã¥°¤·¤Ê¤¤¤Èư¤«¤Ê¤¤¤Ç¤·¤ç¤¦¤Í¡¥ext/Setup¤Ë¥Ç¥£¥ì
-¥¯¥È¥ê̾¤ò½ñ¤¯¤ÈÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¤Î¤Ç¥Ç¥Ð¥Ã¥¬¤¬»È¤¨¤ë¤è¤¦¤Ë¤Ê
-¤ê¤Þ¤¹¡¥¤½¤Îʬ¥³¥ó¥Ñ¥¤¥ë¤¬ÃÙ¤¯¤Ê¤ê¤Þ¤¹¤±¤É¡¥
-
-(9) ¤Ç¤­¤¢¤¬¤ê
-
-¸å¤Ï¤³¤Ã¤½¤ê»È¤¦¤Ê¤ê¡¤¹­¤¯¸ø³«¤¹¤ë¤Ê¤ê¡¤Çä¤ë¤Ê¤ê¡¤¤´¼«Í³¤Ë¤ª
-»È¤¤¤¯¤À¤µ¤¤¡¥Ruby¤Îºî¼Ô¤Ï³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë´Ø¤·¤Æ°ìÀڤθ¢Íø¤ò
-¼çÄ¥¤·¤Þ¤»¤ó¡¥
-
-Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
-
-Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
-¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
-¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
-»×¤¤¤Þ¤¹¡¥
-
-Ruby¸À¸ì¤Î¥³¥¢
-
- class.c
- error.c
- eval.c
- gc.c
- object.c
- parse.y
- variable.c
-
-¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
-
- dln.c
- regex.c
- st.c
- util.c
-
-Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
-
- dmyext.c
- inits.c
- main.c
- ruby.c
- version.c
-
-¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
-
- array.c
- bignum.c
- compar.c
- dir.c
- enum.c
- file.c
- hash.c
- io.c
- marshal.c
- math.c
- numeric.c
- pack.c
- prec.c
- process.c
- random.c
- range.c
- re.c
- signal.c
- sprintf.c
- string.c
- struct.c
- time.c
-
-Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
-
-C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
-** ·¿
-
-VALUE
-
- Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
- ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
- ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
- ̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍѰդµ¤ì¤Æ¤¤¤ë¡¥
-
-** ÊÑ¿ô¡¦Äê¿ô
-
-Qnil
-
- Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
-
-Qtrue
-
- Äê¿ô: true¥ª¥Ö¥¸¥§¥¯¥È(¿¿¤Î¥Ç¥Õ¥©¥ë¥ÈÃÍ)
-
-Qfalse
-
- Äê¿ô: false¥ª¥Ö¥¸¥§¥¯¥È
-
-** C¥Ç¡¼¥¿¤Î¥«¥×¥»¥ë²½
-
-Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
- C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
- ¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
- ´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
- ¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
- ¤¬¤¢¤ë¡¥
-
-Data_Make_Struct(klass, type, mark, free, sval)
-
- type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
- ¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
-
-Data_Get_Struct(data, type, sval)
-
- data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
-
-** ·¿¥Á¥§¥Ã¥¯
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** ·¿ÊÑ´¹
-
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
-NUM2DBL(value)
-rb_float_new(f)
-StringValue(value)
-StringValuePtr(value)
-StringValueCStr(value)
-rb_str_new2(s)
-
-** ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
-
-VALUE rb_define_class(const char *name, VALUE super)
-
- super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
- super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤·¡¤module¤Î
- Äê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_module(const char *name)
-
- ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¡¥
-
-VALUE rb_define_module_under(VALUE module, const char *name)
-
- ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¡¤module¤ÎÄê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
-
-void rb_include_module(VALUE klass, VALUE module)
-
- ¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë¡¥class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯
- ¥ë¡¼¥É¤·¤Æ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß)¡¥
-
-void rb_extend_object(VALUE object, VALUE module)
-
- ¥ª¥Ö¥¸¥§¥¯¥È¤ò¥â¥¸¥å¡¼¥ë(¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¥á¥½¥Ã¥É)¤Ç³ÈÄ¥¤¹¤ë¡¥
-
-** Âç°èÊÑ¿ôÄêµÁ
-
-void rb_define_variable(const char *name, VALUE *var)
-
- Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô̾¤¬`$'¤Ç
- »Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë¡¥name¤È¤·¤ÆRuby¤Î¼±ÊÌ»Ò
- ¤È¤·¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤ÏRuby¥×¥í¥°¥é
- ¥à¤«¤é¤Ï¸«¤¨¤Ê¤¯¤Ê¤ë¡¥
-
-void rb_define_readonly_variable(const char *name, VALUE *var)
-
- Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëread only¤Î¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥
- read only¤Ç¤¢¤ë¤³¤È°Ê³°¤Ïrb_define_variable()¤ÈƱ¤¸¡¥
-
-void rb_define_virtual_variable(const char *name,
- VALUE (*getter)(), void (*setter)())
-
- ´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRubyÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿
- »þ¤Ë¤Ïgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì
- ¤ë¡¥
-
-void rb_define_hooked_variable(const char *name, VALUE *var,
- VALUE (*getter)(), void (*setter)())
-
- ´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô
- ¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ïgetter¤¬¡¤´Ø¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ï
- setter¤¬¸Æ¤Ð¤ì¤ë¡¥getter¤äsetter¤Ë0¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïhook¤ò
- »ØÄꤷ¤Ê¤¤¤Î¤ÈƱ¤¸»ö¤Ë¤Ê¤ë¡¥
-
-void rb_global_variable(VALUE *var)
-
- GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö
- ¥¸¥§¥¯¥È¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë¡¥
-
-** Äê¿ô
-
-void rb_define_const(VALUE klass, const char *name, VALUE val)
-
- Äê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
-void rb_define_global_const(const char *name, VALUE val)
-
- Âç°èÄê¿ô¤òÄêµÁ¤¹¤ë¡¥
-
- rb_define_const(rb_cObject, name, val)
-
- ¤ÈƱ¤¸°ÕÌ£¡¥
-
-** ¥á¥½¥Ã¥ÉÄêµÁ
-
-rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
- ¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô¡¥argc¤¬-1¤Î»þ,
- ´Ø¿ô¤Ë¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2
- °ú¿ô¤È¤¹¤ë·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself)¡¥argc¤¬-2¤Î»þ,
- Âè1°ú¿ô¤¬self, Âè2°ú¿ô¤¬args(args¤Ï°ú¿ô¤ò´Þ¤àRuby¤ÎÇÛÎó)¤È
- ¤¤¤¦·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë¡¥
-
-rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
- private¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
-rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
- ÆÃ°Û¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
-
-rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
- argc, argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô,
- Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú
- ¿ô»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Ä
- ǽ¤Ç¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê
- ¹ß¤ÏÊÑ¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥
- Éղðú¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬
- ÂåÆþ¤µ¤ì¤ë¡¥
-
-** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
-
-VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
- ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥Ê¸»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò
- »È¤¦¡¥
-
-VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
- ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥°ú¿ô¤òargc, argv·Á¼°¤ÇÅϤ¹¡¥
-
-VALUE rb_eval_string(const char *str)
-
- ʸ»úÎó¤òRuby¥¹¥¯¥ê¥×¥È¤È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
-
-ID rb_intern(const char *name)
-
- ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹¡¥
-
-char *rb_id2name(ID id)
-
- ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥
-
-char *rb_class2name(VALUE klass)
-
- ¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥¥¯¥é¥¹¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï,
- ÁÄÀè¤òÁ̤äÆÌ¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
-
-int rb_respond_to(VALUE obj, ID id)
-
- obj¤¬id¤Ç¼¨¤µ¤ì¤ë¥á¥½¥Ã¥É¤ò»ý¤Ä¤«¤É¤¦¤«¤òÊÖ¤¹¡£
-
-** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
-
-VALUE rb_iv_get(VALUE obj, const char *name)
-
- obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë¡¥`@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó
- ¥¹ÊÑ¿ô¤Ï Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤¡Ö±£¤ì¤¿¡×¥¤¥ó
- ¥¹¥¿¥ó¥¹ÊÑ¿ô¤Ë¤Ê¤ë¡¥Äê¿ô¤ÏÂçʸ»ú¤Î̾Á°¤ò»ý¤Ä¥¯¥é¥¹(¤Þ¤¿¤Ï
- ¥â¥¸¥å¡¼¥ë)¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤È¤·¤Æ¼ÂÁõ¤µ¤ì¤Æ¤¤¤ë¡¥
-
-VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
- obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë¡¥
-
-** À©¸æ¹½Â¤
-
-VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
- func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥
- func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
- ¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
-
-VALUE rb_yield(VALUE val)
-
- val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
-
-VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
- ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸
- ¤·¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸
- ¤·¤Ê¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá
- ¤êÃͤǤ¢¤ë¡¥
-
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
-
- ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬
- ȯÀ¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1
- ¤ÎÌá¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
-
-** Îã³°¡¦¥¨¥é¡¼
-
-void rb_warning(const char *fmt, ...)
-
- rb_verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ï
- printf()¤ÈƱ¤¸¡¥
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
- RuntimeErrorÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
-
-void rb_raise(VALUE exception, const char *fmt, ...)
-
- exception¤Ç»ØÄꤷ¤¿Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥fmt°Ê²¼¤Î°ú¿ô¤Ï
- printf()¤ÈƱ¤¸¡¥
-
-void rb_fatal(const char *fmt, ...)
-
- Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
- ¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë
- ¼Â¹Ô¤µ¤ì¤ë)¡¥
-
-void rb_bug(const char *fmt, ...)
-
- ¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤
- ¾õ¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥
- Îã³°½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
-
-** Ruby¤Î½é´ü²½¡¦¼Â¹Ô
-
-Ruby¤ò¥¢¥×¥ê¥±¡¼¥·¥ç¥ó¤ËËä¤á¹þ¤à¾ì¹ç¤Ë¤Ï°Ê²¼¤Î¥¤¥ó¥¿¥Õ¥§¡¼¥¹
-¤ò»È¤¦¡¥Ä̾ï¤Î³ÈÄ¥¥é¥¤¥Ö¥é¥ê¤Ë¤ÏɬÍפʤ¤¡¥
-
-void ruby_init()
-
- Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦¡¥
-
-void ruby_options(int argc, char **argv)
-
- Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î¥³¥Þ¥ó¥É¥é¥¤¥ó°ú¿ô¤Î½èÍý¤ò¹Ô¤Ê¤¦¡¥
-
-void ruby_run()
-
- Ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë¡¥
-
-void ruby_script(char *name)
-
- Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
-
-
-Appendix C. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
-
-extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
-²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
-
-have_macro(macro, headers)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ¥Þ¥¯¥ímacro¤¬ÄêµÁ¤µ
- ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë»þtrue
- ¤òÊÖ¤¹¡¥
-
-have_library(lib, func)
-
- ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥
- ¥é¥¤¥Ö¥é¥ê¤¬Â¸ºß¤¹¤ë»þ¡¤true¤òÊÖ¤¹¡¥
-
-find_library(lib, func, path...)
-
- ´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò -Lpath ¤òÄɲÃ
- ¤·¤Ê¤¬¤é¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥é¥¤¥Ö¥é¥ê¤¬¸«ÉÕ¤«¤Ã¤¿»þ¡¤true¤òÊÖ¤¹¡¥
-
-have_func(func, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã
- ¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢
- ¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯
- »ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
-
-have_var(var, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤ÆÊÑ¿ôvar¤Î¸ºß¤ò¥Á¥§¥Ã
- ¥¯¤¹¤ë¡¥var¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢
- ¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯
- »ö¡¥ÊÑ¿ô¤¬Â¸ºß¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
-
-have_header(header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹
- ¤ë»þtrue¤òÊÖ¤¹¡¥
-
-find_header(header, path...)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤Î¸ºß¤ò -Ipath ¤òÄɲ䷤ʤ¬¤é¥Á¥§¥Ã¥¯
- ¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬¸«ÉÕ¤«¤Ã¤¿»þ¡¤true¤òÊÖ¤¹¡¥
-
-have_struct_member(type, member, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ·¿type¤Ë¥á¥ó¥Ðmember
- ¤¬Â¸ºß¤¹¤ë¤«¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥type¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤member¤ò
- »ý¤Ä¤¹¤ë»þtrue¤òÊÖ¤¹¡¥
-
-have_type(type, header, opt)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ·¿type¤¬Â¸ºß¤¹¤ë¤«¤ò
- ¥Á¥§¥Ã¥¯¤¹¤ë¡¥type¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë»þtrue¤òÊÖ¤¹¡¥
-
-check_sizeof(type, header)
-
- ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ëheader¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ·¿type¤Îcharñ°Ì¥µ¥¤
- ¥º¤òÄ´¤Ù¤ë¡¥type¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤ë»þ¤½¤Î¥µ¥¤¥º¤òÊÖ¤¹¡¥ÄêµÁ¤µ
- ¤ì¤Æ¤¤¤Ê¤¤¤È¤­¤Ïnil¤òÊÖ¤¹¡¥
-
-create_makefile(target)
-
- ³ÈÄ¥¥é¥¤¥Ö¥é¥êÍѤÎMakefile¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤ò¸Æ¤Ð¤Ê¤±¤ì
- ¤Ð¤½¤Î¥é¥¤¥Ö¥é¥ê¤Ï¥³¥ó¥Ñ¥¤¥ë¤µ¤ì¤Ê¤¤¡¥target¤Ï¥â¥¸¥å¡¼¥ë̾
- ¤òɽ¤¹¡¥
-
-find_executable(command, path)
-
- ¥³¥Þ¥ó¥Écommand¤òFile::PATH_SEPARATOR¤Ç¶èÀÚ¤é¤ì¤¿¥Ñ¥¹Ì¾¤Î
- ¥ê¥¹¥Èpath¤«¤éõ¤¹¡¥path¤¬nil¤Þ¤¿¤Ï¾Êά¤µ¤ì¤¿¾ì¹ç¤Ï¡¤´Ä¶­
- ÊÑ¿ôPATH¤ÎÃͤò»ÈÍѤ¹¤ë¡¥¼Â¹Ô²Äǽ¤Ê¥³¥Þ¥ó¥É¤¬¸«¤Ä¤«¤Ã¤¿¾ì¹ç
- ¤Ï¥Ñ¥¹¤ò´Þ¤à¥Õ¥¡¥¤¥ë̾¡¤¸«¤Ä¤«¤é¤Ê¤«¤Ã¤¿¾ì¹ç¤Ïnil¤òÊÖ¤¹¡¥
-
-with_config(withval[, default=nil])
-
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<withval>¤Ç»ØÄꤵ¤ì¤¿¥ª¥×¥·¥ç¥óÃͤòÆÀ¤ë¡¥
-
-enable_config(config, *defaults)
-disable_config(config, *defaults)
-
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--enable-<config>¤Þ¤¿¤Ï
- --disable-<config>¤Ç»ØÄꤵ¤ì¤¿¿¿µ¶ÃͤòÆÀ¤ë¡¥
- --enable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïtrue¡¤
- --disable-<config>¤¬»ØÄꤵ¤ì¤Æ¤¤¤¿¾ì¹ç¤Ïfalse¤òÊÖ¤¹¡¥
- ¤É¤Á¤é¤â»ØÄꤵ¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤Ï¡¤¥Ö¥í¥Ã¥¯¤Ä¤­¤Ç¸Æ¤Ó½Ð¤µ¤ì¤Æ¤¤¤ë¾ì¹ç¤Ï
- *defaults¤òyield¤·¤¿·ë²Ì¡¤¥Ö¥í¥Ã¥¯¤Ê¤·¤Ê¤é*defaults¤òÊÖ¤¹¡¥
-
-dir_config(target[, default_dir])
-dir_config(target[, default_include, default_lib])
-
- ¥³¥Þ¥ó¥É¥é¥¤¥ó¾å¤Î--with-<target>-dir, --with-<target>-include,
- --with-<target>-lib¤Î¤¤¤º¤ì¤«¤Ç»ØÄꤵ¤ì¤ë¥Ç¥£¥ì¥¯¥È¥ê¤ò
- $CFLAGS ¤ä $LDFLAGS ¤ËÄɲ乤롥--with-<target>-dir=/path¤Ï
- --with-<target>-include=/path/include --with-<target>-lib=/path/lib
- ¤ÈÅù²Á¤Ç¤¢¤ë¡¥Äɲ䵤줿 include ¥Ç¥£¥ì¥¯¥È¥ê¤È lib ¥Ç¥£¥ì¥¯¥È¥ê¤Î
- ÇÛÎó¤òÊÖ¤¹¡¥ ([include_dir, lib_dir])
-
-pkg_config(pkg)
-
- pkg-config¥³¥Þ¥ó¥É¤«¤é¥Ñ¥Ã¥±¡¼¥¸pkg¤Î¾ðÊó¤òÆÀ¤ë¡¥
- pkg-config¤Î¼ÂºÝ¤Î¥³¥Þ¥ó¥É̾¤Ï¡¤--with-pkg-config¥³¥Þ¥ó¥É
- ¥é¥¤¥ó¥ª¥×¥·¥ç¥ó¤Ç»ØÄê²Äǽ¡¥
-
-/*
- * Local variables:
- * fill-column: 60
- * end:
- */
+doc/extension.ja.rdocã«ç§»å‹•ã—ã¾ã—ãŸ
diff --git a/README.ja b/README.ja
deleted file mode 100644
index df8cfc03f4..0000000000
--- a/README.ja
+++ /dev/null
@@ -1,160 +0,0 @@
-* Ruby¤È¤Ï
-
-Ruby¤Ï¥·¥ó¥×¥ë¤«¤Ä¶¯ÎϤʥª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥¹¥¯¥ê¥×¥È¸À¸ì¤Ç¤¹¡¥
-Ruby¤ÏºÇ½é¤«¤é½ã¿è¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¸À¸ì¤È¤·¤ÆÀ߷פµ¤ì¤Æ¤¤¤Þ
-¤¹¤«¤é¡¤¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥×¥í¥°¥é¥ß¥ó¥°¤ò¼ê·Ú¤Ë¹Ô¤¦»ö¤¬½ÐÍè¤Þ
-¤¹¡¥¤â¤Á¤í¤óÄ̾ï¤Î¼ê³¤­·¿¤Î¥×¥í¥°¥é¥ß¥ó¥°¤â²Äǽ¤Ç¤¹¡¥
-
-Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
-¤Ç¤¹¡¥¤µ¤é¤Ë¥·¥ó¥×¥ë¤Êʸˡ¤È¡¤Îã³°½èÍý¤ä¥¤¥Æ¥ì¡¼¥¿¤Ê¤É¤Îµ¡¹½
-¤Ë¤è¤Ã¤Æ¡¤¤è¤êʬ¤«¤ê¤ä¤¹¤¤¥×¥í¥°¥é¥ß¥ó¥°¤¬½ÐÍè¤Þ¤¹¡¥
-
-
-* Ruby¤ÎÆÃĹ
-
- + ¥·¥ó¥×¥ë¤Êʸˡ
- + ÉáÄ̤Υª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(¥¯¥é¥¹¡¤¥á¥½¥Ã¥É¥³¡¼¥ë¤Ê¤É)
- + ÆÃ¼ì¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(Mixin, ÆÃ°Û¥á¥½¥Ã¥É¤Ê¤É)
- + ±é»»»Ò¥ª¡¼¥Ð¡¼¥í¡¼¥É
- + Îã³°½èÍýµ¡Ç½
- + ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
- + ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
- + ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
- + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUNIX¾å¤Çư¤¯¤À¤±¤Ç¤Ê¤¯¡¤DOS¤äWindows¡¤
- Mac¡¤BeOS¤Ê¤É¤Î¾å¤Ç¤âư¤¯
-
-
-* Æþ¼êË¡
-
-** FTP¤Ç
-
-°Ê²¼¤Î¾ì½ê¤Ë¤ª¤¤¤Æ¤¢¤ê¤Þ¤¹¡¥
-
- ftp://ftp.ruby-lang.org/pub/ruby/
-
-** Subversion¤Ç
-
-ËÜ¥Ö¥é¥ó¥Á¤ÎRuby¤ÎºÇ¿·¤Î¥½¡¼¥¹¥³¡¼¥É¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¼èÆÀ¤Ç¤­¤Þ¤¹¡¥
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
-³«È¯Àèü¤Î¥½¡¼¥¹¥³¡¼¥É¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¼èÆÀ¤Ç¤­¤Þ¤¹¡¥
-
- $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-¾¤Ë³«È¯Ãæ¤Î¥Ö¥é¥ó¥Á¤Î°ìÍ÷¤Ï¼¡¤Î¥³¥Þ¥ó¥É¤Ç¸«¤é¤ì¤Þ¤¹¡¥
-
- $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-
-* ¥Û¡¼¥à¥Ú¡¼¥¸
-
-Ruby¤Î¥Û¡¼¥à¥Ú¡¼¥¸¤ÎURL¤Ï
-
- http://www.ruby-lang.org/
-
-¤Ç¤¹¡¥
-
-
-* ¥á¡¼¥ê¥ó¥°¥ê¥¹¥È
-
-Ruby¤Î¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤¬¤¢¤ê¤Þ¤¹¡£»²²Ã´õ˾¤ÎÊý¤Ï
-
- ruby-list-ctl@ruby-lang.org
-
-¤Þ¤ÇËÜʸ¤Ë
-
- subscribe YourFirstName YourFamilyName
-
-¤È½ñ¤¤¤ÆÁ÷¤Ã¤Æ²¼¤µ¤¤¡£
-
-Ruby³«È¯¼Ô¸þ¤±¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£¤³¤Á¤é¤Ç¤Ïruby¤Î¥Ð
-¥°¡¢¾­Íè¤Î»ÅÍͳÈÄ¥¤Ê¤É¼ÂÁõ¾å¤ÎÌäÂê¤Ë¤Ä¤¤¤ÆµÄÏÀ¤µ¤ì¤Æ¤¤¤Þ¤¹¡£
-»²²Ã´õ˾¤ÎÊý¤Ï
-
- ruby-dev-ctl@ruby-lang.org
-
-¤Þ¤Çruby-list¤ÈƱÍͤÎÊýË¡¤Ç¥á¡¼¥ë¤·¤Æ¤¯¤À¤µ¤¤¡£
-
-Ruby³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-ext¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
-¿ô³Ø´Ø·¸¤ÎÏÃÂê¤Ë¤Ä¤¤¤ÆÏ䷹礦ruby-math¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤È
-±Ñ¸ì¤ÇÏ䷹礦ruby-talk¥á¡¼¥ê¥ó¥°¥ê¥¹¥È¤â¤¢¤ê¤Þ¤¹¡£»²²ÃÊýË¡
-¤Ï¤É¤ì¤âƱ¤¸¤Ç¤¹¡£
-
-
-* ¥³¥ó¥Ñ¥¤¥ë¡¦¥¤¥ó¥¹¥È¡¼¥ë
-
-°Ê²¼¤Î¼ê½ç¤Ç¹Ô¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
-
- 1. ¤â¤·configure¥Õ¥¡¥¤¥ë¤¬¸«¤Ä¤«¤é¤Ê¤¤¡¢¤â¤·¤¯¤Ï
- configure.in¤è¤ê¸Å¤¤¤è¤¦¤Ê¤é¡¢autoconf¤ò¼Â¹Ô¤·¤Æ
- ¿·¤·¤¯configure¤òÀ¸À®¤¹¤ë
-
- 2. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
-
- 3. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
-
- ¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
-
- 4. (ɬÍפʤé¤Ð)ext/Setup¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò
- »ØÄꤹ¤ë
-
- ext/Setup¤Ëµ­½Ò¤·¤¿¥â¥¸¥å¡¼¥ë¤ÏÀÅŪ¤Ë¥ê¥ó¥¯¤µ¤ì¤Þ¤¹¡¥
-
- ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥°¤ò¥µ¥Ý¡¼¥È¤·¤Æ¤¤¤Ê¤¤¥¢¡¼¥­¥Æ¥¯
- ¥Á¥ã¤Ç¤ÏSetup¤Î1¹ÔÌܤΡÖoption nodynamic¡×¤È¤¤¤¦¹Ô¤Î¥³
- ¥á¥ó¥È¤ò³°¤¹É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤Þ¤¿¡¤¤³¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ç
- ³ÈÄ¥¥â¥¸¥å¡¼¥ë¤òÍøÍѤ¹¤ë¤¿¤á¤Ë¤Ï¡¤¤¢¤é¤«¤¸¤áÀÅŪ¤Ë¥ê¥ó
- ¥¯¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
-
- 5. make¤ò¼Â¹Ô¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¤¹¤ë
-
- 6. make test¤Ç¥Æ¥¹¥È¤ò¹Ô¤¦¡¥
-
- ¡Ötest succeeded¡×¤Èɽ¼¨¤µ¤ì¤ì¤ÐÀ®¸ù¤Ç¤¹¡¥¤¿¤À¤·¥Æ¥¹¥È
- ¤ËÀ®¸ù¤·¤Æ¤â´°àú¤À¤ÈÊݾڤµ¤ì¤Æ¤¤¤ëÌõ¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥
-
- 7. make install
-
- root¤Çºî¶È¤¹¤ëɬÍפ¬¤¢¤ë¤«¤â¤·¤ì¤Þ¤»¤ó¡¥
-
-¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
-¥·¥ó¡¤OS¤Î¼ïÎà¤ò´Þ¤à¤Ç¤­¤ë¤À¤±¾Ü¤·¤¤¥ì¥Ý¡¼¥È¤òºî¼Ô¤ËÁ÷¤Ã¤Æ¤¯
-¤À¤µ¤ë¤È¾¤ÎÊý¤Î¤¿¤á¤Ë¤â¤Ê¤ê¤Þ¤¹¡¥
-
-
-* °Ü¿¢
-
-UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
-¤¹¤¬¡¤»×¤ï¤Ì¸«Íî¤È¤·¤¬¤¢¤Ã¤¿¾ì¹ç(¤¢¤ë¤Ë°ã¤¤¤Ê¤¤)¡¤ºî¼Ô¤Ë¤½¤Î
-¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
-
-¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
-¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò jmp_buf¤Ë
-³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ
-¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤Þ¤¹¡¥ÆÃ¤ËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó
-¾ï¤Ëº¤Æñ¤Ç¤·¤ç¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò
-¥Þ¡¼¥¯¤·¤Æ¤¤¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼
-¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(THINK_C)¡×¤Ç
-³ç¤é¤ì¤Æ¤¤¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤
-
-# ¼ÂºÝ¤Ë¤ÏRuby¤ÏThink C¤Ç¤Ï¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤Þ¤»¤ó¡¥
-
-¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
-¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
-¤ì¤Þ¤»¤ó¡¥
-
-
-* ÇÛÉÛ¾ò·ï
-
-COPYING.ja¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡£
-
-
-* Ãø¼Ô
-
-¥³¥á¥ó¥È¡¤¥Ð¥°¥ì¥Ý¡¼¥È¤½¤Î¾¤Ï matz@netlab.jp ¤Þ¤Ç¡¥
--------------------------------------------------------
-created at: Thu Aug 3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.ja.md b/README.ja.md
new file mode 100644
index 0000000000..4e1e6b9d87
--- /dev/null
+++ b/README.ja.md
@@ -0,0 +1,185 @@
+[![Build Status](https://travis-ci.org/ruby/ruby.svg?branch=master)](https://travis-ci.org/ruby/ruby)
+[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+![](https://github.com/ruby/ruby/workflows/Cygwin/badge.svg)
+![](https://github.com/ruby/ruby/workflows/macOS/badge.svg)
+![](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)
+![](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)
+![](https://github.com/ruby/ruby/workflows/Windows/badge.svg)
+
+# Rubyã¨ã¯
+
+Rubyã¯ã‚·ãƒ³ãƒ—ルã‹ã¤å¼·åŠ›ãªã‚ªãƒ–ジェクト指å‘スクリプト言語ã§ã™ï¼Ž Rubyã¯ç´”粋ãªã‚ªãƒ–ジェクト指å‘言語ã¨ã—ã¦è¨­è¨ˆã•れã¦ã„ã‚‹ã®ã§ï¼Œ
+オブジェクト指å‘プログラミングを手軽ã«è¡Œã†äº‹ãŒå‡ºæ¥ã¾ã™ï¼Žã‚‚ã¡ã‚ã‚“æ™®é€šã®æ‰‹ç¶šãåž‹ã®ãƒ—ログラミングもå¯èƒ½ã§ã™ï¼Ž
+
+Rubyã¯ãƒ†ã‚­ã‚¹ãƒˆå‡¦ç†é–¢ä¿‚ã®èƒ½åŠ›ãªã©ã«å„ªã‚Œï¼ŒPerlã¨åŒã˜ãらã„強力ã§ã™ï¼Žã•らã«ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•ã¨ï¼Œ
+例外処ç†ã‚„イテレータãªã©ã®æ©Ÿæ§‹ã«ã‚ˆã£ã¦ï¼Œã‚ˆã‚Šåˆ†ã‹ã‚Šã‚„ã™ã„プログラミングãŒå‡ºæ¥ã¾ã™ï¼Ž
+
+## Rubyã®ç‰¹é•·
+
+* ã‚·ãƒ³ãƒ—ãƒ«ãªæ–‡æ³•
+* 普通ã®ã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(クラス,メソッドコールãªã©)
+* 特殊ãªã‚ªãƒ–ã‚¸ã‚§ã‚¯ãƒˆæŒ‡å‘æ©Ÿèƒ½(Mixin,特異メソッドãªã©)
+* 演算å­ã‚ªãƒ¼ãƒãƒ¼ãƒ­ãƒ¼ãƒ‰
+* ä¾‹å¤–å‡¦ç†æ©Ÿèƒ½
+* イテレータã¨ã‚¯ãƒ­ãƒ¼ã‚¸ãƒ£
+* ガーベージコレクタ
+* ダイナミックローディング (アーキテクãƒãƒ£ã«ã‚ˆã‚‹)
+* ç§»æ¤æ€§ãŒé«˜ã„.多ãã®Unix-like/POSIX互æ›ãƒ—ラットフォーム上ã§å‹•ãã ã‘ã§ãªã,Windows, macOS,
+ Haikuãªã©ã®ä¸Šã§ã‚‚å‹•ã cf.
+ https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
+
+
+## 入手法
+
+サードパーティーツールを使ã£ãŸæ–¹æ³•ã‚’å«ã‚€Rubyã®ã‚¤ãƒ³ã‚¹ãƒˆãƒ¼ãƒ«æ–¹æ³•ã®ä¸€è¦§ã¯
+
+https://www.ruby-lang.org/ja/downloads/
+
+ã‚’å‚ç…§ã—ã¦ãã ã•ã„.
+
+### Git
+
+ミラーをGitHubã«å…¬é–‹ã—ã¦ã„ã¾ã™ï¼Ž 以下ã®ã‚³ãƒžãƒ³ãƒ‰ã§ãƒªãƒã‚¸ãƒˆãƒªã‚’å–å¾—ã§ãã¾ã™ï¼Ž
+
+ $ git clone https://github.com/ruby/ruby.git
+
+ä»–ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
+
+ $ git ls-remote https://github.com/ruby/ruby.git
+
+Rubyリãƒã‚¸ãƒˆãƒªã®æœ¬æ¥ã®master㯠https://git.ruby-lang.org/ruby.git ã«ã‚りã¾ã™ï¼Ž
+コミッタã¯ã“ã¡ã‚‰ã‚’使ã„ã¾ã™ï¼Ž
+
+### Subversion
+
+å¤ã„Rubyã®ãƒãƒ¼ã‚¸ãƒ§ãƒ³ã®ã‚½ãƒ¼ã‚¹ã‚³ãƒ¼ãƒ‰ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§å–å¾—ã§ãã¾ã™ï¼Ž
+
+ $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
+
+ä»–ã«é–‹ç™ºä¸­ã®ãƒ–ランãƒã®ä¸€è¦§ã¯æ¬¡ã®ã‚³ãƒžãƒ³ãƒ‰ã§è¦‹ã‚‰ã‚Œã¾ã™ï¼Ž
+
+ $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
+
+
+## ホームページ
+
+Rubyã®ãƒ›ãƒ¼ãƒ ãƒšãƒ¼ã‚¸ã®URLã¯
+
+https://www.ruby-lang.org/
+
+ã§ã™ï¼Ž
+
+## メーリングリスト
+
+Rubyã®ãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆãŒã‚りã¾ã™ï¼Žå‚åŠ å¸Œæœ›ã®æ–¹ã¯
+
+mailto:ruby-list-request@ruby-lang.org
+
+ã¾ã§æœ¬æ–‡ã«
+
+ subscribe
+
+ã¨æ›¸ã„ã¦é€ã£ã¦ä¸‹ã•ã„.
+
+Ruby開発者å‘ã‘メーリングリストもã‚りã¾ã™ï¼Žã“ã¡ã‚‰ã§ã¯rubyã®ãƒã‚°ï¼Œå°†æ¥ã®ä»•様拡張ãªã©å®Ÿè£…上ã®å•題ã«ã¤ã„ã¦è­°è«–ã•れã¦ã„ã¾ã™ï¼Ž å‚åŠ å¸Œæœ›ã®æ–¹ã¯
+
+mailto:ruby-dev-request@ruby-lang.org
+
+ã¾ã§ruby-listã¨åŒæ§˜ã®æ–¹æ³•ã§ãƒ¡ãƒ¼ãƒ«ã—ã¦ãã ã•ã„.
+
+Ruby拡張モジュールã«ã¤ã„ã¦è©±ã—åˆã†ruby-extãƒ¡ãƒ¼ãƒªãƒ³ã‚°ãƒªã‚¹ãƒˆã¨æ•°å­¦é–¢ä¿‚ã®è©±é¡Œã«ã¤ã„ã¦è©±ã—åˆã†ruby-mathメーリングリストã¨
+英語ã§rubyã«ã¤ã„ã¦è©±ã—åˆã†ruby-talkメーリングリストもã‚りã¾ã™ï¼Žå‚加方法ã¯ã©ã‚Œã‚‚åŒã˜ã§ã™ï¼Ž
+
+## コンパイル・インストール
+
+ä»¥ä¸‹ã®æ‰‹é †ã§è¡Œã£ã¦ãã ã•ã„.
+
+1. ã‚‚ã— `configure` ファイルãŒè¦‹ã¤ã‹ã‚‰ãªã„,もã—ã㯠`configure.ac` よりå¤ã„よã†ãªã‚‰ï¼Œ `autoconf` を実行ã—ã¦
+ æ–°ã—ã `configure` を生æˆã™ã‚‹
+
+2. `configure` を実行ã—㦠`Makefile` ãªã©ã‚’生æˆã™ã‚‹
+
+ 環境ã«ã‚ˆã£ã¦ã¯ãƒ‡ãƒ•ォルトã®Cコンパイラ用オプションãŒä»˜ãã¾ã™ï¼Ž `configure` オプション㧠`optflags=..`
+ `warnflags=..` ç­‰ã§ä¸Šæ›¸ãã§ãã¾ã™ï¼Ž
+
+3. (å¿…è¦ãªã‚‰ã°)`defines.h` を編集ã™ã‚‹
+
+ 多分,必è¦ç„¡ã„ã¨æ€ã„ã¾ã™ï¼Ž
+
+4. (å¿…è¦ãªã‚‰ã°)`ext/Setup` ã«é™çš„ã«ãƒªãƒ³ã‚¯ã™ã‚‹æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’指定ã™ã‚‹
+
+ `ext/Setup` ã«è¨˜è¿°ã—ãŸãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã¯é™çš„ã«ãƒªãƒ³ã‚¯ã•れã¾ã™ï¼Ž
+
+ ダイナミックローディングをサãƒãƒ¼ãƒˆã—ã¦ã„ãªã„アーキテクãƒãƒ£ã§ã¯ `Setup` ã®1行目ã®ã€Œ`option nodynamic`ã€ã¨ã„ã†è¡Œã®ã‚³
+ メントを外ã™å¿…è¦ãŒã‚りã¾ã™ï¼Ž
+ ã¾ãŸï¼Œã“ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ã§æ‹¡å¼µãƒ¢ã‚¸ãƒ¥ãƒ¼ãƒ«ã‚’利用ã™ã‚‹ãŸã‚ã«ã¯ï¼Œã‚らã‹ã˜ã‚é™çš„ã«ãƒªãƒ³ã‚¯ã‚’ã—ã¦ãŠãå¿…è¦ãŒã‚りã¾ã™ï¼Ž
+
+5. `make` を実行ã—ã¦ã‚³ãƒ³ãƒ‘イルã™ã‚‹
+
+6. `make check`ã§ãƒ†ã‚¹ãƒˆã‚’行ã†ï¼Ž
+
+ 「`check succeeded`ã€ã¨è¡¨ç¤ºã•ã‚Œã‚Œã°æˆåŠŸã§ã™ï¼ŽãŸã ã—ãƒ†ã‚¹ãƒˆã«æˆåŠŸã—ã¦ã‚‚完璧ã ã¨ä¿è¨¼ã•れã¦ã„る訳ã§ã¯ã‚りã¾ã›ã‚“.
+
+7. `make install`
+
+ 以下ã®ãƒ‡ã‚£ãƒ¬ã‚¯ãƒˆãƒªã‚’作ã£ã¦ï¼Œãã“ã«ãƒ•ァイルをインストー ルã—ã¾ã™ï¼Ž
+
+ * `${DESTDIR}${prefix}/bin`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib`
+ * `${DESTDIR}${prefix}/lib/ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/share/man/man1`
+ * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+ Rubyã®APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ãŒ'*x.y.z*'ã§ã‚れã°ï¼Œ`${MAJOR}`ã¯
+ '*x*'ã§ï¼Œ`${MINOR}`ã¯'*y*',`${TEENY}`ã¯'*z*'ã§ã™ï¼Ž
+
+ **注æ„**: APIãƒãƒ¼ã‚¸ãƒ§ãƒ³ã® `teeny` ã¯ï¼ŒRubyプログラムã®ãƒãƒ¼ã‚¸ãƒ§ãƒ³ã¨ã¯ç•°ãªã‚‹ã“ã¨ãŒã‚りã¾ã™ï¼Ž
+
+ `root` ã§ä½œæ¥­ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
+
+
+ã‚‚ã—,コンパイル時ã«ã‚¨ãƒ©ãƒ¼ãŒç™ºç”Ÿã—ãŸå ´åˆã«ã¯ã‚¨ãƒ©ãƒ¼ã®ãƒ­ã‚°ã¨ãƒžã‚·ãƒ³ï¼ŒOSã®ç¨®é¡žã‚’å«ã‚€ã§ãã‚‹ã ã‘詳ã—ã„レãƒãƒ¼ãƒˆã‚’作者ã«é€ã£ã¦ä¸‹ã•ã‚‹ã¨ä»–ã®æ–¹ã®ãŸã‚ã«ã‚‚ãªã‚Šã¾ã™ï¼Ž
+
+## ç§»æ¤
+
+UNIXã§ã‚れ㰠`configure` ãŒã»ã¨ã‚“ã©ã®å·®ç•°ã‚’å¸åŽã—ã¦ãれるã¯ãšã§ã™ãŒï¼Œæ€ã‚ã¬è¦‹è½ã¨ã—ãŒã‚ã£ãŸå ´åˆ(ã‚る事ãŒå¤šã„),作者ã«ãã®
+ã“ã¨ã‚’報告ã™ã‚Œã°ï¼Œè§£æ±ºã§ãã‚‹å¯èƒ½æ€§ãŒã‚りã¾ã™ï¼Ž
+
+アーキテクãƒãƒ£ã«ã‚‚ã£ã¨ã‚‚ä¾å­˜ã™ã‚‹ã®ã¯GC部ã§ã™ï¼ŽRubyã®GCã¯å¯¾è±¡
+ã®ã‚¢ãƒ¼ã‚­ãƒ†ã‚¯ãƒãƒ£ãŒ`setjmp()`ã¾ãŸã¯`getcontext()`ã«ã‚ˆã£ã¦å…¨ã¦ã®ãƒ¬ã‚¸ã‚¹ã‚¿ã‚’ `jmp_buf` ã‚„ `ucontext_t`
+ã«æ ¼ç´ã™ã‚‹ã“ã¨ã¨ï¼Œ `jmp_buf` ã‚„ `ucontext_t` ã¨ã‚¹ã‚¿ãƒƒã‚¯ãŒ32bitアラインメントã•れã¦ã„ã‚‹ã“ã¨ã‚’仮定
+ã—ã¦ã„ã¾ã™ï¼Žç‰¹ã«å‰è€…ãŒæˆç«‹ã—ãªã„å ´åˆã®å¯¾å¿œã¯éžå¸¸ã«å›°é›£ã§ã—ょã†ï¼Ž 後者ã®è§£æ±ºã¯æ¯”較的簡å˜ã§ï¼Œ `gc.c` ã§ã‚¹ã‚¿ãƒƒã‚¯ã‚’マークã—ã¦ã„ã‚‹
+部分ã«ã‚¢ãƒ©ã‚¤ãƒ³ãƒ¡ãƒ³ãƒˆã®ãƒã‚¤ãƒˆæ•°ã ã‘ãšã‚‰ã—ã¦ãƒžãƒ¼ã‚¯ã™ã‚‹ã‚³ãƒ¼ãƒ‰ã‚’追加ã™ã‚‹ã ã‘ã§æ¸ˆã¿ã¾ã™ï¼Ž`defined(__mc68000__)`ã§æ‹¬ã‚‰ã‚Œã¦ã„
+る部分をå‚考ã«ã—ã¦ãã ã•ã„.
+
+レジスタウィンドウをæŒã¤CPUã§ã¯ï¼Œãƒ¬ã‚¸ã‚¹ã‚¿ã‚¦ã‚£ãƒ³ãƒ‰ã‚¦ã‚’スタックã«ãƒ•ラッシュã™ã‚‹ã‚¢ã‚»ãƒ³ãƒ–ラコードを追加ã™ã‚‹å¿…è¦ãŒã‚ã‚‹ã‹ã‚‚ã—れã¾ã›ã‚“.
+
+## é…布æ¡ä»¶
+
+[COPYING.ja](COPYING.ja) ファイルをå‚ç…§ã—ã¦ãã ã•ã„.
+
+## フィードãƒãƒƒã‚¯
+
+Rubyã«é–¢ã™ã‚‹è³ªå•㯠Ruby-Talk(英語)や Ruby-List(日本語) (https://www.ruby-lang.org/ja/community/mailing-lists) や,
+stackoverflow (https://ja.stackoverflow.com/) ãªã©ã®Webã‚µã‚¤ãƒˆã«æŠ•ç¨¿ã—ã¦ãã ã•ã„.
+
+ãƒã‚°å ±å‘Šã¯ https://bugs.ruby-lang.org ã§å—ã‘付ã‘ã¦ã„ã¾ã™ï¼Ž
+
+
+## 著者
+
+Rubyã®ã‚ªãƒªã‚¸ãƒŠãƒ«ç‰ˆã¯ï¼Œ1995å¹´ã«ã¾ã¤ã‚‚ã¨ã‚†ãã²ã‚æ°ã«ã‚ˆã£ã¦è¨­è¨ˆãƒ»é–‹ç™ºã•れã¾ã—ãŸï¼Ž
+
+<mailto:matz@ruby-lang.org>
diff --git a/README.md b/README.md
new file mode 100644
index 0000000000..1e935095c6
--- /dev/null
+++ b/README.md
@@ -0,0 +1,176 @@
+[![Build Status](https://travis-ci.org/ruby/ruby.svg?branch=master)](https://travis-ci.org/ruby/ruby)
+[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
+![](https://github.com/ruby/ruby/workflows/Cygwin/badge.svg)
+![](https://github.com/ruby/ruby/workflows/macOS/badge.svg)
+![](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)
+![](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)
+![](https://github.com/ruby/ruby/workflows/Windows/badge.svg)
+
+# What's Ruby
+
+Ruby is an interpreted object-oriented programming language often
+used for web development. It also offers many scripting features
+to process plain text and serialized files, or manage system tasks.
+It is simple, straightforward, and extensible.
+
+## Features of Ruby
+
+* Simple Syntax
+* **Normal** Object-oriented Features (e.g. class, method calls)
+* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
+* Operator Overloading
+* Exception Handling
+* Iterators and Closures
+* Garbage Collection
+* Dynamic Loading of Object Files (on some architectures)
+* Highly Portable (works on many Unix-like/POSIX compatible platforms as
+ well as Windows, macOS, Haiku, etc.) cf.
+ https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
+
+
+## How to get Ruby
+
+For a complete list of ways to install Ruby, including using third-party tools
+like rvm, see:
+
+https://www.ruby-lang.org/en/downloads/
+
+### Git
+
+The mirror of the Ruby source tree can be checked out with the following command:
+
+ $ git clone https://github.com/ruby/ruby.git
+
+There are some other branches under development. Try the following command
+to see the list of branches:
+
+ $ git ls-remote https://github.com/ruby/ruby.git
+
+You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
+if you are a committer.
+
+### Subversion
+
+Stable branches for older Ruby versions can be checked out with the following command:
+
+ $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
+
+Try the following command to see the list of branches:
+
+ $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
+
+
+## Ruby home page
+
+https://www.ruby-lang.org/
+
+## Mailing list
+
+There is a mailing list to discuss Ruby. To subscribe to this list, please
+send the following phrase:
+
+ subscribe
+
+in the mail body (not subject) to the address
+[ruby-talk-request@ruby-lang.org](mailto:ruby-talk-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe).
+
+## How to compile and install
+
+1. If you want to use Microsoft Visual C++ to compile Ruby, read
+ [win32/README.win32](win32/README.win32) instead of this document.
+
+2. If `./configure` does not exist or is older than `configure.ac`, run
+ `autoconf` to (re)generate configure.
+
+3. Run `./configure`, which will generate `config.h` and `Makefile`.
+
+ Some C compiler flags may be added by default depending on your
+ environment. Specify `optflags=..` and `warnflags=..` as necessary to
+ override them.
+
+4. Edit `defines.h` if you need. Usually this step will not be needed.
+
+5. Remove comment mark(`#`) before the module names from `ext/Setup` (or add
+ module names if not present), if you want to link modules statically.
+
+ If you don't want to compile non static extension modules (probably on
+ architectures which do not allow dynamic loading), remove comment mark
+ from the line "`#option nodynamic`" in `ext/Setup`.
+
+ Usually this step will not be needed.
+
+6. Run `make`.
+
+ * On Mac, set RUBY\_CODESIGN environment variable with a signing identity.
+ It uses the identity to sign `ruby` binary. See also codesign(1).
+
+7. Optionally, run '`make check`' to check whether the compiled Ruby
+ interpreter works well. If you see the message "`check succeeded`", your
+ Ruby works as it should (hopefully).
+
+8. Optionally, run `make update-gems` and `make extract-gems`.
+
+ If you want to install bundled gems, run `make update-gems` and
+ `make extract-gems` before running `make install`.
+
+9. Run '`make install`'.
+
+ This command will create the following directories and install files into
+ them.
+
+ * `${DESTDIR}${prefix}/bin`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib`
+ * `${DESTDIR}${prefix}/lib/ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+ * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+ * `${DESTDIR}${prefix}/share/man/man1`
+ * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+ If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
+ `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
+
+ **NOTE**: teeny of the API version may be different from one of Ruby's
+ program version
+
+ You may have to be a super user to install Ruby.
+
+If you fail to compile Ruby, please send the detailed error report with the
+error log and machine/OS type, to help others.
+
+Some extension libraries may not get compiled because of lack of necessary
+external libraries and/or headers, then you will need to run '`make distclean-ext`'
+to remove old configuration after installing them in such case.
+
+## Copying
+
+See the file [COPYING](COPYING).
+
+## Feedback
+
+Questions about the Ruby language can be asked on the Ruby-Talk mailing list
+(https://www.ruby-lang.org/en/community/mailing-lists) or on websites like
+(https://stackoverflow.com).
+
+Bugs should be reported at https://bugs.ruby-lang.org. Read [HowToReport] for more information.
+
+[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
+
+## Contributing
+
+See the file [CONTRIBUTING.md](CONTRIBUTING.md)
+
+## The Author
+
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
+
+<matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
deleted file mode 100644
index b55e399edf..0000000000
--- a/ToDo
+++ /dev/null
@@ -1,126 +0,0 @@
-Language Spec.
-
-- Class#allocate - basicNew
-- class Foo::Bar<Baz .. end, module Boo::Bar .. end
-* operator !! for rescue. ???
-* objectify characters
-* ../... outside condition invokes operator method too.
-* ... inside condition turns off just before right condition.???
-* package or access control for global variables??
-* named arguments like foo(nation:="german") or foo(nation: "german").
-* method to retrieve argument information (needs new C API)
-* multiple return values, yield values. maybe incompatible ???
-* cascading method invocation ???
-* def Class#method .. end ??
-* def Foo::Bar::baz() .. end ??
-* I18N (or M17N) script/string/regexp
-* Fixnum 0 as false ????
-* discourage use of symbol variables (e.g. $/, etc.) in manual
-* discourage use of Perlish features by giving warnings.
-* non confusing in-block local variable (is it possible?)
- + remove scope by block
- + variables appears within block may have independent values.
-* Regexp: make /o thread safe.
-* decide whether begin with rescue or ensure make do..while loop.
-* a +1 to be a+1, not a(+1).
-* unify == and eql? again
-* to_i returns nil if str contains no digit.
-* raise exception by `` error
-* jar like combined library package. -> RubyGems?
-* resumable Exception via Exception#resume.
-* method combination, e.g. before, after, around, etc.
-* .. or something like defadvice in Emacs.
-* property - for methods, or for objects in general.
-* "in" modifier, to annotate, or to encourage assertion.
-* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
-* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
-* warn/error "bare word" method, like "foo", you should type "foo()"
-* clarify evaluation order of operator argument (=~, .., ...)
-* :symbol => value hash in the form of {symbol: value, ...} ??
-
-Hacking Interpreter
-
-- generational GC
-* non-blocking open (e.g. for named pipe) for thread
-* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
-* objectify interpreters ???
-* remove rb_eval() recursions
-* syntax tree -> bytecode ???
-* scrambled script, or script filter
-* setuid ruby
-* performance tune for in-block (dynamic) local variables.
-* give warnings to assign magic variables.
-* export rb_io_{addstr,printf,puts,print}
-* autoload should work with threads [ruby-talk:4589]
-* remove stdio dependency from IOs.
-* warn for inconsistent local variable usage (lv m and method m at the same time).
-* MicroRuby
-* Built-in Interactive Ruby.
-* Parser API
-* trap every method invocation, which can be enabled by e.g. trap_call :method.
-* unify Errno exceptions of same errno, or new exception comparison scheme.
-* 2.times{|i| if i==0 then a = 15 else puts eval("a") end} should print nil.
-* Thread#max_stack_size attribute (possible??)
-
-Standard Libraries
-
-- Module#define_method which takes a name and a body (block, proc or method).
-- Enume#inject
-- Array#fetch
-- IO::for_fd
-- Process::waitall [ruby-talk:4557]
-- Process::Status
-- File::lchown, File::lchmod; xxx - still need work for non existing platforms
-- move Time::times to Process.
-- Enumerable#sort_by for Schwartzian transformation
-- fork_and_kill_other_threads.
-- signal list (Signal::trap, Signal::list).
-- move NameError under StandardError.
-- Integer#to_s(base)
-- Hash::new{default}
-- hash etc. should handle self referenceing array/hash
-- Array#select(n1,n2...) works like Array#indexes(n1,n2...)
-- use Mersenne Twister RNG for random.
-- deprecate Array#indexes, and Array#indices.
-- remove dependency on MAXPATHLEN.
-* String#scanf(?)
-* Object#fmt(?)
-* Time::strptime
-* Integer[num], Float[num]; Fixnum[num]?
-* method to retrieve non-number trailer for to_i/to_f.
-* Stream or Port, abstract superclass of IO ?
-* String#{pred,prev}, String#downto
-* optional stepsize argument for succ()
-* Ruby module -- Ruby::Version, Ruby::Interpreter
-* introduce Boolean class; super of TrueClass, FalseClass
-* synchronized method - synchronized{...}, synchronized :foo, :bar
-* Array#&, Array#| to allow duplication. ???
-* way to specify immortal (fork endurance) thread;
-* or raise ForkException to every thread but fork caller.
-* new user-defined marshal scheme. _dump(dumper), _load(restorer)
-* library to load per-user profile seeking .ruby_profile or ruby.ini file.
-* warning framework (warn, warning for Ruby level)
-* marshal should not depend on sprintf (works bad with locale).
-* ternary arg pow: a.pow(b,c) == a**b%c
-* new caller(), e.g. call_stack; needs better name.
-* pointer share mechanism similar to one in String for Array.
-* require "1.6" etc. by /usr/lib/ruby/1.6/1.6.rb ;-)
-* save both "feature names" and "normalized path" in $"
-* implement Mutex_m (or MutexMixin) using Mutex.
-
-Extension Libraries
-
-* ptk.rb pTk wrapper that is compatible to tk.rb
-* Berkeley DB extension
-* BitVector
-* thread-safe fcgi
-
-Ruby Libraries
-
-* urllib.rb, nttplib.rb, etc.
-* format like perl's
-
-Tools
-
-* freeze or undump to bundle everything
-* bundle using zlib
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000000..ed7d14ef63
--- /dev/null
+++ b/aclocal.m4
@@ -0,0 +1,47 @@
+# generated automatically by aclocal 1.16.1 -*- Autoconf -*-
+
+# Copyright (C) 1996-2018 Free Software Foundation, Inc.
+
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
+m4_include([tool/m4/_colorize_result_prepare.m4])
+m4_include([tool/m4/ac_msg_result.m4])
+m4_include([tool/m4/colorize_result.m4])
+m4_include([tool/m4/ruby_append_option.m4])
+m4_include([tool/m4/ruby_append_options.m4])
+m4_include([tool/m4/ruby_check_builtin_func.m4])
+m4_include([tool/m4/ruby_check_builtin_setjmp.m4])
+m4_include([tool/m4/ruby_check_printf_prefix.m4])
+m4_include([tool/m4/ruby_check_setjmp.m4])
+m4_include([tool/m4/ruby_check_signedness.m4])
+m4_include([tool/m4/ruby_check_sizeof.m4])
+m4_include([tool/m4/ruby_check_sysconf.m4])
+m4_include([tool/m4/ruby_cppoutfile.m4])
+m4_include([tool/m4/ruby_decl_attribute.m4])
+m4_include([tool/m4/ruby_default_arch.m4])
+m4_include([tool/m4/ruby_define_if.m4])
+m4_include([tool/m4/ruby_defint.m4])
+m4_include([tool/m4/ruby_dtrace_available.m4])
+m4_include([tool/m4/ruby_dtrace_postprocess.m4])
+m4_include([tool/m4/ruby_func_attribute.m4])
+m4_include([tool/m4/ruby_mingw32.m4])
+m4_include([tool/m4/ruby_prepend_option.m4])
+m4_include([tool/m4/ruby_prog_gnu_ld.m4])
+m4_include([tool/m4/ruby_replace_funcs.m4])
+m4_include([tool/m4/ruby_replace_type.m4])
+m4_include([tool/m4/ruby_rm_recursive.m4])
+m4_include([tool/m4/ruby_setjmp_type.m4])
+m4_include([tool/m4/ruby_stack_grow_direction.m4])
+m4_include([tool/m4/ruby_try_cflags.m4])
+m4_include([tool/m4/ruby_try_ldflags.m4])
+m4_include([tool/m4/ruby_type_attribute.m4])
+m4_include([tool/m4/ruby_universal_arch.m4])
+m4_include([tool/m4/ruby_werror_flag.m4])
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..635194b96b
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,2663 @@
+/**********************************************************************
+
+ addr2line.c -
+
+ $Author$
+
+ Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#if defined(__clang__)
+#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
+#pragma clang diagnostic ignored "-Wgcc-compat"
+#endif
+
+#include "ruby/config.h"
+#include "ruby/defines.h"
+#include "ruby/missing.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef HAVE_LIBPROC_H
+#include <libproc.h>
+#endif
+
+#ifdef HAVE_STDBOOL_H
+#include <stdbool.h>
+#else
+#include "missing/stdbool.h"
+#endif
+
+#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
+
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdint.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+/* Make alloca work the best possible way. */
+#ifdef __GNUC__
+# ifndef alloca
+# define alloca __builtin_alloca
+# endif
+#else
+# ifdef HAVE_ALLOCA_H
+# include <alloca.h>
+# else
+# ifdef _AIX
+#pragma alloca
+# else
+# ifndef alloca /* predefined by HP cc +Olibcalls */
+void *alloca();
+# endif
+# endif /* AIX */
+# endif /* HAVE_ALLOCA_H */
+#endif /* __GNUC__ */
+
+#ifdef HAVE_DLADDR
+# include <dlfcn.h>
+#endif
+
+#ifdef HAVE_MACH_O_LOADER_H
+# include <crt_externs.h>
+# include <mach-o/fat.h>
+# include <mach-o/loader.h>
+# include <mach-o/nlist.h>
+# include <mach-o/stab.h>
+#endif
+
+#ifdef USE_ELF
+# ifdef __OpenBSD__
+# include <elf_abi.h>
+# else
+# include <elf.h>
+# endif
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+# define ElfW(x) Elf64##_##x
+# else
+# define ElfW(x) Elf32##_##x
+# endif
+#endif
+#ifndef ELF_ST_TYPE
+# if SIZEOF_VOIDP == 8
+# define ELF_ST_TYPE ELF64_ST_TYPE
+# else
+# define ELF_ST_TYPE ELF32_ST_TYPE
+# endif
+#endif
+#endif
+
+#ifdef SHF_COMPRESSED
+# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
+ /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
+# include <zlib.h>
+# define SUPPORT_COMPRESSED_DEBUG_LINE
+# endif
+#else /* compatibility with glibc < 2.22 */
+# define SHF_COMPRESSED 0
+#endif
+
+#ifndef PATH_MAX
+#define PATH_MAX 4096
+#endif
+
+#define DW_LNS_copy 0x01
+#define DW_LNS_advance_pc 0x02
+#define DW_LNS_advance_line 0x03
+#define DW_LNS_set_file 0x04
+#define DW_LNS_set_column 0x05
+#define DW_LNS_negate_stmt 0x06
+#define DW_LNS_set_basic_block 0x07
+#define DW_LNS_const_add_pc 0x08
+#define DW_LNS_fixed_advance_pc 0x09
+#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
+#define DW_LNS_set_isa 0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence 0x01
+#define DW_LNE_set_address 0x02
+#define DW_LNE_define_file 0x03
+#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
+
+PRINTF_ARGS(static int kprintf(const char *fmt, ...), 1, 2);
+
+typedef struct line_info {
+ const char *dirname;
+ const char *filename;
+ const char *path; /* object path */
+ int line;
+
+ uintptr_t base_addr;
+ uintptr_t saddr;
+ const char *sname; /* function name */
+
+ struct line_info *next;
+} line_info_t;
+
+struct dwarf_section {
+ char *ptr;
+ size_t size;
+ uint64_t flags;
+};
+
+typedef struct obj_info {
+ const char *path; /* object path */
+ char *mapped;
+ size_t mapped_size;
+ void *uncompressed;
+ uintptr_t base_addr;
+ uintptr_t vmaddr;
+ struct dwarf_section debug_abbrev;
+ struct dwarf_section debug_info;
+ struct dwarf_section debug_line;
+ struct dwarf_section debug_ranges;
+ struct dwarf_section debug_str;
+ struct obj_info *next;
+} obj_info_t;
+
+#define DWARF_SECTION_COUNT 5
+
+static struct dwarf_section *
+obj_dwarf_section_at(obj_info_t *obj, int n)
+{
+ struct dwarf_section *ary[] = {
+ &obj->debug_abbrev,
+ &obj->debug_info,
+ &obj->debug_line,
+ &obj->debug_ranges,
+ &obj->debug_str
+ };
+ if (n < 0 || DWARF_SECTION_COUNT <= n) {
+ abort();
+ }
+ return ary[n];
+}
+
+struct debug_section_definition {
+ const char *name;
+ struct dwarf_section *dwarf;
+};
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX + 1];
+
+static unsigned long
+uleb128(char **p)
+{
+ unsigned long r = 0;
+ int s = 0;
+ for (;;) {
+ unsigned char b = *(unsigned char *)(*p)++;
+ if (b < 0x80) {
+ r += (unsigned long)b << s;
+ break;
+ }
+ r += (b & 0x7f) << s;
+ s += 7;
+ }
+ return r;
+}
+
+static long
+sleb128(char **p)
+{
+ long r = 0;
+ int s = 0;
+ for (;;) {
+ unsigned char b = *(unsigned char *)(*p)++;
+ if (b < 0x80) {
+ if (b & 0x40) {
+ r -= (0x80 - b) << s;
+ }
+ else {
+ r += (b & 0x3f) << s;
+ }
+ break;
+ }
+ r += (b & 0x7f) << s;
+ s += 7;
+ }
+ return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, char *p)
+{
+ if (!dir--) {
+ return "";
+ }
+ while (dir--) {
+ while (*p) p++;
+ p++;
+ if (!*p) {
+ kprintf("Unexpected directory number %lu in %s\n",
+ dir, binary_filename);
+ return "";
+ }
+ }
+ return p;
+}
+
+static void
+fill_filename(int file, char *include_directories, char *filenames, line_info_t *line, obj_info_t *obj)
+{
+ int i;
+ char *p = filenames;
+ char *filename;
+ unsigned long dir;
+ for (i = 1; i <= file; i++) {
+ filename = p;
+ if (!*p) {
+ /* Need to output binary file name? */
+ kprintf("Unexpected file number %d in %s at %tx\n",
+ file, binary_filename, filenames - obj->mapped);
+ return;
+ }
+ while (*p) p++;
+ p++;
+ dir = uleb128(&p);
+ /* last modified. */
+ uleb128(&p);
+ /* size of the file. */
+ uleb128(&p);
+
+ if (i == file) {
+ line->filename = filename;
+ line->dirname = get_nth_dirname(dir, include_directories);
+ }
+ }
+}
+
+static void
+fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
+ char *include_directories, char *filenames,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ int i;
+ addr += obj->base_addr - obj->vmaddr;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t a = (uintptr_t)traces[i];
+ /* We assume one line code doesn't result >100 bytes of native code.
