1 files changed, 14 insertions, 0 deletions
diff --git a/spec/ruby/shared/queue/close.rb b/spec/ruby/shared/queue/close.rb
new file mode 100644
index 0000000000..1b0908c27c
--- /dev/null
+++ b/spec/ruby/shared/queue/close.rb
@@ -0,0 +1,14 @@
+describe :queue_close, shared: true do
+  it "may be called multiple times" do
+    q = @object.call
+    q.close
+    q.closed?.should == true
+    q.close # no effect
+    q.closed?.should == true
+  end
+
+  it "returns self" do
+    q = @object.call
+    q.close.should == q
+  end
+end
diff --git a/.document b/.document
new file mode 100644
index 0000000000..8a05d61beb
--- /dev/null
+++ b/.document
@@ -0,0 +1,22 @@
+# This file determines which files in the
+# Ruby hierarchy will be processed by the RDoc
+# tool when it is given the top-level directory
+# as an argument
+
+# Process all the C source files
+*.c
+
+# prelude
+prelude.rb
+
+# the lib/ directory (which has its own .document file)
+
+lib
+
+
+# and some of the ext/ directory (which has its own .document file)
+
+ext
+
+# rdoc files
+doc/*.rdoc
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..2a38da8892
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,757 @@
+define rp
+  if ruby_dummy_gdb_enums.special_consts
+  end
+  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+  else
+  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+    if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+      printf "SYMBOL(:%c)\n", $id
+    else
+    if $id == idDot2
+      echo SYMBOL(:..)\n
+    else
+    if $id == idDot3
+      echo SYMBOL(:...)\n
+    else
+    if $id == idUPlus
+      echo SYMBOL(:+@)\n
+    else
+    if $id == idUMinus
+      echo SYMBOL(:-@)\n
+    else
+    if $id == idPow
+      echo SYMBOL(:**)\n
+    else
+    if $id == idCmp
+      echo SYMBOL(:<=>)\n
+    else
+    if $id == idLTLT
+      echo SYMBOL(:<<)\n
+    else
+    if $id == idLE
+      echo SYMBOL(:<=)\n
+    else
+    if $id == idGE
+      echo SYMBOL(:>=)\n
+    else
+    if $id == idEq
+      echo SYMBOL(:==)\n
+    else
+    if $id == idEqq
+      echo SYMBOL(:===)\n
+    else
+    if $id == idNeq
+      echo SYMBOL(:!=)\n
+    else
+    if $id == idEqTilde
+      echo SYMBOL(:=~)\n
+    else
+    if $id == idNeqTilde
+      echo SYMBOL(:!~)\n
+    else
+    if $id == idAREF
+      echo SYMBOL(:[])\n
+    else
+    if $id == idASET
+      echo SYMBOL(:[]=)\n
+    else
+      printf "SYMBOL(%ld)\n", $id
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+    end
+  else
+  if ($arg0) == RUBY_Qfalse
+    echo false\n
+  else
+  if ($arg0) == RUBY_Qtrue
+    echo true\n
+  else
+  if ($arg0) == RUBY_Qnil
+    echo nil\n
+  else
+  if ($arg0) == RUBY_Qundef
+    echo undef\n
+  else
+  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+    echo immediate\n
+  else
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+    printf "T_NONE: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+    printf "T_NIL: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+    printf "T_OBJECT: "
+    print (struct RObject *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+    printf "T_CLASS%s: ", ($flags & RUBY_FL_SINGLETON) ? "*" : ""
+    print (struct RClass *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+    printf "T_ICLASS: "
+    print (struct RClass *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+    printf "T_MODULE: "
+    print (struct RClass *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+    printf "T_FLOAT: %.16g ", (((struct RFloat*)($arg0))->float_value)
+    print (struct RFloat *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    printf "T_STRING: "
+    set print address off
+    output (char *)(($flags & RUBY_FL_USER1) ? \
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary)
+    set print address on
+    printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+            ((struct RString*)($arg0))->as.heap.len : \
+            (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    if !($flags & RUBY_FL_USER1)
+      printf "(embed) "
+    else
+      if ($flags & RUBY_FL_USER2)
+        printf "(shared) "
+      end
+      if ($flags & RUBY_FL_USER3)
+        printf "(assoc) "
+      end
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+      printf "coderange:unknown "
+    else
+    if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+      printf "coderange:7bit "
+    else
+    if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+      printf "coderange:valid "
+    else
+      printf "coderange:broken "
+    end
+    end
+    end
+    print (struct RString *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+    set $regsrc = ((struct RRegexp*)($arg0))->src
+    set $rsflags = ((struct RBasic*)$regsrc)->flags
+    printf "T_REGEXP: "
+    set print address off
+    output (char *)(($rsflags & RUBY_FL_USER1) ? \
+	    ((struct RString*)$regsrc)->as.heap.ptr : \
+	    ((struct RString*)$regsrc)->as.ary)
+    set print address on
+    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.len : \
+            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    if $flags & RUBY_FL_USER6
+      printf "(none) "
+    end
+    if $flags & RUBY_FL_USER5
+      printf "(literal) "
+    end
+    if $flags & RUBY_FL_USER4
+      printf "(fixed) "
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    print (struct RRegexp *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if ($flags & RUBY_FL_USER1)
+      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+      printf "T_ARRAY: len=%ld ", $len
+      printf "(embed) "
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+	printf " "
+      end
+    else
+      set $len = ((struct RArray*)($arg0))->as.heap.len
+      printf "T_ARRAY: len=%ld ", $len
+      if ($flags & RUBY_FL_USER2)
+	printf "(shared) shared="
+	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+	printf " "
+      else
+	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+      end
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+	printf " "
+      end
+    end
+    print (struct RArray *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+    printf "T_FIXNUM: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+    printf "T_HASH: ",
+    if ((struct RHash *)($arg0))->ntbl
+      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+    end
+    print (struct RHash *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+    printf "T_STRUCT: len=%ld ", \
+      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+       ((struct RStruct *)($arg0))->as.heap.len)
+    print (struct RStruct *)($arg0)
+    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+          ((struct RStruct *)($arg0))->as.ary : \
+          ((struct RStruct *)($arg0))->as.heap.ptr)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+    printf "T_BIGNUM: sign=%d len=%ld ", \
+      (($flags & RUBY_FL_USER1) != 0), \
+      (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+    if $flags & RUBY_FL_USER2
+      printf "(embed) "
+    end
+    print (struct RBignum *)($arg0)
+    x/xw (($flags & RUBY_FL_USER2) ? \
+          ((struct RBignum*)($arg0))->as.ary : \
+          ((struct RBignum*)($arg0))->as.heap.digits)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+    printf "T_RATIONAL: "
+    print (struct RRational *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+    printf "T_COMPLEX: "
+    print (struct RComplex *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+    printf "T_FILE: "
+    print (struct RFile *)($arg0)
+    output *((struct RFile *)($arg0))->fptr
+    printf "\n"
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+    printf "T_TRUE: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+    printf "T_FALSE: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+    if ((struct RTypedData *)($arg0))->typed_flag == 1
+      printf "T_DATA(%s): ", ((struct RTypedData *)($arg0))->type->wrap_struct_name
+      print (struct RTypedData *)($arg0)
+    else
+      printf "T_DATA: "
+      print (struct RData *)($arg0)
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+    printf "T_MATCH: "
+    print (struct RMatch *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+    printf "T_SYMBOL: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+    printf "T_UNDEF: "
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+    printf "T_NODE("
+    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+    printf "): "
+    print *(NODE *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+    printf "T_ZOMBIE: "
+    print (struct RData *)($arg0)
+  else
+    printf "unknown: "
+    print (struct RBasic *)($arg0)
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp
+  Print a Ruby's VALUE.
+end
+
+define nd_type
+  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+  Print a Ruby' node type.
+end
+
+define nd_file
+  print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+  Print the source file name of a node.
+end
+
+define nd_line
+  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+  Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_alen
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+define nd_next
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_cond
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_body
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_else
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_orig
+  printf "u3.value: "
+  rp ($arg0).u3.value
+end
+
+
+define nd_resq
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_ensr
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_1st
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_2nd
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+
+define nd_stts
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+
+define nd_entry
+  printf "u3.entry: "
+  p ($arg0).u3.entry
+end
+
+define nd_vid
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_cflag
+  printf "u2.id: "
+  p ($arg0).u2.id
+end
+
+define nd_cval
+  printf "u3.value: "
+  rp ($arg0).u3.value
+end
+
+
+define nd_cnt
+  printf "u3.cnt: "
+  p ($arg0).u3.cnt
+end
+
+define nd_tbl
+  printf "u1.tbl: "
+  p ($arg0).u1.tbl
+end
+
+
+define nd_var
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_ibdy
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_iter
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_value
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_aid
+  printf "u3.id: "
+  p ($arg0).u3.id
+end
+
+
+define nd_lit
+  printf "u1.value: "
+  rp ($arg0).u1.value
+end
+
+
+define nd_frml
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_rest
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+define nd_opt
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+
+define nd_recv
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_mid
+  printf "u2.id: "
+  p ($arg0).u2.id
+end
+
+define nd_args
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_noex
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_defn
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_old
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_new
+  printf "u2.id: "
+  p ($arg0).u2.id
+end
+
+
+define nd_cfnc
+  printf "u1.cfunc: "
+  p ($arg0).u1.cfunc
+end
+
+define nd_argc
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+
+define nd_cname
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_super
+  printf "u3.node: "
+  rp ($arg0).u3.node
+end
+
+
+define nd_modl
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_clss
+  printf "u1.value: "
+  rp ($arg0).u1.value
+end
+
+
+define nd_beg
+  printf "u1.node: "
+  rp ($arg0).u1.node
+end
+
+define nd_end
+  printf "u2.node: "
+  rp ($arg0).u2.node
+end
+
+define nd_state
+  printf "u3.state: "
+  p ($arg0).u3.state
+end
+
+define nd_rval
+  printf "u2.value: "
+  rp ($arg0).u2.value
+end
+
+
+define nd_nth
+  printf "u2.argc: "
+  p ($arg0).u2.argc
+end
+
+
+define nd_tag
+  printf "u1.id: "
+  p ($arg0).u1.id
+end
+
+define nd_tval
+  printf "u2.value: "
+  rp ($arg0).u2.value
+end
+
+define rb_p
+  call rb_p($arg0)
+end
+
+define rb_numtable_entry
+  set $rb_numtable_tbl = $arg0
+  set $rb_numtable_id = (st_data_t)$arg1
+  set $rb_numtable_key = 0
+  set $rb_numtable_rec = 0
+  if $rb_numtable_tbl->entries_packed
+    set $rb_numtable_p = $rb_numtable_tbl->bins
+    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->bins+$rb_numtable_tbl->num_entries
+      if (st_data_t)$rb_numtable_p[0] == $rb_numtable_id
+	set $rb_numtable_key = (st_data_t)$rb_numtable_p[0]
+	set $rb_numtable_rec = (st_data_t)$rb_numtable_p[1]
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p + 2
+      end
+    end
+  else
+    set $rb_numtable_p = $rb_numtable_tbl->bins[$rb_numtable_id % $rb_numtable_tbl->num_bins]
+    while $rb_numtable_p
+      if $rb_numtable_p->key == $rb_numtable_id
+	set $rb_numtable_key = $rb_numtable_p->key
+	set $rb_numtable_rec = $rb_numtable_p->record
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p->next
+      end
+    end
+  end
+end
+
+define rb_id2name
+  rb_numtable_entry global_symbols.id_str (ID)$arg0
+  if $rb_numtable_rec
+    rp $rb_numtable_rec
+  else
+    echo undef\n
+  end
+end
+document rb_id2name
+  Print the name of id
+end
+
+define rb_method_entry
+  set $rb_method_entry_klass = (struct RClass *)$arg0
+  set $rb_method_entry_id = (ID)$arg1
+  set $rb_method_entry_me = (rb_method_entry_t *)0
+  while !$rb_method_entry_me && $rb_method_entry_klass
+    rb_numtable_entry $rb_method_entry_klass->m_tbl $rb_method_entry_id
+    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+    if !$rb_method_entry_me
+      set $rb_method_entry_klass = (struct RClass *)$rb_method_entry_klass->ptr->super
+    end
+  end
+  if $rb_method_entry_me
+    print *$rb_method_entry_klass
+    print *$rb_method_entry_me
+  else
+    echo method not found\n
+  end
+end
+document rb_method_entry
+  Search method entry by class and id
+end
+
+define rb_classname
+  call classname($arg0)
+  rb_p $
+  print *(struct RClass*)($arg0)
+end
+
+define rb_backtrace
+  call rb_backtrace()
+end
+
+define iseq
+  if dummy_gdb_enums.special_consts
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_NONE
+    echo [none]\n
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_LABEL
+    print *(LABEL*)($arg0)
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_INSN
+    print *(INSN*)($arg0)
+    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+      set $i = 0
+      set $operand_size = ((INSN*)($arg0))->operand_size
+      set $operands = ((INSN*)($arg0))->operands
+      while $i < $operand_size
+	rp $operands[$i++]
+      end
+    end
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+    print *(ADJUST*)($arg0)
+  end
+end
+
+define rb_ps
+  rb_ps_vm ruby_current_vm
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+  print $ps_vm = (rb_vm_t*)$arg0
+  set $ps_threads = (st_table*)$ps_vm->living_threads
+  if $ps_threads->entries_packed
+    set $ps_threads_i = 0
+    while $ps_threads_i < $ps_threads->num_entries
+      set $ps_threads_key = (st_data_t)$ps_threads->bins[$ps_threads_i * 2]
+      set $ps_threads_val = (st_data_t)$ps_threads->bins[$ps_threads_i * 2 + 1]
+      rb_ps_thread $ps_threads_key $ps_threads_val
+      set $ps_threads_i = $ps_threads_i + 1
+    end
+  else
+    set $ps_threads_ptr = (st_table_entry*)$ps_threads->head
+    while $ps_threads_ptr
+      set $ps_threads_key = (st_data_t)$ps_threads_ptr->key
+      set $ps_threads_val = (st_data_t)$ps_threads_ptr->record
+      rb_ps_thread $ps_threads_key $ps_threads_val
+      set $ps_threads_ptr = (st_table_entry*)$ps_threads_ptr->fore
+    end
+  end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_id = $arg1
+  print $ps_thread_th = (rb_thread_t*)$ps_thread->data
+end
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..57557c9c2e
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,131 @@
+*-*-*.def
+*.a
+*.bak
+*.dSYM
+*.dylib
+*.inc
+*.log
+*.o
+*.orig
+*.rej
+*.sav
+*.swp
+*~
+.*-*
+.*.list
+.*.time
+.DS_Store
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+Makefile
+extconf.h
+y.output
+y.tab.c
+
+# /
+/*.pc
+/*_prelude.c
+/COPYING.LIB
+/ChangeLog-1.8.0
+/ChangeLog.pre-alpha
+/ChangeLog.pre1_1
+/Doxyfile
+/GNUmakefile
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/beos
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/doc/capi
+/enc.mk
+/enc/trans/*.c
+/encdb.h
+/exts.mk
+/goruby
+/id.h
+/largefile.h
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/riscos
+/rubicon
+/ruby
+/ruby-man.rd.gz
+/test.rb
+/tmp
+/transdb.h
+/uncommon.mk
+/web
+/yasmdata.rb
+
+# /benchmark/
+/benchmark/bmx_*.rb
+
+# /enc/trans/
+/enc/trans/*.c
+
+# /ext/
+/ext/extinit.c
+
+# /ext/dl/
+/ext/dl/*.func
+
+# /ext/dl/callback/
+/ext/dl/callback/*.func
+/ext/dl/callback/callback-*.c
+/ext/dl/callback/callback.c
+
+# /ext/iconv/
+/ext/iconv/config.charset
+/ext/iconv/iconv.rb
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /ext/tk/
+/ext/tk/config_list
+
+# /spec/
+/spec/mspec
+/spec/rubyspec
+
+# /win32/
+/win32/*.ico
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..6a207a0554
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,21 @@
+-bap
+-nbbb
+-nbc
+-br
+-nbs
+-ncdb
+-ce
+-cli0.5
+-ndj
+-ei
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+
+-TID
+-TVALUE
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..286342c1cc
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,8 @@
+# no installation...
+before_script: autoconf
+script: "./configure && make all test"
+
+branches:
+  only:
+    - trunk
+    - ruby_1_9_3
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..82725534fa
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2010 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/COPYING b/COPYING
index eeb586b392..a1f19ff99d 100644
--- a/COPYING
+++ b/COPYING
@@ -1,340 +1,56 @@
-		    GNU GENERAL PUBLIC LICENSE
-		       Version 2, June 1991
+Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
 
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
-     59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
+  1. You may make and give away verbatim copies of the source form of the
+     software without restriction, provided that you duplicate all of the
+     original copyright notices and associated disclaimers.
 
-			    Preamble
+  2. You may modify your copy of the software in any way, provided that
+     you do at least ONE of the following:
 
-  The licenses for most software are designed to take away your
-freedom to share and change it.  By contrast, the GNU General Public
-License is intended to guarantee your freedom to share and change free
-software--to make sure the software is free for all its users.  This
-General Public License applies to most of the Free Software
-Foundation's software and to any other program whose authors commit to
-using it.  (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.)  You can apply it to
-your programs, too.
+       a) place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+	  modifications to Usenet or an equivalent medium, or by allowing
+	  the author to include your modifications in the software.
 
-  When we speak of free software, we are referring to freedom, not
-price.  Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-this service if you wish), that you receive source code or can get it
-if you want it, that you can change the software or use pieces of it
-in new free programs; and that you know you can do these things.
+       b) use the modified software only within your corporation or
+          organization.
 
-  To protect your rights, we need to make restrictions that forbid
-anyone to deny you these rights or to ask you to surrender the rights.
-These restrictions translate to certain responsibilities for you if you
-distribute copies of the software, or if you modify it.
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
 
-  For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must give the recipients all the rights that
-you have.  You must make sure that they, too, receive or can get the
-source code.  And you must show them these terms so they know their
-rights.
+       d) make other distribution arrangements with the author.
 
-  We protect your rights with two steps: (1) copyright the software, and
-(2) offer you this license which gives you legal permission to copy,
-distribute and/or modify the software.
+  3. You may distribute the software in object code or binary form,
+     provided that you do at least ONE of the following:
 
-  Also, for each author's protection and ours, we want to make certain
-that everyone understands that there is no warranty for this free
-software.  If the software is modified by someone else and passed on, we
-want its recipients to know that what they have is not the original, so
-that any problems introduced by others will not reflect on the original
-authors' reputations.
+       a) distribute the binaries and library files of the software,
+	  together with instructions (in the manual page or equivalent)
+	  on where to get the original distribution.
 
-  Finally, any free program is threatened constantly by software
-patents.  We wish to avoid the danger that redistributors of a free
-program will individually obtain patent licenses, in effect making the
-program proprietary.  To prevent this, we have made it clear that any
-patent must be licensed for everyone's free use or not licensed at all.
+       b) accompany the distribution with the machine-readable source of
+	  the software.
 
-  The precise terms and conditions for copying, distribution and
-modification follow.
-
-		    GNU GENERAL PUBLIC LICENSE
-   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
 
-  0. This License applies to any program or other work which contains
-a notice placed by the copyright holder saying it may be distributed
-under the terms of this General Public License.  The "Program", below,
-refers to any such program or work, and a "work based on the Program"
-means either the Program or any derivative work under copyright law:
-that is to say, a work containing the Program or a portion of it,
-either verbatim or with modifications and/or translated into another
-language.  (Hereinafter, translation is included without limitation in
-the term "modification".)  Each licensee is addressed as "you".
+       d) make other distribution arrangements with the author.
 
-Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope.  The act of
-running the Program is not restricted, and the output from the Program
-is covered only if its contents constitute a work based on the
-Program (independent of having been made by running the Program).
-Whether that is true depends on what the Program does.
+  4. You may modify and include the part of the software into any other
+     software (possibly commercial).  But some files in the distribution
+     are not written by the author, so that they are not under these terms.
 
-  1. You may copy and distribute verbatim copies of the Program's
-source code as you receive it, in any medium, provided that you
-conspicuously and appropriately publish on each copy an appropriate
-copyright notice and disclaimer of warranty; keep intact all the
-notices that refer to this License and to the absence of any warranty;
-and give any other recipients of the Program a copy of this License
-along with the Program.
+     For the list of those files and their copying conditions, see the
+     file LEGAL.
 
-You may charge a fee for the physical act of transferring a copy, and
-you may at your option offer warranty protection in exchange for a fee.
+  5. The scripts and library files supplied as input to or produced as 
+     output from the software do not automatically fall under the
+     copyright of the software, but belong to whomever generated them, 
+     and may be sold commercially, and may be aggregated with this
+     software.
 
-  2. You may modify your copy or copies of the Program or any portion
-of it, thus forming a work based on the Program, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
-    a) You must cause the modified files to carry prominent notices
-    stating that you changed the files and the date of any change.
-
-    b) You must cause any work that you distribute or publish, that in
-    whole or in part contains or is derived from the Program or any
-    part thereof, to be licensed as a whole at no charge to all third
-    parties under the terms of this License.
-
-    c) If the modified program normally reads commands interactively
-    when run, you must cause it, when started running for such
-    interactive use in the most ordinary way, to print or display an
-    announcement including an appropriate copyright notice and a
-    notice that there is no warranty (or else, saying that you provide
-    a warranty) and that users may redistribute the program under
-    these conditions, and telling the user how to view a copy of this
-    License.  (Exception: if the Program itself is interactive but
-    does not normally print such an announcement, your work based on
-    the Program is not required to print an announcement.)
-
-These requirements apply to the modified work as a whole.  If
-identifiable sections of that work are not derived from the Program,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works.  But when you
-distribute the same sections as part of a whole which is a work based
-on the Program, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Program.
-
-In addition, mere aggregation of another work not based on the Program
-with the Program (or with a work based on the Program) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
-  3. You may copy and distribute the Program (or a work based on it,
-under Section 2) in object code or executable form under the terms of
-Sections 1 and 2 above provided that you also do one of the following:
-
-    a) Accompany it with the complete corresponding machine-readable
-    source code, which must be distributed under the terms of Sections
-    1 and 2 above on a medium customarily used for software interchange; or,
-
-    b) Accompany it with a written offer, valid for at least three
-    years, to give any third party, for a charge no more than your
-    cost of physically performing source distribution, a complete
-    machine-readable copy of the corresponding source code, to be
-    distributed under the terms of Sections 1 and 2 above on a medium
-    customarily used for software interchange; or,
-
-    c) Accompany it with the information you received as to the offer
-    to distribute corresponding source code.  (This alternative is
-    allowed only for noncommercial distribution and only if you
-    received the program in object code or executable form with such
-    an offer, in accord with Subsection b above.)
-
-The source code for a work means the preferred form of the work for
-making modifications to it.  For an executable work, complete source
-code means all the source code for all modules it contains, plus any
-associated interface definition files, plus the scripts used to
-control compilation and installation of the executable.  However, as a
-special exception, the source code distributed need not include
-anything that is normally distributed (in either source or binary
-form) with the major components (compiler, kernel, and so on) of the
-operating system on which the executable runs, unless that component
-itself accompanies the executable.
-
-If distribution of executable or object code is made by offering
-access to copy from a designated place, then offering equivalent
-access to copy the source code from the same place counts as
-distribution of the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
-  4. You may not copy, modify, sublicense, or distribute the Program
-except as expressly provided under this License.  Any attempt
-otherwise to copy, modify, sublicense or distribute the Program is
-void, and will automatically terminate your rights under this License.
-However, parties who have received copies, or rights, from you under
-this License will not have their licenses terminated so long as such
-parties remain in full compliance.
-
-  5. You are not required to accept this License, since you have not
-signed it.  However, nothing else grants you permission to modify or
-distribute the Program or its derivative works.  These actions are
-prohibited by law if you do not accept this License.  Therefore, by
-modifying or distributing the Program (or any work based on the
-Program), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Program or works based on it.
-
-  6. Each time you redistribute the Program (or any work based on the
-Program), the recipient automatically receives a license from the
-original licensor to copy, distribute or modify the Program subject to
-these terms and conditions.  You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties to
-this License.
-
-  7. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License.  If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Program at all.  For example, if a patent
-license would not permit royalty-free redistribution of the Program by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Program.
-
-If any portion of this section is held invalid or unenforceable under
-any particular circumstance, the balance of the section is intended to
-apply and the section as a whole is intended to apply in other
-circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system, which is
-implemented by public license practices.  Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
-  8. If the distribution and/or use of the Program is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Program under this License
-may add an explicit geographical distribution limitation excluding
-those countries, so that distribution is permitted only in or among
-countries not thus excluded.  In such case, this License incorporates
-the limitation as if written in the body of this License.
-
-  9. The Free Software Foundation may publish revised and/or new versions
-of the General Public License from time to time.  Such new versions will
-be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
-
-Each version is given a distinguishing version number.  If the Program
-specifies a version number of this License which applies to it and "any
-later version", you have the option of following the terms and conditions
-either of that version or of any later version published by the Free
-Software Foundation.  If the Program does not specify a version number of
-this License, you may choose any version ever published by the Free Software
-Foundation.
-
-  10. If you wish to incorporate parts of the Program into other free
-programs whose distribution conditions are different, write to the author
-to ask for permission.  For software which is copyrighted by the Free
-Software Foundation, write to the Free Software Foundation; we sometimes
-make exceptions for this.  Our decision will be guided by the two goals
-of preserving the free status of all derivatives of our free software and
-of promoting the sharing and reuse of software generally.
-
-			    NO WARRANTY
-
-  11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
-FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
-OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
-PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
-OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
-MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE RISK AS
-TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.  SHOULD THE
-PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
-REPAIR OR CORRECTION.
-
-  12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
-REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
-INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
-OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
-TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
-YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
-PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
-POSSIBILITY OF SUCH DAMAGES.
-
-		     END OF TERMS AND CONDITIONS
-
-	    How to Apply These Terms to Your New Programs
-
-  If you develop a new program, and you want it to be of the greatest
-possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these terms.
-
-  To do so, attach the following notices to the program.  It is safest
-to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least
-the "copyright" line and a pointer to where the full notice is found.
-
-    <one line to give the program's name and a brief idea of what it does.>
-    Copyright (C) 19yy  <name of author>
-
-    This program is free software; you can redistribute it and/or modify
-    it under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 2 of the License, or
-    (at your option) any later version.
-
-    This program is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-    GNU General Public License for more details.
-
-    You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
-
-
-Also add information on how to contact you by electronic and paper mail.
-
-If the program is interactive, make it output a short notice like this
-when it starts in an interactive mode:
-
-    Gnomovision version 69, Copyright (C) 19yy name of author
-    Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
-    This is free software, and you are welcome to redistribute it
-    under certain conditions; type `show c' for details.
-
-The hypothetical commands `show w' and `show c' should show the appropriate
-parts of the General Public License.  Of course, the commands you use may
-be called something other than `show w' and `show c'; they could even be
-mouse-clicks or menu items--whatever suits your program.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the program, if
-necessary.  Here is a sample; alter the names:
-
-  Yoyodyne, Inc., hereby disclaims all copyright interest in the program
-  `Gnomovision' (which makes passes at compilers) written by James Hacker.
-
-  <signature of Ty Coon>, 1 April 1989
-  Ty Coon, President of Vice
-
-This General Public License does not permit incorporating your program into
-proprietary programs.  If your program is a subroutine library, you may
-consider it more useful to permit linking proprietary applications with the
-library.  If this is what you want to do, use the GNU Library General
-Public License instead of this License.
+  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+     PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
new file mode 100644
index 0000000000..5b5b91c149
--- /dev/null
+++ b/COPYING.ja
@@ -0,0 +1,51 @@
+$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(B2-clause BSDL
+$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G$-$^$9(B
+2-clause BSDL$B$K$D$$$F$O(BBSDL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+
+  1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
+
+  2. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$N%=!<%9$r(B
+     $B<+M3$KJQ99$G$-$^$9!%(B
+
+     (a) $B%M%C%H%K%e!<%:$K%]%9%H$7$?$j!$:n<T$KJQ99$rAwIU$9$k(B
+         $B$J$I$NJ}K!$G!$JQ99$r8x3+$9$k!%(B
+
+     (b) $BJQ99$7$?K\%W%m%0%i%`$r<+J,$N=jB0$9$kAH?%FbIt$@$1$G(B
+         $B;H$&!%(B
+
+     (c) $BJQ99E@$rL@<($7$?$&$(!$%=%U%H%&%'%"$NL>A0$rJQ99$9$k!%(B
+         $B$=$N%=%U%H%&%'%"$rG[I[$9$k;~$K$OJQ99A0$NK\%W%m%0%i(B
+         $B%`$bF1;~$KG[I[$9$k!%$^$?$OJQ99A0$NK\%W%m%0%i%`$N%=!<(B
+         $B%9$NF~<jK!$rL@<($9$k!%(B
+
+     (d) $B$=$NB>$NJQ99>r7o$r:n<T$H9g0U$9$k!%(B
+
+  3. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$r%3%s%Q%$(B
+     $B%k$7$?%*%V%8%'%/%H%3!<%I$d<B9T7A<0$G$bG[I[$G$-$^$9!%(B
+
+     (a) $B%P%$%J%j$r<u$1<h$C$??M$,%=!<%9$rF~<j$G$-$k$h$&$K!$(B
+         $B%=!<%9$NF~<jK!$rL@<($9$k!%(B
+
+     (b) $B5!3#2DFI$J%=!<%9%3!<%I$rE:IU$9$k!%(B
+
+     (c) $BJQ99$r9T$C$?%P%$%J%j$OL>A0$rJQ99$7$?$&$(!$%*%j%8%J(B
+         $B%k$N%=!<%9%3!<%I$NF~<jK!$rL@<($9$k!%(B
+
+     (d) $B$=$NB>$NG[I[>r7o$r:n<T$H9g0U$9$k!%(B
+
+  4. $BB>$N%W%m%0%i%`$X$N0zMQ$O$$$+$J$kL\E*$G$"$l<+M3$G$9!%$?(B
+     $B$@$7!$K\%W%m%0%i%`$K4^$^$l$kB>$N:n<T$K$h$k%3!<%I$O!$$=(B
+     $B$l$>$l$N:n<T$N0U8~$K$h$k@)8B$,2C$($i$l$k>l9g$,$"$j$^$9!%(B
+
+     $B$=$l$i%U%!%$%k$N0lMw$H$=$l$>$l$NG[I[>r7o$J$I$KIU$$$F$O(B
+     LEGAL$B%U%!%$%k$r;2>H$7$F$/$@$5$$!%(B
+
+  5. $BK\%W%m%0%i%`$X$NF~NO$H$J$k%9%/%j%W%H$*$h$S!$K\%W%m%0%i(B
+     $B%`$+$i$N=PNO$N8"Mx$OK\%W%m%0%i%`$N:n<T$G$O$J$/!$$=$l$>(B
+     $B$l$NF~=PNO$r@8@.$7$??M$KB0$7$^$9!%$^$?!$K\%W%m%0%i%`$K(B
+     $BAH$_9~$^$l$k$?$a$N3HD%%i%$%V%i%j$K$D$$$F$bF1MM$G$9!%(B
+
+  6. $BK\%W%m%0%i%`$OL5J]>Z$G$9!%:n<T$OK\%W%m%0%i%`$r%5%]!<%H(B
+     $B$9$k0U;V$O$"$j$^$9$,!$%W%m%0%i%`<+?H$N%P%0$"$k$$$OK\%W(B
+     $B%m%0%i%`$N<B9T$J$I$+$iH/@8$9$k$$$+$J$kB;32$KBP$7$F$b@U(B
+     $BG$$r;}$A$^$;$s!%(B
diff --git a/ChangeLog b/ChangeLog
index 3b613bfdd1..b34ed8cda1 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,4453 +1,16435 @@
-Fri Jun 10 13:42:10 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+Sat Nov 10 00:37:02 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* pack.c (pack_pack): template `Z' should be allowed.
+	* siphash.h: check configure macros before include newer headers.
 
-Fri Jun 11 15:21:21 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Nov 10 00:37:02 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/etc/etc.c (etc_group): dumps core if there's no more group.
+	* siphash.c (sip_init_state): use union to suppress warnings by gcc
+	  4.7.
 
-Fri Jun 11 01:50:25 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Nov 10 00:37:02 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (ruby_run): Init_stack() was called too late; local
-	  variables happend to be higher (or lower) than stack_start.
+	* random.c (rb_memhash): use siphash.
 
-Thu Jun 10 16:41:48 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Nov  9 16:17:09 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c: do not call `initialize' for IO objects.  So with Array,
-	  Hash, Range, and Time objects.
-	
-	* ext/curses/curses.c (curses_getch): made thread aware using
-	  rb_read_check().
+	* file.c (append_fspath): revert a part of r37562.
 
-	* ext/curses/curses.c (window_getch): ditto.
+	* file.c (rb_file_expand_path_internal): ditto.
 
-	* ext/curses/curses.c (curses_getstr): made (partially) thread
-	  aware using rb_read_check().
+	* file.c (rb_file_expand_path_internal): ignore the encoding of the
+	  given path name and use filesystem encoding, except when the result
+	  is 8bit range and the filesystem encoding is US-ASCII.
+	  [ruby-dev:39393] [Bug #2154]
 
-	* ext/curses/curses.c (window_getstr): ditto.
+Fri Nov  9 16:15:50 2012  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* io.c (rb_read_check): new function to help making something
-	  (like extension libraries) thread aware.
+	* test/csv/test_features.rb: add require for Tempfile.
+	* test/csv/test_serialization.rb: ditto.
 
-	* eval.c (is_defined): `defined? super' should be true even for
-	  private superclass methods.
+Fri Nov  9 13:47:45 2012  Luis Lavena  <luislavena@gmail.com>
 
-Wed Jun  9 13:26:38 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/win32ole/test_win32ole.rb (test_s_codepage_changed):
+	  FileSystemObject only supports ANSI or UTF-16LE encoding.
+	  Patch by bosko (Bosko Ivanisevic) [ruby-trunk - Bug #6650]
 
-	* eval.c (rb_thread_loading): modified to avoid nested race
-	  condition of require().
+Fri Nov  9 13:16:16 2012  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/tcltklib/tcltklib.c (ip_invoke): queue invocation on non
-	  main threads.
+	* bignum.c (bigmul0): enable big_mul_toom3.
+	  [ruby-core:48552] [Bug #7242]
 
-	* ext/tcltklib/tcltklib.c (lib_mainloop): flush invocation
-	  queues periodically.
+	* bignum.c (bigmul1_toom3): fix incorrect calculation.
+	  the patch is made by Heesob Park.
+	  [ruby-core:48552] [Bug #7242]
 
-	* version.c (ruby_show_version): now print the message to stdout.
+Fri Nov  9 13:16:16 2012  Kenta Murata  <mrkn@mrkn.jp>
 
-	* version.c (ruby_show_copyright): ditto.
+	* bignum.c (bigmul0): disable big_mul_toom3 temporalily.
+	  [ruby-core:48552] [Bug #7242]
 
-Tue Jun  8 00:00:34 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_bignum.rb (test_mul_large_numbers):
+	  add a test for bigmul1_toom3 suggested in [Bug #7242].
 
-	* pack.c (pack_unpack): append sentinel (NUL) to the string.
+Thu Nov  8 17:37:54 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/md5/md5init.c (md5_hexdigest): new method to obtain
-	  printable hash string.
+	* file.c (append_fspath): filesystem encoding is prior to the encoding
+	  of argument.
 
-	* ext/md5/md5init.c (md5_update): should return self.
+	* file.c (rb_file_expand_path_internal, EXPAND_PATH_BUFFER): ignore
+	  the encoding of the given path name, use filesystem encoding always
+	  instead.  [ruby-dev:39393] [Bug #2154]
 
-	* pack.c (pack_pack): undocumented template 'U' for UTF8.
+	* test/ruby/test_file_exhaustive.rb: removed 2.0 spec tests.
 
-	* pack.c (pack_unpack): ditto.
+Thu Nov  8 17:33:53 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* ext/zlib/extconf.rb: Recognize zlibwapi as linking library.
+	  Patch by Daniel Berger.
+
+	  [ruby-core:44979] [Feature #6421]
+
+Thu Nov  8 16:17:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_dir_m17n.rb: remove a garbage.
+
+Thu Nov  8 15:22:09 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_dir_m17n.rb: sorry, typo.
+
+Thu Nov  8 14:50:02 2012  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_win32ole_variant.rb: setting WIN32OLE.locale
+	  to pass some assertion.  Thanks to Hiroshi Shirosaki.
+	  [ruby-core:46873][Bug #6814]
+
+Thu Nov  8 14:46:17 2012  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_win32ole.rb (test_s_codepage_changed):
+	  FileSystemObject only supports ANSI or UTF-16LE encoding.
+	  Patch by h.shirosaki (Hiroshi Shirosaki) [ruby-trunk - Bug #6650]
+
+
+Thu Nov  8 14:43:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_dir_m17n.rb: refactoring. RE should be in the left side
+	  of the =~ operator, and compare the result with nil is meaningless.
+
+Thu Nov  8 14:43:17 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* test/ruby/test_dir_m17n.rb (create_and_check_raw_file_name): add new
+	  helper method to ease encoding testing. Patch by Oleg Sukhodolsky.
+	  [ruby-core:46589][Bug #6765]
+
+	* test/ruby/test_dir_m17n.rb (test_filename_extutf8): use filesystem
+	  encoding when reading entries and comparing.
+
+	* test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_name): removed.
+
+	* test/ruby/test_dir_m17n.rb (test_filename_utf8_raw_jp_name): split test.
+
+Thu Nov  8 14:16:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (MakeMakefile#timestamp_file): use .-. instead of !, a
+	  special character of NMAKE and BSD make.  [Bug #7265]
+
+Thu Nov  8 14:16:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (MakeMakefile#timestamp_file): use ! instead of %, a GNU
+	  make special character.
+
+Thu Nov  8 14:16:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): use timestamp for destination
+	  directories to make them before making or copying files there.
+	  [ruby-dev:46067] [Bug #6904]
+
+Thu Nov  8 14:13:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (visibility_option): visibility attribute is not
+	  available before GCC 4, so do not use -fvisibility option in that
+	  case.  [ruby-core:48147] [Bug #7205]
+
+Thu Nov  8 14:11:49 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (rb_vm_jump_tag_but_local_jump): pass through thrown objects.
+	  [ruby-dev:46234] [Bug #7185]
+
+	* vm_eval.c (rb_eval_cmd): if state is non-zero, val should be nil and
+	  rb_vm_jump_tag_but_local_jump() just jump tag.
+
+Thu Nov  8 14:09:18 2012  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_add),
+	  test/bigdecimal/test_bigdecimal.rb:
+	  need to specify precision for converting Rational and Float.
+	  [ruby-core:48045] [Bug #7176]
+
+Thu Nov  8 14:05:31 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (has_redirection): should use shell (cmd.exe) when
+	  the commandline containts '&'.
+	  reported by Roger Pack at [ruby-core:47912] [Bug #7143], and
+	  patched by Heesob Park at [ruby-core:47931].
+
+Fri Oct 26 17:22:18 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (append_fspath): need to set the encoding to result always.
+
+Fri Oct 26 11:03:46 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
+	  (rb_enc_path_last_separator, rb_enc_path_end)
+	  (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
+	  path handling functions.
+
+	* file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
+	  (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
+	  (rb_file_join): should respect the encodings of arguments than
+	  file system encoding.  [ruby-dev:45145] [Bug #5919]
+
+	* dir.c (check_dirname, ruby_glob0): ditto.
+
+	* ext/pathname/pathname.c (path_sub_ext): ditto.
+
+Fri Oct 26 11:03:46 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* util.c, include/ruby/util.h (ruby_add_suffix): remove the function.
+	  [Bug #5153] [ruby-core:38736]
+
+	* io.c (argf_next_argv): remove the call of above function.
+
+	* ext/-test-/add_suffix, test/-ext-/test_add_suffix.rb: remove the test
+	  extension module because this is only for testsing ruby_add_suffix().
+
+	* LEGAL: remove the mention about a part of util.c, because now we
+	  removed the part.
+
+	* io.c (argf_next_argv): now the new filename is not guranteed to
+	  use, so should check the return value of rename(2).
+
+	* test/ruby/test_argf.rb (TestArgf#test_inplace_rename_impossible):
+	  now we expect same result with other platforms on no_safe_rename
+	  platforms (=Windows).
+
+Thu Oct 25 18:16:25 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/rubygems/installer.rb (check_that_user_bin_dir_is_in_path):
+	  test_generate_bin_bindir_with_user_install_warning(TestGemInstaller)
+	  fails on Windows with msys bash. It makes comparing paths
+	  case-insensitive.
+	  pick from upstream to fix a failure of test-all [ruby-core:47711]
+	  https://github.com/rubygems/rubygems/commit/c474edb2f3704206f04da1c8c6cf9fb079d84abe
+
+Thu Oct 25 17:55:01 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/etc/test_etc.rb (TestEtc#test_getpwuid): `s' is never set to nil.
+
+Thu Oct 25 16:59:17 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* test/ruby/test_file_exhaustive.rb: fix test introduced in r36811 for
+	  posix environments where HOME is not defined.  [ruby-core:47322]
+
+Thu Oct 25 16:59:17 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* configure.in (mingw): add shlwapi to the list of dependency
+	  libs for Windows.
+	* win32/Makefile.sub (EXTSOLIBS): ditto.
+
+	* internal.h: declare internal functions rb_w32_init_file,
+	  rb_file_expand_path_internal and rb_file_expand_path_fast.
+
+	* file.c (Init_File): invoke Windows initialization rb_w32_init_file
+
+	* win32/file.c (rb_file_load_path_internal): new function.
+	  Windows-specific implementation that replaces file_expand_path.
+	  [Bug #6836][ruby-core:46996]
+
+	* win32/file.c (rb_w32_init_file): new function. Initialize codepage
+	  cache for faster conversion encodings lookup.
+
+	* file.c (file_expand_path): rename to rb_file_expand_path_internal.
+	  Conditionally exclude from Windows.
+
+	* file.c (rb_file_expand_path_fast): new function. delegates to
+	  rb_file_expand_path_internal without performing a hit to the
+	  filesystem.
+
+	* file.c (file_expand_path_1): use rb_file_expand_path_internal without
+	  path expansion (used by require).
+	* file.c (rb_find_file_ext_safe): ditto.
+	* file.c (rb_find_file_safe): ditto.
+
+	* load.c (rb_get_expanded_load_path): use rb_file_expand_path_fast.
+	* load.c (rb_feature_provided): ditto.
+
+	* file.c (rb_file_expand_path): use rb_file_expand_path_internal with
+	  path expansion.
+	* file.c (rb_file_absolute_path): ditto.
+
+	* test/ruby/test_file_exhaustive.rb: new tests to exercise
+	  rb_file_expand_path_internal implementation and compliance with
+	  existing behaviors.
+
+Thu Oct 25 16:59:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/file.c (INVALID_FILE_ATTRIBUTES): define for old SDK.
+
+Thu Oct 25 16:59:17 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/makedirs.bat: new command to make intermediate
+	  directories, and not to report any errors if the directory
+	  already exists.
+
+	* win32/Makefile.sub (MAKEDIRS): enable command extensions.
+
+Thu Oct 25 16:59:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/Makefile.sub (MAKEDIRS): use mkdir of cmd.exe instead of ruby.
+	  [Bug #6103] [ruby-core:43012]
+
+	* win32/README.win32: added a notice about command extension of cmd.exe.
+
+Thu Oct 25 16:59:17 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* Makefile.in (PLATFORM_DIR): add a variable for `win32` directory.
+	* Makefile.in (clean-platform): add new target.
+	  It cleans `win32` directory.
+
+	* common.mk (clean): add a dependency for `win32` directory.
+	* common.mk (distclean): ditto.
+	* common.mk (distclean-platform): add new target.
+	  It cleans `win32` directory.
+	* common.mk ($(PLATFORM_D)): add new target to make `win32` directory.
+	* common.mk (win32/win32.$(OBJEXT)): move win32.o into `win32`
+	  directory.
+	* common.mk (win32/file.$(OBJEXT)): add new target for win32/file.c.
+
+	* configure.in: move win32.o into `win32` directory and add
+	  win32/file.o to MISSING.
+
+	* file.c (file_load_ok, rb_file_load_ok): replace static
+	  file_load_ok() with public rb_file_load_ok().
+	  It's to link Windows implementation in win32/file.c.
+	* file.c (rb_find_file_ext_safe): ditto.
+	* file.c (rb_find_file_safe): ditto.
+
+	* win32/file.c (rb_file_load_ok): new file. Add Windows specific
+	  optimized implementation of rb_file_load_ok(). We created a
+	  separated file to avoid too many #ifdef macro which is unreadable.
+
+	* win32/Makefile.sub (PLATFORM_DIR): add a variable for `win32`
+	  directory.
+	* win32/Makefile.sub (MISSING): move win32.obj into `win32`
+	  directory and add win32/file.obj to MISSING.
+	* win32/Makefile.sub (MAKEDIRS): replace MINIRUBY with BASERUBY.
+	  It's because miniruby doesn't exist when making `win32` directory.
+	* win32/Makefile.sub (clean-platform): add new target to clean `win32`
+	  directory.
+	* win32/Makefile.sub ({$(srcdir)}.c{}.obj): make it not match
+	  win32/file.c to build properly.
+	* win32/Makefile.sub (win32/win32.$(OBJEXT)): move win32.obj into
+	 `win32` directory.
+
+	  Patch created with Luis Lavena.
+	  [ruby-core:42480] [Feature #5999]
+
+Fri Oct 19 13:28:29 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (opt-dir): allow multiple directories separated by
+	  $PATH_SEPARATOR as well as dir_config in mkmf.rb. [ruby-core:47868]
+	  [Bug #7120]
+
+Tue Oct 16 11:18:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (dir_config, init_mkmf): use configured libdir value as
+	  default library path.  [ruby-core:43726] [Bug #6207]
+
+Tue Oct 16 10:56:55 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_find_file_ext_safe, rb_find_file_safe): default to
+	  US-ASCII for encdb and transdb.
+
+	* load.c (search_required): keep encoding of feature name.  set
+	  loading path to filesystem encoding.  [Bug #6377][ruby-core:44750]
+
+	* ruby.c (add_modules, require_libraries): assume default external
+	  encoding as well as ARGV.
+
+Tue Oct 16 10:47:43 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (random_s_rand): ensure default PRNG is re-initialized
+	  after fork.  patched by Eric Wong.  [ruby-core:41209][Bug #5661]
+
+Tue Oct 16 10:21:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (rb_f_sub, rb_f_gsub): pass the given block.
+	  [ruby-core:47967] [Bug #7157]
+
+Tue Oct 16 09:47:47 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): use
+	  Regexp.new instead of literal to ignore a parser warning.
+
+Tue Oct 16 09:47:47 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): ignoring
+	  warnings are already set in setup method.
+
+Sun Oct 14 01:21:42 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* regparse.c (parse_char_class): should match with a hyphen after a
+	  range in a character class.
+
+	* test/ruby/test_regexp.rb (TestRegexp#test_char_class): fixed wrong
+	  test.
+
+	* test/ruby/test_regexp.rb (TestRegexp#check): now can accept the
+	  error message.
+
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): renamed
+	  because the previous name was wrong.
+
+	* test/ruby/test_regexp.rb
+	  (TextRegexp#test_raw_hyphen_and_tk_char_type_after_range): added
+	  more test pattern.
+
+Sat Oct 13 01:41:38 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* regparse.c (parse_char_class): also need to check the type of token
+	  after raw hyphen in regexp class, because the charcter code area
+	  is union'ed with the property of TK_CHAR_TYPE.
+	  reported by Bushi Zhang at [ruby-core:47115] [Backport #6853].
+
+Sat Oct 13 01:39:46 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_regexp.rb
+	  (TestRegexp#test_raw_hyphen_and_type_char_after_range): added new
+	  test. ref [ruby-core:47115] [Backport #6853]
+
+Fri Oct 12 18:19:35 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_get_path_check): path name must not contain NUL bytes.
+
+Fri Oct 12 17:51:43 2012  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* error.c (exc_to_s, name_err_to_s, name_err_mesg_to_str): do not
+	  taint messages.
+
+Fri Oct 12 16:11:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (LIBDIR_BASENAME): use configured libdir value to fix
+	  --enable-load-relative on systems where libdir is not default value,
+	  overridden in config.site files.  [ruby-core:47267] [Bug #6903]
+
+	* ruby.c (ruby_init_loadpath_safe): ditto.
+
+Fri Oct 12 13:56:01 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* test/rexml/test_encoding.rb:
+	  Add require 'require 'rexml/document'
+
+Fri Oct 12 13:36:32 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* numeric.c (flodivmod): must through the same pass if HAVE_FMOD or not.
+	  this is a bugfix of r35013.
+
+Fri Oct 12 13:28:37 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (rb_cloexec_fcntl_dupfd): get rid of compile error on windows.
+	  reported by Donovan Lampa at [ruby-core:43152] [Backport #6127],
+	  based on a patch by Hiroshi Shirosaki at [ruby-core:47917].
+
+Fri Oct 12 00:30:17 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (ioctl_narg_len, linux_iocparm_len): reinstantiate linux
+	  specific narg length calculation.
+	* test/ruby/test_io.rb (test_ioctl_linux2): add new test for old and
+	  unstructured ioctl.
+
+Fri Oct 12 00:30:17 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (ioctl_narg_len): don't use _IOC_SIZE macro on Linux.
+	  On Linux some constants for ioctl(2) doesn't include the size of
+	  its return value and 16bit value; for example FIONREAD 0x541B.
+	  Moreover the manual, ioctl_list(2),  says "Note  that  the  size
+	  bits  are  very unreliable: in lots of cases they are wrong,
+	  either because of buggy macros using sizeof(sizeof(struct)),
+	  or because of legacy values."
+	  So we shouldn't use it.
+
+Tue Sep 25 09:30:36 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/mkexports.rb: should not export DllMain().
+	  reported by luis at [ruby-core:46743] [Bug #6790], solved by
+	  Heesob Park, and confirmed by nobu.
+
+Mon Sep 24 16:34:07 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* include/ruby/win32.h (rb_w32_pow): add new function.
+	  We use powl() instead of broken pow() for x64-mingw32. This workaround
+	  fixes test failures related to floating point numeric.
+	  [ruby-core:46686] [Bug #6784]
+
+Mon Sep 24 10:38:55 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* test/win32ole/test_win32ole_method.rb (is_ruby64?): Correct platform
+	  used to identify mingw-w64 (x64-mingw32). Patch by Hiroshi Shirosaki.
+	  [ruby-core:46651][Bug #6782]
+
+Mon Sep 24 10:37:56 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/test/unit/parallel.rb: workaround fix for rubygems.
+	  RubyGems can't find rake if the source directory is not equal to
+	  the directory which is running the test. [Bug #6604]
+
+Fri Sep 21 19:53:38 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/dl/cfunc.c (rb_dlcfunc_call): should convert a Bignum value to
+	  unsigned long long on Win64.
+	  [ruby-core:44636][Bug #6364] reported by raylinn@gmail.com (ray linn)
+
+Fri Sep 21 18:45:20 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* include/ruby/win32.h: undef stat to silence mingw-w64 stat
+	  redefinition warnings (GCC 4.6.3).
+
+Fri Sep 21 17:54:54 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: add -Wall always.
+
+Thu Sep 20 10:23:37 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (native_cond_initialize): destroy condattr
+	  after using it. Patch by Stanislav Sedov. Thank you.
+	  [Bug #7041] [ruby-core:47619]
+
+Sun Sep  9 23:01:43 2012  Tanaka Akira  <akr@fsij.org>
+
+	* ext/zlib/extconf.rb: detect z_crc_t type which will be defined
+	  since zlib-1.2.7.
+
+	* ext/zlib/zlib.c (rb_zlib_crc_table): use z_crc_t if available.
+
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/zlib/extconf.rb: Use an exception instaed of bare puts.
+
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/psych/extconf.rb: Use an exception instaed of bare abort.
+
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/fiddle/extconf.rb: Use an exception instaed of bare abort.
+
+Sun Sep  9 02:44:21 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/readline/extconf.rb: Use an exception instead of bare exit.
+
+Sun Sep  9 02:34:39 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/extmk.rb: Show a message when extconf.rb raised an exception.
+	* ext/openssl/extconf.rb: Use exception raising instead of message
+	  and/or abort. We want to display error message to console _and_
+	  logging into mkmf.log.
+
+Sun Sep  9 02:30:20 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_mutex_lock): stop multiple threads use
+	  pthread_cond_timedwait() concurrently. [Bug #6278] [ruby-core:44275]
+
+Thu Aug 30 09:24:43 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/ftp.rb (URI::FTP#initialize): raise InvalidURIError if "//"
+	  is not present [ruby-core:47344] [Bug #6945]
+
+Tue Aug 28 00:40:14 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/webrick/test_cgi.rb (TestWEBrickCGI#start_cgi_server): there are
+	  no guarantee of existance of RbConfig::CONFIG['LIBPATHENV'].
+	  it only exists in Unix-like environments.
+
+	* test/webrick/test_filehandler.rb
+	  (WEBrick::TestFileHandler#test_script_disclosure): ditto.
+
+Thu Aug 23 12:08:25 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* test/ruby/test_file_exhaustive.rb
+	  (TestFileExhaustive#test_stat_special_file): add a test.
+	  GetFileAttributesExW fails to get attributes of special files
+	  such as pagefile.sys.
+
+	* win32/win32.c (check_valid_dir): for performance, check the path
+	  by FindFirstFileW only if the path contains "...".
+
+	* win32/win32.c (winnt_stat): use GetFileAttributesExW instead of
+	  FindFirstFileW since GetFileAttributesExW is faster.
+	  Based on the patch by Dusan D. Majkic.
+	  [ruby-core:47083] [Feature #6845]
+
+Thu Aug 23 11:19:51 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread_pthread.c (ruby_init_stack): STACK_GROW_DIR_DETECTION is
+	  necessary on platforms with unknown stack direction.  [Bug #6761]
+
+Thu Aug 23 11:19:51 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (get_stack): Linux is the only OS which includes
+	  the size of guard page into the stack size.
+
+Thu Aug 23 11:19:51 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.h (IS_STACK_DIR_UPPER): utility macro.
+
+	* thread_pthread.c (get_stack): seems stack size does not include
+	  guard size on Mac OS X.
+
+	* thread_pthread.c (ruby_init_stack): adjust stack size for offset of
+	  addr from the bottom.
+
+Thu Aug 23 11:19:51 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread_pthread.c (ruby_init_stack): use stack info if possible.
+
+Mon Aug 20 17:11:01 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* file.c (file_path_convert): don't convert it when the path string is
+	  ascii only. [ruby-core:41556] [Bug #5733]
+	  tests are contributed by nobu.
+
+Thu Aug  9 22:48:58 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* pack.c (pack_unpack): when unpack('M') occurs an illegal byte
+	  sequence, output the "=" character and the following character in
+	  the decoded data without any transformation.
+	  [ruby-dev:44875] [Bug #5635]
+
+Tue Jul 31 10:36:12 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: updated to released version.
+
+	* ext/psych/psych.gemspec: ditto
+
+Thu Jul 19 09:33:46 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/emitter.c (initialize): allow a configuration object to be
+	  passed to the constructor so that mutation isn't required after
+	  instantiation.
+
+	* ext/psych/lib/psych/handler.rb: add configuration object
+
+	* ext/psych/lib/psych/visitors/emitter.rb: use configuration object if
+	  extra configuration is present.
+
+Tue Jul 17 03:56:34 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: strings with YAML anchors
+	  are properly referenced. Patched by Joe Rafaniello via Github:
+	    https://github.com/tenderlove/psych/pull/69
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
+	* test/psych/test_alias_and_anchor.rb: test for change
+
+Sat Jun 16 01:27:14 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bumping psych to 1.3.3
+	* ext/psych/psych.gemspec: ditto
+
+Fri May 18 15:53:05 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/psych/extconf.rb: Use an exception instaed of bare abort.
+
+Fri May 18 01:28:21 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c (transcode_string): fix encoding index names.
+	  Thanks markizko for reporting.
+
+Wed May 16 05:11:29 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix a bug with string
+	  subclass dumping and loading.
+
+	* test/psych/test_array.rb: pertinent tests
+
+	* test/psych/test_string.rb: ditto
+
+Wed May 16 01:31:21 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: convert omap tagged maps to
+	  Psych::Omap objects rather than hashes. [Bug #6425]
+
+	* test/psych/test_omap.rb: pertinent test.
+
+Wed May 16 01:15:45 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: keep a reference to
+	  custom coders so that GC does not impact dumped yaml reference ids.
+
+Mon Apr 30 04:43:53 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/json/yaml_events.rb: implicit styles should not
+	  be changeable for JSON events.
+
+Sun Jul 29 04:32:31 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (ruby_pc): make configurable.  [Bug #6051]
+
+Sun Jul 29 04:32:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/ruby.pc.in: added rubylibprefix, {rubylib,vendor,site}dir
+	  and {ruby,vendor,site}archdir.  [ruby-core:42766][Feature #6052]
+
+Sun Jul 29 04:31:01 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* bignum.c: Added #include <strings.h> for ffs(). Patch by Perry
+	  Smith. Thank you. [Bug #6748]
+
+Sat Jul 28 04:04:01 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/intern.h (rb_num_zerodiv): Added NORETURN.
+	  Patched by Xi Wang. [Bug #6736]
+
+Wed Jul  4 19:36:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/dl/cfunc.c (rb_dlcfunc_call): also needed the workaround for VC8
+	  for x64.  [ruby-dev:45875] [Bug #6676]
+	  reported by aves_ramphastos (Seigo Ishigane)
+
+Tue Jul  3 19:37:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rmext): no extension to strip if empty string.
+
+	* proc.c (rb_vm_rewrite_dfp_in_errinfo): Fix `unexpected return'
+	occurs when a proc is called in ensure. [Backport #6460]
+
+Tue Jul  3 11:44:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_enc_path_next, rb_enc_path_skip_prefix)
+	  (rb_enc_path_last_separator, rb_enc_path_end)
+	  (ruby_enc_find_basename, ruby_enc_find_extname): encoding-aware
+	  path handling functions.
+
+	* file.c (rb_home_dir, file_expand_path, rb_realpath_internal)
+	  (rb_file_s_basename, rb_file_dirname, rb_file_s_extname)
+	  (rb_file_join): should respect the encodings of arguments than
+	  file system encoding.  [ruby-dev:45145] [Bug #5919]
+
+	* dir.c (check_dirname, ruby_glob0): ditto.
+
+	* ext/pathname/pathname.c (path_sub_ext): ditto.
+
+Tue Jul  3 11:43:46 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_chdir, check_dirname): get rid of optimization-out.
+
+Thu Jun 28 17:57:49 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (is_socket, is_console): add prototypes to fix compile
+	  problem with gcc introduced at r32549.
+
+Wed Jun 27 08:31:50 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* insns.def (splatarray): make new array if flag is set.
+
+	* compile.c (iseq_compile_each): make new array with
+	  splat. [ruby-core:21901][Feature #1125]
+
+Wed Jun 27 04:23:26 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_sysinit): let the system not display the
+	  critical-error-handler message box and the Windows Error Reporting
+	  dialog.  [ruby-core:45389] [Bug #6535]
+
+Wed Jun 27 04:20:41 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* bignum.c (rb_big_pow): estimate result bit size more precisely.
+	  [ruby-core:30735][Feature #3429]
+
+Tue Jun 26 20:36:53 2012  Tanaka Akira  <akr@fsij.org>
+
+	* lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
+	  OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
+	  http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
+	  reported by Bohuslav Kabrda.
+	  [ruby-core:43844] [ruby-trunk - Bug #6221]
+
+Tue Jun 26 20:35:59 2012  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/zlib/zlib.c (do_inflate):  Inflate more data if buffered data
+	  exists.  Allows Zlib::Inflate#set_dictionary to work.
+	  [ruby-trunk - Bug #5929]
+
+Thu Jun 21 13:42:57 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread.c (rb_threadptr_execute_interrupts_common):
+	  test_signal_requiring of test/ruby/test_signal.rb fail if the sub
+	  process is killed on waiting IO in lex_io_gets in rb_load_file in
+	  rb_load_internal in require.
+	  This is because
+	  (1) the process receive the killing signal in
+	      rb_thread_io_blocking_region in rb_read_internal in lex_io_gets.
+	  (2) set th->errinfo as INT2FIX(TAG_FATAL) at
+	      rb_threadptr_execute_interrupts_common.
+	  (3) escape rb_load_file in rb_load_internal and jump to EXEC_TAG()
+	      without set loaded as TRUE.
+	  (4) call first rb_exc_raise(GET_THREAD()->errinfo); because loaded
+	      is FALSE as above. this errinfo should be an exception object
+	      but this is INT2FIX(TAG_FATAL).
+	  Don't call first rb_exc_raise if GET_THREAD()->errinfo is Fixnum.
+
+Mon Jun 11 19:56:22 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/webrick/test_cgi.rb (class TestWEBrickCGI): respect
+	  RbConfig::CONFIG["LIBPATHENV"]. [Bug #5135] [ruby-core:38653]
+	* test/webrick/test_filehandler.rb (class WEBrick): ditto.
+
+Tue Jun  5 14:03:53 2012  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/ipaddr.rb: Inhibit zero-filled octets in an IPv4 address in
+	  all platforms. [ruby-dev:45671]
+
+	* lib/ipaddr.rb: Allow the x:x:x:x:x:x:d.d.d.d form not limited to
+	  IPv4 mapped/compatible addresses.  This change also makes it
+	  possible for the parser to understand IPv4 mapped and compatible
+	  IPv6 addresses in non-compressed form.
+
+	* lib/ipaddr.rb: Stop exposing IPSocket.valid*? methods which were
+	  only usable on non-IPv6-ready platforms.
+
+Sat Jun  2 18:49:39 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_enc_cr_str_buf_cat): don't reset coderange as unknown.
+	  the condition 'ptr_a8 && str_cr != ENC_CODERANGE_7BIT' means not
+	  unknown, str is also ASCII-8BIT because str_encindex == ptr_encindex,
+	  and nont (str_cr == ENC_CODERANGE_UNKNOWN) and
+	  str_cr != ENC_CODERANGE_7BIT means str_cr is valid because ASCII-8BIT
+	  can't be broken. [ruby-dev:45688] [Bug #6509]
+
+Wed May 30 17:19:56 2012  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/zlib/zlib.c (do_inflate):  Inflate more data if buffered data
+	  exists.  Allows Zlib::Inflate#set_dictionary to work.
+	  [ruby-trunk - Bug #5929]
+
+Mon May 28 11:40:19 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_extract_modeenc): fail only if conflicting
+	  text/binary modes given explicitly.  [ruby-dev:45268][Bug #6055]
+
+Fri May 25 17:18:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (f_arglist): should reset lexical states after empty
+	  argument list with no parenthesis as well as parenthesized list,
+	  so that reserved name method definition work.  [ruby-dev:45626]
+	  [Bug #6403]
+
+Fri May 25 10:40:31 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* include/ruby/win32.h (FD_SET): change function to macro.
+	  To avoid buffer overflow when smaller FD_SETSISE is used in ext
+	  libraries.
+
+	* win32/win32.c (rb_w32_fdset): this function is not used anymore.
+	  But we leave this for compatibility.
+
+	* win32/win32.c (rb_w32_select_with_thread): fix SEGV when smaller
+	  FD_SETSISE is used in ext libraries. Dereference of fd_set pointer
+	  causes SEGV.
+
+	* test/-ext-/win32/test_fd_setsize.rb(TestFdSetSize): add tests for
+	  above.
+	* ext/-test-/win32/fd_setsize/depend: ditto.
+	* ext/-test-/win32/fd_setsize/extconf.rb: ditto.
+	* ext/-test-/win32/fd_setsize/fd_setsize.c: ditto.
+
+	  [ruby-core:44588] [Bug #6352]
+
+Fri May 25 10:38:06 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (io_strip_bom): check EOF.  [Bug #6487][ruby-core:45203]
+
+Fri May 25 10:36:38 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (f_arglist): should reset lexical states after empty
+	  argument list with no parenthesis as well as parenthesized list,
+	  so that reserved name method definition work.  [ruby-dev:45626]
+	  [Bug #6403]
+
+Mon May 21 16:24:40 2012  Akinori MUSHA  <knu@iDaemons.org>
+
+	* ext/syslog/syslog.c (mSyslog_inspect): Use rb_sprintf().
+
+	* ext/syslog/syslog.c (mSyslog_inspect): Make sure self is a
+	  module before calling rb_class2name().
+
+Sat May 19 14:42:37 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/drb/drbtest.rb ({DRbCore,DRbAry}#teardown}: cannot pass SIGTERM
+	  to another process on Windows, so use SIGINT instead.
+
+Sat May 19 14:42:20 2012  Tanaka Akira  <akr@fsij.org>
+
+	* lib/drb/ssl.rb: generate 1024 bits RSA key instead of 512 bits.
+	  OpenSSL 1.0.1 rejects 512 bits RSA key for TLS1.2 with SHA512.
+	  http://rt.openssl.org/Ticket/Display.html?id=2769&user=guest&pass=guest
+	  reported by Bohuslav Kabrda.
+	  [ruby-core:43844] [ruby-trunk - Bug #6221]
+
+Sat May 19 14:41:45 2012  Tanaka Akira  <akr@fsij.org>
+
+	* test/drb/drbtest.rb: rescue Errno::ESRCH for Process.kill.
+	  reported by NARUSE, Yui.  [ruby-dev:45551]
+
+Sat May 19 14:41:09 2012  Tanaka Akira  <akr@fsij.org>
+
+	* lib/drb/extservm.rb (DRb::ExtServManager): don't use /bin/sh to
+	  invoke service subprocess.  mark detach threads for clean up.
+
+	* test/drb/drbtest.rb: clean up the service subprocess in teardown.
+
+	* test/drb/test_drb.rb: set @service_name for teardown.
+
+	* test/drb/test_drbunix.rb: ditto.
+
+	* test/drb/test_drbssl.rb: ditto.
+
+Sat May 19 14:40:49 2012  Tanaka Akira  <akr@fsij.org>
+
+	* lib/drb/ssl.rb: close accepted TCP socket if SSL accept is failed.
+	  [ruby-dev:45541]
+
+Sat May 19 14:39:50 2012  Tanaka Akira  <akr@fsij.org>
+
+	* lib/webrick/utils.rb: fix fcntl call.
+
+	* lib/drb/unix.rb: ditto.
+
+Fri May 18 18:13:44 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (MakeMakefile#configuration): keep space at end of
+	  OUTFLAG and COUTFLAG.  [ruby-dev:45650]
+
+Fri May 18 00:04:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_fstat, rb_w32_fstati64): convert FILETIME
+	  to time_t directly, not to be affected by TZ unnecessarily.
+
+	* win32/win32.c (unixtime_to_filetime): convert time_t to FILETIME
+	  simply.
+
+Wed May 16 01:07:46 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/digest/md5/extconf.rb: use pkg_config for openssl so that
+	  customized ssl paths are used for linking.  Backports fixes for
+	  [ruby-core:44755].
+	* ext/digest/rmd160/extconf.rb: ditto
+	* ext/digest/sha1/extconf.rb: ditto
+	* ext/digest/sha2/extconf.rb: ditto
+
+Mon May 14 17:14:10 2012  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/ruby/test_io.rb (test_flush_in_finalizer1): don't use IO.for_fd
+	  to close IO objects. it create IO object with already closed fd, and
+	  cause occasional Errno::EBADF in following tests. [ruby-core:45020]
+	  [Bug #6228]
+
+Mon May 14 17:14:10 2012  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/ruby/test_io.rb (TestIO): revert r35631. it broke the intent of
+	  test_flush_in_finalizer1.  [ruby-core:43951] [Bug ##6228]
+
+Mon May 14 13:18:56 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_tokadd_string): insert a backslash only if
+	  quoted by single quotes.  [ruby-dev:45281] [Bug #6069]
+
+Mon May 14 13:17:57 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* test/ruby/test_io.rb (class TestIO):  Disable GC during IO tests to
+	  avoid file descriptors being GC'ed. Suggestion by Tomoyuki Chikanaga
+	  [ruby-core:43951][Bug #6228]
+
+Fri May 11 14:09:48 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (PUSH): to prevent VALUE from GC,
+	  must not cast it to unsigned long, which may be shorter than
+	  VALUE, and the result can be mere garbage.
+
+Fri May 11 01:04:54 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* io.c (io_unread): fix IO#pos with mode 'r' bug on Windows.
+	  If the end of reading buffer is CR, io_unread() needs to unread one
+	  more byte.
+	  [ruby-core:44874] [Bug #6401]
+
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_pos_with_buffer_end_cr):
+	  add a test for above.
+
+Wed May  9 15:59:17 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_WERROR_FLAG): append all warning flags which
+	  are enabled to compile, so that printf format modifiers properly
+	  fail.  [ruby-core:41351] [Bug #5679]
+
+Mon May  7 20:23:29 2012  Tanaka Akira  <akr@fsij.org>
+
+	* lib/securerandom.rb (random_bytes): call to_int method for the
+	  argument at first.
+
+Mon May  7 20:23:29 2012  Tanaka Akira  <akr@fsij.org>
+
+	* lib/securerandom.rb: show actual read length in an error message.
+
+Mon May  7 11:09:20 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal): define IDs before
+	  they are used. [ruby-core:44900] [Bug #6406]
+
+Fri Apr 27 11:02:33 2012  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/rinda/test_rinda.rb (test_core_03_notify): Fixed test failures
+	  [ruby-dev:44430] [Ruby 1.9 - Bug #372]
+
+Fri Apr 27 08:29:51 2012  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/rinda/test_rinda.rb: fix sticks on some testsf problem 
+	  [Bug #6272]
+
+Wed Apr 25 05:56:56 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb (OptionParser#to_a): split for each lines.
+	  [ruby-dev:45568][Bug #6348]
+
+Tue Apr 24 21:20:39 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/optparse.rb (OptionParser#to_a): should split by end-of-line,
+	  and MUST TEST IT, MUST RUN THE TEST, MUST VERIFY BEFORE BACKPORT.
+	  [ruby-dev:45568][Bug #6348]
+
+Tue Apr 24 14:55:41 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb (OptionParser#to_a): String#to_a is no longer
+	  defined.  [ruby-dev:45568][Bug #6348]
+
+Sat Apr 21 07:16:16 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* strftime.c (rb_strftime_with_timespec): fix padding of time zone
+	  offset.  [ruby-dev:43287][Bug #4458]
+
+	* strftime.c (rb_strftime_with_timespec): add an interim digit for
+	  the timezone offset which is less than an hour.
+
+	* strftime.c (rb_strftime_with_timespec): fix carry-up bug and
+	  overwrite '+' with '-' if negative offset less than a hour.
+	  [ruby-core:44447][Bug #6323]
+
+Fri Apr 20 12:30:06 2012  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems/ssl_certs/AddTrustExternalCARoot.pem:  Removed to avoid
+	  conflict with ca-bundle.pem
+	* lib/rubygems/ssl_certs/VerisignClass3PublicPrimaryCertificationAuthority-G2.pem:
+	  ditto.
+	* lib/rubygems/ssl_certs/Entrust_net-Secure-Server-Certification-Authority.pem:
+	  ditto.
+
+Fri Apr 20 08:30:55 2012  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems:  Update to RubyGems 1.8.23 which contains security
+	  fixes:
+
+	  RubyGems now disallows redirection from HTTPS to HTTP.
+
+	  RubyGems now verifies SSL connections.
+
+	  See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
+	  changes since 1.8.22.
+	* test/rubygems:  ditto.
+
+Fri Apr 20 07:39:50 2012  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems:  Update to RubyGems 1.8.22 plus r33517 and r35337 which
+	  were ported to the rubygems git repository.
+
+	  See https://github.com/rubygems/rubygems/blob/1.8/History.txt for
+	  changes since 1.8.11.
+
+	* test/rubygems:  ditto.
+
+	* lib/rubygems/version.rb:  Fixed init_with warning by calling into
+	  yaml_initialize (for syck) from psych's init_with
+
+Thu Apr 19 12:55:31 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/win32/dln/extconf.rb: need import library for ordinal
+	  entry even on mingw.  [ruby-core:44441][Bug #6320]
+
+Wed Apr 18 23:08:58 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (DOT, DOXYGEN): use AC_CHECK_PROGS instead of
+	  AC_CHECK_PROG which needs the third argument.  [ruby-core:44433]
+	  [Bug #6316]
+
+	* configure.in (PKG_CONFIG): fix condition to skip older version
+	  of pkg-config.  continue in backticks does not affect outside.
+
+Tue Apr 17 21:35:47 2012  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/parsers/baseparser.rb, test/rexml/test_namespace.rb:
+	  fix the default xml namespace URI validation.
+	  [ruby-dev:45169] [Bug #5956]
+	  Reported by Miho Hiramatsu. Thanks!!!
+
+Mon Apr 17 14:27:22 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln.c (rb_w32_check_imported): skip ordinal entries.  based on a
+	  patch by phasis68 (Heesob Park) at [ruby-core:44381].
+	  [ruby-core:44371][Bug #6303]
+
+Sun Apr 15 14:57:00 2012  Tanaka Akira  <akr@fsij.org>
+
+	* test/test_pty.rb (test_pty_check_default): call PTY.check until
+	  "cat" command is finished.
+
+Sun Apr 15 14:54:16 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_process.rb (TestProcess#windows?): new method.
+
+	* test/ruby/test_process.rb (TestProcess#*): use above method.
+
+	* test/ruby/test_process.rb (TestProcess#test_execopts_redirect):
+	  windows doesn't support FD_CLOEXEC.
+
+Sun Apr 15 06:40:28 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* include/ruby/win32.h (rb_w32_aspawn_flags): add the declaration of
+	  new function.
+
+	* process.c (enum): add EXEC_OPTION_PGROUP and move the position
+	  above for the usage in proc_spawn_n().
+
+	* process.c (proc_spawn_n): add an argument to pass new option
+	  `new_pgroup`. The option specifies CREATE_NEW_PROCESS_GROUP flag to
+	  CreateProcessW(). This flag is necessary for the usage of
+	  Process.kill on the subprocess on Windows.
+
+	* process.c (rb_exec_arg_addopt): ditto.
+
+	* process.c (rb_spawn_process): ditto.
+
+	* process.c (documentation for rb_f_spawn): add documentation for new
+	  option `new_pgroup` of spawn.
+
+	* test/ruby/test_process.rb (TestProcess#test_execopts_new_pgroup):
+	  add tests for option `new_pgroup`.
+
+	* test/ruby/test_thread.rb
+	  (TestThreadGroup#test_thread_timer_and_interrupt):
+	  add option `new_pgroup: true` to spawn on Windows. It's needed for
+	  Process.kill on a subprocess.
+
+	* win32/win32.c (CreateChild): add an argument to pass
+	  dwCreationFlags of CreateProcessW().
+
+	* win32/win32.c (rb_w32_spawn): ditto.
+
+	* win32/win32.c (rb_w32_aspawn_flags): add new function to pass
+	  dwCreationFlags.
+
+	* win32/win32.c (rb_w32_aspawn): refactor to move the content to
+	  rb_w32_aspawn_flags().
+	  [ruby-core:43245][Bug #6131]
+
+Sun Apr 15 06:40:28 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* test/ruby/test_thread.rb
+	  (TestThreadGroup#test_thread_timer_and_interrupt): skip on Windows.
+	  Process.kill cannot kill a subprocess if CREATE_NEW_PROCESS_GROUP
+	  flag is not specified in a call to CreateProcessW().
+
+	* win32/win32.c (CreateChild): revert the usage of
+	  CREATE_NEW_PROCESS_GROUP flag for compatibility.
+	  [ruby-core:43245][Bug #6131]
+
+Sun Apr 15 04:35:48 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* io.c (rb_io_eof): use eof() instead of io_fillbuf(). It's because
+	  io_unread() doesn't work properly when reading CRLF with read(length)
+	  and mode 'r'.
+	  [ruby-core:44189][Bug #6271]
+
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_read_crlf_and_eof):
+	  test for above.
+
+Sun Apr 15 03:00:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (io_unread): fixed memory leak.  report by nagachika via IRC.
+
+Sun Apr 15 03:00:54 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* io.c (static int io_fflush): add the definition.
+	  Use it in set_binary_mode_with_seek_cur().
+
+	* io.c (set_binary_mode_with_seek_cur): refactoring to split the
+	  content into io_unread(). Fix the possibility of buffer overflow.
+
+	* io.c (io_unread): add new implementation for Windows. Previous one
+	  caused invalid cursor position using IO#pos with OS text mode. New
+	  one fixes the bug.
+
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_pos_dont_move_cursor_position): add a test for
+	  above bug.
+	  [ruby-core:43497] [Bug #6179]
+
+Sun Apr 15 03:00:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_io.rb (TestIO#test_pos_with_getc): updated.
+	  see [ruby-core:43550]
+
+Sun Apr 15 03:00:54 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_io.rb (TestIO#test_pos_with_getc): added.
+	  see [Bug #6179][ruby-core:43518]
+
+Wed Apr 11 16:22:16 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/add_suffix/bug.c (ruby_add_suffix): no static
+	  declaration.  [ruby-core:44277][Bug #6279]
+
+Sun Apr  8 06:53:55 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (io_unread): cast as long the value for extra_max.
+	  [ruby-core:44137] [Bug #6257]
+
+Sat Apr  7 10:28:40 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bumping up psych version to match release.
+	* ext/psych/psych.gemspec: ditto
+
+Sat Apr  7 02:07:00 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c: fall back to any encoding if the external
+	  encoding is wrong.  [ruby-core:44163]
+	* test/psych/test_encoding.rb: fix test
+
+Wed Apr  4 18:29:15 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): syntax error.
+
+	* test/ruby/test_sleep.rb (TestSleep#test_sleep_5sec): call uname
+	  only on linux because it's a workaround for linux only.
+
+Wed Apr  4 11:32:09 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/add_suffix/bug.c: make all functions in util.c static
+	  to get rid of multiple definitions.  reported at
+	  https://trac.macports.org/ticket/33814
+
+Tue Apr  3 18:34:33 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (setreuid, setregid): suppress warnings.
+	  [ruby-core:43374][Bug #6169]
+
+Sat Mar 31 12:11:21 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_x509cert.c: Fix doc typo.
+
+Fri Mar 30 14:17:17 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_pkcs7.c: fix crash when parsing garbage data.
+	* test/openssl/test_pkcs7.rb: assert correct behavior for it.
+	  Thanks to Matt Venables for reporting the issue.
+	  [ruby-core:43250][Bug #6134]
+
+Fri Mar 30 14:17:17 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* test/openssl/test_x509cert.rb: exclude test that fails when issuing
+	  a certificate with RSA signature and DSS1 digest for earlier
+	  OpenSSL versions when used in conjunction with OpenSSL 1.0.1.
+	  Thanks, Vit Ondruch, for reporting the issue.
+	  [ruby-core:42949][Bug #6089]
+
+Fri Mar 30 14:15:40 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_new_empty): should copy also the encoding as an
+	  empty substring.  [ruby-dev:45441][Bug #6206]
+
+Fri Mar 30 14:14:36 2012  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c (datetime_s_now): [ruby-core:43256].
+
+Fri Mar 30 14:12:53 2012  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* numeric.c: fix flodivmod for cornercases [Bug #6044]
+	  add ruby_float_mod
+
+	* insns.def (opt_mod): use ruby_float_mod
+
+	* internal.h: declare ruby_float_mod
+
+	* test/ruby/test_float.rb: tests for above
+
+	* test/ruby/envutil.rb: create helper assert_is_minus_zero
+
+Wed Mar 28 08:44:24 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: updating version to match gem
+	* ext/psych/psych.gemspec: ditto
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fixing deprecation warning
+
+Mon Jul 18 13:36:47 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: define a new BadAlias error class.
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: raise an exception when
+	  deserializing an alias that does not exist.
+
+	* test/psych/test_merge_keys.rb: corresponding test.
+
+Fri Mar  9 06:29:22 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb (load, parse): stop parsing or loading after
+	  the first document has been parsed.
+
+	* test/psych/test_stream.rb: pertinent tests.
+
+Fri Mar  9 06:17:05 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb (parse_stream, load_stream): if a block is
+	  given, documents will be yielded to the block as they are parsed.
+	  [ruby-core:42404] [Bug #5978]
+
+	* ext/psych/lib/psych/handlers/document_stream.rb: add a handler that
+	  yields documents as they are parsed
+
+	* test/psych/test_stream.rb: corresponding tests.
+
+Tue Mar  6 02:31:20 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/core_ext.rb: only extend Kernel if IRB is loaded
+	  in order to stop method pollution.
+
+Tue Feb 28 10:28:51 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: default open YAML files with utf8 external
+	  encoding. [ruby-core:42967]
+	* test/psych/test_tainted.rb: ditto
+
+Fri Feb 24 13:54:33 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c: prevent a memory leak by protecting calls to
+	  handler callbacks.
+	* test/psych/test_parser.rb: test to demonstrate leak.
+
+Fri Feb 24 08:08:38 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c: set parser encoding based on the YAML input
+	  rather than user configuration.
+	* test/psych/test_encoding.rb: corresponding tests.
+	* test/psych/test_parser.rb: ditto
+	* test/psych/test_tainted.rb: ditto
+
+Fri Feb 10 03:41:31 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c: removed external encoding setter, allow parser
+	  to be reused.
+	* ext/psych/lib/psych/parser.rb: added external encoding setter.
+	* test/psych/test_parser.rb: test parser reuse
+
+Wed Jan 18 12:49:15 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Added support for loading
+	  subclasses of String with ivars
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Added support for dumping
+	  subclasses of String with ivars
+	* test/psych/test_string.rb: corresponding tests
+
+Wed Jan 18 10:39:47 2012  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Added ability to load array
+	  subclasses with ivars.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Added ability to dump
+	  array subclasses with ivars.
+	* test/psych/test_array.rb: corresponding tests
+
+Wed Dec 21 02:25:36 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/emitter.c: fixing clang warnings. Thanks Joey!
+
+Sun Dec 18 12:42:48 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: BigDecimals can be restored
+	  from YAML.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: BigDecimals can be dumped
+	  to YAML.
+	* test/psych/test_numeric.rb: tests for BigDecimal serialization
+
+Sun Dec 18 12:03:13 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/scalar_scanner.rb: Strings that look like dates
+	  should be treated as strings and not dates.
+
+	* test/psych/test_scalar_scanner.rb: corresponding tests.
+
+Wed Dec  7 08:04:31 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb (module Psych): parse and load methods take
+	  an optional file name that is used when raising Psych::SyntaxError
+	  exceptions
+	* ext/psych/lib/psych/syntax_error.rb (module Psych): allow nil file
+	  names and handle nil file names in the exception message
+	* test/psych/test_exception.rb (module Psych): Tests for changes.
+
+Wed Nov 30 09:09:37 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c (parse): parse method can take an option file
+	  name for use in exception messages.
+	* test/psych/test_parser.rb: corresponding tests.
+
+Tue Nov 22 04:46:22 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: remove autoload from psych
+	* ext/psych/lib/psych/json.rb: ditto
+
+Wed Nov  9 04:52:16 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/tree_builder.rb: dump complex numbers,
+	  rationals, etc with reference ids.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: ditto
+	* ext/psych/lib/psych/visitors/to_ruby.rb: loading complex numbers,
+	  rationals, etc with reference ids.
+	* test/psych/test_object_references.rb: corresponding tests
+
+Mon Nov  7 20:31:52 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/scalar_scanner.rb: make sure strings that look
+	  like base 60 numbers are serialized as quoted strings.
+	* test/psych/test_string.rb: test for change.
+
+Thu Oct 27 08:47:38 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/psych/parser.c: remove unused variable.
+
+Wed Oct  5 02:50:27 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/syntax_error.rb: Add file, line, offset, and
+	  message attributes during parse failure.
+	* ext/psych/parser.c: Update parser to raise exception with correct
+	  values.
+	* test/psych/test_exception.rb: corresponding tests.
+
+Wed Oct  5 01:52:16 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c (parse): Use context_mark for indicating error
+	  line and column.
+
+Wed Oct  5 01:22:08 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/scalar_scanner.rb: use normal begin / rescue
+	  since postfix rescue cannot receive the exception class. Thanks
+	  nagachika!
+
+Tue Mar 27 22:22:50 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_STACK_GROW_DIRECTION): substitute CPU name as
+	  shell variable name.  based on the patch by The Written Word Inc. at
+	  [ruby-core:40421].  [Bug #5488]
+
+Mon Mar 26 09:57:12 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* parse.y (parser_nextc): set encoding for the buffer of ripper.
+
+Sun Mar 18 13:23:28 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* encoding.c (rb_enc_compatible): return ASCII-8BIT even if 2nd string
+	  is ascii only string. [ruby-core:42354] [Bug #5968]
+
+Tue Mar  6 18:55:37 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb (assert_send, assert_not_send):
+	  parenthesize non-empty arguments.
+
+Tue Mar  6 18:55:37 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb (assert_send): make arguments in
+	  the default message clearer.
+
+Tue Mar  6 12:48:08 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (set_rawmode): clear ECHOE and ECHOK
+	  bits too.
+
+	* ext/io/console/console.c (echo_p): ignore ECHOE and ECHOK bits.
+	  [ruby-dev:45309] [Bug #6116]
+
+	* ext/io/console/console.c (console_raw): fix rdoc.
+
+	* ext/io/console/console.c (console_set_echo): mentioned about
+	  platform dependency.
+
+Tue Mar  6 12:40:08 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_raw, console_set_raw)
+	  (console_getch): optional parameters.  [EXPERIMENTAL]
+
+Tue Mar  6 12:39:27 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_cooked, console_set_cooked):
+	  new methods to reset cooked mode.  [EXPERIMENTAL]
+
+Tue Mar  6 12:31:47 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (io_getch): default delegating method
+	  for StringIO.  https://github.com/nobu/io-console/issues/4
+
+	* ext/stringio/stringio.c: moved some methods to hidden modules.
+
+Tue Mar  6 12:29:34 2012  Eric Hodel  <drbrain@segment7.net>
+
+	* io.c (Init_IO):  Mention io/console methods.  [Ruby 1.9 - Bug #5602]
+	* ext/io/console/console.c:  Mention that io/console must be required
+	  similar to lib/time.rb
+
+Tue Mar  6 11:42:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/syck/lib/syck/rubytypes.rb (Exception.yaml_new): fix bug
+	  that causes YAML serialization problem for Exception.
+	  Exception#initialize doesn't use visible instance variable for
+	  the exception message, so call the method with the message.
+	  patched by Jingwen Owen Ou <jingweno AT gmail.com>.
+	  http://github.com/ruby/ruby/pull/41
+
+Fri Mar  2 22:09:03 2012  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* .travis.yml: Backport TravisCI configuration from trunk.
+
+Thu Mar  1 18:39:44 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_join): honor input encodings than ASCII-8BIT.
+	  [ruby-core:40338] [Bug #5483]
+
+Tue Feb 28 11:56:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (debugflags): check if -ggdb is accepted.
+	  [ruby-core:42875][Bug #6080]
+
+Mon Feb 27 17:25:40 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): since methods
+	  can be overridden, so should not make an assumption on the type
+	  of results.  [ruby-core:42969][Bug #6093]
+
+Mon Feb 27 02:28:17 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regparse.c (add_code_range_to_buf0): wrong condition of duplicated
+	  warnings.
+
+Sun Feb 26 12:26:26 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): call on special object instead of
+	  self.  since stabby lambda is a syntax, so it should not be
+	  affected by the context.  [ruby-core:42349][Bug #5966]
+
+	* insns.def (send): no special deal for FCALL.  self should be put
+	  on TOS instead.
+
+Sat Feb 25 23:47:49 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (utime_internal): fix a variable missed to replace.
+	  [ruby-core:42864] [Bug #6077]
+
+Sat Feb 25 21:29:09 2012  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/ruby/test_literal.rb (TestRubyLiteral#test_special_const):
+	  test for https://bugs.php.net/bug.php?id=61095
+
+Sat Feb 25 21:29:09 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c, file.c, io.c (rb_sys_fail_path): use rb_sys_fail_str.
+
+	* error.c: new functions to deal exceptions with string instances.
+
+	* dir.c, file.c, io.c: use rb_sys_fail_path.
+
+Sat Feb 25 21:18:12 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_inspect), io.c (rb_io_inspect): keep encoding of path.
+	  [Bug #6072]
+
+Sat Feb 25 21:18:12 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_initialize): keep path in original encoding.
+
+	* error.c (syserr_initialize): prefer the encoding of message over
+	  locale.  [ruby-dev:45279][Bug #6071]
+
+Sat Feb 25 17:10:51 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/fileutils.rb: use chomp(?/) instead of sub to optimize and avoid
+	  to regexping invalid string.
+
+Sat Feb 25 16:39:13 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* complex.c (nucomp_marshal_load): raise error on invalid data.
+	  reported by John Firebaugh [ruby-core:42860] [Bug #6076]
+
+Fri Feb 24 23:49:05 2012  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/ostruct.rb (delete_field): Bug fix so previous value is
+	  returned. Patch by Nick Recobra [Bug #6063]
+
+Fri Feb 24 08:53:28 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_tokadd_string, parser_yylex): insert a backslash
+	  if the next character is non-ascii.  [ruby-dev:45278] [Bug #6069]
+
+Thu Feb 23 14:44:36 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/common.rb (URI::Parser#initialize_regexp):
+	  use \A \z instead of ^ $. [Bug #5843]
+
+Thu Feb 23 08:08:23 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_uchmod): typo.  [Bug#5671] [ruby-dev:44898]
+
+	* test/ruby/test_file.rb (TestFile#test_chmod_m17n): test of above bug.
+
+Wed Feb 22 23:27:52 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/iconv/test_option.rb: enabled.  [ruby-core:42802][Bug #6061]
+
+Wed Feb 22 22:04:15 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_s_foreach): argument check before making Enumerator.
+	  [ruby-dev:31525]
+
+Wed Feb 22 22:04:15 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (r_byte): should replace getc() with rb_getc().
+	* io.c (rb_io_s_foreach): return enumerator including kerword
+	  arguments.  [ruby-dev:45267][Bug #6054]
 
-	* io.c (rb_getc): getc() replacement uses READ_DATA_PENDING() and
-	  rb_thread_wait_fd().
+Wed Feb 22 21:42:16 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Jun  7 23:23:38 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* configure.in: remove workaround replacement from gcc to gcc-4.2.
+	  [Backport #6043]
 
-	* object.c (rb_mod_clone): should call CLOSESETUP().
+Wed Feb 22 08:11:06 2012  Narihiro Nakamura  <authornari@gmail.com>
 
-	* eval.c (bind_clone): should call CLONESETUP() for new clone.
+	* gc.c : remove gc_clear_mark_on_sweep_slots() and use
+	  rest_sweep() instead of it, because some dead objects might be
+	  marked in next the mark phase by false pointers.
+	  [ruby-core:42672]
 
-Sat Jun  5 10:32:40 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Feb 19 12:27:24 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_oct): binary (e.g. 0b10111) support.
+	* configure.in: ignore all warnings from an arbitrary
+	  header in /usr/local/include.
 
-	* variable.c (rb_const_set): raise warning, not exception.
+Fri Feb 17 12:51:25 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (yycompile): initialize parser internal variables.
+	* lib/mkmf.rb (create_header): log the content of header.
 
-	* parse.y (close_paren): set lex_state to EXPR_PAREN after closing
-	  parenthesis.
+Fri Feb 17 12:26:15 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* parse.y (yylex): returns kDO for `do' right after method_call.
+	* test/readline/test_readline.rb (test_completion_proc_empty_result):
+	  ensure clearance of Readline's line_buffer after the test.
 
-Thu Jun  3 11:05:30 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Fri Feb 17 11:46:39 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (read_backslash): should decode \b within class.
+	* test/readline/test_readline.rb (test_line_buffer__point): use
+	  lambda not to exit entire method by "return".  or "next" for
+	  proc.  [ruby-dev:45042] [Bug #5802]
 
-Thu Jun  3 01:06:18 1999  Katsuyuki Komatsu  <komatsu@sarion.co.jp>
+Fri Feb 17 10:15:54 2012  Tanaka Akira  <akr@fsij.org>
 
-	* dln.c (dln_load): AIX improvement (aix_findmain removed).
+	* ext/dbm/extconf.rb: check _DB_H_ macro unavailable except
+	  Berkeley DB library.
 
-Wed Jun  2 00:41:31 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Feb 17 10:14:47 2012  Tanaka Akira  <akr@fsij.org>
 
-	* pack.c (pack_unpack): new undocumented template Z which strips
-	  stuff after first null.
+	* test/dbm/test_dbm.rb: fix skip condition for libgdbm 1.8.0 or prior.
+	  reported by Bohuslav Kabrda.
+	  [ruby-core:42685] [ruby-trunk - Bug #6036]
 
-	* pack.c (pack_pack): should preserve specified length of the
-	  resulting string.
+Fri Feb 17 09:53:46 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Jun  1 15:29:33 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* tool/transcode-tblgen.rb (import_ucm): don't use \h because the
+	  script should work with ruby 1.8.
 
-	* ext/socket/socket.c (ruby_socket): retry after GC, if socket(2)
-	  failed on EMFILE or ENFILE.
+	* tool/enc-unicode.rb: ditto.
 
-	* ext/socket/socket.c (sock_s_socketpair): ditto.
+Thu Feb 16 17:54:14 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (module_setup): need to add PUSH_VAR/POP_VAR to clear
-	  dyna vars link list.
+	* ext/dbm/extconf.rb: merge trunk's ext/dbm/extconf.rb and
+	  related functions of lib/mkmf.rb. [Backport #6021]
 
-	* version.h (RUBY_RELEASE_CODE): integer macro contant for source
-	  version detection.
+Thu Feb 16 09:25:52 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun May 30 22:19:12 1999  Kenji Nagasawa  <kenn@tcp-ip.or.jp>
+	* configure.in (enable_pthread): use -pthread on OpenBSD without
+	  explicit option. patched by Jeremy Evans. [ruby-core:38572]
 
-	* ext/socket/socket.c: emx/gcc 0.9d now fixes things about
-	  AF_UNIX.
+Thu Feb 16 07:34:34 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* process.c: OS/2 EMX kludge.
+	* cont.c (rb_fiber_reset_root_local_storage): add a new function to
+	  restore rb_thread_t::local_storage.
 
-	* Makefile.in (strncasecmp.o): added dependency.
+	* cont.c (rb_obj_is_fiber): add a new function to tell finalizer to
+	  prevent fibers from destroy.
 
-Mon May 31 16:06:28 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* gc.c (rb_objspace_call_finalizer): don't sweep fibers at finalizing
+	  objspace.
 
-	* version 1.3.4 - preliminary release for 1.4
+	* internal.h (rb_fiber_reset_root_local_storage, rb_obj_is_fiber):
+	  add prototypes.
 
-Mon May 31 15:57:41 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm.c (ruby_vm_destruct): reset main thread's local_storage before
+	  free main thread. rb_thread_t::local_storage is replaced by fiber's
+	  local storage when forked from fiber, and it should be already freed
+	  when the fiber was destroyed. [ruby-core:41456] [Bug #5700]
 
-	* io.c (rb_io_fptr_close): close on IO which main_thread is
-	  waiting cause serious exception, that vanishes the actual fd
-	  closing.  Invocation of rb_thread_fd_close() is deferred
-	  a little.
+	* test/ruby/test_fiber.rb (test_fork_from_fiber): add test for fork
+	  from fiber.
 
-Sat May 29 18:27:13 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+Thu Feb 16 06:30:37 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_match): stack boundary check needed.
+	* ext/fiddle/closure.c (callback): deal with unsinged integers.
+	  [ruby-core:42458][Bug #5991][Bug #6022]
 
-Sat May 29 12:27:00 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/fiddle/conversions.c (value_to_generic, generic_to_value):
+	  ditto.
 
-	* ext/tcltklib/tcltklib.c (ip_invoke): proper ref count management
-	  to avoid leak.  I HATE REF COUNTING!!
+	* ext/fiddle/closure.c (callback): same as r34506.
 
-	* eval.c (ruby_run): moved ruby_require_libraries() to handle `-r'
-	  from ruby_options() to avoid stack corruption for threads
-	  created in libraries.
+Wed Feb 15 10:35:43 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat May 29 02:22:12 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* include/ruby/ruby.h (FIXNUM_P): simple flag should be int.
 
-	* eval.c (rb_yield_0): when `for' appeared in blocks, it
-	  introduced new scope for local variables.
+Wed Feb 15 10:33:41 2012  Eric Hodel  <drbrain@segment7.net>
 
-Fri May 28 17:16:49 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_eval.c (check_funcall):  Call respond_to? with matching arity for
+	  legacy single-argument implementations.  [ruby-trunk - Bug #6000]
 
-	* string.c (rb_str_squeeze_bang): squeeze AND of the arguments.
-	  UNDOCUMENTED.
+Wed Feb 15 10:25:22 2012  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* string.c (rb_str_count): new UNDOCUMENTED method.
+	* vm_eval.c (check_funcall): set array elements one-by-one to fix
+	  compile error with Fujitsu C Compiler 5.6 on Solaris 10 on Sparc.
 
-	* string.c (rb_str_delete_bang): delete AND of the arg ranges.
-	  UNDOCUMENTED FEATURE for 1.3.x.
+Wed Feb 15 10:25:22 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (setipaddr): re-wrote using ip_addrsetup().
+	* test/ruby/test_object.rb: tests that respond_to? returns false.
 
-	* ext/sockt/socket.c (ip_addrsetup): decode symbolic address
-	  <broadcast>.
+Wed Feb 15 10:25:22 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu May 27 12:27:42 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_eval.c (check_funcall): try respond_to? first if redefined.
+	  [Bug #5158]
 
-	* string.c (tr_trans): should handle NUL (\0) within strings.
+Wed Feb 15 07:15:50 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue May 25 16:45:11 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* compile.c (defined_expr): guard the whole expression.
+	  [ruby-dev:45021][Bug#5786]
 
-	* io.c (rb_f_syscall): syscall may return values other than zero
-	  on success.
+Wed Feb 15 05:08:25 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_match): handle empty loop properly (hopefully).
+	* ext/dl/cptr.c (rb_dlptr_s_to_ptr): use rb_check_funcall.
 
-	* regex.c (re_match): remove empty group check, because it does
-	  not help non-grouping parentheses (?:..).
+	* ext/dl/cfunc.c (dlcfunc_mark), ext/dl/cptr.c (dlptr_mark):
+	  workaround to mark wrapped object.  this is not a true fix,
+	  because [Bug #4929] is caused by the interface design of DL.
 
-	* regex.c (re_compile_fastmap): treating try_next, finalize_push
-	  wrong way.
+Wed Feb 15 05:04:47 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c: remove some obsolete functions such as
-	  group_match_null_string_p().
+	* ext/dl/cptr.c (rb_dlptr_aref, rb_dlptr_aset): check NULL pointer
+	  dereference.
 
-Mon May 24 14:47:54 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/rinda/test_rinda.rb: decrease the code that depends on timing.
+	  [Bug #372] [Bug #4160]
 
-	* regex.c (read_backslash): read backslash by regex.
+Wed Feb 15 05:03:41 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Sun May 23 19:44:58 1999  WATANABE Hirofumi  <eban@os.rim.or.jp>
+	* test/rinda/test_rinda.rb (test_remote_array_and_hash):
+	  add local variables to protect objects from GC. [ruby-dev:44253]
+	  [Bug #5104]
 
-	* ext/pty/pty.c (getDevice): portability patch.
+Wed Feb 15 05:02:43 2012  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-Fri May 21 23:01:26 1999  Katsuyuki Komatsu  <komatsu@sarion.co.jp>
+	* test/win32ole/test_err_in_callback.rb (test_err_in_callback): 
+	  skip test if ADODB.connection is not available.
 
-	* ext/socket/getaddrinfo.c (GET_AI): should set error code.
+Wed Feb 15 04:49:23 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Thu May 20 03:43:44 1999  Jun-ichiro itojun Hagino  <itojun@itojun.org>
+	* parse.y (debug_lines, coverage): set file path encoding for coverage
+	  result.  [ruby-dev:44950]
 
-	* ext/socket/socket.c: you should use sockaddr_storage to handle
-	  IPv6 addresses.
+Tue Feb 14 16:57:11 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/socket/getaddrinfo.c (getaddrinfo): prevent retrieving
-	  AF_INET6 address if hints.ai_flags == AI_PASSIVE.
+	* lib/rake/file_list.rb (Rake::FileList#egrep): there is no need to
+	  open files in binary mode.
+	  see more details in https://github.com/jimweirich/rake/issues/74
 
-Wed May 19 12:27:07 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Feb 14 16:52:17 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (exec_end_proc): should protect exceptions.
+	* lib/rdoc/encoding.rb (RDoc::Encoding.read_file): fixup newline chars
+	  on Windows.
+	  see https://github.com/rdoc/rdoc/issues/87
 
-	* gc.c (run_final): ditto.
+	* test/rdoc/test_rdoc_markup_pre_process.rb
+	  (TestRDocMarkupPreProcess#test_include_file, 
+	  TestRDocMarkupPreProcess#test_include_file_encoding_incompatible):
+	  follow above change.
 
-	* parse.y (f_rest_arg): allow just * for rest arg.
+Tue Feb 14 16:34:11 2012  Shota Fukumori  <sorah@tubusu.net>
 
-	* parse.y (mlhs_basic): allow * without formal argument.
+	* test/rubygems/test_gem_commands_help_command.rb: Add one
+	  `require` because if run test-all with test/unit parallel
+	  running, sometimes this test fails by some constants not found.
+	  The error reason is some worker doesn't require the file needed by
+	  this test. This issue is related to [ruby-core:36168].
 
-	* regex.c (re_match): the variable `part' should be initialized.
+Tue Feb 14 15:58:31 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue May 18 15:25:45 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* gc.c (initial_params): pack in a struct.
 
-	* regex.c (re_search): a bug in range adjustment.
+	* gc.c (rb_gc_set_params): set parameters always.
+	  [ruby-dev:44648] [Bug #5467]
 
-Tue May 18 11:35:59 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Tue Feb 14 15:44:42 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* dln.c (conv_to_posix_path): path_len argument added.
+	* test/irb/test_completion.rb: skip if cannot load irb/completion
+	  (maybe readline does not exist).
 
-Mon May 17 12:26:31 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Feb 14 15:07:23 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (fix_rev): should treat Fixnum as signed long.
+	* lib/test/unit/assertions.rb (build_message): skip escaped
+	  question marks.
 
-	* eval.c (massign): add strict number check for yield (and call).
+Mon Feb 13 12:06:29 2012  Loren Segal  <lsegal@soen.ca>
 
-	* eval.c (proc_arity): new method to return number of arguments.
+	* io.c (Init_IO): use directive hack to make ARGF documentable
+	  in other tools.  [ruby-core:42515][Bug #6007]
 
-	* eval.c (method_arity): new method to return number of arguments.
+Sun Feb 12 16:57:56 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* parse.y (read_escape): char may be unsigned.
+	* misc/rdoc-mode.el (rdoc-imenu-create-index): Add imenu support
+	  to rdoc-mode.
 
-	* string.c (rb_str_succ): ditto.
+	* misc/rdoc-mode.el (rdoc-mode): Fix regexp patterns containing
+	  "\s " where CR/LF is not supposed to match.
 
-	* string.c (tr_trans): ditto.
+Sun Feb 12 16:56:23 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* object.c (Init_Object): methods `&', `|', `^' are added to nil.
+	* misc/rdoc-mode.el (rdoc-mode): Add provide so that requiring
+	  this library succeeds.
 
-	* range.c (rb_range_beg_len): it should be OK for [0..-len-1].
+Sun Feb 12 16:53:18 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* regex.c (re_search): search for byte literal within mbcs.
+	* lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): Just
+	  call File.unlink and ignore ENOENT because existence check
+	  before unlinking does not help in terms of race condition.
 
-	* regex.c (is_in_list): parsh
+	* lib/tempfile.rb (Tempfile#unlink, Tempfile::Remover#call): My
+	  comment about thread safeness is obsolete.
 
-	* regex.c (re_compile_fastmap): should have not alter the loop
-	  variable `j' if TRASLATE_P().
+Sun Feb 12 16:50:28 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* regex.c (re_compile_pattern): escaped characters should be read
-	  by PATFETCH_RAW(c).
+	* lib/shellwords.rb: Fix rdoc markups.
 
-Sat May 15 11:23:51 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Feb 12 16:50:28 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-	* regex.c (re_match): endline2 (\Z) should not match at the point
-	  between a newline and end-of-line, like endline ($).
+	* lib/shellwords.rb (Shellwords#shellsplit): Fix a bug where
+	  consecutive backslashes in double quotes are all removed except
+	  the one at the tail.
 
-	* class.c (include_class_new): should initialize iv_tbl to share
-	  between module and iclass.
+Sun Feb 12 16:38:13 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri May 14 08:50:27 1999  Akira Endo  <akendo@t3.rim.or.jp>
+	* lib/shellwords.rb (Shellwords#shellescape): Drop the //n flag
+	  that only causes warnings with no real effect.  [Bug #5637]
 
-	* regex.c (re_compile_fastmap): it should be k != 0 to skip.
+Sun Feb 12 16:34:55 2012  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri May 14 12:46:56 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* tool/merger.rb (#default_merge_branch): Add support for
+	  Subversion 1.7 which adopted a whole new working directory
+	  structure.
 
-	* time.c (time_load): a bug in old marshal format support.
+Sun Feb 12 09:38:46 2012  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* instruby.rb: make site_ruby directory.
+	* vm_method.c (rb_add_method): should not call method_added hook
+	  for undef operation. [Bug #5015]
 
-Fri May 14 10:18:02 1999  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+Sun Feb 12 09:29:28 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_match): a bug in inline `.*' etc.
+	* regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): Power PC does not
+	  allow unaligned word access.
 
-Fri May 14 09:58:46 1999  Minero Aoki  <aamine@dp.u-netsurf.ne.jp>
+	* st.c (UNALIGNED_WORD_ACCESS): x86_64 allows unaligned word
+	  access as well as i386.
 
-	* ruby.c (addpath): should have specified string length.
+Sat Feb 11 08:06:12 2012  Tanaka Akira  <akr@fsij.org>
 
-Thu May 13 10:40:44 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/openssl/test_ssl.rb (test_multibyte_read_write): start server
+	  for each length to avoid race condition.
 
-	* eval.c (rb_eval_string_wrap): new function.
+Sat Feb 11 06:13:07 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): POSIX line match should alter
-	  behavior for `^' and `$' to begbuf and endbuf2 respectively.
+	* dir.c (fnmatch): The * needs to be escaped to avoid formatting in
+	  fnmatch comment.
+	  patched by @dalton. https://github.com/ruby/ruby/pull/91
 
-	* ext/pty/pty.c: un-ANSI-fy function arguments.
+Sat Feb 11 03:38:48 2012  Hiroshi Shirosaki <h.shirosaki@gmail.com>
 
-Wed May 12 14:19:38 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (rb_sys_fail_path): move the definition.
+	  Move above for using it in set_binary_mode_with_seek_cur().
 
-	* struct.c (iv_get): in case of inheritance of generated struct
-	  class, __member__ and __size__ should also be inherited.
-	  Thanks for Pros Yeboah <yeboah@tu-harburg.de>.
+	* io.c (set_binary_mode_with_seek_cur): fix improper seek cursor.
+	  Seeking file cursor with setting binary mode has possibility to
+	  cause infinite loop. Fixed the bug and refined error handling.
+	  Introduced at r34043.
 
-	* io.c (rb_f_gets_internal): should check number of arguments
-	  before checking rb_rs == rb_default_rs.  Thanks for Koji Arai
-	  <JCA02266@nifty.ne.jp>.
+	  And cleanups as below.
+	  Remove unnecessary parentheses of `fptr`.
+	  Use return value of setmode().
 
-Tue May 11 08:29:28 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_seek_with_setting_binmode): add a test for abobe.
+	  [ruby-core:41671] [Bug #5714]
 
-	* regex.c (re_compile_pattern): .?, .+ did not work.
+Sat Feb 11 03:38:48 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon May 10 00:59:33 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_{read_with_binmode_and_get[cs]}): only for Windows.
 
-	* lib/jcode.rb: forgot to squeeze on reverse (complement) case.
+Sat Feb 11 03:38:48 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* string.c (tr_squeeze): should not set modify flag to be honest,
-	  if the string is not modified.
+	* win32/win32.c, include/ruby/win32.h (rb_w32_fd_is_text): new function.
 
-	* signal.c (Init_signal): SIGTERM should not be handled.
+	* win32/win32.c (init_stdhandle): set default mode of stdin as binmode.
 
-	* regex.c (re_match): seeking for longest match is now optional,
-	  which can be set using RE_OPTION_POSIXMATCH.  This satisfies
-	  POSIX longest match as much as Emacs's posix-* functions, which
-	  are known to be incomplete.
+	* io.c (set_binary_mode_with_seek_cur): new function to replace
+	  SET_BINARY_MODE_WITH_SEEK_CUR macro.  now returns previous mode of the
+	  fd and take care of LF in rbuf.
 
-Sun May  9 13:04:01 1999  Katsuyuki Komatsu  <komatsu@sarion.co.jp>
+	* io.c (do_writeconv): set text mode when needed.
 
-	* ext/socket/socket.c (sock_s_getaddrinfo): conversion from
-	  Fixnums to C integers needed.
+	* io.c (io_read): need to change the mode of the IO to binmode
+	  temporally when the length for IO#read, because IO#read with length
+	  must behave so.
 
-Sun May  9 11:51:43 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_{read_with_length,
+	  read_with_length_binmode,get[cs]_and_read_with_binmode,
+	  read_with_binmode_and_get[cs],read_write_with_binmode}): tests for
+	  above changes.
 
-	* range.c (range_eqq): reverse condition.
+	all patches are written by Hiroshi Shirosaki. [ruby-core:41496]
+	[Feature #5714]
 
-	* range.c (range_s_new): default should be end inclusive.
+Sat Feb 11 03:37:56 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat May  8 03:27:51 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/rexml/test_order.rb (OrderTester#test_more_ordering): use
+	  GZip::GzReader.open instead of GZip::GzReader.new with File.new.
+	  fixed a test error on Windows introduced at r33946.
 