+ We may want more reliable way eventually... */
+ if (addr < a && a < addr + 100) {
+ fill_filename(file, include_directories, filenames, &lines[i], obj);
+ lines[i].line = line;
+ }
+ }
+}
+
+struct LineNumberProgramHeader {
+ uint64_t unit_length;
+ uint16_t version;
+ uint8_t format; /* 4 or 8 */
+ uint64_t header_length;
+ uint8_t minimum_instruction_length;
+ uint8_t maximum_operations_per_instruction;
+ uint8_t default_is_stmt;
+ int8_t line_base;
+ uint8_t line_range;
+ uint8_t opcode_base;
+ /* uint8_t standard_opcode_lengths[opcode_base-1]; */
+ const char *include_directories;
+ const char *filenames;
+ const char *cu_start;
+ const char *cu_end;
+};
+
+static int
+parse_debug_line_header(const char **pp, struct LineNumberProgramHeader *header)
+{
+ const char *p = *pp;
+ header->unit_length = *(uint32_t *)p;
+ p += sizeof(uint32_t);
+
+ header->format = 4;
+ if (header->unit_length == 0xffffffff) {
+ header->unit_length = *(uint64_t *)p;
+ p += sizeof(uint64_t);
+ header->format = 8;
+ }
+
+ header->cu_end = p + header->unit_length;
+
+ header->version = *(uint16_t *)p;
+ p += sizeof(uint16_t);
+ if (header->version > 4) return -1;
+
+ header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
+ p += header->format;
+ header->cu_start = p + header->header_length;
+
+ header->minimum_instruction_length = *(uint8_t *)p++;
+
+ if (header->version >= 4) {
+ /* maximum_operations_per_instruction = *(uint8_t *)p; */
+ if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
+ p++;
+ }
+
+ header->default_is_stmt = *(uint8_t *)p++;
+ header->line_base = *(int8_t *)p++;
+ header->line_range = *(uint8_t *)p++;
+ header->opcode_base = *(uint8_t *)p++;
+ /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
+ p += header->opcode_base - 1;
+
+ header->include_directories = p;
+
+ /* temporary measure for compress-debug-sections */
+ if (p >= header->cu_end) return -1;
+
+ /* skip include directories */
+ while (*p) {
+ p = memchr(p, '\0', header->cu_end - p);
+ if (!p) return -1;
+ p++;
+ }
+ p++;
+
+ header->filenames = p;
+
+ *pp = header->cu_start;
+
+ return 0;
+}
+
+static int
+parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ const char *p = (const char *)*debug_line;
+ struct LineNumberProgramHeader header;
+
+ /* The registers. */
+ unsigned long addr = 0;
+ unsigned int file = 1;
+ unsigned int line = 1;
+ /* unsigned int column = 0; */
+ int is_stmt;
+ /* int basic_block = 0; */
+ /* int end_sequence = 0; */
+ /* int prologue_end = 0; */
+ /* int epilogue_begin = 0; */
+ /* unsigned int isa = 0; */
+
+ if (parse_debug_line_header(&p, &header))
+ return -1;
+ is_stmt = header.default_is_stmt;
+
+#define FILL_LINE() \
+ do { \
+ fill_line(num_traces, traces, addr, file, line, \
+ (char *)header.include_directories, \
+ (char *)header.filenames, \
+ obj, lines, offset); \
+ /*basic_block = prologue_end = epilogue_begin = 0;*/ \
+ } while (0)
+
+ while (p < header.cu_end) {
+ unsigned long a;
+ unsigned char op = *p++;
+ switch (op) {
+ case DW_LNS_copy:
+ FILL_LINE();
+ break;
+ case DW_LNS_advance_pc:
+ a = uleb128((char **)&p);
+ addr += a;
+ break;
+ case DW_LNS_advance_line: {
+ long a = sleb128((char **)&p);
+ line += a;
+ break;
+ }
+ case DW_LNS_set_file:
+ file = (unsigned int)uleb128((char **)&p);
+ break;
+ case DW_LNS_set_column:
+ /*column = (unsigned int)*/(void)uleb128((char **)&p);
+ break;
+ case DW_LNS_negate_stmt:
+ is_stmt = !is_stmt;
+ break;
+ case DW_LNS_set_basic_block:
+ /*basic_block = 1; */
+ break;
+ case DW_LNS_const_add_pc:
+ a = ((255UL - header.opcode_base) / header.line_range) *
+ header.minimum_instruction_length;
+ addr += a;
+ break;
+ case DW_LNS_fixed_advance_pc:
+ a = *(unsigned char *)p++;
+ addr += a;
+ break;
+ case DW_LNS_set_prologue_end:
+ /* prologue_end = 1; */
+ break;
+ case DW_LNS_set_epilogue_begin:
+ /* epilogue_begin = 1; */
+ break;
+ case DW_LNS_set_isa:
+ /* isa = (unsigned int)*/(void)uleb128((char **)&p);
+ break;
+ case 0:
+ a = *(unsigned char *)p++;
+ op = *p++;
+ switch (op) {
+ case DW_LNE_end_sequence:
+ /* end_sequence = 1; */
+ FILL_LINE();
+ addr = 0;
+ file = 1;
+ line = 1;
+ /* column = 0; */
+ is_stmt = header.default_is_stmt;
+ /* end_sequence = 0; */
+ /* isa = 0; */
+ break;
+ case DW_LNE_set_address:
+ addr = *(unsigned long *)p;
+ p += sizeof(unsigned long);
+ break;
+ case DW_LNE_define_file:
+ kprintf("Unsupported operation in %s\n",
+ binary_filename);
+ break;
+ case DW_LNE_set_discriminator:
+ /* TODO:currently ignore */
+ uleb128((char **)&p);
+ break;
+ default:
+ kprintf("Unknown extended opcode: %d in %s\n",
+ op, binary_filename);
+ }
+ break;
+ default: {
+ uint8_t adjusted_opcode = op - header.opcode_base;
+ uint8_t operation_advance = adjusted_opcode / header.line_range;
+ /* NOTE: this code doesn't support VLIW */
+ addr += operation_advance * header.minimum_instruction_length;
+ line += header.line_base + (adjusted_opcode % header.line_range);
+ FILL_LINE();
+ }
+ }
+ }
+ *debug_line = (char *)p;
+ return 0;
+}
+
+static int
+parse_debug_line(int num_traces, void **traces,
+ char *debug_line, unsigned long size,
+ obj_info_t *obj, line_info_t *lines, int offset)
+{
+ char *debug_line_end = debug_line + size;
+ while (debug_line < debug_line_end) {
+ if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
+ return -1;
+ }
+ if (debug_line != debug_line_end) {
+ kprintf("Unexpected size of .debug_line in %s\n",
+ binary_filename);
+ }
+ return 0;
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset);
+
+static void
+append_obj(obj_info_t **objp)
+{
+ obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
+ if (*objp) (*objp)->next = newobj;
+ *objp = newobj;
+}
+
+#ifdef USE_ELF
+static void
+follow_debuglink(const char *debuglink, int num_traces, void **traces,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ /* Ideally we should check 4 paths to follow gnu_debuglink,
+ but we handle only one case for now as this format is used
+ by some linux distributions. See GDB's info for detail. */
+ static const char global_debug_dir[] = "/usr/lib/debug";
+ const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
+ char *p;
+ obj_info_t *o1 = *objp, *o2;
+ size_t len;
+
+ p = strrchr(binary_filename, '/');
+ if (!p) {
+ return;
+ }
+ p[1] = '\0';
+
+ len = strlen(binary_filename);
+ if (len >= PATH_MAX - global_debug_dir_len)
+ len = PATH_MAX - global_debug_dir_len - 1;
+ memmove(binary_filename + global_debug_dir_len, binary_filename, len);
+ memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
+ len += global_debug_dir_len;
+ strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
+
+ append_obj(objp);
+ o2 = *objp;
+ o2->base_addr = o1->base_addr;
+ o2->path = o1->path;
+ fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+#endif
+
+enum
+{
+ DW_TAG_compile_unit = 0x11,
+ DW_TAG_inlined_subroutine = 0x1d,
+ DW_TAG_subprogram = 0x2e,
+};
+
+/* Attributes encodings */
+enum
+{
+ DW_AT_sibling = 0x01,
+ DW_AT_location = 0x02,
+ DW_AT_name = 0x03,
+ /* Reserved 0x04 */
+ /* Reserved 0x05 */
+ /* Reserved 0x06 */
+ /* Reserved 0x07 */
+ /* Reserved 0x08 */
+ DW_AT_ordering = 0x09,
+ /* Reserved 0x0a */
+ DW_AT_byte_size = 0x0b,
+ /* Reserved 0x0c */
+ DW_AT_bit_size = 0x0d,
+ /* Reserved 0x0e */
+ /* Reserved 0x0f */
+ DW_AT_stmt_list = 0x10,
+ DW_AT_low_pc = 0x11,
+ DW_AT_high_pc = 0x12,
+ DW_AT_language = 0x13,
+ /* Reserved 0x14 */
+ DW_AT_discr = 0x15,
+ DW_AT_discr_value = 0x16,
+ DW_AT_visibility = 0x17,
+ DW_AT_import = 0x18,
+ DW_AT_string_length = 0x19,
+ DW_AT_common_reference = 0x1a,
+ DW_AT_comp_dir = 0x1b,
+ DW_AT_const_value = 0x1c,
+ DW_AT_containing_type = 0x1d,
+ DW_AT_default_value = 0x1e,
+ /* Reserved 0x1f */
+ DW_AT_inline = 0x20,
+ DW_AT_is_optional = 0x21,
+ DW_AT_lower_bound = 0x22,
+ /* Reserved 0x23 */
+ /* Reserved 0x24 */
+ DW_AT_producer = 0x25,
+ /* Reserved 0x26 */
+ DW_AT_prototyped = 0x27,
+ /* Reserved 0x28 */
+ /* Reserved 0x29 */
+ DW_AT_return_addr = 0x2a,
+ /* Reserved 0x2b */
+ DW_AT_start_scope = 0x2c,
+ /* Reserved 0x2d */
+ DW_AT_bit_stride = 0x2e,
+ DW_AT_upper_bound = 0x2f,
+ /* Reserved 0x30 */
+ DW_AT_abstract_origin = 0x31,
+ DW_AT_accessibility = 0x32,
+ DW_AT_address_class = 0x33,
+ DW_AT_artificial = 0x34,
+ DW_AT_base_types = 0x35,
+ DW_AT_calling_convention = 0x36,
+ DW_AT_count = 0x37,
+ DW_AT_data_member_location = 0x38,
+ DW_AT_decl_column = 0x39,
+ DW_AT_decl_file = 0x3a,
+ DW_AT_decl_line = 0x3b,
+ DW_AT_declaration = 0x3c,
+ DW_AT_discr_list = 0x3d,
+ DW_AT_encoding = 0x3e,
+ DW_AT_external = 0x3f,
+ DW_AT_frame_base = 0x40,
+ DW_AT_friend = 0x41,
+ DW_AT_identifier_case = 0x42,
+ /* Reserved 0x43 */
+ DW_AT_namelist_item = 0x44,
+ DW_AT_priority = 0x45,
+ DW_AT_segment = 0x46,
+ DW_AT_specification = 0x47,
+ DW_AT_static_link = 0x48,
+ DW_AT_type = 0x49,
+ DW_AT_use_location = 0x4a,
+ DW_AT_variable_parameter = 0x4b,
+ DW_AT_virtuality = 0x4c,
+ DW_AT_vtable_elem_location = 0x4d,
+ DW_AT_allocated = 0x4e,
+ DW_AT_associated = 0x4f,
+ DW_AT_data_location = 0x50,
+ DW_AT_byte_stride = 0x51,
+ DW_AT_entry_pc = 0x52,
+ DW_AT_use_UTF8 = 0x53,
+ DW_AT_extension = 0x54,
+ DW_AT_ranges = 0x55,
+ DW_AT_trampoline = 0x56,
+ DW_AT_call_column = 0x57,
+ DW_AT_call_file = 0x58,
+ DW_AT_call_line = 0x59,
+ DW_AT_description = 0x5a,
+ DW_AT_binary_scale = 0x5b,
+ DW_AT_decimal_scale = 0x5c,
+ DW_AT_small = 0x5d,
+ DW_AT_decimal_sign = 0x5e,
+ DW_AT_digit_count = 0x5f,
+ DW_AT_picture_string = 0x60,
+ DW_AT_mutable = 0x61,
+ DW_AT_threads_scaled = 0x62,
+ DW_AT_explicit = 0x63,
+ DW_AT_object_pointer = 0x64,
+ DW_AT_endianity = 0x65,
+ DW_AT_elemental = 0x66,
+ DW_AT_pure = 0x67,
+ DW_AT_recursive = 0x68,
+ DW_AT_signature = 0x69,
+ DW_AT_main_subprogram = 0x6a,
+ DW_AT_data_bit_offset = 0x6b,
+ DW_AT_const_expr = 0x6c,
+ DW_AT_enum_class = 0x6d,
+ DW_AT_linkage_name = 0x6e,
+ DW_AT_string_length_bit_size = 0x6f,
+ DW_AT_string_length_byte_size = 0x70,
+ DW_AT_rank = 0x71,
+ DW_AT_str_offsets_base = 0x72,
+ DW_AT_addr_base = 0x73,
+ DW_AT_rnglists_base = 0x74,
+ /* Reserved 0x75 */
+ DW_AT_dwo_name = 0x76,
+ DW_AT_reference = 0x77,
+ DW_AT_rvalue_reference = 0x78,
+ DW_AT_macros = 0x79,
+ DW_AT_call_all_calls = 0x7a,
+ DW_AT_call_all_source_calls = 0x7b,
+ DW_AT_call_all_tail_calls = 0x7c,
+ DW_AT_call_return_pc = 0x7d,
+ DW_AT_call_value = 0x7e,
+ DW_AT_call_origin = 0x7f,
+ DW_AT_call_parameter = 0x80,
+ DW_AT_call_pc = 0x81,
+ DW_AT_call_tail_call = 0x82,
+ DW_AT_call_target = 0x83,
+ DW_AT_call_target_clobbered = 0x84,
+ DW_AT_call_data_location = 0x85,
+ DW_AT_call_data_value = 0x86,
+ DW_AT_noreturn = 0x87,
+ DW_AT_alignment = 0x88,
+ DW_AT_export_symbols = 0x89,
+ DW_AT_deleted = 0x8a,
+ DW_AT_defaulted = 0x8b,
+ DW_AT_loclists_base = 0x8c,
+ DW_AT_lo_user = 0x2000,
+ DW_AT_hi_user = 0x3fff
+};
+
+/* Attribute form encodings */
+enum
+{
+ DW_FORM_addr = 0x01,
+ /* Reserved 0x02 */
+ DW_FORM_block2 = 0x03,
+ DW_FORM_block4 = 0x04,
+ DW_FORM_data2 = 0x05,
+ DW_FORM_data4 = 0x06,
+ DW_FORM_data8 = 0x07,
+ DW_FORM_string = 0x08,
+ DW_FORM_block = 0x09,
+ DW_FORM_block1 = 0x0a,
+ DW_FORM_data1 = 0x0b,
+ DW_FORM_flag = 0x0c,
+ DW_FORM_sdata = 0x0d,
+ DW_FORM_strp = 0x0e,
+ DW_FORM_udata = 0x0f,
+ DW_FORM_ref_addr = 0x10,
+ DW_FORM_ref1 = 0x11,
+ DW_FORM_ref2 = 0x12,
+ DW_FORM_ref4 = 0x13,
+ DW_FORM_ref8 = 0x14,
+ DW_FORM_ref_udata = 0x15,
+ DW_FORM_indirect = 0x16,
+ DW_FORM_sec_offset = 0x17,
+ DW_FORM_exprloc = 0x18,
+ DW_FORM_flag_present = 0x19,
+ DW_FORM_strx = 0x1a,
+ DW_FORM_addrx = 0x1b,
+ DW_FORM_ref_sup4 = 0x1c,
+ DW_FORM_strp_sup = 0x1d,
+ DW_FORM_data16 = 0x1e,
+ DW_FORM_line_strp = 0x1f,
+ DW_FORM_ref_sig8 = 0x20,
+ DW_FORM_implicit_const = 0x21,
+ DW_FORM_loclistx = 0x22,
+ DW_FORM_rnglistx = 0x23,
+ DW_FORM_ref_sup8 = 0x24,
+ DW_FORM_strx1 = 0x25,
+ DW_FORM_strx2 = 0x26,
+ DW_FORM_strx3 = 0x27,
+ DW_FORM_strx4 = 0x28,
+ DW_FORM_addrx1 = 0x29,
+ DW_FORM_addrx2 = 0x2a,
+ DW_FORM_addrx3 = 0x2b,
+ DW_FORM_addrx4 = 0x2c
+};
+
+enum {
+ VAL_none = 0,
+ VAL_cstr = 1,
+ VAL_data = 2,
+ VAL_uint = 3,
+ VAL_int = 4
+};
+
+# define ABBREV_TABLE_SIZE 256
+typedef struct {
+ obj_info_t *obj;
+ char *file;
+ char *current_cu;
+ uint64_t current_low_pc;
+ char *debug_line_cu_end;
+ char *debug_line_files;
+ char *debug_line_directories;
+ char *p;
+ char *cu_end;
+ char *pend;
+ char *q0;
+ char *q;
+ int format; // 4 or 8
+ uint8_t address_size;
+ int level;
+ char *abbrev_table[ABBREV_TABLE_SIZE];
+} DebugInfoReader;
+
+typedef struct {
+ ptrdiff_t pos;
+ int tag;
+ int has_children;
+} DIE;
+
+typedef struct {
+ union {
+ char *ptr;
+ uint64_t uint64;
+ int64_t int64;
+ } as;
+ uint64_t off;
+ uint64_t at;
+ uint64_t form;
+ size_t size;
+ int type;
+} DebugInfoValue;
+
+/* TODO: Big Endian */
+#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
+
+static uint16_t
+get_uint16(const uint8_t *p)
+{
+ return (uint16_t)MERGE_2INTS(p[0],p[1],8);
+}
+
+static uint32_t
+get_uint32(const uint8_t *p)
+{
+ return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
+}
+
+static uint64_t
+get_uint64(const uint8_t *p)
+{
+ return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
+}
+
+static uint8_t
+read_uint8(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 1);
+ return *p;
+}
+
+static uint16_t
+read_uint16(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 2);
+ return get_uint16(p);
+}
+
+static uint32_t
+read_uint24(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 3);
+ return (*p << 16) | get_uint16(p+1);
+}
+
+static uint32_t
+read_uint32(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 4);
+ return get_uint32(p);
+}
+
+static uint64_t
+read_uint64(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + 8);
+ return get_uint64(p);
+}
+
+static uintptr_t
+read_uintptr(char **ptr)
+{
+ const unsigned char *p = (const unsigned char *)*ptr;
+ *ptr = (char *)(p + SIZEOF_VOIDP);
+#if SIZEOF_VOIDP == 8
+ return get_uint64(p);
+#else
+ return get_uint32(p);
+#endif
+}
+
+static uint64_t
+read_uint(DebugInfoReader *reader)
+{
+ if (reader->format == 4) {
+ return read_uint32(&reader->p);
+ } else { /* 64 bit */
+ return read_uint64(&reader->p);
+ }
+}
+
+static uint64_t
+read_uleb128(DebugInfoReader *reader)
+{
+ return uleb128(&reader->p);
+}
+
+static int64_t
+read_sleb128(DebugInfoReader *reader)
+{
+ return sleb128(&reader->p);
+}
+
+static void
+debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
+{
+ reader->file = obj->mapped;
+ reader->obj = obj;
+ reader->p = obj->debug_info.ptr;
+ reader->pend = obj->debug_info.ptr + obj->debug_info.size;
+ reader->debug_line_cu_end = obj->debug_line.ptr;
+}
+
+static void
+di_read_debug_abbrev_cu(DebugInfoReader *reader)
+{
+ uint64_t prev = 0;
+ char *p = reader->q0;
+ for (;;) {
+ uint64_t abbrev_number = uleb128(&p);
+ if (abbrev_number <= prev) break;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ reader->abbrev_table[abbrev_number] = p;
+ }
+ prev = abbrev_number;
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ /* skip content */
+ for (;;) {
+ uint64_t at = uleb128(&p);
+ uint64_t form = uleb128(&p);
+ if (!at && !form) break;
+ }
+ }
+}
+
+static int
+di_read_debug_line_cu(DebugInfoReader *reader)
+{
+ const char *p;
+ struct LineNumberProgramHeader header;
+
+ p = (const char *)reader->debug_line_cu_end;
+ if (parse_debug_line_header(&p, &header))
+ return -1;
+
+ reader->debug_line_cu_end = (char *)header.cu_end;
+ reader->debug_line_directories = (char *)header.include_directories;
+ reader->debug_line_files = (char *)header.filenames;
+
+ return 0;
+}
+
+static void
+set_uint_value(DebugInfoValue *v, uint64_t n)
+{
+ v->as.uint64 = n;
+ v->type = VAL_uint;
+}
+
+static void
+set_int_value(DebugInfoValue *v, int64_t n)
+{
+ v->as.int64 = n;
+ v->type = VAL_int;
+}
+
+static void
+set_cstr_value(DebugInfoValue *v, char *s)
+{
+ v->as.ptr = s;
+ v->off = 0;
+ v->type = VAL_cstr;
+}
+
+static void
+set_cstrp_value(DebugInfoValue *v, char *s, uint64_t off)
+{
+ v->as.ptr = s;
+ v->off = off;
+ v->type = VAL_cstr;
+}
+
+static void
+set_data_value(DebugInfoValue *v, char *s)
+{
+ v->as.ptr = s;
+ v->type = VAL_data;
+}
+
+static const char *
+get_cstr_value(DebugInfoValue *v)
+{
+ if (v->as.ptr) {
+ return v->as.ptr + v->off;
+ } else {
+ return NULL;
+ }
+}
+
+static void
+debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v)
+{
+ switch (form) {
+ case DW_FORM_addr:
+ if (reader->address_size == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->address_size == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+ break;
+ case DW_FORM_block2:
+ v->size = read_uint16(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block4:
+ v->size = read_uint32(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_data4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_data8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_string:
+ v->size = strlen(reader->p);
+ set_cstr_value(v, reader->p);
+ reader->p += v->size + 1;
+ break;
+ case DW_FORM_block:
+ v->size = uleb128(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_block1:
+ v->size = read_uint8(&reader->p);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_data1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_flag:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_sdata:
+ set_int_value(v, read_sleb128(reader));
+ break;
+ case DW_FORM_strp:
+ set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
+ break;
+ case DW_FORM_udata:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_addr:
+ if (reader->address_size == 4) {
+ set_uint_value(v, read_uint32(&reader->p));
+ } else if (reader->address_size == 8) {
+ set_uint_value(v, read_uint64(&reader->p));
+ } else {
+ fprintf(stderr,"unknown address_size:%d", reader->address_size);
+ abort();
+ }
+ break;
+ case DW_FORM_ref1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_ref2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_ref4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_ref8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_ref_udata:
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_indirect:
+ /* TODO: read the referred value */
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_sec_offset:
+ set_uint_value(v, read_uint(reader)); /* offset */
+ /* addrptr: debug_addr */
+ /* lineptr: debug_line */
+ /* loclist: debug_loclists */
+ /* loclistptr: debug_loclists */
+ /* macptr: debug_macro */
+ /* rnglist: debug_rnglists */
+ /* rnglistptr: debug_rnglists */
+ /* stroffsetsptr: debug_str_offsets */
+ break;
+ case DW_FORM_exprloc:
+ v->size = (size_t)read_uleb128(reader);
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_flag_present:
+ set_uint_value(v, 1);
+ break;
+ case DW_FORM_strx:
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_addrx:
+ /* TODO: read .debug_addr */
+ set_uint_value(v, uleb128(&reader->p));
+ break;
+ case DW_FORM_ref_sup4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_strp_sup:
+ set_uint_value(v, read_uint(reader));
+ /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
+ break;
+ case DW_FORM_data16:
+ v->size = 16;
+ set_data_value(v, reader->p);
+ reader->p += v->size;
+ break;
+ case DW_FORM_line_strp:
+ set_uint_value(v, read_uint(reader));
+ /* *p = reader->file + reader->line->sh_offset + ret; */
+ break;
+ case DW_FORM_ref_sig8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_implicit_const:
+ set_int_value(v, sleb128(&reader->q));
+ break;
+ case DW_FORM_loclistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_rnglistx:
+ set_uint_value(v, read_uleb128(reader));
+ break;
+ case DW_FORM_ref_sup8:
+ set_uint_value(v, read_uint64(&reader->p));
+ break;
+ case DW_FORM_strx1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_strx2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_strx3:
+ set_uint_value(v, read_uint24(&reader->p));
+ break;
+ case DW_FORM_strx4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case DW_FORM_addrx1:
+ set_uint_value(v, read_uint8(&reader->p));
+ break;
+ case DW_FORM_addrx2:
+ set_uint_value(v, read_uint16(&reader->p));
+ break;
+ case DW_FORM_addrx3:
+ set_uint_value(v, read_uint24(&reader->p));
+ break;
+ case DW_FORM_addrx4:
+ set_uint_value(v, read_uint32(&reader->p));
+ break;
+ case 0:
+ goto fail;
+ break;
+ }
+ return;
+
+ fail:
+ fprintf(stderr, "%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
+ exit(1);
+}
+
+/* find abbrev in current compilation unit */
+static char *
+di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number)
+{
+ char *p;
+ if (abbrev_number < ABBREV_TABLE_SIZE) {
+ return reader->abbrev_table[abbrev_number];
+ }
+ p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
+ /* skip 255th record */
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ /* skip content */
+ for (;;) {
+ uint64_t at = uleb128(&p);
+ uint64_t form = uleb128(&p);
+ if (!at && !form) break;
+ }
+ for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
+ if (n == 0) {
+ fprintf(stderr,"%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
+ exit(1);
+ }
+ uleb128(&p); /* tag */
+ p++; /* has_children */
+ /* skip content */
+ for (;;) {
+ uint64_t at = uleb128(&p);
+ uint64_t form = uleb128(&p);
+ if (!at && !form) break;
+ }
+ }
+ return p;
+}
+
+#if 0
+static void
+hexdump0(const unsigned char *p, size_t n)
+{
+ size_t i;
+ fprintf(stderr, " 0 1 2 3 4 5 6 7 8 9 A B C D E F\n");
+ for (i=0; i < n; i++){
+ switch (i & 15) {
+ case 0:
+ fprintf(stderr, "%02zd: %02X ", i/16, p[i]);
+ break;
+ case 15:
+ fprintf(stderr, "%02X\n", p[i]);
+ break;
+ default:
+ fprintf(stderr, "%02X ", p[i]);
+ break;
+ }
+ }
+ if ((i & 15) != 15) {
+ fprintf(stderr, "\n");
+ }
+}
+#define hexdump(p,n) hexdump0((const unsigned char *)p, n)
+
+static void
+div_inspect(DebugInfoValue *v)
+{
+ switch (v->type) {
+ case VAL_uint:
+ fprintf(stderr,"%d: type:%d size:%zx v:%lx\n",__LINE__,v->type,v->size,v->as.uint64);
+ break;
+ case VAL_int:
+ fprintf(stderr,"%d: type:%d size:%zx v:%ld\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
+ break;
+ case VAL_cstr:
+ fprintf(stderr,"%d: type:%d size:%zx v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
+ break;
+ case VAL_data:
+ fprintf(stderr,"%d: type:%d size:%zx v:\n",__LINE__,v->type,v->size);
+ hexdump(v->as.ptr, 16);
+ break;
+ }
+}
+#endif
+
+static DIE *
+di_read_die(DebugInfoReader *reader, DIE *die)
+{
+ uint64_t abbrev_number = uleb128(&reader->p);
+ if (abbrev_number == 0) {
+ reader->level--;
+ return NULL;
+ }
+
+ reader->q = di_find_abbrev(reader, abbrev_number);
+
+ die->pos = reader->p - reader->obj->debug_info.ptr - 1;
+ die->tag = (int)uleb128(&reader->q); /* tag */
+ die->has_children = *reader->q++; /* has_children */
+ if (die->has_children) {
+ reader->level++;
+ }
+ return die;
+}
+
+static DebugInfoValue *
+di_read_record(DebugInfoReader *reader, DebugInfoValue *vp)
+{
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return NULL;
+ vp->at = at;
+ vp->form = form;
+ debug_info_reader_read_value(reader, form, vp);
+ return vp;
+}
+
+static void
+di_skip_records(DebugInfoReader *reader)
+{
+ for (;;) {
+ DebugInfoValue v = {{}};
+ uint64_t at = uleb128(&reader->q);
+ uint64_t form = uleb128(&reader->q);
+ if (!at || !form) return;
+ debug_info_reader_read_value(reader, form, &v);
+ }
+}
+
+typedef struct {
+ uint64_t low_pc;
+ uint64_t high_pc;
+ uint64_t ranges;
+ bool low_pc_set;
+ bool high_pc_set;
+ bool ranges_set;
+} ranges_t;
+
+static void
+ranges_set(ranges_t *ptr, DebugInfoValue *v)
+{
+ switch (v->at) {
+ case DW_AT_low_pc:
+ ptr->low_pc = v->as.uint64;
+ ptr->low_pc_set = true;
+ break;
+ case DW_AT_high_pc:
+ if (v->form == DW_FORM_addr) {
+ ptr->high_pc = v->as.uint64;
+ }
+ else {
+ ptr->high_pc = ptr->low_pc + v->as.uint64;
+ }
+ ptr->high_pc_set = true;
+ break;
+ case DW_AT_ranges:
+ ptr->ranges = v->as.uint64;
+ ptr->ranges_set = true;
+ break;
+ }
+}
+
+static uintptr_t
+ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ exit(1);
+ }
+ if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ else if (ptr->ranges_set) {
+ /* TODO: support base address selection entry */
+ char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ if (from == UINTPTR_MAX) {
+ /* base address selection entry */
+ base = to;
+ }
+ else if (base + from <= addr && addr < base + to) {
+ return from;
+ }
+ }
+ }
+ else if (ptr->low_pc_set) {
+ if (ptr->low_pc == addr) {
+ return (uintptr_t)ptr->low_pc;
+ }
+ }
+ return false;
+}
+
+#if 0
+static void
+ranges_inspect(DebugInfoReader *reader, ranges_t *ptr)
+{
+ if (ptr->high_pc_set) {
+ if (ptr->ranges_set || !ptr->low_pc_set) {
+ fprintf(stderr,"low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
+ exit(1);
+ }
+ fprintf(stderr,"low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
+ }
+ else if (ptr->ranges_set) {
+ char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
+ fprintf(stderr,"low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
+ for (;;) {
+ uintptr_t from = read_uintptr(&p);
+ uintptr_t to = read_uintptr(&p);
+ if (!from && !to) break;
+ fprintf(stderr,"%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
+ }
+ fprintf(stderr,"\n");
+ }
+ else if (ptr->low_pc_set) {
+ fprintf(stderr,"low_pc:%"PRIx64"\n",ptr->low_pc);
+ }
+ else {
+ fprintf(stderr,"empty\n");
+ }
+}
+#endif
+
+static int
+di_read_cu(DebugInfoReader *reader)
+{
+ uint64_t unit_length;
+ uint16_t version;
+ uint64_t debug_abbrev_offset;
+ reader->format = 4;
+ reader->current_cu = reader->p;
+ unit_length = read_uint32(&reader->p);
+ if (unit_length == 0xffffffff) {
+ unit_length = read_uint64(&reader->p);
+ reader->format = 8;
+ }
+ reader->cu_end = reader->p + unit_length;
+ version = read_uint16(&reader->p);
+ if (version > 5) {
+ return -1;
+ }
+ else if (version == 5) {
+ /* unit_type = */ read_uint8(&reader->p);
+ reader->address_size = read_uint8(&reader->p);
+ debug_abbrev_offset = read_uint(reader);
+ }
+ else {
+ debug_abbrev_offset = read_uint(reader);
+ reader->address_size = read_uint8(&reader->p);
+ }
+ reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
+
+ reader->level = 0;
+ di_read_debug_abbrev_cu(reader);
+ if (di_read_debug_line_cu(reader)) return -1;
+
+#if defined(__GNUC__) && !defined(__clang__) && !defined(__INTEL_COMPILER_BUILD_DATE)
+ /* Though DWARF specifies "the applicable base address defaults to the base
+ address of the compilation unit", but GCC seems to use zero as default */
+#else
+ do {
+ DIE die;
+
+ if (!di_read_die(reader, &die)) continue;
+
+ if (die.tag != DW_TAG_compile_unit) {
+ di_skip_records(reader);
+ break;
+ }
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_low_pc:
+ reader->current_low_pc = v.as.uint64;
+ break;
+ }
+ }
+ } while (0);
+#endif
+ return 0;
+}
+
+static void
+read_abstract_origin(DebugInfoReader *reader, uint64_t abstract_origin, line_info_t *line)
+{
+ char *p = reader->p;
+ char *q = reader->q;
+ int level = reader->level;
+ DIE die;
+
+ reader->p = reader->current_cu + abstract_origin;
+ if (!di_read_die(reader, &die)) goto finish;
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ if (!di_read_record(reader, &v)) break;
+ switch (v.at) {
+ case DW_AT_name:
+ line->sname = get_cstr_value(&v);
+ break;
+ }
+ }
+
+ finish:
+ reader->p = p;
+ reader->q = q;
+ reader->level = level;
+}
+
+static void
+debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
+ line_info_t *lines, int offset) {
+ while (reader->p < reader->cu_end) {
+ DIE die;
+ ranges_t ranges = {};
+ line_info_t line = {};
+
+ if (!di_read_die(reader, &die)) continue;
+ /* fprintf(stderr,"%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
+
+ if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
+ skip_die:
+ di_skip_records(reader);
+ continue;
+ }
+
+ /* enumerate abbrev */
+ for (;;) {
+ DebugInfoValue v = {{}};
+ /* ptrdiff_t pos = reader->p - reader->p0; */
+ if (!di_read_record(reader, &v)) break;
+ /* fprintf(stderr,"\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
+ /* div_inspect(&v); */
+ switch (v.at) {
+ case DW_AT_name:
+ line.sname = get_cstr_value(&v);
+ break;
+ case DW_AT_call_file:
+ fill_filename((int)v.as.uint64, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj);
+ break;
+ case DW_AT_call_line:
+ line.line = (int)v.as.uint64;
+ break;
+ case DW_AT_low_pc:
+ case DW_AT_high_pc:
+ case DW_AT_ranges:
+ ranges_set(&ranges, &v);
+ break;
+ case DW_AT_declaration:
+ goto skip_die;
+ case DW_AT_inline:
+ /* 1 or 3 */
+ break; /* goto skip_die; */
+ case DW_AT_abstract_origin:
+ read_abstract_origin(reader, v.as.uint64, &line);
+ break; /* goto skip_die; */
+ }
+ }
+ /* ranges_inspect(reader, &ranges); */
+ /* fprintf(stderr,"%d:%tx: %x ",__LINE__,diepos,die.tag); */
+ for (int i=offset; i < num_traces; i++) {
+ uintptr_t addr = (uintptr_t)traces[i];
+ uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
+ uintptr_t saddr = ranges_include(reader, &ranges, offset);
+ if (saddr) {
+ /* fprintf(stderr, "%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
+ if (lines[i].sname) {
+ line_info_t *lp = malloc(sizeof(line_info_t));
+ memcpy(lp, &lines[i], sizeof(line_info_t));
+ lines[i].next = lp;
+ lp->dirname = line.dirname;
+ lp->filename = line.filename;
+ lp->line = line.line;
+ lp->saddr = 0;
+ }
+ lines[i].path = reader->obj->path;
+ lines[i].base_addr = line.base_addr;
+ lines[i].sname = line.sname;
+ lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
+ }
+ }
+ }
+}
+
+#ifdef USE_ELF
+static unsigned long
+uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
+{
+#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
+ ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
+ unsigned long destsize = chdr->ch_size;
+ int ret = 0;
+
+ if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
+ /* unsupported compression type */
+ return 0;
+ }
+
+ *ptr = malloc(destsize);
+ if (!*ptr) return 0;
+ ret = uncompress((Bytef *)*ptr, &destsize,
+ (const Bytef*)chdr + sizeof(ElfW(Chdr)),
+ shdr->sh_size - sizeof(ElfW(Chdr)));
+ if (ret != Z_OK) goto fail;
+ return destsize;
+
+fail:
+ free(*ptr);
+#endif
+ return 0;
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+ int i, j;
+ char *shstr;
+ ElfW(Ehdr) *ehdr;
+ ElfW(Shdr) *shdr, *shstr_shdr;
+ ElfW(Shdr) *gnu_debuglink_shdr = NULL;
+ int fd;
+ off_t filesize;
+ char *file;
+ ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
+ ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
+ obj_info_t *obj = *objp;
+ uintptr_t dladdr_fbase = 0;
+
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ goto fail;
+ }
+ filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ kprintf("lseek: %s\n", strerror(e));
+ goto fail;
+ }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+ if (filesize > (off_t)SIZE_MAX) {
+ close(fd);
+ kprintf("Too large file %s\n", binary_filename);
+ goto fail;
+ }
+#endif
+ lseek(fd, 0, SEEK_SET);
+ /* async-signal unsafe */
+ file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+ if (file == MAP_FAILED) {
+ int e = errno;
+ close(fd);
+ kprintf("mmap: %s\n", strerror(e));
+ goto fail;
+ }
+ close(fd);
+
+ ehdr = (ElfW(Ehdr) *)file;
+ if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
+ /*
+ * Huh? Maybe filename was overridden by setproctitle() and
+ * it match non-elf file.
+ */
+ goto fail;
+ }
+ obj->mapped = file;
+ obj->mapped_size = (size_t)filesize;
+
+ shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+ shstr_shdr = shdr + ehdr->e_shstrndx;
+ shstr = file + shstr_shdr->sh_offset;
+
+ for (i = 0; i < ehdr->e_shnum; i++) {
+ char *section_name = shstr + shdr[i].sh_name;
+ switch (shdr[i].sh_type) {
+ case SHT_STRTAB:
+ if (!strcmp(section_name, ".strtab")) {
+ strtab_shdr = shdr + i;
+ }
+ else if (!strcmp(section_name, ".dynstr")) {
+ dynstr_shdr = shdr + i;
+ }
+ break;
+ case SHT_SYMTAB:
+ /* if (!strcmp(section_name, ".symtab")) */
+ symtab_shdr = shdr + i;
+ break;
+ case SHT_DYNSYM:
+ /* if (!strcmp(section_name, ".dynsym")) */
+ dynsym_shdr = shdr + i;
+ break;
+ case SHT_PROGBITS:
+ if (!strcmp(section_name, ".gnu_debuglink")) {
+ gnu_debuglink_shdr = shdr + i;
+ }
+ else {
+ const char *debug_section_names[] = {
+ ".debug_abbrev",
+ ".debug_info",
+ ".debug_line",
+ ".debug_ranges",
+ ".debug_str"
+ };
+
+ for (j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(section_name, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + shdr[i].sh_offset;
+ s->size = shdr[i].sh_size;
+ s->flags = shdr[i].sh_flags;
+ if (s->flags & SHF_COMPRESSED) {
+ s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
+ if (!s->size) goto fail;
+ }
+ break;
+ }
+ }
+ break;
+ }
+ }
+
+ if (offset == -1) {
+ /* main executable */
+ offset = 0;
+ if (dynsym_shdr && dynstr_shdr) {
+ char *strtab = file + dynstr_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+ int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+ void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+ if (handle) {
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ Dl_info info;
+ void *s;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
+ s = dlsym(handle, strtab + sym->st_name);
+ if (s && dladdr(s, &info)) {
+ obj->base_addr = dladdr_fbase;
+ dladdr_fbase = (uintptr_t)info.dli_fbase;
+ break;
+ }
+ }
+ dlclose(handle);
+ }
+ if (ehdr->e_type == ET_EXEC) {
+ obj->base_addr = 0;
+ }
+ else {
+ /* PIE (position-independent executable) */
+ obj->base_addr = dladdr_fbase;
+ }
+ }
+ }
+
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ i = 0;
+ while (reader.p < reader.pend) {
+ /* fprintf(stderr, "%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
+ if (di_read_cu(&reader)) goto use_symtab;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+ else {
+ /* This file doesn't have dwarf, use symtab or dynsym */
+use_symtab:
+ if (!symtab_shdr) {
+ /* This file doesn't have symtab, use dynsym instead */
+ symtab_shdr = dynsym_shdr;
+ strtab_shdr = dynstr_shdr;
+ }
+
+ if (symtab_shdr && strtab_shdr) {
+ char *strtab = file + strtab_shdr->sh_offset;
+ ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+ int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+ for (j = 0; j < symtab_count; j++) {
+ ElfW(Sym) *sym = &symtab[j];
+ uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+ if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
+ for (i = offset; i < num_traces; i++) {
+ uintptr_t d = (uintptr_t)traces[i] - saddr;
+ if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
+ lines[i].saddr = saddr;
+ lines[i].path = obj->path;
+ lines[i].base_addr = obj->base_addr;
+ }
+ }
+ }
+ }
+
+ if (!obj->debug_line.ptr) {
+ /* This file doesn't have .debug_line section,
+ let's check .gnu_debuglink section instead. */
+ if (gnu_debuglink_shdr && check_debuglink) {
+ follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+ num_traces, traces,
+ objp, lines, offset);
+ }
+ goto finish;
+ }
+
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
+finish:
+ return dladdr_fbase;
+fail:
+ return (uintptr_t)-1;
+}
+#else /* Mach-O */
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+ obj_info_t **objp, line_info_t *lines, int offset)
+{
+# ifdef __LP64__
+# define LP(x) x##_64
+# else
+# define LP(x) x
+# endif
+ int fd;
+ off_t filesize;
+ char *file, *p = NULL;
+ obj_info_t *obj = *objp;
+ struct LP(mach_header) *header;
+ uintptr_t dladdr_fbase = 0;
+
+ {
+ char *s = binary_filename;
+ char *base = strrchr(binary_filename, '/')+1;
+ size_t max = PATH_MAX;
+ size_t size = strlen(binary_filename);
+ size_t basesize = size - (base - binary_filename);
+ s += size;
+ max -= size;
+ p = s;
+ size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
+ if (size == 0) goto fail;
+ s += size;
+ max -= size;
+ if (max <= basesize) goto fail;
+ memcpy(s, base, basesize);
+ s[basesize] = 0;
+
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ *p = 0; /* binary_filename becomes original file name */
+ fd = open(binary_filename, O_RDONLY);
+ if (fd < 0) {
+ goto fail;
+ }
+ }
+ }
+
+ filesize = lseek(fd, 0, SEEK_END);
+ if (filesize < 0) {
+ int e = errno;
+ close(fd);
+ kprintf("lseek: %s\n", strerror(e));
+ goto fail;
+ }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+ if (filesize > (off_t)SIZE_MAX) {
+ close(fd);
+ kprintf("Too large file %s\n", binary_filename);
+ goto fail;
+ }
+#endif
+ lseek(fd, 0, SEEK_SET);
+ /* async-signal unsafe */
+ file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+ if (file == MAP_FAILED) {
+ int e = errno;
+ close(fd);
+ kprintf("mmap: %s\n", strerror(e));
+ goto fail;
+ }
+ close(fd);
+
+ obj->mapped = file;
+ obj->mapped_size = (size_t)filesize;
+
+ header = (struct LP(mach_header) *)file;
+ if (header->magic == LP(MH_MAGIC)) {
+ /* non universal binary */
+ p = file;
+ }
+ else if (header->magic == FAT_CIGAM) {
+ struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
+ struct fat_header *fat = (struct fat_header *)file;
+ char *q = file + sizeof(*fat);
+ uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
+ /* fprintf(stderr,"%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
+ for (uint32_t i = 0; i < nfat_arch; i++) {
+ struct fat_arch *arch = (struct fat_arch *)q;
+ cpu_type_t cputype = __builtin_bswap32(arch->cputype);
+ cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
+ uint32_t offset = __builtin_bswap32(arch->offset);
+ /* fprintf(stderr,"%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
+ if (mhp->cputype == cputype &&
+ (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
+ p = file + offset;
+ file = p;
+ header = (struct LP(mach_header) *)p;
+ if (header->magic == LP(MH_MAGIC)) {
+ goto found_mach_header;
+ }
+ break;
+ }
+ q += sizeof(*arch);
+ }
+ kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+ else {
+ kprintf("'%s' is not a "
+# ifdef __LP64__
+ "64"
+# else
+ "32"
+# endif
+ "-bit Mach-O file!\n",binary_filename);
+ close(fd);
+ goto fail;
+ }
+found_mach_header:
+ p += sizeof(*header);
+
+ for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
+ struct load_command *lcmd = (struct load_command *)p;
+ switch (lcmd->cmd) {
+ case LP(LC_SEGMENT):
+ {
+ static const char *debug_section_names[] = {
+ "__debug_abbrev",
+ "__debug_info",
+ "__debug_line",
+ "__debug_ranges",
+ "__debug_str"
+ };
+ struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
+ if (strcmp(scmd->segname, "__TEXT") == 0) {
+ obj->vmaddr = scmd->vmaddr;
+ }
+ else if (strcmp(scmd->segname, "__DWARF") == 0) {
+ p += sizeof(struct LP(segment_command));
+ for (uint64_t i = 0; i < scmd->nsects; i++) {
+ struct LP(section) *sect = (struct LP(section) *)p;
+ p += sizeof(struct LP(section));
+ for (int j=0; j < DWARF_SECTION_COUNT; j++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, j);
+
+ if (strcmp(sect->sectname, debug_section_names[j]) != 0)
+ continue;
+
+ s->ptr = file + sect->offset;
+ s->size = sect->size;
+ s->flags = sect->flags;
+ if (s->flags & SHF_COMPRESSED) {
+ goto fail;
+ }
+ break;
+ }
+ }
+ }
+ }
+ break;
+
+ case LC_SYMTAB:
+ {
+ struct symtab_command *cmd = (struct symtab_command *)lcmd;
+ struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
+ char *strtab = file + cmd->stroff, *sname = 0;
+ uint32_t j;
+ uintptr_t saddr = 0;
+ /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, p); */
+ for (j = 0; j < cmd->nsyms; j++) {
+ uintptr_t symsize, d;
+ struct LP(nlist) *e = &nl[j];
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ if (e->n_type != N_FUN) continue;
+ if (e->n_sect) {
+ saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
+ sname = strtab + e->n_un.n_strx;
+ /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
+ continue;
+ }
+ for (int k = offset; k < num_traces; k++) {
+ d = (uintptr_t)traces[k] - saddr;
+ symsize = e->n_value;
+ /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
+ if (lines[k].line > 0 || d > (uintptr_t)symsize)
+ continue;
+ /* fill symbol name and addr from .symtab */
+ if (!lines[k].sname) lines[k].sname = sname;
+ lines[k].saddr = saddr;
+ lines[k].path = obj->path;
+ lines[k].base_addr = obj->base_addr;
+ }
+ }
+ }
+ }
+ p += lcmd->cmdsize;
+ }
+
+ if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
+ DebugInfoReader reader;
+ debug_info_reader_init(&reader, obj);
+ while (reader.p < reader.pend) {
+ if (di_read_cu(&reader)) goto fail;
+ debug_info_read(&reader, num_traces, traces, lines, offset);
+ }
+ }
+
+ if (parse_debug_line(num_traces, traces,
+ obj->debug_line.ptr,
+ obj->debug_line.size,
+ obj, lines, offset) == -1)
+ goto fail;
+
+ return dladdr_fbase;
+fail:
+ return (uintptr_t)-1;
+}
+#endif
+
+#define HAVE_MAIN_EXE_PATH
+#if defined(__FreeBSD__)
+# include <sys/sysctl.h>
+#endif
+/* ssize_t main_exe_path(void)
+ *
+ * store the path of the main executable to `binary_filename`,
+ * and returns strlen(binary_filename).
+ * it is NUL terminated.
+ */
+#if defined(__linux__)
+static ssize_t
+main_exe_path(void)
+{
+# define PROC_SELF_EXE "/proc/self/exe"
+ ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+ if (len < 0) return 0;
+ binary_filename[len] = 0;
+ return len;
+}
+#elif defined(__FreeBSD__)
+static ssize_t
+main_exe_path(void)
+{
+ int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
+ size_t len = PATH_MAX;
+ int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
+ if (err) {
+ kprintf("Can't get the path of ruby");
+ return -1;
+ }
+ len--; /* sysctl sets strlen+1 */
+ return len;
+}
+#elif defined(HAVE_LIBPROC_H)
+static ssize_t
+main_exe_path(void)
+{
+ int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
+ if (len == 0) return 0;
+ binary_filename[len] = 0;
+ return len;
+}
+#else
+#undef HAVE_MAIN_EXE_PATH
+#endif
+
+static void
+print_line0(line_info_t *line, void *address)
+{
+ uintptr_t addr = (uintptr_t)address;
+ uintptr_t d = addr - line->saddr;
+ if (!address) {
+ /* inlined */
+ if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
+ }
+ }
+ else if (!line->path) {
+ kprintf("[0x%"PRIxPTR"]\n", addr);
+ }
+ else if (!line->saddr || !line->sname) {
+ kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
+ }
+ else if (line->line <= 0) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
+ d, addr);
+ }
+ else if (!line->filename) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
+ d, addr, line->line);
+ }
+ else if (line->dirname && line->dirname[0]) {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
+ d, addr, line->dirname, line->filename, line->line);
+ }
+ else {
+ kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
+ d, addr, line->filename, line->line);
+ }
+}
+
+static void
+print_line(line_info_t *line, void *address)
+{
+ print_line0(line, address);
+ if (line->next) {
+ print_line(line->next, NULL);
+ }
+}
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces)
+{
+ int i;
+ /* async-signal unsafe */
+ line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
+ obj_info_t *obj = NULL;
+ /* 2 is NULL + main executable */
+ void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+#ifdef HAVE_MAIN_EXE_PATH
+ char *main_path = NULL; /* used on printing backtrace */
+ ssize_t len;
+ if ((len = main_exe_path()) > 0) {
+ main_path = (char *)alloca(len + 1);
+ if (main_path) {
+ uintptr_t addr;
+ memcpy(main_path, binary_filename, len+1);
+ append_obj(&obj);
+ obj->path = main_path;
+ addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
+ if (addr != (uintptr_t)-1) {
+ dladdr_fbases[0] = (void *)addr;
+ }
+ }
+ }
+#endif
+
+ /* fill source lines by reading dwarf */
+ for (i = 0; i < num_traces; i++) {
+ Dl_info info;
+ if (lines[i].line) continue;
+ if (dladdr(traces[i], &info)) {
+ const char *path;
+ void **p;
+
+ /* skip symbols which is in already checked objects */
+ /* if the binary is strip-ed, this may effect */
+ for (p=dladdr_fbases; *p; p++) {
+ if (*p == info.dli_fbase) {
+ lines[i].path = info.dli_fname;
+ lines[i].sname = info.dli_sname;
+ goto next_line;
+ }
+ }
+ *p = info.dli_fbase;
+
+ append_obj(&obj);
+ obj->base_addr = (uintptr_t)info.dli_fbase;
+ path = info.dli_fname;
+ obj->path = path;
+ lines[i].path = path;
+ lines[i].sname = info.dli_sname;
+ lines[i].saddr = (uintptr_t)info.dli_saddr;
+ strlcpy(binary_filename, path, PATH_MAX);
+ if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
+ break;
+ }
+next_line:
+ continue;
+ }
+
+ /* output */
+ for (i = 0; i < num_traces; i++) {
+ print_line(&lines[i], traces[i]);
+
+ /* FreeBSD's backtrace may show _start and so on */
+ if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
+ break;
+ }
+
+ /* free */
+ while (obj) {
+ obj_info_t *o = obj;
+ for (i=0; i < DWARF_SECTION_COUNT; i++) {
+ struct dwarf_section *s = obj_dwarf_section_at(obj, i);
+ if (s->flags & SHF_COMPRESSED) {
+ free(s->ptr);
+ }
+ }
+ if (obj->mapped_size) {
+ munmap(obj->mapped, obj->mapped_size);
+ }
+ obj = o->next;
+ free(o);
+ }
+ for (i = 0; i < num_traces; i++) {
+ line_info_t *line = lines[i].next;
+ while (line) {
+ line_info_t *l = line;
+ line = line->next;
+ free(l);
+ }
+ }
+ free(lines);
+ free(dladdr_fbases);
+}
+
+/* From FreeBSD's lib/libstand/printf.c */
+/*-
+ * Copyright (c) 1986, 1988, 1991, 1993
+ * The Regents of the University of California. All rights reserved.
+ * (c) UNIX System Laboratories, Inc.
+ * All or some portions of this file are derived from material licensed
+ * to the University of California by American Telephone and Telegraph
+ * Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ * the permission of UNIX System Laboratories, Inc.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ * notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ * notice, this list of conditions and the following disclaimer in the
+ * documentation and/or other materials provided with the distribution.
+ * 4. Neither the name of the University nor the names of its contributors
+ * may be used to endorse or promote products derived from this software
+ * without specific prior written permission.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ * @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
+ */
+
+#include <stdarg.h>
+#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
+static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
+#define hex2ascii(hex) (hex2ascii_data[hex])
+static const char hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static inline int imax(int a, int b) { return (a > b ? a : b); }
+static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
+
+static void putce(int c)
+{
+ char s[1];
+ ssize_t ret;
+
+ s[0] = (char)c;
+ ret = write(2, s, 1);
+ (void)ret;
+}
+
+static int
+kprintf(const char *fmt, ...)
+{
+ va_list ap;
+ int retval;
+
+ va_start(ap, fmt);
+ retval = kvprintf(fmt, putce, NULL, 10, ap);
+ va_end(ap);
+ return retval;
+}
+
+/*
+ * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
+ * order; return an optional length and a pointer to the last character
+ * written in the buffer (i.e., the first character of the string).
+ * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
+ */
+static char *
+ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
+{
+ char *p, c;
+
+ p = nbuf;
+ *p = '\0';
+ do {
+ c = hex2ascii(num % base);
+ *++p = upper ? toupper(c) : c;
+ } while (num /= base);
+ if (lenp)
+ *lenp = (int)(p - nbuf);
+ return (p);
+}
+
+/*
+ * Scaled down version of printf(3).
+ *
+ * Two additional formats:
+ *
+ * The format %b is supported to decode error registers.
+ * Its usage is:
+ *
+ * printf("reg=%b\n", regval, "<base><arg>*");
+ *
+ * where <base> is the output base expressed as a control character, e.g.
+ * \10 gives octal; \20 gives hex. Each arg is a sequence of characters,
+ * the first of which gives the bit number to be inspected (origin 1), and
+ * the next characters (up to a control character, i.e. a character <= 32),
+ * give the name of the register. Thus:
+ *
+ * kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
+ *
+ * would produce output:
+ *
+ * reg=3<BITTWO,BITONE>
+ *
+ * XXX: %D -- Hexdump, takes pointer and separator string:
+ * ("%6D", ptr, ":") -> XX:XX:XX:XX:XX:XX
+ * ("%*D", len, ptr, " " -> XX XX XX XX ...
+ */
+static int
+kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
+{
+#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
+ char nbuf[MAXNBUF];
+ char *d;
+ const char *p, *percent, *q;
+ unsigned char *up;
+ int ch, n;
+ uintmax_t num;
+ int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
+ int cflag, hflag, jflag, tflag, zflag;
+ int dwidth, upper;
+ char padc;
+ int stop = 0, retval = 0;
+
+ num = 0;
+ if (!func)
+ d = (char *) arg;
+ else
+ d = NULL;
+
+ if (fmt == NULL)
+ fmt = "(fmt null)\n";
+
+ if (radix < 2 || radix > 36)
+ radix = 10;
+
+ for (;;) {
+ padc = ' ';
+ width = 0;
+ while ((ch = (unsigned char)*fmt++) != '%' || stop) {
+ if (ch == '\0')
+ return (retval);
+ PCHAR(ch);
+ }
+ percent = fmt - 1;
+ qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
+ sign = 0; dot = 0; dwidth = 0; upper = 0;
+ cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
+reswitch: switch (ch = (unsigned char)*fmt++) {
+ case '.':
+ dot = 1;
+ goto reswitch;
+ case '#':
+ sharpflag = 1;
+ goto reswitch;
+ case '+':
+ sign = 1;
+ goto reswitch;
+ case '-':
+ ladjust = 1;
+ goto reswitch;
+ case '%':
+ PCHAR(ch);
+ break;
+ case '*':
+ if (!dot) {
+ width = va_arg(ap, int);
+ if (width < 0) {
+ ladjust = !ladjust;
+ width = -width;
+ }
+ } else {
+ dwidth = va_arg(ap, int);
+ }
+ goto reswitch;
+ case '0':
+ if (!dot) {
+ padc = '0';
+ goto reswitch;
+ }
+ case '1': case '2': case '3': case '4':
+ case '5': case '6': case '7': case '8': case '9':
+ for (n = 0;; ++fmt) {
+ n = n * 10 + ch - '0';
+ ch = *fmt;
+ if (ch < '0' || ch > '9')
+ break;
+ }
+ if (dot)
+ dwidth = n;
+ else
+ width = n;
+ goto reswitch;
+ case 'b':
+ num = (unsigned int)va_arg(ap, int);
+ p = va_arg(ap, char *);
+ for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
+ PCHAR(*q--);
+
+ if (num == 0)
+ break;
+
+ for (tmp = 0; *p;) {
+ n = *p++;
+ if (num & (1 << (n - 1))) {
+ PCHAR(tmp ? ',' : '<');
+ for (; (n = *p) > ' '; ++p)
+ PCHAR(n);
+ tmp = 1;
+ } else
+ for (; *p > ' '; ++p)
+ continue;
+ }
+ if (tmp)
+ PCHAR('>');
+ break;
+ case 'c':
+ PCHAR(va_arg(ap, int));
+ break;
+ case 'D':
+ up = va_arg(ap, unsigned char *);
+ p = va_arg(ap, char *);
+ if (!width)
+ width = 16;
+ while(width--) {
+ PCHAR(hex2ascii(*up >> 4));
+ PCHAR(hex2ascii(*up & 0x0f));
+ up++;
+ if (width)
+ for (q=p;*q;q++)
+ PCHAR(*q);
+ }
+ break;
+ case 'd':
+ case 'i':
+ base = 10;
+ sign = 1;
+ goto handle_sign;
+ case 'h':
+ if (hflag) {
+ hflag = 0;
+ cflag = 1;
+ } else
+ hflag = 1;
+ goto reswitch;
+ case 'j':
+ jflag = 1;
+ goto reswitch;
+ case 'l':
+ if (lflag) {
+ lflag = 0;
+ qflag = 1;
+ } else
+ lflag = 1;
+ goto reswitch;
+ case 'n':
+ if (jflag)
+ *(va_arg(ap, intmax_t *)) = retval;
+ else if (qflag)
+ *(va_arg(ap, int64_t *)) = retval;
+ else if (lflag)
+ *(va_arg(ap, long *)) = retval;
+ else if (zflag)
+ *(va_arg(ap, size_t *)) = retval;
+ else if (hflag)
+ *(va_arg(ap, short *)) = retval;
+ else if (cflag)
+ *(va_arg(ap, char *)) = retval;
+ else
+ *(va_arg(ap, int *)) = retval;
+ break;
+ case 'o':
+ base = 8;
+ goto handle_nosign;
+ case 'p':
+ base = 16;
+ sharpflag = (width == 0);
+ sign = 0;
+ num = (uintptr_t)va_arg(ap, void *);
+ goto number;
+ case 'q':
+ qflag = 1;
+ goto reswitch;
+ case 'r':
+ base = radix;
+ if (sign)
+ goto handle_sign;
+ goto handle_nosign;
+ case 's':
+ p = va_arg(ap, char *);
+ if (p == NULL)
+ p = "(null)";
+ if (!dot)
+ n = (int)strlen (p);
+ else
+ for (n = 0; n < dwidth && p[n]; n++)
+ continue;
+
+ width -= n;
+
+ if (!ladjust && width > 0)
+ while (width--)
+ PCHAR(padc);
+ while (n--)
+ PCHAR(*p++);
+ if (ladjust && width > 0)
+ while (width--)
+ PCHAR(padc);
+ break;
+ case 't':
+ tflag = 1;
+ goto reswitch;
+ case 'u':
+ base = 10;
+ goto handle_nosign;
+ case 'X':
+ upper = 1;
+ case 'x':
+ base = 16;
+ goto handle_nosign;
+ case 'y':
+ base = 16;
+ sign = 1;
+ goto handle_sign;
+ case 'z':
+ zflag = 1;
+ goto reswitch;
+handle_nosign:
+ sign = 0;
+ if (jflag)
+ num = va_arg(ap, uintmax_t);
+ else if (qflag)
+ num = va_arg(ap, uint64_t);
+ else if (tflag)
+ num = va_arg(ap, ptrdiff_t);
+ else if (lflag)
+ num = va_arg(ap, unsigned long);
+ else if (zflag)
+ num = va_arg(ap, size_t);
+ else if (hflag)
+ num = (unsigned short)va_arg(ap, int);
+ else if (cflag)
+ num = (unsigned char)va_arg(ap, int);
+ else
+ num = va_arg(ap, unsigned int);
+ goto number;
+handle_sign:
+ if (jflag)
+ num = va_arg(ap, intmax_t);
+ else if (qflag)
+ num = va_arg(ap, int64_t);
+ else if (tflag)
+ num = va_arg(ap, ptrdiff_t);
+ else if (lflag)
+ num = va_arg(ap, long);
+ else if (zflag)
+ num = va_arg(ap, ssize_t);
+ else if (hflag)
+ num = (short)va_arg(ap, int);
+ else if (cflag)
+ num = (char)va_arg(ap, int);
+ else
+ num = va_arg(ap, int);
+number:
+ if (sign && (intmax_t)num < 0) {
+ neg = 1;
+ num = -(intmax_t)num;
+ }
+ p = ksprintn(nbuf, num, base, &n, upper);
+ tmp = 0;
+ if (sharpflag && num != 0) {
+ if (base == 8)
+ tmp++;
+ else if (base == 16)
+ tmp += 2;
+ }
+ if (neg)
+ tmp++;
+
+ if (!ladjust && padc == '0')
+ dwidth = width - tmp;
+ width -= tmp + imax(dwidth, n);
+ dwidth -= n;
+ if (!ladjust)
+ while (width-- > 0)
+ PCHAR(' ');
+ if (neg)
+ PCHAR('-');
+ if (sharpflag && num != 0) {
+ if (base == 8) {
+ PCHAR('0');
+ } else if (base == 16) {
+ PCHAR('0');
+ PCHAR('x');
+ }
+ }
+ while (dwidth-- > 0)
+ PCHAR('0');
+
+ while (*p)
+ PCHAR(*p--);
+
+ if (ladjust)
+ while (width-- > 0)
+ PCHAR(' ');
+
+ break;
+ default:
+ while (percent < fmt)
+ PCHAR(*percent++);
+ /*
+ * Since we ignore an formatting argument it is no
+ * longer safe to obey the remaining formatting
+ * arguments as the arguments will no longer match
+ * the format specs.
+ */
+ stop = 1;
+ break;
+ }
+ }
+#undef PCHAR
+}
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..4f6cf179ef
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,21 @@
+/**********************************************************************
+
+ addr2line.h -
+
+ $Author$
+
+ Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+
+#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/appveyor.yml b/appveyor.yml
new file mode 100644
index 0000000000..bf10c97222
--- /dev/null
+++ b/appveyor.yml
@@ -0,0 +1,147 @@
+---
+version: '{build}'
+shallow_clone: true
+platform:
+ - x64
+branches:
+ except:
+ - trunk # mirrored from trunk. avoid doubly building on it
+environment:
+ ruby_version: "24-%Platform%"
+ zlib_version: "1.2.11"
+ matrix:
+ # to reduce time for finishing all jobs, run the slowest msys2 build first.
+ - build: msys2
+ APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
+ GEMS_FOR_TEST: "timezone tzinfo"
+ - build: vs
+ vs: 120
+ ssl: OpenSSL
+ APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2013
+ GEMS_FOR_TEST: ""
+ - build: vs
+ vs: 140
+ ssl: OpenSSL-v111
+ APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
+ GEMS_FOR_TEST: ""
+ RELINE_TEST_ENCODING: "Windows-31J"
+ UPDATE_UNICODE: "UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
+for:
+-
+ matrix:
+ only:
+ - build: vs
+ install:
+ - ver
+ - chcp
+ - SET BITS=%Platform:x86=32%
+ - SET BITS=%BITS:x=%
+ - SET OPENSSL_DIR=C:\%ssl%-Win%BITS%
+ - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
+ - SET vcvars
+ - '"%vcvars%" %Platform:x64=amd64%'
+ - SET ruby_path=C:\Ruby%ruby_version:-x86=%
+ - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
+ - ruby --version
+ - 'cl'
+ - echo> Makefile srcdir=.
+ - echo>> Makefile MSC_VER=0
+ - echo>> Makefile RT=none
+ - echo>> Makefile RT_VER=0
+ - echo>> Makefile BUILTIN_ENCOBJS=nul
+ - type win32\Makefile.sub >> Makefile
+ - nmake %mflags% touch-unicode-files
+ - nmake %mflags% %UPDATE_UNICODE% up incs
+ - del Makefile
+ - mkdir \usr\local\bin
+ - mkdir \usr\local\include
+ - mkdir \usr\local\lib
+ - curl -fsSL -o zlib%zlib_version:.=%.zip --retry 10 https://zlib.net/zlib%zlib_version:.=%.zip
+ - 7z x -o%APPVEYOR_BUILD_FOLDER%\ext\zlib zlib%zlib_version:.=%.zip
+ - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
+ - attrib +r /s /d
+ - mkdir %Platform%-mswin_%vs%
+ build_script:
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - cd %Platform%-mswin_%vs%
+ - ..\win32\configure.bat --without-ext=+,dbm,gdbm,readline --with-opt-dir=/usr/local --with-openssl-dir=%OPENSSL_DIR:\=/%
+ - nmake -l
+ - nmake install-nodoc
+ - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
+ - if not "%GEMS_FOR_TEST%" == "" \usr\bin\gem install --no-document %GEMS_FOR_TEST%
+ - \usr\bin\ruby -ropenssl -e "puts 'Build ' + OpenSSL::OPENSSL_VERSION, 'Runtime ' + OpenSSL::OPENSSL_LIBRARY_VERSION"
+ test_script:
+ - set /a JOBS=%NUMBER_OF_PROCESSORS%
+ - nmake -l "TESTOPTS=-v -q" btest
+ - nmake -l "TESTOPTS=-v -q" test-basic
+ - nmake -l "TESTOPTS=-v --timeout-scale=3.0 --excludes=../test/excludes/_appveyor -j%JOBS% --exclude readline --exclude win32ole --exclude test_bignum --exclude test_syntax --exclude test_open-uri --exclude test_bundled_ca" test-all
+ # separately execute tests without -j which may crash worker with -j.
+ - nmake -l "TESTOPTS=-v --timeout-scale=3.0 --excludes=../test/excludes/_appveyor" test-all TESTS="../test/win32ole ../test/ruby/test_bignum.rb ../test/ruby/test_syntax.rb ../test/open-uri/test_open-uri.rb ../test/rubygems/test_bundled_ca.rb"
+ - nmake -l test-spec MSPECOPT=-fs # not using `-j` because sometimes `mspec -j` silently dies on Windows
+-
+ matrix:
+ only:
+ - build: msys2
+ install:
+ - ver
+ - chcp
+ - set /a JOBS=%NUMBER_OF_PROCESSORS%
+ - set MSYS_NO_PATHCONV=1
+ - SET MSYSTEM=%Platform:x86=32%
+ - SET MSYSTEM=%MSYSTEM:x=MINGW%
+ - SET MSYS2_ARCH=%Platform:x86=i686%
+ - SET MSYS2_ARCH=%MSYS2_ARCH:x64=x86_64%
+ - set MSYSTEM_PREFIX=/mingw64
+ - set MINGW_CHOST=%MSYS2_ARCH%-w64-mingw32
+ - SET ruby_path=C:\Ruby%ruby_version:-x86=%
+ - cd ..
+ - mkdir build
+ - mkdir install
+ - SET PATH=%ruby_path%\bin;C:\msys64\%MSYSTEM%\bin;C:\msys64\usr\bin;%PATH%
+ - ruby --version
+ build_script:
+ - pacman -Syd --noconfirm --noprogressbar --needed mingw-w64-x86_64-binutils mingw-w64-x86_64-isl mingw-w64-x86_64-libiconv mingw-w64-x86_64-mpc mingw-w64-x86_64-gcc-libs mingw-w64-x86_64-windows-default-manifest mingw-w64-x86_64-winpthreads mingw-w64-x86_64-gcc
+ # when fixed in MSYS2 / Mingw-w64, remove above and use normal code below
+ #- pacman -Sy --noconfirm --noprogressbar --needed mingw-w64-x86_64-toolchain
+ - pacman -S --noconfirm --noprogressbar --needed mingw-w64-x86_64-gdbm mingw-w64-x86_64-gmp mingw-w64-x86_64-libffi mingw-w64-x86_64-libyaml mingw-w64-x86_64-openssl mingw-w64-x86_64-ragel mingw-w64-x86_64-readline mingw-w64-x86_64-zlib
+ - cd %APPVEYOR_BUILD_FOLDER%
+ - set CFLAGS=-march=%MSYS2_ARCH:_=-% -mtune=generic -O3 -pipe
+ - set CXXFLAGS=%CFLAGS%
+ - set CPPFLAGS=-D_FORTIFY_SOURCE=2 -D__USE_MINGW_ANSI_STDIO=1 -DFD_SETSIZE=2048
+ - set LDFLAGS=-pipe
+ - sh -c "autoreconf -fi"
+ - cd ..\build
+ - sh ../ruby/configure --disable-install-doc --prefix=/. --build=%MINGW_CHOST% --host=%MINGW_CHOST% --target=%MINGW_CHOST%
+ - mingw32-make %mflags% touch-unicode-files
+ - mingw32-make -j%JOBS% %UPDATE_UNICODE% up incs
+ - mingw32-make -j%JOBS% V=1
+ - mingw32-make DESTDIR=../install install-nodoc
+ - if not "%GEMS_FOR_TEST%" == "" ..\install\bin\gem install --no-document %GEMS_FOR_TEST%
+ - ..\install\bin\ruby.exe -v -ropenssl -e "puts 'Build ' + OpenSSL::OPENSSL_VERSION, 'Runtime ' + OpenSSL::OPENSSL_LIBRARY_VERSION"
+ test_script:
+ - mingw32-make test
+ - mingw32-make test-all TESTOPTS="--retry --job-status=normal --show-skip --timeout-scale=1.5 --excludes=../ruby/test/excludes/_appveyor -j %JOBS% --exclude win32ole --exclude test_open-uri"
+ # separately execute tests without -j which may crash worker with -j.
+ - mingw32-make test-all TESTOPTS="--retry --job-status=normal --show-skip --timeout-scale=1.5 --excludes=../ruby/test/excludes/_appveyor" TESTS="../ruby/test/win32ole ../ruby/test/open-uri/test_open-uri.rb"
+ - mingw32-make test-spec MSPECOPT=-fs # not using `-j` because sometimes `mspec -j` silently dies on Windows
+notifications:
+ # Using "Webhook" with templated body to skip notification on Pull Request
+ - provider: Webhook
+ method: POST
+ url:
+ secure: iMINHMS0nZabaDsxN9omRDsekxzVvAAzEq5ev7lN6vb+gUETT+rbDKLGxBxBpEpxlnPlLdzroIJ+DTKlwfJA8VkGawTn9EXNsucH0OkSf2M= # AppVeyor CI
+ body: >-
+ {{^isPullRequest}}
+ {
+ "attachments": [
+ {
+ "text": "Build <{{buildUrl}}|#{{buildVersion}}> (<{{commitUrl}}|{{commitId}}>) of {{repositoryName}}@{{branch}} by {{commitAuthor}} {{status}}",
+ "color": "{{#passed}}good{{/passed}}{{#failed}}danger{{/failed}}"
+ }
+ ],
+ "channel": "#alerts"
+ }
+ {{/isPullRequest}}
+ on_build_success: false
+ on_build_failure: true
+ on_build_status_changed: true
diff --git a/array.c b/array.c
index baae2706e5..28bd8c866b 100644
--- a/array.c
+++ b/array.c
@@ -2,164 +2,731 @@
array.c -
- $Author: akr $
- $Date: 2006/06/24 14:53:36 $
+ $Author$
created at: Fri Aug 6 09:46:12 JST 1993
- Copyright (C) 1993-2003 Yukihiro Matsumoto
+ Copyright (C) 1993-2007 Yukihiro Matsumoto
Copyright (C) 2000 Network Applied Communication Laboratory, Inc.
Copyright (C) 2000 Information-technology Promotion Agency, Japan
**********************************************************************/
-
-#include "ruby.h"
-#include "util.h"
-#include "st.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "ruby/st.h"
+#include "probes.h"
+#include "id.h"
+#include "debug_counter.h"
+#include "transient_heap.h"
+#include "internal.h"
+
+#if !ARRAY_DEBUG
+# define NDEBUG
+#endif
+#include "ruby_assert.h"
VALUE rb_cArray;
-static ID id_cmp;
+
+/* for OPTIMIZED_CMP: */
+#define id_cmp idCmp
#define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+#define SMALL_ARRAY_LEN 16
+
+static int
+should_be_T_ARRAY(VALUE ary)
+{
+ return RB_TYPE_P(ary, T_ARRAY);
+}
+
+static int
+should_not_be_shared_and_embedded(VALUE ary)
+{
+ return !FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG);
+}
+
+#define ARY_SHARED_P(ary) \
+ (assert(should_be_T_ARRAY((VALUE)(ary))), \
+ assert(should_not_be_shared_and_embedded((VALUE)ary)), \
+ FL_TEST_RAW((ary),ELTS_SHARED)!=0)
+
+#define ARY_EMBED_P(ary) \
+ (assert(should_be_T_ARRAY((VALUE)(ary))), \
+ assert(should_not_be_shared_and_embedded((VALUE)ary)), \
+ FL_TEST_RAW((ary), RARRAY_EMBED_FLAG) != 0)
+
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_HEAP_CAPA(a) (assert(!ARY_EMBED_P(a)), assert(!ARY_SHARED_ROOT_P(a)), \
+ RARRAY(a)->as.heap.aux.capa)
+
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+ (assert(ARY_EMBED_P(a)), \
+ (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+ (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (assert(should_be_T_ARRAY((VALUE)(a))), \
+ !FL_TEST_RAW((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
+
+#define FL_SET_EMBED(a) do { \
+ assert(!ARY_SHARED_P(a)); \
+ FL_SET((a), RARRAY_EMBED_FLAG); \
+ RARY_TRANSIENT_UNSET(a); \
+ ary_verify(a); \
+} while (0)
+
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ FL_SET((ary), ELTS_SHARED); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+
+#define ARY_SET_PTR(ary, p) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.ptr = (p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+ long tmp_n = (n); \
+ assert(ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+ RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+ if (ARY_EMBED_P(ary)) { \
+ ARY_SET_EMBED_LEN((ary), (n)); \
+ } \
+ else { \
+ ARY_SET_HEAP_LEN((ary), (n)); \
+ } \
+ assert(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do { \
+ assert(!OBJ_FROZEN(ary)); \
+ if (ARY_EMBED_P(ary)) { \
+ ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+ } \
+ else { \
+ RARRAY(ary)->as.heap.len += (n); \
+ } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+ ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
+#define ARY_SET_CAPA(ary, n) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!ARY_SHARED_P(ary)); \
+ assert(!OBJ_FROZEN(ary)); \
+ RARRAY(ary)->as.heap.aux.capa = (n); \
+} while (0)
+
+#define ARY_SHARED_ROOT(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared_root)
+#define ARY_SET_SHARED(ary, value) do { \
+ const VALUE _ary_ = (ary); \
+ const VALUE _value_ = (value); \
+ assert(!ARY_EMBED_P(_ary_)); \
+ assert(ARY_SHARED_P(_ary_)); \
+ assert(ARY_SHARED_ROOT_P(_value_)); \
+ RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared_root, _value_); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (assert(should_be_T_ARRAY((VALUE)(ary))), \
+ FL_TEST_RAW((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_ROOT_REFCNT(ary) \
+ (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SHARED_ROOT_OCCUPIED(ary) (ARY_SHARED_ROOT_REFCNT(ary) == 1)
+#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
+ assert(ARY_SHARED_ROOT_P(ary)); \
+ RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+ assert(!ARY_EMBED_P(ary)); \
+ assert(!RARRAY_TRANSIENT_P(ary)); \
+ FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+static inline void
+ARY_SET(VALUE a, long i, VALUE v)
+{
+ assert(!ARY_SHARED_P(a));
+ assert(!OBJ_FROZEN(a));
+
+ RARRAY_ASET(a, i, v);
+}
+#undef RARRAY_ASET
+
+
+#if ARRAY_DEBUG
+#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
+
+static VALUE
+ary_verify_(VALUE ary, const char *file, int line)
+{
+ assert(RB_TYPE_P(ary, T_ARRAY));
+
+ if (FL_TEST(ary, ELTS_SHARED)) {
+ VALUE root = RARRAY(ary)->as.heap.aux.shared_root;
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ const VALUE *root_ptr = RARRAY_CONST_PTR_TRANSIENT(root);
+ long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
+ assert(FL_TEST(root, RARRAY_SHARED_ROOT_FLAG));
+ assert(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
+ ary_verify(root);
+ }
+ else if (ARY_EMBED_P(ary)) {
+ assert(!RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_SHARED_P(ary));
+ assert(RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX);
+ }
+ else {
+#if 1
+ const VALUE *ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ long i, len = RARRAY_LEN(ary);
+ volatile VALUE v;
+ if (len > 1) len = 1; /* check only HEAD */
+ for (i=0; i<len; i++) {
+ v = ptr[i]; /* access check */
+ }
+ v = v;
+#endif
+ }
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ assert(rb_transient_heap_managed_ptr_p(RARRAY_CONST_PTR_TRANSIENT(ary)));
+ }
+
+ rb_transient_heap_verify();
+
+ return ary;
+}
void
-rb_mem_clear(mem, size)
- register VALUE *mem;
- register long size;
+rb_ary_verify(VALUE ary)
+{
+ ary_verify(ary);
+}
+#else
+#define ary_verify(ary) ((void)0)
+#endif
+
+VALUE *
+rb_ary_ptr_use_start(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+ return (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary);
+}
+
+void
+rb_ary_ptr_use_end(VALUE ary)
+{
+#if ARRAY_DEBUG
+ FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
+#endif
+}
+
+void
+rb_mem_clear(VALUE *mem, long size)
{
while (size--) {
*mem++ = Qnil;
}
}
+static void
+ary_mem_clear(VALUE ary, long beg, long size)
+{
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ rb_mem_clear(ptr + beg, size);
+ });
+}
+
static inline void
-memfill(mem, size, val)
- register VALUE *mem;
- register long size;
- register VALUE val;
+memfill(register VALUE *mem, register long size, register VALUE val)
{
while (size--) {
*mem++ = val;
}
}
-#define ARY_TMPLOCK FL_USER1
+static void
+ary_memfill(VALUE ary, long beg, long size, VALUE val)
+{
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ memfill(ptr + beg, size, val);
+ RB_OBJ_WRITTEN(ary, Qundef, val);
+ });
+}
+
+static void
+ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
+{
+ assert(!ARY_SHARED_P(buff_owner_ary));
+
+ if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
+ rb_gc_writebarrier_remember(buff_owner_ary);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMCPY(ptr+beg, argv, VALUE, argc);
+ });
+ }
+ else {
+ int i;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ for (i=0; i<argc; i++) {
+ RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+ }
+ });
+ }
+}
+
+static void
+ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
+{
+ ary_memcpy0(ary, beg, argc, argv, ary);
+}
+
+static VALUE *
+ary_heap_alloc(VALUE ary, size_t capa)
+{
+ VALUE *ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * capa);
+
+ if (ptr != NULL) {
+ RARY_TRANSIENT_SET(ary);
+ }
+ else {
+ RARY_TRANSIENT_UNSET(ary);
+ ptr = ALLOC_N(VALUE, capa);
+ }
+
+ return ptr;
+}
+
+static void
+ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ /* ignore it */
+ }
+ else {
+ ruby_sized_xfree((void *)ptr, size);
+ }
+}
+
+static void
+ary_heap_free(VALUE ary)
+{
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+ }
+}
+
+static void
+ary_heap_realloc(VALUE ary, size_t new_capa)
+{
+ size_t old_capa = ARY_HEAP_CAPA(ary);
+ if (RARRAY_TRANSIENT_P(ary)) {
+ if (new_capa <= old_capa) {
+ /* do nothing */
+ }
+ else {
+ VALUE *new_ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * new_capa);
+
+ if (new_ptr == NULL) {
+ new_ptr = ALLOC_N(VALUE, new_capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+
+ MEMCPY(new_ptr, ARY_HEAP_PTR(ary), VALUE, old_capa);
+ ARY_SET_PTR(ary, new_ptr);
+ }
+ }
+ else {
+ SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, old_capa);
+ }
+ ary_verify(ary);
+}
+
+#if USE_TRANSIENT_HEAP
static inline void
-rb_ary_modify_check(ary)
- VALUE ary;
+rb_ary_transient_heap_evacuate_(VALUE ary, int transient, int promote)
{
- if (OBJ_FROZEN(ary)) rb_error_frozen("array");
- if (FL_TEST(ary, ARY_TMPLOCK))
- rb_raise(rb_eRuntimeError, "can't modify array during iteration");
- if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
- rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+ if (transient) {
+ VALUE *new_ptr;
+ const VALUE *old_ptr = ARY_HEAP_PTR(ary);
+ long capa = ARY_HEAP_CAPA(ary);
+ long len = ARY_HEAP_LEN(ary);
+
+ if (ARY_SHARED_ROOT_P(ary)) {
+ capa = len;
+ }
+
+ assert(ARY_OWNS_HEAP_P(ary));
+ assert(RARRAY_TRANSIENT_P(ary));
+ assert(!ARY_PTR_USING_P(ary));
+
+ if (promote) {
+ new_ptr = ALLOC_N(VALUE, capa);
+ RARY_TRANSIENT_UNSET(ary);
+ }
+ else {
+ new_ptr = ary_heap_alloc(ary, capa);
+ }
+
+ MEMCPY(new_ptr, old_ptr, VALUE, capa);
+ /* do not use ARY_SET_PTR() because they assert !frozen */
+ RARRAY(ary)->as.heap.ptr = new_ptr;
+ }
+
+ ary_verify(ary);
}
+void
+rb_ary_transient_heap_evacuate(VALUE ary, int promote)
+{
+ rb_ary_transient_heap_evacuate_(ary, RARRAY_TRANSIENT_P(ary), promote);
+}
+
+void
+rb_ary_detransient(VALUE ary)
+{
+ assert(RARRAY_TRANSIENT_P(ary));
+ rb_ary_transient_heap_evacuate_(ary, TRUE, TRUE);
+}
+#else
+void
+rb_ary_detransient(VALUE ary)
+{
+ /* do nothing */
+}
+#endif
+
static void
-rb_ary_modify(ary)
- VALUE ary;
+ary_resize_capa(VALUE ary, long capacity)
{
- VALUE *ptr;
+ assert(RARRAY_LEN(ary) <= capacity);
+ assert(!OBJ_FROZEN(ary));
+ assert(!ARY_SHARED_P(ary));
+
+ if (capacity > RARRAY_EMBED_LEN_MAX) {
+ if (ARY_EMBED_P(ary)) {
+ long len = ARY_EMBED_LEN(ary);
+ VALUE *ptr = ary_heap_alloc(ary, capacity);
+
+ MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+ FL_UNSET_EMBED(ary);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_HEAP_LEN(ary, len);
+ }
+ else {
+ ary_heap_realloc(ary, capacity);
+ }
+ ARY_SET_CAPA(ary, capacity);
+ }
+ else {
+ if (!ARY_EMBED_P(ary)) {
+ long len = ARY_HEAP_LEN(ary);
+ long old_capa = ARY_HEAP_CAPA(ary);
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+
+ if (len > capacity) len = capacity;
+ MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+ ary_heap_free_ptr(ary, ptr, old_capa);
+ FL_SET_EMBED(ary);
+ ARY_SET_LEN(ary, len);
+ }
+ }
+
+ ary_verify(ary);
+}
+
+static inline void
+ary_shrink_capa(VALUE ary)
+{
+ long capacity = ARY_HEAP_LEN(ary);
+ long old_capa = ARY_HEAP_CAPA(ary);
+ assert(!ARY_SHARED_P(ary));
+ assert(old_capa >= capacity);
+ if (old_capa > capacity) ary_heap_realloc(ary, capacity);
+
+ ary_verify(ary);
+}
+
+static void
+ary_double_capa(VALUE ary, long min)
+{
+ long new_capa = ARY_CAPA(ary) / 2;
+
+ if (new_capa < ARY_DEFAULT_SIZE) {
+ new_capa = ARY_DEFAULT_SIZE;
+ }
+ if (new_capa >= ARY_MAX_SIZE - min) {
+ new_capa = (ARY_MAX_SIZE - min) / 2;
+ }
+ new_capa += min;
+ ary_resize_capa(ary, new_capa);
+
+ ary_verify(ary);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared_root)
+{
+ if (shared_root) {
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root) - 1;
+ if (num == 0) {
+ rb_ary_free(shared_root);
+ rb_gc_force_recycle(shared_root);
+ }
+ else if (num > 0) {
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num);
+ }
+ }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+ VALUE shared_root = RARRAY(ary)->as.heap.aux.shared_root;
+ rb_ary_decrement_share(shared_root);
+ FL_UNSET_SHARED(ary);
+}
+
+static inline void
+rb_ary_unshare_safe(VALUE ary)
+{
+ if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ }
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared_root)
+{
+ long num = ARY_SHARED_ROOT_REFCNT(shared_root);
+ if (num >= 0) {
+ ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
+ }
+ return shared_root;
+}
+
+static void
+rb_ary_set_shared(VALUE ary, VALUE shared_root)
+{
+ rb_ary_increment_share(shared_root);
+ FL_SET_SHARED(ary);
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, shared_root);
+}
+
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+ rb_check_frozen(ary);
+ ary_verify(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
rb_ary_modify_check(ary);
- if (FL_TEST(ary, ELTS_SHARED)) {
- ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
- FL_UNSET(ary, ELTS_SHARED);
- RARRAY(ary)->aux.capa = RARRAY(ary)->len;
- MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- RARRAY(ary)->ptr = ptr;
+ if (ARY_SHARED_P(ary)) {
+ long shared_len, len = RARRAY_LEN(ary);
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+
+ ary_verify(shared_root);
+
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ const VALUE *ptr = ARY_HEAP_PTR(ary);
+ FL_UNSET_SHARED(ary);
+ FL_SET_EMBED(ary);
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+ rb_ary_decrement_share(shared_root);
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
+ long shift = RARRAY_CONST_PTR_TRANSIENT(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root);
+ FL_UNSET_SHARED(ary);
+ ARY_SET_PTR(ary, RARRAY_CONST_PTR_TRANSIENT(shared_root));
+ ARY_SET_CAPA(ary, shared_len);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr+shift, VALUE, len);
+ });
+ FL_SET_EMBED(shared_root);
+ rb_ary_decrement_share(shared_root);
+ }
+ else {
+ VALUE *ptr = ary_heap_alloc(ary, len);
+ MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
+ rb_ary_unshare(ary);
+ ARY_SET_CAPA(ary, len);
+ ARY_SET_PTR(ary, ptr);
+ }
+
+ rb_gc_writebarrier_remember(ary);
}
+ ary_verify(ary);
}
-VALUE
-rb_ary_freeze(ary)
- VALUE ary;
+static VALUE
+ary_ensure_room_for_push(VALUE ary, long add_len)
{
- return rb_obj_freeze(ary);
+ long old_len = RARRAY_LEN(ary);
+ long new_len = old_len + add_len;
+ long capa;
+
+ if (old_len > ARY_MAX_SIZE - add_len) {
+ rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ }
+ if (ARY_SHARED_P(ary)) {
+ if (new_len > RARRAY_EMBED_LEN_MAX) {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
+ if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
+ rb_ary_modify_check(ary);
+
+ ary_verify(ary);
+ ary_verify(shared_root);
+ return shared_root;
+ }
+ else {
+ /* if array is shared, then it is likely it participate in push/shift pattern */
+ rb_ary_modify(ary);
+ capa = ARY_CAPA(ary);
+ if (new_len > capa - (capa >> 6)) {
+ ary_double_capa(ary, new_len);
+ }
+ ary_verify(ary);
+ return ary;
+ }
+ }
+ }
+ ary_verify(ary);
+ rb_ary_modify(ary);
+ }
+ else {
+ rb_ary_modify_check(ary);
+ }
+ capa = ARY_CAPA(ary);
+ if (new_len > capa) {
+ ary_double_capa(ary, new_len);
+ }
+
+ ary_verify(ary);
+ return ary;
}
/*
* call-seq:
- * array.frozen? -> true or false
+ * ary.freeze -> ary
+ *
+ * Calls Object#freeze on +ary+ to prevent any further
+ * modification. A RuntimeError will be raised if a modification
+ * attempt is made.
*
- * Return <code>true</code> if this array is frozen (or temporarily frozen
- * while being sorted).
*/
-static VALUE
-rb_ary_frozen_p(ary)
- VALUE ary;
+VALUE
+rb_ary_freeze(VALUE ary)
{
- if (OBJ_FROZEN(ary)) return Qtrue;
- if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
+ return rb_obj_freeze(ary);
+}
+
+/* This can be used to take a snapshot of an array (with
+ e.g. rb_ary_replace) and check later whether the array has been
+ modified from the snapshot. The snapshot is cheap, though if
+ something does modify the array it will pay the cost of copying
+ it. If Array#pop or Array#shift has been called, the array will
+ be still shared with the snapshot, but the array length will
+ differ. */
+VALUE
+rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
+{
+ if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
+ !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+ RARRAY(ary1)->as.heap.aux.shared_root == RARRAY(ary2)->as.heap.aux.shared_root &&
+ RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
+ return Qtrue;
+ }
return Qfalse;
}
-static VALUE ary_alloc _((VALUE));
static VALUE
-ary_alloc(klass)
- VALUE klass;
+ary_alloc(VALUE klass)
{
- NEWOBJ(ary, struct RArray);
- OBJSETUP(ary, klass, T_ARRAY);
-
- ary->len = 0;
- ary->ptr = 0;
- ary->aux.capa = 0;
-
+ NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+ /* Created array is:
+ * FL_SET_EMBED((VALUE)ary);
+ * ARY_SET_EMBED_LEN((VALUE)ary, 0);
+ */
return (VALUE)ary;
}
static VALUE
-ary_new(klass, len)
- VALUE klass;
- long len;
+empty_ary_alloc(VALUE klass)
{
- VALUE ary = ary_alloc(klass);
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+ return ary_alloc(klass);
+}
- if (len < 0) {
+static VALUE
+ary_new(VALUE klass, long capa)
+{
+ VALUE ary,*ptr;
+
+ if (capa < 0) {
rb_raise(rb_eArgError, "negative array size (or size too big)");
}
- if (len > 0 && len * sizeof(VALUE) <= len) {
+ if (capa > ARY_MAX_SIZE) {
rb_raise(rb_eArgError, "array size too big");
}
- if (len == 0) len++;
- RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
- RARRAY(ary)->aux.capa = len;
+
+ RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+ ary = ary_alloc(klass);
+ if (capa > RARRAY_EMBED_LEN_MAX) {
+ ptr = ary_heap_alloc(ary, capa);
+ FL_UNSET_EMBED(ary);
+ ARY_SET_PTR(ary, ptr);
+ ARY_SET_CAPA(ary, capa);
+ ARY_SET_HEAP_LEN(ary, 0);
+ }
return ary;
}
VALUE
-rb_ary_new2(len)
- long len;
+rb_ary_new_capa(long capa)
{
- return ary_new(rb_cArray, len);
+ return ary_new(rb_cArray, capa);
}
-
VALUE
-rb_ary_new()
+rb_ary_new(void)
{
- return rb_ary_new2(ARY_DEFAULT_SIZE);
+ return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
}
-#ifdef HAVE_STDARG_PROTOTYPES
-#include <stdarg.h>
-#define va_init_list(a,b) va_start(a,b)
-#else
-#include <varargs.h>
-#define va_init_list(a,b) va_start(a)
-#endif
-
VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
-rb_ary_new3(long n, ...)
-#else
-rb_ary_new3(n, va_alist)
- long n;
- va_dcl
-#endif
+(rb_ary_new_from_args)(long n, ...)
{
va_list ar;
VALUE ary;
@@ -167,120 +734,290 @@ rb_ary_new3(n, va_alist)
ary = rb_ary_new2(n);
- va_init_list(ar, n);
+ va_start(ar, n);
for (i=0; i<n; i++) {
- RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
+ ARY_SET(ary, i, va_arg(ar, VALUE));
}
va_end(ar);
- RARRAY(ary)->len = n;
+ ARY_SET_LEN(ary, n);
return ary;
}
-VALUE
-rb_ary_new4(n, elts)
- long n;
- const VALUE *elts;
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
{
VALUE ary;
- ary = rb_ary_new2(n);
+ ary = ary_new(klass, n);
if (n > 0 && elts) {
- MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
+ ary_memcpy(ary, 0, n, elts);
+ ARY_SET_LEN(ary, n);
}
- /* This assignment to len will be moved to the above "if" block in Ruby 1.9 */
- RARRAY(ary)->len = n;
-
return ary;
}
VALUE
-rb_assoc_new(car, cdr)
- VALUE car, cdr;
+rb_ary_new_from_values(long n, const VALUE *elts)
{
- VALUE ary;
+ return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
+}
- ary = rb_ary_new2(2);
- RARRAY(ary)->ptr[0] = car;
- RARRAY(ary)->ptr[1] = cdr;
- RARRAY(ary)->len = 2;
+VALUE
+rb_ary_tmp_new(long capa)
+{
+ VALUE ary = ary_new(0, capa);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ return ary;
+}
+VALUE
+rb_ary_tmp_new_fill(long capa)
+{
+ VALUE ary = ary_new(0, capa);
+ ary_memfill(ary, 0, capa, Qnil);
+ ARY_SET_LEN(ary, capa);
+ rb_ary_transient_heap_evacuate(ary, TRUE);
return ary;
}
+void
+rb_ary_free(VALUE ary)
+{
+ if (ARY_OWNS_HEAP_P(ary)) {
+ if (USE_DEBUG_COUNTER &&
+ !ARY_SHARED_ROOT_P(ary) &&
+ ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
+ }
+
+ if (RARRAY_TRANSIENT_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_transient);
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_ptr);
+ ary_heap_free(ary);
+ }
+ }
+ else {
+ RB_DEBUG_COUNTER_INC(obj_ary_embed);
+ }
+
+ if (ARY_SHARED_P(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared);
+ }
+ if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
+ }
+}
+
+RUBY_FUNC_EXPORTED size_t
+rb_ary_memsize(VALUE ary)
+{
+ if (ARY_OWNS_HEAP_P(ary)) {
+ return ARY_CAPA(ary) * sizeof(VALUE);
+ }
+ else {
+ return 0;
+ }
+}
+
+static inline void
+ary_discard(VALUE ary)
+{
+ rb_ary_free(ary);
+ RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+ RBASIC(ary)->flags &= ~(RARRAY_EMBED_LEN_MASK | RARRAY_TRANSIENT_FLAG);
+}
+
static VALUE
-to_ary(ary)
- VALUE ary;
+ary_make_shared(VALUE ary)
{
- return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ assert(!ARY_EMBED_P(ary));
+ ary_verify(ary);
+
+ if (ARY_SHARED_P(ary)) {
+ return ARY_SHARED_ROOT(ary);
+ }
+ else if (ARY_SHARED_ROOT_P(ary)) {
+ return ary;
+ }
+ else if (OBJ_FROZEN(ary)) {
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ ary_shrink_capa(ary);
+ FL_SET_SHARED_ROOT(ary);
+ ARY_SET_SHARED_ROOT_REFCNT(ary, 1);
+ return ary;
+ }
+ else {
+ long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
+ const VALUE *ptr;
+ NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+
+ rb_ary_transient_heap_evacuate(ary, TRUE);
+ ptr = ARY_HEAP_PTR(ary);
+
+ FL_UNSET_EMBED(shared);
+ ARY_SET_LEN((VALUE)shared, capa);
+ ARY_SET_PTR((VALUE)shared, ptr);
+ ary_mem_clear((VALUE)shared, len, capa - len);
+ FL_SET_SHARED_ROOT(shared);
+ ARY_SET_SHARED_ROOT_REFCNT((VALUE)shared, 1);
+ FL_SET_SHARED(ary);
+ RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
+ ARY_SET_SHARED(ary, (VALUE)shared);
+ OBJ_FREEZE(shared);
+
+ ary_verify((VALUE)shared);
+ ary_verify(ary);
+
+ return (VALUE)shared;
+ }
+}
+
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+ long len = RARRAY_LEN(ary);
+
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE subst = rb_ary_new2(len);
+ ary_memcpy(subst, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_EMBED_LEN(subst, len);
+ return subst;
+ }
+ else {
+ return rb_ary_increment_share(ary_make_shared(ary));
+ }
}
VALUE
-rb_check_array_type(ary)
- VALUE ary;
+rb_assoc_new(VALUE car, VALUE cdr)
{
- return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+ return rb_ary_new3(2, car, cdr);
}
-static VALUE rb_ary_replace _((VALUE, VALUE));
+VALUE
+rb_to_array_type(VALUE ary)
+{
+ return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+#define to_ary rb_to_array_type
+
+VALUE
+rb_check_array_type(VALUE ary)
+{
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_check_to_array(VALUE ary)
+{
+ return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+}
+
+/*
+ * call-seq:
+ * Array.try_convert(obj) -> array or nil
+ *
+ * Tries to convert +obj+ into an array, using the +to_ary+ method. Returns
+ * the converted array or +nil+ if +obj+ cannot be converted.
+ * This method can be used to check if an argument is an array.
+ *
+ * Array.try_convert([1]) #=> [1]
+ * Array.try_convert("1") #=> nil
+ *
+ * if tmp = Array.try_convert(arg)
+ * # the argument is an array
+ * elsif tmp = String.try_convert(arg)
+ * # the argument is a string
+ * end
+ *
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+ return rb_check_array_type(ary);
+}
/*
* call-seq:
- * Array.new(size=0, obj=nil)
+ * Array.new(size=0, default=nil)
* Array.new(array)
* Array.new(size) {|index| block }
*
- * Returns a new array. In the first form, the new array is
- * empty. In the second it is created with _size_ copies of _obj_
- * (that is, _size_ references to the same
- * _obj_). The third form creates a copy of the array
- * passed as a parameter (the array is generated by calling
- * to_ary on the parameter). In the last form, an array
- * of the given size is created. Each element in this array is
- * calculated by passing the element's index to the given block and
- * storing the return value.
- *
- * Array.new
- * Array.new(2)
- * Array.new(5, "A")
- *
- * # only one copy of the object is created
+ * Returns a new array.
+ *
+ * In the first form, if no arguments are sent, the new array will be empty.
+ * When a +size+ and an optional +default+ are sent, an array is created with
+ * +size+ copies of +default+. Take notice that all elements will reference the
+ * same object +default+.
+ *
+ * The second form creates a copy of the array passed as a parameter (the
+ * array is generated by calling to_ary on the parameter).
+ *
+ * first_array = ["Matz", "Guido"]
+ *
+ * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *
+ * first_array.equal? second_array #=> false
+ *
+ * In the last form, an array of the given size is created. Each element in
+ * this array is created by passing the element's index to the given block
+ * and storing the return value.
+ *
+ * Array.new(3) {|index| index ** 2}
+ * # => [0, 1, 4]
+ *
+ * == Common gotchas
+ *
+ * When sending the second parameter, the same object will be used as the
+ * value for all the array elements:
+ *
* a = Array.new(2, Hash.new)
+ * # => [{}, {}]
+ *
* a[0]['cat'] = 'feline'
- * a
+ * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *
* a[1]['cat'] = 'Felix'
- * a
- *
- * # here multiple copies are created
- * a = Array.new(2) { Hash.new }
+ * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *
+ * Since all the Array elements store the same hash, changes to one of them
+ * will affect them all.
+ *
+ * If multiple copies are what you want, you should use the block
+ * version which uses the result of that block each time an element
+ * of the array needs to be initialized:
+ *
+ * a = Array.new(2) {Hash.new}
* a[0]['cat'] = 'feline'
- * a
- *
- * squares = Array.new(5) {|i| i*i}
- * squares
- *
- * copy = Array.new(squares)
+ * a # => [{"cat"=>"feline"}, {}]
+ *
*/
static VALUE
-rb_ary_initialize(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
{
long len;
VALUE size, val;
rb_ary_modify(ary);
- if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
- RARRAY(ary)->len = 0;
+ if (argc == 0) {
+ if (ARY_OWNS_HEAP_P(ary) && ARY_HEAP_PTR(ary) != NULL) {
+ ary_heap_free(ary);
+ }
+ rb_ary_unshare_safe(ary);
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
if (rb_block_given_p()) {
rb_warning("given block not used");
}
return ary;
}
-
+ rb_scan_args(argc, argv, "02", &size, &val);
if (argc == 1 && !FIXNUM_P(size)) {
val = rb_check_array_type(size);
if (!NIL_P(val)) {
@@ -290,16 +1027,16 @@ rb_ary_initialize(argc, argv, ary)
}
len = NUM2LONG(size);
+ /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
if (len < 0) {
rb_raise(rb_eArgError, "negative array size");
}
- if (len > 0 && len * (long)sizeof(VALUE) <= len) {
+ if (len > ARY_MAX_SIZE) {
rb_raise(rb_eArgError, "array size too big");
}
- if (len > RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
- RARRAY(ary)->aux.capa = len;
- }
+ /* recheck after argument conversion */
+ rb_ary_modify(ary);
+ ary_resize_capa(ary, len);
if (rb_block_given_p()) {
long i;
@@ -308,331 +1045,514 @@ rb_ary_initialize(argc, argv, ary)
}
for (i=0; i<len; i++) {
rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
- RARRAY(ary)->len = i + 1;
+ ARY_SET_LEN(ary, i + 1);
}
}
else {
- memfill(RARRAY(ary)->ptr, len, val);
- RARRAY(ary)->len = len;
+ ary_memfill(ary, 0, len, val);
+ ARY_SET_LEN(ary, len);
}
-
return ary;
}
-
-/*
-* Returns a new array populated with the given objects.
-*
-* Array.[]( 1, 'a', /^A/ )
-* Array[ 1, 'a', /^A/ ]
-* [ 1, 'a', /^A/ ]
-*/
+/*
+ * Returns a new array populated with the given objects.
+ *
+ * Array.[]( 1, 'a', /^A/) # => [1, "a", /^A/]
+ * Array[ 1, 'a', /^A/ ] # => [1, "a", /^A/]
+ * [ 1, 'a', /^A/ ] # => [1, "a", /^A/]
+ */
static VALUE
-rb_ary_s_create(argc, argv, klass)
- int argc;
- VALUE *argv;
- VALUE klass;
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
{
- VALUE ary = ary_alloc(klass);
-
- if (argc > 0) {
- RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
- MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+ VALUE ary = ary_new(klass, argc);
+ if (argc > 0 && argv) {
+ ary_memcpy(ary, 0, argc, argv);
+ ARY_SET_LEN(ary, argc);
}
- RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
return ary;
}
void
-rb_ary_store(ary, idx, val)
- VALUE ary;
- long idx;
- VALUE val;
+rb_ary_store(VALUE ary, long idx, VALUE val)
{
+ long len = RARRAY_LEN(ary);
+
if (idx < 0) {
- idx += RARRAY(ary)->len;
+ idx += len;
if (idx < 0) {
- rb_raise(rb_eIndexError, "index %ld out of array",
- idx - RARRAY(ary)->len);
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ idx - len, -len);
}
}
+ else if (idx >= ARY_MAX_SIZE) {
+ rb_raise(rb_eIndexError, "index %ld too big", idx);
+ }
rb_ary_modify(ary);
- if (idx >= RARRAY(ary)->aux.capa) {
- long new_capa = RARRAY(ary)->aux.capa / 2;
+ if (idx >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, idx);
+ }
+ if (idx > len) {
+ ary_mem_clear(ary, len, idx - len + 1);
+ }
- if (new_capa < ARY_DEFAULT_SIZE) {
- new_capa = ARY_DEFAULT_SIZE;
- }
- new_capa += idx;
- if (new_capa * (long)sizeof(VALUE) <= new_capa) {
- rb_raise(rb_eArgError, "index too big");
- }
- REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
- RARRAY(ary)->aux.capa = new_capa;
+ if (idx >= len) {
+ ARY_SET_LEN(ary, idx + 1);
+ }
+ ARY_SET(ary, idx, val);
+}
+
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
+{
+ assert(offset >= 0);
+ assert(len >= 0);
+ assert(offset+len <= RARRAY_LEN(ary));
+
+ if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE result = ary_alloc(klass);
+ ary_memcpy(result, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary) + offset);
+ ARY_SET_EMBED_LEN(result, len);
+ return result;
}
- if (idx > RARRAY(ary)->len) {
- rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
- idx-RARRAY(ary)->len + 1);
+ else {
+ VALUE shared, result = ary_alloc(klass);
+ FL_UNSET_EMBED(result);
+
+ shared = ary_make_shared(ary);
+ ARY_SET_PTR(result, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_LEN(result, RARRAY_LEN(ary));
+ rb_ary_set_shared(result, shared);
+
+ ARY_INCREASE_PTR(result, offset);
+ ARY_SET_LEN(result, len);
+
+ ary_verify(shared);
+ ary_verify(result);
+ return result;
}
+}
+
+static VALUE
+ary_make_shared_copy(VALUE ary)
+{
+ return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+}
+
+enum ary_take_pos_flags
+{
+ ARY_TAKE_FIRST = 0,
+ ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+ long n;
+ long len;
+ long offset = 0;
- if (idx >= RARRAY(ary)->len) {
- RARRAY(ary)->len = idx + 1;
+ argc = rb_check_arity(argc, 0, 1);
+ /* the case optional argument is omitted should be handled in
+ * callers of this function. if another arity case is added,
+ * this arity check needs to rewrite. */
+ RUBY_ASSERT_ALWAYS(argc == 1);
+
+ n = NUM2LONG(argv[0]);
+ len = RARRAY_LEN(ary);
+ if (n > len) {
+ n = len;
}
- RARRAY(ary)->ptr[idx] = val;
+ else if (n < 0) {
+ rb_raise(rb_eArgError, "negative array size");
+ }
+ if (last) {
+ offset = len - n;
+ }
+ return ary_make_partial(ary, rb_cArray, offset, n);
}
/*
* call-seq:
- * array << obj -> array
- *
+ * ary << obj -> ary
+ *
* Append---Pushes the given object on to the end of this array. This
* expression returns the array itself, so several appends
* may be chained together.
*
- * [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
+ * a = [ 1, 2 ]
+ * a << "c" << "d" << [ 3, 4 ]
+ * #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
+ * a
* #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
*
*/
VALUE
-rb_ary_push(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_push(VALUE ary, VALUE item)
+{
+ long idx = RARRAY_LEN((ary_verify(ary), ary));
+ VALUE target_ary = ary_ensure_room_for_push(ary, 1);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+ });
+ ARY_SET_LEN(ary, idx + 1);
+ ary_verify(ary);
+ return ary;
+}
+
+VALUE
+rb_ary_cat(VALUE ary, const VALUE *argv, long len)
{
- rb_ary_store(ary, RARRAY(ary)->len, item);
+ long oldlen = RARRAY_LEN(ary);
+ VALUE target_ary = ary_ensure_room_for_push(ary, len);
+ ary_memcpy0(ary, oldlen, len, argv, target_ary);
+ ARY_SET_LEN(ary, oldlen + len);
return ary;
}
-/*
+/*
* call-seq:
- * array.push(obj, ... ) -> array
- *
- * Append---Pushes the given object(s) on to the end of this array. This
+ * ary.push(obj, ...) -> ary
+ * ary.append(obj, ...) -> ary
+ *
+ * Append --- Pushes the given object(s) on to the end of this array. This
* expression returns the array itself, so several appends
- * may be chained together.
+ * may be chained together. See also Array#pop for the opposite
+ * effect.
*
* a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
+ * a.push("d", "e", "f")
* #=> ["a", "b", "c", "d", "e", "f"]
+ * [1, 2, 3].push(4).push(5)
+ * #=> [1, 2, 3, 4, 5]
*/
static VALUE
-rb_ary_push_m(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
{
- while (argc--) {
- rb_ary_push(ary, *argv++);
- }
- return ary;
+ return rb_ary_cat(ary, argv, argc);
+}
+
+VALUE
+rb_ary_pop(VALUE ary)
+{
+ long n;
+ rb_ary_modify_check(ary);
+ n = RARRAY_LEN(ary);
+ if (n == 0) return Qnil;
+ if (ARY_OWNS_HEAP_P(ary) &&
+ n * 3 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+ {
+ ary_resize_capa(ary, n * 2);
+ }
+ --n;
+ ARY_SET_LEN(ary, n);
+ ary_verify(ary);
+ return RARRAY_AREF(ary, n);
}
/*
* call-seq:
- * array.pop -> obj or nil
- *
- * Removes the last element from <i>self</i> and returns it, or
- * <code>nil</code> if the array is empty.
- *
- * a = [ "a", "m", "z" ]
- * a.pop #=> "z"
- * a #=> ["a", "m"]
+ * ary.pop -> obj or nil
+ * ary.pop(n) -> new_ary
+ *
+ * Removes the last element from +self+ and returns it, or
+ * +nil+ if the array is empty.
+ *
+ * If a number +n+ is given, returns an array of the last +n+ elements
+ * (or less) just like <code>array.slice!(-n, n)</code> does. See also
+ * Array#push for the opposite effect.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.pop #=> "d"
+ * a.pop(2) #=> ["b", "c"]
+ * a #=> ["a"]
*/
-VALUE
-rb_ary_pop(ary)
- VALUE ary;
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
{
- rb_ary_modify_check(ary);
- if (RARRAY(ary)->len == 0) return Qnil;
- if (!FL_TEST(ary, ELTS_SHARED) &&
- RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
- RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
- RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+ VALUE result;
+
+ if (argc == 0) {
+ return rb_ary_pop(ary);
}
- return RARRAY(ary)->ptr[--RARRAY(ary)->len];
+
+ rb_ary_modify_check(ary);
+ result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+ ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+ ary_verify(ary);
+ return result;
}
-static VALUE
-ary_make_shared(ary)
- VALUE ary;
+VALUE
+rb_ary_shift(VALUE ary)
{
- if (!FL_TEST(ary, ELTS_SHARED)) {
- NEWOBJ(shared, struct RArray);
- OBJSETUP(shared, rb_cArray, T_ARRAY);
+ VALUE top;
+ long len = RARRAY_LEN(ary);
- shared->len = RARRAY(ary)->len;
- shared->ptr = RARRAY(ary)->ptr;
- shared->aux.capa = RARRAY(ary)->aux.capa;
- RARRAY(ary)->aux.shared = (VALUE)shared;
- FL_SET(ary, ELTS_SHARED);
- OBJ_FREEZE(shared);
- return (VALUE)shared;
+ rb_ary_modify_check(ary);
+ if (len == 0) return Qnil;
+ top = RARRAY_AREF(ary, 0);
+ if (!ARY_SHARED_P(ary)) {
+ if (len < ARY_DEFAULT_SIZE) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr+1, VALUE, len-1);
+ }); /* WB: no new reference */
+ ARY_INCREASE_LEN(ary, -1);
+ ary_verify(ary);
+ return top;
+ }
+ assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+ ARY_SET(ary, 0, Qnil);
+ ary_make_shared(ary);
}
- else {
- return RARRAY(ary)->aux.shared;
+ else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, ptr[0] = Qnil);
}
+ ARY_INCREASE_PTR(ary, 1); /* shift ptr */
+ ARY_INCREASE_LEN(ary, -1);
+
+ ary_verify(ary);
+
+ return top;
}
/*
* call-seq:
- * array.shift -> obj or nil
- *
- * Returns the first element of <i>self</i> and removes it (shifting all
- * other elements down by one). Returns <code>nil</code> if the array
+ * ary.shift -> obj or nil
+ * ary.shift(n) -> new_ary
+ *
+ * Removes the first element of +self+ and returns it (shifting all
+ * other elements down by one). Returns +nil+ if the array
* is empty.
- *
+ *
+ * If a number +n+ is given, returns an array of the first +n+ elements
+ * (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
+ * containing only the remainder elements, not including what was shifted to
+ * +new_ary+. See also Array#unshift for the opposite effect.
+ *
+ * args = [ "-m", "-q", "filename" ]
+ * args.shift #=> "-m"
+ * args #=> ["-q", "filename"]
+ *
* args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
+ * args.shift(2) #=> ["-m", "-q"]
+ * args #=> ["filename"]
*/
-VALUE
-rb_ary_shift(ary)
- VALUE ary;
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
{
- VALUE top;
+ VALUE result;
+ long n;
+
+ if (argc == 0) {
+ return rb_ary_shift(ary);
+ }
rb_ary_modify_check(ary);
- if (RARRAY(ary)->len == 0) return Qnil;
- top = RARRAY(ary)->ptr[0];
- ary_make_shared(ary);
- RARRAY(ary)->ptr++; /* shift ptr */
- RARRAY(ary)->len--;
+ result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+ n = RARRAY_LEN(result);
+ rb_ary_behead(ary,n);
- return top;
+ return result;
}
-VALUE
-rb_ary_unshift(ary, item)
- VALUE ary, item;
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_behead(VALUE ary, long n)
{
- rb_ary_modify(ary);
- if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
- long capa_inc = RARRAY(ary)->aux.capa / 2;
- if (capa_inc < ARY_DEFAULT_SIZE) {
- capa_inc = ARY_DEFAULT_SIZE;
+ if (n<=0) return ary;
+
+ rb_ary_modify_check(ary);
+ if (ARY_SHARED_P(ary)) {
+ if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
+ setup_occupied_shared:
+ ary_mem_clear(ary, 0, n);
}
- RARRAY(ary)->aux.capa += capa_inc;
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+ ARY_INCREASE_PTR(ary, n);
}
+ else {
+ if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
+ }); /* WB: no new reference */
+ }
+ else {
+ ary_make_shared(ary);
+ goto setup_occupied_shared;
+ }
+ }
+ ARY_INCREASE_LEN(ary, -n);
- /* sliding items */
- MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ ary_verify(ary);
+ return ary;
+}
- RARRAY(ary)->len++;
- RARRAY(ary)->ptr[0] = item;
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+ long len = RARRAY_LEN(ary);
+ long new_len = len + argc;
+ long capa;
+ const VALUE *head, *sharedp;
+
+ if (len > ARY_MAX_SIZE - argc) {
+ rb_raise(rb_eIndexError, "index %ld too big", new_len);
+ }
+
+ if (ARY_SHARED_P(ary)) {
+ VALUE shared_root = ARY_SHARED_ROOT(ary);
+ capa = RARRAY_LEN(shared_root);
+ if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && capa > new_len) {
+ rb_ary_modify_check(ary);
+ head = RARRAY_CONST_PTR_TRANSIENT(ary);
+ sharedp = RARRAY_CONST_PTR_TRANSIENT(shared_root);
+ goto makeroom_if_need;
+ }
+ }
- return ary;
+ rb_ary_modify(ary);
+ capa = ARY_CAPA(ary);
+ if (capa - (capa >> 6) <= new_len) {
+ ary_double_capa(ary, new_len);
+ }
+
+ /* use shared array for big "queues" */
+ if (new_len > ARY_DEFAULT_SIZE * 4) {
+ ary_verify(ary);
+
+ /* make a room for unshifted items */
+ capa = ARY_CAPA(ary);
+ ary_make_shared(ary);
+
+ head = sharedp = RARRAY_CONST_PTR_TRANSIENT(ary);
+ goto makeroom;
+ makeroom_if_need:
+ if (head - sharedp < argc) {
+ long room;
+ makeroom:
+ room = capa - new_len;
+ room -= room >> 4;
+ MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+ head = sharedp + argc + room;
+ }
+ ARY_SET_PTR(ary, head - argc);
+ assert(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+
+ ary_verify(ary);
+ return ARY_SHARED_ROOT(ary);
+ }
+ else {
+ /* sliding items */
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr + argc, ptr, VALUE, len);
+ });
+
+ ary_verify(ary);
+ return ary;
+ }
}
/*
* call-seq:
- * array.unshift(obj, ...) -> array
- *
- * Prepends objects to the front of <i>array</i>.
- * other elements up one.
- *
+ * ary.unshift(obj, ...) -> ary
+ * ary.prepend(obj, ...) -> ary
+ *
+ * Prepends objects to the front of +self+, moving other elements upwards.
+ * See also Array#shift for the opposite effect.
+ *
* a = [ "b", "c", "d" ]
* a.unshift("a") #=> ["a", "b", "c", "d"]
* a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
*/
static VALUE
-rb_ary_unshift_m(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
{
- long len = RARRAY(ary)->len;
-
- if (argc == 0) return ary;
+ long len = RARRAY_LEN(ary);
+ VALUE target_ary;
- /* make rooms by setting the last item */
- rb_ary_store(ary, len + argc - 1, Qnil);
+ if (argc == 0) {
+ rb_ary_modify_check(ary);
+ return ary;
+ }
- /* sliding items */
- MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
- MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
-
+ target_ary = ary_ensure_room_for_unshift(ary, argc);
+ ary_memcpy0(ary, 0, argc, argv, target_ary);
+ ARY_SET_LEN(ary, len + argc);
return ary;
}
+VALUE
+rb_ary_unshift(VALUE ary, VALUE item)
+{
+ return rb_ary_unshift_m(1,&item,ary);
+}
+
/* faster version - use this if you don't need to treat negative offset */
static inline VALUE
-rb_ary_elt(ary, offset)
- VALUE ary;
- long offset;
+rb_ary_elt(VALUE ary, long offset)
{
- if (RARRAY(ary)->len == 0) return Qnil;
- if (offset < 0 || RARRAY(ary)->len <= offset) {
+ long len = RARRAY_LEN(ary);
+ if (len == 0) return Qnil;
+ if (offset < 0 || len <= offset) {
return Qnil;
}
- return RARRAY(ary)->ptr[offset];
+ return RARRAY_AREF(ary, offset);
}
VALUE
-rb_ary_entry(ary, offset)
- VALUE ary;
- long offset;
+rb_ary_entry(VALUE ary, long offset)
{
- if (offset < 0) {
- offset += RARRAY(ary)->len;
- }
- return rb_ary_elt(ary, offset);
+ return rb_ary_entry_internal(ary, offset);
}
-static VALUE
-rb_ary_subseq(ary, beg, len)
- VALUE ary;
- long beg, len;
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
{
- VALUE klass, ary2, shared;
- VALUE *ptr;
+ VALUE klass;
+ long alen = RARRAY_LEN(ary);
- if (beg > RARRAY(ary)->len) return Qnil;
+ if (beg > alen) return Qnil;
if (beg < 0 || len < 0) return Qnil;
- if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
- len = RARRAY(ary)->len - beg;
- if (len < 0)
- len = 0;
+ if (alen < len || alen < beg + len) {
+ len = alen - beg;
}
klass = rb_obj_class(ary);
if (len == 0) return ary_new(klass, 0);
- shared = ary_make_shared(ary);
- ptr = RARRAY(ary)->ptr;
- ary2 = ary_alloc(klass);
- RARRAY(ary2)->ptr = ptr + beg;
- RARRAY(ary2)->len = len;
- RARRAY(ary2)->aux.shared = shared;
- FL_SET(ary2, ELTS_SHARED);
-
- return ary2;
+ return ary_make_partial(ary, klass, beg, len);
}
-/*
+static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+
+/*
* call-seq:
- * array[index] -> obj or nil
- * array[start, length] -> an_array or nil
- * array[range] -> an_array or nil
- * array.slice(index) -> obj or nil
- * array.slice(start, length) -> an_array or nil
- * array.slice(range) -> an_array or nil
+ * ary[index] -> obj or nil
+ * ary[start, length] -> new_ary or nil
+ * ary[range] -> new_ary or nil
+ * ary.slice(index) -> obj or nil
+ * ary.slice(start, length) -> new_ary or nil
+ * ary.slice(range) -> new_ary or nil
+ *
+ * Element Reference --- Returns the element at +index+, or returns a
+ * subarray starting at the +start+ index and continuing for +length+
+ * elements, or returns a subarray specified by +range+ of indices.
*
- * Element Reference---Returns the element at _index_,
- * or returns a subarray starting at _start_ and
- * continuing for _length_ elements, or returns a subarray
- * specified by _range_.
- * Negative indices count backward from the end of the
- * array (-1 is the last element). Returns nil if the index
- * (or starting index) are out of range.
+ * Negative indices count backward from the end of the array (-1 is the last
+ * element). For +start+ and +range+ cases the starting index is just before
+ * an element. Additionally, an empty array is returned when the starting
+ * index for an element range is at the end of the array.
+ *
+ * Returns +nil+ if the index (or starting index) are out of range.
*
* a = [ "a", "b", "c", "d", "e" ]
* a[2] + a[0] + a[1] #=> "cab"
@@ -644,44 +1564,44 @@ rb_ary_subseq(ary, beg, len)
* a[-3, 3] #=> [ "c", "d", "e" ]
* # special cases
* a[5] #=> nil
+ * a[6, 1] #=> nil
* a[5, 1] #=> []
* a[5..10] #=> []
*
*/
VALUE
-rb_ary_aref(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
{
- VALUE arg;
- long beg, len;
-
+ rb_check_arity(argc, 1, 2);
if (argc == 2) {
- if (SYMBOL_P(argv[0])) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- if (beg < 0) {
- beg += RARRAY(ary)->len;
- }
- return rb_ary_subseq(ary, beg, len);
+ return rb_ary_aref2(ary, argv[0], argv[1]);
}
- if (argc != 1) {
- rb_scan_args(argc, argv, "11", 0, 0);
+ return rb_ary_aref1(ary, argv[0]);
+}
+
+VALUE
+rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
+{
+ long beg = NUM2LONG(b);
+ long len = NUM2LONG(e);
+ if (beg < 0) {
+ beg += RARRAY_LEN(ary);
}
- arg = argv[0];
+ return rb_ary_subseq(ary, beg, len);
+}
+
+MJIT_FUNC_EXPORTED VALUE
+rb_ary_aref1(VALUE ary, VALUE arg)
+{
+ long beg, len;
+
/* special case - speeding up */
if (FIXNUM_P(arg)) {
return rb_ary_entry(ary, FIX2LONG(arg));
}
- if (SYMBOL_P(arg)) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
/* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
+ switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
case Qfalse:
break;
case Qnil:
@@ -692,129 +1612,106 @@ rb_ary_aref(argc, argv, ary)
return rb_ary_entry(ary, NUM2LONG(arg));
}
-/*
+/*
* call-seq:
- * array.at(index) -> obj or nil
+ * ary.at(index) -> obj or nil
*
- * Returns the element at _index_. A
- * negative index counts from the end of _self_. Returns +nil+
- * if the index is out of range. See also <code>Array#[]</code>.
- * (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
- * as it does not accept ranges and so on.)
+ * Returns the element at +index+. A negative index counts from the end of
+ * +self+. Returns +nil+ if the index is out of range. See also
+ * Array#[].
*
* a = [ "a", "b", "c", "d", "e" ]
* a.at(0) #=> "a"
* a.at(-1) #=> "e"
*/
-static VALUE
-rb_ary_at(ary, pos)
- VALUE ary, pos;
+VALUE
+rb_ary_at(VALUE ary, VALUE pos)
{
return rb_ary_entry(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * array.first -> obj or nil
- * array.first(n) -> an_array
+ * ary.first -> obj or nil
+ * ary.first(n) -> new_ary
*
* Returns the first element, or the first +n+ elements, of the array.
- * If the array is empty, the first form returns <code>nil</code>, and the
- * second form returns an empty array.
+ * If the array is empty, the first form returns +nil+, and the
+ * second form returns an empty array. See also Array#last for
+ * the opposite effect.
*
* a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(1) #=> ["q"]
- * a.first(3) #=> ["q", "r", "s"]
+ * a.first #=> "q"
+ * a.first(2) #=> ["q", "r"]
*/
static VALUE
-rb_ary_first(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
{
if (argc == 0) {
- if (RARRAY(ary)->len == 0) return Qnil;
- return RARRAY(ary)->ptr[0];
+ if (RARRAY_LEN(ary) == 0) return Qnil;
+ return RARRAY_AREF(ary, 0);
}
else {
- VALUE nv, result;
- long n, i;
-
- rb_scan_args(argc, argv, "01", &nv);
- n = NUM2LONG(nv);
- if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
- result = rb_ary_new2(n);
- for (i=0; i<n; i++) {
- rb_ary_push(result, RARRAY(ary)->ptr[i]);
- }
- return result;
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
}
}
/*
* call-seq:
- * array.last -> obj or nil
- * array.last(n) -> an_array
- *
- * Returns the last element(s) of <i>self</i>. If the array is empty,
- * the first form returns <code>nil</code>.
- *
- * [ "w", "x", "y", "z" ].last #=> "z"
+ * ary.last -> obj or nil
+ * ary.last(n) -> new_ary
+ *
+ * Returns the last element(s) of +self+. If the array is empty,
+ * the first form returns +nil+.
+ *
+ * See also Array#first for the opposite effect.
+ *
+ * a = [ "w", "x", "y", "z" ]
+ * a.last #=> "z"
+ * a.last(2) #=> ["y", "z"]
*/
-static VALUE
-rb_ary_last(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+VALUE
+rb_ary_last(int argc, const VALUE *argv, VALUE ary)
{
if (argc == 0) {
- if (RARRAY(ary)->len == 0) return Qnil;
- return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
+ long len = RARRAY_LEN(ary);
+ if (len == 0) return Qnil;
+ return RARRAY_AREF(ary, len-1);
}
else {
- VALUE nv, result;
- long n, i;
-
- rb_scan_args(argc, argv, "01", &nv);
- n = NUM2LONG(nv);
- if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
- result = rb_ary_new2(n);
- for (i=RARRAY(ary)->len-n; n--; i++) {
- rb_ary_push(result, RARRAY(ary)->ptr[i]);
- }
- return result;
+ return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
}
}
/*
* call-seq:
- * array.fetch(index) -> obj
- * array.fetch(index, default ) -> obj
- * array.fetch(index) {|index| block } -> obj
- *
- * Tries to return the element at position <i>index</i>. If the index
- * lies outside the array, the first form throws an
- * <code>IndexError</code> exception, the second form returns
- * <i>default</i>, and the third form returns the value of invoking
- * the block, passing in the index. Negative values of <i>index</i>
- * count from the end of the array.
- *
+ * ary.fetch(index) -> obj
+ * ary.fetch(index, default) -> obj
+ * ary.fetch(index) {|index| block} -> obj
+ *
+ * Tries to return the element at position +index+, but throws an IndexError
+ * exception if the referenced +index+ lies outside of the array bounds. This
+ * error can be prevented by supplying a second argument, which will act as a
+ * +default+ value.
+ *
+ * Alternatively, if a block is given it will only be executed when an
+ * invalid +index+ is referenced.
+ *
+ * Negative values of +index+ count from the end of the array.
+ *
* a = [ 11, 22, 33, 44 ]
* a.fetch(1) #=> 22
* a.fetch(-1) #=> 44
* a.fetch(4, 'cat') #=> "cat"
- * a.fetch(4) { |i| i*i } #=> 16
+ * a.fetch(100) {|i| puts "#{i} is out of bounds"}
+ * #=> "100 is out of bounds"
*/
static VALUE
-rb_ary_fetch(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
{
VALUE pos, ifnone;
long block_given;
@@ -828,198 +1725,293 @@ rb_ary_fetch(argc, argv, ary)
idx = NUM2LONG(pos);
if (idx < 0) {
- idx += RARRAY(ary)->len;
+ idx += RARRAY_LEN(ary);
}
- if (idx < 0 || RARRAY(ary)->len <= idx) {
+ if (idx < 0 || RARRAY_LEN(ary) <= idx) {
if (block_given) return rb_yield(pos);
if (argc == 1) {
- rb_raise(rb_eIndexError, "index %ld out of array", idx);
+ rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+ idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
}
return ifnone;
}
- return RARRAY(ary)->ptr[idx];
+ return RARRAY_AREF(ary, idx);
}
/*
* call-seq:
- * array.index(obj) -> int or nil
- *
- * Returns the index of the first object in <i>self</i> such that is
- * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- * no match is found.
- *
+ * ary.find_index(obj) -> int or nil
+ * ary.find_index {|item| block} -> int or nil
+ * ary.find_index -> Enumerator
+ * ary.index(obj) -> int or nil
+ * ary.index {|item| block} -> int or nil
+ * ary.index -> Enumerator
+ *
+ * Returns the _index_ of the first object in +ary+ such that the object is
+ * <code>==</code> to +obj+.
+ *
+ * If a block is given instead of an argument, returns the _index_ of the
+ * first object for which the block returns +true+. Returns +nil+ if no
+ * match is found.
+ *
+ * See also Array#rindex.
+ *
+ * An Enumerator is returned if neither a block nor argument is given.
+ *
* a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
+ * a.index("b") #=> 1
+ * a.index("z") #=> nil
+ * a.index {|x| x == "b"} #=> 1
*/
static VALUE
-rb_ary_index(ary, val)
- VALUE ary;
- VALUE val;
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
{
+ VALUE val;
long i;
- for (i=0; i<RARRAY(ary)->len; i++) {
- if (rb_equal(RARRAY(ary)->ptr[i], val))
+ if (argc == 0) {
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ return LONG2NUM(i);
+ }
+ }
+ return Qnil;
+ }
+ rb_check_arity(argc, 0, 1);
+ val = argv[0];
+ if (rb_block_given_p())
+ rb_warn("given block not used");
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
return LONG2NUM(i);
+ }
}
return Qnil;
}
/*
* call-seq:
- * array.rindex(obj) -> int or nil
- *
- * Returns the index of the last object in <i>array</i>
- * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- * no match is found.
- *
+ * ary.rindex(obj) -> int or nil
+ * ary.rindex {|item| block} -> int or nil
+ * ary.rindex -> Enumerator
+ *
+ * Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ *
+ * If a block is given instead of an argument, returns the _index_ of the
+ * first object for which the block returns +true+, starting from the last
+ * object.
+ *
+ * Returns +nil+ if no match is found.
+ *
+ * See also Array#index.
+ *
+ * If neither block nor argument is given, an Enumerator is returned instead.
+ *
* a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
+ * a.rindex("b") #=> 3
+ * a.rindex("z") #=> nil
+ * a.rindex {|x| x == "b"} #=> 3
*/
static VALUE
-rb_ary_rindex(ary, val)
- VALUE ary;
- VALUE val;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
{
- long i = RARRAY(ary)->len;
+ VALUE val;
+ long i = RARRAY_LEN(ary), len;
- while (i--) {
- if (i > RARRAY(ary)->len) {
- i = RARRAY(ary)->len;
- continue;
+ if (argc == 0) {
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (i--) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+ return LONG2NUM(i);
+ if (i > (len = RARRAY_LEN(ary))) {
+ i = len;
+ }
}
- if (rb_equal(RARRAY(ary)->ptr[i], val))
+ return Qnil;
+ }
+ rb_check_arity(argc, 0, 1);
+ val = argv[0];
+ if (rb_block_given_p())
+ rb_warn("given block not used");
+ while (i--) {
+ VALUE e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, val)) {
return LONG2NUM(i);
+ }
+ if (i > RARRAY_LEN(ary)) {
+ break;
+ }
}
return Qnil;
}
-/*
- * call-seq:
- * array.indexes( i1, i2, ... iN ) -> an_array
- * array.indices( i1, i2, ... iN ) -> an_array
- *
- * Deprecated; use <code>Array#values_at</code>.
- */
-
-static VALUE
-rb_ary_indexes(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
-{
- VALUE new_ary;
- long i;
-
- rb_warn("Array#%s is deprecated; use Array#values_at", rb_id2name(rb_frame_last_func()));
- new_ary = rb_ary_new2(argc);
- for (i=0; i<argc; i++) {
- rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
- }
-
- return new_ary;
-}
-
VALUE
-rb_ary_to_ary(obj)
- VALUE obj;
+rb_ary_to_ary(VALUE obj)
{
- if (TYPE(obj) == T_ARRAY) {
- return obj;
- }
- if (rb_respond_to(obj, rb_intern("to_ary"))) {
- return rb_convert_type(obj, T_ARRAY, "Array", "to_ary");
- }
+ VALUE tmp = rb_check_array_type(obj);
+
+ if (!NIL_P(tmp)) return tmp;
return rb_ary_new3(1, obj);
}
static void
-rb_ary_splice(ary, beg, len, rpl)
- VALUE ary;
- long beg, len;
- VALUE rpl;
+rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
{
- long rlen;
+ long olen;
+ long rofs;
if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
+ olen = RARRAY_LEN(ary);
if (beg < 0) {
- beg += RARRAY(ary)->len;
+ beg += olen;
if (beg < 0) {
- beg -= RARRAY(ary)->len;
- rb_raise(rb_eIndexError, "index %ld out of array", beg);
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ beg - olen, -olen);
}
}
- if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
- len = RARRAY(ary)->len - beg;
+ if (olen < len || olen < beg + len) {
+ len = olen - beg;
}
- if (NIL_P(rpl)) {
- rlen = 0;
- }
- else {
- rpl = rb_ary_to_ary(rpl);
- rlen = RARRAY(rpl)->len;
+ {
+ const VALUE *optr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
}
- rb_ary_modify(ary);
- if (beg >= RARRAY(ary)->len) {
- len = beg + rlen;
- if (len >= RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
- RARRAY(ary)->aux.capa = len;
+ if (beg >= olen) {
+ VALUE target_ary;
+ if (beg > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", beg);
}
- rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
+ target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+ len = beg + rlen;
+ ary_mem_clear(ary, olen, beg - olen);
if (rlen > 0) {
- MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ ary_memcpy0(ary, beg, rlen, rptr, target_ary);
}
- RARRAY(ary)->len = len;
+ ARY_SET_LEN(ary, len);
}
else {
long alen;
- if (beg + len > RARRAY(ary)->len) {
- len = RARRAY(ary)->len - beg;
+ if (olen - len > ARY_MAX_SIZE - rlen) {
+ rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
}
-
- alen = RARRAY(ary)->len + rlen - len;
- if (alen >= RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
- RARRAY(ary)->aux.capa = alen;
+ rb_ary_modify(ary);
+ alen = olen + rlen - len;
+ if (alen >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, alen);
}
if (len != rlen) {
- MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
- VALUE, RARRAY(ary)->len - (beg + len));
- RARRAY(ary)->len = alen;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+ VALUE, olen - (beg + len)));
+ ARY_SET_LEN(ary, alen);
}
if (rlen > 0) {
- MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+ if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
+ /* give up wb-protected ary */
+ RB_OBJ_WB_UNPROTECT_FOR(ARRAY, ary);
+
+ /* do not use RARRAY_PTR() because it can causes GC.
+ * ary can contain T_NONE object because it is not cleared.
+ */
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr,
+ MEMMOVE(ptr + beg, rptr, VALUE, rlen));
}
}
}
-/*
+void
+rb_ary_set_len(VALUE ary, long len)
+{
+ long capa;
+
+ rb_ary_modify_check(ary);
+ if (ARY_SHARED_P(ary)) {
+ rb_raise(rb_eRuntimeError, "can't set length of shared ");
+ }
+ if (len > (capa = (long)ARY_CAPA(ary))) {
+ rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+ }
+ ARY_SET_LEN(ary, len);
+}
+
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary an array
+ * \param len new size
+ * \return \a ary
+ * \post the size of \a ary is \a len.
+ */
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+ long olen;
+
+ rb_ary_modify(ary);
+ olen = RARRAY_LEN(ary);
+ if (len == olen) return ary;
+ if (len > ARY_MAX_SIZE) {
+ rb_raise(rb_eIndexError, "index %ld too big", len);
+ }
+ if (len > olen) {
+ if (len >= ARY_CAPA(ary)) {
+ ary_double_capa(ary, len);
+ }
+ ary_mem_clear(ary, olen, len - olen);
+ ARY_SET_LEN(ary, len);
+ }
+ else if (ARY_EMBED_P(ary)) {
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else if (len <= RARRAY_EMBED_LEN_MAX) {
+ VALUE tmp[RARRAY_EMBED_LEN_MAX];
+ MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+ ary_discard(ary);
+ MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+ ARY_SET_EMBED_LEN(ary, len);
+ }
+ else {
+ if (olen > len + ARY_DEFAULT_SIZE) {
+ ary_heap_realloc(ary, len);
+ ARY_SET_CAPA(ary, len);
+ }
+ ARY_SET_HEAP_LEN(ary, len);
+ }
+ ary_verify(ary);
+ return ary;
+}
+
+/*
* call-seq:
- * array[index] = obj -> obj
- * array[start, length] = obj or an_array or nil -> obj or an_array or nil
- * array[range] = obj or an_array or nil -> obj or an_array or nil
+ * ary[index] = obj -> obj
+ * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
+ * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
+ *
+ * Element Assignment --- Sets the element at +index+, or replaces a subarray
+ * from the +start+ index for +length+ elements, or replaces a subarray
+ * specified by the +range+ of indices.
+ *
+ * If indices are greater than the current capacity of the array, the array
+ * grows automatically. Elements are inserted into the array at +start+ if
+ * +length+ is zero.
+ *
+ * Negative indices will count backward from the end of the array. For
+ * +start+ and +range+ cases the starting index is just before an element.
+ *
+ * An IndexError is raised if a negative index points past the beginning of
+ * the array.
+ *
+ * See also Array#push, and Array#unshift.
*
- * Element Assignment---Sets the element at _index_,
- * or replaces a subarray starting at _start_ and
- * continuing for _length_ elements, or replaces a subarray
- * specified by _range_. If indices are greater than
- * the current capacity of the array, the array grows
- * automatically. A negative indices will count backward
- * from the end of the array. Inserts elements if _length_ is
- * zero. If +nil+ is used in the second and third form,
- * deletes elements from _self_. An +IndexError+ is raised if a
- * negative index points past the beginning of the array. See also
- * <code>Array#push</code>, and <code>Array#unshift</code>.
- *
* a = Array.new
* a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
* a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
@@ -1027,41 +2019,37 @@ rb_ary_splice(ary, beg, len, rpl)
* a[0, 2] = "?" #=> ["?", 2, nil, "4"]
* a[0..2] = "A" #=> ["A", "4"]
* a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A"]
+ * a[1..-1] = nil #=> ["A", nil]
+ * a[1..-1] = [] #=> ["A"]
+ * a[0, 0] = [ 1, 2 ] #=> [1, 2, "A"]
+ * a[3, 0] = "B" #=> [1, 2, "A", "B"]
*/
static VALUE
-rb_ary_aset(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
{
long offset, beg, len;
+ VALUE rpl;
if (argc == 3) {
- if (SYMBOL_P(argv[0])) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
- if (SYMBOL_P(argv[1])) {
- rb_raise(rb_eTypeError, "Symbol as subarray length");
- }
- rb_ary_splice(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
- return argv[2];
- }
- if (argc != 2) {
- rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
+ rb_ary_modify_check(ary);
+ beg = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ goto range;
}
+ rb_check_arity(argc, 2, 2);
+ rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
offset = FIX2LONG(argv[0]);
goto fixnum;
}
- if (SYMBOL_P(argv[0])) {
- rb_raise(rb_eTypeError, "Symbol as array index");
- }
- if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
+ if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
/* check if idx is Range */
- rb_ary_splice(ary, beg, len, argv[1]);
- return argv[1];
+ range:
+ rpl = rb_ary_to_ary(argv[argc-1]);
+ rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR_TRANSIENT(rpl), RARRAY_LEN(rpl));
+ RB_GC_GUARD(rpl);
+ return argv[argc-1];
}
offset = NUM2LONG(argv[0]);
@@ -1072,88 +2060,108 @@ fixnum:
/*
* call-seq:
- * array.insert(index, obj...) -> array
- *
- * Inserts the given values before the element with the given index
- * (which may be negative).
- *
+ * ary.insert(index, obj...) -> ary
+ *
+ * Inserts the given values before the element with the given +index+.
+ *
+ * Negative indices count backwards from the end of the array, where +-1+ is
+ * the last element. If a negative index is used, the given values will be
+ * inserted after that element, so using an index of +-1+ will insert the
+ * values at the end of the array.
+ *
* a = %w{ a b c d }
* a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
* a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
*/
static VALUE
-rb_ary_insert(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
{
long pos;
- if (argc == 1) return ary;
- if (argc < 1) {
- rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
- }
+ rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+ rb_ary_modify_check(ary);
pos = NUM2LONG(argv[0]);
+ if (argc == 1) return ary;
if (pos == -1) {
- pos = RARRAY(ary)->len;
+ pos = RARRAY_LEN(ary);
}
- if (pos < 0) {
+ else if (pos < 0) {
+ long minpos = -RARRAY_LEN(ary) - 1;
+ if (pos < minpos) {
+ rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+ pos, minpos);
+ }
pos++;
}
- rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+ rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
return ary;
}
+static VALUE
+rb_ary_length(VALUE ary);
+
+static VALUE
+ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
+{
+ return rb_ary_length(ary);
+}
+
/*
* call-seq:
- * array.each {|item| block } -> array
- *
- * Calls <i>block</i> once for each element in <i>self</i>, passing that
- * element as a parameter.