-	* ext/socket/socket.c (thread_connect): replace nasty
-	  rb_thread_fd_writable() with rb_thread_select().
+Sat Feb 11 03:37:34 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri May  7 20:49:00 1999  Katsuyuki Komatsu  <komatsu@sarion.co.jp>
+	* ext/zlib/zlib.c (rb_gzreader_initialize): revert a part of r33937.
+	  1st, to change the mode of an IO is very sensitive problem, so
+	  fixed test errors on Windows introduced at r33953.
+	  the maintainer of this library should judge it.
+	  2nd, usually Zlib::GzReader.new is not called directly.  #initialize
+	  is called via .open, and in the method the I/O is opened in binary
+	  mode, so there is no problem without changing the mode in #initialize.
 
-	* ext/socket/getaddrinfo.c (inet_pton): wrong parameter to
-	  inet_aton().
+	  fixed test errors on Windows introduced at r33947.
+Sat Feb 11 03:23:58 2012  Luis Lavena  <luislavena@gmail.com>
 
-	* ext/socket/addrinfo.h (__P): silly cut and paste typo.
+	* ext/zlib/zlib.c (rb_gzreader_initialize): use binary mode by default
+	  under Windows. Patch by Hiroshi Shirosaki. [ruby-core:40706]
+	  [Feature #5562]
 
-Fri May  7 17:03:57 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* include/ruby/encoding.h (void rb_econv_binmode): define NEWLINE
+	  decorator.
 
-	* dir.c (glob): removed GPL'ed glob.c completely.
+	* io.c (rb_cloexec_fcntl_dupfd): Introduce NEED_READCONV and
+	  NEED_WRITECONV to replace universal newline decorator by CRLF only
+	  when required to improve file reading and writing under Windows.
+	  Patch by Hiroshi Shirosaki. [ruby-core:40706] [Feature #5562]
+	* io.c (do_writeconv): adjust binary mode if required.
+	* io.c (read_all, appendline, swallow, rb_io_getline_1): ditto.
+	* io.c (io_getc, rb_io_each_codepoint, rb_io_ungetc): ditto.
+	* io.c (rb_io_binmode, rb_io_ascii8bit_binmode): ditto.
+	* io.c (rb_io_extract_modeenc, rb_sysopen): ditto.
+	* io.c (pipe_open, prep_stdio, io_encoding_set): ditto.
+	* io.c (rb_io_s_pipe, copy_stream_body): ditto.
 
-Fri May  7 08:17:19 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_io_m17n.rb (EOT): add test for pipe and stdin in
+	  binary mode.
 
-	* ext/sdbm/extconf.rb: sdbm extension added to the distribution.
+	* win32/win32.c (init_stdhandle): remove O_BINARY from stdhandle
+	  initialization.
+	* win32/win32.c (rb_w32_write): use FTEXT mode accordingly.
 
-Fri May  7 01:42:20 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Feb 11 03:20:22 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/socket/socket.c (tcp_s_gethostbyname): aboid using struct
-	  sockaddr_storage.
+	* io.c (argf_next_argv): wrong timing of setting ecflags.
+	  fixed the failure of TestArgf#test_textmode introduced at r33662.
 
-Thu May  6 13:21:41 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Feb 11 03:19:45 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* array.c (rb_ary_indexes): should not use rb_ary_concat().
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_default_stdout_stderr_mode): new test for
+	  r33627-33629.  see [backport #5565]
+Sat Feb 11 03:20:22 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu May  4 12:34:18 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+	* include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_READ_MASK,
+	  ECONV_NEWLINE_DECORATOR_WRITE_MASK): new macro.
 
-	* parse.y (parse_string): there shuould be newline escape by
-	  backslashes in strings.
+	* io.c (rb_io_extract_modeenc, pipe_open, prep_stdio, argf_next_argv):
+	  set TEXTMODE_NEWLINE_DECORATOR_ON_WRITE for textmode on creating IO
+	  if the flag is available.
 
-	* parse.y (parse_qstring): ditto.
+	* io.c (make_writeconv): drop decorators for reading.
 
-Mon May  3 04:37:20 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+	* io.c (make_readconv): drop decorators for writing.
 
-	* ext/tcltklib/extconf.rb: better search for libX11.
+	* io.c (do_writeconv): existing writeconv is not the condition to raise
+	  ArgumentError.  should check textmode or not.
 
-	* range.c (range_s_new): embarrassing =/== typo.
+	* test/ruby/test_io_m17n.rb
+	  (TestIO_M17N#test_{cr,lf,crlf}_decorator_on_stdout): test above
+	  changes.
 
-	* re.c (Init_Regexp): failed to set default kcode.
 
-Mon May  3 02:39:55 1999  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+Sat Feb 11 03:19:45 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/socket/socket.c (open_inet): typo (res and res0).
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
+	  default_mode_on_unix,text_mode,binary_mode}): sorry for wrong test
+	  committed in r33144.  I'd misunderstood the spec of ruby's universal
+	  newline.
 
-Tue May  4 02:07:49 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Feb 11 03:17:41 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* mkconfig.rb: leave undefined $(VARIABLE) unexpanded in the
-	  Config::CONFIG hash table.
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#test_{default_mode_on_dosish,
+	  default_mode_on_unix,text_mode,binary_mode}): tests for [Bug #5164].
 
-Mon May  3 09:37:22 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Feb 11 03:13:27 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): expand exactn{n} at compile time.
-	  handles stop_paren specially.
+	* transcode.c: enabled econv newline option.
 
-	* regex.c (re_compile_pattern): expand x{n} at compile time.
+Sat Feb 11 02:39:09 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* regex.c (re_search): posix line match should be checked.
+	* variable.c (set_const_visibility): clear inine-cache when constant's
+	  visibility is modified. [ruby-dev:44929]
 
-	* regex.c (re_search): a bug in anchor condition.
+	* test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
+	  add test for it.
 
-Fri Apr 30 18:57:41 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* version 1.3.3
+	* variable.c (set_const_visibility): print a warning when no argument
+	  is passwd to Module#private_constant.  [ruby-list:48558]
 
-	* string.c (rb_str_rindex): position should be END point, not
-	  START point.
+	* vm_method.c (set_method_visibility): ditto for
+	  Module#private_class_method.
 
-	* re.c (rb_reg_search): pos means end point on reverse now.
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* array.c (rb_ary_s_create): should clear ary->ptr to avoid
-	  potential gc crash.
+	* variable.c (set_const_visibility): Module#private_constant has
+	  changed the visibility of only the first argument.  Now it changes
+	  all of them.  [ruby-list:48558]
 
-Fri Apr 30 15:24:58 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_module.rb: add a test for above.
 
-	* ext/socket/addrinfo.h: compatibility hack for ipv4.
+Sat Feb 11 02:39:09 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/socket/socket.c: itojun's ipv6 patches applied.
+	* variable.c (set_const_visibility): clear inine-cache when constant's
+	  visibility is modified. [ruby-dev:44929]
 
-	* ext/socket/extconf.rb: detect ipv6 features based on itojun's
-	  ipv6 patches.
+	* test/ruby/test_module.rb (test_private_constants_clear_inlinecache):
+	  add test for it.
 
-	* ext/extmk.rb.in (enable_config): can handle --enable-xxx now.
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* lib/mkmf.rb (enable_config): ditto.
+	* variable.c (set_const_visibility): print a warning when no argument
+	  is passwd to Module#private_constant.  [ruby-list:48558]
 
-Fri Apr 30 05:22:23 1999  Shugo Maeda  <shugo@netlab.co.jp>
+	* vm_method.c (set_method_visibility): ditto for
+	  Module#private_class_method.
 
-	* string.c (rb_str_aset): last index should not append.
+Sat Feb 11 02:39:09 2012  Yusuke Endoh  <mame@tsg.ne.jp>
 
-Thu Apr 29 18:55:31 1999  WATANABE Hirofumi  <eban@os.rim.or.jp>
+	* variable.c (set_const_visibility): Module#private_constant has
+	  changed the visibility of only the first argument.  Now it changes
+	  all of them.  [ruby-list:48558]
 
-	* dln.c (conv_to_posix_path): remove const from args.
+	* test/ruby/test_module.rb: add a test for above.
 
-	* ruby.c (rubylib_mangle): remove Fatal(), the obsolete function.
+Sat Feb 11 02:26:51 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Tue Apr 27 14:11:45 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/openssl/buffering.rb: Force multi-byte strings to be treated as
+	  binary data.
+	* test/openssl/test_ssl.rb: Add test for it.
 
-	* parse.y (fname): lazy workaround for keywords did not work well.
+	Thanks to Niklas Baumstark for reporting the issue!
 
-	* ext/extmk.rb.in: `--with-xxx=yyy' argument configuration.
+	[Ruby 1.9 - Bug #5233] [ruby-core:39120]
 
-	* lib/mkmf.rb: ditto.
+Fri Feb 10 17:25:28 2012  Tanaka Akira  <akr@fsij.org>
 
-	* misc/ruby-mode.el: forgot to handle $`.
+	* lib/set.rb (SortedSet.setup): remove old_init after initialize
+	  method is redefined.  The remove before redefinition makes the
+	  warning prevention fragile.  [ruby-dev:44892]
 
-	* ext/extmk.rb.in: better AIX link support proposed by
-	  <komatsu@sarion.co.jp>.
+Fri Feb 10 17:02:12 2012  okkez  <okkez000@gmail.com>
 
-Mon Apr 26 16:46:59 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_pthread.c (rb_thread_create_timer_thread): fix memory
+	  leak. [ruby-dev:44904] [Bug #5688]
 
-	* ext/extmk.rb.in: AIX shared library support modified.
+Fri Feb 10 05:22:32 2012  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/aix_mksym.rb: ditto.
+	* cont.c (fiber_setcontext): Use longjmp() instead of swapcontext() on
+	  FreeBSD 9. [ruby-dev:41316] [Bug #3295] [Bug #5526]
 
+Fri Feb 10 05:13:12 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* object.c: Added examples for Object#is_a? and
+	  Object#instance_of? patcheed from Manoj Kumar.
+	  [Bug #5880] [ruby-core:42057]
+
+Fri Feb 10 05:11:43 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (argf_next_argv): reset ARGF.next_p on ARGV.replace.
+	  r34409 breaks replacing ARGV.
+	  [ruby-dev:45160] [Bug #5952]
+
+Fri Feb 10 05:11:43 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_close): skip stdin, which should be readable again.
+	  [ruby-dev:45160] [Bug #5952]
+
+	* io.c (argf_readlines): reinitialize after all read to be
+	  readable again.
+
+Fri Feb  9 01:36:19 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r34482 from trunk
+
+	* ext/openssl/ossl_ssl.c: Add SSL constants and allow to unset SSL
+	  option to prevent BEAST attack. See [Bug #5353].
+
+	  In OpenSSL, OP_DONT_INSERT_EMPTY_FRAGMENTS is used to prevent
+	  TLS-CBC-IV vulunerability described at
+	  http://www.openssl.org/~bodo/tls-cbc.txt
+	  It's known issue of TLSv1/SSLv3 but it attracts lots of attention
+	  these days as BEAST attack. (CVE-2011-3389)
+
+	  Until now ossl sets OP_ALL at SSLContext allocation and call
+	  SSL_CTX_set_options at connection.  SSL_CTX_set_options updates the
+	  value by using |= so bits set by OP_ALL cannot be unset afterwards.
+	  This commit changes to call SSL_CTX_set_options only 1 time for each
+	  SSLContext. It sets the specified value if SSLContext#options= are
+	  called and sets OP_ALL if not.
+
+	  To help users to unset bits in OP_ALL, this commit also adds several
+	  constant to SSL such as
+	  OpenSSL::SSL::OP_DONT_INSERT_EMPTY_FRAGMENTS.  These constants were
+	  not exposed in Ruby because there's no way to unset bits in OP_ALL
+	  before.
+
+	  Following is an example to enable 0/n split for BEAST prevention.
+
+	    ctx.options = OP_ALL & ~OP_DONT_INSERT_EMPTY_FRAGMENTS
+
+	* test/openssl/test_ssl.rb: Test above option exists.
+
+Thu Feb  9 17:08:20 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* cont.c (cont_mark): mark original Thread object from saved_thread.
+	  [ruby-dev:44567] [Bug #5386]
+
+Thu Feb  9 17:05:07 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* cont.c (HAVE_GETCONTEXT): see getcontext(3) because DragonFly BSD
+	  x64 port doesn't have it.
+
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/memory_status.rb (Memory::Win32): 64bit support.
+
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/dl/lib/value.rb (DL::ValueUtil.{unsigned_value,signed_value}):
+	  currenly pack/unpack does not accept "q!" and "Q!".
+
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/fiddle/conversions.c (value_to_generic): src is not guranteed as
+	  a Bignum if the type is LONG_LONG.  it may be a Fixnum if the value
+	  is small.
+
+Thu Feb  9 16:19:04 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/dl/lib/types.rb: Win64 support.
+
+Thu Feb  9 11:11:15 2012  Hiroshi Shirosaki <h.shirosaki@gmail.com>
+
+	* ext/dbm/dbm.c (Init_dbm): fix a build error on mswin32.
+	  use `extern __declspec(dllimport)` for dll link with VC.
+	  [ruby-core:41996] [Bug #5869]
+
+Thu Feb  9 11:11:15 2012  Tanaka Akira  <akr@fsij.org>
+
+	* ext/dbm/dbm.c: use db_version() instead of DB_VERSION_STRING to
+	  detect runtime Berkeley DB version.
+	  use dpversion instead of _QDBM_VERSION to detect runtime QDBM
+	  version.
+	  [ruby-dev:44948]
+
+Thu Feb  9 11:11:15 2012  Tanaka Akira  <akr@fsij.org>
+
+	* ext/dbm/extconf.rb: detect gdbm_version in libgdbm.
+
+	* ext/dbm/dbm.c: make DBM::VERSION more informative for gdbm, qdbm and
+	  Berkeley DB 1.x.  [ruby-dev:44944]
+
+Thu Feb  9 07:32:40 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (rb_enc_uint_char): raise RangeError when added codepoint
+	  is invalid. [Feature #5855] [Bug #5863] [Bug #5864]
+
+	* string.c (rb_str_concat): ditto.
+
+	* string.c (rb_str_concat): set encoding as ASCII-8BIT when the string
+	  is US-ASCII and the argument is an integer greater than 127.
+
+	* regenc.c (onigenc_mb2_code_to_mbclen): rearrange error code.
+
+	* enc/euc_jp.c (code_to_mbclen): ditto.
+
+	* enc/shift_jis.c (code_to_mbclen): ditto.
+
+Thu Feb  9 07:28:43 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/pathname/test_pathname.rb: not read but binread.
+	  patched by Benoit Daloze, [ruby-core:42440] [Bug #5984]
+
+Wed Feb  8 22:29:59 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_modify_expand): fix memory leak.
+
+Wed Feb  8 10:58:45 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  respect encodings.  [Bug #5941]
+
+Wed Feb  8 10:56:00 2012  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  fix compile error.
+
+Wed Feb  8 10:56:00 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  empty completion result does not mean memory error.
+
+Wed Feb  8 10:54:49 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/readline/readline.c (readline_readline): check if outstream
+	  is closed to get rid of a bug of readline 6.  [ruby-dev:45043]
+	  [Bug #5803]
+
+Wed Feb  8 10:52:51 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/readline/readline.c (Init_readline): like r18313, libedit's
+	  replace_history_entry may use offset instead of which.
+	  so introduce history_replace_offset_func and initialize it.
+
+	* ext/readline/readline.c (hist_set): use history_replace_offset_func.
+
+Wed Feb  8 10:52:36 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/readline/readline.c (Init_readline): fix wrong condition.
+
+Wed Feb  8 10:50:11 2012  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/ruby/test_rubyoptions.rb (test_script_from_stdin): slave pty
+	  should be manipulated because master pty may not be a tty on some
+	  environment (e.g. Solaris). [Bug:#5222] [ruby-dev:44420]
+
+Wed Feb  8 10:38:36 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (CFLAGS): append ARCH_FLAG.
+
+	* configure.in (ARCH_FLAG): exclude from CFLAGS.
+
+Wed Feb 08 09:19:00 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_cipher.c: Add warning about key as IV.
+
+Wed Feb  8 10:37:31 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_cipher.c: Update and complete documentation.
+
+Wed Feb 08 09:57:33 2012  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_asn1.c: Call INT2NUM only once for GeneralString.
+	  Thanks to Mantas Mikulenas for noticing and providing a patch!
+	  [ruby-core:42358] [Bug #5972]
+
+Wed Feb  8 10:34:59 2012  TAKAO Kouji  <kouji@takao7.net>
+
+	* ext/readline/readline.c (readline_attempted_completion_function):
+	  in Readline module with GNU Readline 6 case, Readline module
+	  resets completion_append_character to " ", after it executes
+	  completion. So, Readline module stores
+	  completion_append_character, and Readline module always sets it
+	  after Readline module executes completion. [ruby-dev:43456]
+	  [Feature #4635]
+
+Wed Feb  8 09:47:52 2012  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_sleep.rb (test_sleep_5sec): 0.1sec tolerance is too
+	  small for busy environment.
+
+Wed Feb  8 09:45:23 2012  Tanaka Akira  <akr@fsij.org>
+
+	* test/dbm/test_dbm.rb: split tests for read only database.
+
+	* test/gdbm/test_gdbm.rb: ditto.
+
+Wed Feb  8 09:43:48 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* error.c (name_err_mesg_to_str): clear rb_thread_t::errinfo when
+	  ignore exception under rb_protect(). [ruby-core:41612] [Bug #5755]
+
+	* test/ruby/test_exception.rb (test_exception_in_name_error_to_str):
+	  add a corresponding test.
+
+Wed Feb  8 09:36:42 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (require_enc): reject only loading from untrusted
+	  load paths.  [ruby-dev:44541] [Bug #5279]
+
+	* transcode.c (load_transcoder_entry): ditto.
+
+Wed Feb  8 09:36:42 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (load_encoding): predefined encoding names are safe.
+	  [ruby-dev:44469] [Bug #5279]
+
+	* transcode.c (load_transcoder_entry): ditto.
+
+Tue Feb  7 14:29:16 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* st.c (st_foreach): should not yield same pair when checking
+	  after unpacking.
+
+Tue Feb  7 14:03:45 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* lib/tempfile.rb (Tempfile#_close): clear @tempfile and @data[1] even
+	  when exception is raised at @tempfile.close. [ruby-dev:45113]
+
+	* lib/tempfile.rb (Tempfile#unlink): fix a typo.
+
+Tue Feb  7 14:02:32 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* test/ruby/test_io.rb (test_autoclose_true_closed_by_finalizer,
+	  test_autoclose_true_closed_by_finalizer): skip if IO objects are
+	  not recycled yet. [ruby-dev:45098] [Bug #5850]
+
+Tue Feb  7 13:59:26 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* gc.c (run_finalizer): clear rb_thread_t::errinfo when ignore
+	  an exception under rb_protect(). [ruby-dev:45113]
+
+Mon Feb  6 15:34:47 2012  Tanaka Akira  <akr@fsij.org>
+
+	* ruby.c (fill_standard_fds): use fstat() instead of fcntl(F_GETFD)
+	  for MinGW.  reported by Luis Lavena.  [ruby-core:40526] [Bug #5516]
+
+Mon Feb  6 15:34:47 2012  Tanaka Akira  <akr@fsij.org>
+
+	* ruby.c (fill_standard_fds): new function to open closed standard
+	  file descriptors.
+	  (ruby_sysinit): call fill_standard_fds.
+
+Mon Feb  6 15:19:17 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (rb_io_fsync,rb_io_fdatasync): release GVL during fsync().
+	  fsync() and fdatasync() may take a long time on slow disks and/or
+	  if there is much dirty data.
+	  Patch by Eric Wong. [Feature #5665] [ruby-core:41247]
+
+Mon Feb  6 15:01:55 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (vm_call0): should pass block to enumerators.  patched
+	  by Kazuki Tsujimoto.  [ruby-dev:44961][Bug #5731]
+
+	* vm_eval.c (method_missing), vm_insnhelper.c (vm_call_method):
+	  ditto.  patched by satoshi shiba.
+
+Mon Feb  6 21:52:20 2012  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* common.mk (INSTRUBY_ARGS): added --mantype to apply mdoc2man.rb
+	  to man pages.  Fixes #5598.
+	  (do-install-nodoc, do-install-local, do-install-man,
+	  dont-install-nodoc, dont-install-local, dont-install-man):
+	  No longer needs --mantype.
+
+	  Reported by Rainer Orth <ro AT cebitec.uni-bielefeld.de>,
+	  patch by George Koehler <xkernigh AT netscape.net>.
+
+Mon Feb  6 21:21:46 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/unit/assertions.rb (MINI_DIR): quick dirty hack to get rid of
+	  warnings when using assert/assert_respond_to.
+
+Mon Feb  6 20:38:19 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* file.c (file_expand_path): reset coderange after expanding path.
+
+Mon Feb  6 20:32:17 2012  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_strptime.c: moved detector of leftover.
+
+Mon Feb  6 20:32:17 2012  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_parse.c: [ruby-core:42173].
+
+Mon Feb  6 20:31:35 2012  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: uses to_integer instead.
+	* test/date/test_switch_hitter.rb: added a test.
+
+Mon Feb  6 20:31:35 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/date/date_core.c (wholenum): fix the type of the return value.
+
+Mon Feb  6 20:31:35 2012  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c:  [ruby-dev:45008].
+
+Mon Feb  6 16:38:56 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (unixtime_to_filetime): should check the return value
+	  of localtime().  reported by snowjail at gmail.com.
+	  [ruby-dev:44838] [Bug #5596]
+
+Mon Feb  6 16:36:25 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_update_max_fd): fstat(2) can fail with other than
+	  EBADF.  [ruby-dev:44837] [Bug #5593].  Cf.
+	  http://pubs.opengroup.org/onlinepubs/9699919799/functions/fstat.html
+
+Mon Feb  6 16:31:16 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (io_fwrite): call rb_w32_write_console() only if FMODE_TTY is
+	  set.  this is the one of the reason of IO writing slowness of Windows
+	  in 1.9.3 or later.
+
+Mon Feb  6 16:21:57 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* file.c (file_expand_path): reset coderange after expanding path.
+
+Mon Feb  6 00:06:39 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/json/parser/parser.rl (json_string_unescape): workaround fix
+	  for over optimization of GCC 4.7. [ruby-core:42085] [Bug #5888]
+	  http://gcc.gnu.org/bugzilla/show_bug.cgi?id=51862
+
+Fri Feb  3 16:16:10 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/envutil.rb (EnvUtil.invoke_ruby): yield also child pid
+	  in block form.
+
+Fri Feb  3 16:16:10 2012  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* test/ruby/test_thread.rb
+	  (TestThreadGroup#test_thread_timer_and_interrupt): skip exit status
+	  assertion because we cannot get signal status on Windows.
+
+	* win32/win32.c (CreateChild): create process group to receive the
+	  signal by GenerateConsoleCtrlEvent().
+
+	* win32/win32.c (kill): use CTRL_BREAK_EVENT instead of CTRL_C_EVENT
+	  if a process group is specified. CTRL_C_EVENT signal cannot be
+	  generated for process groups for the specification.
+	  [ruby-dev:45149] [Bug #5812]
+
+Fri Feb  3 16:16:10 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* test/ruby/envutil.rb (invoke_ruby): remove :timeout option before
+	  pass it to Kernel#spawn.
+
+Fri Feb  3 10:10:02 2012  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* thread_pthread.c (ping_signal_thread_list): remove return value.
+	* thread_pthread.c (check_signal_thread_list): add a new function to
+	  check if signal thread list is empty.
+	* thread_pthread.c (thread_timer): check signal thread list after
+	  timer_thread_function(). main thread might be added into signal thread
+	  list during timer_thread_function().
+
+Fri Feb  3 10:10:02 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (ubf_select): call rb_thread_wakeup_timer_thread()
+	  only when it is not timer_thread. [Bug #5757] [ruby-dev:44985]
+	  patched by Tomoyuki Chikanaga.
+
+Wed Feb  1 09:50:10 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* doc/re.rdoc (Repetition): fix typo.  reported by Ori Avtalion
+	  and patched by Zachary Scott.  [Bug #5947]
+
+Tue Jan 24 11:38:05 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/common.rb (URI.encode_www_form_component): initialize on
+	  requiring to support JRuby, which runs parallel multithreads.
+	  [ruby-core:42222] [Bug #5925]
+
+	* lib/uri/common.rb (URI.decode_www_form_component): initialize on
+
+Sat Jan 28 05:53:34 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/irb/completion.rb (IRB::InputCompletor::CompletionProc):
+	  ignore non-string name modules.  [ruby-core:42244][Bug #5938]
+
+Mon Jan 23 18:18:58 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* encoding.c (rb_enc_compatible): fix segv on symbols.
+	  [ruby-core:42204] [Bug #5921]
+
+Tue Jan 17 17:18:41 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (SPT_TYPE): enable as SPT_REUSEARGV on Darwin.
+
+	* missing/setproctitle.c (ruby_init_setproctitle): changed prefix.
+
+Mon Jan 16 16:41:53 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb (Regexp): fix incorrect options when casting to
+	  a Regexp, and suppress encoding option warnings.
+	  https://github.com/ruby/ruby/pull/82
+
+Fri Jan 13 15:22:43 2012  Tanaka Akira  <akr@fsij.org>
+
+	* time.c (TIME_COPY_GMT): copy vtm.utc_offset and vtm.zone too.
+	  patch by Tomoyuki Chikanaga.
+	  [ruby-dev:44827] [Bug #5586]
+
+Thu Jan 12 13:52:13 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* cont.c (cont_restore_0): prevent optimizing out `sp'. sp is used for
+	  reserving a memory space with ALLOCA_N for restoring machine stack
+	  stored in cont->machine_stack, but clang optimized out it (and
+	  maybe #5851 is also caused by this).
+	  This affected TestContinuation#test_check_localvars.
+
+	* cont.c (cont_restore_1): revert workaround introduced in r32201.
+
+Thu Jan 12 01:40:33 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_io.rb (TestIO#test_autoclose): Tempfile.new doesn't
+	  accept the block argument.
+
+Sat Jan  7 22:46:36 2012  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/parsers/baseparser.rb: use private instead of _xxx
+	  method name. This is Ruby code not Python code.
+	  refs #5696
+
+Tue Jan 03 23:57:37 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* lib/rexml/parsers/baseparser.rb: rexml BaseParser uses
+	  instance_eval unnecessarily on listener add.
+	  patch from Charles Nutter. [Bug #5696] [ruby-core:41437]
+
+Tue Jan 03 19:13:05 2012  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* test/rexml/test_sax.rb: add require 'rexml/document'.
+	  [Backport #5834] [ruby-dev:45079]
+
+Tue Jan  3 19:05:42 2012  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* include/ruby/defines.h (FLUSH_REGISTER_WINDOWS): move sparc asm code
+	  to a separete file sparc.c for preventing inlining optimization.
+	  Patched by Jurij Smakov. [Bug #5244] [ruby-core:40685]
+	* sparc.c (rb_sparc_flush_register_windows): ditto.
 	* configure.in: ditto.
 
-	* sprintf.c (rb_f_sprintf): should allocate proper sized buffer
-	  for float numbers.
+Mon Jan  2 23:52:20 2012  TAKAO Kouji  <kouji@takao7.net>
+
+	* ext/readline/readline.c (Init_readline): libedit check
+	  rl_getc_function only when rl_initialize() is called, and
+	  using_history() call rl_initialize(). This assignment should be
+	  placed before using_history(). [ruby-core:40641] [Bug #5539]
+
+Mon Jan  2 23:47:58 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/rbinstall.rb (install_recursive, bin-comm): split mere
+	  string not path name.  [ruby-core:40462] [Bug #5492]
+
+Mon Jan  2 23:41:57 2012  Tajima Akil <artonx@yahoo.co.jp>
+
+	* win32/Makefile.sub (CONFIG_H): have stdint.h if VC2010.
+	  [Bug #5243]
+
+Mon Jan  2 21:40:45 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* tool/merger.rb (#version_up): version.h date should be Japanese
+	  locale date.
+
+Mon Jan  2 21:36:56 2012  Luis Lavena  <luislavena@gmail.com>
+
+	* configure.in: check -fno-omit-frame-pointer acceptance and usage
+	  under MinGW. [ruby-core:39957] [Bug #5407]
+
+Mon Jan  2 20:05:10 2012  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* include/ruby/ruby.h (SIZE_MAX): define SIZE_MAX if not defined.
+	  patched by The Written Word Inc. [ruby-core:40422] [Bug #5489]
+
+Mon Jan  2 20:00:01 2012  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/pty/pty.c (pty_check): should return nil until the child
+	  terminates or stops.  [ruby-dev:44600] [Bug #2642]
+
+Mon Jan  2 19:27:18 2012  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* thread.c (update_coverage): skip coverage count up if the current
+	  line is out of the way.  rb_sourceline() is unreliable when source
+	  code is big.  [ruby-dev:44413]
+
+	* test/coverage/test_coverage.rb: add a test for above.
+
+Mon Jan  2 19:08:54 2012  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (gvl_yield): don't prevent concurrent sched_yield().
+	  [Bug #5130] [ruby-core:38647]
+
+Mon Jan  2 18:54:52 2012  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/configure.bat: disable delayed expansion of enironment variable.
+	  [Bug #5517] [ruby-core:40531]
+
+Wed Dec 28 11:22:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/fileutils.rb (FileUtils::Entry_#entries): use utility method
+	  instead of typoed regexp.  [ruby-core:41829] [Bug #5817]
+
+Thu Dec 15 10:44:54 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_reject_bang, rb_ary_delete_if): update rdoc.
+	  documentation from Thomas Leitner <t_leitner AT gmx.at> in
+	  [ruby-core:41616].  [Bug #5752]
+
+Wed Dec 14 15:28:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (str_encode): about the extension of :fallback
+	  option since 1.9.3.
+
+Tue Oct  4 06:43:47 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: update psych version.
+	* ext/psych/psych.gemspec: generate new gemspec for new version.
+
+Tue Oct  4 06:29:55 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: calling `yaml` rather than `to_yaml`.
+	* ext/psych/lib/psych/nodes/node.rb: Rename `to_yaml` to just `yaml`
+	  in order to avoid YAML::ENGINE switching from replacing this method.
+	* test/psych/helper.rb: fix tests for method name change.
+	* test/psych/test_document.rb: ditto
+	* test/psych/visitors/test_emitter.rb: ditto
+
+Tue Oct  4 06:20:19 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/scalar_scanner.rb: Match values against the
+	  floating point spec defined in YAML to avoid erronious parses.
+	* test/psych/test_numeric.rb: corresponding test.
+
+Tue Oct  4 05:59:24 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: ToRuby visitor can be
+	  constructed with a ScalarScanner.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: ScalarScanner can be
+	  passed to the YAMLTree visitor.
+
+Tue Oct  4 05:47:23 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Define Regexp::NOENCODING
+	  for 1.9.2 backwards compatibility.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Fix Date string
+	  generation for 1.9.2 backwards compatibility.
+
+Fri Sep  2 04:05:25 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: emit strings tagged as
+	  ascii-8bit as binary in YAML.
+	* test/psych/test_string.rb: corresponding test.
+
+Wed Dec  7 19:04:22 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rpath): fix typo in the help string.  a patch from
+	  Yuji Yamano <yyamano AT kt.rim.or.jp> in [ruby-list:48568].
+
+Wed Nov 30 18:22:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* complex.c (nucomp_rationalize): fix function.  [ruby-core:40667]
+	  [Bug #5546]
+
+Thu Nov 17 10:36:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb (load_file): make sure opened yaml files are
+	  also closed. [ruby-core:41088]
+
+Wed Nov 30 02:58:46 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* numeric.c (dbl2ival): Fix Float#divmod and #round for 32 bit
+	  platform. part 1 of [bug #5276]
+
+Wed Nov 30 02:58:46 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* numeric.c (flo_round): Fix criteria for 32 bits platform
+	  part 2 of [bug #5276]
+
+Wed Nov 30 02:37:32 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* numeric.c (flo_round): Make Float#round round big values [bug
+	  #5272]
+
+Wed Nov 30 02:37:32 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (flo_round): substitute machine dependent magic number.
+
+Wed Nov 30 02:28:22 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* numeric.c (int_round): Integer#round always returns an Integer [Bug
+	  #5271]
+
+Fri Nov  4 01:56:30 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (make_writeconv): unversal_newline converter is for reading.
+	  so, if the io is text mode and has ECONV_UNIVERSAL_NEWLINE_DECORATOR
+	  flag, use crlf_newline converter for writing.
+	  this change fixes the problem about the luck of CR up Kernel.p and
+	  Kernel.puts to stdout/stderr on Windows.
+
+Mon Nov  7 23:39:23 2011  Tajima Akio <artonx@yahoo.co.jp>
+
+	* io.c (io_fflush): remove fsync().
+	* io.c (rb_io_flush, rb_io_rewind): fsync() here.
+	  These pathces are backports of trunk r33651 for [Bug #5585]
+
+Mon Oct 10 22:33:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/-ext-/old_thread_select/test_old_thread_select.rb:
+	  select() with timeout may return early in old Linux kernels
+	  with 250 Hz tickrate and no dynticks, so skip everything older
+	  than 2.6.32 (which has long term support).
+	  And, Make the timing assertions consistently use assert_operator with
+	  timing difference in error message
+	  Patch by Eric Wong. [Bug #5335] [ruby-core:39618]
+
+Tue Oct  4 16:17:50 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/time.rb (Time.strptime): use Time.at if d[:seconds] is set.
+	  Reported by Christopher Eberz. [ruby-core:39903] Bug #5399
+
+Tue Oct  4 11:44:10 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* gc.c (rb_gc_set_params): ruby_verbose can be Qnil, so use RTEST.
+
+Mon Oct  3 23:56:39 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* gc.c (rb_gc_set_params): output GC parameter change messages only
+	  if -w/-v options are specified. these messages are output to stderr,
+	  not to stdout. [ruby-core:39795] [Bug #5380]
+
+	* test/ruby/test_gc.rb (test_gc_parameter): add test for it.
+
+Wed Sep 28 09:14:16 2011  Nobuyoshi Nakada  <>
+
+	* configure.in (pthread_np.h): needs pthread.h to be included
+	  previously on OpenBSD.  a patch by George Koehler <xkernigh AT
+	  netscape.net> at [ruby-core:39752].  [Bug #5376]
+
+Tue Sep 13 15:02:48 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/pstore.rb (PStore): always open in binary mode even if
+	  default encodings are set.  [Bug #5311] [ruby-core:39503]
+
+Sat Oct  8 07:31:42 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (ary_join_1): should not copy the encoding of non-string
+	  element after string element.  [ruby-core:39776] [Bug #5379]
+
+Sat Oct  8 06:51:46 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems:  Update to RubyGems 1.8.11.  Move Deprecate into the
+	  Gem namespace.
+
+Sat Oct  8 06:37:08 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* gc.c (rb_gc_set_params): output GC parameter change messages only
+	  if -w/-v options are specified. these messages are output to stderr,
+	  not to stdout. [ruby-core:39795] [Bug #5380]
+
+	* test/ruby/test_gc.rb (test_gc_parameter): add test for it.
+
+Sat Oct  8 06:26:24 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* gc.c (add_heap_slots, init_heap): reset heaps_inc zero when
+	  heap slots are expanded by environment variable RUBY_HEAP_MIN_SLOTS.
+	  [ruby-core:39777] [Bug #5380]
+
+	* test/ruby/test_gc.rb (test_gc_parameter): add test for it.
+
+	* test/ruby/envutil.rb (assert_normal_exit): add :child_env option to
+	  enable pass environemnt variables to child process.
+
+Sat Oct  8 05:45:28 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* proc.c (proc_call):  Update documentation to match argument handling
+	  of proc/Proc.new/lambda/->()
+
+Sat Oct  8 05:38:29 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* proc.c (proc_call):  Fix documentation of Proc#call vs Proc#===.
+	  [Ruby 1.9 - Bug #5349]
+
+Tue Sep 27 13:05:39 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_asn1.c: fix int_ossl_asn1_decode0_cons when being
+	  fed arbitrary string values.
+	  Clearly distinguish between the cases "universal, infinite and
+	  not a SEQUENCE or SET" and "universal SEQUENCE or SET, possibly
+	  infinite". Raise error for universal tags that are not infinite.
+	* test/openssl/test_asn1.rb: add a test for this.
+
+	  Thanks to Hiroshi Yoshida for reporting this bug.
+	  [Bug #5363] [ruby-dev:44542]
+
+Sat Sep 17 23:34:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_data_type): inherit the core type in ripper so
+	  that checks in core would work.  [ruby-core:39591] [Bug #5331]
+
+Fri Sep 23 14:15:01 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_asn1.c
+	  ext/openssl/ossl_pkey.c: Remove unused variables.
+
+Fri Sep 23 06:54:44 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r33315 from trunk.
+
+	* test/openssl/test_ssl_session.rb: execute test_session_exts_read
+	  only for OpenSSL versions >= 0.9.8k. Thanks, Eric Wong, for
+	  reporting this.
+	  [Bug #4961] [ruby-core:37726]
+
+Fri Sep 23 12:18:52 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r33311 from trunk.
+
+	* test/openssl/test_ssl_session.rb: ensure server calls callbacks in
+	  test_ctx_server_session_cb. Thanks to Eric Wong for the patch.
+	  [Bug #5336] [ruby-core:39619]
+
+Thu Sep 22 19:45:22 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* thread_pthread.c (ubf_select): activate timer thread when interrupt
+	  blocking thread.
+	  A patch created by Koichi Sasada. [ruby-core:39634] [Bug #5343]
+	  to cover race condition, timer thread periodically send SIGVTARLM to
+	  threads in signal thread list. so you should activate timer thread
+	  when interrupt a thread.
+
+Wed Sep 21 16:57:03 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/io/wait/test_io_wait.rb (TestIOWait#setup): of course, the
+	  behavior of mingw is just same with mswin.
+
+Sat Sep 17 22:21:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (rb_vm_make_env_object, rb_vm_get_sourceline): export as a
+	  workaround for ruby-debug19 for the time being.
+	  [ruby-core:38972] [Bug #5193]
+
+Fri Sep 16 01:08:19 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* NEWS: cosmetic changes.
+
+Wed Sep 14 12:39:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* configure.in: do not use gcc-4.2 as the default compiler.
+
+	* NEWS: describe the issue about Xcode.
+
+Wed Sep 14 11:46:30 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_fd_rcopy): added an argument guard.
+	  Patch by NAKAMURA Usaku. [Bug #5306] [ruby-core:39435]
+
+Tue Sep 13 09:28:58 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* NEWS: wrote about rb_reserved_fd_p() and objspace.
+
+Mon Sep 12 20:47:52 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_select): fix a typo to initialize efds
+	  properly.  [Bug #5299] [ruby-core:39380]
+
+Mon Sep 12 20:41:20 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_select): fix to ignore an argument
+	  modification of rb_thread_fd_select().
+	  based on a patch by Eric Wong. [Bug #5306] [ruby-core:39435]
+	* thread.c (rb_fd_rcopy): New. for reverse fd copy.
+
+	* test/-ext-/old_thread_select/test_old_thread_select.rb
+	(test_old_select_false_positive): test for bug5306.
+
+	* ext/-test-/old_thread_select/old_thread_select.c (fdset2array):
+	  New. convert fdsets to array.
+	* ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
+	  return 'read', 'write', 'except' argument of rb_thread_select()
+	  to ruby script.
+
+Tue Sep  6 13:15:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (load_encoding): predefined encoding names are safe.
+	  [ruby-dev:44469] [Bug #5279]
+
+	* transcode.c (load_transcoder_entry): ditto.
+
+Fri Sep  9 16:02:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* insns.def (concatstrings): don't use initial ASCII-8BIT string.
+	  [ruby-core:38635] [Bug #5126]
+
+Thu Sep  8 21:17:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: import nkf 2.1.2 (be9c280)
+	  Bump version number/release date only.
+
+Wed Sep  7 23:42:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_next_argv): open in default text mode.
+	  [ruby-core:39234] [Bug #5268]
+
+Mon Sep  5 15:06:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/rubygems/test_gem_security.rb
+	  (test_class_build_self_signed_cert): reset opt[:trust_dir] to apply
+	  temporary Gem.user_home.
+
+Sun Sep  4 00:56:58 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* backport r33177 from trunk.
+
+	* test/ruby/test_fiber.rb (TestFiber#test_no_valid_cfp):
+	  add a test. Unlike TestThread#test_no_valid_cfp,
+	  this test succeeds even if win32ole is required (see r33153).
+
+Fri Sep  2 21:11:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (validate_enc_binmode, prep_stdio): default to text mode on
+	  dosish platforms.  [ruby-core:38822] [Bug #5164]
+
+	* transcode.c (rb_econv_prepare_options): keep default ecflags
+	  unchanged if no options.
+
+Fri Sep  2 14:36:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_search_const_defined_class): search
+	  ancestors only when global scope.  [ruby-core:39227] [Bug #5264]
+
+Fri Sep  2 09:58:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_tokadd_string, parser_yylex): ignore a backslash
+	  which prefixes an non-ascii character, which has no escape
+	  syntax.  [ruby-core:39222] [Ruby 1.9 - Bug #5262]
+
+Thu Sep  1 17:31:22 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* insns.def (defineclass), vm_insnhelper.c (vm_get_cvar_base): see
+	  also inherited constants for classes without superclass and
+	  modules.  [ruby-core:37698] [Bug #3423]
+
+Thu Sep  1 14:11:16 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_thread.rb (TestThread#test_no_valid_cfp): skip when
+	  win32ole is required.  in such case, win32ole redefines
+	  Thread#initialize, and the block argument becomes to be not the top
+	  of the thread, then this testcase always fails.
+
+Wed Aug 31 16:02:45 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/json: Merge json gem v1.5.4 (3dab4c5a6a97fac03dac).
+
+Wed Aug 31 13:19:31 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* numeric.c (flo_round): Avoid overflow by optimizing for trivial
+	  cases
+	  [Bug #5227]
+
+Wed Aug 31 06:45:32 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: fix r32835. $withval can't be used outer AC_ARG_WITH().
+
+Wed Aug 31 05:29:03 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_select_with_thread): and my typo. we all must
+	  be more careful.
+
+Wed Aug 31 05:28:45 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread.c (rb_thread_select): critical typo in r33117.
+
+Wed Aug 31 05:28:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/-ext-/old_thread_select/test_old_thread_select.rb
+	  (TestOldThreadSelect#test_old_select_read_timeout): if the machine
+	  is fast enough, the time used by code around IO.select may be smaller
+	  than Time implement threshold.
+
+Wed Aug 31 05:27:59 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/-test-/old_thread_select/old_thread_select.c (old_thread_select):
+	  typo.
+
+	* test/-ext-/old_thread_select/test_old_thread_select.rb
+	  (TestOldThreadSelect#test_old_select_signal_safe): use SIGINT instead
+	  of SIGUSR1 because the former is general and the latter is platform
+	  dependent.
+
+Wed Aug 31 05:26:30 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c, include/ruby/intern.h (rb_w32_fd_copy): implement
+	  for rb_thread_select() in thread.c.  the use of rb_fd_copy() is
+	  introduced in r33117.
+	  [Bug #5229] [ruby-core:39102]
+
+	* thread.c (rb_thread_select): must call rb_fd_init() before using
+	  rb_fdset_t.  see the implementations of rb_fd_init()s if you want to
+	  know the reason.
+
+Tue Aug 30 11:25:21 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/json: Merge json gem 1.5.4+ (2149f4185c598fb97db1).
+	  [Bug #5173] [ruby-core:38866]
+
+Tue Aug 30 09:53:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* cont.c (fiber_entry): fix stack allocation failure on Debian
+	  GNU/kFreeBSD.
+	  Patch by Lucas Nussbaum <lucas at lucas-nussbaum dot net>.
+	  [Bug #5241] [ruby-core:39147]
+
+Tue Aug 30 09:52:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* backport r33117 from trunk.
+
+	* thread.c (rb_thread_select): rewrite by using
+	  rb_thread_fd_select(). old one is EINTR unsafe.
+	  Patch by Eric Wong. [Bug #5229] [ruby-core:39102]
+
+	* test/-ext-/old_thread_select/test_old_thread_select.rb:
+	  a testcase for rb_thread_select().
+	* ext/-test-/old_thread_select/old_thread_select.c: ditto.
+	* ext/-test-/old_thread_select/depend: ditto.
+	* ext/-test-/old_thread_select/extconf.rb: ditto.
+
+Tue Aug 30 09:16:17 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: fix a build failure on GNU Hurd.
+	  Patch by Samuel Thibault <sthibault at debian dot org>. Thank you!
+	  [Bug #5250] [ruby-core:39185]
+
+Sun Aug 28 15:38:17 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* backport r33106 from trunk.
+
+	* ext/date/date_parse.c (date_zone_to_diff): keep a temporary string
+	  stored in variable while the contents buffer is beeing used.
+
+	* ext/date/date_parse.c (date_zone_to_diff): get rid of out of bounds
+	  memory read. [ruby-dev:44409] [Bug #5213]
+
+Sun Aug 28 05:29:50 2011  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* backport r33102 from trunk.
+
+	* lib/minitest/*: Imported minitest 2.5.1 (r6596)
+	* test/minitest/*: ditto
+
+Sat Aug 27 20:54:54 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* backport r33099 from trunk.
+
+	* vm.c (rb_vm_rewrite_dfp_in_errinfo): change return type
+	  to suppress a warning.
+
+	* vm_core.h: ditto.
+
+Sat Aug 27 19:03:44 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* backport r33096 from trunk.
+
+	* proc.c (proc_new): force to rewrite errinfo when calling Proc.new in ensure.
+	  [Bug #5234] [ruby-core:39125]
+
+	* vm.c (rb_vm_rewrite_dfp_in_errinfo): new function.
+
+	* vm.c (vm_make_env_each): changed accordingly.
+
+	* vm_core.h: ditto.
+
+	* bootstraptest/test_flow.rb: add tests for above.
+
+Sat Aug 27 08:59:12 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* NEWS:  Update version of rake to 0.9.2.2.
+
+Sat Aug 27 08:44:58 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33087 from trunk
+
+	* lib/rdoc:  Import RDoc 3.9.4.  Typo and grammar fixes by Luke Gruber.
+	  [Ruby 1.9 - Bug #5203]
+
+Sat Aug 27 07:53:34 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33087 from trunk.
+
+	* lib/open-uri.rb:  Fix indentation of OpenURI::OpenRead#open.  Use ++
+	  instead of `' for method arguments in open-uri.rb
+
+Sat Aug 27 07:22:07 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33086 from trunk.
+
+	* ext/pathname/lib/pathname.rb:  Fix typos and grammar mistakes.  Patch
+	  by Luke Gruber.  [#5203]
+	* ext/pty/lib/expect.rb:  ditto
+	* lib/mathn.rb:  ditto
+	* lib/net/http.rb:  ditto
+	* lib/open-uri.rb:  ditto
+	* lib/ostruct.rb:  ditto
+	* lib/tempfile.rb:  ditto
+	* lib/thread.rb:  ditto
+	* lib/weakref.rb:  ditto
+	* sample/webrick/httpproxy.rb:  ditto
+
+Fri Aug 26 10:10:37 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33074 from trunk.
+
+	* lib/rubygems:  Update to RubyGems 1.8.10.  Fixes security issue in
+	  creating ruby-format gemspecs.  Fixes Gem.dir not being at the front
+	  of Gem.path to fix uninstall and cleanup commands.  Fixes gem
+	  uninstall stopping on the first missing gem.
+
+Wed Aug 24 09:49:10 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* backport r33045 from trunk.
+
+	* insns.def (defined): fix to checking class variable.
+	  A patch by Magnus Holm <judofyr@gmail.com>.  Thanks!
+
+Fri Aug 26 08:21:10 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* test/ruby/test_variable.rb: add a test for above.
+
+Thu Aug 25 09:43:16 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33066 from trunk.
+
+	* ext/openssl/lib/openssl/bn.rb:  Hide copyright info from RDoc.
+	* ext/openssl/lib/openssl/digest.rb:  ditto
+	* ext/openssl/lib/openssl/cipher.rb:  ditto
+
+Thu Aug 25 09:25:48 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33065 from trunk.
+
+	* ext/openssl/ossl_digest.c:  Document OpenSSL::Digest::digest and add
+	  an example to OpenSSL::Digest.  Patch by Sylvain Daubert.
+	  [Ruby 1.9 - Bug #5166]
+	* ext/openssl/lib/openssl/digest.rb (module OpenSSL):  ditto
+
+Thu Aug 25 08:19:43 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_make_env_each): work around to solve Bug #2729.
+	  fixes: Bug #2729
+	  a patch from Kazuki Tsujimoto <kazuki@callcc.net>
+	  This problem is caused by changing dfp (dynamic env pointer)
+	  from saved dfp.  Saved dfp is pointed env in VM stack.  However,
+	  the dfp can be moved because VM copies env from VM stack to
+	  the heap.  At this copying, dfp was also changed.  To solve this
+	  problem, I'll try to change throw mechanism (not save target dfp,
+	  but save target cfp).
+
+	* bootstraptest/test_flow.rb: add a test for above.
+
+Thu Aug 25 08:04:08 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* numeric.c (int_round): Fix Integer#round [ruby-core:39096]
+
+Thu Aug 25 06:51:08 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: Fixing psych version number.
+
+Thu Aug 25 06:11:35 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/nodes/node.rb: default `to_yaml` encoding to be
+	  UTF-8.
+	* test/psych/test_encoding.rb: test yaml dump encoding.
+
+Wed Aug 24 08:53:06 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33043 from trunk.
+
+	* lib/rdoc:  Update to RDoc 3.9.3.  Fixes RDoc with `ruby -Ku`.  Allows
+	  HTTPS image paths to be turned into <img> tags.  Prevents special
+	  markup inside <tt> from being processed.
+
+Wed Aug 24 07:57:43 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33040 from trunk.
+
+	* lib/rubygems:  Update to RubyGems 1.8.9.  Fixes uninstalling multiple
+	  gems and gem cleanup.
+
+Wed Aug 24 06:45:20 2011  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* backport r33036 from trunk.
+
+	* lib/minitest/*: Imported minitest 2.5.0 (r6557)
+	* test/minitest/*: ditto
+
+Tue Aug 23 15:23:56 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r33027 from trunk.
+
+	* load.c (rb_f_require):  Improve documentation of Kernel#require.
+	  [Ruby 1.9 - Bug #5210]
+
+Tue Aug 23 15:11:48 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r33023 from trunk.
+
+	* ext/zlib/zlib.c (gzfile_read_header): Ensure that each section of
+	  gzip header is readable to avoid SEGV.
+
+	* test/zlib/test_zlib.rb (test_corrupted_header): Test it.
+
+Mon Aug 22 23:43:33 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* backport r33021 from trunk.
+
+	* sprintf.c (rb_str_format): add RB_GC_GUARD to prevent temporary
+	  strings from GC.
+
+Sun Aug 21 17:58:38 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* backport r33019 from trunk.
+
+	* iseq.c (iseq_s_disasm): remove variable which is no longer used
+	  since r33013.
+
+Sun Aug 21 14:20:58 2011  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: use LD_LIBRARY_PATH_64 on 64-bit Solaris.
+
+Sun Aug 21 11:13:54 2011  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* backport r32895 from trunk.
+
+	* ext/fiddle/conversions.c (generic_to_value): ffi_arg and ffi_sarg
+	  should be used to handle shorter return value. fix [Bug #3861]
+	  [ruby-core:32504]
+
+	* ext/fiddle/closure.c (callback): ditto
+
+	* ext/fiddle/conversions.h (fiddle_generic): ditto
+
+	* ext/fiddle/conversions.c (value_to_generic): char, short and int
+	  are strictly distinguished on big-endian CPU, e.g. sparc64.
+
+Sat Aug 20 13:28:32 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* backport r33013 from trunk.
+
+	* iseq.c (iseq_s_disasm): fix a bug that may cause SEGV.
+
+	* test/ruby/test_method.rb (test_body): add a test for the above change.
+
+Sat Aug 20 10:43:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_read): return new string if nil
+	  is explicitly given as a buffer ([Bug #5207]), otherwise set the
+	  encoding.  also removed dead code.
+
+Fri Aug 19 14:25:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (proc_spawn_v, proc_spawn): should not wait the
+	  spawned process.
+
+	* process.c (proc_spawn_v): fix missing argument, and try with
+	  /bin/sh only if failed with ENOEXEC.
+
+Fri Aug 19 14:12:57 2011  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* backport r33007 from trunk.
+
+	* lib/net/imap.rb (idle): raises a Net::IMAP::Error when the
+	  connection is closed.  based on the patch by Hugo Barauna.
+	  [Bug #5190] [ruby-core:38930]
+
+Fri Aug 19 11:28:58 2011  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* backport r33001 from trunk.
+
+	* lib/net/imap.rb (msg_att): accepts extra space before ')'.
+	  based on the patch by art lussos.  [Bug #5163] [ruby-core:38820]
+
+Wed Aug 17 15:27:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* backport r32996 from trunk.
+
+	* ext/bigdecimal/bigdecimal.c (cannot_be_coerced_into_BigDecimal):
+	  add a new function for raising error when an object cannot coerce
+	  into BigDecimal.  [Bug #5172]
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimalValueWithPrec): use
+	  cannot_be_coerced_into_BigDecimal function.
+
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_exp): ditto.
+
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_log): ditto.
+
+	* test/bigdecimal/test_bigdecimal.rb: test for the avobe changes.
+
+	* test/bigdecimal/testbase.rb (under_gc_stress): add a new utility
+	  method to run tests under the condition of GC.stress = true.
+
+Wed Aug 17 10:16:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* backport r32994 from trunk.
+
+	* rational.c (nurat_coerce): Rational#coerce should converts itself
+	  into Complex if the argument is a Complex with non-zero imaginary
+	  part.  [Bug #5020] [ruby-dev:44088]
+
+	* test/ruby/test_rational.rb (test_coerce): test for the above change.
+
+Wed Aug 17 06:33:19 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r32992 from trunk.
+
+	* ext/openssl/ossl_x509cert.c: Add class documentation for
+	  OpenSSL::X509::Certificate.
+
+Wed Aug 17 05:02:25 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r32987 from trunk.
+
+	* ext/openssl/ossl_pkey.c: corrected docs, OpenSSL::PKey::DH does
+	  *not* support #sign/verify.
+
+Tue Aug 16 18:56:54 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (ruby_threadptr_data_type): rename to hide.
+	  [ruby-core:38972]
+
+Tue Aug 16 18:52:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/mkexports.rb (Exports::Mswin#each_export): exclude Init_
+	  and _threadptr_ functions, as well as mingw.
+
+Tue Aug 16 09:38:37 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r32981 and r32982 from trunk.
+
+	* ext/dl:  Add documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #5192]
+
+	* ext/.document (fiddle):  Remove duplicate entry
+
+	* ext/fiddle:  Complete documentation of Fiddle.  Patch by Vincent
+	  Batts.  [#5192]
+
+Tue Aug 16 08:00:15 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r32977 from trunk
+
+	* ext/socket:  Make Socket documentation appear.  Add documentation for
+	  Socket, TCPServer, SOCKSSocket.  Patch by Sylvain Daubert.
+	  [Ruby 1.9 - Feature #5182]
+
+Mon Aug 15 10:16:55 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+	* backport r32973 from trunk.
+
+	* ext/openssl/ossl_ssl.c: Support disabling OpenSSL compression.
+
+	* test/openssl/test_ssl.rb: Add a test for it.
+	  Thanks to Eric Wong for the patch.
+	  [Ruby 1.9 - Feature #5183] [ruby-core:38911]
+
+Sat Aug 13 22:17:27 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/mkconfig.rb: do not make the entries related to sitedir and
+	  verdordir if disabled by --without options.  [ruby-core:38922]
+	  [Bug #5187]
+
+Sat Aug 13 17:06:57 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: [ruby-core:38861]
+
+Sat Aug 13 16:59:51 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* test/date/test_*.rb: added tests.
+
+Sat Aug 13 09:36:19 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* ext/date/date_parse.c (parse_ddd_cb): fix r32896. RB_GC_GUARD
+	  insertion position was mistaken. [ruby-dev:44337] [Bug #5152]
+
+Sat Aug 13 09:26:24 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/core_ext.rb: Make Kernel#y private.
+	  [ruby-core:38913]
+
+	* test/psych/test_yaml.rb: corresponding test.
+
+Sat Aug 13 09:15:16 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c (date_strftime_alloc): followed the change
+	  of r32885.
+
+	* NEWS: followed the above change.
+
+Sat Aug 13 08:49:05 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: [ruby-core:38855].
+
+Sat Aug 13 03:41:37 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r32953 from trunk.
+
+	* lib/uri/common.rb:  Fix documentation of URI::Parser.new.  Patch by
+	  Steve Klabnik.  [Ruby 1.9 - Bug #5177]
+
+Sat Aug 13 02:19:57 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r32950 from trunk.
+
+	* ext/digest/digest.c:  Add documentation for the Digest module.  Patch
+	  by Sylvain Daubert.  [Ruby 1.9 - Bug #5167]
+
+Fri Aug  5 13:32:43 2011  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* backport r32856 from trunk.
+
+	* lib/xmlrpc/client.rb, lib/xmlrpc/server.rb: should use
+	  String#bytesize instead of String#size.
+
+Fri Aug 12 13:53:03 2011  Narihiro Nakamura  <narihiro@netlab.jp>
+
+	* backport r32894 from trunk.
+
+	* gc.c (gc_lazy_sweep): if sweep target slots are not found, we
+	  try heap_increment() because it might be able to expand the
+	  heap. [Bug #5127] [ruby-dev:44285]
+
+	* gc.c (gc_clear_mark_on_sweep_slots): if a sweeping was
+	  interrupted, we expand the heap if at all possible.
+
+Fri Aug 12 12:28:17 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rake:  Update to Rake 0.9.2.2.  Prevent pollution of toplevel
+	  namespace by Commands.  Remove unused variable and debugging
+	  statement in tests.
+
+Fri Aug 12 09:00:24 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r32941 from trunk
+
+	* lib/rubygems:  Import RubyGems 1.8.8.  Fixes encoding of YAML gemspec
+	  from gems.  Github Issue #149
+
+Fri Aug 12 03:24:35 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* backport r32935 from trunk
+
+	* lib/rdoc:  Import RDoc 3.9.2.  Fixes TIDYLINK for HTML output.
+
+Tue Aug  2 22:04:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* backport r32815 from trunk.
+
+	* gc.c (init_heap): allocate sigaltstack after heaps are allocated.
+	  [ruby-dev:44315] [Bug #5139]
+
+	* vm.c (thread_free): use free because objspace is not ready.
+
+	* vm.c (th_init): use malloc because objspace is not ready.
+
+Thu Aug 11 19:04:38 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r32931 from trunk.
+
+	* variable.c (autoload_delete): An autoload entry is still in a
+	  RCLASS_IV_TBL, not in a RCLASS_CONST_TBL, so take back the table
+	  changed in r29600. And an autoload entry keeps not a
+	  rb_const_entry_t but a NODE so remove rb_const_entry_t thing added
+	  in r29602.
+
+Thu Aug 11 15:07:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (link_command): use LIBRUBYARG in rbconfig for
+	  unbundled extensions.  [ruby-core:38802] [Bug #5147]
+
+	* lib/mkmf.rb (init_mkmf): revert r32902.  [ruby-core:38903]
+
+Wed Aug 10 19:30:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* backport r32903 from trunk.
+
+	* complex.c (nucomp_rationalize): calls rationalize of real part if
+	  imaginary part is exactly zero.  The patch is made by Marc-Andre
+	  Lafortune.  fixes [Bug #5178] [ruby-core:38885]
+
+	* test/ruby/test_complex.rb (test_rationalize): add a test for the
+	  above change.
+
+	* complex.c (nucomp_to_r): fix RDoc comment.  The patch is made by
+	  Marc-Andre Lafortune.
+
+Wed Aug 10 14:11:07 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (init_mkmf): set $LIBRUBYARG regardless of shared
+	  option.  [ruby-core:38802] [Bug #5147]
+
+Wed Aug 10 02:57:01 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb: come back autoload. OpenSSL constant is used
+	  some places, so it leads mistakes like HTTP.start.
+
+Tue Aug  9 22:57:45 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* ext/date/date_parse.c (date_zone_to_diff): add RB_GC_GUARD.
+	  [ruby-dev:44337] [Bug #5152]
+
+	* ext/date/data_parse.c (parse_ddd_cb): ditto.
+
+Tue Aug  9 12:20:33 2011  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/fiddle/helper.rb (libc_so, libm_so): Solaris support added.
+	  [ruby-core:38853] [Bug #5168]
+
+	* test/dl/test_base.rb (libc_so, libm_so): on Solaris, remove libc
+	  and libm version numbers for detecting default libc and libm.
+
+Tue Aug  9 10:49:52 2011  Igor Zubkov  <igor.zubkov@gmail.com>
+
+	* array.c: Fix typo. https://github.com/ruby/ruby/pull/36
+
+Mon Aug  8 00:10:45 2011  Akinori MUSHA  <knu@iDaemons.org>
+
+	* test/test_syslog.rb (TestSyslog#test_log): Do not be too
+	  specific about the log line format.  Fixes #5081.
+
+Sun Aug  7 23:39:44 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* time.c (rb_strftime_alloc): raise ERANGE if width is too large.
+	  Patch by Nobuyoshi Nakada. [Bug #4457] [ruby-dev:43285]
+
+	* test/ruby/test_time.rb (class TestTime): add a test for the
+	  above change.
+
+Sun Aug  7 14:15:10 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* backport r32876 from trunk.
+
+	* ext/objspace/objspace.c: fix typos in a document.
+
+Sun Aug  7 04:42:36 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* marshal.c (w_object):  Fix exception message when _dump_data
+	  is not defined on a T_DATA object.
+
+Sat Aug  6 06:14:20 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc:  Update to 3.9.1.  Fixes === lines in verbatim sections.
+	  Fixes :nodoc: on class aliases.  Fixes :stopdoc: creating references
+	  to Object.  Fixes spacing when class comments are merged in ri.
+	  Fixes `ri []` crash.  Fixes bug report URL when rdoc crashes.  Adds
+	  :doc: and :nodoc: to allow hiding of implementation details in ruby.
+	  Makes `rdoc` and `ri` gem-aware.
+
+Sat Aug  6 03:19:45 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems:  Import RubyGems 1.8.7:
+	  Added missing require for `gem uninstall --format-executable`.
+
+	  The correct name of the executable being uninstalled is now displayed
+	  with --format-executable.
+
+	  Fixed `gem unpack uninstalled_gem` default version picker.
+
+	  RubyGems no longer claims a nonexistent gem can be uninstalled.
+
+	  `gem which` no longer claims directories are requirable files.
+
+	  `gem cleanup` continues cleaning up gems if one can't be uninstalled
+	  due to permissions.  Issue #82.
+
+	  Gem repository directories are no longer created world-writable.
+	  Patch by Sakuro OZAWA.  [Ruby 1.9 - Bug #4930]
+
+Fri Aug  5 23:08:39 2011  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* backport r32845 from trunk.
+
+	* configure.in: when Solaris cc, use $(CC) to link shared libs.
+
+Fri Aug  5 22:16:20 2011  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* numeric.c (rb_infinity, rb_nan): use WORDS_BIGENDIAN to get endian.
+	  fix [Bug #5160] [ruby-dev:44356]
+
+Fri Aug  5 15:57:10 2011  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* complex.c (f_signbit): fix compile error in gcc4 on Solaris with
+	  CFLAGS="-std=gnu99".  [ruby-dev:44355] fix [Bug #5159]
+
+	* math.c: ditto.
+
+Thu Aug  5 10:09:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* backport r32846 from trunk.
+
+	* thread_pthread.c (native_cond_signal): retry to call pthread_cond_signal
+	  and pthread_cond_broadcast if they return EAGAIN in
+	  native_cond_signal and native_cond_broadcast, respectively.
+	  It is for the pthread implementation of Mac OS X 10.7 (Lion).
+	  fixes #5155.  [ruby-dev:44342].
+
+	* thread_pthread.c (native_cond_broadcast): ditto.
+
+	* thread_pthread.c (struct cached_thread_entry): stop using
+	  pthread_cond_t and its functions directly.
+
+	* thread_pthread.c (register_cached_thread_and_wait): ditto.
+
+	* thread_pthread.c (use_cached_thread): ditto.
+
+Fri Aug  5 07:35:00 2011  Luis Lavena  <luislavena@gmail.com>
+
+	* lib/rubygems/installer.rb (class Gem): Correct path check on Windows
+	  Possible fix for [Ruby 1.9 - Bug #5111]
+
+	* test/rubygems/test_gem_installer.rb (load Gem): ditto
+	  Backported from trunk r32804
+
+Fri Aug  5 07:00:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/io/console/test_io_console.rb (test_noctty): daemon() on
+	  Fedora Rawhide seems not to detach the controlling terminal,
+	  when the argument noclose is non-zero.  ref: [Bug #5135]
+
+Wed Aug  4 02:35:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* configure.in: use build_os variable for checking C and C++ compilers
+	  matching.
+
+	* configure.in: use clang++ if clang is used.
+
+Thu Aug  4 02:21:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (link_command): use static library only for bundled
+	  extensions.  [Bug #5147]
+
+Wed Aug  3 00:11:08 2011  Tanaka Akira  <akr@fsij.org>
+
+	* lib/prettyprint.rb: update document.  [ruby-core:36776]
+
+
+Tue Aug  2 20:10:16 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/testunit/test_parallel.rb: pass "--ruby" option to
+	  test/testunit/tests_for_parallel/runner.rb. [Bug #5132] [ruby-dev:44303]
+	  Backported from trunk r32812.
+
+Tue Aug  2 12:03:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (recursive_hash): hash value of emptied hash should be
+	  equal to an empty hash.  [ruby-core:38650]
+
+Tue Aug  2 11:42:15 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (rb_enc_symname2_p): :! is valid symbol.  [Bug #5136]
+
+Tue Aug  2 03:26:02 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/rake/test_rake_directory_task.rb (TestRakeDirectoryTask#
+	  test_directory_win32): fixed wrong test.
+	  backported r32670 from trunk.
+
+Mon Aug  1 15:45:23 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* test/rake/test_rake_functional.rb:  Don't assume the binary name of
+	  ruby is "ruby".  [Ruby 1.9 - Bug #5114]
+	* test/rake/helper.rb:  ditto
+
+Mon Aug  1 05:21:42 2011  TAKANO Mitsuhiro (takano32)  <tak@no32.tk>
+
+	* cont.c (cont_save_thread): fix missing semicolon.
+
+Sun Jul 31 22:57:16 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* enc/Makefile.in (ECHO1): Same as the recent fix in common.mk.
+	  ":" in a make variable replacement cause a syntax error with
+	  /usr/ccs/bin/make on Solaris.  Uses $(NULLCMD) instead.
+
+Sun Jul 31 22:44:08 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* configure.in: fix typos.
+
+Sun Jul 31 21:19:51 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* lib/mkmf.rb (configuration:ECHO1): Same as the recent fix in
+	  common.mk.
+	  ":" in a make variable replacement cause a syntax error with
+	  /usr/ccs/bin/make on Solaris.  Uses $(NULLCMD) instead.
+
+Sun Jul 31 21:16:02 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* complex.c (f_signbit): gcc4 on Solaris DOES have signbit but does
+	  not have it on header.
+
+	* math.c: ditto.
+
+Sun Jul 31 21:09:04 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* common.mk (node_name.inc): Use $(Q) for consistency.
+
+	* Makefile.in (INSNS): ditto.
+
+Sun Jul 31 20:39:12 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* common.mk (ECHO1): nmake does not allow parenthesis in make variable
+	  replacement.
+
+Sun Jul 31 20:21:36 2011  "Yuki Sonoda (Yugui)"  <yugui@yugui.jp>
+
+	* common.mk (ECHO1): ":" in a make variable replacement cause a syntax
+	  error with /usr/ccs/bin/make on Solaris.  Uses $(NULLCMD) instead.
+
+	* configure.in (NULLCMD): new check.
+
+	* Makefile.in (NULLCMD): Reflects checking in configure.
+
+	* win32/Makefile.sub (NULLCMD): new assignment.
+
+Sun Jul 31 11:31:07 2011  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* backport r32768 from trunk.
+
+	* vm.c: check if cfp is valid. [Bug #5083] [ruby-dev:44208]
+
+Sat Jul 31 01:23:45 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* backport r32762 from trunk.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_version): removed.
+
+Sat Jul 30 23:51:44 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/cmath.rb (cbrt): should return a real number if possible.
+
+Sat Jul 30 23:48:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: an issue that is same as  [ruby-dev:44071].
+
+	* ext/date/date_strftime.c: identical to [ruby-dev:44112].
+
+Sat Jul 30 23:19:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/default_gems: separate from tool/rbinstall.rb.
+
+Sat Jul 30 23:14:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_each_byte): rbuf can be refreshed during yield.
+	  [Bug #5119]
+
+Sat Jul 30 22:35:50 2011  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* strftime.c (NEEDS): avoid SEGV due to integer overflow in
+	  sparc-solaris2.10 and i686-linux.  fix [Bug #4456] [ruby-dev:43284]
+
+Sat Jul 30 14:27:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* backport r32754 from trunk.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_version): version 1.1.0.
+
+	* ext/bigdecimal/bigdecimal.gemspec: turn into a default gem.
+
+	* tool/rbinstall.rb: ditto.
+
+Sat Jul 30 13:52:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
+	  revive zero and implicit precision support as a deprecated feature.
+
+	* test/bigdecimal/test_bigdecimal_util.rb: modify a test for the above
+	  change.
+
+	* NEWS: describes the above change.
+
+Sat Jul 30 10:58:10 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm.c (th_init): preallocate alternative stack.
+	  NoMemoryError is better than rb_bug, of course.
+	  Patch by Eric Wong. [ruby-core:38572][ruby-core:38594].
+
+	* signal.c (rb_register_sigaltstack): ditto.
+
+	* vm_core.h: moved ALT_STACK_SIZE definition from signal.c.
+
+	* vm.c (thread_free): use xfree() instead of free().
+
+Sat Jul 30 07:20:49 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/lib/socket.rb (udp_server_sockets): unused variable
+	  removed.
+	  patch by Jeremy Evans.  [ruby-core:38600]
+
+Fri Jul 29 23:56:32 2011  Tanaka Akira  <akr@fsij.org>
+
+	* lib/securerandom.rb: call OpenSSL::Random.seed at the
+	  SecureRandom.random_bytes call.
+	  based on the patch by Masahiro Tomita.  [ruby-dev:44270]
+
+Fri Jul 29 20:48:39 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/mkconstants.rb: fix typos.
+
+Fri Jul 29 20:28:56 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/mkconstants.rb: use whitespaces as a separator.
+
+Fri Jul 29 18:59:07 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/mkconstants.rb: add documents for constants.
+	  patch by Eric Hodel.  [ruby-core:37853] [Bug #4989]
+
+Mon Jul 25 23:51:01 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* backport r32671 from trunk.
+
+	* proc.c: pre-allocate the unlinked_method_entry_list_entry struct to
+	  avoid memory allocation during GC.  based on a patch from Eric Wong.
+	  [ruby-core:38498]
+
+Mon Jul 25 22:36:11 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* backport r32669 from trunk.
+
+	* proc.c (struct METHOD), gc.c (gc_marks), vm_method.c
+	  (rb_gc_mark_unlinked_live_method_entries): fix SEGV bug.
+	  rb_method_entry_t was free'd even when the method is still on the
+	  stack if it is BMETHOD (i.e., Method#call).  This is because
+	  rb_method_entry_t is embedded in struct METHOD.  This commit
+	  separates them and marks the live method entries.
+	  See [ruby-core:38449] in detail.  fix [Bug #5047] [ruby-core:38171]
+
+Thu Jul 28 23:36:28 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* ext/fiddle/closure.c (callback): use rb_ary_tmp_new() instead of
+	  xmalloc() to allocate an array for arguments of callback procedure,
+	  to prevent arguments from being swept by GC. [ruby-core:38546]
+	  [Bug #4929]
+
+Thu Jul 28 22:51:27 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r32723 from trunk.
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_initialize): Avoid possible
+	  SEGV from AES encryption/decryption. Processing data by
+	  Cipher#update without initializing key (meaningless usage of Cipher
+	  object since we don't offer a way to export a key) could cause SEGV.
+
+	  In OpenSSL, the EVP which has EVP_CIPH_RAND_KEY flag (such as DES3)
+	  allows uninitialized key, but other EVPs (such as AES) does not
+	  allow it. Calling EVP_CipherUpdate() without initializing key causes
+	  SEGV so we set the data filled with "\0" as the key by default. See
+	  #2768.
+
+	* test/openssl/test_cipher.rb: test it.
+
+Thu Jul 28 04:53:31 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/delegate.rb:  Move file-level documentation to the appropriate
+	  classes.
+
+Thu Jul 28 00:33:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/fileutils/test_fileutils.rb: add OpenBSD case.
+	  patched by Jeremy Evans [ruby-core:38530] see #5097
+
+	* test/ruby/test_process.rb: ditto.
+
+Wed Jul 27 17:59:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* include/ruby/missing.h: define __syscall if the platform has
+	  __syscall in the library but doesn't define it in headers
+	  for example Mac OS X.
+
+Wed Jul 27 15:39:14 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* object.c:  Add usage documentation for BasicObject.  Based on patch
+	  by Thomas Sawyer.  [Ruby 1.9 - Bug #5067]
+
+Wed Jul 27 12:24:17 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems/uninstaller.rb:  Add missing require and update
+	  messaging to avoid confusion with uninstall --format-executable.
+	  [Ruby 1.9 - Bug #4062]
+
+Wed Jul 27 10:47:57 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems:  Update to RubyGems 1.8.6.1.
+
+Wed Jul 27 10:04:06 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r32690 from trunk.
+
+	* test/openssl/test_pkcs12.rb: Add test and intermediate certificates.
+	  [ Ruby 1.9 - Feature #3793 ] [ruby-core:32088]
+
+Sat Jul 27 01:26:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* NEWS: add changes of bigdecimal and bigdecimal/util.
+
+Wed Jul 27 01:13:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Rational#to_d):
+	  zero or negative precision is error.  fixes #5098.
+	  [ruby-dev:44210]
+
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Float#to_d): modified for
+	  specifying precision.  fixes #5098.  [ruby-dev:44210]
+
+	* ext/bigdecimal/lib/bigdecimal/util.rb (Integer#to_d): added
+	  for symmetry to BigDecimal() function with an Integer.
+	  fixes #5098.  [ruby-dev:44210]
+
+	* ext/bigdecimal/lib/bigdecimal/util.rb (BigDecimal#to_d): added
+	  for adapting other Numeric subclasses.  [ruby-dev:44245]
+
+	* test/bigdecimal/test_bigdecimal_util.rb: add tests for the above
+	  changes.
+
+Wed Jul 27 00:54:38 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* bigdecimal/bigdecimal.c (VpDup) a new function for duplicating
+	  a BigDecimal.
+
+	* bigdecimal/bigdecimal.c (BigDecimal_new): support generating a new
+	  BigDecimal from another BigDecimal using BigDecimal global function
+	  or constructor.  [ruby-dev:44245]
+
+Mon Jul 25 22:24:09 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r32666 from trunk.
+
+	* lib/xmlrpc/client.rb: Fix possible HTTP header formatting failure by
+	  'Basic' header. Long username caused the base64 String truncation in
+	  HTTP header which is not allowed. See #5046.
+
+	* test/xmlrpc/test_webrick_server.rb: test it.
+
+Mon Jul 25 15:36:07 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/{x509.rb,ssl.rb}: Add deprecation warning
+	  for openssl/{x509,ssl} usage. Users should require "openssl" instead
+	  of "openssl/ssl" and "openssl/x509". Start of transition period
+	  introduced by [ruby-dev:38018].
+
+Mon Jul 25 13:50:33 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r32662 from trunk.
+
+	* ext/openssl/lib/openssl/x509.rb: Cosmetic change: move definition
+	  introduced in r30152 to x509-internal.rb.
+
+Mon Jul 25 13:35:20 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r32658 from trunk.
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Avoid randomly generated
+	  SSLError from SSLSocket just after invoking SSLSocket#close.
+	  OpenSSL's SSL_shutdown could try to send alert packet and it might
+	  set SSLerr(global error stack) as the result. It causes the next
+	  SSL read/write operation to fail by unrelated reason.
+
+	  By design, we're ignoring any error at SSL_shutdown() so we clear
+	  global error stack after SSL_shutdown is called. See #5039.
+
+Sun Jul 24 20:29:53 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/extconf.rb: refine the recvmsg test.
+
+Sun Jul 24 20:02:31 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/extconf.rb: fix the recvmsg test.
+
+Sun Jul 24 08:42:51 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/extconf.rb: test recvmsg allocates file descriptors for
+	  fd passing even with MSG_PEEK.
+
+	* ext/socket/ancdata.c: use the above test result.
+
+Sun Jul 24 01:24:31 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems/specification.rb:  Restore behavior of
+	  Gem::Specification#loaded.  [Ruby 1.9 - Bug #5032]
+
+Sun Jul 24 01:14:49 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/rake/test_rake_functional.rb (setup): Use __FILE__ for the base
+	  directory. Current directory is not the top source directory when
+	  the building process runs on other than there.
+
+	* test/rake/test_rake_rake_test_loader.rb: ditto.
+
+	* test/rake/test_rake_task_argument_parsing.rb
+	  (test_terminal_width_using_hardcoded_80): hardcoded 80 is used
+	  when app.unix? is false.
+
+Sun Jul 24 00:42:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* configure.in: change the default compiler to gcc-4.2 if target os
+	  is OS X 10.7 (Lion).
+
+Sat Jul 23 17:06:25 2011  Tanaka Akira  <akr@fsij.org>
+
+	* io.c (rb_update_max_fd): validate fd.
+
+	* ext/socket/rubysocket.h (rsock_discard_cmsg_resource): add
+	  msg_peek_p argument for the declaration.
+
+	* ext/socket/ancdata.c (discard_cmsg): add msg_peek_p argument.
+	  assume FreeBSD, NetBSD and MacOS X doesn't generate passed fd
+	  when MSG_PEEK.
+	  (rsock_discard_cmsg_resource): add msg_peek_p argument.
+	  (bsock_recvmsg_internal): call rsock_discard_cmsg_resource with
+	  msg_peek_p argument.
+
+	* ext/socket/unixsocket.c (unix_recv_io): call
+	  rsock_discard_cmsg_resource with msg_peek_p argument.
+
+Sat Jul 23 14:38:28 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* test/rake*: Remove dependencies on flexmock and session gems.
+	  [Ruby 1.9 - Bug #4987]
+
+Fri Jul 22 21:46:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm_insnhelper.c (vm_call_cfunc): added volatile for a workaround
+	  of cfp consistency error problem on OS X 10.7 (Lion). It's
+	  suspected llvm optimization bug.
+	  [Bug #5076] [ruby-dev:44185]
+
+Fri Jul 22 21:50:16 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/generic.rb (WFKV_): unroll the loop of regexp.
+
+	* lib/uri/generic.rb (URI.decode_www_form_component): ditto.
+
+Fri Jul 22 21:49:48 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enum.c (enum_inject): remove empty line to notify rdoc
+	  Enumerable#reduce is alias. patched by milki@github.
+	  https://github.com/ruby/ruby/pull/26
+
+Fri Jul 22 21:49:28 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#each):
+	  Allow HTTP/0.9 request which doesn't has any header or body.
+	  patched by Felix Jodoin. [ruby-core:38040] [Bug #5022]
+
+Fri Jul 22 21:45:21 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/dl/handle.c (dlhandle_sym): clear previous error with dlerror()
+	  before calling dlsym(). [ruby-dev:44091] [Bug #5021]
+
+Fri Jul 22 19:05:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (rb_enc_symname2_p): get rid of potential out-of-bound
+	  access.
+
+Fri Jul 22 13:55:59 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/net/http.rb:  Net::HTTP#finish is used to manually close
+	  connections.  [Ruby 1.9 - Bug #5045]
+
+Fri Jul 22 13:51:29 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/readline/readline.c:  Add examples for Readline.completion_proc=.
+	  [Ruby 1.9 - Bug #5057]
+
+Fri Jul 22 13:20:33 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* tool/rbinstall.rb (default gems):  Install executables into the fake
+	  gem dir for Gem.bin_path.  [Ruby 1.9 - Bug #4485]
+
+Fri Jul 22 13:03:12 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r32609 from trunk.
+
+	* ext/openssl/ossl_hmac.c: Revert checking return type of
+	  HMAC_Init_ex as it is not compatible with OpenSSL < 1.0.0.
+
+Fri Jul 22 11:22:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r32606 from trunk.
+
+	* ext/openssl/ossl_digest.c: Check return value of EVP_DigestInit_ex.
+	* ext/openssl/ossl_hmac.c: Check return value of HMAC_Init_ex.
+	  Thanks, Jared Jennings, for the patch.
+	  [ Ruby 1.9 - Bug #4944 ] [ruby-core:37670]
+
+Fri Jul 22 09:17:43 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r32604 from trunk.
+
+	* ext/openssl/ossl_engine.c: Avoid double free of ENGINE reference.
+	* test/openssl/test_engine.rb: Add a test for it.
+	  Thanks to Ippei Obayashi for providing the patch.
+	  [ Ruby 1.9 - Bug #5062 ] [ruby-dev:44173]
+
+Fri Jul 22 06:39:34 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/csv.rb: Do not modify CSV.generate's argument [ruby-core:38356]
+
+Thu Jul 21 20:02:11 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* thread.c (set_trace_func, thread_set_trace_func_m): reset tracing
+	  state when set_trace_func hook is removed.  This is workaround patch
+	  to force to reset tracing state that is broken by continuation call.
+	  a patch from James M. Lawrence.  [Feature #4347] [ruby-core:34998]
+
+	* test/ruby/test_continuation.rb (class TestContinuation): add a test
+	  for above.  a patch from James M. Lawrence.
+
+Thu Jul 21 20:59:59 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/ancdata.c (discard_cmsg): workaround for MacOS X Lion.
+
+
+Thu Jul 21 07:07:57 2011  Tanaka Akira  <akr@fsij.org>
+
+	* backport r32579, r32581, r32587 by akr and r32588 by kazu.
+
+	r32579:
+
+	* io.c (rb_update_max_fd): new function.
+
+	* internal.h (rb_update_max_fd): declare rb_update_max_fd.
+
+	* thread_pthread.c (rb_thread_create_timer_thread): update max fd when
+	  timer thread pipe is created.
+
+	r32581:
+
+	* io.c (UPDATE_MAXFD): removed.
+
+	r32587:
+
+	* include/ruby/intern.h (rb_update_max_fd): declaration moved from
+	  internal.h.
+
+	* file.c: ditto.
+
+	* io.c: call rb_update_max_fd for each new fds.
+
+	* process.c: ditto.
+
+	* random.c: ditto.
+
+	* ruby.c: ditto.
+
+	* ext/io/console/console.c: ditto.
+
+	* ext/openssl/ossl_bio.c: ditto.
+
+	* ext/pty/pty.c: ditto.
+
+	* ext/socket/init.c: ditto.
+
+	* ext/socket/socket.c: ditto.
+
+	* ext/socket/ancdata.c: ditto.
+
+	* ext/socket/unixsocket.c: ditto.
+
+	r32588:
+
+	* io.c (rb_update_max_fd): remove parentheses. they are not in
+	  macro.
+
+Sun Jul 17 08:07:31 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* backport r32563 from trunk
+
+	* test/openssl/test_ssl_session.rb: add PEM SSL session without TLS
+	  extensions. Use this as the default for the tests to ensure
+	  compatibility with OpenSSL 0.9.7.
+	  [ Ruby 1.9 - Bug #4961 ] [ruby-core:37726]
+
+Sat Jul 16 17:29:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_UNIVERSAL_ARCH): restore arch flag.
+	  Bug #4977
+
+Sat Jul 16 11:18:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/setup.mak: support to build x64-mswin64 on Windows7 (and Vista,
+	  perhaps).
+	  backported r32521 from trunk
+
+Sat Jul 16 06:31:23 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/uri/common.rb (module): Remove optional parser argument to
+	  Kernel#URI
+	  [ruby-core:38061]
+
+	* lib/uri/generic.rb (module): ditto
+
+Sat Jul 16 01:15:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* time.c (time_dup): used rb_obj_class() instead of CLASS_OF().
+	  The patch is made by Kazuki Tsujimoto. [Bug #5012] [ruby-dev:44071]
+
+	* test/ruby/test_time.rb (TestTime#test_getlocal_dont_share_eigenclass):
+	  added a new test for eigenclass of time object.
+
+Fri Jul 15 19:11:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* bignum.c (bigsub_int): add RB_GC_GUARD.  This patch is made by
+	  Makoto Kishimoto.  fixes #4223 [ruby-dev:42907]
+
+	* bignum.c (bigadd_int): ditto.
+
+Fri Jul 15 09:59:12 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r32546 from trunk.
+
+	* ext/digest/sha2/sha2.c (SHA256_Update, SHA512_Update): avoid Bus
+	  Error caused by unalignment access on Sparc-Solaris (and possibly on
+	  other similar environment.) This patch just do memcpy always instead
+	  of checking architecture. I see no perf drop on my 64bit env. For
+	  more details, see #4320.
+
+	* test/digest/test_digest.rb: add test for unalignment access.
+
+
+Thu Jul 14 12:40:07 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* backport r32537 from trunk.
+
+	* ext/openssl/ossl.c (ossl_verify_cb): trap the exception from
+	  verify callback of SSLContext and X509Store and make the
+	  verification fail normally. Raising exception directly from callback
+	  causes orphan resources in OpenSSL stack. Patched by Ippei Obayashi.
+	  See #4445.
+
+	* test/openssl/test_ssl.rb
+	  (test_exception_in_verify_callback_is_ignored): test it.
+
+Wed Jul 13 08:20:08 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb(Test::Unit::Options#process_args): Fix bug.
+	  Fix process_args didn't return `@option` after r30939. Backported
+	  r32526 from trunk.
+
+Mon Jul 11 23:50:39 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
+
+	* time.c: can't compile time.c on AIX due to missing declaration for
+	  ffs(). It is declared in strings.h on AIX. backported r32518 from
+	  trunk.
+
+Mon Jul 11 23:47:00 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
+
+	* thread_pthread.c (get_stack):  need to adjust stack addr for
+	  [Bug #1813] on AIX. backported r32511 from trunk.
+
+Mon Jul 11 15:17:03 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* numeric.c (rb_num2ull): use FIX2LONG instead of FIX2ULONG. see
+	  rb_num2ulong(). fixed the problem of ObjectSpace._id2ref of IL32LLP64
+	  platforms, introduced at r32433.
+	  backported r32512 from trunk.
+
+Sun Jul 10 23:58:55 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* version.h: 1.9.3 is no longer trunk.
+
+Sun Jul 10 23:24:29 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* class.c (rb_mix_module): reverted r31873.
+	  (check_mix_method_i, do_mix_method_i) reverted r31917.
+
+	* test/ruby/test_module.rb (TestModule#test_mix_const): reverted
+	  r31918.
+
+Sun Jul 10 22:50:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): fix
+	  precision treatment errors.
+
+	* test/bigdecimal/test_bigdecimal.rb: add tests for the above change.
+	  fix precision treatment errors.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_power): precision argument
+	  should be optional for its compatibility.
+
+Sun Jul 10 22:38:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (var_ref): distinguish vcall from local variable
+	  references.  based on a patch by Michael Edgar michael.j.edgar
+	  AT dartmouth.edu.  Bug #5002
+
+Sun Jul 10 21:51:29 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: add comments (cautions).
+
+Sun Jul 10 20:59:38 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb: Add new class variable `@@testfile_prefix`.
+	  This is for changing test name prefix. (For testing)
+
+	* test/testunit/tests_for_parallel/ptest_first.rb: Renamed from
+	  test_first.rb
+
+	* test/testunit/tests_for_parallel/ptest_second.rb: Renamed from
+	  test_second.rb
+
+	* test/testunit/tests_for_parallel/ptest_third.rb: Renamed from
+	  test_third.rb
+
+	* test/testunit/tests_for_parallel/ptest_forth.rb: Renamed from
+	  test_forth.rb
+
+	* test/testunit/tests_for_parallel/runner.rb: Remove misc.rb
+
+	* test/testunit/tests_for_parallel/ptest_first.rb: ditto.
+
+	* test/testunit/tests_for_parallel/ptest_second.rb: ditto.
+
+	* test/testunit/tests_for_parallel/ptest_third.rb: ditto.
+
+	* test/testunit/tests_for_parallel/ptest_forth.rb: ditto.
+
+	* test/testunit/tests_for_parallel/misc.rb: Removed because no longer
+	  needed.
+
+	* test/testunit/test_parallel.rb: Fix assertions for above.
+
+Sun Jul 10 16:57:08 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_throw): check a class frame.
+	  Fixes Bug #4648.
+	  The patch is contributed by Kazuki Tsujimoto.
+
+	* bootstraptest/test_proc.rb: add tests for above.
+
+Sun Jul 10 17:28:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (mutex_debug): use exit(EXIT_FAILURE) instad of
+	  exit(1).
+	* thread_pthread.c (add_signal_thread_list): ditto.
+	* thread.c (rb_thread_call_with_gvl): ditto.
+	* util.c (Bug): ditto.
+
+Sun Jul 10 15:58:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/json: Merge json gem 1.5.4+ (f7f78896607b6f6226cd).
+	  [Bug #4700]
+
+Sun Jul 10 16:41:32 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm_core.h (typedef struct rb_vm_struct): create a new
+	  'inhibit_thread_creation' field.
+	* thread.c (rb_thread_terminate_all): set inhibit_thread_creation.
+	* thread.c (thread_s_new): don't permit to create new thread
+	  if the VM is under destruction. Otherwise evil finalizer code
+	  can make SEGV. [Bug #4992][ruby-core:37858]
+
+	* bootstraptest/test_objectspace.rb: new test for this fix.
+
+Sun Jul 10 16:06:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* signal.c (sigsegv): use abort() instead of exit() when nested
+	  SEGV was happen. Because unnested SEGV use abort().
+	  [Bug #5013][ruby-dev:44078]
+
+Sun Jul 10 15:30:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* load.c (rb_f_autoload): prevent to autoload for singleton
+	  classes.  fixes [Bug #4886] [ruby-dev:43816]
+
+	* bootstraptest/test_autoload.rb: add tests for the above change.
+
+Sun Jul 10 15:09:17 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit/assertions.rb: Import documentation patch by Justin
+	  Collins. [ruby-core:37225] [Feature #4903]
+
+Sun Jul 10 14:57:36 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: canonicalizes nth and sf.
+
+Sun Jul 10 14:13:50 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h (rb_thread_call_with_gvl, rb_thread_call_without_gvl):
+	  make them visible as experimental C APIs.  fixes Feature #4328.
+
+Sun Jul 10 12:18:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_power): support non-integral
+	  exponent.  fixes [Bug #3271]
+
+	* ext/bigdecimal/bigdecimal.c (rmpd_power_by_big_decimal): ditto.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_power_op): add a function to
+	  only use for "**" operator.
+
+	* test/bigdecimal/test_bigdecimal.rb: add a bunch of tests for the
+	  above changes.
+
+	* ext/bigdecimal/bigdecimal.c (is_integer): add an utility function.
+
+	* ext/bigdecimal/bigdecimal.c (is_negative): ditto.
+
+	* ext/bigdecimal/bigdecimal.c (is_positive): ditto.
+
+	* ext/bigdecimal/bigdecimal.c (is_zero): ditto.
+
+	* ext/bigdecimal/bigdecimal.c (is_one): ditto.
+
+	* ext/bigdecimal/bigdecimal.c (is_even): ditto.
+
+Sun Jul 10 12:08:39 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* compile.c (when_vals): when a string literal is written on when
+	  clause, skip string creation to make it faster.  [ruby-dev:44068]
+	  [Feature #5000]
+
+Sun Jul 10 11:35:29 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* parse.y (reduce_nodes_gen): NODE_RETURN in rescue body must not be
+	  reduced when there is an else clause.  This caused bizarre behavior
+	  in [Bug #4473] [ruby-core:35629] [ruby-core:37884].
+
+Sun Jul 10 09:46:14 2011  Masaya Tarui  <tarui@ruby-lnag.org>
+
+	* range.c (range_max): fix behavior with excluded end value.
+	  [Bug #4591]
+
+Sun Jul 10 09:13:18 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* NEWS:  Fix RubyGems version.  [Ruby 1.9 - Bug #5004]
+
+Sat Jul  9 20:01:59 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* internal.h: rb_rational_reciprocal is defined in rational.c.
+
+Sat Jul  9 19:48:31 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* internal.h: added declarations.
+	* complex.c: followed the above change.
+
+Sat Jul  9 17:24:41 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* NEWS: bigdecimal is not a builtin.
+
+Sat Jul  9 17:17:53 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: some improvements for performance.
+
+Sat Jul  9 16:56:01 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* atomic.h (ATOMIC_OR): _InterlockedOr is unavailable in VC6.
+
+	* numeric.c (ULLONG_MAX): fallback definition.
+
+Sat Jul  9 15:59:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_{read,write}): should be signed.
+	  Bug #5001
+
+Sat Jul  9 14:02:20 2011  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
+
+	* lib/cgi/core.rb: fix multipart form parsing bug. [Bug #3866]
+
+Sat Jul  9 11:41:03 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Add Vector#normalize [ruby-dev:43829]
+
+Sat Jul  9 09:25:06 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* enumerator.c:  Remove "enumeration sequenced by".
+	  [Ruby 1.9 - Bug #4757]
+
+Sat Jul  9 09:14:56 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* io.c:  Note that methods other than IO#gets may increase IO#lineno.
+	  [Ruby 1.9 - Bug #4902]
+
+Sat Jul  9 08:39:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (RUN_OPT): disable gems.
+
+Sat Jul  9 08:37:05 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_close): close(2) on a fd which is being read by
+	  another thread causes deadlock on Mac OS X 10.5
+
+Fri Jul  8 21:20:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* addr2line.c: use USE_ELF instead of __ELF__ because Solaris
+	  doesn't define it. USE_ELF is already provided by configure.
+	  patched by Naohisa Goto. [ruby-dev:44066] [Bug #4998]
+
+	* addr2line.h: ditto.
+
+	* vm_dump.c: ditto.
+
+Fri Jul  8 16:40:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/parser/parser.rl (convert_encoding): should not modify
+	  the argument.
+
+	* ext/json/parser/parser.rl (convert_encoding): no needs to use
+	  force_encoding.
+
+Fri Jul  8 15:53:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_bug): get rid of segfault after all threads
+	  disposed.
+
+Fri Jul  8 15:01:06 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/openssl/ossl.h: include openssl/e_os2.h before checking the
+	  definition of OPENSSL_SYS_WIN32.
+
+Fri Jul  8 14:40:39 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (wunlink): reverted a part of r32426. it was mistakenly
+	  mixed.
+
+Fri Jul  8 14:29:47 2011  Narihiro Nakamura  <authornari@gmail.com>
+
+	* configure.in: can't subtract void *.
+
+Fri Jul  8 14:33:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/Makefile.sub (config.h): define GC_MARK_STACKFRAME_WORD.
+	  fixed build problem of r32438.  the value (30) is temporary value.
+	  maybe it's enough by 20~24 according to my observation.
+
+Fri Jul  8 13:47:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_mutex_unlock_all): folded into
+	  rb_threadptr_unlock_all_locking_mutexes.
+	* thread.c (rb_threadptr_unlock_all_locking_mutexes) ditto.
+
+Fri Jul  8 13:36:02 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (thread_unlock_all_locking_mutexes): rename to
+	  rb_threadptr_unlock_all_locking_mutexes and remove static.
+	* vm_core.h: add rb_threadptr_unlock_all_locking_mutexes declaration.
+	* thread.c (thread_start_func_2): adjust the above rename.
+
+	* eval.c (ruby_cleanup): call rb_threadptr_unlock_all_locking_mutexes
+	  again after finalizer. [Bug #4988] [ruby-dev:44049]
+
+Fri Jul  8 13:06:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* cont.c (FIBER_MACHINE_STACK_ALLOCATION_SIZE): Fiber stack size
+	  don't need to keep multiple number of sizeof(VALUE).
+
+Fri Jul  8 11:39:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (sudo-precheck): true command is not standard on
+	  Windows.
+
+Fri Jul  8 10:39:52 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (gvl_destroy): fix cond_t leak.
+
+Fri Jul  8 09:17:59 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* gc.c:  Improve documentation
+
+Thu Jul  7 23:35:31 2011  Narihiro Nakamura  <authornari@gmail.com>
+
+	* gc.c: change water_mark value that may call
+	  gc_mark(lev <= GC_LEVEL_MAX) in gc_mark().
+	  In ruby_stack_check(), water_mark is a value that may call some
+	  C function. Fixes Bug #3781
+
+	* configure.in: define GC_MARK_STACKFRAME_WORD that approximate
+	  size of gc_mark() and gc_mark_children() stackframes.
+
+Thu Jul  7 17:55:05 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/testunit/test_parallel.rb (TestParallelWorker#teardown): wait
+	  the child process even if the communication pipe is broken.
+
+Thu Jul  7 15:44:42 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (rb_enc_set_index, rb_enc_associate_index): should
+	  check if frozen.
+
+	* parse.y (rb_intern3), ruby.c (process_options, ruby_script):
+	  defer freezing after associating encodings.
+
+Thu Jul  7 15:16:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (rb_num2ull): use own switch sentence.
+	  Current implementation can't convert 18446744073709551615.
+
+Thu Jul  7 06:56:15 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* cont.c (FIBER_STACK_FLAGS): workaround fix for r32420 on FreeBSD.
+
+Thu Jul  7 06:46:12 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* benchmark/driver.rb:  Add difference column to report that averages
+	  across all runs of a benchmark.  [Ruby 1.9 - Feature #4982]
+
+Thu Jul  7 06:19:38 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems.rb:  Reduce requires to improve `make benchmark`.
+	  [#4962]
+	* lib/rubygems/specification.rb:  Delay initialization of rubygems
+	  until require is called.
+
+Thu Jul  7 04:31:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (arg): rescue_mod is in inverse order from other
+	  modifiers.  patched by michael.j.edgar AT dartmouth.edu at
+	  [ruby-core:36248].  fixed #4716.
+
+Thu Jul  7 00:40:16 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (kill): check that the process exited or not before
+	  terminating it. [Bug #4943]
+
+Wed Jul  6 23:13:19 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (opt_call_args): allow trailing comma after assoc
+	  argument e.g. 'foo(bar:1,)'.  fixed #3456
+
+Wed Jul  6 22:11:12 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Validate date in
+	  "Date:" header
+
+Wed Jul  6 21:29:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* cont.c (fiber_machine_stack_alloc): cleanup pointer arithmetic.
+	  "size/sizeof(VALUE)" is ugly and easy confusing.
+	* cont.c (fiber_initialize_machine_stack_context): ditto.
+
+Wed Jul  6 21:24:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* cont.c (fiber_machine_stack_alloc): fix mprotect misuse. A stack
+	  guard page should have PROT_NONE.
+	* cont.c (fiber_initialize_machine_stack_context):
+	  th->machine_stack_maxsize shouldn't be included guard pages size.
+	  [Bug #4983][ruby-dev:44043]
+
+Wed Jul  6 21:23:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* cont.c (fiber_machine_stack_alloc): use MAP_STACK if it's provided.
+
+Wed Jul  6 21:22:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* cont.c (fiber_machine_stack_alloc): use MAP_FAILED instead of -1.
+
+Wed Jul  6 21:21:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* cont.c (fiber_machine_stack_alloc): remove unnecessary cast.
+
+Wed Jul  6 18:10:13 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Adding space after
+	  comma.
+
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Remove variable
+	  `now`. Suppress warning.
+
+Wed Jul  6 12:18:09 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/cgi/test_cgi_header.rb(test_cgi_header_nph): Fix bug depends to
+	  time. The test fails if time past 1 second in line 136-145
+
+Tue Jul  5 15:28:04 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_here_document): should dispatch heredoc_end
+	  scanner event on an empty here document.  fixed Bug#4543.
+
+Tue Jul  5 13:49:26 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* addr2line.c: fix r32407 to check HAVE_ALLOCA_H.
+
+Tue Jul  5 14:05:43 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/webrick/httpauth/digestauth.rb (_authenticate):
+	  Literal texts in HTTP ABNF is case-insensitive (RFC2616 2.1),
+	  and a sample implementation in RFC2617 also ignores the case
+	  of algorithms. So now this ignores those cases.
+	  [ruby-dev:43965] [Feature #4936]
+
+	* lib/webrick/httpauth/digestauth.rb (initialize):
+	  Because of above, opera_hack is useless and removed.
+
+Tue Jul  5 01:30:01 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* thread_pthread.c (native_sleep): cut the waiting time up to
+	  100,000,000 because Solaris cond_timedwait() return EINVAL if an
+	  argument is greater than current_time + 100,000,000.  This is
+	  considered as a kind of spurious wakeup.  The caller to native_sleep
+	  should care about spurious wakeup.
+
+Tue Jul  5 01:24:26 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* cont.c: disable FIBER_USE_NATIVE on Solaris because resuming any
+	  Fiber caused SEGV.  I haven't follow up the issue deeply, but it
+	  works when disabling the feature.
+
+Tue Jul  5 01:22:46 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* addr2line.c: include <alloca.h> to fix a build issue on Solaris.
+
+Tue Jul  5 00:49:05 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* ext/coverage/coverage.c: resurrect r32071 + add GC guard for
+	  rb_coverages. [ruby-core:37352] [Bug #4927]
+	  [ruby-core:36539] [Feature #4796]
+
+	* test/coverage/test_coverage.rb resurrect r32071.
+
+Mon Jul  4 22:24:46 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (get_stack): For NetBSD/FreeBSD, use
+	  pthread_attr_getstack() if possible. and, remove an assumption
+	  of stack growing direction.
+
+Mon Jul  4 20:42:31 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* ext/coverage/coverage.c: revert r32071.  The commit caused SEGV on
+	  some minor nonfree OS.  I have no means of debugging the bug.  My
+	  personal opinion is that such OS should be unsupported unless there
+	  is an active maintainer.  [ruby-core:37352]
+
+	* test/coverage/test_coverage.rb: ditto.
+
+Mon Jul  4 07:14:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (get_stack): the return address of get_stack
+	  must be the highest address of the current thread's stack.
+
+Mon Jul  4 06:37:22 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/intern.h, thread_pthread.c (rb_reserved_fd_p,
+	  RB_RESERVED_FD_P): added.  This C API is to limit to access
+	  fds which are used by RubyVM internal.  In this version of
+	  CRuby, return 1 if fd is communication pipe.
+	  If your application needs to close all file descriptors to
+	  present resource leak, skip internal fds using this C API.
+	  We also define a macro RB_RESERVED_FD_P(fd).  So you can write
+	    #ifndef RB_RESERVED_FD_P
+	    #define RB_RESERVED_FD_P(fd) 0
+	    #endif
+	  for Ruby 1.9.2 or previous version to write compatible extensions.
+	  See [ruby-core:37727]
+
+	* thread_win32.c (rb_reserved_fd_p): added (return 0 for any fds).
+
+	* io.c (rb_io_initialize): raise ArgumentError if given fd is reserved by Ruby.
+
+Sun Jul  3 23:43:56 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* ext/extmk.rb (extmake): suppresses outputs from extconf.rb.
+	  (extmake) warns a failure in extconf.rb.
+
+Sun Jul  3 13:44:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (ary_reject_bang): should not remove elements which are
+	  not yielded.  [Bug #2545]
+
+Sun Jul  3 06:10:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (get_stack): pthread_attr_getstack() doesn't
+	  return stack start address, but stack base address. Thus,
+	  we need to add stack size for getting stack start address.
+	  And, we don't have to decrease guard size twice.
+	* thread_pthread.c (thread_start_func_1): don't use inaccurate
+	  stack start guess if native_thread_init_stack() can be used.
+	  [Bug #1813] [ruby-core:24540]
+
+Sun Jul  3 04:50:08 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (get_stack): add to a care of guard page on Mac
+	  OS X. [Bug #1813] [ruby-core:24540]
+	* signal.c (ruby_signal): SIGBUS use alternative stack too.
+	* signal.c (sigbus): On Mac, thread stack overflow makes SIGBUS
+	  instead of SIGSEGV. thus, added stackoverflow check.
+	* signal.c (default_handler): get rid of compilation warning.
+	* signal.c (Init_signal): ditto.
+
+Sat Jul 02 08:59:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* test/openssl/test_ocsp.rb
+	* test/openssl/test_x509_cert.rb: Perform SHA-256 tests only if
+	  supported by the available OpenSSL version. Versions < 0.9.8 don't
+	  support it. [ruby-core:37724]
+
+Sat Jul  2 07:17:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_reject_bang, rb_ary_delete_if): rejected
+	  elements should be removed.  fixed [Bug #2545]
+
+Sat Jul  2 01:57:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* NEWS: remove a description of Kernel#respond_to? because it has
+	  been reverted at revision 28564.
+
+Sat Jul  2 00:58:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* NEWS: describe a change of multiplication of Bignum.
+
+Fri Jul  1 18:52:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* benchmark/bm_app_erb.rb: increase loop count. too short
+	  measurement time makes less accuracy.
+	* benchmark/bm_app_factorial.rb: ditto.
+	* benchmark/bm_app_mandelbrot.rb: ditto.
+	* benchmark/bm_app_strconcat.rb: ditto.
+
+	* benchmark/bm_io_file_create.rb: ditto.
+	* benchmark/bm_io_file_read.rb: ditto.
+	* benchmark/bm_io_file_write.rb: ditto.
+
+	* benchmark/bm_so_concatenate.rb: ditto.
+	* benchmark/bm_so_lists.rb: ditto.
+	* benchmark/bm_so_matrix.rb: ditto.
+	* benchmark/bm_so_random.rb: ditto.
+	* benchmark/bm_so_sieve.rb: ditto.
+
+	* benchmark/bm_vm_thread_mutex1.rb: ditto.
+	* benchmark/bm_vm_thread_mutex2.rb: ditto.
+	* benchmark/bm_vm_thread_mutex3.rb: ditto.
+
+	* benchmark/bm_vm1_block.rb: cleanup.
+	* benchmark/bm_vm1_const.rb: cleanup.
+	* benchmark/bm_vm1_ensure.rb: cleanup.
+	* benchmark/bm_vm1_ivar.rb: cleanup.
+	* benchmark/bm_vm1_length.rb: cleanup.
+	* benchmark/bm_vm1_neq.rb: cleanup.
+	* benchmark/bm_vm1_not.rb: cleanup.
+	* benchmark/bm_vm1_rescue.rb: cleanup.
+	* benchmark/bm_vm1_simplereturn.rb: cleanup.
+	* benchmark/bm_vm1_swap.rb: cleanup.
+
+	* benchmark/bm_vm2_array.rb: cleanup.
+	* benchmark/bm_vm2_case.rb: cleanup.
+	* benchmark/bm_vm2_defined_method.rb: cleanup.
+	* benchmark/bm_vm2_eval.rb: cleanup.
+	* benchmark/bm_vm2_method.rb: cleanup.
+	* benchmark/bm_vm2_mutex.rb: cleanup.
+	* benchmark/bm_vm2_poly_method.rb: cleanup.
+	* benchmark/bm_vm2_poly_method_ov.rb: cleanup.
+	* benchmark/bm_vm2_proc.rb: cleanup.
+	* benchmark/bm_vm2_regexp.rb: cleanup.
+	* benchmark/bm_vm2_send.rb: cleanup.
+	* benchmark/bm_vm2_super.rb: cleanup.
+	* benchmark/bm_vm2_unif1.rb: cleanup.
+	* benchmark/bm_vm2_zsuper.rb: cleanup.
+
+	* benchmark/bm_vm_thread_alive_check1.rb: cleanup.
+
+Fri Jul  1 15:23:00 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix: Add LUP decomposition
+
+Fri Jul  1 15:21:14 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Allow non integer exponents for Matrix#**
+
+Fri Jul  1 15:13:25 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix: Add Eigenvalue Decomposition
+
+Fri Jul  1 15:10:22 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix: Add Matrix#round
+
+Fri Jul  1 11:41:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (tr_trans): free heap ptr when the str is not embedded.
+	  patched by Eric Wong. [Bug #4956] [ruby-core:37708]
+
+Fri Jul  1 11:07:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (do_select): fix memory leak.
+	  Patch by Eric Wong. Thank you! [Bug #4953] [ruby-core:37702]
+
+Fri Jul  1 08:21:28 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_getivar): check vm state version
+	  to invalidate inline cache (ivar index).
+	  fixes Bug #4926.
+
+	* vm_insnhelper.c (vm_setivar): ditto.
+
+Fri Jul  1 08:03:15 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c, thread_pthread.c (WRITE_CONST): suppress warnings
+	  `ignoring return value'.
+
+Fri Jul  1 06:41:36 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread.c (rb_threadptr_check_signal): only wake up main thread.
+
+	* thread.c (rb_threadptr_execute_interrupts_common): check signal
+	  delivery if it is main thread.
+	  fixes [ruby-dev:44005] [Ruby 1.9 - Bug #4950]
+
+	* bootstraptest/test_fork.rb: add a test for above.
+
+	* signal.c (rb_get_next_signal): skip if signal_buff is empty.
+	  (check signal_buff.size first)
+
+	* vm_core.h: remove unused variable rb_thread_t::exec_signal.
+
+	* thread.c (rb_thread_check_trap_pending): check
+	  rb_signal_buff_size() because rb_thread_t::exec_signal
+	  is no longer available.
+
+Fri Jul  1 03:28:25 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* class.c (Init_class_hierarchy): should name BasicObject
+	  explicitly.
+
+	* variable.c (rb_const_defined_0): should not check for
+	  superclasses as const_get.
+
+Fri Jul  1 03:24:03 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: mathn is still alive (should die soon).
+
+Thu Jun 30 23:50:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* misc/ruby-mode.el (ruby-indent-beg-re): Fix broken regular
+	  expression.  Fixes #4546
+
+Thu Jun 30 23:43:30 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl.c/.h: Added ossl_x509_name_sk2ary.
+	* ext/openssl/ossl.c: Replaced ossl_x509_ary2k by generic macro to
+	  simplify future conversions.
+	* ext/openssl/ossl_ssl.c: Implement SSLSocket#client_ca.
+	* test/openssl/test_ssl.rb: Add test for SSLSocket#client_ca.
+	  Thanks to Ippei Obayashi for providing the patch!
+	  [ Ruby 1.9 - Feature #4481 ] [ruby-core:35461]
+
+Thu Jun 30 22:38:58 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm2_defined_method.rb: added to measure performance of
+	  bmethod (method defined by define_method()).
+
+Thu Jun 30 22:17:04 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_bmethod): fix to hook call/return event
+	  for methods defined by define_method().  fixes Bug #4613.
+
+	* thread.c (call_trace_proc): Fix to skip if class is not given (0).
+	  Note that ID and Class object are passed for call/return event
+	  if the called method was defined by define_method().
+	  If you are author of tracer/profiler/debugger, this may be an
+	  important change.  You should check passed class as zero or
+	  non-zero instead of checking the event type.
+
+	* test/ruby/test_settracefunc.rb: add a test for above.
+
+Thu Jun 30 21:18:35 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
+
+	* configure.in: Add warnflags for XL/C on AIX during configure
+	  to avoid [Bug #3971]. See [ruby-core:32859]
+
+Thu Jun 30 21:16:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c (m_ajd): refers a constant.
+
+Thu Jun 30 20:54:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	  * ext/io/console/io-console.gemspec: spin-off gem for 1.9.2.
+
+Thu Jun 30 20:36:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: trivial changes.
+
+Thu Jun 30 20:12:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_module.rb: tests for [Bug #3422] and [Bug #3423].
+
+Thu Jun 30 20:03:39 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: modified doc.
+
+Thu Jun 30 19:09:19 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c (thread_timer): ignore unknown errno.
+	  (we observed that select(2) was canceled by errno=514 on
+	  boron == Linux/Xen environment)
+
+Thu Jun 30 17:33:25 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
+	  Fix rdoc.  Fixes Bug #3892.
+
+	* ext/objspace/objspace.c (ObjectSpace.count_tdata_objects):
+	  Change key type if the klass of a object is zero (internal object).
+	  Read rdoc for details.
+
+	* internal.h: export rb_objspace_data_type_name().
+
+Thu Jun 30 17:25:08 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c (ping_signal_thread_list, thread_timer):
+	  fix to keep polling state if there are any ping-tasks.
+
+Thu Jun 30 12:25:34 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c (rb_thread_create_timer_thread): allocate
+	  machine stack for the timer thread at least 12KB.  FreeBSD 8.2
+	  AMD64 causes machine stack overflow (SIGSEGV) only with
+	  PTHREAD_STACK_MIN (maybe defined as 2KB).
+
+Thu Jun 30 09:36:37 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/weakref.rb:  Attach documentation to WeakRef and add missing
+	  documentation
+
+Thu Jun 30 09:30:14 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/yaml.rb:  Document toplevel YAML and YAML::ENGINE to describe
+	  Psych vs Syck engines.
+
+Thu Jun 30 09:21:52 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/cmath.rb:  Hide handle_no_method_error from RDoc.
+	* error.c:  Document or hide undocumented error classes.
+
+Thu Jun 30 07:49:04 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* hash.c:  Document ENV
+
+Thu Jun 30 06:37:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (ruby_init_loadpath_safe): ensure RUBYLIB_PREFIX stored
+	  before RUBYLIB, even if MANGLED_PATH is enabled.  fixed #1679.
+	  MANGLED_PATH is disabled by the default and will be removed
+	  completely in the future.
+
+Thu Jun 30 06:32:21 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/drb/drb.rb:  Hide deprecated toplevel DRb constants.
+
+Thu Jun 30 06:17:02 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/cmath.rb (CMath.log): second argument: b can be nil.
+
+Thu Jun 30 06:23:28 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* thread.c (ruby_thread_s_pass):  Fix typo.
+
+Thu Jun 30 06:16:53 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc:  Update to RDoc 3.8 which contains fixes for documentation
+	  in trunk.
+
+Thu Jun 30 02:53:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_threadptr_execute_interrupts_common): remove
+	  meaningless native_thread_yield(). It never close a race.
+
+Thu Jun 30 02:41:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_schedule_limits): minor optimization.
+	  eliminate machine context saving when running time is enough small.
+
+Thu Jun 30 02:28:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_schedule_rec): move interrupt_flag check to
+	  rb_thread_schedule().
+	  And also rename to rb_thread_schedule_limits() and remove
+	  sched_depth argument. It's no longer called recursive.
+	* thread.c (rb_thread_schedule): add to check interrupt_flag as
+	  above explained.
+
+	* thread.c (rb_threadptr_execute_interrupts_rec): rename to
+	  rb_threadptr_execute_interrupts_common() and remove sched_depth
+	  argument. It's no longer called recursive.
+
+	* thread.c (rb_thread_sleep): adapt the renaming.
+	* thread.c (rb_threadptr_execute_interrupts): ditto.
+	* thread.c (rb_thread_execute_interrupts): ditto.
+
+Thu Jun 30 01:31:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (thread_s_pass): change RDoc description and remove
+	  a sample code. The actual implementation never behave as explained by
+	  an example. It's a documentation bug.
+
+Thu Jun 30 00:54:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_stop): change RDoc sample code. The old
+	  example is buggy and may cause deadlock. The patch is
+	  suggested by Heesob Park <phasis@gmail.com>. Thank you!
+	  [Bug #3606][ruby-core:31454]
+
+Thu Jun 30 00:49:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_wakeup): change RDoc sample code. The old
+	  example is buggy and may not display anything by a race.
+	  The patch is suggested by Heesob Park <phasis@gmail.com>.
+	  Thank you! [Bug #3606][ruby-core:31454]
+
+Thu Jun 30 00:43:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_run): change RDoc. The old example is buggy
+	  and may cause deadlock. The patch is suggested by Heesob Park
+	  <phasis@gmail.com>. Thank you! [Bug #3606][ruby-core:31454]
+
+Thu Jun 30 00:30:15 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/cmath.rb: make same exception for Math. fix [Bug #3137].
+
+Thu Jun 30 00:03:20 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/irb/completion.rb: complement correctly string literal. fix
+	  [Bug #1145].
+
+Wed Jun 29 23:42:51 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: avoided using timev.
+	* ext/date/date_strftime.c: ditto.
+	* ext/date/date_tmx.h: ditto.
+
+Wed Jun 29 23:17:57 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/openssl/ossl.h (OPENSSL_SYS_WIN32): support for mingw(msys).
+
+Wed Jun 29 23:09:14 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/tk/extconf.rb (intptr_t, uintptr_t): support for the latest ActiveTcl with mingw.
+
+Wed Jun 29 22:49:10 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/irb/cmd/help.rb: support RDoc 3.7. fix [Bug #3760].
+
+Wed Jun 29 22:04:14 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* lib/tracer.rb: Tracer.on only if required by -r command-line option.
+	  and consider --disable-gems option.
+	* test/test_tracer.rb: add tests for it.
+
+Wed Jun 29 13:55:36 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* variable.c (rb_const_get_0): should not look for superclasses if
+	  the second optional argument is given for #const_get().
+	  fix [Bug #3422] [Bug #3423]
+
+Wed Jun 29 12:07:27 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* math.c:  Attach documentation for Math.
+	* object.c:  Document NIL, TRUE, FALSE.
+	* io.c:  Improve grammar in ARGF comment.  Document STDIN/OUT/ERR.
+	  Document ARGF global constant.
+	* lib/rake:  Hide deprecated toplevel constants from RDoc (import from
+	  rake trunk).
+	* lib/thwait.rb:  Document ThWait.
+	* lib/mathn.rb:  Hide Math redefinition from RDoc
+	* lib/sync.rb:  Add a basic comment for Sync_m, Synchronizer_m, Sync,
+	  Synchronizer.
+	* parse.y:  Document SCRIPT_LINES__.
+	* hash.c:  Document ENV class and global constant.
+	* vm.c:  Document TOPLEVEL_BINDING.
+	* version.c:  Document RUBY_* constants.
+	* ruby.c:  Document DATA and ARGV.
+
+Wed Jun 29 10:13:12 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Matrix.zero can build rectangular matrices.
+	  Vector#r should be called #magnitude
+
+Wed Jun 29 10:11:08 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Add Matrix#diagonal?, hermitian?, normal?,
+	  orthogonal?
+	  permutation?, symmetric?, {lower|upper}triangular?, unitary?, zero?
+
+Wed Jun 29 10:09:35 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Specialize Matrix#find_index to return [row, col]
+	  and accept the same optional argument as #each
+
+Wed Jun 29 10:07:32 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Matrix#each{_with_index} can iterate over a subset
+	  of the Matrix
+
+Wed Jun 29 06:21:02 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c (native_stop_timer_thread): skip to close
+	  communication pipe to avoid timing bug (process termination timing).
+	  The communication pipe will closed by OS.
+
+Wed Jun 29 06:09:54 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* error.c (rb_async_bug_errno): async-safe bug report function.
+	  In timer thread, signal handler should use it.
+	  The patch is contributed by Eric Wong <normalperson@yhbt.net>.
+	  Refs: [ruby-core:37644] and [ruby-core:37647]
+
+	* thread_pthread.c: use rb_async_bug_errno().
+	  And replace all fprintf() to write().
+
+	* internal.h (rb_async_bug_errno): add decl. of above func.
+
+Tue Jun 28 23:46:08 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/tracer.rb: count only non-internal libraries in stack trace,
+	  ignoring custom_require.
+
+Tue Jun 28 21:44:58 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/irb/ruby-lex.rb: recognize '\char' in ruby statement.
+
+Tue Jun 28 20:39:29 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* lib/debug.rb (var_list): Command 'var *' did not work on 1.9(!).
+	  global_variables, local_variables, and instance_variables returns
+	  Symbols from 1.9 and need to stringify before evaling it.
+	  See #4931.
+
+Tue Jun 28 19:23:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* signal.c: Now, USE_TRAP_SIGMASK depend on HAVE_PTHREAD_SIGMASK.
+	  The code have already depended on pthread_sigmask since r27464.
+
+Tue Jun 28 15:09:21 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/benchmark.rb: merge eregon/benchmark.
+	  https://github.com/eregon/ruby/tree/benchmark
+	  patched by Benoit Daloze. [ruby-core:37593] [Bug #4940]
+
+	* lib/benchmark (Benchmark#bmbm): bmbm should be consistent with bm
+	  for the return value.
+
+	* test/benchmark: remove preemptive test instead of skipping
+	  I removed the preemptive test I wrote for Feature #4197.
+	  I'll add it back when the implementation will be able to satisfy it.
+
+	* lib/benchmark (Benchmark#bmbm): remove useless explicit call,
+	  #format is an alias of #to_s test/benchmark: add a test for
+	  format of long time.
+
+	* lib/benchmark: fix label width: always add 1 to ensure there is a
+	  space delimiter even with times over 100s
+	  When I asked for Feature #4197, I wanted to make delimiting spaces
+	  consistent for #bm and #bmbm.
+	  But with times over 100s, the output contains no space between the
+	  label and the first time (user).
+	  Now both ensure there is always a space, even if that means 3 spaces
+	  with times under 10s (because it is formatted as %10.6f)
+
+	* test/benchmark: let labels be a constant
+	  lib/benchmark (Benchmark#realtime): avoid creating an unused Proc
+	  lib/benchmark (Benchmark#benchmark): use ensure clause to restore
+	  STDOUT.sync, as in #bmbm
+
+Tue Jun 28 13:41:51 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread_win32.c (native_stop_timer_thread): fixed commit miss of
+	  r32244.  grep sources before changing the signature of a function.
+
+Tue Jun 28 11:49:14 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c (consume_communication_pipe):
+	  Make "buff" as static.  (Maybe) "buff" can be shared between
+	  any caller (any threads) because no one use the read values.
+	  "buff" (1024 byte) on stack may cause stack overflow on
+	  several environment (we found a crash on FreeBSD).
+	  And remove const value "buff_size", and define CCP_READ_BUFF_SIZE
+	  macro.
+
+Tue Jun 28 11:45:30 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rake:  Update rake to fix some bugs and hide deprecated features
+	  from RDoc.
+	* lib/rake/version.rb:  Bump version to 0.9.2.1 to distinguish it from
+	  the released version.
+	* NEWS:  ditto
+
+Tue Jun 28 11:17:28 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc:  Update to RDoc 3.7 (final)
+	* NEWS:  ditto
+
+Tue Jun 28 10:18:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* process.c (rb_daemon): fix wrong #endif position.
+
+Tue Jun 28 07:50:32 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* object.c (Init_Object):  Teach RDoc what Init_class_hierarchy does to
+	  hook up ri for BasicObject, Object, Module and Class.
+
+Tue Jun 28 05:03:32 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* thread.c (rb_thread_local_aref): RDoc fix. Thread#[] example
+	  had a race. See #4480.
+
+Tue Jun 28 01:22:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_log): move BigMath.log from
+	  bigdecimal/math.rb.
+
+	* ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
+
+	* test/bigdecimal/test_bigdecimal.rb: move test for BigMath.log from
+	  test/bigdecimal/test_bigmath.rb.
+
+	* test/bigdecimal/test_bigmath.rb: ditto.
+
+Tue Jun 28 01:19:52 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/irb/ruby-lex.rb: fix [Bug #4232].
+
+Tue Jun 28 00:14:13 2011  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: fix [Bug #4409]. add DRbServer#here?.
+
+	* test/drb/test_drb.rb: ditto.
+
+	* test/drb/drbtest.rb: ditto.
+
+	* test/drb/ut_eq.rb: ditto.
+
+Tue Jun 28 00:08:43 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/irb/workspace.rb: fix BUG#4793.
+
+Mon Jun 27 22:06:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (consume_communication_pipe): don't use C99
+	  style variable length array.
+
+Mon Jun 27 22:04:27 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (consume_communication_pipe): change return
+	  type to void. caller doesn't use it.
+
+Mon Jun 27 21:29:50 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.h (rb_global_vm_lock_struct): add volatile to
+	  gvl->waiting. now thread_timer() access it w/o lock.
+
+Mon Jun 27 21:16:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c: s/__gvl_acquire/gvl_acquire_common/ and
+	  s/__gvl_release/gvl_release_common/.
+
+Mon Jun 27 11:41:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (rb_thread_create_timer_thread):
+	  the type of return value of write(2) is ssize_t.
+
+Mon Jun 27 09:57:02 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c (rb_thread_create_timer_thread):
+	  Fixes missing initialization of oflags.
+
+Mon Jun 27 09:07:42 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c: Stop polling in the timer thread when there are
+	  no waiting thread.  If there are 2 or more runnable threads,
+	  the timer thread does polling.  Avoid polling makes power save
+	  for several computers (0.2W per a Ruby process, when I measured).
+	  If outside-event such as signal or Thread#kill was occurred
+	  when the timer thread does not do polling, then wake-up
+	  the timer thread using communication-pipe (the timer thread
+	  waits this communication-pipe with select(2)).
+	  The discussion about this modification can be found from the post
+	  [ruby-core:33456] and other related posts.
+	  Note that Eric Wong and KOSAKI Motohiro give us the huge
+	  contributions for this modification.  Thanks.
+
+	* thread_pthread.c (rb_thread_wakeup_timer_thread): add a function.
+	  This function wakes up the timer thread using communication-pipe.
+
+	* thread.c (rb_thread_stop_timer_thread): add a parameter which
+	  specify closing communication-pipe or not.
+
+	* thread.c (rb_thread_terminate_all): do not stop timer thread here
+	  (ruby_cleanup() terminate timer thread).
+
+	* signal.c: wake up timer thread using
+	  rb_thread_wakeup_timer_thread() from signal handler.
+
+	* eval.c (ruby_cleanup): use rb_thread_stop_timer_thread(1).
+
+	* process.c: use rb_thread_stop_timer_thread(0)
+	  (reuse communication-pipe).
+
+	* thread_win32.c (rb_thread_wakeup_timer_thread): add a dummy
+	  function.
+
+	* vm_core.h: add and fix decl. of functions.
+
+Mon Jun 27 08:01:19 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_parse.c: should use ALLOCA_N.
+
+Mon Jun 27 01:34:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/etc/test_etc.rb (TestEtc#test_get{pw,gr}nam): skip entries
+	  start with + sign, which means NIS.  these are returned in the
+	  case that passwd and group entries in /etc/nsswitch.conf are set
+	  to use "nis" explicitly on Debian.  fixed #3683
+
+Mon Jun 27 00:44:53 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* parse.y (rb_parser_end_seen_p): fix documentation about return
+	  value. patched by Sho Hashimoto. [Bug #4511]
+
+Mon Jun 27 00:40:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* hash.c (rb_hash_reject): add documentation that Hash#reject
+	  without block returns enumerator.
+	  patched by Michael Edgar [Bug #4847] [ruby-core:36800]
+
+Sun Jun 26 23:49:21 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* test/date/test_switch_hitter.rb: added a test.
+
+ Sun Jun 26 22:21:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: refactoring.
+
+Sun Jun 26 18:03:30 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* parse.y: comma at the end of line is no longer allowed.
+	  A patch from Yukihiro Matsumoto  <matz AT ruby-lang.org>.
+	  (fixed #3456).
+
+Sun Jun 26 13:35:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm_dump.c (rb_vm_bugreport): change CrashReporter suggestion messages
+	  on Mac. It should be placed after "-- C level backtrace" line.
+	  Suggested by Endoh-san.
+
+	  <before>
+	  -- See Crash Report log file under ~/Library/Logs/CrashReporter or ---------
+	  -- /Library/Logs/CrashReporter, for the more detail of ---------------------
+	  -- C level backtrace information -------------------------------------------
+
+	<after>
+	  -- C level backtrace information -------------------------------------------
+
+	     See Crash Report log file under ~/Library/Logs/CrashReporter or
+	     /Library/Logs/CrashReporter, for the more detail of.
+
+Sun Jun 26 10:08:28 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/extconf.rb
+	* ext/openssl/ossl_missing.h/.c: add ASN1_put_eoc if missing.
+
+	* ext/openssl/ossl_asn1.c: introduce ossl_asn1_object_size and
+	  ossl_asn1_put_object to wrap functionality depending on OpenSSL
+	  version in use.
+	  Fixes	[ Ruby 1.9 - Bug #4916 ] reported by Hiroshi Nakamura.
+	  [ruby-core:37286]
+
+Sun Jun 26 01:00:15 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c (date_strftime_internal): removed meaningless braces.
+	* ext/date/date_core.c (gengo): the value should be int.
+
+Sat Jun 25 23:45:30 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* vm_insnhelper.c (vm_search_superclass): avoid control frame
+	  stack overrun. currently super() in Proc created in a method
+	  defined by Module#define_method raise NoMethodError. [Bug #4881]
+	* test/ruby/test_method.rb t_super_in_proc_from_define_method):
+	  add test for it.
+
+Sat Jun 25 23:23:14 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* thread.c (sleep_forever): now Kernel#sleep don't wakeup by
+	  signal handler execution. [Bug #4072]
+
+Sat Jun 25 23:14:47 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* thread.c (rb_threadptr_check_signal): remove unnecessary th->status
+	  backup. fix race condition which may results unexpected main thread's
+	  status transition. see #4072
+
+Fri Jun 24 19:57:30 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* lib/webrick/httprequest.rb (setup_forwarded_info): Parsing request
+	  header failed when the request is from 2 or more Apache reverse
+	  proxies. It's said that all X-Forwarded-* headers will contain more
+	  than one (comma-separated) value if the original request already
+	  contained one of these headers.  Since we could use these values as
+	  Host header, we choose the initial(first) value. See #4922.
+
+	* test/webrick/test_httprequest.rb (test_forwarded): Test it.
+
+Fri Jun 24 17:06:33 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (proc_daemon): should not start timer thread
+	  twice.  fixed Bug#4920.
+
+Fri Jun 24 15:54:14 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): Try to shutdown SSL
+	  connection more gracefully. Call SSL_shutdown() max 4 times until it
+	  returns 1 (success). Bi-directional SSL close has several states but
+	  SSL_shutdown() kicks only 1 transition per call. Max 4 is from
+	  mod_ssl.c of Apache httpd that says 'max 2x pending + 2x data = 4'.
+	  See #4237.
+
+Fri Jun 24 07:24:37 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rake/version.rb:  Fixed VERSION to work with tool/rbinstall.rb
+	* bin/rake:  Import bin/rake from 0.9.2
+	* tool/rbinstall.rb (install):  Rake::VERSION is now in
+	  lib/rake/version.rb.  Fixes `make install`
+
+Fri Jun 24 07:11:37 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rake: Import Rake 0.9.2
+
+Fri Jun 24 00:44:15 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c (c_valid_{julian,gregorian}_p): fixed the range of month.
+
+Fri Jun 24 00:14:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: trivial changes on text.
+
+Thu Jun 23 22:46:57 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_x509name.c: Add X509::Name#hash_old as a wrapper
+	  for X509_NAME_hash_old in OpenSSL 1.0.0. See #4805
+
+	* test/openssl/test_x509name.rb (test_hash): Make test pass with
+	  OpenSSL 1.0.0.
+
+	* NEWS: Add it.
+
+Thu Jun 23 19:30:53 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_time): Check
+	  argument type with NUM2LONG if the arg is not a Time object.
+	  See #4919.
+
+	* ext/openssl/ossl_ssl_session.c (ossl_ssl_session_set_timeout): Check
+	  type with NUM2LONG. Time as an arg is not allowed. See #4919.
+
+	* test/openssl/test_ssl_session.rb (test_session_time,
+	  test_session_timeout): Test it.
+
+Wed Jun 23 13:30:30 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* signal.c(ruby_atomic_exchange): Fix definition style.
+
+Wed Jun 22 22:34:05 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_session_new_cb): Return 0 to
+	  OpenSSL from the callback for SSL_CTX_sess_set_get_cb().
+	  Returning 0 means to OpenSSL that the session is still valid
+	  (since we created Ruby Session object) and was not freed by us with
+	  SSL_SESSION_free(). Call SSLContext#remove_session(sess) in
+	  session_get_cb block if you don't want OpenSSL to cache the session
+	  internally.
+	  This potential issue was pointed by Ippei Obayashi. See #4416.
+
+	* test/openssl/test_ssl_session.rb (test_ctx_server_session_cb): Test
+	  it.
+
+Wed Jun 22 22:21:17 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_ssl_session.c: Respect T_BIGNUM time values. Patch by
+	  Tomoyuki Chikanaga.
+	  [ Ruby 1.9 - Bug #4919 ] [ruby-dev:43869]
+
+Wed Jun 22 21:29:25 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/socket/depend (SOCK_HEADERS): use $(top_srcdir) instead of
+	  $(topdir). sorry!
+
+Wed Jun 22 19:47:03 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* cont.c (cont_capture): add volatile.
+	  On clang -O, it is needed to avoid the optimization.
+	  With this and llvm/clang's recent fix, clang 3.0 can
+	  build ruby-trunk with -O option.
+
+	* cont.c (cont_capture): use for-loop.
+
+	* array.c (rb_ary_each): add volatile and use it.
+
+	* vm_insnhelper.c (vm_call_cfunc): ditto.
+
+Wed Jun 22 18:20:46 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_session_remove_cb):
+	  OpenSSL::SSL::SSLContext#session_remove_cb was broken. It wrongly
+	  tried to call the session_*new*_cb callback.
+
+	* test/openssl/test_ssl_session.rb (class OpenSSL): Test it.
+
+Wed Jun 22 17:37:49 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl.h: Introduced OSSL_BIO_reset macro for PEM/DER
+	  fallback scenarios.
+
+	* ext/openssl/ossl_pkey_dsa.c
+	* ext/openssl/ossl_x509req.c
+	* ext/openssl/ossl_pkey_rsa.c
+	* ext/openssl/ossl_pkey_ec.c
+	* ext/openssl/ossl_ssl_session.c
+	* ext/openssl/ossl_x509crl.c
+	* ext/openssl/ossl_pkey.c
+	* ext/openssl/ossl_pkey_dh.c
+	* ext/openssl/ossl_x509cert.c
+	* ext/openssl/ossl_pkcs7.c: Use OSSL_BIO_reset.
+
+	* ext/openssl/ossl_ssl.c
+	* ext/openssl/ossl_cipher.c
+	* ext/openssl/ossl_pkey_ec.c
+	* ext/openssl/ossl_pkcs12.c
+	* ext/openssl/ossl_ssl_session.c: Replace rb_raise occurrences by
+	  ossl_raise. This automatically flushes OpenSSL's error queue.
+
+	* ext/openssl/ossl_pkcs7.c: Raise error if DER fallback for parsing
+	  fails.
+
+	* test/openssl/test_pkey_ec.rb
+	* test/openssl/test_pkey_dsa.rb
+	* test/openssl/test_pkey_rsa.rb: Add assertions that OpenSSL.errors is
+	  empty.
+
+	* test/openssl/test_pkey_rsa.rb: Remove initial OpenSSL.errors call in
+	  test_new.
+	  [ Ruby 1.9 - Bug #4885 ] [ruby-core:37134]
+
+Wed Jun 22 15:01:24 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_ssl.c: Use SSL_MODE_RELEASE_BUFFERS if available.
+	  Thanks, Eric Wong, for providing the patch.
+	  [ Ruby 1.9 - Feature #4672 ] [ruby-core:36127]
+
+Wed Jun 22 14:47:53 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* test/openssl/test_buffering.rb
+	* test/openssl/test_pkcs12.rb: Inherit from Test::Unit::TestCase
+	  instead of MiniTest::Unit::TestCase. [ruby-core:37275]
+
+Wed Jun 22 12:41:03 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der):
+	  OpenSSL::SSL::Session#to_der was broken. Fix buffer handling.
+
+	* test/openssl/test_ssl_session.rb (test_session): Test it.
+
+Wed Jun 22 12:38:52 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* test/openssl/test_ssl_session.rb: Split out SSL::Session related
+	  tests from test_ssl.rb
+
+Wed Jun 22 03:20:52 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Fix cyclic references of
+	  objects.  Thanks to CvX for reporting the bug and a test case.
+	* test/psych/test_object.rb: test for cyclic object references.
+
+Wed Jun 22 02:39:54 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* lib/net/http.rb (Net::HTTP.post_form): Do not ignore query part of
+	  the given URI to post. See #655.
+
+	* test/net/http/test_http.rb, test/net/http/utils.rb: Test it.
+
+Wed Jun 22 01:28:13 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* test/openssl/test_x509store.rb (test_set_errors): Redhat is
+	  distributing a patched version of OpenSSL that allows multiple CRL
+	  for a key (multi-crl.patch.) Make test pass on such env. See #4122,
+	  #4554.
+
+Tue Jun 21 21:50:37 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* lib/webrick/httpresponse.rb (HTTPResponse#setup_header): Close
+	  HTTP/1.1 connection when returning an IO object as response body
+	  without setting HTTPResponse#chunked to true. See #855 no.1.
+
+	* test/webrick/test_httpserver.rb: Test it.
+
+Tue Jun 21 21:27:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* internal.h: move rb_thread_io_blocking_region() declaration
+	  from intern.h to internal.h. It's still experimental API and
+	  need more discussion. [ruby-dev:43698]
+	* include/ruby/intern.h: ditto.
+
+	* ext/socket/rubysocket.h: include internal.h.
+	* ext/socket/depend: add internal.h dependency.
+	* ext/socket/extconf.rb: add $INCFLAGS to topdir.
+
+Tue Jun 21 20:38:47 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c (datetime_s_*): canonicalize 24 o'clock.
+
+Tue Jun 21 19:46:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_thread.rb (TestThread#test_priority): enable
+	  this test again. Current GVL respect thread priority rather
+	  than past.
+
+Tue Jun 21 13:25:35 2011  TAKAO Kouji  <kouji@takao7.net>
+
+	* ext/readline/readline.c (readline_getc): applied a patch in
+	  #3827 by by Akio Tajima <artonx AT yahoo.co.jp>. (see #3827)
+
+Tue Jun 21 13:16:31 2011  TAKAO Kouji  <kouji@takao7.net>
+
+	* ext/readline/extconf.rb: fixed bug, specify --disable-libedit
+	  then disable libedit, does not specify then check readline and
+	  libedit if failed checking readline. (fixes #3375)
+
+Mon Jun 20 22:52:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (before_exec): use sig_do_nothing instead of SIG_DFL
+	  for avoiding a race.
+	* process.c (sig_do_nothing): new function.
+
+Mon Jun 20 21:31:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (thread_timer): rename timeout_10ms to
+	  time_quantum. it's no longer 10ms.
+
+Mon Jun 20 18:46:02 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_cipher.c, ext/openssl/lib/openssl/cipher.rb:
+	  Documentation fix by Ippei Obayashi. See #4419.
+
+Mon Jun 20 15:41:33 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* lib/webrick/cookie.rb (WEBrick::Cookie.parse): Revert r31228.
+	  r31228 was for allowing the 'Cookie:' header which did not have no
+	  SP after ';' for separating cookie-pairs but RFC6265 requires single
+	  SP after ';' there.  We allow multiple SPs here for compatibility
+	  with older WEBrick version.
+
+	* test/webrick/test_cookie.rb: Test it.
+
+Sun Jun 19 13:31:26 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* NEWS: Introduce --hide-skip on test/unit.
+
+Sun Jun 19 10:05:16 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit/parallel.rb: Override Test::Unit::TestCase#on_parallel_worker?
+	  only when $0 == __FILE__.
+
+	* lib/test/unit/parallel.rb: Run Test::Unit::Worker.run only when
+	  $0 == __FILE__.
+
+Sat Jun 18 23:59:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (fill_cbuf): finish reading at EOF, and the readconv has
+	  been cleared by another thread while io_fillbuf() is waiting at
+	  select().  a patch in [ruby-core:37197] by Hiroshi Shirosaki
+	  <h.shirosaki AT gmail.com>.  fixed #3840
+
+Sat Jun 18 21:36:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c: remove GVL_DEBUG
+
+Sat Jun 18 21:32:02 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm.c, vm_core.h (rb_vm_stack_to_heap): remove const.
+	  It makes compilations warnings.
+
+Sat Jun 18 18:54:15 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c, vm_core.h (rb_vm_stack_to_heap): fix "const" place.
+
+Sat Jun 18 17:23:38 2011  Tanaka Akira  <akr@fsij.org>
+
+	* eval.c, hash.c, load.c, proc.c, range.c, thread.c, time.c: don't
+	  declare internal functions.
+
+	* internal.h, vm_core.h: declare internal functions.
+
+	* array.c: include internal.h.
+
+	* common.mk: update dependency for array.o.
+
+Sat Jun 18 13:39:33 2011  Tanaka Akira  <akr@fsij.org>
+
+	* internal.h: declarations declared in include/ruby/*.h removed.
+
+Sat Jun 18 12:42:17 2011  Tanaka Akira  <akr@fsij.org>
+
+	* method.h, internal.h iseq.h: declare internal functions.
+
+	* compile.c, eval.c, iseq.c, object.c, parse.y, proc.c, process.c,
+	  thread.c, vm.c, vm_eval.c, vm_insnhelper.c, vm_method.c: don't
+	  declare internal functions.
+
+	  Note that rb_method_entry_eq() is defined in vm_method.c but
+	  there was a declaration in proc.c with different const-ness.
+	  Now it is declared in method.h with same const-ness to the
+	  definition.
+
+	* object.c (rb_mod_module_exec): don't declare functions declared in
+	  include/ruby/intern.h.
+
+Sat Jun 18 12:05:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/backward/classext.h: for evil gems.  fixed #4803
+
+Sat Jun 18 11:12:13 2011  Tanaka Akira  <akr@fsij.org>
+
+	* common.mk: update dependencies.
+
+Sat Jun 18 11:09:03 2011  Tanaka Akira  <akr@fsij.org>
+
+	* io.c: suppress warnings.
+
+Sat Jun 18 10:22:39 2011  Tanaka Akira  <akr@fsij.org>
+
+	* internal.h: declare more internal functions.
+
+	* iseq.h (rb_method_get_iseq): declared.
+
+	* compile.c, eval.c, eval_error.c, iseq.c, parse.y, proc.c, range.c,
+	  ruby.c, time.c, util.c, vm.c: don't declare internal functions.
+
+	* eval.c, parse.y, thread_pthread.c: non-existing function declarations
+	  removed.
+
+Sat Jun 18 08:12:54 2011  Tanaka Akira  <akr@fsij.org>
+
+	* common.mk: dependencies updated.
+
+	* tool/update-deps: new file to assist update dependencies in
+	  common.mk.
+
+Sat Jun 18 07:27:27 2011  Tanaka Akira  <akr@fsij.org>
+
+	* internal.h: declare internal functions here.
+
+	* node.h: declare NODE dependent internal functions here.
+
+	* iseq.h: declare rb_iseq_t dependent internal functions here.
+
+	* vm_core.h: declare rb_thread_t dependent internal functions here.
+
+	* bignum.c, class.c, compile.c, complex.c, cont.c, dir.c, encoding.c,
+	  enumerator.c, error.c, eval.c, file.c, gc.c, hash.c, inits.c, io.c,
+	  iseq.c, load.c, marshal.c, math.c, numeric.c, object.c, parse.y,
+	  proc.c, process.c, range.c, rational.c, re.c, ruby.c, string.c,
+	  thread.c, time.c, transcode.c, variable.c, vm.c,
+	  tool/compile_prelude.rb: don't declare internal functions declared
+	  in above headers.  include above headers if required.
+
+	  Note that rb_thread_mark() was declared as
+	  void rb_thread_mark(rb_thread_t *th) in cont.c but defined as
+	  void rb_thread_mark(void *ptr) in vm.c.  Now it is declared as
+	  the later in internal.h.
+
+Sat Jun 18 02:36:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (VpNewRbClass): fix type of the 2nd
+	  argument.
+
+	* ext/bigdecimal/bigdecimal.h: ditto.
+
+Sat Jun 18 02:30:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigMath_s_exp): move BigMath.exp from
+	  bigdecimal/math.rb.
+
+	* ext/bigdecimal/lib/bigdecimal/math.rb: ditto.
+
+	* test/bigdecimal/test_bigdecimal.rb: move test for BigMath.exp from
+	  test/bigdecimal/test_bigmath.rb.
+
+	* test/bigdecimal/test_bigmath.rb: ditto.
+
+Sat Jun 18 00:20:54 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: do not define wnum[01].
+
+Fri Jun 17 18:57:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): fix return value of obj[a,*b]=c.
+
+Fri Jun 17 13:09:45 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/curses/curses.c:  Clean up documentation.
+
+Fri Jun 17 09:25:14 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/curses/curses.c:  Document curses constants.  Patch by Vincent
+	  Batts.  [Ruby 1.9 - Bug #4880]
+
+Fri Jun 17 09:11:05 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* object.c:  Document Module#method_added and #method_removed.
+	  Patch by Bryce Kerley.  [Ruby 1.9 - Feature #4867]
+
+Fri Jun 17 08:50:16 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* io.c:  Improve documentation of IO and File open and new.
+	  Patch by Roger Pack.  [Ruby 1.9 - Bug #4790]
+
+Fri Jun 17 07:53:50 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/csv.rb:  Document #raw_encoding.  Patch by David Czarnecki.
+	  [Ruby 1.9 - Bug #4874]
+
+Fri Jun 17 07:46:50 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/benchmark.rb:  Document Benchmark::Tms#memberwise.  Patch by
+	  David Czarnecki.  [Ruby 1.9 - Bug #4873]
+
+Fri Jun 17 07:38:31 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/prettyprint.rb:  Improve documentation.  Patch by Ysiad
+	  Ferreiras.  [#4834]
+
+Fri Jun 17 07:23:03 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* array.c (rb_ary_drop):  Improve documentation.  Patch by Caley Woods.
+	  [Ruby 1.9 - Bug #4858]
+
+Fri Jun 17 06:11:31 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/webrick/log.rb:  Improve documentation of BasicLog and Log.
+	  Patch by Olivier Brisse.  [Ruby 1.9 - Bug #4833]
+	* lib/webrick/httpstatus.rb:  Improve documentation of
+	  WEBrick::HTTPStatus.  Patch by Olivier Brisse.
+	  [Ruby 1.9 - Bug #4833]
+
+Fri Jun 17 04:48:22 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c, thread_pthread.h: remove unused variables.
+	  (native_thread_data_t::gvl_cond, native_thread_data_t::gvl_next)
+
+Thu Jun 16 14:32:31 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* time.c (rb_time_new): prevent overflow by "* 1000".
+
+Fri Jun 17 03:07:36 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm4_thread_create_join.rb,
+	  benchmark/bm_vm4_thread_mutex[1-3].rb: renamed to
+	  bm_thread_* (fix last rename).
+
+Fri Jun 17 02:26:47 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_pthread.c (native_thread_create): fix debug message.
+	  (add last newline)
+
+Thu Jun 16 23:40:49 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_schedule_rec): fix {UN,}LIKELY macro misuse.
+	* gc.c (rb_newobj): ditto.
+	* vm_insnhelper.c (vm_method_search): ditto.
+
+Thu Jun 16 20:06:15 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/testunit/test_parallel.rb: Fix Regexp for test.
+
+	* test/testunit/tests_for_parallel/test_third.rb: Use
+	  Test::Unit::TestCase#on_parallel_worker? for detecting worker.
+
+	* lib/test/unit/testcase.rb(Test::Unit::TestCase#on_parallel_worker?):
+	  New Method Test::Unit::TestCase#on_parallel_worker? returns true
+	  when a testcase is running on parallel worker.
+	* lib/test/unit/parallel.rb(Test::Unit::TestCase#on_parallel_worker?):
+	  ditto.
+
+Thu Jun 16 19:27:12 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
+
+	* test/test_securerandom.rb: Add testcase.  This testcase does NOT aim
+	  to test cryptographically strongness and randomness.  It includes
+	  the test for PID recycle issue of OpenSSL described in #4579 but
+	  it's disabled by default.
+
+Thu Jun 16 17:55:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_io.rb (TestIO#test_copy_stream_socket): fix
+	  test hanging up issue. Patch by CHIKANAGA Tomoyuki.
+
+Thu Jun 16 15:17:39 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* variable.c (const_missing):  Add simple example of const_missing.
+	  Patch by Anuj Dutta.  [Ruby 1.9 - Bug #4794]
+
+Thu Jun 16 15:09:29 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/monitor.rb:  Improve documentation.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4823]
+
+Thu Jun 16 14:54:09 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/webrick/utils.rb: Document WEBrick::Utils.  Patch by Olivier
+	  Brisse.  [Ruby 1.9 - Bug #4819]
+
+Thu Jun 16 14:26:46 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/webrick/httpservlet/erbhandler.rb:  Allow the ERB document to
+	  alter the content-type of the response.  [Ruby 1.9 - Bug #4685]
+
+Thu Jun 16 14:15:47 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/timeout.rb: Clarify timeout duration types.  Patch by Alf Mikula.
+	  [Ruby 1.9 - Bug #4791]
+	* lib/net/http.rb: ditto
+
+Thu Jun 16 13:25:25 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc*:  Import RDoc 3.7 release candidate
+
+Thu Jun 16 11:35:09 2011  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (search_response): parses SEARCH responses from
+	  the Yahoo IMAP server correctly.  patched by Mark Nadig.  [Bug #4509]
+
+Thu Jun 16 09:12:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* fix for build on solaris 10.
+
+Thu Jun 16 09:08:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/io/console/test_io_console.rb (TestIO_Console#test_sync):
+	  fix for daemon process.
+
+Thu Jun 16 07:58:01 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/testunit/test_parallel.rb(test_ignore_tzero): Test for r32109.
+
+	* test/testunit/tests_for_parallel/test_third.rb: Use another way to
+	  detect that test is running on worker. This fixes sometimes
+	  TestParallel failing.
+
+Thu Jun 16 07:20:06 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb(Test::Unit::Runner#_run_parallel): Ignore -j0
+	  because it makes blocking forever by IO.select.
+
+Thu Jun 16 03:08:11 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/testunit/test_parallel.rb (TestParallel::TestParallelWorker#
+	  setup): now can run on Windows, probably.
+
+	* test/testunit/test_parallel.rb (TestParallel::TestParallel#setup):
+	  ditto.
+
+Thu Jun 16 03:00:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread.c (do_select): Windows: no need to poll if select(2) is
+	  cancelable.
+
+	* thread_win32.c (native_fd_select): new function to make select(2)
+	  cancelable.
+
+	* thread_win32.c (rb_w32_check_interrupt): new function for checking
+	  interrupt.
+
+	* win32/win32.c (rb_w32_select_with_thread): new function. cancelable
+	  select(2).
+
+	* win32/win32.c (rb_w32_select): use above function internally.
+
+Wed Jun 15 23:30:45 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* gc.c: fix a regression by r31690 on AIX because AIX malloc
+	  return NULL if it's passed 0. But some caller don't expect it.
+	  patch by Yutaka Kanemoto. [ruby-dev:43779]
+	(vm_malloc_prepare): return calculated size.
+	(vm_xmalloc): use above result.
+	(vm_xcalloc): ditto.
+
+Wed Jun 15 23:11:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c: remove BLOCKING_REGION_CORE() macro. It's no longer used
+	  since r32022.
+
+Wed Jun 15 21:00:47 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* test/openssl/test_config.rb: execute based on the existence of the
+	  OpenSSL module.
+
+Wed Jun 15 12:35:11 2011  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_io.rb (test_copy_stream_socket): wait a child process
+	  before SIGUSR1 handler is removed.
+
+	* test/pathname/test_pathname.rb (define_assertion): use line number
+	  for test method names.
+
+Wed Jun 15 10:37:43 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* file.c (rb_stat_rdev): use DEVT2NUM.
+
+	* file.c (rb_stat_rdev_major): ditto.
+
+	* file.c (rb_stat_rdev_minor): ditto.
+
+Wed Jun 15 05:12:59 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tcltklib.c (lib_eventloop_core): revert the last change (it's
+	  the part for ruby_1_8), and use rb_thread_check_ints() when RUBY_VM
+	  is defined.
+
+Wed Jun 15 04:42:47 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm3_thread_*.rb: renamed bm_vm3_thread_*.rb to
+	  benchmark/bm_vm_thread_*.rb.
+
+Wed Jun 15 04:28:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* benchmark/bm_vm4_thread_pass.rb: rename bm_vm4* to
+	  bm_vm_thread_*. suggested by ko1.
+	* benchmark/bm_vm4_pipe.rb: ditto.
+	* benchmark/bm_vm4_alive_check1.rb: ditto.
+	* benchmark/bm_vm4_pass_flood.rb: ditto.
+
+Wed Jun 15 03:52:50 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* benchmark/bm_vm4_pass_flood.rb: new benchmark for GVL fairness.
+	* benchmark/bm_vm4_alive_check1.rb: ditto.
+
+Wed Jun 15 01:27:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (gvl_yield): fix live lock issue on 1-2 cpus
+	  system. It's additional fix for r32021.
+	* thread_pthread.c (gvl_init): add switch_wait_cond.
+	* thread_pthread.h (typedef struct rb_global_vm_lock_struct): ditto.
+
+Tue Jun 14 23:16:22 2011  Tanaka Akira  <akr@fsij.org>
+
+	* bootstraptest/runner.rb (show_progress): refine verbose mode.
+	  (exec_test): ditto.
+
+Tue Jun 14 23:02:36 2011  Tanaka Akira  <akr@fsij.org>
+
+	* bootstraptest/runner.rb (show_progress): extracted from assert_check.
+	  (assert_check): use show_progress.
+	  (assert_normal_exit): ditto.
+	  (assert_finish): ditto.
+	  (flunk): ditto.
+
+Tue Jun 14 22:51:42 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* test/date/test_*.rb: added tests.
+
+Tue Jun 14 22:09:58 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: renamed some functions.
+	* ext/date/date_core.c: modified doc.
+
+Tue Jun 14 21:26:01 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* cont.c (cont_save_thread): add new utility function.
+	  rb_context_t::saved_thread.machine_stack_start and
+	  machine_stack_end should be cleared immediately after a snapshot of
+	  current thread is stored to saved_thread. [ruby-dev:43680] [Bug #4855]
+	  this change aims to get rid of unnecessary GC mark at machine stack.
+
+Tue Jun 14 19:50:49 2011  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_autoload.rb: remove temporary directory.
+
+Tue Jun 14 11:05:03 2011  Narihiro Nakamura  <narihiro@netlab.jp>
+
+	* gc.c (rb_gc_set_params): call initial_expand_heap if
+	  initial_heap_min_slots is set.
+
+Tue Jun 14 11:02:08 2011  Narihiro Nakamura  <narihiro@netlab.jp>
+
+	* gc.c: use size_t.
+
+Tue Jun 14 01:10:38 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* test/coverage/test_coverage.rb: add a test for restart.  a patch
+	  from Xavier Shay.  [ruby-core:36745]
+
+Tue Jun 14 01:05:10 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* ext/coverage/coverage.c: make it restartable.  [ruby-core:36539]
+
+Mon Jun 13 23:55:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (rb_thread_schedule_rec): call gvl_yield() unconditionally.
+	* thread_pthread.c: remove HAVE_GVL_YIELD macro.
+	* thread_win32.c (gvl_yield): new. this fallback logic was moved from
+	  rb_thread_schedule_rec().
+
+Mon Jun 13 23:50:25 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/io/console/console.c (console_dev): typo.
+
+Mon Jun 13 23:38:23 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_parse_string): flush delayed token.  based on a
+	  patch by Masaya Tarui in [ruby-dev:43762].  Bug #4544
+
+	* parse.y (yylex): revert r24557.  delayed token at the end of
+	  string should be flushed already by the above change.
+
+Mon Jun 13 23:33:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_dev): console should be
+	  unbuffered.
+
+	* ext/io/console/console.c (console_dev): take care of no-ctty
+	  case.
+
+Mon Jun 13 23:06:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c: rewrite GVL completely. This fix improve some
+	  benchmark dramatically (e.g. vm3_thread_mutex result changed
+	  form 120.601sec to 3.426sec).
+	* thread_win32.c: ditto.
+	* thread_pthread.h: ditto.
+	* vm_core.h: ditto.
+	* thread.c: ditto.
+
+Mon Jun 13 23:11:52 2011  Tanaka Akira  <akr@fsij.org>
+
+	* test/socket/test_unix.rb: don't use Thread.abort_on_exception.
+
+Mon Jun 13 23:05:01 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/unixsocket.c (unix_send_io): race condition fixed.
+	  (unix_recv_io): ditto.
+	  fixed by Eric Wong.  [ruby-core:35574]
+
+	* test/socket/test_unix.rb: test added for above problem.
+
+Mon Jun 13 21:41:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_win32.c (native_cond_signal): remove unnecessary rb_bug().
+	  It's additional fix for r32021. [Bug #4696]
+
+Mon Jun 13 20:50:49 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* test/openssl/test_ec.rb
+	  test/openssl/test_pkey_ec.rb: merge both files into test_pkey_ec.rb.
+	  Removed redundant group instantiation from PKey tests.
+	* test/openssl/utils.rb: only create TEST_PKEY_EC_P256V1 if EC is
+	  defined.
+
+Mon Jun 13 20:28:24 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* test/openssl/digest.rb: remove MDC2 from test, it is not available
+	  by default in an OpenSSL installation.
+
+Mon Jun 13 20:18:55 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, vm_insnhelper.h: move decl. of
+	  ruby_vm_global_state_version and related macros
+	  from vm_core.h to vm_insnhelper.h.
+
+	* vm.c (vm_clear_all_cache): added.  This function is called
+	  when ruby_vm_global_state_version overflows.
+	  TODO: vm_clear_all_inline_method_cache() is only place holder.
+	        We need to implement it ASAP.
+
+	* vm_method.c (vm_clear_global_method_cache): added.
+
+Mon Jun 13 19:46:21 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/cmath.rb: add new method Object#real?. fix #3137
+
+Mon Jun 13 18:52:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (is_kind_of_BigDecimal): new function to
+	  examine the whether the object is kind of BigDecimal.
+
+Mon Jun 13 18:49:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimalCmp): use GetVpValueWithPrec
+	  for Float and Rational arguments.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_new, test_cmp, test_power):
+	  add and modify tests for the above change.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimalCmp): modify coding style to
+	  match ruby's standard.
+
+Mon Jun 13 18:33:04 2011  Tanaka Akira  <akr@fsij.org>
+
+	* lib/securerandom.rb (SecureRandom.random_bytes): modify PRNG state
+	  to prevent random number sequence repetition at forked child
+	  process which has same pid.
+	  reported by Eric Wong.  [ruby-core:35765]
+
+Mon Jun 13 17:02:34 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (Net::HTTP#use_ssl?): require 'openssl' only when
+	  https is needed. fixes r31933.
+
+Mon Jun 13 14:35:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* lib/cmath.rb (CMath.cbrt): returns the principal value of the cube
+	  root of the argument.  fix #3676
+
+	* test/test_cmath.rb (test_cbrt_returns_principal_value_of_cube_root):
+	  test for the above change.
+
+Mon Jun 13 14:17:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* lib/test/unit.rb (Test::Unit::GlobOption#non_options): fix typo.
+
+Mon Jun 13 13:04:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_digest.c: fix error for digests that have no oid
+	(e.g. DSS1).
+	* test/openssl/test_digest.c: add tests for this.
+
+Mon Jun 13 12:51:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/yaml.rb: load psych only when syck is not loaded.
+
+Mon Jun 13 12:23:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+Mon Jun 13 12:23:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/psych/lib/psych/deprecated.rb (Object#to_yaml_properties):
+	  undef to_yaml_properties before redefine it.
+
+	* ext/syck/lib/syck/rubytypes.rb: ditto.
+
+Mon Jun 13 11:30:10 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_digest.c: allow Digests to be created by sn, ln or
+	  oid.
+	* test/openssl/test_digest.rb: add tests for this.
+	  [Ruby 1.9 - Feature #4412] [ruby-core:35319]
+
+Mon Jun 13 10:54:03 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/pkey_dh.c: corrected documentation.
+	* test/openssl/utils.rb: add test key for DH.
+	* test/openssl/test_pkey_dh.rb: add tests.
+
+Mon Jun 13 10:13:08 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/pkey_dh.c: clarify difference between DH#public_key and
+	DH#pub_key in documentation.
+
+Mon Jun 13 05:50:43 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* NEWS: introduce PKey.read.
+
+Mon Jun 13 05:17:29 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_pkey.c: added PKey.read module function that allows
+	  reading arbitrary public/private keys from DER-/PEM-encoded File or
+	  string instances.
+	* ext/openssl/ossl_pkey_dh.c: improved documentation.
+	* test/openssl/utils.rb: added EC test key.
+	* test/openssl/test_pkey_rsa.rb
+	  test/openssl/test_pkey_dsa.rb: Test PKey.read. Reuse keys from
+	  OpenSSL::TestUtils.
+	* test/openssl/test_pkey_ec.rb: Created test file for EC tests.
+	  Test PKey.read.
+	  [Ruby 1.9 - Feature #4424] [ruby-core:35330]
+
+Mon Jun 13 04:42:24 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (total_i): fix to skip no ruby objects.
+
+Mon Jun 13 03:07:38 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/benchmark/test_benchmark.rb (capture_output):
+	  replace '-' as space. On NetBSD, subtract between two Process.times
+	  after and before the short process may return negative value like:
+	  t0=Process.times; yield; t1=Process.times; p t1.utime-t0.utime
+
+Mon Jun 13 02:40:23 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* test/openssl/test_pkey_dsa.rb: Test for DSA#syssign/sysverify.
+
+Mon Jun 13 01:59:19 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_pkey_dh.c: completed documentation.
+	* ext/openssl/ossl_pkey_dsa.c: corrected examples. Improved parameter
+	  sections.
+
+Mon Jun 13 00:25:10 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
+
+	* ext/openssl/ossl_pkey_dsa.c: completed documentation.
+
+Sun Jun 12 23:36:46 2011  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb (kill_sub_thread): remove the method. [ruby-core:34185]
+
+Sun Jun 12 21:01:56 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c (d_lite_marshal_load): should give converted value.
+
+Sun Jun 12 20:36:30 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: edited doc.
+
+Sun Jun 12 18:12:07 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm3_clearmethodcache.rb: added.
+
+Sun Jun 12 17:40:29 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_clear_cache*): update only vm state version.
+
+	* vm_method.c (rb_method_entry_get_without_cache, rb_method_entry):
+	  Fill method cache entry with vm state version, and
+	  check current vm state version for method (cache) look up.
+	  This modification speed-up invalidating of global method cache table.
+	  [Ruby 1.9 - Feature #3905] [ruby-core:36908]
+
+Sun Jun 12 16:19:48 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/extconf.rb: fail on Mac OS X. [Bug #4853][ruby-dev:43655]
+
+Sun Jun 12 15:56:08 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c: remove th->transition_for_lock. It's thread unsafe.
+	  [Bug #4723][ruby-dev:43563]
+
+Sun Jun 12 15:47:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c: introduce spurious wakeup safe deadlock check.
+	  [Bug #4696][ruby-dev:43554]
+
+Sun Jun 12 13:33:52 2011  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm3_thread_mutex.rb: remove it.
 