- *
+ * ary.each {|item| block} -> ary
+ * ary.each -> Enumerator
+ *
+ * Calls the given block once for each element in +self+, passing that element
+ * as a parameter. Returns the array itself.
+ *
+ * If no block is given, an Enumerator is returned.
+ *
* a = [ "a", "b", "c" ]
* a.each {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* a -- b -- c --
*/
VALUE
-rb_ary_each(ary)
- VALUE ary;
+rb_ary_each(VALUE ary)
{
long i;
-
- for (i=0; i<RARRAY(ary)->len; i++) {
- rb_yield(RARRAY(ary)->ptr[i]);
+ ary_verify(ary);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_yield(RARRAY_AREF(ary, i));
}
return ary;
}
/*
* call-seq:
- * array.each_index {|index| block } -> array
- *
- * Same as <code>Array#each</code>, but passes the index of the element
- * instead of the element itself.
- *
+ * ary.each_index {|index| block} -> ary
+ * ary.each_index -> Enumerator
+ *
+ * Same as Array#each, but passes the +index+ of the element instead of the
+ * element itself.
+ *
+ * An Enumerator is returned if no block is given.
+ *
* a = [ "a", "b", "c" ]
* a.each_index {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* 0 -- 1 -- 2 --
*/
static VALUE
-rb_ary_each_index(ary)
- VALUE ary;
+rb_ary_each_index(VALUE ary)
{
long i;
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- for (i=0; i<RARRAY(ary)->len; i++) {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
rb_yield(LONG2NUM(i));
}
return ary;
@@ -1161,29 +2169,32 @@ rb_ary_each_index(ary)
/*
* call-seq:
- * array.reverse_each {|item| block }
- *
- * Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
- * order.
- *
+ * ary.reverse_each {|item| block} -> ary
+ * ary.reverse_each -> Enumerator
+ *
+ * Same as Array#each, but traverses +self+ in reverse order.
+ *
* a = [ "a", "b", "c" ]
* a.reverse_each {|x| print x, " " }
- *
+ *
* produces:
- *
+ *
* c b a
*/
static VALUE
-rb_ary_reverse_each(ary)
- VALUE ary;
+rb_ary_reverse_each(VALUE ary)
{
- long len = RARRAY(ary)->len;
+ long len;
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ len = RARRAY_LEN(ary);
while (len--) {
- rb_yield(RARRAY(ary)->ptr[len]);
- if (RARRAY(ary)->len < len) {
- len = RARRAY(ary)->len;
+ long nlen;
+ rb_yield(RARRAY_AREF(ary, len));
+ nlen = RARRAY_LEN(ary);
+ if (nlen < len) {
+ len = nlen;
}
}
return ary;
@@ -1191,555 +2202,908 @@ rb_ary_reverse_each(ary)
/*
* call-seq:
- * array.length -> int
- *
- * Returns the number of elements in <i>self</i>. May be zero.
- *
+ * ary.length -> int
+ *
+ * Returns the number of elements in +self+. May be zero.
+ *
* [ 1, 2, 3, 4, 5 ].length #=> 5
+ * [].length #=> 0
*/
static VALUE
-rb_ary_length(ary)
- VALUE ary;
+rb_ary_length(VALUE ary)
{
- return LONG2NUM(RARRAY(ary)->len);
+ long len = RARRAY_LEN(ary);
+ return LONG2NUM(len);
}
/*
* call-seq:
- * array.empty? -> true or false
- *
- * Returns <code>true</code> if <i>self</i> array contains no elements.
- *
+ * ary.empty? -> true or false
+ *
+ * Returns +true+ if +self+ contains no elements.
+ *
* [].empty? #=> true
*/
static VALUE
-rb_ary_empty_p(ary)
- VALUE ary;
+rb_ary_empty_p(VALUE ary)
{
- if (RARRAY(ary)->len == 0)
+ if (RARRAY_LEN(ary) == 0)
return Qtrue;
return Qfalse;
}
VALUE
-rb_ary_dup(ary)
- VALUE ary;
+rb_ary_dup(VALUE ary)
{
- VALUE dup = rb_ary_new2(RARRAY(ary)->len);
+ long len = RARRAY_LEN(ary);
+ VALUE dup = rb_ary_new2(len);
+ ary_memcpy(dup, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_LEN(dup, len);
- DUPSETUP(dup, ary);
- MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- RARRAY(dup)->len = RARRAY(ary)->len;
+ ary_verify(ary);
+ ary_verify(dup);
return dup;
}
+VALUE
+rb_ary_resurrect(VALUE ary)
+{
+ return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
+}
+
extern VALUE rb_output_fs;
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
static VALUE
-inspect_join(ary, arg)
- VALUE ary;
- VALUE *arg;
+recursive_join(VALUE obj, VALUE argp, int recur)
{
- return rb_ary_join(arg[0], arg[1]);
+ VALUE *arg = (VALUE *)argp;
+ VALUE ary = arg[0];
+ VALUE sep = arg[1];
+ VALUE result = arg[2];
+ int *first = (int *)arg[3];
+
+ if (recur) {
+ rb_raise(rb_eArgError, "recursive array join");
+ }
+ else {
+ ary_join_1(obj, ary, sep, 0, result, first);
+ }
+ return Qnil;
}
-VALUE
-rb_ary_join(ary, sep)
- VALUE ary, sep;
+static void
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
{
- long len = 1, i;
- int taint = Qfalse;
- VALUE result, tmp;
-
- if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
- if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
+ long i;
+ VALUE val;
- for (i=0; i<RARRAY(ary)->len; i++) {
- tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
- len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
- }
- if (!NIL_P(sep)) {
- StringValue(sep);
- len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
+ if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
+ for (i=0; i<max; i++) {
+ val = RARRAY_AREF(ary, i);
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+ rb_str_buf_append(result, val);
}
- result = rb_str_buf_new(len);
- for (i=0; i<RARRAY(ary)->len; i++) {
- tmp = RARRAY(ary)->ptr[i];
- switch (TYPE(tmp)) {
- case T_STRING:
- break;
- case T_ARRAY:
- if (rb_inspecting_p(tmp)) {
- tmp = rb_str_new2("[...]");
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+{
+ VALUE val, tmp;
+
+ for (; i<RARRAY_LEN(ary); i++) {
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+
+ val = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(val, T_STRING)) {
+ str_join:
+ rb_str_buf_append(result, val);
+ if (*first) {
+ rb_enc_copy(result, val);
+ *first = FALSE;
+ }
+ }
+ else if (RB_TYPE_P(val, T_ARRAY)) {
+ obj = val;
+ ary_join:
+ if (val == ary) {
+ rb_raise(rb_eArgError, "recursive array join");
}
else {
- VALUE args[2];
+ VALUE args[4];
- args[0] = tmp;
+ *first = FALSE;
+ args[0] = val;
args[1] = sep;
- tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+ args[2] = result;
+ args[3] = (VALUE)first;
+ rb_exec_recursive(recursive_join, obj, (VALUE)args);
}
- break;
- default:
- tmp = rb_obj_as_string(tmp);
}
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
- rb_str_buf_append(result, tmp);
- if (OBJ_TAINTED(tmp)) taint = Qtrue;
+ else {
+ tmp = rb_check_string_type(val);
+ if (!NIL_P(tmp)) {
+ val = tmp;
+ goto str_join;
+ }
+ tmp = rb_check_array_type(val);
+ if (!NIL_P(tmp)) {
+ obj = val;
+ val = tmp;
+ goto ary_join;
+ }
+ val = rb_obj_as_string(val);
+ goto str_join;
+ }
}
+}
+
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+ long len = 1, i;
+ VALUE val, tmp, result;
+
+ if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+
+ if (!NIL_P(sep)) {
+ StringValue(sep);
+ len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+ }
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ val = RARRAY_AREF(ary, i);
+ tmp = rb_check_string_type(val);
+
+ if (NIL_P(tmp) || tmp != val) {
+ int first;
+ result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+ rb_enc_associate(result, rb_usascii_encoding());
+ ary_join_0(ary, sep, i, result);
+ first = i == 0;
+ ary_join_1(ary, ary, sep, i, result, &first);
+ return result;
+ }
+
+ len += RSTRING_LEN(tmp);
+ }
+
+ result = rb_str_new(0, len);
+ rb_str_set_len(result, 0);
+
+ ary_join_0(ary, sep, RARRAY_LEN(ary), result);
- if (taint) OBJ_TAINT(result);
return result;
}
/*
* call-seq:
- * array.join(sep=$,) -> str
- *
+ * ary.join(separator=$,) -> str
+ *
* Returns a string created by converting each element of the array to
- * a string, separated by <i>sep</i>.
- *
+ * a string, separated by the given +separator+.
+ * If the +separator+ is +nil+, it uses current <code>$,</code>.
+ * If both the +separator+ and <code>$,</code> are +nil+,
+ * it uses an empty string.
+ *
* [ "a", "b", "c" ].join #=> "abc"
* [ "a", "b", "c" ].join("-") #=> "a-b-c"
+ *
+ * For nested arrays, join is applied recursively:
+ *
+ * [ "a", [1, 2, [:x, :y]], "b" ].join("-") #=> "a-1-2-x-y-b"
*/
static VALUE
-rb_ary_join_m(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
{
VALUE sep;
- rb_scan_args(argc, argv, "01", &sep);
- if (NIL_P(sep)) sep = rb_output_fs;
-
+ if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
+ sep = rb_output_fs;
+ if (!NIL_P(sep)) {
+ rb_warn("$, is set to non-nil value");
+ }
+ }
+
return rb_ary_join(ary, sep);
}
+static VALUE
+inspect_ary(VALUE ary, VALUE dummy, int recur)
+{
+ long i;
+ VALUE s, str;
+
+ if (recur) return rb_usascii_str_new_cstr("[...]");
+ str = rb_str_buf_new2("[");
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ s = rb_inspect(RARRAY_AREF(ary, i));
+ if (i > 0) rb_str_buf_cat2(str, ", ");
+ else rb_enc_copy(str, s);
+ rb_str_buf_append(str, s);
+ }
+ rb_str_buf_cat2(str, "]");
+ return str;
+}
+
/*
* call-seq:
- * array.to_s -> string
- *
- * Returns _self_<code>.join</code>.
- *
- * [ "a", "e", "i", "o" ].to_s #=> "aeio"
+ * ary.inspect -> string
+ * ary.to_s -> string
*
+ * Creates a string representation of +self+, by calling #inspect
+ * on each element.
+ *
+ * [ "a", "b", "c" ].to_s #=> "[\"a\", \"b\", \"c\"]"
*/
-VALUE
-rb_ary_to_s(ary)
- VALUE ary;
+static VALUE
+rb_ary_inspect(VALUE ary)
{
- if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-
- return rb_ary_join(ary, rb_output_fs);
+ if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+ return rb_exec_recursive(inspect_ary, ary, 0);
}
-static ID inspect_key;
+VALUE
+rb_ary_to_s(VALUE ary)
+{
+ return rb_ary_inspect(ary);
+}
-struct inspect_arg {
- VALUE (*func)();
- VALUE arg1, arg2;
-};
+/*
+ * call-seq:
+ * ary.to_a -> ary
+ *
+ * Returns +self+.
+ *
+ * If called on a subclass of Array, converts the receiver to an Array object.
+ */
static VALUE
-inspect_call(arg)
- struct inspect_arg *arg;
+rb_ary_to_a(VALUE ary)
{
- return (*arg->func)(arg->arg1, arg->arg2);
+ if (rb_obj_class(ary) != rb_cArray) {
+ VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+ rb_ary_replace(dup, ary);
+ return dup;
+ }
+ return ary;
}
+/*
+ * call-seq:
+ * ary.to_h -> hash
+ * ary.to_h {|item| block } -> hash
+ *
+ * Returns the result of interpreting <i>ary</i> as an array of
+ * <tt>[key, value]</tt> pairs.
+ *
+ * [[:foo, :bar], [1, 2]].to_h
+ * # => {:foo => :bar, 1 => 2}
+ *
+ * If a block is given, the results of the block on each element of
+ * the array will be used as pairs.
+ *
+ * ["foo", "bar"].to_h {|s| [s.ord, s]}
+ * # => {102=>"foo", 98=>"bar"}
+ */
+
static VALUE
-get_inspect_tbl(create)
- int create;
+rb_ary_to_h(VALUE ary)
{
- VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-
- if (NIL_P(inspect_tbl)) {
- if (create) {
- tbl_init:
- inspect_tbl = rb_ary_new();
- rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
+ long i;
+ VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
+ int block_given = rb_block_given_p();
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ const VALUE e = rb_ary_elt(ary, i);
+ const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
+ const VALUE key_value_pair = rb_check_array_type(elt);
+ if (NIL_P(key_value_pair)) {
+ rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+ rb_obj_class(elt), i);
}
+ if (RARRAY_LEN(key_value_pair) != 2) {
+ rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+ i, RARRAY_LEN(key_value_pair));
+ }
+ rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
}
- else if (TYPE(inspect_tbl) != T_ARRAY) {
- rb_warn("invalid inspect_tbl value");
- if (create) goto tbl_init;
- rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
- return Qnil;
- }
- return inspect_tbl;
+ return hash;
}
+/*
+ * call-seq:
+ * ary.to_ary -> ary
+ *
+ * Returns +self+.
+ */
+
static VALUE
-inspect_ensure(obj)
- VALUE obj;
+rb_ary_to_ary_m(VALUE ary)
{
- VALUE inspect_tbl;
-
- inspect_tbl = get_inspect_tbl(Qfalse);
- if (!NIL_P(inspect_tbl)) {
- rb_ary_pop(inspect_tbl);
- }
- return 0;
+ return ary;
}
-VALUE
-rb_protect_inspect(func, obj, arg)
- VALUE (*func)(ANYARGS);
- VALUE obj, arg;
+static void
+ary_reverse(VALUE *p1, VALUE *p2)
{
- struct inspect_arg iarg;
- VALUE inspect_tbl;
- VALUE id;
-
- inspect_tbl = get_inspect_tbl(Qtrue);
- id = rb_obj_id(obj);
- if (rb_ary_includes(inspect_tbl, id)) {
- return (*func)(obj, arg);
+ while (p1 < p2) {
+ VALUE tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
}
- rb_ary_push(inspect_tbl, id);
- iarg.func = func;
- iarg.arg1 = obj;
- iarg.arg2 = arg;
-
- return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
}
VALUE
-rb_inspecting_p(obj)
- VALUE obj;
+rb_ary_reverse(VALUE ary)
{
- VALUE inspect_tbl;
+ VALUE *p2;
+ long len = RARRAY_LEN(ary);
- inspect_tbl = get_inspect_tbl(Qfalse);
- if (NIL_P(inspect_tbl)) return Qfalse;
- return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
-}
-
-static VALUE
-inspect_ary(ary)
- VALUE ary;
-{
- int tainted = OBJ_TAINTED(ary);
- long i;
- VALUE s, str;
-
- str = rb_str_buf_new2("[");
- for (i=0; i<RARRAY(ary)->len; i++) {
- s = rb_inspect(RARRAY(ary)->ptr[i]);
- if (OBJ_TAINTED(s)) tainted = Qtrue;
- if (i > 0) rb_str_buf_cat2(str, ", ");
- rb_str_buf_append(str, s);
+ rb_ary_modify(ary);
+ if (len > 1) {
+ RARRAY_PTR_USE_TRANSIENT(ary, p1, {
+ p2 = p1 + len - 1; /* points last item */
+ ary_reverse(p1, p2);
+ }); /* WB: no new reference */
}
- rb_str_buf_cat2(str, "]");
- if (tainted) OBJ_TAINT(str);
- return str;
+ return ary;
}
/*
* call-seq:
- * array.inspect -> string
+ * ary.reverse! -> ary
*
- * Create a printable version of <i>array</i>.
+ * Reverses +self+ in place.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.reverse! #=> ["c", "b", "a"]
+ * a #=> ["c", "b", "a"]
*/
static VALUE
-rb_ary_inspect(ary)
- VALUE ary;
+rb_ary_reverse_bang(VALUE ary)
{
- if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
- if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
- return rb_protect_inspect(inspect_ary, ary, 0);
+ return rb_ary_reverse(ary);
}
/*
* call-seq:
- * array.to_a -> array
- *
- * Returns _self_. If called on a subclass of Array, converts
- * the receiver to an Array object.
+ * ary.reverse -> new_ary
+ *
+ * Returns a new array containing +self+'s elements in reverse order.
+ *
+ * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
+ * [ 1 ].reverse #=> [1]
*/
static VALUE
-rb_ary_to_a(ary)
- VALUE ary;
+rb_ary_reverse_m(VALUE ary)
{
- if (rb_obj_class(ary) != rb_cArray) {
- VALUE dup = rb_ary_new2(RARRAY(ary)->len);
- rb_ary_replace(dup, ary);
- return dup;
+ long len = RARRAY_LEN(ary);
+ VALUE dup = rb_ary_new2(len);
+
+ if (len > 0) {
+ const VALUE *p1 = RARRAY_CONST_PTR_TRANSIENT(ary);
+ VALUE *p2 = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(dup) + len - 1;
+ do *p2-- = *p1++; while (--len > 0);
}
- return ary;
+ ARY_SET_LEN(dup, RARRAY_LEN(ary));
+ return dup;
}
-/*
- * call-seq:
- * array.to_ary -> array
- *
- * Returns _self_.
- */
+static inline long
+rotate_count(long cnt, long len)
+{
+ return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+}
-static VALUE
-rb_ary_to_ary_m(ary)
- VALUE ary;
+static void
+ary_rotate_ptr(VALUE *ptr, long len, long cnt)
{
- return ary;
+ --len;
+ if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+ if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+ if (len > 0) ary_reverse(ptr, ptr + len);
}
VALUE
-rb_ary_reverse(ary)
- VALUE ary;
+rb_ary_rotate(VALUE ary, long cnt)
{
- VALUE *p1, *p2;
- VALUE tmp;
-
rb_ary_modify(ary);
- if (RARRAY(ary)->len > 1) {
- p1 = RARRAY(ary)->ptr;
- p2 = p1 + RARRAY(ary)->len - 1; /* points last item */
- while (p1 < p2) {
- tmp = *p1;
- *p1++ = *p2;
- *p2-- = tmp;
- }
+ if (cnt != 0) {
+ long len = RARRAY_LEN(ary);
+ if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
+ return ary;
+ }
}
- return ary;
+ return Qnil;
}
/*
* call-seq:
- * array.reverse! -> array
- *
- * Reverses _self_ in place.
- *
- * a = [ "a", "b", "c" ]
- * a.reverse! #=> ["c", "b", "a"]
- * a #=> ["c", "b", "a"]
+ * ary.rotate!(count=1) -> ary
+ *
+ * Rotates +self+ in place so that the element at +count+ comes first, and
+ * returns +self+.
+ *
+ * If +count+ is negative then it rotates in the opposite direction, starting
+ * from the end of the array where +-1+ is the last element.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.rotate! #=> ["b", "c", "d", "a"]
+ * a #=> ["b", "c", "d", "a"]
+ * a.rotate!(2) #=> ["d", "a", "b", "c"]
+ * a.rotate!(-3) #=> ["a", "b", "c", "d"]
*/
static VALUE
-rb_ary_reverse_bang(ary)
- VALUE ary;
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
{
- return rb_ary_reverse(ary);
+ long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+ rb_ary_rotate(ary, n);
+ return ary;
}
/*
* call-seq:
- * array.reverse -> an_array
- *
- * Returns a new array containing <i>self</i>'s elements in reverse order.
- *
- * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
- * [ 1 ].reverse #=> [1]
+ * ary.rotate(count=1) -> new_ary
+ *
+ * Returns a new array by rotating +self+ so that the element at +count+ is
+ * the first element of the new array.
+ *
+ * If +count+ is negative then it rotates in the opposite direction, starting
+ * from the end of +self+ where +-1+ is the last element.
+ *
+ * a = [ "a", "b", "c", "d" ]
+ * a.rotate #=> ["b", "c", "d", "a"]
+ * a #=> ["a", "b", "c", "d"]
+ * a.rotate(2) #=> ["c", "d", "a", "b"]
+ * a.rotate(-3) #=> ["b", "c", "d", "a"]
*/
static VALUE
-rb_ary_reverse_m(ary)
- VALUE ary;
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
{
- return rb_ary_reverse(rb_ary_dup(ary));
+ VALUE rotated;
+ const VALUE *ptr;
+ long len;
+ long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
+
+ len = RARRAY_LEN(ary);
+ rotated = rb_ary_new2(len);
+ if (len > 0) {
+ cnt = rotate_count(cnt, len);
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ len -= cnt;
+ ary_memcpy(rotated, 0, len, ptr + cnt);
+ ary_memcpy(rotated, len, cnt, ptr);
+ }
+ ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+ return rotated;
}
struct ary_sort_data {
VALUE ary;
- VALUE *ptr;
- long len;
+ struct cmp_opt_data cmp_opt;
};
-static void
-ary_sort_check(data)
- struct ary_sort_data *data;
+static VALUE
+sort_reentered(VALUE ary)
{
- if (RARRAY(data->ary)->ptr != data->ptr || RARRAY(data->ary)->len != data->len) {
- rb_raise(rb_eArgError, "array modified during sort");
+ if (RBASIC(ary)->klass) {
+ rb_raise(rb_eRuntimeError, "sort reentered");
}
+ return Qnil;
}
static int
-sort_1(a, b, data)
- VALUE *a, *b;
- struct ary_sort_data *data;
+sort_1(const void *ap, const void *bp, void *dummy)
{
- VALUE retval = rb_yield_values(2, *a, *b);
+ struct ary_sort_data *data = dummy;
+ VALUE retval = sort_reentered(data->ary);
+ VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+ VALUE args[2];
int n;
- n = rb_cmpint(retval, *a, *b);
- ary_sort_check(data);
+ args[0] = a;
+ args[1] = b;
+ retval = rb_yield_values2(2, args);
+ n = rb_cmpint(retval, a, b);
+ sort_reentered(data->ary);
return n;
}
static int
-sort_2(ap, bp, data)
- VALUE *ap, *bp;
- struct ary_sort_data *data;
+sort_2(const void *ap, const void *bp, void *dummy)
{
- VALUE retval;
- VALUE a = *ap, b = *bp;
+ struct ary_sort_data *data = dummy;
+ VALUE retval = sort_reentered(data->ary);
+ VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
int n;
- if (FIXNUM_P(a) && FIXNUM_P(b)) {
+ if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Fixnum)) {
if ((long)a > (long)b) return 1;
if ((long)a < (long)b) return -1;
return 0;
}
- if (TYPE(a) == T_STRING) {
- if (TYPE(b) == T_STRING) return rb_str_cmp(a, b);
+ if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
+ return rb_str_cmp(a, b);
+ }
+ if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(data->cmp_opt, Float)) {
+ return rb_float_cmp(a, b);
}
- retval = rb_funcall(a, id_cmp, 1, b);
+ retval = rb_funcallv(a, id_cmp, 1, &b);
n = rb_cmpint(retval, a, b);
- ary_sort_check(data);
+ sort_reentered(data->ary);
return n;
}
-static VALUE
-sort_internal(ary)
- VALUE ary;
+/*
+ * call-seq:
+ * ary.sort! -> ary
+ * ary.sort! {|a, b| block} -> ary
+ *
+ * Sorts +self+ in place.
+ *
+ * Comparisons for the sort will be done using the <code><=></code> operator
+ * or using an optional code block.
+ *
+ * The block must implement a comparison between +a+ and +b+ and return
+ * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ * are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *
+ * The result is not guaranteed to be stable. When the comparison of two
+ * elements returns +0+, the order of the elements is unpredictable.
+ *
+ * ary = [ "d", "a", "e", "c", "b" ]
+ * ary.sort! #=> ["a", "b", "c", "d", "e"]
+ * ary.sort! {|a, b| b <=> a} #=> ["e", "d", "c", "b", "a"]
+ *
+ * See also Enumerable#sort_by.
+ */
+
+VALUE
+rb_ary_sort_bang(VALUE ary)
{
- struct ary_sort_data data;
+ rb_ary_modify(ary);
+ assert(!ARY_SHARED_P(ary));
+ if (RARRAY_LEN(ary) > 1) {
+ VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+ struct ary_sort_data data;
+ long len = RARRAY_LEN(ary);
+ RBASIC_CLEAR_CLASS(tmp);
+ data.ary = tmp;
+ data.cmp_opt.opt_methods = 0;
+ data.cmp_opt.opt_inited = 0;
+ RARRAY_PTR_USE(tmp, ptr, {
+ ruby_qsort(ptr, len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2, &data);
+ }); /* WB: no new reference */
+ rb_ary_modify(ary);
+ if (ARY_EMBED_P(tmp)) {
+ if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ }
+ ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+ ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+ }
+ else {
+ if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+ FL_UNSET_SHARED(ary);
+ ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+ }
+ else {
+ assert(!ARY_SHARED_P(tmp));
+ if (ARY_EMBED_P(ary)) {
+ FL_UNSET_EMBED(ary);
+ }
+ else if (ARY_SHARED_P(ary)) {
+ /* ary might be destructively operated in the given block */
+ rb_ary_unshare(ary);
+ }
+ else {
+ ary_heap_free(ary);
+ }
+ ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
+ ARY_SET_HEAP_LEN(ary, len);
+ ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
+ }
+ /* tmp was lost ownership for the ptr */
+ FL_UNSET(tmp, FL_FREEZE);
+ FL_SET_EMBED(tmp);
+ ARY_SET_EMBED_LEN(tmp, 0);
+ FL_SET(tmp, FL_FREEZE);
+ }
+ /* tmp will be GC'ed. */
+ RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
+ }
+ ary_verify(ary);
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.sort -> new_ary
+ * ary.sort {|a, b| block} -> new_ary
+ *
+ * Returns a new array created by sorting +self+.
+ *
+ * Comparisons for the sort will be done using the <code><=></code> operator
+ * or using an optional code block.
+ *
+ * The block must implement a comparison between +a+ and +b+ and return
+ * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ * are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *
+ * The result is not guaranteed to be stable. When the comparison of two
+ * elements returns +0+, the order of the elements is unpredictable.
+ *
+ * ary = [ "d", "a", "e", "c", "b" ]
+ * ary.sort #=> ["a", "b", "c", "d", "e"]
+ * ary.sort {|a, b| b <=> a} #=> ["e", "d", "c", "b", "a"]
+ *
+ * To produce the reverse order, the following can also be used
+ * (and may be faster):
+ *
+ * ary.sort.reverse! #=> ["e", "d", "c", "b", "a"]
+ *
+ * See also Enumerable#sort_by.
+ */
- data.ary = ary;
- data.ptr = RARRAY(ary)->ptr; data.len = RARRAY(ary)->len;
- qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
+VALUE
+rb_ary_sort(VALUE ary)
+{
+ ary = rb_ary_dup(ary);
+ rb_ary_sort_bang(ary);
return ary;
}
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
+/*
+ * call-seq:
+ * ary.bsearch {|x| block } -> elem
+ *
+ * By using binary search, finds a value from this array which meets
+ * the given condition in O(log n) where n is the size of the array.
+ *
+ * You can use this method in two modes: a find-minimum mode and
+ * a find-any mode. In either case, the elements of the array must be
+ * monotone (or sorted) with respect to the block.
+ *
+ * In find-minimum mode (this is a good choice for typical use cases),
+ * the block must always return true or false, and there must be an index i
+ * (0 <= i <= ary.size) so that:
+ *
+ * - the block returns false for any element whose index is less than
+ * i, and
+ * - the block returns true for any element whose index is greater
+ * than or equal to i.
+ *
+ * This method returns the i-th element. If i is equal to ary.size,
+ * it returns nil.
+ *
+ * ary = [0, 4, 7, 10, 12]
+ * ary.bsearch {|x| x >= 4 } #=> 4
+ * ary.bsearch {|x| x >= 6 } #=> 7
+ * ary.bsearch {|x| x >= -1 } #=> 0
+ * ary.bsearch {|x| x >= 100 } #=> nil
+ *
+ * In find-any mode (this behaves like libc's bsearch(3)), the block
+ * must always return a number, and there must be two indices i and j
+ * (0 <= i <= j <= ary.size) so that:
+ *
+ * - the block returns a positive number for ary[k] if 0 <= k < i,
+ * - the block returns zero for ary[k] if i <= k < j, and
+ * - the block returns a negative number for ary[k] if
+ * j <= k < ary.size.
+ *
+ * Under this condition, this method returns any element whose index
+ * is within i...j. If i is equal to j (i.e., there is no element
+ * that satisfies the block), this method returns nil.
+ *
+ * ary = [0, 4, 7, 10, 12]
+ * # try to find v such that 4 <= v < 8
+ * ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
+ * # try to find v such that 8 <= v < 10
+ * ary.bsearch {|x| 4 - x / 2 } #=> nil
+ *
+ * You must not mix the two modes at a time; the block must always
+ * return either true/false, or always return a number. It is
+ * undefined which value is actually picked up at each iteration.
+ */
+
static VALUE
-sort_unlock(ary)
- VALUE ary;
+rb_ary_bsearch(VALUE ary)
{
- FL_UNSET(ary, ARY_TMPLOCK);
- return ary;
+ VALUE index_result = rb_ary_bsearch_index(ary);
+
+ if (FIXNUM_P(index_result)) {
+ return rb_ary_entry(ary, FIX2LONG(index_result));
+ }
+ return index_result;
}
/*
* call-seq:
- * array.sort! -> array
- * array.sort! {| a,b | block } -> array
- *
- * Sorts _self_. Comparisons for
- * the sort will be done using the <code><=></code> operator or using
- * an optional code block. The block implements a comparison between
- * <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- * <code>Enumerable#sort_by</code>.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * ary.bsearch_index {|x| block } -> int or nil
+ *
+ * By using binary search, finds an index of a value from this array which
+ * meets the given condition in O(log n) where n is the size of the array.
+ *
+ * It supports two modes, depending on the nature of the block. They are
+ * exactly the same as in the case of the #bsearch method, with the only difference
+ * being that this method returns the index of the element instead of the
+ * element itself. For more details consult the documentation for #bsearch.
*/
-VALUE
-rb_ary_sort_bang(ary)
- VALUE ary;
+static VALUE
+rb_ary_bsearch_index(VALUE ary)
{
- rb_ary_modify(ary);
- if (RARRAY(ary)->len > 1) {
- FL_SET(ary, ARY_TMPLOCK); /* prohibit modification during sort */
- rb_ensure(sort_internal, ary, sort_unlock, ary);
+ long low = 0, high = RARRAY_LEN(ary), mid;
+ int smaller = 0, satisfied = 0;
+ VALUE v, val;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ while (low < high) {
+ mid = low + ((high - low) / 2);
+ val = rb_ary_entry(ary, mid);
+ v = rb_yield(val);
+ if (FIXNUM_P(v)) {
+ if (v == INT2FIX(0)) return INT2FIX(mid);
+ smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+ }
+ else if (v == Qtrue) {
+ satisfied = 1;
+ smaller = 1;
+ }
+ else if (v == Qfalse || v == Qnil) {
+ smaller = 0;
+ }
+ else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+ const VALUE zero = INT2FIX(0);
+ switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+ case 0: return INT2FIX(mid);
+ case 1: smaller = 1; break;
+ case -1: smaller = 0;
+ }
+ }
+ else {
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+ " (must be numeric, true, false or nil)",
+ rb_obj_class(v));
+ }
+ if (smaller) {
+ high = mid;
+ }
+ else {
+ low = mid + 1;
+ }
}
- return ary;
+ if (!satisfied) return Qnil;
+ return INT2FIX(low);
+}
+
+
+static VALUE
+sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
+{
+ return rb_yield(i);
}
/*
* call-seq:
- * array.sort -> an_array
- * array.sort {| a,b | block } -> an_array
- *
- * Returns a new array created by sorting <i>self</i>. Comparisons for
- * the sort will be done using the <code><=></code> operator or using
- * an optional code block. The block implements a comparison between
- * <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- * <code>Enumerable#sort_by</code>.
- *
- * a = [ "d", "a", "e", "c", "b" ]
- * a.sort #=> ["a", "b", "c", "d", "e"]
- * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
+ * ary.sort_by! {|obj| block} -> ary
+ * ary.sort_by! -> Enumerator
+ *
+ * Sorts +self+ in place using a set of keys generated by mapping the
+ * values in +self+ through the given block.
+ *
+ * The result is not guaranteed to be stable. When two keys are equal,
+ * the order of the corresponding elements is unpredictable.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * See also Enumerable#sort_by.
*/
-VALUE
-rb_ary_sort(ary)
- VALUE ary;
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
{
- ary = rb_ary_dup(ary);
- rb_ary_sort_bang(ary);
+ VALUE sorted;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_modify(ary);
+ sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+ rb_ary_replace(ary, sorted);
return ary;
}
+
/*
* call-seq:
- * array.collect {|item| block } -> an_array
- * array.map {|item| block } -> an_array
- *
- * Invokes <i>block</i> once for each element of <i>self</i>. Creates a
- * new array containing the values returned by the block.
- * See also <code>Enumerable#collect</code>.
- *
+ * ary.collect {|item| block} -> new_ary
+ * ary.map {|item| block} -> new_ary
+ * ary.collect -> Enumerator
+ * ary.map -> Enumerator
+ *
+ * Invokes the given block once for each element of +self+.
+ *
+ * Creates a new array containing the values returned by the block.
+ *
+ * See also Enumerable#collect.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
* a = [ "a", "b", "c", "d" ]
- * a.collect {|x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
- * a #=> ["a", "b", "c", "d"]
+ * a.collect {|x| x + "!"} #=> ["a!", "b!", "c!", "d!"]
+ * a.map.with_index {|x, i| x * i} #=> ["", "b", "cc", "ddd"]
+ * a #=> ["a", "b", "c", "d"]
*/
static VALUE
-rb_ary_collect(ary)
- VALUE ary;
+rb_ary_collect(VALUE ary)
{
long i;
VALUE collect;
- if (!rb_block_given_p()) {
- return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
- }
-
- collect = rb_ary_new2(RARRAY(ary)->len);
- for (i = 0; i < RARRAY(ary)->len; i++) {
- rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ collect = rb_ary_new2(RARRAY_LEN(ary));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
}
return collect;
}
-/*
+
+/*
* call-seq:
- * array.collect! {|item| block } -> array
- * array.map! {|item| block } -> array
+ * ary.collect! {|item| block } -> ary
+ * ary.map! {|item| block } -> ary
+ * ary.collect! -> Enumerator
+ * ary.map! -> Enumerator
+ *
+ * Invokes the given block once for each element of +self+, replacing the
+ * element with the value returned by the block.
+ *
+ * See also Enumerable#collect.
+ *
+ * If no block is given, an Enumerator is returned instead.
*
- * Invokes the block once for each element of _self_, replacing the
- * element with the value returned by _block_.
- * See also <code>Enumerable#collect</code>.
- *
* a = [ "a", "b", "c", "d" ]
- * a.collect! {|x| x + "!" }
- * a #=> [ "a!", "b!", "c!", "d!" ]
+ * a.map! {|x| x + "!" }
+ * a #=> [ "a!", "b!", "c!", "d!" ]
+ * a.collect!.with_index {|x, i| x[0...i] }
+ * a #=> ["", "b", "c!", "d!"]
*/
static VALUE
-rb_ary_collect_bang(ary)
- VALUE ary;
+rb_ary_collect_bang(VALUE ary)
{
long i;
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
- for (i = 0; i < RARRAY(ary)->len; i++) {
- rb_ary_store(ary, i, rb_yield(RARRAY(ary)->ptr[i]));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
}
return ary;
}
VALUE
-rb_values_at(obj, olen, argc, argv, func)
- VALUE obj;
- long olen;
- int argc;
- VALUE *argv;
- VALUE (*func) _((VALUE,long));
+rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
{
VALUE result = rb_ary_new2(argc);
long beg, len, i, j;
@@ -1750,15 +3114,13 @@ rb_values_at(obj, olen, argc, argv, func)
continue;
}
/* check if idx is Range */
- switch (rb_range_beg_len(argv[i], &beg, &len, olen, 0)) {
- case Qfalse:
- break;
- case Qnil:
- continue;
- default:
- for (j=0; j<len; j++) {
- rb_ary_push(result, (*func)(obj, j+beg));
+ if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+ long end = olen < beg+len ? olen : beg+len;
+ for (j = beg; j < end; j++) {
+ rb_ary_push(result, (*func)(obj, j));
}
+ if (beg + len > j)
+ rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
continue;
}
rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
@@ -1766,118 +3128,297 @@ rb_values_at(obj, olen, argc, argv, func)
return result;
}
-/*
+static VALUE
+append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
+{
+ long beg, len;
+ if (FIXNUM_P(idx)) {
+ beg = FIX2LONG(idx);
+ }
+ /* check if idx is Range */
+ else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
+ if (len > 0) {
+ const VALUE *const src = RARRAY_CONST_PTR_TRANSIENT(ary);
+ const long end = beg + len;
+ const long prevlen = RARRAY_LEN(result);
+ if (beg < olen) {
+ rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
+ }
+ if (end > olen) {
+ rb_ary_store(result, prevlen + len - 1, Qnil);
+ }
+ }
+ return result;
+ }
+ else {
+ beg = NUM2LONG(idx);
+ }
+ return rb_ary_push(result, rb_ary_entry(ary, beg));
+}
+
+/*
* call-seq:
- * array.values_at(selector,... ) -> an_array
+ * ary.values_at(selector, ...) -> new_ary
+ *
+ * Returns an array containing the elements in +self+ corresponding to the
+ * given +selector+(s).
+ *
+ * The selectors may be either integer indices or ranges.
+ *
+ * See also Array#select.
*
- * Returns an array containing the elements in
- * _self_ corresponding to the given selector(s). The selectors
- * may be either integer indices or ranges.
- * See also <code>Array#select</code>.
- *
* a = %w{ a b c d e f }
- * a.values_at(1, 3, 5)
- * a.values_at(1, 3, 5, 7)
- * a.values_at(-1, -3, -5, -7)
- * a.values_at(1..3, 2...5)
+ * a.values_at(1, 3, 5) # => ["b", "d", "f"]
+ * a.values_at(1, 3, 5, 7) # => ["b", "d", "f", nil]
+ * a.values_at(-1, -2, -2, -7) # => ["f", "e", "e", nil]
+ * a.values_at(4..6, 3...6) # => ["e", "f", nil, "d", "e", "f"]
*/
static VALUE
-rb_ary_values_at(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
{
- return rb_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
+ long i, olen = RARRAY_LEN(ary);
+ VALUE result = rb_ary_new_capa(argc);
+ for (i = 0; i < argc; ++i) {
+ append_values_at_single(result, ary, olen, argv[i]);
+ }
+ RB_GC_GUARD(ary);
+ return result;
}
+
/*
* call-seq:
- * array.select {|item| block } -> an_array
- *
- * Invokes the block passing in successive elements from <i>array</i>,
- * returning an array containing those elements for which the block
- * returns a true value (equivalent to <code>Enumerable#select</code>).
- *
- * a = %w{ a b c d e f }
- * a.select {|v| v =~ /[aeiou]/} #=> ["a", "e"]
+ * ary.select {|item| block} -> new_ary
+ * ary.select -> Enumerator
+ * ary.filter {|item| block} -> new_ary
+ * ary.filter -> Enumerator
+ *
+ * Returns a new array containing all elements of +ary+
+ * for which the given +block+ returns a true value.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * [1,2,3,4,5].select {|num| num.even? } #=> [2, 4]
+ *
+ * a = %w[ a b c d e f ]
+ * a.select {|v| v =~ /[aeiou]/ } #=> ["a", "e"]
+ *
+ * See also Enumerable#select.
+ *
+ * Array#filter is an alias for Array#select.
*/
static VALUE
-rb_ary_select(ary)
- VALUE ary;
+rb_ary_select(VALUE ary)
{
VALUE result;
long i;
- result = rb_ary_new2(RARRAY(ary)->len);
- for (i = 0; i < RARRAY(ary)->len; i++) {
- if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ result = rb_ary_new2(RARRAY_LEN(ary));
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
rb_ary_push(result, rb_ary_elt(ary, i));
}
}
return result;
}
+struct select_bang_arg {
+ VALUE ary;
+ long len[2];
+};
+
+static VALUE
+select_bang_i(VALUE a)
+{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long i1, i2;
+
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+ VALUE v = RARRAY_AREF(ary, i1);
+ if (!RTEST(rb_yield(v))) continue;
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, v);
+ }
+ arg->len[1] = ++i2;
+ }
+ return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+select_bang_ensure(VALUE a)
+{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
+ long len = RARRAY_LEN(ary);
+ long i1 = arg->len[0], i2 = arg->len[1];
+
+ if (i2 < len && i2 < i1) {
+ long tail = 0;
+ if (i1 < len) {
+ tail = len - i1;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+ });
+ }
+ ARY_SET_LEN(ary, i2 + tail);
+ }
+ return ary;
+}
+
/*
* call-seq:
- * array.delete(obj) -> obj or nil
- * array.delete(obj) { block } -> obj or nil
- *
- * Deletes items from <i>self</i> that are equal to <i>obj</i>. If
- * the item is not found, returns <code>nil</code>. If the optional
- * code block is given, returns the result of <i>block</i> if the item
- * is not found.
- *
+ * ary.select! {|item| block } -> ary or nil
+ * ary.select! -> Enumerator
+ * ary.filter! {|item| block } -> ary or nil
+ * ary.filter! -> Enumerator
+ *
+ * Invokes the given block passing in successive elements from +self+,
+ * deleting elements for which the block returns a +false+ value.
+ *
+ * The array may not be changed instantly every time the block is called.
+ *
+ * If changes were made, it will return +self+, otherwise it returns +nil+.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * See also Array#keep_if.
+ *
+ * Array#filter! is an alias for Array#select!.
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
+{
+ struct select_bang_arg args;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_modify(ary);
+
+ args.ary = ary;
+ args.len[0] = args.len[1] = 0;
+ return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
+/*
+ * call-seq:
+ * ary.keep_if {|item| block} -> ary
+ * ary.keep_if -> Enumerator
+ *
+ * Deletes every element of +self+ for which the given block evaluates to
+ * +false+, and returns +self+.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * a = %w[ a b c d e f ]
+ * a.keep_if {|v| v =~ /[aeiou]/ } #=> ["a", "e"]
+ * a #=> ["a", "e"]
+ *
+ * See also Array#select!.
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
+{
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_select_bang(ary);
+ return ary;
+}
+
+static void
+ary_resize_smaller(VALUE ary, long len)
+{
+ rb_ary_modify(ary);
+ if (RARRAY_LEN(ary) > len) {
+ ARY_SET_LEN(ary, len);
+ if (len * 2 < ARY_CAPA(ary) &&
+ ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+ ary_resize_capa(ary, len * 2);
+ }
+ }
+}
+
+/*
+ * call-seq:
+ * ary.delete(obj) -> item or nil
+ * ary.delete(obj) {block} -> item or result of block
+ *
+ * Deletes all items from +self+ that are equal to +obj+.
+ *
+ * Returns the last deleted item, or +nil+ if no matching item is found.
+ *
+ * If the optional code block is given, the result of the block is returned if
+ * the item is not found. (To remove +nil+ elements and get an informative
+ * return value, use Array#compact!)
+ *
* a = [ "a", "b", "b", "b", "c" ]
* a.delete("b") #=> "b"
* a #=> ["a", "c"]
* a.delete("z") #=> nil
- * a.delete("z") { "not found" } #=> "not found"
+ * a.delete("z") {"not found"} #=> "not found"
*/
VALUE
-rb_ary_delete(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_delete(VALUE ary, VALUE item)
{
+ VALUE v = item;
long i1, i2;
- for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
- VALUE e = RARRAY(ary)->ptr[i1];
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE e = RARRAY_AREF(ary, i1);
- if (rb_equal(e, item)) continue;
+ if (rb_equal(e, item)) {
+ v = e;
+ continue;
+ }
if (i1 != i2) {
rb_ary_store(ary, i2, e);
}
i2++;
}
- if (RARRAY(ary)->len == i2) {
+ if (RARRAY_LEN(ary) == i2) {
if (rb_block_given_p()) {
return rb_yield(item);
}
return Qnil;
}
- rb_ary_modify(ary);
- if (RARRAY(ary)->len > i2) {
- RARRAY(ary)->len = i2;
- if (i2 * 2 < RARRAY(ary)->aux.capa &&
- RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
- RARRAY(ary)->aux.capa = i2 * 2;
+ ary_resize_smaller(ary, i2);
+
+ ary_verify(ary);
+ return v;
+}
+
+void
+rb_ary_delete_same(VALUE ary, VALUE item)
+{
+ long i1, i2;
+
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+ VALUE e = RARRAY_AREF(ary, i1);
+
+ if (e == item) {
+ continue;
+ }
+ if (i1 != i2) {
+ rb_ary_store(ary, i2, e);
}
+ i2++;
+ }
+ if (RARRAY_LEN(ary) == i2) {
+ return;
}
- return item;
+ ary_resize_smaller(ary, i2);
}
VALUE
-rb_ary_delete_at(ary, pos)
- VALUE ary;
- long pos;
+rb_ary_delete_at(VALUE ary, long pos)
{
- long i, len = RARRAY(ary)->len;
+ long len = RARRAY_LEN(ary);
VALUE del;
if (pos >= len) return Qnil;
@@ -1887,52 +3428,48 @@ rb_ary_delete_at(ary, pos)
}
rb_ary_modify(ary);
- del = RARRAY(ary)->ptr[pos];
- for (i = pos + 1; i < len; i++, pos++) {
- RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
- }
- RARRAY(ary)->len = pos;
-
+ del = RARRAY_AREF(ary, pos);
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
+ MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+ });
+ ARY_INCREASE_LEN(ary, -1);
+ ary_verify(ary);
return del;
}
/*
* call-seq:
- * array.delete_at(index) -> obj or nil
- *
- * Deletes the element at the specified index, returning that element,
- * or <code>nil</code> if the index is out of range. See also
- * <code>Array#slice!</code>.
- *
- * a = %w( ant bat cat dog )
+ * ary.delete_at(index) -> obj or nil
+ *
+ * Deletes the element at the specified +index+, returning that element, or
+ * +nil+ if the +index+ is out of range.
+ *
+ * See also Array#slice!
+ *
+ * a = ["ant", "bat", "cat", "dog"]
* a.delete_at(2) #=> "cat"
* a #=> ["ant", "bat", "dog"]
* a.delete_at(99) #=> nil
*/
static VALUE
-rb_ary_delete_at_m(ary, pos)
- VALUE ary, pos;
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
{
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * array.slice!(index) -> obj or nil
- * array.slice!(start, length) -> sub_array or nil
- * array.slice!(range) -> sub_array or nil
- *
- * Deletes the element(s) given by an index (optionally with a length)
- * or by a range. Returns the deleted object, subarray, or
- * <code>nil</code> if the index is out of range. Equivalent to:
- *
- * def slice!(*args)
- * result = self[*args]
- * self[*args] = nil
- * result
- * end
- *
+ * ary.slice!(index) -> obj or nil
+ * ary.slice!(start, length) -> new_ary or nil
+ * ary.slice!(range) -> new_ary or nil
+ *
+ * Deletes the element(s) given by an +index+ (optionally up to +length+
+ * elements) or by a +range+.
+ *
+ * Returns the deleted object (or objects), or +nil+ if the +index+ is out of
+ * range.
+ *
* a = [ "a", "b", "c" ]
* a.slice!(1) #=> "b"
* a #=> ["a", "c"]
@@ -1943,194 +3480,312 @@ rb_ary_delete_at_m(ary, pos)
*/
static VALUE
-rb_ary_slice_bang(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
{
VALUE arg1, arg2;
- long pos, len;
+ long pos, len, orig_len;
- if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
- pos = NUM2LONG(arg1);
- len = NUM2LONG(arg2);
+ rb_ary_modify_check(ary);
+ if (argc == 2) {
+ pos = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
delete_pos_len:
+ if (len < 0) return Qnil;
+ orig_len = RARRAY_LEN(ary);
if (pos < 0) {
- pos = RARRAY(ary)->len + pos;
+ pos += orig_len;
+ if (pos < 0) return Qnil;
+ }
+ else if (orig_len < pos) return Qnil;
+ if (orig_len < pos + len) {
+ len = orig_len - pos;
}
- arg2 = rb_ary_subseq(ary, pos, len);
- rb_ary_splice(ary, pos, len, Qnil); /* Qnil/rb_ary_new2(0) */
+ if (len == 0) return rb_ary_new2(0);
+ arg2 = rb_ary_new4(len, RARRAY_CONST_PTR_TRANSIENT(ary)+pos);
+ RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
+ rb_ary_splice(ary, pos, len, 0, 0);
return arg2;
}
- if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
- goto delete_pos_len;
+ rb_check_arity(argc, 1, 2);
+ arg1 = argv[0];
+
+ if (!FIXNUM_P(arg1)) {
+ switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+ case Qtrue:
+ /* valid range */
+ goto delete_pos_len;
+ case Qnil:
+ /* invalid range */
+ return Qnil;
+ default:
+ /* not a range */
+ break;
+ }
}
return rb_ary_delete_at(ary, NUM2LONG(arg1));
}
-/*
- * call-seq:
- * array.reject! {|item| block } -> array or nil
- *
- * Equivalent to <code>Array#delete_if</code>, deleting elements from
- * _self_ for which the block evaluates to true, but returns
- * <code>nil</code> if no changes were made. Also see
- * <code>Enumerable#reject</code>.
- */
+static VALUE
+ary_reject(VALUE orig, VALUE result)
+{
+ long i;
+
+ for (i = 0; i < RARRAY_LEN(orig); i++) {
+ VALUE v = RARRAY_AREF(orig, i);
+
+ if (!RTEST(rb_yield(v))) {
+ rb_ary_push(result, v);
+ }
+ }
+ return result;
+}
static VALUE
-rb_ary_reject_bang(ary)
- VALUE ary;
+reject_bang_i(VALUE a)
{
+ volatile struct select_bang_arg *arg = (void *)a;
+ VALUE ary = arg->ary;
long i1, i2;
- rb_ary_modify(ary);
- for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
- VALUE v = RARRAY(ary)->ptr[i1];
+ for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+ VALUE v = RARRAY_AREF(ary, i1);
if (RTEST(rb_yield(v))) continue;
if (i1 != i2) {
rb_ary_store(ary, i2, v);
}
- i2++;
+ arg->len[1] = ++i2;
}
- if (RARRAY(ary)->len == i2) return Qnil;
- if (i2 < RARRAY(ary)->len)
- RARRAY(ary)->len = i2;
+ return (i1 == i2) ? Qnil : ary;
+}
- return ary;
+static VALUE
+ary_reject_bang(VALUE ary)
+{
+ struct select_bang_arg args;
+ rb_ary_modify_check(ary);
+ args.ary = ary;
+ args.len[0] = args.len[1] = 0;
+ return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
}
/*
* call-seq:
- * array.reject {|item| block } -> an_array
- *
- * Returns a new array containing the items in _self_
- * for which the block is not true.
+ * ary.reject! {|item| block} -> ary or nil
+ * ary.reject! -> Enumerator
+ *
+ * Deletes every element of +self+ for which the block evaluates to +true+,
+ * if no changes were made returns +nil+.
+ *
+ * The array may not be changed instantly every time the block is called.
+ *
+ * See also Enumerable#reject and Array#delete_if.
+ *
+ * If no block is given, an Enumerator is returned instead.
*/
static VALUE
-rb_ary_reject(ary)
- VALUE ary;
+rb_ary_reject_bang(VALUE ary)
{
- ary = rb_ary_dup(ary);
- rb_ary_reject_bang(ary);
- return ary;
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rb_ary_modify(ary);
+ return ary_reject_bang(ary);
}
/*
* call-seq:
- * array.delete_if {|item| block } -> array
- *
- * Deletes every element of <i>self</i> for which <i>block</i> evaluates
- * to <code>true</code>.
- *
- * a = [ "a", "b", "c" ]
- * a.delete_if {|x| x >= "b" } #=> ["a"]
+ * ary.reject {|item| block } -> new_ary
+ * ary.reject -> Enumerator
+ *
+ * Returns a new array containing the items in +self+ for which the given
+ * block is not +true+. The ordering of non-rejected elements is maintained.
+ *
+ * See also Array#delete_if
+ *
+ * If no block is given, an Enumerator is returned instead.
*/
static VALUE
-rb_ary_delete_if(ary)
- VALUE ary;
+rb_ary_reject(VALUE ary)
{
- rb_ary_reject_bang(ary);
+ VALUE rejected_ary;
+
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ rejected_ary = rb_ary_new();
+ ary_reject(ary, rejected_ary);
+ return rejected_ary;
+}
+
+/*
+ * call-seq:
+ * ary.delete_if {|item| block} -> ary
+ * ary.delete_if -> Enumerator
+ *
+ * Deletes every element of +self+ for which block evaluates to +true+.
+ *
+ * The array is changed instantly every time the block is called, not after
+ * the iteration is over.
+ *
+ * See also Array#reject!
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * scores = [ 97, 42, 75 ]
+ * scores.delete_if {|score| score < 80 } #=> [97]
+ */
+
+static VALUE
+rb_ary_delete_if(VALUE ary)
+{
+ ary_verify(ary);
+ RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+ ary_reject_bang(ary);
return ary;
}
+static VALUE
+take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
+{
+ VALUE *args = (VALUE *)cbarg;
+ if (args[1] == 0) rb_iter_break();
+ else args[1]--;
+ if (argc > 1) val = rb_ary_new4(argc, argv);
+ rb_ary_push(args[0], val);
+ return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
+{
+ VALUE result = rb_check_array_type(obj);
+ VALUE args[2];
+
+ if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+ result = rb_ary_new2(n);
+ args[0] = result; args[1] = (VALUE)n;
+ if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
+ rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+ rb_obj_class(obj));
+ return result;
+}
+
+
/*
* call-seq:
- * array.zip(arg, ...) -> an_array
- * array.zip(arg, ...) {| arr | block } -> nil
- *
- * Converts any arguments to arrays, then merges elements of
- * <i>self</i> with corresponding elements from each argument. This
- * generates a sequence of <code>self.size</code> <em>n</em>-element
- * arrays, where <em>n</em> is one more that the count of arguments. If
- * the size of any argument is less than <code>enumObj.size</code>,
- * <code>nil</code> values are supplied. If a block given, it is
- * invoked for each output array, otherwise an array of arrays is
- * returned.
- *
+ * ary.zip(arg, ...) -> new_ary
+ * ary.zip(arg, ...) {|arr| block} -> nil
+ *
+ * Converts any arguments to arrays, then merges elements of +self+ with
+ * corresponding elements from each argument.
+ *
+ * This generates a sequence of <code>ary.size</code> _n_-element arrays,
+ * where _n_ is one more than the count of arguments.
+ *
+ * If the size of any argument is less than the size of the initial array,
+ * +nil+ values are supplied.
+ *
+ * If a block is given, it is invoked for each output +array+, otherwise an
+ * array of arrays is returned.
+ *
* a = [ 4, 5, 6 ]
* b = [ 7, 8, 9 ]
- *
- * [1,2,3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- * [1,2].zip(a,b) #=> [[1, 4, 7], [2, 5, 8]]
- * a.zip([1,2],[8]) #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
+ * [1, 2, 3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ * [1, 2].zip(a, b) #=> [[1, 4, 7], [2, 5, 8]]
+ * a.zip([1, 2], [8]) #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
*/
static VALUE
-rb_ary_zip(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
{
int i, j;
- long len;
- VALUE result;
+ long len = RARRAY_LEN(ary);
+ VALUE result = Qnil;
for (i=0; i<argc; i++) {
- argv[i] = to_ary(argv[i]);
+ argv[i] = take_items(argv[i], len);
}
+
if (rb_block_given_p()) {
- for (i=0; i<RARRAY(ary)->len; i++) {
- VALUE tmp = rb_ary_new2(argc+1);
+ int arity = rb_block_arity();
- rb_ary_push(tmp, rb_ary_elt(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ if (arity > 1) {
+ VALUE work, *tmp;
+
+ tmp = ALLOCV_N(VALUE, work, argc+1);
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ tmp[0] = RARRAY_AREF(ary, i);
+ for (j=0; j<argc; j++) {
+ tmp[j+1] = rb_ary_elt(argv[j], i);
+ }
+ rb_yield_values2(argc+1, tmp);
+ }
+
+ if (work) ALLOCV_END(work);
+ }
+ else {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE tmp = rb_ary_new2(argc+1);
+
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_yield(tmp);
}
- rb_yield(tmp);
}
- return Qnil;
}
- len = RARRAY(ary)->len;
- result = rb_ary_new2(len);
- for (i=0; i<len; i++) {
- VALUE tmp = rb_ary_new2(argc+1);
+ else {
+ result = rb_ary_new_capa(len);
- rb_ary_push(tmp, rb_ary_elt(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ for (i=0; i<len; i++) {
+ VALUE tmp = rb_ary_new_capa(argc+1);
+
+ rb_ary_push(tmp, RARRAY_AREF(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+ }
+ rb_ary_push(result, tmp);
}
- rb_ary_push(result, tmp);
}
+
return result;
}
/*
* call-seq:
- * array.transpose -> an_array
- *
- * Assumes that <i>self</i> is an array of arrays and transposes the
- * rows and columns.
- *
+ * ary.transpose -> new_ary
+ *
+ * Assumes that +self+ is an array of arrays and transposes the rows and
+ * columns.
+ *
* a = [[1,2], [3,4], [5,6]]
* a.transpose #=> [[1, 3, 5], [2, 4, 6]]
+ *
+ * If the length of the subarrays don't match, an IndexError is raised.
*/
static VALUE
-rb_ary_transpose(ary)
- VALUE ary;
+rb_ary_transpose(VALUE ary)
{
long elen = -1, alen, i, j;
VALUE tmp, result = 0;
- alen = RARRAY(ary)->len;
+ alen = RARRAY_LEN(ary);
if (alen == 0) return rb_ary_dup(ary);
for (i=0; i<alen; i++) {
tmp = to_ary(rb_ary_elt(ary, i));
if (elen < 0) { /* first element */
- elen = RARRAY(tmp)->len;
+ elen = RARRAY_LEN(tmp);
result = rb_ary_new2(elen);
for (j=0; j<elen; j++) {
rb_ary_store(result, j, rb_ary_new2(alen));
}
}
- else if (elen != RARRAY(tmp)->len) {
- rb_raise(rb_eIndexError, "element size differs (%d should be %d)",
- RARRAY(tmp)->len, elen);
+ else if (elen != RARRAY_LEN(tmp)) {
+ rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+ RARRAY_LEN(tmp), elen);
}
for (j=0; j<elen; j++) {
rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
@@ -2141,75 +3796,111 @@ rb_ary_transpose(ary)
/*
* call-seq:
- * array.replace(other_array) -> array
- *
- * Replaces the contents of <i>self</i> with the contents of
- * <i>other_array</i>, truncating or expanding if necessary.
- *
+ * ary.replace(other_ary) -> ary
+ * ary.initialize_copy(other_ary) -> ary
+ *
+ * Replaces the contents of +self+ with the contents of +other_ary+,
+ * truncating or expanding if necessary.
+ *
* a = [ "a", "b", "c", "d", "e" ]
* a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
* a #=> ["x", "y", "z"]
*/
-static VALUE
-rb_ary_replace(copy, orig)
- VALUE copy, orig;
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
{
- VALUE shared;
-
- rb_ary_modify(copy);
+ rb_ary_modify_check(copy);
orig = to_ary(orig);
if (copy == orig) return copy;
- shared = ary_make_shared(orig);
- if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
- free(RARRAY(copy)->ptr);
- RARRAY(copy)->ptr = RARRAY(orig)->ptr;
- RARRAY(copy)->len = RARRAY(orig)->len;
- RARRAY(copy)->aux.shared = shared;
- FL_SET(copy, ELTS_SHARED);
+ if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+ VALUE shared_root = 0;
+
+ if (ARY_OWNS_HEAP_P(copy)) {
+ ary_heap_free(copy);
+ }
+ else if (ARY_SHARED_P(copy)) {
+ shared_root = ARY_SHARED_ROOT(copy);
+ FL_UNSET_SHARED(copy);
+ }
+ FL_SET_EMBED(copy);
+ ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR_TRANSIENT(orig));
+ if (shared_root) {
+ rb_ary_decrement_share(shared_root);
+ }
+ ARY_SET_LEN(copy, RARRAY_LEN(orig));
+ }
+ else {
+ VALUE shared_root = ary_make_shared(orig);
+ if (ARY_OWNS_HEAP_P(copy)) {
+ ary_heap_free(copy);
+ }
+ else {
+ rb_ary_unshare_safe(copy);
+ }
+ FL_UNSET_EMBED(copy);
+ ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
+ ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
+ rb_ary_set_shared(copy, shared_root);
+ }
+ ary_verify(copy);
return copy;
}
-/*
+/*
* call-seq:
- * array.clear -> array
+ * ary.clear -> ary
*
- * Removes all elements from _self_.
+ * Removes all elements from +self+.
*
* a = [ "a", "b", "c", "d", "e" ]
* a.clear #=> [ ]
*/
VALUE
-rb_ary_clear(ary)
- VALUE ary;
+rb_ary_clear(VALUE ary)
{
- rb_ary_modify(ary);
- RARRAY(ary)->len = 0;
- if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
- RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
+ rb_ary_modify_check(ary);
+ if (ARY_SHARED_P(ary)) {
+ if (!ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
+ ARY_SET_EMBED_LEN(ary, 0);
+ }
+ }
+ else {
+ ARY_SET_LEN(ary, 0);
+ if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+ ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+ }
}
+ ary_verify(ary);
return ary;
}
/*
* call-seq:
- * array.fill(obj) -> array
- * array.fill(obj, start [, length]) -> array
- * array.fill(obj, range ) -> array
- * array.fill {|index| block } -> array
- * array.fill(start [, length] ) {|index| block } -> array
- * array.fill(range) {|index| block } -> array
- *
- * The first three forms set the selected elements of <i>self</i> (which
- * may be the entire array) to <i>obj</i>. A <i>start</i> of
- * <code>nil</code> is equivalent to zero. A <i>length</i> of
- * <code>nil</code> is equivalent to <i>self.length</i>. The last three
- * forms fill the array with the value of the block. The block is
- * passed the absolute index of each element to be filled.
- *
+ * ary.fill(obj) -> ary
+ * ary.fill(obj, start [, length]) -> ary
+ * ary.fill(obj, range) -> ary
+ * ary.fill {|index| block} -> ary
+ * ary.fill(start [, length]) {|index| block} -> ary
+ * ary.fill(range) {|index| block} -> ary
+ *
+ * The first three forms set the selected elements of +self+ (which
+ * may be the entire array) to +obj+.
+ *
+ * A +start+ of +nil+ is equivalent to zero.
+ *
+ * A +length+ of +nil+ is equivalent to the length of the array.
+ *
+ * The last three forms fill the array with the value of the given block,
+ * which is passed the absolute index of each element to be filled.
+ *
+ * Negative values of +start+ count from the end of the array, where +-1+ is
+ * the last element.
+ *
* a = [ "a", "b", "c", "d" ]
* a.fill("x") #=> ["x", "x", "x", "x"]
* a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
@@ -2219,18 +3910,12 @@ rb_ary_clear(ary)
*/
static VALUE
-rb_ary_fill(argc, argv, ary)
- int argc;
- VALUE *argv;
- VALUE ary;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
{
- VALUE item, arg1, arg2;
+ VALUE item = Qundef, arg1, arg2;
long beg = 0, end = 0, len = 0;
- VALUE *p, *pend;
- int block_p = Qfalse;
if (rb_block_given_p()) {
- block_p = Qtrue;
rb_scan_args(argc, argv, "02", &arg1, &arg2);
argc += 1; /* hackish */
}
@@ -2240,112 +3925,162 @@ rb_ary_fill(argc, argv, ary)
switch (argc) {
case 1:
beg = 0;
- len = RARRAY(ary)->len;
+ len = RARRAY_LEN(ary);
break;
case 2:
- if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
break;
}
/* fall through */
case 3:
beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
if (beg < 0) {
- beg = RARRAY(ary)->len + beg;
+ beg = RARRAY_LEN(ary) + beg;
if (beg < 0) beg = 0;
}
- len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
+ len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
break;
}
rb_ary_modify(ary);
- end = beg + len;
- if (end < 0) {
+ if (len < 0) {
+ return ary;
+ }
+ if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
rb_raise(rb_eArgError, "argument too big");
}
- if (end > RARRAY(ary)->len) {
- if (end >= RARRAY(ary)->aux.capa) {
- REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
- RARRAY(ary)->aux.capa = end;
+ end = beg + len;
+ if (RARRAY_LEN(ary) < end) {
+ if (end >= ARY_CAPA(ary)) {
+ ary_resize_capa(ary, end);
}
- rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
- RARRAY(ary)->len = end;
+ ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+ ARY_SET_LEN(ary, end);
}
- if (block_p) {
+ if (item == Qundef) {
VALUE v;
long i;
for (i=beg; i<end; i++) {
v = rb_yield(LONG2NUM(i));
- if (i>=RARRAY(ary)->len) break;
- RARRAY(ary)->ptr[i] = v;
+ if (i>=RARRAY_LEN(ary)) break;
+ ARY_SET(ary, i, v);
}
}
else {
- p = RARRAY(ary)->ptr + beg;
- pend = p + len;
- while (p < pend) {
- *p++ = item;
- }
+ ary_memfill(ary, beg, len, item);
}
return ary;
}
-/*
+/*
* call-seq:
- * array + other_array -> an_array
+ * ary + other_ary -> new_ary
*
- * Concatenation---Returns a new array built by concatenating the
+ * Concatenation --- Returns a new array built by concatenating the
* two arrays together to produce a third array.
- *
+ *
* [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
+ * a = [ "a", "b", "c" ]
+ * c = a + [ "d", "e", "f" ]
+ * c #=> [ "a", "b", "c", "d", "e", "f" ]
+ * a #=> [ "a", "b", "c" ]
+ *
+ * Note that
+ * x += y
+ * is the same as
+ * x = x + y
+ * This means that it produces a new array. As a consequence,
+ * repeated use of <code>+=</code> on arrays can be quite inefficient.
+ *
+ * See also Array#concat.
*/
VALUE
-rb_ary_plus(x, y)
- VALUE x, y;
+rb_ary_plus(VALUE x, VALUE y)
{
VALUE z;
- long len;
+ long len, xlen, ylen;
y = to_ary(y);
- len = RARRAY(x)->len + RARRAY(y)->len;
+ xlen = RARRAY_LEN(x);
+ ylen = RARRAY_LEN(y);
+ len = xlen + ylen;
z = rb_ary_new2(len);
- MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
- MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
- RARRAY(z)->len = len;
+
+ ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR_TRANSIENT(x));
+ ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR_TRANSIENT(y));
+ ARY_SET_LEN(z, len);
return z;
}
-/*
+static VALUE
+ary_append(VALUE x, VALUE y)
+{
+ long n = RARRAY_LEN(y);
+ if (n > 0) {
+ rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR_TRANSIENT(y), n);
+ }
+ return x;
+}
+
+/*
* call-seq:
- * array.concat(other_array) -> array
+ * ary.concat(other_ary1, other_ary2, ...) -> ary
+ *
+ * Appends the elements of <code>other_ary</code>s to +self+.
+ *
+ * [ "a", "b" ].concat( ["c", "d"]) #=> [ "a", "b", "c", "d" ]
+ * [ "a" ].concat( ["b"], ["c", "d"]) #=> [ "a", "b", "c", "d" ]
+ * [ "a" ].concat #=> [ "a" ]
*
- * Appends the elements in other_array to _self_.
- *
- * [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ * a = [ 1, 2, 3 ]
+ * a.concat( [ 4, 5 ])
+ * a #=> [ 1, 2, 3, 4, 5 ]
+ *
+ * a = [ 1, 2 ]
+ * a.concat(a, a) #=> [1, 2, 1, 2, 1, 2]
+ *
+ * See also Array#+.
*/
-
-VALUE
-rb_ary_concat(x, y)
- VALUE x, y;
+static VALUE
+rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
{
- y = to_ary(y);
- if (RARRAY(y)->len > 0) {
- rb_ary_splice(x, RARRAY(x)->len, 0, y);
+ rb_ary_modify_check(ary);
+
+ if (argc == 1) {
+ rb_ary_concat(ary, argv[0]);
}
- return x;
+ else if (argc > 1) {
+ int i;
+ VALUE args = rb_ary_tmp_new(argc);
+ for (i = 0; i < argc; i++) {
+ rb_ary_concat(args, argv[i]);
+ }
+ ary_append(ary, args);
+ }
+
+ ary_verify(ary);
+ return ary;
}
+VALUE
+rb_ary_concat(VALUE x, VALUE y)
+{
+ return ary_append(x, to_ary(y));
+}
-/*
+/*
* call-seq:
- * array * int -> an_array
- * array * str -> a_string
+ * ary * int -> new_ary
+ * ary * str -> new_string
*
- * Repetition---With a String argument, equivalent to
- * self.join(str). Otherwise, returns a new array
- * built by concatenating the _int_ copies of _self_.
+ * Repetition --- With a String argument, equivalent to
+ * <code>ary.join(str)</code>.
+ *
+ * Otherwise, returns a new array built by concatenating the +int+ copies of
+ * +self+.
*
*
* [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
@@ -2354,11 +4089,11 @@ rb_ary_concat(x, y)
*/
static VALUE
-rb_ary_times(ary, times)
- VALUE ary, times;
+rb_ary_times(VALUE ary, VALUE times)
{
VALUE ary2, tmp;
- long i, len;
+ const VALUE *ptr;
+ long t, len;
tmp = rb_check_string_type(times);
if (!NIL_P(tmp)) {
@@ -2366,37 +4101,48 @@ rb_ary_times(ary, times)
}
len = NUM2LONG(times);
- if (len == 0) return ary_new(rb_obj_class(ary), 0);
+ if (len == 0) {
+ ary2 = ary_new(rb_obj_class(ary), 0);
+ goto out;
+ }
if (len < 0) {
rb_raise(rb_eArgError, "negative argument");
}
- if (LONG_MAX/len < RARRAY(ary)->len) {
+ if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
rb_raise(rb_eArgError, "argument too big");
}
- len *= RARRAY(ary)->len;
+ len *= RARRAY_LEN(ary);
ary2 = ary_new(rb_obj_class(ary), len);
- RARRAY(ary2)->len = len;
-
- for (i=0; i<len; i+=RARRAY(ary)->len) {
- MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- }
- OBJ_INFECT(ary2, ary);
-
+ ARY_SET_LEN(ary2, len);
+
+ ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
+ t = RARRAY_LEN(ary);
+ if (0 < t) {
+ ary_memcpy(ary2, 0, t, ptr);
+ while (t <= len/2) {
+ ary_memcpy(ary2, t, t, RARRAY_CONST_PTR_TRANSIENT(ary2));
+ t *= 2;
+ }
+ if (t < len) {
+ ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR_TRANSIENT(ary2));
+ }
+ }
+ out:
return ary2;
}
-/*
+/*
* call-seq:
- * array.assoc(obj) -> an_array or nil
+ * ary.assoc(obj) -> element_ary or nil
+ *
+ * Searches through an array whose elements are also arrays comparing +obj+
+ * with the first element of each contained array using <code>obj.==</code>.
+ *
+ * Returns the first contained array that matches (that is, the first
+ * associated array), or +nil+ if no match is found.
*
- * Searches through an array whose elements are also arrays
- * comparing _obj_ with the first element of each contained array
- * using obj.==.
- * Returns the first contained array that matches (that
- * is, the first associated array),
- * or +nil+ if no match is found.
- * See also <code>Array#rassoc</code>.
+ * See also Array#rassoc
*
* s1 = [ "colors", "red", "blue", "green" ]
* s2 = [ "letters", "a", "b", "c" ]
@@ -2407,17 +4153,15 @@ rb_ary_times(ary, times)
*/
VALUE
-rb_ary_assoc(ary, key)
- VALUE ary, key;
+rb_ary_assoc(VALUE ary, VALUE key)
{
long i;
VALUE v;
- for (i = 0; i < RARRAY(ary)->len; ++i) {
- v = RARRAY(ary)->ptr[i];
- if (TYPE(v) == T_ARRAY &&
- RARRAY(v)->len > 0 &&
- rb_equal(RARRAY(v)->ptr[0], key))
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ v = rb_check_array_type(RARRAY_AREF(ary, i));
+ if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+ rb_equal(RARRAY_AREF(v, 0), key))
return v;
}
return Qnil;
@@ -2425,42 +4169,79 @@ rb_ary_assoc(ary, key)
/*
* call-seq:
- * array.rassoc(key) -> an_array or nil
- *
- * Searches through the array whose elements are also arrays. Compares
- * <em>key</em> with the second element of each contained array using
- * <code>==</code>. Returns the first contained array that matches. See
- * also <code>Array#assoc</code>.
- *
+ * ary.rassoc(obj) -> element_ary or nil
+ *
+ * Searches through the array whose elements are also arrays.
+ *
+ * Compares +obj+ with the second element of each contained array using
+ * <code>obj.==</code>.
+ *
+ * Returns the first contained array that matches +obj+.
+ *
+ * See also Array#assoc.
+ *
* a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
* a.rassoc("two") #=> [2, "two"]
* a.rassoc("four") #=> nil
*/
VALUE
-rb_ary_rassoc(ary, value)
- VALUE ary, value;
+rb_ary_rassoc(VALUE ary, VALUE value)
{
long i;
VALUE v;
- for (i = 0; i < RARRAY(ary)->len; ++i) {
- v = RARRAY(ary)->ptr[i];
- if (TYPE(v) == T_ARRAY &&
- RARRAY(v)->len > 1 &&
- rb_equal(RARRAY(v)->ptr[1], value))
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ v = RARRAY_AREF(ary, i);
+ if (RB_TYPE_P(v, T_ARRAY) &&
+ RARRAY_LEN(v) > 1 &&
+ rb_equal(RARRAY_AREF(v, 1), value))
return v;
}
return Qnil;
}
-/*
+static VALUE
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
+{
+ long i, len1;
+ const VALUE *p1, *p2;
+
+ if (recur) return Qtrue; /* Subtle! */
+
+ /* rb_equal() can evacuate ptrs */
+ p1 = RARRAY_CONST_PTR(ary1);
+ p2 = RARRAY_CONST_PTR(ary2);
+ len1 = RARRAY_LEN(ary1);
+
+ for (i = 0; i < len1; i++) {
+ if (*p1 != *p2) {
+ if (rb_equal(*p1, *p2)) {
+ len1 = RARRAY_LEN(ary1);
+ if (len1 != RARRAY_LEN(ary2))
+ return Qfalse;
+ if (len1 < i)
+ return Qtrue;
+ p1 = RARRAY_CONST_PTR(ary1) + i;
+ p2 = RARRAY_CONST_PTR(ary2) + i;
+ }
+ else {
+ return Qfalse;
+ }
+ }
+ p1++;
+ p2++;
+ }
+ return Qtrue;
+}
+
+/*
* call-seq:
- * array == other_array -> bool
+ * ary == other_ary -> bool
*
- * Equality---Two arrays are equal if they contain the same number
- * of elements and if each element is equal to (according to
- * Object.==) the corresponding element in the other array.
+ * Equality --- Two arrays are equal if they contain the same number of
+ * elements and if each element is equal to (according to Object#==) the
+ * corresponding element in +other_ary+.
*
* [ "a", "c" ] == [ "a", "c", 7 ] #=> false
* [ "a", "c", 7 ] == [ "a", "c", 7 ] #=> true
@@ -2469,21 +4250,28 @@ rb_ary_rassoc(ary, value)
*/
static VALUE
-rb_ary_equal(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_equal(VALUE ary1, VALUE ary2)
{
- long i;
-
if (ary1 == ary2) return Qtrue;
- if (TYPE(ary2) != T_ARRAY) {
- if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
+ if (!RB_TYPE_P(ary2, T_ARRAY)) {
+ if (!rb_respond_to(ary2, idTo_ary)) {
return Qfalse;
}
return rb_equal(ary2, ary1);
}
- if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
+ return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+}
+
+static VALUE
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
+{
+ long i;
+
+ if (recur) return Qtrue; /* Subtle! */
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
return Qfalse;
}
return Qtrue;
@@ -2491,346 +4279,814 @@ rb_ary_equal(ary1, ary2)
/*
* call-seq:
- * array.eql?(other) -> true or false
+ * ary.eql?(other) -> true or false
*
- * Returns <code>true</code> if _array_ and _other_ are the same object,
- * or are both arrays with the same content.
+ * Returns +true+ if +self+ and +other+ are the same object,
+ * or are both arrays with the same content (according to Object#eql?).
*/
static VALUE
-rb_ary_eql(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_eql(VALUE ary1, VALUE ary2)
{
- long i;
-
if (ary1 == ary2) return Qtrue;
- if (TYPE(ary2) != T_ARRAY) return Qfalse;
- if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
- return Qfalse;
- }
- return Qtrue;
+ if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
+ if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+ if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
+ return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
}
/*
* call-seq:
- * array.hash -> fixnum
+ * ary.hash -> integer
+ *
+ * Compute a hash-code for this array.
+ *
+ * Two arrays with the same content will have the same hash code (and will
+ * compare using #eql?).
*
- * Compute a hash-code for this array. Two arrays with the same content
- * will have the same hash code (and will compare using <code>eql?</code>).
+ * See also Object#hash.
*/
static VALUE
-rb_ary_hash(ary)
- VALUE ary;
+rb_ary_hash(VALUE ary)
{
- long i, h;
+ long i;
+ st_index_t h;
VALUE n;
- h = RARRAY(ary)->len;
- for (i=0; i<RARRAY(ary)->len; i++) {
- h = (h << 1) | (h<0 ? 1 : 0);
- n = rb_hash(RARRAY(ary)->ptr[i]);
- h ^= NUM2LONG(n);
+ h = rb_hash_start(RARRAY_LEN(ary));
+ h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ n = rb_hash(RARRAY_AREF(ary, i));
+ h = rb_hash_uint(h, NUM2LONG(n));
}
- return LONG2FIX(h);
+ h = rb_hash_end(h);
+ return ST2FIX(h);
}
/*
* call-seq:
- * array.include?(obj) -> true or false
- *
- * Returns <code>true</code> if the given object is present in
- * <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
- * <code>false</code> otherwise.
- *
+ * ary.include?(object) -> true or false
+ *
+ * Returns +true+ if the given +object+ is present in +self+ (that is, if any
+ * element <code>==</code> +object+), otherwise returns +false+.
+ *
* a = [ "a", "b", "c" ]
* a.include?("b") #=> true
* a.include?("z") #=> false
*/
VALUE
-rb_ary_includes(ary, item)
- VALUE ary;
- VALUE item;
+rb_ary_includes(VALUE ary, VALUE item)
{
long i;
-
- for (i=0; i<RARRAY(ary)->len; i++) {
- if (rb_equal(RARRAY(ary)->ptr[i], item)) {
+ VALUE e;
+
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (rb_equal(e, item)) {
return Qtrue;
}
}
return Qfalse;
}
+static VALUE
+rb_ary_includes_by_eql(VALUE ary, VALUE item)
+{
+ long i;
+ VALUE e;
-/*
- * call-seq:
- * array <=> other_array -> -1, 0, +1
- *
- * Comparison---Returns an integer (-1, 0,
- * or +1) if this array is less than, equal to, or greater than
- * other_array. Each object in each array is compared
- * (using <=>). If any value isn't
- * equal, then that inequality is the return value. If all the
- * values found are equal, then the return is based on a
- * comparison of the array lengths. Thus, two arrays are
- * ``equal'' according to <code>Array#<=></code> if and only if they have
- * the same length and the value of each element is equal to the
- * value of the corresponding element in the other array.
- *
- * [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
- * [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
- *
- */
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (rb_eql(item, e)) {
+ return Qtrue;
+ }
+ }
+ return Qfalse;
+}
-VALUE
-rb_ary_cmp(ary1, ary2)
- VALUE ary1, ary2;
+static VALUE
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
{
long i, len;
- ary2 = to_ary(ary2);
- len = RARRAY(ary1)->len;
- if (len > RARRAY(ary2)->len) {
- len = RARRAY(ary2)->len;
+ if (recur) return Qundef; /* Subtle! */
+ len = RARRAY_LEN(ary1);
+ if (len > RARRAY_LEN(ary2)) {
+ len = RARRAY_LEN(ary2);
}
for (i=0; i<len; i++) {
- VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
+ VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+ VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
if (v != INT2FIX(0)) {
return v;
}
}
- len = RARRAY(ary1)->len - RARRAY(ary2)->len;
+ return Qundef;
+}
+
+/*
+ * call-seq:
+ * ary <=> other_ary -> -1, 0, +1 or nil
+ *
+ * Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
+ * array is less than, equal to, or greater than +other_ary+.
+ *
+ * Each object in each array is compared (using the <=> operator).
+ *
+ * Arrays are compared in an "element-wise" manner; the first element of +ary+
+ * is compared with the first one of +other_ary+ using the <=> operator, then
+ * each of the second elements, etc...
+ * As soon as the result of any such comparison is non zero (i.e. the two
+ * corresponding elements are not equal), that result is returned for the
+ * whole array comparison.
+ *
+ * If all the elements are equal, then the result is based on a comparison of
+ * the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
+ * and only if, they have the same length and the value of each element is
+ * equal to the value of the corresponding element in the other array.
+ *
+ * +nil+ is returned if the +other_ary+ is not an array or if the comparison
+ * of two elements returned +nil+.
+ *
+ * [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
+ * [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
+ * [ 1, 2 ] <=> [ 1, :two ] #=> nil
+ *
+ */
+
+VALUE
+rb_ary_cmp(VALUE ary1, VALUE ary2)
+{
+ long len;
+ VALUE v;
+
+ ary2 = rb_check_array_type(ary2);
+ if (NIL_P(ary2)) return Qnil;
+ if (ary1 == ary2) return INT2FIX(0);
+ v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+ if (v != Qundef) return v;
+ len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
return INT2FIX(-1);
}
static VALUE
-ary_make_hash(ary1, ary2)
- VALUE ary1, ary2;
+ary_add_hash(VALUE hash, VALUE ary)
{
- VALUE hash = rb_hash_new();
long i;
- for (i=0; i<RARRAY(ary1)->len; i++) {
- rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ VALUE elt = RARRAY_AREF(ary, i);
+ rb_hash_add_new_element(hash, elt, elt);
}
- if (ary2) {
- for (i=0; i<RARRAY(ary2)->len; i++) {
- rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
- }
+ return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(VALUE ary)
+{
+ long size = RARRAY_LEN(ary);
+ VALUE hash = rb_hash_new_with_size(size);
+
+ RBASIC_CLEAR_CLASS(hash);
+ return hash;
+}
+
+static VALUE
+ary_make_hash(VALUE ary)
+{
+ VALUE hash = ary_tmp_hash_new(ary);
+ return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+ long i;
+
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+ rb_hash_add_new_element(hash, k, v);
}
return hash;
}
-/*
+static VALUE
+ary_make_hash_by(VALUE ary)
+{
+ VALUE hash = ary_tmp_hash_new(ary);
+ return ary_add_hash_by(hash, ary);
+}
+
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+ assert(RBASIC_CLASS(hash) == 0);
+ if (RHASH_ST_TABLE_P(hash)) {
+ st_table *tbl = RHASH_ST_TABLE(hash);
+ st_free_table(tbl);
+ RHASH_ST_CLEAR(hash);
+ }
+}
+
+/*
* call-seq:
- * array - other_array -> an_array
+ * ary - other_ary -> new_ary
+ *
+ * Array Difference
*
- * Array Difference---Returns a new array that is a copy of
- * the original array, removing any items that also appear in
- * other_array. (If you need set-like behavior, see the
- * library class Set.)
+ * Returns a new array that is a copy of the original array, removing all
+ * occurrences of any item that also appear in +other_ary+. The order is
+ * preserved from the original array.
+ *
+ * It compares elements using their #hash and #eql? methods for efficiency.
*
* [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
+ *
+ * Note that while 1 and 2 were only present once in the array argument, and
+ * were present twice in the receiver array, all occurrences of each Integer are
+ * removed in the returned array.
+ *
+ * If you need set-like behavior, see the library class Set.
+ *
+ * See also Array#difference.
*/
static VALUE
-rb_ary_diff(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_diff(VALUE ary1, VALUE ary2)
{
VALUE ary3;
- volatile VALUE hash;
+ VALUE hash;
long i;
- hash = ary_make_hash(to_ary(ary2), 0);
+ ary2 = to_ary(ary2);
ary3 = rb_ary_new();
- for (i=0; i<RARRAY(ary1)->len; i++) {
- if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ VALUE elt = rb_ary_elt(ary1, i);
+ if (rb_ary_includes_by_eql(ary2, elt)) continue;
+ rb_ary_push(ary3, elt);
+ }
+ return ary3;
+ }
+
+ hash = ary_make_hash(ary2);
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
rb_ary_push(ary3, rb_ary_elt(ary1, i));
}
+ ary_recycle_hash(hash);
return ary3;
}
-/*
+/*
+ * call-seq:
+ * ary.difference(other_ary1, other_ary2, ...) -> new_ary
+ *
+ * Array Difference
+ *
+ * Returns a new array that is a copy of the original array, removing all
+ * occurrences of any item that also appear in +other_ary+. The order is
+ * preserved from the original array.
+ *
+ * It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ * [ 1, 1, 2, 2, 3, 3, 4, 5 ].difference([ 1, 2, 4 ]) #=> [ 3, 3, 5 ]
+ *
+ * Note that while 1 and 2 were only present once in the array argument, and
+ * were present twice in the receiver array, all occurrences of each Integer are
+ * removed in the returned array.
+ *
+ * Multiple array arguments can be supplied and all occurrences of any element
+ * in those supplied arrays that match the receiver will be removed from the
+ * returned array.
+ *
+ * [ 1, 'c', :s, 'yep' ].difference([ 1 ], [ 'a', 'c' ]) #=> [ :s, "yep" ]
+ *
+ * If you need set-like behavior, see the library class Set.
+ *
+ * See also Array#-.
+ */
+
+static VALUE
+rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE ary_diff;
+ long i, length;
+ volatile VALUE t0;
+ bool *is_hash = ALLOCV_N(bool, t0, argc);
+ ary_diff = rb_ary_new();
+ length = RARRAY_LEN(ary);
+
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
+ if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
+ }
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ int j;
+ VALUE elt = rb_ary_elt(ary, i);
+ for (j = 0; j < argc; j++) {
+ if (is_hash[j]) {
+ if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
+ break;
+ }
+ else {
+ if (rb_ary_includes_by_eql(argv[j], elt)) break;
+ }
+ }
+ if (j == argc) rb_ary_push(ary_diff, elt);
+ }
+
+ ALLOCV_END(t0);
+
+ return ary_diff;
+}
+
+
+/*
* call-seq:
- * array & other_array
+ * ary & other_ary -> new_ary
+ *
+ * Set Intersection --- Returns a new array containing unique elements common to the
+ * two arrays. The order is preserved from the original array.
*
- * Set Intersection---Returns a new array
- * containing elements common to the two arrays, with no duplicates.
+ * It compares elements using their #hash and #eql? methods for efficiency.
*
- * [ 1, 1, 3, 5 ] & [ 1, 2, 3 ] #=> [ 1, 3 ]
+ * [ 1, 1, 3, 5 ] & [ 3, 2, 1 ] #=> [ 1, 3 ]
+ * [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ] #=> [ 'a', 'b' ]
+ *
+ * See also Array#uniq.
*/
static VALUE
-rb_ary_and(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_and(VALUE ary1, VALUE ary2)
{
- VALUE hash, ary3, v, vv;
+ VALUE hash, ary3, v;
+ st_data_t vv;
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
- RARRAY(ary1)->len : RARRAY(ary2)->len);
- hash = ary_make_hash(ary2, 0);
+ ary3 = rb_ary_new();
+ if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
+
+ if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ if (!rb_ary_includes_by_eql(ary2, v)) continue;
+ if (rb_ary_includes_by_eql(ary3, v)) continue;
+ rb_ary_push(ary3, v);
+ }
+ return ary3;
+ }
- for (i=0; i<RARRAY(ary1)->len; i++) {
- v = vv = rb_ary_elt(ary1, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+ hash = ary_make_hash(ary2);
+
+ for (i=0; i<RARRAY_LEN(ary1); i++) {
+ v = RARRAY_AREF(ary1, i);
+ vv = (st_data_t)v;
+ if (rb_hash_stlike_delete(hash, &vv, 0)) {
rb_ary_push(ary3, v);
}
}
+ ary_recycle_hash(hash);
return ary3;
}
-/*
+/*
* call-seq:
- * array | other_array -> an_array
+ * ary.intersection(other_ary1, other_ary2, ...) -> new_ary
*
- * Set Union---Returns a new array by joining this array with
- * other_array, removing duplicates.
+ * Set Intersection --- Returns a new array containing unique elements common
+ * to +self+ and <code>other_ary</code>s. Order is preserved from the original
+ * array.
*
- * [ "a", "b", "c" ] | [ "c", "d", "a" ]
- * #=> [ "a", "b", "c", "d" ]
+ * It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ * [ 1, 1, 3, 5 ].intersection([ 3, 2, 1 ]) # => [ 1, 3 ]
+ * [ "a", "b", "z" ].intersection([ "a", "b", "c" ], [ "b" ]) # => [ "b" ]
+ * [ "a" ].intersection #=> [ "a" ]
+ *
+ * See also Array#&.
*/
static VALUE
-rb_ary_or(ary1, ary2)
- VALUE ary1, ary2;
+rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE result = rb_ary_dup(ary);
+ int i;
+
+ for (i = 0; i < argc; i++) {
+ result = rb_ary_and(result, argv[i]);
+ }
+
+ return result;
+}
+
+static int
+ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
+{
+ if (existing) return ST_STOP;
+ *key = *value = (VALUE)arg;
+ return ST_CONTINUE;
+}
+
+static void
+rb_ary_union(VALUE ary_union, VALUE ary)
{
- VALUE hash, ary3;
- VALUE v, vv;
long i;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE elt = rb_ary_elt(ary, i);
+ if (rb_ary_includes_by_eql(ary_union, elt)) continue;
+ rb_ary_push(ary_union, elt);
+ }
+}
+
+static void
+rb_ary_union_hash(VALUE hash, VALUE ary2)
+{
+ long i;
+ for (i = 0; i < RARRAY_LEN(ary2); i++) {
+ VALUE elt = RARRAY_AREF(ary2, i);
+ if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+ RB_OBJ_WRITTEN(hash, Qundef, elt);
+ }
+ }
+}
+
+/*
+ * call-seq:
+ * ary | other_ary -> new_ary
+ *
+ * Set Union --- Returns a new array by joining +ary+ with +other_ary+,
+ * excluding any duplicates and preserving the order from the given arrays.
+ *
+ * It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ * [ "a", "b", "c" ] | [ "c", "d", "a" ] #=> [ "a", "b", "c", "d" ]
+ * [ "c", "d", "a" ] | [ "a", "b", "c" ] #=> [ "c", "d", "a", "b" ]
+ *
+ * See also Array#union.
+ */
+
+static VALUE
+rb_ary_or(VALUE ary1, VALUE ary2)
+{
+ VALUE hash, ary3;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
- hash = ary_make_hash(ary1, ary2);
+ if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
+ ary3 = rb_ary_new();
+ rb_ary_union(ary3, ary1);
+ rb_ary_union(ary3, ary2);
+ return ary3;
+ }
- for (i=0; i<RARRAY(ary1)->len; i++) {
- v = vv = rb_ary_elt(ary1, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
- rb_ary_push(ary3, v);
+ hash = ary_make_hash(ary1);
+ rb_ary_union_hash(hash, ary2);
+
+ ary3 = rb_hash_values(hash);
+ ary_recycle_hash(hash);
+ return ary3;
+}
+
+/*
+ * call-seq:
+ * ary.union(other_ary1, other_ary2, ...) -> new_ary
+ *
+ * Set Union --- Returns a new array by joining <code>other_ary</code>s with +self+,
+ * excluding any duplicates and preserving the order from the given arrays.
+ *
+ * It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ * [ "a", "b", "c" ].union( [ "c", "d", "a" ] ) #=> [ "a", "b", "c", "d" ]
+ * [ "a" ].union( ["e", "b"], ["a", "c", "b"] ) #=> [ "a", "e", "b", "c" ]
+ * [ "a" ].union #=> [ "a" ]
+ *
+ * See also Array#|.
+ */
+
+static VALUE
+rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
+{
+ int i;
+ long sum;
+ VALUE hash, ary_union;
+
+ sum = RARRAY_LEN(ary);
+ for (i = 0; i < argc; i++) {
+ argv[i] = to_ary(argv[i]);
+ sum += RARRAY_LEN(argv[i]);
+ }
+
+ if (sum <= SMALL_ARRAY_LEN) {
+ ary_union = rb_ary_new();
+
+ rb_ary_union(ary_union, ary);
+ for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
+
+ return ary_union;
+ }
+
+ hash = ary_make_hash(ary);
+ for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
+
+ ary_union = rb_hash_values(hash);
+ ary_recycle_hash(hash);
+ return ary_union;
+}
+
+/*
+ * call-seq:
+ * ary.max -> obj
+ * ary.max {|a, b| block} -> obj
+ * ary.max(n) -> array
+ * ary.max(n) {|a, b| block} -> array
+ *
+ * Returns the object in _ary_ with the maximum value. The
+ * first form assumes all objects implement Comparable;
+ * the second uses the block to return <em>a <=> b</em>.
+ *
+ * ary = %w(albatross dog horse)
+ * ary.max #=> "horse"
+ * ary.max {|a, b| a.length <=> b.length} #=> "albatross"
+ *
+ * If the +n+ argument is given, maximum +n+ elements are returned
+ * as an array.
+ *
+ * ary = %w[albatross dog horse]
+ * ary.max(2) #=> ["horse", "dog"]
+ * ary.max(2) {|a, b| a.length <=> b.length } #=> ["albatross", "horse"]
+ */
+static VALUE
+rb_ary_max(int argc, VALUE *argv, VALUE ary)
+{
+ struct cmp_opt_data cmp_opt = { 0, 0 };
+ VALUE result = Qundef, v;
+ VALUE num;
+ long i;
+
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+ return rb_nmin_run(ary, num, 0, 1, 1);
+
+ if (rb_block_given_p()) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
+ result = v;
+ }
}
}
- for (i=0; i<RARRAY(ary2)->len; i++) {
- v = vv = rb_ary_elt(ary2, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
- rb_ary_push(ary3, v);
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) > 0) {
+ result = v;
+ }
}
}
- return ary3;
+ if (result == Qundef) return Qnil;
+ return result;
}
/*
* call-seq:
- * array.uniq! -> array or nil
- *
- * Removes duplicate elements from _self_.
- * Returns <code>nil</code> if no changes are made (that is, no
- * duplicates are found).
- *
+ * ary.min -> obj
+ * ary.min {| a,b | block } -> obj
+ * ary.min(n) -> array
+ * ary.min(n) {| a,b | block } -> array
+ *
+ * Returns the object in _ary_ with the minimum value. The
+ * first form assumes all objects implement Comparable;
+ * the second uses the block to return <em>a <=> b</em>.
+ *
+ * ary = %w(albatross dog horse)
+ * ary.min #=> "albatross"
+ * ary.min {|a, b| a.length <=> b.length} #=> "dog"
+ *
+ * If the +n+ argument is given, minimum +n+ elements are returned
+ * as an array.
+ *
+ * ary = %w[albatross dog horse]
+ * ary.min(2) #=> ["albatross", "dog"]
+ * ary.min(2) {|a, b| a.length <=> b.length } #=> ["dog", "horse"]
+ */
+static VALUE
+rb_ary_min(int argc, VALUE *argv, VALUE ary)
+{
+ struct cmp_opt_data cmp_opt = { 0, 0 };
+ VALUE result = Qundef, v;
+ VALUE num;
+ long i;
+
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
+ return rb_nmin_run(ary, num, 0, 0, 1);
+
+ if (rb_block_given_p()) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
+ result = v;
+ }
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) < 0) {
+ result = v;
+ }
+ }
+ }
+ if (result == Qundef) return Qnil;
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.minmax -> [obj, obj]
+ * ary.minmax {| a,b | block } -> [obj, obj]
+ *
+ * Returns a two element array which contains the minimum and the
+ * maximum value in the array.
+ *
+ * Can be given an optional block to override the default comparison
+ * method <code>a <=> b</code>.
+ */
+static VALUE
+rb_ary_minmax(VALUE ary)
+{
+ if (rb_block_given_p()) {
+ return rb_call_super(0, NULL);
+ }
+ return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
+}
+
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+ rb_ary_push((VALUE)ary, (VALUE)val);
+ return ST_CONTINUE;
+}
+
+/*
+ * call-seq:
+ * ary.uniq! -> ary or nil
+ * ary.uniq! {|item| ...} -> ary or nil
+ *
+ * Removes duplicate elements from +self+.
+ *
+ * If a block is given, it will use the return value of the block for
+ * comparison.
+ *
+ * It compares values using their #hash and #eql? methods for efficiency.
+ *
+ * +self+ is traversed in order, and the first occurrence is kept.
+ *
+ * Returns +nil+ if no changes are made (that is, no duplicates are found).
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! #=> ["a", "b", "c"]
+ * a.uniq! # => ["a", "b", "c"]
+ *
* b = [ "a", "b", "c" ]
- * b.uniq! #=> nil
+ * b.uniq! # => nil
+ *
+ * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ * c.uniq! {|s| s.first} # => [["student", "sam"], ["teacher", "matz"]]
+ *
*/
static VALUE
-rb_ary_uniq_bang(ary)
- VALUE ary;
+rb_ary_uniq_bang(VALUE ary)
{
- VALUE hash, v, vv;
- long i, j;
+ VALUE hash;
+ long hash_size;
- hash = ary_make_hash(ary, 0);
-
- if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
+ rb_ary_modify_check(ary);
+ if (RARRAY_LEN(ary) <= 1)
+ return Qnil;
+ if (rb_block_given_p())
+ hash = ary_make_hash_by(ary);
+ else
+ hash = ary_make_hash(ary);
+
+ hash_size = RHASH_SIZE(hash);
+ if (RARRAY_LEN(ary) == hash_size) {
return Qnil;
}
- for (i=j=0; i<RARRAY(ary)->len; i++) {
- v = vv = rb_ary_elt(ary, i);
- if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
- rb_ary_store(ary, j++, v);
- }
+ rb_ary_modify_check(ary);
+ ARY_SET_LEN(ary, 0);
+ if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+ rb_ary_unshare(ary);
+ FL_SET_EMBED(ary);
}
- RARRAY(ary)->len = j;
+ ary_resize_capa(ary, hash_size);
+ rb_hash_foreach(hash, push_value, ary);
+ ary_recycle_hash(hash);
return ary;
}
/*
* call-seq:
- * array.uniq -> an_array
- *
- * Returns a new array by removing duplicate values in <i>self</i>.
- *
+ * ary.uniq -> new_ary
+ * ary.uniq {|item| ...} -> new_ary
+ *
+ * Returns a new array by removing duplicate values in +self+.
+ *
+ * If a block is given, it will use the return value of the block for comparison.
+ *
+ * It compares values using their #hash and #eql? methods for efficiency.
+ *
+ * +self+ is traversed in order, and the first occurrence is kept.
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq #=> ["a", "b", "c"]
+ * a.uniq # => ["a", "b", "c"]
+ *
+ * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ * b.uniq {|s| s.first} # => [["student", "sam"], ["teacher", "matz"]]
+ *
*/
static VALUE
-rb_ary_uniq(ary)
- VALUE ary;
+rb_ary_uniq(VALUE ary)
{
- ary = rb_ary_dup(ary);
- rb_ary_uniq_bang(ary);
- return ary;
+ VALUE hash, uniq;
+
+ if (RARRAY_LEN(ary) <= 1) {
+ hash = 0;
+ uniq = rb_ary_dup(ary);
+ }
+ else if (rb_block_given_p()) {
+ hash = ary_make_hash_by(ary);
+ uniq = rb_hash_values(hash);
+ }
+ else {
+ hash = ary_make_hash(ary);
+ uniq = rb_hash_values(hash);
+ }
+ RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
+ if (hash) {
+ ary_recycle_hash(hash);
+ }
+
+ return uniq;
}
-/*
+/*
* call-seq:
- * array.compact! -> array or nil
+ * ary.compact! -> ary or nil
+ *
+ * Removes +nil+ elements from the array.
*
- * Removes +nil+ elements from array.
- * Returns +nil+ if no changes were made.
+ * Returns +nil+ if no changes were made, otherwise returns the array.
*
* [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
* [ "a", "b", "c" ].compact! #=> nil
*/
static VALUE
-rb_ary_compact_bang(ary)
- VALUE ary;
+rb_ary_compact_bang(VALUE ary)
{
VALUE *p, *t, *end;
+ long n;
rb_ary_modify(ary);
- p = t = RARRAY(ary)->ptr;
- end = p + RARRAY(ary)->len;
-
+ p = t = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary); /* WB: no new reference */
+ end = p + RARRAY_LEN(ary);
+
while (t < end) {
if (NIL_P(*t)) t++;
else *p++ = *t++;
}
- if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
+ n = p - RARRAY_CONST_PTR_TRANSIENT(ary);
+ if (RARRAY_LEN(ary) == n) {
return Qnil;
}
- RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
- REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ ary_resize_smaller(ary, n);
return ary;
}
/*
* call-seq:
- * array.compact -> an_array
+ * ary.compact -> new_ary
*
- * Returns a copy of _self_ with all +nil+ elements removed.
+ * Returns a copy of +self+ with all +nil+ elements removed.
*
* [ "a", nil, "b", nil, "c", nil ].compact
* #=> [ "a", "b", "c" ]
*/
static VALUE
-rb_ary_compact(ary)
- VALUE ary;
+rb_ary_compact(VALUE ary)
{
ary = rb_ary_dup(ary);
rb_ary_compact_bang(ary);
@@ -2839,149 +5095,1846 @@ rb_ary_compact(ary)
/*
* call-seq:
- * array.nitems -> int
- *
- * Returns the number of non-<code>nil</code> elements in _self_.
- * May be zero.
- *
- * [ 1, nil, 3, nil, 5 ].nitems #=> 3
+ * ary.count -> int
+ * ary.count(obj) -> int
+ * ary.count {|item| block} -> int
+ *
+ * Returns the number of elements.
+ *
+ * If an argument is given, counts the number of elements which equal +obj+
+ * using <code>==</code>.
+ *
+ * If a block is given, counts the number of elements for which the block
+ * returns a true value.
+ *
+ * ary = [1, 2, 4, 2]
+ * ary.count #=> 4
+ * ary.count(2) #=> 2
+ * ary.count {|x| x%2 == 0} #=> 3
+ *
*/
static VALUE
-rb_ary_nitems(ary)
- VALUE ary;
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
{
- long n = 0;
- VALUE *p, *pend;
+ long i, n = 0;
+
+ if (rb_check_arity(argc, 0, 1) == 0) {
+ VALUE v;
- p = RARRAY(ary)->ptr;
- pend = p + RARRAY(ary)->len;
+ if (!rb_block_given_p())
+ return LONG2NUM(RARRAY_LEN(ary));
- while (p < pend) {
- if (!NIL_P(*p)) n++;
- p++;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ v = RARRAY_AREF(ary, i);
+ if (RTEST(rb_yield(v))) n++;
+ }
+ }
+ else {
+ VALUE obj = argv[0];
+
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+ }
}
+
return LONG2NUM(n);
}
-static long
-flatten(ary, idx, ary2, memo)
- VALUE ary;
- long idx;
- VALUE ary2, memo;
+static VALUE
+flatten(VALUE ary, int level)
{
- VALUE id;
- long i = idx;
- long n, lim = idx + RARRAY(ary2)->len;
-
- id = rb_obj_id(ary2);
- if (rb_ary_includes(memo, id)) {
- rb_raise(rb_eArgError, "tried to flatten recursive array");
- }
- rb_ary_push(memo, id);
- rb_ary_splice(ary, idx, 1, ary2);
- while (i < lim) {
- VALUE tmp;
-
- tmp = rb_check_array_type(rb_ary_elt(ary, i));
- if (!NIL_P(tmp)) {
- n = flatten(ary, i, tmp, memo);
- i += n; lim += n;
+ long i;
+ VALUE stack, result, tmp, elt, vmemo;
+ st_table *memo;
+ st_data_t id;
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ elt = RARRAY_AREF(ary, i);
+ tmp = rb_check_array_type(elt);
+ if (!NIL_P(tmp)) {
+ break;
+ }
+ }
+ if (i == RARRAY_LEN(ary)) {
+ return ary;
+ } else if (tmp == ary) {
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+
+ result = ary_new(0, RARRAY_LEN(ary));
+ ary_memcpy(result, 0, i, RARRAY_CONST_PTR_TRANSIENT(ary));
+ ARY_SET_LEN(result, i);
+
+ stack = ary_new(0, ARY_DEFAULT_SIZE);
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i + 1));
+
+ vmemo = rb_hash_new();
+ RBASIC_CLEAR_CLASS(vmemo);
+ memo = st_init_numtable();
+ rb_hash_st_table_set(vmemo, memo);
+ st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+ st_insert(memo, (st_data_t)tmp, (st_data_t)Qtrue);
+
+ ary = tmp;
+ i = 0;
+
+ while (1) {
+ while (i < RARRAY_LEN(ary)) {
+ elt = RARRAY_AREF(ary, i++);
+ if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+ rb_ary_push(result, elt);
+ continue;
+ }
+ tmp = rb_check_array_type(elt);
+ if (RBASIC(result)->klass) {
+ RB_GC_GUARD(vmemo);
+ st_clear(memo);
+ rb_raise(rb_eRuntimeError, "flatten reentered");
+ }
+ if (NIL_P(tmp)) {
+ rb_ary_push(result, elt);
+ }
+ else {
+ id = (st_data_t)tmp;
+ if (st_is_member(memo, id)) {
+ st_clear(memo);
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+ st_insert(memo, id, (st_data_t)Qtrue);
+ rb_ary_push(stack, ary);
+ rb_ary_push(stack, LONG2NUM(i));
+ ary = tmp;
+ i = 0;
+ }
+ }
+ if (RARRAY_LEN(stack) == 0) {
+ break;
}
- i++;
+ id = (st_data_t)ary;
+ st_delete(memo, &id, 0);
+ tmp = rb_ary_pop(stack);
+ i = NUM2LONG(tmp);
+ ary = rb_ary_pop(stack);
}
- rb_ary_pop(memo);
- return lim - idx - 1; /* returns number of increased items */
+ st_clear(memo);
+
+ RBASIC_SET_CLASS(result, rb_obj_class(ary));
+ return result;
}
/*
* call-seq:
- * array.flatten! -> array or nil
- *
- * Flattens _self_ in place.
- * Returns <code>nil</code> if no modifications were made (i.e.,
- * <i>array</i> contains no subarrays.)
- *
+ * ary.flatten! -> ary or nil
+ * ary.flatten!(level) -> ary or nil
+ *
+ * Flattens +self+ in place.
+ *
+ * Returns +nil+ if no modifications were made (i.e., the array contains no
+ * subarrays.)
+ *
+ * The optional +level+ argument determines the level of recursion to flatten.
+ *
* a = [ 1, 2, [3, [4, 5] ] ]
* a.flatten! #=> [1, 2, 3, 4, 5]
* a.flatten! #=> nil
* a #=> [1, 2, 3, 4, 5]
+ * a = [ 1, 2, [3, [4, 5] ] ]
+ * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
-rb_ary_flatten_bang(ary)
- VALUE ary;
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
{
- long i = 0;
- int mod = 0;
- VALUE memo = Qnil;
+ int mod = 0, level = -1;
+ VALUE result, lv;
- while (i<RARRAY(ary)->len) {
- VALUE ary2 = RARRAY(ary)->ptr[i];
- VALUE tmp;
+ lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
+ rb_ary_modify_check(ary);
+ if (!NIL_P(lv)) level = NUM2INT(lv);
+ if (level == 0) return Qnil;
- tmp = rb_check_array_type(ary2);
- if (!NIL_P(tmp)) {
- if (NIL_P(memo)) {
- memo = rb_ary_new();
- }
- i += flatten(ary, i, tmp, memo);
- mod = 1;
- }
- i++;
+ result = flatten(ary, level);
+ if (result == ary) {
+ return Qnil;
}
- if (mod == 0) return Qnil;
+ if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+ rb_ary_replace(ary, result);
+ if (mod) ARY_SET_EMBED_LEN(result, 0);
+
return ary;
}
/*
* call-seq:
- * array.flatten -> an_array
- *
- * Returns a new array that is a one-dimensional flattening of this
- * array (recursively). That is, for every element that is an array,
- * extract its elements into the new array.
- *
+ * ary.flatten -> new_ary
+ * ary.flatten(level) -> new_ary
+ *
+ * Returns a new array that is a one-dimensional flattening of +self+
+ * (recursively).
+ *
+ * That is, for every element that is an array, extract its elements into
+ * the new array.
+ *
+ * The optional +level+ argument determines the level of recursion to
+ * flatten.
+ *
* s = [ 1, 2, 3 ] #=> [1, 2, 3]
* t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
* a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
+ * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ * a = [ 1, 2, [3, [4, 5] ] ]
+ * a.flatten(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
-rb_ary_flatten(ary)
- VALUE ary;
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+ int level = -1;
+ VALUE result;
+
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
+ level = NUM2INT(argv[0]);
+ if (level == 0) return ary_make_shared_copy(ary);
+ }
+
+ result = flatten(ary, level);
+ if (result == ary) {
+ result = ary_make_shared_copy(ary);
+ }
+
+ return result;
+}
+
+#define OPTHASH_GIVEN_P(opts) \
+ (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static ID id_random;
+
+#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
+
+/*
+ * call-seq:
+ * ary.shuffle! -> ary
+ * ary.shuffle!(random: rng) -> ary
+ *
+ * Shuffles elements in +self+ in place.
+ *
+ * a = [ 1, 2, 3 ] #=> [1, 2, 3]
+ * a.shuffle! #=> [2, 3, 1]
+ * a #=> [2, 3, 1]
+ *
+ * The optional +rng+ argument will be used as the random number generator.
+ *
+ * a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE opts, randgen = rb_cRandom;
+ long i, len;
+
+ if (OPTHASH_GIVEN_P(opts)) {
+ VALUE rnd;
+ ID keyword_ids[1];
+
+ keyword_ids[0] = id_random;
+ rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+ if (rnd != Qundef) {
+ randgen = rnd;
+ }
+ }
+ rb_check_arity(argc, 0, 0);
+ rb_ary_modify(ary);
+ i = len = RARRAY_LEN(ary);
+ RARRAY_PTR_USE(ary, ptr, {
+ while (i) {
+ long j = RAND_UPTO(i);
+ VALUE tmp;
+ if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR_TRANSIENT(ary)) {
+ rb_raise(rb_eRuntimeError, "modified during shuffle");
+ }
+ tmp = ptr[--i];
+ ptr[i] = ptr[j];
+ ptr[j] = tmp;
+ }
+ }); /* WB: no new reference */
+ return ary;
+}
+
+
+/*
+ * call-seq:
+ * ary.shuffle -> new_ary
+ * ary.shuffle(random: rng) -> new_ary
+ *
+ * Returns a new array with elements of +self+ shuffled.
+ *
+ * a = [ 1, 2, 3 ] #=> [1, 2, 3]
+ * a.shuffle #=> [2, 3, 1]
+ * a #=> [1, 2, 3]
+ *
+ * The optional +rng+ argument will be used as the random number generator.
+ *
+ * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
{
ary = rb_ary_dup(ary);
- rb_ary_flatten_bang(ary);
+ rb_ary_shuffle_bang(argc, argv, ary);
return ary;
}
-/* Arrays are ordered, integer-indexed collections of any object.
- * Array indexing starts at 0, as in C or Java. A negative index is
- * assumed to be relative to the end of the array---that is, an index of -1
- * indicates the last element of the array, -2 is the next to last
- * element in the array, and so on.
+/*
+ * call-seq:
+ * ary.sample -> obj
+ * ary.sample(random: rng) -> obj
+ * ary.sample(n) -> new_ary
+ * ary.sample(n, random: rng) -> new_ary
+ *
+ * Choose a random element or +n+ random elements from the array.
+ *
+ * The elements are chosen by using random and unique indices into the array
+ * in order to ensure that an element doesn't repeat itself unless the array
+ * already contained duplicate elements.
+ *
+ * If the array is empty the first form returns +nil+ and the second form
+ * returns an empty array.
+ *
+ * a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+ * a.sample #=> 7
+ * a.sample(4) #=> [6, 4, 2, 5]
+ *
+ * The optional +rng+ argument will be used as the random number generator.
+ *
+ * a.sample(random: Random.new(1)) #=> 6
+ * a.sample(4, random: Random.new(1)) #=> [6, 10, 9, 2]
+ */
+
+
+static VALUE
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE nv, result;
+ VALUE opts, randgen = rb_cRandom;
+ long n, len, i, j, k, idx[10];
+ long rnds[numberof(idx)];
+ long memo_threshold;
+
+ if (OPTHASH_GIVEN_P(opts)) {
+ VALUE rnd;
+ ID keyword_ids[1];
+
+ keyword_ids[0] = id_random;
+ rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+ if (rnd != Qundef) {
+ randgen = rnd;
+ }
+ }
+ len = RARRAY_LEN(ary);
+ if (rb_check_arity(argc, 0, 1) == 0) {
+ if (len < 2)
+ i = 0;
+ else
+ i = RAND_UPTO(len);
+
+ return rb_ary_elt(ary, i);
+ }
+ nv = argv[0];
+ n = NUM2LONG(nv);
+ if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+ if (n > len) n = len;
+ if (n <= numberof(idx)) {
+ for (i = 0; i < n; ++i) {
+ rnds[i] = RAND_UPTO(len - i);
+ }
+ }
+ k = len;
+ len = RARRAY_LEN(ary);
+ if (len < k && n <= numberof(idx)) {
+ for (i = 0; i < n; ++i) {
+ if (rnds[i] >= len) return rb_ary_new_capa(0);
+ }
+ }
+ if (n > len) n = len;
+ switch (n) {
+ case 0:
+ return rb_ary_new_capa(0);
+ case 1:
+ i = rnds[0];
+ return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+ case 2:
+ i = rnds[0];
+ j = rnds[1];
+ if (j >= i) j++;
+ return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+ case 3:
+ i = rnds[0];
+ j = rnds[1];
+ k = rnds[2];
+ {
+ long l = j, g = i;
+ if (j >= i) l = i, g = ++j;
+ if (k >= l && (++k >= g)) ++k;
+ }
+ return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+ }
+ memo_threshold =
+ len < 2560 ? len / 128 :
+ len < 5120 ? len / 64 :
+ len < 10240 ? len / 32 :
+ len / 16;
+ if (n <= numberof(idx)) {
+ long sorted[numberof(idx)];
+ sorted[0] = idx[0] = rnds[0];
+ for (i=1; i<n; i++) {
+ k = rnds[i];
+ for (j = 0; j < i; ++j) {
+ if (k < sorted[j]) break;
+ ++k;
+ }
+ memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+ sorted[j] = idx[i] = k;
+ }
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE_TRANSIENT(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+ }
+ });
+ }
+ else if (n <= memo_threshold / 2) {
+ long max_idx = 0;
+#undef RUBY_UNTYPED_DATA_WARNING
+#define RUBY_UNTYPED_DATA_WARNING 0
+ VALUE vmemo = Data_Wrap_Struct(0, 0, st_free_table, 0);
+ st_table *memo = st_init_numtable_with_size(n);
+ DATA_PTR(vmemo) = memo;
+ result = rb_ary_new_capa(n);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ long r = RAND_UPTO(len-i) + i;
+ ptr_result[i] = r;
+ if (r > max_idx) max_idx = r;
+ }
+ len = RARRAY_LEN(ary);
+ if (len <= max_idx) n = 0;
+ else if (n > len) n = len;
+ RARRAY_PTR_USE_TRANSIENT(ary, ptr_ary, {
+ for (i=0; i<n; i++) {
+ long j2 = j = ptr_result[i];
+ long i2 = i;
+ st_data_t value;
+ if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
+ if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
+ st_insert(memo, (st_data_t)j, (st_data_t)i2);
+ ptr_result[i] = ptr_ary[j2];
+ }
+ });
+ });
+ DATA_PTR(vmemo) = 0;
+ st_free_table(memo);
+ }
+ else {
+ result = rb_ary_dup(ary);
+ RBASIC_CLEAR_CLASS(result);
+ RB_GC_GUARD(ary);
+ RARRAY_PTR_USE(result, ptr_result, {
+ for (i=0; i<n; i++) {
+ j = RAND_UPTO(len-i) + i;
+ nv = ptr_result[j];
+ ptr_result[j] = ptr_result[i];
+ ptr_result[i] = nv;
+ }
+ });
+ RBASIC_SET_CLASS_RAW(result, rb_cArray);
+ }
+ ARY_SET_LEN(result, n);
+
+ return result;
+}
+
+static VALUE
+rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
+{
+ long mul;
+ VALUE n = Qnil;
+ if (args && (RARRAY_LEN(args) > 0)) {
+ n = RARRAY_AREF(args, 0);
+ }
+ if (RARRAY_LEN(self) == 0) return INT2FIX(0);
+ if (n == Qnil) return DBL2NUM(HUGE_VAL);
+ mul = NUM2LONG(n);
+ if (mul <= 0) return INT2FIX(0);
+ n = LONG2FIX(mul);
+ return rb_fix_mul_fix(rb_ary_length(self), n);
+}
+
+/*
+ * call-seq:
+ * ary.cycle(n=nil) {|obj| block} -> nil
+ * ary.cycle(n=nil) -> Enumerator
+ *
+ * Calls the given block for each element +n+ times or forever if +nil+ is
+ * given.
+ *
+ * Does nothing if a non-positive number is given or the array is empty.
+ *
+ * Returns +nil+ if the loop has finished without getting interrupted.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * a = ["a", "b", "c"]
+ * a.cycle {|x| puts x} # print, a, b, c, a, b, c,.. forever.
+ * a.cycle(2) {|x| puts x} # print, a, b, c, a, b, c.
+ *
+ */
+
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+ long n, i;
+
+ rb_check_arity(argc, 0, 1);
+
+ RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
+ if (argc == 0 || NIL_P(argv[0])) {
+ n = -1;
+ }
+ else {
+ n = NUM2LONG(argv[0]);
+ if (n <= 0) return Qnil;
+ }
+
+ while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+ for (i=0; i<RARRAY_LEN(ary); i++) {
+ rb_yield(RARRAY_AREF(ary, i));
+ }
+ }
+ return Qnil;
+}
+
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
+
+/*
+ * Build a ruby array of the corresponding values and yield it to the
+ * associated block.
+ * Return the class of +values+ for reentry check.
+ */
+static int
+yield_indexed_values(const VALUE values, const long r, const long *const p)
+{
+ const VALUE result = rb_ary_new2(r);
+ long i;
+
+ for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
+ ARY_SET_LEN(result, r);
+ rb_yield(result);
+ return !RBASIC(values)->klass;
+}
+
+/*
+ * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
+ *
+ * When we have a complete permutation of array indices, copy the values
+ * at those indices into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
+{
+ long i = 0, index = 0;
+
+ for (;;) {
+ const char *const unused = memchr(&used[i], 0, n-i);
+ if (!unused) {
+ if (!index) break;
+ i = p[--index]; /* pop index */
+ used[i++] = 0; /* index unused */
+ }
+ else {
+ i = unused - used;
+ p[index] = i;
+ used[i] = 1; /* mark index used */
+ ++index;
+ if (index < r-1) { /* if not done yet */
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ if (used[i]) continue;
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "permute reentered");
+ }
+ }
+ i = p[--index]; /* pop index */
+ used[i] = 0; /* index unused */
+ p[index] = ++i;
+ }
+ }
+}
+
+/*
+ * Returns the product of from, from-1, ..., from - how_many + 1.
+ * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ */
+static VALUE
+descending_factorial(long from, long how_many)
+{
+ VALUE cnt;
+ if (how_many > 0) {
+ cnt = LONG2FIX(from);
+ while (--how_many > 0) {
+ long v = --from;
+ cnt = rb_int_mul(cnt, LONG2FIX(v));
+ }
+ }
+ else {
+ cnt = LONG2FIX(how_many == 0);
+ }
+ return cnt;
+}
+
+static VALUE
+binomial_coefficient(long comb, long size)
+{
+ VALUE r;
+ long i;
+ if (comb > size-comb) {
+ comb = size-comb;
+ }
+ if (comb < 0) {
+ return LONG2FIX(0);
+ }
+ else if (comb == 0) {
+ return LONG2FIX(1);
+ }
+ r = LONG2FIX(size);
+ for (i = 1; i < comb; ++i) {
+ r = rb_int_mul(r, LONG2FIX(size - i));
+ r = rb_int_idiv(r, LONG2FIX(i + 1));
+ }
+ return r;
+}
+
+static VALUE
+rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
+
+ return descending_factorial(n, k);
+}
+
+/*
+ * call-seq:
+ * ary.permutation {|p| block} -> ary
+ * ary.permutation -> Enumerator
+ * ary.permutation(n) {|p| block} -> ary
+ * ary.permutation(n) -> Enumerator
+ *
+ * When invoked with a block, yield all permutations of length +n+ of the
+ * elements of the array, then return the array itself.
+ *
+ * If +n+ is not specified, yield all permutations of all elements.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3]
+ * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ * a.permutation(1).to_a #=> [[1],[2],[3]]
+ * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ * a.permutation(0).to_a #=> [[]] # one permutation of length 0
+ * a.permutation(4).to_a #=> [] # no permutations of length 4
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+ long r, n, i;
+
+ n = RARRAY_LEN(ary); /* Array length */
+ RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size); /* Return enumerator if no block */
+ r = n;
+ if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
+ r = NUM2LONG(argv[0]); /* Permutation size from argument */
+
+ if (r < 0 || n < r) {
+ /* no permutations: yield nothing */
+ }
+ else if (r == 0) { /* exactly one permutation: the zero-length array */
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (r == 1) { /* this is a special, easy case */
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
+ }
+ else { /* this is the general case */
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+ char *used = (char*)(p + r);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
+
+ MEMZERO(used, char, n); /* initialize array */
+
+ permute0(n, r, p, used, ary0); /* compute and yield permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
+ return ary;
+}
+
+static void
+combinate0(const long len, const long n, long *const stack, const VALUE values)
+{
+ long lev = 0;
+
+ MEMZERO(stack+1, long, n);
+ stack[0] = -1;
+ for (;;) {
+ for (lev++; lev < n; lev++) {
+ stack[lev+1] = stack[lev]+1;
+ }
+ if (!yield_indexed_values(values, n, stack+1)) {
+ rb_raise(rb_eRuntimeError, "combination reentered");
+ }
+ do {
+ if (lev == 0) return;
+ stack[lev--]++;
+ } while (stack[lev+1]+n == len+lev+1);
+ }
+}
+
+static VALUE
+rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+ return binomial_coefficient(k, n);
+}
+
+/*
+ * call-seq:
+ * ary.combination(n) {|c| block} -> ary
+ * ary.combination(n) -> Enumerator
+ *
+ * When invoked with a block, yields all combinations of length +n+ of elements
+ * from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3, 4]
+ * a.combination(1).to_a #=> [[1],[2],[3],[4]]
+ * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ * a.combination(4).to_a #=> [[1,2,3,4]]
+ * a.combination(0).to_a #=> [[]] # one combination of length 0
+ * a.combination(5).to_a #=> [] # no combinations of length 5
+ *
+ */
+
+static VALUE
+rb_ary_combination(VALUE ary, VALUE num)
+{
+ long i, n, len;
+
+ n = NUM2LONG(num);
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
+ len = RARRAY_LEN(ary);
+ if (n < 0 || len < n) {
+ /* yield nothing */
+ }
+ else if (n == 0) {
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (n == 1) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
+ }
+ else {
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ volatile VALUE t0;
+ long *stack = ALLOCV_N(long, t0, n+1);
+
+ RBASIC_CLEAR_CLASS(ary0);
+ combinate0(len, n, stack, ary0);
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
+ return ary;
+}
+
+/*
+ * Compute repeated permutations of +r+ elements of the set
+ * <code>[0..n-1]</code>.
+ *
+ * When we have a complete repeated permutation of array indices, copy the
+ * values at those indices into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(const long n, const long r, long *const p, const VALUE values)
+{
+ long i = 0, index = 0;
+
+ p[index] = i;
+ for (;;) {
+ if (++index < r-1) {
+ p[index] = i = 0;
+ continue;
+ }
+ for (i = 0; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated permute reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
+ }
+}
+
+static VALUE
+rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+ if (k < 0) {
+ return LONG2FIX(0);
+ }
+ if (n <= 0) {
+ return LONG2FIX(!k);
+ }
+ return rb_int_positive_pow(n, (unsigned long)k);
+}
+
+/*
+ * call-seq:
+ * ary.repeated_permutation(n) {|p| block} -> ary
+ * ary.repeated_permutation(n) -> Enumerator
+ *
+ * When invoked with a block, yield all repeated permutations of length +n+ of
+ * the elements of the array, then return the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2]
+ * a.repeated_permutation(1).to_a #=> [[1], [2]]
+ * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
+ * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
+ */
+
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+ long r, n, i;
+
+ n = RARRAY_LEN(ary); /* Array length */
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size); /* Return Enumerator if no block */
+ r = NUM2LONG(num); /* Permutation size from argument */
+
+ if (r < 0) {
+ /* no permutations: yield nothing */
+ }
+ else if (r == 0) { /* exactly one permutation: the zero-length array */
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (r == 1) { /* this is a special, easy case */
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
+ }
+ else { /* this is the general case */
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, r);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
+
+ rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
+ return ary;
+}
+
+static void
+rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
+{
+ long i = 0, index = 0;
+
+ p[index] = i;
+ for (;;) {
+ if (++index < r-1) {
+ p[index] = i;
+ continue;
+ }
+ for (; i < n; ++i) {
+ p[index] = i;
+ if (!yield_indexed_values(values, r, p)) {
+ rb_raise(rb_eRuntimeError, "repeated combination reentered");
+ }
+ }
+ do {
+ if (index <= 0) return;
+ } while ((i = ++p[--index]) >= n);
+ }
+}
+
+static VALUE
+rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+ long n = RARRAY_LEN(ary);
+ long k = NUM2LONG(RARRAY_AREF(args, 0));
+ if (k == 0) {
+ return LONG2FIX(1);
+ }
+ return binomial_coefficient(k, n + k - 1);
+}
+
+/*
+ * call-seq:
+ * ary.repeated_combination(n) {|c| block} -> ary
+ * ary.repeated_combination(n) -> Enumerator
+ *
+ * When invoked with a block, yields all repeated combinations of length +n+ of
+ * elements from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ * a = [1, 2, 3]
+ * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
+ * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
+ *
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+ long n, i, len;
+
+ n = NUM2LONG(num); /* Combination size from argument */
+ RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size); /* Return enumerator if no block */
+ len = RARRAY_LEN(ary);
+ if (n < 0) {
+ /* yield nothing */
+ }
+ else if (n == 0) {
+ rb_yield(rb_ary_new2(0));
+ }
+ else if (n == 1) {
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+ }
+ }
+ else if (len == 0) {
+ /* yield nothing */
+ }
+ else {
+ volatile VALUE t0;
+ long *p = ALLOCV_N(long, t0, n);
+ VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+ RBASIC_CLEAR_CLASS(ary0);
+
+ rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+ ALLOCV_END(t0);
+ RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+ }
+ return ary;
+}
+
+/*
+ * call-seq:
+ * ary.product(other_ary, ...) -> new_ary
+ * ary.product(other_ary, ...) {|p| block} -> ary
+ *
+ * Returns an array of all combinations of elements from all arrays.
+ *
+ * The length of the returned array is the product of the length of +self+ and
+ * the argument arrays.
+ *
+ * If given a block, #product will yield all combinations and return +self+
+ * instead.
+ *
+ * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
+ * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ * [1,2].product() #=> [[1],[2]]
+ * [1,2].product([]) #=> []
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+ int n = argc+1; /* How many arrays we're operating on */
+ volatile VALUE t0 = tmpary(n);
+ volatile VALUE t1 = Qundef;
+ VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+ int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
+ VALUE result = Qnil; /* The array we'll be returning, when no block given */
+ long i,j;
+ long resultlen = 1;
+
+ RBASIC_CLEAR_CLASS(t0);
+
+ /* initialize the arrays of arrays */
+ ARY_SET_LEN(t0, n);
+ arrays[0] = ary;
+ for (i = 1; i < n; i++) arrays[i] = Qnil;
+ for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+ /* initialize the counters for the arrays */
+ for (i = 0; i < n; i++) counters[i] = 0;
+
+ /* Otherwise, allocate and fill in an array of results */
+ if (rb_block_given_p()) {
+ /* Make defensive copies of arrays; exit if any is empty */
+ for (i = 0; i < n; i++) {
+ if (RARRAY_LEN(arrays[i]) == 0) goto done;
+ arrays[i] = ary_make_shared_copy(arrays[i]);
+ }
+ }
+ else {
+ /* Compute the length of the result array; return [] if any is empty */
+ for (i = 0; i < n; i++) {
+ long k = RARRAY_LEN(arrays[i]);
+ if (k == 0) {
+ result = rb_ary_new2(0);
+ goto done;
+ }
+ if (MUL_OVERFLOW_LONG_P(resultlen, k))
+ rb_raise(rb_eRangeError, "too big to product");
+ resultlen *= k;
+ }
+ result = rb_ary_new2(resultlen);
+ }
+ for (;;) {
+ int m;
+ /* fill in one subarray */
+ VALUE subarray = rb_ary_new2(n);
+ for (j = 0; j < n; j++) {
+ rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+ }
+
+ /* put it on the result array */
+ if (NIL_P(result)) {
+ FL_SET(t0, FL_USER5);
+ rb_yield(subarray);
+ if (! FL_TEST(t0, FL_USER5)) {
+ rb_raise(rb_eRuntimeError, "product reentered");
+ }
+ else {
+ FL_UNSET(t0, FL_USER5);
+ }
+ }
+ else {
+ rb_ary_push(result, subarray);
+ }
+
+ /*
+ * Increment the last counter. If it overflows, reset to 0
+ * and increment the one before it.
+ */
+ m = n-1;
+ counters[m]++;
+ while (counters[m] == RARRAY_LEN(arrays[m])) {
+ counters[m] = 0;
+ /* If the first counter overflows, we are done */
+ if (--m < 0) goto done;
+ counters[m]++;
+ }
+ }
+done:
+ tmpary_discard(t0);
+ ALLOCV_END(t1);
+
+ return NIL_P(result) ? ary : result;
+}
+
+/*
+ * call-seq:
+ * ary.take(n) -> new_ary
+ *
+ * Returns first +n+ elements from the array.
+ *
+ * If a negative number is given, raises an ArgumentError.
+ *
+ * See also Array#drop
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.take(3) #=> [1, 2, 3]
+ *
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+ long len = NUM2LONG(n);
+ if (len < 0) {
+ rb_raise(rb_eArgError, "attempt to take negative size");
+ }
+ return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ * call-seq:
+ * ary.take_while {|obj| block} -> new_ary
+ * ary.take_while -> Enumerator
+ *
+ * Passes elements to the block until the block returns +nil+ or +false+, then
+ * stops iterating and returns an array of all prior elements.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * See also Array#drop_while
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.take_while {|i| i < 3} #=> [1, 2]
+ *
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+ long i;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+ }
+ return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ * call-seq:
+ * ary.drop(n) -> new_ary
+ *
+ * Drops first +n+ elements from +ary+ and returns the rest of the elements in
+ * an array.
+ *
+ * If a negative number is given, raises an ArgumentError.
+ *
+ * See also Array#take
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.drop(3) #=> [4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+ VALUE result;
+ long pos = NUM2LONG(n);
+ if (pos < 0) {
+ rb_raise(rb_eArgError, "attempt to drop negative size");
+ }
+
+ result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+ if (result == Qnil) result = rb_ary_new();
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.drop_while {|obj| block} -> new_ary
+ * ary.drop_while -> Enumerator
+ *
+ * Drops elements up to, but not including, the first element for which the
+ * block returns +nil+ or +false+ and returns an array containing the
+ * remaining elements.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * See also Array#take_while
+ *
+ * a = [1, 2, 3, 4, 5, 0]
+ * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+ long i;
+
+ RETURN_ENUMERATOR(ary, 0, 0);
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+ }
+ return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+/*
+ * call-seq:
+ * ary.any? [{|obj| block} ] -> true or false
+ * ary.any?(pattern) -> true or false
+ *
+ * See also Enumerable#any?
+ */
+
+static VALUE
+rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qfalse;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+ }
+ }
+ return Qfalse;
+}
+
+/*
+ * call-seq:
+ * ary.all? [{|obj| block} ] -> true or false
+ * ary.all?(pattern) -> true or false
+ *
+ * See also Enumerable#all?
+ */
+
+static VALUE
+rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * ary.none? [{|obj| block} ] -> true or false
+ * ary.none?(pattern) -> true or false
+ *
+ * See also Enumerable#none?
+ */
+
+static VALUE
+rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qtrue;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
+ }
+ }
+ return Qtrue;
+}
+
+/*
+ * call-seq:
+ * ary.one? [{|obj| block} ] -> true or false
+ * ary.one?(pattern) -> true or false
+ *
+ * See also Enumerable#one?
+ */
+
+static VALUE
+rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
+{
+ long i, len = RARRAY_LEN(ary);
+ VALUE result = Qfalse;
+
+ rb_check_arity(argc, 0, 1);
+ if (!len) return Qfalse;
+ if (argc) {
+ if (rb_block_given_p()) {
+ rb_warn("given block not used");
+ }
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else if (!rb_block_given_p()) {
+ for (i = 0; i < len; ++i) {
+ if (RTEST(RARRAY_AREF(ary, i))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ else {
+ for (i = 0; i < RARRAY_LEN(ary); ++i) {
+ if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+ if (result) return Qfalse;
+ result = Qtrue;
+ }
+ }
+ }
+ return result;
+}
+
+/*
+ * call-seq:
+ * ary.dig(idx, ...) -> object
+ *
+ * Extracts the nested value specified by the sequence of <i>idx</i>
+ * objects by calling +dig+ at each step, returning +nil+ if any
+ * intermediate step is +nil+.
+ *
+ * a = [[1, [2, 3]]]
+ *
+ * a.dig(0, 1, 1) #=> 3
+ * a.dig(1, 2, 3) #=> nil
+ * a.dig(0, 0, 0) #=> TypeError: Integer does not have #dig method
+ * [42, {foo: :bar}].dig(1, :foo) #=> :bar
+ */
+
+static VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+ rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+ self = rb_ary_at(self, *argv);
+ if (!--argc) return self;
+ ++argv;
+ return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+static inline VALUE
+finish_exact_sum(long n, VALUE r, VALUE v, int z)
+{
+ if (n != 0)
+ v = rb_fix_plus(LONG2FIX(n), v);
+ if (r != Qundef) {
+ /* r can be an Integer when mathn is loaded */
+ if (FIXNUM_P(r))
+ v = rb_fix_plus(r, v);
+ else if (RB_TYPE_P(r, T_BIGNUM))
+ v = rb_big_plus(r, v);
+ else
+ v = rb_rational_plus(r, v);
+ }
+ else if (!n && z) {
+ v = rb_fix_plus(LONG2FIX(0), v);
+ }
+ return v;
+}
+
+/*
+ * call-seq:
+ * ary.sum(init=0) -> number
+ * ary.sum(init=0) {|e| expr } -> number
+ *
+ * Returns the sum of elements.
+ * For example, [e1, e2, e3].sum returns init + e1 + e2 + e3.
+ *
+ * If a block is given, the block is applied to each element
+ * before addition.
+ *
+ * If <i>ary</i> is empty, it returns <i>init</i>.