-Sat Apr 24 00:00:16 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* benchmark/bm_vm3_thread_mutex[1-3].rb: added 3 benchmarks.
+	    1: one thread with one mutex (no contention).
+	    2: two threads with one mutex (contention).
+	    3: 1000 threads with one mutex (huge number of contention)
+	  Above removed benchmark was type 3.
+	  Therefore, this commit adds type 1 and 2 benchmark.
 
-	* parse.y (operation): syntax like `a.[]=(1,2)' is allowed.
+Sun Jun 12 11:16:59 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri Apr 23 23:54:09 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c: use select() appropriately for sendfile().
+	  Fixed by Eric Wong.  [ruby-core:36150]
+	  (maygvl_copy_stream_wait_readwrite): removed.
+	  (nogvl_copy_stream_sendfile): use nogvl_copy_stream_wait_write and
+	  maygvl_copy_stream_wait_read instead of
+	  maygvl_copy_stream_wait_readwrite.
 
-	* io.c (argf_binmode): binmode method added to ARGF.
+Sun Jun 12 09:32:13 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Apr 23 13:55:22 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* atomic.h (ATOMIC_OR): _InterlockedOr is not available on mingw.h
+	* gc.c (rb_gc_set_params): VM_OBJSPACE is disabled on mingw.
 
-	* string.c (rb_f_chomp): should assign the result to $_.  or maybe
-	  sub/gsub/chop/chomp should NOT assign $_ altogether.
+Sun Jun 12 01:07:09 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Thu Apr 22 16:50:54 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c: edited doc.
 
-	* eval.c (rb_callcc): call scope_dup() for all scopes in
-	  the interpreter stack.
+Sat Jun 11 23:18:00 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Apr 20 11:24:18 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_core.h (RUBY_VM_SET_TIMER_INTERRUPT, RUBY_VM_SET_INTERRUPT,
+	  RUBY_VM_SET_FINALIZER_INTERRUPT): use atomic ops for preventing
+	  interrupt_flag bit lost. [Bug #4770][ruby-dev:43467]
+	* thread.c (rb_threadptr_execute_interrupts_rec): ditto.
+	* vm_core.h (typedef struct rb_thread_struct): change type of
+	  interrupt_flag to rb_atomic_t.
+	* atomic.h: move atomic ops definition from signal.c.
+	* signal.c: remove atomic ops definition.
+	* common.mk (gc, signal, thread, cont): add to dependency to atomic.h.
 
-	* string.c (rb_str_dump): `#' should be escaped.
+Sat Jun 11 23:23:52 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Apr 20 02:32:42 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c: edited doc.
 
-	* parse.y (parse_regx): option /p for posix match added.
+Sat Jun 11 23:02:36 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* re.c (rb_reg_desc): did not print options properly.
+	* ext/openssl/lib/openssl/buffering.rb (module OpenSSL):
+	  Buffering#each_byte should return String in accordance with IO in
+	  1.9.
 
-	* io.c (rb_file_s_open): intialize was called twice.
+	* test/openssl/test_buffering.rb (class OpenSSL): add tests for getc
+	  and each_byte.
 
-Mon Apr 19 18:56:21 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Jun 11 22:41:37 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* configure.in (DEFAULT_KCODE): can specify default code for
-	  $KCODE by --with-default-kcode=(euc|sjis|utf8|none).
+	* time.c: a correction of doc for strftime (%v).
 
-	* regex.c (IS_A_LETTER): a byte sequence shorter than mbc should
-	  not match with \w etc.
+Sat Jun 11 22:30:53 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Apr 19 13:49:11 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c: replaced doc for strftime based on Time's one.
 
-	* eval.c (eval): should restore ruby_dyna_vars.
+Sat Jun 11 22:07:56 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Fri Apr 16 21:40:43 1999  Nobuetsu Nokada  <gea02117@nifty.ne.jp>
+	* ext/date/date_core.c (datetime_s_{iso8601,rfc3339,xmlschema,rfc2822,httpdate}):
+	  do not take argument comp.
 
-	* io.c (f_backquote): pipe_open may return nil.
+Sat Jun 11 21:58:31 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* io.c (f_open): rb_io_open may return nil.
+	* ext/date/date_core.c: added examples.
 
-	* io.c (io_s_foreach): ditto.
+Sat Jun 11 19:40:45 2011  Narihiro Nakamura  <authornari@gmail.com>
 
-	* io.c (io_s_readlines): ditto.
+	* gc.c: expand heap if initial_heap_min_slots is bigger than
+	  HEAP_MIN_SLOTS.
 
-	* io.c (io_defset): wrong message.
+Sat Jun 11 19:42:50 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Fri Apr 16 15:09:20 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ChangeLog (vim): set shiftwidth to 2.
 
-	* bignum.c (rb_str2inum): strtoul() returns long, not int.
+Sat Jun 11 19:27:06 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* eval.c (rb_load): size of VALUE and ID may be different.
+	* ext/openssl/ossl_x509req.c: raise RequestError instead of
+	  CertificateError when Request#to_der gets an error from OpenSSL.
+	  Patch from Ippei Obayashi, see #4420. I cannot write a test for
+	  this... Request does not allow to create broken bytes...
 
-	* util.c (mmprepare): int is too small to cast from pointers.
+Sat Jun 11 19:34:51 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* config.guess: avoid 'linux-gnu' for alpha-unknown-linux.
+	* ext/date/date_core.c (Date::(ABBR_)?(MONTH|DAY)NAMES): should be usascii.
 
-Thu Apr 15 23:46:20 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Sat Jun 11 19:24:33 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ruby.c (rubylib_mangle): mangle path by RUBYLIB_PREFIX.
+	* ext/date/date_core.c: rewrote doc.
 
-Wed Apr 14 23:52:51 1999  SHIROYAMA Takayuki  <psi@tokyo.stellar.co.jp>
+Sat Jun 11 19:04:15 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* node.h (NODE_LMASK): should be long to avoid overflow.
+	* lib/test/unit.rb (Test::Unit::GlobOption#non_options): should run
+	  with 1.8.
 
-Wed Apr 14 13:14:35 1999  Katsuyuki Komatsu  <komatsu@sarion.co.jp>
+Sat Jun 11 18:05:57 2011  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* dln.c: AIX dynamic link.
+	* bootstraptest/runner.rb: should initialize $stress to avoid warnings.
 
-	* ext/aix_ld.rb: ditto.
+Sat Jun 11 18:02:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Apr 14 12:19:09 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (io_getc): should be 7bit if ascii.  fixes #4557
 
-	* lib/thread.rb: Queue#{enq,deq} added.
+Sat Jun 11 16:52:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Apr 13 17:43:56 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* numeric.c (rb_enc_uint_chr): fix message format. Bug#4869
 
-	* hash.c (rb_hash_s_create): Hash::[] acts more like casting.
+Sat Jun 11 16:28:25 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-Tue Apr 13 00:33:52 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/rexml/formatters/pretty.rb
+	  (REXML::Formatters::Pretty#write_text),
+	  test/rexml/test_core.rb
+	  (Tester#test_pretty_format_long_text_finite): don't ignore
+	  'width' parameter in pretty formatter. fixes #4498
+	  Reported by Michael Frasca. Thanks!!!
 
-	* io.c (rb_io_stdio_set): warning for assignment to the variables
-	  $std{in,out,err}.
+Sat Jun 11 16:11:36 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-Mon Apr 12 23:12:32 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/rexml/test_core.rb
+	  (Tester#test_pretty_format_long_text_finite): remove needless
+	  assert_nothing_raised.
 
-	* io.c (rb_io_reopen): check for reopening same IO.
+Sat Jun 11 16:04:03 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-Fri Apr  9 17:45:11 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/rexml/parsers/xpathparser.rb
+	  (REXML::Parsers::XPathParser#parse),
+	  test/rexml/test_elements.rb
+	  (ElementsTester#test_each_with_frozen_condition):
+	  don't modify original XPath. fixes #4161
+	  Reported by Pavel Shved. Thanks!!!
 
-	* parse.y (rb_compile_string): bug for nested eval().
+Sat Jun 11 15:53:27 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-	* regex.c (re_match): should pop non-greedy stack items on
-	  failure, after best_regs are fixed.
+	* test/rexml/test_elements.rb (ElementsTester): remove needless
+	  prefix from test name.
 
-Thu Apr  8 17:30:40 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Jun 11 15:36:36 2011  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* common.mk: fixed a grammatical error
 
-	* pack.c (PACK_LENGTH_ADJUST): need to adjust for `*' length.
+Sat Jun 11 14:20:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Apr  6 23:28:44 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm.c (thread_memsize): don't ignore size of th->local_storage.
 
-	* parse.y (void_check): add void context checks.
+Sat Jun 11 10:32:46 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Apr  5 12:23:42 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb: should quote arch_hdrdir and libpath for the case
+	  installed prefix contains spaces.
 
-	* time.c (time_s_at): should copy gmt-mode.
+Sat Jun 11 10:20:52 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (eval_node): preserve ruby_eval_tree.
+	* thread_pthread.c (native_cond_timeout): wrap conditionally used
+	  label.
 
-Fri Apr  2 14:00:34 1999  NAKAMURA, Hiroshi  <nakahiro@sarion.co.jp>
+	* thread_pthread.c (native_sleep): remove unused variable.
 
-	* lib/debug.rb: wrong command interpreting.
+Sat Jun 11 10:15:50 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri Apr  2 11:46:22 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (rb_thread_execute_interrupts): use GetThreadPtr to extract
+	  rb_thread_t from VALUE.
+	  reported by Motohiro KOSAKI.  [ruby-dev:43700]
 
-	* version 1.3.2
+Sat Jun 11 10:00:49 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Apr  2 10:40:04 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ruby.c (ruby_process_options): add missing return type.
 
-	* io.c (rb_io_s_pipe): forgot to define IO::pipe.
+Fri Jun 10 23:18:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Apr  1 14:40:46 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/tk/tcltklib.c (lib_eventloop_core): replace CHECK_INTS with
+	  rb_thread_check_ints(). Because current code can't be compiled.
 
-	* eval.c (assign): modified for rhs change.
+Fri Jun 10 16:38:13 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (stmt): unparenthesisized method calls can be right hand
-	  side expression of the assignment.
+	* encoding.c (rb_locale_charmap): When ruby process is run as Windows
+	  Service the console codepage is not set, GetConsoleCP returns 0.
+	  So on such environment, use GetACP().
+	  http://blogs.msdn.com/b/michkap/archive/2005/02/08/369197.aspx
+	  patched by Rafal Bigaj [ruby-core:36832] [Bug #4854]
 
-Sat Mar 27 22:42:47 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+Fri Jun 10 14:34:24 2011  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/nkf/nkf.c (rb_nkf_kconv): check size output_ctr before
-	  decrement.
+	* common.mk: restore TESTRUN_SCRIPT to "$(srcdir)/test.rb".
+	  TESTRUN_SCRIPT is used by "make run", "make gdb" and so on.
 
-Thu Mar 25 09:11:03 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Jun 10 13:01:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* time.c (time_s_at): preserve gmt-mode for result.
+	* test/ruby/test_module.rb (TestModule#remove_rake_mixins): remove all
+	  module related to Rake.
 
-	* parse.y (rb_compile_string): do not use cur_mid, use
-	  compile_for_eval instead.
+Fri Jun 10 09:52:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* st.c (PTR_NOT_EQUAL): wrong logical condition.
+	* encoding.c:  Mention that Encoding.compatible? can work with more
+	  than just Strings.
 
-Wed Mar 24 13:06:43 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Jun 10 02:25:53 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* parse.y (yycompile): should clear cur_mid after compilation.
+	* ext/psych/lib/psych.rb: updating version to match released gem.
 
-	* io.c (next_argv): need to check type for ARGV.shift.
+Fri Jun 10 01:06:29 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (blk_copy_prev): need to preverse outer scope as well as
-	  outer frames.
+	* ext/bigdecimal (BigDecimal_to_i): Integer#** may return flonum.
 
-	* parse.y (rb_compile_string): return can appear within eval().
+Fri Jun 10 00:35:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Mar 23 10:15:07 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+	* complex.c (string_to_c_internal): uses rb_reg_nth_match;
+	* rational.c (string_to_r_internal): ditto.
 
-	* configure.in: AC_C_CONST check added.
+Fri Jun 10 00:25:03 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Tue Mar 23 02:07:35 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* gc.c: remove an unused declaration.
 
-	* time.c (time_plus): preserve gmt-mode for result.
+Fri Jun 10 00:24:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Mar 22 01:32:37 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* rational.c (string_to_r): Rational#** may return flonum.
 
-	* eval.c (rb_eval): adjust line numbers before expression
-	  interpolation within strings.
+Thu Jun  9 23:57:53 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_eval): defined? returns nil for false condition.
+	* io.c: fix IO.copy_stream interrupt handling.
+	  based on the patch by Eric Wong.  [ruby-core:36156]
 
-	* numeric.c (num_nonzero_p): returns nil for false condition.
+	* vm_core.h (rb_thread_call_with_gvl): don't declare here.
 
-Sat Mar 20 13:07:43 1999  Keiju Ishitsuka  <keiju@rational.com>
+	* thread.c: include internal.h.
+	  (rb_thread_execute_interrupts): new function.
 
-	* lib/weakref.rb: avoid leak for two weakrefs for one object.
+	* internal.h (rb_thread_execute_interrupts): declared.
+	  (rb_thread_call_with_gvl): declared.
 
-Fri Mar 19 11:26:45 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Thu Jun  9 23:34:01 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* eval.c (ruby_run): needed to eval END{} on exit.
+	* gc.c (rb_objspace_call_finalizer): use rb_typeddata_is_kind_of() for
+	  type check to get rid of a double free when main Thread has singleton
+	  class. [ruby-core:36741] [Bug #4828]
+	* thread.c (rb_obj_is_mutex): add a new utility function.
+	* vm.c (rb_obj_is_thread): ditto.
 
-	* eval.c (rb_exit): ditto.
+Thu Jun  9 22:53:49 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Fri Mar 19 02:17:27 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_thread.rb (TestThread#test_kill_thread_subclass):
+	  add test for Thread.kill with Thread subclass instance.
 
-	* signal.c (Init_signal): handles terminating signals HUP, TERM,
-	  QUIT, PIPE, etc.
+Thu Jun  9 22:31:47 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Thu Mar 18 15:47:18 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_thread.rb (TestThread#test_kill_wrong_argument):
+	  test for [ruby-core:35086].
+	  partially forward porting r31402 from ruby_1_9_2 branch.
 
-	* bignum.c (rb_big_and): bug in sign calculation.
+Thu Jun  9 18:36:00 2011  Kenta Murata <mrkn@mrkn.jp>
 
-	* bignum.c (rb_big_or): ditto.
+	* string.c: Fix the ambiguous description of the behavior of
+	  rb_str_aref_m with a range.  It returns nil when the beginning of
+	  the range is greater than the end of the string rather than the range.
 
-	* io.c (rb_f_select): forgot to use to_io to retrieve IO, after
-	  calling select(2).
+Thu Jun  9 10:57:03 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Mar 16 19:54:31 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Hash subclasses can be read
+	  from YAML files.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Hash subclasses can be
+	  dumped to YAML files.
+	* test/psych/test_hash.rb: corresponding test.
 
-	* ext/extmk.rb.in: static linking cause infinite make loop.
+Thu Jun  9 09:18:51 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Mar 16 18:50:04 1999  Yoshida Masato  <yoshidam@yoshidam.net>
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Ruby modules can be loaded
+	  from YAML files.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby modules can be
+	  dumped to YAML files.
+	* test/psych/test_class.rb: corresponding test.
 
-	* ext/socket/socket.c (tcp_s_gethostbyname): typo, not NUM2INT(),
-	  but INT2NUM().
+Thu Jun  9 09:05:04 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/socket/socket.c (mkhostent): ditto.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: Ruby classes can be loaded
+	  from YAML files.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Ruby classes can be
+	  dumped to YAML files.
+	* test/psych/test_class.rb: corresponding test.
 
-Tue Mar 16 12:31:44 1999  Ryo HAYASAKA  <hayasaka@cheer.u-aizu.ac.jp>
+Wed Jun  8 21:38:57 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* file.c (utime_internal): suppress warning by const.
+	* cont.c (root_fiber_alloc): set root fiber's status RUNNING.
+	  in cont_mark() only RUNNING fiber's machine stack is marked.
+	  root fiber's status should be RUNNING at the beginning regardless of
+	  FIBER_USE_NATIVE. [ruby-core:36735] fixes #4827
 
-	* time.c (time_gmtime): ditto.
+Tue Jun  7 20:50:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Mar 16 10:23:05 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* doc/irb/irb.rd: fix typo. patch by Nobuhiro IMAI.
+	  [Bug #4843] [ruby-dev:43639]
+	* doc/irb/irb.rd.ja: ditto.
+	* doc/ChangeLog-YARV: ditto.
 
-	* time.c (time_clone): Time object can be cloned.
+Tue Jun  7 18:52:55 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Mar 16 03:13:10 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+	* lib/rubygems/user_interaction.rb (Gem::StreamUI#tty?): IO#tty? of
+	  Windows has been fixed at r29969.
 
-	* ruby.c (load_file): argv[argc] should be NULL.
+	* test/rubygems/test_gem_stream_ui.rb: now can run tests.
 
-Mon Mar 15 22:12:08 1999  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+Tue Jun  7 18:36:41 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* sprintf.c (rb_f_sprintf): typo in arg_num check at exit.
+	* test/rubygems/test_gem.rb (TestGem#{test_self_user_home_userprofile,
+	  test_self_user_home_user_drive_and_path}): should simply ignore
+	  meaningless tests instead of skipping them.
 
-Mon Mar 15 16:42:22 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Jun  7 18:15:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* array.c (rb_ary_dup): dup2 should copy class too.
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  should show some messages when skipping tests.
 
-Mon Mar 15 15:12:53 1999  Yasuhiro Fukuma  <yasuf@big.or.jp>
+Tue Jun  7 13:59:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb: install program relative path check.
+	* ext/date/date_core.c (date_s_today, datetime_s_now): check the
+	  result of localtime_r().
 
-Mon Mar 15 14:05:25 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Jun  7 13:36:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* re.c (rb_reg_s_new): 2nd argument is now option.
-	  Regexp::EXTENDED can be specified.
+	* ext/tk/extconf.rb: use $defs not $CPPFLAGS to get rid of
+	  command line escape issues on Windows.  fixed #4835.
 
-Fri Mar 12 10:47:49 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Jun  7 03:18:45 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* string.c (rb_str_index): str.index("") should always match at
-	  offset point.
+	* test/ruby/test_io.rb (TestIO#test_s_{,bin}write): do not create a
+	  file under /tmp. [Bug #4846]
 
-	* string.c (rb_str_upto): can specify end point exclusion.
+Mon Jun  6 22:51:43 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* string.c (rb_str_index): negative offset.
+	* cont.c: use #if FIBER_USE_NATIVE instead of #ifdef.
+	  you can suppress use of setcontext for Fiber with compile option
+	  -DFIBER_USE_NATIVE=0
 
-	* regex.c (re_match): begline should not match at the point
-	  between a newline and end-of-string.  endline neither.
+Mon Jun  6 21:59:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (re_compile_pattern): context_indep_anchors .
+	* test/date/test_switch_hitter.rb: added a test.
 
-	* parse.y (parse_regx): need not to push backslashes before
-	  escaped characters.
+Mon Jun  6 21:37:45 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (rb_thread_join): re-raises exception within target.
+	* ext/date/date_core.c: added notes.
 
-Fri Mar 12 01:09:36 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+Mon Jun  6 21:02:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/readline/readline.c (readline_s_vi_editing_mode): wrong
-	  number of arguments.
+	* ext/date/date_core.c: flattened format to strftimev.
+	* ext/date/date_core.c (date_strftime_internal): taints run.
 
-Fri Mar 12 02:12:50 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Jun  6 15:10:17 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* pack.c (PACK_ITEM_ADJUST): "a".unpack("C3") => [97, nil, nil]
+	* include/ruby/{defines,missing}.h (rb_infinity, rb_nan): move from
+	  defines.h to missing.h.  (couldn't use RUBY_EXTERN there.)
 
-Thu Mar 11 18:23:50 1999  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+Mon Jun  6 14:35:48 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/socket/socket.c (Init_socket): UDPsocket was ommited.
+	* test/rdoc/test_rdoc_markup_pre_process.rb (TestRDocMarkupPreProcess#
+	  {test_include_file,test_include_file_encoding_incompatible}): no
+	  need to write such workaround.  don't hide the bug of ruby. (and the
+	  bug is already fixed.)
 
-Thu Mar 11 16:43:30 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Jun  6 14:11:11 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* pack.c (PACK_LENGTH_ADJUST): push fixed number of items per
-	  template to result array.
+	* ext/date/date_core.c (valid_jd_sub): need to convert from VALUE to
+	  double.
 
-	* pack.c (pack_unpack): I/N/C etc. push nil in the array for "".
+	* ext/date/date_core.c (offset_to_sec): get rid of a compiler warning.
 
-Tue Mar  9 00:19:21 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Jun  6 14:09:08 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* hash.c (ruby_unsetenv): use ruby_setenv(name, 0).
+	* include/ruby/defines.h (rb_infinity, rb_nan): export for Windows.
 
-	* hash.c (env_delete): ditto.
+Mon Jun  6 10:54:45 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* string.c (rb_str_upto): do not check `beg<end' to generate
-	  strings for the pattern like "a".upto("#a").
+	* lib/test/unit.rb(Test::Unit::Runner#puke):
+	  Add overriding from MiniTest::Unit#puke. This reverts minitest's fix
+	  that skip messages are hidden when not verbose mode (-v option).
+	  To hide skip messages, use --hide-skip option instead.
 
-	* range.c (range_each): treat strings as special case.
+Mon Jun  6 10:52:13 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* range.c (range_each): no longer use upto for generic cases.
+	* lib/net/http.rb: don't use autoload.
 
-Sun Mar  7 14:21:32 1999  IKARASHI Akira <ikarashi@itlb.te.noda.sut.ac.jp>
+Mon Jun  6 09:39:43 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* string.c (rb_str_index): wrong end point calculation.
+	* ext/psych/parser.c (parse): release event objects to plug memory
+	leak.  Thanks Mark J. Titorenko!
 
-Sat Mar  6 02:19:12 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Jun  5 23:26:15 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* re.c (match_index): MatchingData#index(n) added.
+	* eval.c: remove rb_thread_stop_timer_thread function declaration.
+	  Instead, include vm_core.h.
+	* process.c: ditto.
 
-	* array.c (rb_ary_subseq): ary[n..-1] returns an sub-array unless
-	  n is too small negative index.
+Sun Jun  5 21:38:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* re.c (rb_reg_match_method): Regexp#match(str) added.
+	* thread_pthread.c (thread_timer): add to care a spurious wakeup.
+	  When native_cond_timedwait() return 0 by spurious wakeup, we
+	  don't have to neither 1) call timer_thread_function and 2)
+	  exit the timer thread.
 
-	* array.c (rb_ary_indexes): understands ranges as indexes.
+Sun Jun  5 17:50:01 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* re.c (match_size): MatchingData#size added.
+	* ext/date/date_core.c (m_real_cwyear): new.  derived from m_cwyear.
+	* ext/date/date_strftime.c: trivial changes.
 
-Fri Mar  5 01:04:57 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Jun  5 17:22:01 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* array.c (rb_ary_fill): modified for range.
+	* ext/tk/config_list.in: add new options for tcltklib.
 
-	* array.c (rb_ary_aset): a[n..m] revisited.
+Sun Jun  5 10:06:50 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Thu Mar  4 14:23:29 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_tmx.h: now does not place decoded data.  allows to
+	  access indirectly via functions on demand.
+	* ext/date/date_strftime.c: ditto.
+	* ext/date/date_core.c: ditto.
+	* ext/date/date_core.c ({d|dt}_lite_to_s): use strftime.
 
-	* string.c (rb_str_subseq): a[n..m] revisited.
+Sun Jun  5 06:22:02 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* parse.y (method_call): allow Const::method{}.
+	* NEWS: wrote about changes of date.
 
-	* array.c (rb_ary_replace_method): should replace original array.
+Sat Jun  4 16:59:26 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Thu Mar  4 02:30:22 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c (d_lite_inspect): changed the format.
+	* ext/date/date_core.c: refactoring and fixing some bugs.
 
-	* configure.in: remove --disable-thread, thread feature is no
-	  longer optional.
+Sat Jun  4 04:04:41 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Mar  4 00:32:17 1999  Yasuhiro Fukuma  <yasuf@big.or.jp>
+	* test/rubygems/test_gem_commands_which_command.rb:
+	  "missing" exists on ruby's top source directory. [Bug #4815]
 
-	* parse.y (read_escape): wrong arguments for scan_oct,scan_hex.
+Fri Jun  3 21:48:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Mar  3 11:51:53 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/rubygems/test_case.rb: Refix for test-all in separate directory.
+	  r31147 + r31151.
 
-	* ext/socket/socket.c (Init_socket): rename class names as
-	  TCPsocket -> TCPSocket etc.
+Fri Jun  3 20:58:47 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Mar  2 19:46:42 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* ext/date/date_core.c (d_lite_plus): get rid of compiler warnings.
 
-	* configure.in (LDSHARED): use gcc -Wl,-G for solaris with gcc.
+Fri Jun  3 20:56:40 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Mar  2 17:04:19 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* include/ruby/missing.h, numeric.c (round): moved prototype of round()
+	  from numeric.c to missing.h.  (note: round() is C99 feature, so ruby
+	  provides it if not exist in C runtime.)
 
-	* parse.y (yylex): backslashes do not concatenate comment lines
-	  anymore.
+Fri Jun  3 20:42:04 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Mon Mar  1 14:05:12 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/test/unit/parallel.rb: Keep $stdin, $stdout before run testcase
+	  and restore after run. Because some test break $stdin, $stdout.
+	  Fixes [Bug #4433] [ruby-core:35353]
 
-	* eval.c (rb_call0): adjust argv for optional arguments.  super
-	  without arguments emit superclasse method with the value from
-	  optinal arguments.  enabled as experiment.
+Fri Jun  3 19:58:14 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Feb 28 14:04:07 1999  WATANABE Hirofumi  <eban@os.rim.or.jp>
+	* io.c (io_fflush): windows -- call fsync() only when the FD is tied to
+	  file, because if the FD is pipe, it blocks.
 
-	* parse.y (nextc): backslash at the eof cause infinite loop
+Fri Jun  3 09:27:31 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Feb 28 11:01:26 1999  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* lib/net/http.rb (URI::HTTP#request_uri): return nil when the uri
+	  is path-rootless form. Bug #4759
 
-	* time.c (make_time_t): month range check added.
+Thu Jun  2 23:51:03 2011  James Edward Gray II  <jeg2@ruby-lang.org>
 
-Sat Feb 27 02:36:05 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/csv.rb: Improve the line ending detection algorithm
+	  patch by Alexey).
 
-	* re.c (Init_Regexp): add escape as alias of quote.
+Thu Jun  2 20:05:57 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* re.c (rb_reg_s_quote): char-code can be specified now.
+	* io.c (rb_io_s_write, rb_io_s_binwrite): return!!!
 
-Fri Feb 26 18:45:36 1999  Yasuhiro Fukuma  <yasuf@big.or.jp>
+Thu Jun  2 16:29:34 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* eval.c (error_print): bug for error message with newlines.
+	* io.c: Add File.write, File.binwrite. [Feature #1081] [ruby-core:21701]
 
-Fri Feb 26 12:00:04 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_io.rb: Test for File.write, File.binwrite.
 
-	* time.c (make_time_t): future check modified to allow 1969-12-31
-	  at certain timezone.
+	* NEWS: News for above.
 
-	* time.c (time_arg): year >= 1000 should be past.
+Thu Jun  2 12:33:09 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* version.c (Init_version): constant RELEASE_DATE added.
+	* io.c (io_fflush, rb_io_flush): need to fsync() when ruby calls
+	  internal flush. [ruby-core:36670] [Bug #4813]
 
-Fri Feb 26 01:08:30 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Jun  2 07:56:24 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* string.c (rb_str_substr): returns nil for out-of-range access.
+	* ext/tk/tcltklib.c: reduce CPU power required by an eventloop.
 
-	* array.c (rb_ary_subseq): returns nil for out-of-range access.
+Tue May 31 21:28:33 2011  Tanaka Akira  <akr@fsij.org>
 
-	* array.c (rb_ary_store): negative index message has changed.
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
+	  redirect stderr to null device.
 
-	* string.c (rb_str_aset): reallocation needed.
+Thu Jun  2 00:45:26 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* string.c (rb_str_aset): allow char append to the string.
+	* ext/tk/extconf.rb: fix for uninitialized global variables.
+	  [Ruby 1.9 - Bug #4811]
 
-Thu Feb 25 23:30:17 1999  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+Wed Jun  1 21:57:08 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* time.c (time_load): tm_year should be packed in 17 bits, not 18.
+	* thread_pthread.c (native_sleep): fix 1000times calculation error.
+	  this is a regression since r31457. [Bug #4808] [ruby-dev:43606]
 
-Thu Feb 25 12:50:25 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Jun  1 17:19:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* missing/dup2.c: replaced by public domain version.
+	* thread_pthread.c: remove unused macro.
 
-	* time.c (make_time_t): add `future check' in loops.
+Wed Jun  1 15:42:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (rb_num2dbl): forbid implicit conversion from nil, or
-	  strings.  thus `Time.now + str' should raise error.
+	* parse.y (peek_n): new macro to see next nth char.
 
-	* object.c (rb_Float): convert nil into 0.0.
+Wed Jun  1 15:40:46 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (rb_Integer): conversion method improved.
+	* tool/rbinstall.rb (gem): fix for rubygems change.
 
-Thu Feb 25 03:27:50 1999  Shugo Maeda  <shugo@netlab.co.jp>
+Wed Jun  1 14:07:57 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* eval.c (rb_call): should handle T_ICLASS properly.
+	* lib/minitest/*: Imported minitest 2.2.2 (r6281)
+	* test/minitest/*: ditto
 
-Thu Feb 25 00:04:00 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Jun  1 12:35:50 2011  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* error.c (Init_Exception): global function Exception() removed.
+	* lib/rubygems*: Import rubygems 1.8.5 (released @ 137c80f)
+	* test/rubygems: Ditto
 
-	* variable.c (rb_class2name): returns "nil"/"true"/"false" for them.
+Wed Jun  1 12:34:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* time.c (time_dump): time marshaling format compressed size from
-	  11 bytes to 8 bytes.  thanx to tadf@kt.rim.or.jp.
+	* NEWS: add new features of bigdecimal.
 
-	* eval.c (rb_obj_call_init): should specify arguments explicitly.
+Wed Jun  1 09:41:14 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Feb 24 15:43:28 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/cgi/util.rb:  Improve documentation.  Patch by Kuba Fietkiewicz.
+	  [Ruby 1.9 - Bug #4775]
+	* lib/cgi/core.rb:  ditto
 
-	* parse.y (yylex): comment concatenation requires preceding space
-	  before backslash at the end of line.
+Wed Jun  1 09:26:05 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* io.c (rb_f_pipe): global pipe is obsolete now.
+	* lib/mathn.rb:  Improve documentation and attach it to Numeric.
+	  Modified from patch by Anil V.  [Ruby 1.9 - Bug #4762]
 
-	* object.c (Init_Object): remove true.to_i, false.to_i.
+Wed Jun  1 09:21:30 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Feb 23 14:21:41 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/prime.rb:  Indent examples enough to appear as code sections.
+	  Note that Prime is Enumerable.  [#4762]
 
-	* parse.y (yylex): warn if identifier! immediately followed by `='.
+Wed Jun  1 07:34:57 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Feb 23 12:32:41 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* hash.c (key_i):  Change rdoc from "the first occurrence" to "an
+	  occurrence" since first occurrence is not a specification of
+	  Hash#key.  [Ruby 1.9 - Bug #4760]
 
-	* eval.c (rb_load): tilde expandion moved to find_file.
+Wed Jun  1 07:26:19 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (find_file): tilde expandion added.
+	* ext/pty/pty.c (pty_check):  Restore "not reached" comment.
+	  [Ruby 1.9 - Bug #4756]
 
-Tue Feb 23 10:50:20 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Jun  1 07:21:40 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (require_method): require can handle multiple fnames.
+	* ext/zlib/zlib.c:  Fix document-method declarations for set_sync and
+	  set_comment.  [Ruby 1.9 - Bug #4695]
 
-	* hash.c (rb_hash_foreach_iter): hash key may be nil.
+Wed Jun  1 06:43:13 2011  Masaya Tarui  <tarui@ruby-lang.org>
 
-Mon Feb 22 17:44:02 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* load.c (loaded_feature_path): cut nonsense loop execution to fix
+	  performance bug.
 
-	* regex.c (re_match): should not pop failure point on success for
-	  non-greedy matches.
+Wed Jun  1 01:16:02 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (Init_IO): remove global_functions getc, readchar, ungetc,
-	  seek, tell, rewind.
+	* class.c (rb_mix_module): implement Module#mix.
 
-Sat Feb 20 22:54:26 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Jun  1 01:15:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (rb_num2long): no implicit conversion from boolean.
+	* io.c (io_encoding_set): should honor already set ecflags since it
+	  might be set by mode option.  fixed #4804
 
-Sat Feb 20 09:58:42 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+Wed Jun  1 00:34:04 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* numeric.c (flo_to_s): portable Infinity and NaN support.
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): remove unused
+	  variable.
 
-Sat Feb 20 07:13:31 1999  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+Wed Jun  1 00:32:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* io.c (rb_file_sysopen): forgot to initialize a local variable.
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): support instantiation from
+	  a Float through Rational.
 
-Fri Feb 19 23:05:07 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_new): ditto.
 
-	* string.c (rb_str_subseq): range check changed.
+	* test/bigdecimal/test_bigdecimal.rb (test_global_new_float): add a test for
+	  the above changes.
 
-	* marshal.c: increment MARSHAL_MINOR for Time format change.
+	* test/bigdecimal/test_bigdecimal.rb (test_new_with_float): ditto.
 
-	* time.c (time_old_load): support old marshal format.
+Wed Jun  1 00:07:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* time.c (time_load): changed for new format Y/M/D/h/m/s/usec.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_coerce): support coerce with a
+	  Rational.  The precision used for instantiate a BigDecimal from the
+	  given Rational is obtained from the receiver BigDecimal.
 
-	* time.c (time_dump): marshal dump format has changed.
+	* test/bigdecimal/test_bigdecimal.rb (test_coerce): add a test for the
+	  above change.
 
-Fri Feb 19 00:25:57 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue May 31 23:49:08 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* time.c (time_arg): should reject "sep\0" and such.
+	* ext/date/date_core.c (offset_to_sec): fixed invalid validation.
 
-	* time.c (time_plus): Time#+ should not receive Time object
-	  operand.
+Tue May 31 23:43:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* string.c (rb_str_substr): nagative length raises exception now.
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): replace the algorithm for
+	  coercing from a Rational to stop requiring "bigdecimal/util.rb".
+	  [ruby-core:34318]
 
-	* array.c (beg_len): if end == -1, it points end of the array.
+	* ext/bigdecimal/bigdecimal.c (GetVpValue): refactoring.
 
-	* array.c (rb_ary_subseq): nagative length raises exception now.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation from a
+	  Rational.
 
-Thu Feb 18 20:57:04 1999  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* test/bigdecimal/test_bigdecimal.rb (test_global_new_with_rational): add a
+	  test for the above change.
 
-	* time.c (rb_strftime): strftime() may return 0 on success too.
+	* test/bigdecimal/test_bigdecimal.rb (test_new_with_rational): ditto.
 
-	* time.c (time_strftime): `\0' within format string shoule not be
-	  ommited in the result.
+Tue May 31 22:44:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-	* time.c (rb_strftime): zero length format.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_new): support instantiation a
+	  BigDecimal object from an Integer.
 
-	* time.c (time_to_a): yday start with 1 now.
+	* test/bigdecimal/test_bigdecimal.rb (test_new_with_integer):
+	  add for testing the above change.
 
-	* time.c (time_zone): support for long timezone name.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_global_new): replace its body
+	  with a BigDecimal_new call.
 
-	* time.c (time_yday): yday start with 1 now.
+	* test/bigdecimal/test_bigdecimal.rb (test_global_new_with_integer):
+	  add for testing the above change.
 
-	* time.c (time_minus): minus calculation was wrong.
+Tue May 31 22:24:39 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* time.c (time_minus): sec, usec should be at least `long', maybe
-	  they should be `time_t'.
+	* ext/date/date_core.c: use simple/complex mode instead of light/right mode.
+	* test/date/*.rb: followed the above changes.
 
-	* time.c (time_plus): addition with float was wrong.
+Tue May 31 21:28:33 2011  Tanaka Akira  <akr@fsij.org>
 
-	* time.c (time_to_s): support for long timezone name.
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring):
+	  initialize SIGINT handler.
 
-	* time.c (time_gm_or_local): too far future check moved.
+Tue May 31 17:03:24 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* time.c (time_arg): treat 2 digit year as 69-99 => 1969-1999,
-	  00-68 => 2000-2068
+	* lib/net/http.rb, lib/net/protocol.rb: Allow to configure to wait
+	  server returning '100 continue' response before sending HTTP request
+	  body. See NEWS for more detail. See #3622.
+	  Original patch is made by Eric Hodel <drbrain@segment7.net>.
 
-Thu Feb 18 03:56:47 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/net/http/test_http.rb: test it.
 
-	* missing/fnmatch.c: moved to missing directory.
+	* NEWS: Add new feature.
 
-Wed Feb 17 16:22:26 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue May 31 14:17:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* struct.c (rb_struct_alloc): actual initialization now be done in
-	  `initialize'.
+	* io.c (rb_io_s_pipe): potential bug. the mode of read IO is set as
+	  DEFAULT_TEXTMODE in call of io_set_encoding(), and of write IO is
+	  also set as it in call of io_new_instance() via rb_protect().
+	  so, if DEFAULT_TEXTMODE is not 0, we should check the result of
+	  extract_binmode() and avoid crush of default IO mode and the result.
 
-Wed Feb 17 09:47:15 1999  okabe katsuyuki  <hgc02147@nifty.ne.jp>
+Tue May 31 13:00:17 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* regex.c (re_search): use mbclen() instead of ismbchar().
+	* strftime.c (rb_strftime_with_timespec): improved style consistency.
+	  constified some variables.
 
-	* re.c (rb_reg_s_quote): should handle mbchars properly.
+	* test/test_time.rb (TestTime#test_huge_precision): test for #4456.
 
-Wed Feb 17 01:25:26 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue May 31 12:53:10 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* parse.y (yylex): stop comment concatenation by backslash follows
-	  after >= 0x80 char.  may cause problem with Latin chars.
+	* test/io/wait/test_io_wait.rb (TestIOWait#{test_nread,test_ready?,
+	  test_wait}: give system some time to process the written data.
 
-	* eval.c (error_print): exception in rb_obj_as_string() caused
-	  SEGV. protect it by PUSH_TAG/POP_TAG.
+Tue May 31 12:40:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* error.c (exc_exception): `Exception#exception' should return self.
+	* test/ruby/test_io.rb (TestIO#test_open_mode): MUST release resources
+	  explicitly. fix problem of r31671
 
-Wed Feb 17 01:12:22 1999  Hirotaka Ichikawa  <hirotaka.ichikawa@tosmec.toshiba.co.jp>
+Tue May 31 10:49:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* configure.in: BeOS patch.
+	* vm_exec.c: remove conditions for clang
+	  because clang version 3.0 (trunk 132165) doesn't need them.
 
-Tue Feb 16 14:25:00 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon May 30 22:19:33 2011  Tanaka Akira  <akr@fsij.org>
 
-	* regex.c (re_compile_pattern): should reallocate mbc space for
-	  character class unless current_mbctype is ASCII.
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring): don't
+	  close stderr.
 
-Mon Feb 15 15:48:30 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Mon May 30 20:22:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* configure.in: specify `-Wl,-E' only for GNU ld.
+	* test/ruby/test_signal.rb (TestSignal#test_signal_requiring): small
+	  but critical typo of r31642.  sorry...
+	  [Bug #4798] [ruby-core:36550]
 
-Mon Feb 15 11:43:22 1999  GOTO Kentaro  <gotoken@math.sci.hokudai.ac.jp>
+Mon May 30 15:44:16 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* array.c (rb_inspecting_p): should return Qfalse.
+	* insns.def (opt_mult): as r31805, volatile it.
+	  Without this, clang -O fails calculation.
 
-Sun Feb 14 22:36:40 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+	* numeric.c (fix_mul): ditto.
 
-	* sprintf.c (rb_f_sprintf): `%G' was ommited.
+	* rational.c (f_imul): ditto.
 
-Sun Feb 14 12:47:48 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+Mon May 30 10:26:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* numeric.c (Init_Numeric): allow divide by zero on FreeBSD.
+	* numeric.c (int_pow): make sure to assign the result of x * z.
+	  If xz is optimized out, the value won't overflow.
 
-	* numeric.c (Init_Numeric): FloatDomainError added.
+Sun May 29 23:17:29 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* configure.in (AC_REPLACE_FUNCS): add checks for functions
-	  insinf, isnan, and finite.
+	* re.c (rb_reg_match): fix rdoc of Regexp#=~.
+	  patched by Tsuyoshi Sawada. [Bug #4781]
 
-Sat Feb 13 01:24:16 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 29 23:10:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (rb_thread_create_0): should protect th->thread.
+	* lib/webrick/https.rb (WEBrick::HTTPRequest#parse_uri):
+	  keep parse_uri as private. patched by okkez. [Bug #4773]
 
-Fri Feb 12 16:16:47 1999  Yasuhiro Fukuma  <yasuf@big.or.jp>
+Sun May 29 17:53:03 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* string.c (rb_str_inspect): wrong mbc position.
+	* numeric.c: add #include "internal.h" for rb_big_uminus() prototype.
 
-Fri Feb 12 16:21:17 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 29 15:09:05 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_fd_close): 
+	* numeric.c (flo_round): fix for negative value.
 
-	* io.c (rb_io_fptr_close): tell scheduler that fd is closed.
+Sun May 29 02:16:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* io.c (rb_io_reopen): ditto.
+	* test/net/http/utils.rb (TestNetHTTPUtils#teardown): add nil check.
 
-	* io.c (READ_CHECK): check if closed after thread context switch.
+Sun May 29 00:22:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/socket/socket.c (bsock_close_read): do not check
-	  the return value from shutdown(2).
+	* process.c (before_exec, after_exec): change from macro to function.
 
-	* ext/socket/socket.c (bsock_close_write): ditto.
+Sat May 28 19:30:17 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/socket/socket.c (sock_new): need to dup(fd) for close_read
-	  and close_write.
+	* process.c (before_exec, after_exec): change SIGPIPE handler to SIG_DFL
+	  before calling execve(). Because r31760 reintroduced an issue that
+	  system() may hang up (i.e. [ruby-dev:12261]).
+	* process.c (save_sigpipe, restore_sigpipe): new.
 
-	* parse.y (here_document): handle newlines within #{}.
+Sat May 28 16:08:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* regex.h: should replace symbols for ruby.
+	* signal.c (Init_signal, default_handler): change default SIGPIPE handler
+	  from empty function to SIG_IGN. [ruby-dev:43215]
+	* signal.c (sigpipe): removed.
 
-Fri Feb 12 00:46:28 1999  Shugo Maeda  <shugo@netlab.co.jp>
+Sat May 28 03:04:27 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* marshal.c (r_object): should update the method name in message.
+	* io.c (fill_cbuf): return MORE_CHAR_SUSPENDED when cbuf is not empty.
 
-	* marshal.c (w_object): limit should be converted into Fixnum.
+Sat May 28 02:22:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Feb 10 15:20:03 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* string.c (rb_str_bytesize): rb_str_bytesize() should use LONG2NUM().
+	  Patch by Nikolai Weibull. [Bug #4789] [ruby-core:36511]
 
-	* regex.c (re_match): empty pattern should not cause infinite
-	  pattern match loop.
+Sat May 28 02:06:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* regex.c (re_compile_pattern): RE_OPTIMIZE_ANCHOR for /.*/, not
-	  for /(.|\n)/.
+	* io.c (fill_cbuf): Fix test-all crash.
 
-	* numeric.c (fix_pow): `fixnum**nil' should raise TypeError.
+Sat May 28 00:58:40 2011  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* bignum.c (rb_big_pow): need to normalize results.
+	* lib/ostruct.rb (method_missing): Handle [] and []= correctly.
+	  Based on a patch by Caius Durling, bug #4179 [ruby-core:33792]
 
-Wed Feb 10 01:42:41 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+Fri May 27 23:56:54 2011  Kouhei Sutou  <kou@cozmixng.org>
 
-	* numeric.c (fix_pow): `(5**1).type' should be Integer.
+	* test/rexml/test_core.rb (Tester::test_text_frozen): split frozen
+	  string test. refs #4783
 
-Tue Feb  9 01:22:49 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May 27 22:46:23 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (yylex): do not ignore newlines in mbchars.
+	* tool/rbinstall.rb (gem): install gemspec of json.  fixed #4784
 
-	* io.c (rb_file_s_open): mode can be specified by flags like
-	  open(2), e.g. File::open(path, File::CREAT|File::WRONLY).
+Fri May 27 22:45:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_f_open): bit-wise mode flags for pipes
+	* io.c (validate_enc_binmode): do not clear textmode flag if
+	  default.  fixed #4732
 
-	* io.c (Init_IO): bit flags for open.
+	* io.c (fill_cbuf): finish reading at EOF.
 
-Sat Feb  6 22:56:21 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May 27 11:31:51 2011  misfo <tedwardo2@gmail.com>
 
-	* string.c (rb_str_sub_bang): should not overwrite match data by
-	  regexp match within the block.
+	* lib/rexml/text.rb (REXML::Text#initialize): prevent an error
+	  when passing a frozen string to REXML::Text.new
 
-	* string.c (rb_str_gsub_bang): ditto.
+	  dup the string passed in instead of cloning so that it's frozen
+	  state is ignored
 
-Sat Feb  6 03:06:17 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May 27 08:47:26 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* re.c (match_getter): accessng $~ without matching caused SEGV.
+	* thread.c (ppoll): typo bug fix.
 
-Fri Feb  5 22:11:08 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+Fri May 27 08:35:04 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* parse.y (yylex): binary literal support, like 0b01001.
+	* ext/tk/lib/tk.rb: hang-up at exit before calling Tk.mainloop.
 
-	* parse.y (yylex): octal numbers can contain `_'s.
+	* ext/tk/lib/tk/extconf.rb: cannot make on MinGW [Ruby 1.9 - Bug #4141].
 
-	* parse.y (yylex): warns if non-octal number follows immediately
-	  after octal literal.
+Thu May 27 00:34:07 2011  James Edward Gray II  <jeg2@ruby-lang.org>
 
-	* parse.y (yylex): now need at least one digit after prefix such
-	  as 0x, or 0b.
+    * lib/csv.rb: Enhance each() to support Enumerator.
 
-	* bignum.c (rb_str2inum): recognize binary numbers like 0b0101.
+Thu May 26 10:32:11 2011  James Edward Gray II  <jeg2@ruby-lang.org>
 
-Fri Feb  5 03:26:56 1999  Yasuhiro Fukuma  <yasuf@big.or.jp>
+    * lib/csv.rb: Documentation improvements from Ysiad Ferreiras.
+      [Ruby 1.9 - Bug #4785]
 
-	* ruby.c (proc_options): -e without program prints error.
+Thu May 26 15:42:02 2011  Cezary Baginski <cezary.baginski@gmail.com>
 
-Fri Feb  5 00:01:50 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/xmlrpc/parser.rb (FaultException): fix to_s and inspect
 
-	* parse.y (terms): needed to clear heredoc_end.
+	* test/xmlrpc/parser.rb: test for the above
 
-	* numeric.c (flo_div): allow float division by zero.
+Wed May 25 11:54:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Feb  4 11:56:24 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/curses/curses.c:  Remove color constants block.
+	  [Ruby 1.9 - Bug #4748]
 
-	* missing/strtod.c: for compatibility.
+Wed May 25 09:56:45 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* configure.in (strtod): add strtod compatible check.
+	* ext/curses/curses.c:  Add missing documentation for button state, MIN
+	  and MAX comments.  Add Curses. to TABSIZE= and ESCDELAY= methods.
+	  [Ruby 1.9 - Bug #4747]
 
-	* numeric.c (rb_num2long): missing/vsnprintf.c does not supprt
-	  floating points.
+Wed May 25 09:35:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* numeric.c (flo_to_s): ditto.
+	* lib/benchmark.rb:  Restore nodoc for Benchmark::Job and
+	  Benchmark::Report.  [Ruby 1.9 - Bug #4726]
 
-Wed Feb  3 23:02:12 1999  Yoshida Masato  <yoshidam@yoshidam.net>
+Wed May 25 09:29:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* regex.c (re_compile_pattern): use ismbchar() to get next char.
+	* lib/net/pop.rb:  Hide implementation details from RDoc.
+	  [Ruby 1.9 - Bug #4711]
 
-	* regex.c (re_search): wrong mbchar shift.
+Wed May 25 09:26:29 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* re.c (rb_reg_search): needed to reset $KCODE after match.
+	* lib/net/ftp.rb:  Add :nodoc: for private methods.
+	  [Ruby 1.9 - Bug #4710]
 
-	* regex.c (re_compile_fastmap): mbchars should match with \w.
+Wed May 25 09:19:17 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Feb  3 22:35:12 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+	* ext/zlib/zlib.c:  Fix Document-method declarations.  Improve
+	  Zlib::GzipFile's method catalog.  [Ruby 1.9 - Bug #4695]
 
-	* parse.y (yylex): too big float raise warning, not error.
+Wed May 25 08:22:12 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Feb  2 23:41:42 1999  Yoshida Masato  <yoshidam@yoshidam.net>
+	* lib/erb.rb:  Hide documentation for implementation details of ERB.
+	  [Ruby 1.9 - Bug #4694]
 
-	* regex.c (re_match): wrong boundary.
+Wed May 25 07:58:14 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (IS_A_LETTER): re_mbctab[c] may not be 1 for mbc.
+	* lib/tempfile.rb (Tempfile.{mkdir,rmdir}): revert for backward
+	  compatibility.
 
-	* regex.c (re_search): mbchar support for shifting ranges.
+Wed May 25 07:13:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (MBC2WC): wrong conversion.
+	* spec/README: update the description.
 
-Wed Feb  3 15:03:16 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May 25 07:12:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (parse_regx): need to escape parens if terminators are
-	  not any kind of parenthesis.
+	* lib/tempfile.rb (Tempfile.{lock,unlock}_tempfile): refactor.
 
-	* parse.y (parse_qstring): ditto.
+Tue May 24 17:30:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (parse_string): ditto.
+	* spec/README: fix typo.
+	  patched by bowsersenior. https://github.com/ruby/ruby/pull/24
 
-Tue Feb  2 17:11:26 1999  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+Tue May 24 07:06:34 2011  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* string.c (rb_str_gsub_bang): too small realoc condition.
+	* ext/tk/lib/tk.rb: fail to start Tk.mainloop (exit immediately) on
+	  some environment (reported on [ruby-talk:381444]).
 
-Mon Feb  1 10:01:17 1999  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+	* ext/tk/lib/tk/canvas.rb: support creating a canvas item object from
+	  an item ID number.
 
-	* parse.y (yylex): range check for the float literal.
+	* ext/tk/lib/tk/image.rb: import documents which are pull-requested.
+	  [Ruby 1.9 - Feature #4595]
 
-Sat Jan 30 18:34:16 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/tk/lib/tk/extconf.rb: search directories for 64bit library (e.g.
+	  /usr/lib64), add some new configure options (see README.tcltklib),
+	  and bug fix.
 
-	* ruby.c (usage): -h option to show brief command description.
+	* ext/tk/lib/tk/README.tcltklib: modify docs for some new configure
+	  options.
 
-Sat Jan 30 08:45:16 1999  IKARASHI Akira  <ikarashi@itlb.te.noda.sut.ac.jp>
+Tue May 24 04:01:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/cgi-lib.rb: cookie support added.
+	* lib/yaml.rb: switch default YAML engine to Psych, old syck engine
+	  may be enabled via YAML::ENGINE.yamler = "syck". [ruby-core:36374]
 
-Sat Jan 30 13:38:24 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon May 23 09:45:26 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): mbchars should match with \w
-	  within character classs.  Was matching with \W.
+	* include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. Forgot to
+	  include this file in the commit r31692. __APPLE__ is not
+	  CASEFOLD_FILESYSTEM again, from this time.
 
-	* regex.c (re_match): \w should match with multi byte characters,
-	  not its first byte.
+Mon May 23 10:01:02 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Sat Jan 30 10:06:41 1999  Yoshida Masato  <yoshidam@yoshidam.net>
+	* ext/openssl/ossl_asn1.c: Do not parse zero-tagged values as EOC. Do
+	  not let current length become negative for infinite length constructed
+	  values. Support constructed values of length zero. Added tests.
 
-	* re.c (rb_reg_s_new): UTF-8 flag handle (/u, /U).
+Mon May 23 09:19:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* re.c (rb_kcode): $KCODE handle for UTF-8.
+	* lib/net/smtp.rb:  Document Net::SMTP::Response.  Patch by J.R. Garcia.
+	  [Ruby 1.9 - Bug #4768]
 
-Sat Jan 30 01:51:16 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon May 23 09:03:52 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* array.c (rb_ary_delete_if): RTEST() missing.
+	* lib/test/unit/parallel.rb: Never Ignore SIGINT. When received
+	Interrupt, immediately puts result and exit. [ruby-dev:43571]
 
-	* hash.c (delete_if_i): ditto.
+	* lib/test/unit.rb: When received Interrupt, wait results from workers
+	and collect them. [ruby-dev:43571]
 
-	* enum.c (Init_Enumerable): select (=find_all), detect (=find)
-	  added as aliases.
+Mon May 23 09:08:07 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Jan 29 21:32:19 1999  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+	* lib/mathn.rb:  Improve documentation.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4767]
 
-	* hash.c (rb_f_setenv): SEGV caused by small typo.
+Mon May 23 08:45:55 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Jan 29 00:15:58 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/ostruct.rb:  Improve documentation.  Patch by Franklin Webber.
+	  [Ruby 1.9 - Bug #4761]
 
-	* lib/parsedate.rb (parsedate): support date format like
-	  23-Feb-93, which is required by HTTP/1.1.
+Mon May 23 08:35:24 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* variable.c (find_class_path): avoid calling rb_iv_set().
+	* hash.c:  Improve documentation of Hash#key.  Patch by Utkarsh
+	  Kukreti.  [Ruby 1.9 - Bug #4760]
 
-	* eval.c (backtrace): do not need to modify $SAFE internally.
+Mon May 23 08:32:59 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* variable.c (classname): inline __classid__ access.
+	* enumerator.c:  Improve documentation.  Patch by Dave Copeland.
+	  [Ruby 1.9 - Bug #4757]
 
-	* eval.c (THREAD_ALLOC): needed to initialize wrapper.
+Mon May 23 07:19:45 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* lib/ftools.rb (makedirs): allows slash at the end of the path.
+	* NEWS (openssl): Infinite length support. Different behavior of
+	  Constructive and Primitive constructors.
 
-	* numeric.c (rb_fix_induced_from): ensure result to be Fixnum.
+Mon May 23 06:58:33 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Thu Jan 28 17:31:43 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/openssl/ossl_asn1.c: Forbid Constructives whose value is not an
+	  Array to prevent segfault. Added test.
 
-	* numeric.c (flo_to_s): float format changed to "%16.10g".
+Mon May 23 06:33:17 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Thu Jan 28 02:13:11 1999  Yoshinori Toki  <toki@freedom.ne.jp>
+	* ext/openssl/ossl_asn1.c: Forbid Constructive without infinite
+	  length. This also prevents a segfault. Added test and improved
+	  documentation.
 
-	* array.c (rb_ary_store): expand allocated buffer by 3/2.
+Mon May 23 05:58:14 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Wed Jan 27 17:50:02 1999  Kazuhiro HIWADA  <hiwada@kuee.kyoto-u.ac.jp>
+	* ext/openssl/ossl_asn1.c: Fix decoding of infinite length values.
+	  Simplified ossl_asn1_decode0 by splitting it into three separate
+	  functions. Add tests.
+	  [Ruby 1.9 - Bug #4374][ruby-core:35123]
 
-	* bignum.c (dbl2big): raised error if double is too big to cast
-	  into long.  check added.
+Mon May 23 04:03:46 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Wed Jan 27 03:16:18 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/openssl/ossl_asn1.c (ossl_asn1_initialize): Allow creation of
+	  Constructives with an explicit tag_class parameter without
+	  automatically setting tagging to :EXPLICIT. Fixes a bug when encoding
+	  infinite length primitive values.
 