+ *
+ * [].sum #=> 0
+ * [].sum(0.0) #=> 0.0
+ * [1, 2, 3].sum #=> 6
+ * [3, 5.5].sum #=> 8.5
+ * [2.5, 3.0].sum(0.0) {|e| e * e } #=> 15.25
+ * [Object.new].sum #=> TypeError
+ *
+ * The (arithmetic) mean value of an array can be obtained as follows.
+ *
+ * mean = ary.sum(0.0) / ary.length
+ *
+ * This method can be used for non-numeric objects by
+ * explicit <i>init</i> argument.
+ *
+ * ["a", "b", "c"].sum("") #=> "abc"
+ * [[1], [[2]], [3]].sum([]) #=> [1, [2], 3]
+ *
+ * However, Array#join and Array#flatten is faster than Array#sum for
+ * array of strings and array of arrays.
+ *
+ * ["a", "b", "c"].join #=> "abc"
+ * [[1], [[2]], [3]].flatten(1) #=> [1, [2], 3]
+ *
+ *
+ * Array#sum method may not respect method redefinition of "+" methods
+ * such as Integer#+.
+ *
+ */
+
+static VALUE
+rb_ary_sum(int argc, VALUE *argv, VALUE ary)
+{
+ VALUE e, v, r;
+ long i, n;
+ int block_given;
+
+ v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
+
+ block_given = rb_block_given_p();
+
+ if (RARRAY_LEN(ary) == 0)
+ return v;
+
+ n = 0;
+ r = Qundef;
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ if (FIXNUM_P(e)) {
+ n += FIX2LONG(e); /* should not overflow long type */
+ if (!FIXABLE(n)) {
+ v = rb_big_plus(LONG2NUM(n), v);
+ n = 0;
+ }
+ }
+ else if (RB_TYPE_P(e, T_BIGNUM))
+ v = rb_big_plus(e, v);
+ else if (RB_TYPE_P(e, T_RATIONAL)) {
+ if (r == Qundef)
+ r = e;
+ else
+ r = rb_rational_plus(r, e);
+ }
+ else
+ goto not_exact;
+ }
+ v = finish_exact_sum(n, r, v, argc!=0);
+ return v;
+
+ not_exact:
+ v = finish_exact_sum(n, r, v, i!=0);
+
+ if (RB_FLOAT_TYPE_P(e)) {
+ /*
+ * Kahan-Babuska balancing compensated summation algorithm
+ * See http://link.springer.com/article/10.1007/s00607-005-0139-x
+ */
+ double f, c;
+ double x, t;
+
+ f = NUM2DBL(v);
+ c = 0.0;
+ goto has_float_value;
+ for (; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ if (RB_FLOAT_TYPE_P(e))
+ has_float_value:
+ x = RFLOAT_VALUE(e);
+ else if (FIXNUM_P(e))
+ x = FIX2LONG(e);
+ else if (RB_TYPE_P(e, T_BIGNUM))
+ x = rb_big2dbl(e);
+ else if (RB_TYPE_P(e, T_RATIONAL))
+ x = rb_num2dbl(e);
+ else
+ goto not_float;
+
+ if (isnan(f)) continue;
+ if (isnan(x)) {
+ f = x;
+ continue;
+ }
+ if (isinf(x)) {
+ if (isinf(f) && signbit(x) != signbit(f))
+ f = NAN;
+ else
+ f = x;
+ continue;
+ }
+ if (isinf(f)) continue;
+
+ t = f + x;
+ if (fabs(f) >= fabs(x))
+ c += ((f - t) + x);
+ else
+ c += ((x - t) + f);
+ f = t;
+ }
+ f += c;
+ return DBL2NUM(f);
+
+ not_float:
+ v = DBL2NUM(f);
+ }
+
+ goto has_some_value;
+ for (; i < RARRAY_LEN(ary); i++) {
+ e = RARRAY_AREF(ary, i);
+ if (block_given)
+ e = rb_yield(e);
+ has_some_value:
+ v = rb_funcall(v, idPLUS, 1, e);
+ }
+ return v;
+}
+
+static VALUE
+rb_ary_deconstruct(VALUE ary)
+{
+ return ary;
+}
+
+/*
+ * Arrays are ordered, integer-indexed collections of any object.
+ *
+ * Array indexing starts at 0, as in C or Java. A negative index is assumed
+ * to be relative to the end of the array---that is, an index of -1 indicates
+ * the last element of the array, -2 is the next to last element in the
+ * array, and so on.
+ *
+ * == Creating Arrays
+ *
+ * A new array can be created by using the literal constructor
+ * <code>[]</code>. Arrays can contain different types of objects. For
+ * example, the array below contains an Integer, a String and a Float:
+ *
+ * ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ *
+ * An array can also be created by explicitly calling Array.new with zero, one
+ * (the initial size of the Array) or two arguments (the initial size and a
+ * default object).
+ *
+ * ary = Array.new #=> []
+ * Array.new(3) #=> [nil, nil, nil]
+ * Array.new(3, true) #=> [true, true, true]
+ *
+ * Note that the second argument populates the array with references to the
+ * same object. Therefore, it is only recommended in cases when you need to
+ * instantiate arrays with natively immutable objects such as Symbols,
+ * numbers, true or false.
+ *
+ * To create an array with separate objects a block can be passed instead.
+ * This method is safe to use with mutable objects such as hashes, strings or
+ * other arrays:
+ *
+ * Array.new(4) {Hash.new} #=> [{}, {}, {}, {}]
+ * Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
+ *
+ * This is also a quick way to build up multi-dimensional arrays:
+ *
+ * empty_table = Array.new(3) {Array.new(3)}
+ * #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ * An array can also be created by using the Array() method, provided by
+ * Kernel, which tries to call #to_ary, then #to_a on its argument.
+ *
+ * Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ *
+ * == Example Usage
+ *
+ * In addition to the methods it mixes in through the Enumerable module, the
+ * Array class has proprietary methods for accessing, searching and otherwise
+ * manipulating arrays.
+ *
+ * Some of the more common ones are illustrated below.
+ *
+ * == Accessing Elements
+ *
+ * Elements in an array can be retrieved using the Array#[] method. It can
+ * take a single integer argument (a numeric index), a pair of arguments
+ * (start and length) or a range. Negative indices start counting from the end,
+ * with -1 being the last element.
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr[2] #=> 3
+ * arr[100] #=> nil
+ * arr[-3] #=> 4
+ * arr[2, 3] #=> [3, 4, 5]
+ * arr[1..4] #=> [2, 3, 4, 5]
+ * arr[1..-3] #=> [2, 3, 4]
+ *
+ * Another way to access a particular array element is by using the #at method
+ *
+ * arr.at(0) #=> 1
+ *
+ * The #slice method works in an identical manner to Array#[].
+ *
+ * To raise an error for indices outside of the array bounds or else to
+ * provide a default value when that happens, you can use #fetch.
+ *
+ * arr = ['a', 'b', 'c', 'd', 'e', 'f']
+ * arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
+ * arr.fetch(100, "oops") #=> "oops"
+ *
+ * The special methods #first and #last will return the first and last
+ * elements of an array, respectively.
+ *
+ * arr.first #=> 1
+ * arr.last #=> 6
+ *
+ * To return the first +n+ elements of an array, use #take
+ *
+ * arr.take(3) #=> [1, 2, 3]
+ *
+ * #drop does the opposite of #take, by returning the elements after +n+
+ * elements have been dropped:
+ *
+ * arr.drop(3) #=> [4, 5, 6]
+ *
+ * == Obtaining Information about an Array
+ *
+ * Arrays keep track of their own length at all times. To query an array
+ * about the number of elements it contains, use #length, #count or #size.
+ *
+ * browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
+ * browsers.length #=> 5
+ * browsers.count #=> 5
+ *
+ * To check whether an array contains any elements at all
+ *
+ * browsers.empty? #=> false
+ *
+ * To check whether a particular item is included in the array
+ *
+ * browsers.include?('Konqueror') #=> false
+ *
+ * == Adding Items to Arrays
+ *
+ * Items can be added to the end of an array by using either #push or #<<
+ *
+ * arr = [1, 2, 3, 4]
+ * arr.push(5) #=> [1, 2, 3, 4, 5]
+ * arr << 6 #=> [1, 2, 3, 4, 5, 6]
+ *
+ * #unshift will add a new item to the beginning of an array.
+ *
+ * arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
+ *
+ * With #insert you can add a new element to an array at any position.
+ *
+ * arr.insert(3, 'apple') #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
+ *
+ * Using the #insert method, you can also insert multiple values at once:
+ *
+ * arr.insert(3, 'orange', 'pear', 'grapefruit')
+ * #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
+ *
+ * == Removing Items from an Array
+ *
+ * The method #pop removes the last element in an array and returns it:
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.pop #=> 6
+ * arr #=> [1, 2, 3, 4, 5]
+ *
+ * To retrieve and at the same time remove the first item, use #shift:
+ *
+ * arr.shift #=> 1
+ * arr #=> [2, 3, 4, 5]
+ *
+ * To delete an element at a particular index:
+ *
+ * arr.delete_at(2) #=> 4
+ * arr #=> [2, 3, 5]
+ *
+ * To delete a particular element anywhere in an array, use #delete:
+ *
+ * arr = [1, 2, 2, 3]
+ * arr.delete(2) #=> 2
+ * arr #=> [1,3]
+ *
+ * A useful method if you need to remove +nil+ values from an array is
+ * #compact:
+ *
+ * arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ * arr.compact #=> ['foo', 0, 'bar', 7, 'baz']
+ * arr #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ * arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
+ * arr #=> ['foo', 0, 'bar', 7, 'baz']
+ *
+ * Another common need is to remove duplicate elements from an array.
+ *
+ * It has the non-destructive #uniq, and destructive method #uniq!
+ *
+ * arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
+ * arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
+ *
+ * == Iterating over Arrays
+ *
+ * Like all classes that include the Enumerable module, Array has an each
+ * method, which defines what elements should be iterated over and how. In
+ * case of Array's #each, all elements in the Array instance are yielded to
+ * the supplied block in sequence.
+ *
+ * Note that this operation leaves the array unchanged.
+ *
+ * arr = [1, 2, 3, 4, 5]
+ * arr.each {|a| print a -= 10, " "}
+ * # prints: -9 -8 -7 -6 -5
+ * #=> [1, 2, 3, 4, 5]
+ *
+ * Another sometimes useful iterator is #reverse_each which will iterate over
+ * the elements in the array in reverse order.
+ *
+ * words = %w[first second third fourth fifth sixth]
+ * str = ""
+ * words.reverse_each {|word| str += "#{word} "}
+ * p str #=> "sixth fifth fourth third second first "
+ *
+ * The #map method can be used to create a new array based on the original
+ * array, but with the values modified by the supplied block:
+ *
+ * arr.map {|a| 2*a} #=> [2, 4, 6, 8, 10]
+ * arr #=> [1, 2, 3, 4, 5]
+ * arr.map! {|a| a**2} #=> [1, 4, 9, 16, 25]
+ * arr #=> [1, 4, 9, 16, 25]
+ *
+ * == Selecting Items from an Array
+ *
+ * Elements can be selected from an array according to criteria defined in a
+ * block. The selection can happen in a destructive or a non-destructive
+ * manner. While the destructive operations will modify the array they were
+ * called on, the non-destructive methods usually return a new array with the
+ * selected elements, but leave the original array unchanged.
+ *
+ * === Non-destructive Selection
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.select {|a| a > 3} #=> [4, 5, 6]
+ * arr.reject {|a| a < 3} #=> [3, 4, 5, 6]
+ * arr.drop_while {|a| a < 4} #=> [4, 5, 6]
+ * arr #=> [1, 2, 3, 4, 5, 6]
+ *
+ * === Destructive Selection
+ *
+ * #select! and #reject! are the corresponding destructive methods to #select
+ * and #reject
+ *
+ * Similar to #select vs. #reject, #delete_if and #keep_if have the exact
+ * opposite result when supplied with the same block:
+ *
+ * arr.delete_if {|a| a < 4} #=> [4, 5, 6]
+ * arr #=> [4, 5, 6]
+ *
+ * arr = [1, 2, 3, 4, 5, 6]
+ * arr.keep_if {|a| a < 4} #=> [1, 2, 3]
+ * arr #=> [1, 2, 3]
+ *
*/
void
-Init_Array()
+Init_Array(void)
{
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
+
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
- rb_define_alloc_func(rb_cArray, ary_alloc);
+ rb_define_alloc_func(rb_cArray, empty_ary_alloc);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
+ rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
- rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+ rb_define_alias(rb_cArray, "to_s", "inspect");
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
+ rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
- rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -2993,12 +6946,17 @@ Init_Array()
rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
rb_define_method(rb_cArray, "first", rb_ary_first, -1);
rb_define_method(rb_cArray, "last", rb_ary_last, -1);
- rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
+ rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+ rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
+ rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
+ rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
- rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
- rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
+ rb_define_alias(rb_cArray, "append", "push");
+ rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+ rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+ rb_define_alias(rb_cArray, "prepend", "unshift");
rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
@@ -3006,20 +6964,26 @@ Init_Array()
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
rb_define_alias(rb_cArray, "size", "length");
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
- rb_define_method(rb_cArray, "index", rb_ary_index, 1);
- rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
- rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
- rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
+ rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+ rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+ rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+ rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+ rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+ rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+ rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+ rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
+ rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
+ rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -3047,14 +7011,41 @@ Init_Array()
rb_define_method(rb_cArray, "&", rb_ary_and, 1);
rb_define_method(rb_cArray, "|", rb_ary_or, 1);
+ rb_define_method(rb_cArray, "max", rb_ary_max, -1);
+ rb_define_method(rb_cArray, "min", rb_ary_min, -1);
+ rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
+
rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
- rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
- rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
- rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
-
- id_cmp = rb_intern("<=>");
- inspect_key = rb_intern("__inspect_key__");
+ rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+ rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+ rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+ rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+ rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+ rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
+ rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+ rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+ rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+ rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+ rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+ rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+ rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+ rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+ rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+ rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+ rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
+ rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+ rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
+ rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
+ rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
+ rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
+ rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+ rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
+
+ rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
+
+ id_random = rb_intern("random");
}
diff --git a/ast.c b/ast.c
new file mode 100644
index 0000000000..1133fb8a10
--- /dev/null
+++ b/ast.c
@@ -0,0 +1,691 @@
+/* indent-tabs-mode: nil */
+#include "ruby.h"
+#include "ruby/encoding.h"
+#include "ruby/util.h"
+#include "internal.h"
+#include "node.h"
+#include "vm_core.h"
+#include "iseq.h"
+#include "builtin.h"
+
+static VALUE rb_mAST;
+static VALUE rb_cNode;
+
+struct ASTNodeData {
+ rb_ast_t *ast;
+ NODE *node;
+};
+
+static void
+node_gc_mark(void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ rb_gc_mark((VALUE)data->ast);
+}
+
+static size_t
+node_memsize(const void *ptr)
+{
+ struct ASTNodeData *data = (struct ASTNodeData *)ptr;
+ return rb_ast_memsize(data->ast);
+}
+
+static const rb_data_type_t rb_node_type = {
+ "AST/node",
+ {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
+ 0, 0,
+ RUBY_TYPED_FREE_IMMEDIATELY,
+};
+
+static VALUE rb_ast_node_alloc(VALUE klass);
+
+static void
+setup_node(VALUE obj, rb_ast_t *ast, NODE *node)
+{
+ struct ASTNodeData *data;
+
+ TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
+ data->ast = ast;
+ data->node = node;
+}
+
+static VALUE
+ast_new_internal(rb_ast_t *ast, NODE *node)
+{
+ VALUE obj;
+
+ obj = rb_ast_node_alloc(rb_cNode);
+ setup_node(obj, ast, node);
+
+ return obj;
+}
+
+static VALUE rb_ast_parse_str(VALUE str);
+static VALUE rb_ast_parse_file(VALUE path);
+static VALUE rb_ast_parse_array(VALUE array);
+
+static VALUE
+ast_parse_new(void)
+{
+ return rb_parser_set_context(rb_parser_new(), NULL, 0);
+}
+
+static VALUE
+ast_parse_done(rb_ast_t *ast)
+{
+ if (!ast->body.root) {
+ rb_ast_dispose(ast);
+ rb_exc_raise(GET_EC()->errinfo);
+ }
+
+ return ast_new_internal(ast, (NODE *)ast->body.root);
+}
+
+static VALUE
+ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str)
+{
+ return rb_ast_parse_str(str);
+}
+
+static VALUE
+rb_ast_parse_str(VALUE str)
+{
+ rb_ast_t *ast = 0;
+
+ StringValue(str);
+ ast = rb_parser_compile_string_path(ast_parse_new(), Qnil, str, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path)
+{
+ return rb_ast_parse_file(path);
+}
+
+static VALUE
+rb_ast_parse_file(VALUE path)
+{
+ VALUE f;
+ rb_ast_t *ast = 0;
+ rb_encoding *enc = rb_utf8_encoding();
+
+ FilePathValue(path);
+ f = rb_file_open_str(path, "r");
+ rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
+ ast = rb_parser_compile_file_path(ast_parse_new(), Qnil, f, 1);
+ rb_io_close(f);
+ return ast_parse_done(ast);
+}
+
+static VALUE
+lex_array(VALUE array, int index)
+{
+ VALUE str = rb_ary_entry(array, index);
+ if (!NIL_P(str)) {
+ StringValue(str);
+ if (!rb_enc_asciicompat(rb_enc_get(str))) {
+ rb_raise(rb_eArgError, "invalid source encoding");
+ }
+ }
+ return str;
+}
+
+static VALUE
+rb_ast_parse_array(VALUE array)
+{
+ rb_ast_t *ast = 0;
+
+ array = rb_check_array_type(array);
+ ast = rb_parser_compile_generic(ast_parse_new(), lex_array, Qnil, array, 1);
+ return ast_parse_done(ast);
+}
+
+static VALUE node_children(rb_ast_t*, NODE*);
+
+static VALUE
+node_find(VALUE self, const int node_id)
+{
+ VALUE ary;
+ long i;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ if (nd_node_id(data->node) == node_id) return self;
+
+ ary = node_children(data->ast, data->node);
+
+ for (i = 0; i < RARRAY_LEN(ary); i++) {
+ VALUE child = RARRAY_AREF(ary, i);
+
+ if (CLASS_OF(child) == rb_cNode) {
+ VALUE result = node_find(child, node_id);
+ if (RTEST(result)) return result;
+ }
+ }
+
+ return Qnil;
+}
+
+extern VALUE rb_e_script;
+
+static VALUE
+script_lines(VALUE path)
+{
+ VALUE hash, lines;
+ ID script_lines;
+ CONST_ID(script_lines, "SCRIPT_LINES__");
+ if (!rb_const_defined_at(rb_cObject, script_lines)) return Qnil;
+ hash = rb_const_get_at(rb_cObject, script_lines);
+ if (!RB_TYPE_P(hash, T_HASH)) return Qnil;
+ lines = rb_hash_lookup(hash, path);
+ if (!RB_TYPE_P(lines, T_ARRAY)) return Qnil;
+ return lines;
+}
+
+static VALUE
+ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body)
+{
+ VALUE path, node, lines;
+ int node_id;
+ const rb_iseq_t *iseq = NULL;
+
+ if (rb_obj_is_proc(body)) {
+ iseq = vm_proc_iseq(body);
+
+ if (!rb_obj_is_iseq((VALUE)iseq)) {
+ iseq = NULL;
+ }
+ }
+ else {
+ iseq = rb_method_iseq(body);
+ }
+
+ if (!iseq) return Qnil;
+
+ path = rb_iseq_path(iseq);
+ node_id = iseq->body->location.node_id;
+ if (!NIL_P(lines = script_lines(path))) {
+ node = rb_ast_parse_array(lines);
+ }
+ else if (RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0) {
+ node = rb_ast_parse_str(rb_e_script);
+ }
+ else {
+ node = rb_ast_parse_file(path);
+ }
+
+ return node_find(node, node_id);
+}
+
+static VALUE
+rb_ast_node_alloc(VALUE klass)
+{
+ struct ASTNodeData *data;
+ VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
+
+ return obj;
+}
+
+static const char*
+node_type_to_str(const NODE *node)
+{
+ return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
+}
+
+static VALUE
+ast_node_type(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
+}
+
+#define NEW_CHILD(ast, node) node ? ast_new_internal(ast, node) : Qnil
+
+static VALUE
+rb_ary_new_from_node_args(rb_ast_t *ast, long n, ...)
+{
+ va_list ar;
+ VALUE ary;
+ long i;
+
+ ary = rb_ary_new2(n);
+
+ va_start(ar, n);
+ for (i=0; i<n; i++) {
+ NODE *node;
+ node = va_arg(ar, NODE *);
+ rb_ary_push(ary, NEW_CHILD(ast, node));
+ }
+ va_end(ar);
+ return ary;
+}
+
+static VALUE
+dump_block(rb_ast_t *ast, NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ do {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ } while (node->nd_next &&
+ nd_type(node->nd_next) == NODE_BLOCK &&
+ (node = node->nd_next, 1));
+ if (node->nd_next) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+ }
+
+ return ary;
+}
+
+static VALUE
+dump_array(rb_ast_t *ast, NODE *node)
+{
+ VALUE ary = rb_ary_new();
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+
+ while (node->nd_next && nd_type(node->nd_next) == NODE_LIST) {
+ node = node->nd_next;
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
+
+ return ary;
+}
+
+static VALUE
+var_name(ID id)
+{
+ if (!id) return Qnil;
+ if (!rb_id2str(id)) return Qnil;
+ return ID2SYM(id);
+}
+
+static VALUE
+node_children(rb_ast_t *ast, NODE *node)
+{
+ char name[DECIMAL_SIZE_OF_BITS(sizeof(long) * CHAR_BIT) + 2]; /* including '$' */
+
+ enum node_type type = nd_type(node);
+ switch (type) {
+ case NODE_BLOCK:
+ return dump_block(ast, node);
+ case NODE_IF:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_UNLESS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
+ case NODE_CASE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE2:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_CASE3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_WHEN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_IN:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
+ case NODE_WHILE:
+ goto loop;
+ case NODE_UNTIL:
+ loop:
+ return rb_ary_push(rb_ary_new_from_node_args(ast, 2, node->nd_cond, node->nd_body),
+ (node->nd_state ? Qtrue : Qfalse));
+ case NODE_ITER:
+ case NODE_FOR:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_iter, node->nd_body);
+ case NODE_FOR_MASGN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_var);
+ case NODE_BREAK:
+ goto jump;
+ case NODE_NEXT:
+ goto jump;
+ case NODE_RETURN:
+ jump:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_stts);
+ case NODE_REDO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_RETRY:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_BEGIN:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_RESCUE:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_resq, node->nd_else);
+ case NODE_RESBODY:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_args, node->nd_body, node->nd_head);
+ case NODE_ENSURE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_ensr);
+ case NODE_AND:
+ goto andor;
+ case NODE_OR:
+ andor:
+ {
+ VALUE ary = rb_ary_new();
+
+ while (1) {
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_1st));
+ if (!node->nd_2nd || nd_type(node->nd_2nd) != (int)type)
+ break;
+ node = node->nd_2nd;
+ }
+ rb_ary_push(ary, NEW_CHILD(ast, node->nd_2nd));
+ return ary;
+ }
+ case NODE_MASGN:
+ if (NODE_NAMED_REST_P(node->nd_args)) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_value, node->nd_head, node->nd_args);
+ }
+ else {
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_value),
+ NEW_CHILD(ast, node->nd_head),
+ ID2SYM(rb_intern("NODE_SPECIAL_NO_NAME_REST")));
+ }
+ case NODE_LASGN:
+ goto asgn;
+ case NODE_DASGN:
+ goto asgn;
+ case NODE_DASGN_CURR:
+ goto asgn;
+ case NODE_IASGN:
+ goto asgn;
+ case NODE_CVASGN:
+ asgn:
+ if (NODE_REQUIRED_KEYWORD_P(node)) {
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
+ }
+ return rb_ary_new_from_args(2, var_name(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ case NODE_GASGN:
+ goto asgn;
+ case NODE_CDECL:
+ if (node->nd_vid) {
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_vid), NEW_CHILD(ast, node->nd_value));
+ }
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_else), ID2SYM(node->nd_else->nd_mid), NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN1:
+ return rb_ary_new_from_args(4, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args->nd_head),
+ NEW_CHILD(ast, node->nd_args->nd_body));
+ case NODE_OP_ASGN2:
+ return rb_ary_new_from_args(4, NEW_CHILD(ast, node->nd_recv),
+ node->nd_next->nd_aid ? Qtrue : Qfalse,
+ ID2SYM(node->nd_next->nd_vid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_AND:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idANDOP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_ASGN_OR:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idOROP),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_OP_CDECL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head),
+ ID2SYM(node->nd_aid),
+ NEW_CHILD(ast, node->nd_value));
+ case NODE_CALL:
+ case NODE_OPCALL:
+ case NODE_QCALL:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv),
+ ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_FCALL:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid),
+ NEW_CHILD(ast, node->nd_args));
+ case NODE_VCALL:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_SUPER:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_args);
+ case NODE_ZSUPER:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_LIST:
+ goto ary;
+ case NODE_VALUES:
+ ary:
+ return dump_array(ast, node);
+ case NODE_ZLIST:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_HASH:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_YIELD:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_LVAR:
+ case NODE_DVAR:
+ return rb_ary_new_from_args(1, var_name(node->nd_vid));
+ case NODE_IVAR:
+ case NODE_CONST:
+ case NODE_CVAR:
+ case NODE_GVAR:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_vid));
+ case NODE_NTH_REF:
+ snprintf(name, sizeof(name), "$%ld", node->nd_nth);
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_BACK_REF:
+ name[0] = '$';
+ name[1] = (char)node->nd_nth;
+ name[2] = '\0';
+ return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
+ case NODE_MATCH:
+ goto lit;
+ case NODE_MATCH2:
+ if (node->nd_args) {
+ return rb_ary_new_from_node_args(ast, 3, node->nd_recv, node->nd_value, node->nd_args);
+ }
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_MATCH3:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
+ case NODE_LIT:
+ goto lit;
+ case NODE_STR:
+ goto lit;
+ case NODE_XSTR:
+ lit:
+ return rb_ary_new_from_args(1, node->nd_lit);
+ case NODE_ONCE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_DSTR:
+ goto dlit;
+ case NODE_DXSTR:
+ goto dlit;
+ case NODE_DREGX:
+ goto dlit;
+ case NODE_DSYM:
+ dlit:
+ return rb_ary_new_from_args(3, node->nd_lit,
+ NEW_CHILD(ast, node->nd_next->nd_head),
+ NEW_CHILD(ast, node->nd_next->nd_next));
+ case NODE_EVSTR:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ARGSCAT:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_ARGSPUSH:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_SPLAT:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_BLOCK_PASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
+ case NODE_DEFN:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_DEFS:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
+ case NODE_ALIAS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ case NODE_VALIAS:
+ return rb_ary_new_from_args(2, ID2SYM(node->nd_alias), ID2SYM(node->nd_orig));
+ case NODE_UNDEF:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_undef);
+ case NODE_CLASS:
+ return rb_ary_new_from_node_args(ast, 3, node->nd_cpath, node->nd_super, node->nd_body);
+ case NODE_MODULE:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_cpath, node->nd_body);
+ case NODE_SCLASS:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_body);
+ case NODE_COLON2:
+ return rb_ary_new_from_args(2, NEW_CHILD(ast, node->nd_head), ID2SYM(node->nd_mid));
+ case NODE_COLON3:
+ return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
+ case NODE_DOT2:
+ goto dot;
+ case NODE_DOT3:
+ goto dot;
+ case NODE_FLIP2:
+ goto dot;
+ case NODE_FLIP3:
+ dot:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_beg, node->nd_end);
+ case NODE_SELF:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_NIL:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_TRUE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_FALSE:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_ERRINFO:
+ return rb_ary_new_from_node_args(ast, 0);
+ case NODE_DEFINED:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_head);
+ case NODE_POSTEXE:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_ATTRASGN:
+ return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_args));
+ case NODE_LAMBDA:
+ return rb_ary_new_from_node_args(ast, 1, node->nd_body);
+ case NODE_OPT_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_KW_ARG:
+ return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
+ case NODE_POSTARG:
+ if (NODE_NAMED_REST_P(node->nd_1st)) {
+ return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
+ }
+ return rb_ary_new_from_args(2, ID2SYM(rb_intern("NODE_SPECIAL_NO_NAME_REST")),
+ NEW_CHILD(ast, node->nd_2nd));
+ case NODE_ARGS:
+ {
+ struct rb_args_info *ainfo = node->nd_ainfo;
+ return rb_ary_new_from_args(10,
+ INT2NUM(ainfo->pre_args_num),
+ NEW_CHILD(ast, ainfo->pre_init),
+ NEW_CHILD(ast, ainfo->opt_args),
+ var_name(ainfo->first_post_arg),
+ INT2NUM(ainfo->post_args_num),
+ NEW_CHILD(ast, ainfo->post_init),
+ var_name(ainfo->rest_arg),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_args)),
+ (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_rest_arg)),
+ var_name(ainfo->block_arg));
+ }
+ case NODE_SCOPE:
+ {
+ ID *tbl = node->nd_tbl;
+ int i, size = tbl ? (int)*tbl++ : 0;
+ VALUE locals = rb_ary_new_capa(size);
+ for (i = 0; i < size; i++) {
+ rb_ary_push(locals, var_name(tbl[i]));
+ }
+ return rb_ary_new_from_args(3, locals, NEW_CHILD(ast, node->nd_args), NEW_CHILD(ast, node->nd_body));
+ }
+ case NODE_ARYPTN:
+ {
+ struct rb_ary_pattern_info *apinfo = node->nd_apinfo;
+ VALUE rest = NODE_NAMED_REST_P(apinfo->rest_arg) ? NEW_CHILD(ast, apinfo->rest_arg) :
+ ID2SYM(rb_intern("NODE_SPECIAL_NO_NAME_REST"));
+ return rb_ary_new_from_args(4,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, apinfo->pre_args),
+ rest,
+ NEW_CHILD(ast, apinfo->post_args));
+ }
+ case NODE_HSHPTN:
+ {
+ VALUE kwrest = node->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
+ NEW_CHILD(ast, node->nd_pkwrestarg);
+
+ return rb_ary_new_from_args(3,
+ NEW_CHILD(ast, node->nd_pconst),
+ NEW_CHILD(ast, node->nd_pkwargs),
+ kwrest);
+ }
+ case NODE_ARGS_AUX:
+ case NODE_LAST:
+ break;
+ }
+
+ rb_bug("node_children: unknown node: %s", ruby_node_name(type));
+}
+
+static VALUE
+ast_node_children(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return node_children(data->ast, data->node);
+}
+
+static VALUE
+ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_lineno(data->node));
+}
+
+static VALUE
+ast_node_first_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_first_column(data->node));
+}
+
+static VALUE
+ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_lineno(data->node));
+}
+
+static VALUE
+ast_node_last_column(rb_execution_context_t *ec, VALUE self)
+{
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ return INT2NUM(nd_last_column(data->node));
+}
+
+static VALUE
+ast_node_inspect(rb_execution_context_t *ec, VALUE self)
+{
+ VALUE str;
+ VALUE cname;
+ struct ASTNodeData *data;
+ TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
+
+ cname = rb_class_path(rb_obj_class(self));
+ str = rb_str_new2("#<");
+
+ rb_str_append(str, cname);
+ rb_str_catf(str, ":%s@%d:%d-%d:%d>",
+ node_type_to_str(data->node),
+ nd_first_lineno(data->node), nd_first_column(data->node),
+ nd_last_lineno(data->node), nd_last_column(data->node));
+
+ return str;
+}
+
+#include "ast.rbinc"
+
+void
+Init_ast(void)
+{
+ rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
+ rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
+ rb_undef_alloc_func(rb_cNode);
+
+ load_ast();
+}
diff --git a/ast.rb b/ast.rb
new file mode 100644
index 0000000000..1fedf76649
--- /dev/null
+++ b/ast.rb
@@ -0,0 +1,144 @@
+# for ast.c
+
+class RubyVM
+
+ # AbstractSyntaxTree provides methods to parse Ruby code into
+ # abstract syntax trees. The nodes in the tree
+ # are instances of RubyVM::AbstractSyntaxTree::Node.
+ #
+ # This class is MRI specific as it exposes implementation details
+ # of the MRI abstract syntax tree.
+ #
+ # This class is experimental and its API is not stable, therefore it might
+ # change without notice. As examples, the order of children nodes is not
+ # guaranteed, the number of children nodes might change, there is no way to
+ # access children nodes by name, etc.
+ #
+ # If you are looking for a stable API or an API working under multiple Ruby
+ # implementations, consider using the _parser_ gem or Ripper. If you would
+ # like to make RubyVM::AbstractSyntaxTree stable, please join the discussion
+ # at https://bugs.ruby-lang.org/issues/14844.
+ #
+ module AbstractSyntaxTree
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse(string) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Parses the given _string_ into an abstract syntax tree,
+ # returning the root node of that tree.
+ #
+ # SyntaxError is raised if the given _string_ is invalid syntax.
+ #
+ # RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
+ def self.parse string
+ __builtin_ast_s_parse string
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.parse_file(pathname) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Reads the file from _pathname_, then parses it like ::parse,
+ # returning the root node of the abstract syntax tree.
+ #
+ # SyntaxError is raised if _pathname_'s contents are not
+ # valid Ruby syntax.
+ #
+ # RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
+ def self.parse_file pathname
+ __builtin_ast_s_parse_file pathname
+ end
+
+ # call-seq:
+ # RubyVM::AbstractSyntaxTree.of(proc) -> RubyVM::AbstractSyntaxTree::Node
+ # RubyVM::AbstractSyntaxTree.of(method) -> RubyVM::AbstractSyntaxTree::Node
+ #
+ # Returns AST nodes of the given _proc_ or _method_.
+ #
+ # RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
+ #
+ # def hello
+ # puts "hello, world"
+ # end
+ #
+ # RubyVM::AbstractSyntaxTree.of(method(:hello))
+ # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
+ def self.of body
+ __builtin_ast_s_of body
+ end
+
+ # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
+ # RubyVM::AbstractSyntaxTree.
+ #
+ # This class is MRI specific.
+ #
+ class Node
+
+ # call-seq:
+ # node.type -> symbol
+ #
+ # Returns the type of this node as a symbol.
+ #
+ # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
+ # root.type # => :SCOPE
+ # call = root.children[2]
+ # call.type # => :OPCALL
+ def type
+ __builtin_ast_node_type
+ end
+
+ # call-seq:
+ # node.first_lineno -> integer
+ #
+ # The line number in the source code where this AST's text began.
+ def first_lineno
+ __builtin_ast_node_first_lineno
+ end
+
+ # call-seq:
+ # node.first_column -> integer
+ #
+ # The column number in the source code where this AST's text began.
+ def first_column
+ __builtin_ast_node_first_column
+ end
+
+ # call-seq:
+ # node.last_lineno -> integer
+ #
+ # The line number in the source code where this AST's text ended.
+ def last_lineno
+ __builtin_ast_node_last_lineno
+ end
+
+ # call-seq:
+ # node.last_column -> integer
+ #
+ # The column number in the source code where this AST's text ended.
+ def last_column
+ __builtin_ast_node_last_column
+ end
+
+ # call-seq:
+ # node.children -> array
+ #
+ # Returns AST nodes under this one. Each kind of node
+ # has different children, depending on what kind of node it is.
+ #
+ # The returned array may contain other nodes or <code>nil</code>.
+ def children
+ __builtin_ast_node_children
+ end
+
+ # call-seq:
+ # node.inspect -> string
+ #
+ # Returns debugging information about this node as a string.
+ def inspect
+ __builtin_ast_node_inspect
+ end
+ end
+ end
+end
diff --git a/basictest/runner.rb b/basictest/runner.rb
new file mode 100755
index 0000000000..0f398e7acc
--- /dev/null
+++ b/basictest/runner.rb
@@ -0,0 +1,33 @@
+#! ./miniruby
+
+exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
+ruby = ENV["RUBY"]
+unless ruby
+ load './rbconfig.rb'
+ ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
+end
+unless File.exist? ruby
+ print "#{ruby} is not found.\n"
+ print "Try `make' first, then `make test', please.\n"
+ exit false
+end
+ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
+
+$stderr.reopen($stdout)
+error = ''
+
+srcdir = File.expand_path('..', File.dirname(__FILE__))
+if env = ENV["RUBYOPT"]
+ ENV["RUBYOPT"] = env + " -W1"
+end
+`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
+ if line =~ /^end of test/
+ print "\ntest succeeded\n"
+ exit true
+ end
+ error << line if %r:^(basictest/test.rb|not): =~ line
+end
+puts
+print error
+print "test failed\n"
+exit false
diff --git a/basictest/test.rb b/basictest/test.rb
new file mode 100755
index 0000000000..25a4298234
--- /dev/null
+++ b/basictest/test.rb
@@ -0,0 +1,2360 @@
+#! /usr/bin/env ruby
+# -*- coding: us-ascii -*-
+
+$testnum=0
+$ntest=0
+$failed = 0
+class Progress
+ def initialize
+ @color = nil
+ @tty = nil
+ @quiet = nil
+ @verbose = nil
+ ARGV.each do |arg|
+ case arg
+ when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+ warn "unknown --color argument: #$3" if $3
+ @color = $1 ? nil : !$2
+ when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+ warn "unknown --tty argument: #$3" if $3
+ @tty = !$1 || !$2
+ true
+ when /\A-(q|-quiet)\z/
+ @quiet = true
+ when /\A-(v|-verbose)\z/
+ @verbose = true
+ end
+ end
+ @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
+ @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
+ case @color
+ when nil
+ @color = @tty
+ end
+ if @color
+ # dircolors-like style
+ colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+ begin
+ File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+ colors[n] ||= c
+ end
+ rescue
+ end
+ @passed = "\e[;#{colors["pass"] || "32"}m"
+ @failed = "\e[;#{colors["fail"] || "31"}m"
+ @reset = "\e[m"
+ else
+ @passed = @failed = @reset = ""
+ end
+ extend(Rotator) if @tty
+ end
+
+ def passed_string
+ "."
+ end
+ def failed_string
+ "#{@failed}F#{@reset}"
+ end
+ def init_string
+ end
+ def finish_string
+ if @quiet
+ @eol
+ else
+ "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
+ end
+ end
+ def pass
+ STDERR.print passed_string
+ end
+ def fail
+ @ok = false
+ STDERR.print failed_string
+ end
+ def init
+ @ok = true
+ STDERR.print init_string
+ end
+ def finish
+ STDERR.print finish_string
+ end
+
+ module Rotator
+ ROTATOR = %w[- \\ | /]
+ BS = "\b" * ROTATOR[0].size
+ def passed_string
+ "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
+ end
+ def failed_string
+ "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
+ end
+ def init_string
+ @count = 0
+ " "
+ end
+ def finish_string
+ s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
+ s.gsub!(/\n/, "\r\e[2K\r") if @quiet
+ s
+ end
+ end
+end
+PROGRESS = Progress.new
+
+def test_check(what)
+ unless $ntest.zero?
+ PROGRESS.finish
+ end
+ STDERR.print "#{$0}:#{what} "
+ PROGRESS.init
+ $what = what
+ $testnum = 0
+end
+
+def test_ok(cond,n=1)
+ $testnum+=1
+ $ntest+=1
+ where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
+ if cond
+ PROGRESS.pass
+ printf "ok %d (%s)\n", $testnum, where
+ else
+ PROGRESS.fail
+ printf "not ok %s %d -- %s\n", $what, $testnum, where
+ $failed+=1
+ end
+ STDOUT.flush
+ STDERR.flush
+end
+
+# make sure conditional operators work
+
+test_check "assignment"
+
+a=[]; a[0] ||= "bar";
+test_ok(a[0] == "bar")
+h={}; h["foo"] ||= "bar";
+test_ok(h["foo"] == "bar")
+
+aa = 5
+aa ||= 25
+test_ok(aa == 5)
+bb ||= 25
+test_ok(bb == 25)
+cc &&=33
+test_ok(cc == nil)
+cc = 5
+cc &&=44
+test_ok(cc == 44)
+
+a = nil; test_ok(a == nil)
+a = 1; test_ok(a == 1)
+a = []; test_ok(a == [])
+a = [1]; test_ok(a == [1])
+a = [nil]; test_ok(a == [nil])
+a = [[]]; test_ok(a == [[]])
+a = [1,2]; test_ok(a == [1,2])
+a = [*[]]; test_ok(a == [])
+a = [*[1]]; test_ok(a == [1])
+a = [*[1,2]]; test_ok(a == [1,2])
+
+a = *[]; test_ok(a == [])
+a = *[1]; test_ok(a == [1])
+a = *[nil]; test_ok(a == [nil])
+a = *[[]]; test_ok(a == [[]])
+a = *[1,2]; test_ok(a == [1,2])
+a = *[*[]]; test_ok(a == [])
+a = *[*[1]]; test_ok(a == [1])
+a = *[*[1,2]]; test_ok(a == [1,2])
+
+a, = nil; test_ok(a == nil)
+a, = 1; test_ok(a == 1)
+a, = []; test_ok(a == nil)
+a, = [1]; test_ok(a == 1)
+a, = [nil]; test_ok(a == nil)
+a, = [[]]; test_ok(a == [])
+a, = 1,2; test_ok(a == 1)
+a, = [1,2]; test_ok(a == 1)
+a, = [*[]]; test_ok(a == nil)
+a, = [*[1]]; test_ok(a == 1)
+a, = *[1,2]; test_ok(a == 1)
+a, = [*[1,2]]; test_ok(a == 1)
+
+a, = *[]; test_ok(a == nil)
+a, = *[1]; test_ok(a == 1)
+a, = *[nil]; test_ok(a == nil)
+a, = *[[]]; test_ok(a == [])
+a, = *[1,2]; test_ok(a == 1)
+a, = *[*[]]; test_ok(a == nil)
+a, = *[*[1]]; test_ok(a == 1)
+a, = *[*[1,2]]; test_ok(a == 1)
+
+*a = nil; test_ok(a == [nil])
+*a = 1; test_ok(a == [1])
+*a = []; test_ok(a == [])
+*a = [1]; test_ok(a == [1])
+*a = [nil]; test_ok(a == [nil])
+*a = [[]]; test_ok(a == [[]])
+*a = [1,2]; test_ok(a == [1,2])
+*a = [*[]]; test_ok(a == [])
+*a = [*[1]]; test_ok(a == [1])
+*a = [*[1,2]]; test_ok(a == [1,2])
+
+*a = *[]; test_ok(a == [])
+*a = *[1]; test_ok(a == [1])
+*a = *[nil]; test_ok(a == [nil])
+*a = *[[]]; test_ok(a == [[]])
+*a = *[1,2]; test_ok(a == [1,2])
+*a = *[*[]]; test_ok(a == [])
+*a = *[*[1]]; test_ok(a == [1])
+*a = *[*[1,2]]; test_ok(a == [1,2])
+
+a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
+
+def f; yield nil; end; f {|a| test_ok(a == nil)}
+def f; yield 1; end; f {|a| test_ok(a == 1)}
+def f; yield []; end; f {|a| test_ok(a == [])}
+def f; yield [1]; end; f {|a| test_ok(a == [1])}
+def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
+def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
+def f; yield [*[]]; end; f {|a| test_ok(a == [])}
+def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
+def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
+def f; yield *[]; end; f {|a| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a| test_ok(a == [])}
+def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
+
+def f; yield; end; f {|a,| test_ok(a == nil)}
+def f; yield nil; end; f {|a,| test_ok(a == nil)}
+def f; yield 1; end; f {|a,| test_ok(a == 1)}
+def f; yield []; end; f {|a,| test_ok(a == nil)}
+def f; yield [1]; end; f {|a,| test_ok(a == 1)}
+def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield [[]]; end; f {|a,| test_ok(a == [])}
+def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield *[]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
+def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
+def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
+
+def f; yield; end; f {|*a| test_ok(a == [])}
+def f; yield nil; end; f {|*a| test_ok(a == [nil])}
+def f; yield 1; end; f {|*a| test_ok(a == [1])}
+def f; yield []; end; f {|*a| test_ok(a == [[]])}
+def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
+def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
+def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
+def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
+def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
+
+def f; yield *[]; end; f {|*a| test_ok(a == [])}
+def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
+def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
+def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
+def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
+def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
+
+def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
+def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
+def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
+def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
+
+def r; return; end; a = r(); test_ok(a == nil)
+def r; return nil; end; a = r(); test_ok(a == nil)
+def r; return 1; end; a = r(); test_ok(a == 1)
+def r; return []; end; a = r(); test_ok(a == [])
+def r; return [1]; end; a = r(); test_ok(a == [1])
+def r; return [nil]; end; a = r(); test_ok(a == [nil])
+def r; return [[]]; end; a = r(); test_ok(a == [[]])
+def r; return [*[]]; end; a = r(); test_ok(a == [])
+def r; return [*[1]]; end; a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; a = r(); test_ok(a == [])
+def r; return *[1]; end; a = r(); test_ok(a == [1])
+def r; return *[nil]; end; a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; a = r(); test_ok(a == [[]])
+def r; return *[*[]]; end; a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
+def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
+
+def r; return; end; *a = r(); test_ok(a == [nil])
+def r; return nil; end; *a = r(); test_ok(a == [nil])
+def r; return 1; end; *a = r(); test_ok(a == [1])
+def r; return []; end; *a = r(); test_ok(a == [])
+def r; return [1]; end; *a = r(); test_ok(a == [1])
+def r; return [nil]; end; *a = r(); test_ok(a == [nil])
+def r; return [[]]; end; *a = r(); test_ok(a == [[]])
+def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return [*[]]; end; *a = r(); test_ok(a == [])
+def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[]; end; *a = r(); test_ok(a == [])
+def r; return *[1]; end; *a = r(); test_ok(a == [1])
+def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
+def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
+def r; return *[*[]]; end; *a = r(); test_ok(a == [])
+def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
+def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
+
+def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
+def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
+def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
+
+def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
+def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
+def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
+def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
+
+f = lambda {|r,| test_ok([] == r)}
+f.call([], *[])
+
+f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
+f.call([], *[1])
+
+f = lambda{|x| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|x,| x}
+test_ok(f.call(42) == 42)
+test_ok(f.call([42]) == [42])
+test_ok(f.call([[42]]) == [[42]])
+test_ok(f.call([42,55]) == [42,55])
+
+f = lambda{|*x| x}
+test_ok(f.call(42) == [42])
+test_ok(f.call([42]) == [[42]])
+test_ok(f.call([[42]]) == [[[42]]])
+test_ok(f.call([42,55]) == [[42,55]])
+test_ok(f.call(42,55) == [42,55])
+
+f = lambda { |a, b=42, *c| [a,b,c] }
+test_ok(f.call(1 ) == [1,42,[ ]] )
+test_ok(f.call(1,43 ) == [1,43,[ ]] )
+test_ok(f.call(1,43,44) == [1,43,[44]] )
+
+f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
+test_ok(f.call(8 ) == [8,24,[ ],nil] )
+test_ok(f.call(8,43 ) == [8,43,[ ],nil] )
+test_ok(f.call(8,43,44) == [8,43,[44],nil] )
+test_ok(f.call(8 ){45} == [8,24,[ ],45 ] )
+test_ok(f.call(8,43 ){45} == [8,43,[ ],45 ] )
+test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
+
+f = lambda { |a, b=42, *c, d| [a,b,c,d] }
+test_ok(f.call(1 ,99) == [1,42,[ ],99] )
+test_ok(f.call(1,43 ,99) == [1,43,[ ],99] )
+test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
+
+f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
+test_ok(f.call(8 ) == [8,24,nil] )
+test_ok(f.call(8,43) == [8,43,nil] )
+test_ok(f.call(8,43) == [8,43,nil] )
+test_ok(f.call(8 ){45} == [8,24,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+test_ok(f.call(8,43){45} == [8,43,45 ] )
+
+f = lambda { |a, b=42, d| [a,b,d] }
+test_ok(f.call(1 ,99) == [1,42,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+test_ok(f.call(1,43,99) == [1,43,99] )
+
+f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
+test_ok(f.call( ) == [42,[ ],nil] )
+test_ok(f.call(43 ) == [43,[ ],nil] )
+test_ok(f.call(43,44) == [43,[44],nil] )
+test_ok(f.call( ){45} == [42,[ ],45 ] )
+test_ok(f.call(43 ){45} == [43,[ ],45 ] )
+test_ok(f.call(43,44){45} == [43,[44],45 ] )
+
+f = lambda { |b=42, *c, d| [b,c,d] }
+test_ok(f.call( 99) == [42,[ ],99] )
+test_ok(f.call(43 ,99) == [43,[ ],99] )
+test_ok(f.call(43,44,99) == [43,[44],99] )
+
+f = lambda { |b=42, &block| [b,block&&block[]] }
+test_ok(f.call( ) == [42,nil] )
+test_ok(f.call(43) == [43,nil] )
+test_ok(f.call(43) == [43,nil] )
+test_ok(f.call( ){45} == [42,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+test_ok(f.call(43){45} == [43,45 ] )
+
+f = lambda { |b=42, d| [b,d] }
+test_ok(f.call( 99) == [42,99] )
+test_ok(f.call(43,99) == [43,99] )
+test_ok(f.call(43,99) == [43,99] )
+
+
+a,=*[1]
+test_ok(a == 1)
+a,=*[[1]]
+test_ok(a == [1])
+a,=*[[[1]]]
+test_ok(a == [[1]])
+
+x, (y, z) = 1, 2, 3
+test_ok([1,2,nil] == [x,y,z])
+x, (y, z) = 1, [2,3]
+test_ok([1,2,3] == [x,y,z])
+x, (y, z) = 1, [2]
+test_ok([1,2,nil] == [x,y,z])
+
+a = loop do break; end; test_ok(a == nil)
+a = loop do break nil; end; test_ok(a == nil)
+a = loop do break 1; end; test_ok(a == 1)
+a = loop do break []; end; test_ok(a == [])
+a = loop do break [1]; end; test_ok(a == [1])
+a = loop do break [nil]; end; test_ok(a == [nil])
+a = loop do break [[]]; end; test_ok(a == [[]])
+a = loop do break [*[]]; end; test_ok(a == [])
+a = loop do break [*[1]]; end; test_ok(a == [1])
+a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+a = loop do break *[]; end; test_ok(a == [])
+a = loop do break *[1]; end; test_ok(a == [1])
+a = loop do break *[nil]; end; test_ok(a == [nil])
+a = loop do break *[[]]; end; test_ok(a == [[]])
+a = loop do break *[*[]]; end; test_ok(a == [])
+a = loop do break *[*[1]]; end; test_ok(a == [1])
+a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break; end; test_ok(a == [nil])
+*a = loop do break nil; end; test_ok(a == [nil])
+*a = loop do break 1; end; test_ok(a == [1])
+*a = loop do break []; end; test_ok(a == [])
+*a = loop do break [1]; end; test_ok(a == [1])
+*a = loop do break [nil]; end; test_ok(a == [nil])
+*a = loop do break [[]]; end; test_ok(a == [[]])
+*a = loop do break [1,2]; end; test_ok(a == [1,2])
+*a = loop do break [*[]]; end; test_ok(a == [])
+*a = loop do break [*[1]]; end; test_ok(a == [1])
+*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
+
+*a = loop do break *[]; end; test_ok(a == [])
+*a = loop do break *[1]; end; test_ok(a == [1])
+*a = loop do break *[nil]; end; test_ok(a == [nil])
+*a = loop do break *[[]]; end; test_ok(a == [[]])
+*a = loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = loop do break *[*[]]; end; test_ok(a == [])
+*a = loop do break *[*[1]]; end; test_ok(a == [1])
+*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+*a = *loop do break *[[]]; end; test_ok(a == [[]])
+*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
+*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
+
+a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
+a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
+a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
+a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
+a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
+
+def r(val); a = yield(); test_ok(a == val, 2); end
+r(nil){next}
+r(nil){next nil}
+r(1){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+r([]){next *[]}
+r([1]){next *[1]}
+r([nil]){next *[nil]}
+r([[]]){next *[[]]}
+r([]){next *[*[]]}
+r([1]){next *[*[1]]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); *a = yield(); test_ok(a == val, 2); end
+r([nil]){next}
+r([nil]){next nil}
+r([1]){next 1}
+r([]){next []}
+r([1]){next [1]}
+r([nil]){next [nil]}
+r([[]]){next [[]]}
+r([1,2]){next [1,2]}
+r([]){next [*[]]}
+r([1]){next [*[1]]}
+r([1,2]){next [*[1,2]]}
+
+def r(val); *a = *yield(); test_ok(a == val, 2); end
+r([[]]){next *[[]]}
+r([1,2]){next *[1,2]}
+r([1,2]){next *[*[1,2]]}
+
+def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
+r([nil,nil,[]]){next}
+r([nil,nil,[]]){next nil}
+r([1,nil,[]]){next 1}
+r([nil,nil,[]]){next []}
+r([1,nil,[]]){next [1]}
+r([nil,nil,[]]){next [nil]}
+r([[],nil,[]]){next [[]]}
+r([1,2,[]]){next [1,2]}
+r([nil,nil,[]]){next [*[]]}
+r([1,nil,[]]){next [*[1]]}
+r([1,2,[]]){next [*[1,2]]}
+
+def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
+r([[],nil,[]]){next *[[]]}
+r([1,2,[]]){next *[1,2]}
+r([1,2,[]]){next *[*[1,2]]}
+
+test_check "condition"
+
+$x = '0';
+
+$x == $x && test_ok(true)
+$x != $x && test_ok(false)
+$x == $x || test_ok(false)
+$x != $x || test_ok(true)
+
+# first test to see if we can run the tests.
+
+test_check "if/unless";
+
+$x = 'test';
+test_ok(if $x == $x then true else false end)
+$bad = false
+unless $x == $x
+ $bad = true
+end
+test_ok(!$bad)
+test_ok(unless $x != $x then true else false end)
+
+test_check "case"
+
+case 5
+when 1, 2, 3, 4, 6, 7, 8
+ test_ok(false)
+when 5
+ test_ok(true)
+end
+
+case 5
+when 5
+ test_ok(true)
+when 1..10
+ test_ok(false)
+end
+
+case 5
+when 1..10
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+case 5
+when 5
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+case "foobar"
+when /^f.*r$/
+ test_ok(true)
+else
+ test_ok(false)
+end
+
+test_check "while/until";
+
+while_tmp = "while_tmp.#{$$}"
+tmp = open(while_tmp, "w")
+tmp.print "tvi925\n";
+tmp.print "tvi920\n";
+tmp.print "vt100\n";
+tmp.print "Amiga\n";
+tmp.print "paper\n";
+tmp.close
+
+# test break
+
+tmp = open(while_tmp, "r")
+test_ok(tmp.kind_of?(File))
+
+while line = tmp.gets()
+ break if /vt100/ =~ line
+end
+
+test_ok(!tmp.eof? && /vt100/ =~ line)
+tmp.close
+
+# test next
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ next if /vt100/ =~ line
+ $bad = 1 if /vt100/ =~ line
+end
+test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
+tmp.close
+
+# test redo
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ lastline = line
+ line = line.gsub(/vt100/, 'VT100')
+ if lastline != line
+ line.gsub!('VT100', 'Vt100')
+ redo
+ end
+ $bad = 1 if /vt100/ =~ line
+ $bad = 1 if /VT100/ =~ line
+end
+test_ok(tmp.eof? && !$bad)
+tmp.close
+
+sum=0
+for i in 1..10
+ sum += i
+ i -= 1
+ if i > 0
+ redo
+ end
+end
+test_ok(sum == 220)
+
+# test interval
+$bad = false
+tmp = open(while_tmp, "r")
+while line = tmp.gets()
+ break if 3
+ case line
+ when /vt100/, /Amiga/, /paper/
+ $bad = true
+ end
+end
+test_ok(!$bad)
+tmp.close
+
+File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
+test_ok(!File.exist?(while_tmp))
+
+i = 0
+until i>4
+ i+=1
+end
+test_ok(i>4)
+
+
+# exception handling
+test_check "exception";
+
+begin
+ raise "this must be handled"
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+$bad = true
+begin
+ raise "this must be handled no.2"
+rescue
+ if $bad
+ $bad = false
+ retry
+ test_ok(false)
+ end
+end
+test_ok(true)
+
+# exception in rescue clause
+$string = "this must be handled no.3"
+begin
+ begin
+ raise "exception in rescue clause"
+ rescue
+ raise $string
+ end
+ test_ok(false)
+rescue => e
+ test_ok($! == e)
+ test_ok(e.message == $string)
+ test_ok(e != $string)
+end
+
+# exception in ensure clause
+begin
+ begin
+ raise "this must be handled no.4"
+ ensure
+ raise "exception in ensure clause"
+ end
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+$bad = true
+begin
+ begin
+ raise "this must be handled no.5"
+ ensure
+ $bad = false
+ end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+begin
+ begin
+ raise "this must be handled no.6"
+ ensure
+ $bad = false
+ end
+rescue
+end
+test_ok(!$bad)
+
+$bad = true
+while true
+ begin
+ break
+ ensure
+ $bad = false
+ end
+end
+test_ok(!$bad)
+
+test_ok(catch(:foo) {
+ loop do
+ loop do
+ throw :foo, true
+ break
+ end
+ break
+ test_ok(false) # should not reach here
+ end
+ false
+ })
+
+test_check "array"
+test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
+test_ok([1, 2] * 2 == [1, 2, 1, 2])
+test_ok([1, 2] * ":" == "1:2")
+
+test_ok([1, 2].hash == [1, 2].hash)
+
+test_ok([1,2,3] & [2,3,4] == [2,3])
+test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
+test_ok([1,2,3] - [2,3] == [1])
+
+$x = [0, 1, 2, 3, 4, 5]
+test_ok($x[2] == 2)
+test_ok($x[1..3] == [1, 2, 3])
+test_ok($x[1,3] == [1, 2, 3])
+
+$x[0, 2] = 10
+test_ok($x[0] == 10 && $x[1] == 2)
+
+$x[0, 0] = -1
+test_ok($x[0] == -1 && $x[1] == 10)
+
+$x[-1, 1] = 20
+test_ok($x[-1] == 20 && $x.pop == 20)
+
+# array and/or
+test_ok(([1,2,3]&[2,4,6]) == [2])
+test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
+
+# compact
+$x = [nil, 1, nil, nil, 5, nil, nil]
+$x.compact!
+test_ok($x == [1, 5])
+
+# uniq
+$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
+$x.uniq!
+test_ok($x == [1, 4, 2, 5])
+
+# empty?
+test_ok(!$x.empty?)
+$x = []
+test_ok($x.empty?)
+
+# sort
+$x = ["it", "came", "to", "pass", "that", "..."]
+$x = $x.sort.join(" ")
+test_ok($x == "... came it pass that to")
+$x = [2,5,3,1,7]
+$x.sort!{|a,b| a<=>b} # sort with condition
+test_ok($x == [1,2,3,5,7])
+$x.sort!{|a,b| b-a} # reverse sort
+test_ok($x == [7,5,3,2,1])
+
+# split test
+$x = "The Book of Mormon"
+test_ok($x.split(//).reverse!.join == $x.reverse)
+test_ok($x.reverse == $x.reverse!)
+test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
+$x = "a b c d"
+test_ok($x.split == ['a', 'b', 'c', 'd'])
+test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
+test_ok(defined? "a".chomp)
+test_ok("abc".scan(/./) == ["a", "b", "c"])
+test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
+# non-greedy match
+test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
+
+$x = [1]
+test_ok(($x * 5).join(":") == '1:1:1:1:1')
+test_ok(($x * 1).join(":") == '1')
+test_ok(($x * 0).join(":") == '')
+
+*$x = *(1..7).to_a
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+$x = [1,2,3]
+$x[1,0] = $x
+test_ok($x == [1,1,2,3,2,3])
+
+$x = [1,2,3]
+$x[-1,0] = $x
+test_ok($x == [1,2,1,2,3,3])
+
+$x = [1,2,3]
+$x.concat($x)
+test_ok($x == [1,2,3,1,2,3])
+
+test_check "hash"
+$x = {1=>2, 2=>4, 3=>6}
+
+test_ok($x[1] == 2)
+
+test_ok(begin
+ for k,v in $x
+ raise if k*2 != v
+ end
+ true
+ rescue
+ false
+ end)
+
+test_ok($x.length == 3)
+test_ok($x.has_key?(1))
+test_ok($x.has_value?(4))
+test_ok($x.values_at(2,3) == [4,6])
+test_ok($x == {1=>2, 2=>4, 3=>6})
+
+$z = $x.keys.sort.join(":")
+test_ok($z == "1:2:3")
+
+$z = $x.values.sort.join(":")
+test_ok($z == "2:4:6")
+test_ok($x == $x)
+
+$x.shift
+test_ok($x.length == 2)
+
+$z = [1,2]
+$x[$z] = 256
+test_ok($x[$z] == 256)
+
+$x = Hash.new(0)
+$x[1] = 1
+test_ok($x[1] == 1)
+test_ok($x[2] == 0)
+
+$x = Hash.new([])
+test_ok($x[22] == [])
+test_ok($x[22].equal?($x[22]))
+
+$x = Hash.new{[]}
+test_ok($x[22] == [])
+test_ok(!$x[22].equal?($x[22]))
+
+$x = Hash.new{|h,k| $z = k; h[k] = k*2}
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+$x.default = 5
+test_ok($x[23] == 5)
+
+$x = Hash.new
+def $x.default(k)
+ $z = k
+ self[k] = k*2
+end
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 22)
+$z = 0
+test_ok($x[22] == 44)
+test_ok($z == 0)
+
+test_check "iterator"
+
+# yield at top level
+test_ok(!defined?(yield))
+
+$x = [1, 2, 3, 4]
+$y = []
+
+# iterator over array
+for i in $x
+ $y.push i
+end
+test_ok($x == $y)
+
+# nested iterator
+def tt
+ 1.upto(10) {|i|
+ yield i
+ }
+end
+
+i=0
+tt{|i| break if i == 5}
+test_ok(i == 0)
+
+def tt2(dummy)
+ yield 1
+end
+
+def tt3(&block)
+ tt2(raise(ArgumentError,""),&block)
+end
+
+$x = false
+begin
+ tt3{}
+rescue ArgumentError
+ $x = true
+rescue Exception
+end
+test_ok($x)
+
+def tt4 &block
+ tt2(raise(ArgumentError,""),&block)
+end
+$x = false
+begin
+ tt4{}
+rescue ArgumentError
+ $x = true
+rescue Exception
+end
+test_ok($x)
+
+# iterator break/redo/next/retry
+done = true
+loop{
+ break
+ done = false # should not reach here
+}
+test_ok(done)
+
+done = false
+$bad = false
+loop {
+ break if done
+ done = true
+ next
+ $bad = true # should not reach here
+}
+test_ok(!$bad)
+
+done = false
+$bad = false
+loop {
+ break if done
+ done = true
+ redo
+ $bad = true # should not reach here
+}
+test_ok(!$bad)
+
+$x = []
+for i in 1 .. 7
+ $x.push i
+end
+test_ok($x.size == 7)
+test_ok($x == [1, 2, 3, 4, 5, 6, 7])
+
+# append method to built-in class
+class Array
+ def iter_test1
+ collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
+ end
+ def iter_test2
+ a = collect{|e| [e, yield(e)]}
+ a.sort{|a,b|a[1]<=>b[1]}
+ end
+end
+$x = [[1,2],[3,4],[5,6]]
+test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
+
+class IterTest
+ def initialize(e); @body = e; end
+
+ def each0(&block); @body.each(&block); end
+ def each1(&block); @body.each {|*x| block.call(*x) } end
+ def each2(&block); @body.each {|*x| block.call(x) } end
+ def each3(&block); @body.each {|x| block.call(*x) } end
+ def each4(&block); @body.each {|x| block.call(x) } end
+ def each5; @body.each {|*x| yield(*x) } end
+ def each6; @body.each {|*x| yield(x) } end
+ def each7; @body.each {|x| yield(*x) } end
+ def each8; @body.each {|x| yield(x) } end
+
+ def f(a)
+ a
+ end
+end
+test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
+m = /\w+/.match("abc")
+test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
+
+IterTest.new([0]).each0 {|x| test_ok(x == 0)}
+IterTest.new([1]).each1 {|x| test_ok(x == 1)}
+IterTest.new([2]).each2 {|x| test_ok(x == [2])}
+#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
+IterTest.new([4]).each4 {|x| test_ok(x == 4)}
+IterTest.new([5]).each5 {|x| test_ok(x == 5)}
+IterTest.new([6]).each6 {|x| test_ok(x == [6])}
+#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
+IterTest.new([8]).each8 {|x| test_ok(x == 8)}
+
+IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
+IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
+IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
+IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
+IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
+IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
+IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
+IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
+IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
+
+IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
+IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
+
+def m0(v)
+ v
+end
+
+def m1
+ m0(block_given?)