-	* variable.c (rb_mod_const_at): can't list constants of the
-	  untainted objects in safe mode.
+Mon May 23 04:03:46 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* class.c (method_list): can't list methods of untainted objects
-	  in safe mode.
+	* ext/openssl/ossl_asn1.c (ossl_asn1_cons_to_der): Add an additional
+	  EOC for infinite length Constructives that are supposed to be encoded
+	  with explicit tagging. Also tabify method correctly.
 
-Tue Jan 26 02:40:41 1999  GOTO Kentaro  <gotoken@math.sci.hokudai.ac.jp>
+Mon May 23 03:44:39 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* prec.c: Precision support for numbers.
+	* ext/openssl/ossl_asn1.c (ossl_asn1data_to_der): Remove redundant
+	  flag tmp_cons.
 
-Thu Jan 21 19:08:14 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon May 23 00:35:00 2001  Kenta Murata  <mrkn@mrkn.jp>
 
-	* eval.c (rb_f_raise): calls `exception' method, not `new'.
+	* bignum.c (dump_bignum, bigmul1_balance, big_split, biglsh_bang),
+	  (bigrsh_bang, big_split3, bigmul1_toom3, bigmul0): implement Toom3 (Toom-Cook)
+	  multiplication.
 
-	* error.c (exc_exception): renamed from `new'.
+	* include/ruby/defines.h: add format prefixes for BDIGIT and BDIGIT_DBL.
 
-Wed Jan 20 03:39:48 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 22 23:24:02 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* parse.y (yycompile): rb_in_compile renamed to ruby_in_compile.
+	* ext/openssl/ossl_asn1.c: Instead of rb_intern use static symbols to
+	  improve performance.
 
-	* ruby.c (load_file): define DATA iff __END__ appeared in script.
+Sun May 22 21:56:51 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Tue Jan 19 14:57:51 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/openssl/ossl_asn1.c: Use OpenSSL constants V_ASN1_xxx instead of
+	  hardcoded numbers for initializing class_tag_map.
 
-	* parse.y (here_document): need to protect lex_lastline.
+Sun May 22 21:29:29 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-	* parse.y (yylex): disable %//, %'', %``.
+	* include/ruby/defines.h (CASEFOLD_FILESYSTEM): Revert r30508. See #4255.
+	  Now __APPLE__ is not CASEFOLD_FILESYSTEM again.
 
-Tue Jan 19 05:01:16 1999  Koji Arai  <JCA02266@nifty.ne.jp>
+	* load.c (loaded_feature_path, rb_feature_p, load_lock): Revert r30508.
+	  See #4255. Make $LOADED_FEATURES scanning case-sensitive again.
 
-	* array.c (beg_len): round range value too much.
+Sun May 22 18:59:27 2011  Hiroshi Nakamura  <nahi@ruby-lang.org>
 
-Mon Jan 18 13:02:27 1999  Kuroda Jun  <jkuro@dwe.co.j>
+	* ext/openssl/ossl_asn1.c(ossl_asn1_default_tag): avoid using RCLASS_SUPER
+	  to make it compilable. Plus, tabify and change variable definition style.
 
-	* hash.c (env_keys): strchr() may return NULL.
+Sun May 22 18:26:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jan 18 17:51:47 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* gc.c (vm_xcalloc): use calloc provided by platforms.
+	  fixes #4754
 
-	* instruby.rb (wdir): install libruby.a in archdir.
+Sun May 22 11:44:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* lib/ftools.rb (install): removes file before installing.
+	* ext/pty/pty.c:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4756]
 
-Mon Jan 18 16:55:31 1999  MAEDA shugo  <shugo@aianet.ne.jp>
+Sun May 22 11:26:39 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_callcc): experimental continuation support.
+	* lib/timeout.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4755]
 
-Sun Jan 17 19:45:37 1999  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Sun May 22 11:21:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* pack.c (pack_pack): nil packing caused SEGV.
+	* lib/ipaddr.rb:  Improve documentation.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4753]
 
-Sat Jan 16 13:18:03 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 22 11:14:40 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* string.c (rb_str_concat): character (fixnum) can be append to
-	  strings
+	* lib/forwardable.rb:  Document def_delegator.  Patch by Sandor Szucs.
+	  [Ruby 1.9 - Bug #4752]
 
-	* array.c (rb_ary_unshift): unshift returns array.
+Sun May 22 11:11:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Jan 16 01:39:19 1999  Yoshida Masato  <yoshidam@tau.bekkoame.ne.jp>
+	* lib/fileutils.rb:  Document block behavior of FileUtils.cd.  Patch by
+	  Bil Kleb.  [Ruby 1.9 - Bug #4751]
 
-	* string.c (rb_str_split_method): UTF-8 support.
+Sun May 22 11:07:47 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* regex.c: UTF-8 support.
+	* ext/curses/curses.c:  Complete documentation.  Patch by Vincent
+	  Batts.  [Ruby 1.9 - Bug #4748]
 
-Thu Jan 14 00:42:55 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 22 09:29:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (rb_str_gsub_bang): forget to add offset for null match.
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  use spawn. it prevent that other tests inherit renamed $0.
 
-	* eval.c (rb_thread_local_aset): can't modify in tainted mode.
+Sun May 22 08:57:13 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* hash.c (env_each_key): avoid generating temporary array.
+	* ext/openssl/ossl_asn1.c: Default tag lookup in constant time via hash
+	  instead of previous linear algorithm.
+	  [Ruby 1.9 - Feature #4309][ruby-core:34813]
 
-Wed Jan 13 23:58:50 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 22 07:54:16 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* hash.c (rb_f_setenv): name and value can be tainted.
+	* ext/openssl/ossl_digest.c: Explain DSS and DSS1 in documentation.
 
-Wed Jan  6 02:42:08 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 22 07:10:25 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* bignum.c (Init_Bignum): forgot to define Bignum#===.
+	* test/openssl/test_pkey_dsa.rb: Add tests for sign/verify.
 
-	* gc.c (gc_sweep): if add_heap() is called during GC, objects on
-	  allocated heap page(s) are not marked, should not be recycled.
+Sun May 22 06:07:17 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* gc.c (gc_sweep): should refer latest freelist.
+	* test/openssl/test_x509cert.rb: Merge DSA-related tests from ruby_1_8
+	  branch.
 
-	* gc.c (id2ref): modified to support performance patch.
+Sun May 22 04:11:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* object.c (rb_obj_id): performance patch (no bignum for id).
+	* thread.c (Init_Thread): add a code comment why the meaningless
+	  line is necessary.
 
-Tue Jan  5 01:56:18 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 22 01:35:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* config.guess: merge up-to-date from autoconf 2.12.
+	* ext/date/date_core.c: modified documentation.
 
-	* array.c (rb_ary_join): avoid calling rb_protect_inspect() till
-	  it is really needed.
+Sat May 21 22:46:26 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* object.c (rb_obj_inspect): show detailed information for the
-	  instance variables (infinite loop can avoid now).
+	* ext/date/date_strftime(date_strftime_with_tmx): "%v" means "%e-%b-%Y".
 
-	* struct.c (rb_struct_inspect): avoid infinite loop.
+Sat May 21 22:14:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jan  3 01:37:58 1999  Takao KAWAMURA  <kawamura@ike.tottori-u.ac.jp>
+	* io.c (rb_io_extract_modeenc): accept combination hash and
+	  File::Constants. (eg. File.open('yo', :mode => File::WRONLY))
+	  [Feature #4742][ruby-core:36338]
+	* test/ruby/test_io.rb (TestIO#test_open_mode): new test.
 
-	* misc/ruby-mode.el (ruby-end-of-defun): moved too much.
+Sat May 21 21:44:14 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* misc/ruby-mode.el (ruby-mode-variables): set paragraph-separator
-	  for the mode.
+	* test/date/test_switch_hitter.rb: new.
 
-	* misc/ruby-mode.el: proper font-lock for `def' and `nil' etc.
+Sat May 21 21:18:29 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sat Jan  2 17:09:06 1999  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_{core,parse}.c: moved nearly all core code from ext/date/lib.
+	* ext/date/lib/{date,date/format}.rb: removed nearly all code.
 
-	* eval.c (rb_jump_tag): new api to invoke JUMP_TAG.  tag values
-	  can obtained from rb_eval_string_protect()/rb_load_protect().
+Sat May 21 02:58:46 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_rescue): now catches all exceptions but SystemExit.
+	* ext/.document:  Add curses to documented extensions.
+	* ext/curses/curses.c:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4747]
 
-	* eval.c (rb_eval_string_protect): eval string with protection.
+Sat May 21 02:51:01 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_load_protect): load file with protection.
+	* ext/bigdecimal/lib/bigdecimal/util.rb:  Improve documentation.  Patch
+	  by Pete Higgins.  [Ruby 1.9 - Bug #4746]
 
-	* io.c (rb_io_puts): avoid infinite loop for cyclic arrays.
+Sat May 21 02:44:10 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_thread_local_aref): thread local hash tables.
+	* ext/bigdecimal/lib/bigdecimal/jacobian.rb:  Document isEqual.  Patch
+	  by Kuba Fietkiewicz.  [Ruby 1.9 - Bug #4744]
 
-	* object.c (rb_equal): check exact equal before calling `=='.
+Sat May 21 02:22:34 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Dec 31 22:28:53 1998  MAEDA shugo  <shugo@aianet.ne.jp>
+	* ext/date/lib/date/format.rb:  Document date formats.  Patch by
+	  Clinton Nixon.  [Ruby 1.9 - Bug #4743]
 
-	* eval.c (rb_f_require): feature names should be provided with
-	  DLEXT extension.
+Fri May 20 05:15:19 2011  Nobuhiro Iwamatsu  <iwamatsu@nigauri.org>
 
-	* marshal.c (Init_marshal): need to provide `marshal.so'.
+	* gc.c: Fix build on m68k by 'error: too few arguments to
+	  function 'mark_locations_array''.
 
-Wed Dec 30 02:29:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May 20 04:23:42 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* variable.c (classname): do not call rb_ivar_set().
+	* lib/scanf.rb:  Improve documentation.  Patch by Gabe McArthur.
+	  [Ruby 1.9 - Bug #4735]
 
-	* eval.c (ruby_run): finalizers were called too early.
+Fri May 20 00:58:01 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Dec 25 12:19:30 1998  Fukuda Masaki  <fukuda@wni.co.jp>
+	* enc/trans/ibm737-tbl.rb: greek code page.  fixes #4738
 
-	* gc.c (rb_gc_mark): should not return on FL_EXIVAR.
+Thu May 19 14:44:05 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Dec 25 11:56:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_signal.rb (test_signal_requiring): skip on Windows.
+	  we can send SIGINT only to pid 0 and the process itself.
 
-	* gc.c (gc_mark): proper scanning for temporary region.
+Thu May 19 09:07:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (TMP_ALLOC): protection for C_ALLOCA was broken.
+	* lib: revert r31635-r31638 and untabify with expand(1).
 
-Thu Dec 24 18:26:04 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May 19 07:47:26 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* development version 1.3 released.
+	* test/openssl/test_pkey_rsa.rb: Add tests for sign/verify.
 
-Thu Dec 24 00:17:00 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May 19 07:19:16 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* eval.c (rb_load): top self should be set properly.
+	* ext/openssl/ossl_pkey.c: Add documentation.
 
-	* variable.c (classname): check __classpath__ iff it is defined.
+Thu May 19 07:06:56 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* variable.c (classname): invalid warning at -v with static linked
-	  ruby interpreter.
+	* lib/benchmark.rb:  Fix indentation.
+	* lib/net/imap.rb:  Fix indentation of regular expressions.
 
-	* eval.c (is_defined): modified for expr::Const support.
+Thu May 19 06:36:11 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_eval): invoke method expr::Const if expr is not class
-	  nor module.
+	* lib/net/imap.rb:  Fix indentation of EOF for heredoc.
+	* lib/debug.rb (Commands):  Fix indentation of EOHELP for heredoc.
 
-	* parse.y (primary): enable expr::identifier as method
-	  invocation.
+Thu May 19 06:30:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Dec 23 03:04:36 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb:  Fix indentation of EOM for heredoc.
 
-	* regex.c (re_match): avoid too many loop pops for (?:..).
+Thu May 19 06:16:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Dec 22 18:01:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib:  Convert tabs to spaces for ruby files per
+	  http://redmine.ruby-lang.org/projects/ruby/wiki/DeveloperHowto#coding-style
+	  Patch by Steve Klabnik [Ruby 1.9 - Bug #4730]
+	  Patch by Jason Dew [Ruby 1.9 - Feature #4718]
 
-	* experimental version 1.1d1 released.
+Thu May 19 06:06:07 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Dec 21 01:33:03 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/cgi/util.rb:  Improve documentation.  Patch by Clinton Nixon.
+	  [Ruby 1.9 - Bug #4733]
+	* lib/cgi/core.rb:  ditto
+	* lib/cgi/cookie.rb:  ditto
 
-	* eval.c (TMP_PROTECT): add volatile to ensure GC protection.
+Thu May 19 06:02:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* string.c (rb_str_gsub_bang): calculate buffer size properly.
+	* lib/tempfile.rb:  Document Dir.mkdir and Dir.rmdir.  Patch by Clinton
+	  Nixon.  [Ruby 1.9 - Bug #4728]
 
-	* parse.y (lex_get_str): needed to return Qnil at EOS.
+Thu May 19 05:57:52 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (find_file): check policy modified, raise exception
-	  immediately for tainted load_path.
+	* encoding.c:  Improve documentation for Encoding#default_external and
+	  Encoding#default_internal.
 
-	* hash.c (rb_f_setenv): do not depend on setenv() nor putenv().
+Wed May 18 22:45:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec 17 06:29:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/io/console/lib/console/size.rb (IO#console_size): new
+	  method.  (EXPERIMENTAL)
 
-	* ext/tk/tkutil.c (tk_s_new): use rb_obj_instance_eval(), instead
-	  of rb_yield_0().
+Wed May 18 22:41:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_f_require): forgot to call find_file in some cases.
+	* internal.h: add for internal use only.
 
-	* eval.c (rb_f_require): `require "feature.so"' to load dynamic
-	  libraries.  old `require "feature.o"' is still OK.
+Wed May 18 22:36:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_eval): yield without value dumped core.
+	* eval.c (setup_exception): internal exception should be hidden
 
-Wed Dec 16 16:28:31 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May 18 20:25:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* experimental version 1.1d0 (pre1.2) released.
+	* lib/timeout.rb (Timeout#timeout): don't leak "execution expired"
+	  exception. [Bug #4283] [ruby-core:34534].
 
-Wed Dec 16 10:43:34 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May 18 06:09:24 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* regex.c (re_search): bound check before calling re_match().
+	* lib/cmath.rb:  Add some examples and improve documentation.  Patch by
+	  Sandor Szucs.  [Ruby 1.9 - Bug #4727]
 
-Tue Dec 15 13:59:01 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May 18 05:40:31 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* error.c (exc_to_s): returns class name for unset mesg.
+	* lib/benchmark.rb:  Remove nodoc from Benchmark::Job and
+	  Benchmark::Report.  Patch by Sandor Szucs.  [Ruby 1.9 - Bug #4726]
 
-	* error.c (exc_initialize): do not initialize @mesg by "".
+Wed May 18 05:29:26 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* parse.y (nextc): __END__ should handle CR+LF newlines.
+	* lib/webrick/compat.rb:  Improve documentation.  Patch by Sandor
+	  Szucs.  [Ruby 1.9 - Bug #4725]
 
-Wed Dec  9 13:37:12 1998  MAEDA shugo  <shugo@aianet.ne.jp>
+Wed May 18 05:10:35 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* pack.c (encodes): use buffering for B-encoding.
+	* lib/tracer.rb:  Improve documentation.  Patch by Richard Ramsden.
+	  [Ruby 1.9 - Feature #4720]
 
-	* pack.c (pack_pack): Q-encoding by 'M'.
+Wed May 18 04:53:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Dec  8 14:10:00 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/cmath.rb:  Improve documentation.  Patch by Jason Dew.
+	  [Ruby 1.9 - Feature #4717]
 
-	* variable.c (generic_ivar_get): any object can have instance
-	  variables now.  great improvement.
+Wed May 18 04:50:24 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* variable.c (rb_name_class): do not set __classpath__ by default,
-	  use __classid__ instead.
+	* lib/net/ftp.rb:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4710]
 
-Mon Dec  7 22:08:22 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May 18 03:14:49 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ruby.h (struct RFile): IO objects can have instance variables now.
+	* test/test_singleton.rb:  Add tests from lib/singleton.rb.  Patch by
+	  Pete Higgins.  [Ruby 1.9 - Bug #4715]
 
-	* parse.y (primary): allows `def obj::foo; .. end'.
+Wed May 18 03:03:07 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Dec  7 18:24:50 1998  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+	* lib/singleton.rb:  Improve documentation.  Patch by Pete Higgins.
+	  [Ruby 1.9 - Bug #4709]
 
-	* ruby.c (set_arg0): $0 supprt for HP-UX.
+Tue May 17 21:24:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Dec  7 01:30:28 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* thread.c (rb_mutex_lock): remove remove_signal_thread_list() call.
+	  It's meaningless because lock_interrupt doesn't call
+	  add_signal_thread_list().
 
-	* dln.c (dln_strerror): better error messages on win32.
+Tue May 17 20:20:49 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat Dec  5 23:27:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_core.h (rb_thread_struct): add volatile to
+	  transition_for_lock because it is not protected by lock.
 
-	* parse.y (here_document): indentable here-doc delimiter by
-	  `<<-'.  Proposed by Clemens <c.hintze@gmx.net>.  Thanks.
+Tue May 17 20:08:53 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Dec  3 16:50:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* LEGAL (missing/{elf,tgamma,lgamma_r}.c): they've been replaced by
+	  public domain implementations.
 
-	* ext/extmk.rb.in (realclean): trouble on install.
+	* LEGAL (vsnprintf.c): it has moved to srcdir from missing/.
 
-Sun Nov 29 22:25:39 1998  Takaaki Tateishi  <ttate@jaist.ac.jp>
+	* LEGAL (missing/crypt.c): list its original license.
 
-	* process.c (f_exec): check number of argument.
+Tue May 17 19:54:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Nov 26 17:27:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* LEGAL (configure): add missing/setproctitle.c
 
-	* version 1.1c9 released.
+Tue May 17 19:35:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	Fix FreeBSD test failure.
 
-Wed Nov 25 13:07:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  use ps -o command instead of ps -o cmd. FreeBSD doesn't support
+	  -o cmd option.
 
-	* string.c (rb_str_dup): do not copy additional data (STR_NO_ORIG).
+Tue May 17 08:04:26 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* parse.y (yycompile): reduce known memory leak (hard to remove).
+	* ext/openssl/ossl_digest.c: Add documentation.
 
-Wed Nov 25 03:41:21 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue May 17 07:14:58 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* st.c (st_init_table_with_size): round size up to prime number.
+	* lib/net/http.rb:  Improve documentation of proxy configuration
+	  methods.  Patch by Alf Mikula.  [Ruby 1.9 - Bug #4714]
 
-Sat Nov 21 23:27:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue May 17 07:09:01 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* hash.c (rb_hash_aset): reduce copying key strings.
+	* lib/net/pop.rb:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4711]
+	* lib/net/telnet.rb:  ditto
 
-	* gc.c (looks_pointerp): declare as inline function if possible.
+Tue May 17 07:00:41 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* st.c (PTR_NOT_EQUAL): compare hash values first before calling
-	  comparing function.
+	* lib/net/http.rb:  Fix nodoc for Net::HTTP::version_1_1?.  Patch by
+	  Alf Mikula.  [Ruby 1.9 - Bug #4713]
 
-	* st.c (ADD_DIRECT): save hash value in entries to reduce hash
-	  calculation.
+Tue May 17 06:56:26 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* string.c (rb_str_gsub_bang): avoid rb_scan_args() to speed-up.
+	* lib/optparse.rb:  Add link to make_switch to improve documentation.
+	  Patch by David Copeland.  [Ruby 1.9 - Bug #4708]
 
-	* string.c (rb_str_sub_bang): ditto.
+Tue May 17 06:50:40 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Nov 21 18:44:06 1998  Masaki Fukushima  <fukusima@goto.info.waseda.ac.jp>
+	* lib/observer.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4707]
 
-	* time.c (time_s_now): had memory leak.
+Tue May 17 06:42:53 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* ext/md5/md5init.c (md5_new): had memory leak.
+	* lib/logger.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4706]
 
-	* ext/md5/md5init.c (md5_clone): ditto.
+Tue May 17 06:28:14 2011  Eric Hodel  <drbrain@segment7.net>
 
-Fri Nov 20 23:23:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/gserver.rb:  Improve documentation.  Patch by David Copeland.
+	  [Ruby 1.9 - Bug #4705]
 
-	* lib/delegate.rb: do not propagate hash and eql?.
+Tue May 17 06:21:15 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Nov 19 01:40:52 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/cgi.rb: Add toplevel documentation to class CGI
+	* lib/cgi/session.rb: Add overview documentation to CGI::Cookie
+	* lib/cgi/html.rb:  Don't add CGI::TagMaker documentation to CGI.
+	  Patch by David Copeland.  [Ruby 1.9 - Bug #4704]
+	* lib/cgi/core.rb:  Clean up CGI documentation.  Patch by David
+	  Copeland.  [Ruby 1.9 - Bug #4704]
+	* lib/cgi/cookie.rb:  Clean up CGI::Cookie documentation.  Patch by
+	  David Copeland.  [Ruby 1.9 - Bug #4704]
 
-	* sample/ruby-mode.el (ruby-expr-beg): failed to find reserved
-	  word boundary.
+Tue May 17 05:52:30 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_eval): avoid calling `concat' method.  calls
-	  rb_ary_concat() directly for efficiency.
+	* ext/digest: Improve documentation of Digest, Digest::HMAC and
+	  Digest::SHA2.  Patch by Pete Higgins.  [Ruby 1.9 - Bug #4702]
 
-	* eval.c (rb_eval): actual rest arguments extended arrays too much.
+Tue May 17 03:51:42 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Nov 18 14:30:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/abbrev.rb:  Hide copyright and revision information from RDoc.
+	  Inspired by patch from David Copeland, bug #4703.
 
-	* class.c (rb_define_global_function): global functions now be
-	  module function of the Kernel.
+Tue May 17 03:33:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-Wed Nov 18 10:48:09 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/timeout.rb (module Timeout):  Hide internal constants.  Patch by
+	  Pete Higgins.  [Ruby 1.9 - Bug #4701]
 
-	* io.c (read_all): SEGV on large files.
+Mon May 16 11:21:09 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Nov 17 18:11:20 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* configure.in, win32/Makefile.sub (RUBY_SO_NAME): add CPU as prefix
+	  of RUBY_SO_NAME on x64/ia64 mswin/mingw.
+	  [Feature #4602]
 
-	* version 1.1c8 released.
+Mon May 16 08:00:05 2011  Eric Hodel  <drbrain@segment7.net>
 
-Tue Nov 17 16:58:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/rdoc.rb:  Update to RDoc 3.6.1, allows OpenSSL::Digest to be
+	  found.
 
-	* parse.y (arg): assignment to attribute name start with capital
-	  should be allowed.
+Mon May 16 05:49:54 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (thread_alloc): needed to mark terminated threads too.
+	* lib/drb/acl.rb:  Add documentation.
 
-Tue Nov 17 12:33:48 1998  Motoyuki Kasahara  <m-kasahr@sra.co.jp>
+Mon May 16 05:13:20 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* ext/extmk.rb.in (create_makefile): Set `libdir' to `@libdir@',
-	  Set `pkglibdir' to `$libdir/$(RUBY_INSTALL_NAME)'.
+	* ext/openssl/ossl_asn1.c: Add documentation.
 
-Tue Nov 17 10:30:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon May 16 00:32:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* sprintf.c (f_sprintf): %l%%c -> %%l%c
+	* test/ruby/test_signal.rb (TestSignal#test_signal_process_group):
+	  skip if the platform doesn't have :pgroup capability. (i.e. skip
+	  if mswin32)
 
-Tue Nov 17 01:08:50 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 15 23:53:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* parse.y (ret_args): distinguish `a' and `*a' for the arguments
-	  of yield and return.
+	* include/ruby/intern.h: resurrect old rb_fd_copy().
+	* thread.c (rb_fd_copy): ditto.
 
-	* eval.c (rb_eval): flip3 should work like sed.
+Sun May 15 23:45:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_eval): flip{2,3} now have independent state for each
-	  scope to work fine with thread.
+	* include/ruby/intern.h: remove rb_fd_copy() to rb_fd_dup() and
+	  rb_w32_fdcopy() to rb_w32_fd_dup().
+	* win32/win32.c: ditto.
+	* thread.c: ditto.
 
-Mon Nov 16 23:26:29 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May 15 22:26:39 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* parse.y (primary): exec else clause if no exception raised.
+	* signal.c (rb_f_kill): accept '-SIGXXX' style signal with Symbol or
+	  implicit convertion with #to_str. [ruby-dev:43169] fixes #4362
+	* test/ruby/test_signal.rb (test_signal_process_group): add a test
+	  for send signal to process group.
 
-Sun Nov 15 15:44:07 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+Sun May 15 21:22:35 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* ext/extmk.rb.in (install): bug in target.
+	* cont.c (cont_init): clear macihne_stack_start/end of saved thread to
+	  prevent mark machine stack of GC'ed Thread. root Fiber is not
+	  initialized by fiber_init().
+	  based on a patch by Serge Balyuk [ruby-core:35891] fixes #4612
+	* test/ruby/test_fiber.rb (test_gc_root_fiber): add test for it.
 
-Sat Nov 14 11:02:05 1998  Motoyuki Kasahara  <m-kasahr@sra.co.jp>
+Sun May 15 21:04:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* Makefile.in (install): Give the argument `$(DESTDIR)' to
-	`instruby.rb'.
-	* instruby.rb: Recognize ARG[0] as `destdir'.
-	* instruby.rb: Give the argument `destdir' to `extmk.rb'.
-	* ext/extmk.rb.in: Recognize ARG[1] as `$destdir'.
+	* transcode.c (econv_init): revert r31353.  [ruby-dev:43512]
 
-	* instruby.rb: Create the installation directories (bindir, libdir,
-	archdir, pkglibdir, archdir, and mandir) under `destdir', and
-	install all files under there.
-	* ext/extmk.rb.in: Likewise.
-	
-Sat Nov 14 10:56:55 1998  Motoyuki Kasahara  <m-kasahr@sra.co.jp>
+Sun May 15 03:39:35 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* instruby.rb: Add the variable `pkglibdir'.
-	* instruby.rb: Set the variable `libdir' to `$(libdir)', not
-	`$(libdir)/$(ruby_install_name)'. `libruby.so' and `libruby.so.LIB'
-	are installed at `libdir'.
-	* instruby.rb: Set the variable `archdir' to `$(pkglibdir)/$(arch)'.
+	* ext/zlib/zlib.c:  Improve documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4695]
 
-Fri Nov 13 19:43:29 1998  KIMURA Koichi  <kbk@kt.rim.or.jp>
+Sun May 15 03:23:46 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* missing/nt.c (SafeFree): wrong free offset.
+	* lib/erb.rb:  Document ERB::Compiler.  Patch by Simon Chiang.
+	  [Ruby 1.9 - Bug #4694]
 
-Thu Nov 12 20:11:53 1998  Koji Arai  <JCA02266@nifty.ne.jp>
+Sun May 15 00:58:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	fix mswin32 build error.
 
-	* sample/ruby-mode.el: wrong highlight.
+	* missing/setproctitle.c: add #ifdef HAVE_UNISTD_H.
+	* win32/Makefile.sub (MISSING): add setproctitle.obj
 
-	* parse.y (parse_regx): newline in regexp was ignored.
+Sat May 14 22:45:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Nov 11 10:54:57 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* missing/setproctitle.c: add to include "ruby/util.h".
 
-	* parse.y (here_document): <<'FOO' should not escape anything.
+Sat May 14 19:52:22 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* parse.y (here_document): bare << here-doc available, even though
-	  it's deprecated.
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions#test_set_program_name):
+	  add for $0 test.
 
-	* file.c (rb_file_s_readlink): return value should be tainted.
+Sat May 14 19:50:46 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/etc/etc.c (setup_passwd): information (eg. GCOS name) should
-	  be tainted (modified at Perl Conference).
+	* missing/setproctitle.c (compat_init_setproctitle): use
+	  ruby_strdup() instead of strdup().
 
-Tue Nov 10 00:22:11 1998  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+Sat May 14 19:37:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* configure.in: elf supprt for FreeBSD 3.x
+	* include/ruby/missing.h: add setproctitle() declaration.
+	* missing/setproctitle.c: added.
+	* configure.in: add check for missing/setproctitle.c.
 
-Tue Nov 10 00:05:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ruby.c (ruby_process_options): add to call compat_init_setproctitle().
+	* ruby.c (set_arg0): remove all platform specific code. it's
+	  moved to missing/setproctitle.c.
+	* ruby.c (origarg): remove len field. It's no longer used.
+	* ruby.c (get_arglen): removed.
 
-	* parse.y (yylex): here document available in eval.
+	This patch makes a lot of cleanup set_arg0 related code and fixes
+	[Feature #4689].
 
-Mon Nov  9 17:55:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May 14 17:42:21 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* version 1.1c7 released.
+	* process.c (rb_proc_times): improve documentation.
+	  [ruby-core:35785] fixes #4581, reported by Andrew Grimm.
 
-Fri Nov  6 19:25:27 1998  Takao KAWAMURA  <kawamura@ike.tottori-u.ac.jp>
+Sat May 14 12:12:54 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* sample/ruby-mode.el: font-lock patch.
+	* test/openssl/test_pkey_dsa.rb: Add basic tests and tests that
+	  ensure new public key PEM encoding behavior and ensure backward
+	  compatibility.
+	  [Ruby 1.9 - Bug #4422] [ruby-core:35328]
+	* test/openssl/test_pkey_rsa.rb: Remove line with 'puts'.
 
-Thu Nov  5 15:42:22 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May 14 12:06:49 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* sample/README, lib/README: simple description for each file.
+	* lib/rdoc/context.rb (class RDoc):  Fix infinite loop caused by
+	  re-encountering BasicObject.
 
-Wed Nov  4 18:14:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May 14 10:32:36 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* eval.c (assign): attribute assignment should be called as public.
+	* test/openssl/test_pkey_rsa.rb: Add tests that ensure new public key
+	  encoding behavior and also ensure backward compatibility.
+	  [Ruby 1.9 - Bug #4421] [ruby-core:35327]
 
-Tue Nov  3 23:36:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May 14 09:50:10 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* string.c (rb_str_dump): dumps core for negative char value.
+	* lib/yaml/dbm.rb:  Add documentation.  Patch by Justin Collins.
+	  [Ruby 1.9 - Bug #4693]
+	* lib/yaml/store.rb:  ditto
 
-	* regex.c (re_compile_pattern): out of boundary access for empty
-	  regexp.
+Sat May 14 09:31:43 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Nov  2 22:54:01 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/rdoc.rb: Updated to RDoc 3.6
 
-	* string.c (rb_str_aset): `str[str]' replaces first match.
+Sat May 14 07:30:29 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Mon Nov  2 18:24:33 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/psych/lib/psych.rb: released a new gem, so increasing version.
 
-	* eval.c (thread_create): was accessing modified status.
+Sat May 14 05:08:32 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Sun Nov  1 01:18:52 1998  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+	* ext/openssl/ossl_digest.c
+	* ext/openssl/ossl_pkey.c
+	* ext/openssl/ossl_pkey.h
+	* test/openssl/pkey/test_pkey_rsa.rb
+	  Reverted premature commit. Sorry for the noise!
 
-	* gc.c (xrealloc): size 0 needs round up to 1.
+Sat May 14 05:02:58 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sat Oct 31 23:18:34 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/uri.rb:  Add toplevel documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4690]
 
-	* string.c (rb_str_split_method): negative LIMIT means number of
-	  splitted fields are unlimited, as in perl.
+Sat May 14 04:19:06 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* string.c (rb_str_split_method): if LIMIT is unspecified,
-	  trailing null fields are stripped.
+	* NEWS: Describe altered behaviour for RSA and DSA public key
+	  encoding. [Ruby 1.9 - Bug #4421, Bug #4422]
+	  [ruby-core:35327,35328]
 
-Sat Oct 31 04:16:14 1998  Inaba Hiroto   <inaba@st.rim.or.jp>
+Sat May 14 02:57:52 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* string.c (str_aref): regexp index SEGVed.
+	* lib/ipaddr.rb (unless Socket):  Document valid*? methods.  Patch by
+	  Sebastian Martinez.  [Ruby 1.9 - Feature #4687]
 
-Fri Oct 30 14:33:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May 14 02:54:04 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* re.c (reg_match): returns nil for unmatch.
+	* lib/rexml/functions.rb:  Add some documentation for REXML::Functions.
+	  Patch by Sebastian Martinez.  [Ruby 1.9 - Feature #4688]
 
-	* dir.c (dir_entries): new method.
+Sat May 14 02:51:42 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (block_pass): do not push block, substitute it.
+	* lib/resolv.rb:  Hide private method and state-tracking constants from
+	  RDoc.  Patch by Mark Turner.  [Ruby 1.9 - Feature #4691]
 
-Fri Oct 30 01:28:52 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May 13 19:23:21 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* range.c (range_check): avoid <=> check for Fixnums.
+	* numeric.c (flo_coerce): Add #flo_coerce documentation.
+	  Patch by Sebastian Martinez.
+	  https://github.com/ruby/ruby/pull/21
 
-	* array.c (rb_ary_aset): accept negative index.
+Fri May 13 18:42:22 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Wed Oct 28 22:00:54 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* README.EXT: fix typo.  Patch by William Blackerby.
+	  https://github.com/ruby/ruby/pull/19
 
-	* regex.c (re_match): access out of boundary fixed.
+	* README.EXT.ja: ditto.
 
-Wed Oct 28 11:37:42 1998  TAMITO  <tommy@valley.ne.jp>
+Fri May 13 15:22:34 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* io.c (f_select): fd number comparison bug.
+	* win32/win32.c (rb_w32_select): check invalid handle before doing
+	  select operations.  see [ruby-dev:43513], [ruby-dev:43535]
 
-Tue Oct 27 23:07:11 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May 13 08:34:00 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* sample/ruby-mode.el (ruby-parse-region): forgot to support %w()
-	  style array literal.
+	* lib/rdoc/rdoc.rb:  Output summary after documentation report.
+	* lib/rdoc/stats/normal.rb:  Don't output information for users when
+	  we're not on a TTY
 
-	* eval.c (rb_eval): unused block raises warning.
+Fri May 13 07:49:02 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Oct 26 09:37:53 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/fileutils.rb:  Hide internal methods from RDoc.  Patch by Darragh
+	  Curran.  [Ruby 1.9 - Bug #4684]
 
-	* eval.c (dvar_asgn_push): dvar pushed too many times if
-	  variable-in-block first appear in loops.
+Fri May 13 07:36:23 2011  Eric Hodel  <drbrain@segment7.net>
 
-Sun Oct 25 22:59:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/webrick/httpservlet/erbhandler.rb:  Add documentation.
 
-	* regex.c (set_list_bits): was using wrong offset.
+Fri May 13 07:04:33 2011  Eric Hodel  <drbrain@segment7.net>
 
-Thu Oct 22 00:07:11 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mathn.rb:  Fix indentation.  Patch by Jason Dew.
+	  [Ruby 1.9 - Feature #4682]
 
-	* eval.c (rb_obj_method): method retrieved from tainted object
-	  should be tainted too.
+Fri May 13 06:50:43 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (method_call): safe_level should be restored during
-	  Method#call.
+	* lib/mathn.rb:  Add documentation.  Patch by Jason Dew.  [Ruby 1.9 -
+	  Feature #4667]
 
-Wed Oct 21 14:21:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May 13 05:44:19 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* io.c (Init_IO): new constants IO::SEEK_{SET,CUR,END}.
+	* lib/logger.rb (class Logger):  Document Logger#datetime_format.
+	  Patch by Sergio Gil Perez de la Manga.  [Ruby 1.9 - Bug #4678]
 
-	* io.c (rb_f_ungetc): ungetc pushes a char back into STDIN.
+Fri May 13 05:39:11 2011  Eric Hodel <drbrain@segment7.net>
 
-Mon Oct 19 11:50:00 1998  Motoyuki Kasahara  <m-kasahr@sra.co.jp>
+	* re.c (Init_Regexp): Document option constants.  Patch by Vincent
+	  Batts.  [Ruby 1.9 - Bug #4677]
+	* lib/uri/common.rb (module URI):  Documentation for URI.  Patch by
+	  Vincent Batts.  [Ruby 1.9- Bug #4677]
+	* lib/uri/ftp.rb (module URI):  ditto
+	* lib/uri/generic.rb (module URI):  ditto
+	* lib/uri/http.rb (module URI):  ditto
+	* lib/uri/https.rb (module URI):  ditto
+	* lib/uri/ldap.rb (module URI):  ditto
+	* lib/uri/ldaps.rb (module URI):  ditto
+	* lib/uri/mailto.rb (module URI):  ditto
+	* process.c (Init_process):  Document Process constants.  Patch by
+	  Vincent Batts.  [Ruby 1.9- Bug #4677]
 
-	* ext/extmk.rb: Load '@top_srcdir@/lib/find.rb', not
-	'../lib/find.rb'.
-	* ext/extmk.rb: Distinguish between `top_srcdir' and `topdir'.
-	* Makefile.in (CFLAGS): Add `-I.'.
-	* Makefile.in (lex.c): Give `@srcdir@/keywords' to gperf, not
-	`keywords'.
-	* instruby.rb: Use `CONFIG["bindir"]', instead of `prefix + "/bin"'.
-	* instruby.rb: Use `CONFIG["libdir"]', instead of `prefix + "/lib"'.
-	* instruby.rb Use `CONFIG["mandir"]', instead of `prefix + "/man"'.
-	* instruby.rb (wdir): Add the variable to preserve the current
-	working directory.
-	* instruby.rb: Chdir to wdir before install `config.h' and
-	`rbconfig.rb'.
+Fri May 13 05:16:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Oct 19 10:07:01 1998  EGUCHI Osamu  <eguchi@shizuokanet.ne.jp>
+	* lib/rss/atom.rb (module RSS):  Document URIs.  Patch by Mark Turner.
+	  [Ruby 1.9 - #4671]
+	* lib/rss/rss.rb (module RSS):  Document exception classes.  Patch by
+	  Mark Turner.  [Ruby 1.9 - #4671]
 
-	* eval.c (rb_eval): reduce recursive calls to rb_eval().
+Fri May 13 02:15:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Oct 16 15:31:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (select_internal): remove unused variable (interrupt_flag).
 
-	* time.c (time_new_internal): timeval must be positive.
+Thu May 12 18:24:34 2011  Kouhei Sutou  <kou@clear-code.com>
 
-Thu Oct 15 13:54:48 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* configure.in: limit to "T" type for prefix of external symbols
+	  because x86_64-w64-mingw32-gcc on Debian GNU/Linux generates the
+	  following symbol:
+	    0000000068483390 D _GLOBAL__F__conftest_external
 
-	* parse.y (arg): local variabls can be accessed within right side
- 	  expression in assignment, notably in blocks.
+	  Approved by nobu.
 
-Wed Oct 14 00:18:33 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May 12 14:50:52 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* array.c (Init_Array): Array#=== is now for equal check, not
-	  inclusion check.
+	* test/dl/test_base.rb (Fiddle::LIBC_SO): its always msvc*.dll on
+	  mswin/mingw.
 
-	* parse.y (when_args): `when a, *b' style new syntax for array
-	  expansion in `case'.
+Thu May 12 14:47:53 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Oct 13 14:30:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb (Logging.postpone): copy only when temporary logfile
+	  exists.
 
-	* object.c (rb_obj_untaint): taint marks can be unset.
+Thu May 12 12:24:22 2011  Nobuhiro Iwamatsu  <iwamatsu@nigauri.org>
 
-	* eval.c (rb_eval): taint propagation for embedded strings.
+	* ext/openssl/ossl_ssl.c: By trunk@31346, function check of SSLv2 is
+	  executed.
+	  However, the problem is not revised in this.
+	  This adds the control of using function of SSLv2 in made macro by
+	  function check.
 
-Mon Oct 12 13:27:15 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May 12 08:10:46 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (rb_call0): check stack depth more frequently.
+	* lib/set.rb (class Set):  Add nodoc to internal-use methods.  Patch
+	  by Pete Higgins.  [Ruby 1.9 - Bug #4665]
 
-Mon Oct 12 08:08:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May 12 08:01:14 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* io.c (rb_p): can print even in secure mode.
+	* ext/openssl/ossl_pkey_ec.c: Allow encryption when PEM-encoding
+	  Elliptic Curve private keys.
+	  [ruby-core:35329] [Bug #4423]
 
-Sun Oct 11 22:50:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May 12 07:54:59 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* variable.c (rb_const_set): taint check for modification.
+	* object.c (rb_obj_equal):  Add documentation.  Patch by Vincent Batts.
+	  [Ruby 1.9 - Bug #4664]
+	* lib/rexml:  ditto
+	* lib/mkmf.rb:  ditto
+	* ext/socket/lib/socket.rb:  ditto
 
-	* variable.c (rb_ivar_set): taint check for modification.
+Thu May 12 07:30:08 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* string.c (rb_str_modify): taint check for modification.
+	* Various .document files: Update .document files to match files which
+	  have documentation.
 
-	* hash.c (rb_hash_modify): taint check for modification.
+Thu May 12 07:18:45 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-	* array.c (rb_ary_modify): taint check for modification.
+	* ext/openssl/ossl_pkey_dsa.c: Use generic X.509 SubjectPublicKeyInfo
+	  format for PEM-encoding DSA public keys.
+	  [ruby-core:35328] [Bug #4422]
 
-	* ruby.h (FL_TAINT): taint for all objects, not only strings.
+Thu May 12 06:27:31 2011  Martin Bosslet  <Martin.Bosslet@googlemail.com>
 
-Fri Oct  9 17:01:14 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/openssl/ossl_pkey_rsa.c: Use generic X.509 SubjectPublicKeyInfo
+	  format for encoding RSA public keys.
+	  [ruby-core:35327] [Bug #4421]
 
-	* io.c (read_all): read() returns "" at immediate EOF.
+Wed May 11 19:45:27 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* io.c (io_read): read(nil) read all until EOF.
+	* lib/forwardable.rb: support 'delegate :foo => :bar' for to meet
+	  by specification of RDOC.
 
-Thu Oct  8 13:32:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May 11 08:36:38 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* time.c (time_dump): marshal can dump Time object now.
+	* lib/webrick: Add documentation for WEBrick::HTTPAuth
 
-	* marshal.c (Init_marshal): rename marshal methods `_dump_to' to
- 	  `_dump', `_load_from' to `_load'.
+Wed May 11 03:06:35 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* parse.y (rb_intern): "+=".intern generates proper symbol.
+	* lib/rss.rb: Add documentation for RSS.  Patch by Steve Klabnik.
+	  [Ruby 1.9 - Bug #4663]
 
-Mon Oct  5 18:31:53 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue May 10 14:50:32 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* version 1.1c6 released.
+	* lib/test/unit.rb: Add option for hiding skip messages when test
+	  ends. #4657
 
-Fri Oct  2 14:22:33 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/testunit/test_hideskip.rb, test/testunit/test4test_hideskip.rb:
+	  test for above.
 
-	* regex.c (re_search): `/\s*(--)$/ =~ "- --"' did not match,
-	  because of wrong optimize condition.
+Tue May 10 10:53:04 2011  Eric Hodel  <drbrain@segment7.net>
 
-Mon Oct  1 01:55:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* common.mk (rdoc): Add rdoc-coverage rule
 
-	* parse.y (rb_intern): should not raise exceptions.
+Tue May 10 09:13:21 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* parse.y (yylex): symbol like `:foo?=' should not be allowed.
+	* lib/webrick: Add Documentation
 
-	* ext/extmk.rb.in: makes *.a for static link modules.
+Tue May 10 04:22:09  Eric Hodel  <drbrain@segment7.net>
 
-Wed Sep 30 14:13:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/webrick/log.rb: Hide copyright info from ri
+	* lib/webrick/httpstatus.rb: ditto
+	* lib/webrick/htmlutils.rb: ditto
+	* lib/webrick/httpversion.rb: ditto
+	* lib/webrick/version.rb: ditto
+	* lib/webrick/httpauth/userdb.rb: ditto
+	* lib/webrick/httpauth/authenticator.rb: ditto
+	* lib/webrick/accesslog.rb: ditto
 
-	* eval.c (rb_thread_start): supports making a subclass of the
-	  Thread class.
+Mon May  9 20:57:13 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Sep 29 17:46:01 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_{complex,rational}.rb: added tests.
 
-	* eval.c (rb_thread_join): join is now an instance method.
+Mon May  9 20:29:44 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Fri Sep 25 12:01:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* complex.c (string_to_c_internal): a refactoring.
 
-	* parse.y (yylex): `@foo!' should be an error.
+Mon May  9 18:33:05 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Sep 24 14:55:06 1998  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+	* string.c: Improve documentation for String#start_with? and
+	  String#end_with?. fixes #4652
+	  patched by Andrew Grimm <andrew.j.grimm at gmail.com>
 
-	* ext/etc/etc.c (Init_etc): wrong field definition.
+Mon May  9 13:49:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Thu Sep 17 17:09:05 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* complex.c (string_to_c_internal): support scientific notation.
+	  patched by Tinco Andringa. https://github.com/ruby/ruby/pull/16
+	  [ruby-core:36046][Bug #4655]
 
-	* io.c (io_reopen): was creating FILE* for wrong fd.
+Mon May  9 11:52:48 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Sep 15 05:28:11 1998  Koji Arai  <JCA02266@nifty.ne.jp>
+	* numeric.c (int_ord): remove K&R style.
+	  patched by Daehyub Kim. https://github.com/ruby/ruby/pull/17
 
-	* regex.c (re_compile_pattern): forgot to fixup for the pattern
- 	  like (?=(A)|(B)).
+Sun May  8 22:17:24 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Sep 15 01:06:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_{complex2,complexrational}.rb: use skip.
+	* test/date/*.rb: ditto.
 
-	* io.c (rb_io_gets_internal): do not set $_ by default, only
-	  gets/readline set the variable.
+Sun May  8 21:02:31 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (rb_f_load): load toplevel class is set to anonymous
-	  module if safe_level >= 5, to encapsulate modification.
+	* test/ruby/test_{complex2,complexrational}.rb: NEVER SKIP.
 
-	* eval.c (rb_f_load): set frame properly.
+Sun May  8 21:01:21 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* string.c (rb_str_each_line): do not set $_.
+	* test/date/test_date_base.rb: fixed.
 
-Mon Sep 14 14:42:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May  8 20:54:11 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (re_match): beginning and end of the string, do not
-	  automatically match `\b'.
+	* test/date/*.rb: NEVER SKIP.
 
-	* string.c (scan_once): comsume at leaset on character.
+Sun May  8 20:37:33 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (re_search): wrong behavior for negative range.
+	* test/date/*.rb: reverted 31432.
 
-Sat Sep 12 21:21:26 1998  Koji Arai  <JCA02266@nifty.ne.jp>
+Sun May  8 20:32:43 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (re_search): range value should be maintained.
+	* test/date/*.rb: reverted 31483.
 
-Thu Sep 10 10:55:00 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May  8 19:39:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* parse.y (backref_error): yyerror does not understand formats.
+	* thread_pthread.c (native_cond_timedwait): add to care EINTR.
+	* thread_pthread.c (thread_timer): remove EINTR check.
 
-Tue Sep  8 18:05:33 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May  8 19:04:15 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* version 1.1c5 released.
+	* lib/time.rb (xmlschema): avoid passing any negative numbers.
 
-Tue Sep  8 10:03:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May  8 18:40:03 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* string.c (str_each_line): wrong line splitting with newline at
- 	  top of the string.
+	* ext/date/date_{parse,strptime}.c: introduced some macros.
 
-	* string.c: non bang methods return copied string.
+Sun May  8 17:17:13 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (f_END): needed to initialize frame->argc;
+	* test/date/*.rb: use skip /w messages.
 
-Fri Sep  4 11:27:40 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun May  8 17:04:55 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* bignum.c (bigadd): proper sign combination.
+	* ext/date/lib/date/format.rb (_httpdate): omitted to call zone_to_diff.
 
-	* regex.c (re_search): wrong return value for \A.
+Sun May  8 16:56:19 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
->>>>>>> 1.1.1.2.2.154
-Thu Sep  3 14:08:14 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c (date_s_test_*): use macros.
 
-	* version 1.1c4 released.
+Sun May  8 10:24:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Sep  1 10:47:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_pthread.c: cleanup signal_thread_list related ifdef.
+	  1) we don't have to use #ifdef FOO-PLATFORM directly 2) About
+	  half #ifdef didn't care symbian properly.
 
-	* regex.c (slow_search): do not compare llen and blen.  llen may
-	  be longer than blen, if little contains 0xff.
+Sun May  8 05:19:37 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* regex.c (mbctab_euc): set 0x8e as multibyte character.
+	* test/io/wait/test_io_wait.rb: Linux socketpair(2) only support
+	  AF_UNIX, but windows socketpair doesn't support it. we can't
+	  avoid platform check. sigh!
 
-	* string.c (str_inspect): mask character for octal output.
+Sun May  8 00:13:05 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Aug 31 15:32:41 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/io/wait/test_io_wait.rb: use Socket.pair instead of pipe.
+	  Windows can only treat a socket.
 
-	* regex.c (re_search): use calculated offset if exactn is the
-	  first opcode in the compiled regexp.
+Sat May  7 22:43:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* regex.c (bm_search): use Boyer-Moore search for simple search.
+	* thread.c (rb_fd_zero): remove redundant zero fill.
 
-	* regex.c (must_instr): wrong length check if pattern includes
-	  byte escape by 0xff.
+Sat May  7 22:38:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* regex.c (re_compile_pattern): need not to check current_mbctype.
+	* thread.c (rb_fd_init): remove volatile qualifier.
 
-Sat Aug 29 16:31:40 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May  7 22:34:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_check_safe_str): avoid calling rb_id2name() in normal 
-	  cases to speed-up.
+	* thread.c (rb_fd_init_copy): new internal api. It provide efficient
+	  copy constructor semantics.
+	* thread.c (do_select): use rb_fd_init_copy().
 
-	* eval.c (thread_raise): do not save context of terminated thread.
+Sat May  7 15:18:06 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	fix incorrect native_cond_signal call when deadlock was detected.
 
-	* regex.c (re_compile_pattern): mask \nnn over 256.
+	* thread.c (lock_func): decrement cond_waiting if timeout was happen.
 
-Sat Aug 29 02:09:46 1998 1998  Koji Arai  <JCA02266@nifty.ne.jp>
+Sat May  7 18:28:37 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* sprintf.c (f_sprintf): wrong buffer size check.
+	* thread_pthread.c (USE_MONOTONIC_COND): check the availability
+	  more strictly.
 
-Fri Aug 28 01:57:04 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_pthread.h (rb_thread_cond_t): ditto.
 
-	* regex.c (re_compile_pattern): accepts (?ix-ix) and (?ix-ix:...).
+Sat May  7 15:15:10 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Aug 28 12:25:33 1998  Hiroshi Igarashi  <igarashi@ueda.info.waseda.ac.jp>
+	fix win32 native_cond_timedwait() makes SIGSEGV.
 
-	* ruby.c (ruby_require_modules): load modules in appearing order.
+	* thread_win32.h (rb_thread_cond_struct): add prev field instead of
+	  last. (ie cond_event_entry is now using double linked list instead of
+	  single)
+	* thread_win32.c (cond_event_entry): add prev field.
 
-Fri Aug 28 01:57:04 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_win32.c (__cond_timedwait): remove entry properly if timeout
+	  was happen.
 
-	* regex.c (re_compile_pattern): accepts (?ix-ix) and (?ix-ix:...).
+	* thread_win32.c (native_cond_signal): change for double linked list.
+	* thread_win32.c (native_cond_broadcast): ditto.
+	* thread_win32.c (native_cond_initialize): ditto.
 
-Thu Aug 27 12:54:28 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May  7 12:41:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	fix mutex deadlock test hang-up.
 
-	* version 1.1c3 released.
+	* thread_win32.c (abs_timespec_to_timeout_ms): fix 1000x calculation
+	  mistake. (ie fix hang-up native_cond_timedwait())
 
-Wed Aug 26 14:40:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May  7 03:14:13 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_eval): check whether ruby_class is properly set,
-	  before accessing it.
+	sleep_cond use monotonic time if possible.
 
-	* eval.c (rb_obj_instance_eval): ruby_class should be Qnil for
-	  special objects like Fixnums.
+	* thread_pthread.c (native_thread_init): change sleep_cond
+	  attribute to monotonic.
+	* thread_pthread.c (native_sleep): use native_cond_timeout().
 
-	* ext/tkutil/tkutil.c (Init_tkutil): removes calls to
-	  rb_yield_0().  used instance_eval() instead in the tk.rb.
+	* thread_pthread.c (native_cond_timeout): add overflow care.
+	* thread_win32.c (native_cond_timeout): ditto.
 
-Wed Aug 26 11:47:00 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat May  7 02:49:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	  fix win32 compile error.
 
-	* regex.c (re_match): pop non-greedy stack elements on success.
+	* thread_win32.c (RB_CONDATTR_CLOCK_MONOTONIC): define
+	  RB_CONDATTR_CLOCK_MONOTONIC always.
+	* thread_pthread.c (RB_CONDATTR_CLOCK_MONOTONIC): ditto.
 
-Wed Aug 26 09:25:35 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Sat May  7 02:29:41 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ruby.h: add #define environ for cygwin32.
+	  mutex: deadlock check timeout use monotonic time.
 
-Tue Aug 25 08:57:41 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_pthread.c (native_cond_timeout): new internal api.
+	  it calculate a proper time for argument of native_cond_timedwait().
+	* thread_win32.c (native_cond_timeout): ditto.
 
-	* array.c (rb_ary_sort_bang): temporarily freeze sorting array.
+	* thread_pthread.c (thread_timer): use native_cond_timeout()
+	  instead of get_ts.
+	* thread.c (lock_func): ditto.
 
-Mon Aug 24 18:46:44 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* thread_pthread.c (get_ts): removed. use native_cond_timeout().
+	* thread.c (init_lock_timeout): ditto.
 
-	* dln.c (dln_find_1): path check was too strict.
+Sat May  7 01:54:21 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Aug 24 15:28:11 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* thread_pthread.c (get_ts): add monotonic clock capability.
+	* thread_pthread.c (rb_thread_create_timer_thread): use monotonic
+	  clock if possible.
 
-	* parse.y (f_arglist): opt_nl added after f_args.
+Sat May  7 01:43:37 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Aug 21 01:06:01 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_pthread.h (rb_thread_cond_t): add clockid field. it's
+	  no longer an alias of pthread_cond_t.
+	* thread_pthread.c: adapt new rb_thread_cond_t type.
+	* thread.c (mutex_alloc): ditto.
+	* thread_win32.c (native_cond_initialize): ditto.
+	* configure.in: add check for pthread_cond_attr_setclock() and
+	  clockid_t type.
 
-	* ext/socket/socket.c: grand renaming on socket.c.
+Fri May  6 23:29:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/socket/socket.c (inet_aton): supply inet_aton for those
-	  systems that do not have it.
+	* thread.c (rb_wait_for_single_fd): use ppoll() instead of poll()
+	  if possible. based on a patch from Eric Wong. [ruby-core:36003].
 
-	* ext/socket/socket.c (setipaddr): use inet_aton instead of
-	  inet_addr.
+Fri May  6 23:13:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/socket/socket.c (tcp_s_gethostbyname): new method: works
-	  like Socket.gethostbyname but returning array contains ip-addrs
-	  as octet decimal string format like "127.0.0.1".
+	* configure.in: remove nanosleep check. we no longer use it.
+	  r20124 removed last usage.
 
-	* ext/socket/socket.c (mkhostent): return format changed to
-	  [host, aliases, type, ipaddr..]  as documented.
+Fri May  6 22:35:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 19 00:31:09 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/syck/rubyext.c (mktime_do): extra digits are not used.
 
-	* io.c (io_ctl): forgot to place TRAP_END at right position.
+Fri May  6 17:43:07 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Aug 14 11:01:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/syck/rubyext.c (mktime_do): remove unused variable offset.
 
-	* eval.c (call_trace_func): save __FILE__, __LINE__ before
- 	  executing trace_func, since trace function should not corrupt
- 	  line number information.
+	* ext/syck/syck.h: use #ifdef instead of #if DEBUG.
 
-Thu Aug 13 15:09:02 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May  6 16:27:33 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* array.c (ary_s_new): was marking unallocated region on GC.
+	* ext/date/date_core.c (DAY_IN_NANOSECONDS): refix: 31438.
+	  check with LONG_MAX and cast as long; without this the calculation
+	  will be done as int and overflow.
 
-Tue Aug 11 11:57:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May  6 15:01:11 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* version 1.1c2 released.
+	* ext/syck/rubyext.c (mktime_do): avoid buffer overrun, by
+	  silently ignoring lesser significant digits.  Required buffer
+	  length can be computable so you might at first think of
+	  allocating enough memory space on the fly using alloca().  That
+	  is a wrong idea because when using alloca there is always risk
+	  of integer overflow.  A function that accepts outer-process
+	  resources like this should not blindly trust its inputs.  In
+	  this particular case we just want to generate milliseconds
+	  resolution by strtod() so the string in question needs no more
+	  length than what we originally have.  Ignoring lesser
+	  significant digits should suffice I believe.
 
-Mon Aug 10 14:05:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri May  6 14:25:53 2011  Tinco Andringa <mail@tinco.nl>
 
-	* process.c (f_system): removed fflush(stdin).
+	* ext/syck/rubyext.c (mktime_do): YAML.load time correctly parse
+	  usecs smaller than 1 fixes #4571
 
-Fri Aug  7 17:44:44 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May  5 22:23:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* error.c (err_snprintf): replace sprintf for fixed sized buffer,
- 	  with snprintf to avoid buffer over-run.  For systems which does
-	  dot provide snprintf, missing/snprintf.c added.
+	* thread_pthread.c (native_mutex_reinitialize_atfork): removed
+	  unused macro.
+	* thread_win32.c (native_mutex_reinitialize_atfork): ditto.
 
-Wed Aug  5 00:47:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May  5 22:09:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* re.c (rb_reg_search): recycle match object.
+	* ext/date/date_core.c (DAY_IN_NANOSECONDS): long long int is not
+	  available on all platforms.
 
-Mon Aug  3 09:17:55 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu May  5 17:36:31 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* string.c (rb_str_gsub_bang): do not allocate temporary string.
+	* eval.c (frame_func_id): store result of method_entry_of_iseq() to
+	  cfp->me because method_entry_of_iseq() might become expensive.
 
-	* string.c (rb_str_sub_bang): use inline replace.
+Thu May  5 15:03:51 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-Wed Jul 29 00:36:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* eval.c (frame_func_id): __method__ return different name from
+	  methods defined by Module#define_method with a same block.
+	  [ruby-core:35386] fixes #4606
+	* eval.c (method_entry_of_iseq): new helper function. search control
+	  frame stack for a method entry which has given iseq.
+	* test/ruby/test_method.rb: add tests for #4606
 
-	* hash.c (hash_s_new): the default value can be specified.
+Wed May  4 22:13:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* hash.c (hash_default): method to set the default value.
+	* benchmark/bm_vm4_pipe.rb: Reduced iterations. Too slow benchmark
+	  is bad.
+	* benchmark/bm_vm4_thread_pass.rb: ditto.
 
-	* hash.c (hash_aref): now returns the default value.
+Wed May  4 22:08:22 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Jul 28 13:03:25 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/date/test_date_base.rb: don't use no message skip().
 
-	* array.c (ary_s_new): argument to specify initial value is added.
+Wed May  4 21:11:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* array.c (ary_s_new): specifies size, not capacity.
+	* benchmark/bm_io_select2.rb: reduce number of using file
+	  descriptors. because gdb need some fds.
 
-Mon Jul 27 12:39:34 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May  4 19:00:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (str_replace): zero fill for expansion gap.
+	* thread.c (rb_wait_for_single_fd): Fix wrong return value.
+	* test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb
+	  (TestWaitForSingleFD#test_wait_for_closed_pipe): test for it.
 
-	* regex.c (mbctab_euc): set flags on for 0xA1-0xFE.  suggested by
-	  <inaba@st.rim.or.jp>.
+Wed May  4 18:46:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (str_inspect): consider current_mbctype.
+	* ext/-test-/wait_for_single_fd: New. for testing
+	  rb_wait_for_single_fd() internal function.
+	  The patch was written by Eric Wong. [ruby-core:35991]
 
-Sun Jul 26 15:37:11 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb: ditto.
 
-	* array.c (ary_s_new): Array.new(1<<30) dumps core.
+Wed May  4 12:46:25 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul 24 13:40:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (rb_wait_for_single_fd): Added POLLNVAL check.
+	  based on a patch from Eric Wong at [ruby-core:35991].
 
-	* version 1.1c1 released.
+Wed May  4 11:51:01 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul 24 02:10:22 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (rb_f_select): remove useless ifdef.
 
-	* marshal.c (r_bytes2): allocated buffer size was too short.
+Wed May  4 11:42:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* marshal.c (w_object): saves all options, not only casefold flag.
+	* ext/socket/init.c (wait_connectable): fix error handling code.
+	  RB_WAITFD_OUT is turned on even though an error occur.
 
-	* re.c (reg_clone): now copies options properly.
+Wed May  4 10:12:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* re.c (reg_get_kcode): code number was wrong.
+	* ext/readline/readline.c (readline_event): use rb_wait_for_single_fd().
+	The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-Thu Jul 23 13:11:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed May  4 10:10:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_attr): argument should be symbol or string.
+	* ext/socket/init.c (wait_connectable): use rb_wait_for_single_fd().
+	  The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-Wed Jul 22 11:59:34 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/socket/init.c (try_wait_connectable, wait_connectable_ensure):
+	  removed.
 
-	* regex.c (calculate_must_string): wrong offset added.
+Wed May  4 10:07:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Jul 22 11:59:59 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/io/wait/wait.c (io_wait): use rb_wait_for_single_fd().
+	  The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-	* st.c (rehash): still had a GC problem.  fixed.
+Wed May  4 10:01:27 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Jul 21 13:19:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (rb_wait_for_single_fd): new. poll(2) based backend for
+	  rb_wait_for_single_fd().
+	  Now only Linux uses it.
 
-	* eval.c (gc_mark_threads): crashed on GC before thread allocation.
+	The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-	* st.c (rehash): GC during rehash caused SEGV.
+Wed May  4 09:56:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Tue Jul 21 01:25:10 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (rb_wait_for_single_fd): new.
+	* thread.c (select_single): select(2) based backend for
+	  rb_wait_for_single_fd().
 
-	* sprintf.c (f_sprintf): integer formatter totally re-written.
+	* io.c (make_writeconv): use rb_wait_for_single_fd() instead of
+	  rb_thread_fd_select().
+	* io.c (rb_io_wait_readable): ditto.
+	* thread.c (rb_thread_wait_fd_rw): ditto.
 
-	* sprintf.c (remove_sign_bits): support uppercase hexadecimal.
+	* io.c (wait_readable): removed.
+	* thread.c (init_set_fd): new helper function.
+	* include/ruby/io.h (RB_WAITFD_IN, RB_WAITFD_PRI, RB_WAITFD_OUT):
+	  new constant for rb_single_wait_fd().
 
-Sat Jul 18 00:14:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	The patch was written by Eric Wong. [Ruby 1.9 - Feature #4531]
 
-	* sprintf.c (f_sprintf): proper sign position for %X and %O.
+Wed May  4 08:04:59 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Fri Jul 17 14:10:20 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix time dumping so that
+	  Syck can load UTC times that Psych dumps.
 
-	* version 1.1c0 released.
+Wed May  4 07:33:00 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul 17 08:01:49 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* thread.c (rb_fd_copy): fix wrong argument.This issue was pointed
+	  out by Eric Wong. [ruby-core:35982]
 
-	* process.c (f_exec): Check_SafeStr() added.
+Tue May  3 20:29:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* process.c (f_system): Check_SafeStr() moved before fork().
+	* test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
+	  Skip sticky bit test if the platform is FreeBSD. It doesn't allow to
+	  change sticky bit if a target is regular file.
 
-Thu Jul 16 22:58:48 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue May  3 18:23:57 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* string.c (scan_once): substrings to the block should not be
- 	  tainted.  use reg_nth_match(), not str_substr().
+	* test/date/test_date.rb (TestDate#test_coerce):
+	  test for [ruby-core:35127].
 
-	* string.c (str_substr): needed to transfer taint.
+Tue May  3 04:27:53 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 16 16:15:57 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (rb_thread_select): preserve errno if no error
+	  occurred.
 
-	* gc.c (xmalloc): object allocation count added to GC trigger.
+Tue May  3 03:57:04 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (thread_save_context): avoid marking uninitialized stack
-	  in thread_mark.  GC may be triggered by REALLOC_N().
+	* include/ruby/intern.h (rb_w32_fdcopy): add prototype.  fixes
+	  #4640
 
-Wed Jul 15 15:11:57 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon May  2 01:02:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* experimental release 1.1b9_31.
+	* lib/fileutils.rb (FileUtils#chmod): accept symbolic mode argument.
+	  The patch was written by takkanm. [ruby-core:26029][Feature #2190]
 
-Wed Jul 15 15:05:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/fileutils.rb (FileUtils#fu_mode): new helper function.
+	* lib/fileutils.rb (FileUtils#symbolic_modes_to_i): ditto.
+	* lib/fileutils.rb (FileUtils#mode_mask): ditto.
+	* lib/fileutils.rb (FileUtils#user_mask): ditto.
 
-	* eval.c (thread_create): exit() and abort() in threads now
- 	  forwarded to main_thread.
+	* test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_symbol_mode):
+	  new test for the above symbolic mode.
+	* test/fileutils/test_fileutils.rb (TestFileUtils#test_chmod_R): ditto.
 
-Tue Jul 14 14:03:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon May  2 00:36:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* variable.c (obj_instance_variables): list names that is not
-	  instance variables.
+	* ext/socket/init.c (rsock_connect): add to care EINTR. based
+	  on a patch from Eric Wong at [ruby-core:35621][Bug #4555]
 
-	* gc.c (GC_MALLOC_LIMIT): choose smaller limit value.
+Sun May  1 01:06:24 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Jul 13 12:39:38 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (rb_thread_select): release GVL while waiting select().
 
-	* object.c (str2cstr): should not return NULL.
+Sat Apr 30 23:10:15 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jul 10 11:51:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* win32/win32.c (rb_w32_fdcopy): New. This can copy even though
+	  fdset size exceed FD_SETSIZE.
+	* include/ruby/intern.h (rb_fd_copy): use rb_w32_fdcopy()
 
-	* parse.y (gettable): needed to add dyna_in_block() check.
+Sat Apr 30 20:18:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Jul  9 17:38:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (do_select): Change argument type to rb_fdset_t.
+	  Now do_select() is free from unexpected hangup if
+	  HAVE_RB_FD_INIT=1 [Bug #4636]
 
-	* experimental release 1.1b9_30.
+	* thread.c (rb_thread_fd_select, rb_thread_wait_fd_rw):
+	  adapt new argument type.
 
-Thu Jul  9 16:01:48 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (rb_thread_select): make dummy implementation.
 
-	* sprintf.c (fmt_setup): format specifier for long needed.
+Sat Apr 30 20:16:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* sprintf.c (f_sprintf): ditto.
+	* thread.c (rb_fd_copy): Change function argument. Now
+	  rb_fd_copy() has fully copy semantics.
+	* include/ruby/intern.h: ditto.
 
-	* numeric.c (fix2str): ditto.
+Sat Apr 30 20:11:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (thread_create): no more ITIMER_REAL.
+	* include/ruby/intern.h (rb_thread_select): mark as deprecated.
 
-	* eval.c (thread_create): thread finalization needed before
-	  aborting thread if thread_abort is set.
+	* ext/io/wait/wait.c (wait_readable): use rb_thread_fd_select
+	  instead of rb_thread_select.
+	* ext/socket/init.c (wait_connectable0): ditto.
+	* ext/readline/readline.c (readline_event): ditto.
+	* io.c (rb_io_wait_readable, wait_readable, rb_io_wait_writable,
+	  wait_writable): ditto.
 
-Wed Jul  8 18:17:33 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Apr 30 20:06:36 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* bignum.c (big_pow): abandon power by bignum (too big).
+	* thread.c (do_select): remove useless ifdef. time calculation
+	  is not heavy weight.
 
-Tue Jul  7 13:58:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Apr 30 16:48:36 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_catch): add C level catch/throw feature.
+	* benchmark/bm_io_select3.rb: New.
 
-Mon Jul  6 15:18:09 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Apr 30 16:27:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* parse.y (arg): proper return values for `||=' and `&&='.
+	* io.c (copy_stream_body, rb_io_s_copy_stream): move rb_fd_init()
+	  from copy_stream_body to rb_io_s_copy_stream. fds of passing
+	  rb_fd_term() have to be guaranteed initialized.
 
-Fri Jul  3 16:05:11 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Apr 30 16:13:17 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* experimental release 1.1b9_29.
+	* benchmark/bm_io_select.rb, benchmark/bm_io_select2.rb: New.
+	  based on a patch from Eric Wong at [Feature #4531]
 
-Fri Jul  3 11:20:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Apr 30 03:25:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* marshal.c (r_byte): byte should not extend sign bit.
+	* test/io/wait/test_io_wait.rb: New. for testing ext/io/wait.
+	  the patch was written by Eric Wong. [Feature #4531]
 
-	* numeric.c (fix_mul): use FIX2LONG() instead of FIX2INT() for
-	  64bit architectures.
+Sat Apr 30 00:34:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* marshal.c (r_bytes): remove weird casting bwetween pointer and int.
+	* include/ruby/win32.h: remove redundant declaration of
+	  rb_w32_time_subtract().
 
-	* process.c (proc_setsid): new method Process#setsid().
+Sat Apr 30 00:16:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Jul  2 12:49:21 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_pthread.c (gvl_init): fix hangup if GVL_SIMPLE_LOCK=1.
+	  We don't have to call mutex_unlock() before initialize it!
 
-	* marshal.c (w_object): remove `write_bignum' label for 64bit
- 	  architectures.
+Fri Apr 29 13:15:15 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* marshal.c (r_bytes): needs int, not long.
+	* thread_win32.c (native_cond_timedwait): New. r31373 caused
+	  win32 build failure.
 
-Wed Jul  1 14:21:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_win32.c (__cond_timedwait, abs_timespec_to_timeout_ms):
+	  New helper functions.
 
-	* numeric.c (flo_plus): should not allow addition with strings.
+	* win32/win32.c (rb_w32_time_subtract): rename from subtract and
+	  remove static.
 
-Wed Jul  1 13:09:01 1998  Keiju ISHITSUKA  <keiju@rational.com>
+Fri Apr 29 10:43:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* numeric.c (num_uminus): wrong coerce direction.
+	* benchmark/bm_vm4_pipe.rb: Add two new benchmark for GVL
+	  performance. They was written by Koichi Sasada.
+	* benchmark/bm_vm4_thread_pass.rb: ditto.
 
-Tue Jun 30 10:13:44 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Apr 29 10:25:31 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* io.c (f_p): accepts arbitrary number of arguments.
+	* vm_method.c (rb_clear_cache_by_class): Revert r29673. It made
+	  a segmentation fault regression. [Bug #4289][ruby-core:34554].
 
-	* eval.c (rb_yield_0): there's some case that iterator_p() returns 
-	  true even if the_block was not set.  check added.
+Fri Apr 29 10:24:51 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jun 30 01:05:20 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (make_writeconv): do not add textmode newline decorator if any
+	  newline decorator is set already.  fixes #4618, fixes #4619
 
-	* eval.c (BEGIN_CALLARGS): adjust the_block before evaluating the
-	  receiver's value and the arguments.
+Fri Apr 29 10:17:42 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jun 26 18:02:50 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread.c (lock_func): small cleanup.
 
-	* experimental release 1.1b9_28.
+Fri Apr 29 10:07:13 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Jun 26 11:01:26 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* thread.c (rb_mutex_lock, lock_func): Avoid busy loop and
+	  performance regression. bm_vm3_thread_mutex.rb performance
+	  change from 109.064sec to 16.331sec. [Feature #4607]
 
-	* string.c (str_aset_method): needed to convert to string.
+	* thread.c (init_lock_timeout): New helper function.
 
-Thu Jun 25 02:05:50 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Apr 28 16:15:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* regex.c (re_search): optimize for `.*' at beginning of the
-	  pattern.
+	* win32/{win32.c,dir.h} (rb_w32_uopendir): new API to pass UTF-8 path.
 
-	* regex.c (re_search): optimize for character class repeat at
-	  beginning of the pattern.
+	* win32/win32.c (opendir_internal, rb_w32_opendir): extract and merge
+	  common part of rb_w32_opendir() and rb_w32_uopendir().
 
-	* regex.c (re_compile_pattern): detect optimization potential for
-	  the compiled patterns.
+	* dir.c (do_opendir, glob_helper): encoding.
 
-Thu Jun 25 00:02:26 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* dir.c (dir_initialize, do_opendir): convert path to UTF-8 and call
+	  rb_w32_uopendir() instead of rb_w32_opendir() on Windows.
+	  fixes #4491, reported by Joey Zhou.
 
-	* re.c (reg_s_new): flag value was wrong.
+Thu Apr 28 15:32:53 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jun 24 23:45:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/dl/test_base.rb (DL::LIBC_SO): its always msvc*.dll on
+	  mswin/mingw.
 
-	* regex.c (re_search): wrong anchor handling for reverse search.
+Thu Apr 28 06:07:06 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jun 24 02:18:57 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/csv.rb (CSV::open): suppress universal newline decorator.
+	  fixes #4603
 
-	* parse.y (mlhs): `((a,b)),c = [[1,2]],3' assigns a=1,b=2,c=3.
+	* lib/csv.rb (CSV.read): no mode is needed.
 
-Tue Jun 23 11:46:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Apr 28 06:06:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (yylex): `&&=' and `||=' added.
+	* io.c (rb_io_extract_modeenc, rb_f_backquote): set default text
+	  mode.  fixes #4619
 
-Sat Jun 20 02:53:50 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (pipe_open): set universal newline decorator if needed.
 
-	* parse.y (assignable): nesting local variables should have higher
- 	  priority than normal local variables for assignment too.
+Wed Apr 27 11:33:08 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Jun 19 18:28:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* enc/trans/emoji_iso2022_kddi.trans: ISO-2022-JP-KDDI doesn't have
+	  CP932 UDA. Another reason is emacs-mule: the implementation of
+	  stateless-iso-2022-jp doesn't support beyond 94x94 (0x7fxx);
+	  but CP932 UDA is in 7Fxx-92xx.
 
-	* experimental release 1.1b9_27.
+Wed Apr 27 07:42:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jun 19 14:34:49 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* configure.in (STRIP): use proper toolchain.  based on a patch
+	  from Jon Forums at [ruby-core:35909].  fixes #4617
 
-	* eval.c (assign): support hack for nested multiple assignment.
+Wed Apr 27 01:20:59 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* parse.y (mlhs): nested multiple assignment.
+	* ext/date/date_core.c (date_zone_to_diff): renamed.
+	* ext/date/date_parse.c: ditto.
+	* ext/date/date_strptime.c: ditto.
 
-	* eval.c (rb_eval): in-block variables now honors static scope.
+Wed Apr 27 01:16:59 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in: RSHIFT check moved to configure.
+	* encoding.c (enc_find): accept Encoding objects.
 
-Thu Jun 18 16:46:04 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Apr 27 00:55:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* experimental release 1.1b9_26.
+	* transcode.c (econv_opts): add newline option.
 
-Thu Jun 18 13:37:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (validate_enc_binmode, rb_io_extract_modeenc): set newline
+	  decorator according to open mode.
 
-	* file.c (file_s_ftype): uses lstat(2) instead of stat(2).
+	* transcode.c (rb_econv_prepare_options): new function, to prepare
+	  econv options with newline flags.
 
-	* dir.c (dir_s_glob): there can be buffer overrun, check added.
+	* include/ruby/encoding.h (ECONV_NEWLINE_DECORATOR_MASK): add.
 
-	* eval.c (f_binding): handles in-block variables declared after
-	  binding's generation.
+Wed Apr 27 00:51:01 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (flo_floor): floor, ceil, round added to Float.
+	* file.c (rb_file_truncate): fix function.
 
-Wed Jun 17 11:20:00 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* include/ruby/win32.h (ftruncate, truncate, ftello, fseeko): non-64
+	  versions on mingw are useless because they use int32_t.  fixes #4564
 
-	* parse.y (gettable): nesting local variables should have higher
- 	  priority than normal local variables.
+Wed Apr 27 00:50:33 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Jun 16 12:30:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c: modified validation methods.
+	* ext/date/lib/date.rb: ditto.
 
-	* bignum.c (str2inum): handles `+ddd'.
+Wed Apr 27 00:00:37 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* struct.c (make_struct): name parameter can be nil for unnamed
-	  structures.
+	* ext/date/date_core.c (dt_lite_set_tmx): should get df value.
 
-Mon Jun 15 16:30:10 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Apr 26 22:34:04 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* object.c (class_s_inherited): prohibiting to make subclass of
-	  class Class.
+	* ext/date/lib/date/format.rb (_iso8601): allowed day only civil
+	  date.  disallowed separatorless day only ordinal date.
 
-	* object.c (module_s_new): support for making subclass of Module.
+Mon Apr 25 21:31:36 2011  Nobuhiro Iwamatsu  <iwamatsu@nigauri.org>
 
-	* parse.y (yycompile): clear eval_tree before compiling.
+	* ext/openssl/extconf.rb: Should check SSLv2_*method.
+	  openssl compiled with "no-ssl2" the extconf don't fail
+	  when running `make' having this compilation errors.
+	  Patched by Laurent Arnoud. fixes #4562, #4556
 
-Fri Jun 12 17:58:18 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr 25 20:53:32 2011  Tajima, Akio <artonx@yahoo.co.jp>
 
-	* eval.c (eval): write back the_dyna_var into the block.
+	* win32/win32.c (kill): accept 0 only sig is SIGINT #4596
 
-Thu Jun 11 18:19:18 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr 25 19:59:47 2011  Tajima, Akio <artonx@yahoo.co.jp>
 
-	* experimental release 1.1b9_25.
+	* win32/win32.c (kill): accept 0 as pid, fixes #4596
 
-	* eval.c (dvar_add_compiling): register dyna_var at compile time.
+Mon Apr 25 16:43:45 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): RE_DUP_MAX iteration is too big.
+	* random.c (random_rand): remove unused variables.
 
-Wed Jun 10 15:12:04 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* struct.c (rb_struct_define_without_accessor): ditto.
 
-	* io.c (io_eof): do not block other threads.
+	* strftime.c (rb_strftime_with_timespec): ditto.
 
-	* signal.c (trap): reserve SIGALRM for thread.
+	* sprintf.c: ditto.
 
-	* eval.c (thread_create): use ITIMER_REAL also to avoid system
-	  call blocking.
+	* time.c (time_asctime): remove useless GetTimeval().
 
-	* io.c (f_syscall): add TRAP_BEG, TRAP_END around system calls.
+	* thread_pthread.c: cast to (void *) for %p.
 
-	* io.c (io_ctl): add TRAP_BEG, TRAP_END around system calls.
+Mon Apr 25 11:02:11 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* enum.c (enum_collect): did not collect false values.
+	* ext/ripper/lib/ripper/sexp.rb: fix rdoc around sexp.
+	  patched by Sho Hashimoto. fixes #4599
 
-	* array.c (ary_new2): forgot to initialize capa field.
+Mon Apr 25 08:24:04 2011  Shota Fukumori  <sorah@tubusu.net>
 
-Tue Jun  9 18:36:15 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* random.c (rb_f_rand, random_s_rand): RDocs for them.
 
-	* string.c (str_split_method): split dumped core for "\xff".
+Mon Apr 25 07:18:00 2011  Kenta Murata  <mrkn@mrkn.jp>
 
-Tue Jun  9 16:22:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* random.c (random_s_rand, Init_Random): Random.rand should behave as
+	  Random::DEFAULT.rand rather than Kernel#rand.
 
-	* experimental release 1.1b9_24.
+	* random.c (rand_range, random_rand): rand_range function extracted
+	  from random_rand function.
 
-Tue Jun  9 16:04:07 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* random.c (rb_f_rand): accept a Range argument as Random#rand
+	  [ruby-dev:43427] #4605
 
-	* ext/kconv/kconv.c (kconv_guess): more precise decision for EUC,
-	  using jless algorithm (3 sequential EUC hiragana characters).
+Mon Apr 25 03:31:06 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Jun  9 15:12:44 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/time.rb: require 'date'.
+	* ext/date/lib/date/format.rb: removed require line.
 
-	* ext/kconv/kconv.c (kconv_guess): wrong guess for EUC as SJIS in
-	  some cases (0xe0 - 0xef).
+Mon Apr 25 03:08:39 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* gc.c (xmalloc): insert size check for big (negative in signed)
-	  allocation size.
+	* ext/date/lib/date/format.rb: require 'date'.
 
-Tue Jun  9 02:54:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr 25 03:04:16 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* lib/parsedate.rb: wday moved to the last in the return values.
+	* ext/date/lib/date/format.rb (_iso8601): added a pattern.
 
-Mon Jun  8 10:40:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr 25 02:51:22 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (str_split_method): split dumped core for "\0".
+	* ext/date/lib/date/format.rb: require 'date_core.so'.
+	  date/format needs methods which are now in date_core.so.
+	  This breaks make rdoc which uses Date._parse from time.rb.
 
-Sat Jun  6 22:50:52 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr 25 02:47:46 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (calculate_must_string): wrong condition for
-	  {start,stop}_nowidth.
+	* ext/date/lib/date/format.rb (_iso8601): fixed a bug of regex.
 
-	* regex.c (re_match): various features imported from GNU regex.c
- 	  0.12, such as nested grouping, avoiding infinite loop with empty
- 	  match, etc.
+Mon Apr 25 02:12:26 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (register_info_type): now use union.
+	* ext/date/lib/date/format.rb: an adjustment of regex.
 
-	* regex.c (re_search): more precise anchor(^) check.
+Mon Apr 25 01:58:50 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Jun  3 18:07:54 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/lib/date/format.rb: omitted to call _parse.
 
-	* re.c (reg_raise): check rb_in_compile, not rb_in_eval.
+Mon Apr 25 01:03:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Jun  1 05:26:06 1998  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+	* string.c (rb_to_id): remove unused variable.
 
-	* string.c (trnext): casting to signed char* needed.
+Sun Apr 24 22:19:05 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Tue Jun  2 16:00:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* complex.c, rational.c: omitted some method calls.
 
-	* ext/socket/socket.c (udp_addrsetup): error check enhanced.
+Sun Apr 24 02:57:27 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* ext/socket/socket.c (sock_s_getservbyaname): use strtoul(), if
-	  possible.
+	* ext/date/date_parse.c (n2i): takes long.
 
-Sat May 30 07:10:02 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Apr 24 02:51:06 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* re.c (reg_prepare_re): no more needless regular expression
- 	  recompile on casefold conditions.
+	* ext/date/date_parse.c: reverted.
 
-Thu May 28 18:02:55 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Apr 24 02:25:23 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* object.c (nil_plus): no more `+' method for nil.
+	* include/ruby/intern.h: pcc can't use __builtin_constant_p.
 
-Wed May 27 17:33:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_exec.c: change condition.
 
-	* hash.c (hash_fetch): new method.
+Sun Apr 24 01:58:01 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* regex.c (re_search): check whether translate table is set.
+	* ext/date/date_core.c (leap_p): suppress warning: parentheses.
 
-Tue May 26 11:39:50 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c (date_s__parse_internal): remove unused
+	  variable "str".
 
-	* experimental release 1.1b9_23.
+	* ext/date/date_parse.c (parse_ddd_cb): use RSTRING_LENINT.
 
-	* parse.y (yylex): no UPLUS/UMINUS for 1st argument if
-	  parenthesises are omitted.
+	* ext/date/date_strftime.c (date_strftime_with_tmx): remove unused
+	  variable.
 
-Tue May 26 01:09:55 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Apr 24 00:34:23 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (re_compile_pattern): (?XI) for turns off the
-	  corresponding option.
+	* ext/date/date_parse.c: removed some unused macros.  use strchr()
+	  instead of index().
 
-Mon May 25 12:38:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Apr 23 21:29:42 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* regex.c (re_compile_pattern): inline i option (?i).
+	* ext/date/date_core.c: replacement of implementation of
+	  _parse.  [experimental]
+	* ext/date/date_parse.c: new.
+	* ext/date/lib/date/format.rb: removed ruby version of _parse.
 
-	* regex.c (re_compile_pattern): inline x option (?x).
+Fri Apr 22 12:04:15 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): x option for regexp.
+	* array.c (rb_ary_sort_bang): fix rdoc.
+	  patched by burningTyger. https://github.com/ruby/ruby/pull/11
 
-	* dir.c (dir_s_open): returns block's evaluated value.
+Fri Apr 22 11:49:49 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (f_open): returns block's evaluated value.
+	* lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
+	  XML-RPC's int is 32bit int, and Fixnum also may be beyond 32bit.
 
-	* ext/curses/curses.c (curses_addstr): nil argument caused SEGV.
+	* lib/xmlrpc/create.rb (XMLRPC::Create#conv2value):
+	  XML-RPC doesn't allow Infinity and NaN.
+	  http://www.xmlrpc.com/spec
 
-Fri May 22 11:52:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Apr 22 04:16:14 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* regex.c (re_compile_pattern): push mark on (?:), so that
-	  laststart check for {a,b} can be done.
+	* ext/psych/parser.c (parse): strings from psych have proper taint
+	  markings.
 
-Thu May 21 17:31:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/psych/test_tainted.rb: test for string taint
 
-	* regex.c (re_match): wrong match (too non-greedy) for `{a,b}?'.
+Thu Apr 21 01:30:02 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (io_lineno): new method IO#lineno, IO#lineno=.
+	* random.c (rb_f_srand): fix rdoc: srand(0)'s 0 is a seed.
+	  [ruby-core:35833] fixes #4590
 
-Wed May 20 06:04:43 1998  MAEDA shugo  <shugo@aianet.ne.jp>
+Thu Apr 21 01:01:28 2011  Masaya Tarui  <tarui@ruby-lang.org>
 
-	* BeOS patch.
+	* win32/win32.c (CreateChild): maximum length of lpCommandLine is
+	  32,768 characters, including the Unicode terminating null character.
 
-Wed May 20 16:32:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Apr 20 21:32:11 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* bignum.c (BIGDN): use RSHIFT(), instead of mere `>>'.
+	* ext/date/date_strptime.c (date__strptime_internal): do not
+	  overwrite local variables.
 
-Tue May 19 16:36:26 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Apr 20 14:41:28 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* experimental release 1.1b9_22.
+	* string.c (rb_str_each_line): check string's length when compare
+	  separator and string. [ruby-core:35815] fixes #4586
 
-Tue May 19 16:31:57 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Apr 20 00:02:13 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (assignable): specification changed for in-block
- 	  variable definition.
+	* misc/ruby-mode.el (ruby-parse-partial): use position of open paren.
 
-	* eval.c (dyna_var_asgn): error in in-block variables' compile
- 	  time definition.
+Tue Apr 19 01:00:21 2011  Tajima Akio <artonx@yahoo.co.jp>
 
-	* parse.y (str_extend): wrong nesting detection.
+	* test/ruby/test_io.rb (TestIO#test_cross_thread_close_fd):
+	  skip cross thread pipe close if windows
 
-Tue May 19 09:47:55 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Mon Apr 18 12:15:46 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* numeric.c (num2int): re-defined (extensions may use this).
+	* test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
+	  avoid float error. [ruby-core:35804]
 
-Mon May 18 16:40:50 1998  MAEDA shugo  <shugo@aianet.ne.jp>
+Sun Apr 17 00:20:14 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* error.c (get_syserr): BeOS support.
+	* ext/date/date_{core,strftime}.c: use struct tmx instead of vtm.
+	* ext/date/date_tmx.h: new.
 
-	* configure.in: modified for BeOS.
+Sat Apr 16 22:23:52 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* string.c (str_dump): do not call isascii().
+	* ext/date/date_strftime.c (date_strftime_wo_timespec): changed
+	  the way of validation of locale modifiers.
 
-	* sprintf.c (remove_sign_bits): forgot to initialize end pointer.
+Sat Apr 16 21:55:12 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* glob.c: #include <alloca.h> added.
+	* ext/date/date_core.c: replacement of implementation of
+	  _strptime.  [experimental]
+	* ext/date/date_strptime.c: new.
+	* ext/date/lib/date/format.rb: removed ruby version of _strptime.
 
-Mon May 18 14:52:21 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
-	
-	* experimental release 1.1b9_21.
+Sat Apr 16 10:18:30 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Mon May 18 03:27:57 1998  MAEDA shugo  <shugo@aianet.ne.jp>
+	* vm.c (Init_VM): suppress warning: "OPT_BASIC_OPERATIONS" is not
+	  defined.
 
-	* file.c (file_s_expand_path): optional second argument
-	  `default_directory' added.
+Fri Apr 15 23:41:18 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Sat May 16 22:06:52 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* ruby.c (proc_options): suppress warning:
+	  "ALLOW_DEFAULT_SOURCE_ENCODING" is not defined.
 
-	* error.c (RAISE_ERROR): wrong error message
+Fri Apr 15 15:10:29 2011  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri May 15 14:43:25 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/uri/generic.rb (#route_from_path): Fix a bug where
+	  URI('http://h/b/').route_to('http://h/b') wrongly returned './'
+	  (should be '../b'). [Bug #4476]
 
-	* experimental release 1.1b9_20.
+Fri Apr 15 14:58:06 2011  Akinori MUSHA  <knu@iDaemons.org>
 
-Thu May 14 14:44:21 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* lib/fileutils.rb (FileUtils#touch): Fix corrupted output when
+	  mtime is specified in addition to nocreate (and verbose).
+	  ref [ruby-dev:43401]
 
-	* sun4 cc patches for intern.h and regex.h.
+Thu Apr 14 23:43:43 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu May 14 14:03:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* numeric.c (ruby_float_step): wrong loop condition.
+	  fixes [ruby-core:35753], reported by Joey Zhou.
 
-	* random.c (RANDOM_MAX): guessing proper maximum value for random
- 	  numbers.
+	* test/ruby/test_range.rb (TestRange#test_step_ruby_core_35753):
+	  test above change.
 
-	* random.c (f_rand): use drand48 if possible.
+Thu Apr 14 22:48:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed May 13 19:05:20 1998 1998  MAEDA shugo  <shugo@aianet.ne.jp>
+	* lib/test/unit.rb (Test::Unit::Options#setup_options): set possible
+	  values for completion. no conversion is needed.
 
-	* BeOS patches for io.c, error.c and config.guess.
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#initialize): use
+	  positional arguments instead of keyword arguments.
 
-Wed May 13 14:56:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/test/unit.rb (Test::Unit::Runner#jobs_status): io/console may
+	  not be available. use 80 as the last resort if IO#winsize and
+	  COLUMNS are unavailable.
 
-	* experimental release 1.1b9_19.
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#died): rename using a
+	  verb.
 
-	* most of the Mac and BeOS patches merged, except path separators.
+	* lib/test/unit.rb (Test::Unit::Runner#_run_parallel): check if worker
+	  is signaled and use its exit status.
 
-	* error.c (err_append): generated SyntaxError was String.
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#dead): no longer @in
+	  and @out are separated.
 
-	* ruby.h: xxx2INT, xxx2UINT checks values as int, not long.
+Thu Apr 14 21:23:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h: remove typedef's. INT, UINT, UCHAR, USHORT.
+	* variable.c (rb_autoload_p): search superclasses as same as actual
+	  loading.  fixes [ruby-core:35679]
 
-Tue May 12 17:38:00 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Apr 14 21:21:06 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* experimental release 1.1b9_18.
+	* include/ruby/win32.h (frexp, modf): wrongly declared as pure in
+	  mingw math.h.
 
-Tue May 12 11:38:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* include/ruby/win32.h (ftruncate, truncate): mingw64 misses
+	  prototypes.
 
-	* error.c (syserr_errno): returns errno of the SystemCallError.
+	* win32/win32.c (rb_w32_read): suppress warning.
 
-	* error.c (rb_sys_fail): saves errno in the Exception.
+Thu Apr 14 19:55:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* error.c (set_syserr): no need to protect syserr_list.
+	* lib/fileutils.rb (FileUtils#touch): fix corrupted output when
+	  FileUtils.touch(:nocreate => true, :verbose => true) case.
+	  The patch was written by Hiroyuki Iwatsuki. [ruby-dev:43401]
 
-	* error.c (rb_sys_fail): no more bufsize limit.
+Thu Apr 14 16:01:45 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* error.c (set_syserr): integer value of errno can be accessed by
-	  Errno::EXXX::Errno.
+	* io.c (rb_f_syscall): suppress warning: "HAVE___SYSCALL" is not
+	  defined.
 
-Sun May 10 03:10:33 1998  WATANABE Tetsuya  <tetsu@jpn.hp.com>
+Thu Apr 14 00:41:09 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* io.c (io_tell etc.): moved from File class to IO class.
+	* thread.c (thread_fd_close_i): IOError exception should be assigned
+	  to rb_thread_t::thrown_errinfo.
 
-Fri May  8 12:26:37 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Apr 13 20:12:26 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* pack.c (pack_unpack): should be unsigned int (was signed int).
+	* io.c (rb_io_fdatasync): remove unused variable.
 
-Thu May  7 16:34:10 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Apr 12 20:54:12 2011  Tanaka Akira  <akr@fsij.org>
 
-	* pack.c (pack_pack): `V', `N' uses newly created NUM2UINT().
+	* include/ruby/st.h: parenthesize macro arguments.
 
-	* ruby.h (NUM2UINT): new macro.
+Tue Apr 12 19:19:50 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* bignum.c (big2uint): try to convert bignum into UINT.
+	* lib/uri/common.rb: avoid race condition. fixes #4572
 
-	* re.c (reg_match): needed to return false for match with nil.
+Tue Apr 12 18:07:13 2011  TAKAO Kouji  <kouji@takao7.net>
 
-	* gc.c (obj_free): wrong condition to free string.
+	* ext/readline/extconf.rb: --disable-libedit to disable
+	  libedit. fixes #4550
 
-Wed May  6 21:08:08 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Tue Apr 12 10:37:39 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ruby.c (ruby_process_options): modified for DJGPP.
+	* include/ruby/win32.h: VC doesn't have ftruncate() and others, but
+	  ruby needs HAVE_ macros to use our emulation functions.
+	  (fix the problem of 31262)
 
-Wed May  6 15:48:03 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Apr 12 01:33:00 2011  Luis Lavena  <luislavena@gmail.com>
 
-	* experimental release 1.1b9_17.
+	* configure.in: properly evaluate existence of truncate, ftruncate
+	  and ftello for MinGW. [ruby-core:35678]
+	* win32/win32.c: rename truncate, ftruncate and ftello to avoid
+	  redefinitions.
+	* win32/win32.h: ditto.
 
-Wed May  6 01:37:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr 11 21:51:52 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c: remove global variable `errat'.
+	* io.c: revert r31230. Because it made a regression.
+	  [ruby-core:35631]
 
-	* eval.c (rb_longjmp): embed error position information in the
- 	  exception object.
+Mon Apr 11 21:49:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sat May  2 12:20:02 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_io.rb: Added TestIO#test_cross_thread_close_stdio
+	  and TestIO#test_cross_thread_close_fd.
+	  The patch was written by Eric Wong. [ruby-core:35669]
 
-	* re.c (reg_search): supports reverse search.
+Mon Apr 11 21:15:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (str_index_method): does update $~ etc.
+	* file.c (rb_group_member): kill 256K of stack usage.
+	  the patch was written by Eric Wong. [ruby-core:35699]
 
-	* eval.c (f_load): needed to clear the_dyna_vars.
+Mon Apr 11 07:24:13 2011  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (dyna_var_asgn): do not push dyna_var, which is id == 0.
+	* ext/openssl/ossl.c:  Fix typo, document version constants.
 
-	* error.c (Init_Exception): NotImplementError is no longer
-	  StandardError, which is not handled by default rescue.
+Sun Apr 10 22:23:45 2011  Tanaka Akira  <akr@fsij.org>
 
-Fri May  1 00:35:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* include/ruby/ruby.h: parenthesize macro arguments.
 
-	* ruby.c (proc_options): `-d' turns on verbose flag too.
+Sat Apr  9 23:31:47 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* error.c (exception): last argument may be the superclass of the
-	  defining exception(s).
+	* ext/stringio/stringio.c (strio_each, strio_readlines):
+	  Use `NUM2LONG` instead of `FIX2INT`. Fixes [ruby-dev:43395].
 
-	* io.c (Init_IO): EOFError is now subclass of the IOError.
+Sat Apr  9 23:22:27 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* io.c (Init_IO): forgot to define IOError.
+	* ext/stringio/stringio.c (strio_each):
+	  Fix exception message and don't raise immediately if block is not
+	  given.
+	  Fixes [ruby-dev:43394].
 
-	* error.c (Init_Exception): old Exception class renamed to
-	  StandardError.  Exception now replaces old GlobalExit.
+	* test/stringio/test_stringio.rb (test_each_line_limit_0):
+	  Fix test for above.
 
-	* error.c (Init_Exception): Exception is now the root of the
-	  Global Exits.  There's no longer GlobalExit class.
+Sat Apr  9 21:54:15 2011  Shota Fukumori  <sorah@tubusu.net>
 
-	* util.c (ruby_mktemp): check TMP, TMPDIR first.
+	* ext/stringio/stringio.c (strio_each, strio_readlines):
+	  limit must not be zero. Fixes [ruby-dev:43392].
 
-Thu Apr 30 01:08:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/stringio/test_stringio.rb: Add tests for above.
 
-	* lib/tk.rb: call 'unknown', if proc not defined.
+Sat Apr  9 18:01:36 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (handle_rescue): default rescue handles `Exceptional' not 
-	  only the instance of the `Exception's.
+	* include/ruby/util.h: parenthesize macro arguments.
 
-	* eval.c (f_raise): exception can be any object.
+Fri Apr  8 16:01:56 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* time.c (time_gm_or_local): call time_gmtime or time_localtime.
+	* ext/stringio/stringio.c (strio_getline): check whether str is
+	  a string when str and lim are given.
+	  https://twitter.com/watson1978/status/56225052152168449
 
-	* eval.c (f_raise): raises TypeError if the class which is not a
-	  subclass of String is specified (checked in exc_new()).
+Thu Apr  7 20:03:52 2011  Tanaka Akira  <akr@fsij.org>
 
-	* error.c (exc_new): need to check whether invalid class (not a
-	  subclass of String) is specified.
+	* include/ruby/io.h: parenthesize macro arguments.
 
-Wed Apr 29 21:05:44 1998  WATANABE Hirofumi  <eban@os.rim.or.jp>
+Wed Apr  6 21:08:31 2011  Tanaka Akira  <akr@fsij.org>
 
-	* ruby.c (proc_options): option '-e' via tempfile.
+	* include/ruby/intern.h: parenthesize macro arguments.
 
-Tue Apr 28 15:27:58 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Apr  6 15:12:40 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* experimental release 1.1b9_16.
+	* ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize):
+	  pop pushed error after each try of reading. fixes #4550
 
-Tue Apr 28 00:07:38 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
 
-	* eval.c (obj_is_proc): type check predicate.
+	* ext/openssl/ossl_pkey_ec.c (ossl_ec_initialize): ditto.
 
-	* eval.c (obj_is_block): ditto.
+Wed Apr  6 11:36:44 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Apr 27 16:59:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize):
+	  pop pushed error after each try of reading. fixes #4550
 
-	* ext/gtk/gtk.c (Init_gtk): use timeout, not idle to avoid
-	  comsuming CPU too much.
+Tue Apr  5 20:33:43 2011  Tanaka Akira  <akr@fsij.org>
 
-	* lib/tk.rb: use tcltklib#_invoke instead of `_eval'.
+	* include/ruby/encoding.h: parenthesize macro arguments.
 
-Mon Apr 27 16:59:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr  4 22:02:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* array.c (ary_sort): use dup, not clone.
+	* ext/io/nonblock/nonblock.c (io_nonblock_set): Avoid F_SETFL if
+	  we're not changing the O_NONBLOCK bit. F_SETFL is an expensive
+	  operation since it needs to affect all processes with the same
+	  file object.
+	  The patch is written by Eric Wong. [ruby-core:35556]
 
-Mon Apr 27 13:46:27 1998  Tadahiro Maebashi  <maebashi@iij.ad.jp>
+Mon Apr  4 21:41:26 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c (ip_invoke): invoke tcl command
-	  directly.  need not worry about escaping tcl characters.
+	* io.c (rb_io_syswrite): While local FS writes are usually
+	  buffered, the buffers can be full or the file opened with
+	  O_SYNC. IO#syswrite can also be used on blocking IOs
+	  (pipe/socket) just like IO#write.
+	  The patch is written by Eric Wong. [ruby-core:35554]
 
-Mon Apr 27 12:04:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Apr  4 11:50:40 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* random.c (f_rand): do not call srand() implicitly.
+	* test/test_tempfile.rb: simply ignore platform dependent testcases
+	  instead of skipping.
 
-Fri Apr 24 14:35:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Apr  3 22:52:22 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* experimental release 1.1b9_15.
+	* ext/syslog/syslog.c: improve rdoc.
+	  a patch by Jonas Pfenniger. [ruby-core:35592] fixes #4545
 
-	* parse.y (assignable): dyna_var_asgn actually defines nested
-	  local variables in outer context.
+Sun Apr  3 22:10:09 2011  Tanaka Akira  <akr@fsij.org>
 
-	* random.c (f_rand): call srand(), if it has not called yet.
+	* ext/zlib/zlib.c: parenthesize macro arguments.
 
-	* random.c (f_srand): use tv_usec as the default seed.
+Sun Apr  3 21:33:58 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (rb_eval): values of nested local variables should be
- 	  independent.
+	* configure.in: disable fdatasync again on Mac OS X.
+	  [ruby-core:35493][Bug #4500]
 
-	* eval.c (rb_yield_0): local variables wrong nested conditions.
+Sun Apr  3 21:16:20 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Apr 22 23:27:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (io_reopen): IO#close releases GVL if possible.
+	  close() may block for certain file types (NFS, SO_LINGER
+	  sockets, inotify), so let other threads run. The patch was
+	  created by Eric Wong [ruby-core:35555][Bug #4527]
 
-	* io.c (select_get_io): get IO object by `to_io'.
+	* io.c (fptr_finalize): ditto.
 
-	* io.c (io_to_io): method to retrieve IO object, from delegating
- 	  object for example.
+	* io.c (maygvl_fclose): new.
+	* io.c (nogvl_fclose): ditto.
+	* io.c (maygvl_close): ditto.
+	* io.c (nogvl_close): ditto.
 
-Wed Apr 22 16:52:37 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Apr  1 22:25:50 2011  Tanaka Akira  <akr@fsij.org>
 
-	* experimental release 1.1b9_14.
+	* ext/syslog/syslog.c: parenthesize macro arguments.
 
-	* string.c (str_modify): check for embedded pointer reference.
+Fri Apr 1 18:53:06 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* gc.c (obj_free): ditto.
+	* lib/webrick/cookie.rb (WEBrick::Cookie.parse): 'white space is
+	  permitted between tokens' according to RFC2965. Though 'Netscape
+	  spec' does not define the syntax clearly, make it tolerant as a
+	  server. As a real-world example, rest-client gem sends
+	  'Cookie: foo=1;bar=2'
 
-	* pack.c (pack_pack): p/P template to embed pointers.
+	* test/webrick/test_cookie.rb (test_parse_non_whitespace): test it.
 
-Wed Apr 22 00:07:10 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+Fri Apr  1 13:19:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (ary_rindex): embarrassing typo.
+	* vm_core.h (RUBY_VM_CHECK_INTS_TH): merge a patch by ko1
+	  in [ruby-dev:43373].
 
-Tue Apr 21 12:31:48 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Mar 31 23:15:46 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* experimental release 1.1b9_13.
+	* misc/ruby-mode.el (ruby-brace-to-do-end, ruby-do-end-to-brace):
+	  adjust space between block beginning and block arguments
 
-	* configure.in (RUBY_LIB): supports --program-{prefix,suffix}.
+Thu Mar 31 20:42:05 2011  Tanaka Akira  <akr@fsij.org>
 
-	* array.c (ary_rindex): new method.
+	* ext/strscan/strscan.c:  parenthesize macro arguments.
 
-	* io.c (io_binmode): should return self.
+Thu Mar 31 18:06:12 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-Tue Apr 21 08:23:04 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* vm_insnhelper.c (vm_get_ev_const): should ignore crefs with
+	  the NODE_FL_CREF_PUSHED_BY_EVAL flag.
 
-	* parse.y (here_document): calling parse_string with wrong
-	  arguments.
+Thu Mar 31 16:49:56 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* struct.c (struct_aset): problem member assignment with name.
+	* vm_insnhelper.c (vm_get_ev_const): search root cref properly.
+	  [ruby-dev:43365]
 
-Mon Apr 20 14:47:49 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Mar 31 14:50:25 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* experimental release 1.1b9_12.
+	* eval.c (rb_mod_s_constants): should ignore crefs with
+	  the NODE_FL_CREF_PUSHED_BY_EVAL flag.
 
-	* time.c (time_arg): args may be string (support for reduced
-	  implicit type conversion).
+Wed Mar 30 22:55:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/base64.rb: changed to use pack/unpack with `m' template.
+	* misc/ruby-mode.el (ruby-toggle-block): toggle do/end and {}.
 
-Mon Apr 20 06:23:20 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* misc/ruby-mode.el (ruby-move-to-block): move to opening of
+	  block.
 
-	* variable.c (mod_remove_const): new method.
+Wed Mar 30 14:35:15 2011  Shugo Maeda  <shugo@ruby-lang.org>
 
-Sat Apr 18 03:53:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_insnhelper.h (COPY_CREF): should copy
+	  the NODE_FL_CREF_PUSHED_BY_EVAL flag to hide constants from
+	  methods defined by class_eval.  [ruby-dev:43365]
 
-	* hash.c (hash_each_with_index): removed.  use Enumerable's
-	  each_with_index instead.
+Wed Mar 30 00:24:53 2011  Tanaka Akira  <akr@fsij.org>
 
-	* class.c (rb_include_module): check for super modules, since
- 	  module's included modules may be changed.
+	* ext/stringio/stringio.c: parenthesize macro arguments.
 
-Fri Apr 17 21:50:47 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Tue Mar 29 21:51:31 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
 
-	* marshal.c (r_long): r_byte() may return signed byte.
+	* object.c (rb_String): Kernel#String should call to_str before to_s.
 
-Fri Apr 17 11:58:30 1998  NAGAI Hidetoshi  <nagai@dumbo.ai.kyutech.ac.jp>
+Tue Mar 29 10:28:08 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c (lib_mainloop): thread and interrupt check.
+	* test/webrick/test_filehandler.rb
+	  (WEBrick::TestFileHandler#test_short_filename): the cgi doesn't exist
+	  on current directory.
 
-Fri Apr 17 11:06:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Mar 29 05:19:57 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (find_file): try to fopen() to check whether file exists.
+	* ext/socket/raddrinfo.c: parenthesize macro arguments.
 
-	* ruby.c (load_file): ditto.
+Tue Mar 29 00:03:51 2011 Tajima Akio <artonx@yahoo.co.jp>
 
-	* struct.c (struct_aset): struct member can be set by member name.
+	* test/webrick/test_filehandler.rb (test_short_filename):
+	  read real short filename by cmd because smb mounted files
+	  have different naming convention.
 
-Fri Apr 17 00:47:19 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Mon Mar 28 11:38:08 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/extmk.rb.in: added m68k-human support
+	* ext/date/date_core.c (date_s_today): use int for year.
 
-	* file.c (LOCK_SH): defines moved.
+	* ext/date/date_core.c (datetime_s_now): ditto.
 
-	* array.c (ary_flatten_bang): simplified loop.
+Mon Mar 28 11:07:41 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Apr 16 16:52:01 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/extmk.rb: set MFLAGS from MAKEFLAGS when using nmake.
 
-	* experimental release 1.1b9_11.
+Mon Mar 28 11:07:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/tk.rb: thread support (experimental - maybe slow).
+	* common.mk (love): all you need is love.
 
-	* eval.c (rb_longjmp): trace event on exception in raising
- 	  context, just before raising exception.
+Sun Mar 27 23:16:31 2011  Tanaka Akira  <akr@fsij.org>
 
-	* struct.c (struct_s_members): forgot to check singletons.
+	* ext/socket/ipsocket.c: parenthesize macro arguments.
 
-	* struct.c (struct_aref): members can be accessed by names too.
+Sun Mar 27 16:55:34 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (ary_flatten): new method.
+	* misc/ruby-mode.el (ruby-mode-map): remove unnecessary
+	  binding. fixes
+	  http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=468952
 
-	* eval.c (rb_longjmp): prints exception information with `-d'.
+	* misc/ruby-mode.el: suppress warnings at byte compile.  fixes
+	  http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=502926
 
-	* object.c (any_to_s): remove class name restriction.
+Sun Mar 27 11:18:35 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Thu Apr 16 01:38:02 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/date/date_core.c: removed unused variables.
 
-	* file.c (thread_flock): do not block other threads.
+Sat Mar 26 15:16:09 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (thread_trap_eval): signals are now delivered to the
- 	  current thread again.  In case that the current thread is dead,
- 	  signals are forwarded to the main thread.
+	* ext/socket/getaddrinfo.c: parenthesize macro arguments.
 
-	* string.c (str_new4): need not to duplicate frozen strings.
+Sat Mar 26 05:27:34 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Apr 15 08:33:47 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* ext/date/lib/date/format.rb (DateTime#strftime): removed because
+	  date_core defines it.
 
-	* struct.c (struct_inspect): remove restriction for struct names.
+Fri Mar 25 21:59:45 2011  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Wed Apr 15 02:55:02 1998  Kazuya 'Sharl' Masuda  <sharl@www.ufo.co.jp>
+	* ext/date/date_core.c: should not force cast with macros.
 
-	* x68 patches to config.sub, ext/extmk.rb.in
+Fri Mar 25 21:56:10 2011  Tanaka Akira  <akr@fsij.org>
 
-Wed Apr 15 01:22:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/sdbm/init.c: parenthesize macro arguments.
 
-	* string.c (str_dup_frozen): do not duplicate frozen strings.
+Fri Mar 25 19:39:40 2011  Ben Walton <bwalton@artsci.utoronto.ca>
 
-	* parse.y (yylex): allow nested parenthesises.
+	* test/test_syslog.rb:
+	  Skip syslog tests that rely on LOG_PERROR unless it's defined
 
-	* io.c (obj_displayln): prints newline after `display'ing the
+	  Instead of checking looking at the platform to determine if the tests
+	  relying on LOG_PERROR should be run, look for the definition of the
+	  constant as this will be robust against all platforms as long as the
+	  underlying syslog.c code sets it up correctly.
+
+	  This specifically addresses failures on Solaris 9.
+
+	  Use LOG_PID instead of LOG_PERROR in Syslog.open test
+
+	  LOG_PERROR isn't a POSIX option for syslog, so it fails on platforms
+	  that don't define it.  Solaris 9 and 10 are examples of this.
+
+	  Use LOG_PID instead.
+
+Fri Mar 25 15:42:17 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/sdbm/_sdbm.c (sdbm_open): use size_t.
+
+	* ext/syck/bytecode.c: ditto.
+
+	* ext/sdbm/_sdbm.c (delpair): use ptrdiff_t.
+
+	* ext/sdbm/init.c: use RSTRING_LENINT.
+
+	* ext/dl/handle.c: suppress warning: shorten-64-to-32.
+
+	* ext/strscan/strscan.c: ditto.
+
+	* ext/syck/emitter.c: ditto.
+
+	* ext/syck/implicit.c: ditto.
+
+	* ext/syck/syck.c: ditto.
+
+	* ext/syck/token.c: ditto.
+
+Fri Mar 25 12:14:58 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: import nkf 7f18e30.
+
+Fri Mar 25 11:49:29 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_process.rb (TestProcess#test_no_curdir): skip silently
+	  on Windows, because this tests a platform specific feature and it'll
+	  never be supported on ruby on Windows.
+
+	* test/ruby/test_dir_m17n.rb
+	  (TestDir_M17N#test_filename_extutf8_invalid,
+	  TestDir_M17N#test_filename_as_bytes_extutf8): ditto.
+
+	* test/open-uri/test_open-uri.rb
+	  (TestOpenURI#test_find_proxy_case_sensitive_env): ditto.
+
+	* test/dl/test_handle.rb (DL::TestHandle#test_NEXT,
+	  DL::TestHandle#test_DEFAULT): ditto.
+
+Thu Mar 24 23:06:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_get_ev_const): should not autoload in
+	  defined? mode.
+
+	* variable.c (rb_const_defined_0): fix autoloading base.
+	  [ruby-core:35509]
+
+Thu Mar 24 22:48:43 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/sdbm/_sdbm.c: parenthesize macro arguments.
+
+Thu Mar 24 14:45:57 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl.c: suppress warning: shorten-64-to-32.
+
+	* ext/openssl/ossl.h: ditto.
+
+	* ext/openssl/ossl_asn1.c: ditto.
+
+	* ext/openssl/ossl_bio.c: ditto.
+
+	* ext/openssl/ossl_bn.c: ditto.
+
+	* ext/openssl/ossl_cipher.c: ditto.
+
+	* ext/openssl/ossl_hmac.c: ditto.
+
+	* ext/openssl/ossl_ns_spki.c: ditto.
+
+	* ext/openssl/ossl_ocsp.c: ditto.
+
+	* ext/openssl/ossl_pkcs5.c: ditto.
+
+	* ext/openssl/ossl_pkey.c: ditto.
+
+	* ext/openssl/ossl_pkey_dh.c: ditto.
+
+	* ext/openssl/ossl_pkey_dsa.c: ditto.
+
+	* ext/openssl/ossl_pkey_ec.c: ditto.
+
+	* ext/openssl/ossl_pkey_rsa.c: ditto.
+
+	* ext/openssl/ossl_rand.c: ditto.
+
+	* ext/openssl/ossl_ssl.c: ditto.
+
+	* ext/openssl/ossl_x509ext.c: ditto.
+
+	* ext/openssl/ossl_x509name.c: ditto.
+
+Thu Mar 24 11:48:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_rand.c (ossl_rand_egd_bytes): use NUM2INT because
+	  the result is used with functions whose argument is int.
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): ditto.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_purpose): ditto.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_trust): ditto.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509stctx_set_purpose): ditto.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509stctx_set_trust): ditto.
+
+Thu Mar 24 11:36:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_x509name.c: id_aref's type is ID.
+
+Thu Mar 24 10:04:35 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/io/console/console.c (console_set_winsize):
+	  suppress warning: shorten-64-to-32.
+
+Thu Mar 24 09:56:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_verify): flags is VALUE,
+	  so it should use NUM2INT.
+
+	* ext/openssl/ossl_ocsp.c (ossl_ocspbres_verify): ditto.
+
+Wed Mar 23 21:09:29 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/readline/readline.c: parenthesize macro arguments.
+
+Wed Mar 23 08:07:33 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (flo_round): fix inaccurate results.
+
+Wed Mar 23 00:12:16 2011  Tajima Akio <artonx@yahoo.co.jp>
+
+	* win32/win32.c: wait process real termination after reading
+	  exit code. fixes #4518
+
+Tue Mar 22 21:20:10 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/rubygems/test_case.rb: save current dir to @current_dir
+	  before Dir.chdir.
+
+Tue Mar 22 20:10:04 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/psych/parser.c: parenthesize macro arguments.
+
+Tue Mar 22 20:10:01 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ruby_missing.h: parenthesize macro arguments.
+
+Tue Mar 22 13:33:22 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/buffering.rb: removed circular require of
+	  openssl.rb.
+
+	* ext/openssl/lib/openssl/*: removed following comment for transition
+	  measures of avoiding circular require. No one claimed about this as
+	  far as I know.
+	  ##
+	  # Should we care what if somebody require this file directly?
+	  # require "openssl"
+
+Tue Mar 22 10:57:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/runner.rb: set Gem::TestCase's @@project_dir.
+
+	* lib/rubygems/test_case.rb: set Gem::TestCase's @@project_dir only
+	  when it is not defined.
+
+Tue Mar 22 09:38:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (flo_round): use pow instead of while-loop. fixes #4510
+	  patched by Alex Young [ruby-core:35526]
+
+Tue Mar 22 06:47:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/date/date_strftime.c (date_strftime_wo_timespec):
+	  suppress warning: shorten-64-to-32.
+
+Tue Mar 22 06:42:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/date/date_core.c: suppress warning: shorten-64-to-32.
+
+Tue Mar 22 06:41:37 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/test/unit/parallel.rb: remove unused variable.
+
+Tue Mar 22 06:19:42 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/utf_16le.c: suppress warning: shorten-64-to-32.
+
+	* ext/dbm/dbm.c: ditto.
+
+	* ext/gdbm/gdbm.c: ditto.
+
+	* parse.y (Init_ripper): suppress warning: unused value.
+
+Mon Mar 21 11:21:32 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb: Refactoring. Unified if and elsif.
+
+Sun Mar 20 23:09:34 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_strftime.c: checks duplicated modifiers.
+
+Sun Mar 20 22:32:30 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_strftime.c: removed unused code and arguments.
+
+Sun Mar 20 21:34:49 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: replacement of implementation of
+	  strftime. It has some limitations that is same as Time's
+	  one.  [experimental]
+	* ext/date/date_strftime.c: new.
+	* ext/date/lib/date/format.rb: removed ruby version of strftime.
+
+Sun Mar 20 12:43:12 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509store.c: parenthesize macro arguments.
+
+Sun Mar 20 01:39:48 2011  Tajima Akio <artonx@yahoo.co.jp>
+
+	* hash.c (ruby_setenv): check env process block size with OS ver.
+	* win32/win32.c: export rb_w32_osver for above patch.
+	* include/ruby/win32.h: declare rb_w32_osver for Win32 Libs.
+
+Sat Mar 19 18:35:05 2011  Tajima Akio <artonx@yahoo.co.jp>
+
+	* hash.c (ruby_setenv): calculate total env block size for win32.
+	* test/ruby/test_env.rb: add test for above patch.
+
+Sat Mar 19 17:14:46 2011  Tajima Akio <artonx@yahoo.co.jp>
+
+	* hash.c (ruby_setenv): checking with max process environment
+	  block size for Win32. 32767 for 2000/XP, 2003. if failed to
+	  read the block, then checking with 5120 for earlier Windows.
+
+Sat Mar 19 12:30:25 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509revoked.c: parenthesize macro arguments.
+
+Fri Mar 18 20:44:36 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509req.c: parenthesize macro arguments.
+
+Fri Mar 18 08:48:06 2011  Oleg Shaldybin  <oleg.shaldybin@gmail.com>
+
+	* lib/fileutils.rb (FileUtils::Entry_#copy_file): updated FileUtils.cp
+	  to still copy file permissions when :preserve is false (as cp does
+	  this even when -p isn't set).
+
+Fri Mar 18 00:59:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32ole/extconf.rb (create_docfile): removed.  should not
+	  modify source directory unnecessarily, platform dependent
+	  documentation should be dealt with by rdoc.  [ruby-core:35495]
+
+Fri Mar 18 00:54:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (rb_funcall_passing_block): add prototype.
+	  a patch by James M. Lawrence at [ruby-core:35501]
+
+Wed Mar 17 06:23:31 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509name.c: parenthesize macro arguments.
+
+Wed Mar 16 20:36:56 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/ipsocket.c (init_inetsock_internal): raise an error on
+	  listen(2) failure.
+	  reported by Xavier Shay.  [ruby-core:35505]
+
+Wed Mar 16 15:06:21 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/openssl/lib/openssl/buffering.rb (module OpenSSL): #flush should
+	  not change sync mode on exception.
+	* test/openssl/test_buffering.rb: added
+
+Wed Mar 16 13:45:28 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/openssl/lib/openssl/buffering.rb: de-nest Buffering module
+
+	* ext/openssl/lib/openssl/buffering.rb: add RDoc
+
+Wed Mar 16 08:40:39 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509ext.c: parenthesize macro arguments.
+
+Tue Mar 15 18:34:27 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509crl.c: parenthesize macro arguments.
+
+Tue Mar 15 09:49:03 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/misc/test_ruby_mode.rb (test_singleton_class): Skip for Pending.
+
+Mon Mar 14 21:20:44 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* test/ruby/test_require.rb (test_require_too_long_filename):
+	  increase path length, because MAXPATHLEN is defined as 4096 on linux.
+
+	* test/ruby/test_require.rb (test_require_path_home_1): ditto.
+
+	* test/ruby/test_require.rb (test_require_path_home_2): ditto.
+
+Mon Mar 14 19:54:37 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509cert.c: parenthesize macro arguments.
+
+Sun Mar 13 18:11:28 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_x509attr.c: parenthesize macro arguments.
+
+Sun Mar 13 16:07:58 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/pstore.rb: Fix don't raise "nested transaction" when thread_safe
+	  is true. Patch by Masaki Matsushita (Glass_saga). [ruby-dev:43337]
+
+	* test/test_pstore.rb: Test for above.
+	  Patch by Masaki Matsushita (Glass_saga) [ruby-dev:43337]
+
+Sat Mar 12 04:12:41 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_ssl_session.c: parenthesize macro arguments.
+
+Sat Mar 12 02:27:07 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c ({d,dt}_lite_marshal_load): checks the given
+	  argument.
+
+Sat Mar 12 01:26:24 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c: changed some directives.
+
+Sat Mar 12 01:16:02 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/date_core.c, ext/date/lib/*: moved rdoc descriptions.
+
+Sat Mar 12 00:06:24 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* ext/date/lib: moved from lib.
+
+Fri Mar 11 23:32:38 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date/delta*: removed undocumented delta.
+
+Fri Mar 11 18:42:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (find_executable0): should exclude directories.
+
+Fri Mar 11 01:40:35 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (proc_getmaxgroups, proc_setmaxgroups): Process#maxgroups
+	  and Process#maxgroups= now raise NotImplementedError if the
+	  platform don't support supplementary groups concept.
+
+Fri Mar 11 01:25:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (get_sc_ngroups_max): return -1 if platform don't
+	  support NGROUPS_MAX.
+
+Thu Mar 10 22:28:15 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_ssl.h: parenthesize macro arguments.
+
+Thu Mar 10 21:59:37 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* parse.y (parser_encode_length): add exception as UTF8-MAC for
+	  magic comment's emacs newline specifier
+	  patched by James M. Lawrence [ruby-core:35476] fixes #4489
+
+Thu Mar 10 16:00:22 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* parse.y (parser_encode_length): fix typo: the length of
+	  "-dos" and "-mac" is not 5 but 4.
+	  patched by James M. Lawrence [ruby-core:35476] fixes #4489
+
+Thu Mar 10 10:52:01 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_require.rb: setting too long string to ENV causes
+	  Errno::EINVAL on Windows.  long path name errors may causes over
+	  about 1024 bytes, then limit it about 4000 bytes.
+
+Thu Mar 10 10:09:35 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/test/unit.rb (Test::Unit::Runner::Worker#read): fix for the case
+	  when IO#read or IO#gets returns nil.
+
+Thu Mar 10 07:12:03 2011  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* lib/rubygems*: Import rubygems 1.6.2 (release candidate @ 2026fbb5)
+	* test/rubygems: Ditto
+	* test/runner.rb: Added test to load path to fix test requires.
+
+Thu Mar 10 03:00:43 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_ssl.c: parenthesize macro arguments.
+
+Wed Mar  9 23:51:26 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* test/ruby/test_io_m17n.rb (test_io_new_enc): "sjis" is now an alias
+	  of Windows-31J.
+
+Wed Mar  9 23:06:13 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-parse-partial): fix indent after aref.
+
+Wed Mar  9 12:50:24 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: Rescue exceptions when
+	  people implement the method method. Thanks Lin Jen-Shin.
+	  [ruby-core:35255]
+
+	* test/psych/visitors/test_yaml_tree.rb: test for implementation of
+	  method method.
+
+Wed Mar  9 11:53:31 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/shift_jis.c: Change SJIS as an alias of Windows-31J.
+	  [ruby-dev:43027] fixes #4280
+
+	* enc/shift_jis.c: Add PCK as an alias of Windows-31J.
+
+Wed Mar  9 00:45:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: nmake substitutes all occurrences in macro.
+
+	* ext/extmk.rb: workaround for nmake.
+
+Tue Mar  8 23:49:45 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (proc_setgroups): cleanup.
+
+Tue Mar  8 23:40:30 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/misc/test_ruby_mode.rb: test for ruby-mode.el.
+
+Tue Mar  8 23:27:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (get_sc_ngroups_max): try to use NGROUPS_MAX at first if
+	  _SC_NGROUP_MAX is not defined.
+
+Tue Mar  8 23:10:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-parse-partial): fix for array in block.
+
+Tue Mar  8 21:44:49 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_rand.c: parenthesize macro arguments.
+
+Tue Mar  8 16:45:31 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* hash.c (ruby_setenv): MSDN says that Windows XP or earlier limits
+	  the total size of environment block to 5,120 chars.  and on such
+	  OS, putenv() causes SEGV.  So, ruby should limit the size of an
+	  environment variable to 5,120 bytes for workaround.
+
+Tue Mar  8 15:57:20 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/rubygems/test_gem_spec_fetcher.rb
+	  (TestGemSpecFetcher#test_cache_dir_escapes_windows_paths): cache_dir
+	  may have driveletter and `:' for base of cache_dir itself, so need
+	  to skip it for checking.
+
+Tue Mar  8 12:30:06 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-deep-indent-paren-p, ruby-calculate-indent):
+	  do not apply deep-indent inside parens at the beginning of
+	  expressions.
+
+Tue Mar  8 09:32:48 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (configure-ext, build-ext), ext/extmk.rb (extmake):
+	  support parallel-make under ext.
+
+Tue Mar  8 09:25:23 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (proc_setgroups): use getgrnam() if getgrnam_r() is
+	  not available.
+
+	* process.c: RARRAY_LEN() returns long int.
+
+Tue Mar  8 09:07:03 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_REPLACE_TYPE): enclose in quotes for multiple
+	  type names.
+
+Tue Mar  8 01:43:11 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* process.c (get_sc_ngroups_max): define to wrap sysconf(3).
+	  this also supports Windows which doesn't have sysconf(3).
+
+	* process.c (maxgroups): use get_sc_ngroups_max.
+
+	* process.c (proc_setmaxgroups): ditto.
+
+Tue Mar  8 01:16:49 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* gc.c (rb_objspace): an initializer must be a constant.
+
+Tue Mar  8 01:11:44 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* process.c (maxgroups): cast because sysconf(3)'s return value is long.
+
+	* process.c (proc_setmaxgroups): ditto.
+
+	* process.c (proc_setgroups): cast because RARRAY_LEN() is long.
+
+Tue Mar  8 00:02:47 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_pkey_rsa.c: parenthesize macro arguments.
+
+Mon Mar  7 22:59:39 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/pstore.rb: Delete variable @transaction and fix #4474. Patch by
+	  Masaki Matsushita (Glass_saga).
+
+	* test/test_pstore.rb(test_thread_safe): Add test for #4474.
+
+Mon Mar  7 21:31:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (proc_setgroups): replace getgrnam() with getgrnam_r()
+	  because getgrnam() isn't thread safe.
+
+Mon Mar  7 20:49:12 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (proc_getmaxgroups, proc_setmaxgroups): reflect
+	  platform maxgroups limitation by default instead hardcoded 65536.
+
+Mon Mar  7 17:13:00 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (rb_gc_set_params): allow GC parameter configuration by
+	  environment variables.  based on a patch from funny-falcon at
+	  https://gist.github.com/856296, but honors safe level.
+
+Mon Mar  7 09:05:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c: NUM2RLIM is defined but no getrlimit and setrlimit on
+	  mingw.
+
+Mon Mar  7 08:38:14 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/date_core.c (DateTimeData): should not use bare 'long long'
+	  and 'long double', which are not defined by C89.
+
+	* ext/date/date_core.c (dt_lite_plus): get rid of overflow at casting
+	  down double to integer.
+
+Mon Mar  7 00:21:11 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (proc_getgroups): get rid of maxgroups dependency.
+	  ngroups can be calculated dynamically.
+
+Sun Mar  6 23:45:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: rlim_t use standard RUBY_REPLACE_TYPE mechanism.
+
+Sun Mar  6 23:26:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (proc_setmaxgroups): added negative value check.
+	  This was suggested by Daniel Berger. Thanks Daniel!
+	  [ruby-core:35426][Bug#4467]
+
+Sun Mar  6 23:18:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (maxgroups, proc_setmaxgroups): increase max groups
+	  limitation up to 65536.
+
+Sun Mar  6 22:20:59 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_pkey_ec.c: parenthesize macro arguments.
+
+Sun Mar  6 21:49:04 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* sample/list.rb (MyElem#initialize): initialize @head
+	  explicitly. Otherwise -W2 option makes following warning.
+	  "warning: instance variable @head not initialized".
+	  This issue was founded by Andrew Grimm. Thanks Andrew!
+	  [ruby-core:35435][Bug#4471]
+
+Sun Mar  6 05:21:41 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* class.c: fix camelCase to snake_case in documentation code examples.
+	  patched by Andrew Grimm. fixes Bug #4469
+
+	* marshal.c: ditto.
+
+	* proc.c: ditto.
+
+	* sample/biorhythm.rb: ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_method.c: ditto.
+
+
+Sun Mar  6 03:22:27 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (io_cntl): use rb_thread_io_blocking_region() instead
+	  rb_thread_blocking_region().
+
+Sat Mar  5 22:54:36 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* include/ruby/intern.h: fix a typo of prototype declaration.
+	  rb_mutex_try_lock -> rb_mutex_trylock [ruby-dev:43213]
+
+Sat Mar  5 19:44:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_io.rb (TestIO#test_fcntl_lock): small clean up.
+
+Sat Mar  5 01:33:46 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (io_cntl, nogvl_io_cntl): IO.fcntl() and IO.ioctl()
+	  release GVL during calling kernel interface.
+	  Suggested by Eric Wong. [ruby-core:35417][Bug #4463]
+
+	* test/ruby/test_io.rb (TestIO#test_fcntl_lock): add new test for
+	  IO.fcntl().
+
+Fri Mar  4 23:09:12 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* test/testunit/test_parallel.rb
+	  (test_should_run_all_without_any_leaks): consider that the order of
+	  testcase could change. [ruby-dev:43300] [Bug #4466]
+
+Fri Mar  4 22:01:14 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (io_cntl): change 'cmd' type to int. ioctl and fcntl need to
+	  be passed int.
+	* io.c (rb_io_ctl): ditto.
+
+Fri Mar  4 21:10:40 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: save warnflags. the patch is created by Eric Wong.
+	  [Bug #4465]
+
+Wed Mar  2 21:15:00 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_pkey_dsa.c: parenthesize macro arguments.
+
+Thu Mar  3 22:10:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c (check_exec_redirect_fd, check_exec_redirect): raise
+	  ArgumentError if fd >= 3 on Windows because the feature is not
+	  supported.
+
+	* test/ruby/test_process.rb (test_execopts_redirect): remove meaningless
+	  argument.
+
+Thu Mar  3 21:21:42 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_process.rb (test_execopts_redirect): redirecting fd
+	  >= 3 is not supported on Windows, so should not specify such options
+	  when calling spawn or others.
+
+Thu Mar  3 18:59:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_slice_bang): raise error when the string is frozen.
+
+Thu Mar  3 14:25:19 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* strftime.c (STRFTIME): return 0 and ERANGE when precision is too
+	  large. [ruby-dev:43284] fixes #4456
+
+Thu Mar  3 00:46:51 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* addr2line.c (uleb128): cast the value to unsigned long.
+
+	* addr2line.c (fill_lines): print error when lseek fails.
+
+Thu Mar  3 00:36:29 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/rexml/encoding.rb (REXML::Encoding#encoding=): store @encoding
+	  a String which means the name of the encoding.
+	  this partially revert r29646.
+
+	* lib/rexml/document.rb: follow above.
+
+	* lib/rexml/output.rb: ditto.
+
+	* lib/rexml/parsers/baseparser.rb: ditto.
+
+	* lib/rexml/source.rb: ditto.
+
+	* lib/rexml/xmldecl.rb: ditto.
+
+Wed Mar  2 23:19:56 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_byte_substr): return nil for negative length.
+
+Wed Mar  2 21:15:00 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_pkey_dh.c: parenthesize macro arguments.
+
+Wed Mar  2 14:24:04 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit/parallel.rb: Fix name from `inclement_io` to
+	  `increment_io`.
+
+Wed Mar  2 14:06:01 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_slice_bang): move treatments which is only needed
+	  when the result is not nil.
+
+Wed Mar  2 14:02:29 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/testunit/test_parallel.rb(TestParallel#spawn_runner):
+	  Fix outputing empty line in running test.
+
+	* test/testunit/tests_for_parallel/test_third.rb: Remove `sleep`
+
+Tue Mar  1 22:29:10 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_pkey.h: parenthesize macro arguments.
+
+Tue Mar  1 22:02:35 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit/parallel.rb: Fix number.
+
+Tue Mar  1 21:48:22 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit/parallel.rb: For Windows.
+
+	* test/testunit/test_parallel.rb(TestParallelWorker#test_quit_in_test):
+	  Fix for above specification change.
+	* test/testunit/test_parallel.rb(TestParallel#spawn_runner):
+	  Fix outputing empty line in running test.
+
+Tue Mar  1 20:51:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_system.rb (TestSystem#test_system_at):
+	  remove tests for [bug#4396]. because we decided to reject this
+	  ticket.
+
+Tue Mar  1 19:46:19 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* test/date/{test_date.rb,test_date_attr.rb}: [ruby-dev:43280]
+
+Tue Mar  1 18:40:38 2011  Ryan Davis  <ryan@YPCMC09457>
+
+	* lib/rubygems*: Import rubygems 1.6.0 (released version @ 58d8a0b9)
+	* test/rubygems: Ditto
+
+Tue Mar  1 16:22:22 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c: revert r30987 because it causes some failures in
+	  test-all, especially webrick.
+
+Tue Mar  1 15:59:53 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_byteslice): the resulted encoding should keep
+	  original encoding. this also fixes the encoding when the result
+	  shares internal string. [ruby-core:35376]
+
+Tue Mar  1 13:25:00 2011  Kenta Murata <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (VpMemAlloc): CVE-2011-0188.
+	  Fixes a bug reported by Drew Yao <ayao at apple.com>
+
+Tue Mar  1 10:34:39 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_byteslice): Add String#byteslice. [ruby-core:35376]
+
+Tue Mar  1 00:12:49 2011  Tajima Akio <artonx@yahoo.co.jp>
+
+	* include/ruby/win32.h: define WIN32 if neither _WIN64 nor WIN32
+	  defined. it forces to use push/pop for pack(4) pragma.
+
+Mon Feb 28 23:52:13 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* test/testunit/test_rake_integration.rb (test_with_rake_runner):
+	  use assert_in_out_err for suppress messages.
+
+Mon Feb 28 22:48:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* win32/win32.c (rb_w32_spawn): use shell if a commandline contain
+	  double-quote character.
+	* win32/win32.c (is_internal_cmd): similar, use shell if a commandline
+	  contain caret character.
+
+	* test/ruby/test_system.rb (TestSystem#test_system_at): fix
+	  wrong test case. if system() invoke a command by using shell,
+	  system() never return nil. Also, "" quotation must not appear
+	  twice in a command line.
+
+Mon Feb 28 17:36:57 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_pkcs7.c: parenthesize macro arguments.
+
+Mon Feb 28 16:48:42 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_pkcs12.c: parenthesize macro arguments.
+
+Mon Feb 28 16:28:15 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (tr_trans): when the hash for multibyte repl is empty,
+	  tr is inverse mode, and a character doesn't much the table, the
+	  character should be replaced by last replacement. Bug #4449
+
+Mon Feb 28 16:38:56 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_ocsp.c: parenthesize macro arguments.
+
+Mon Feb 28 13:02:15 2011  Danial Pearce <github@tigris.id.au>
+
+	* lib/tempfile.rb: Fix example file paths in docs for tempfile.
+	  https://github.com/ruby/ruby/pull/5
+
+Mon Feb 28 12:56:18 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_init): typo fix.
+	  https://github.com/ruby/ruby/pull/8
+
+Mon Feb 28 12:28:13 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/date/date_core.c (datetime_s_now): localtime() and localtime_r()
+	  required time_t pointer as 1st parameter, and tv_sec member of struct
+	  timeval is long.
+
+Mon Feb 28 11:57:40 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/testunit/test_parallel.rb: Temporally disable test on Windows.
+
+Mon Feb 28 07:28:35 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb(Test::Unit::Runner#after_worker_quit):
+	  method name more be natural English.
+
+	* lib/test/unit.rb(Test::Unit::Runner::Worker.launch):
+	  IO.sync doesn't need. Should use "b" for mode.
+
+Sun Feb 27 21:59:37 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_system.rb (TestSystem#test_system_redirect_win):
+	  add test for system().
+
+Sun Feb 27 18:00:09 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb: Refactoring; Worker never use Hash for internal
+	  storage.
+
+	* lib/test/unit.rb: Never use Kernel#spawn. Use IO.popen instead.
+
+Sun Feb 27 13:16:48 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_ns_spki.c: parenthesize macro arguments.
+
+Sat Feb 26 17:07:53 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb: [Feature #4257]
+
+	* ext/date/extconf.rb: new
+
+	* ext/date/date_core.c: new
+
+Sat Feb 26 16:10:23 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb: --jobs-status won't puts over 2 lines.
+
+	* test/testunit/test_parallel.rb: Fix test for above.
+
+	* lib/test/*: refactoring.
+
+Sat Feb 26 07:10:05 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/scalar_scanner.rb: fix parsing timezone's whose
+	  whose format is (+/-)hhmm.  Thanks Goncalo Silva!
+
+	* test/psych/test_scalar_scanner.rb: test for bug.
+
+Thu Feb 24 23:02:55 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_hmac.c: parenthesize macro arguments.
+
+Thu Feb 24 22:53:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (love): for the birthday.
+
+Thu Feb 24 22:51:54 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (ruby_vm_destruct): run vm exit hooks after all objects are
+	  destructed.
+
+Thu Feb 24 14:40:33 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* ChangeLog (vim): Modeline for vim
+
+Thu Feb 24 13:39:25 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* common.mk: Use $RUNRUBY for worker process.
+
+	* lib/test/unit.rb: Fix bug.
+
+	* lib/test/unit.rb: @options[:ruby](@opts[:ruby]) is now Array.
+
+	* test/testunit/parallel.rb: Fix for above.
+
+Thu Feb 24 10:05:55 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/testunit/tests_for_parallel/misc.rb: Fix bug in r30947.
+
+	* lib/test/unit.rb, lib/test/unit/assertions.rb: For this test.
+
+Wed Feb 23 23:07:38 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* test/testunit/test_parallel.rb, test/testunit/parallel/*:
+	  Test for r30939.
+
+	* lib/test/unit.rb: For test.
+
+	* lib/test/parallel.rb: For test.
+
+	* lib/test/unit/testcase.rb: For test.
+
+Wed Feb 23 22:05:13 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_engine.c: parenthesize macro arguments.
+
+Tue Feb 22 23:15:17 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb: Fix --ruby option doesn't effect.
+
+	* lib/test/unit.rb: Fix typo.
+
+Tue Feb 22 21:39:28 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_digest.c: parenthesize macro arguments.
+
+Tue Feb 22 14:34:26 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb: Fix merging miss.
+
+Tue Feb 22 12:27:26 2011  Shota Fukumori  <sorah@tubusu.net>
+
+	* lib/test/unit.rb: Add new options; --jobs,-j,--ruby,--jobs-status,
+	  --no-retry.
+	  [Feature #4415] [ruby-dev:43226],[ruby-dev:43222],[ruby-core:35294]
+
+	* lib/test/unit/parallel.rb: Used at test/unit --jobs(-j) option.
+
+	* test/csv/test_serialization.rb: test/unit parallel running ready.
+
+	* test/rake/test_file_task.rb: test/unit parallel running ready.
+
+Tue Feb 22 06:09:10 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* ext/syslog/syslog.c: Apply documentation patch from mathew murphy.
+	  [Bug #4149]
+
+Tue Feb 22 03:09:10 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: increase Psych to 1.1.0 for help with
+	  debugging.
+
+Tue Feb 22 03:04:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/streaming.rb: refactor streaming methods to a
+	  module.
+	* ext/psych/lib/psych/stream.rb: extracted streaming specific methods
+	  to a module.
+	* ext/psych/lib/psych/json/stream.rb: JSON stream inherits from
+	  JSONTree and includes streaming methods.
+	* ext/psych/lib/psych/visitors/json_tree.rb: JSON does not support
+	  object references, so remove object reference testing when building
+	  JSON trees.
+
+Tue Feb 22 02:41:51 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb (accept): use Hash#key?
+	  when looking up object references to err on the side of cache
+	  misses.
+
+Mon Feb 21 10:58:39 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/json/yaml_events.rb: refactoring JSON event
+	  handling methods to a module for reuse.
+	* ext/psych/lib/psych/json/tree_builder.rb: AST builder uses JSON
+	  event methods.
+	* ext/psych/lib/psych/json/stream.rb: stream emitter uses JSON event
+	  methods.
+
+Mon Feb 21 10:54:29 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/json/stream.rb: do not emit custom tags in maps
+	  or sequences when emitting JSON.
+	* ext/psych/lib/psych/json/tree_builder.rb: do not emit custom tags in
+	  sequences when emitting JSON.
+	* test/psych/json/test_stream.rb: tests for custom stream emits.
+	* test/psych/test_json_tree.rb: tests for JSON emits.
+
+Mon Feb 21 10:05:10 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/json/ruby_events.rb: DRY up ruby event handling
+	  for JSON.
+	* ext/psych/lib/psych/visitors/json_tree.rb: use ruby events module
+	* ext/psych/lib/psych/json/stream.rb: ditto
+
+Mon Feb 21 10:01:01 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/json/stream.rb: fix JSON stream emits to use
+	  double quotes during stream.
+	* test/psych/json/test_stream.rb: tests to reflect changes.
+
+Mon Feb 21 00:38:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_system.rb (TestSystem#test_system_at):
+	  add testcase for bug4396.
+
+Sun Feb 20 19:59:32 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_cipher.c: parenthesize macro arguments.
+
+Sun Feb 20 16:26:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (exec_recursive): prevent temporary objects from GC.
+
+	* prevent temporary objects from GC, and should not use
+	  RSTRING_PTR() for function calls since it evaluates the argument
+	  a couple of times.
+
+Sun Feb 20 16:22:53 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_flock): use rb_thread_io_blocking_region for the
+	  time being.
+
+Sun Feb 20 05:33:17 2011  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* lib/minitest/*.rb: Imported minitest 2.0.2 r6207.
+	* test/minitest/*: ditto
+
+Sun Feb 20 02:14:09 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* signal.c (sig_trap): avoid pthread_sigmask(xx, &mask, &mask) usage
+	  because FreeBSD don't permit it. If it's used, it behave as
+	  pthread_sigmask(xx, NULL, &mask).
+
+	* signal.c (init_sigchld): ditto.
+
+Sun Feb 20 00:46:51 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl_bn.c: parenthesize macro arguments.
+
+Sat Feb 19 22:37:42 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* vm_insnhelper.c (vm_check_if_namespace): guard temporary object
+	  from GC.
+
+Sat Feb 19 06:36:27 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* lib/test/unit.rb: partial revert of r30849. [ruby-core:32864]
+
+	* test/testunit/test_rake_integration.rb: adding an integration test
+	  with the rake loader to prevent regressions.
+
+Fri Feb 18 19:31:31 2011  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/fileutils.rb (FileUtils::remove_entry_secure): there is a
+	  race condition in the case where the given path is a directory,
+	  and some other user can move that directory, and create a
+	  symlink while this method is executing.
+	  Reported by: Nicholas Jefferson <nicholas at pythonic.com.au>
+
+Fri Feb 18 00:28:39 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* compile.c (get_exception_sym2type): guard temporary object from GC.
+
+Thu Feb 17 23:54:29 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* iseq.c (prepare_iseq_build): initialize iseq_compile_data::err_info
+	  with nil. this fix exception in rb_iseq_load().
+
+Thu Feb 17 22:32:35 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* test/ruby/test_marshal.rb (test_marshal_dump_extra_iv):
+	  fix a typo of local variable. [Bug #3720] [ruby-dev:42083]
+
+Thu Feb 17 21:32:53 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/ossl.h: parenthesize macro arguments.
+
+Wed Feb 16 20:37:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* eval_jump.c (rb_exec_end_proc): changed at_exit and END proc
+	  evaluation order. [Bug #4400] [ruby-core:35237]
+	* eval_jump.c (rb_mark_end_proc): ditto.
+
+	* test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_nested_at_exit):
+	  added a test for nested at_exit.
+	* test/ruby/test_beginendblock.rb (TestBeginEndBlock#test_beginendblock):
+	  changed the test to adopt new spec.
+
+Wed Feb 16 20:17:06 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/openssl/openssl_missing.h: parenthesize macro arguments.
+
+Tue Feb 15 21:37:45 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/gdbm/gdbm.c: parenthesize macro arguments.
+
+Tue Feb 15 20:34:53 2011  Tanaka Akira  <akr@fsij.org>
+
+	* array.c (ary_join_1): fix array size.
+
+Tue Feb 15 19:43:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: fix and resubmit r30621. [ruby-dev:43203]
+
+Tue Feb 15 15:41:30 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* array.c (array_join): copy the encoding of the first element as
+	  an initial encoding.
+
+	* array.c (array_join_0): ditto.
+
+	* array.c (array_join_1): ditto.
+
+	* array.c (inspect_ary): ditto.
+
+	* array.c (array_join_1): add an argument to check the appending is
+	  first one or not.
+
+Tue Feb 15 15:40:53 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* hash.c (inspect_i): copy the encoding of the first key as
+	  an initial encoding.
+
+Mon Feb 14 15:00:16 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* array.c (inspect_ary): don't taint the inspected result of a
+	  recursive array.
+
+Tue Feb 15 15:43:29 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* encoding.c (rb_enc_compatible): change the rule for empty strings:
+	  remove the special treatment of the US-ASCII encoded empty string.
+	  Now Encoding.compatible? usually respect the encoding of the
 	  receiver.
 
-	* io.c (io_puts): avoid generating "\n" each time.  use RS_default
- 	  instead.
+Tue Feb 15 15:39:37 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_enc_cr_str_buf_cat): remove special treatment of
+	  ASCII-8BIT receivers.
+
+	* string.c (str_gsub): set initial encoding of the buffer as the
+	  same of the receiver. [ruby-core:35141]
+
+Tue Feb 15 09:49:33 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_system.rb (TestSystem#test_system_at): use findstr
+	  command instead of find command, because the latter is confusing
+	  another famous Unix command.
+
+Mon Feb 14 23:01:19 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* thread.c (rb_thread_io_blocking_region): reset th->waiting_fd
+	  after blocking region, because remaining waiting_fd might
+	  cause unnecessary IOError.
+
+Mon Feb 14 21:06:50 2011  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* configure.in: revert r30621.  That revision introduced mkmf test
+	  failures and it turned out to be OK to revert. [ruby-dev:43203]
+
+Mon Feb 14 21:04:01 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/fiddle/conversions.h: parenthesize macro arguments.
+
+Mon Feb 14 18:41:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* win32/setup.mak (USE_RUBYGEMS): fixed r30835. It didn't work on
+	  mswin32 port. If you changed win32/configure.bat, you should change
+	  setup.mak too.
+
+Mon Feb 14 17:28:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_system.rb (TestSystem#test_system_at):
+	  added test. [ruby-core:35218] (#4393)
+
+Mon Feb 14 13:15:35 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (is_internal_cmd): if the first char of prog is '@',
+	  execute it via shell.  [ruby-core:35218] (#4393)
+
+Mon Feb 14 10:33:45 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/test/unit.rb: revert r30863, because it causes too many noise.
+
+Mon Feb 14 07:34:55 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/curses/curses.c: parenthesize macro arguments.
+
+Sun Feb 13 19:41:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit.rb (Test::Unit::RequireFiles#non_options): skip
+	  test suites failed to load instead of mere messages.
+
+Sun Feb 13 09:56:44 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/openssl/test_config.rb (OpenSSL#test_freeze): fix error
+	  message assertion.
+
+	* test/io/nonblock/test_flush.rb (TestIONonblock#flush_test):
+	  return true to finish the test.
+
+	* test/syck/test_string.rb (Syck::TestString#test_non_binary_string):
+	  use assert_not instead of refute, unless required minitest
+	  explicitly.
+
+	* test/test_prime.rb (TestPrime::sieve.Integer): ditto.
+
+	* test/xmlrpc/webrick_testing.rb (WEBrick_Testing#start_server):
+	  catch IOError when server socket was closed.
+
+Sun Feb 13 07:39:51 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* enum.c (enum_inject): typo fixed. a patch from Gaku Ueda in
+	  [ruby-core:35216].
+
+Sun Feb 13 00:48:47 2011  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb (Date#===): [ruby-core:35127]
+
+Sun Feb 13 00:29:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit.rb (Test::Unit::Options#process_args): always
+	  return options.
+
+	* lib/test/unit.rb (Test::Unit::RequireFiles#non_options): return
+	  if any test case get loaded.
+
+	* lib/test/unit.rb (Test::Unit::AutoRunner#initialize): do not add
+	  default directory if it is nil.
+
+	* lib/test/unit.rb (Test::Unit::AutoRunner#process_args): return
+	  true if any test cases to run.
+
+Sat Feb 12 23:17:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit.rb (assert_include): add alias.
+
+Sat Feb 12 14:44:20 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_io_blocking_region): new function to run
+	  blocking region with GIL released, for fd.
+
+	* thread.c (rb_thread_fd_close): implement.  [ruby-core:35203]
+
+	* vm.c (th_init): rename from th_init2.
+
+Sat Feb 12 14:41:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit.rb (Test::Unit::AutoRunner#initialize): use
+	  default_dir if no test case given.
+
+	* lib/test/unit.rb (Test::Unit::Runner): rename from Test::Unit::Mini.
+
+	* lib/test/unit.rb (Test::Unit::GlobOption#non_options): run tests
+	  under base directory if no argument given.
+
+Sat Feb 12 08:03:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_settracefunc.rb (TestSetTraceFunc): ensure to use
+	  method_added hook defined in Module.
+
+Sat Feb 12 01:04:02 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (proc_options): enable rubygems if --gem option is given.
+
+	* ruby.c (process_options): load rubygems if it is disabled but
+	  --gem option is given.
+
+Fri Feb 11 23:27:50 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* ruby.c (proc_options): add --gem=enabled as an alias of
+	  --enable=gems and --gem=disabled as an alias of --disable=gems.
+	  Gem named "enabled" or "disabled" has already been reserved
+	  legitimately for this purpose.
+
+Fri Feb 11 23:17:04 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/dl/cfunc.c: parenthesize macro arguments.
+
+Fri Feb 11 21:41:53 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* bin/testrb, test/runner.rb, lib/test/unit.rb: improve backward
+	  compatibility.
+
+Fri Feb 11 19:45:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ruby_cleanup): use rb_ary_free to free internal object.
+
+	* gc.h (RUBY_FREE_UNLESS_NULL): get rid of double free.
+	  [ruby-core:35192]
+
+Fri Feb 11 16:57:03 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_transcode.rb (test_from_cp50221): fix wrong
+	  assertion and move back.
+
+Fri Feb 11 14:33:18 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb (assert_no_match): alias for
+	  backward compatibility.
+
+Fri Feb 11 12:06:48 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (add_gems, require_libraries, proc_options): add
+	  --require and --gem options.
+
+Fri Feb 11 12:03:24 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rubygems): add --disable-rubygems option.
+
+Fri Feb 11 11:39:03 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/fake.rb.in (CROSS_COMPILING): get rid of NameError.
+
+Thu Feb 10 23:12:34 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/dl/dl.h: parenthesize macro arguments.
+
+Wed Feb  9 23:11:27 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pty/pty.c: parenthesize macro arguments.
+
+Tue Feb  8 11:47:11 2011  Loren Sands-Ramshaw  <lorensr@gmail.com>
+
+	* array.c: documentation clarification in rotate, rotate!,
+	  index, and rindex. [ruby-core:35144]
+
+Wed Feb  9 09:45:43 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/rdoc/test_rdoc_encoding.rb: remove unnecessary (and wrong)
+	  platform-dependent hacks.
+
+Wed Feb  9 00:47:18 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/etc/etc.c: parenthesize macro arguments.
+
+Tue Feb  8 19:38:00 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-expr-beg): fix for invalid nest errors.
+
+Tue Feb  8 19:22:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in (AC_MSG_CHECKING): fixed typo. the patch is
+	  created by Benoit Daloze. Thanks a lot. [Bug #4384][ruby-core:35148]
+
+Tue Feb  8 16:04:03 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (rb_io_s_sysopen): use NUM2MODET() instead NUM2UINT().
+
+Tue Feb  8 15:59:23 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* process.c (rb_run_exec_options_err): use MODET2NUM() instead
+	  LONG2NUM().
+
+Tue Feb  8 13:59:56 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: revert r30725. Now we have proper runtime fallback.
+	  Therefore, no need compile time disabling. (see r30762).
+
+Tue Feb  8 01:00:21 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* process.c (proc_setgroups): add GC guard to prevent intermediate
+	  variable from GC.
+
+Tue Feb  8 00:56:33 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-expr-beg, ruby-in-here-doc-p): tell
+	  singleton class definitions from here documents.
+
+	* misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial): keyword
+	  followed by colon is label.
+
+Mon Feb  7 22:56:16 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* lib/benchmark.rb (Benchmark#bmbm): use ensure clause instead of
+	  Object#tap to restore STDOUT.sync.
+
+Mon Feb  7 22:34:20 2011  Tanaka Akira  <akr@fsij.org>
+
+	* lib/net/http.rb (Net::HTTP#connect): support SNI (Server Name
+	  Indication) for HTTPS.  [ruby-dev:43164]
+	  http://stackoverflow.com/questions/4685736/openssl-server-name-indication-support-in-ruby
+
+Mon Feb  7 16:05:32 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc: Upgrade to RDoc 3.5.3  Fixes [Bug #4376]
+
+Mon Feb  7 11:46:59 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* common.mk (rdoc): add --encoding=UTF-8; ruby's rdoc must be UTF-8.
+
+Mon Feb  7 10:21:50 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
+	  there is no easy way to create owner unreadable file on Windows.
+	  So, skip the test.
+
+Sun Feb  6 13:48:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/lib/json/common.rb (JSON::MissingUnicodeSupport.iconv):
+	  should not drop rest of the result.  use Iconv.conv instead.
+
+Sun Feb  6 12:46:02 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* string.c (gsub): Ensure result encoding is the same as input
+	  encoding.  [Bug #4340].
+
+Sun Feb  6 12:18:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (words, qwords): dispatch array events.  based on a
+	  patch from Michael Edgar.  [Bug #4365].
+
+Sun Feb  6 12:12:59 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/fileutils/fileasserts.rb (FileAssertions): separate module.
+
+Sun Feb  6 11:29:23 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/dbm/dbm.c: parenthesize macro arguments.
+
+Sat Feb  5 22:01:59 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  revert r30796. r30797 and r30798 are an alternative fix.
+	  [ruby-dev:43174]
+
+Sat Feb  5 21:47:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (mlhs_basic): include mlhs_post for ripper.  a patch
+	  from Michael Edgar at [ruby-core:35078].
+
+Sat Feb  5 21:22:21 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb (assert_block): move from
+	  test/fileutils/fileasserts.rb.
+
+	* test/fileutils/fileasserts.rb (assert_block): pass arguments
+	  as-is.  [ruby-dev:43174]
+
+Sat Feb  5 16:47:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  msg can be passed nil. [Bug #4371] [ruby-dev:43174]
+
+Sat Feb  5 15:18:25 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc: Upgrade to RDoc 3.5.2
+
+Sat Feb  5 12:05:27 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/syck/rubyext.c (syck_node_init_copy): SyckNode is not
+	  copiable.  [ruby-core:35094]
+
+Sat Feb  5 11:48:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_alloc): leave data ptr
+	  NULL.
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_new, ossl_cipher_initialize):
+	  allocate internal structure.  [ruby-core:35094]
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_copy): ditto.
+
+Sat Feb  5 11:29:10 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/parser/parser.h (GET_PARSER): raise TypeError.
+
+	* ext/json/parser/parser.rl (cParser_initialize): ditto.
+
+	* ext/json/parser/parser.h (GET_PARSER): check if initialized.
+	  [ruby-core:35079]
+
+	* ext/json/parser/parser.rl (cParser_initialize): ditto.
+
+Sat Feb  5 10:09:31 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_get_expanded_load_path): always expand load paths.
+
+Sat Feb  5 09:38:08 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (encoded_dup): extract.
+
+Sat Feb  5 03:37:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/fileutils.rb (FileUtils::LowMethods): make low level methods
+	  in NoWrite and DryRun to do nothing.  [ruby-dev:43129]
+
+	* test/fileutils/fileasserts.rb: add message arguments.
+
+	* test/fileutils/fileasserts.rb (Test::Unit::Assertions#assert_block):
+	  show the given message.
+
+Sat Feb  5 02:09:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (lex_getline, parser_set_encode): set encoding of lines
+	  in SCRIPT_LINES__ as source encoding.  [ruby-dev:43168]
+
+Sat Feb  5 02:08:37 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (ruby_thread_data_type): add prefix.
+
+Sat Feb  5 00:59:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm_core.h (GetThreadPtr): use TypedData_Get_Struct() instead
+	  CoreDataFromValue() because we need type check. Otherwise,
+	  type mismatch can cause segmentation fault crash.
+	  [ruby-core:35086] [Ruby 1.9-Bug#4367]
+
+	* vm.c (thread_data_type): remove static.
+
+Fri Feb  4 19:14:27 2011  Tanaka Akira  <akr@fsij.org>
+
+	* enc/trans/utf8_mac.trans: parenthesize macro arguments.
+
+Fri Feb  4 12:11:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* string.c (str_utf8_nth): fixed a condition of optimized lead
+	  byte counting. [Bug #4366][ruby-dev:43170]
+
+Fri Feb  4 01:50:13 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* string.c (count_utf8_lead_bytes_with_word): wrote function
+	  comments.
+
+Fri Feb  4 00:14:55 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/zlib/zlib.c (gzfile_reader_get_unused): no need to dup
+	  before rb_str_resurrect.
+
+Thu Feb  3 20:04:44 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/curses/curses.c (CHECK): unused macro removed.
+
+Thu Feb  3 18:33:26 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/zlib/zlib.c (gzfile_reader_get_unused): use rb_str_resurrect
+	  because gz->z.input is hidden string. [ruby-core:35057]
+
+Thu Feb  3 16:34:10 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/shift_jis.c (code_to_mbc): cast as int from the subtraction of
+	  pointers.
+
+	* enc/utf_16le.c (utf16le_mbc_enc_len): use ptrdiff_t.
+
+	* enc/utf_32be.c (utf32be_left_adjust_char_head): ditto.
+
+	* enc/utf_32le.c (utf32le_left_adjust_char_head): ditto.
+
+Thu Feb  3 16:31:43 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* include/ruby/missing.h: don't use HAVE_STDDEF_H because it never
+	  defined by configure though configure.bat defines it.
+
+	* include/ruby/ruby.h: move include stddef.h to defines.h
+
+	* include/ruby/defines.h: ditto.
+
+Wed Feb  2 20:25:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* include/ruby/encoding.h (rb_enc_step_back): cast 4th argument 'n'
+	  as int because Ruby usually treats length value as long but
+	  onigenc_step_back's 4th argument is int.
+
+Thu Feb  3 07:20:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: use Regexp::NOENCODING
+	  rather than magic number.
+
+	* ext/syck/lib/syck/rubytypes.rb: ditto
+
+Thu Feb  3 07:16:11 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* re.c (Init_Regexp): added a constant for ARG_ENCODING_NONE
+	  [ruby-core:35054]
+
+	* test/ruby/test_regexp.rb: corresponding test.
+
+Thu Feb  3 07:02:16 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: ARG_ENCODING_NONE regular
+	  expressions can round trip. [ruby-core:34969]
+
+	* test/psych/test_yaml.rb: test for ARG_ENCODING_NONE regex
+
+	* ext/sych/lib/syck/rubytypes.rb: ARG_ENCODING_NONE regular
+	  expressions can round trip.
+
+	* test/syck/test_yaml.rb: test for ARG_ENCODING_NONE regex
+
+Wed Feb  2 17:09:22 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (rb_io_fdatasync): Use fsync(2) if the underlying
+	  operating system does not support fdatasync(2).
+
+Wed Feb  2 14:51:08 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc/markup/to_tt_only.rb: commit miss
+	* test/rdoc/test_rdoc_markup_to_tt_only.rb: ditto
+	* test/rdoc/test_rdoc_single_class.rb: ditto
+
+Wed Feb  2 09:27:53 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc: Upgrade to RDoc 3.5.1
+
+Wed Feb  2 00:30:43 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/st.h (st_table): Added comment why we need __extension__.
+
+Tue Feb  1 20:45:44 2011  Tanaka Akira  <akr@fsij.org>
+
+	* enc/encdb.c: parenthesize macro arguments.
+
+Tue Feb  1 15:12:26 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_require.rb (TestRequire#test_require_with_unc):
+	  use ``127.0.0.1'' instead of ``localhost'' as host name, because
+	  XP or earlier cannot resolv it as NBT hostname.
+
+Tue Feb  1 13:20:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/benchmark/test_benchmark.rb (#capture_bench_output):
+	  Added explicit sleep. Windows have imprecise time support.
+	  Thus Tms.new.Add!{} may be or may be not equal 0. The
+	  test failure started since r30747.
+
+Tue Feb  1 11:03:47 2011  Ryan Davis  <ryan@lust.local>
+
+	* lib/rubygems*: Import rubygems 1.5.0 (released version @ 1fb59d0)
+	* test/rubygems: Ditto
+
+Tue Feb  1 08:01:39 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_set_winsize): new method to set
+	  console size.  [EXPERIMENTAL]
+
+	* ext/io/console/console.c (console_winsize): use GetWriteFD.
+
+Tue Feb  1 02:28:14 2011  Masaya Tarui  <tarui@ruby-lnag.org>
+
+	* include/ruby/win32.h, win32/win32.c: add rb_w32_inet_ntop.
+	  inet_ntop's minimum supported client is Vista.
+
+Tue Feb  1 00:10:30 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/benchmark.rb: fix benchmark to work with current ruby.
+	  patched by Benoit Daloze [ruby-core:33846] [ruby-dev:43143]
+	  merged from https://github.com/eregon/ruby/commits/benchmark
+
+	*  lib/benchmark (Report#width): update documentation
+	*  lib/benchmark: document the return value of #benchmark and the
+	   :list attribute in Report
+	*  lib/benchmark (Tms#format): rename variables, use String#%
+	   instead of Kernel.format
+	*  lib/benchmark: remove undocumented Benchmark::times (an alias
+	   of Process::times used twice)
+	*  lib/benchmark (#benchmark): use label_width for the caption
+	*  lib/benchmark (Tms#initialize): rename variables
+	*  lib/benchmark: allow title to not be a String and call #to_s
+	*  lib/benchmark (Benchmark#bm): return an Array of the times with
+	   the labels
+	*  lib/benchmark: correct output for Benchmark#bmbm
+	   (remove the extra space)
+	*  lib/benchmark: add a few tests for Benchmark::Tms output
+	*  lib/benchmark: improve style (enumerators, ljust, unused vars)
+	*  lib/benchmark: add spec about output and return value
+	*  lib/benchmark: improve basic style and consistency
+	   no parenthesis for print and use interpolation instead of printf
+	*  lib/benchmark: remove unnecessary conversions and variables
+	*  lib/benchmark: correct indentation
+	*  lib/benchmark: rename the FMTSTR constant and variable to FORMAT
+	*  lib/benchmark: remove useless exception
+
+	*  test/benchmark: remove unused variable warnings
+
+Mon Jan 31 23:27:23 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* node.c (add_id): remove duplicated rb_id2str() call.
+
+Sun Jan 30 17:19:46 2011  Tanaka Akira  <akr@fsij.org>
+
+	* missing/langinfo.c: parenthesize macro arguments.
+
+Mon Jan 31 21:57:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: revert r30698.
+
+Mon Jan 31 21:32:44 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* thread.c (thread_start_func_2): check deadlock condition before
+	  release thread stack. fix memory violation when deadlock detected.
+	  reported by Max Aller. [Bug #4009] [ruby-core:32982]
+
+Mon Jan 31 14:45:47 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* lib/irb/locale.rb (IRB::Locale::#search_file):
+	  Gem might be undefined if --disable-gems. [ruby-core:34990]
+
+Mon Jan 31 12:26:14 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* addr2line.c: suppressed shorten-64-to-32 warnings.
+	* regcomp.c: ditto.
+	* regexec.c: ditto.
+	* regint.h: ditto.
+	* regparse.c: ditto.
+	* regparse.h: ditto.
+	* time.c: ditto.
+	* variable.c: ditto.
+
+Mon Jan 31 04:45:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* array.c (rb_ary_uniq_bang): call ARY_SET_LEN(ary, 0) before
+	  ary_resize_capa because ary_resize_capa expects resized length is
+	  smaller than current array length. call rb_ary_unshare before
+	  ary_resize_capa because ary_resize_capa lost the reference to
+	  original shared array. [ruby-core:34997]
+
+Sun Jan 30 17:19:46 2011  Tanaka Akira  <akr@fsij.org>
+
+	* missing/crypt.c: parenthesize macro arguments.
+
+Sun Jan 30 16:40:27 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/rubygems/test_gem_security.rb (TestGemSecurity): valid only
+	  if OpenSSL is available.
+
+	* test/dl/test_dl2.rb (TestDL#test_sin): math functions do not
+	  work on x86_64 due to the design of DL2.
+
+	* test/dl/test_func.rb (DL::TestFunc#test_{sinf,sin): ditto.
+
+Sun Jan 30 16:09:22 2011  Tanaka Akira  <akr@fsij.org>
+
+	* strftime.c (rb_strftime_with_timespec): %G produces 4 digits.
+
+Sun Jan 30 15:13:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enc/emacs_mule.c (emacsmule_islead): 7bit range is also leading
+	  byte.
+
+Sun Jan 30 13:03:16 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_fetch_m): use useful message for longer key, not a
+	  nonsense id value.
+
+	* string.c (rb_str_ellipsize): new function to ellipsize a string.
+
+	* include/ruby/encoding.h (rb_enc_step_back): new function to step
+	  back n characters.
+
+Sun Jan 30 12:53:38 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enc/emacs_mule.c (emacsmule_islead): fix inverse condition.
+
+Sun Jan 30 09:37:25 2011  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
+
+	* io.c (struct argf): char behaves like an unsigned char
+	  by default on AIX.
+
+Sun Jan 30 08:02:55 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in: Mac OS X wrongly reports it has fdatasync(3).
+
+Sun Jan 30 03:29:47 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_bn.c (GetBNPtr): add missing nil case.
+	  patched by Martin Bosslet. [ruby-core:34987]
+
+Sun Jan 30 01:02:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/ruby.h: Added NUM2MODET() and MODET2NUM() default
+	  definition.
+	  Because r30686 introduced win32 build failure.
+
+Sat Jan 29 22:16:26 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* array.c (rb_ary_join): [].join.encoding must be US-ASCII.
+	  [ruby-list:47790]
+
+Sat Jan 29 20:22:39 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* benchmark/driver.rb (BenchmarkDriver#measure): Show command line
+	  when abnormal exiting occur.
+
+Sat Jan 29 10:53:16 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* vm_insnhelper.c (vm_get_ev_const): no-scope reference to toplevel
+	  private constant has been prohibited incorrectly.
+
+	* test/ruby/test_module.rb (test_toplevel_private_constant): add a
+	  test for above.
+
+Sat Jan 29 08:43:23 2011  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* lib/rubygems*: Import rubygems 1.5.0 (release candidate @ 09893d9)
+	* test/rubygems: Ditto
+
+Sat Jan 29 02:02:37 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* variable.c (rb_mod_const_of, sv_i): Module#constant should exclude
+	  private constants.  see [ruby-core:32912].
+
+	* test/ruby/test_module.rb (test_constants_with_private_constant): add
+	  a test for above.
+
+Sat Jan 29 01:36:41 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* variable.c (rb_const_set): const_set should preserve constant
+	  visibility.  see [ruby-core:32912].
+
+	* test/ruby/test_module.rb: add a test for above.
+
+Sat Jan 29 01:24:57 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* compile.c (NODE_CLASS, NODE_MODULE), insns.def (defineclass): raise
+	  an exception when "class Foo::Bar" is evaluated and Foo::Bar is
+	  private.  To implement this, define_type of "defineclass" is added
+	  so that the instruction can distinguish whether the class definition
+	  is scoped (class Foo::Bar) or not (class Bar).
+
+	* test/ruby/test_class.rb (test_redefine_private_class),
+	  test/ruby/test_module.rb
+	  (test_define_module_under_private_constant): add tests for above.
+
+Sat Jan 29 01:19:17 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* constant.h, variable.c: to ensure compatibility, rb_const_get_* must
+	  not raise an exception even when the constant is private.  Instead,
+	  rb_public_const_get_* and rb_public_const_defined_* are introduced,
+	  which raise an exception when the referring constant is private.
+	  see [ruby-core:32912].
+
+	* vm_insnhelper.c (vm_get_ev_const): use rb_public_const_get_* instead
+	  of rb_const_get_* to follow the constant visibility when user code
+	  refers a constant.
+
+	* test/ruby/test_marshal.rb (test_marshal_private_class): add a test.
+	  This test had failed because of incompatibility of rb_const_get.
+
+Sat Jan 29 00:30:44 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* variable.c (set_const_visibility): fix typo.  a patch from Tomoyuki
+	  Chikanaga in [ruby-core:32919].
+
+Fri Jan 28 23:20:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create,
+	  TestGDBM2#test_writer_open_notexist): We only need to skip libgdbm
+	  1.8.0, not all 1.8.x. 1.8.1 or later don't have GDBM_WRITER sickness.
+
+Fri Jan 28 21:56:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/dbm/extconf.rb: Added new header places for Fedora13.
+
+Fri Jan 28 21:49:30 2011  Tanaka Akira  <akr@fsij.org>
+
+	* ext/zlib/zlib.c: parenthesize macro arguments.
+
+Fri Jan 28 17:47:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/gdbm/test_gdbm.rb (TestGDBM2#test_writer_open_notexist):
+	  gdbm 1.8.x changed GDBM::WRITER behavior. Thus our testcase need
+	  to be changed too.
+
+Fri Jan 28 17:33:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_no_create): skip
+	  the test if gdbm version is 1.8.x.
+
+Fri Jan 28 16:30:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_require.rb (TestRequire#test_require_too_long_filename):
+	  Added -w option because too long path error don't output a message
+	  by default since r30660. [Bug #4336] [ruby-dev:43134]
+
+Fri Jan 28 16:19:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2}):
+	  Added -w option because too long path error don't output a message
+	  by default since r30660. [Bug #4336] [ruby-dev:43134]
+
+Fri Jan 28 16:04:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_require.rb (TestRequire#test_require_path_home_{1,2,3}):
+	  split from test_require_path_home.
+
+Fri Jan 28 13:04:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in (--with-valgrind): Fixed r29683. Now this option
+	  is really default on.
+
+Fri Jan 28 12:05:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: Add #include<sys/stat.h> when struct stat is
+	  tested. Otherwise, incomplete type dereference error will occur.
+
+Fri Jan 28 11:53:19 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: redundant variable names made strange conftest
+	  error. Fixed it.
+
+Fri Jan 28 11:47:00 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_process.rb (TestProcess#test_too_long_path{,2}):
+	  should handle Errno::E2BIG, because this test checks crash of ruby,
+	  not the error type system.
+
+Fri Jan 28 11:23:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (rb_io_open): Use NUM2MODET() instead NUM2UINT().
+	* io.c (rb_scan_open_args): ditto.
+
+Fri Jan 28 10:58:20 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: Added mode_t type checking.
+	* process.c (rb_exec_arg_addopt): Use NUM2MODET() instead
+	  NUM2LONG because clang makes compile error by this narrowing
+	  conversion.
+	* process.c (rb_run_exec_options_err): ditto.
+
+Fri Jan 28 02:37:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* re.c (rb_reg_raise): add GC guard to prevent intermediate
+	  variable from GC.
+
+Fri Jan 28 02:35:41 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* hash.c (rb_hash_fetch_m): add GC guard to prevent intermediate
+	  variable from GC.
+
+Fri Jan 28 01:33:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_process.rb (TestProcess#test_too_long_path)
+	  TestProcess#test_too_long_path): Reduced string size from 100MB
+	  to 10MB. 100MB may cause no memory error. It isn't intended.
+
+Fri Jan 28 01:27:42 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_process.rb (TestProcess#test_too_long_path2):
+	  Factored out from test_too_long_path. A test should only do
+	  one test.
+
+Thu Jan 27 23:29:36 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* st.c (st_foreach): check if unpacked.
+
+Thu Jan 27 23:14:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-mode-map): remove deprecated binding.
+	  use M-; instead.
+
+Thu Jan 27 21:58:32 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* bignum.c (rb_str_to_inum): get rid of too huge alloca().
+
+Thu Jan 27 21:43:29 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* object.c (rb_str_to_dbl): rewrite again. use ALLOCV instead
+	  rb_str_tmp_new().
+
+Thu Jan 27 21:41:47 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* win32/win32.c: get rid of STRNDUPA(). It's dangerous API.
+
+Thu Jan 27 21:31:57 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* win32/win32.c (rb_w32_aspawn): get rid of too huge alloca().
+	  [Bug #4330] [ruby-core:34898]
+
+Thu Jan 27 20:30:18 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* win32/win32.c (rb_w32_spawn): get rid of too huge alloca().
+
+Thu Jan 27 18:49:53 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* win32/win32.c (open_dir_handle): get rid of too huge alloca().
+
+Thu Jan 27 18:34:58 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* file.c (w32_io_info): get rid of too huge alloca().
+	  [Bug #4313] [ruby-core:34830]
+
+Thu Jan 27 18:19:51 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* win32/win32.c (wstati64): get rid of too huge alloca().
+	  [Bug #4316] [ruby-core:34834]
+
+Thu Jan 27 15:11:52 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_spawn, rb_w32_aspawn): get rid of too huge
+	  alloca(). this is the real fix of [ruby-core:34833].
+
+Thu Jan 27 12:46:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (ALLOC_ARGV_WITH_STR): fix void pointer arithmetic.
+
+Thu Jan 27 08:41:40 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (proc_exec_v, rb_proc_exec_n, rb_proc_exec)
+	  (proc_spawn_n, proc_spawn): get rid of too huge alloca().
+	  [ruby-core:34827], [ruby-core:34833]
+
+Thu Jan 27 08:32:17 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (ALLOCV): new API for exception-safe
+	  temporary buffer.  [ruby-core:34844]
+
+	* string.c (rb_alloc_tmp_buffer, rb_free_tmp_buffer):
+	  implementation of the API.
+
+Thu Jan 27 08:22:49 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln_find.c (dln_find_1): use rb_warning and return immediately
+	  if fname is longer than buffer.
+
+Wed Jan 26 22:57:30 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* class.c (clone_method): add GC guard to prevent intermediate
+	  variable from GC. [Bug #4321] [ruby-dev:43107]
+
+Wed Jan 26 22:45:16 2011  Tanaka Akira  <akr@fsij.org>
+
+	* template/id.h.tmpl: parenthesize macro arguments.
+
+Wed Jan 26 22:28:49 2011  CHIKANAGA Tomoyuki  <nagachika00@gmail.com>
+
+	* vm_eval.c (rb_throw_obj): add GC guard to prevent intermediate
+	  variable from GC. [Bug #4322] [ruby-dev:43108]
+
+Wed Jan 26 17:08:59 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_decode0): OpenSSL::ASN1.decode
+	  should reject indefinite length primitive encodings as that is
+	  illegal. Patch by Martin Bosslet. See #4324.
+
+Wed Jan 26 10:36:28 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (=~): documentation fix; the return value is nil when
+	  it doesn't match. patched by Andrei Kulakov [ruby-core:34562]
+
+Tue Jan 25 08:41:58 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln_find.c (dln_find_1): omit too long pathnames.
+
+Tue Jan 25 08:28:19 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_resize): get rid of out-of-bound access.
+
+Tue Jan 25 07:48:22 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/ruby/test_thread.rb: remove unused variables.
+
+Tue Jan 25 07:45:44 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/ruby/test_thread.rb (TestThread#test_condvar_nolock_2): get
+	  rid of method redefined.
+
+Tue Jan 25 07:00:52 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_string_value_cstr): rb_str_modify can change
+	  RSTRING_PTR.
+
+Tue Jan 25 03:24:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_thread.rb: Added various ConditionVariable tests.
+
+Mon Jan 24 22:26:33 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* object.c (rb_str_to_dbl): Fix again. use rb_str_tmp_new()
+	  instead ALLOC_N.
+
+Mon Jan 24 21:50:48 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vm_insnhelper.h: parenthesize macro arguments.
+
+Mon Jan 24 21:28:34 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* object.c (rb_str_to_dbl): use ALLOC_N instead ALLOCA_N because
+	  ALLOC_N may cause stack overflow.
+
+Mon Jan 24 21:04:45 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_invalid_str): prevent intermediate variable from GC.
+	  [ruby-core:34820]
+
+Sun Jan 23 23:01:54 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/io/console/test_io_console.rb: Don't run test if the system
+	  don't support io/console.
+
+Sun Jan 23 22:17:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/fiddle/test_fiddle.rb: Don't run test if the system don't support
+	  fiddle.
+
+	* test/fiddle/test_function.rb: ditto.
+	* test/fiddle/test_closure.rb: ditto.
+
+Sun Jan 23 11:39:18 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vm_exec.h: parenthesize macro arguments.
+
+Sun Jan 23 10:33:02 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/fake.rb.in (ruby): suppress warnings.
+
+Sun Jan 23 08:00:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_nth_len, str_utf8_nth): return the rest length together.
+
+	* string.c (rb_str_substr): get rid of measure the length always
+	  to improve performance for huge string.  [ruby-core:34648]
+
+Sun Jan 23 00:40:10 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/test_syslog.rb: Fix to make a lot of test failure if
+	  the platform doesn't support syslog.
+
+Sat Jan 22 11:49:55 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fixing merge key support
+	  when multiple merge keys are specified.
+
+	* test/psych/test_merge_keys.rb: tests for multi-merge key support
+
+Sat Jan 22 11:33:04 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: merge keys are actually
+	  part of YAML 1.1, so they should be supported.  Remove warning and
+	  merge keys to parent.  [ruby-core:34679]
+
+	* test/psych/test_merge_keys.rb: test for merge keys
+
+Sat Jan 22 10:25:19 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c (parse): add the file name to the exception when
+	  parse errors occur.
+
+	* test/psych/test_parser.rb: test for parse error file name
+
+Sat Jan 22 10:12:30 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/parser.c (parse): fix assertion error when reusing a
+	  parser after an exception has been raised
+
+	* test/psych/test_parser.rb: test for assertion error
+
+Sat Jan 22 04:09:22 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/nodes/node.rb: Make Psych::Nodes::Node
+	  enumerable.
+
+	* ext/psych/lib/psych/visitors/depth_first.rb: Add a depth-first
+	  visitor to enumerate over a YAML AST in a depth-first fashion
+
+	* test/psych/nodes/test_enumerable.rb: test for enumerating nodes
+
+	* test/psych/visitors/test_depth_first.rb: test for depth-first
+	  visitor
+
+Sat Jan 22 00:53:42 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vm_core.h: parenthesize macro arguments.
+
+Fri Jan 21 18:15:09 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: should not use -Werror=* flags while conftests.
+
+Fri Jan 21 09:17:00 2011  Luis Lavena  <luislavena@gmail.com>
+
+	* configure.in: Fix incorrectly detected x86_64-w64-mingw32 due
+	  canonalization of target_os. Bug #3889 [ruby-core:32634]
+
+Thu Jan 20 23:44:00 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: Fix rb_cv_va_args_macro was broken. We are using
+	  -Werror=implicit-function-declaration compile option. therefore
+	  we need a function declaration explicitly.
+
+Thu Jan 20 23:58:02 2011  Tanaka Akira  <akr@fsij.org>
+
+	* node.h: parenthesize macro arguments.
+
+Thu Jan 20 23:25:28 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: Add '#include <stdlib.h>' to
+	  rb_cv_localtime_overflow test too. It's reported by Tomoyuki
+	  Chikanaga. Thanks.
+
+Thu Jan 20 16:11:00 2011  Kenta Murata <mrkn@mrkn.jp>
+
+	* README.EXT, README.EXT.ja: You shouldn't choose ``conftest.c'' as a
+	  name of a source file.
+
+Thu Jan 20 12:15:44 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: Add stdlib.h inclusion into rb_cv_negative_time_t
+	  test because it's required for exit(3). The patch is
+	  created by Tomoyuki Chikanaga. [Bug #4287] [ruby-dev:43060]
+
+Thu Jan 20 11:39:41 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/webrick/utils.rb (TestWEBrick::RubyBin): test CGI does not need
+	  to load rubygems.  if it activated, ruby raises LoadError about
+	  rbconfig.rb.
+
+Thu Jan 20 09:19:42 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/json_tree.rb: Fix JSON emit for
+	  DateTime and Time classes.
+
+	* test/psych/test_json_tree.rb: test for JSON emit
+
+Thu Jan 20 08:02:46 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/coder.rb (represent_object): arbitrary objects
+	  may be passed to the Psych::Coder object.
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: support for visiting
+	  arbitrary objects set on the coder.
+
+	* test/psych/test_coder.rb: supporting test case.
+
+Thu Jan 20 06:03:17 2011  Tanaka Akira  <akr@fsij.org>
+
+	* method.h: parenthesize macro arguments.
+
+Wed Jan 19 13:16:05 2011  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rubygems/commands/sources_command.rb: Finish removing code,
+	  (fixes sources command test).
+
+Wed Jan 19 13:04:16 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* proc.c (proc_call): Add gc guard to avoid segfault. The fix
+	  is created by Tomoyuki Chikanaga. [Bug #4238][ruby-dev:42963]
+
+Wed Jan 19 12:31:28 2011  Eric Hodel <drbrain@segment7.net>
+
+	* lib/rubygems.rb: Since gem_prelude requires rubygems, enable
+	  custom_require always.
+
+Wed Jan 19 12:08:08 2011  Eric Hodel <drbrain@segment7.net>
+
+	* lib/rubygems/commands/dependency_command.rb: Remove require of
+	  deleted file.
+	* lib/rubygems/commands/fetch_command.rb: ditto
+	* lib/rubygems/commands/setup_command.rb: ditto
+	* lib/rubygems/commands/sources_command.rb: ditto
+	* lib/rubygems/commands/specification_command.rb: ditto
+
+Wed Jan 19 08:13:59 2011  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* lib/rubygems*: Import rubygems 1.5.0 (release candidate)
+	* test/rubygems: Ditto
+
+Tue Jan 18 23:31:01 2011  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* parse.y: avoid NULL reference.  [ruby-dev:43067]
+
+Wed Jan 19 02:54:04 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vsnprintf.c (cvt): set first byte of buf to NUL for the case when
+	  no bytes are written to the buf. [ruby-dev:43062]
+
+Tue Jan 18 23:04:51 2011  Tanaka Akira  <akr@fsij.org>
+
+	* gc.h: parenthesize macro arguments.
+
+Tue Jan 18 18:31:14 2011  Keiju Ishitsuka  <keiju@ishitsuka.com>
+
+	* lib/irb/completion.rb: Irb tab completion support for XX::method
+	  forms.
+
+Tue Jan 18 15:05:55 2011  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/logger.rb: added RDoc document for logging message escape
+	  by Hal Brodigan. See #3869
+
+Tue Jan 18 07:53:52 2011  Tanaka Akira  <akr@fsij.org>
+
+	* eval_intern.h: parenthesize macro arguments.
+
+Tue Jan 18 04:42:44 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/parser.rb (Mark): Adding a class to wrap
+	  marker information
+
+	* ext/psych/parser.c (mark): Add a method to return the mark object
+	  for the parser
+
+	* test/psych/test_parser.rb: tests for the Mark class.
+
+Tue Jan 18 02:46:55 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/json_tree.rb (visit_String): JSON
+	  strings should be dumped with double quotes. [ruby-core:34186]
+
+	* test/psych/test_json_tree.rb: test for double quotes
+
+Mon Jan 17 23:36:33 2011  Tanaka Akira  <akr@fsij.org>
+
+	* array.c (rb_ary_times): less MEMCPY calls.
+
+Mon Jan 17 22:54:33 2011  Tanaka Akira  <akr@fsij.org>
+
+	* debug.h: parenthesize macro arguments.
+
+Mon Jan 17 21:40:25 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): revert r30549.
+
+Sun Jan 16 20:55:45 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vsnprintf.c: parenthesize macro arguments.
+
+Sat Jan 15 11:57:30 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (warnflags): add -Werror=implicit-function-declaration
+	  if available.
+
+	* lib/mkmf.rb (init_mkmf): ignore warnings in mkmf tests.
+
+	* test/mkmf/base.rb (setup, teardown): restore config values.
+
+	* test/mkmf/test_flags.rb: split from test_find_executable.rb.
+
+Sat Jan 15 10:04:14 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): autoload rubygems.
+
+	* tool/compile_prelude.rb (Prelude#initialize): ignore empty
+	  preludes.
+
+	* ruby.c (ruby_init_prelude): get rid of global namespace
+	  pollution.
+
+Sat Jan 15 09:42:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/io.h: missing prototypes.
+
+Fri Jan 14 23:25:55 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vm_method.c: parenthesize macro arguments.
+
+Fri Jan 14 15:32:29 2011  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/net/imap/test_imap.rb: call neither logout nor disconnect
+	  unless connected.  patch by Kazuhiro NISHIYAMA.  [ruby-dev:42860]
+
+Fri Jan 14 14:56:57 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/imap.rb: use bytesize for binary strings.
+	  patched by Yoshimasa Niwa. [ruby-core:34222]
+
+Fri Jan 14 14:01:12 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* pack.c (pack_unpack): the resulted string of unpack('M') must have
+	  ASCII-8BIT encoding (and ENC_CODERANGE_VALID). [ruby-core:34482]
+
+Fri Jan 14 13:38:58 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/zlib/zlib.c (gzfile_check_footer): ISIZE (Input SIZE) in
+	  gzip's header is the size of uncompressed input data modulo 2^32.
+	  [ruby-core:34481] http://www.ietf.org/rfc/rfc1952.txt
+
+Fri Jan 14 11:36:25 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* configure.in, win32/Makefile.sub (RUNRUBY): require path should
+	  include "." because rbconfig.rb is there.
+
+Fri Jan 14 10:40:11 2011  Ryan Davis  <ryan@lust.local>
+
+	* gem_prelude.rb: Just require rubygems. Fixes rubygems 1.4.
+	* lib/rubygems.rb: removed all Gem::Quickloader code.
+	* ruby.c: renamed ruby_init_gems to ruby_init_prelude. Set
+	  $disable_rubygems since there is no fine grained mechanism to
+	  skip parts of the prelude. Open to suggestions on how to do this
+	  better.
+	* test/*.rb: Load path isn't set up correctly, so add
+	  --disable-gems as needed to failing tests that are explicitly
+	  testing stderr w/ ==.
+
+Fri Jan 14 07:30:47 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_next_argv): go advance when the next file cannot be
+	  read.  [ruby-core:34446]
+
+Thu Jan 13 20:49:19 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vm_insnhelper.c: parenthesize macro arguments.
+
+Thu Jan 13 13:21:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* vm_dump.c: delete dashes to make lines 80 chars, Patched by
+	  Shota Fukumori (sora_h).  [Bug #4275] [ruby-dev:43021]
+
+Thu Jan 13 13:21:00 2011  Kenta Murata  <mrkn@mrkn.jp>
+
+	* vm_dump.c: fix misspelling of CrashReporter, Patched by Shota
+	  Fukumori (sora_h).  [Bug #4275] [ruby-dev:43021]
+
+Thu Jan 13 06:27:29 2011  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* error.c: Exception#to_s should actually call to_s.
+
+Thu Jan 13 00:32:54 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* addr2line.c (get_nth_dirname): decrement the directory index
+	  because the index specifies the index of given included_directories
+	  which is separated by NUL and its index is begun from 1.
+	  Note that 0 specifies the current directory of the compilation.
+	  see also http://www.dwarfstd.org/doc/dwarf-2.0.0.pdf
+
+Thu Jan 13 00:06:38 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (rb_f_syscall): Add warning messages. [ruby-core:34062]
+
+Thu Jan 13 00:00:07 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (rb_f_syscall): Some syscall return unsigned or pointer value.
+	  Therefore we should only check the result is -1 or not.
+	  [ruby-core:34062]
+
+Wed Jan 12 23:55:48 2011  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (rb_f_syscall): Add 64bit Linux support. Some syscall takes
+	  long type arguments.
+
+Wed Jan 12 19:37:10 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vm_dump.c: parenthesize macro arguments.
+
+Wed Jan 12 19:28:23 2011  Tanaka Akira  <akr@fsij.org>
+
+	* vm.c (thread_free): reset ruby_current_thread if it points the
+	  thread to free.
+	* gc.c (slot_sweep): don't call RUBY_VM_SET_FINALIZER_INTERRUPT if
+	  there is no current thread.
+	  [ruby-dev:43000]
+
+Wed Jan 12 19:09:29 2011  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c (sort_by_i): reenter check more strictly.
+	  (sort_by_cmp): ditto.
+	  [ruby-dev:43003] reported by Usaku NAKAMURA.
+
+Wed Jan 12 16:25:12 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* lib/net/http.rb (Net::HTTP#connect): makes it timeout during
+	  SSL handshake too. [ruby-core:34203]
+	  Patch by Marc Slemko.
+
+	* test/net/http/test_http.rb (TestNetHTTP_v1_2#test_timeout_during_HTTP_session):
+	  test for [ruby-core:34203]
+
+	* test/net/http/test_https.rb (TestNetHTTPS#test_timeout_during_SSL_handshake):
+	  ditto.
+
+Wed Jan 12 16:24:53 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* ext/readline/extconf.rb: new checks for RL_PROMPT_START_IGNORE
+	  and RL_PROMPT_END_IGNORE. [ruby-core:34331]
+
+	* ext/readline/readline.c: enables USE_INSERT_IGNORE_ESCAPE only if
+	  RL_PROMPT_{START,END}_IGNORE are available to get rid of compilation
+	  error with libedit.
+
+Wed Jan 12 15:53:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* README.EXT.ja (rb_ensure): typo.
+
+Wed Jan 12 11:33:46 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* addr2line.c: OpenBSD uses the elf_abi.h header file instead of the
+	  elf.h header file. patched by Jeremy Evans [ruby-core:34384]
+
+Wed Jan 12 03:59:36 2011  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/webrick/test_cgi.rb: Removes usage of deprecated
+	  :RequestHandler option.
+	  patched by Peter Weldon [ruby-core:34010]
+
+	* test/webrick/test_httpproxy.rb: ditto.
+
+	* test/webrick/test_httpserver.rb: Add a test of the deprecation
+	  behaviour.
+
+Wed Jan 12 08:37:07 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (hash_i): return different values for inverse hash.
+	  [ruby-core:34334]
+
+Tue Jan 11 20:32:59 2011  Tanaka Akira  <akr@fsij.org>
+
+	* variable.c: parenthesize macro arguments.
+
+Tue Jan 11 13:06:38 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* array.c (rb_ary_resize): should care of embeded array when extending
+	  the array.
+
+	* array.c (rb_ary_resize): need to set capa when changing the real
+	  size of the array.
+	  these are latent bugs.
+
+Mon Jan 10 22:46:43 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/defines.h (CASEFOLD_FILESYSTEM): HFS+ is case
+	  insensitive.
+
+	* load.c (loaded_feature_path, rb_feature_p, load_lock): on a
+	  case-insensitive filesystem, loaded features search should
+	  ignore case.  [ruby-core:34297]
+
+Mon Jan 10 21:34:12 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (showflags): show LD commands.
+
+Mon Jan 10 14:32:55 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_method.rb (TestMethod#test_define_method): method
+	  transplanting between class and module is impossible.
+
+Mon Jan 10 13:51:17 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/rdoc-mode.el (rdoc-mode): show trailing whitespace.
+
+Mon Jan 10 11:22:02 2011  Tanaka Akira  <akr@fsij.org>
+
+	* util.c: parenthesize macro arguments.
+
+Mon Jan 10 07:41:31 2011  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* misc/README: mention rdoc-mode.el and ruby-style.el.
+
+Sun Jan  9 20:37:21 2011  Tanaka Akira  <akr@fsij.org>
+
+	* transcode.c: parenthesize macro arguments.
+
+Sun Jan  9 16:31:53 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* io.c (Kernel.#syscall): implemented on LP64/LLP64 environments too.
+	  also uses __syscall if available for *BSD on 64bit architecture.
+	  [ruby-core:34062]
+
+Sun Jan  9 16:31:34 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* lib/irb/locale.rb (IRB::Locale::LOCALE_NAME_RE):
+	  some platform has a locale without territory but with
+	  encoding.
+	  (#each_sub_locale): ditto.
+
+Sun Jan  9 14:47:50 2011  TAKAO Kouji  <kouji@takao7.net>
+
+	* ext/readline/readline.c: apply a patch from Nobuyoshi Nakada.
+	  fixed #3616 [ruby-core:31484] IRB + readline incorrectly counts
+	  non-printing characters in prompt
+
+Sat Jan  8 21:47:26 2011  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c (enum_sort_by): use rb_ary_resize.
+	  (ary_cutoff): removed.
+
+Sat Jan  8 21:24:17 2011  Tanaka Akira  <akr@fsij.org>
+
+	* pack.c (swapf): compilation condition simplified.
+	  (swapd): ditto.
+
+Sat Jan  8 20:51:25 2011  Tanaka Akira  <akr@fsij.org>
+
+	* pack.c (swapd): remove duplicated code.
+
+Sat Jan  8 19:28:55 2011  Tanaka Akira  <akr@fsij.org>
+
+	* thread.c: parenthesize macro arguments.
+
+Fri Jan  7 23:07:40 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (configuration): backref needs to capture.
+
+Fri Jan  7 21:57:22 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-mode-variables), misc/ruby-style.el:
+	  show trailing whitespace.
+
+	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): highlight
+	  regexp after open bracket.  [ruby-core:34183]
+
+Fri Jan  7 00:37:35 2011  Tanaka Akira  <akr@fsij.org>
+
+	* string.c: parenthesize macro arguments.
+
+Thu Jan  6 22:42:02 2011  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* bignum.c (bigmul1_karatsuba): avoid overflow that make assertion
+	  fail in certain case.  this patch is contributed from Ray Chason
+	  <chasonr at gmail.com> in personal communication.
+
+Thu Jan  6 20:55:49 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): ignore rest from first dot from
+	  TARGET to generate init function name.
+	  this is followup of r30464.
+
+Thu Jan  6 11:27:01 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/json/tree_builder.rb (start_mapping): tags
+	  should not be included in JSON mapping
+
+Thu Jan  6 09:23:33 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* lib/net/protocol.rb (eof?): BufferedIO should proxy eof? to the
+	  underlying IO object.
+
+Thu Jan  6 09:12:31 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* lib/mkmf.rb (configuration): fixing gsub when multiple error flags
+	  are passed to GCC.
+
+Thu Jan  6 05:25:49 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_modify): export.
+
+Thu Jan  6 05:14:41 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (get_strio, strio_set_string)
+	  (strio_reopen): check if frozen.  [ruby-core:33648]
+
+Thu Jan  6 05:10:58 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_resize): new utility function.  [ruby-dev:42912]
+
+Thu Jan  6 05:03:26 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln.c (init_funcname_len): ignore rest from first dot.
+	  [ruby-dev:41774]
+
+Thu Jan  6 02:55:48 2011  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: use YAML 1.0 output
+	  format for serializing nil values.  Thanks Eric Hodel!
+
+	* test/psych/test_nil.rb: test for nil values
+
+Wed Jan  5 14:21:34 2011  Mark Dodwell  <hi@mkdynamic.co.uk>
+
+	* string.c: fix rdoc typo.
+	  https://github.com/shyouhei/ruby/pull/3
 
-	* io.c (f_p): ditto.
+Wed Jan  5 14:06:01 2011  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Apr 14 22:18:17 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* test/rdoc/test_rdoc_options.rb (TestRDocOptions#test_check_files):
+	  skip on Windows because chmod 0 doesn't mean unreadable by owner.
 
-	* struct.c (struct_aref): should not subtract negative index.
+Wed Jan  5 13:56:54 2011  Akinori MUSHA  <knu@iDaemons.org>
 
-Tue Apr 14 11:34:50 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/net/http.rb (Net::HTTP#get): A header hash given should not
+	  be modified.
 
-	* experimental release 1.1b9_10.
+Wed Jan  5 12:10:08 2011  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* parse.y: token names prefixed by `t'.
+	* ext/dl/{cfunc.c,dl.h,handle.c}, ext/fiddle/fiddle.{h,c}: Use _WIN32
+	  rather than checking for windows.h.  Thanks Jon Forums!
+	  [ruby-core:33977]
 
-	* struct.c (struct_s_def): supports subclassing of Struct.
+Sat Jan  1 17:02:50 2011  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* io.c (io_s_new): supports subclassing of IO.
+	* lib/irb/locale.rb (IRB::Locale#search_file): make it possible
+	  to load a localization from a gem.
+	  (IRB::Locale#lc_path): obsoleted because of the change of #search_file
+	  (IRB::Locale#each_localized_path): new private method, based on
+	  lc_path
+	  (IRB::Locale#find): follows the change of #search_file.
+	  (IRB::Locale#load): removed duplicate with #find.
 
-Mon Apr 13 11:07:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Jan  1 11:44:42 2011  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (f_binding): need to restore method name.
+	* strftime.c: parenthesize macro arguments.
 
-	* eval.c (rb_call0): raises SystemStackError, not Fatal.
+Sat Jan  1 11:10:29 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (obj_display): same as `print self'.
+	* ext/zlib/zlib.c: take care of platforms where long is bigger
+	  than int.
 
-	* io.c (f_p): can now be called in the method form.
+Sat Jan  1 11:03:58 2011  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* re.c (reg_regsub): needed to be mbchar aware.
+	* NEWS (optparse): shell completion support.
 
-Mon Apr 13 13:18:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* misc/README (rb_optparse.{bash,zsh}): for shell completion.
 
-	* eval.c (thread_trap_eval): all signals delivered to main_thread.
+	* include/ruby/intern.h (VALUE rb_ary_print_on): I have never seen
+	  this function anywhere.
 
-Mon Apr 13 12:47:03 1998  TAKAHASHI Masayoshi  <maki@inac.co.jp>
+Sat Jan  1 04:20:11 2011  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* re.c (kcode_set_option): did not set SJIS on SJIS condition.
+	* win32/win32.c (rb_w32_write_console): don't raise exception when
+	  the conversion is for writing to console.
+	  Patched by Heesob Park [ruby-core:33999]
 
-Sun Apr 12 22:14:07 1998  Kazunori NISHI  <kazunori@swlab.csce.kyushu-u.ac.jp>
+Fri Dec 31 12:02:06 2010  Tanaka Akira  <akr@fsij.org>
 
-	* array.c (ary_uniq_bang): should be `==', not `='. embarrassing.
+	* enum.c (enum_sort_by): use less temporary objects.
 
-Sat Apr 11 02:13:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Dec 31 11:46:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (ary_subseq): SEGVed for `[][1,1]'.
+	* configure.in (warnflags), lib/mkmf.rb (configuration): turn
+	  warnings into errors only for bundled extensions.
+	  [ruby-core:33815]
 
-Fri Apr 10 21:29:06 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+Fri Dec 31 11:15:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (ary_subseq): add check for beg larger than array length.
+	* ext/zlib/zlib.c (sizeof): zlib.h mistakenly assumes the result
+	  of sizeof to be int, not size_t.
 
-Wed Apr  8 17:24:11 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
+Fri Dec 31 10:27:34 2010  Tanaka Akira  <akr@fsij.org>
 
-	* dir.c (dir_s_open): can be called with block (like IO#open).
+	* st.c: parenthesize macro arguments.
 
-	* dir.c (dir_s_chdir): print directory path on error.
+Fri Dec 31 03:23:26 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* dir.c (dir_s_chroot): ditto
+	* vsnprintf.c (BSD__uqtoa): Fix overflow when long != quad_t.
+	  patched by Peter Weldon <peter.weldon AT null.net>
+	  [ruby-core:33985]
 
-	* dir.c (Init_Dir): needed to override `new'.
+Fri Dec 31 03:00:34 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Thu Apr  9 18:24:58 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* Makefile.in: remove unnecessary semicolons.
 
-	* experimental release 1.1b9_09.
+Thu Dec 30 23:09:47 2010  wanabe  <s.wanabe@gmail.com>
 
-	* string.c (str_cmp): do not depend on sentinel at the end of the
-	  strings. 
+	* vm.c (vm_define_method): guard iseq from GC while method definition.
+	  [ruby-dev:42832]
 
-	* string.c (str_chomp_bang): forgot to set the sentinel.
+Thu Dec 30 20:18:32 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Apr  8 00:59:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* win32/Makefile.sub: ditto.
 
-	* bignum.c (big2int): converted int may be too big to fit in
-	  signed int.
+Thu Dec 30 20:57:09 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* parse.y (arg): `foo += 1' should not cause an error.
+	* Makefile.in: Check V=1 argument if run "make clean" or similar.
 
-	* variable.c (rb_const_defined): returned false even if the
-	  constant is defined at the top level.
+Thu Dec 30 20:41:50 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (f_local_variables): dyna_var->id may be null.  should
-	  have checked before calling str_new2().
+	* Makefile.in: Kill ugly line continuation.
 
-Tue Apr  7 01:15:15 1998  Kaneko Naoshi  <wbs01621@mail.wbs.or.jp>
+Thu Dec 30 11:49:40 2010  Tanaka Akira  <akr@fsij.org>
 
-	* re.c (reg_regsub): need to check string boundary.
+	* sprintf.c: parenthesize macro arguments.
 
-Tue Apr  7 19:19:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Dec 29 21:20:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_cmp): returns either 1, 0, -1.
+	* io.c (maygvl_copy_stream_wait_readwrite): define if USE_SENDFILE
 
-	* array.c (ary_cmp): should check array length, too
+Wed Dec 29 20:37:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Apr  7 18:50:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/extmk.rb: strip current directory prefix.
 
-	* experimental release 1.1b9_08.
+	* enc/depend (clean): remove name2ctype.h when out-of-place build.
 
-Tue Apr  7 18:31:27 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* win32/Makefile.sub (clean-enc): pass V to inferior make.
 
-	* instruby.rb (mandir): dll installation for cygwin32
+Wed Dec 29 18:23:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Apr  7 01:16:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* re.c (rb_reg_expr_str): need to escape if the coderange is invalid.
 
-	* config.sub (maybe_os): TOWNS support?
+Wed Dec 29 10:06:51 2010  Tanaka Akira  <akr@fsij.org>
 
-	* config.guess: too strict check for libc versions on linuxes.
+	* signal.c: parenthesize macro arguments.
 
-	* experimental release 1.1b9_07.
+Wed Dec 29 07:22:15 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* array.c (ary_cmp): compare each element using `<=>'.
+	* lib/rake/rdoctask.rb: Deprecate in favor of rdoc/task.
 
-	* hash.c (hash_each_with_index): yields [value, key] pair.
+Wed Dec 29 07:07:06 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* class.c (class_protected_instance_methods): list protected
-	  method names.
+	* lib/rdoc: Import RDoc 3.1
 
-	* class.c (ins_methods_i): exclude protected methods.
+Tue Dec 28 18:36:38 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (PUSH_BLOCK): dynamic variables can be accessed from
- 	  eval() with bindings.
+	* error.c, include/ruby/intern.h (rb_compile_error_with_enc): new
+	  function to raise syntax error, with source encoding'ed message.
 
-Mon Apr  6 14:49:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* parse.y (compile_error): use above function.
+	  [ruby-core:33951] (#4217)
 
-	* eval.c (thread_yield): must return evaluated value.
+Tue Dec 28 07:37:38 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Apr  3 13:07:29 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ruby.c: parenthesize macro arguments.
 
-	* eval.c (thread_schedule): context switch bypassed on wrong
-	  conditions.
+Tue Dec 28 07:17:11 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* variable.c (rb_name_class): set classname by id before String
- 	  class is initialized (1.0 behavior restored).
+	* NEWS: add ARGF.write and so on.
 
-Fri Apr  3 11:25:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec 28 07:12:38 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* numeric.c (num2int): no implicit conversion from string.
+	* NEWS: add new magic-comment. (warn-indent) [ruby-core:25442]
 
-	* numeric.c (num2int): check whether `to_i' returns an Integer.
+Tue Dec 28 04:32:37 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* numeric.c (num_zero_p): new method.
+	* ext/fiddle/extconf.rb: check for windows.h while building fiddle.
+	  Thanks Jon Forums! [ruby-core:33923]
 
-	* numeric.c (num_nonzero_p): new method.  returns the receiver if
- 	  it's not zero.
+Tue Dec 28 01:45:12 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* eval.c (obj_instance_eval): the_class should be the object's
-	  singleton class.
+	* NEWS: Add Zlib.deflate and Zlib.inflate.
+	  [ruby-dev:42833]
 
-	* error.c (exc_s_new): message is converted into a string.
+Mon Dec 27 21:22:33 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Apr  2 18:31:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* win32/configure.bat: Remove obsoleted coding rule. Now, we
+	  don't support to build on Windows 95/98 and Me.
 
-	* eval.c (obj_call_init): every object call `initialize'.
+Mon Dec 27 18:27:13 2010  Tanaka Akira  <akr@fsij.org>
 
-Wed Apr  1 08:51:53 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* re.c: parenthesize macro arguments.
 
-	* parse.y (stmt): UNTIL_MOD should be for stmt, not only for expr.
+Mon Dec 27 15:22:23 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Apr  1 01:20:31 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* win32/README.win32: note to need NT based OS to build ruby.
 
-	* object.c (true_and): boolean operators &, | and ^.
+Mon Dec 27 12:14:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Mar 31 13:23:58 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* common.mk (EXTMK_ARGS): specify to pass macro V, because nmake
+	  doesn't pass it via MAKEFLAGS.
 
-	* array.c (ary_compact_bang): returns nil, if it does not modify
-	  the array like String's bang methods.
+Mon Dec 27 10:33:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* array.c (ary_uniq_bang): new method to remove duplicate items.
+	* ext/zlib/zlib.c (Init_zlib): Add Zlib.deflate and Zlib.inflate.
+	  [ruby-dev:42833]
 
-	* eval.c (bind_s_new): new method.
+Mon Dec 27 07:38:07 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* numeric.c (num2int): raise exception if Fixnums too big to
- 	  convert into `int' in case that sizeof(int) < sizeof(INT).
+	* misc/rb_optparse.zsh: add compdef for generator.
 
-	* string.c (str_center): SEGV on negative width.
+Mon Dec 27 07:32:07 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* eval.c (eval): forgot to set sourcefile.
+	* lib/optparse.rb (OptionParser#compsys): escape brackets too.
+	  [ruby-dev:42754]
 
-Mon Mar 30 11:12:29 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec 27 01:30:08 2010  Tanaka Akira  <akr@fsij.org>
 
-	* file.c (f_test): raises exception for unkown command.
+	* ext/socket/mkconstants.rb: add IF_NAMESIZE.
+	  add a default for INET6_ADDRSTRLEN.
 
-	* eval.c (Init_eval): `class_eval': alias to the module_eval.
+Sun Dec 26 23:49:47 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Mar 30 18:50:42 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+	* win32/Makefile.sub: suppress a strange error message when RMALL
+	  found no such file.
+	* win32/rmall.bat: new.
 
-	* string.c (str_capitalize_bang): did not check string modification.
+Sun Dec 26 21:23:23 2010    <kosaki.motohiro@gmail.com>
 
-	* string.c (str_delete_bang): wrong conversion.
+	* win32/Makefile.sub: fix 'nmake clean-enc' breakage since r28322.
 
-	* string.c (str_intern): typo in error message.
+Sun Dec 26 22:25:07 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Mar 30 01:44:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/ripper/depend (ripper.y): fix messages with nmake.
+	  [ruby-dev:42896]
 
-	* eval.c (obj_instance_eval): accepts block as evaluation body.
-	  No compilation needed each time.
+Sun Dec 26 22:24:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (mod_module_eval): ditto
+	* file.c (file_expand_path): get rid of warnings caused by
+	  -Wdeclaration-after-statement on cygwin.
 
-	* file.c (file_s_umask): umask did not return old values, if no
- 	  argument given.
+Sun Dec 26 20:28:34 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Mar 29 00:54:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* process.c (before_exec): add small comment.
 
-	* eval.c (f_throw): nil returned always.
+Sun Dec 26 20:52:21 2010  Tanaka Akira  <akr@fsij.org>
 
-Sat Mar 28 20:40:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/socket/mkconstants.rb: define INET_ADDRSTRLEN as 16 if not
+	  available.  fix compilation error on mswin32-60.  reported by nobu.
 
-	* experimental release 1.1b9_06.
+Sun Dec 26 19:37:37 2010  Tanaka Akira  <akr@fsij.org>
 
-Sat Mar 28 16:07:11 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* ext/socket/option.c: define IFNAMSIZ if not available.
+	  fix compilation error on mingw32.  reported by nobu.
 
-	* io.c (io_closed): should not cause exception fot closed IO.
+Sun Dec 26 12:16:29 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_tr): returned nil for success.
+	* lib/rdoc/ri/paths.rb (RDoc::RI::Paths::HOMEDIR): no exception if
+	  HOME is not set.  [ruby-core:33867]
 
-Sat Mar 28 00:47:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 26 11:39:11 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (f_local_variables): new method to return an array of
- 	  local variable names.
+	* parse.y (stmt): missing ripper rule.  i.e., `a::B ||= c 1'.
+	  http://twitter.com/#!/wannabe53/status/18797576396472321
+	  http://twitter.com/#!/wannabe53/status/18798416150663168
 
-	* variable.c (obj_instance_variables): now returns an array of
-	  variable names, as described in the reference.
+Sun Dec 26 11:15:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_attr): honors default method visibility of the
-	  current scope.
+	* test/with_different_ofs.rb (DifferentOFS): should not affect
+	  original classes.
 
-Fri Mar 27 13:49:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 26 09:35:07 2010  Tanaka Akira  <akr@fsij.org>
 
-	* experimental release 1.1b9_05.
+	* rational.c: parenthesize macro arguments.
 
-	* ruby.c (ruby_prog_init): `site_ruby' added to load_path.
+Sun Dec 26 09:22:19 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ruby.c (ruby_prog_init): load-path order changed.  Paths in
- 	  the RUBYLIB environment variable comes first in non-tainted
- 	  mode.
+	* ext/socket/option.c (rb_if_indextoname): new function to abstract
+	  environments without if_indextoname.
+	  (inspect_ipv6_multicast_if): new function to inspect
+	  IPV6_MULTICAST_IF.
+	  Socket::Option.new(:INET6, :IPV6, :MULTICAST_IF,
+	  [2].pack("I!")).inspect is
+	  "#<Socket::Option: INET6 IPV6 MULTICAST_IF eth0>".
 
-Thu Mar 26 11:51:09 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 26 04:31:15 2010  Luis Lavena  <luislavena@gmail.com>
 
-	* eval.c (rb_call): new feature: `protected' methods.
+	* ext/dl/win32/registry.rb: Corrected RegCreateKeyExA signature.
+	  Patch by Rafal Michalski [ruby-core:33874] [Ruby 1.9-Bug#4203]
 
-	* string.c (str_dump): new method.
+Sun Dec 26 02:31:58 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (block_pass): block argument can be nil, which means no
-	  block is supplied for the method.
+	* io.c (advice_arg_check): Change argument check.
+	  Now, an unsupported advice makes NotImplementedError.
+	  [ruby-dev:42887] [Ruby 1.9-Feature#4204]
 
-Wed Mar 25 21:20:13 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+Sun Dec 26 03:00:53 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (str_reverse_bang): string copied to wrong place.
+	* ext/socket/extconf.rb: Fix build error which was introduced r30372.
 
-Wed Mar 25 08:12:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 26 01:37:10 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* numeric.c (flo_modulo): caused SEGV if left operand is not a
- 	  float value.
+	* ext/socket/extconf.rb: check the existence of if_indextoname().
 
-	* eval.c (f_eval): optional third and fourth argument to specify
-	  file-name and line-number.
+	* ext/socket/option.c: yesterday's akr's commits destroyed the build of
+	  some unrelated platforms (such as Windows).
 
-	* eval.c (eval): file-name and line-number set properly.
+Sat Dec 25 23:29:11 2010  Tanaka Akira  <akr@fsij.org>
 
-	* parse.y (assign_in_cond): literal assignment is now warning, not 
-	  compile error.
+	* ext/socket/option.c (inspect_ipv4_add_drop_membership): new function
+	  to inspect struct ip_mreq and struct ip_mreqn for
+	  IP_ADD_MEMBERSHIP and IP_DROP_MEMBERSHIP.
+	  Socket::Option.new(:INET, :IP, :ADD_MEMBERSHIP,
+	  [239,255,99,81, 0,0,0,0].pack("CCCCCCCC")).inspect is now
+	  "#<Socket::Option: INET IP ADD_MEMBERSHIP 239.255.99.81 0.0.0.0>".
+	  (inspect_ipv4_multicast_if): new function to inspect struct in_addr
+	  and struct ip_mreqn for IP_MULTICAST_IF.
+	  Socket::Option.new(:INET, :IP, :MULTICAST_IF,
+	  [192,168,0,7].pack("CCCC")).inspect is now
+	  "#<Socket::Option: INET IP MULTICAST_IF 192.168.0.7>".
 
-	* error.c (Warn): Warn() always print message, OTOH Waring()
-	  prints when verbose flag is set.
+	* ext/socket/extconf.rb: check struct ip_mreq and struct ip_mreqn.
 
-Tue Mar 24 12:50:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec 25 22:49:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.c (ruby_prog_init): `.' should come last in the load-path.
+	* test/csv: DifferentOFS needs to be include in each classes.
 
-	* eval.c (Init_eval): `__send__', alias for `send'.
+	* test/digest/test_digest_extend.rb (TestDigestExtend#setup):
+	  should not depend on the result of previous tests
 
-Mon Mar 23 12:44:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/with_different_ofs.rb (DifferentOFS::WithDifferentOFS): give
+	  name.
 
-	* string.c (str_chomp_bang): now takes `rs' as an argument.
+	* test/with_different_ofs.rb (DifferentOFS): test suite for test
+	  suites affected by $,.
 
-	* eval.c (thread_free): main_thread should not be freed.
+	* test/digest/test_digest_extend.rb (TestDigestExtend): should not
+	  assume $, invariant.
 
-Fri Mar 20 16:40:34 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/csv/test_data_converters.rb, test/csv/test_table.rb: don't
+	  call setup within tests.
 
-	* string.c (str_chomp_bang): chomp! (and other ! methods) returns
- 	  nil if it does not modify the string.
+Sat Dec 25 20:01:40 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* string.c (str_sub_iter_s): should check last pattern since it
- 	  may be matched to null.
+	* io.c (pipe_open): Added rb_thread_atfork(). We must reinitialize
+	  GVL at new process creation.
 
-Thu Mar 19 13:48:55 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec 25 18:26:55 2010  Tanaka Akira  <akr@fsij.org>
 
-	* experimental release 1.1b9_04.
+	* ext/socket/option.c (inspect_ipv6_mreq): new function to inspect
+	  struct ipv6_mreq for IPV6_JOIN_GROUP and IPV6_LEAVE_GROUP.
+	  Socket::Option.new(:INET6, :IPV6, :JOIN_GROUP,
+	  [0xff12,0,0,0,0,0,0,1, 2].pack("nnnnnnnnI!")).inspect is now
+	  "#<Socket::Option: INET6 IPV6 JOIN_GROUP ff12::1 eth0>".
 
-	* parse.y (yylex): `10e0.9' should cause syntax error.
+	* ext/socket/extconf.rb: check struct ipv6_mreq.
 
-Wed Mar 18 17:46:31 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec 25 18:04:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.c (load_file): new file object constant DATA.  Only
-	  available for the script from the file.
+	* lib/csv.rb (CSV.foreach): 'rb' mode is defaulted in open.
 
-	* regex.c (re_match): forwading failure point popped too much. 
+	* lib/csv.rb (CSV#init_separators): cannonicalize encoding options
+	  as Encoding objects.
 
-Tue Mar 17 18:23:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec 25 18:30:34 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* math.c (math_frexp): newly added.
+	* thread.c (rb_thread_atfork): Add small comment why we need
+	  reset random seed.
 
-	* math.c (math_ldexp): ditto.
+Sat Dec 25 17:33:55 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bignum.c (bigdivmod): calculates modulo.
+	* test/csv/base.rb (TestCSV.with_different_ofs): give name to
+	  anonymous classes.
 
-	* numeric.c (fix_remainder): returns reminder, formerly introduced
- 	  as modulo.
+	* lib/csv.rb (CSV#init_separators): use IO#gets with length
+	  parameter to get rid of wrong convertion.
 
-	* numeric.c (fix_modulo): calculates proper `modulo'.
+	* lib/csv.rb (CSV::foreach, CSV#initialize): directly use encoding
 
-	* bignum.c (bigdivmod): wrong sign for reminder.
+	* lib/csv.rb, test/csv: should not assume $, invariant.
 
-Mon Mar 16 17:07:28 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec 25 16:08:06 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* experimental release 1.1b9_03.
+	* signal.c: change rb_atomic_t definition from uchar to uint.
 
-Mon Mar 16 16:33:53 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Sat Dec 25 15:04:05 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (pipe_finalize): needed to add pipe_finalize to pipes on
-	  cygwin32.
+	* test/csv/test_encodings.rb (TestEncodings#setup): fix evil test
+	  suite writing to the source directory.
 
-Mon Mar 16 14:11:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec 25 15:08:08 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* class.c (ins_methods_i): needed to consider NOEX_UNDEF.
+	* ext/pty/pty.c (chfunc): Added rb_thread_atfork_before_exec().
+	  We must reinitialize GVL at new process creation. Otherwise
+	  we may meet an insane deadlock. [Bug#4121][ruby-dev:42686]
 
-Mon Mar 16 13:23:53 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Sat Dec 25 14:27:09 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_check_closed): check for `fptr->f2 == NULL'.
+	* io.c (rb_io_extract_encoding_option): accept Encoding object as
+	  encoding: optional argument.  [ruby-dev:42884]
 
-	* io.c (io_fptr_close): ditto.
+Sat Dec 25 13:37:55 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Mon Mar 16 11:49:25 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/minitest/*.rb: Imported minitest 2.0.2 r6093.
 
-	* io.c (pipe_atexit): free()ing referencing pipe_list.
+Sat Dec 25 13:05:59 2010  Tanaka Akira  <akr@fsij.org>
 
-	* range.c (range_length): returns zero, if the first is greater
-	  than the last.
+	* random.c: parenthesize macro arguments.
 
-	* signal.c (trap_restore_mask): restore signal mask before raising 
-	  exceptions and throws.
+Sat Dec 25 12:48:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Mar 13 13:49:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* load.c (rb_f_require_relative): don't omit return type.
 