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+def m
+ m0(block_given?,&Proc.new{})
+end
+test_ok(m1{p 'test'})
+test_ok(!m1)
+
+class C
+ include Enumerable
+ def initialize
+ @a = [1,2,3]
+ end
+ def each(&block)
+ @a.each(&block)
+ end
+end
+
+test_ok(C.new.collect{|n| n} == [1,2,3])
+
+test_ok(Proc == lambda{}.class)
+test_ok(Proc == Proc.new{}.class)
+lambda{|a|test_ok(a==1)}.call(1)
+def block_test(klass, &block)
+ test_ok(klass === block)
+end
+
+block_test(NilClass)
+block_test(Proc){}
+
+def call_argument_test(state, proc, *args)
+ x = state
+ begin
+ proc.call(*args)
+ rescue ArgumentError
+ x = !x
+ end
+ test_ok(x,2)
+end
+
+call_argument_test(true, lambda{||})
+call_argument_test(false, lambda{||}, 1)
+call_argument_test(true, lambda{|a,|}, 1)
+call_argument_test(false, lambda{|a,|})
+call_argument_test(false, lambda{|a,|}, 1,2)
+
+call_argument_test(true, Proc.new{||})
+call_argument_test(true, Proc.new{||}, 1)
+call_argument_test(true, Proc.new{|a,|}, 1)
+call_argument_test(true, Proc.new{|a,|})
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+def block_get(&block)
+ block
+end
+
+test_ok(Proc == block_get{}.class)
+call_argument_test(true, block_get{||})
+call_argument_test(true, block_get{||}, 1)
+call_argument_test(true, block_get{|a,|}, 1)
+call_argument_test(true, block_get{|a,|})
+call_argument_test(true, block_get{|a,|}, 1,2)
+
+call_argument_test(true, block_get(&lambda{||}))
+call_argument_test(false, block_get(&lambda{||}),1)
+call_argument_test(true, block_get(&lambda{|a,|}),1)
+call_argument_test(false, block_get(&lambda{|a,|}),1,2)
+
+blk = block_get{11}
+test_ok(blk.class == Proc)
+test_ok(blk.to_proc.class == Proc)
+test_ok(blk.clone.call == 11)
+test_ok(block_get(&blk).class == Proc)
+
+lmd = lambda{44}
+test_ok(lmd.class == Proc)
+test_ok(lmd.to_proc.class == Proc)
+test_ok(lmd.clone.call == 44)
+test_ok(block_get(&lmd).class == Proc)
+
+test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
+call_argument_test(true, Proc.new{|a,|}, 1,2)
+
+test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
+test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
+
+def test_return1
+ Proc.new {
+ return 55
+ }.yield + 5
+end
+test_ok(test_return1() == 55)
+def test_return2
+ lambda {
+ return 55
+ }.call + 5
+end
+test_ok(test_return2() == 60)
+
+def proc_call(&b)
+ b.call
+end
+def proc_yield()
+ yield
+end
+def proc_return1
+ lambda{return 42}.call+1
+end
+test_ok(proc_return1() == 43)
+def proc_return2
+ ->{return 42}.call+1
+end
+test_ok(proc_return2() == 43)
+def proc_return3
+ proc_call{return 42}+1
+end
+test_ok(proc_return3() == 42)
+def proc_return4
+ proc_yield{return 42}+1
+end
+test_ok(proc_return4() == 42)
+
+def ljump_test(state, proc, *args)
+ x = state
+ begin
+ proc.call(*args)
+ rescue LocalJumpError
+ x = !x
+ end
+ test_ok(x,2)
+end
+
+ljump_test(false, block_get{break})
+ljump_test(true, lambda{break})
+
+def exit_value_test(&block)
+ block.call
+rescue LocalJumpError
+ $!.exit_value
+end
+
+test_ok(45 == exit_value_test{break 45})
+
+test_ok(55 == begin
+ block_get{break 55}.call
+ rescue LocalJumpError
+ $!.exit_value
+ end)
+
+def block_call(&block)
+ block.call
+end
+
+def test_b1
+ block_call{break 11}
+end
+test_ok(test_b1() == 11)
+
+def ljump_rescue(r)
+ begin
+ yield
+ rescue LocalJumpError => e
+ r if /from proc-closure/ =~ e.message
+ end
+end
+
+def test_b2
+ ljump_rescue(22) do
+ block_get{break 21}.call
+ end
+end
+test_ok(test_b2() == 22)
+
+def test_b3
+ ljump_rescue(33) do
+ Proc.new{break 31}.yield
+ end
+end
+test_ok(test_b3() == 33)
+
+def test_b4
+ lambda{break 44}.call
+end
+test_ok(test_b4() == 44)
+
+def test_b5
+ ljump_rescue(55) do
+ b = block_get{break 54}
+ block_call(&b)
+ end
+end
+test_ok(test_b5() == 55)
+
+def test_b6
+ b = lambda{break 67}
+ block_call(&b)
+ 66
+end
+test_ok(test_b6() == 66)
+
+def util_r7
+ block_get{break 78}
+end
+
+def test_b7
+ b = util_r7()
+ ljump_rescue(77) do
+ block_call(&b)
+ end
+end
+test_ok(test_b7() == 77)
+
+def util_b8(&block)
+ block_call(&block)
+end
+
+def test_b8
+ util_b8{break 88}
+end
+test_ok(test_b8() == 88)
+
+def util_b9(&block)
+ lambda{block.call; 98}.call
+end
+
+def test_b9
+ util_b9{break 99}
+end
+test_ok(test_b9() == 99)
+
+def util_b10
+ util_b9{break 100}
+end
+
+def test_b10
+ util_b10()
+end
+test_ok(test_b10() == 100)
+
+def test_b11
+ ljump_rescue(111) do
+ loop do
+ Proc.new{break 110}.yield
+ break 112
+ end
+ end
+end
+test_ok(test_b11() == 111)
+
+def test_b12
+ loop do
+ break lambda{break 122}.call
+ break 121
+ end
+end
+test_ok(test_b12() == 122)
+
+def test_b13
+ ljump_rescue(133) do
+ while true
+ Proc.new{break 130}.yield
+ break 131
+ end
+ end
+end
+test_ok(test_b13() == 133)
+
+def test_b14
+ while true
+ break lambda{break 144}.call
+ break 143
+ end
+end
+test_ok(test_b14() == 144)
+
+def test_b15
+ [0].each {|c| yield 1 }
+ 156
+end
+test_ok(test_b15{|e| break 155 } == 155)
+
+def marity_test(m)
+ method = method(m)
+ test_ok(method.arity == method.to_proc.arity, 2)
+end
+marity_test(:test_ok)
+marity_test(:marity_test)
+marity_test(:p)
+
+lambda(&method(:test_ok)).call(true)
+lambda(&block_get{|a,n| test_ok(a,n)}).call(true, 2)
+
+class ITER_TEST1
+ def a
+ block_given?
+ end
+end
+
+class ITER_TEST2 < ITER_TEST1
+ def a
+ test_ok(super)
+ super
+ end
+end
+test_ok(ITER_TEST2.new.a {})
+
+class ITER_TEST3
+ def foo x
+ return yield if block_given?
+ x
+ end
+end
+
+class ITER_TEST4 < ITER_TEST3
+ def foo x
+ test_ok(super == yield)
+ test_ok(super(x, &nil) == x)
+ end
+end
+
+ITER_TEST4.new.foo(44){55}
+
+class ITER_TEST5
+ def tt(aa)
+ aa
+ end
+
+ def uu(a)
+ class << self
+ define_method(:tt) do |sym|
+ super(sym)
+ end
+ end
+ end
+
+ def xx(*x)
+ x.size
+ end
+end
+
+a = ITER_TEST5.new
+a.uu(12)
+test_ok(a.tt(1) == 1)
+
+class ITER_TEST6 < ITER_TEST5
+ def xx(*a)
+ a << 12
+ super
+ end
+end
+
+test_ok(ITER_TEST6.new.xx([24]) == 2)
+
+test_check "float"
+test_ok(2.6.floor == 2)
+test_ok((-2.6).floor == -3)
+test_ok(2.6.ceil == 3)
+test_ok((-2.6).ceil == -2)
+test_ok(2.6.truncate == 2)
+test_ok((-2.6).truncate == -2)
+test_ok(2.6.round == 3)
+test_ok((-2.4).truncate == -2)
+test_ok((13.4 % 1 - 0.4).abs < 0.0001)
+nan = 0.0/0
+def nan_test(x,y)
+ test_ok(x != y)
+ test_ok((x < y) == false)
+ test_ok((x > y) == false)
+ test_ok((x <= y) == false)
+ test_ok((x >= y) == false)
+end
+nan_test(nan, nan)
+nan_test(nan, 0)
+nan_test(nan, 1)
+nan_test(nan, -1)
+nan_test(nan, 1000)
+nan_test(nan, -1000)
+nan_test(nan, 1_000_000_000_000)
+nan_test(nan, -1_000_000_000_000)
+nan_test(nan, 100.0);
+nan_test(nan, -100.0);
+nan_test(nan, 0.001);
+nan_test(nan, -0.001);
+nan_test(nan, 1.0/0);
+nan_test(nan, -1.0/0);
+
+#s = "3.7517675036461267e+17"
+#test_ok(s == sprintf("%.16e", s.to_f))
+f = 3.7517675036461267e+17
+test_ok(f == sprintf("%.16e", f).to_f)
+
+
+test_check "bignum"
+def fact(n)
+ return 1 if n == 0
+ f = 1
+ while n>0
+ f *= n
+ n -= 1
+ end
+ return f
+end
+$x = fact(40)
+test_ok($x == $x)
+test_ok($x == fact(40))
+test_ok($x < $x+2)
+test_ok($x > $x-2)
+test_ok($x == 815915283247897734345611269596115894272000000000)
+test_ok($x != 815915283247897734345611269596115894272000000001)
+test_ok($x+1 == 815915283247897734345611269596115894272000000001)
+test_ok($x/fact(20) == 335367096786357081410764800000)
+$x = -$x
+test_ok($x == -815915283247897734345611269596115894272000000000)
+test_ok(2-(2**32) == -(2**32-2))
+test_ok(2**32 - 5 == (2**32-3)-2)
+
+$good = true;
+for i in 1000..1014
+ $good = false if ((1 << i) != (2**i))
+end
+test_ok($good)
+
+$good = true;
+n1= 1 << 1000
+for i in 1000..1014
+ $good = false if ((1 << i) != n1)
+ n1 *= 2
+end
+test_ok($good)
+
+$good = true;
+n2=n1
+for i in 1..10
+ n1 = n1 / 2
+ n2 = n2 >> 1
+ $good = false if (n1 != n2)
+end
+test_ok($good)
+
+$good = true;
+for i in 4000..4096
+ n1 = 1 << i;
+ if (n1**2-1) / (n1+1) != (n1-1)
+ $good = false
+ end
+end
+test_ok($good)
+
+b = 10**80
+a = b * 9 + 7
+test_ok(7 == a.modulo(b))
+test_ok(-b + 7 == a.modulo(-b))
+test_ok(b + -7 == (-a).modulo(b))
+test_ok(-7 == (-a).modulo(-b))
+test_ok(7 == a.remainder(b))
+test_ok(7 == a.remainder(-b))
+test_ok(-7 == (-a).remainder(b))
+test_ok(-7 == (-a).remainder(-b))
+
+test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
+test_ok(10**40/10**20 == 100000000000000000000)
+
+a = 677330545177305025495135714080
+b = 14269972710765292560
+test_ok(a % b == 0)
+test_ok(-a % b == 0)
+
+def shift_test(a)
+ b = a / (2 ** 32)
+ c = a >> 32
+ test_ok(b == c)
+
+ b = a * (2 ** 32)
+ c = a << 32
+ test_ok(b == c)
+end
+
+shift_test(-4518325415524767873)
+shift_test(-0xfffffffffffffffff)
+
+test_check "string & char"
+
+test_ok("abcd" == "abcd")
+test_ok("abcd" =~ /abcd/)
+test_ok("abcd" === "abcd")
+# compile time string concatenation
+test_ok("ab" "cd" == "abcd")
+test_ok("#{22}aa" "cd#{44}" == "22aacd44")
+test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
+test_ok("abc" !~ /^$/)
+test_ok("abc\n" !~ /^$/)
+test_ok("abc" !~ /^d*$/)
+test_ok(("abc" =~ /d*$/) == 3)
+test_ok("" =~ /^$/)
+test_ok("\n" =~ /^$/)
+test_ok("a\n\n" =~ /^$/)
+test_ok("abcabc" =~ /.*a/ && $& == "abca")
+test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
+test_ok("abcabc" =~ /.*?a/ && $& == "a")
+test_ok("abcabc" =~ /.*?c/ && $& == "abc")
+test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
+
+test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
+test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
+test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
+
+test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
+
+$x = <<END;
+ABCD
+ABCD
+END
+$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
+test_ok($x == "AC\nAC\n")
+
+test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
+test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
+
+$foo = "abc"
+test_ok("#$foo = abc" == "abc = abc")
+test_ok("#{$foo} = abc" == "abc = abc")
+
+foo = "abc"
+test_ok("#{foo} = abc" == "abc = abc")
+
+test_ok('-' * 5 == '-----')
+test_ok('-' * 1 == '-')
+test_ok('-' * 0 == '')
+
+foo = '-'
+test_ok(foo * 5 == '-----')
+test_ok(foo * 1 == '-')
+test_ok(foo * 0 == '')
+
+$x = "a.gif"
+test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
+test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
+test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
+test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
+
+# character constants(assumes ASCII)
+test_ok("a"[0] == ?a)
+test_ok(?a == ?a)
+test_ok(?\C-a == "\1")
+test_ok(?\M-a == "\341")
+test_ok(?\M-\C-a == "\201")
+test_ok("a".upcase![0] == ?A)
+test_ok("A".downcase![0] == ?a)
+test_ok("abc".tr!("a-z", "A-Z") == "ABC")
+test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
+test_ok("abcc".squeeze!("a-z") == "abc")
+test_ok("abcd".delete!("bc") == "ad")
+
+$x = "abcdef"
+$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
+$bad = false
+$x.each_byte {|i|
+ if i.chr != $y.shift
+ $bad = true
+ break
+ end
+}
+test_ok(!$bad)
+
+s = "a string"
+s[0..s.size]="another string"
+test_ok(s == "another string")
+
+s = <<EOS
+#{
+[1,2,3].join(",")
+}
+EOS
+test_ok(s == "1,2,3\n")
+test_ok("Just".to_i(36) == 926381)
+test_ok("-another".to_i(36) == -23200231779)
+test_ok(1299022.to_s(36) == "ruby")
+test_ok(-1045307475.to_s(36) == "-hacker")
+test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
+test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
+
+a = []
+(0..255).each {|n|
+ ch = [n].pack("C")
+ a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
+}
+test_ok(a.size == 0)
+
+test_check "assignment"
+a = nil
+test_ok(defined?(a))
+test_ok(a == nil)
+
+# multiple assignment
+a, b = 1, 2
+test_ok(a == 1 && b == 2)
+
+a, b = b, a
+test_ok(a == 2 && b == 1)
+
+a, = 1,2
+test_ok(a == 1)
+
+a, *b = 1, 2, 3
+test_ok(a == 1 && b == [2, 3])
+
+a, (b, c), d = 1, [2, 3], 4
+test_ok(a == 1 && b == 2 && c == 3 && d == 4)
+
+*a = 1, 2, 3
+test_ok(a == [1, 2, 3])
+
+*a = 4
+test_ok(a == [4])
+
+*a = nil
+test_ok(a == [nil])
+
+test_check "call"
+def aaa(a, b=100, *rest)
+ res = [a, b]
+ res += rest if rest
+ return res
+end
+
+# not enough argument
+begin
+ aaa() # need at least 1 arg
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+begin
+ aaa # no arg given (exception raised)
+ test_ok(false)
+rescue
+ test_ok(true)
+end
+
+test_ok(aaa(1) == [1, 100])
+test_ok(aaa(1, 2) == [1, 2])
+test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
+test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
+
+test_check "proc"
+$proc = Proc.new{|i| i}
+test_ok($proc.call(2) == 2)
+test_ok($proc.call(3) == 3)
+
+$proc = Proc.new{|i| i*2}
+test_ok($proc.call(2) == 4)
+test_ok($proc.call(3) == 6)
+
+Proc.new{
+ iii=5 # nested local variable
+ $proc = Proc.new{|i|
+ iii = i
+ }
+ $proc2 = Proc.new {
+ $x = iii # nested variables shared by procs
+ }
+ # scope of nested variables
+ test_ok(defined?(iii))
+}.call
+test_ok(!defined?(iii)) # out of scope
+
+loop{iii=5; test_ok(eval("defined? iii")); break}
+loop {
+ iii = 10
+ def dyna_var_check
+ loop {
+ test_ok(!defined?(iii))
+ break
+ }
+ end
+ dyna_var_check
+ break
+}
+$x=0
+$proc.call(5)
+$proc2.call
+test_ok($x == 5)
+
+if defined? Process.kill
+ test_check "signal"
+
+ $x = 0
+ trap "SIGINT", Proc.new{|sig| $x = 2}
+ Process.kill "SIGINT", $$
+ 100.times {
+ sleep 0.1
+ break if $x != 0
+ }
+ test_ok($x == 2)
+
+ trap "SIGINT", Proc.new{raise "Interrupt"}
+
+ x = false
+ begin
+ Process.kill "SIGINT", $$
+ sleep 0.1
+ rescue
+ x = $!
+ end
+ test_ok(x && /Interrupt/ =~ x.message)
+end
+
+test_check "eval"
+test_ok(eval("") == nil)
+$bad=false
+eval 'while false; $bad = true; print "foo\n" end'
+test_ok(!$bad)
+
+test_ok(eval('Object'))
+test_ok(eval('true'))
+test_ok(!eval('nil'))
+test_ok(!eval('false'))
+
+$foo = 'test_ok(true)'
+begin
+ eval $foo
+rescue
+ test_ok(false)
+end
+
+test_ok(eval("$foo") == 'test_ok(true)')
+test_ok(eval("true") == true)
+i = 5
+test_ok(eval("i == 5"))
+test_ok(eval("i") == 5)
+test_ok(eval("defined? i"))
+
+# eval with binding
+def test_ev
+ local1 = "local1"
+ lambda {
+ local2 = "local2"
+ return binding
+ }.call
+end
+
+$x = test_ev
+test_ok(eval("local1", $x) == "local1") # normal local var
+test_ok(eval("local2", $x) == "local2") # nested local var
+$bad = true
+begin
+ p eval("local1")
+rescue NameError # must raise error
+ $bad = false
+end
+test_ok(!$bad)
+
+module EvTest
+ EVTEST1 = 25
+ evtest2 = 125
+ $x = binding
+end
+test_ok(eval("EVTEST1", $x) == 25) # constant in module
+test_ok(eval("evtest2", $x) == 125) # local var in module
+$bad = true
+begin
+ eval("EVTEST1")
+rescue NameError # must raise error
+ $bad = false
+end
+test_ok(!$bad)
+
+x = binding #! YARV Limitation: Proc.new{}
+eval "i4 = 1", x
+test_ok(eval("i4", x) == 1)
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "i4 = 22", x
+test_ok(eval("i4", x) == 22)
+$x = []
+x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+
+x = binding
+eval "i = 1", x
+test_ok(eval("i", x) == 1)
+x = Proc.new{binding}.call
+eval "i = 22", x
+test_ok(eval("i", x) == 22)
+$x = []
+x = Proc.new{binding}.call
+eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
+test_ok($x[4].call == 8)
+x = Proc.new{binding}.call
+eval "for i6 in 1..1; j6=i6; end", x
+test_ok(eval("defined? i6", x))
+test_ok(eval("defined? j6", x))
+
+Proc.new {
+ p = binding
+ eval "foo11 = 1", p
+ foo22 = 5
+ Proc.new{foo11=22}.call
+ Proc.new{foo22=55}.call
+ test_ok(eval("foo11", p) == eval("foo11"))
+ test_ok(eval("foo11") == 1)
+ test_ok(eval("foo22", p) == eval("foo22"))
+ test_ok(eval("foo22") == 55)
+}.call if false #! YARV Limitation
+
+#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+p1 = Proc.new{i7 = 0; binding}.call
+#! YARV Limitation: test_ok(p1.call == 0)
+eval "i7=5", p1
+#! YARV Limitation: test_ok(p1.call == 5)
+test_ok(!defined?(i7))
+
+if false #! YARV Limitation
+p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
+i7 = nil
+test_ok(p1.call == 0)
+eval "i7=1", p1
+test_ok(p1.call == 1)
+eval "i7=5", p1
+test_ok(p1.call == 5)
+test_ok(i7 == nil)
+end
+
+test_check "system"
+test_ok(`echo foobar` == "foobar\n")
+test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
+
+script_tmp = "script_tmp.#{$$}"
+tmp = open(script_tmp, "w")
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
+test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.close
+
+test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
+
+tmp = open(script_tmp, "w")
+tmp.print "this is a leading junk\n";
+tmp.print "#! /usr/local/bin/ruby -s\n";
+tmp.print "print $zzz\n";
+tmp.print "__END__\n";
+tmp.print "this is a trailing junk\n";
+tmp.close
+
+test_ok(`./miniruby -x #{script_tmp}` == '')
+test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
+
+tmp = open(script_tmp, "w")
+for i in 1..5
+ tmp.print i, "\n"
+end
+tmp.close
+
+`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
+done = true
+tmp = open(script_tmp, "r")
+while tmp.gets
+ if $_.to_i % 5 != 0
+ done = false
+ break
+ end
+end
+tmp.close
+test_ok(done)
+
+File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
+File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
+
+test_check "const"
+TEST1 = 1
+TEST2 = 2
+
+module Const
+ TEST3 = 3
+ TEST4 = 4
+end
+
+module Const2
+ TEST3 = 6
+ TEST4 = 8
+end
+
+include Const
+
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
+
+include Const2
+STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
+test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
+
+
+test_ok((String <=> Object) == -1)
+test_ok((Object <=> String) == 1)
+test_ok((Array <=> String) == nil)
+
+test_check "clone"
+foo = Object.new
+def foo.test
+ "test"
+end
+bar = foo.clone
+def bar.test2
+ "test2"
+end
+
+test_ok(bar.test2 == "test2")
+test_ok(bar.test == "test")
+test_ok(foo.test == "test")
+
+begin
+ foo.test2
+ test_ok false
+rescue NoMethodError
+ test_ok true
+end
+
+module M001; end
+module M002; end
+module M003; include M002; end
+module M002; include M001; end
+module M003; include M002; end
+
+test_ok(M003.ancestors == [M003, M002, M001])
+
+test_check "marshal"
+$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
+$y = Marshal.dump($x)
+test_ok($x == Marshal.load($y))
+
+StrClone=String.clone;
+test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
+
+[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
+ a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
+ ma = Marshal.dump(a)
+ b = Marshal.load(ma)
+ test_ok(a == b)
+}
+
+test_check "pack"
+
+$format = "c2x5CCxsdils_l_a6";
+# Need the expression in here to force ary[5] to be numeric. This avoids
+# test2 failing because ary2 goes str->numeric->str and ary does not.
+ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
+$x = ary.pack($format)
+ary2 = $x.unpack($format)
+
+test_ok(ary.length == ary2.length)
+test_ok(ary.join(':') == ary2.join(':'))
+test_ok($x =~ /def/)
+
+$x = [-1073741825]
+test_ok($x.pack("q").unpack("q") == $x)
+
+test_check "math"
+test_ok(Math.sqrt(4) == 2)
+
+include Math
+test_ok(sqrt(4) == 2)
+
+test_check "struct"
+struct_test = Struct.new("Test", :foo, :bar)
+test_ok(struct_test == Struct::Test)
+
+test = struct_test.new(1, 2)
+test_ok(test.foo == 1 && test.bar == 2)
+test_ok(test[0] == 1 && test[1] == 2)
+
+a, b = test.to_a
+test_ok(a == 1 && b == 2)
+
+test[0] = 22
+test_ok(test.foo == 22)
+
+test.bar = 47
+test_ok(test.bar == 47)
+
+test_check "variable"
+test_ok($$.instance_of?(Integer))
+
+# read-only variable
+begin
+ $$ = 5
+ test_ok false
+rescue NameError
+ test_ok true
+end
+
+foobar = "foobar"
+$_ = foobar
+test_ok($_ == foobar)
+
+class Gods
+ @@rule = "Uranus" # private to Gods
+ def ruler0
+ @@rule
+ end
+
+ def self.ruler1 # <= per method definition style
+ @@rule
+ end
+ class << self # <= multiple method definition style
+ def ruler2
+ @@rule
+ end
+ end
+end
+
+module Olympians
+ @@rule ="Zeus"
+ def ruler3
+ @@rule
+ end
+end
+
+class Titans < Gods
+ @@rule = "Cronus" # do not affect @@rule in Gods
+ include Olympians
+ def ruler4
+ @@rule
+ end
+end
+
+test_ok(Gods.new.ruler0 == "Cronus")
+test_ok(Gods.ruler1 == "Cronus")
+test_ok(Gods.ruler2 == "Cronus")
+test_ok(Titans.ruler1 == "Cronus")
+test_ok(Titans.ruler2 == "Cronus")
+atlas = Titans.new
+test_ok(atlas.ruler0 == "Cronus")
+test_ok(atlas.ruler3 == "Zeus")
+test_ok(atlas.ruler4 == "Cronus")
+
+test_check "trace"
+$x = 1234
+$y = 0
+trace_var :$x, Proc.new{$y = $x}
+$x = 40414
+test_ok($y == $x)
+
+untrace_var :$x
+$x = 19660208
+test_ok($y != $x)
+
+trace_var :$x, Proc.new{$x *= 2}
+$x = 5
+test_ok($x == 10)
+
+untrace_var :$x
+
+test_check "defined?"
+
+test_ok(defined?($x)) # global variable
+test_ok(defined?($x) == 'global-variable')# returns description
+
+foo=5
+test_ok(defined?(foo)) # local variable
+
+test_ok(defined?(Array)) # constant
+test_ok(defined?(Object.new)) # method
+test_ok(!defined?(Object.print))# private method
+test_ok(defined?(1 == 2)) # operator expression
+
+class Foo
+ def foo
+ p :foo
+ end
+ protected :foo
+ def bar(f)
+ test_ok(defined?(self.foo))
+ test_ok(defined?(f.foo))
+ end
+end
+f = Foo.new
+test_ok(defined?(f.foo) == nil)
+f.bar(f)
+
+def defined_test
+ return !defined?(yield)
+end
+
+test_ok(defined_test) # not iterator
+test_ok(!defined_test{}) # called as iterator
+
+test_check "alias"
+class Alias0
+ def foo; "foo" end
+end
+class Alias1 < Alias0
+ alias bar foo
+ def foo; "foo+" + super end
+end
+class Alias2 < Alias1
+ alias baz foo
+ undef foo
+end
+
+x = Alias2.new
+test_ok(x.bar == "foo")
+test_ok(x.baz == "foo+foo")
+
+# test_check for cache
+test_ok(x.baz == "foo+foo")
+
+class Alias3 < Alias2
+ def foo
+ defined? super
+ end
+ def bar
+ defined? super
+ end
+ def quux
+ defined? super
+ end
+end
+x = Alias3.new
+test_ok(!x.foo)
+test_ok(x.bar)
+test_ok(!x.quux)
+
+test_check "path"
+test_ok(File.basename("a") == "a")
+test_ok(File.basename("a/b") == "b")
+test_ok(File.basename("a/b/") == "b")
+test_ok(File.basename("/") == "/")
+test_ok(File.basename("//") == "/")
+test_ok(File.basename("///") == "/")
+test_ok(File.basename("a/b////") == "b")
+test_ok(File.basename("a.rb", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".rb") == "a")
+test_ok(File.basename("a.rb///", ".*") == "a")
+test_ok(File.basename("a.rb///", ".c") == "a.rb")
+test_ok(File.dirname("a") == ".")
+test_ok(File.dirname("/") == "/")
+test_ok(File.dirname("/a") == "/")
+test_ok(File.dirname("a/b") == "a")
+test_ok(File.dirname("a/b/c") == "a/b")
+test_ok(File.dirname("/a/b/c") == "/a/b")
+test_ok(File.dirname("/a/b/") == "/a")
+test_ok(File.dirname("/a/b///") == "/a")
+case Dir.pwd
+when %r'\A\w:'
+ test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
+ test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
+ dosish = true
+when %r'\A//'
+ test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
+ test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
+ dosish = true
+else
+ test_ok(File.expand_path(".", "/") == "/")
+ test_ok(File.expand_path("sub", "/") == "/sub")
+end
+if dosish
+ test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
+ test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
+ test_ok(File.expand_path("/", "z:/sub") == "z:/")
+ test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
+end
+test_ok(File.expand_path(".", "//") == "//")
+test_ok(File.expand_path("sub", "//") == "//sub")
+
+# test_check "Proc#binding"
+ObjectSpace.each_object(Proc){|o|
+ begin
+ b = o.binding
+ eval 'self', b
+ rescue ArgumentError
+ end
+}
+
+test_check "gc"
+begin
+ 1.upto(10000) {
+ tmp = [0,1,2,3,4,5,6,7,8,9]
+ }
+ tmp = nil
+ test_ok true
+rescue
+ test_ok false
+end
+class S
+ def initialize(a)
+ @a = a
+ end
+end
+l=nil
+100000.times {
+ l = S.new(l)
+}
+GC.start
+test_ok true # reach here or dumps core
+l = []
+100000.times {
+ l.push([l])
+}
+GC.start
+test_ok true # reach here or dumps core
+
+ObjectSpace.each_object{|o|
+ o.class.name
+}
+
+test_ok true # reach here or dumps core
+
+PROGRESS.finish
+if $failed > 0
+ printf "not ok/test: %d failed %d\n", $ntest, $failed
+else
+ printf "end of test(test: %d)\n", $ntest
+end
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
deleted file mode 100644
index de7a2beeb8..0000000000
--- a/bcc32/Makefile.sub
+++ /dev/null
@@ -1,490 +0,0 @@
-# -*- makefile -*-
-
-SHELL = $(COMSPEC)
-MKFILES = Makefile
-
-#### Start of system configuration section. ####
-OS = bccwin32
-RT = $(OS)
-
-## variables may be overridden by $(compile_dir)/Makefile
-!ifndef srcdir
-srcdir = ..
-!endif
-!ifndef RUBY_INSTALL_NAME
-RUBY_INSTALL_NAME = ruby
-!endif
-!ifndef RUBYW_INSTALL_NAME
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!endif
-!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
-!endif
-!ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
-!endif
-!ifndef icondirs
-!ifdef ICONDIRS
-icondirs=$(ICONDIRS)
-!endif
-!endif
-!ifdef icondirs
-icondirs=$(icondirs:\=/)
-iconinc=-I$(icondirs: = -I)
-!endif
-###############
-
-VPATH = $(srcdir):$(srcdir)/missing
-.SUFFIXES: .y
-
-!ifndef CC
-CC = bcc32
-!endif
-!ifndef CPP
-CPP = cpp32
-!endif
-!ifndef RC
-RC = brcc32
-!endif
-!ifndef YACC
-YACC = byacc
-!endif
-!ifndef AR
-AR = tlib
-!endif
-
-PURIFY =
-AUTOCONF = autoconf
-RM = $(srcdir:/=\)\win32\rm.bat
-
-!if !defined(PROCESSOR_ARCHITECTURE)
-PROCESSOR_ARCHITECTURE = x86
-!endif
-MACHINE = $(PROCESSOR_ARCHITECTURE)
-!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
-!ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = 5
-!endif
-!if 6 < $(PROCESSOR_LEVEL)
-PROCESSOR_LEVEL = 6
-!endif
-PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
-CPU = i$(PROCESSOR_LEVEL)86
-ARCH = i386
-!else
-CPU = $(PROCESSOR_ARCHITECTURE)
-ARCH = $(PROCESSOR_ARCHITECTURE)
-!endif
-!ifndef DEBUGFLAGS
-DEBUGFLAGS =
-!endif
-!ifndef OPTFLAGS
-OPTFLAGS = -O
-!endif
-
-!ifndef prefix
-prefix = /usr
-!endif
-!ifndef exec_prefix
-exec_prefix = $(prefix)
-!endif
-!ifndef libdir
-libdir = $(exec_prefix)/lib
-!endif
-!if !defined(datadir)
-datadir = /share
-!endif
-!ifndef EXTOUT
-EXTOUT = .ext
-!endif
-!ifndef RIDATADIR
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-!endif
-!ifndef TESTUI
-TESTUI = console
-!endif
-!ifndef TESTS
-TESTS =
-!endif
-!ifndef RDOCTARGET
-RDOCTARGET = install-nodoc
-!endif
-
-OUTFLAG = -o
-!ifndef CFLAGS
-CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-!endif
-!ifndef LDFLAGS
-LDFLAGS = -S:$(STACK)
-!endif
-!ifndef RFLAGS
-RFLAGS = $(iconinc)
-!endif
-!ifndef EXTLIBS
-EXTLIBS =
-!endif
-!ifndef MEMLIB
-MEMLIB =
-!endif
-LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj crypt.obj erf.obj win32.obj
-
-!ifndef STACK
-STACK = 0x2000000
-!endif
-
-XCFLAGS = -DRUBY_EXPORT -I. -I$(srcdir) -I$(srcdir)/missing
-
-ARFLAGS = /a
-LD = ilink32 -q -Gn
-LDSHARED = $(LD)
-XLDFLAGS = -Tpe c0x32.obj
-WLDFLAGS = -aa -Tpe c0w32.obj
-DLDFLAGS = -Tpd c0d32.obj
-LIBRUBY_LDSHARED = $(LDSHARED)
-LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
-LDOBJECTS = $(MAINOBJ)
-
-SOLIBS =
-
-EXEEXT = .exe
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
-RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT)
-RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
-
-ORGLIBPATH = $(LIB)
-
-#### End of system configuration section. ####
-
-LIBRUBY_A = $(RUBY_SO_NAME)-static.lib
-LIBRUBY_SO = $(RUBY_SO_NAME).dll
-LIBRUBY = $(RUBY_SO_NAME).lib
-LIBRUBYARG = $(LIBRUBY)
-
-PREP = miniruby$(EXEEXT)
-
-OBJEXT = obj
-
-WINMAINOBJ = winmain.$(OBJEXT)
-MINIOBJS = dmydln.$(OBJEXT)
-
-.path.c = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.h = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.y = $(srcdir)
-.path. = $(srcdir)
-
-.c.obj:
- $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
-
-.rc.res:
- $(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
-
-.y.c:
- $(YACC) $(YFLAGS) $(<:\=/)
- sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
- @del y.tab.c
-
-all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
-
-ruby: $(PROGRAM)
-rubyw: $(WPROGRAM)
-
-!include $(srcdir)/common.mk
-
-PHONY: Makefile
-
-CONFIG_H = ./.config.h.time
-
-config: config.status
-
-config.status: $(CONFIG_H)
-
-$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
- @$(srcdir:/=\)\win32\ifchange.bat config.h &&|
-\#define HAVE_SYS_TYPES_H 1
-\#define HAVE_SYS_STAT_H 1
-\#define HAVE_STDLIB_H 1
-\#define HAVE_STRING_H 1
-\#define HAVE_MEMORY_H 1
-\#define HAVE_OFF_T 1
-\#define SIZEOF_INT 4
-\#define SIZEOF_SHORT 2
-\#define SIZEOF_LONG 4
-\#define SIZEOF_LONG_LONG 0
-\#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 4
-\#define SIZEOF_VOIDP 4
-\#define SIZEOF_FLOAT 4
-\#define SIZEOF_DOUBLE 8
-\#define SIZEOF_TIME_T 4
-\#define HAVE_PROTOTYPES 1
-\#define TOKEN_PASTE(x,y) x\#\#y
-\#define HAVE_STDARG_PROTOTYPES 1
-\#define NORETURN(x) x
-\#define RUBY_EXTERN extern __declspec(dllimport)
-\#define HAVE_DECL_SYS_NERR 1
-\#define HAVE_LIMITS_H 1
-\#define HAVE_FCNTL_H 1
-\#define HAVE_UTIME_H 1
-\#define HAVE_FLOAT_H 1
-\#define rb_uid_t uid_t
-\#define rb_gid_t gid_t
-\#define rb_pid_t int
-\#define HAVE_STRUCT_STAT_ST_RDEV 1
-\#define HAVE_ST_RDEV 1
-\#define GETGROUPS_T int
-\#define RETSIGTYPE void
-\#define HAVE_ALLOCA 1
-\#define HAVE_DUP2 1
-\#define HAVE_MEMMOVE 1
-\#define HAVE_MKDIR 1
-\#define HAVE_STRCASECMP 1
-\#define HAVE_STRNCASECMP 1
-\#define HAVE_STRERROR 1
-\#define HAVE_STRFTIME 1
-\#define HAVE_STRCHR 1
-\#define HAVE_STRSTR 1
-\#define HAVE_STRTOD 1
-\#define HAVE_STRTOL 1
-\#define HAVE_STRTOUL 1
-\#define HAVE_ISNAN 1
-\#define HAVE_FINITE 1
-\#define HAVE_HYPOT 1
-\#define HAVE_FMOD 1
-\#define HAVE_WAITPID 1
-\#define HAVE_FSYNC 1
-\#define HAVE_GETCWD 1
-\#define HAVE_CHSIZE 1
-\#define HAVE_TIMES 1
-\#define HAVE_FCNTL 1
-\#define HAVE_LINK 1
-\#define HAVE_TELLDIR 1
-\#define HAVE_SEEKDIR 1
-\#define HAVE_COSH 1
-\#define HAVE_SINH 1
-\#define HAVE_TANH 1
-\#define RSHIFT(x,y) ((x)>>(int)y)
-\#define FILE_COUNT level
-\#define FILE_READPTR curp
-\#define inline __inline
-\#define NEED_IO_SEEK_BETWEEN_RW 1
-\#define STACK_GROW_DIRECTION -1
-\#define DEFAULT_KCODE KCODE_NONE
-\#define DLEXT ".so"
-\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
-\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-|
- @exit > $@
-
-config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
- @echo Creating $@
- @type > $@ &&|
-# Generated automatically by Makefile.sub.
-s,@SHELL@,$$(COMSPEC),;t t
-s,@BUILD_FILE_SEPARATOR@,\,;t t
-s,@PATH_SEPARATOR@,;,;t t
-s,@CFLAGS@,$(CFLAGS),;t t
-s,@CPPFLAGS@,$(CPPFLAGS),;t t
-s,@CXXFLAGS@,$(CXXFLAGS),;t t
-s,@FFLAGS@,$(FFLAGS),;t t
-s,@LDFLAGS@,,;t t
-s,@LIBS@,$(LIBS),;t t
-s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,,;t t
-s,@program_transform_name@,s,,,,;t t
-s,@bindir@,$${exec_prefix}/bin,;t t
-s,@sbindir@,$${exec_prefix}/sbin,;t t
-s,@libexecdir@,$${exec_prefix}/libexec,;t t
-s,@datadir@,$${prefix}/share,;t t
-s,@sysconfdir@,$${prefix}/etc,;t t
-s,@sharedstatedir@,/etc,;t t
-s,@localstatedir@,/var,;t t
-s,@libdir@,$${exec_prefix}/lib,;t t
-s,@includedir@,$${prefix}/include,;t t
-s,@oldincludedir@,/usr/include,;t t
-s,@infodir@,$${prefix}/info,;t t
-s,@mandir@,$${prefix}/man,;t t
-s,@build@,$(CPU)-pc-$(OS),;t t
-s,@build_alias@,$(CPU)-$(OS),;t t
-s,@build_cpu@,$(CPU),;t t
-s,@build_vendor@,pc,;t t
-s,@build_os@,$(OS),;t t
-s,@host@,$(CPU)-pc-$(OS),;t t
-s,@host_alias@,$(CPU)-$(OS),;t t
-s,@host_cpu@,$(CPU),;t t
-s,@host_vendor@,pc,;t t
-s,@host_os@,$(OS),;t t
-s,@target@,$(ARCH)-pc-$(OS),;t t
-s,@target_alias@,$(ARCH)-$(OS),;t t
-s,@target_cpu@,$(ARCH),;t t
-s,@target_vendor@,pc,;t t
-s,@target_os@,$(OS),;t t
-s,@CC@,$(CC),;t t
-s,@CPP@,cpp32,;t t
-s,@YACC@,$(YACC),;t t
-s,@RANLIB@,,;t t
-s,@AR@,$(AR),;t t
-s,@ARFLAGS@,$(ARFLAGS) ,;t t
-s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,$(SET_MAKE),;t t
-s,@CP@,copy > nul,;t t
-s,@INSTALL@,copy > nul,;t t
-s,@INSTALL_PROG@,$$(INSTALL),;t t
-s,@INSTALL_DATA@,$$(INSTALL),;t t
-s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
-s,@ALLOCA@,$(ALLOCA),;t t
-s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
-s,@EXEEXT@,.exe,;t t
-s,@OBJEXT@,obj,;t t
-s,@XCFLAGS@,$(XCFLAGS),;t t
-s,@XLDFLAGS@,$(XLDFLAGS),;t t
-s,@DLDFLAGS@,$(DLDFLAGS),;t t
-s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
-s,@STATIC@,$(STATIC),;t t
-s,@CCDLFLAGS@,,;t t
-s,@LDSHARED@,$(LDSHARED),;t t
-s,@DLEXT@,so,;t t
-s,@LIBEXT@,lib,;t t
-s,@STRIP@,$(STRIP),;t t
-s,@EXTSTATIC@,$(EXTSTATIC),;t t
-s,@setup@,Setup,;t t
-s,@MINIRUBY@,$(MINIRUBY),;t t
-s,@PREP@,miniruby$(EXEEXT),;t t
-s,@RUNRUBY@,$(RUNRUBY),;t t
-s,@EXTOUT@,$(EXTOUT),;t t
-s,@ARCHFILE@,,;t t
-s,@RDOCTARGET@,,;t t
-s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
-s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
-s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
-s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
-s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
-s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
-s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
-s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
-s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
-s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
-s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
-s,@SOLIBS@,$(SOLIBS),;t t
-s,@DLDLIBS@,$(DLDLIBS),;t t
-s,@ENABLE_SHARED@,yes,;t t
-s,@OUTFLAG@,$(OUTFLAG),;t t
-s,@CPPOUTFILE@,,;t t
-s,@LIBPATHFLAG@, -L"%s",;t t
-s,@RPATHFLAG@,,;t t
-s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
-s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
-s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
-s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
-s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
-s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
-s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
-s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
-s,@EXPORT_PREFIX@,_,;t t
-s,@arch@,$(ARCH)-$(OS),;t t
-s,@sitearch@,$(ARCH)-$(OS),;t t
-s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
-s,@configure_args@,--enable-shared $(configure_args),;t t
-s,@configure_input@,$$configure_input,;t t
-s,@srcdir@,$(srcdir),;t t
-s,@top_srcdir@,$(srcdir),;t t
-|
-
-miniruby$(EXEEXT):
- @echo $(LIBS)
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS),$@,nul,$(LIBRUBY_A) $(LIBS)
-
-$(PROGRAM): $(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
- $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
-
-$(WPROGRAM): $(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
- $(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
-
-$(LIBRUBY_A): $(OBJS) $(DMYEXT)
- @-if exist $@ del $@
- $(AR) $(ARFLAGS) "$@" $(OBJS) $(DMYEXT)
-
-# $(LIBRUBY): $(LIBRUBY_SO)
-# implib $@ $(LIBRUBY_SO)
-
-$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
- @echo $(DLDOBJS)
- $(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
-
-$(LIBRUBY): $(LIBRUBY_SO)
-
-$(RUBYDEF): $(LIBRUBY_A) $(PREP)
- $(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
-
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
- @$(MINIRUBY) $(srcdir)/win32/resource.rb \
- -ruby_name=$(RUBY_INSTALL_NAME) \
- -rubyw_name=$(RUBYW_INSTALL_NAME) \
- -so_name=$(RUBY_SO_NAME) \
- . $(icondirs) $(srcdir)/win32
-
-post-install-ext::
- $(MINIRUBY) -I$(srcdir)lib -rrbconfig -rfileutils \
- -e "FileUtils.rm_f(Dir[ARGV[0]+Config::CONFIG['archdir']+'/**/*.tds'])" "$(DESTDIR:\=/)"
-
-clean-local::
- @$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
- @$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
-
-distclean-local::
- @$(RM) ext\config.cache $(RBCONFIG:/=\)
- @$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
- @$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
-
-ext/extinit.obj: ext/extinit.c $(SETUP)
- $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
-
-main.$(OBJEXT): win32.h
-array.$(OBJEXT): win32.h
-bignum.$(OBJEXT): win32.h
-class.$(OBJEXT): win32.h
-compar.$(OBJEXT): win32.h
-dir.$(OBJEXT): dir.h win32.h
-dln.$(OBJEXT): win32.h
-enum.$(OBJEXT): win32.h
-error.$(OBJEXT): win32.h
-eval.$(OBJEXT): win32.h
-file.$(OBJEXT): win32.h
-gc.$(OBJEXT): win32.h
-hash.$(OBJEXT): win32.h
-inits.$(OBJEXT): win32.h
-io.$(OBJEXT): win32.h
-marshal.$(OBJEXT): win32.h
-math.$(OBJEXT): win32.h
-numeric.$(OBJEXT): win32.h
-object.$(OBJEXT): win32.h
-pack.$(OBJEXT): win32.h
-parse.$(OBJEXT): win32.h
-process.$(OBJEXT): win32.h
-prec.$(OBJEXT): win32.h
-random.$(OBJEXT): win32.h
-range.$(OBJEXT): win32.h
-re.$(OBJEXT): win32.h
-regex.$(OBJEXT): win32.h
-ruby.$(OBJEXT): win32.h
-signal.$(OBJEXT): win32.h
-sprintf.$(OBJEXT): win32.h
-st.$(OBJEXT): win32.h
-string.$(OBJEXT): win32.h
-struct.$(OBJEXT): win32.h
-time.$(OBJEXT): win32.h
-util.$(OBJEXT): win32.h
-variable.$(OBJEXT): win32.h
-version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
deleted file mode 100644
index c27a1261f1..0000000000
--- a/bcc32/README.bcc32
+++ /dev/null
@@ -1,137 +0,0 @@
-=begin
-
-= How to build ruby using Borland C++
-
-== Requirement
-
-(1) Borland C++ 5.0 or later.
-
-(2) Please set environment variable (({PATH}))
- to run required commands properly from the command line.
-
- Note: building ruby requires following commands.
- * make
- * bcc32
- * tlib
- * ilink32
-
-(3) If you want to build from CVS source, following commands are required.
- * byacc ((<URL:http://gnuwin32.sourceforge.net/packages/byacc.htm>))
- * sed ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
-
-(4) We strongly recommend to build ruby on C++Builder, to link following files.
- * usebormm.lib
- * memmgr.lib
-
- RTL's internal memory manager cannot handle large memory block properly,
- so we should use borlndmm.dll instead.
- 10000.times { "" << "." * 529671; GC.start } # crash
-
-== How to compile and install
-
-(1) Execute bcc32\configure.bat on your build directory.
- ex. c:\ruby-1.6.7>bcc32\configure.bat
-
-(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
- if you want to change the name of the executable files.
- And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
- executable without console window if also you want.
-
-(3) Run `((%make%))'
-
-(4) Run `((%make test%))'
-
-(5) Run `((%make DESTDIR=<install_directory> install%))'
-
- This command will create following directories and install files onto them.
- * <install_directory>\bin
- * <install_directory>\lib
- * <install_directory>\lib\ruby
- * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
- * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
- * <install_directory>\lib\ruby\site_ruby
- * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
- * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
- * <install_directory>\man\man1
- If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
- The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
-
-(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
- usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
- directory.
-
-== Icons
-
-Any icon files(*.ico) in the build directory, directories specified with
-((|icondirs|)) make variable and (({win32})) directory under the ruby
-source directory will be included in DLL or executable files, according
-to their base names.
- $(RUBY_INSTALL_NAME).ico or ruby.ico --> $(RUBY_INSTALL_NAME).exe
- $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
- the others --> $(RUBY_SO_NAME).dll
-
-Although no icons are distributed with the ruby source or in the official
-site, you can use anything you like. For example, followings are written
-in Japanese, but you can download at least.
-
-* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
- ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
-* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
- ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
-
-== Build examples
-
-* Build on the ruby source directory.
-
- ex.)
- ruby source directory: C:\ruby
- build directory: C:\ruby
- install directory: C:\usr\local
-
- C:
- cd \ruby
- bcc32\configure
- make
- make test
- make DESTDIR=/usr/local install
-
-* Build on the relative directory from the ruby source directory and CPU type
- i386.
-
- ex.)
- ruby source directory: C:\ruby
- build directory: C:\ruby\bccwin32
- install directory: C:\usr\local
- CPU i386
-
- C:
- cd \ruby
- mkdir bccwin32
- cd bccwin32
- ..\bcc32\configure target i386-bccwin32
- make
- make test
- make DESTDIR=/usr/local install
-
-* Build on the different drive.
-
- ex.)
- ruby source directory: C:\src\ruby
- build directory: D:\build\ruby
- install directory: C:\usr\local
-
- D:
- cd D:\build\ruby
- C:\src\ruby\bcc32\configure
- make
- make test
- make DESTDIR=C:/usr/local install
-
-== Bugs
-
-You can ((*NOT*)) use a path name contains any white space characters as
-the ruby source directory, this restriction comes from the behavior of
-(({!INCLUDE})) directives of (({MAKE})).
-((- you may call it a bug. -))
-
-=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
deleted file mode 100755
index 123a3f23c8..0000000000
--- a/bcc32/configure.bat
+++ /dev/null
@@ -1,92 +0,0 @@
-@echo off
-::: Don't set environment variable in batch file other than autoexec.bat
-::: to avoid "Out of environment space" problem on Windows 95/98.
-::: set TMPMAKE=~tmp~.mak
-
-echo> ~tmp~.mak ####
-echo>> ~tmp~.mak conf = %0
-echo>> ~tmp~.mak $(conf:\=/): nul
-echo>> ~tmp~.mak @del ~tmp~.mak
-echo>> ~tmp~.mak @-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
-:loop
-if "%1" == "" goto :end
-if "%1" == "--prefix" goto :prefix
-if "%1" == "--srcdir" goto :srcdir
-if "%1" == "srcdir" goto :srcdir
-if "%1" == "--target" goto :target
-if "%1" == "target" goto :target
-if "%1" == "--with-static-linked-ext" goto :extstatic
-if "%1" == "--program-suffix" goto :suffix
-if "%1" == "--program-name" goto :progname
-if "%1" == "--enable-install-doc" goto :enable-rdoc
-if "%1" == "--disable-install-doc" goto :disable-rdoc
-if "%1" == "--extout" goto :extout
-if "%1" == "-h" goto :help
-if "%1" == "--help" goto :help
- echo>> ~tmp~.mak "%1" \
- shift
-goto :loop
-:srcdir
- echo>> ~tmp~.mak -D"srcdir=%2" \
- shift
- shift
-goto :loop
-:prefix
- echo>> ~tmp~.mak -D"prefix=%2" \
- shift
- shift
-goto :loop
-:suffix
- echo>> ~tmp~.mak -D"RUBY_SUFFIX=%2" \
- shift
- shift
-goto :loop
-:installname
- echo>> ~tmp~.mak -D"RUBY_INSTALL_NAME=%2" \
- shift
- shift
-goto :loop
-:soname
- echo>> ~tmp~.mak -D"RUBY_SO_NAME=%2" \
- shift
- shift
-goto :loop
-:target
- echo>> ~tmp~.mak "%2" \
- shift
- shift
-goto :loop
-:extstatic
- echo>> ~tmp~.mak -D"EXTSTATIC=static" \
- shift
-goto :loop
-:enable-rdoc
- echo>> ~tmp~.mak -D"RDOCTARGET=install-doc" \
- shift
-goto :loop
-:disable-rdoc
- echo>> ~tmp~.mak -D"RDOCTARGET=install-nodoc" \
- shift
-goto :loop
-:extout
- echo>> ~tmp~.mak "EXTOUT=%2" \
- shift
- shift
-goto :loop
-:help
- echo Configuration:
- echo --help display this help
- echo --srcdir=DIR find the sources in DIR [configure dir or `..']
- echo Installation directories:
- echo --prefix=PREFIX install files in PREFIX (ignored currently)
- echo System types:
- echo --target=TARGET configure for TARGET [i386-bccwin32]
- echo Optional Package:
- echo --with-static-linked-ext link external modules statically
- echo --enable-install-doc install rdoc indexes during install
- del ~tmp~.mak
-goto :exit
-:end
-echo>> ~tmp~.mak bcc32dir="$(@D)"
-make -s -f ~tmp~.mak
-:exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
deleted file mode 100644
index e34b441e2f..0000000000
--- a/bcc32/mkexports.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-#!./miniruby -s
-
-SYM = {}
-STDIN.reopen(open("nul"))
-ARGV.each do |obj|
- IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
- next unless /(?:PUBDEF|PUBD32)/ =~ l
- SYM[$1] = true if /'(.*?)'/ =~ l
- end
-end
-
-exports = []
-if $name
- exports << "Name " + $name
-elsif $library
- exports << "Library " + $library
-end
-exports << "Description " + $description.dump if $description
-exports << "EXPORTS" << SYM.keys.sort
-
-if $output
- open($output, 'w') {|f| f.puts exports.join("\n")}
-else
- puts exports.join("\n")
-end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
deleted file mode 100644
index b7a2539d0a..0000000000
--- a/bcc32/setup.mak
+++ /dev/null
@@ -1,133 +0,0 @@
-# -*- makefile -*-
-
-!if "$(srcdir)" != ""
-bcc32dir = $(srcdir)/bcc32
-!elseif "$(bcc32dir)" == "bcc32/"
-srcdir = .
-!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
-srcdir = $(bcc32dir:/bcc32/=)
-!else
-srcdir = $(bcc32dir)/..
-!endif
-!ifndef prefix
-prefix = /usr
-!endif
-OS = bccwin32
-RT = $(OS)
-BANG = !
-APPEND = echo>>$(MAKEFILE)
-!ifdef MAKEFILE
-MAKE = $(MAKE) -f $(MAKEFILE)
-!else
-MAKEFILE = Makefile
-!endif
-
-all: Makefile
-Makefile: -prologue- -generic- -epilogue-
-i386-$(OS): -prologue- -i386- -epilogue-
-i486-$(OS): -prologue- -i486- -epilogue-
-i586-$(OS): -prologue- -i586- -epilogue-
-i686-$(OS): -prologue- -i686- -epilogue-
-alpha-$(OS): -prologue- -alpha- -epilogue-
-
--prologue-: nul
- @echo Creating $(MAKEFILE)
- @type > $(MAKEFILE) &&|
-\#\#\# Makefile for ruby $(OS) \#\#\#
-$(BANG)ifndef srcdir
-srcdir = $(srcdir:\=/)
-$(BANG)endif
-$(BANG)ifndef prefix
-prefix = $(prefix:\=/)
-$(BANG)endif
-$(BANG)ifndef EXTSTATIC
-EXTSTATIC = $(EXTSTATIC)
-$(BANG)endif
-!if defined(RDOCTARGET)
-$(BANG)ifndef RDOCTARGET
-RDOCTARGET = $(RDOCTARGET)
-$(BANG)endif
-!endif
-!if defined(EXTOUT)
-$(BANG)ifndef EXTOUT
-EXTOUT = $(EXTOUT)
-$(BANG)endif
-!endif
-|
- @type > usebormm.bat &&|
-@echo off
-ilink32 -Gn -x usebormm.lib > nul
-if exist usebormm.tds echo MEMLIB = usebormm.lib
-|
- @usebormm.bat >> $(MAKEFILE)
- @del usebormm.*
-
- @cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
-\#include "version.h"
-MAJOR = RUBY_VERSION_MAJOR
-MINOR = RUBY_VERSION_MINOR
-TEENY = RUBY_VERSION_TEENY
-|
- @type $(MAKEFILE).i >> $(MAKEFILE)
- @del $(MAKEFILE).i
-
--generic-: nul
-!if defined(PROCESSOR_ARCHITECTURE) || defined(PROCESSOR_LEVEL)
- @type >> $(MAKEFILE) &&|
-!if defined(PROCESSOR_ARCHITECTURE)
-$(BANG)ifndef PROCESSOR_ARCHITECTURE
-PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
-$(BANG)endif
-!endif
-!if defined(PROCESSOR_LEVEL)
-$(BANG)ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
-$(BANG)endif
-!endif
-
-|
-!endif
-
--alpha-: nul
- @$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
- @$(APPEND) PROCESSOR_ARCHITECTURE = alpha
- @$(APPEND) !endif
--ix86-: nul
- @$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
- @$(APPEND) PROCESSOR_ARCHITECTURE = x86
- @$(APPEND) !endif
-
--i386-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 3
- @$(APPEND) !endif
--i486-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 4
- @$(APPEND) !endif
--i586-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 5
- @$(APPEND) !endif
--i686-: -ix86-
- @$(APPEND) !ifndef PROCESSOR_LEVEL
- @$(APPEND) PROCESSOR_LEVEL = 6
- @$(APPEND) !endif
-
--epilogue-: nul
- @type >> $(MAKEFILE) &&|
-
-\# OS = $(OS)
-\# RT = $(RT)
-\# RUBY_INSTALL_NAME = ruby
-\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
-\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)/missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
-\# STACK = 0x2000000
-\# LDFLAGS = -S:$$(STACK)
-\# RFLAGS = $$(iconinc)
-\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
-$(BANG)include $$(srcdir)/bcc32/Makefile.sub
-|
- @$(srcdir:/=\)\win32\rm.bat config.h config.status
- @echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/README.md b/benchmark/README.md
new file mode 100644
index 0000000000..24a2669143
--- /dev/null
+++ b/benchmark/README.md
@@ -0,0 +1,72 @@
+# ruby/benchmark
+
+This directory has benchmark definitions to be run with
+[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
+
+## Normal usage
+
+Execute `gem install benchmark_driver` and run a command like:
+
+```bash
+# Run a benchmark script with the ruby in the $PATH
+benchmark-driver benchmark/app_fib.rb
+
+# Run benchmark scripts with multiple Ruby executables or options
+benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
+
+# Or compare Ruby versions managed by rbenv
+benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
+
+# You can collect many metrics in many ways
+benchmark-driver benchmark/*.rb --runner memory --output markdown
+
+# Some are defined with YAML for complex setup or accurate measurement
+benchmark-driver benchmark/*.yml
+```
+
+See also:
+
+```console
+Usage: benchmark-driver [options] RUBY|YAML...
+ -r, --runner TYPE Specify runner type: ips, time, memory, once (default: ips)
+ -o, --output TYPE Specify output type: compare, simple, markdown, record (default: compare)
+ -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
+ --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
+ --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage
+ --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best)
+ --bundler Install and use gems specified in Gemfile
+ --filter REGEXP Filter out benchmarks with given regexp
+ --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3)
+ -v, --verbose Verbose mode. Multiple -v options increase visilibity (max: 2)
+```
+
+## make benchmark
+
+Using `make benchmark`, `make update-benchmark-driver` automatically downloads
+the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
+benchmark\_driver.
+
+```bash
+# Run all benchmarks with the ruby in the $PATH and the built ruby
+make benchmark
+
+# Or compare with specific ruby binary
+make benchmark COMPARE_RUBY="/path/to/ruby --jit"
+
+# Run vm1 benchmarks
+make benchmark ITEM=vm1
+
+# Run some limited benchmarks in ITEM-matched files
+make benchmark ITEM=vm1 OPTS=--filter=block
+
+# You can specify the benchmark by an exact filename instead of using the default argument:
+# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
+make benchmark ARGS=../benchmark/erb_render.yml
+
+# You can specify any option via $OPTS
+make benchmark OPTS="--help"
+
+# With `make benchmark`, some special runner plugins are available:
+# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
+make benchmark ITEM=vm2_bigarray OPTS="-r peak"
+```
diff --git a/benchmark/app_answer.rb b/benchmark/app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+def the_answer_to_life_the_universe_and_everything
+ (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
new file mode 100644
index 0000000000..16296af12b
--- /dev/null
+++ b/benchmark/app_aobench.rb
@@ -0,0 +1,297 @@
+# coding: US-ASCII
+
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+# https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+srand(0)
+
+class Vec
+ def initialize(x, y, z)
+ @x = x
+ @y = y
+ @z = z
+ end
+
+ attr_accessor :x, :y, :z
+
+ def vadd(b)
+ Vec.new(@x + b.x, @y + b.y, @z + b.z)
+ end
+
+ def vsub(b)
+ Vec.new(@x - b.x, @y - b.y, @z - b.z)
+ end
+
+ def vcross(b)
+ Vec.new(@y * b.z - @z * b.y,
+ @z * b.x - @x * b.z,
+ @x * b.y - @y * b.x)
+ end
+
+ def vdot(b)
+ @x * b.x + @y * b.y + @z * b.z
+ end
+
+ def vlength
+ Math.sqrt(@x * @x + @y * @y + @z * @z)
+ end
+
+ def vnormalize
+ len = vlength
+ v = Vec.new(@x, @y, @z)
+ if len > 1.0e-17 then
+ v.x = v.x / len
+ v.y = v.y / len
+ v.z = v.z / len
+ end
+ v
+ end
+end
+
+
+class Sphere
+ def initialize(center, radius)
+ @center = center
+ @radius = radius
+ end
+
+ attr_reader :center, :radius
+
+ def intersect(ray, isect)
+ rs = ray.org.vsub(@center)
+ b = rs.vdot(ray.dir)
+ c = rs.vdot(rs) - (@radius * @radius)
+ d = b * b - c
+ if d > 0.0 then
+ t = - b - Math.sqrt(d)
+
+ if t > 0.0 and t < isect.t then
+ isect.t = t
+ isect.hit = true
+ isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+ ray.org.y + ray.dir.y * t,
+ ray.org.z + ray.dir.z * t)
+ n = isect.pl.vsub(@center)
+ isect.n = n.vnormalize
+ else
+ 0.0
+ end
+ end
+ nil
+ end
+end
+
+class Plane
+ def initialize(p, n)
+ @p = p
+ @n = n
+ end
+
+ def intersect(ray, isect)
+ d = -@p.vdot(@n)
+ v = ray.dir.vdot(@n)
+ v0 = v
+ if v < 0.0 then
+ v0 = -v
+ end
+ if v0 < 1.0e-17 then
+ return
+ end
+
+ t = -(ray.org.vdot(@n) + d) / v
+
+ if t > 0.0 and t < isect.t then
+ isect.hit = true
+ isect.t = t
+ isect.n = @n
+ isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+ ray.org.y + t * ray.dir.y,
+ ray.org.z + t * ray.dir.z)
+ end
+ nil
+ end
+end
+
+class Ray
+ def initialize(org, dir)
+ @org = org
+ @dir = dir
+ end
+
+ attr_accessor :org, :dir
+end
+
+class Isect
+ def initialize
+ @t = 10000000.0
+ @hit = false
+ @pl = Vec.new(0.0, 0.0, 0.0)
+ @n = Vec.new(0.0, 0.0, 0.0)
+ end
+
+ attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+ i = f * 255.5
+ if i > 255.0 then
+ i = 255.0
+ end
+ if i < 0.0 then
+ i = 0.0
+ end
+ i.to_i
+end
+
+def otherBasis(basis, n)
+ basis[2] = Vec.new(n.x, n.y, n.z)
+ basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+ if n.x < 0.6 and n.x > -0.6 then
+ basis[1].x = 1.0
+ elsif n.y < 0.6 and n.y > -0.6 then
+ basis[1].y = 1.0
+ elsif n.z < 0.6 and n.z > -0.6 then
+ basis[1].z = 1.0
+ else
+ basis[1].x = 1.0
+ end
+
+ basis[0] = basis[1].vcross(basis[2])
+ basis[0] = basis[0].vnormalize
+
+ basis[1] = basis[2].vcross(basis[0])
+ basis[1] = basis[1].vnormalize
+end
+
+class Scene
+ def initialize
+ @spheres = Array.new
+ @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+ @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+ @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+ @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+ end
+
+ def ambient_occlusion(isect)
+ basis = Array.new
+ otherBasis(basis, isect.n)
+
+ ntheta = NAO_SAMPLES
+ nphi = NAO_SAMPLES
+ eps = 0.0001
+ occlusion = 0.0
+
+ p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+ isect.pl.y + eps * isect.n.y,
+ isect.pl.z + eps * isect.n.z)
+ nphi.times do |j|
+ ntheta.times do |i|
+ r = rand
+ phi = 2.0 * 3.14159265 * rand
+ x = Math.cos(phi) * Math.sqrt(1.0 - r)
+ y = Math.sin(phi) * Math.sqrt(1.0 - r)
+ z = Math.sqrt(r)
+
+ rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+ ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+ rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+ raydir = Vec.new(rx, ry, rz)
+ ray = Ray.new(p0, raydir)
+
+ occisect = Isect.new
+ @spheres[0].intersect(ray, occisect)
+ @spheres[1].intersect(ray, occisect)
+ @spheres[2].intersect(ray, occisect)
+ @plane.intersect(ray, occisect)
+ if occisect.hit then
+ occlusion = occlusion + 1.0
+ else
+ 0.0
+ end
+ end
+ end
+
+ occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+ Vec.new(occlusion, occlusion, occlusion)
+ end
+
+ def render(w, h, nsubsamples)
+ cnt = 0
+ nsf = nsubsamples.to_f
+ h.times do |y|
+ w.times do |x|
+ rad = Vec.new(0.0, 0.0, 0.0)
+
+ # Subsampling
+ nsubsamples.times do |v|
+ nsubsamples.times do |u|
+
+ cnt = cnt + 1
+ wf = w.to_f
+ hf = h.to_f
+ xf = x.to_f
+ yf = y.to_f
+ uf = u.to_f
+ vf = v.to_f
+
+ px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+ py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+ eye = Vec.new(px, py, -1.0).vnormalize
+
+ ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+ isect = Isect.new
+ @spheres[0].intersect(ray, isect)
+ @spheres[1].intersect(ray, isect)
+ @spheres[2].intersect(ray, isect)
+ @plane.intersect(ray, isect)
+ if isect.hit then
+ col = ambient_occlusion(isect)
+ rad.x = rad.x + col.x
+ rad.y = rad.y + col.y
+ rad.z = rad.z + col.z
+ end
+ end
+ end
+
+ r = rad.x / (nsf * nsf)
+ g = rad.y / (nsf * nsf)
+ b = rad.z / (nsf * nsf)
+ printf("%c", clamp(r))
+ printf("%c", clamp(g))
+ printf("%c", clamp(b))
+ end
+ nil
+ end
+
+ nil
+ end
+end
+
+alias printf_orig printf
+def printf *args
+ # $fp.printf(*args)
+end
+
+# File.open("ao.ppm", "w") do |fp|
+ # $fp = fp
+ printf("P6\n")
+ printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+ printf("255\n")
+ Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
new file mode 100644
index 0000000000..31e29b7644
--- /dev/null
+++ b/benchmark/app_erb.yml
@@ -0,0 +1,23 @@
+#
+# Create many HTML strings with ERB.
+#
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+benchmark:
+ app_erb: ERB.new(data).result(binding)
+loop_count: 15000
diff --git a/benchmark/app_factorial.rb b/benchmark/app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+ if(n > 1)
+ n * fact(n-1)
+ else
+ 1
+ end
+end
+
+100.times {
+ fact(5000)
+}
diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
+
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+# "Understanding Computation" by Tom Stuart
+# http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST = -> l { LEFT[RIGHT[l]] }
+IF = -> b { b }
+LEFT = -> p { p[-> x { -> y { x } } ] }
+RIGHT = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY = LEFT
+REST = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+ proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+ IF[proc][true][false]
+end
+
+def to_array(proc)
+ array = []
+
+ until to_boolean(IS_EMPTY[proc])
+ array.push(FIRST[proc])
+ proc = REST[proc]
+ end
+
+ array
+end
+
+def to_char(c)
+ '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+ to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+ to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+ i = 0
+ while i<100
+ i += 1
+ z = z * z
+ return false if z.abs > 2
+ end
+ true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+ (0..1000).each{|dy|
+ x = dx / 50.0
+ y = dy / 50.0
+ c = Complex(x, y)
+ ary << c if mandelbrot?(c)
+ }
+}
+
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
new file mode 100644
index 0000000000..47be7b203f
--- /dev/null
+++ b/benchmark/app_pentomino.rb
@@ -0,0 +1,130 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+ nb.each{|x|
+ a[n] = x
+ if n == NP-1
+ $p << [a.sort]
+ else
+ nbc=nb.dup
+ [-ROW, -1, 1, ROW].each{|d|
+ if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+ nbc << x+d
+ end
+ }
+ nbc.delete x
+ piece(n+1,a[0..n],nbc)
+ end
+ }
+end
+
+def kikaku(a)
+ a.collect {|x| x - a[0]}
+end
+def ud(a)
+ kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+ kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+ kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+ piece(0,[],[0])
+ $p.each do |a|
+ a0 = a[0]
+ a[1] = ud(a0)
+ a[2] = rl(a0)
+ a[3] = ud(rl(a0))
+ a[4] = xy(a0)
+ a[5] = ud(xy(a0))
+ a[6] = rl(xy(a0))
+ a[7] = ud(rl(xy(a0)))
+ a.sort!
+ a.uniq!
+ end
+ $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+ (0...ROW*COL).each{|i|
+ if i % ROW >= ROW-NP
+ $b[i] = -2
+ else
+ $b[i] = -1
+ end
+ $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+ }
+end
+
+def pboard
+ return # skip print
+ print "No. #$no\n"
+ (0...COL).each{|i|
+ print "|"
+ (0...ROW-NP).each{|j|
+ x = $b[i*ROW+j]
+ if x < 0
+ print "..|"
+ else
+ printf "%2d|",x+1
+ end
+ }
+ print "\n"
+ }
+ print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+ if a.length == $p.length then
+ $no += 1
+ pboard
+ return
+ end
+ while $b[pos] != -1
+ pos += 1
+ end
+ ($pnum - a).each do |i|
+ $p[i].each do |x|
+ f = 0
+ x.each{|s|
+ if $b[pos+s] != -1
+ f=1
+ break
+ end
+ }
+ if f == 0 then
+ x.each{|s|
+ $b[pos+s] = i
+ }
+ a << i
+ setpiece(a.dup, pos)
+ a.pop
+ x.each{|s|
+ $b[pos+s] = -1
+ }
+ end
+ end
+ end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+ i += 1
+ begin
+ raise
+ rescue
+ end
+end
diff --git a/benchmark/app_strconcat.rb b/benchmark/app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+ "#{1+1} #{1+1} #{1+1}"
+ i += 1
+end
diff --git a/benchmark/app_tak.rb b/benchmark/app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/app_tarai.rb b/benchmark/app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+ if x <= y
+ then y
+ else tarai(tarai(x-1, y, z),
+ tarai(y-1, z, x),
+ tarai(z-1, x, y))
+ end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/app_uri.rb b/benchmark/app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+ uri = URI.parse('http://www.ruby-lang.org')
+ uri.scheme
+ uri.host
+ uri.port
+}
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
new file mode 100644
index 0000000000..88ef544ba0
--- /dev/null
+++ b/benchmark/array_flatten.yml
@@ -0,0 +1,19 @@
+prelude: |
+ small_flat_ary = 5.times.to_a
+ large_flat_ary = 100.times.to_a
+ small_pairs_ary = [[1, 2]] * 5
+ large_pairs_ary = [[1, 2]] * 100
+ mostly_flat_ary = 100.times.to_a.push([101, 102])
+
+benchmark:
+ small_flat_ary.flatten: small_flat_ary.flatten
+ small_flat_ary.flatten!: small_flat_ary.flatten!