-	* experimental release 1.1b9_02.
+Sat Dec 25 11:06:00 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* object.c (mod_clone): need to dups constants and instance
-	  variables.
+	* load.c (rb_f_require_relative): Add documentation.
 
-	* eval.c (rb_eval): forgot to initialize body for NODE_DEFS.
+Sat Dec 25 11:02:52 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_eval): retrieve self from calling frame, since self
-	  changes sometimes.
+	* ext/zlib/zlib.c (gzreader_gets): support optional length
+	  parameter.
 
-	* env.h (FRAME): need to save self in the calling frame.
+	* ext/zlib/zlib.c (gzfile_read, gzfile_readpartial): length should
+	  be long.
 
-	* io.c (f_gets_method): rs should be initialized by RS.
+Sat Dec 25 10:51:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Mar 12 15:33:57 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/json/generator/generator.{c,h} (fbuffer_free_only_buffer):
+	  unused.
 
-	* experimental release 1.1b9_01.
+	* ext/openssl/ossl_pkcs5.c (ossl_pkcs5_pbkdf2_hmac): add casts.
 
-	* range.c (range_s_new): check values by `first <= last'.
+Fri Dec 24 08:46:04 2010  Tanaka Akira  <akr@fsij.org>
 
-	* parse.y (lastline_set): fixed offset for $_ and $~ in the local
-	  variable space.
+	* process.c: parenthesize macro arguments.
 
-Wed Mar 11 02:14:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec 23 19:17:14 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
 
-	* io.c (io_gets): handle normal case specially for speed.
+	* test/net/imap/cacert.pem: updated because it has been expired.
 
-	* eval.c (rb_disable_super): function to disable superclass's
-	  method explicitly.
+	* test/net/imap/server.crt: signed again because CA cert was expired.
 
-	* eval.c (rb_eval): inherits previous method definition's
-	  NOEX_UNDEF-ness, if exists.
+Thu Dec 23 11:16:52 2010  Tanaka Akira  <akr@fsij.org>
 
-	* class.c (rb_define_method): disables superclass's overriding
- 	  method by default.
+	* parse.y: parenthesize macro arguments.
 
-Wed Mar 11 01:40:48 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
+Thu Dec 23 11:00:09 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (flo_gt,etc.): do not depend on `<=>', to handle NaN.
+	* error.c (rb_check_type): check for type from extensions for ruby
+	  1.8.  see [ruby-core:33797].
 
-Tue Mar 10 00:03:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec 23 08:12:59 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ruby.c (load_file): understands multiple options in #! line.
+	* lib/net/smtp.rb: refactoring Net::SMTP#esmtp= to use an
+	  attr_accessor
 
-	* regex.c (re_compile_pattern): support for [:alpha:] etc.
+Thu Dec 23 06:35:41 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Mon Mar  9 16:53:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/net/smtp.rb: Net::SMTP should close the SSL connection if the
+	  connection verification fails.
 
-	* io.h (GetOpenFile): embed io_check_closed in GetOpenFile.
+Thu Dec 23 01:47:58 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* sprintf.c (f_sprintf): zero padding failed for negative
-	  integers.
+	* NEWS: remove #object_id. [ruby-dev:42840]
 
-	* sprintf.c (remove_sign_bits): failed to remove some bits.
+Wed Dec 22 08:56:39 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Sat Mar  7 21:51:46 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
+	* NEWS: add Module#private_constant and Module#public_constant.
+	  [ruby-dev:39685][ruby-core:32698]
 
-	* class.c (ins_methods_i): body may be NULL for some case.
+Wed Dec 22 07:59:23 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Fri Mar  6 17:23:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* NEWS: add IO#advise. [ruby-core:33110] [Ruby 1.9-Feature#4038]
 
-	* regex.c (mbcinit): table driven mbchar detection.
+Tue Dec 21 23:45:31 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* object.c (obj_alloc): check for allocating instance for the
-	  primitive classes (mostly perfect).
+	* gc.c (Init_GC): move back object_id to Kernel. [ruby-dev:42840]
 
-	* ext/curses/curses.c (curses_finalize): restore original state at 
-	  interpreter temination.
+Tue Dec 21 12:45:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/curses/curses.c (curses_addstr): forgot to check argument
-	  type (caused SEGV).  now uses STR2CSTR() macro.
+	* configure.in (target_archs): remove temporary objects.
 
-Thu Mar  5 13:47:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* enc/Makefile.in, enc/depend (clean): remove work directories.
 
-	* eval.c (block_pass): accepts method object as block args.
+Tue Dec 21 07:39:12 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (f_missing): use any_to_s() for stringify.
+	* pack.c: parenthesize macro arguments.
 
-Wed Mar  4 01:39:52 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec 21 06:25:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (block_arg): new syntax - block argument in the
-	  calling arglist.
+	* test/rexml/test_contrib.rb (ContribTester#test_pos): should not
+	  use fixed path name for tests.  [ruby-dev:42827]
 
-	* eval.c (rb_call): no module search. simplified a lot.
+	* test/rexml/test_sax.rb (SAX2Tester#test_socket): should not use
+	  fixed port for tests.  [ruby-dev:42828]
 
-	* eval.c (rb_eval): block arg support.
+Tue Dec 21 06:10:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (f_block_arg): new syntax - block argument in the
- 	  formal arglist.
+	* compile.c (setup_args), vm.c (invoke_block_from_c),
+	  vm_insnhelper.c (caller_setup_args): reverted r30241 and r30243
+	  except for the test.
 
-Tue Mar  3 14:20:15 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec 21 01:41:42 2010  Masaya Tarui  <tarui@ruby-lnag.org>
 
-	* eval.c (obj_method): returns bound method object.
+	* io.c : add an extra byte to buffer for the specification of read
+	  in Windows. see [ruby-core:33460] and r29980. and, we have to
+	  discuss how to do this one byte.
 
-	* eval.c (rb_call): argument check for empty methods.
+Tue Dec 21 01:18:06 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ruby.h (NUM2CHR): new macro, originally from curses module.
+	* error.c: Fix build error for win32. This regression was
+	  introduced by r30271.
 
-Tue Mar  3 13:03:35 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
+Tue Dec 21 00:59:40 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* io.c (io_putc): new method.
+	* thread.c (thread_cleanup_func): Moved interrupted_lock
+	  destroying code from native_thread_destroy() to
+	  thread_cleanup_func() because it's platform independent logic.
 
-Tue Mar  3 11:21:28 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* thread_win32.c (native_thread_destroy): ditto.
+	* thread_pthread.c (native_thread_destroy): ditto.
 
-	* string.c (str_inspect): more strict charcode detection.
+Tue Dec 21 00:46:20 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (thread_stop): stopping only thread raises ThreadError
-	  exception.
+	* thread.c (thread_cleanup_func): Don't touch native threading
+	  resource at fork. Sadly this is purely bandaid. We need to
+	  implement proper fix later. [Bug #4169] [ruby-core:33767]
 
-Tue Mar  3 08:04:56 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
+Tue Dec 21 00:22:44 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* struct.c (struct_alloc): imcomplete struct initialization made
- 	  GC to access unallocated addresses.
+	* error.c (exit_success_p): Check status code more carefully.
+	  status code may have garbage in upper bit.
 
-Mon Mar  2 16:28:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec 20 23:12:37 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (thread_stop_method): remove Thread#stop.
+	* node.c: parenthesize macro arguments.
 
-Fri Feb 27 18:16:26 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec 20 20:04:41 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* version 1.1b9 released.
+	* NEWS: add #__id__ and #object_id. [ruby-dev:42778]
 
-Fri Feb 27 09:36:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec 20 20:03:21 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* hash.c (hash_delete_nil): needed to compare value to nil, since
-	  nil is the valid key for hashes.
+	* thread_pthread.c (native_thread_destroy): Fixed gvl_cond leak.
 
-	* hash.c (hash_foreach_iter): rehashing causes IndexError.
+Mon Dec 20 13:49:05 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* hash.c (hash_foreach_iter): rehash check by pointer comparison.
+	* NEWS: Add item for RDoc 3.0.1
 
-Thu Feb 26 17:22:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/rdoc: Import RDoc 3.0.1, remove require for perl parser.
 
-	* parse.y (fname): convert reswords into symbols.
+Mon Dec 20 12:15:32 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* parse.y (reswords): reserved words are now embedded in the
- 	  syntax (sigh).
+	* lib/rdoc: Import RDoc 3.0.
 
-	* parse.y: now reserved words can be method names safely.
+Mon Dec 20 01:55:03 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Feb 25 15:50:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (Init_IO): Added O_DIRECT. This feature was proposed by
+	  Run Paint Run Run.
+	  [Feature #4015] [ruby-core:33018]
 
-	* eval.c (mod_module_eval): clear the_scope's PRIVATE flag before
-	  calling eval().
+Sun Dec 19 19:15:23 2010  Tanaka Akira  <akr@fsij.org>
 
-	* gc.c (gc_call_finalizer_at_exit): run finalizers before any data 
-	  object being freed.
+	* marshal.c: parenthesize macro arguments.
 
-	* eval.c (rb_eval): needed to keep prot_tag->retval before
-	  evaluating the ensure clause.
+Sat Dec 18 21:52:37 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Feb 24 11:16:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vsnprintf.c (BSD_vfprintf): suppress warning: "_WIN32" is not
+	  defined.
 
-	* parse.y (yylex): reserved words can be appear as method names at
- 	  right after 'def' and `.'(dot), like foo.next.
+Sat Dec 18 16:02:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (return_check): checks for return out of thread (formerly
- 	  done in return_value).
+	* compile.c (setup_args), vm.c (invoke_block_from_c),
+	  vm_insnhelper.c (caller_setup_args): fix of r30241. lambda block
+	  should check argument number.
 
-	* eval.c (POP_TAG): copy retval to outer level.
+Sat Dec 18 14:42:29 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (return_value): just set retval, no check, no unwinding.
+	* load.c: parenthesize macro arguments.
 
-	* parse.y (nextc): line continuation by backslash at end of line.
+Sat Dec 18 10:07:04 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): forgot to clear pending_exact on
-	  closing parentheses.
+	* compile.c (setup_args, iseq_compile_each): optimize AMPER LAMBDA
+	  combination as block.
 
-	* parse.y (assignable): should not assign dyna_var to true, if it
- 	  is already defined.
+Fri Dec 17 22:07:16 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Feb 23 14:35:03 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* gc.c (Init_GC): move #__id__ and #object_id to BasicObject.
+	  [ruby-dev:42778]
 
-	* object.c (obj_is_kind_of): no longer accepts true/false/nil.
+Fri Dec 17 19:35:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c ({true,false,nil}_to_i): can be converted into integers.
+	* test/mkmf/base.rb (TestMkmf::FakeLog): capture output from mkmf.
 
-Mon Feb 23 12:11:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/mkmf/test_find_executable.rb (test_find_executable):
+	  suppress meaningless differences for chkbuild.
 
-	* re.c (reg_s_quote): needed to be mbchar aware.
+Fri Dec 17 13:26:54 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (proc_s_new): wrong iter mark.
+	* win32/setup.mak (BASERUBY): quit with an error when BASERUBY was not
+	  able to set, just like configure.in does. [ruby-dev:42782]
 
-Sat Feb 21 22:59:30 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
+Fri Dec 17 07:04:09 2010  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (f_syscall): no argument check.
+	* iseq.c: parenthesize macro arguments.
 
-Fri Feb 20 10:17:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Dec 17 04:18:37 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* version 1.1b8 released.
+	* transcode.c (str_encode): Alter comment for better wording and ri
+	  output.
 
-	* ext/kconv/kconv.c (kconv_kconv): default output code now be
-	  determined according to the value of $KCODE.
+Fri Dec 17 00:05:40 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* re.c (rb_get_kcode): can retrieve $KCODE from C code. 
+	* io.c (rb_io_advise): New API. IO#advise() allows to tell the
+	  ruby runtime how it expects to use a file handle. This feature
+	  can be improved a performance some situations.
+	  Note: This feature is mainly developed by Run Paint Run Run.
+	  Thank you! [ruby-core:33110] [Ruby 1.9-Feature#4038]
 
-	* parse.y (stmt): if/unless modifiers returns nil, if condition is 
-	  not established.
+	* io.c (do_io_advise): Helper function.
+	* io.c (io_advise_sym_to_const): ditto.
 
-Thu Feb 19 11:06:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec 16 23:29:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/kconv/kconv.c (kconv_kconv): charcode can be specified by
-	  code name (JIS, SJIS, EUC like value of $KCODE).
+	* tool/rbinstall.rb (bin-comm): use transformed name.
+	  [ruby-dev:42777]
 
-	* regex.c (re_compile_pattern): forgot to fixup_jump for (?:..).
+Thu Dec 16 21:52:07 2010  Tanaka Akira  <akr@fsij.org>
 
-	* regex.c (re_compile_pattern): needed to clear pending_exact on
-	  non-registering grouping (?:...).
+	* io.c: parenthesize macro arguments.
 
-Wed Feb 18 19:54:21 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec 16 21:46:39 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (here_document): needed to set lex_state to EXPR_END.
+	* tool/mkconfig.rb (RbConfig): honor ARCHFLAGS and RC_ARCHS to
+	  override embedded ARCH_FLAG value on universal-darwin.
 
-Wed Feb 18 18:45:10 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Thu Dec 16 19:50:12 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* patches for cygwin32 applied.
+	* win32/{configure.bat,setup.mak,Makefile.sub} (PROGRAM_PREFIX,
+	  PROGRAM_SUFFIX): unite the differences of the names of macros of
+	  prefix and suffix.
+	  reported by HANEDA Norikatsu. [ruby-dev:42775]
 
-Wed Feb 18 00:41:31 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec 16 08:04:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_sub_s): needed to be mbchar aware to increment one
- 	  character.
+	* node.h (RNode): match the type of flags to RBasic, and renamed
+	  nd_file as nd_reserved.
 
-	* regex.c (re_match): \Z matches newline just before the end of
-	  the string.
+	* iseq.c (set_relation), vm_insnhelper.c (vm_cref_push): nd_file
+	  is always zero-cleared.
 
-Tue Feb 17 00:04:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec 16 07:22:30 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-	* time.c (time_arg): Time.gm and Time.local now understands
- 	  Time#to_a format.
+	* lib/minitest/unit.rb: Imported minitest 2.0.1 r6079.
 
-	* string.c (str_sub_s): replace happened twice for null pattern.
+Wed Dec 15 20:45:02 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* regex.c (re_search): null pattern should not match after newline 
-	  at the end of string.
+	* lib/test/unit.rb (process_args): need to setup @help to print options.
 
-	* time.c (time_isdst): now returns boolean value.
+Wed Dec 15 11:19:33 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* error.c (rb_check_type): treat special constants in messages.
+	* test/zlib/test_zlib.rb (test_to_io): forgotten to fix with r30201.
 
-	* parse.y (yylex): new form `::Const' to see toplevel constants.
+Wed Dec 15 11:07:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (cond): SEGV on `if ()'.
+	* io.c (simple_sendfile): enable on Mac OS X.
 
-	* gc.c (obj_free): some data needed explicit free().
+	* io.c (nogvl_copy_stream_sendfile): moved precheck of copy length.
 
-Mon Feb 16 23:55:40 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* io.c (nogvl_copy_stream_sendfile): should wait for both of
+	  read/write fds.
 
-	* eval.c (blk_free): release duplicated block informations.
+Wed Dec 15 07:11:55 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (blk_copy_prev): duplicate outer block information into
- 	  the heap, when proc/binding created.
+	* hash.c: parenthesize macro arguments.
 
-Mon Feb 16 14:38:25 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Dec 15 04:02:00 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* time.c (time_mon): now 1 for January and so on.
+	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
+	  fix compile error when !HAVE_X509V3_SET_NCONF. Thanks
+	  Chikanaga-san. [ruby-dev:42761] [Ruby 1.9-Bug#4158]
 
-	* time.c (time_year): year in 19xx (no + 1900 needed anymore).
+Wed Dec 15 03:41:31 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Mon Feb 16 13:28:33 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ripper/test_parser_events.rb (TestRipper#test_block_variables):
+	  Limit address space 100MB instead 100KB. Quite frankly, This
+	  margin is too narrow to contain ruby. [ruby-dev:42763] [Bug#4159]
 
-	* regex.c (re_compile_pattern): need to fetch mbchar's second byte
- 	  without translation.
+Tue Dec 14 23:53:52 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Feb 16 12:29:27 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
+	* io.c (simple_sendfile): improve linux compatibility on FreeBSD,
+	  and now it works. But without cpuset -l 0, it still gets stuck.
 
-	* eval.c (f_pass_block): pass iterator block to other method.
+Tue Dec 14 20:31:33 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Feb 13 08:16:11 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* gc.c: parenthesize macro arguments.
 
-	* parse.y (parse_regx): handle \s before read_escape().
+Tue Dec 14 18:31:48 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* parse.y (read_escape): `\s' in strings as space.
+	* lib/test/unit.rb: help messages.
 
-Tue Feb 10 17:29:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec 14 18:19:03 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* version 1.1b7 released.
+	* common.mk (help): there is no reason to use the abbreviation for here.
 
-	* string.c (str_aset): string insertion by `str[n] = str2'.
+Tue Dec 14 15:03:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* string.c (str_oct): does recognize `0x'.
+	* test/ruby/test_io.rb (test_reopen, test_reinitialize): should close
+	  the temporary files.
 
- 	* sprintf.c (f_sprintf): use baes 10 for conversion from string to
- 	  integer.
+Tue Dec 14 14:24:15 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Feb  9 14:51:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_io.rb (make_tempfile): change the prefix from 'foo'
+	  to 'test_io' because the old one is meaningless and inconvenient.
 
-	* numeric.c (do_coerce): proper error message.
+	* test/ruby/test_io.rb (test_binmode_after_closed): the temporary file
+	  maked by make_temfile is already closed.
 
-	* string.c (str_sum): bug - masked by wrong value. (sigh..)
+Tue Dec 14 13:52:19 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Feb  7 15:11:14 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_io.rb (test_flush_in_finalizer[12]): should close
+	  temporary file because it's only used for taking pathname and
+	  unlinking the file after the end of the test (in GC phase).
 
-	* string.c (str_empty): new method
+Tue Dec 14 13:34:33 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Feb  6 01:42:15 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/zlib/zlib.c (gzfile_s_open): should close the IO if some error
+	  occurs in initializing.
 
-	* time.c (time_asctime): use asctime(3), not strftime(3).
+Tue Dec 14 13:04:16 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Feb  5 18:58:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/net/http.rb (Net::HTTPRequest#send_request_body_data):
+	  set binmode to tempfile.
 
-	* io.c (io_fptr_close): do not free path on close().
+Tue Dec 14 12:55:46 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* array.c (ary_filter): new method.
+	* test/zlib/test_zlib.rb (*): should close files associated with zlib.
 
-	* enum.c (enum_each_with_index): new method.
+Tue Dec 14 11:30:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Feb  5 14:10:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_argf.rb (test_inplace_rename_impossible): unlink
+	  the renamed temporary file on no_safe_rename platforms.
 
-	* parse.y (primary): singleton class def can be appeared inside
- 	  method bodies.
+	* test/ruby/test_argf.rb (test_readlines_limit_0,
+	  test_each_line_limit_0): should close argf because the associated
+	  Tempfile object cannot unlink the temporary file when it's gc'ed
+	  on some platforms (Windows, etc.)
 
-	* hash.c (hash_replace): replace content.
+Tue Dec 14 11:27:07 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (str_replace_method): replace content.
+	* lib/minitest/unit.rb (Minitest::Unit#_run_suite): split test
+	  name and its time. Thiw allows to know test's name when you are
+	  running tests and meet a test which spends long time at realtime.
 
-	* array.c (ary_replace_method): replace elements.
+Tue Dec 14 11:25:20 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* string.c (str_succ_bang): String#succ!
+	* configure.in: Add -Werror=declaration-after-statement to default
+	  warning flag. If you are using GCC, this flag is useful to
+	  prevent breaking VC build.
 
-Thu Feb  5 18:20:30 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Tue Dec 14 10:25:57 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* string.c (str_upcase_bang): multi byte character support.
+	* ext/openssl/ossl_asn1.c (ossl_asn1_decode0): how many gcc-c99isms
+	  must a man mend; before he can build with VC? r30178
 
-Wed Feb  4 13:55:26 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec 13 21:26:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* array.c (ary_reverse): SEGV on empty array reverse.
+	* io.c (simple_sendfile): disable the use of sendfile(2) on
+	  FreeBSD. It blocks on TestIO#test_copy_stream_socket.
 
-Tue Feb  3 12:24:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec 13 18:35:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* re.c (match_to_a): non matching element should be nil.
+	* io.c: define USE_SENDFILE on FreeBSD or DragonFly BSD.
+	  Remove Mac OS X because its argument is different from them.
 
-	* ruby.c (ruby_load_script): load script after all initialization.
+Mon Dec 13 12:00:09 2010  Tanaka Akira  <akr@fsij.org>
 
-	* bignum.c (str2inum): need to interpret prefix `0' of `0x'.
+	* file.c: parenthesize macro arguments.
 
-Tue Feb  3 10:00:18 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Mon Dec 13 11:21:14 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* numeric.c (fix_rshift): use `sizeof(INT)*8' instead of 32.
+	* io.c (simple_sendfile): added for BSD version of sendfile(2).
 
-Mon Feb  2 14:09:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec 13 09:50:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ruby.c (set_arg0): grab environment region too.
+	* lib/net/http.rb (Net::HTTPRequest#set_form): Added to support
+	  both application/x-www-form-urlencoded and multipart/form-data.
+	  There is a similar API, Net::HTTPRequest#set_form_data, but
+	  to keep its compatibility this is newly added. [ruby-dev:42729]
 
-Thu Jan 29 18:36:25 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Sun Dec 12 23:45:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (rb_proc_exec): check `sh' to be exist.
+	* compile.c (iseq_compile_each): fix for __goto__ and __label__
+	  where were totally broken.
 
-Thu Jan 29 18:18:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 12 22:45:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_stdio_set): assignment to $stdin or $stdout does
-	  reopen() as well as $stderr.
+	* common.mk (ID_H_INCLUDES): now id.h depends on vm_opts.h.
 
-Thu Jan 29 14:18:40 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 12 20:42:47 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* class.c (mod_ancestors): should not include singleton classes.
+	* template/id.h.tmpl: suppress all warning: "SUPPORT_JOKE" is not
+	  defined.  [ruby-dev:42730]
 
-	* object.c (obj_type): should not return internal class.
+Sun Dec 12 20:35:07 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* io.c (io_reopen): unwillingly closes stdio streams.
+	* misc/rb_optparse.zsh: update how to install.
 
-Thu Jan 29 11:50:35 1998  Toshihiko SHIMOKAWA  <toshi@csce.kyushu-u.ac.jp>
+	* misc/rb_optparse.zsh: avoid error when setopt noclobber.
 
-	* ext/socket/socket.c (udp_addrsetup): forgot to use htons().
+	* lib/optparse.rb: fix typo. pointed out at
+	  <http://d.hatena.ne.jp/nagachika/20101207>.
 
-Tue Jan 27 23:15:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 12 13:27:35 2010  Tanaka Akira  <akr@fsij.org>
 
-	* keywords: __FILE__, __LINE__ are available again.
+	* eval_error.c: parenthesize macro arguments.
 
-Fri Jan 23 14:19:28 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 12 11:53:24 2010  Tanaka Akira  <akr@fsij.org>
 
-	* version 1.1b6 released.
+	* error.c: parenthesize macro arguments.
 
-	* object.c (mod_to_s): need to duplicate classpath.
+Sun Dec 12 04:01:58 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* error.c (exc_inspect): need to duplicate classpath.
+	* string.c (rb_str_inspect): fix: extra back slash is added when
+	  the string is dummy encoding and includes \x22 or \x5C.
 
-Thu Jan 22 00:37:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec 12 02:42:24 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ruby.h (STR2CSTR): new macro to retrieve char*.
+	* ext/openssl/ossl_asn1.c: indefinite length BER to DER encoding is
+	  properly supported.  Thanks Martin Bosslet! [ruby-core:33082]
 
-	* class.c (rb_define_method): `initialize' should always be
-	  private, even if it defined by C extensions.
+Sat Dec 11 17:43:34 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* eval.c (rb_eval): `initialize' should always be private.
+	* ext/bigdecimal/bigdecimal.h: suppress "warning: 'VPrint' declared
+	  'static' but never defined".
 
-Thu Jan 22 16:21:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec 11 09:24:57 2010  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_eval): some singleton class def cause SEGV.
+	* encoding.c: parenthesize macro arguments.
 
-	* eval.c (TMP_ALLOC): replace ALLOCA_N, where thread context
- 	  switch may happen.
+Sat Dec 11 08:12:48 2010  Eric Hodel  <drbrain@segment7.net>
 
-Wed Jan 21 01:43:42 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/openssl/ossl.c, ext/openssl/ossl_pkey_rsa.c: Document RSA, RSA
+	  encryption/decryption and PKCS #5 encryption/decryption.
 
-	* eval.c (PUSH_FRAME): do not use ALLOCA_N().  crash on some
-	  platforms that use missing/alloca.c.
+Sat Dec 11 06:23:41 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* regex.c (re_compile_pattern): too many pops for non register
-	  subexpr.
+	* ext/openssl/ossl_x509name.c: include Comparable to provide #==.
+	  Document OpenSSL::X509::Name#<=>.  [Ruby 1.9-Feature#4116]
 
-	* parse.y (yylex): open parentheses after identifiers are argument 
-	  list, even if whitespaces have seen.
+Sat Dec 11 05:48:28 2010  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Tue Jan 20 15:19:59 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/tk/lib/multi-tk.rb: infinite loop on method_missing at loading.
+	  [ruby-dev:42716] [Ruby 1.9-Bug#4129]
 
-	* parse.y (terms): quoted word list by %w(a b c).
+	* ext/tk/lib/multi-tk.rb: when no eventloop is running, ruby freezes at
+	  exit.
 
-	* ext/tcltklib/extconf.rb: more accurate check for tcl/tk libs.
+Sat Dec 11 02:23:15 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* file.c (rb_stat): most of the FileTest methods (and function
- 	  `test') accept File objects as the argument.
+	* ext/openssl/extconf.rb: try pkgconfig first, then fall back to
+	  normal have_library, etc.  Thanks Erik Hollensbe. [ruby-core:32406]
 
-Tue Jan 19 18:19:24 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Fri Dec 10 22:33:39 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/extmk.rb.in (install): there should be no newline after install:
+	* dln_find.c: parenthesize macro arguments.
 
-	* re.c (MIN): renamed from min().  there's a local variable named
- 	  min in the file, so that some cpp will raise an error.
+Fri Dec 10 20:05:42 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jan 19 16:30:05 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* template/id.h.tmpl (ruby_method_ids): suppress warnings.
+	  [ruby-dev:42730]
 
-	* version 1.1b5 released.
+Fri Dec 10 18:29:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (rb_syswait): no exception raised.
+	* ruby.c (ruby_init_loadpath_safe): relatively called non-shared
+	  binary cannot be found in PATH, so use given pathname.
 
-Fri Jan 16 00:43:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Dec 10 18:28:40 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h (CLONESETUP): copies its singleton classes too.
+	* cygwin/GNUmakefile.in (SCRIPTPROGRAMS): ignore backup files and etc.
 
-	* class.c (singleton_class_attached): saves binded object in the
-	  singleton classes.
+	* cygwin/GNUmakefile.in (scriptbin): set executable bit.
 
-	* eval.c (rb_eval): calls singleton_method_added even in the
-	  singleton class clauses.
+	* tool/rbinstall.rb (install_recursive): always skip default ignored
+	  files.  if block is given, call it instead of calling install.
 
-Fri Jan 15 23:22:43 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* tool/rbinstall.rb (bin-comm): use install_recursive.
 
-	* ruby.c (proc_options): -S does not recognize PATH.
+Fri Dec 10 18:12:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jan 15 02:03:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/mkmf/base.rb (TestMkmf#config_value): extract macro value from
+	  config.h.
 
-	* eval.c (rb_clear_cache_by_id): clear only affected cache
-	  entries.
+	* test/mkmf/test_sizeof.rb (TestMkmf::TestSizeof#test_sizeof_builtin),
+	  (TestMkmf::TestSizeof#test_sizeof_struct): more tests.
 
-Wed Jan 14 02:14:48 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb (check_signedness): should use the prelude code.
+	  [ruby-dev:42731]
 
-	* ext/socket/socket.c: new UDP/IP socket classes.
+	* lib/mkmf.rb (Logging.log_close): separate from Logging.logfile.
 
-Tue Jan 13 10:00:18 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/mkmf/base.rb (TestMkmf::MKMFLOG): show mkmf.log at failures.
 
-	* string.c (str_cmp): ignorecase($=) works wrong.
+	* test/mkmf/base.rb (TestMkmf#teardown): close log file for each tests.
 
-Fri Jan  9 13:19:55 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Dec 10 11:36:43 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* version 1.1b4 released.
+	* compile.c (enum): remove a comma at end of enumerator list.
 
-	* eval.c (f_missing): class name omitted from the error message.
+	* constant.h (rb_const_flag_t): ditto.
 
-	* error.c (exc_inspect): description changed.
+	* iseq.h (enum catch_type): ditto.
 
-	* string.c (Init_String): GlobalExit's superclass did not filled,
-	  since GlobalExit created earlier than String.
+	* iseq.h (enum defined_type): ditto.
 
-Thu Jan  8 12:10:09 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_core.h (enum iseq_type): ditto.
 
-	* parse.y (aryset): expr in the brackets can be null.
+	* vm_core.h (enum vm_special_object_type): ditto.
 
-Wed Jan  7 21:13:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Dec 10 10:47:53 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (io_reopen): keep stderr unclosed.
+	* sprintf.c (_HAVE_SANE_QUAD_): Don't forget LP64, r30156.
 
-	* io.c (io_errset): keep stderr unclosed.
+Fri Dec 10 10:37:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jan  6 00:27:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* sprintf.c (_HAVE_SANE_QUAD_): if a certain platform has LONG_LONG in
+	  8 byte, it might be sane quad. [ruby-core:33634]
 
-	* parse.y: syntax modified for `while expr do .. end' etc.
+Fri Dec 10 10:07:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* process.c (f_exec,f_system): can supply arbitrary name for the
- 	  new process.
+	* lib/net/http.rb: remove version 1.1 features.
 
-Mon Jan  5 16:59:13 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Fri Dec 10 02:18:02 2010  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* file.c (file_s_basename): removes any extention by ".*".
+	* ext/openssl/ossl_x509store.c (ossl_x509stctx_cleanup): removing C
+	  implementation of `cleanup`.
 
-Sun Jan  4 19:36:22 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* ext/openssl/lib/openssl/x509.rb: adding ruby implementation of
+	  `cleanup`.  OpenSSL::X509::StoreContext#cleanup is deprecated since
+	  reusing the underlying struct doesn't make sense. [ruby-dev:42546]
 
-	* parse.y (yylex): needed to update lex_p (reading point).
+Thu Dec  9 20:14:39 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jan  3 19:14:14 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* parse.y (lvar_defined_gen, shadowing_lvar_gen, dvar_defined): no
+	  warnings for unused method and block arguments.
+	  [ruby-dev:42718] [ruby-dev:42724]
 
-	* class.c,object.c: duplicate defines mKernel and cFinxnum.
+Thu Dec  9 19:25:49 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Jan  2 20:38:59 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* dln.c: parenthesize macro arguments.
 
-	* ext/curses/curses.c (NUM2CHAR): uses the first character for
- 	  string arguments.
+Thu Dec  9 18:51:06 2010  Tanaka Akira  <akr@fsij.org>
 
-	* array.c (ary_fill): did not extend array for ranges.
+	* lib/webrick/accesslog.rb (WEBrick::AccessLog#format): support
+	  %{remote}p for logging remote (client) port number.
+	  [ruby-dev:42670]
 
-	* array.c (beg_len): did not return end pos bigger than size.
+Thu Dec  9 11:00:30 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Jan  2 02:09:16 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* array.c (rb_ary_dup): should copy contents only.  no instance
+	  variable, no class would be copied.  it would affect methods
+	  #sort, #reject, #transpose, #uniq, #compact, and #shuffle.
+	  [ruby-core:33640]
 
-	* dir.c (dir_s_chdir): bug in nil check.
+	* array.c (rb_ary_reverse_m): ditto.
 
-	* array.c (ary_fill): bug in nil check.
+	* array.c (rb_ary_rotate_m): ditto.
 
-Tue Dec 30 11:46:23 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Dec  8 21:38:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* hash.c (env_path_tainted): checks directories in PATH
-	  environment variable are not world writable.
+	* ext/dl/lib/dl/struct.rb: clean a warning: assigned but unused
+	  variable. patched by Kouhei Yanagita. [ruby-dev:42722]
 
-	* ruby.c (load_file): invoke specified interpreter if the #! line
- 	  does not contain the word `ruby'.
+	* ext/dl/lib/dl/import.rb: ditto.
 
-Fri Dec 26 03:26:41 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Dec  8 21:36:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (uscore_get): type information included in the error
- 	  message.
+	* parse.y (shadowing_lvar_gen): fix line number.  [ruby-dev:42718]
 
-	* variable.c (f_untrace_var): does not free trace-data within
- 	  trace procedure.
+Wed Dec  8 20:37:11 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Dec 25 02:50:29 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* dir.c: parenthesize macro arguments.
 
-	* version 1.1b3 released.
+Tue Dec  7 22:37:15 2010  Masaya Tarui  <tarui@ruby-lnag.org>
 
-	* ruby.h: inlining some functions on gcc 2.x
+	* io.c (io_read): duplicate string if shared. [ruby-dev:42719]
 
-Tue Dec 23 02:47:33 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec  7 22:31:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_eval): public/private information kept in the current 
-	  scope, to remove undesired state from the class/module.
+	* lib/optparse.rb (OptionParser::Officious): separate completion
+	  options from --help.  [ruby-dev:42690]
 
-	* time.c (time_strftime): remove hidden limit of 100 bytes of
-	  result string, using malloc'ed buffer. 
+	* lib/optparse.rb (OptionParser::Completion#candidate),
+	  (OptionParser::Switch#compsys): remove unused variables.
 
-	* hash.c (hash_update): merges the contents of another hash,
-	  overriding existing keys.
+Tue Dec  7 22:05:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (must_instr): totally re-written.
+	* transcode.c (transcode_loop): call default handler of the given
+	  hash, method, proc or [] method as fallback.  [ruby-dev:42692]
 
-	* io.c (read_all): try to allocate proper sized buffer using
-	  fstat(2) for speedup.
+Tue Dec  7 21:59:37 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Sat Dec 20 00:27:28 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/rexml/light/node.rb: remove circular require.
 
-	* regex.c (must_instr): need to skip 2 bytes for mbchars.
+Tue Dec  7 21:56:01 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-Fri Dec 19 01:18:29 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/rexml/test_light.rb: really suppress a warning.
 
-	* version 1.1b2 released.
+Tue Dec  7 21:51:57 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* eval.c (check_errat): check and convert (if necessary) traceback 
-	  information before assigning to the variable $@.
+	* test/rexml/test_light.rb: suppress a warning.
 
-	* eval.c (f_raise): optional third argument to specify traceback
-	  information.
+Tue Dec  7 21:14:03 2010  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (f_open): prevent infinite recursive call.
+	* debug.c: parenthesize macro arguments.
 
-Thu Dec 18 19:33:47 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec  7 21:06:38 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* string.c (str_rindex): now accepts regexp as index.
+	* lib/rexml/doctype.rb, test/rexml/test_doctype.rb: suppress warnings.
+	  [ruby-core:33305]
+	  Reported by Aaron Patterson. Thanks!!!
 
-Thu Dec 18 18:42:50 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Tue Dec  7 18:56:52 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/socket/extconf.rb: modified to detect win32 socket lib.
+	* ext/nkf/lib/kconv.rb (String#kconv): fix typo and update rdoc.
+	  patched by Kouhei Yanagita [ruby-dev:42696]
 
-Thu Dec 18 00:25:03 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec  7 20:32:11 2010  Kouhei Sutou  <kou@cozmixng.org>
 
-	* re.c (reg_equal): checks for source and casefold and kcode matching.
+	* test/rexml/test_doctype.rb: add Accessor to test case name.
 
-	* marshal.c: became built-in module.
+Tue Dec  7 20:31:02 2010  Kouhei Sutou  <kou@clear-code.com>
 
-	* ext/marshal/marshal.c (r_object): displays struct name for
-	  non-compatible struct.
+	* test/rexml/test_doctype.rb: Doctype -> DocType.
 
-	* string.c (str_index_method): now searches character (fixnum) in
-	  the string.
+Tue Dec  7 20:29:23 2010  Kouhei Sutou  <kou@clear-code.com>
 
-	* string.c (str_include): redefine `include?'.
+	* test/rexml/test_doctype_mixin.rb: rename to ...
+	* test/rexml/test_doctype.rb: ... this to remove needless name.
 
-	* regex.c (re_match): start_nowidth saves current stack position
-	  to stop_nowidth.
+Tue Dec  7 17:03:16 2010  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): add space to stop_nowidth to save
-	  runtime stack position.
+	* lib/net/imap.rb (xlist): supported the XLIST command, which is an
+	  extension by Apple and Google.  patch by Geoff Youngs.
+	  [ruby-core:33521]
 
-Tue Dec 16 14:57:43 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Dec  7 08:00:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (scan_once): wrong exception for regexp that match with 
-	  null string (use substr instead of subseq).
+	* configure.in, win32/Makefile.sub (WERRORFLAG): flag to treat
+	  warnings as errors.
 
-Sat Dec 13 00:13:32 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb (Logging.postpone): yield log file object.
 
-	* parse.y (expr): remove bare assocs from expr rule.
+	* lib/mkmf.rb (xsystem): add options, :werror only right now.
 
-	* rbconfig.rb: renamed from config.rb (it was too generic name).
+	* lib/mkmf.rb (with_werror): check as if warnings are errors.
 
-Fri Dec 12 00:50:25 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb (convertible_int): make declaration conflict
+	  warnings errors not to pass wrong type.  [ruby-dev:42684]
 
-	* parse.y (expr): warns if BEGIN or END appear in the method
- 	  bodies.
+	* lib/mkmf.rb (COMMON_MACROS): get rid of conflicts.
 
-	* string.c (str_match): calls y =~ x if y is neither String nor
-	  Regexp so that eregex.rb works.  
+	* win32/Makefile.sub (WARNFLAGS): make declaration conflict
+	  warnings errors if possible.
 
-	* eval.c (f_at_exit): to register end proc.
+Sun Dec  7 21:16:10 2010  Tanaka Akira  <akr@fsij.org>
 
-	* class.c (rb_define_module_function): define 'function' method
-	  for the Module, not private method.
+	* cont.c: parenthesize macro arguments.
 
-	* class.c (rb_define_function): function to define `function' method.
+Tue Dec  7 00:27:14 2010  Masaya Tarui  <tarui@ruby-lnag.org>
 
-	* eval.c (rb_eval): inherit visibility from superclass's method
-	  except when it is set to `function'
+	* win32/win32.c (rb_w32_read): fixed more for readline,
+	  and so on. [ruby-core:33511]
 
-	* eval.c (rb_eval): new visibility status `function'.
+Mon Dec  6 23:18:22 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (yycompile): do not clear eval_tree. thus enable multipe 
-	  command line script by optn `-e'.
+	* test/mkmf/base.rb (TestMkmf#setup): run quietly.
 
-	* eval.c (rb_eval): END execute just once.
+	* test/mkmf/test_find_executable.rb (test_find_executable): use
+	  configured results.
 
-	* parse.y (expr): BEGIN/END built in the syntax.
+	* common.mk (test-build): test for build process.
 
-Thu Dec 11 13:14:35 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec  6 22:47:15 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (mod_le): Module (or Class) comparison.
+	* lib/optparse.rb (OptionParser#candidate): skip separators.
 
-	* eval.c (rb_remove_method): raises NameError if named method does 
-	  not exist.
+	* sample/optparse/opttest.rb: should not override --help.
+	  [ruby-dev:42690]
 
-	* ext/curses/curses.c: remove CHECK macro for BSD curses.
-	
-Thu Dec 11 12:44:01 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Mon Dec  6 19:00:48 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* pack.c: sun4 cc patch
+	* misc/rb_optparse.zsh: fix typos.
 
-Wed Dec 10 15:21:36 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec  6 18:59:04 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/marshal/marshal.c (marshal_load): can supply evolution proc
-	  object as optional second argument.
+	* NEWS: add new encodings.
 
-	* re.c (reg_source): get source string of the regular expression.
+Mon Dec  6 18:56:42 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Dec  9 10:05:17 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/ruby/test_string.rb (TestString#test_scan): add a test for
+	  [ruby-core:33338] #4087.
 
-	* version 1.1b1 released.
+Mon Dec  6 18:55:36 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* parse.y (tokadd): token buffer overrun.
+	* test/uri/test_common.rb (TestCommon#test_encode_www_form): add
+	  tests for r30015.
 
-	* ruby.c (ruby_prog_init): forgot to protect rb_argv0 from gc.
+Mon Dec  6 10:39:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (ruby_run): call finalizers at process termination.
+	* lib/uri/common.rb (URI::Parser#initialize_pattern):
+	  refix for restrict the pattern.
 
-	* gc.c (gc_call_finalizer_at_exit): call free proc for every Data
- 	  Wrapper, and finalizer for specified objects at termination.
+Mon Dec  6 09:45:11 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* version.c (show_version): version format changed.
+	* ext/openssl (OpenSSL): add toplevel documentation
+	* ext/openssl/ossl_ssl.c (SSLContext, SSLSocket: add additional
+	  documentation
+	* ext/openssl: move "let rdoc know about mOSSL" comments so they don't
+	  show up in output
 
-	* regex.c (re_match): wrong match with non-greedy if they appear
-	  more than once in regular expressions.
+Mon Dec  6 09:16:46 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* sample/ruby-mode.el (ruby-expr-beg): forgot to handle modifiers.
+	* lib/uri/common.rb (URI::Parser#initialize_pattern):
+	  workaround fix pattern of hostname for RFC 3986. [ruby-dev:42672]
 
-Mon Dec  8 19:00:15 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Dec  6 09:14:38 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (io_puts): just put a newline if no argument given.
+	* lib/mkmf.rb (check_signedness): rename unused variable prelude.
 
-	* ext/tcltklib/tcltklib.c (lib_mainloop): thread-aware tk handle
- 	  when $tk_thread_safe is set.
+Sun Dec  5 17:56:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c (lib_mainloop): use Tcl_DoOneEvent()
-	  instead of Tk_MainLoop().
+	* class.c (make_metaclass): fix probable typo.  builtin type flag
+	  cannot be used with FL_TEST.
 
-Mon Dec  6 07:11:16 1997  MAEDA shugo  <shugo@po.aianet.ne.jp>
+Sun Dec  5 12:09:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_puts): core dumped without any argument.
+	* lib/irb/init.rb (IRB.parse_opts): fix typo. [ruby-core:33574]
 
-Fri Dec  5 18:17:17 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Dec  5 11:27:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (mod_remove_method): remove (not undef) a method from the 
-	  class/module.
+	* ruby.c (load_file_internal): decrement for ungotten line.
+	  [ruby-dev:42680]
 
-	* variable.c (obj_remove_instance_variable): method to remove
-	  instance variables.
+Sun Dec  5 10:32:11 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Dec  4 13:50:29 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* complex.c: parenthesize macro arguments.
 
-	* version 1.1b0 released.
+Sat Dec  4 11:39:17 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* string.c (str_aref): called str_index for regexp.
+	* ext/openssl/ossl_x509ext.c (initialize): add documentation.
 
-Mon Dec  1 15:24:41 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec  4 11:21:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* compar.c (cmp_between): wrong comparison made.
+	* hash.c (rb_hash_update_by): new API for Hash#update.
 
-Wed Nov 26 18:18:05 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec  4 11:18:10 2010  Tanaka Akira  <akr@fsij.org>
 
-	* lib/mkmf.rb: generate Makefile for extention modules out of ruby 
-	  source tree. use like `ruby -r mkmf extconf.rb'.
+	* class.c: parenthesize macro arguments.
 
-	* numeric.c (fix2str): enlarge buffer to prevent overflow on some
-	  machines.
+Sat Dec  4 11:07:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (here_document): wrong line number generated after here-doc.
+	* vm_core.h (rb_vm_inc_const_missing_count): missing prototype.
 
-Fri Nov 21 13:17:12 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec  4 08:50:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (yylex): skip multibyte characters in comments.
+	* ext/iconv/iconv.c (Init_iconv): no warnings if $VERBOSE is nil.
 
-Wed Nov 19 17:19:20 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Dec  4 08:25:15 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (nil_to_a): nil.to_a => [].
+	* vm_insnhelper.c (vm_call_method): revert r30064 and r30071,
+	  because of [ruby-core:26761]. Bug#4106 rejected.
 
-	* parse.y (call_args): wrong node generation.
+Sat Dec  4 07:46:48 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov 18 10:13:08 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb (String#tr_cpp): substitute * with P like as
+	  autoconf.
 
-	* array.c (Init_Array): Array#=== works as Array#include?
+Fri Dec  3 22:36:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): insert initialize code for jump_n, 
-	  before entering loops.
+	* vm_insnhelper.c (vm_call_method): protected methods should be
+	  checked against the real class.
 
-	* re.c (reg_search): does not save registers unless $& etc appear
-	  in the script.
+Fri Dec  3 20:23:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov 17 13:01:43 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/mkmf.rb (convertible_int): define printf format prefix too.
 
-	* eval.c (is_defined): add defined? check for receivers and
- 	  arguments for calls.
+	* lib/mkmf.rb (convertible_int): detect convertible integer type.
+	  port RUBY_REPLACE_INT from configure.in.
 
-	* re.c (reg_search): cache last match object.
+	* lib/mkmf.rb (check_sizeof): should return integer always.
 
-	* re.c (match_aref): $[0] etc. are available.
+Fri Dec  3 12:54:48 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Nov 15 00:11:36 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* win32/Makefile.sub (RCFLAGS): VC10 and after only. fixed the problem
+	  of r30015. [ruby-core:33530]
 
-	* io.c (io_s_popen): "rb" detection
+Fri Dec  3 12:41:52 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Fri Nov 14 18:28:40 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* gc.c (rb_objspace_free): With our "lazy-sweep" GC engine, it is
+	  possible for an object to survive until its surrounding object
+	  space is about to be freed.  Those objects, if any, remains
+	  leaked for the rest of a process life.  This is problematic
+	  because for instance a T_DATA object may have its own destructor
+	  to terminate something.
 
-	* string.c (scan_once): returns whole match if the pattern does
-	  not contain any parentheses.
+	* vm.c (ruby_vm_destruct): ruby_current_vm termination should be
+	  somewhere after rb_objspace_free for above reason.
 
-Thu Nov 13 14:39:06 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Dec  3 12:17:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_sub): returns copy of the receiver string, even if 
-	  any substitution occurred.
+	* vm_insnhelper.c (vm_call_method): protected singleton methods should
+	  be visible from same real class methods.  [ruby-core:33506]
 
-	* regex.c (re_compile_pattern): no-width match by (?=..), (?!..).
+Fri Dec  3 07:08:42 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov 12 13:44:47 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ext/stringio/stringio.c (strio_getline): round upto next char
+	  boundary.  [ruby-dev:42674]
 
-	* time.c: remove coerce from Time class.
+Fri Dec  3 06:52:46 2010  Tanaka Akira  <akr@fsij.org>
 
-	* regex.c (re_match): non-greedy match by ??, *? +?, {n,m}?.
+	* compile.c: parenthesize macro arguments.
 
-Mon Nov 10 11:24:51 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Dec  3 04:08:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): non-resitering parens (?:..).
+	* encoding.c (enc_alias_internal): use st_insert2 and change return
+	  value to int.
 
-	* regex.c (re_compile_pattern): new meta character \< (wordbeg)
-	  and \> (wordend).
+	* encoding.c (enc_alias): follow enc_alias_internal.
 
-	* regex.c (re_compile_pattern): embedded comment for regular
-	  expression by (?#...).
+Fri Dec  3 01:52:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Nov  7 16:58:24 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* encoding.c (enc_alias_internal): use xfree instead of free.
 
-	* regex.c (re_compile_pattern): perl5 regxp \A and \Z available.
+Thu Dec  2 23:52:26 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): can expand compile stack dynamically.
+	* NEWS: entry for ruby_vm_at_exit().
 
-	* regex.c (PUSH_FAILURE_POINT): wrong compare condition.
+	* eval.c (ruby_cleanup): bug fix around at_exit (1) timing was
+	  wrong. (2) execution order was opposite.
 
-Wed Nov  2 16:00:00 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Thu Dec  2 23:05:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* string.c (str_sub_s): "".sub! "", "" => "\000"
+	* win32/Makefile.sub (RCFLAGS): -nologo switch is only available in
+	  newer versions of rc.exe. fixed the problem of r30012.
 
-Fri Oct 31 15:52:10 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec  2 21:28:07 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (assoc): keyword assoc like {fg->"black"}.
+	* ext/json/lib/json/add/rails.rb: removed.
 
-Thu Oct 30 17:33:38 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec  2 21:22:05 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (io_println): print with newline, which is not affected by
-	  the values of $/ and $\.
+	* encoding.c (enc_alias_internal): free the copied key and
+	  return NULL when given key is already registered.
 
-Thu Oct 30 16:54:01 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* encoding.c (enc_alias): call set_encoding_const only when the
+	  alias is not registered yet.
 
-	* string.c (str_chop_bang): "".chop caused SEGV.
+Thu Dec  2 19:58:24 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* string.c (str_chomp_bang): method to chop out last newline.
+	* vm.c (ruby_vm_at_exit): new API.  This enables extension libs to
+	  hook a VM termination.  Right now, because the VM we have is
+	  process global, most extensions do not deallocate resources and
+	  leave them to Operating System's reaping userland processes.  But
+	  in a future we plan to have multiple VMs to run simultaneously in
+	  a single process (MVM project).  At that stage we can no longer
+	  rely on OSes and have to manage every resources to be reclaimed
+	  properly.  So it is.  For a forward-compatibility reason this API
+	  is introduced now, encouraging you to be as gentle as you can for
+	  your resources; that is, tidy up your room.
 
-Mon Oct 27 13:49:13 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* include/ruby/vm.h: ditto.
 
-	* ext/extmk.rb.in: library may have pathname contains `.'
+	* vm_core.h (rb_vm_struct): new field.
 
-	* eval.c (rb_rescue): should not protect SystemError.
+	* vm.c (vm_init2): initialize above new field.
 
-Fri Oct 24 10:58:53 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* eval.c (ruby_cleanup): trigger those hooks.
 
-	* io.c (io_s_with_open_stream): ensures to close stream.
+Thu Dec  2 17:00:44 2010  Tanaka Akira  <akr@fsij.org>
 
-Thu Oct 23 11:17:44 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* bignum.c: parenthesize macro arguments.
 
-	* io.c (io_errset): value of $stderr can be changed (to any IO
- 	  object).
+Thu Dec  2 15:31:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* io.c (next_argv): $< can be anything that responds to `write'.
+	* win32/win32.c (rb_w32_read): more fix. [ruby-core:33513]
 
-	* file.c (file_s_with_open_file): ensures to close file.
+Thu Dec  2 13:41:43 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* error.c (exception): create error under the current class/module.
+	* win32/win32.c (rb_w32_read): workaround for console reading troubles.
+	  fixed [ruby-core:33511]
 
-	* range.c (range_eqq): fixnum check for last needed too.
+Thu Dec  2 13:10:42 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Oct 22 12:52:30 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/uri/common.rb (URI.encode_www_form):
+	  split key-value when the value is Array like object.
 
-	* ext/socket/socket.c: Socket::Constants added.
+Thu Dec  2 10:39:39 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* file.c: File::Constants added for inclusion.
+	* lib/net/http.rb (Net::HTTP#set_form_data):
+	  use URI.encode_www_form for application/x-www-form-urlencoded.
 
-	* array.c (ary_join): call ary_join() recursively for the 1st
- 	  array element.
+Thu Dec  2 10:38:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Mon Oct 20 12:18:29 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* ext/extmk.rb: remove $makeflags.defined?, it should be $mflags.
 
-	* ruby.c (load_file): wrong condition for #! check with -x.
+Thu Dec  2 10:19:47 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* file.c (file_s_dirname): did return "" for "/a".
+	* win32/Makefile.sub (rc): suppress meaningless message.
 
-Fri Oct 17 14:29:09 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec  2 10:09:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ruby.c: now works on alpha-linux.
+	* ext/json/generator/extconf.rb: remove the lines which set -O3
+	  when -O option is not set.
+	  Note that -O3 doesn't always exist.
 
-	* bignum.c (bigadd): some undefined side effect order assumed.
+	* ext/json/parser/extconf.rb: ditto.
 
-Wed Oct 15 17:49:24 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec  2 10:01:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* intern.h: function prototypes added.
+	* ext/extmk.rb: define $makeflags.defined? like $mflags.
 
-Mon Oct 13 16:54:18 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec  2 07:20:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* class.c (rb_define_class_id): call superclass's `inherited'
- 	  method when making subclasses.
+	* lib/test/unit.rb (Test::Unit::GCStressOption): --gc-stress
+	  option.
 
-	* parse.y (nextc): clear lex_lastline at the end of file.
+	* lib/test/unit.rb (Test::Unit::Mini#_run_suites): show the result
+	  even when interrupted on the way.
 
-	* object.c (Init_Object): need to undef Class#append_features.
+Thu Dec  2 07:08:38 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_eval): no warning on extending classes or modules.
+	* ext/io/console/console.c (setattr): should retry on EINTR.
+	  [ruby-dev:42666]
 
-Thu Oct  9 11:17:50 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec  2 02:30:50 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* eval.c (error_print): the exception name follows after the error 
-	  message.
+	* lib/net/http.rb: fixed positional wording to match revised order.
 
-	* eval.c (compile_error): error message slightly changed.
+Thu Dec  2 01:24:39 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (nextc): script parsing will be terminated by __END__ at
- 	  beginning of line.
+	* ext/json/lib/json/common.rb: don't use iconv on 1.9.
+	  patched by Shota Fukumori [ruby-core:33164]
 
-	* eval.c (compile_error): `__END__' is no longer a keyword.
+Thu Dec  2 01:02:03 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (nextc): protect lastline read from script stream.
+	* ext/json: Update github/flori/json from 1.4.2+ to
+	  e22b2f2bdfe6a9b0. this fixes some bugs.
 
-Tue Oct  7 14:06:06 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Thu Dec  2 00:05:44 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* version 1.1 alpha9 released.
+	* lib/net/http.rb: improve rdoc.
+	  This change the order of chapter because such overview should
+	  begin with simple examples.
+	  patched by Eric Hodel [ruby-core:33469]
 
-	* eval.c (mod_append_features): renamed from extend_class.
+Wed Dec  1 22:01:49 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_eval): defining method calls `method_added'.
+	* numeric.c (Init_Numeric): fixed a potential bug when using bccwin32
+	  ruby with Microsoft's dll, though we already gave up of supporting
+	  bccwin32. [ruby-core:33503]
 
-	* eval.c (ruby_options): exception while processing options must
-	  terminate the interpreter.
+Wed Dec  1 21:43:21 2010  Tanaka Akira  <akr@fsij.org>
 
-	* error.c (Init_Exception): wrong method configuration.  `new'
-	  should have been a singleton method.
+	* array.c: parenthesize macro arguments.
 
-Mon Oct  6 18:55:38 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Dec  1 21:41:57 2010  Tanaka Akira  <akr@fsij.org>
 
-	* ext/kconv/kconv.c (kconv_guess): code to guess character code
-	  from string.
+	* test/socket/test_addrinfo.rb: extract Errno::EADDRINUSE as a method.
 
-Mon Oct  6 18:38:17 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* test/socket/test_socket.rb: ditto.
 
-	* pack.c: now encode/decode base64 by `m' template.
+Wed Dec  1 15:08:32 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Oct  3 10:51:10 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* test/openssl/test_ssl.rb (test_not_started_session): non socket
+	  argument of SSLSocket.new is not supported on Windows.
 
-	* MANIFEST: needed to include lex.c in the distribution.
+Wed Dec  1 14:36:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (ruby_options): f_require() called too early.
+	* string.c (rb_memhash): zero-filled strings should return
+	  different values.  [ruby-core:33500]
 
-	* eval.c (rb_provide): module extentions should always be `.o'.
+Wed Dec  1 14:27:49 2010  Ryan Davis  <ryand-ruby@zenspider.com>
 
-Thu Oct  2 11:38:31 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/minitest/*.rb: Imported minitest 2.0.0 r5952.
+	* test/minitest/*.rb: ditto.
+	* lib/test/unit.rb: Compatibility fix for minitest changes.
 
-	* version 1.1 alpha8 released.
+Wed Dec  1 10:16:41 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/marshal/marshal.c (r_object): remove temporal regist for
- 	  structs. (caused problem if structs form cycles.)
+	* string.c (rb_str_inspect): fix typo (not 0xFD but 0xFE).
 
-	* parse.y (match_gen): static binding for match(=~) calls
-	  with regexp literals.
+Wed Dec  1 09:28:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Oct  1 15:26:55 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* addr2line.c: Follow .gnu_debuglink section.
+	  A user of distribution provided ruby will see line
+	  info if s/he has a debug package for ruby.
+	  patched by Shinichiro Hamaji [ruby-dev:42655]
 
-	* eval.c: protect retval in struct tag from GC for C_ALLOCA.
+Wed Dec  1 01:29:15 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c: no more pointer value from setjmp/longjmp.
+	* string.c (rb_str_inspect): inspect as a dummy encoding string
+	  when a UTF-16/32 (not BE/LE) string does not have a BOM.
+	  Unicode and some RFCs say that a string labeled as UTF-16/32
+	  doesn't have a BOM, it should be considered big endian.
+	  But many Windows programs generates little endian UTF-16
+	  strings without a BOM. So String#inspect treats a string
+	  labeled UTF-16/32 without a BOM as a dummy encoding string.
+	  patched by Martin Duerst. [ruby-core:33461]
 
-Wed Oct  1 14:01:49 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Tue Nov 30 17:04:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/marshal/marshal.c (w_byte): argument must be char.
+	* addr2line.c (parse_debug_line_cu): ignore DW_LNE_set_discriminator.
+	  To ignore, it needs to read a single unsigned LEB128 integer.
 
-Wed Oct  1 10:30:22 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Nov 30 16:29:19 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* variable.c (mod_const_at): global constants now belongs to the
-	  class Object.
+	* vm_dump.c: undef HAVE_BACKTRACE when the OS is FreeBSD (in other
+	  words backtrace() is libexecinfo) and it is optimized.
+	  This temporary hack may be also applied to other libexecinfo
+	  environments.
 
-	* object.c (Init_Object): new global constant NIL.
+Tue Nov 30 16:23:23 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/marshal/marshal.c (marshal_dump): try to set binmode.
+	* lib/net/http.rb: improve rdoc.
+	  patched by Eric Hodel ref #4100
 
-	* ext/marshal/marshal.c (r_object): forgot to re-regist structs in 
-	  the object table.
+Tue Nov 30 12:23:52 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (ruby_options): call Init_ext() before any require()
- 	  calls by `-r'.
+	* win32/win32.c (rb_w32_read): read only 1 byte at once on console.
+	  workaround of Windows bug. see [ruby-core:33460].
+	  this is not the final solution.
 
-Fri Sep 30 14:29:22 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Tue Nov 30 11:39:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/marshal/marshal.c (w_object): marshal dumped core.
+	* lib/net/http.rb: improve rdoc.
+	  patched by mathew murphy [ruby-core:33472] ref #4100
 
-Tue Sep 30 10:27:39 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Nov 30 05:03:44 2010  Eric Hodel  <drbrain@segment7.net>
 
-	* sample/test.rb: bignum test suits added.
+	* lib/uri/common.rb (encode_www_form, encode_www_form_component):
+	  Improve English in documentation.
 
-	* eval.c (rb_eval): new pseudo variable `true' and `false'.
+	* ext/openssl/ossl_ssl.c (ssl_version=, ciphers=): Document
+	  #ssl_version=, add documentation for #ciphers=.
 
-	* parse.y: new keywords `true' and `false' added.
+Mon Nov 29 22:55:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep 29 13:37:58 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/uri/common.rb (URI::WFKV_): get rid of backtrack explosion
+	  by nested repeat operators.  [ruby-core:33464]
 
-	* ruby.c (forbid_setid): forbid some options in suid mode.
+Mon Nov 29 22:53:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h (NUM2DBL): new macro to convert into doubles.
+	* win32/Makefile.sub (scriptbin.mk): fix generated rules.
 
-Mon Sep 27 09:53:48 1997  EGUCHI Osamu  <eguchi@shizuokanet.or.jp>
+	* win32/win32.c (rb_w32_write_console): fix argument type.
 
-	* bignum.c: modified for speeding.
+Mon Nov 29 21:12:51 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep 26 18:27:59 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* misc/ruby-mode.el (ruby-forward-sexp): stop after literal hash
+	  key labels.
 
-	* sample/from.rb: some extensions.
+	* misc/ruby-mode.el (ruby-font-lock-keywords): highlight literal
+	  hash key labels as symbols.
 
-Mon Sep 29 13:15:56 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Nov 29 18:31:31 2010  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-	* parse.y (lhs): no more syntax error on `obj.CONSTANT = value'.
+	* test/ruby/test_transcode.rb (test_unicode_public_review_issue_121):
+	  - Removed commented-out options that are no longer under discussion.
+	  - Added two more tests for forthcomming clarifications.
 
-Fri Sep 26 14:41:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Mon Nov 29 14:31:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (ruby_run): deferred calling Init_ext() just before eval_node.
+	* win32/win32.c (rb_w32_isatty): use GetConsoleMode() to determine the
+	  fd is console or not, just like rb_w32_write_console(). [experimental]
 
-Fri Sep 26 13:27:24 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Mon Nov 29 14:19:40 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* io.c (io_isatty): forgot to return TRUE value.
+	* include/ruby/win32.h (rb_w32_write_console): wrong prototype.
 
-Fri Sep 25 11:10:58 1997  EGUCHI Osamu  <eguchi@shizuokanet.or.jp>
+Mon Nov 29 14:10:55 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c: use _setjmp/_longjmp instead of setjmp/longjmp on some
-	  platforms.
+	* win32/win32.c (rb_w32_write_console): fixed indentation.
 
-Wed Sep 24 17:43:13 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Nov 28 22:13:39 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* string.c (Init_String): String#taint and String#taint? added.
+	* thread_pthread.c (NATIVE_MUTEX_LOCK_DEBUG): move and use it.
 
-	* class.c (mod_ancestors): ancestors include the class itself.
+	* ChangeLog: fix my timezone.
 
-Wed Sep 24 00:57:00 1997  Katsuyuki Okabe  <HGC02147@niftyserve.or.jp>
+Mon Nov 28 21:58:58 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* X68000 patch.
+	* thread_pthread.c: remove pthread_atfork().
 
-Tue Sep 23 20:42:30 1997  EGUCHI Osamu  <eguchi@shizuokanet.or.jp>
+Mon Nov 28 21:54:22 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* parse.y (node_newnode): SEGV on null node setup.
+	* thread_pthread.c (native_cond_*): Check return code.
+	  (Some OSes except Linux return error code).
 
-Mon Sep 22 11:22:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Nov 28 21:46:21 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.c (ruby_prog_init): wrong safe condition check.
+	* thread_pthread.c (thread_start_func_1): initialize native thread
+	  data immediately before starting.
 
-Sun Sep 21 14:46:02 1997  MAEDA shugo  <shugo@po.aianet.ne.jp>
+Sun Nov 28 14:56:32 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* error.c (exc_inspect): garbage added to classpath.
+	* io.c (struct argf): make lineno long, and reorder members.
 
-Fri Sep 19 11:49:23 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Nov 28 14:55:42 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (newtok): forgot to adjust buffer size when shrinking
-	  the token buffer.
+	* thread_win32.c (gvl_release, gvl_init): suppress warnings.
 
-	* enum.c (enum_find): rb_eval_cmd() does not return value.
+Sun Nov 28 14:48:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (pipe_open): close fds on pipe exec. fcntl(fd, F_SETFD, 1)
-	  no longer used.
+	* thread_pthread.c (gvl_release, gvl_init): suppress warnings.
 
-Tue Sep 16 17:54:25 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_core.h (rb_vm_gvl_destroy): add prototype.
 
-	* file.c (f_test): problem if wrong command specified.
+Sun Nov 28 14:46:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.c (ruby_prog_init): close stdaux and stdprn for MSDOS.
+	* thread_pthread.c (gvl_reinit): register atfork handler only in
+	  the parent process, to get rid of dead lock.
 
-	* ruby.c (ruby_prog_init): should not add path from environment
-	  variable, if ruby is running under seuid.
+Sun Nov 28 12:23:57 2010  Koichi Sasada  <ko1@atdot.net>
 
-	* process.c (init_ids): check suid check for setuid/seteuid etc.
+	* thread.c, vm_core.h: make gvl_acquire/release/init/destruct
+	  APIs to modularize GVL implementation.
 
-Mon Sep 15 00:42:04 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* thread_pthread.c, thread_pthread.h: Two GVL implementations.
+	  (1) Simple locking GVL which is same as existing GVL.
+	  (2) Wake-up queued threads.  The wake-up order is simple FIFO.
+	     (We can make several queues to support exact priorities, however
+	      this causes some issues such as priority inversion and so on.)
+	      This impl. prevents spin-loop (*1) caused on SMP environments.
+	  *1: Only one Ruby thread acquires GVL again and again.
+	      Bug #2359 [ruby-core:26694]
 
-	* regex.c (re_compile_pattern): \w{3} and \W{3} did not work.
+	* thread_win32.c, thread_win32.h: Using simple lock
+	  not by CRITICAL_SECTION but by Mutex.
+	  Bug #3890 [ruby-dev:42315]
 
-Thu Sep 11 10:31:48 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm.c (ruby_vm_destruct): ditto.
 
-	* version 1.1 alpha7 released.
+Sun Nov 28 04:40:00 2010  Luis Lavena  <luislavena@gmail.com>
 
-	* ext/socket/socket.c (sock_new): no setbuf() for NT.
+	* io.c (io_fwrite): use rb_w32_write_console under Windows.
 
-	* io.c (rb_fopen,rb_fdopen): set close-on-exec for every fd.
+	* win32/win32.c (rb_w32_write_console): added to write to write
+	  Unicode using WriteConsoleW for stdout/stderr. [ruby-core:33166]
 
-Wed Sep 10 15:55:31 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sun Nov 28 03:58:47 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/marshal/marshal.c (r_bytes0): extra big length check.
+	* lib/net/http.rb: improve rdoc.
+	  patched by Mike Perham [ruby-core:33433]
 
-Tue Sep  9 16:27:14 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Sat Nov 27 19:12:10 2010  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (pipe_fptr_atexit): clean up popen()'ed fptr.
+	* time.c: parenthesize macro arguments.
 
-	* error.c (set_syserr): some system has error code that is bigger
-	  than sys_nerr. grrr.
+Sat Nov 27 18:08:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep  8 18:33:33 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* time.c (leap_year_v_p): fixed typo.  [ruby-dev:42631]
 
-	* io.c (io_s_new): dereferenced nil for optional mode.
+Sat Nov 27 17:57:08 2010  Tanaka Akira  <akr@fsij.org>
 
-Fri Sep  5 10:26:03 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* resolv.rb (Resolv::DNS): use the same DNS server when retry using
+	  TCP.  reported by Julian Mehnle.  [ruby-core:32970]
 
-	* class.c (class_instance_methods): do not include methods which
-	  are changed to private in subclasses.
+Sat Nov 27 15:45:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep  4 12:38:53 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_dump.c (rb_vm_bugreport): see CrashReport log on Mac OS X.
 
-	* variable.c (f_global_variables): list name of the global
-	  variables.
+	* configure.in: link addr2line only for ELF.
 
-	* object.c (obj_id): returns unique integer.
+Sat Nov 27 13:58:55 2010  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Sep  3 14:05:16 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/optparse.rb (OptionParser#candidate): : was missing.  Thanks,
+	  Shota Fukumori.  [ruby-dev:42634]
 
-	* version 1.1 alpha6 released.
+Sat Nov 27 12:07:05 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* eval.c (mod_s_constants): context sensitive constant list.
+	* man/ruby.1: Ruby man page from Arthur Gunn in [ruby-core:33412]
 
-	* variable.c (mod_constants): no more `all' option.
+Sat Nov 27 11:29:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* variable.c (mod_const_of): the values for autoload classes are
-	  their name strings.
+	* lib/optparse.rb (OptionParser#candidate): get rid of 1.9 syntax
+	  so that BASERUBY can be 1.8.
 
-	* class.c (class_instance_methods): no special treatment for
-	  singleton classes.
+Sat Nov 27 08:16:21 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (obj_singleton_methods): returns list of singleton
-	  method names.
+	* addr2line.c (rb_dump_backtrace_with_lines): should close fd on
+	  edge case.
 
-	* parse.y (yylex): no here document after `class' keyword.
+Fri Nov 26 13:33:24 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (f_load): expand path if fname begins with `~'.
+	* addr2line.c: apply a patch from shinichiro.h.
 
-Tue Sep  2 13:19:48 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Nov 26 12:21:20 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* class.c (ins_methods_i): do not list undef'ed methods.
+	* addr2line.c: added to show source filename and line number of
+	  functions in backtrace. [ruby-dev:42625]
+	  a patch from shinichiro.h <shinichiro.hamaji AT gmail.com>
 
-Mon Sep  1 13:42:48 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* addr2line.h: ditto.
 
-	* version 1.1 alpha5 released.
+	* common.mk: add addr2line.$(OBJEXT).
 
-	* object.c (mod_attr_reader): create methods to define attribute
- 	  reader/write/accessor.
+	* configure.in: check dl_iterate_phdr.
 
-	* class.c (rb_define_attr): always defines accessors.
+	* vm_dump.c (rb_vm_bugreport): use rb_dump_backtrace_with_lines in
+	  addr2line.c when the binary is ELF.
 
-	* eval.c (rb_call): alias occured in the module body caused SEGV.
+Fri Nov 26 12:12:50 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y: did not generate here document strings properly.
+	* regcomp.c (setup_tree): restart setup_tree() for a node whose
+	  AnchorNode's type is ANCHOR_PREC_BEHIND or ANCHOR_PREC_BEHIND_NOT
+	  and divide_look_behind_alternatives() divided it to NT_ALT or
+	  NT_LIST. [ruby-core:33370]
 
-Mon Sep  1 11:43:57 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
-	
-	* parse.y (yylex): heredoc dropped an extra character.
+Fri Nov 26 11:40:11 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Aug 29 11:10:21 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vm_dump.c (dump_thread): get only required rights of the target
+	  thread because THREAD_ALL_ACCESS causes an access error on XP.
+	  reported by Masaya TARUI via IRC.
 
-	* class.c (class_instance_methods): same method names should not
- 	  appear more than twice.
+Fri Nov 26 11:09:07 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* parse.y (yylex): spaces can follow =begin/=end.
+	* vm_dump.c (dump_thread): show the displacement from the beginning
+	  of the symbol.
 
-	* variable.c (find_class_path): look for class_tbl also for
-	  unnamed fundamental classes, such as Object, String, etc.
+Fri Nov 26 10:48:23 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* variable.c (rb_name_class): can't name class before String class
- 	  is initilialized.
+	* vm_dump.c (dump_thread): follow the output of glibc.
+	  see [ruby-dev:42627]
 
-	* inits.c (rb_call_inits): unrecognized dependency from GC to
-	  Array.
+Fri Nov 26 09:48:45 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* variable.c (find_class_path): could not find class if Object's
- 	  iv_tbl is NULL.
+	* re.c (rb_reg_initialize_str): should succeed the taint status from
+	  the origin. [ruby-core:33338]
 
-Thu Aug 28 13:12:05 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Fri Nov 26 09:32:37 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* version 1.1 alpha4 released.
+	* vm_dump.c (dump_thread): seems to be necessary the 3rd argument of
+	  SymGetLineFromAddr64(), even though MSDN says it can be zero.
 
-	* variable.c (mod_constants): wrong condition for singleton
-	  class. 
+Fri Nov 26 09:03:38 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (yylex): revised `=begin' skip code.
+	* regcomp.c (onig_is_prelude): added to check whether ruby is still
+	  in prelude (or other boot processes) or not.
 
-	* parse.y (here_document): forgot to free(eos).
+	* regcomp.c (optimize_node_left): use onig_is_prelude for printing.
 
-	* parse.y (yylex): spaces after `<<' prohibited for here
- 	  documents to avoid confusing with operator `<<'.
+	* regcomp.c (set_optimize_info_from_tree): ditto.
 
-	* eval.c (is_defined): separated from rb_eval().
+	* regcomp.c (onig_compile): ditto.
 
-Wed Aug 27 11:32:42 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* regcomp.c (print_compiled_byte_code_list): print its address.
 
-	* version 1.1 alpha3 released.
+	* regcomp.c (print_indent_tree): print its contents tree of
+	    ANCHOR_PREC_READ(_NOT) and ANCHOR_PREC_BEHIND(_NOT).
 
-	* variable.c (mod_name): returns name of the class/module.
+Thu Nov 25 23:10:49 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (here_document): finally here document available now.
+	* regcomp.c (print_distance_range): use PRIuSIZE.
 
-	* variable.c (fc_i): some classes/modules does not have iv_tbl.
+	* regcomp.c (print_optimize_info): use %ld because the type of
+	  calculated value of integers is long.
 
-	* variable.c (find_class_path): avoid inifinite loop.
+	* regexec.c (onig_print_compiled_byte_code): add prototype.
 
-Tue Aug 26 13:43:47 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* regexec.c (match_at): add 2nd argument.
 
-	* eval.c (rb_eval): undef'ing non-existing method will raise
-	  NameError exception.
+Thu Nov 25 10:29:55 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* object.c (class_s_new): needed to create metaclass too.
+	* ext/dl/callback/mkcallback.rb (gencallback): shouldn't assume that
+	  VALUE is the same size with long.
 
-	* eval.c (error_print): no class name print for anonymous class.
+Thu Nov 25 10:03:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_longjmp): proper exception raised if raise() called
- 	  without arguments, with $! or $@ set.
+	* test/win32ole/test_err_in_callback.rb (teardown): remove tmp file
+	  only when it exists.
 
-	* object.c (Init_Object): superclass()'s method argument setting
- 	  was wrong again.
+Thu Nov 25 01:38:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* class.c (mod_anscestors): list superclasses and included modules 
-	  in priority order.
+	* enc/trans/big5-hkscs-tbl.rb: Update table as HKSCS-2008.
+	  patched by oCameLo oTnTh [ruby-core:33256]
 
-Mon Aug 25 11:53:11 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* enc/big5.c: add alias Big5-HKSCS:2008 to Big5-HKSCS.
 
-	* version 1.1 alpha2 released.
+Wed Nov 24 15:18:07 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* sample/ruby-mode.el (ruby-parse-region): auto-indent now
- 	  supports "\\" in the strings.
+	* vsnprintf (BSD_vfprintf): use QUADINT macro only when _HAVE_SANE_QUAD_
+	  macro is defined.
 
-	* struct.c (struct_getmember): new API to get member value from C
-	  language side.
+Wed Nov 24 12:47:16 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Aug 23 21:39:05 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* vsnprintf (BSD_vfprintf): added VC++ compatible size specifications
+	  (I, I32, I64).
 
-	* parse.y (asignable): remove unnecessary local variable
-	  initialize by nil.
+Wed Nov 24 11:19:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Aug 22 14:26:40 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* string.c (rb_str_inspect): treat UTF-16 and UTF-32 as BE or LE.
 
-	* eval.c (error_print): modified exception print format.
+Wed Nov 24 06:35:32 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Aug 21 16:10:58 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* enc/trans/utf_16_32.trans: add the UTF-32 converter.
 
-	* sample/ruby-mode.el (ruby-calculate-indent): wrong indent level
-	  calculated with keyword operators.
+Wed Nov 24 05:40:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Aug 21 11:36:58 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+Wed Nov 24 06:13:32 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (arg): ary[0] += 1 cause SEGV
+	* win32/win32.c (filecp, wstr_to_mbstr, mbstr_to_wstr):
+	  refactored.
 
-Wed Aug 20 17:28:50 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Wed Nov 24 05:40:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ruby.c (ruby_process_options): require() all modules after
- 	  processing all options
+	* enc/trans/utf_16_32.trans: add a converter from UTF-8 to UTF-16.
 
-	* process.c (rb_proc_exec): more security checks added.
+Wed Nov 24 03:21:35 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* process.c (rb_proc_exec): insecure path on exec.
+	* enc/trans/utf_16_32.trans: raise error on unpaired upper
+	  surrogates.
 
-	* hash.c (f_getenv): PATH modification security check.
+Wed Nov 24 01:40:23 2010  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Aug 19 00:15:38 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* enc/utf_16_32.h: add UTF-16 and UTF-32 as a dummy encoding.
 
-	* version 1.1 alpha1 released.
+	* enc/trans/utf_16_32.trans: add a converter from UTF-16 to UTF-8.
 
-	* eval.c (mod_eval): work as normal eval() if second binding
- 	  argument given.
+Tue Nov 23 21:59:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_call): did not raise ArgumentError if too many
- 	  arguments more than optional arguments (without rest arg).
+	* win32/win32.c (wlink, rb_w32_getppid): use typedef instead of
+	  repeating complicated function prototypes.
 
-	* eval.c (rb_eval): did not work well for op_asgn2 (attribute
-	  self assignment).
+Tue Nov 23 18:54:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (Init_Thread): returns main thread.
+	* vm.c (rb_thread_mark): should mark self in control
+	  frames.  [ruby-core:33289]
 
-Mon Aug 18 09:25:56 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Nov 23 07:57:31 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* object.c (inspect_i): did not display T_DATA instance variables.
+	* lib/date/delta/parser.{ry,rb}: fixed a bug of token scanner.
 
-	* parse.y: provides more accurate line number information.
+Tue Nov 23 07:29:24 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* eval.c (thread_value): include value's backtrace information in
-	  the variable `$@'. 
+	* complex.c, rational.c ({nucomp,nurat}_expt): added a check.
 
-	* eval.c (f_abort): print backtrace and exit.
+Tue Nov 23 07:27:27 2010  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Sat Aug 16 00:17:44 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* lib/date.rb (daynum): should be private.
 
-	* eval.c (class_new_instance): do not make instance from virtual
-	  classes. 
+Tue Nov 23 07:22:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (class_s_new): do not make subclass of singleton class.
+	* ChangeLog (change-log-indent-text): hanging indent.
 
-Fri Aug 15 15:49:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+Tue Nov 23 06:30:51 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (call_trace_func): block context switch in the trace
-          function.
+	* configure.in (SITE_DIR, VENDOR_DIR),
+	  version.c (ruby_initial_load_paths): exclude directories that
+	  are configured without them from $LOAD_PATH. [ruby-core:33267]
 
-	* eval.c (rb_eval): clear method cache at class extention.
+	* configure.in (rubylibprefix): No ruby, No libprefix.
 