+ large_flat_ary.flatten: large_flat_ary.flatten
+ large_flat_ary.flatten!: large_flat_ary.flatten!
+ small_pairs_ary.flatten: small_pairs_ary.flatten
+ small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
+ large_pairs_ary.flatten: large_pairs_ary.flatten
+ large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
+ mostly_flat_ary.flatten: mostly_flat_ary.flatten
+ mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
+loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
new file mode 100644
index 0000000000..26705323fd
--- /dev/null
+++ b/benchmark/array_intersection.yml
@@ -0,0 +1,14 @@
+prelude: |
+ small1 = [1, 2, 3]
+ small2 = [1, 2, 3, 4, 5]
+ small3 = [2, 3, 4, 5]
+ small4 = [2]
+ big1 = [1, 2, 3, 4] * 64
+ big2 = [1, 2, 3] * 64
+ big3 = [1, 2] * 64
+
+benchmark:
+ small-&: small1 & small2 & small3 & small4
+ small-intersection: small1.intersection(small2, small3, small4)
+ big-&: big1 & big2 & big3
+ big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
new file mode 100644
index 0000000000..5f41ecc32b
--- /dev/null
+++ b/benchmark/array_sample_100k_10.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
new file mode 100644
index 0000000000..18b1715319
--- /dev/null
+++ b/benchmark/array_sample_100k_11.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
new file mode 100644
index 0000000000..22863afe89
--- /dev/null
+++ b/benchmark/array_sample_100k__100.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
new file mode 100644
index 0000000000..4cd79e6c67
--- /dev/null
+++ b/benchmark/array_sample_100k__1k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
new file mode 100644
index 0000000000..b3d264249e
--- /dev/null
+++ b/benchmark/array_sample_100k__6k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
new file mode 100644
index 0000000000..5dd55ec058
--- /dev/null
+++ b/benchmark/array_sample_100k___10k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
new file mode 100644
index 0000000000..1506732c3c
--- /dev/null
+++ b/benchmark/array_sample_100k___50k.rb
@@ -0,0 +1,2 @@
+arr = [*0...100000]
+10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+ [10_000,1_000_000,100_000_000].each do |n|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift"){ ary.shift }
+ (0..4).each do |i|
+ ary = Array.new(n,0)
+ GC.start
+ x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+ end
+ end
+end
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
new file mode 100644
index 0000000000..e53a6edae6
--- /dev/null
+++ b/benchmark/array_small_and.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 & arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
new file mode 100644
index 0000000000..9661ee48db
--- /dev/null
+++ b/benchmark/array_small_diff.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 - arr2
+ end
+ end
+end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
new file mode 100644
index 0000000000..c58b5fd1ff
--- /dev/null
+++ b/benchmark/array_small_or.rb
@@ -0,0 +1,17 @@
+MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
+MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
+ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
+
+ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
+ (MIN_SIZE..MAX_SIZE).map do |size2|
+ [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
+ end
+end
+
+ITERATIONS.times do
+ ARRAYS.each do |group|
+ group.each do |arr1, arr2|
+ arr1 | arr2
+ end
+ end
+end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
new file mode 100644
index 0000000000..3579786056
--- /dev/null
+++ b/benchmark/array_sort_block.rb
@@ -0,0 +1,2 @@
+ary = Array.new(1000) { rand(1000) }
+10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
new file mode 100644
index 0000000000..9a6e2f8bd2
--- /dev/null
+++ b/benchmark/array_sort_float.rb
@@ -0,0 +1,2 @@
+arr = Array.new(1000) { rand }
+10000.times { arr.sort }
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
new file mode 100644
index 0000000000..6cb394cb9f
--- /dev/null
+++ b/benchmark/array_values_at_int.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
new file mode 100644
index 0000000000..5b53806d1c
--- /dev/null
+++ b/benchmark/array_values_at_range.rb
@@ -0,0 +1,2 @@
+ary = Array.new(10000) {|i| i}
+100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
new file mode 100644
index 0000000000..e2ad5a5c94
--- /dev/null
+++ b/benchmark/bighash.rb
@@ -0,0 +1 @@
+h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
new file mode 100644
index 0000000000..af6abd08ac
--- /dev/null
+++ b/benchmark/cgi_escape_html.yml
@@ -0,0 +1,40 @@
+prelude: require 'cgi/escape'
+benchmark:
+ - name: escape_html_blank
+ prelude: str = ""
+ script: CGI.escapeHTML(str)
+ loop_count: 20000000
+ - name: escape_html_short_none
+ prelude: str = "abcde"
+ script: CGI.escapeHTML(str)
+ loop_count: 20000000
+ - name: escape_html_short_one
+ prelude: str = "abcd<"
+ script: CGI.escapeHTML(str)
+ loop_count: 20000000
+ - name: escape_html_short_all
+ prelude: str = "'&\"<>"
+ script: CGI.escapeHTML(str)
+ loop_count: 5000000
+ - name: escape_html_long_none
+ prelude: str = "abcde" * 300
+ script: CGI.escapeHTML(str)
+ loop_count: 1000000
+ - name: escape_html_long_all
+ prelude: str = "'&\"<>" * 10
+ script: CGI.escapeHTML(str)
+ loop_count: 1000000
+ - name: escape_html_real
+ prelude: | # http://example.com/
+ str = <<~HTML
+ <body>
+ <div>
+ <h1>Example Domain</h1>
+ <p>This domain is established to be used for illustrative examples in documents. You may use this
+ domain in examples without prior coordination or asking for permission.</p>
+ <p><a href="http://www.iana.org/domains/example">More information...</a></p>
+ </div>
+ </body>
+ HTML
+ script: CGI.escapeHTML(str)
+ loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
new file mode 100644
index 0000000000..d0150c5e5b
--- /dev/null
+++ b/benchmark/complex_float_add.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_add: c = a + b
+loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
new file mode 100644
index 0000000000..b9f5e1d51c
--- /dev/null
+++ b/benchmark/complex_float_div.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_div: c = a / b
+loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
new file mode 100644
index 0000000000..59b096a6dc
--- /dev/null
+++ b/benchmark/complex_float_mul.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_mul: c = a * b
+loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
new file mode 100644
index 0000000000..6fcde3125b
--- /dev/null
+++ b/benchmark/complex_float_new.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_new: c = Complex(a, b)
+loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
new file mode 100644
index 0000000000..c40a31ab55
--- /dev/null
+++ b/benchmark/complex_float_power.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_power: c = a ** b
+loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
new file mode 100644
index 0000000000..3fafe7cdbe
--- /dev/null
+++ b/benchmark/complex_float_sub.yml
@@ -0,0 +1,7 @@
+prelude: |
+ max, min = 1000.0, -1000.0
+ a = Complex(rand(max)+min, rand(max)+min)
+ b = Complex(rand(max)+min, rand(max)+min)
+benchmark:
+ complex_float_sub: c = a - b
+loop_count: 1000000
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
new file mode 100644
index 0000000000..8329c757cf
--- /dev/null
+++ b/benchmark/dir_empty_p.rb
@@ -0,0 +1,5 @@
+require 'tmpdir'
+max = 100_000
+Dir.mktmpdir('bm_dir_empty_p') do |dir|
+ max.times { Dir.empty?(dir) }
+end
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
new file mode 100644
index 0000000000..8832392e65
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_100.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
new file mode 100644
index 0000000000..329509fa8f
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_20.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
new file mode 100644
index 0000000000..02ea4d4e71
--- /dev/null
+++ b/benchmark/enum_lazy_grep_v_50.rb
@@ -0,0 +1,4 @@
+grep_data = (1..10).to_a * 1000
+N = 100
+enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
new file mode 100644
index 0000000000..2e6434d9c4
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_100.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
new file mode 100644
index 0000000000..75e6398fee
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_20.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
+N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
new file mode 100644
index 0000000000..59a39b78ff
--- /dev/null
+++ b/benchmark/enum_lazy_uniq_50.rb
@@ -0,0 +1,4 @@
+uniq_data = (1..10_000).to_a
+N = 100
+enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
+N.times {enum.each {}}
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
new file mode 100644
index 0000000000..15f6c3880b
--- /dev/null
+++ b/benchmark/erb_render.yml
@@ -0,0 +1,24 @@
+prelude: |
+ require 'erb'
+
+ data = <<erb
+ <html>
+ <head> <%= title %> </head>
+ <body>
+ <h1> <%= title %> </h1>
+ <p>
+ <%= content %>
+ </p>
+ </body>
+ </html>
+ erb
+
+ title = "hello world!"
+ content = "hello world!\n" * 10
+
+ src = "def self.render(title, content); #{ERB.new(data).src}; end"
+ mod = Module.new
+ mod.instance_eval(src, "(ERB)")
+benchmark:
+ erb_render: mod.render(title, content)
+loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
new file mode 100755
index 0000000000..a36c759f8e
--- /dev/null
+++ b/benchmark/fiber_chain.yml
@@ -0,0 +1,36 @@
+prelude: |
+ def make_link(previous)
+ Fiber.new do
+ while message = previous.resume
+ Fiber.yield(message)
+ end
+ end
+ end
+
+ def make_chain(length = 1000, &block)
+ chain = Fiber.new(&block)
+
+ (length - 1).times do
+ chain = make_link(chain)
+ end
+
+ return chain
+ end
+
+ message = "Hello World!"
+
+ chain = make_chain do
+ while true
+ Fiber.yield(message)
+ end
+ end
+benchmark:
+ make_chain: |
+ make_chain(100) do
+ while true
+ Fiber.yield(message)
+ end
+ end
+ resume_chain: |
+ chain.resume
+loop_count: 5000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
new file mode 100644
index 0000000000..1cd4760c9d
--- /dev/null
+++ b/benchmark/file_chmod.rb
@@ -0,0 +1,9 @@
+# chmod file
+require 'tempfile'
+max = 200_000
+tmp = Tempfile.new('chmod')
+path = tmp.path
+max.times do
+ File.chmod(0777, path)
+end
+tmp.close!
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
new file mode 100644
index 0000000000..bbb44aebac
--- /dev/null
+++ b/benchmark/file_rename.rb
@@ -0,0 +1,11 @@
+# rename file
+require 'tempfile'
+
+max = 100_000
+tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
+a, b = tmp.map { |x| x.path }
+tmp.each { |t| t.close } # Windows can't rename files without closing them
+max.times do
+ File.rename(a, b)
+ File.rename(b, a)
+end
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..275f58b924
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..83347cdd20
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..23d0b91c6c
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,57 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = false
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.on('-p'){$gcprof = true}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+ GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+ load script
+}
+
+gc_time = 0
+
+if $gcprof
+ gc_time = GC::Profiler.total_time
+ GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+ GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+ puts
+ puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts " (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+ h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+ ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+ h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..8ebdff7d1d
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../app_pentomino'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+ dir = File.join(d, 'rdocbench')
+ args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+ args << '--op' << dir
+
+ r = RDoc::RDoc.new
+ r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+ class Node
+ attr_accessor :color
+ attr_accessor :key
+ attr_accessor :left
+ attr_accessor :right
+ attr_accessor :parent
+
+ RED = :red
+ BLACK = :black
+ COLORS = [RED, BLACK].freeze
+
+ def initialize(key, color = RED)
+ raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+ @color = color
+ @key = key
+ @left = @right = @parent = NilNode.instance
+ end
+
+ def black?
+ return color == BLACK
+ end
+
+ def red?
+ return color == RED
+ end
+ end
+
+ class NilNode < Node
+ class << self
+ private :new
+
+ # it's not thread safe
+ def instance
+ @instance ||= begin
+ def instance
+ return @instance
+ end
+
+ new
+ end
+ end
+ end
+
+ def initialize
+ self.color = BLACK
+ self.key = 0
+ self.left = nil
+ self.right = nil
+ self.parent = nil
+ end
+
+ def nil?
+ return true
+ end
+ end
+
+ include Enumerable
+
+ attr_accessor :root
+ attr_accessor :size
+
+ def initialize
+ self.root = NilNode.instance
+ self.size = 0
+ end
+
+ def add(key)
+ insert(Node.new(key))
+ end
+
+ def insert(x)
+ insert_helper(x)
+
+ x.color = Node::RED
+ while x != root && x.parent.color == Node::RED
+ if x.parent == x.parent.parent.left
+ y = x.parent.parent.right
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.right
+ x = x.parent
+ left_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ right_rotate(x.parent.parent)
+ end
+ else
+ y = x.parent.parent.left
+ if !y.nil? && y.color == Node::RED
+ x.parent.color = Node::BLACK
+ y.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ x = x.parent.parent
+ else
+ if x == x.parent.left
+ x = x.parent
+ right_rotate(x)
+ end
+ x.parent.color = Node::BLACK
+ x.parent.parent.color = Node::RED
+ left_rotate(x.parent.parent)
+ end
+ end
+ end
+ root.color = Node::BLACK
+ end
+
+ alias << insert
+
+ def delete(z)
+ y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+ x = y.left.nil? ? y.right : y.left
+ x.parent = y.parent
+
+ if y.parent.nil?
+ self.root = x
+ else
+ if y == y.parent.left
+ y.parent.left = x
+ else
+ y.parent.right = x
+ end
+ end
+
+ z.key = y.key if y != z
+
+ if y.color == Node::BLACK
+ delete_fixup(x)
+ end
+
+ self.size -= 1
+ return y
+ end
+
+ def minimum(x = root)
+ while !x.left.nil?
+ x = x.left
+ end
+ return x
+ end
+
+ def maximum(x = root)
+ while !x.right.nil?
+ x = x.right
+ end
+ return x
+ end
+
+ def successor(x)
+ if !x.right.nil?
+ return minimum(x.right)
+ end
+ y = x.parent
+ while !y.nil? && x == y.right
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def predecessor(x)
+ if !x.left.nil?
+ return maximum(x.left)
+ end
+ y = x.parent
+ while !y.nil? && x == y.left
+ x = y
+ y = y.parent
+ end
+ return y
+ end
+
+ def inorder_walk(x = root)
+ x = self.minimum
+ while !x.nil?
+ yield x.key
+ x = successor(x)
+ end
+ end
+
+ alias each inorder_walk
+
+ def reverse_inorder_walk(x = root)
+ x = self.maximum
+ while !x.nil?
+ yield x.key
+ x = predecessor(x)
+ end
+ end
+
+ alias reverse_each reverse_inorder_walk
+
+ def search(key, x = root)
+ while !x.nil? && x.key != key
+ key < x.key ? x = x.left : x = x.right
+ end
+ return x
+ end
+
+ def empty?
+ return self.root.nil?
+ end
+
+ def black_height(x = root)
+ height = 0
+ while !x.nil?
+ x = x.left
+ height +=1 if x.nil? || x.black?
+ end
+ return height
+ end
+
+private
+
+ def left_rotate(x)
+ raise "x.right is nil!" if x.right.nil?
+ y = x.right
+ x.right = y.left
+ y.left.parent = x if !y.left.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.left = x
+ x.parent = y
+ end
+
+ def right_rotate(x)
+ raise "x.left is nil!" if x.left.nil?
+ y = x.left
+ x.left = y.right
+ y.right.parent = x if !y.right.nil?
+ y.parent = x.parent
+ if x.parent.nil?
+ self.root = y
+ else
+ if x == x.parent.left
+ x.parent.left = y
+ else
+ x.parent.right = y
+ end
+ end
+ y.right = x
+ x.parent = y
+ end
+
+ def insert_helper(z)
+ y = NilNode.instance
+ x = root
+ while !x.nil?
+ y = x
+ z.key < x.key ? x = x.left : x = x.right
+ end
+ z.parent = y
+ if y.nil?
+ self.root = z
+ else
+ z.key < y.key ? y.left = z : y.right = z
+ end
+ self.size += 1
+ end
+
+ def delete_fixup(x)
+ while x != root && x.color == Node::BLACK
+ if x == x.parent.left
+ w = x.parent.right
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ left_rotate(x.parent)
+ w = x.parent.right
+ end
+ if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.right.color == Node::BLACK
+ w.left.color = Node::BLACK
+ w.color = Node::RED
+ right_rotate(w)
+ w = x.parent.right
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.right.color = Node::BLACK
+ left_rotate(x.parent)
+ x = root
+ end
+ else
+ w = x.parent.left
+ if w.color == Node::RED
+ w.color = Node::BLACK
+ x.parent.color = Node::RED
+ right_rotate(x.parent)
+ w = x.parent.left
+ end
+ if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+ w.color = Node::RED
+ x = x.parent
+ else
+ if w.left.color == Node::BLACK
+ w.right.color = Node::BLACK
+ w.color = Node::RED
+ left_rotate(w)
+ w = x.parent.left
+ end
+ w.color = x.parent.color
+ x.parent.color = Node::BLACK
+ w.left.color = Node::BLACK
+ right_rotate(x.parent)
+ x = root
+ end
+ end
+ end
+ x.color = Node::BLACK
+ end
+end
+
+def rbt_bm
+ n = 100_000
+ a1 = []; n.times { a1 << rand(999_999) }
+ a2 = []; n.times { a2 << rand(999_999) }
+
+ start = Time.now
+
+ tree = RedBlackTree.new
+
+ n.times {|i| tree.add(i) }
+ n.times { tree.delete(tree.root) }
+
+ tree = RedBlackTree.new
+ a1.each {|e| tree.add(e) }
+ a2.each {|e| tree.search(e) }
+ tree.inorder_walk {|key| key + 1 }
+ tree.reverse_inorder_walk {|key| key + 1 }
+ n.times { tree.minimum }
+ n.times { tree.maximum }
+
+ return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+ # puts rbt_bm.to_f
+ rbt_bm.to_f
+ # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+ attr_reader :next_ring
+ def initialize n = nil
+ @next_ring = n
+ end
+
+
+ def size
+ s = 1
+ ring = self
+ while ring.next_ring
+ s += 1
+ ring = ring.next_ring
+ end
+ s
+ end
+end
+
+ring = Ring.new
+
+max.times{
+ ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+ "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+ symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+ symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
new file mode 100644
index 0000000000..2217274c82
--- /dev/null
+++ b/benchmark/hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str.rb b/benchmark/hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
new file mode 100644
index 0000000000..f75d163fe6
--- /dev/null
+++ b/benchmark/hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+ syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+ syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
new file mode 100644
index 0000000000..9dab8df7be
--- /dev/null
+++ b/benchmark/hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+ syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+ syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
new file mode 100644
index 0000000000..65f521ec94
--- /dev/null
+++ b/benchmark/hash_dup.yml
@@ -0,0 +1,8 @@
+prelude: |
+ small_hash = { a: 1 }
+ larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
+
+benchmark:
+ dup_small: small_hash.dup
+ dup_larger: larger_hash.dup
+loop_count: 10000
diff --git a/benchmark/hash_flatten.rb b/benchmark/hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+1000.times do
+ h.flatten
+end
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
new file mode 100644
index 0000000000..0c7edfed3e
--- /dev/null
+++ b/benchmark/hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_num.rb b/benchmark/hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/hash_ident_str.rb b/benchmark/hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_keys.rb b/benchmark/hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.keys
+end
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
new file mode 100644
index 0000000000..c188529260
--- /dev/null
+++ b/benchmark/hash_literal_small2.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz" } }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
new file mode 100644
index 0000000000..739f71b5b0
--- /dev/null
+++ b/benchmark/hash_literal_small4.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
new file mode 100644
index 0000000000..53d80af535
--- /dev/null
+++ b/benchmark/hash_literal_small8.rb
@@ -0,0 +1,3 @@
+# frozen_string_literal: true
+
+1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
new file mode 100644
index 0000000000..03d9109602
--- /dev/null
+++ b/benchmark/hash_long.rb
@@ -0,0 +1,4 @@
+k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
+k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
+h = {k1 => 0, k2 => 0};
+3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_shift.rb b/benchmark/hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+50000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+ h[i] = nil
+end
+
+300000.times do
+ k, v = h.shift
+ h[k] = v
+end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
new file mode 100644
index 0000000000..45485d9c71
--- /dev/null
+++ b/benchmark/hash_small2.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
new file mode 100644
index 0000000000..acd4084334
--- /dev/null
+++ b/benchmark/hash_small4.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
new file mode 100644
index 0000000000..9cffcc91b6
--- /dev/null
+++ b/benchmark/hash_small8.rb
@@ -0,0 +1 @@
+1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do |i|
+ [i].map(&h)
+end
diff --git a/benchmark/hash_values.rb b/benchmark/hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+ h[i] = nil
+end
+
+5000.times do
+ h.values
+end
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
new file mode 100644
index 0000000000..e22a3f8c30
--- /dev/null
+++ b/benchmark/int_quo.rb
@@ -0,0 +1 @@
+5000000.times { 42.quo(3) }
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
new file mode 100644
index 0000000000..3fd87250a4
--- /dev/null
+++ b/benchmark/io_copy_stream_write.rb
@@ -0,0 +1,24 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ src = Zero.new
+ dst = File.open(IO::NULL, 'wb')
+ n = IO.copy_stream(src, dst)
+rescue Errno::ENOENT
+ # not *nix
+end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
new file mode 100644
index 0000000000..11f369bd0d
--- /dev/null
+++ b/benchmark/io_copy_stream_write_socket.rb
@@ -0,0 +1,35 @@
+# The goal of this is to use a synthetic (non-IO) reader
+# to trigger the read/write loop of IO.copy_stream,
+# bypassing in-kernel mechanisms like sendfile for zero copy,
+# so we wrap the /dev/zero IO object:
+class Zero
+ def initialize
+ @n = 100000
+ @in = File.open('/dev/zero', 'rb')
+ end
+
+ def read(len, buf)
+ return if (@n -= 1) == 0
+ @in.read(len, buf)
+ end
+end
+
+begin
+ require 'socket'
+ src = Zero.new
+ rd, wr = UNIXSocket.pair
+ pid = fork do
+ wr.close
+ buf = String.new
+ while rd.read(16384, buf)
+ end
+ end
+ rd.close
+ IO.copy_stream(src, wr)
+rescue Errno::ENOENT, NotImplementedError, NameError
+ # not *nix: missing /dev/zero, fork, or UNIXSocket
+rescue LoadError # no socket?
+ensure
+ wr.close if wr
+ Process.waitpid(pid) if pid
+end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/io_file_create.rb b/benchmark/io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+ f = open(file, 'w')
+ f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/io_file_read.rb b/benchmark/io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+ f.seek 0
+ f.read
+}
diff --git a/benchmark/io_file_write.rb b/benchmark/io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world! " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+ f.seek 0
+ f.write str
+}
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+ r, w = IO.pipe
+ while i < nr
+ i += 1
+ w.write_nonblock(msg, noex)
+ r.read_nonblock(1, buf, noex)
+ end
+rescue ArgumentError # old Rubies
+ while i < nr
+ i += 1
+ w.write_nonblock(msg)
+ r.read_nonblock(1, buf)
+ end
+ensure
+ r.close
+ w.close
+end
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+ r, w = IO.pipe
+ while i < nr
+ i += 1
+ w.write_nonblock(msg, exception: false)
+ r.read_nonblock(1, buf, exception: false)
+ end
+rescue ArgumentError # old Rubies
+ while i < nr
+ i += 1
+ w.write_nonblock(msg)
+ r.read_nonblock(1, buf)
+ end
+ensure
+ r.close
+ w.close
+end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
new file mode 100644
index 0000000000..6862a8ae61
--- /dev/null
+++ b/benchmark/io_pipe_rw.rb
@@ -0,0 +1,13 @@
+# Measure uncontended GVL performance via read/write with 1:1 threading
+# If we switch to M:N threading, this will benchmark something else...
+r, w = IO.pipe
+src = '0'.freeze
+dst = String.new
+i = 0
+while i < 1_000_000
+ i += 1
+ w.write(src)
+ r.read(1, dst)
+end
+w.close
+r.close
diff --git a/benchmark/io_select.rb b/benchmark/io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+ IO.select nil, w
+}
+
diff --git a/benchmark/io_select2.rb b/benchmark/io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+ ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+ IO.select nil, last
+end
+
diff --git a/benchmark/io_select3.rb b/benchmark/io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+ max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+ max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+ r, w = IO.pipe
+ r.close
+ ios.push w
+end
+
+nr.times do
+ IO.select nil, ios
+end
+
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
new file mode 100644
index 0000000000..ebdc8d7e8b
--- /dev/null
+++ b/benchmark/irb_color.yml
@@ -0,0 +1,13 @@
+prelude: |
+ require 'irb/color'
+ code = <<~'CODE'
+ def self.foo # bar
+ :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
+ end
+ CODE
+benchmark:
+ irb_color_complete: |
+ IRB::Color.colorize_code(code, complete: true)
+ irb_color_incomplete: |
+ IRB::Color.colorize_code(code, complete: false)
+loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
new file mode 100644
index 0000000000..28933f8b38
--- /dev/null
+++ b/benchmark/irb_exec.yml
@@ -0,0 +1,10 @@
+prelude: |
+ # frozen_string_literal: true
+ require 'rbconfig'
+ irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
+benchmark:
+ irb_exec: |
+ IO.popen(irb_f, 'w') do |io|
+ io.write('exit')
+ end
+loop_count: 30
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
new file mode 100644
index 0000000000..d22236e9fb
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/output/driver.rb
@@ -0,0 +1,36 @@
+require 'benchmark_driver/output/simple'
+
+# This replicates the legacy benchmark/driver.rb behavior.
+class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
+ def initialize(*)
+ super
+ @stdout = $stdout
+ @strio = StringIO.new
+ $stdout = IOMultiplexer.new(@stdout, @strio)
+ end
+
+ def with_benchmark(*)
+ super
+ ensure
+ logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
+ puts "\nLog file: #{logfile}"
+
+ $stdout = @stdout
+ File.write(logfile, @strio.tap(&:rewind).read)
+ end
+
+ class IOMultiplexer
+ def initialize(io1, io2)
+ @io1 = io1
+ @io2 = io2
+ end
+
+ [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
+ define_method(method) do |*args|
+ @io1.send(method, *args)
+ @io2.send(method, *args)
+ end
+ end
+ end
+ private_constant :IOMultiplexer
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
new file mode 100644
index 0000000000..3c3453e527
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cstime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cstime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
new file mode 100644
index 0000000000..e139962ef2
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/cutime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :cutime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/mjit_exec.rb b/benchmark/lib/benchmark_driver/runner/mjit_exec.rb
new file mode 100644
index 0000000000..9f7c8c8af3
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/mjit_exec.rb
@@ -0,0 +1,237 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'erb'
+
+# A special runner dedicated for measuring mjit_exec overhead.
+class BenchmarkDriver::Runner::MjitExec
+ METRIC = BenchmarkDriver::Metric.new(name: 'Iteration per second', unit: 'i/s')
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = ::BenchmarkDriver::Struct.new(
+ :name, # @param [String] name - This is mandatory for all runner
+ :metrics, # @param [Array<BenchmarkDriver::Metric>]
+ :num_methods, # @param [Integer] num_methods - The number of methods to be defined
+ :loop_count, # @param [Integer] loop_count
+ :from_jit, # @param [TrueClass,FalseClass] from_jit - Whether the mjit_exec() is from JIT or not
+ :to_jit, # @param [TrueClass,FalseClass] to_jit - Whether the mjit_exec() is to JIT or not
+ )
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ class << JobParser = Module.new
+ # @param [Array,String] num_methods
+ # @param [Integer] loop_count
+ # @param [TrueClass,FalseClass] from_jit
+ # @param [TrueClass,FalseClass] to_jit
+ def parse(num_methods:, loop_count:, from_jit:, to_jit:)
+ if num_methods.is_a?(String)
+ num_methods = eval(num_methods)
+ end
+
+ num_methods.map do |num|
+ if num_methods.size > 1
+ suffix = "[#{'%4d' % num}]"
+ else
+ suffix = "_#{num}"
+ end
+ Job.new(
+ name: "mjit_exec_#{from_jit ? 'JT' : 'VM'}2#{to_jit ? 'JT' : 'VM'}#{suffix}",
+ metrics: [METRIC],
+ num_methods: num,
+ loop_count: loop_count,
+ from_jit: from_jit,
+ to_jit: to_jit,
+ )
+ end
+ end
+ end
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+ def run(jobs)
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ @contexts.each do |context|
+ result = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: true, rest_on_average: :average) do
+ run_benchmark(job, context: context)
+ end
+ value, duration = result.value
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { METRIC => value }, duration: duration, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ if job.from_jit
+ if job.to_jit
+ benchmark = BenchmarkJT2JT.new(num_methods: job.num_methods, loop_count: job.loop_count)
+ else
+ raise NotImplementedError, "JT2VM is not implemented yet"
+ end
+ else
+ if job.to_jit
+ benchmark = BenchmarkVM2JT.new(num_methods: job.num_methods, loop_count: job.loop_count)
+ else
+ benchmark = BenchmarkVM2VM.new(num_methods: job.num_methods, loop_count: job.loop_count)
+ end
+ end
+
+ duration = Tempfile.open(['benchmark_driver-result', '.txt']) do |f|
+ with_script(benchmark.render(result: f.path)) do |path|
+ opt = []
+ if context.executable.command.any? { |c| c.start_with?('--jit') }
+ opt << '--jit-min-calls=2'
+ end
+ IO.popen([*context.executable.command, '--disable-gems', *opt, path], &:read)
+ if $?.success?
+ Float(f.read)
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+
+ [job.loop_count.to_f / duration, duration]
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [Integer] num_methods
+ # @param [Integer] loop_count
+ BenchmarkVM2VM = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:)
+ ERB.new(<<~EOS, trim_mode: '%').result(binding)
+ % num_methods.times do |i|
+ def a<%= i %>
+ nil
+ end
+ % end
+ RubyVM::MJIT.pause if RubyVM::MJIT.enabled?
+
+ def vm
+ t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
+ i = 0
+ while i < <%= loop_count / 1000 %>
+ % 1000.times do |i|
+ a<%= i % num_methods %>
+ % end
+ i += 1
+ end
+ % (loop_count % 1000).times do |i|
+ a<%= i % num_methods %>
+ % end
+ Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
+ end
+
+ vm # warmup call cache
+ File.write(<%= result.dump %>, vm)
+ EOS
+ end
+ end
+ private_constant :BenchmarkVM2VM
+
+ # @param [Integer] num_methods
+ # @param [Integer] loop_count
+ BenchmarkVM2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:)
+ ERB.new(<<~EOS, trim_mode: '%').result(binding)
+ % num_methods.times do |i|
+ def a<%= i %>
+ nil
+ end
+ a<%= i %>
+ a<%= i %> # --jit-min-calls=2
+ % end
+ RubyVM::MJIT.pause if RubyVM::MJIT.enabled?
+
+ def vm
+ t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
+ i = 0
+ while i < <%= loop_count / 1000 %>
+ % 1000.times do |i|
+ a<%= i % num_methods %>
+ % end
+ i += 1
+ end
+ % (loop_count % 1000).times do |i|
+ a<%= i % num_methods %>
+ % end
+ Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
+ end
+
+ vm # warmup call cache
+ File.write(<%= result.dump %>, vm)
+ EOS
+ end
+ end
+ private_constant :BenchmarkVM2JT
+
+ # @param [Integer] num_methods
+ # @param [Integer] loop_count
+ BenchmarkJT2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:)
+ ERB.new(<<~EOS, trim_mode: '%').result(binding)
+ % num_methods.times do |i|
+ def a<%= i %>
+ nil
+ end
+ % end
+
+ # You may need to:
+ # * Increase `JIT_ISEQ_SIZE_THRESHOLD` to 10000000 in mjit.h
+ # * Always return false in `inlinable_iseq_p()` of mjit_compile.c
+ def jit
+ t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
+ i = 0
+ while i < <%= loop_count / 1000 %>
+ % 1000.times do |i|
+ a<%= i % num_methods %>
+ % end
+ i += 1
+ end
+ % (loop_count % 1000).times do |i|
+ a<%= i % num_methods %>
+ % end
+ Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
+ end
+
+ jit
+ jit
+ RubyVM::MJIT.pause if RubyVM::MJIT.enabled?
+ File.write(<%= result.dump %>, jit)
+ EOS
+ end
+ end
+ private_constant :BenchmarkJT2JT
+end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
new file mode 100644
index 0000000000..d04f2e51ff
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/peak.rb
@@ -0,0 +1,151 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ jobs = jobs.map do |job|
+ job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
+ end
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => value }, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render) do |path|
+ output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
+ if $?.success?
+ Integer(f.read)
+ else
+ $stdout.print(output)
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def target
+ 'peak'
+ end
+
+ # Overridden by BenchmarkDriver::Runner::Size
+ def metric
+ METRIC
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ def render
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+#{while_loop(script, loop_count)}
+#{teardown}
+
+result_file, target, memory_status = ARGV
+require_relative memory_status
+
+ms = Memory::Status.new
+case target.to_sym
+when :peak
+ key = ms.respond_to?(:hwm) ? :hwm : :peak
+when :size
+ key = ms.respond_to?(:rss) ? :rss : :size
+else
+ raise('unexpected target: ' + target)
+end
+
+File.write(result_file, ms[key])
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ end
+
+ if times > 1
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ else
+ content
+ end
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
new file mode 100644
index 0000000000..1b31f901c7
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/size.rb
@@ -0,0 +1,25 @@
+require 'benchmark_driver/runner/peak'
+
+# Actually the same as BenchmarkDriver::Runner::Memory
+class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
+ METRIC = BenchmarkDriver::Metric.new(
+ name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
+ )
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Peak#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Peak#target
+ def target
+ 'size'
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
new file mode 100644
index 0000000000..4577fb0bf8
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/stime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :stime
+ end
+end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
new file mode 100644
index 0000000000..64dc14f84e
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/total.rb
@@ -0,0 +1,137 @@
+require 'benchmark_driver/struct'
+require 'benchmark_driver/metric'
+require 'benchmark_driver/default_job'
+require 'benchmark_driver/default_job_parser'
+require 'tempfile'
+
+class BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ # @param [BenchmarkDriver::Config::RunnerConfig] config
+ # @param [BenchmarkDriver::Output] output
+ # @param [BenchmarkDriver::Context] contexts
+ def initialize(config:, output:, contexts:)
+ @config = config
+ @output = output
+ @contexts = contexts
+ end
+
+ # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
+ # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
+ def run(jobs)
+ if jobs.any? { |job| job.loop_count.nil? }
+ raise 'missing loop_count is not supported in Ruby repository'
+ end
+
+ @output.with_benchmark do
+ jobs.each do |job|
+ @output.with_job(name: job.name) do
+ job.runnable_contexts(@contexts).each do |context|
+ duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
+ run_benchmark(job, context: context)
+ end
+ @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
+ @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
+ end
+ end
+ end
+ end
+ end
+ end
+
+ private
+
+ # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
+ # @param [BenchmarkDriver::Context] context
+ # @return [BenchmarkDriver::Metrics]
+ def run_benchmark(job, context:)
+ benchmark = BenchmarkScript.new(
+ preludes: [context.prelude, job.prelude],
+ script: job.script,
+ teardown: job.teardown,
+ loop_count: job.loop_count,
+ )
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ with_script(benchmark.render(result: f.path, target: target)) do |path|
+ IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
+ if $?.success?
+ Float(f.read)
+ else
+ BenchmarkDriver::Result::ERROR
+ end
+ end
+ end
+ end
+
+ # This method is overridden by some subclasses
+ def metric
+ METRIC
+ end
+
+ # This method is overridden by some subclasses
+ def target
+ :total
+ end
+
+ def with_script(script)
+ if @config.verbose >= 2
+ sep = '-' * 30
+ $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
+ end
+
+ Tempfile.open(['benchmark_driver-', '.rb']) do |f|
+ f.puts script
+ f.close
+ return yield(f.path)
+ end
+ end
+
+ # @param [String] prelude
+ # @param [String] script
+ # @param [String] teardown
+ # @param [Integer] loop_count
+ BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
+ # @param [String] result - A file to write result
+ def render(result:, target:)
+ prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
+ <<-RUBY
+#{prelude}
+
+require 'benchmark'
+__bmdv_result = Benchmark.measure {
+ #{while_loop(script, loop_count)}
+}
+
+#{teardown}
+
+File.write(#{result.dump}, __bmdv_result.#{target})
+ RUBY
+ end
+
+ private
+
+ def while_loop(content, times)
+ if !times.is_a?(Integer) || times <= 0
+ raise ArgumentError.new("Unexpected times: #{times.inspect}")
+ elsif times == 1
+ return content
+ end
+
+ # TODO: execute in batch
+ <<-RUBY
+__bmdv_i = 0
+while __bmdv_i < #{times}
+ #{content}
+ __bmdv_i += 1
+end
+ RUBY
+ end
+ end
+ private_constant :BenchmarkScript
+end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
new file mode 100644
index 0000000000..b61d83a188
--- /dev/null
+++ b/benchmark/lib/benchmark_driver/runner/utime.rb
@@ -0,0 +1,22 @@
+require 'benchmark_driver/runner/total'
+
+class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
+ METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
+
+ # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
+ Job = Class.new(BenchmarkDriver::DefaultJob)
+ # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
+ JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
+
+ private
+
+ # Overriding BenchmarkDriver::Runner::Total#metric
+ def metric
+ METRIC
+ end
+
+ # Overriding BenchmarkDriver::Runner::Total#target
+ def target
+ :utime
+ end
+end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
new file mode 100644
index 0000000000..31b770c484
--- /dev/null
+++ b/benchmark/lib/load.rb
@@ -0,0 +1,18 @@
+# How to use this file:
+# 1. write a `$(srcdir)/test.rb` like:
+=begin
+require_relative 'benchmark/lib/load'
+
+Benchmark.driver(repeat_count: 5){|x|
+ x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
+ x.executable name: 'modif-miniruby', command: %w'./miniruby'
+
+ x.report %q{
+ h = {a: 1, b: 2, c: 3, d: 4}
+ }
+}
+=end
+#
+# 2. `make run`
+$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
+require 'benchmark_driver'
diff --git a/benchmark/loop_for.rb b/benchmark/loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+ #
+end
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+ gen = (1..max).each
+ loop do
+ gen.next
+ end
+else
+ require 'generator'
+ gen = Generator.new((0..max))
+ while gen.next?
+ gen.next
+ end
+end
diff --git a/benchmark/loop_times.rb b/benchmark/loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/loop_whileloop.rb b/benchmark/loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+ i += 1
+end
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+ i += 1
+end
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
new file mode 100644
index 0000000000..9b8d0c6afb
--- /dev/null
+++ b/benchmark/marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+ @a = :a
+ @b = :b
+ @c = :c
+end
+100000.times do
+ a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
new file mode 100644
index 0000000000..ffda109912
--- /dev/null
+++ b/benchmark/match_gt4.rb
@@ -0,0 +1 @@
+1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
new file mode 100644
index 0000000000..3b743d484a
--- /dev/null
+++ b/benchmark/match_small.rb
@@ -0,0 +1 @@
+1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/mjit_exec_jt2jt.yml b/benchmark/mjit_exec_jt2jt.yml
new file mode 100644
index 0000000000..5be408e30c
--- /dev/null
+++ b/benchmark/mjit_exec_jt2jt.yml
@@ -0,0 +1,8 @@
+# Usage:
+# RUBYOPT=-Ibenchmark/lib benchmark-driver -e 'ruby --jit' benchmark/mjit_exec_vm2jt.yml
+type: mjit_exec # benchmark/lib/benchmark_driver/runner/mjit_exec.rb
+num_methods: [1]
+#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
+loop_count: 50000000
+from_jit: true
+to_jit: true
diff --git a/benchmark/mjit_exec_vm2jt.yml b/benchmark/mjit_exec_vm2jt.yml
new file mode 100644
index 0000000000..9947dbb7dd
--- /dev/null
+++ b/benchmark/mjit_exec_vm2jt.yml
@@ -0,0 +1,8 @@
+# Usage:
+# RUBYOPT=-Ibenchmark/lib benchmark-driver -e 'ruby --jit' benchmark/mjit_exec_vm2jt.yml
+type: mjit_exec # benchmark/lib/benchmark_driver/runner/mjit_exec.rb
+num_methods: [1]
+#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
+loop_count: 50000000
+from_jit: false
+to_jit: true
diff --git a/benchmark/mjit_exec_vm2vm.yml b/benchmark/mjit_exec_vm2vm.yml
new file mode 100644
index 0000000000..4b84427b10
--- /dev/null
+++ b/benchmark/mjit_exec_vm2vm.yml
@@ -0,0 +1,8 @@
+# Usage:
+# RUBYOPT=-Ibenchmark/lib benchmark-driver -e 'ruby --jit' benchmark/mjit_exec_vm2vm.yml
+type: mjit_exec # benchmark/lib/benchmark_driver/runner/mjit_exec.rb
+num_methods: [1]
+#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
+loop_count: 50000000
+from_jit: false
+to_jit: false
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
new file mode 100644
index 0000000000..79ba4f2177
--- /dev/null
+++ b/benchmark/nil_p.yml
@@ -0,0 +1,9 @@
+prelude: |
+ class Niller; def nil?; true; end; end
+ xnil, notnil = nil, Object.new
+ niller = Niller.new
+benchmark:
+ - xnil.nil?
+ - notnil.nil?
+ - niller.nil?
+loop_count: 10000000
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+ return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+ : Ack($_[0]-1, 1))
+ : $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+ if (not M):
+ return( N + 1 )
+ if (not N):
+ return( Ack(M-1, 1) )
+ return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+ NUM = 9
+ sys.setrecursionlimit(10000)
+ Ack(3, NUM)
+
+main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+ (cond ((zero? m) (+ n 1))
+ ((zero? n) (ack (- m 1) 1))
+ (else (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+ loop
+ ack
+ fib
+ tak
+ fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+ ruby-cyg
+ ../../../test6/miniruby
+ perl
+ python
+ gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+ .rb
+ .rb
+ .pl
+ .py
+ .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+ m = Benchmark.measure{
+ #p cmd
+ system(cmd)
+ }
+ [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+ r = []
+ Lang.each_with_index{|l, idx|
+ cmd = "#{l} #{b}#{Ext[idx]}"
+ r << bench(cmd)
+ }
+ Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+ print b, "\t"
+ puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+ print b, "\t"
+ puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+ my $n = @_[0];
+ if($n < 2){
+ return 1;
+ }
+ else{
+ return $n * fact($n-1);
+ }
+}
+
+for($i=0; $i<10000; $i++){
+ &fact(100);
+}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..1ce9f76275
--- /dev/null
+++ b/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+ r = 1
+ for x in range(2, n+1):
+ r *= x
+ return r
+
+def factR(n):
+ if n < 2:
+ return 1
+ else:
+ return n * factR(n-1)
+
+for i in range(10000):
+ factR(100)
+
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..6cedc752cd
--- /dev/null
+++ b/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+ if n < 2
+ 1
+ else
+ n * fact(n-1)
+ end
+end
+
+i = 0
+while i<10000
+ i += 1
+ fact(100)
+end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+ (if (< n 2)
+ 1
+ (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+ (fact 100))
+
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+ my $n = $_[0];
+ if($n < 3){
+ return 1;
+ }
+ else{
+ return fib($n-1) + fib($n-2);
+ }
+};
+
+&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+ if n < 3:
+ return 1
+ else:
+ return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+ if n < 3
+ 1
+ else
+ fib(n-1) + fib(n-2)
+ end
+end
+
+fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+ (if (< n 3)
+ 1
+ (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+ pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..b367b9dbf3
--- /dev/null
+++ b/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30000000
+ i += 1
+end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+ local($x, $y, $z) = @_;
+ if (!($y < $x)) {
+ return $z;
+ } else {
+ return &tak(&tak($x - 1, $y, $z),
+ &tak($y - 1, $z, $x),
+ &tak($z - 1, $x, $y));
+ }
+}
+&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+ if not(y<x):
+ return z
+ else:
+ return tak(tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+ unless y < x
+ z
+ else
+ tak( tak(x-1, y, z),
+ tak(y-1, z, x),
+ tak(z-1, x, y))
+ end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+ (if (not (< y x))
+ z
+ (tak (tak (- x 1) y z)
+ (tak (- y 1) z x)
+ (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
new file mode 100644
index 0000000000..a6674f82ee
--- /dev/null
+++ b/benchmark/range_last.yml
@@ -0,0 +1,4 @@
+benchmark:
+ - (1..1_000_000).last(100)
+ - (1..1_000_000).last(1000)
+ - (1..1_000_000).last(10000)
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
new file mode 100644
index 0000000000..90a029d5b9
--- /dev/null
+++ b/benchmark/realpath.yml
@@ -0,0 +1,30 @@
+prelude: |
+ f = File
+ pwd = Dir.pwd
+ Dir.mkdir('b') unless f.directory?('b')
+ f.write('b/a', '') unless f.file?('b/a')
+
+ relative = 'b/a'
+ absolute = File.join(pwd, relative)
+ dir = 'b'
+ file = 'a'
+
+ relative_dir = 'b/c'
+ absolute_dir = File.join(pwd, relative_dir)
+ file_dir = 'c'
+benchmark:
+ relative_nil: "f.realpath(relative, nil)"
+ absolute_nil: "f.realpath(absolute, nil)"
+ relative_relative: "f.realpath(file, dir)"
+ absolute_relative: "f.realpath(absolute, dir)"
+ relative_absolute: "f.realpath(relative, pwd)"
+ relative_nil_dir: "f.realdirpath(relative_dir, nil)"
+ absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
+ relative_relative_dir: "f.realdirpath(file_dir, dir)"
+ absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
+ relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
+ relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
+ absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
+ relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
+ absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
+ relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..09f218cf08
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,32 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ 1.upto(10000) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..0c63257106
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,40 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
+ end
+ end
+
+ prepare
+benchmark:
+ require_thread: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ i=0
+ t = Thread.new do
+ while true
+ i = i+1 # dummy loop
+ end
+ end
+
+ 1.upto(100) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+ t.kill
+loop_count: 1
diff --git a/benchmark/securerandom.rb b/benchmark/securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+ SecureRandom.random_number(100)
+end
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
new file mode 100644
index 0000000000..4effa1ecaf
--- /dev/null
+++ b/benchmark/so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+ if m == 0 then
+ n + 1
+ elsif n == 0 then
+ ack(m - 1, 1)
+ else
+ ack(m - 1, ack(m, n - 1))
+ end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
new file mode 100644
index 0000000000..767e03db5f
--- /dev/null
+++ b/benchmark/so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+ x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+ (n-1).step(0,-1) do |bi|
+ y[bi] += x.at(bi)
+ end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/so_binary_trees.rb b/benchmark/so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+ # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+ tree[1]
+ else
+ tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+ item_item = 2 * item
+ depth -= 1
+ [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+ [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+ temp_tree = bottom_up_tree(i, depth)
+ check += item_check(temp_tree)
+
+ temp_tree = bottom_up_tree(-i, depth)
+ check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
new file mode 100644
index 0000000000..4468e20ac8
--- /dev/null
+++ b/benchmark/so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+ i += 1
+ hello = ''
+ 4_000_000.times do |e|
+ hello << STUFF
+ end
+end
+# puts hello.length
+
+
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
new file mode 100644
index 0000000000..99683505f9
--- /dev/null
+++ b/benchmark/so_count_words.yml
@@ -0,0 +1,65 @@
+prelude: |
+ #!/usr/bin/ruby
+
+ wc_input_base = <<EOS
+ Subject: Re: Who was Izchak Miller?
+ From: "Jane D. Anonymous" <nobody@yale.edu>
+ Date: 1996/04/28
+ Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
+ References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+ To: 75176.2330@compuserve.com
+ Content-Type: text/plain; charset=us-ascii
+ Organization: Yale University
+ X-Url: news:4lk6vl$gde@ns.oar.net
+ Mime-Version: 1.0
+ Newsgroups: rec.games.roguelike.nethack
+ X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
+
+ Hello there, Izchak Miller was my father. When I was younger I spent
+ many a night, hunched over the keyboard with a cup of tea, playing
+ nethack with him and my brother. my dad was a philosopher with a strong
+ weakness for fantasy/sci fi. I remember when he started to get involved
+ with the Nethack team- my brother's Dungeons and Dragons monster book
+ found a regular place beside my dad's desk. it's nice to see him living
+ on in the game he loved so much :-).
+ Tamar Miller
+
+ The following is a really long word of 5000 characters:
+
+ wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+ EOS
+
+ # prepare 'wc.input'
+
+ def prepare_wc_input(wcbase)
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ unless FileTest.exist?(wcinput)
+ data = wcbase.dup
+ 13.times{
+ data << data
+ }
+ open(wcinput, 'w'){|f| f.write data}
+ end
+ end
+
+ prepare_wc_input(wc_input_base)
+
+benchmark:
+ so_count_words: |
+ # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+ # http://www.bagley.org/~doug/shootout/
+ # with help from Paul Brannan
+ input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+ nl = nw = nc = 0
+ while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+ end
+ # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
new file mode 100644
index 0000000000..eb205b4df1
--- /dev/null
+++ b/benchmark/so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+class Hi_Exception < Exception
+ def initialize(num)
+ @value = num
+ end
+end
+
+def some_function(num)
+ begin
+ hi_function(num)
+ rescue
+ print "We shouldn't get here, exception is: #{$!.type}\n"
+ end
+end
+
+def hi_function(num)
+ begin
+ lo_function(num)
+ rescue Hi_Exception
+ $HI = $HI + 1
+ end
+end
+
+def lo_function(num)
+ begin
+ blowup(num)
+ rescue Lo_Exception
+ $LO = $LO + 1
+ end
+end
+
+def blowup(num)
+ if num % 2 == 0
+ raise Lo_Exception.new(num)
+ else
+ raise Hi_Exception.new(num)
+ end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+ i += 1
+ some_function(i+1)
+end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+ maxFlips, m, r, check = 0, n-1, n, 0
+ count = (1..n).to_a
+ perm = (1..n).to_a
+
+ while true
+ if check < 30
+ puts "#{perm}"
+ check += 1
+ end
+
+ while r != 1
+ count[r-1] = r
+ r -= 1
+ end
+
+ if perm[0] != 1 and perm[m] != n
+ perml = perm.clone #.dup
+ flips = 0
+ while (k = perml.first ) != 1
+ perml = perml.slice!(0, k).reverse + perml
+ flips += 1
+ end
+ maxFlips = flips if flips > maxFlips
+ end
+ while true
+ if r==n then return maxFlips end
+ perm.insert r,perm.shift
+ break if (count[r] -= 1) > 0
+ r += 1
+ end
+ end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
new file mode 100644
index 0000000000..dcc6b39507
--- /dev/null
+++ b/benchmark/so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+]
+homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_k_nucleotide
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(100_000)
+ script: |
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org
+ #
+ # contributed by jose fco. gonzalez
+ # modified by Sokolov Yura
+
+ seq = String.new
+
+ def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+ end
+
+ def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+ end
+
+ def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+ line = input.gets while line !~ /^>THREE/
+ line = input.gets
+
+ while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+ end
+
+ [1,2].each {|i| sort_by_freq( seq,i ) }
+
+ %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+ loop_count: 1
diff --git a/benchmark/so_lists.rb b/benchmark/so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+ # create a list of integers (Li1) from 1 to SIZE
+ li1 = (1..SIZE).to_a
+ # copy the list to li2 (not by individual items)
+ li2 = li1.dup
+ # remove each individual item from left side of li2 and
+ # append to right side of li3 (preserving order)
+ li3 = Array.new
+ while (not li2.empty?)
+ li3.push(li2.shift)
+ end
+ # li2 must now be empty
+ # remove each individual item from right side of li3 and
+ # append to right side of li2 (reversing list)
+ while (not li3.empty?)
+ li2.push(li3.pop)
+ end
+ # li3 must now be empty
+ # reverse li1 in place
+ li1.reverse!
+ # check that first item is now SIZE
+ if li1[0] != SIZE then
+ p "not SIZE"
+ 0
+ else
+ # compare li1 and li2 for equality
+ if li1 != li2 then
+ return(0)
+ else
+ # return the length of the list
+ li1.length
+ end
+ end
+end
+
+i = 0
+while i<NUM
+ i += 1
+ result = test_lists()
+end
+
+result
diff --git a/benchmark/so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/so_mandelbrot.rb
@@ -0,0 +1,57 @@
+# The Computer Language Benchmarks Game
+# http://shootout.alioth.debian.org/
+#
+# contributed by Karl von Laudermann
+# modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49 # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1 # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+ for x in 0..count_size
+ zr = 0.0
+ zi = 0.0
+ cr = (2.0*x/size)-1.5
+ ci = (2.0*y/size)-1.0
+ escape = false
+
+ # To make use of the for..in code, we use a dummy variable,
+ # like one would in C
+ for dummy in 0..ITER
+ tr = zr*zr - zi*zi + cr
+ ti = 2*zr*zi + ci
+ zr, zi = tr, ti
+
+ if (zr*zr+zi*zi) > LIMIT_SQUARED
+ escape = true
+ break
+ end
+ end
+
+ byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+ bit_num += 1
+
+ # Code is very similar for these cases, but using separate blocks
+ # ensures we skip the shifting when it's unnecessary, which is most cases.
+ if (bit_num == 8)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ elsif (x == count_size)
+ byte_acc <<= (8 - bit_num)
+ print byte_acc.chr
+ byte_acc = 0
+ bit_num = 0
+ end
+ end
+end
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
new file mode 100644
index 0000000000..2d1e72bda9
--- /dev/null
+++ b/benchmark/so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- Ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+ count = 1
+ mx = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ row[j] = count
+ count += 1
+ end
+ mx[bi] = row
+ end
+ mx
+end
+
+def mmult(rows, cols, m1, m2)
+ m3 = Array.new(rows)
+ (0 .. (rows - 1)).each do |bi|
+ row = Array.new(cols, 0)
+ (0 .. (cols - 1)).each do |j|
+ val = 0
+ (0 .. (cols - 1)).each do |k|
+ val += m1.at(bi).at(k) * m2.at(k).at(j)
+ end
+ row[j] = val
+ end
+ m3[bi] = row
+ end
+ m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+ mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
new file mode 100644
index 0000000000..8c136baa6c
--- /dev/null
+++ b/benchmark/so_meteor_contest.rb
@@ -0,0 +1,563 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+# contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM: the main body is at the bottom.
+# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# 2) see how I represent a board as a bitmask by reading the blank_board comments
+# 3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+ # an array (by location) containing a bit mask for how the piece maps at the given location.
+ # if the rotation is invalid at that location the mask will contain false
+ attr_reader :start_masks
+
+ # maps a direction to a relative location. these differ depending on whether it is an even or
+ # odd row being mapped from
+ @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+ @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+ def initialize( directions )
+ @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+ @even_mask = mask_for_offsets( @even_offsets)
+ @odd_mask = mask_for_offsets( @odd_offsets)
+
+ @start_masks = Array.new(60)
+
+ # create the rotational masks by placing the base mask at the location and seeing if
+ # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
+ # is true the piece cannot be placed
+ 0.upto(59) do | offset |
+ mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+ if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+ imask = compute_required( mask, offset)
+ @start_masks[offset] = [ mask, imask, imask | mask ]
+ else
+ @start_masks[offset] = false
+ end
+ end
+ end
+
+ def compute_required( mask, offset )
+ board = blank_board
+ 0.upto(offset) { | i | board |= 1 << i }
+ board |= mask
+ return 0 if (!prunable(board | mask, offset))
+ board = flood_fill(board,58)
+ count = 0
+ imask = 0
+ 0.upto(59) do | i |
+ if (board[i] == 0) then
+ imask |= (1 << i)
+ count += 1
+ end
+ end
+ (count > 0 && count < 5) ? imask : 0
+ end
+
+ def flood_fill( board, location)
+ return board if (board[location] == 1)
+ board |= 1 << location
+ row, col = location.divmod(6)
+ board = flood_fill( board, location - 1) if (col > 0)
+ board = flood_fill( board, location + 1) if (col < 4)
+ if (row % 2 == 0) then
+ board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+ else
+ board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+ board = flood_fill( board, location - 6) if (row > 0)
+ board = flood_fill( board, location + 6) if (row < 9)
+ board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+ end
+ board
+ end
+
+ # given a location, produces a list of relative locations covered by the piece at this rotation
+ def offsets( location)
+ if is_even( location) then
+ @even_offsets.collect { | value | value + location }
+ else
+ @odd_offsets.collect { | value | value + location }
+ end
+ end
+
+ # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+ # this is hard to explain. imagine we have this partial board:
+ # 0 0 0 0 0 x [positions 0-5]
+ # 0 0 1 1 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 1 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # The top-left of the piece is at position 8, the
+ # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+ # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+ # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
+ # 0 0 0 1 1 x [positions 0-5]
+ # 0 0 1 0 0 x [positions 6-11]
+ # 0 0 1 0 0 x [positions 12-17]
+ # 0 1 0 0 0 x [positions 18-23]
+ # 0 0 0 0 0 x [positions 24-29]
+ # 0 0 0 0 0 x [positions 30-35]
+ # ...
+ # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+ # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+ # this function would return
+ def normalize_offsets( values)
+ min = values.min
+ even_min = is_even(min)
+ other_min = even_min ? min + 6 : min + 7
+ other_values = values.collect do | value |
+ if is_even(value) then
+ value + 6 - other_min
+ else
+ value + 7 - other_min
+ end
+ end
+ values.collect! { | value | value - min }
+
+ if even_min then
+ [values, other_values]
+ else
+ [other_values, values]
+ end
+ end
+
+ # produce a bitmask representation of an array of offset locations
+ def mask_for_offsets( offsets )
+ mask = 0
+ offsets.each { | value | mask = mask + ( 1 << value ) }
+ mask
+ end
+
+ # finds a "safe" position that a position as described by a list of directions can be placed
+ # without falling off any edge of the board. the values returned a location to place the first piece
+ # at so it will fit after making the described moves
+ def start_adjust( directions )
+ south = east = 0;
+ directions.each do | direction |
+ east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+ south += 1 if ( direction == :nw || direction == :ne )
+ end
+ south * 6 + east
+ end
+
+ # given a set of directions places the piece (as defined by a set of directions) on the board at
+ # a location that will not take it off the edge
+ def get_values( directions )
+ start = start_adjust(directions)
+ values = [ start ]
+ directions.each do | direction |
+ if (start % 12 >= 6) then
+ start += @@rotation_odd_adder[direction]
+ else
+ start += @@rotation_even_adder[direction]
+ end
+ values += [ start ]
+ end
+
+ # some moves take you back to an existing location, we'll strip duplicates
+ values.uniq
+ end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+# rotations -- all the rotations of the piece
+# type -- a numeic "name" of the piece
+# masks -- an array by location of all legal rotational masks (a n inner array) for that location
+# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+ attr_reader :rotations, :type, :masks
+ attr_accessor :placed
+
+ # transform hashes that change one direction into another when you either flip or rotate a set of directions
+ @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+ @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+ def initialize( directions, type )
+ @type = type
+ @rotations = Array.new();
+ @map = {}
+
+ generate_rotations( directions )
+ directions.collect! { | value | @@flip_converter[value] }
+ generate_rotations( directions )
+
+ # creates the masks AND a map that returns [location, rotation] for any given mask
+ # this is used when a board is found and we want to draw it, otherwise the map is unused
+ @masks = Array.new();
+ 0.upto(59) do | i |
+ even = true
+ @masks[i] = @rotations.collect do | rotation |
+ mask = rotation.start_masks[i]
+ @map[mask[0]] = [ i, rotation ] if (mask)
+ mask || nil
+ end
+ @masks[i].compact!
+ end
+ end
+
+ # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+ def generate_rotations( directions )
+ 6.times do
+ rotations.push( Rotation.new(directions))
+ directions.collect! { | value | @@rotate_converter[value] }
+ end
+ end
+
+ # given a board string, adds this piece to the board at whatever location/rotation
+ # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+ def fill_string( board_string)
+ location, rotation = @map[@placed]
+ rotation.offsets(location).each do | offset |
+ row, col = offset.divmod(6)
+ board_string[ row*5 + col, 1 ] = @type.to_s
+ end
+ end
+end
+
+# a blank bit board having this form:
+#
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 0 0 0 0 0 1
+# 1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+ 0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+ 0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+ (location % 12) < 6
+end
+
+# support function that create three utility maps:
+# $converter -- for each row an array that maps a five bit row (via array mapping)
+# to the a five bit representation of the bits below it
+# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+# a region array has three values the first is a mask of bits in the region,
+# the second is the count of those bits and the third is identical to the first
+# examples:
+# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+# 0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+ odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+ even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+ all_odds = Array.new(0b100000)
+ all_evens = Array.new(0b100000)
+ bit_counts = Array.new(0b100000)
+ new_regions = Array.new(0b100000)
+ 0.upto(0b11111) do | i |
+ bit_count = odd = even = 0
+ 0.upto(4) do | bit |
+ if (i[bit] == 1) then
+ bit_count += 1
+ odd |= odd_map[bit]
+ even |= even_map[bit]
+ end
+ end
+ all_odds[i] = odd
+ all_evens[i] = even
+ bit_counts[i] = bit_count
+ new_regions[i] = create_regions( i)
+ end
+
+ $converter = []
+ 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+ $bit_counts = bit_counts
+ $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five. The following board is an example of a prunable board:
+# 0 0 1 0 0
+# 0 1 0 0 0
+# 1 1 0 0 0
+# 0 1 0 0 0
+# 0 0 0 0 0
+# ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+# board -- an initial bit board (6 bit padded rows, see blank_board for format)
+# location -- starting location, everything above and to the left is already full
+# slotting -- set to true only when testing initial pieces, when filling normally
+# additional assumptions are possible
+#
+# Algorithm:
+# The algorithm starts at the top row (as determined by location) and iterates a row at a time
+# maintainng counts of active open areas (kept in the collector array) each collector contains
+# three values at the start of an iteration:
+# 0: mask of bits that would be adjacent to the collector in this row
+# 1: the number of bits collected so far
+# 2: a scratch space starting as zero, but used during the computation to represent
+# the empty bits in the new row that are adjacent (position 0)
+# The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+ collectors = []
+ # loop across the rows
+ (location / 6).to_i.upto(9) do | row_on |
+ # obtain a set of regions representing the bits of the current row.
+ regions = $regions[(board >> (row_on * 6)) & 0b11111]
+ converter = $converter[row_on]
+
+ # track the number of collectors at the start of the cycle so that
+ # we don't compute against newly created collectors, only existing collectors
+ initial_collector_count = collectors.length
+
+ # loop against the regions. For each region of the row
+ # we will see if it connects to one or more existing collectors.
+ # if it connects to 1 collector, the bits from the region are added to the
+ # bits of the collector and the mask is placed in collector[2]
+ # If the region overlaps more than one collector then all the collectors
+ # it overlaps with are merged into the first one (the others are set to nil in the array)
+ # if NO collectors are found then the region is copied as a new collector
+ regions.each do | region |
+ collector_found = nil
+ region_mask = region[2]
+ initial_collector_count.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ collector_mask = collector[0]
+ if (collector_mask & region_mask != 0) then
+ if (collector_found) then
+ collector_found[0] |= collector_mask
+ collector_found[1] += collector[1]
+ collector_found[2] |= collector[2]
+ collectors[collector_num] = nil
+ else
+ collector_found = collector
+ collector[1] += region[1]
+ collector[2] |= region_mask
+ end
+ end
+ end
+ end
+ if (collector_found == nil) then
+ collectors.push(Array.new(region))
+ end
+ end
+
+ # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+ # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
+ # the board is prunable. if it is a multiple of five it is removed.
+ # Collector that are still active have a new adjacent value [0] set based n the matched bits
+ # and have [2] cleared out for the next cycle.
+ collectors.length.times do | collector_num |
+ collector = collectors[collector_num]
+ if (collector) then
+ if (collector[2] == 0) then
+ return true if (collector[1] % 5 != 0)
+ collectors[collector_num] = nil
+ else
+ # if a collector matches all bits in the row then we can return unprunable early for the
+ # following reasons:
+ # 1) there can be no more unavailable bits bince we fill from the top left downward
+ # 2) all previous regions have been closed or joined so only this region can fail
+ # 3) this region must be good since there can never be only 1 region that is nuot
+ # a multiple of five
+ # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+ # in pieces to see what configurations work for them (the only other time this algorithm is used).
+ return false if (collector[2] == 0b11111 && !slotting)
+ collector[0] = converter[collector[2]]
+ collector[2] = 0
+ end
+ end
+ end
+
+ # get rid of all the empty converters for the next round
+ collectors.compact!
+ end
+ return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+ collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask. see prunable for what a "region" is
+def create_regions( value )
+ regions = []
+ cur_region = 0
+ 5.times do | bit |
+ if (value[bit] == 0) then
+ cur_region |= 1 << bit
+ else
+ if (cur_region != 0 ) then
+ regions.push( cur_region)
+ cur_region = 0;
+ end
+ end
+ end
+ regions.push(cur_region) if (cur_region != 0)
+ regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+ find_top( 1)
+ find_top( 0)
+ print_results
+end
+
+# show the board
+def print_results
+ print "#{@boards_found} solutions found\n\n"
+ print_full_board( @min_board)
+ print "\n"
+ print_full_board( @max_board)
+ print "\n"
+end
+
+# finds solutions. This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece. It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+# Since any found solution has an inverse we want to maximize finding solutions that are not already found
+# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
+# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
+# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
+# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+# maximum number
+def find_top( rotation_skip)
+ board = blank_board
+ (@pieces.length-1).times do
+ piece = @pieces.shift
+ piece.masks[0].each do | mask, imask, cmask |
+ if ((rotation_skip += 1) % 2 == 0) then
+ piece.placed = mask
+ find( 1, 1, board | mask)
+ end
+ end
+ @pieces.push(piece)
+ end
+ piece = @pieces.shift
+ @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found. depth is achieved via recursion. the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+# start_location -- where to start looking for place for the next piece at
+# placed -- number of pieces placed
+# board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+ # find the next location to place a piece by looking for an empty bit
+ while board[start_location] == 1
+ start_location += 1
+ end
+
+ @pieces.length.times do
+ piece = @pieces.shift
+ piece.masks[start_location].each do | mask, imask, cmask |
+ if ( board & cmask == imask) then
+ piece.placed = mask
+ if (placed == 9) then
+ add_board
+ else
+ find( start_location + 1, placed + 1, board | mask)
+ end
+ end
+ end
+ @pieces.push(piece)
+ end
+end
+
+# print the board
+def print_full_board( board_string)
+ 10.times do | row |
+ print " " if (row % 2 == 1)
+ 5.times do | col |
+ print "#{board_string[row*5 + col,1]} "
+ end
+ print "\n"
+ end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+ board_string = "99999999999999999999999999999999999999999999999999"
+ @all_pieces.each { | piece | piece.fill_string( board_string ) }
+ save( board_string)
+ save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+ if (@all_boards[board_string] == nil) then
+ @min_board = board_string if (board_string < @min_board)
+ @max_board = board_string if (board_string > @max_board)
+ @all_boards.store(board_string,true)
+ @boards_found += 1
+
+ # the exit motif is a time saver. Ideally the function should return, but those tests
+ # take noticeable time (performance).
+ if (@boards_found == @stop_count) then
+ print_results
+ exit(0)
+ end
+ end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+ Piece.new( [ :nw, :ne, :east, :east ], 2),
+ Piece.new( [ :ne, :se, :east, :ne ], 7),
+ Piece.new( [ :ne, :east, :ne, :nw ], 1),
+ Piece.new( [ :east, :sw, :sw, :se ], 6),
+ Piece.new( [ :east, :ne, :se, :ne ], 5),
+ Piece.new( [ :east, :east, :east, :se ], 0),
+ Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+ Piece.new( [ :se, :se, :se, :west ], 9),
+ Piece.new( [ :se, :se, :east, :se ], 8),
+ Piece.new( [ :east, :east, :sw, :se ], 3)
+ ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
new file mode 100644