-	* object.c (obj_type): returns object's class even if it defines
+Tue Nov 23 01:05:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): don't output floating point
+	  when the precision is 0. [ruby-dev:42615]
+
+Mon Nov 22 21:30:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_inspect): fix for ascii-compatible external
+	  encoding and different encoding string.  [ruby-core:33283]
+
+Mon Nov 22 18:45:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): should not duplicate rules.
+	  bug fix of r29842.
+
+Mon Nov 22 18:04:40 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/big5.c: split CP950 from Big5.
+
+	* enc/big5.c: split CP951 from Big5-HKSCS.
+
+	* enc/trans/big5.trans: import conversion table of Big5, Big5-HKSCS,
+	  CP950, and CP951 from ICU. they need fallback conversions.
+	  ref [ruby-core:33256]
+	  http://source.icu-project.org/repos/icu/data/trunk/charset/data/ucm/
+
+	* tool/transcode-tblgen.rb (import_ucm): add to import ucm files.
+
+Mon Nov 22 18:33:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_inspect): append for each chars instead of bulk
+	  copy if encoding conversion is needed.  [ruby-core:33283]
+
+Mon Nov 22 14:22:45 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* time.c (time_zone): use rb_locale_str_new_cstr to set encoding
+	  as locale and convert its content to internal encoding.
+	  [ruby-core:33278]
+
+Mon Nov 22 11:58:11 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_concat): set ENC_CODERANGE_VALID when the
+	  receiver is 7BIT and the argument is non ASCII.
+
+Mon Nov 22 01:48:58 2010  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb: some improvements for performance.
+
+Sat Nov 20 07:45:50 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* lib/mkmf.rb: adding compilation support for ObjC/ObjC++ extensions.
+	  Thanks Scott Gonyea! [ruby-core:33260]
+
+Sat Nov 20 01:57:55 2010  Akio Tajima  <artonx@yahoo.co.jp>
+
+	* common.mk: add dependency(insns.inc) to compile.obj
+
+Fri Nov 19 23:05:48 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/Makefile.sub (insns_rules.mk): remove extra backslash.
+
+	* cygwin/GNUmakefile.in, win32/Makefile.sub (clean): rc files are
+	  made at compile time, so should be removed by clean.
+
+Fri Nov 19 22:09:46 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rexml/test_core.rb
+	  (Tester#test_pretty_format_long_text_finite): skip a test that
+	  uses long string on small memory system. [ruby-dev:42599]
+
+Fri Nov 19 21:07:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb: shell completion support for zsh.  based on
+	  <http://d.hatena.ne.jp/rubikitch/20071002/zshcomplete>
+
+	* lib/optparse.rb: shell completion support for bash.
+
+Fri Nov 19 00:00:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* cygwin/GNUmakefile.in (SCRIPTPROGRAMS): no needs on cygwin.
+
+	* win32/Makefile.sub (scriptbin): create script binaries.
+
+Thu Nov 18 23:21:23 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/formatters/pretty.rb (REXML::Formatters::Pretty#wrap):
+	  REXML::Formatters::Pretty#wrap used a recursive method call to
+	  format text.  This switches it to use an iterative approach.
+	  [ruby-core:33245]
+	  Patch by Jeremy Evans. Thanks!!!
+
+	* test/rexml/test_core.rb: add a test for it.
+
+Thu Nov 18 22:58:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/io.h (rb_io_buffer_t): extract from rb_io_t.
+
+Thu Nov 18 07:37:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (reconfig): force reconfigure with previous options.
+
+	* common.mk (showconfig): show configure flags, like as
+	  `config.status --config' generated by recent autoconf.
+
+Thu Nov 18 07:16:49 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* missing/langinfo.c (strncasecmp): get rid of redefinition.
+
+Thu Nov 18 00:02:17 2010  James Edward Gray II  <jeg2@ruby-lang.org>
+
+	* lib/csv.rb: Upgrading output encoding with ASCII content
+	  as needed.  [ruby-core:33229]
+
+Wed Nov 17 23:19:21 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/configure.bat: remove quotes from arguments to be quoted.
+
+	* lib/mkmf.rb (create_makefile): use forward slashes in messages.
+
+	* lib/mkmf.rb (create_makefile): make extension libraries messages
+	  brief.
+
+	* win32/Makefile.sub (MAKEDIRS): should not include silent flag.
+
+	* common.mk (ext/ripper/ripper.c, ext/json/parser/parser.c): pass
+	  Q and ECHO.  [ruby-core:33226]
+
+Wed Nov 17 16:09:52 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* test/test_tracer.rb: new test case.
+	  minimal regression test for r29280.
+
+Wed Nov 17 16:04:23 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* test/ruby/envutil.rb (Test::Unit::Assersions#assert_warn):
+	  new assertion to assert that a particular warning message is
+	  displayed.
+	  forward port from branches/ruby_1_9_2@29795.
+
+Wed Nov 17 15:16:48 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regint.h (OnigOpInfoType): constify name.
+
+	* regcomp.c (op2name): constify return value.
+
+	* regcomp.c (onig_print_compiled_byte_code): use PRIuPTR and
+	  uintptr_t to clean warnings.
+
+	* regcomp.c (print_indent_tree): use PRIxPTR and intptr_t.
+
+	* regexec.c (match_at): use PRIdPTR and intptr_t.
+
+Wed Nov 17 09:49:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/shift_jis.c (property_name_to_ctype): fix memory leak.
+
+	* enc/euc_jp.c (property_name_to_ctype): ditto.
+
+Wed Nov 17 08:54:04 2010  James Edward Gray II  <jeg2@ruby-lang.org>
+
+	* lib/csv.rb: Upgrading output encoding as needed.  [ruby-core:33135]
+
+Tue Nov 16 22:30:39 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* vm_insnhelper.c (vm_throw): remove fear of undefined behavior :-)
+	  Coverity Scan found this bug.
+
+Tue Nov 16 09:33:00 2010  Kenta Murata <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/lib/bigdecimal/util.rb (to_digits): avoid unused
+	  variables warning, reported by Aaron Patterson.
+
+Tue Nov 16 06:39:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* pack.c (PACK_ITEM_ADJUST): return nil not result array and yield
+	  values if block is given.  [ruby-core:33193]
+
+Tue Nov 16 00:21:20 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* regparse.c (and_cclass, or_cclass): fix memory leak.  Coverity Scan
+	  found this bug.  [ruby-dev:42579]
+
+Tue Nov 16 00:07:32 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* gc.c (assign_heap_slot): fix fear of memory leak and memory
+	  violation.  Coverity Scan found this bug.
+
+Mon Nov 15 23:54:45 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* eval_intern.h (CHECK_STACK_OVERFLOW): it was not intended to add
+	  size_t to a pointer typed VALUE*.  Coverity Scan found this defect.
+
+Mon Nov 15 23:41:21 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* compile.c (iseq_set_exception_local_table, iseq_set_local_table,
+	  rb_iseq_build_from_ary): fix type inconsistency (which is benign
+	  because sizeof(ID) == sizeof(ID*), though).  Coverity Scan found
+	  these bugs.
+
+Mon Nov 15 22:47:27 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* vm_eval.c (rb_funcall): ensure va_end after va_init_list.  Coverity
+	  Scan found this bug.
+
+Mon Nov 15 08:36:12 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* lib/racc/parser.rb (do_parse, yyparse): using class eval to define
+	  method and avoid __send__.
+
+Mon Nov 15 06:43:48 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* etc/openssl/ossl_ssl.c (ossl_ssl_get_cert): raise exception if
+	  pointer is invalid.  Thanks Ippei Obayashi! [ruby-dev:42573]
+
+Sun Nov 14 17:57:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enc/Makefile.in (distclean): should not remove sources which are
+	  distributed in tarball.
+
+Sun Nov 14 16:48:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_set_token_info): turn on/off with directives.
+	  [ruby-core:25442]
+
+Sun Nov 14 12:05:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_readlines): forward to current_file for arguments
+	  check.  http://twitter.com/nagachika/status/3634254856589312
+
+Sun Nov 14 08:48:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/setup.mak (-basic-vars-, -runtime-): suppress trailing
+	  space and compiler command line.
+
+Sun Nov 14 04:22:32 2010  Alexander Zavorine  <alexandre.zavorine@nokia.com>
+
+	* symbian/setup (config.h): Added HAVE_LABS and HAVE_LLABS to config.h.
+
+	* symbian/configure.bat: Changed packaging version in line with API
+	  style 3 versioning.
+
+Sat Nov 13 16:37:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (showflags, help): emit messages at once.
+
+	* win32/Makefile.sub (MSG, EOM): remove surrounding quotes by %~I.
+
+Sat Nov 13 01:31:30 2010  Akio Tajima <artonx@yahoo.co.jp>
+
+	* win32/Makefile.sub: reorder variable End Of Message (don't display it)
+
+Fri Nov 12 20:52:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (showflags, help): use caret to quote leading spaces on
+	  Windows.
+
+	* Makefile.in, common.mk, cygwin/GNUmakefile.in, enc/depend,
+	  ext/ripper/depend, lib/mkmf.rb, win32/Makefile.sub: caddle up.
+
+Fri Nov 12 16:35:31 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in: support C level backtrace information on FreeBSD.
+	  When devel/libexecinfo is installed on FreeBSD, now ruby
+	  can show C level backtrace information.
+	  http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/libexecinfo/
+
+Fri Nov 12 09:58:30 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/setup.mak: use findstr.exe instead of find.exe, because all
+	  target build platforms should have findstr.exe, and, find.exe often
+	  means another command such as cygwin's.
+
+Fri Nov 12 00:30:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/Makefile.sub (config.h): need PRI_LL_PREFIX.
+
+Thu Nov 11 23:38:32 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: ANSI C-conforming const and volatile are mandatory
+
+	* configure.in (AC_C_CONST, AC_C_INLINE, AC_C_VOLATILE): check
+	  before used in other checks.
+
+	* configure.in (RUBY_CHECK_PRINTF_PREFIX): should not break from
+	  RUBY_WERROR_FLAG, so that ac_c_werror_flag gets restored.
+
+Thu Nov 11 23:04:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/iconv.c (warn_deprecated): show caller position.
+
+Thu Nov 11 23:03:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_close): untie tied io before closing.
+
+	* io.c (argf_write): add ARGF.write and so on.
+
+	* io.c (argf_read_nonblock): add ARGF.read_nonblock.
+
+Thu Nov 11 21:49:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/stats.rb (RDoc#print): get rid of NaN.
+
+Thu Nov 11 21:47:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (SHOWFLAGS): show compile flags.
+
+	* common.mk: hide long command lines by default.  verbose-mode is
+	  turned on by V=1 as before.
+	  http://jarp.does.notwork.org/diary/200605b.html#200605121
+
+Thu Nov 11 21:32:09 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (try_func): accept variable address.
+
+	* ext/win32ole/extconf.rb: libuuid is needed on cygwin.
+
+Thu Nov 11 21:24:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (file_expand_path): use cygwin_conv_path on cygwin 1.7 or
+	  later.
+
+	* ruby.c (push_include_cygwin): ditto.
+
+Thu Nov 11 20:49:48 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (PRI_LL_PREFIX): format type specifier for
+	  LONG_LONG may vary on platforms.
+
+Thu Nov 11 20:45:23 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (SYMBOL_PREFIX): separate from EXPORT_PREFIX.
+
+	* win32/mkexports.rb (Exports#each_export): use SYMBOL_PREFIX.
+
+Wed Nov 10 07:20:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* cygwin/GNUmakefile.in (scriptbin): make executable file from
+	  scripts with stub.
+
+	* ruby.c (load_file_internal): assume xflag for exe file as well
+	  as no-shebang file.
+
+	* tool/rbinstall.rb: install script programs.
+
+	* win32/mkexports.rb (Exports#initialize): alias ruby_sysinit for
+	  stub.
+
+	* win32/stub.c: stub for scripts.  [EXPERIMENTAL]
+
+Tue Nov  9 21:57:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln.c (init_funcname): allocate and build initialization
+	  funciton name at once.
+
+Tue Nov  9 21:14:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (AC_FUNC_GETPGRP, AC_FUNC_SETPGRP): no need when
+	  not used.
+
+	* configure.in (EXPORT_PREFIX): check generic prefix.
+
+Tue Nov  9 13:24:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regenc.c (onigenc_minimum_property_name_to_ctype):
+	  \p{...} should be case insensitive. [ruby-core:33000]
+
+	* regenc.c (onigenc_property_list_add_property):
+	  ditto.
+
+	* enc/euc_jp.c (init_property_list, property_name_to_ctype):
+	  to lowercase property names.
+
+	* enc/shift_jis.c (init_property_list, property_name_to_ctype):
+	  ditto.
+
+Tue Nov  9 13:29:36 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (overlapped_socket_io): get rid of a warning of 64bit
+	  mingw.
+
+Tue Nov  9 10:44:19 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* util.c (ruby_strtod): this code uses FPU's rounding system.
+	  But x86's FPU calculates double precision floating-point
+	  numbers in 80bit precision, so it fails to round the value.
+	  So ensure the value is assigned a variable. [ruby-dev:42551]
+	  see also [ruby-math:00802]
+	  http://www.shudo.net/java-grandprix99/strictfp/
+
+Tue Nov  9 07:30:15 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_syserr_new): new function to make SystemCallError
+	  instance without errno.  [EXPERIMENTAL]
+
+	* error.c (rb_syserr_fail, rb_mod_syserr_fail): ditto.
+
+Tue Nov  9 05:54:57 2010  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/*.rb: Remove unused variable warnings.
+	  Patch by Run Paint [ruby-core:30991]
+
+	* lib/rubygems/*, lib/rdoc/*.rb, lib/rake/*.rb: ditto
+
+Mon Nov  8 18:26:03 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* util.c (ruby_hdtoa): fix type cast and bufsize.
+
+Mon Nov  8 15:40:56 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): fix precision specifier doesn't
+	  work well on %f. [ruby-dev:42552]
+
+Mon Nov  8 14:41:40 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (get_wsa_extension_function): typos.
+
+Mon Nov  8 13:41:33 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/enc-unicode.rb,
+	  enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+	  enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+	  Add Age property to regexp. [ruby-core:33019]
+	  patched by Ammar Ali, tested by Run Paint Run Run
+
+Mon Nov  8 12:16:39 2010  Ben Walton  <bwalton@artsci.utoronto.ca>
+
+	* configure.in: support -h for solaris linker when gcc not used
+
+Mon Nov  8 11:47:39 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (finish_overlapped_socket): refactoring.
+
+Mon Nov  8 11:02:21 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (get_proc_address): refactoring.
+
+	* win32/win32.c (get_wsa_exetinsion_function): refactoring.
+
+Mon Nov  8 09:45:35 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/trans/gbk-tbl.rb: Add euro sign. [ruby-core:33094]
+	  CP936, which is de facto definition of GBK, has it.
+	  http://msdn.microsoft.com/en-us/goglobal/cc305153.aspx
+
+Mon Nov  8 07:26:20 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check only the first symbol to get rid of
+	  duplication.  [ruby-core:33084] #4031
+
+Sun Nov  7 10:13:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (NM): check on all platforms.  #4031
+
+Sun Nov  7 06:16:33 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* test/openssl/test_ocsp.rb: adding test for r29699.  Thanks Elise
+	  Huard! [ruby-core:32460]
+
+Sat Nov  6 07:33:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_export_prefix): check for prefixed
+	  underscore of exported symbols
+
+	* tool/rbinstall.rb (bin-comm): prepend prolog shell script if
+	  necessary.
+
+	* configure.in (LIBRUBY_RELATIVE): use rpath token expansion.
+
+Sat Nov  6 07:24:01 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/ruby.pc.in (arch, sitearch): reordered.
+
+	* configure.in: keep failed file.
+
+Sat Nov  6 07:03:49 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_fork_err): save errinfo before fdopen.
+
+Sat Nov  6 00:43:58 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/openssl/ossl_ocsp.c (ossl_ocspcid_initialize): an optional
+	  parameter may be used to specify the OpenSSL::OCSP::CertificateId on
+	  initialization.  Thanks Elise Huard! [ruby-core:32460]
+
+Fri Nov  5 12:23:01 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_{process,system}.rb (test_fallback_to_sh):
+	  meaningless and wrong tests where /bin/sh does not exist.
+
+	* process.c (proc_spawn_v): should spawn, not exec.
+
+Fri Nov  5 01:21:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (proc_exec_v, proc_spawn_v): try to execute with sh if
+	  no shebang.  [ruby-core:32745] [EXPERIMENTAL]
+
+Fri Nov  5 00:39:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_readlines, rb_io_each_line): limit must not be zero.
+	  a patch from Tomoyuki Chikanaga at [ruby-dev:42538].  #4024
+
+Fri Nov  5 00:14:15 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/fiddle/extconf.rb: fixing ffi library location on windows.
+	  Thanks Usa! [ruby-core:32930]
+
+Thu Nov  4 20:04:44 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_newobj): force garbage_collect() if GC.stress == true.
+
+Thu Nov  4 19:48:22 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* ChangeLog: missed to write a last ChangeLog.
+
+	* gc.c (gc_finalize_deferred): removed.
+
+	* gc.c (rb_gc_finalize_deferred): Do not invoke a free_unused_heaps().
+
+Thu Nov  4 19:45:27 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (run_final): do not need argument obj.
+
+Thu Nov  4 19:26:10 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (before_gc_sweep): fix commit miss.
+
+Thu Nov  4 19:20:46 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (after_gc_sweep, before_gc_sweep):
+	  invoke rb_sweep_method_entry() as soon as possible.
+
+Thu Nov  4 19:13:58 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (after_gc_sweep, slot_sweep): finalizers should be invoked
+	  as soon as possible.
+
+Thu Nov  4 10:30:40 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* configure.in (--with-valgrind): Now this option is default on.
+	  You can still explicitly disable this feature by specifying
+	  --without-valgrind.
+
+Thu Nov  4 02:06:16 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* cont.c (fiber_t_alloc): raise an error when fiber is going to be
+	  initialized twice.  [ruby-dev:42524]
+
+Thu Nov  4 02:04:25 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* cont.c (rb_fiber_resume): raise an "double resume" error when root
+	  fiber is going to be resumed.  [ruby-dev:42523]
+
+Wed Nov  3 14:17:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/ostruct.rb (OpenStruct#delete_field): also undefine
+	  accessor methods.  [ruby-core:33010]
+
+Wed Nov  3 14:13:46 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_enc_cr_str_buf_cat): concatenation of valid
+	  encoding string and invalid encoding string should result
+	  invalid encoding.  [ruby-core:33027]
+
+Wed Nov  3 08:58:59 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c, vm.c, vm_core.h: remove USE_VALUE_CACHE option.
+
+Wed Nov  3 07:47:25 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/irb/ruby-lex.rb (RubyLex#identify_string): parse multiple
+	  regex options.  a patch from Heesob Park in [ruby-core:32988].
+
+Wed Nov  3 07:33:57 2010  Tanaka Akira  <akr@fsij.org>
+
+	* vm_method.c (rb_clear_cache_by_class): just return if the class has
+	  no method.  reported by Eric Wong.  [ruby-core:32689]
+
+Tue Nov  2 22:50:25 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/visitor.rb (initialize): push accessor
+	  methods to subclass that actually uses them.
+
+Tue Nov  2 22:47:08 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/visitor.rb (accept): switch to
+	  a dispatch cache rather than case / when statement.
+
+Tue Nov  2 21:46:52 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* NEWS: fix a typo.
+
+Tue Nov  2 20:10:32 2010  Tajima Akio <artonx@yahoo.co.jp>
+
+	* test/rake/test_tasks.rb: clear env var which is used by the test.
+	  [ruby-dev:42508]
+
+Tue Nov  2 00:25:54 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/extconf.rb: win64 is just same with win32 about socket.
+	  notice: but wince is not same.
+
+Mon Nov  1 21:25:57 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* main.c: <stdlib.h> is needed, to introduce the getenv(3)
+	  prototype declaration.  Without it a C compiler shall infer
+	  the getenv type as "int getenv(...);", but this is totally
+	  wrong, especially when your machine's sizeof(int) and
+	  sizeof(char*) differs.  On such environment a return value
+	  of getenv(3), which is in fact a char*, might first casted
+	  into a int (loses data here), and then casted back to char*
+	  by automatic integral promotion to fit to the prototype of
+	  ruby_set_debug_option().
+
+Sun Oct 31 23:27:09 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (finalizer_table, objspace->final.table):
+	  Create finalizer_table at Init_heap().
+	  Remove all null checks of finalizer_table.
+
+	* gc.c (mark_tbl): skip if no table entries.
+
+	* gc.c (slot_swee): remove useless need_call_final check.
+
+Sun Oct 31 22:32:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (rb_objspace_free): finalizers should be called separately
+	  from freeing objspace.  [ruby-dev:42479]
+
+Sun Oct 31 22:24:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ruby_cleanup): free current VM and its objspace even
+	  when exiting by SystemExit.
+
+Sun Oct 31 22:10:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (new_child_iseq): adjust argument types.
+
+	* iseq.c (prepare_iseq_build, rb_iseq_new),
+	  (rb_iseq_new_with_bopt_and_opt, rb_iseq_new_with_opt),
+	  (rb_iseq_new_with_bopt): ditto.
+
+	* compile.c (iseq_set_exception_table): suppress warnings.
+
+	* insns.def (putspecialobject, defined): ditto.
+
+	* iseq.c (iseq_load): ditto.
+
+Sun Oct 31 09:30:51 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: some refactoring.
+	  - move decl. of rb_compile_option_struct to iseq.h.
+	  - define enum iseq_type.
+	  - define enum vm_special_object_type.
+
+	* compile.c: some refactoring.
+	  - apply above changes.
+	  - (struct iseq_link_element): change value of type.
+	  - remove unused decl.
+	  - fix comment.
+	  - rename iseq_build_body and iseq_build_exception to
+	    iseq_build_from_ary_body and iseq_build_from_ary_exception.
+
+	* iseq.h: define enum catch_type and enum defined_type.
+
+	* insns.def: apply above changes.
+
+	* iseq.c: define ISEQ_MAJOR_VERSION and ISEQ_MINOR_VERSION.
+
+Sat Oct 30 23:38:59 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/encoding.rb: untabify.
+
+Sat Oct 30 21:06:37 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/encoding.rb: use Ruby native encoding mechanism.
+	  [ruby-dev:42464]
+	* lib/rexml/encodings/: remove.
+
+	* lib/rexml/document.rb, lib/rexml/formatters/default.rb,
+	  lib/rexml/output.rb, lib/rexml/parseexception.rb,
+	  lib/rexml/parsers/baseparser.rb, lib/rexml/source.rb,
+	  lib/rexml/xmldecl.rb: use Ruby's native Encoding object.
+
+	* test/rexml/, test/rss/: follow the above encoding changes.
+
+	* NEWS: add REXML's incompatible change about encoding.
+
+Sat Oct 30 17:23:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* util.c (ruby_strtod): get rid of overflow/underflow as possible.
+
+Sat Oct 30 14:37:39 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (ruby_pc): erase runtime-defined variables and
+	  check if generated pc file is valid.
+
+	* template/ruby.pc.in (DEFFILE): need for mingw.
+
+	* template/ruby.pc.in (LIBRUBY): fix the order.
+
+Sat Oct 30 11:33:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/Makefile.sub (ruby_pc): ignore missing variables.
+
+	* template/ruby.pc.in: add missing variables for mswin.
+
+Sat Oct 30 10:24:35 2010  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* object.c: Make BasicObject.new accept no parameter.
+	  Revert of r26135 [ruby-core:27080], as per [ruby-core:32952].
+
+Sat Oct 30 09:40:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c: use constants in id.h.
+
+Sat Oct 30 09:08:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/closure.c (fiddle_closure): embed cif not reference
+	  so that the content surely get initialized.  [ruby-dev:42480]
+
+Sat Oct 30 07:01:53 2010  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv-replace.rb: suppress warning.
+
+	* lib/open-uri.rb: ditto.
+
+Sat Oct 30 06:32:52 2010  Tanaka Akira  <akr@fsij.org>
+
+	* test/pathname/test_pathname.rb (TestPathname#test_grpowned?): the
+	  group of the created file is inherited from the parent
+	  directory on BSDs and MacOS X.  Linux also inherit the group if
+	  the setgid bit of the directory is set.  It causes the test fail.
+	  fixed by Shota Fukumori.  [ruby-dev:42458]
+
+Sat Oct 30 05:58:54 2010  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb: retry via TCP if UDP reply is truncated.
+	  fixed by Julian Mehnle.  [ruby-core:32407]
+
+Sat Oct 30 00:35:13 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_s_compile): fix optional argument.
+	  a patch from Yutaka HARA [ruby-core:32953] [Ruby 1.9-Bug#4001]
+
+Sat Oct 30 00:24:42 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (memsize_of): take care of
+	  T_CLASS/const_tbl.
+	  a patch from nagachika <nagachika00@gmail.com> [ruby-dev:42490]
+
+Fri Oct 29 23:32:36 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* test/profile_test_all.rb: added.
+	  You can use test-all profiler with the following command:
+	    RUBY_TEST_ALL_PROFILE=true make test-all
+	  This command generates ./test_all_profile and you can analyze
+	  which tests consume memories.
+
+	* test/runner.rb: ditto.
+
+Fri Oct 29 10:02:03 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/enc-unicode.rb,
+	  enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+	  enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+	  Add 'Unknown' Script.
+	  patched by Run Paint Run Run. [ruby-core:32937] #3998
+
+Fri Oct 29 05:13:34 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (ObjectSpace.memsize_of_all): rename
+	  ObjectSpace.total_memsize_of_all_objects() to
+	  ObjectSpace.memsize_of_all([klass]).
+	  Accept Class object to filter the objects.
+
+	* test/objspace/test_objspace.rb: fix test for above change.
+
+Fri Oct 29 03:04:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_dump): fix expected length. [ruby-core:32935]
+
+Thu Oct 28 23:31:39 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (before_gc_sweep, run_final): fix decrement timing of final_num.
+
+Thu Oct 28 20:11:30 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/enc-unicode.rb,
+	  enc/unicode/name2ctype.h, enc/unicode/name2ctype.h.blt,
+	  enc/unicode/name2ctype.kwd, enc/unicode/name2ctype.src:
+	  Update Oniguruma for Unicode 6.
+	  patched by Run Paint Run Run. [ruby-core:32923] #3989
+
+Thu Oct 28 20:06:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* include/ruby/oniguruma.h (ONIGENC_CTYPE_SPECIAL_MASK):
+	  change mask from 128 to 256. [ruby-core:32931]
+
+Thu Oct 28 12:06:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/webrick/httprequest.rb (read_request_line): extend max
+	  length to 2083. This is from Internet Explorer's max uri
+	  length. http://support.microsoft.com/kb/208427 [ruby-core:32924]
+
+Thu Oct 28 04:00:08 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (GC.stat): added.  [ruby-dev:38607]
+
+	* test/ruby/test_gc.rb: add a test for above.
+
+Thu Oct 28 03:13:06 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (memsize_of): fix rdoc.
+
+	* ext/objspace/objspace.c (total_memsize_of_all_objects): added.
+
+	* test/objspace/test_objspace.rb:
+	  - add a test for ObjectSpace.total_memsize_of_all_objects.
+	  - add two tests for ObjectSpace.memsize_of (for nil and Fixnum).
+
+Wed Oct 27 23:55:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/iconv.c (Init_iconv): warn deprecated use.
+
+Wed Oct 27 18:50:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* bignum.c (rb_big2long, rb_big2ulong): rb2ulong() returns VALUE, but
+	  its real range is ulong. So, if the size of VALUE is bigger than
+	  ulong, upper bits are always zero even if the actual value is
+	  negative.
+	  fixed #3490
+
+Wed Oct 27 18:27:17 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_io.rb (TestIO#pipe): should close write end of pipe
+	  before closing read end, to get rid of timing problem.
+
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
+
+Wed Oct 27 18:14:27 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_getppid): support Win64.
+
+Wed Oct 27 15:07:19 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread_win32.c (w32_error): should get error no only once, because
+	  the result of the second getting will indicate the error of the
+	  first FormatMessage() call.
+
+Wed Oct 27 13:51:25 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_io.rb (TestIO#pipe): need to propagate exceptions
+	  in read/write thread. fix r29541.
+
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
+
+Wed Oct 27 12:05:40 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* class.c (clone_const): need to return value. fix r29602.
+
+Wed Oct 27 11:58:58 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* include/ruby/ruby.h (NUM2LONG_internal): add cast to get rid of a
+	  non GCC compiler warning. this is intentional type conversion.
+
+Wed Oct 27 09:25:46 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* cont.c: apply documentation patch by Run Paint Run Run.
+	  [ruby-core:32915]
+
+Wed Oct 27 02:12:10 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* object.c (Init_Object), constant.h, variable.c
+	  (rb_mod_private_constant, rb_mod_public_constant,
+	  set_const_visibility, rb_const_get_0): add Module#public_constant
+	  and private_constant.  [ruby-dev:39685][ruby-core:32698]
+
+	* test/ruby/test_module.rb: add tests for above.
+
+Wed Oct 27 02:02:54 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* class.c, constant.h, gc.c, method.h, object.c, variable.c,
+	  vm_insnhelper.c: use struct rb_constant_entry_t as entry of
+	  RCLASS_CONST_TBL.  RCLASS_CONST_TBL has contained VALUE of constant
+	  directly.  Now instead rb_const_entry_t is contained in
+	  RCLASS_CONST_TBL,  rb_const_entry_t is managed by malloc, and
+	  have not only the value itself but also visibility flag.
+	  This is another preparation for private constant (see
+	  [ruby-dev:39685][ruby-core:32698]).
+
+Wed Oct 27 01:56:34 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* class.c, gc.c, object.c, variable.c, vm_insnhelper.c,
+	  include/ruby/ruby.h: separate RCLASS_CONST_TBL from RCLASS_IV_TBL.
+	  RCLASS_IV_TBL has contained not only instance variable table but
+	  also constant table.  Now the two table are separated to
+	  RCLASS_CONST_TBL and RCLASS_IV_TBL.  This is a preparation for
+	  private constant (see [ruby-dev:39685][ruby-core:32698]).
+
+Tue Oct 26 18:51:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/scanf.rb (extract_float): allow 2.e+2 style.
+	  [ruby-dev:42452] #3978
+
+Tue Oct 26 18:09:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (ASFLAGS): needs INCFLAGS.
+
+	* configure.in (rb_cv_dynamic_alloca): check if extra source for
+	  dynamic size alloca.
+
+	* missing/x86_64-chkstk.s (___chkstk): necessary for alloca of
+	  amd64-mingw32msvc-gcc on Ubuntu.
+
+	* thread_win32.c (ruby_alloca_chkstk): check stack overflow
+
+Tue Oct 26 18:04:53 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/ruby.pc.in (Libs): needs DLDFLAGS.
+
+Tue Oct 26 12:47:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (pkgconfig-data): moved from Makefile.in.
+
+	* tool/rbinstall.rb: install pc file only if non-empty.
+	  [ruby-core:32901] #3983
+
+	* win32/Makefile.sub (ruby_pc): create pc file.
+
+Tue Oct 26 09:13:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_gcc_atomic_builtins): check for atomic
+	  builtins, all are not available in Apple derivative gcc.
+
+Tue Oct 26 00:29:26 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (pkgconfig-data): create pkg-config metadata file.
+
+	* tool/rbinstall.rb: install pkg-config metadata file.
+
+	* template/ruby.pc.in: template of pkg-config metadata file.
+
+Mon Oct 25 16:38:07 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* signal.c  (rb_atomic_t): GCC (of  at least  recent versions)
+	  has  ubiquitous  support  for  atomic operations.   On  that
+	  compiler a C program can  issue a memory barrier using these
+	  dedicated  instructions.  According to  the GCC  manual they
+	  cargo culted  this feature form  the Itanium ABI  so chances
+	  are that  other compilers  could also support  this feature.
+	  But so far GCC is the  only compiler that I know to have it.
+	  Also note that this works on non-Itanium machines.
+
+Mon Oct 25 06:21:35 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): prec digits fractal part should be
+	  appended to 0 if prec is given.  [ruby-dev:42453] #3979
+
+Mon Oct 25 02:57:21 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* common.mk (run.gdb): Quit gdb on 'make gdb' when
+	  no signals are received.
+
+Mon Oct 25 00:25:23 2010  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb: some corrections of documentation.
+
+Sun Oct 24 17:14:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c, gc.c, hash.c, object.c, string.c, struct.c,
+	  transcode.c, variable.c, vm.c, vm_insnhelper.c, vm_method.c:
+	  replace calls to rb_error_frozen() with rb_check_frozen().  a
+	  patch from Run Paint Run Run at [ruby-core:32014]
+
+	* include/ruby/intern.h (rb_check_frozen): optimize.
+	  [ruby-core:32878]
+
+Sun Oct 24 15:16:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit.rb (Test::Unit::Mini#run): abort if interrupted.
+
+	* lib/test/unit.rb (Test::Unit::Mini#run_test_suites): show the
+	  result even when interrupted on the way.
+
+	* lib/test/unit.rb (Test::Unit::Mini#run_test_suites): ensure
+	  output sync mode to be restored.
+
+Sun Oct 24 14:11:16 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (vm_define_method): defined method is run with the default
+	  public visibility regardless the visibility context of definition.
+	  [ruby-core:30638]
+
+Sun Oct 24 12:08:54 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* lib/test/unit.rb: make test/unit play nicely with the rake test
+	  loader. [ruby-core:32864]
+
+Sun Oct 24 00:25:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_rubyoptions.rb (test_segv_test): follow up the
+	  change at r29556.
+
+Sat Oct 23 14:39:58 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb: $extmk should be true for test/runner.
+
+Sat Oct 23 10:55:37 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_dump.c (rb_vm_bugreport): fix to add bug outputs.
+	  - loaded script ($0)
+	  - loaded features ($")
+	  - process memory map on Linux (/proc/self/maps)
+
+	* vm_dump.c (rb_vmdebug_stack_dump_raw): fix header message.
+
+Fri Oct 22 14:50:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  assertion message must not be nil.
+
+Fri Oct 22 13:59:50 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions#assert):
+	  treat nil case. Please run test-all before commit such change.
+
+Thu Oct 21 23:58:14 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_lazy_sweep): Variable declarations should be at
+	  the head of block.
+
+Thu Oct 21 23:56:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (objspace_each_objects, rb_objspace_each_objects): use
+	  struct.
+
+	* gc.c (objspace_each_objects): fix return with no value.
+
+Thu Oct 21 23:47:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_initialize): remove useless intermediate variable.
+
+Thu Oct 21 16:07:20 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_f_select): change rdoc.
+	  patched by Eito Katagiri [ruby-core:31805]
+
+Thu Oct 21 15:55:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/webrick/httpauth/digestauth.rb
+	  (WEBrick::HTTPAuth::ProxyDigestAuth#check_uri): privated.
+	  [ruby-dev:42344]
+
+Thu Oct 21 15:50:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_f_select): add correct rdoc.
+	  patched by Dave Thomas [ruby-core:32467]
+
+Thu Oct 21 15:42:01 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/telnet.rb (Net::Telnet#close): added.
+	  patched by Erik Hollensbe [ruby-dev:42260] #3830
+
+Thu Oct 21 13:08:00 2010  Narihiro Nakamura  <authornari@gmail.com>
+
+	* gc.c (rb_objspace_each_objects): don't lazy sweep in
+	  rb_objspace_each_objects. [Bug #3940] [ruby-dev:42369]
+
+Thu Oct 21 00:05:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_io.rb (TestIO#pipe): get rid of deadlock on pipe.
+	  a patch from Tomoyuki Chikanaga at [ruby-dev:42435].  #3970
+
+	* test/ruby/test_io_m17n.rb (TestIO_M17N#pipe): ditto.
+
+Wed Oct 20 23:54:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/dbm/dbm.c: rdoc based on a patch by mathew meta AT
+	  pobox.com, at [ruby-core:32853].
+
+Wed Oct 20 10:47:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* util.c (ruby_strtod): reject 0x1.p+0. [ruby-dev:42432] #3966
+
+Wed Oct 20 10:00:57 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): print floating point on "%#a".
+	  [ruby-dev:42431] Bug#3965
+
+Tue Oct 19 19:30:11 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): clear ALT flag for %a.
+	  [ruby-core:32841] [ruby-core:32848]
+
+Tue Oct 19 12:19:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): fix over-count of field size.
+
+Tue Oct 19 03:08:52 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vsnprintf.c (BSD_vfprintf): use HEXPREFIX flag for prefix of %a.
+	  [ruby-core:32841]
+
+Mon Oct 18 13:18:01 2010  Akinori MUSHA  <knu@iDaemons.org>
+
+	* ext/digest/digest.c (rb_digest_class_init): Define
+	  Digest::Class.new(). [Feature #3954]
+
+Mon Oct 18 12:58:40 2010  Tanaka Akira  <akr@fsij.org>
+
+	* pack.c (pack_pack): refine the document.  [ruby-dev:42397]
+	  (pack_unpack): ditto.
+
+Mon Oct 18 10:19:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (transport_request): @socket may be nil.
+	  patched by Egbert Eich [ruby-core:32829]
+
+Mon Oct 18 09:57:28 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* sprintf.c (BSD_vfprintf): wrong padding around prefix and
+	  floating point with %a. [ruby-dev:42403] Bug #3956
+
+Sun Oct 17 22:36:33 2010  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date/delta.rb: added an rdoc tag.
+
+Sun Oct 17 10:47:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_mod_remove_const): update rdoc.
+	  [ruby-core:31957]
+
+Sun Oct 17 10:40:17 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (rb_define_{class,module}_id_under): register to be
+	  marked, which probably are defined and used internally.
+
+Sat Oct 16 11:10:55 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_encoding2cp): set codepage 20936
+	  according to GB2312. [Bug #3937] [ruby-core:32758]
+
+Sat Oct 16 10:54:57 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (CPP): already used in .c.i rule.
+
+	* cygwin/GNUmakefile.in (DLLWRAP, WINDRES): add --driver-name and
+	  --preprocessor options explicitly.  [ruby-core:32776]
+
+Sat Oct 16 10:06:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/sdbm/_sdbm.c (SEEDUPS, BADMESS): make settable using command
+	  line options.
+
+	* ext/sdbm/_sdbm.c (makroom): suppress unused result warning.
+
+	* ext/sdbm/extconf.rb: disable BADMESS, a library should not emit
+	  messages directly.
+
+Sat Oct 16 08:39:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln.c (dln_strerror): get English message first, instead of
+	  system default. see [ruby-dev:42358].
+
+Sat Oct 16 00:08:00 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* hash.c (rb_hash_aref): skip calling "default" method
+	  if it is not needed, for speed-up.
+
+Fri Oct 15 23:36:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (NUM2DEVT, DEVT2NUM, PRI_DEVT_PREFIX): fallback to
+	  unsigned int.
+
+Fri Oct 15 22:54:46 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_hresult2msg): get English message first,
+	  instead of system default. [ruby-core:32765]
+
+Fri Oct 15 22:47:31 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (VALUE): prefer long over uintptr_t,
+	  FIX2LONG expects VALUE to be long at least.
+
+	* include/ruby/ruby.h (FIX2LONG): parenthesize the argument.
+
+Fri Oct 15 20:30:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (dev_t): use RUBY_REPLACE_TYPE.
+
+	* file.c (rb_stat_inspect): use PRI_DEVT_PREFIX.
+
+Fri Oct 15 17:26:57 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* pack.c (pack_pack): simplify comparison of explicit_endian
+	  as pointed by nobu.
+
+	* pack.c (pack_unpack): ditto.
+
+Fri Oct 15 16:40:37 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* pack.c (pack_pack): fix more than one modifiers appear in the
+	  format string. [ruby-core:32793]
+
+	* pack.c (pack_unpack): ditto.
+
+Thu Oct 14 23:20:42 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_folderitem2_invokeverb.rb: refactoring.
+
+Thu Oct 14 22:18:29 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def, iseq.c, vm_insnhelper.c: rename variable name
+	  (ip -> iseq).
+
+Thu Oct 14 20:41:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* pack.c (pack_pack): support endian modifiers: < and >.
+	  [ruby-dev:42376] Feature #3491
+
+	* pack.c (pack_unpack): ditto.
+
+Thu Oct 14 20:50:51 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (reg_get_val): expand environment in
+	  the pathname. [Bug #3907]
+
+Thu Oct 14 07:35:07 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* file.c (DEVT2NUM): added. Size of dev_t is depend on the
+	  environment even if POSIX defines dev_t as unsigned integer.
+	  For example, OpenVMS, 64bit Solaris 9, and NetBSD 6 defines
+	  dev_t as 64bit unsigned integer.
+
+	* file.c (rb_stat_dev): use DEVT2NUM.
+
+	* file.c (rb_stat_dev_major): dev_t is not long. major(3)'s return
+	  value is int.
+
+	* file.c (rb_stat_dev_minor): dev_t is not long. minor(3)'s return
+	  value is int.
+
+	* configure.in: check size of dev_t.
+
+Thu Oct 14 07:22:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_and, rb_ary_or), class.c (rb_mod_init_copy),
+	  gc.c (undefine_final), time.c (time_mload): get rid of
+	  type-punning casts.
+
+Thu Oct 14 04:16:41 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (ruby_float_step): fix Numeric#step with infinity unit
+	  doesn't works well. [ruby-core:32779]
+
+Wed Oct 13 23:16:46 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/enc-unicode.rb: get rid of lots of warnings.
+
+	* iseq.c (insn_operand_intern, rb_iseq_disasm): fix format specifiers.
+
+	* vm.c (thread_free): ditto.
+
+	* numeric.c (check_uint): get rid of overflow on LLP64 platforms.
+
+	* insns.def (opt_case_dispatch): use st_data_t.
+
+Wed Oct 13 22:32:34 2010  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
+
+	* lib/cgi/util.rb (CGI::unescape): bugfix to unescape the multibyte
+	  string. Thanks nobu and tDiary dev members. [Bug #3909]
+
+Wed Oct 13 21:13:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (int_chr): raise error when the value is negative.
+
+Wed Oct 13 19:24:08 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* vm.c (ruby_vm_destruct): This function type was wrong; correct to the prototype.
+
+Wed Oct 13 14:58:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (rb_num_to_uint): fix 32bit logic.
+
+Wed Oct 13 12:53:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (rb_num_to_uint): added to check the range of arguments.
+	  Mainly for negative value with NUM2UINT on 32bit environment.
+
+	* string.c (rb_str_concat): use rb_num_to_uint.
+
+Wed Oct 13 12:10:02 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread_win32.c (w32_error): get English message first, instead
+	  of system default. see [ruby-core:32765].
+	  [experimental]
+
+Wed Oct 13 11:04:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* debug.c (ruby_set_debug_option): define always for binary
+	  compatibility with debug env enabled binary.
+
+	* signal.c (ruby_enable_coredump): ditto.
+
+Wed Oct 13 10:52:51 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (ruby_executable_node): missing prototype.
+
+Wed Oct 13 05:23:04 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* missing/strchr.c: add strlen's prototype.
+
+	* missing/strstr.c: ditto.
+
+Wed Oct 13 00:21:17 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/syck/rubyext.c (struct mktime_arg): constified.
+
+	* ext/syck/rubyext.c (mktime_do, mktime_r, rb_syck_mktime): fix
+	  function signatures.
+
+Wed Oct 13 00:18:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* st.c (MurmurMagic): get rid of literal overflow.
+
+	* configure.in (RUBY_CHECK_PRINTF_PREFIX): check for printf format
+	  specifier if possible.
+
+Tue Oct 12 23:58:19 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_open_osfhandle, rb_w32_wopen, rb_w32_pipe):
+	  use uintptr_t instead of long for win64.
+
+	* win32/win32.c (socketpair_internal): suppress warnings.
+
+	* win32/win32.c (ftruncate): use HANDLE instead of long for win64.
+
+	* vsnprintf.c (BSD_vfprintf): fix cast.
+
+	* numeric.c (rb_num2fix): result of rb_num2long is SIGNED_VALUE.
+
+	* compile.c (iseq_build_body), error.c (set_syserr, get_syserr),
+	  (syserr_initialize), gc.c (define_final, rb_gc_copy_finalizer),
+	  (run_final), hash.c (rb_hash_aref, rb_hash_lookup2),
+	  (rb_hash_fetch_m, rb_hash_clear, rb_hash_aset, eql_i),
+	  iseq.c (iseq_load, iseq_data_to_ary), marshal.c (r_symlink),
+	  thread.c (rb_thread_local_aref),
+	  variable.c (generic_ivar_remove, ivar_get, rb_const_get_0),
+	  (rb_cvar_get), vm.c (rb_vm_check_redefinition_opt_method),
+	  vm_insnhelper.c (vm_get_ev_const), vm_method.c (remove_method),
+	  ext/iconv/iconv.c (map_charset): use st_data_t.
+
+	* compile.c (iseq_build_body), insns.def (getglobal, setglobal),
+	  iseq.c (iseq_load, iseq_data_to_ary), util.c (valid_filename):
+	  use VALUE.
+
+	* gc.c (obj_free, rb_objspace_call_finalizer): fix truncating
+	  cast.
+
+	* gc.c (mark_current_machine_context): suppress warnings.
+
+	* compile.c (iseq_compile_each): fix truncating cast.
+
+	* cont.c (fiber_setcontext): missing variable definition.
+
+Tue Oct 12 19:25:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* error.c (exc_to_s): use OBJ_INFECT.
+
+	* error.c (name_err_to_s): ditto.
+
+	* error.c (name_err_mesg_to_str): ditto.
+
+	* error.c (syserr_initialize): ditto.
+
+Tue Oct 12 19:07:55 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* error.c (syserr_initialize): taint message if mesg is given
+	  and it is tainted.
+
+Tue Oct 12 18:25:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_io_ungetc): always see Bignum. On 32bit valid value
+	  may be a Bignum. On 64bit for errors. [ruby-dev:42366]
+
+Tue Oct 12 18:25:04 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_concat): use unsigned int for GB18030.
+
+Tue Oct 12 17:53:49 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric (check_uint): the mask must refer to VALUE.
+
+Tue Oct 12 17:47:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric (check_uint): set MSB for negative value.
+
+	* numeric (rb_num2uint): return value's type of rb_num2ulong
+	  is VALUE.
+
+	* numeric (int_chr): variable i can't be negative.
+
+Tue Oct 12 16:04:37 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_strerror): get English message first, instead
+	  of system default. see [ruby-dev:42358].
+	  [experimental]
+
+Tue Oct 12 15:52:35 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_strerror): unmap some range of errno for
+	  workaround of VC10's strerror() and sys_nerr problem.
+	  based on a patch from Akio Tajima, [ruby-dev:42355].
+
+Tue Oct 12 15:36:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_io_ungetc): use unsigned int for GB18030.
+
+Tue Oct 12 15:14:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_io_putc): support multibyte characters.
+	  [ruby-core:30697]
+
+Tue Oct 12 15:10:31 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (rb_enc_uint_chr): split from int_chr.
+
+	* numeric.c (int_chr): use rb_enc_uint_chr.
+
+	* include/ruby/encoding.h (rb_enc_uint_chr): added.
+
+Tue Oct 12 14:04:41 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* numeric.c (int_chr): a codepoint of Ruby M17N must be 32bit
+	  unsigned int; GB18030 uses MSB. Also note that OnigCodePoint
+	  is defined as unsigned int.
+
+Tue Oct 12 12:20:54 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* vm_dump.c (dump_thread): foolish mistake.
+
+Tue Oct 12 10:39:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_MINGW32): canonicalize only on mingw.
+
+Mon Oct 11 20:20:23 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (HTTP.get): specify ASCII-8BIT as the result
+	  encoding of Zlib::GzipReader.
+	  http://hibari.2ch.net/test/read.cgi/tech/1281473294/271
+
+Mon Oct 11 17:42:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* error.c (syserr_initialize): use mesg's encoding when locale
+	  encoding is US-ASCII. If locale encoding is not US-ASCII,
+	  assume err has non ASCII characters. [ruby-dev:42358]
+
+Mon Oct 11 14:03:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* error.c (syserr_initialize): set the encoding of Errno::*#message
+	  as locale. [ruby-dev:42358]
+
+Mon Oct 11 06:38:27 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_set_encoding):
+	  StringIO#set_encoding can get 2nd argument and optional hash
+	  for API compatibility to IO. [ruby-dev:42356]
+
+Mon Oct 11 06:11:30 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_io_set_encoding): use rb_funcall2 when the io is not
+	  a T_FILE. [ruby-dev:42356]
+
+Sun Oct 10 18:42:23 2010  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb (Set#replace): Apply a bit of optimization.
+
+Sun Oct 10 10:20:07 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_MINGW32): canonicalize as like mswin version.
+
+Sun Oct 10 05:33:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_signal_buff_size, rb_signal_exec): moved
+	  declarations from thread.c.
+
+Sat Oct  9 16:54:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RSHIFT): quote to get rid of argument expansion
+	  for autoconf 2.68.
+
+Sat Oct  9 11:00:06 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (thread_reset_event_flags, exec_event_hooks): ignore
+	  hooks marked as removed.
+
+	* thread.c (thread_exec_event_hooks): remove hooks to be removed.
+
+	* thread.c (rb_threadptr_remove_event_hook, rb_remove_event_hook):
+	  defer removing hooks if running the hooks.  [ruby-dev:42350]
+
+Sat Oct  9 10:51:00 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_threadptr_exec_event_hooks): suppress each event
+	  hooks separately.
+
+	* thread.c (thread_suppress_tracing): split from
+	  ruby_suppress_tracing, accepting thread pointer and event mask.
+
+Sat Oct  9 08:16:01 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_threadptr_remove_event_hook): fix typo.
+
+Fri Oct  8 10:52:25 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (RBCONFIG): depends on version.h due to
+	  RUBY_PATCHLEVEL.  [ruby-core:32709]
+
+Fri Oct  8 00:24:54 2010  James Edward Gray II  <jeg2@ruby-lang.org>
+
+	* lib/csv.rb: Fixing documentation typos.  [ruby-core:32712]
+
+Thu Oct  7 09:14:28 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_exec.c (vm_exec_core):  Treat clang as non gcc on this
+	  context: It has __asm__ but doesn't works well.
+
+Wed Oct  6 12:28:22 2010  Tanaka Akira  <akr@fsij.org>
+
+	* lib/uri/generic.rb (URI::Generic#hostname): new method.
+	  (URI::Generic#hostname=): ditto.
+
+	* lib/open-uri.rb: use URI#hostname
+
+	* lib/net/http.rb: ditto.
+
+	  reported by Adam Majer.  [ruby-core:32056]
+
+Wed Oct  6 11:52:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (fptr_finalize): write_mutex might have been destroyed
+	  already in finalization phase, as the order of finalizers is not
+	  guaranteed.  rb_mutex_t should be used in place of Mutex object
+	  in the future.
+
+Tue Oct  5 22:17:02 2010  wanabe  <s.wanabe@gmail.com>
+
+	* win32/mkexports.rb: revert r29320 and r29402.
+
+Mon Oct  4 12:43:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (regexp): dregexp has literal string only at the head
+	  and successors are array.  [ruby-core:32682]
+
+Mon Oct  4 10:22:21 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* random.c (rand_init): This checks the value is in 32bit or not,
+	  so use int32_t, not int.
+
+Mon Oct  4 09:47:39 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* random.c (rand_init): remove useless assignment.
+
+	* re.c (update_char_offset): remove unused variable.
+
+	* re.c (read_escaped_byte): ditto.
+
+Mon Oct  4 09:30:42 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/bn.rb (Integer#to_bn): OpenSSL::BN.new
+	  accepts only Strings, so call Integer#to_s(16).
+	  16 is for an optimization. [ruby-dev:42336]
+
+Mon Oct  4 07:57:51 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* cont.c (fiber_memsize): Return size.
+	  Before this change, fiber_memsize always returns 0.
+
+Mon Oct  4 07:16:55 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/unicode.c (onigenc_unicode_property_name_to_ctype):
+	  remove useless assignment.
+
+	* vm.c (vm_make_proc_from_block): ditto.
+
+	* variable.c (rb_ivar_count): ditto.
+
+Mon Oct  4 06:40:24 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* Makefile.in (clean-rdoc): Don't use \ in variable expansion.
+	  BSD make treats it as an escape character.
+
+Mon Oct  4 00:01:53 2010  wanabe  <s.wanabe@gmail.com>
+
+	* tool/config.sub: revert r29320, r29324, r29347, r29354, r29365
+	  to automake-1.11.1. [ruby-core:32634]
+
+	* win32/mkexports.rb: no longer use 'mingw64'. a patch from Luis Lavena
+	  at [ruby-core:32678].
+
+Sun Oct  3 20:36:37 2010  Akio Tajima (arton)  <artonx@yahoo.co.jp>
+
+	* test/win32ole/test_folderitem2_invokeverb.rb: Change creating
+	  shortcut verb to 'Link' [Bug #3339]
+
+Sun Oct  3 19:44:23 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (Makefile): get rid of duplicated ruby target when
+	  already there it was.
+
+Sat Oct  2 22:59:32 2010  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_thread.rb: add for win32ole with Thread.
+
+Fri Oct  1 17:03:00 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/webrick/test_httpproxy.rb (TestWEBrickHTTPProxy::test_upstream_proxy):
+	  My machine fails this test at this line, saying 503 service unavailable.
+
+Thu Sep 30 16:11:08 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_getenv): should return NULL if specified name
+	  is empty. a patch from Heesob Park at [ruby-core:32650]
+
+Thu Sep 30 15:18:23 2010  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (command_asgn): allow command_call to be right hand side
+	  expression of chained assignment.  [ruby-dev:42313]
+
+Thu Sep 30 10:55:38 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* hash.c (ruby_setenv): workaround for old Windows. a patch from
+	  Heesob Park. [ruby-core:32353]
+
+Thu Sep 30 09:29:06 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/common.rb (URI.encode_www_form): change treatment of
+	  undefined value in given array as latest internet draft for
+	  application/www-form-urlencoded.
+	  http://tools.ietf.org/html/draft-hoehrmann-urlencoded-01
+
+Thu Sep 30 09:34:03 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* vm_dump.c (dump_thread): fixed wrong type of return value of
+	  SymGetModuleBase64(). [ruby-dev:42306]
+
+Wed Sep 29 21:04:05 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/ruby/test_rubyoptions.rb (TestRubyOptions::test_script_from_stdin):
+	  As usual, PTY is not always available.
+
+Wed Sep 29 18:38:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/config.sub (x64): regularize only for pc vendor, and strip
+	  useless 64 suffix.
+
+Wed Sep 29 17:53:02 2010  Kenta Murata <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BIGDECIMAL_ENABLE_VPRINT):
+	  VPrint is usually disabled.  It's only used in debugging.
+
+Wed Sep 29 17:41:34 2010  Kenta Murata <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_save_limit):
+	  return the result of a block.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_save_limit):
+	  add a test for the above change.
+
+Wed Sep 29 16:18:03 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* vm_dump.c (dump_thread): remove unused optional arguments.
+
+Wed Sep 29 13:26:30 2010  Kenta Murata <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_save_rounding_mode):
+	  return the result of a block.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_save_rounding_mode):
+	  add a test for the above change.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_save_exception_mode):
+	  add a test for the return value of BigDecimal.save_exception_mode.
+
+Wed Sep 29 12:45:30 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_div2, BigDecimal_add2,
+	  BigDecimal_sub2, BigDecimal_mult2, VpLimitRound): remove meaningless
+	  casts to get rid of compiler warnings.
+
+Wed Sep 29 12:35:13 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (VPrint, VpToString): fix format.
+
+Wed Sep 29 12:31:12 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/known_classes.rb (RDoc::KNOWN_CLASSES): add Encoding.
+
+Tue Sep 28 20:50:23 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/config.sub (x64): regularize same as mswin.
+
+Tue Sep 28 20:06:14 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* vm_dump.c (rb_vm_bugreport): add windows support.
+	  based on patches from Peter Weldon at [ruby-core:32551]
+
+Mon Sep 27 23:30:34 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def (opt_case_dispatch), vm_insnhelper.c:
+	  execute the procedures of "when" clauses by bytecode
+	  instead of st_foreach() when the object does not hit
+	  prepared hash.  [ruby-dev:42304]
+
+Mon Sep 27 15:54:03 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/net/http/test_https.rb: As always, localhost is not
+	  guaranteed to be resolved as 127.0.0.1.  But a SSL
+	  certificate needs a socket to listen on a specific address
+	  where a CN resolves to.  On situations where localhost is
+	  not 127.0.0.1, these tests are not possible.
+
+Mon Sep 27 15:25:05 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/net/imap/test_imap.rb: resurrection of r29259.
+	  this change depends on minitest 1.7.1.
+
+	* lib/test/unit/assertions.rb: ditto.
+
+Sun Sep 26 22:59:45 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/config.sub (x86_64-pc-mingw64): regularize.
+
+Sun Sep 26 22:21:07 2010  wanabe  <s.wanabe@gmail.com>
+
+	* ext/openssl/ossl_hmac.c (ossl_hmac_hexdigest, ossl_hmac_s_hexdigest),
+	  ext/openssl/ossl_pkey_ec.c (ossl_ec_group_set_seed),
+	  ext/openssl/ossl_ssl_session.c (ossl_ssl_session_to_der),
+	  ext/openssl/ossl_pkcs7.c (numberof): suppress warnings.
+	  [ruby-core:31932]
+
+Sun Sep 26 10:25:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/config.{guess,sub}: updated to automake-1.11.1.
+
+Sat Sep 25 22:48:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (LIBRUBY_DLDFLAGS): fix quoting.
+
+Sat Sep 25 10:30:37 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (LIBRUBY_DLDFLAGS): use -unexported_symbol only
+	  when available.  http://trac.macports.org/ticket/26341
+
+Sat Sep 25 10:05:49 2010  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: Always add -mieee for Renesas SH4.
+	  Thanks, Nobuhiro Iwamatsu. [Feature #3874] [ruby-core:32548]
+
+Sat Sep 25 01:34:41 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (install-cross): target to install cross-compiling
+	  stuff.
+
+Fri Sep 24 23:44:59 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (sym_call), vm.c (invoke_block_from_c),
+	  vm_insnhelper.c (vm_yield_with_cfunc): pass given block.
+	  [ruby-core:32075]
+
+	* vm_eval.c (rb_funcall_passing_block): new function to call
+	  method with passing given block.
+
+Fri Sep 24 15:50:43 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_to_i): fix rdoc: String#to_i raises an
+	  exception when base is invalid. [ruby-core:31685]
+
+Fri Sep 24 15:28:35 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (rb_str_rindex): use rb_enc_prev_char instead of repeated
+	  str_nth.
+	  patched by Michael Selig [ruby-core:32498]
+
+Fri Sep 24 14:19:12 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/test_pty.rb: Same as 229281; existence of PTY class do not
+	  guarantee a successful pty operation.
+
+Fri Sep 24 06:25:55 2010  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* lib/minitest/*.rb: Imported minitest 1.7.2 r5879.
+	* test/minitest/*.rb: ditto.
+
+Thu Sep 23 23:09:08 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_get_cref0): cref is stacked only in normal
+	  iseqs, so check if it is the case first.
+
+Thu Sep 23 23:08:41 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/config.sub: mingw64 should use x86_64.  [ruby-core:32514]
+
+Thu Sep 23 21:40:40 2010  wanabe  <s.wanabe@gmail.com>
+
+	* ext/socket/raddrinfo.c (init_addrinfo, inspect_sockaddr): suppress
+	  warnings.  see [ruby-core:31932].
+
+Thu Sep 23 19:27:57 2010  wanabe  <s.wanabe@gmail.com>
+
+	* thread_win32.c (w32_wait_events, w32_close_handle): suppress warnings.
+	  see [ruby-core:31932].
+
+Thu Sep 23 18:54:39 2010  wanabe  <s.wanabe@gmail.com>
+
+	* tool/config.sub: add mingw64.
+
+	* win32/mkexports.rb (Exports::Mingw64): added.
+
+	* win32/mkexports.rb (Exports::Mingw32): renamed from Exports::Mingw.
+
+Thu Sep 23 09:01:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_cref_push): no outer cref is needed for proc
+	  from method.  Bug #3786, Bug #3860, [ruby-core:32501]
+
+Wed Sep 22 17:12:01 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/openssl/utils.rb (OpenSSL#silent): always restore $VERBOSE.
+	  [ruby-dev:42285]
+
+Wed Sep 22 16:59:40 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* test/test_prime.rb (TestPrime#test_new): the warning expected have
+	  not been displayed when $VERBOSE == nil. Patch by Shota Fukumori
+	  a.k.a. sora_h. [ruby-dev:42272]
+	  Recovers $stderr even if StringIO.new fails. Reported by unak.
+
+Wed Sep 22 01:55:48 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* bootstraptest/test_method.rb: fix last commit.
+
+Wed Sep 22 01:49:52 2010  Koichi Sasada  <ko1@atdot.net>
+
+	* bootstraptest/test_method.rb: add a test for [ruby-core:30534].
+
+Wed Sep 22 00:52:44 2010  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/rdoc/ri/store.rb (save_cache): remove duplicate entries.
+
+Wed Sep 22 00:00:05 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_f_pathname): Pathname() translated
+	  from pathname.rb.
+
+Tue Sep 21 22:18:30 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/mkconfig.rb: fixed build problem on mswin64 introduced in r29278.
+
+Tue Sep 21 02:42:35 2010  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/pathname/test_pathname.rb (TestPathname#test_mkdir): fix typo.
+
+Mon Sep 20 23:23:05 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (bracket): get rid of scanning at the end of the pattern
+	  string, not to raise an exception while globbing command line.
+	  [ruby-core:32478]
+
+Mon Sep 20 11:25:49 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (Init_pathname): Pathname#=~ undefinition
+	  translated from pathname.rb.
+
+Mon Sep 20 02:34:11 2010  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (check_rounding_mode, BigDecimal_mode):
+	  raise ArgumentError instead of TypeError passing invalid modes.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
+	  change against the above modifications.
+
+Sun Sep 19 22:08:39 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* lib/mkmf.rb (try_link): rdoc
+	  (try_compile): ditto
+	  (try_cpp): ditto
+	  (try_func): ditto
+	  (try_var): ditto
+	  (try_run): ditto
+	  (egrep_cpp): ditto
+
+Sun Sep 19 20:43:33 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* configure.in (--disable-install-doc): disables capi too, in addition
+	  to rdoc.
+	  (--disable-install-rdoc): a new option for disabling only rdoc.
+	  (--disable-install-capi): a new option for disabling only capi.
+
+Sun Sep 19 20:37:45 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* common.mk (clean): removes all documents on cleaning.o
+	  (CAPIOUT): new variable.
+	  (clean-capi, distclean-capi, realclean-capi): new targets
+
+	* Makefile.in (clean-capi, distclean-capi, realclean-capi): ditto.
+
+	* win32/Makefile.sub (clean-capi, distclean-capi, realclean-capi):
+	  ditto.
+
+Sun Sep 19 13:44:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (LIBRUBY_SO): fix an oversight of replace
+	  RUBY_INSTALL_NAME with RUBY_SO_NAME.  a patch from Jeremy Evans
+	  at [ruby-core:32474].
+
+Sun Sep 19 07:48:20 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_unlink): Pathname#unlink and
+	  Pathname#delete translated from pathname.rb.
+
+Sun Sep 19 06:06:07 2010  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (check_rounding_mode): added for
+	  converting symbol to rounding mode number.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round):
+	  support to specify rounding mode by symbol.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_mode, test_round):
+	  add tests for above changes.
+
+Sun Sep 19 05:14:35 2010  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c: fix rounding algorithms for half-down
+	  and half-even.  This change is based on the patch created by Matthew
+	  Willson, the reporter of this bug.  [Bug #3803] [ruby-core:32136]
+
+	* test/bigdecimal/test_bigdecimal.rb: add tests for above changes.
+
+Sat Sep 18 20:09:51 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_each_entry): Pathname#each_entry
+	  translated from pathname.rb.
+
+Fri Sep 17 23:44:07 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/xpath_parser.rb, test/rexml/test_xpath.rb:
+	  add missing method availability check. [ruby-core:32447]
+	  Reported by Wiebe Cazemier. Thanks!!!
+
+Fri Sep 17 23:23:26 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rexml/test_sax.rb: don't use thread and sleep to avoid slow test.
+
+Fri Sep 17 23:10:44 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rexml/test_core.rb: enable.
+
+Fri Sep 17 22:46:02 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rexml/: untabify.
+
+Fri Sep 17 22:29:56 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rexml/: fix fixture data path. All REXML tests are worked.
+
+Fri Sep 17 22:15:15 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rexml/test_listener.rb: remove needless codes.
+
+Fri Sep 17 22:12:23 2010  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rexml/: import REXML tests from
+	  http://www.germane-software.com/repos/rexml/trunk/test/.
+	  Many tests are failed temporary. I'll fix them quickly. Sorry.
+
+Fri Sep 17 16:48:49 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/io/console/test_io_console.rb (TestIO_Console::helper):
+	  PTY.open is not guaranteed to work.  On my machine opening a
+	  pty is prohibited via process control group.  On those cases
+	  exceptions shall occur, and that doesn't mean our fault.
+	  Skip those tests on such situations.
+
+Fri Sep 17 08:30:27 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/tracer.rb: count only non-internal libraries in stack trace,
+	  ignoring custom_require.  [ruby-core:31858]
+
+Fri Sep 17 02:18:41 2010  Akinori MUSHA  <knu@iDaemons.org>
+
+	* tool/mkconfig.rb: Fix build with m4 1.4.15 generating duplicate
+	  lines in config.status.  According to nobu, the mswin32 port may
+	  depend on the piece of code in question, so the behavior is left
+	  unchanged on mswin32.
+
+Thu Sep 16 23:47:59 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_opendir): Pathname#opendir translated
+	  from pathname.rb.
+
+Thu Sep 16 21:40:37 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit.rb (Test::Unit::GlobOption): merged RejectOption.
+
+	* test/runner.rb: utilize GlobOption.
+
+Thu Sep 16 21:31:24 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/ri/driver.rb (RDoc::RI::Driver.setup_options)
+	  (RDoc::RI::Driver.fixup_options): split from process_args.
+	  libraries should not parse ARGV inside, since it's a task of
+	  applications, not libraries.
+
+Thu Sep 16 21:02:30 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/ri/paths.rb (RDoc::RI::Paths.each): HOMEDIR can be nil
+	  if $HOME is unset.
+
+Thu Sep 16 14:50:42 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/ruby/test_file_exhaustive.rb (TestFileExhaustive::test_expand_path):
+	  ENV["HOME"] might not be set.  On those cases without it an
+	  exception raises here, which effectively disables later
+	  tests on this method.
+
+Thu Sep 16 08:30:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_f_sprintf): fix rdoc.  pointed out by Tomoyuki
+	  Chikanaga at [ruby-core:32395], and a patch from Daniel
+	  Bovensiepen at [ruby-core:32403].
+
+Thu Sep 16 08:27:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/etc/extconf.rb: use expanded sysconfdir with empty DESTDIR.
+	  [ruby-core:32394]
+
+Thu Sep 16 06:07:24 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_rmdir): Pathname#rmdir translated
+	  from pathname.rb.
+
+Thu Sep 16 00:36:25 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/readline/extconf.rb: Remove Readline 6 check because
+	  Ruby's license is now GPLv3 compatible. [ruby-core:28736]
+
+Thu Sep 16 00:26:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* COPYING: change Ruby's License from a dual license with GPLv2
+	  to a dual license with 2-clause BSDL.
+	  [ruby-dev:42166] [ruby-core:31971]
+	  [ruby-dev:39167] [ruby-core:25272]
+
+	* COPYING.ja: ditto.
+
+	* BSDL: added. this is from The FreeBSD License.
+
+Wed Sep 15 21:07:06 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_mkdir): Pathname#mkdir translated
+	  from pathname.rb.
+
+Wed Sep 15 13:37:00 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* test/net/imap/test_imap.rb: "localhost" not guaranteed to
+	  resolve to "127.0.0.1".  On my machine it is "::1" instead.
+	  The problem is, you have to connect to the imaps server via
+	  the canonical name written in a server certificate, and that
+	  of the server.cert is "localhost".  So you have to listen to
+	  the address of what "localhost" resolves to.  I think this
+	  situation cannot be resolved in a handy manner because the
+	  test "test_imaps_post_connection_check" is actually
+	  expecting to connect to a server via an address other than
+	  the CN.  On my machine several assertions won't pass because
+	  the test cannot connect to the server.
+
+Wed Sep 15 09:12:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_puts): fix for wide char encoding strings.
+	  [ruby-dev:42212]
+
+Wed Sep 15 07:27:52 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_format_m): mentioned about Hash argument.  a patch
+	  from Daniel Bovensiepen at [ruby-core:32386].
+
+	* sprintf.c (get_hash): ditto, and fix typo.
+
+Wed Sep 15 07:22:20 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_entries): Pathname#entries translated
+	  from pathname.rb.
+
+Wed Sep 15 02:13:44 2010  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/fiddle/closure.c : Don't use FFI closure alloc on OpenBSD.
+	  Thanks Jeremy Evans! [ruby-core:32384]
+
+Tue Sep 14 20:17:48 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_s_getwd): Pathname.getwd and
+	  Pathname.pwd translated from pathname.rb.
+
+Tue Sep 14 05:13:04 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_s_glob): Pathname.glob translated
+	  from pathname.rb.
+
+Tue Sep 14 01:24:51 2010  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
+
+	* ext/socket/raddrinfo.c (ruby_getaddrinfo__aix): suppress a
+	  warning.
+
+Mon Sep 13 20:48:30 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_zero_p): Pathname#zero? translated
+	  from pathname.rb.
+
+Mon Sep 13 19:56:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/rubysocket.h (__DARWIN_ALIGNBYTES): workaround of a
+	  bug in system header of darwin 9.  [ruby-core:32341]
+
+Mon Sep 13 18:11:55 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (try_do): fix typo.  a patch from Peter Weldon
+	  at [ruby-core:32327].
+
+Mon Sep 13 10:12:09 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* util.c (ruby_strtod): reject Float('0x0.').
+	  [ruby-dev:42239] Bug #3820
+
+Mon Sep 13 09:23:58 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_bn.c (ossl_bn_is_prime): fix comparison
+	  with rb_scan_args. Before this fix, OpenSSL::BN#prime?
+	  is fully broken. [ruby-dev:42225]
+
+Mon Sep 13 06:45:24 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_writable_real_p):
+	  Pathname#writable_real? translated from pathname.rb.
+
+Sun Sep 12 21:21:50 2010  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb: [ruby-core:32096]  Thanks Colin Bartlett.
+
+Sun Sep 12 19:30:27 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_world_writable_p):
+	  Pathname#world_writable? translated from pathname.rb.
+
+Sun Sep 12 09:16:06 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_writable_p): Pathname#writable?
+	  translated from pathname.rb.
+
+Sun Sep 12 08:36:15 2010  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (rlimit_resource_name2int): support more limits:
+	  RLIMIT_MSGQUEUE, RLIMIT_NICE, RLIMIT_RTPRIO, RLIMIT_RTTIME and
+	  RLIMIT_SIGPENDING.
+	  (Init_process): ditto.
+	  patch by Run Paint Run Run.  [ruby-core:32262]
+
+Sun Sep 12 04:27:13 2010  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (rlimit_resource_name2int): use STRCASECMP to avoid
+	  ALLOCA_N.
+
+Sat Sep 11 16:47:41 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (ruby_setenv): raise if putenv and SetEnvironmentVariable
+	  failed, because of the restriction of the size on Windows.
+	  based on a patch from Peter Weldon at [ruby-core:32304].  fix:
+	  Bug#3812, [ruby-core:32250]
+
+Sat Sep 11 15:19:57 2010  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/webrick/httpauth/digestauth.rb (WEBrick::Config::DigestAuth):
+	  Add documentation
+
+	* lib/webrick/config.rb (WEBrick::Config::DigestAuth): Add
+	  documentation
+
+Sat Sep 11 12:32:05 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/intern.h (rb_set_kcode, rb_get_kcode): removed
+	  zombie prototype declarations.  a patch from Eric Hodel
+	  at [ruby-core:32305].
+
+Sat Sep 11 06:53:12 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_symlink_p): Pathname#symlink?
+	  translated from pathname.rb.
+
+Fri Sep 10 23:03:43 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_sticky_p): Pathname#sticky? translated
+	  from pathname.rb.
+
+Fri Sep 10 19:11:13 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#continue): add
+	  method for generating HTTP/1.1 100 continue response if the client
+	  expects it, otherwise does nothing.  Patch by Brian Candler.
+	  ref #855.
+
+	* test/webrick/test_httprequest.rb: test added.
+
+Fri Sep 10 17:49:34 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/x509-internal.rb: removed unused local
+	  variable.
+
+	* test/openssl/*: less warnings while test running with -w.
+
+Fri Sep 10 16:49:20 2010  Akinori MUSHA  <knu@iDaemons.org>
+
+	* class.c (rb_scan_args): Add support for optional keyword
+	  argument hash. [ruby-dev:42221] [ruby-dev:38048]
+
+	* README.EXT, README.EXT.ja: Update documentation accordingly.
+
+	* dir.c (dir_initialize): Make use of the new rb_scan_args()
+	  feature.
+
+	* io.c (rb_io_s_popen, rb_scan_open_args, rb_io_initialize)
+	  (rb_io_s_pipe, open_key_args, io_s_foreach, io_s_readlines)
+	  (rb_io_s_read, rb_io_set_encoding): Ditto.
+
+	* transcode.c (str_transcode, econv_args)
+	  (econv_primitive_convert): Ditto.
+
+	* ext/zlib/zlib.c (rb_gzreader_initialize): Ditto.
+
+Fri Sep 10 10:33:18 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* random.c (rb_genrand_ulong_limited): renamed from
+	  rb_rand_internal and now this is public API.
+
+	* include/ruby/ruby.h (rb_genrand_ulong_limited): added.
+
+	* bignum.c (big_sparse_p): use rb_genrand_ulong_limited.
+
+Fri Sep 10 13:07:22 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* ext/digest/lib/digest.rb: removed unused exception variable
+	  assignment to avoid a warning.
+
+Fri Sep 10 07:29:14 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/etc/etc.c (etc_systmpdir): assume system default tmpdir
+	  safe.  [ruby-dev:42089]
+
+Fri Sep 10 07:03:23 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_size_p): Pathname#size? translated from
+	  pathname.rb.
+
+Fri Sep 10 02:15:29 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/option.c (inspect_peercred): support OpenBSD-current.
+	  patch by Jeremy Evans.  [ruby-core:32240]
+
+Thu Sep  9 23:25:53 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (vm_backtrace_each): skip allocator frames which have no
+	  name.  [ruby-core:32231]
+
+Thu Sep  9 22:39:08 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_size): Pathname#size translated from
+	  pathname.rb.
+
+Thu Sep  9 22:34:48 2010  wanabe  <s.wanabe@gmail.com>
+
+	* compile.c (case_when_optimizable_literal): When float value can be
+	  treated as integer, add to table hash of case that way.
+	  based on a patch from Ikuo KOBORI. [ruby-dev:42038]
+
+	* insns.def (opt_case_dispatch): ditto.
+
+	* test/ruby/test_case.rb: add tests.
+
+Thu Sep  9 17:15:15 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/net/http/test_https.rb (test_identity_verify_failure): follows
+	  the SSL hostname check error message of openssl.
+
+Thu Sep  9 10:44:46 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* test/ruby/test_env.rb (test_aset): OpenBSD acts like NetBSD in
+	  that it ignores characters after = in ENV.
+	  patched by Jeremy Evans [ruby-core:32184]
+
+Thu Sep  9 09:02:01 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/rbinstall.rb (install?): gemspec filename should include
+	  its version. patched by Luis Lavena [ruby-core:32165]
+
+Wed Sep  8 22:46:31 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ssl_get_error): Thread context switch was
+	  blocked on Windows while blocking call for SSLSocket.  Need to
+	  convert errno for letting rb_io_wait_readable detect EWOULDBLOCK.
+	  Patch by arton. ref #3794.
+
+Wed Sep  8 20:56:57 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_setgid_p): Pathname#setgid? translated
+	  from pathname.rb.
+
+Wed Sep  8 06:25:41 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_setuid_p): Pathname#setuid? translated
+	  from pathname.rb.
+
+Tue Sep  7 21:03:35 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_readable_real_p):
+	  Pathname#readable_real?  translated from pathname.rb.
+
+Mon Sep  6 23:07:25 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_world_readable_p):
+	  Pathname#world_readable?  translated from pathname.rb.
+
+Mon Sep  6 11:03:13 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* Fixed wrong check of missing functions. Patch by Adrian Quark.
+	  ref #3400
+	  The patch contains following comment:
+	    This patch should avoid unnecessary incompatibility with future
+	    versions of Openssl.  Changes suggested by bmaher_at_amazon.com.
+
+Mon Sep  6 10:46:55 2010  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* Fixed exception message for SSL post connection check failure. Patch
+	  by Paul Betteridge. ref [Bug #3704]
+
+Mon Sep  6 10:31:59 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/readline/readline.c (readline_s_get_line_buffer):
+	  Readline.line_buffer should return locale string.
+	  [ruby-dev:42184] #3791
+
+Mon Sep  6 09:47:24 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* util.c (ruby_strtod): check there is at least 1 digit after
+	  "0x" before ".". [ruby-dev:42183] #3790
+
+Mon Sep  6 09:44:50 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* util.c (ruby_strtod): check integer overflow.
+	  [ruby-dev:42180] #3789
+
+Mon Sep  6 06:17:21 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_readable_p): Pathname#readable?
+	  translated from pathname.rb.
+
+Sun Sep  5 23:02:34 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_owned_p): Pathname#owned?
+	  translated from pathname.rb.
+
+Sat Sep  4 23:48:47 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_s_readlink): symlink target should be in
+	  filesystem encoding.
+
+Sat Sep  4 10:40:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (ruby_init_ext): export for golfers.
+
+	* vm_core.h (rb_iseq_eval, rb_iseq_compile_with_option): ditto.
+
+Sun May 23 17:29:41 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* common.mk (capi): uses a timestamp file to get rid of
+	  generating twice.
+
+Fri Jun 18 01:33:21 2010  Yuki Sonoda (Yugui)  <yugui@yugui.jp>
+
+	* enc/Makefile.in (realclean): has been missing. necessary
+	  for make realclean-enc.
+
+Fri Sep  3 23:51:26 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_socket_p): Pathname#socket?
+	  translated from pathname.rb.
+
+Fri Sep  3 06:40:44 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/pty/pty.c (chfunc): pass through exceptions.
+
+	* io.c (rb_io_bufwrite, rb_io_bufread): added.
+
+	* process.c (rb_fork_err): protect from exceptions.
+
+Fri Sep  3 06:16:07 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_pipe_p): Pathname#pipe?
+	  translated from pathname.rb.
+
+Fri Sep  3 06:14:40 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/pty/pty.c (chfunc): restore errno from SystemCallError and
+	  propagate proper exception to the parent.  [ruby-dev:41965]
+
+Thu Sep  2 22:10:38 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_file_p): Pathname#file?
+	  translated from pathname.rb.
+
+Thu Sep  2 09:12:02 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_spawn, rb_w32_aspawn): don't forget to free
+	  memory.
+
+Thu Sep  2 09:01:13 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (CreateChild): unicodize.
+
+	* win32/win32.c (rb_w32_spawn, rb_w32_aspawn): convert arguments of
+	  CreateChild() from ACP to WideChar.
+
+Thu Sep  2 06:53:43 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_directory_p): Pathname#directory?
+	  translated from pathname.rb.
+
+Wed Sep  1 22:03:41 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_grpowned_p): Pathname#grpowned?
+	  translated from pathname.rb.
+
+Wed Sep  1 17:39:02 2010  Ryan Davis  <ryand-ruby@zenspider.com>
+
+	* lib/minitest/*.rb: Imported minitest 1.7.1 r5835.
+	* test/minitest/*.rb: ditto.
+
+Wed Sep  1 16:50:42 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (tr_setup_table): optimized. don't create hash objects
+	  when given pattern is ASCII only.
+
+	* string.c (tr_find): ditto.
+
+Wed Sep  1 14:35:29 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* array.c (rb_ary_rotate_m): fix typo of rdoc.
+	  patched by Andrei Kulakov [ruby-core:31975]
+
+Wed Sep  1 14:33:36 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enum.c (enum_zip): fix typo of rdoc.
+	  patched by Andrei Kulakov [ruby-core:31974]
+
+Wed Sep  1 12:56:36 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (ruby_suppress_tracing): restore the state and invoke
+	  the func with normal state.  a patch from Satoshi Shiba <shiba
+	  AT rvm.jp> at [ruby-dev:42162].  [ruby-core:31783]
+
+Tue Aug 31 21:10:23 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_exist_p): Pathname#exist? translated
+	  from pathname.rb.
+
+Tue Aug 31 17:32:34 2010  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/stubs.c: fix [Bug #3771] "VC++ can't make ext/tk with enabling
+	  stubs". Thanks, Akio Tajima [ruby-dev:42159].
+
+Tue Aug 31 03:42:14 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (tr_setup_table): fix bug in r29146.
+	  Initialize table even if cflag is 0; tr_find see whether
+	  del is empty or not.
+
+	* string.c (tr_find): nodel can't be NULL; if NULL, it means
+	  it is not specified.
+
+Mon Aug 30 21:29:21 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_executable_real_p):
+	  Pathname#executable_real? translated from pathname.rb.
+
+Mon Aug 30 15:00:13 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (tr_setup_table): initialize negating table when
+	  negating string is given. [ruby-core:31851]
+
+	* string.c (tr_find): add a sentence for the time when
+	  target characters include negating one.
+
+	* string.c (rb_str_count): move definition.
+
+Mon Aug 30 07:32:41 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_executable_p): Pathname#executable?
+	  translated from pathname.rb.
+
+Sun Aug 29 23:54:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/parser/ruby.rb (RDoc#parse_call_parameters): don't
+	  include assignment.  [Bug #3759], [ruby-dev:42154]
+
+	* lib/rdoc/parser/ruby.rb (RDoc#parse_class): ignore non-constant
+	  name singleton class.  [Bug #3759], [ruby-dev:42154]
+
+Sun Aug 29 23:25:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_get_path_check): clarify error message for
+	  ASCII-incompatible path name.
+
+Sun Aug 29 16:02:54 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* common.mk (node_name.inc): remove command option -n and give
+	  file as stdin, because IronRuby 1.1 still doesn't support it.
+	  So now we can use ir.exe as BASERUBY.
+
+	* tool/node_name.rb: read stdin with while gets.
+
+Sun Aug 29 13:22:43 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (rb_thread_method_id_and_class): curried proc has no
+	  method.  [ruby-core:31871]
+
+Sun Aug 29 12:51:33 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_provide_feature): clarify error message for frozen
+	  $LOADED_FEATURES.  based on a patch from Run Paint Run Run at
+	  [ruby-core:31913].
+
+Sun Aug 29 12:19:58 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (load_failed): should honor encoding.  [ruby-core:31915]
+
+Sun Aug 29 09:35:10 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* common.mk (clean): exclude *.inc. [ruby-dev:41931]
+
+	* common.mk (distclean): include *.inc.
+
+	* common.mk (help): change description about clean and distclean.
+
+Sat Aug 29 06:34:52 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_chardev_p): Pathname#chardev?
+	  translated from pathname.rb.
+
+Sat Aug 28 17:39:33 2010  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_save_exception_mode,
+	  BigDecimal_save_rounding_mode, BigDecimal_save_limit): added.
+
+	* test/bigdecimal/test_bigdecimal.rb: added tests for the above
+	  features.
+
+Sat Aug 28 08:11:05 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_blockdev_p): Pathname#blockdev?
+	  translated from pathname.rb.
+
+Fri Aug 27 16:20:01 2010  URABE Shyouhei  <shyouhei@ruby-lang.org>
+
+	* string.c (rb_str_prepend): new method by Shota Fukumori (sora_h)
+	  [Feature #3765]
+
+Fri Aug 27 15:24:20 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* math.c (math_atan2): you should know that M_PI is not the feature
+	  of C90.
+	  fixed build failure caused by r29115.
+
+Fri Aug 27 15:26:33 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (null_device): move from io.c.
+
+Fri Aug 27 12:47:44 2010  Kenta Murata  <mrkn@mrkn.jp>
+
+	* math.c (math_atan2): change the behavior when x and y are zero.
+	  [ruby-dev:42090] [Bug #3736] [ruby-dev:42116]
+
+	* test/ruby/test_math.rb (test_atan2): add tests for the above
+	  changes.
+
+Fri Aug 27 12:26:23 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* object.c (rb_obj_class): remove mention of obsolete method.
+	  a patch from Run Paint Run Run at [ruby-core:31842].
+
+Fri Aug 27 12:25:03 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (null_device): the name of null device.  [ruby-dev:41791]
+
+Fri Aug 27 07:57:34 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_shuffle_bang): bail out from modification during
+	  shuffle.
+
+	* array.c (rb_ary_sample): ditto.
+
+Fri Aug 27 05:11:51 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_sysopen): Pathname#sysopen translated
+	  from pathname.rb.
+
+Thu Aug 26 22:53:56 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_shuffle): rdoc fix.  argument name was missing.
+	  a patch from Run Paint Run Run at [ruby-core:31848].
+
+Thu Aug 26 21:49:46 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_readlines): Pathname#readlines
+	  translated from pathname.rb.
+
+Thu Aug 26 10:37:00 2010  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regint.h (OnigStackIndex): the type should be intptr_t.
+	  Original Oniguruma assumes the size of long and that of void *
+	  are equal, but it's not true on LLP64 platform: mswin64.
+	  originally patched by shintaro kuwamoto [ruby-dev:42133]
+
+Thu Aug 26 10:38:11 2010  Yutaka Kanemoto  <kanemoto@ruby-lang.org>
+
+	* test/dl/test_base.rb: AIX does not have dynamically loadable lib[cm].
+
+	* test/fiddle/helper.rb: AIX does not have dynamically loadable lib[cm].
+
+Thu Aug 26 09:49:50 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_shuffle_bang): check number of argument.
+
+Tue Aug 26 09:11:40 2010  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+	  rmpd_set_thread_local_exception_mode, VpGetException,
+	  VpSetException): thread-local exception mode.
+
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+	  rmpd_set_thread_local_precision_limit, VpGetPrecLimit,
+	  VpSetPrecLimit): thread-local precision limit.
+
+	* ext/bigdecimal/bigdecimal.c (Init_bigdecimal,
+	  rmpd_set_thread_local_rounding_mode, VpGetRoundMode,
+	  VpSetRoundMode, VpException, VpInternalRound):
+	  thread-local rounding mode.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_mode, BigDecimal_round,
+	  VpIsRoundMode, VpGetRoundMode, VpSetRoundMode, VpActiveRound,
+	  VpMidRound, VpLeftRound), ext/bigdecimal/bigdecimal.h:
+	  use unsigned short for rounding mode.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_mode): add test for
+	  setting rounding mode.
+
+	* test/bigdecimal/test_bigdecimal.rb (test_thread_local_mode):
+	  add test for setting mode thread-locally.
+
+Thu Aug 26 07:29:54 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_{shuffle_bang,sample}): use Random class object.
+
+	* random.c (try_get_rnd): use default_rand for Random as same as
 	  singleton methods.
 
-Fri Aug 15 19:40:43 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	* random.c (rb_random_real): check the range of result.
+
+Wed Aug 25 22:11:11 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_binread): Pathname#binread translated
+	  from pathname.rb.
+
+Wed Aug 25 03:42:43 2010  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/dl/cfunc.c (rb_dlcfunc_call): workaround for VC9 for x64.
+	  reported by kuwamoto shintaro in [ruby-dev:42125].
+
+Tue Aug 24 23:28:50 2010  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* .gitignore: updated.
+
+Tue Aug 24 22:07:28 2010  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/pathname.c (path_read): Pathname#read translated from
+	  pathname.rb.
+
+Tue Aug 24 10:11:04 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: read API version from include/ruby/version.h.
+
+	* {bcc,win}32/setup.mak (-version-): ditto.
+
+	* version.h (RUBY_LIB_VERSION): use API version numbers.
+
+Tue Aug 24 07:07:28 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_shuffle_bang, rb_ary_sample): add optional
+	  argument random.  [ruby-dev:41923] [EXPERIMENTAL]
+
+	* random.c (rb_random_{int32,real,bytes}): fallback to normal
+	  method invocation.
+
+Tue Aug 24 06:08:10 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/version.h (RUBY_API_VERSION_*): renamed and moved
+	  from version.h.  [ruby-dev:42103]
 
-	* ext/socket/socket.c (Init_socket): small typo caused SEGV.
+Tue Aug 24 05:58:18 2010  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 13 17:51:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
+	* ChangeLog: flushed.  [ruby-dev:42050]
 
-	* version 1.1 alpha0 released.
+For the changes before 1.9.3, see doc/ChangeLog-1.9.3
+For the changes before 1.8.0, see doc/ChangeLog-1.8.0
 
+Local variables:
+coding: us-ascii
+add-log-time-format: (lambda ()
+  (let* ((time (current-time))
+	 (system-time-locale "C")
+	 (diff (+ (cadr time) 32400))
+	 (lo (% diff 65536))
+	 (hi (+ (car time) (/ diff 65536))))
+  (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
+indent-tabs-mode: t
+tab-width: 8
+change-log-indent-text: 2
+end:
+vim: tabstop=8 shiftwidth=2
diff --git a/GPL b/GPL
new file mode 100644
index 0000000000..5b6e7c66c2
--- /dev/null
+++ b/GPL
@@ -0,0 +1,340 @@
+		    GNU GENERAL PUBLIC LICENSE
+		       Version 2, June 1991
+
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.
+                       59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+			    Preamble
+
+  The licenses for most software are designed to take away your
+freedom to share and change it.  By contrast, the GNU General Public
+License is intended to guarantee your freedom to share and change free
+software--to make sure the software is free for all its users.  This
+General Public License applies to most of the Free Software
+Foundation's software and to any other program whose authors commit to
+using it.  (Some other Free Software Foundation software is covered by
+the GNU Library General Public License instead.)  You can apply it to
+your programs, too.
+
+  When we speak of free software, we are referring to freedom, not
+price.  Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+this service if you wish), that you receive source code or can get it
+if you want it, that you can change the software or use pieces of it
+in new free programs; and that you know you can do these things.
+
+  To protect your rights, we need to make restrictions that forbid
+anyone to deny you these rights or to ask you to surrender the rights.
+These restrictions translate to certain responsibilities for you if you
+distribute copies of the software, or if you modify it.
+
+  For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must give the recipients all the rights that
+you have.  You must make sure that they, too, receive or can get the
+source code.  And you must show them these terms so they know their
+rights.
+
+  We protect your rights with two steps: (1) copyright the software, and
+(2) offer you this license which gives you legal permission to copy,
+distribute and/or modify the software.
+
+  Also, for each author's protection and ours, we want to make certain
+that everyone understands that there is no warranty for this free
+software.  If the software is modified by someone else and passed on, we
+want its recipients to know that what they have is not the original, so
+that any problems introduced by others will not reflect on the original
+authors' reputations.
+
+  Finally, any free program is threatened constantly by software
+patents.  We wish to avoid the danger that redistributors of a free
+program will individually obtain patent licenses, in effect making the
+program proprietary.  To prevent this, we have made it clear that any
+patent must be licensed for everyone's free use or not licensed at all.
+
+  The precise terms and conditions for copying, distribution and
+modification follow.
+
+		    GNU GENERAL PUBLIC LICENSE
+   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+  0. This License applies to any program or other work which contains
+a notice placed by the copyright holder saying it may be distributed
+under the terms of this General Public License.  The "Program", below,
+refers to any such program or work, and a "work based on the Program"
+means either the Program or any derivative work under copyright law:
+that is to say, a work containing the Program or a portion of it,
+either verbatim or with modifications and/or translated into another
+language.  (Hereinafter, translation is included without limitation in
+the term "modification".)  Each licensee is addressed as "you".
+
+Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope.  The act of
+running the Program is not restricted, and the output from the Program
+is covered only if its contents constitute a work based on the
+Program (independent of having been made by running the Program).
+Whether that is true depends on what the Program does.
+
+  1. You may copy and distribute verbatim copies of the Program's
+source code as you receive it, in any medium, provided that you
+conspicuously and appropriately publish on each copy an appropriate
+copyright notice and disclaimer of warranty; keep intact all the
+notices that refer to this License and to the absence of any warranty;
+and give any other recipients of the Program a copy of this License
+along with the Program.
+
+You may charge a fee for the physical act of transferring a copy, and
+you may at your option offer warranty protection in exchange for a fee.
+
+  2. You may modify your copy or copies of the Program or any portion
+of it, thus forming a work based on the Program, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+    a) You must cause the modified files to carry prominent notices
+    stating that you changed the files and the date of any change.
+
+    b) You must cause any work that you distribute or publish, that in
+    whole or in part contains or is derived from the Program or any
+    part thereof, to be licensed as a whole at no charge to all third
+    parties under the terms of this License.
+
+    c) If the modified program normally reads commands interactively
+    when run, you must cause it, when started running for such
+    interactive use in the most ordinary way, to print or display an
+    announcement including an appropriate copyright notice and a
+    notice that there is no warranty (or else, saying that you provide
+    a warranty) and that users may redistribute the program under
+    these conditions, and telling the user how to view a copy of this
+    License.  (Exception: if the Program itself is interactive but
+    does not normally print such an announcement, your work based on
+    the Program is not required to print an announcement.)
+
+These requirements apply to the modified work as a whole.  If
+identifiable sections of that work are not derived from the Program,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works.  But when you
+distribute the same sections as part of a whole which is a work based
+on the Program, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Program.
+
+In addition, mere aggregation of another work not based on the Program
+with the Program (or with a work based on the Program) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+  3. You may copy and distribute the Program (or a work based on it,
+under Section 2) in object code or executable form under the terms of
+Sections 1 and 2 above provided that you also do one of the following:
+
+    a) Accompany it with the complete corresponding machine-readable
+    source code, which must be distributed under the terms of Sections
+    1 and 2 above on a medium customarily used for software interchange; or,
+
+    b) Accompany it with a written offer, valid for at least three
+    years, to give any third party, for a charge no more than your
+    cost of physically performing source distribution, a complete
+    machine-readable copy of the corresponding source code, to be
+    distributed under the terms of Sections 1 and 2 above on a medium
+    customarily used for software interchange; or,
+
+    c) Accompany it with the information you received as to the offer
+    to distribute corresponding source code.  (This alternative is
+    allowed only for noncommercial distribution and only if you
+    received the program in object code or executable form with such
+    an offer, in accord with Subsection b above.)
+
+The source code for a work means the preferred form of the work for
+making modifications to it.  For an executable work, complete source
+code means all the source code for all modules it contains, plus any
+associated interface definition files, plus the scripts used to
+control compilation and installation of the executable.  However, as a
+special exception, the source code distributed need not include
+anything that is normally distributed (in either source or binary
+form) with the major components (compiler, kernel, and so on) of the
+operating system on which the executable runs, unless that component
+itself accompanies the executable.
+
+If distribution of executable or object code is made by offering
+access to copy from a designated place, then offering equivalent
+access to copy the source code from the same place counts as
+distribution of the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+  4. You may not copy, modify, sublicense, or distribute the Program
+except as expressly provided under this License.  Any attempt
+otherwise to copy, modify, sublicense or distribute the Program is
+void, and will automatically terminate your rights under this License.
+However, parties who have received copies, or rights, from you under
+this License will not have their licenses terminated so long as such
+parties remain in full compliance.
+
+  5. You are not required to accept this License, since you have not
+signed it.  However, nothing else grants you permission to modify or
+distribute the Program or its derivative works.  These actions are
+prohibited by law if you do not accept this License.  Therefore, by
+modifying or distributing the Program (or any work based on the
+Program), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Program or works based on it.
+
+  6. Each time you redistribute the Program (or any work based on the
+Program), the recipient automatically receives a license from the
+original licensor to copy, distribute or modify the Program subject to
+these terms and conditions.  You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties to
+this License.
+
+  7. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License.  If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Program at all.  For example, if a patent
+license would not permit royalty-free redistribution of the Program by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Program.
+
+If any portion of this section is held invalid or unenforceable under
+any particular circumstance, the balance of the section is intended to
+apply and the section as a whole is intended to apply in other
+circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system, which is
+implemented by public license practices.  Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+  8. If the distribution and/or use of the Program is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Program under this License
+may add an explicit geographical distribution limitation excluding
+those countries, so that distribution is permitted only in or among
+countries not thus excluded.  In such case, this License incorporates
+the limitation as if written in the body of this License.
+
+  9. The Free Software Foundation may publish revised and/or new versions
+of the General Public License from time to time.  Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+Each version is given a distinguishing version number.  If the Program
+specifies a version number of this License which applies to it and "any
+later version", you have the option of following the terms and conditions
+either of that version or of any later version published by the Free
+Software Foundation.  If the Program does not specify a version number of
+this License, you may choose any version ever published by the Free Software
+Foundation.
+
+  10. If you wish to incorporate parts of the Program into other free
+programs whose distribution conditions are different, write to the author
+to ask for permission.  For software which is copyrighted by the Free
+Software Foundation, write to the Free Software Foundation; we sometimes
+make exceptions for this.  Our decision will be guided by the two goals
+of preserving the free status of all derivatives of our free software and
+of promoting the sharing and reuse of software generally.
+
+			    NO WARRANTY
+
+  11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
+FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
+OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
+PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
+OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE RISK AS
+TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.  SHOULD THE
+PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
+REPAIR OR CORRECTION.
+
+  12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
+REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
+OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
+TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
+YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+		     END OF TERMS AND CONDITIONS
+
+	    How to Apply These Terms to Your New Programs
+
+  If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+  To do so, attach the following notices to the program.  It is safest
+to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+    <one line to give the program's name and a brief idea of what it does.>
+    Copyright (C) <year>  <name of author>
+
+    This program is free software; you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 2 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+
+
+Also add information on how to contact you by electronic and paper mail.
+
+If the program is interactive, make it output a short notice like this
+when it starts in an interactive mode:
+
+    Gnomovision version 69, Copyright (C) year name of author
+    Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+    This is free software, and you are welcome to redistribute it
+    under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License.  Of course, the commands you use may
+be called something other than `show w' and `show c'; they could even be
+mouse-clicks or menu items--whatever suits your program.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the program, if
+necessary.  Here is a sample; alter the names:
+
+  Yoyodyne, Inc., hereby disclaims all copyright interest in the program
+  `Gnomovision' (which makes passes at compilers) written by James Hacker.
+
+  <signature of Ty Coon>, 1 April 1989
+  Ty Coon, President of Vice
+
+This General Public License does not permit incorporating your program into
+proprietary programs.  If your program is a subroutine library, you may
+consider it more useful to permit linking proprietary applications with the
+library.  If this is what you want to do, use the GNU Library General
+Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..b97a08d928
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,5 @@
+#
+# This test file concludes tests which point out known bugs.
+# So all tests will cause failure.
+#
+
diff --git a/LEGAL b/LEGAL
new file mode 100644
index 0000000000..65706459cd
--- /dev/null
+++ b/LEGAL
@@ -0,0 +1,533 @@
+LEGAL NOTICE INFORMATION
+------------------------
+
+All the files in this distribution are covered under either the Ruby's
+license (see the file COPYING) or public-domain except some files
+mentioned below.
+
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+
+http://www.geocities.jp/kosako3/oniguruma/
+http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
+http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
+
+   When this software is partly used or it is distributed with Ruby, 
+   this of Ruby follows the license of Ruby.
+
+configure:
+
+  This file is free software.
+
+    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+
+    This configure script is free software; the Free Software Foundation
+    gives unlimited permission to copy, distribute and modify it.
+
+tool/config.guess:
+tool/config.sub:
+
+  As long as you distribute these files with the file configure, they
+  are covered under the Ruby's license.
+
+      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
+      Free Software Foundation, Inc.
+
+    This file is free software; you can redistribute it and/or modify it
+    under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 2 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful, but
+    WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+    General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+
+    As a special exception to the GNU General Public License, if you
+    distribute this file as part of a program that contains a
+    configuration script generated by Autoconf, you may include it under
+    the same distribution terms that you use for the rest of that program.
+
+parse.c:
+
+  This file is licensed under the GPL, but is incorporated into Ruby and 
+  redistributed under the terms of the Ruby license, as permitted by the
+  exception to the GPL below.
+
+     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+     Free Software Foundation, Inc.
+
+     This program is free software; you can redistribute it and/or modify
+     it under the terms of the GNU General Public License as published by
+     the Free Software Foundation; either version 2, or (at your option)
+     any later version.
+
+     This program is distributed in the hope that it will be useful,
+     but WITHOUT ANY WARRANTY; without even the implied warranty of
+     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+     GNU General Public License for more details.
+
+     You should have received a copy of the GNU General Public License
+     along with this program; if not, write to the Free Software
+     Foundation, Inc., 51 Franklin Street, Fifth Floor,
+     Boston, MA 02110-1301, USA.  */
+
+  /* As a special exception, you may create a larger work that contains
+     part or all of the Bison parser skeleton and distribute that work
+     under terms of your choice, so long as that work isn't itself a
+     parser generator using the skeleton or a modified version thereof
+     as a parser skeleton.  Alternatively, if you modify or redistribute
+     the parser skeleton itself, you may (at your option) remove this
+     special exception, which will cause the skeleton and the resulting
+     Bison output files to be licensed under the GNU General Public
+     License without this special exception.
+
+     This special exception was added by the Free Software Foundation in
+     version 2.2 of Bison.  */
+
+util.c (partly):
+
+    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose without fee is hereby granted, provided that this entire notice
+    is included in all copies of any software which is or includes a copy
+    or modification of this software and in all copies of the supporting
+    documentation for such software.
+
+    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
+win32/win32.[ch]:
+
+  You can apply the Artistic License to these files. (or GPL,
+  alternatively)
+
+    Copyright (c) 1993, Intergraph Corporation
+
+    You may distribute under the terms of either the GNU General Public
+    License or the Artistic License, as specified in the perl README file.
+
+util.c (partly):
+
+   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+
+   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+   SUCH DAMAGE.
+
+random.c
+
+  This file is under the new-style BSD license.
+
+    A C-program for MT19937, with initialization improved 2002/2/10.
+    Coded by Takuji Nishimura and Makoto Matsumoto.
+    This is a faster version by taking Shawn Cokus's optimization,
+    Matthe Bellew's simplification, Isaku Wada's real version.
+
+    Before using, initialize the state by using init_genrand(seed) 
+    or init_by_array(init_key, key_length).
+
+    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
+    All rights reserved.                          
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+
+      1. Redistributions of source code must retain the above copyright
+	 notice, this list of conditions and the following disclaimer.
+
+      2. Redistributions in binary form must reproduce the above copyright
+	 notice, this list of conditions and the following disclaimer in the
+	 documentation and/or other materials provided with the distribution.
+
+      3. The names of its contributors may not be used to endorse or promote 
+	 products derived from this software without specific prior written 
+	 permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
+    "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+    LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+    A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL THE COPYRIGHT OWNER OR
+    CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+    PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF
+    LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
+    NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
+    SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+
+    Any feedback is very welcome.
+    http://www.math.keio.ac.jp/matumoto/emt.html
+    email: matumoto@math.keio.ac.jp
+
+vsnprintf.c:
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright (c) 1990, 1993
+         The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    IMPORTANT NOTE:
+    --------------
+    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+    paragraph 3 above is now null and void.
+
+st.[ch]:
+missing/alloca.c:
+missing/dup2.c:
+missing/erf.c:
+missing/finite.c:
+missing/hypot.c:
+missing/isinf.c:
+missing/isnan.c:
+missing/lgamma_r.c:
+missing/memcmp.c:
+missing/memmove.c:
+missing/strchr.c:
+missing/strstr.c:
+missing/strtol.c:
+missing/tgamma.c:
+ext/digest/sha1/sha1.[ch]:
+
+  These files are all under public domain.
+
+missing/crypt.c:
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright (c) 1989, 1993
+    	The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Tom Truscott.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+missing/setproctitle.c
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright 2003 Damien Miller
+    Copyright (c) 1983, 1995-1997 Eric P. Allman
+    Copyright (c) 1988, 1993
+    	The Regents of the University of California.  All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+missing/strlcat.c
+missing/strlcpy.c
+
+  These files are under the new-style BSD license.
+
+   Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+   3. The name of the author may not be used to endorse or promote products
+      derived from this software without specific prior written permission.
+
+   THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
+   INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
+   AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
+   THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+   EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+   PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
+   OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+   WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
+   OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
+   ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+missing/langinfo.c
+
+  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+  Ruby uses a modified version. The file contains the following
+  author/copyright notice:
+
+  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+  Permission to use, copy, modify, and distribute this software
+  for any purpose and without fee is hereby granted. The author
+  disclaims all warranties with regard to this software.
+
+ext/digest/md5/md5.[ch]:
+
+  These files are under the following license.  Ruby uses modified
+  versions of them.
+
+    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
+
+    This software is provided 'as-is', without any express or implied
+    warranty.  In no event will the authors be held liable for any damages
+    arising from the use of this software.
+
+    Permission is granted to anyone to use this software for any purpose,
+    including commercial applications, and to alter it and redistribute it
+    freely, subject to the following restrictions:
+
+    1. The origin of this software must not be misrepresented; you must not
+       claim that you wrote the original software. If you use this software
+       in a product, an acknowledgment in the product documentation would be
+       appreciated but is not required.
+    2. Altered source versions must be plainly marked as such, and must not be
+       misrepresented as being the original software.
+    3. This notice may not be removed or altered from any source distribution.
+
+    L. Peter Deutsch
+    ghost@aladdin.com
+
+ext/digest/rmd160/rmd160.[ch]:
+
+  These files have the following copyright information, and by the
+  author we are allowed to use it under the new-style BSD license.
+
+    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
+              (Arranged for libc by Todd C. Miller)
+    DATE:     1 March 1996
+
+    Copyright (c) Katholieke Universiteit Leuven
+    1996, All Rights Reserved
+
+ext/digest/sha2/sha2.[ch]:
+
+  These files are under the new-style BSD license.
+
+    Copyright 2000 Aaron D. Gifford.  All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the copyright holder nor the names of contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR(S) AND CONTRIBUTOR(S) ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR(S) OR CONTRIBUTOR(S) BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+ext/nkf/nkf-utf8/config.h:
+ext/nkf/nkf-utf8/nkf.c:
+ext/nkf/nkf-utf8/utf8tbl.c:
+
+  These files are under the following license.  So to speak, it is
+  copyrighted semi-public-domain software.
+
+    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
+       Everyone is permitted to do anything on this program 
+       including copying, modifying, improving,
+       as long as you don't try to pretend that you wrote it.
+       i.e., the above copyright notice has to appear in all copies.
+       Binary distribution requires original version messages.
+       You don't have to ask before copying, redistribution or publishing.
+       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+ext/socket/addrinfo.h:
+ext/socket/getaddrinfo.c:
+ext/socket/getnameinfo.c:
+
+  These files are under the new-style BSD license.
+
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the project nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+ext/win32ole/win32ole.c:
+
+  You can apply the Artistic License to this file. (or GPL,
+  alternatively)
+
+    (c) 1995 Microsoft Corporation. All rights reserved.
+    Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
+
+    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+    <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
+ 
+    You may distribute under the terms of either the GNU General Public
+    License or the Artistic License, as specified in the README file
+    of the Perl distribution.
diff --git a/MANIFEST b/MANIFEST
deleted file mode 100644
index e9a2bfca0f..0000000000
--- a/MANIFEST
+++ /dev/null
@@ -1,232 +0,0 @@
-COPYING
-COPYING.LIB
-ChangeLog
-MANIFEST
-Makefile.in
-README
-README.jp
-README.EXT
-README.EXT.jp
-ToDo
-array.c
-bignum.c
-class.c
-compar.c
-configure
-configure.bat
-configure.in
-config_h.dj
-config_s.dj
-config.guess
-config.sub
-defines.h
-dir.c
-dln.c
-dln.h
-dmyext.c
-enum.c
-env.h
-error.c
-eval.c
-file.c
-gc.c
-hash.c
-inits.c
-install-sh
-instruby.rb
-intern.h
-io.c
-keywords
-lex.c
-main.c
-marshal.c
-math.c
-mkconfig.rb
-node.h
-numeric.c
-object.c
-pack.c
-parse.c
-parse.y
-prec.c
-process.c
-random.c
-range.c
-re.c
-re.h
-regex.c
-regex.h
-ruby.1
-ruby.c
-ruby.h
-rubyio.h
-rubysig.h
-rubytest.rb
-signal.c
-sprintf.c
-st.c
-st.h
-string.c
-struct.c
-time.c
-top.sed
-util.h
-util.c
-variable.c
-version.c
-version.h
-beos/ruby.def.in
-cygwin/GNUmakefile.in
-ext/Setup
-ext/Setup.dj
-ext/Setup.emx
-ext/Setup.nt
-ext/Setup.x68
-ext/aix_mksym.rb
-ext/cygwin32_ld.rb
-ext/extmk.rb.in
-ext/extmk.rb.nt
-lib/CGI.rb
-lib/English.rb
-lib/Env.rb
-lib/README
-lib/base64.rb
-lib/cgi-lib.rb
-lib/complex.rb
-lib/date.rb
-lib/date2.rb
-lib/debug.rb
-lib/delegate.rb
-lib/e2mmap.rb
-lib/eregex.rb
-lib/find.rb
-lib/final.rb
-lib/finalize.rb
-lib/ftplib.rb
-lib/ftools.rb
-lib/getopts.rb
-lib/getoptlong.rb
-lib/importenv.rb
-lib/jcode.rb
-lib/mailread.rb
-lib/mathn.rb
-lib/matrix.rb
-lib/mkmf.rb
-lib/monitor.rb
-lib/mutex_m.rb
-lib/observer.rb
-lib/open3.rb
-lib/ostruct.rb
-lib/parsearg.rb
-lib/parsedate.rb
-lib/ping.rb
-lib/profile.rb
-lib/pstore.rb
-lib/rational.rb
-lib/readbytes.rb
-lib/shellwords.rb
-lib/singleton.rb
-lib/sync.rb
-lib/telnet.rb
-lib/tempfile.rb
-lib/thread.rb
-lib/thwait.rb
-lib/timeout.rb
-lib/tracer.rb
-lib/weakref.rb
-misc/README
-misc/inf-ruby.el
-misc/ruby-mode.el
-misc/rubydb2x.el
-misc/rubydb3x.el
-missing/alloca.c
-missing/crypt.c
-missing/dir.h
-missing/dup2.c
-missing/file.h
-missing/finite.c
-missing/flock.c
-missing/fnmatch.c
-missing/fnmatch.h
-missing/isinf.c
-missing/isnan.c
-missing/memcmp.c
-missing/memmove.c
-missing/mkdir.c
-missing/os2.c
-missing/strcasecmp.c
-missing/strncasecmp.c
-missing/strchr.c
-missing/strdup.c
-missing/strerror.c
-missing/strftime.c
-missing/strstr.c
-missing/strtod.c
-missing/strtol.c
-missing/strtoul.c
-missing/vsnprintf.c
-missing/x68.c
-sample/README
-sample/biorhythm.rb
-sample/cal.rb
-sample/cbreak.rb
-sample/clnt.rb
-sample/dbmtest.rb
-sample/dir.rb
-sample/dualstack-fetch.rb
-sample/dualstack-httpd.rb
-sample/eval.rb
-sample/export.rb
-sample/exyacc.rb
-sample/fact.rb
-sample/fib.awk
-sample/fib.pl
-sample/fib.py
-sample/fib.rb
-sample/fib.scm
-sample/freq.rb
-sample/from.rb
-sample/fullpath.rb
-sample/getopts.test
-sample/goodfriday.rb
-sample/less.rb
-sample/list.rb
-sample/list2.rb
-sample/list3.rb
-sample/mine.rb
-sample/mkproto.rb
-sample/mpart.rb
-sample/mrshtest.rb
-sample/observ.rb
-sample/occur.pl
-sample/occur.rb
-sample/occur2.rb
-sample/philos.rb
-sample/pi.rb
-sample/rename.rb
-sample/rbc.rb
-sample/rcs.awk
-sample/rcs.dat
-sample/rcs.rb
-sample/rd2html.rb
-sample/regx.rb
-sample/sieve.rb
-sample/svr.rb
-sample/test.rb
-sample/time.rb
-sample/trojan.rb
-sample/tsvr.rb
-sample/uumerge.rb
-win32/Makefile
-win32/config.h
-win32/config.status
-win32/ntsetup.bat
-win32/ruby.def
-win32/sdbm.c
-win32/sdbm.h
-win32/win32.c
-win32/win32.h
-x68/fconvert.c
-x68/select.c
-x68/_dtos18.c
-x68/_round.c
diff --git a/Makefile.in b/Makefile.in
index 6fbd9fcf5c..df521cae94 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,30 +1,97 @@
 SHELL = /bin/sh
+NULLCMD = @NULLCMD@
+RUNCMD = $(SHELL)
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
 
 #### Start of system configuration section. ####
 
 srcdir = @srcdir@
-VPATH = @srcdir@:@srcdir@/missing
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
 
 CC = @CC@
-YACC = @YACC@
+CPP = @CPP@
+YACC = bison
 PURIFY =
 AUTOCONF = autoconf
 @SET_MAKE@
+MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+DOXYGEN = @DOXYGEN@
 
 prefix = @prefix@
-CFLAGS = @CFLAGS@ -I. -I@srcdir@ -I@includedir@
+exec_prefix = @exec_prefix@
+bindir = @bindir@
+sbindir = @sbindir@
+libdir = @libdir@
+libexecdir = @libexecdir@
+datarootdir = @datarootdir@
+datadir = @datadir@
+arch = @arch@
+sitearch = @sitearch@
+sitedir = @sitedir@
+ruby_version = @ruby_version@
+
+TESTUI = console
+TESTS =
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
+
+EXTOUT = @EXTOUT@
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/enc:$(srcdir)/missing
+
+empty =
+OUTFLAG = @OUTFLAG@$(empty)
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS = @CFLAGS@ $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@
+INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
 LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-XLDFLAGS = @XLDFLAGS@
+EXTLDFLAGS = 
+XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
 EXTLIBS = 
 LIBS = @LIBS@ $(EXTLIBS)
 MISSING = @LIBOBJS@ @ALLOCA@
 LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) $(ARCH_FLAG)
 SOLIBS = @SOLIBS@
-
+MAINLIBS = @MAINLIBS@
+ARCHMINIOBJS = @MINIOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
 RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-binsuffix = @binsuffix@
-PROGRAM=$(RUBY_INSTALL_NAME)$(binsuffix)
+RUBY_SO_NAME=@RUBY_SO_NAME@
+EXEEXT = @EXEEXT@
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+RUBY = $(RUBY_INSTALL_NAME)
+MINIRUBY = @MINIRUBY@\
+	$(MINIRUBYOPT)
+RUNRUBY = @RUNRUBY@ $(RUNRUBYOPT) -- $(RUN_OPTS)
+XRUBY = @XRUBY@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
+
+DEFAULT_PRELUDES = $(@USE_RUBYGEMS@_GEM_PRELUDE)
 
 #### End of system configuration section. ####
 
@@ -37,227 +104,286 @@ LIBRUBY_SO    = @LIBRUBY_SO@
 LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
 LIBRUBY	      = @LIBRUBY@
 LIBRUBYARG    = @LIBRUBYARG@
+LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
+LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+
+THREAD_MODEL  = @THREAD_MODEL@
+
+PREP          = @PREP@
+ARCHFILE      = @ARCHFILE@
+SETUP         =
+EXTSTATIC     = @EXTSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
+
+MAKEDIRS      = @MKDIR_P@
+CP            = cp
+MV            = mv
+RM            = rm -f
+RMDIR         = @RMDIR@
+RMDIRS        = @RMDIRS@
+RMALL         = @RMALL@
+NM            = @NM@
+AR            = @AR@
+ARFLAGS       = rcu
+RANLIB        = @RANLIB@
+AS            = @AS@
+ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE      = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP       = @OBJDUMP@
+OBJCOPY       = @OBJCOPY@
+VCS           = @VCS@
+VCSUP         = @VCSUP@
+
+OBJEXT        = @OBJEXT@
+ASMEXT        = S
+DLEXT         = @DLEXT@
+MANTYPE	      = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
+
+INSTALLED_LIST= .installed.list
+
+MKMAIN_CMD    = mkmain.sh
+
+SRC_FILE      = $<
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
+
+configure_args = @configure_args@
+#### End of variables
+
+all:
+
+.DEFAULT: all
+
+# Prevent GNU make v3 from overflowing arg limit on SysV.
+.NOEXPORT:
 
-EXTOBJS	      = 
-
-MAINOBJ	      = main.o
-
-OBJS	      = array.o \
-		bignum.o \
-		class.o \
-		compar.o \
-		dir.o \
-		dln.o \
-		enum.o \
-		error.o \
-		eval.o \
-		file.o \
-		gc.o \
-		hash.o \
-		inits.o \
-		io.o \
-		marshal.o \
-		math.o \
-		numeric.o \
-		object.o \
-		pack.o \
-		parse.o \
-		process.o \
-		prec.o \
-		random.o \
-		range.o \
-		re.o \
-		regex.o \
-		ruby.o \
-		signal.o \
-		sprintf.o \
-		st.o \
-		string.o \
-		struct.o \
-		time.o \
-		util.o \
-		variable.o \
-		version.o \
-		$(MISSING)
-
-all:		miniruby$(binsuffix) rbconfig.rb
-		@./miniruby$(binsuffix) -Xext extmk.rb @EXTSTATIC@
-
-miniruby$(binsuffix):	config.status $(LIBRUBY_A) $(MAINOBJ) dmyext.o
-		@rm -f $@
-		$(PURIFY) $(CC) $(LDFLAGS) $(MAINOBJ) dmyext.o $(LIBRUBY_A) $(LIBS) -o $@
-
-$(PROGRAM):     $(LIBRUBY) $(MAINOBJ) $(EXTOBJS) 
-		@rm -f $@
-		$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) -o $@
-
-$(LIBRUBY_A):	$(OBJS) dmyext.o
-		@AR@ rcu $@ $(OBJS) dmyext.o
-		@-@RANLIB@ $@ 2> /dev/null || true
-
-$(LIBRUBY_SO):	$(OBJS) dmyext.o
-		$(LDSHARED) $(DLDFLAGS) $(SOLIBS) $(OBJS) dmyext.o -o $@
-		@-./miniruby -e 'ARGV.each{|link| File.delete link if File.exist? link; \
+miniruby$(EXEEXT):
+		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(DMYEXT) $(LIBS) $(OUTFLAG)$@
+
+$(PROGRAM):
+		@$(RM) $@
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
+
+# We must `rm' the library each time this rule is invoked because "updating" a
+# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
+# supported.
+$(LIBRUBY_A):
+		@$(RM) $@
+		$(ECHO) linking static-library $@
+		$(Q) $(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
+		@-$(RANLIB) $@ 2> /dev/null || true
+
+$(LIBRUBY_SO):
+		@-$(PRE_LIBRUBY_UPDATE)
+		$(ECHO) linking shared-library $@
+		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
+		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)*_threadptr_*' $@
+		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
 						  File.symlink "$(LIBRUBY_SO)", link}' \
 				$(LIBRUBY_ALIASES) || true
 
-install:	rbconfig.rb
-		./miniruby$(binsuffix) $(srcdir)/instruby.rb $(DESTDIR)
-
-clean:;		@rm -f $(OBJS) $(LIBRUBY_A) $(LIBRUBY_SO) $(LIBRUBY_ALIASES) $(MAINOBJ) rbconfig.rb
-		@rm -f ext/extinit.c ext/extinit.o dmyext.o
-		@-./miniruby$(binsuffix) -Xext extmk.rb clean 2> /dev/null || true
-
-distclean:	clean
-		@rm -f Makefile ext/extmk.rb config.h
-		@rm -f ext/config.cache config.cache config.log config.status
-		@rm -f *~ core *.core gmon.out y.tab.c y.output ruby.imp
-		@rm -f $(PROGRAM) miniruby$(binsuffix)
-
-realclean:	distclean
-		@rm -f parse.c
-		@rm -f lex.c
-
-test:		miniruby$(binsuffix)
-		@./miniruby$(binsuffix) $(srcdir)/rubytest.rb
-
-rbconfig.rb:	miniruby$(binsuffix)
-		@./miniruby$(binsuffix) $(srcdir)/mkconfig.rb rbconfig.rb
-
-config.status:	$(srcdir)/configure
-		$(SHELL) ./config.status --recheck
+fake: $(arch)-fake.rb
+$(arch)-fake.rb: config.status $(srcdir)/template/fake.rb.in
+		@./config.status --file=$@:$(srcdir)/template/fake.rb.in
+		@chmod +x $@
+
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+	$(ECHO) installing cross-compiling stuff
+	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+	$(Q) $(BASERUBY) -p \
+	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+	rbconfig.rb > fake-rbconfig.rb
+	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+	@$(RM) fake.rb fake-rbconfig.rb
+	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status
+		MAKE=$(MAKE) $(SHELL) ./config.status
+		@{ \
+		    echo "all:; -@rm -f conftest.mk"; \
+		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
+		    echo ".force:"; \
+		} > conftest.mk || exit 1; \
+		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
+		{ echo "Makefile updated, restart."; exit 1; }
+
+uncommon.mk: $(srcdir)/common.mk
+		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
+
+.PHONY: reconfig
+reconfig-args = $(srcdir)/configure $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3`
+reconfig-exec-1 = set -x; "$$@"
+
+reconfig config.status:	$(srcdir)/configure $(srcdir)/enc/Makefile.in
+	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
 
 $(srcdir)/configure: $(srcdir)/configure.in
-		cd $(srcdir) && $(AUTOCONF)
-
-.c.o:
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
-
-lex.c: keywords
-	gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ @srcdir@/keywords > lex.c
-
-parse.c: parse.y
-	$(YACC) $<
-	mv -f y.tab.c parse.c
-
-alloca.o: @srcdir@/missing/alloca.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/alloca.c
-
-crypt.o: @srcdir@/missing/crypt.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/crypt.c
-
-dup2.o: @srcdir@/missing/dup2.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/dup2.c
-
-finite.o: @srcdir@/missing/finite.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/finite.c
-
-flock.o: @srcdir@/missing/flock.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/flock.c
-
-isinf.o: @srcdir@/missing/isinf.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/isinf.c
-
-isnan.o: @srcdir@/missing/isnan.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/isnan.c
-
-fnmatch.o: @srcdir@/missing/fnmatch.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/fnmatch.c
-
-memcmp.o: @srcdir@/missing/memcmp.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/memcmp.c
-
-memmove.o: @srcdir@/missing/memmove.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/memmove.c
-
-mkdir.o: @srcdir@/missing/mkdir.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/mkdir.c
-
-vsnprintf.o: @srcdir@/missing/vsnprintf.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/vsnprintf.c
-
-strcasecmp.o: @srcdir@/missing/strcasecmp.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strcasecmp.c
-
-strncasecmp.o: @srcdir@/missing/strncasecmp.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strncasecmp.c
-
-strchr.o: @srcdir@/missing/strchr.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strchr.c
-
-strdup.o: @srcdir@/missing/strdup.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strdup.c
-
-strerror.o: @srcdir@/missing/strerror.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strerror.c
-
-strftime.o: @srcdir@/missing/strftime.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strftime.c
-
-strstr.o: @srcdir@/missing/strstr.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strstr.c
-
-strtod.o: @srcdir@/missing/strtod.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strtod.c
-
-strtol.o: @srcdir@/missing/strtol.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strtol.c
-
-strtoul.o: @srcdir@/missing/strtoul.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strtoul.c
-
-nt.o: @srcdir@/missing/nt.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/nt.c
-
-x68.o: @srcdir@/missing/x68.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/x68.c
-
-os2.o: @srcdir@/missing/os2.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/os2.c
-
-dl_os2.o: @srcdir@/missing/dl_os2.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/dl_os2.c
-
-# Prevent GNU make v3 from overflowing arg limit on SysV.
-.NOEXPORT:
-###
-parse.o: parse.y ruby.h config.h defines.h intern.h env.h node.h st.h regex.h util.h lex.c
-###
-array.o: array.c ruby.h config.h defines.h intern.h
-bignum.o: bignum.c ruby.h config.h defines.h intern.h
-class.o: class.c ruby.h config.h defines.h intern.h node.h st.h
-compar.o: compar.c ruby.h config.h defines.h intern.h
-dir.o: dir.c ruby.h config.h defines.h intern.h
-dln.o: dln.c config.h defines.h dln.h
-dmyext.o: dmyext.c
-enum.o: enum.c ruby.h config.h defines.h intern.h
-error.o: error.c ruby.h config.h defines.h intern.h env.h
-eval.o: eval.c ruby.h config.h defines.h intern.h node.h env.h rubysig.h st.h dln.h
-file.o: file.c ruby.h config.h defines.h intern.h rubyio.h rubysig.h
-fnmatch.o: fnmatch.c config.h fnmatch.h
-gc.o: gc.c ruby.h config.h defines.h intern.h rubysig.h st.h node.h env.h re.h regex.h
-hash.o: hash.c ruby.h config.h defines.h intern.h st.h rubysig.h util.h
-inits.o: inits.c ruby.h config.h defines.h intern.h
-io.o: io.c ruby.h config.h defines.h intern.h rubyio.h rubysig.h
-main.o: main.c ruby.h config.h defines.h intern.h
-marshal.o: marshal.c ruby.h config.h defines.h intern.h rubyio.h st.h
-prec.o: prec.c ruby.h config.h defines.h intern.h
-math.o: math.c ruby.h config.h defines.h intern.h
-numeric.o: numeric.c ruby.h config.h defines.h intern.h
-object.o: object.c ruby.h config.h defines.h intern.h st.h
-pack.o: pack.c ruby.h config.h defines.h intern.h
-process.o: process.c ruby.h config.h defines.h intern.h rubysig.h st.h
-random.o: random.c ruby.h config.h defines.h intern.h
-range.o: range.c ruby.h config.h defines.h intern.h
-re.o: re.c ruby.h config.h defines.h intern.h re.h regex.h
-regex.o: regex.c config.h regex.h util.h
-ruby.o: ruby.c ruby.h config.h defines.h intern.h dln.h util.h
-signal.o: signal.c ruby.h config.h defines.h intern.h rubysig.h
-sprintf.o: sprintf.c ruby.h config.h defines.h intern.h
-st.o: st.c config.h st.h
-string.o: string.c ruby.h config.h defines.h intern.h re.h regex.h
-struct.o: struct.c ruby.h config.h defines.h intern.h
-time.o: time.c ruby.h config.h defines.h intern.h
-util.o: util.c ruby.h config.h defines.h intern.h util.h
-variable.o: variable.c ruby.h config.h defines.h intern.h env.h node.h st.h
-version.o: version.c ruby.h config.h defines.h intern.h version.h
+	$(CHDIR) $(srcdir) && exec $(AUTOCONF)
+
+incs: id.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+	@\
+	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+	  [ $(Q) ] && echo copying $@ || set -x; \
+	  $(CP) $(srcdir)/lex.c.blt $@; \
+	else \
+	  [ $(Q) ] && echo generating $@ || set -x; \
+	  gperf -C -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@.tmp && \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(srcdir)/defs/lex.c.src && \
+	  $(CP) $@ $(srcdir)/lex.c.blt; \
+	fi
+
+NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
+
+enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  trap '$(RM) $@-1.h $@-2.h' 0 && \
+	  set -x; \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
+	  gperf $(NAME2CTYPE_OPTIONS) < $? > $@-2.h && \
+	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
+
+.c.@OBJEXT@:
+	@$(ECHO) compiling $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
+
+.s.@OBJEXT@:
+	@$(ECHO) assembling $<
+	$(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+	@$(ECHO) translating $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+	@$(ECHO) preprocessing $<
+	$(Q) $(CPP) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
+
+clean-local::
+	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output
+	-$(Q)$(RM) $(pkgconfig_DATA)
+
+distclean-local::
+	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+	-$(Q)$(RM) run.gdb
+	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h
+	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+clean-ext distclean-ext realclean-ext::
+	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+	test "$$#" = 0 && set .; \
+	set dummy `\
+	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$:~:' | sort | sed 's:~$$::'; \
+	`; shift; \
+	cd ..; \
+	for dir do \
+	    echo $(@:-ext=)ing "$$dir"; \
+	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
+	    case "$@" in \
+	    *distclean-ext*|*realclean-ext*) \
+		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
+	    esac; \
+	done
+
+distclean-ext realclean-ext::
+	-$(Q)$(RMDIR) ext 2> /dev/null || true
+
+clean-extout:
+	-$(Q)$(RMDIRS) $(EXTOUT) 2> /dev/null || true
+
+clean-enc distclean-enc realclean-enc:
+	@test -f "$(ENC_MK)" || exit 0; \
+	echo $(@:-enc=ing) encodings; \
+	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
+
+clean-rdoc distclean-rdoc realclean-rdoc:
+	@echo $(@:-rdoc=ing) rdoc
+	$(Q)$(RMALL) $(RDOCOUT)
+clean-capi distclean-capi realclean-capi:
+	@echo $(@:-capi=ing) capi
+	$(Q)$(RMALL) $(CAPIOUT)
+
+clean-platform:
+	@$(RM) $(PLATFORM_D)
+	-$(Q) $(RMDIR) $(PLATFORM_DIR) 2> /dev/null || true
+
+ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
+	$(ECHO) compiling $@
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+up::
+	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+update-mspec:
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/mspec ]; then \
+	  cd spec/mspec; \
+	  echo updating mspec ...; \
+	  exec git pull; \
+	else \
+	  echo retrieving mspec ...; \
+	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
+	fi
+
+update-rubyspec: update-mspec
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/rubyspec ]; then \
+	  cd spec/rubyspec; \
+	  echo updating rubyspec ...; \
+	  exec git pull; \
+	else \
+	  echo retrieving rubyspec ...; \
+	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
+	fi
+
+test-rubyspec-precheck:
+	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
+
+INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+	  vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+	$(ECHO) generating $@
+	$(Q) $(BASERUBY) -Ks $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
diff --git a/NEWS b/NEWS
new file mode 100644
index 0000000000..30fec33fdd
--- /dev/null
+++ b/NEWS
@@ -0,0 +1,341 @@
+# -*- rd -*-
+= NEWS
+
+This document is a list of user visible feature changes made between
+releases except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or
+reference information is supplied with.  For a full list of changes
+with all sufficient information, see the ChangeLog file.
+
+== Changes since the 1.9.2 release
+=== License
+
+* Ruby's License is changed from a dual license with GPLv2
+  to a dual license with 2-clause BSDL.
+
+=== Known platform dependent issues
+==== OS X Lion
+
+* You have to configure ruby with '--with-gcc=gcc-4.2' if you're using
+  Xcode 4.1, or, if you're using Xcode 4.2, you have to configure ruby
+  with '--with-gcc=clang'.
+
+=== C API updates
+
+* rb_scan_args() is enhanced with support for option hash argument
+  extraction.
+
+* ruby_vm_at_exit() added.  This enables extension libs to hook a VM
+  termination.
+
+* rb_reserved_fd_p() added.  If you want to close all file descriptors,
+  check using this API.  [ruby-core:37759]
+
+=== Library updates (outstanding ones only)
+
+* builtin classes
+
+  * ARGF
+    * new methods:
+      * ARGF.print
+      * ARGF.printf
+      * ARGF.putc
+      * ARGF.puts
+      * ARGF.read_nonblock
+      * ARGF.to_write_io
+      * ARGF.write
+
+  * Array
+    * extended method:
+      * Array#pack supports endian modifiers
+
+  * Bignum
+    * Multiplication algorithm for Bignums with a large number of digits over
+      150 BDIGITs is changed in order to reduce its calculation time.
+      Now such large Bignums are multiplied by using Toom-3 algorithm.
+
+  * Encoding
+    * new encodings:
+      * CP950
+      * CP951
+      * UTF-16
+      * UTF-32
+    * change alias:
+      * SJIS is Windows-31J
+
+  * File
+    * new constant:
+      * File::NULL
+        name of NULL device.
+      * File::DIRECT
+        name of O_DIRECT.
+
+  * IO
+    * extended method:
+      * IO#putc supports multibyte characters
+    * new methods:
+      * IO#advise
+      * IO.write(name, string, [offset] )
+        Write `string` to file `name`.
+        Opposite with File.read.
+      * IO.binwrite(name, string, [offset] )
+        binary version of IO.write.
+
+  * Kernel
+    * move #__id__ to BasicObject.
+    * extended method:
+      * Kernel#rand supports range argument
+
+  * Module
+    * new methods:
+      * Module#private_constant
+      * Module#public_constant
+
+  * Random
+    * extended method:
+      * Random.rand supports range argument
+
+  * String
+    * extended method:
+      * String#unpack supports endian modifiers
+    * new method:
+      * String#prepend
+      * String#byteslice
+
+  * Time
+    * extended method:
+      * Time#strftime supports %:z and %::z.
+
+  * Process
+    * Process#maxgroups and Process#maxgroups= now raise NotImplementedError if
+      the platform don't support supplementary groups concept.
+
+* bigdecimal
+
+  * BigDecimal#power and BigDecimal#** support non-integral exponent.
+
+  * Kernel.BigDecimal and BigDecimal.new now accept instances of Integer,
+    Rational, Float, and BigDecimal.  If you pass a Rational or a Float to
+    them, you must specify the precision to produce the digits of a BigDecimal.
+
+  * The behavior of BigDecimal#coerce with a Rational is changed.  It uses
+    the precision of the receiver BigDecimal to produce the digits of a
+    BigDecimal from the given Rational.
+
+* bigdecimal/util
+
+  * BigDecimal#to_d and Integer#to_d are added.
+
+  * Float#to_d accepts a precision.
+
+  * Rational#to_d raises ArgumentError when passing zero or negative
+    precision.
+
+  * Rational#to_d
+
+    * Zero and an implicit precision is deprecated.
+      This feature is removed at the next release of bigdecimal.
+
+    * A negative precision isn't supported.
+      Be careful it is an incompatible change.
+
+* date
+
+  * Accepts flonum explicitly with limitations.
+    * If the given offset is flonum, DateTime assumes its precision is
+      at most second.
+
+      DateTime.new(2001,2,3,0,0,0,3.0/24) ==
+      DateTime.new(2001,2,3,0,0,0,'+03:00')
+        #=> true
+
+    * If the given operand for -/+ is flonum, DateTime assumes its
+      precision is at most nanosecond.
+
+      DateTime.new(2001,2,3) + 0.5 == DateTime.new(2001,2,3,12)
+        #=> true
+
+    * Precision of offset is always at most second.
+
+      Rational('0.5') == Rational('0.500001')  #=> false
+      DateTime.new(2001,2,3,0,0,0,Rational('0.5')) ==
+      DateTime.new(2001,2,3,0,0,0,Rational('0.500001'))
+        #=> true
+
+  * Ignores long offset and far reform day (with warning).
+
+    * Now accepts only:
+
+      -1<=offset<=1 (-24:00..+24:00)
+      2298874<=start<=2426355 or -/+oo
+        (proleptic Gregorian/Julian mean -/+oo)
+
+  * A method strftime cannot produce huge output (same as Time's one).
+
+    * Even though Date/DateTime can handle far dates, the following causes
+      an exception.
+
+      DateTime.new(1<<10000).strftime('%Y')  # Errno::ERANGE
+
+  * Changed the format of inspect.
+  * Changed the format of marshal (but, can load old dumps).
+
+* io/console
+  * new methods:
+    * IO#noecho {|io| }
+    * IO#echo=
+    * IO#echo?
+    * IO#raw {|io| }
+    * IO#raw!
+    * IO#getch
+    * IO#winsize
+    * IO.console
+
+* json
+  * updated to v1.5.4.
+
+* matrix
+  * new classes:
+    * Matrix::EigenvalueDecomposition
+    * Matrix::LUPDecomposition
+  * new methods:
+    * Matrix#diagonal?
+    * Matrix#eigen
+    * Matrix#eigensystem
+    * Matrix#hermitian?
+    * Matrix#lower_triangular?
+    * Matrix#lup
+    * Matrix#lup_decomposition
+    * Matrix#normal?
+    * Matrix#orthogonal?
+    * Matrix#permutation?
+    * Matrix#round
+    * Matrix#symmetric?
+    * Matrix#unitary?
+    * Matrix#upper_triangular?
+    * Matrix#zero?
+    * Vector#magnitude, #norm
+    * Vector#normalize
+  * extended methods:
+    * Matrix#each and #each_with_index can iterate on a subset of the elements
+    * Matrix#find_index returns [row, column] and can iterate on a subset
+      of the elements
+    * Matrix#** implements Numeric exponents (using the eigensystem)
+    * Matrix.zero can build rectangular matrices
+
+* minitest
+  * Minitest has been updated to version 2.2.2.
+  * For full details, see https://github.com/seattlerb/minitest/blob/master/History.txt
+
+* net/http
+  * SNI (Server Name Indication) supported for HTTPS.
+
+  * Allow to configure to wait server returning '100 continue' response
+    before sending HTTP request body. Set Net::HTTP#continue_timeout AND pass
+    'expect' => '100-continue' to a extra HTTP header.
+
+    For example, the following code sends HTTP header and waits for getting
+    '100 continue' response before sending HTTP request body. When 0.5 [sec]
+    timeout occurs or the server send '100 continue', the client sends HTTP
+    request body.
+      http.continue_timeout = 0.5
+      http.request_post('/continue', 'body=BODY', 'expect' => '100-continue')
+
+  * new method:
+    * Net::HTTPRequest#set_form): Added to support
+      both application/x-www-form-urlencoded and multipart/form-data.
+
+* objspace
+  * new method:
+    * ObjectSpace::memsize_of_all
+
+* openssl
+  * PKey::RSA and PKey::DSA now use the generic X.509 encoding scheme
+    (e.g. used in a X.509 certificate's Subject Public Key Info) when
+    exporting public keys to DER or PEM. Backward compatibility is
+    ensured by (already existing) fallbacks during creation.
+  * OpenSSL::ASN1::Constructive#new and OpenSSL::ASN1::Primitive#new
+    (and the constructors of their sub-classes) will no longer force
+    tagging to be set to :EXPLICIT when tag and/or tag_class are passed
+    as parameters. tagging must be set explicitly.
+  * Support for infinite length encodings via infinite_length attribute.
+  * OpenSSL::PKey.read( file | string [, pwd] ) allows to read arbitrary
+    public/private keys in DER-/PEM-encoded form with an optional password
+    for encrypted PEM encodings.
+  * Add new method OpenSSL::X509::Name#hash_old as a wrapper of
+    X509_NAME_hash_old() defined from OpenSSL 1.0.0. It returns OpenSSL 0.9.8
+    compatible hash value.
+
+* optparse
+  * support for bash/zsh completion.
+
+* Rake
+  * Rake has been upgraded from 0.8.7 to 0.9.2.2.  For full release notes see
+    https://github.com/jimweirich/rake/blob/master/CHANGES
+
+* RDoc
+  * RDoc has been upgraded to version 3.9.4.  For full release notes see
+    http://docs.seattlerb.org/rdoc/History_txt.html
+
+* rexml
+  * Support Ruby native encoding mechanism and iconv dependency is dropped.
+
+* RubyGems
+  * RubyGems has been upgraded to version 1.8.10. For full release notes see
+    http://rubygems.rubyforge.org/rubygems-update/History_txt.html
+
+* stringio
+  * extended method:
+    * StringIO#set_encoding can get 2nd argument and optional hash.
+
+* test/unit
+  * New arguments:
+    * -j N, --jobs=N: Allow run N testcases at once.
+    * --jobs-status: Show status of jobs when parallel running.
+    * --no-retry: Don't retry testcases which failed when parallel running.
+    * --ruby=RUBY: path to ruby for job(worker) process. optional.
+    * --hide-skip: Hide skip messages. You'll see the number of skips at end of
+      test result.
+
+* uri
+  * new methods:
+    * URI::Generic#hostname
+    * URI::Generic#hostname=
+
+* webrick
+  * new method:
+    * WEBrick::HTTPRequest#continue for generating '100 continue' response.
+  * new logging directive:
+    * %{remote}p for remote (client) port number.
+
+* yaml
+  * The default YAML engine is now Psych. You may downgrade to syck by setting
+    YAML::ENGINE.yamler = 'syck'.
+
+* zlib
+  * new methods:
+    * Zlib.deflate
+    * Zlib.inflate
+
+* FileUtils
+  * extended method:
+    * FileUtils#chmod supports symbolic mode argument.
+
+=== Language changes
+
+* Regexps now support Unicode 6.0. (new characters and scripts)
+
+* [experimental] Regexps now support Age property.
+  Unlike Perl, current implementation takes interpretation of the
+  interpretation of UTS #18.
+  http://www.unicode.org/reports/tr18/
+
+* Turning on/off indentation warnings with directives.
+  ("# -*- warn-indent: true -*-" / "# -*- warn-indent: false -*-")
+
+=== Compatibility issues (excluding feature bug fixes)
+
+  * Rational#to_d
+
+    See above.
diff --git a/README b/README
index 44e0844a8f..3d2e636e4d 100644
--- a/README
+++ b/README
@@ -5,6 +5,7 @@ easy object-oriented programming.  It has many features to
 process text files and to do system management tasks (as in
 Perl).  It is simple, straight-forward, and extensible.
 
+
 * Features of Ruby
 
   + Simple Syntax
@@ -15,116 +16,122 @@ Perl).  It is simple, straight-forward, and extensible.
   + Iterators and Closures
   + Garbage Collection
   + Dynamic Loading of Object files(on some architecture)
-  + Highly Portable(works on many UNIX machines, and on DOS,
-    Windows, Mac, BeOS etc.)
+  + Highly Portable (works on many Unix-like/POSIX compatible platforms
+    as well as Windows, Mac OS X, BeOS etc.)
+    cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatforms
+
 
 * How to get Ruby
 
-The Ruby distribution can be found on
+The Ruby distribution files can be found in the following FTP site:
 
-  ftp://ftp.netlab.co.jp/pub/lang/ruby/
+  ftp://ftp.ruby-lang.org/pub/ruby/
 
-* How to compile and install
+The trunk of the Ruby source tree can be checked out with the
+following command:
 
-This is what you need to do to compile and install Ruby:
+  $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
 
-  1. Run ./configure, which will generate config.h and Makefile.
+There are some other branches under development.  Try the following
+command and see the list of branches:
 
-  2. Edit defines.h if you need.  Probably this step will not need.
+  $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
 
-  3. Remove comment mark(#) before the module names from ext/Setup (or
-     add module names if not present), if you want to link modules
-     statically.
 
-     If you don't want to compile non static extension modules
-     (probably on architectures which does not allow dynamic loading),
-     remove comment mark from the line "#option nodynamic" in
-     ext/Setup.
+* Ruby home-page
 
-  4. Run make.
+The URL of the Ruby home-page is:
 
-  5. Optionally, run 'make test' to check whether the compiled Ruby
-     interpreter works well.  If you see the message "test succeeded",
-     your ruby works as it should (hopefully).
+   http://www.ruby-lang.org/
 
-  6. Run 'make install'
 
-     You may have to be a super user to install ruby.
+* Mailing list
 
-If you fail to compile ruby, please send the detailed error report with
-the error log and machine/OS type, to help others.
+There is a mailing list to talk about Ruby.
+To subscribe this list, please send the following phrase
 
-* Copying
+	subscribe YourFirstName YourFamilyName
+e.g.
+        subscribe Joseph Smith
 
-Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.co.jp>.
-You can redistribute it and/or modify it under either the terms of the GPL
-(see COPYING file), or the conditions below:
+in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
 
-  1. You may make and give away verbatim copies of the source form of the
-     software without restriction, provided that you duplicate all of the
-     original copyright notices and associated disclaimers.
 
-  2. You may modify your copy of the software in any way, provided that
-     you do at least ONE of the following:
+* How to compile and install
 
-       a) place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-	  modifications to Usenet or an equivalent medium, or by allowing
-	  the author to include your modifications in the software.
+This is what you need to do to compile and install Ruby:
 
-       b) use the modified software only within your corporation or
-          organization.
+  1. If ./configure does not exist or is older than configure.in,
+     run autoconf to (re)generate configure.
 
-       c) rename any non-standard executables so the names do not conflict
-	  with standard executables, which must also be provided.
+  2. Run ./configure, which will generate config.h and Makefile.
 
-       d) make other distribution arrangements with the author.
+     Some C compiler flags may be added by default depending on your
+     environment.  Specify optflags=.. and warnflags=.. as necessary
+     to override them.
 
-  3. You may distribute the software in object code or executable
-     form, provided that you do at least ONE of the following:
+  3. Edit defines.h if you need.  Usually this step will not be needed.
 
-       a) distribute the executables and library files of the software,
-	  together with instructions (in the manual page or equivalent)
-	  on where to get the original distribution.
+  4. Remove comment mark(#) before the module names from ext/Setup (or
+     add module names if not present), if you want to link modules
+     statically.
 
-       b) accompany the distribution with the machine-readable source of
-	  the software.
+     If you don't want to compile non static extension modules
+     (probably on architectures which does not allow dynamic loading),
+     remove comment mark from the line "#option nodynamic" in
+     ext/Setup.
 
-       c) give non-standard executables non-standard names, with
-          instructions on where to get the original software distribution.
+  5. Run make.
 
-       d) make other distribution arrangements with the author.
+  6. Optionally, run 'make test' to check whether the compiled Ruby
+     interpreter works well.  If you see the message "test succeeded",
+     your ruby works as it should (hopefully).
+
+  7. Run 'make install'
+
+     This command will create following directories and install files
+     onto them.
+
+       * ${DESTDIR}${prefix}/bin
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib
+       * ${DESTDIR}${prefix}/lib/ruby
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/share/man/man1
+       * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
+
+     If Ruby's API version is `x.y.z', the ((|${MAJOR}|)) is `x', the
+     ((|${MINOR}|)) is `y', and the ((|${TEENY}|)) is `z'.
+
+     NOTE: teeny of the API version may be different from one of
+     Ruby's program version
 
-  4. You may modify and include the part of the software into any other
-     software (possibly commercial).  But some files in the distribution
-     are not written by the author, so that they are not under this terms.
-     They are gc.c(partly), utils.c(partly), regex.[ch], st.[ch] and some
-     files under the ./missing directory.  See each file for the copying
-     condition.
+     You may have to be a super user to install ruby.
 
-  5. The scripts and library files supplied as input to or produced as 
-     output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them, 
-     and may be sold commercially, and may be aggregated with this
-     software.
+If you fail to compile ruby, please send the detailed error report with
+the error log and machine/OS type, to help others.
 
-  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-     WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR
-     PURPOSE.
 
-* Ruby home-page
+* Copying
 
-The URL of the Ruby home-page is:
+See the file COPYING.
 
-   http://www.netlab.co.jp/ruby/
 
 * The Author
 
 Feel free to send comments and bug reports to the author.  Here is the 
 author's latest mail address:
 
-  matz@netlab.co.jp
+  matz@netlab.jp
 
 -------------------------------------------------------
 created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.EXT b/README.EXT
index cc6c963baf..de63f54699 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1,59 +1,63 @@
 .\" README.EXT -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
 
-This document explains how to make extention libraries for Ruby.
+This document explains how to make extension libraries for Ruby.
 
-1��Basic knowledge
+1. Basic knowledge
 
 In C, variables have types and data do not have types.  In contrast,
-Ruby variables do not have static type and data themselves have
-types.  So, data need to be converted across the languages.
+Ruby variables do not have a static type, and data themselves have
+types, so data will need to be converted between the languages.
 
-Data in Ruby represented C type `VALUE'.  Each VALUE data have its
-data-type.
+Data in Ruby are represented by the C type `VALUE'.  Each VALUE data
+has its data-type.
 
-To retrieve an C data from the VALUE, you need to:
+To retrieve C data from a VALUE, you need to:
 
- (1) Identify VALUE's data type
- (2) Convert VALUE into C data
+ (1) Identify the VALUE's data type
+ (2) Convert the VALUE into C data
 
-Converting to wrong data type may cause serious promblems.
+Converting to the wrong data type may cause serious problems.
 
 
 1.1 Data-types
 
-Ruby interpreter has data-types as below:
+The Ruby interpreter has the following data types:
 
 	T_NIL		nil
-	T_OBJECT	ordinaly object
+	T_OBJECT	ordinary object
 	T_CLASS		class
 	T_MODULE	module
 	T_FLOAT		floating point number
 	T_STRING	string
 	T_REGEXP	regular expression
 	T_ARRAY		array
-	T_FIXNUM	Fixnum(31bit integer)
-	T_HASH		assosiative array
+	T_HASH		associative array
 	T_STRUCT	(Ruby) structure
 	T_BIGNUM	multi precision integer
+	T_FIXNUM	Fixnum(31bit or 63bit integer)
+	T_COMPLEX       complex number
+	T_RATIONAL      rational number
+	T_FILE		IO
 	T_TRUE		true
 	T_FALSE		false
 	T_DATA		data
+	T_SYMBOL        symbol
 
-Otherwise, there are several other types used internally:
+In addition, there are several other types used internally:
 
 	T_ICLASS
 	T_MATCH
-	T_VARMAP
-	T_SCOPE
+	T_UNDEF
 	T_NODE
+	T_ZOMBIE
 
 Most of the types are represented by C structures.
 
 1.2 Check Data Type of the VALUE
 
-The macro TYPE() defined in ruby.h shows data-type of the VALUE.
+The macro TYPE() defined in ruby.h shows the data type of the VALUE.
 TYPE() returns the constant number T_XXXX described above.  To handle
-data-types, the code will be like:
+data types, your code will look something like this:
 
   switch (TYPE(obj)) {
     case T_FIXNUM:
@@ -67,49 +71,75 @@ data-types, the code will be like:
       break;
     default:
       /* raise exception */
-      Fail("not valid value");
+      rb_raise(rb_eTypeError, "not valid value");
       break;
   }
 
-There is the data-type check function.
+There is the data-type check function
 
   void Check_Type(VALUE value, int type)
 
-It raises an exception, if the VALUE does not have the type specified.
+which raises an exception if the VALUE does not have the type
+specified.
 
-There are faster check-macros for fixnums and nil.
+There are also faster check macros for fixnums and nil.
 
   FIXNUM_P(obj)
   NIL_P(obj)
 
 1.3 Convert VALUE into C data
 
-The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
+The data for type T_NIL, T_FALSE, T_TRUE are nil, false, true
 respectively.  They are singletons for the data type.
-
-The T_FIXNUM data is the 31bit length fixed integer (63bit length on
-some machines), which can be conver to the C integer by using
-FIX2INT() macro.  There also be NUM2INT() which converts any Ruby
-numbers into C integer.  The NUM2INT() macro includes type check, so
-the exception will be raised if conversion failed.
+The equivalent C constants are: Qnil, Qfalse, Qtrue.
+Note that Qfalse is false in C also (i.e. 0), but not Qnil.
+
+The T_FIXNUM data is a 31bit or 63bit length fixed integer.
+This size is depend on the size of long: if long is 32bit then
+T_FIXNUM is 31bit, if long is 64bit then T_FIXNUM is 63bit.
+T_FIXNUM can be converted to a C integer by using the
+FIX2INT() macro or FIX2LONG().  Though you have to check that the
+data is really FIXNUM before using them, they are faster.  FIX2LONG()
+never raises exceptions, but FIX2INT() raises RangeError if the
+result is bigger or smaller than the size of int.
+There are also NUM2INT() and NUM2LONG() which converts any Ruby
+numbers into C integers.  These macros includes a type check,
+so an exception will be raised if the conversion failed.  NUM2DBL()
+can be used to retrieve the double float value in the same way.
+
+You can use the macros
+StringValue() and StringValuePtr() to get a char* from a VALUE.
+StringValue(var) replaces var's value with the result of "var.to_str()".
+StringValuePtr(var) does same replacement and returns char*
+representation of var.  These macros will skip the replacement if var
+is a String.  Notice that the macros take only the lvalue as their
+argument, to change the value of var in place.
+
+You can also use the macro named StringValueCStr(). This is just
+like StringValuePtr(), but always add nul character at the end of
+the result. If the result contains nul character, this macro causes
+the ArgumentError exception.
+StringValuePtr() doesn't guarantee the existence of a nul at the end
+of the result, and the result may contain nul.
 
 Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc.  VALUE of the type which has corresponding structure
-can be cast to retrieve the pointer to the struct.  The casting macro
-RXXXX for each data type like RARRAY(obj).  see "ruby.h".
+for T_ARRAY etc. The VALUE of the type which has the corresponding
+structure can be cast to retrieve the pointer to the struct.  The
+casting macro will be of the form RXXXX for each data type; for
+instance, RARRAY(obj).  See "ruby.h".
 
-For example, `RSTRING(size)->len' is the way to get the size of the
-Ruby String object.  The allocated region can be accessed by
-`RSTRING(str)->ptr'.  For arrays, `RARRAY(ary)->len' and
-`RARRAY(ary)->ptr' respectively.
+There are some accessing macros for structure members, for example
+`RSTRING_LEN(str)' to get the size of the Ruby String object.  The
+allocated region can be accessed by `RSTRING_PTR(str)'.  For arrays,
+use `RARRAY_LEN(ary)' and `RARRAY_PTR(ary)' respectively.
 
 Notice: Do not change the value of the structure directly, unless you
-are responsible about the result.  It will be the cause of interesting
-bugs.
+are responsible for the result.  This ends up being the cause of
+interesting bugs.
 
 1.4 Convert C data into VALUE
 
-To convert C data to the values of Ruby:
+To convert C data to Ruby values:
 
   * FIXNUM
 
@@ -119,75 +149,148 @@ To convert C data to the values of Ruby:
 
     cast to VALUE.
 
-You can determine whether VALUE is pointer or not, by checking LSB.  
+You can determine whether a VALUE is pointer or not by checking its LSB.  
 
-Notice Ruby does not allow arbitrary pointer value to be VALUE.  They
-should be pointers to the structures which Ruby knows.  The known
+Notice Ruby does not allow arbitrary pointer values to be a VALUE.  They
+should be pointers to the structures which Ruby knows about.  The known
 structures are defined in <ruby.h>.
 
-To convert C numbers to Ruby value, use these macros.
+To convert C numbers to Ruby values, use these macros.
 
-  INT2FIX()	for intergers within 31bits.
+  INT2FIX()	for integers within 31bits.
   INT2NUM()	for arbitrary sized integer.
 
-INT2NUM() converts integers into Bignums, if it is out of FIXNUM
-range, but bit slower.
+INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
+range, but is a bit slower.
 
-1.5 Manipulate Ruby data
+1.5 Manipulating Ruby data
 
-As I already told, it is not recommended to modify object's internal
-structure.  To manipulate objects, use functions supplied by Ruby
-interpreter.  Useful functions are listed below (not all):
+As I already mentioned, it is not recommended to modify an object's
+internal structure.  To manipulate objects, use the functions supplied
+by the Ruby interpreter. Some (not all) of the useful functions are
+listed below:
 
- String funtions
+ String functions
 
-  rb_str_new(char *ptr, int len)
+  rb_str_new(const char *ptr, long len)
 
     Creates a new Ruby string.
 
-  rb_str_new2(char *ptr)
+  rb_str_new2(const char *ptr)
+  rb_str_new_cstr(const char *ptr)
 
-    Creates a new Ruby string from C string.  This is equivalent to
+    Creates a new Ruby string from a C string.  This is equivalent to
     rb_str_new(ptr, strlen(ptr)).
 
-  rb_str_cat(VALUE str, char *ptr, int len)
+  rb_tainted_str_new(const char *ptr, long len)
+
+    Creates a new tainted Ruby string.  Strings from external data
+    sources should be tainted.
+
+  rb_tainted_str_new2(const char *ptr)
+  rb_tainted_str_new_cstr(const char *ptr)
+
+    Creates a new tainted Ruby string from a C string.
+
+  rb_sprintf(const char *format, ...)
+  rb_vsprintf(const char *format, va_list ap)
+
+    Creates a new Ruby string with printf(3) format.
+
+  rb_str_cat(VALUE str, const char *ptr, long len)
+
+    Appends len bytes of data from ptr to the Ruby string.
+
+  rb_str_cat2(VALUE str, const char* ptr)
 
-    Appends len bytes data from ptr to the Ruby string.
+    Appends C string ptr to Ruby string str.  This function is
+    equivalent to rb_str_cat(str, ptr, strlen(ptr)).
+
+  rb_str_catf(VALUE str, const char* format, ...)
+  rb_str_vcatf(VALUE str, const char* format, va_list ap)
+
+    Appends C string format and successive arguments to Ruby string
+    str according to a printf-like format.  These functions are
+    equivalent to rb_str_cat2(str, rb_sprintf(format, ...)) and
+    rb_str_cat2(str, rb_vsprintf(format, ap)), respectively.
+
+  rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
+  
+    Creates a new Ruby string with the specified encoding.
+     
+  rb_usascii_str_new(const char *ptr, long len)
+  rb_usascii_str_new_cstr(const char *ptr)
+
+    Creates a new Ruby string with encoding US-ASCII.
+
+  rb_str_resize(VALUE str, long len)
+
+    Resizes Ruby string to len bytes.  If str is not modifiable, this
+    function raises an exception.  The length of str must be set in
+    advance.  If len is less than the old length the content beyond
+    len bytes is discarded, else if len is greater than the old length
+    the content beyond the old length bytes will not be preserved but
+    will be garbage.  Note that RSTRING_PTR(str) may change by calling
+    this function.
+
+  rb_str_set_len(VALUE str, long len)
+
+    Sets the length of Ruby string.  If str is not modifiable, this
+    function raises an exception.  This function preserves the content
+    upto len bytes, regardless RSTRING_LEN(str).  len must not exceed
+    the capacity of str.
 
  Array functions
 
   rb_ary_new()
 
-    Creates an array with no element.
+    Creates an array with no elements.
 
-  rb_ary_new2(int len)
+  rb_ary_new2(long len)
 
-    Creates an array with no element, with allocating internal buffer
+    Creates an array with no elements, allocating internal buffer
     for len elements.
 
-  rb_ary_new3(int n, ...)
+  rb_ary_new3(long n, ...)
+
+    Creates an n-element array from the arguments.
 
-    Creates an n-elements array from arguments.
+  rb_ary_new4(long n, VALUE *elts)
 
-  rb_ary_new4(int n, VALUE *elts)
+    Creates an n-element array from a C array.
 
-    Creates an n-elements array from C array.
+  rb_ary_to_ary(VALUE obj)
+
+    Converts the object into an array.
+    Equivalent to Object#to_ary.
+
+ There are many functions to operate an array.
+ They may dump core if other types are given.
+
+  rb_ary_aref(argc, VALUE *argv, VALUE ary)
+
+    Equivaelent to Array#[].
+
+  rb_ary_entry(VALUE ary, long offset)
+
+    ary[offset]
+
+  rb_ary_subseq(VALUE ary, long beg, long len)
+
+    ary[beg, len]
 
   rb_ary_push(VALUE ary, VALUE val)
   rb_ary_pop(VALUE ary)
   rb_ary_shift(VALUE ary)
   rb_ary_unshift(VALUE ary, VALUE val)
-  rb_ary_entry(VALUE ary, int idx)
 
-    Array operations.  The first argument to each functions must be an 
-    array.  They may dump core if other types given.
 
-2. Extend Ruby with C
+2. Extending Ruby with C
 
-2.1 Add new features to Ruby
+2.1 Adding new features to Ruby
 
 You can add new features (classes, methods, etc.) to the Ruby
-interpreter.  Ruby provides the API to define things below:
+interpreter.  Ruby provides APIs for defining the following things:
 
  * Classes, Modules
  * Methods, Singleton Methods
@@ -195,38 +298,43 @@ interpreter.  Ruby provides the API to define things below:
 
 2.1.1 Class/module definition
 
-To define class or module, use functions below:
+To define a class or module, use the functions below:
+
+  VALUE rb_define_class(const char *name, VALUE super)
+  VALUE rb_define_module(const char *name)
 
-  VALUE rb_define_class(char *name, VALUE super)
-  VALUE rb_define_module(char *name)
+These functions return the newly created class or module.  You may
+want to save this reference into a variable to use later.
 
-These functions return the newly created class ot module.  You may
-want to save this reference into the variable to use later.
+To define nested classes or modules, use the functions below:
+
+  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+  VALUE rb_define_module_under(VALUE outer, const char *name)
 
 2.1.2 Method/singleton method definition
 
-To define methods or singleton methods, use functions below:
+To define methods or singleton methods, use these functions:
 
-  void rb_define_method(VALUE class, char *name, 
+  void rb_define_method(VALUE klass, const char *name, 
 		        VALUE (*func)(), int argc)
 
-  void rb_define_singleton_method(VALUE object, char *name, 
+  void rb_define_singleton_method(VALUE object, const char *name, 
 			          VALUE (*func)(), int argc)
 
 The `argc' represents the number of the arguments to the C function,
-which must be less than 17.  But I believe you don't need that much. :-)
+which must be less than 17.  But I doubt you'll need that many.
 
-If `argc' is negative, it specifies calling sequence, not number of
+If `argc' is negative, it specifies the calling sequence, not number of
 the arguments.  
 
-If argc is -1, the function will be called like:
+If argc is -1, the function will be called as:
 
   VALUE func(int argc, VALUE *argv, VALUE obj)
 
 where argc is the actual number of arguments, argv is the C array of
 the arguments, and obj is the receiver.
 
-if argc is -2, the arguments are passed in Ruby array. The function
+If argc is -2, the arguments are passed in a Ruby array. The function
 will be called like:
 
   VALUE func(VALUE obj, VALUE args)
@@ -234,15 +342,23 @@ will be called like:
 where obj is the receiver, and args is the Ruby array containing
 actual arguments.
 
-There're two more functions to define method.  One is to define
-private method:
+There are some more functions to define methods. One takes an ID
+as the name of method to be defined. See 2.2.2 for IDs.
+
+  void rb_define_method_id(VALUE klass, ID name, 
+                           VALUE (*func)(ANYARGS), int argc)
+
+There are two functions to define private/protected methods:
 
-  void rb_define_private_method(VALUE class, char *name, 
+  void rb_define_private_method(VALUE klass, const char *name, 
 			        VALUE (*func)(), int argc)
+  void rb_define_protected_method(VALUE klass, const char *name, 
+			          VALUE (*func)(), int argc)
 
-The other is to define module function, which is private AND singleton
-method of the module.  For example, sqrt is the module function
-defined in Math module.  It can be call in the form like:
+At last, rb_define_module_function defines a module functions,
+which are private AND singleton methods of the module.
+For example, sqrt is the module function defined in Math module.
+It can be called in the following way:
 
   Math.sqrt(4)
 
@@ -251,56 +367,94 @@ or
   include Math
   sqrt(4)
 
-To define module function
+To define module functions, use:
 
-  void rb_define_module_function(VALUE module, char *name, 
+  void rb_define_module_function(VALUE module, const char *name, 
 				 VALUE (*func)(), int argc)
 
-Oh, in addition, function-like method, which is private method defined
-in Kernel module, can be defined using:
+In addition, function-like methods, which are private methods defined
+in the Kernel module, can be defined using:
+
+  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+To define an alias for the method,
+
+  void rb_define_alias(VALUE module, const char* new, const char* old);
+
+To define a reader/writer for an attribute,
+
+  void rb_define_attr(VALUE klass, const char *name, int read, int write)
 
-  void rb_define_global_function(char *name, VALUE (*func)(), int argc)
+To define and undefine the `allocate' class method,
 
+  void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
+  void rb_undef_alloc_func(VALUE klass);
+
+func has to take the klass as the argument and return a newly
+allocated instance.  This instance should be as empty as possible,
+without any expensive (including external) resources.
 
 2.1.3 Constant definition
 
 We have 2 functions to define constants:
 
-  void rb_define_const(VALUE class, char *name, VALUE val)
-  void rb_define_global_const(char *name, VALUE val)
+  void rb_define_const(VALUE klass, const char *name, VALUE val)
+  void rb_define_global_const(const char *name, VALUE val)
 
-The former is to define constant under specified class/module.  The
-latter is to define global constant.
+The former is to define a constant under specified class/module.  The
+latter is to define a global constant.
 
 2.2 Use Ruby features from C
 
 There are several ways to invoke Ruby's features from C code.
 
-2.2.1 Evaluate Ruby Program in String
+2.2.1 Evaluate Ruby Programs in a String
 
-Easiest way to call Ruby's function from C program is to evaluate the
-string as Ruby program.  This function will do the job.
+The easiest way to use Ruby's functionality from a C program is to
+evaluate the string as Ruby program.  This function will do the job:
 
-  VALUE rb_eval_string(char *str)
+  VALUE rb_eval_string(const char *str)
 
-Evaluation is done under current context, thus current local variables
+Evaluation is done under the current context, thus current local variables
 of the innermost method (which is defined by Ruby) can be accessed.
 
+Note that the evaluation can raise an exception. There is a safer 
+function:
+
+  VALUE rb_eval_string_protect(const char *str, int *state)
+
+It returns nil when an error occur. Moreover, *state is zero if str was
+successfully evaluated, or nonzero otherwise.
+
+
 2.2.2 ID or Symbol
 
 You can invoke methods directly, without parsing the string.  First I
-need to explain about symbols (which data type is ID).  ID is the
-integer number to represent Ruby's identifiers such as variable names.
-It can be accessed from Ruby in the form like:
+need to explain about ID.  ID is the integer number to represent
+Ruby's identifiers such as variable names.  The Ruby data type
+corresponding to ID is Symbol.  It can be accessed from Ruby in the
+form:
 
  :Identifier
+or
+ :"any kind of string"
+
+You can get the ID value from a string within C code by using
+
+  rb_intern(const char *name)
+
+You can retrieve ID from Ruby object (Symbol or String) given as an
+argument by using
 
-You can get the symbol value from string within C code, by using
+  rb_to_id(VALUE symbol)
 
-  rb_intern(char *name)
+You can convert C ID to Ruby Symbol by using
 
-In addition, the symbols for one character operators (e.g +) is the
-code for that character.
+  VALUE ID2SYM(ID id)
+
+and to convert Ruby Symbol object to ID, use
+
+  ID SYM2ID(VALUE symbol)
 
 2.2.3 Invoke Ruby method from C
 
@@ -308,14 +462,14 @@ To invoke methods directly, you can use the function below
 
   VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
 
-This function invokes the method of the recv, which name is specified
-by the symbol mid.
+This function invokes a method on the recv, with the method name
+specified by the symbol mid.
 
 2.2.4 Accessing the variables and constants
 
-You can access class variables, and instance variables using access
-functions.  Also, global variables can be shared between both worlds.
-There's no way to access Ruby's local variables.
+You can access class variables and instance variables using access
+functions.  Also, global variables can be shared between both
+environments.  There's no way to access Ruby's local variables.
 
 The functions to access/modify instance variables are below:
 
@@ -330,16 +484,17 @@ To access the constants of the class/module:
 
 See 2.1.3 for defining new constant.
 
-3. Informatin sharing between Ruby and C
+3. Information sharing between Ruby and C
 
-3.1 Ruby constant that C can be accessed from C
+3.1 Ruby constants that C can be accessed from C
 
-Following Ruby constants can be referred from C.
+As stated in section 1.3,
+the following Ruby constants can be referred from C.
 
   Qtrue
   Qfalse
 
-Boolean values.  Qfalse is false in the C also (i.e. 0).
+Boolean values.  Qfalse is false in C also (i.e. 0).
 
   Qnil
 
@@ -347,80 +502,92 @@ Ruby nil in C scope.
 
 3.2 Global variables shared between C and Ruby
 
-Information can be shared between two worlds, using shared global
+Information can be shared between the two environments using shared global
 variables.  To define them, you can use functions listed below:
 
-  void rb_define_variable(char *name, VALUE *var)
+  void rb_define_variable(const char *name, VALUE *var)
 
-This function defines the variable which is shared by the both world.
-The value of the global variable pointerd by `var', can be accessed
+This function defines the variable which is shared by both environments.
+The value of the global variable pointed to by `var' can be accessed
 through Ruby's global variable named `name'.
 
-You can define read-only (from Ruby, of course) variable by the
+You can define read-only (from Ruby, of course) variables using the
 function below.
 
-  void rb_define_readonly_variable(char *name, VALUE *var)
+  void rb_define_readonly_variable(const char *name, VALUE *var)
 
 You can defined hooked variables.  The accessor functions (getter and
 setter) are called on access to the hooked variables.
 
-  void rb_define_hooked_variable(char *name, VALUE *var,
-				 VALUE (*getter)(), VALUE (*setter)())
+  void rb_define_hooked_variable(const char *name, VALUE *var,
+				 VALUE (*getter)(), void (*setter)())
 
 If you need to supply either setter or getter, just supply 0 for the
 hook you don't need.  If both hooks are 0, rb_define_hooked_variable()
 works just like rb_define_variable().
 
-  void rb_define_virtual_variable(char *name,
-				  VALUE (*getter)(), VALUE (*setter)())
+The prototypes of the getter and setter functions are as follows:
+
+  VALUE (*getter)(ID id, VALUE *var);
+  void (*setter)(VALUE val, ID id, VALUE *var);
+
 
-This function defines the Ruby global variable without corresponding C
+Also you can define a Ruby global variable without a corresponding C
 variable.  The value of the variable will be set/get only by hooks.
 
-The prototypes of the getter and setter functions are as following:
+  void rb_define_virtual_variable(const char *name,
+				  VALUE (*getter)(), void (*setter)())
 
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+The prototypes of the getter and setter functions are as follows:
 
-3.3 Encapsulate C data into Ruby object
+  VALUE (*getter)(ID id);
+  void (*setter)(VALUE val, ID id);
 
-To wrapping and objectify the C pointer as Ruby object (so called
+
+3.3 Encapsulate C data into a Ruby object
+
+To wrap and objectify a C pointer as a Ruby object (so called
 DATA), use Data_Wrap_Struct().
 
-  Data_Wrap_Struct(class,mark,free,ptr)
+  Data_Wrap_Struct(klass, mark, free, ptr)
 
-Data_Wrap_Struct() returns a created DATA object.  The class argument
+Data_Wrap_Struct() returns a created DATA object.  The klass argument
 is the class for the DATA object.  The mark argument is the function
 to mark Ruby objects pointed by this data.  The free argument is the
-function to free the pointer allocation.  The functions, mark and
-free, will be called from garbage collector.
+function to free the pointer allocation.  If this is -1, the pointer
+will be just freed.  The functions mark and free will be called from
+garbage collector.
+
+These mark / free functions are invoked during GC execution.  No
+object allocations are allowed during it, so do not allocate ruby
+objects inside them.
 
 You can allocate and wrap the structure in one step.
 
-  Data_Make_Struct(class, type, mark, free, sval)
+  Data_Make_Struct(klass, type, mark, free, sval)
 
 This macro returns an allocated Data object, wrapping the pointer to
 the structure, which is also allocated.  This macro works like:
 
-  (sval = ALLOC(type), Data_Wrap_Struct(class, mark, free, sval))
+  (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
 
-Arguments, class, mark, free, works like thier counterpart of
-Data_Wrap_Struct().  The pointer to allocated structure will be
-assigned to sval, which should be the pointer to the type specified.
+Arguments klass, mark, and free work like their counterparts in
+Data_Wrap_Struct().  A pointer to the allocated structure will be
+assigned to sval, which should be a pointer of the type specified.
 
 To retrieve the C pointer from the Data object, use the macro
 Data_Get_Struct().
 
   Data_Get_Struct(obj, type, sval)
 
-The pointer to the structure will be assigned to the variable sval.
+A pointer to the structure will be assigned to the variable sval.
 
-See example below for detail. 
+See the example below for details. 
 
-4��Example - Creating dbm extension
+4. Example - Creating dbm extension
 
-OK, here's the example to make extension library.  This is the
-extension to access dbm.  The full source is included in ext/
+OK, here's the example of making an extension library.  This is the
+extension to access DBMs.  The full source is included in the ext/
 directory in the Ruby's source tree.
 
 (1) make the directory
@@ -429,34 +596,30 @@ directory in the Ruby's source tree.
 
 Make a directory for the extension library under ext directory.
 
-(2) create MANIFEST file
-
-  % cd ext/dbm
-  % touch MANIFEST
-
-There should be MANIFEST file in the directory for the extension
-library.  Make empty file now.
-
-(3) design the library
+(2) design the library
 
 You need to design the library features, before making it.
 
-(4) write C code.
+(3) write C code.
 
 You need to write C code for your extension library.  If your library
 has only one source file, choosing ``LIBRARY.c'' as a file name is
-preferred.  On the other hand, in case your library has prural source
-files, avoid chooing ``LIBRARY.c'' for a file name.  It may conflict
-with intermediate file ``LIBRARY.o'' on some platforms.
+preferred.  On the other hand, in case your library has multiple source
+files, avoid choosing ``LIBRARY.c'' for a file name.  It may conflict
+with an intermediate file ``LIBRARY.o'' on some platforms.
+Note that some functions in mkmf library described below generate
+a file ``conftest.c'' for checking with compilation.  You shouldn't
+choose ``conftest.c'' as a name of a source file.
 
 Ruby will execute the initializing function named ``Init_LIBRARY'' in
-the library.  For exapmle, ``Init_dbm()'' will be executed when loading
+the library.  For example, ``Init_dbm()'' will be executed when loading
 the library.
 
 Here's the example of an initializing function.
 
 --
-Init_dbm()
+void
+Init_dbm(void)
 {
     /* define DBM class */
     cDBM = rb_define_class("DBM", rb_cObject);
@@ -472,10 +635,13 @@ Init_dbm()
     rb_define_method(cDBM, "[]", fdbm_fetch, 1);
 		:
 
+    /* ID for a instance variable to store DBM data */
+    id_dbm = rb_intern("dbm");
 }
 --
 
-The dbm extension wrap dbm struct in C world using Data_Make_Struct.
+The dbm extension wraps the dbm struct in the C environment using 
+Data_Make_Struct.
 
 --
 struct dbmdata {
@@ -484,13 +650,14 @@ struct dbmdata {
 };
 
 
-obj = Data_Make_Struct(class,struct dbmdata,0,free_dbm,dbmp);
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
 --
 
-This code wraps dbmdata structure into Ruby object.  We avoid wrapping
-DBM* directly, because we want to cache size information.
+This code wraps the dbmdata structure into a Ruby object.  We avoid
+wrapping DBM* directly, because we want to cache size information.
 
-To retrieve dbmdata structure from Ruby object, we define the macro below:
+To retrieve the dbmdata structure from a Ruby object, we define the
+following macro:
 
 --
 #define GetDBM(obj, dbmp) {\
@@ -499,16 +666,15 @@ To retrieve dbmdata structure from Ruby object, we define the macro below:
 }
 --
 
-This sort of complicated macro do the retrieving and close check for
+This sort of complicated macro does the retrieving and close checking for
 the DBM.
 
-There are three kind of way to receiving method arguments.  First, the
-methods with fixed number of arguments receives arguments like this:
+There are three kinds of way to receive method arguments.  First,
+methods with a fixed number of arguments receive arguments like this:
 
 --
 static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
+fdbm_delete(VALUE obj, VALUE keystr)
 {
 	:
 }
@@ -517,15 +683,12 @@ fdbm_delete(obj, keystr)
 The first argument of the C function is the self, the rest are the
 arguments to the method.
 
-Second, the methods with arbtrary number of arguments receives
+Second, methods with an arbitrary number of arguments receive
 arguments like this:
 
 --
 static VALUE
-fdbm_s_open(argc, argv, class)
-    int argc;
-    VALUE *argv;
-    VALUE class;
+fdbm_s_open(int argc, VALUE *argv, VALUE klass)
 {
 	:
     if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
@@ -535,21 +698,22 @@ fdbm_s_open(argc, argv, class)
 }
 --
 
-The first argument is the number of method arguments.  the second
-argument is the C array of the method arguments.  And the third
+The first argument is the number of method arguments, the second
+argument is the C array of the method arguments, and the third
 argument is the receiver of the method.
 
 You can use the function rb_scan_args() to check and retrieve the
-arguments.  For exapmle "11" means, the method requires at least one
-argument, and at most receives two arguments.
+arguments.  The third argument is a string that specifies how to
+capture method arguments and assign them to the following VALUE
+references.
+
 
-The methods with arbtrary number of arguments can receives arguments
-by Ruby's array, like this:
+The following is an example of a method that takes arguments by Ruby's
+array:
 
 --
 static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
+thread_initialize(VALUE thread, VALUE args)
 {
 	:
 }
@@ -560,139 +724,207 @@ which contains the arguments to the method.
 
 ** Notice
 
-GC should know about global variables which refers Ruby's objects, but
-not exported to the Ruby world.  You need to protect them by
+GC should know about global variables which refer to Ruby's objects, but
+are not exported to the Ruby world.  You need to protect them by
 
   void rb_global_variable(VALUE *var)
 
-(5) prepare extconf.rb
+(4) prepare extconf.rb
 
-If there exists the file named extconf.rb, it will be executed to
-generate Makefile.  If not, compilation scheme try to generate
-Makefile anyway.
+If the file named extconf.rb exists, it will be executed to generate
+Makefile.
 
-The extconf.rb is the file to check compilation condition etc.  You
+extconf.rb is the file for checking compilation conditions etc.  You
 need to put
 
   require 'mkmf'
 
-at the top of the file.  You can use the funcitons below to check the
-condition.
+at the top of the file.  You can use the functions below to check
+various conditions.
 
   have_library(lib, func): check whether library containing function exists.
-  have_func(func): check whether function exists
+  have_func(func, header): check whether function exists
   have_header(header): check whether header file exists
   create_makefile(target): generate Makefile
 
-The value of variables below will affect Makefile.
+The value of the variables below will affect the Makefile.
 
-  $CFLAGS: included in CFLAGS make variable (such as -I)
+  $CFLAGS: included in CFLAGS make variable (such as -O)
+  $CPPFLAGS: included in CPPFLAGS make variable (such as -I, -D)
   $LDFLAGS: included in LDFLAGS make variable (such as -L)
+  $objs: list of object file names
 
-If compilation condition is not fulfilled, you do not call
-``create_makefile''.  Makefile will not generated, compilation will
+Normally, the object files list is automatically generated by searching
+source files, but you must define them explicitly if any sources will
+be generated while building.
+
+If a compilation condition is not fulfilled, you should not call
+``create_makefile''.  The Makefile will not be generated, compilation will
 not be done.
 
-(6) prepare depend (optional)
+(5) prepare depend (optional)
 
 If the file named depend exists, Makefile will include that file to
-check dependency.  You can make this file by invoking
-
- % gcc -MM *.c > depend
+check dependencies.  You can make this file by invoking
 
-It's no harm.  Prepare it.
+  % gcc -MM *.c > depend
 
-(7) put file names into MANIFEST (optional)
+It's harmless.  Prepare it.
 
-  % find * -type f -print > MANIFEST
-  % vi MANIFEST
+(6) generate Makefile
 
-Append file names into MANIFEST.  The compilation scheme requires
-MANIFEST only to be exist.  But, you'd better take this step to
-distinguish required files.
+Try generating the Makefile by:
 
-(8) generate Makefile
+  ruby extconf.rb
 
-Try generate Makefile by:
+If the library should be installed under vendor_ruby directory
+instead of site_ruby directory, use --vendor option as follows.
 
-  ruby extconf.rb
+  ruby extconf.rb --vendor
 
-You don't need this step, if you put extension library under ext
+You don't need this step if you put the extension library under the ext
 directory of the ruby source tree.  In that case, compilation of the
 interpreter will do this step for you.
 
-(9) make
+(7) make
 
 Type
 
   make
 
-to compile your extension.  You don't need this step neither, if you
-put extension library under ext directory of the ruby source tree.
+to compile your extension.  You don't need this step either if you have
+put the extension library under the ext directory of the ruby source tree.
 
-(9) debug
+(8) debug
 
-You may need to rb_debug the extension.  The extensions can be linked
-statically by adding directory name in the ext/Setup file, so that you
-can inspect the extension with the debugger.
+You may need to rb_debug the extension.  Extensions can be linked
+statically by adding the directory name in the ext/Setup file so that
+you can inspect the extension with the debugger.
 
-(10) done, now you have the extension library
+(9) done, now you have the extension library
 
 You can do anything you want with your library.  The author of Ruby
-will not claim any restriction about your code depending Ruby API.
+will not claim any restrictions on your code depending on the Ruby API.
 Feel free to use, modify, distribute or sell your program.
 
 Appendix A. Ruby source files overview
 
 ruby language core
 
-  class.c
-  error.c
-  eval.c
-  gc.c
-  object.c
+  class.c         : classes and modules
+  error.c         : exception classes and exception mechanism
+  gc.c            : memory management
+  load.c          : library loading
+  object.c        : objects
+  variable.c      : variables and constants
+
+ruby syntax parser
   parse.y
-  variable.c
+    -> parse.c    : automatically generated
+  keywords        : reserved keywords
+    -> lex.c      : automatically generated
+
+ruby evaluator (a.k.a. YARV)
+  compile.c
+  eval.c
+  eval_error.c
+  eval_jump.c
+  eval_safe.c
+  insns.def           : definition of VM instructions
+  iseq.c              : implementation of VM::ISeq
+  thread.c            : thread management and context swiching
+  thread_win32.c      : thread implementation
+  thread_pthread.c    : ditto
+  vm.c
+  vm_dump.c
+  vm_eval.c
+  vm_exec.c
+  vm_insnhelper.c
+  vm_method.c
+
+  opt_insns_unif.def  : instruction unification
+  opt_operand.def     : definitions for optimization
+
+    -> insn*.inc      : automatically generated
+    -> opt*.inc       : automatically generated
+    -> vm.inc         : automatically generated
+
+regular expression engine (oniguruma)
+  regex.c
+  regcomp.c
+  regenc.c
+  regerror.c
+  regexec.c
+  regparse.c
+  regsyntax.c
 
 utility functions
 
-  dln.c
-  fnmatch.c
-  glob.c
-  regex.c
-  st.c
-  util.c
+  debug.c       : debug symbols for C debuggger
+  dln.c         : dynamic loading
+  st.c          : general purpose hash table
+  strftime.c    : formatting times
+  util.c        : misc utilities
 
 ruby interpreter implementation
 
   dmyext.c
+  dmydln.c 
+  dmyencoding.c
+  id.c
   inits.c
   main.c
   ruby.c
   version.c
 
+  gem_prelude.rb
+  prelude.rb
+
+
 class library
 
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  math.c
-  numeric.c
-  pack.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
+  array.c       : Array
+  bignum.c      : Bignum
+  compar.c      : Comparable
+  complex.c     : Complex
+  cont.c        : Fiber, Continuation
+  dir.c         : Dir
+  enum.c        : Enumerable
+  enumerator.c  : Enumerator
+  file.c        : File
+  hash.c        : Hash
+  io.c          : IO
+  marshal.c     : Marshal
+  math.c        : Math
+  numeric.c     : Numeric, Integer, Fixnum, Float
+  pack.c        : Array#pack, String#unpack
+  proc.c        : Binding, Proc
+  process.c     : Process
+  random.c      : random number
+  range.c       : Range
+  rational.c    : Rational
+  re.c          : Regexp, MatchData
+  signal.c      : Signal
+  sprintf.c     : 
+  string.c      : String
+  struct.c      : Struct
+  time.c        : Time
+
+  defs/known_errors.def  : Errno::* exception classes
+    -> known_errors.inc  : automatically generated
+
+multilingualization
+  encoding.c    : Encoding
+  transcode.c   : Encoding::Converter
+  enc/*.c       : encoding classes
+  enc/trans/*   : codepoint mapping tables
+
+goruby interpreter implementation
+  
+  goruby.c
+  golf_prelude.rb     : goruby specific libraries.
+    -> golf_prelude.c : automatically generated
+
 
 Appendix B. Ruby extension API reference
 
@@ -700,7 +932,7 @@ Appendix B. Ruby extension API reference
 
  VALUE
 
-The type for Ruby object.  Actual structures are defined in ruby.h,
+The type for the Ruby object.  Actual structures are defined in ruby.h,
 such as struct RString, etc.  To refer the values in structures, use
 casting macros like RSTRING(obj).
 
@@ -720,14 +952,15 @@ const: false object
 
 ** C pointer wrapping
 
- Data_Wrap_Struct(VALUE class, void (*mark)(), void (*free)(), void *sval)
+ Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
 
-Wrap C pointer into Ruby object.  If object has references to other
-Ruby object, they should be marked by using mark function during GC
-process.  Otherwise, mark should be 0.  When this object is no longer
-referred by anywhere, the pointer will be discarded by free function.
+Wrap a C pointer into a Ruby object.  If object has references to other
+Ruby objects, they should be marked by using the mark function during
+the GC process.  Otherwise, mark should be 0.  When this object is no
+longer referred by anywhere, the pointer will be discarded by free
+function.
 
- Data_Make_Struct(class, type, mark, free, sval)
+ Data_Make_Struct(klass, type, mark, free, sval)
 
 This macro allocates memory using malloc(), assigns it to the variable
 sval, and returns the DATA encapsulating the pointer to memory region.
@@ -737,73 +970,101 @@ sval, and returns the DATA encapsulating the pointer to memory region.
 This macro retrieves the pointer value from DATA, and assigns it to
 the variable sval. 
 
+** Checking data types
+
+TYPE(value)
+FIXNUM_P(value)
+NIL_P(value)
+void Check_Type(VALUE value, int type)
+void Check_SafeStr(VALUE value)
+
+** Data type conversion
+
+FIX2INT(value), INT2FIX(i)
+FIX2LONG(value), LONG2FIX(l)
+NUM2INT(value), INT2NUM(i)
+NUM2UINT(value), UINT2NUM(ui)
+NUM2LONG(value), LONG2NUM(l)
+NUM2ULONG(value), ULONG2NUM(ul)
+NUM2LL(value), LL2NUM(ll)
+NUM2ULL(value), ULL2NUM(ull)
+NUM2OFFT(value), OFFT2NUM(off)
+NUM2SIZET(value), SIZET2NUM(size)
+NUM2SSIZET(value), SSIZET2NUM(ssize)
+NUM2DBL(value)
+rb_float_new(f)
+StringValue(value)
+StringValuePtr(value)
+StringValueCStr(value)
+rb_str_new2(s)
+
 ** defining class/module
 
- VALUE rb_define_class(char *name, VALUE super)
+ VALUE rb_define_class(const char *name, VALUE super)
 
-Defines new Ruby class as subclass of super.
+Defines a new Ruby class as a subclass of super.
 
- VALUE rb_define_class_under(VALUE module, char *name, VALUE super)
+ VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
 
-Creates new Ruby class as subclass of super, under the module's
+Creates a new Ruby class as a subclass of super, under the module's
 namespace.
 
- VALUE rb_define_module(char *name)
+ VALUE rb_define_module(const char *name)
 
-Defines new Ruby module.
+Defines a new Ruby module.
 
- VALUE rb_define_module_under(VALUE module, char *name, VALUE super)
+ VALUE rb_define_module_under(VALUE module, const char *name)
 
-Defines new Ruby module, under the modules's namespace.
+Defines a new Ruby module under the module's namespace.
 
- void rb_include_module(VALUE class, VALUE module)
+ void rb_include_module(VALUE klass, VALUE module)
 
 Includes module into class.  If class already includes it, just
-ignore.
+ignored.
 
  void rb_extend_object(VALUE object, VALUE module)
 
-Extend the object with module's attribute.
+Extend the object with the module's attributes.
 
 ** Defining Global Variables
 
- void rb_define_variable(char *name, VALUE *var)
+ void rb_define_variable(const char *name, VALUE *var)
 
 Defines a global variable which is shared between C and Ruby.  If name
-contains the character which is not allowed to be part of the symbol,
+contains a character which is not allowed to be part of the symbol,
 it can't be seen from Ruby programs.
 
- void rb_define_readonly_variable(char *name, VALUE *var)
+ void rb_define_readonly_variable(const char *name, VALUE *var)
 
 Defines a read-only global variable.  Works just like
-rb_define_variable(), except defined variable is read-only.
+rb_define_variable(), except the defined variable is read-only.
 
- void rb_define_virtual_variable(char *name,
-				VALUE (*getter)(), VALUE (*setter)())
+ void rb_define_virtual_variable(const char *name,
+				 VALUE (*getter)(), VALUE (*setter)())
 
-Defines a virtual variable, whose behavior is defined by pair of C
+Defines a virtual variable, whose behavior is defined by a pair of C
 functions.  The getter function is called when the variable is
-referred. The setter function is called when the value is set to the
-variable.  The prototype for getter/setter functions are:
+referenced.  The setter function is called when the variable is set to a
+value.  The prototype for getter/setter functions are:
 
 	VALUE getter(ID id)
 	void setter(VALUE val, ID id)
 
 The getter function must return the value for the access.
 
- void rb_define_hooked_variable(char *name, VALUE *var,
+ void rb_define_hooked_variable(const char *name, VALUE *var,
 				VALUE (*getter)(), VALUE (*setter)())
 
-Defines hooked variable.  It's virtual variable with C variable.  The
-getter is called as
+Defines hooked variable.  It's a virtual variable with a C variable.  
+The getter is called as
 
 	VALUE getter(ID id, VALUE *var)
 
-returning new value.  The setter is called as
+returning a new value.  The setter is called as
 
 	void setter(VALUE val, ID id, VALUE *var)
 
-GC requires to mark the C global variables which hold Ruby values.
+GC requires C global variables which hold Ruby values to be marked.
 
  void rb_global_variable(VALUE *var)
 
@@ -811,141 +1072,223 @@ Tells GC to protect these variables.
 
 ** Constant Definition
 
- void rb_define_const(VALUE klass, char *name, VALUE val)
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
 
 Defines a new constant under the class/module.
 
- void rb_define_global_const(char *name, VALUE val)
+ void rb_define_global_const(const char *name, VALUE val)
 
-Defines global contant.  This is just work as
+Defines a global constant.  This is just the same as
 
      rb_define_const(cKernal, name, val)
 
 ** Method Definition
 
- rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
+ rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
 
 Defines a method for the class.  func is the function pointer.  argc
 is the number of arguments.  if argc is -1, the function will receive
-3 arguments argc, argv, and self.  if argc is -2, the function will
-receive 2 arguments, self and args, where args is the Ruby array of
+3 arguments: argc, argv, and self.  if argc is -2, the function will
+receive 2 arguments, self and args, where args is a Ruby array of
 the method arguments.
 
- rb_define_private_method(VALUE class, char *name, VALUE (*func)(), int argc)
+ rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
 
 Defines a private method for the class.  Arguments are same as
 rb_define_method().
 
- rb_define_singleton_method(VALUE class, char *name, VALUE (*func)(), int argc)
+ rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
 
 Defines a singleton method.  Arguments are same as rb_define_method().
 
- rb_scan_args(int argc, VALUE *argv, char *fmt, ...)
+ rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+Retrieve argument from argc and argv to given VALUE references
+according to the format string.  The format can be described in ABNF
+as follows:
 
-Retrieve argument from argc, argv.  The fmt is the format string for
-the arguments, such as "12" for 1 non-optinal argument, 2 optinal
-aruguments.  If `*' appears at the end of fmt, it means the rest of
-the arguments are assigned to corresponding variable, packed in
-array.
+--
+scan-arg-spec  := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
+pre-arg-spec   := num-of-leading-mandatory-args [num-of-optional-args]
+post-arg-spec  := sym-for-variable-length-args [num-of-trailing-mandatory-args]
+pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
+option-hash-arg-spec := sym-for-option-hash-arg
+block-arg-spec := sym-for-block-arg
+
+num-of-leading-mandatory-args  := DIGIT ; The number of leading
+                                        ; mandatory arguments
+num-of-optional-args           := DIGIT ; The number of optional
+                                        ; arguments
+sym-for-variable-length-args   := "*"   ; Indicates that variable
+                                        ; length arguments are
+                                        ; captured as a ruby array
+num-of-trailing-mandatory-args := DIGIT ; The number of trailing
+                                        ; mandatory arguments
+sym-for-option-hash-arg        := ":"   ; Indicates that an option
+                                        ; hash is captured if the last
+                                        ; argument is a hash or can be
+                                        ; converted to a hash with
+                                        ; #to_hash.  When the last
+                                        ; argument is nil, it is
+                                        ; captured if it is not
+                                        ; ambiguous to take it as
+                                        ; empty option hash; i.e. '*'
+                                        ; is not specified and
+                                        ; arguments are given more
+                                        ; than sufficient.
+sym-for-block-arg              := "&"   ; Indicates that an iterator
+                                        ; block should be captured if
+                                        ; given
+--
+
+For example, "12" means that the method requires at least one
+argument, and at most receives three (1+2) arguments.  So, the format
+string must be followed by three variable references, which are to be
+assigned to captured arguments.  For omitted arguments, variables are
+set to Qnil.  NULL can be put in place of a variable reference, which
+means the corresponding captured argument(s) should be just dropped.
+
+The number of given arguments, excluding an option hash or iterator
+block, is returned.
 
 ** Invoking Ruby method
 
  VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
 
-Invokes the method.  To retrieve mid from method name, use rb_intern().
+Invokes a method.  To retrieve mid from a method name, use rb_intern().
 
  VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
 
-Invokes method, passing arguments by array of values.
+Invokes a method, passing arguments by an array of values.
 
- VALUE rb_eval_string(char *str)
+ VALUE rb_eval_string(const char *str)
 
-Compiles and executes the string as Ruby program.
+Compiles and executes the string as a Ruby program.
 
- ID rb_intern(char *name)
+ ID rb_intern(const char *name)
 
-Returns ID corresponding the name.
+Returns ID corresponding to the name.
 
  char *rb_id2name(ID id)
 
 Returns the name corresponding ID.
 
- char *rb_class2name(VALUE class)
+ char *rb_class2name(VALUE klass)
 
 Returns the name of the class.
 
+ int rb_respond_to(VALUE object, ID id)
+
+Returns true if the object responds to the message specified by id.
+
 ** Instance Variables
 
- VALUE rb_iv_get(VALUE obj, char *name)
+ VALUE rb_iv_get(VALUE obj, const char *name)
 
 Retrieve the value of the instance variable.  If the name is not
 prefixed by `@', that variable shall be inaccessible from Ruby.
 
- VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
+ VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
 
 Sets the value of the instance variable.
 
 ** Control Structure
 
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ VALUE rb_block_call(VALUE recv, ID mid, int argc, VALUE * argv,
+		     VALUE (*func) (ANYARGS), VALUE data2)
+
+Calls a method on the recv, with the method name specified by the
+symbol mid, with argc arguments in argv, supplying func as the
+block. When func is called as the block, it will receive the value
+from yield as the first argument, and data2 as the second argument.
+When yielded with multiple values (in C, rb_yield_values(),
+rb_yield_values2() and rb_yield_splat()), data2 is packed as an Array,
+whereas yielded values can be gotten via argc/argv of the third/fourth
+arguments.
+
+ [OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
 
 Calls the function func1, supplying func2 as the block.  func1 will be
 called with the argument arg1.  func2 receives the value from yield as
 the first argument, arg2 as the second argument.
-
  
+When rb_iterate is used in 1.9, func1 has to call some Ruby-level method.
+This function is obsolete since 1.9; use rb_block_call instead.
+
  VALUE rb_yield(VALUE val)
 
 Evaluates the block with value val.
 
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+ VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
 
-Calls the function func1, with arg1 as the argument.  If exception
+Calls the function func1, with arg1 as the argument.  If an exception
 occurs during func1, it calls func2 with arg2 as the argument.  The
 return value of rb_rescue() is the return value from func1 if no
 exception occurs, from func2 otherwise.
 
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+ VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
 
 Calls the function func1 with arg1 as the argument, then calls func2
-with arg2, whenever execution terminated.  The return value from
-rb_ensure() is that of func1.
+with arg2 if execution terminated.  The return value from
+rb_ensure() is that of func1 when no exception occured.
+
+ VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
+
+Calls the function func with arg as the argument.  If no exception
+occured during func, it returns the result of func and *state is zero.
+Otherwise, it returns Qnil and sets *state to nonzero.  If state is
+NULL, it is not set in both cases.
+
+ void rb_jump_tag(int state)
+
+Continues the exception caught by rb_protect() and rb_eval_string_protect().
+state must be the returned value from those functions.  This function
+never return to the caller.
 
 ** Exceptions and Errors
 
- void rb_warn(char *fmt, ...)
+ void rb_warn(const char *fmt, ...)
 
-Prints warning message according to the printf-like format.
+Prints a warning message according to a printf-like format.
 
- void rb_warning(char *fmt, ...)
+ void rb_warning(const char *fmt, ...)
 
-Prints warning message according to the printf-like format, if
+Prints a warning message according to a printf-like format, if
 $VERBOSE is true.
 
- void rb_raise(VALUE exception, char *fmt, ...)
+void rb_raise(rb_eRuntimeError, const char *fmt, ...)
+
+Raises RuntimeError.  The fmt is a format string just like printf().
 
-Raises an exception of class exception.  The fmt is the format string
-just like printf().
+ void rb_raise(VALUE exception, const char *fmt, ...)
 
- void rb_fatal(char *fmt, ...)
+Raises a class exception.  The fmt is a format string just like printf().
 
-Raises fatal error, terminates the interpreter.  No exception handling
-will be done for fatal error, but ensure blocks will be executed.
+ void rb_fatal(const char *fmt, ...)
 
- void rb_bug(char *fmt, ...)
+Raises a fatal error, terminates the interpreter.  No exception handling
+will be done for fatal errors, but ensure blocks will be executed.
 
-Termintates the interpreter immediately.  This function should be
+ void rb_bug(const char *fmt, ...)
+
+Terminates the interpreter immediately.  This function should be
 called under the situation caused by the bug in the interpreter.  No
 exception handling nor ensure execution will be done.
 
-** Initialize and Starts the Interpreter
+** Initialize and Start the Interpreter
 
-The embedding API are below (not needed for extension libraries):
+The embedding API functions are below (not needed for extension libraries):
 
- void ruby_init(int argc, char **argv, char **envp)
+ void ruby_init()
 
 Initializes the interpreter.
 
+ void ruby_options(int argc, char **argv)
+
+Process command line arguments for the interpreter.
+
  void ruby_run()
 
 Starts execution of the interpreter.
@@ -954,30 +1297,171 @@ Starts execution of the interpreter.
 
 Specifies the name of the script ($0).
 
-Appendix B. Functions Available in extconf.rb
+** Hooks for the Interpreter Events
+
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
+
+Adds a hook function for the specified interpreter events.
+events should be Or'ed value of:
+
+	RUBY_EVENT_LINE
+	RUBY_EVENT_CLASS
+	RUBY_EVENT_END
+	RUBY_EVENT_CALL
+	RUBY_EVENT_RETURN
+	RUBY_EVENT_C_CALL
+	RUBY_EVENT_C_RETURN
+	RUBY_EVENT_RAISE
+	RUBY_EVENT_ALL
+
+The definition of rb_event_hook_func_t is below:
+
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
+ 				      VALUE self, ID id, VALUE klass)
+
+The third argument `data' to rb_add_event_hook() is passed to the hook
+function as the second argument, which was the pointer to the current
+NODE in 1.8.  See RB_EVENT_HOOKS_HAVE_CALLBACK_DATA below.
+
+ int rb_remove_event_hook(rb_event_hook_func_t func)
+
+Removes the specified hook function.
+
+** Macros for the Compatibilities
+
+Some macros to check API compatibilities are available by default.
+
+ NORETURN_STYLE_NEW
+
+Means that NORETURN macro is functional style instead of prefix.
+
+ HAVE_RB_DEFINE_ALLOC_FUNC
+
+Means that function rb_define_alloc_func() is provided, that means the
+allocation framework is used.  This is same as the result of
+have_func("rb_define_alloc_func", "ruby.h").
+
+ HAVE_RB_REG_NEW_STR
+
+Means that function rb_reg_new_str() is provided, that creates Regexp
+object from String object.  This is same as the result of
+have_func("rb_reg_new_str", "ruby.h").
+
+ HAVE_RB_IO_T
+
+Means that type rb_io_t is provided.
+
+ USE_SYMBOL_AS_METHOD_NAME
+
+Means that Symbols will be returned as method names, e.g.,
+Module#methods, #singleton_methods and so on.
+
+ HAVE_RUBY_*_H
+
+Defined in ruby.h and means correspoinding header is available.  For
+instance, when HAVE_RUBY_ST_H is defined you should use ruby/st.h not
+mere st.h.
+
+ RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
+
+Means that rb_add_event_hook() takes the third argument `data', to be
+passed to the given event hook function.
+
+Appendix C. Functions Available in extconf.rb
 
 These functions are available in extconf.rb:
 
+ have_macro(macro, headers)
+
+Checks whether macro is defined with header.  Returns true if the macro
+is defined.
+
  have_library(lib, func)
 
-Checks whether library which contains specified function exists.
+Checks whether the library exists, containing the specified function.
 Returns true if the library exists.
 
- have_func(func)
+ find_library(lib, func, path...)
+
+Checks whether a library which contains the specified function exists in
+path.  Returns true if the library exists.
 
-Checks whether func exists.  Returns true if the function exists.  To
-check functions in the additional library, you need to check that
-library first using have_library().
+ have_func(func, header)
+
+Checks whether func exists with header.  Returns true if the function
+exists.  To check functions in an additional library, you need to
+check that library first using have_library().
+
+ have_var(var, header)
+
+Checks whether var exists with header.  Returns true if the variable
+exists.  To check variables in an additional library, you need to
+check that library first using have_library().
 
  have_header(header)
 
-Checks for the header files.  Returns true if the header file exists.
+Checks whether header exists.  Returns true if the header file exists.
+
+ find_header(header, path...)
+
+Checks whether header exists in path.  Returns true if the header file
+exists.
+
+ have_struct_member(type, member, header)
+
+Checks whether type has member with header.  Returns true if the type
+is defined and has the member.
+
+ have_type(type, header, opt)
+
+Checks whether type is defined with header.  Returns true if the type
+is defined.
+
+ check_sizeof(type, header)
+
+Checks the size of type in char with header.  Returns the size if the
+type is defined, otherwise nil.
 
  create_makefile(target)
 
 Generates the Makefile for the extension library.  If you don't invoke
 this method, the compilation will not be done.
 
+ find_executable(bin, path)
+
+Finds command in path, which is File::PATH_SEPARATOR-separated list of
+directories.  If path is nil or omitted, environment variable PATH
+will be used.  Returns the path name of the command if it is found,
+otherwise nil.
+
+ with_config(withval[, default=nil])
+
+Parses the command line options and returns the value specified by
+--with-<withval>.
+
+ enable_config(config, *defaults)
+ disable_config(config, *defaults)
+
+Parses the command line options for boolean.  Returns true if
+--enable-<config> is given, or false if --disable-<config> is given.
+Otherwise, yields defaults to the given block and returns the result
+if it is called with a block, or returns defaults.
+
+ dir_config(target[, default_dir])
+ dir_config(target[, default_include, default_lib])
+
+Parses the command line options and adds the directories specified by
+--with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
+to $CFLAGS and/or $LDFLAGS.  --with-<target>-dir=/path is equivalent to
+--with-<target>-include=/path/include --with-<target>-lib=/path/lib.
+Returns an array of the added directories ([include_dir, lib_dir]).
+
+ pkg_config(pkg)
+
+Obtains the information for pkg by pkg-config command.  The actual
+command name can be overridden by --with-pkg-config command line
+option.
+
 /*
  * Local variables:
  * fill-column: 70
diff --git a/README.EXT.ja b/README.EXT.ja
new file mode 100644
index 0000000000..f2d7609ff5
--- /dev/null
+++ b/README.EXT.ja
@@ -0,0 +1,1570 @@
+.\" README.EXT.ja -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
+
+Ruby�γ�ĥ�饤�֥��κ�������������ޤ���
+
+1�������μ�
+
+C���ѿ��ˤϷ������ꡤ�ǡ����ˤϷ�������ޤ��󡥤Ǥ����顤��
+�Ȥ��Хݥ��󥿤�int���ѿ�����������ȡ������ͤ������Ȥ��Ƽ�
+�갷���ޤ����դ�Ruby���ѿ��ˤϷ����ʤ����ǡ����˷��������
+�������ΰ㤤�Τ��ᡤC��Ruby����ߤ��Ѵ����ʤ���С����ߤ���
+�ǡ����򥢥������Ǥ��ޤ���
+
+Ruby�Υǡ�����VALUE�Ȥ���C�η���ɽ������ޤ���VALUE���Υǡ�
+���Ϥ��Υǡ��������פ�ʬ���ΤäƤ��ޤ������Υǡ��������פ�
+�����Τϥǡ���(���֥�������)�μºݤι�¤���̣���Ƥ��ơ�Ruby
+�Υ��饹�ȤϤޤ���ä���ΤǤ���
+
+VALUE����C�ˤȤäư�̣�Τ���ǡ�������Ф�����ˤ�
+
+ (1) VALUE�Υǡ��������פ��Τ�
+ (2) VALUE��C�Υǡ������Ѵ�����
+
+��ξ����ɬ�פǤ���(1)��˺���ȴְ�ä��ǡ������Ѵ����Ԥ��
+�ơ��ǰ��ץ�����बcore dump���ޤ���
+
+1.1 �ǡ���������
+
+Ruby�ˤϥ桼�����Ȥ���ǽ���Τ���ʲ��Υ����פ�����ޤ���
+
+	T_NIL		nil
+	T_OBJECT	�̾�Υ��֥�������
+	T_CLASS		���饹
+	T_MODULE	�⥸�塼��
+	T_FLOAT		��ư��������
+	T_STRING	ʸ����
+	T_REGEXP	����ɽ��
+	T_ARRAY		����
+	T_HASH		Ϣ������
+	T_STRUCT	(Ruby��)��¤��
+	T_BIGNUM	¿��Ĺ����
+	T_FIXNUM	Fixnum(31bit�ޤ���63bitĹ����)
+	T_COMPLEX	ʣ�ǿ�
+	T_RATIONAL	ͭ����
+	T_FILE		������
+	T_TRUE		��
+	T_FALSE		��
+	T_DATA		�ǡ���
+	T_SYMBOL	����ܥ�
+
+����¾�����������Ѥ���Ƥ���ʲ��Υ����פ�����ޤ���
+
+	T_ICLASS
+	T_MATCH
+	T_UNDEF
+	T_NODE
+	T_ZOMBIE
+
+�ۤȤ�ɤΥ����פ�C�ι�¤�ΤǼ�������Ƥ��ޤ���
+
+1.2 VALUE�Υǡ��������פ�����å�����
+
+ruby.h�Ǥ�TYPE()�Ȥ����ޥ������������Ƥ��ơ�VALUE�Υǡ���
+�����פ��Τ뤳�Ȥ�����ޤ���TYPE()�ޥ����Ͼ�ǾҲ𤷤�T_XXXX
+�η�����������֤��ޤ���VALUE�Υǡ��������פ˱����ƽ�������
+���ˤϡ�TYPE()���ͤ�ʬ�����뤳�Ȥˤʤ�ޤ���
+
+  switch (TYPE(obj)) {
+    case T_FIXNUM:
+      /* FIXNUM�ν��� */
+      break;
+    case T_STRING:
+      /* ʸ����ν��� */
+      break;
+    case T_ARRAY:
+      /* ����ν��� */
+      break;
+    default:
+      /* �㳰��ȯ�������� */
+      rb_raise(rb_eTypeError, "not valid value");
+      break;
+  }
+
+����ȥǡ��������פ�����å����ơ��������ʤ�����㳰��ȯ����
+��ؿ����Ѱդ���Ƥ��ޤ���
+
+  void Check_Type(VALUE value, int type)
+
+���δؿ���value��type��̵����С��㳰��ȯ�������ޤ���������
+����Ϳ����줿VALUE�Υǡ��������פ����������ɤ��������å���
+�뤿��ˤϡ����δؿ���Ȥ��ޤ���
+
+FIXNUM��NIL�˴ؤ��ƤϤ���®��Ƚ�̥ޥ������Ѱդ���Ƥ��ޤ���
+
+  FIXNUM_P(obj)
+  NIL_P(obj)
+
+1.3 VALUE��C�Υǡ������Ѵ�����
+
+�ǡ��������פ�T_NIL��T_FALSE��T_TRUE�Ǥ�������ǡ����Ϥ��줾
+��nil��false��true�Ǥ������Υǡ��������פΥ��֥������ȤϤҤ�
+�Ĥ��Ĥ���¸�ߤ��ޤ���
+
+�ǡ��������פ�T_FIXNUM�λ��������31bit�ޤ���63bit�Υ�������
+���������Ǥ���long�Υ�������32bit�Υץ�åȥե�����Ǥ����
+31bit�ˡ�long�Υ�������64bit�Υץ�åȥե�����Ǥ����63bit
+�ˤʤ�ޤ�. FIXNUM �� C ���������Ѵ����뤿��ˤϥޥ���
+��FIX2INT()�פޤ��ϡ�FIX2LONG()�פ�Ȥ��ޤ��������Υޥ���
+����Ѥ���ݤˤϻ����˥ǡ��������פ�FIXNUM�Ǥ��뤳�Ȥ��ǧ��
+��ɬ�פ�����ޤ��������Ū��®���Ѵ���Ԥ����Ȥ��Ǥ��ޤ�����
+������FIX2LONG()�פ��㳰��ȯ�����ޤ��󤬡���FIX2INT()�פ���
+����̤�int�Υ������˼��ޤ�ʤ����ˤ��㳰��ȯ�����ޤ���
+���줫�顤FIXNUM�˸¤餺Ruby�Υǡ������������Ѵ�����
+��NUM2INT()�פ���ӡ�NUM2LONG()�פȤ����ޥ���������ޤ�����
+���Υޥ����ϥޥ����ϥǡ��������פΥ����å�̵���ǻȤ��ޤ�
+(�������Ѵ��Ǥ��ʤ����ˤ��㳰��ȯ������)��Ʊ�ͤ˥����å�̵
+�ǻȤ����Ѵ��ޥ�����double����Ф���NUM2DBL()�פ�����ޤ���
+
+char* ����Ф���硤 StringValue() �� StringValuePtr() 
+��Ȥ��ޤ���
+StringValue(var) �� var �� String 
+�Ǥ���в��⤻���������Ǥʤ���� var �� var.to_str() �η��
+���֤�������ޥ�����StringValuePtr(var) ��Ʊ�ͤ� var ��
+String ���֤������Ƥ��� var �ΥХ�����ɽ�����Ф��� char* ��
+�֤��ޥ����Ǥ���var �����Ƥ�ľ���֤����������������Τǡ�
+var �� lvalue �Ǥ���ɬ�פ�����ޤ���
+�ޤ���StringValuePtr() ��������� StringValueCStr() �Ȥ�����
+�����⤢��ޤ���StringValueCStr(var) �� var �� String ���֤�
+�����Ƥ��� var ��ʸ����ɽ�����Ф��� char* ���֤��ޤ����֤���
+��ʸ����������ˤ� nul ʸ�����ղä���ޤ����ʤ�������� nul
+ʸ�����ޤޤ����� ArgumentError ��ȯ�����ޤ���
+������StringValuePtr() �Ǥϡ������� nul ʸ���������ݾڤϤʤ���
+����� nul ʸ�����ޤޤ�Ƥ����ǽ���⤢��ޤ���
+
+����ʳ��Υǡ��������פ��б�����C�ι�¤�Τ�����ޤ����б���
+�빽¤�ΤΤ���VALUE�Ϥ��Τޤޥ��㥹��(���Ѵ�)����й�¤�Τ�
+�ݥ��󥿤��Ѵ��Ǥ��ޤ���
+
+��¤�Τϡ�struct RXxxxx�פȤ���̾����ruby.h���������Ƥ���
+�����㤨��ʸ����ϡ�struct RString�פǤ����ºݤ˻Ȥ���ǽ����
+����Τ�ʸ��������󤯤餤���Ȼפ��ޤ���
+
+ruby.h�ǤϹ�¤�Τإ��㥹�Ȥ���ޥ������RXXXXX()��(������ʸ
+���ˤ������)�Ȥ���̾�����󶡤���Ƥ��ޤ�(��: RSTRING())��
+
+��¤�Τ���ǡ�������Ф��ޥ������󶡤���Ƥ��ޤ���ʸ����
+str��Ĺ�������뤿��ˤϡ�RSTRING_LEN(str)�פȤ���ʸ����str��
+char*�Ȥ������뤿��ˤϡ�RSTRING_PTR(str)�פȤ��ޤ��������
+���ˤϡ����줾���RARRAY_LEN(ary)�ס���RARRAY_PTR(ary)�פ�
+�ʤ�ޤ���
+
+Ruby�ι�¤�Τ�ľ�ܥ�������������˵���Ĥ��ʤ���Фʤ�ʤ���
+�Ȥϡ������ʸ����ι�¤�Τ���Ȥϻ��Ȥ�������ǡ�ľ���ѹ���
+�ʤ����ȤǤ���ľ���ѹ�������硤���֥������Ȥ����Ƥ���������
+�Ȥ�ʤ��ʤäơ��פ�̥Х��θ����ˤʤ�ޤ���
+
+1.4 C�Υǡ�����VALUE���Ѵ�����
+
+VALUE�μºݤι�¤��
+
+  * FIXNUM�ξ��
+
+    1bit�����եȤ��ơ�LSB��Ω�Ƥ롥
+
+  * ����¾�Υݥ��󥿤ξ��
+
+    ���Τޤ�VALUE�˥��㥹�Ȥ��롥
+
+�ȤʤäƤ��ޤ�����äơ�LSB������å������VALUE��FIXNUM����
+�����狼��櫓�Ǥ�(�ݥ��󥿤�LSB��Ω�äƤ��ʤ����Ȥ��ꤷ��
+����)��
+
+�Ǥ����顤FIXNUM�ʳ���Ruby�Υ��֥������Ȥι�¤�Τ�ñ��VALUE
+�˥��㥹�Ȥ��������VALUE���Ѵ�����ޤ�����������Ǥ�դι�¤
+�Τ�VALUE�˥��㥹�Ƚ����櫓�ǤϤ���ޤ��󡥥��㥹�Ȥ����
+��Ruby���ΤäƤ��빽¤��(ruby.h���������Ƥ���struct RXxxx
+�Τ��)�����Ǥ���
+
+FIXNUM�˴ؤ��Ƥ��Ѵ��ޥ������ͳ����ɬ�פ�����ޤ���C������
+����VALUE���Ѵ�����ޥ����ϰʲ��Τ�Τ�����ޤ���ɬ�פ˱���
+�ƻȤ�ʬ���Ƥ���������
+
+  INT2FIX()	��Ȥ�������31bit�ޤ���63bit����˼��ޤ뼫��
+		�������
+  INT2NUM()	Ǥ�դ���������VALUE��
+
+INT2NUM()��������FIXNUM���ϰϤ˼��ޤ�ʤ���硤Bignum���Ѵ�
+���Ƥ���ޤ�(���������٤�)��
+
+1.5 Ruby�Υǡ���������
+
+������Ҥ٤��̤ꡤRuby�ι�¤�Τ򥢥���������������Ƥι�����
+�Ԥ����Ȥϴ�����ޤ��󡥤ǡ�Ruby�Υǡ�����������ˤ�
+Ruby���Ѱդ��Ƥ���ؿ����Ѥ��Ƥ���������
+
+�����ǤϤ�äȤ�Ȥ���Ǥ�����ʸ��������������/�����
+���ؿ��򤢤��ޤ�(�����ǤϤʤ��Ǥ�)��
+
+ ʸ������Ф���ؿ�
+
+  rb_str_new(const char *ptr, long len)
+
+    ������Ruby��ʸ������������롥
+
+  rb_str_new2(const char *ptr)
+  rb_str_new_cstr(const char *ptr)
+
+    C��ʸ���󤫤�Ruby��ʸ������������롥���δؿ��ε�ǽ��
+    rb_str_new(ptr, strlen(ptr))��Ʊ���Ǥ��롥
+
+  rb_tainted_str_new(const char *ptr, long len)
+
+    �����ޡ������ղä��줿������Ruby��ʸ������������롥����
+    ����Υǡ����˴�Ť�ʸ����ˤϱ����ޡ������ղä����٤�
+    �Ǥ��롥
+
+  rb_tainted_str_new2(const char *ptr)
+  rb_tainted_str_new_cstr(const char *ptr)
+
+    C��ʸ���󤫤�����ޡ������ղä��줿Ruby��ʸ������������롥
+
+  rb_sprintf(const char *format, ...)
+  rb_vsprintf(const char *format, va_list ap)
+
+    C��ʸ����format��³��������printf(3)�Υե����ޥåȤˤ������ä�
+    ��������Ruby��ʸ������������롥
+
+  rb_str_cat(VALUE str, const char *ptr, long len)
+
+    Ruby��ʸ����str��len�Х��Ȥ�ʸ����ptr���ɲä��롥
+
+  rb_str_cat2(VALUE str, const char* ptr)
+
+    Ruby��ʸ����str��C��ʸ����ptr���ɲä��롥���δؿ��ε�ǽ��
+    rb_str_cat(str, ptr, strlen(ptr))��Ʊ���Ǥ��롥
+
+  rb_str_catf(VALUE str, const char* format, ...)
+  rb_str_vcatf(VALUE str, const char* format, va_list ap)
+
+    C��ʸ����format��³��������printf(3)�Υե����ޥåȤˤ������ä�
+    ��������Ruby��ʸ����str���ɲä��롥���δؿ��ε�ǽ�ϡ����줾��
+    rb_str_cat2(str, rb_sprintf(format, ...)) ��
+    rb_str_cat2(str, rb_vsprintf(format, ap)) ��Ʊ���Ǥ��롥
+
+  rb_enc_str_new(const char *ptr, long len, rb_encoding *enc)
+  
+    ���ꤵ�줿���󥳡��ǥ��󥰤�Ruby��ʸ�������������.
+     
+  rb_usascii_str_new(const char *ptr, long len)
+  rb_usascii_str_new_cstr(const char *ptr)
+
+    ���󥳡��ǥ��󥰤�US-ASCII��Ruby��ʸ�������������.
+
+  rb_str_resize(VALUE str, long len)
+
+    Ruby��ʸ����Υ�������len�Х��Ȥ��ѹ����롥str��Ĺ������
+    �ʤƥ��åȤ���Ƥ��ʤ���Фʤ�ʤ���len������Ĺ������û
+    �����ϡ�len�Х��Ȥ�ۤ�����ʬ�����ƤϼΤƤ��롥len����
+    ��Ĺ������Ĺ�����ϡ�����Ĺ����ۤ�����ʬ�����Ƥ���¸��
+    ��ʤ��ǥ��ߤˤʤ�����������δؿ��θƤӽФ��ˤ�ä�
+    RSTRING_PTR(str)���ѹ�����뤫�⤷��ʤ����Ȥ����ա�
+
+  rb_str_set_len(VALUE str, long len)
+
+    Ruby��ʸ����Υ�������len�Х��Ȥ˥��åȤ��롥str���ѹ���
+    ǽ�Ǥʤ�����㳰��ȯ�����롥RSTRING_LEN(str)�Ȥ�̵�ط��ˡ�
+    len�Х��ȤޤǤ����Ƥ���¸����롥len��str�����̤�ۤ��Ƥ�
+    �ƤϤʤ�ʤ���
+
+
+ ������Ф���ؿ�
+
+  rb_ary_new()
+
+    ���Ǥ�0��������������롥
+
+  rb_ary_new2(long len)
+
+    ���Ǥ�0��������������롥len����ʬ���ΰ�򤢤餫������
+    ���ƤƤ�����
+
+  rb_ary_new3(long n, ...)
+
+    �����ǻ��ꤷ��n���Ǥ�ޤ�������������롥
+
+  rb_ary_new4(long n, VALUE *elts)
+
+    �����Ϳ����n���Ǥ�������������롥
+
+  rb_ary_to_ary(VALUE obj)
+
+    ���֥������Ȥ�������Ѵ�����.
+    Object#to_ary��Ʊ���Ǥ���.
+
+ ¾�ˤ����������ؿ���¿������. ������
+ ����ary��������Ϥ��ʤ���Фʤ�ʤ�. ����ʤ���
+ �������Ǥ�.
+
+  rb_ary_aref(argc, VALUE *argv, VALUE ary)
+
+    Array#[]��Ʊ��.
+
+  rb_ary_entry(VALUE ary, long offset)
+
+    ary[offset]
+
+  rb_ary_subseq(VALUE ary, long beg, long len)
+
+    ary[beg, len]
+
+  rb_ary_push(VALUE ary, VALUE val)
+  rb_ary_pop(VALUE ary)
+  rb_ary_shift(VALUE ary)
+  rb_ary_unshift(VALUE ary, VALUE val)
+
+2��Ruby�ε�ǽ��Ȥ�
+
+����Ū��Ruby�ǽ񤱤뤳�Ȥ�C�Ǥ�񤱤ޤ���Ruby���Τ�Τ�C�ǵ�
+�Ҥ���Ƥ����Ǥ����顤�����Ȥ����������ʤ�Ǥ����ɡ�������
+��Ruby�γ�ĥ�˻Ȥ����Ȥ�¿����������ͽ¬����뵡ǽ���濴�˾�
+�𤷤ޤ���
+
+2.1 Ruby�˵�ǽ���ɲä���
+
+Ruby���󶡤���Ƥ���ؿ���Ȥ���Ruby���󥿥ץ꥿�˿�������ǽ
+���ɲä��뤳�Ȥ��Ǥ��ޤ���Ruby�Ǥϰʲ��ε�ǽ���ɲä���ؿ���
+�󶡤���Ƥ��ޤ���
+
+ * ���饹���⥸�塼��
+ * �᥽�åɡ��ðۥ᥽�åɤʤ�
+ * ���
+
+�ǤϽ�˾Ҳ𤷤ޤ���
+
+2.1.1 ���饹/�⥸�塼�����
+
+���饹��⥸�塼���������뤿��ˤϡ��ʲ��δؿ���Ȥ��ޤ���
+
+  VALUE rb_define_class(const char *name, VALUE super)
+  VALUE rb_define_module(const char *name)
+
+�����δؿ��Ͽ�����������줿���饹��⥸�塼����֤��ޤ���
+�᥽�åɤ����������ˤ������ͤ�ɬ�פʤΤǡ��ۤȤ�ɤξ��
+������ͤ��ѿ��˳�Ǽ���Ƥ���ɬ�פ�����Ǥ��礦��
+
+���饹��⥸�塼���¾�Υ��饹�������˥ͥ��Ȥ�������������
+�ϰʲ��δؿ���Ȥ��ޤ���
+
+  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+  VALUE rb_define_module_under(VALUE outer, const char *name)
+
+2.1.2 �᥽�å�/�ðۥ᥽�å����
+
+�᥽�åɤ��ðۥ᥽�åɤ��������ˤϰʲ��δؿ���Ȥ��ޤ���
+
+  void rb_define_method(VALUE klass, const char *name, 
+		        VALUE (*func)(), int argc)
+
+  void rb_define_singleton_method(VALUE object, const char *name, 
+			          VALUE (*func)(), int argc)
+
+
+ǰ�Τ�����������ȡ��ðۥ᥽�åɡפȤϡ���������Υ��֥�����
+�Ȥ��Ф��Ƥ���ͭ���ʥ᥽�åɤǤ���Ruby�ǤϤ褯Smalltalk�ˤ�
+���륯�饹�᥽�åɤȤ��ơ����饹���Ф����ðۥ᥽�åɤ��Ȥ��
+�ޤ���
+
+�����δؿ��� argc�Ȥ���������C�δؿ����Ϥ��������ο�(��
+����)����ޤ���argc��0�ʾ�λ��ϴؿ��˰����Ϥ������ο����
+̣���ޤ���16�İʾ�ΰ����ϻȤ��ޤ���(�����פ�ޤ����͡���
+��ʤ�)���ºݤδؿ��ˤ���Ƭ�ΰ����Ȥ���self��Ϳ�����ޤ���
+�ǡ����ꤷ�������1¿����������Ĥ��Ȥˤʤ�ޤ���
+
+argc����λ��ϰ����ο��ǤϤʤ�����������ꤷ�����Ȥˤʤ�ޤ���
+argc��-1�λ��ϰ����������������Ϥ���ޤ���argc��-2�λ��ϰ�
+����Ruby������Ȥ����Ϥ���ޤ���
+
+�᥽�åɤ��������ؿ��Ϥޤ������Ĥ�����ޤ�. �ҤȤĤϥ᥽�å�
+̾�Ȥ���ID����ޤ�. ID�ˤĤ��Ƥ�2.2.2�򻲾�.
+
+  void rb_define_method_id(VALUE klass, ID name, 
+                           VALUE (*func)(ANYARGS), int argc)
+
+private/protected�ʥ᥽�åɤ��������դ��Ĥδؿ�������ޤ�.
+
+  void rb_define_private_method(VALUE klass, const char *name, 
+				VALUE (*func)(), int argc)
+  void rb_define_protected_method(VALUE klass, const char *name, 
+			          VALUE (*func)(), int argc)
+
+private�᥽�åɤȤϴؿ������Ǥ����ƤӽФ����Ȥν���ʤ��᥽��
+�ɤǤ���
+
+�Ǹ�ˡ� rb_define_module�ؿ��ϥ⥸�塼��ؿ���������ޤ���
+�⥸�塼��ؿ��Ȥϥ⥸�塼����ðۥ᥽�åɤǤ��ꡤƱ����
+private�᥽�åɤǤ⤢���ΤǤ�����򤢤����Math�⥸�塼��
+��sqrt()�ʤɤ��������ޤ������Υ᥽�åɤ�
+
+  Math.sqrt(4)
+
+�Ȥ��������Ǥ�
+
+  include Math
+  sqrt(4)
+
+�Ȥ��������Ǥ�Ȥ��ޤ����⥸�塼��ؿ����������ؿ��ϰʲ���
+�̤�Ǥ���
+
+  void rb_define_module_function(VALUE module, const char *name, 
+		                 VALUE (*func)(), int argc)
+
+�ؿ�Ū�᥽�å�(Kernel�⥸�塼���private method)��������뤿
+��δؿ��ϰʲ����̤�Ǥ���
+
+  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+
+�᥽�åɤ���̾��������뤿��δؿ��ϰʲ����̤�Ǥ���
+
+  void rb_define_alias(VALUE module, const char* new, const char* old);
+
+°���μ���������᥽�åɤ��������ˤ�
+
+  void rb_define_attr(VALUE klass, const char *name, int read, int write)
+
+���饹�᥽�å�allocate������������������ꤹ�뤿��δؿ���
+�ʲ����̤�Ǥ���
+
+  void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
+  void rb_undef_alloc_func(VALUE klass);
+
+func�ϥ��饹������Ȥ��Ƽ�����äơ�������������Ƥ�줿����
+�����󥹤��֤��ʤ��ƤϤʤ�ޤ��󡥤��Υ��󥹥��󥹤ϡ�������
+�������ʤɤ�ޤޤʤ����Ǥ�������ֶ��פΤޤޤˤ��Ƥ������ۤ�
+���褤�Ǥ��礦��
+
+2.1.3 ������
+
+��ĥ�饤�֥�꤬ɬ�פ�����Ϥ��餫����������Ƥ����������ɤ�
+�Ǥ��礦��������������ؿ�����Ĥ���ޤ���
+
+  void rb_define_const(VALUE klass, const char *name, VALUE val)
+  void rb_define_global_const(const char *name, VALUE val)
+
+���Ԥ�����Υ��饹/�⥸�塼���°�����������������Ρ���
+�Ԥϥ������Х���������������ΤǤ���
+
+2.2 Ruby�ε�ǽ��C����ƤӽФ�
+
+���ˡ�1.5 Ruby�Υǡ���������٤ǰ����Ҳ𤷤��褦�ʴؿ���
+�Ȥ��С�Ruby�ε�ǽ��¸����Ƥ���ؿ���ľ�ܸƤӽФ����Ȥ�����
+�ޤ���
+
+# ���Τ褦�ʴؿ��ΰ���ɽ�Ϥ��ޤΤȤ�������ޤ��󡥥�������
+# �뤷���ʤ��Ǥ��͡�
+
+����ʳ��ˤ�Ruby�ε�ǽ��ƤӽФ���ˡ�Ϥ����Ĥ�����ޤ���
+
+2.2.1 Ruby�Υץ�������eval����
+
+C����Ruby�ε�ǽ��ƤӽФ���äȤ��ñ����ˡ�Ȥ��ơ�ʸ�����
+Ϳ����줿Ruby�Υץ�������ɾ������ʲ��δؿ�������ޤ���
+
+  VALUE rb_eval_string(const char *str)
+
+����ɾ���ϸ��ߤδĶ��ǹԤ��ޤ����Ĥޤꡤ���ߤΥ��������ѿ�
+�ʤɤ�����Ѥ��ޤ���
+
+ɾ�����㳰��ȯ�����뤫�⤷��ʤ����Ȥ����դ��ޤ��礦. ������
+�ʴؿ��⤢��ޤ�.
+
+  VALUE rb_eval_string_protect(const char *str, int *state)
+
+���δؿ��ϥ��顼��ȯ�������nil���֤��ޤ��������ơ��������ˤ�
+*state�ϥ����ˡ�����ʤ����󥼥��ˤʤ�ޤ���
+
+
+2.2.2 ID�ޤ��ϥ���ܥ�
+
+C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ����Ȥ�Ǥ���
+�����������ˡ�Ruby���󥿥ץ꥿��ǥ᥽�åɤ��ѿ�̾����ꤹ��
+���˻Ȥ��Ƥ���ID�ˤĤ����������Ƥ����ޤ��礦��
+
+ID�Ȥ��ѿ�̾���᥽�å�̾��ɽ�������Ǥ���Ruby����Ǥ�
+
+ :���̻�
+�ޤ���
+ :"Ǥ�դ�ʸ����"
+
+�ǥ��������Ǥ��ޤ���C���餳�����������뤿��ˤϴؿ�
+
+  rb_intern(const char *name)
+
+��Ȥ��ޤ���Ruby��������Ȥ���Ϳ����줿����ܥ�(�ޤ���ʸ��
+��)��ID���Ѵ�����ˤϰʲ��δؿ���Ȥ��ޤ���
+
+  rb_to_id(VALUE symbol)
+
+2.2.3 C����Ruby�Υ᥽�åɤ�ƤӽФ�
+
+C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ�����ˤϰʲ�
+�δؿ���Ȥ��ޤ���
+
+  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+���δؿ��ϥ��֥�������recv��mid�ǻ��ꤵ���᥽�åɤ�Ƥӽ�
+���ޤ�������¾�˰����λ���λ������㤦�ʲ��δؿ��⤢��ޤ���
+
+  VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+  VALUE rb_apply(VALUE recv, ID mid, VALUE args)
+
+apply�ˤϰ����Ȥ���Ruby�������Ϳ���ޤ���
+
+2.2.4 �ѿ�/����򻲾�/��������
+
+C����ؿ���Ȥäƻ��ȡ������Ǥ���Τϡ���������󥹥�����
+���Ǥ�������ѿ��ϰ����Τ�Τ�C������ѿ��Ȥ��ƥ��������Ǥ�
+�ޤ������������ѿ��򻲾Ȥ�����ˡ�ϸ������Ƥ��ޤ���
+
+���֥������ȤΥ��󥹥����ѿ��򻲾ȡ���������ؿ��ϰʲ�����
+��Ǥ���
+
+  VALUE rb_ivar_get(VALUE obj, ID id)
+  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id��rb_intern()���������Τ�ȤäƤ���������
+
+����򻲾Ȥ���ˤϰʲ��δؿ���ȤäƤ���������
+
+  VALUE rb_const_get(VALUE obj, ID id)
+
+����򿷤���������뤿��ˤϡ�2.1.3 �������٤ǾҲ�
+��Ƥ���ؿ���ȤäƤ���������
+
+3��Ruby��C�Ȥξ���ͭ
+
+C�����Ruby�δ֤Ǿ����ͭ������ˡ�ˤĤ��Ʋ��⤷�ޤ���
+
+3.1 C���黲�ȤǤ���Ruby�����
+
+�ʲ���Ruby�������C�Υ�٥뤫�黲�ȤǤ��ޤ���
+
+  Qtrue
+  Qfalse
+
+    �����͡�Qfalse��C����Ǥ⵶�Ȥߤʤ���ޤ�(�Ĥޤ�0)��
+
+  Qnil
+
+    C���줫�鸫����nil�ס�
+
+3.2 C��Ruby�Ƕ�ͭ���������ѿ�
+
+C��Ruby������ѿ���Ȥäƾ����ͭ�Ǥ��ޤ�����ͭ�Ǥ������
+�ѿ��ˤϤ����Ĥ��μ��ब����ޤ������Τʤ��Ǥ�äȤ��ɤ��Ȥ�
+���Ȼפ���Τ�rb_define_variable()�Ǥ���
+
+  void rb_define_variable(const char *name, VALUE *var)
+
+���δؿ���Ruby��C�ȤǶ�ͭ��������ѿ���������ޤ����ѿ�̾��
+`$'�ǻϤޤ�ʤ����ˤϼ�ưŪ���ɲä���ޤ��������ѿ����ͤ���
+������ȼ�ưŪ��Ruby���б������ѿ����ͤ��Ѥ��ޤ���
+
+�ޤ�Ruby¦����Ϲ����Ǥ��ʤ��ѿ��⤢��ޤ�������read only��
+�ѿ��ϰʲ��δؿ���������ޤ���
+
+  void rb_define_readonly_variable(const char *name, VALUE *var)
+
+������ѿ���¾��hook��Ĥ�������ѿ�������Ǥ��ޤ���hook�դ�
+������ѿ��ϰʲ��δؿ����Ѥ���������ޤ���hook�դ�����ѿ���
+�ͤλ��Ȥ������hook�ǹԤ�ɬ�פ�����ޤ���
+
+  void rb_define_hooked_variable(const char *name, VALUE *var,
+				 VALUE (*getter)(), void (*setter)())
+
+���δؿ���C�δؿ��ˤ�ä�hook�ΤĤ���줿����ѿ����������
+�����ѿ������Ȥ��줿���ˤϴؿ�getter�����ѿ����ͤ����åȤ���
+�����ˤϴؿ�setter���ƤФ�롥hook����ꤷ�ʤ�����getter��
+setter��0����ꤷ�ޤ���
+# getter��setter��0�ʤ��rb_define_variable()��Ʊ���ˤʤ롥
+
+getter��setter�λ��ͤϼ����̤�Ǥ���
+
+  VALUE (*getter)(ID id, VALUE *var);
+  void (*setter)(VALUE val, ID id, VALUE *var);
+
+
+���줫�顤�б�����C���ѿ�������ʤ�Ruby������ѿ����������
+���Ȥ�Ǥ��ޤ�. �����ѿ����ͤϥեå��ؿ��Τߤˤ�äƼ���������
+����ޤ�.
+
+  void rb_define_virtual_variable(const char *name,
+				  VALUE (*getter)(), void (*setter)())
+
+���δؿ��ˤ�ä�������줿Ruby������ѿ������Ȥ��줿���ˤ�
+getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�ޤ���
+
+getter��setter�λ��ͤϰʲ����̤�Ǥ���
+
+  (*getter)(ID id);
+  (*setter)(VALUE val, ID id);
+
+3.3 C�Υǡ�����Ruby���֥������Ȥˤ���
+
+C��������������줿�ǡ���(��¤��)��Ruby�Υ��֥������ȤȤ���
+��갷��������礬���ꤨ�ޤ������Τ褦�ʾ��ˤϡ�Data�Ȥ���
+Ruby���֥������Ȥ�C�ι�¤��(�ؤΥݥ���)�򤯤�ळ�Ȥ�Ruby
+���֥������ȤȤ��Ƽ�갷����褦�ˤʤ�ޤ���
+
+Data���֥������Ȥ��������ƹ�¤�Τ�Ruby���֥������Ȥ˥��ץ���
+�����뤿��ˤϡ��ʲ��Υޥ�����Ȥ��ޤ���
+
+  Data_Wrap_Struct(klass, mark, free, ptr)
+
+���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
+
+klass�Ϥ���Data���֥������ȤΥ��饹�Ǥ���ptr�ϥ��ץ��벽����
+C�ι�¤�ΤؤΥݥ��󥿤Ǥ���mark�Ϥ��ι�¤�Τ�Ruby�Υ��֥���
+���Ȥؤλ��Ȥ�������˻Ȥ��ؿ��Ǥ������Τ褦�ʻ��Ȥ�ޤޤʤ�
+���ˤ�0����ꤷ�ޤ���
+
+# ���Τ褦�ʻ��Ȥϴ�����ޤ���
+
+free�Ϥ��ι�¤�Τ��⤦���פˤʤä����˸ƤФ��ؿ��Ǥ�������
+�ؿ��������١������쥯������ƤФ�ޤ������줬-1�ξ��ϡ�ñ
+��˳�������ޤ���
+
+mark�����free�ؿ���GC�¹���˸ƤӽФ���ޤ�.
+�ʤ�, GC�¹����Ruby���֥������ȤΥ������������϶ػߤ����
+��. ��ä�, mark�����free�ؿ���Ruby���֥������ȤΥ���������
+���ϹԤ�ʤ��Ǥ�������.
+
+C�ι�¤�Τγ�����Data���֥������Ȥ�������Ʊ���˹Ԥ��ޥ�����
+���ưʲ��Τ�Τ��󶡤���Ƥ��ޤ���
+
+  Data_Make_Struct(klass, type, mark, free, sval)
+
+���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
+
+klass, mark, free��Data_Wrap_Struct��Ʊ��Ư���򤷤ޤ���type
+�ϳ�����Ƥ�C��¤�Τη��Ǥ���������Ƥ�줿��¤�Τ��ѿ�sval
+����������ޤ��������ѿ��η��� (type*) �Ǥ���ɬ�פ�����ޤ���
+
+Data���֥������Ȥ���ݥ��󥿤���Ф��Τϰʲ��Υޥ������Ѥ�
+�ޤ���
+
+  Data_Get_Struct(obj, type, sval)
+
+C�ι�¤�ΤؤΥݥ��󥿤��ѿ�sval����������ޤ���
+
+������Data�λȤ����Ϥ���ä�ʬ����ˤ����Τǡ������������
+����򻲾Ȥ��Ƥ���������
+
+4������ - dbm�ѥå���������
+
+�����ޤǤ������ǤȤꤢ������ĥ�饤�֥��Ϻ���Ϥ��Ǥ���
+Ruby��ext�ǥ��쥯�ȥ�ˤ��Ǥ˴ޤޤ�Ƥ���dbm�饤�֥������
+�����ʳ�Ū���������ޤ���
+
+(1) �ǥ��쥯�ȥ����
+
+  % mkdir ext/dbm
+
+Ruby 1.1�����Ǥ�դΥǥ��쥯�ȥ�ǥ����ʥߥå��饤�֥����
+�뤳�Ȥ��Ǥ���褦�ˤʤ�ޤ�����Ruby����Ū�˥�󥯤������
+��Ruby��Ÿ�������ǥ��쥯�ȥ�β���ext�ǥ��쥯�ȥ����˳�ĥ
+�饤�֥���ѤΥǥ��쥯�ȥ����ɬ�פ�����ޤ���̾����Ŭ����
+����ǹ����ޤ���
+
+(2) �߷פ���
+
+�ޤ��������ʤ�Ǥ����ɡ��ɤ�������ǽ��¸����뤫�ɤ����ޤ���
+�פ���ɬ�פ�����ޤ����ɤ�ʥ��饹��Ĥ��뤫�����Υ��饹�ˤ�
+�ɤ�ʥ᥽�åɤ����뤫�����饹���󶡤�������ʤɤˤĤ����߷�
+���ޤ���
+
+(3) C�����ɤ��
+
+��ĥ�饤�֥�����ΤȤʤ�C����Υ�������񤭤ޤ���C����Υ���
+�����ҤȤĤλ��ˤϡ֥饤�֥��̾.c�פ����֤��ɤ��Ǥ��礦��C
+����Υ�������ʣ���ξ��ˤϵդˡ֥饤�֥��̾.c�פȤ����ե�
+����̾���򤱤�ɬ�פ�����ޤ������֥������ȥե�����ȥ⥸�塼
+�������������Ū�����������֥饤�֥��̾.o�פȤ����ե�����
+�Ȥ����ͤ��뤫��Ǥ����ޤ�����Ҥ��� mkmf �饤�֥��Τ�����
+���δؿ�������ѥ�����פ���ƥ��ȤΤ���ˡ�conftest.c�פȤ�
+���ե�����̾����Ѥ��뤳�Ȥ����դ��Ƥ����������������ե�����
+̾�Ȥ��ơ�conftest.c�פ���Ѥ��ƤϤʤ�ޤ���
+
+Ruby�ϳ�ĥ�饤�֥�������ɤ�����ˡ�Init_�饤�֥��̾�פ�
+�����ؿ���ưŪ�˼¹Ԥ��ޤ���dbm�饤�֥��ξ���Init_dbm��
+�Ǥ������δؿ�����ǥ��饹���⥸�塼�롤�᥽�åɡ�����ʤɤ�
+�����Ԥ��ޤ���dbm.c����������Ѥ��ޤ���
+
+--
+void
+Init_dbm(void)
+{
+    /* DBM���饹��������� */
+    cDBM = rb_define_class("DBM", rb_cObject);
+    /* DBM��Enumerate�⥸�塼��򥤥󥯥롼�ɤ��� */
+    rb_include_module(cDBM, rb_mEnumerable);
+
+    /* DBM���饹�Υ��饹�᥽�å�open(): ������C������Ǽ����� */
+    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+    /* DBM���饹�Υ᥽�å�close(): �����Ϥʤ� */
+    rb_define_method(cDBM, "close", fdbm_close, 0);
+    /* DBM���饹�Υ᥽�å�[]: ������1�� */
+    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+		:
+
+    /* DBM�ǡ������Ǽ���륤�󥹥����ѿ�̾�Τ����ID */
+    id_dbm = rb_intern("dbm");
+}
+--
+
+DBM�饤�֥���dbm�Υǡ������б����륪�֥������Ȥˤʤ�Ϥ���
+�����顤C��������dbm��Ruby�������˼�����ɬ�פ�����ޤ���
+
+
+dbm.c�Ǥ�Data_Make_Struct��ʲ��Τ褦�˻ȤäƤ��ޤ���
+
+--
+struct dbmdata {
+    int  di_size;
+    DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+--
+
+�����Ǥ�dbmstruct��¤�ΤؤΥݥ��󥿤�Data�˥��ץ��벽���Ƥ�
+�ޤ���DBM*��ľ�ܥ��ץ��벽���ʤ��Τ�close()�������ν������
+���ƤΤ��ȤǤ���
+
+Data���֥������Ȥ���dbmstruct��¤�ΤΥݥ��󥿤���Ф�����
+�˰ʲ��Υޥ�����ȤäƤ��ޤ���
+
+--
+#define GetDBM(obj, dbmp) {\
+    Data_Get_Struct(obj, struct dbmdata, dbmp);\
+    if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+����ä�ʣ���ʥޥ����Ǥ������פ����dbmdata��¤�ΤΥݥ���
+�μ��Ф��ȡ�close����Ƥ��뤫�ɤ����Υ����å���ޤȤ�Ƥ�
+������Ǥ���
+
+DBM���饹�ˤϤ�������᥽�åɤ�����ޤ�����ʬ�ह���3�����
+�����μ�����������ޤ����ҤȤĤϰ����ο�������Τ�Τǡ����
+���Ƥ�delete�᥽�åɤ�����ޤ���delete�᥽�åɤ�������Ƥ���
+fdbm_delete()�Ϥ��Τ褦�ˤʤäƤ��ޤ���
+
+--
+static VALUE
+fdbm_delete(VALUE obj, VALUE keystr)
+{
+	:
+}
+--
+
+�����ο�������Υ����פ���1������self����2�����ʹߤ��᥽�å�
+�ΰ����Ȥʤ�ޤ���
+
+�����ο�������Τ�Τ�C������Ǽ������Τ�Ruby������Ǽ���
+���ΤȤ�����ޤ���dbm�饤�֥�����ǡ�C������Ǽ�������
+��DBM�Υ��饹�᥽�åɤǤ���open()�Ǥ��������������Ƥ����
+��fdbm_s_open()�Ϥ����ʤäƤ��ޤ���
+
+--
+static VALUE
+fdbm_s_open(int argc, VALUE *argv, VALUE klass)
+{
+	:
+    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+	mode = 0666;		/* default value */
+    }
+	:
+}
+--
+
+���Υ����פδؿ�����1������Ϳ����줿�����ο�����2������Ϳ��
+��줿���������äƤ�������ˤʤ�ޤ���self����3�����Ȥ���Ϳ
+�����ޤ���
+
+���������Ϳ����줿��������Ϥ��뤿��δؿ���open()�Ǥ�Ȥ�
+��Ƥ���rb_scan_args()�Ǥ�����3�����˻��ꤷ���ե����ޥåȤ˽�
+������4�ѿ��ʹߤ˻��ꤷ��VALUE�ؤλ��Ȥ��ͤ��������Ƥ����
+����
+
+
+������Ruby������Ȥ��Ƽ������᥽�åɤ���ˤ�
+Thread#initialize������ޤ��������Ϥ����Ǥ���
+
+--
+static VALUE
+thread_initialize(VALUE thread, VALUE args)
+{
+	:
+}
+--
+
+��1������self����2������Ruby������Ǥ���
+
+** ���ջ���
+
+Ruby�ȶ�ͭ�Ϥ��ʤ���Ruby�Υ��֥������Ȥ��Ǽ�����ǽ���Τ���
+C������ѿ��ϰʲ��δؿ���Ȥä�Ruby���󥿥ץ꥿���ѿ���¸��
+�򶵤��Ƥ����Ƥ����������Ǥʤ���GC�ǥȥ�֥�򵯤����ޤ���
+
+  void rb_global_variable(VALUE *var)
+
+(4) extconf.rb���Ѱդ���
+
+Makefile������ο����ˤʤ�extconf.rb�Ȥ����ե��������
+�ޤ���extconf.rb�ϥ饤�֥��Υ���ѥ����ɬ�פʾ��Υ�����
+���ʤɤ�Ԥ����Ȥ���Ū�Ǥ����ޤ���
+
+  require 'mkmf'
+
+��extconf.rb����Ƭ���֤��ޤ���extconf.rb����Ǥϰʲ���Ruby��
+����Ȥ����Ȥ�����ޤ���
+
+  have_library(lib, func): �饤�֥���¸�ߥ����å�
+  have_func(func, header): �ؿ���¸�ߥ����å�
+  have_header(header): �إå��ե������¸�ߥ����å�
+  create_makefile(target): Makefile������
+
+�ʲ����ѿ���Ȥ����Ȥ��Ǥ��ޤ���
+
+  $CFLAGS: ����ѥ�������ɲ�Ū�˻��ꤹ��ե饰(-O�ʤ�)
+  $CPPFLAGS: �ץ�ץ����å����ɲ�Ū�˻��ꤹ��ե饰(-I��-D�ʤ�)
+  $LDFLAGS: ��󥯻����ɲ�Ū�˻��ꤹ��ե饰(-L�ʤ�)
+  $objs: ��󥯤���륪�֥������ȥե�����̾�Υꥹ��
+
+���֥������ȥե�����Υꥹ�Ȥϡ��̾�ϥ������ե�����򸡺���
+�Ƽ�ưŪ����������ޤ�����make������ǥ���������������褦��
+��������Ū�˻��ꤹ��ɬ�פ�����ޤ���
+
+�饤�֥��򥳥�ѥ��뤹���郎·�鷺�����Υ饤�֥��򥳥�
+�ѥ��뤷�ʤ����ˤ�create_makefile��ƤФʤ����Makefile����
+�����줺������ѥ����Ԥ��ޤ���
+
+(5) depend���Ѱդ���
+
+�⤷���ǥ��쥯�ȥ��depend�Ȥ����ե����뤬¸�ߤ���С�
+Makefile����¸�ط�������å����Ƥ���ޤ���
+
+  % gcc -MM *.c > depend
+
+�ʤɤǺ�뤳�Ȥ�����ޤ������ä�»��̵���Ǥ��礦��
+
+(6) Makefile����������
+
+Makefile��ºݤ��������뤿��ˤ�
+
+  ruby extconf.rb
+
+�Ȥ��ޤ���extconf.rb�� require 'mkmf' �ιԤ��ʤ����ˤϥ��顼
+�ˤʤ�ޤ��Τǡ��������ɲä���
+
+  ruby -r mkmf extconf.rb
+
+�Ȥ��Ƥ���������
+
+site_ruby �ǥ��쥯�ȥ�Ǥʤ���
+vendor_ruby �ǥ��쥯�ȥ�˥��󥹥ȡ��뤹����ˤ�
+�ʲ��Τ褦�� --vendor ���ץ�����ä��Ƥ���������
+
+  ruby extconf.rb --vendor
+
+�ǥ��쥯�ȥ��ext�ʲ����Ѱդ������ˤ�Ruby���Τ�make�λ���
+��ưŪ��Makefile����������ޤ��Τǡ����Υ��ƥåפ����פǤ���
+
+(7) make����
+
+ưŪ��󥯥饤�֥�������������ˤϤ��ξ��make���Ƥ�����
+����ɬ�פǤ���� make install �ǥ��󥹥ȡ��뤵��ޤ���
+
+ext�ʲ��˥ǥ��쥯�ȥ���Ѱդ������ϡ�Ruby�Υǥ��쥯�ȥ��
+make��¹Ԥ����Makefile����������make��ɬ�פˤ�äƤϤ��Υ�
+���塼���Ruby�ؤΥ�󥯤ޤǼ�ưŪ�˼¹Ԥ��Ƥ���ޤ���
+extconf.rb��񤭴�����ʤɤ���Makefile�κ�������ɬ�פʻ��Ϥ�
+��Ruby�ǥ��쥯�ȥ��make���Ƥ���������
+
+��ĥ�饤�֥���make install��Ruby�饤�֥��Υǥ��쥯�ȥ��
+���˥��ԡ�����ޤ����⤷��ĥ�饤�֥��ȶ�Ĵ���ƻȤ�Ruby�ǵ�
+�Ҥ��줿�ץ�����ब���ꡤRuby�饤�֥����֤��������ˤϡ�
+��ĥ�饤�֥���ѤΥǥ��쥯�ȥ�β��� lib �Ȥ����ǥ��쥯�ȥ�
+���ꡤ������ ��ĥ�� .rb �Υե�������֤��Ƥ�����Ʊ���˥���
+���ȡ��뤵��ޤ���
+
+(8) �ǥХå�
+
+�ޤ����ǥХå����ʤ���ư���ʤ��Ǥ��礦�͡�ext/Setup�˥ǥ���
+���ȥ�̾��񤯤���Ū�˥�󥯤���ΤǥǥХå����Ȥ���褦�ˤ�
+��ޤ�������ʬ����ѥ��뤬�٤��ʤ�ޤ����ɡ�
+
+(9) �Ǥ�������
+
+��Ϥ��ä���Ȥ��ʤꡤ������������ʤꡤ���ʤꡤ����ͳ�ˤ�
+�Ȥ�����������Ruby�κ�Ԥϳ�ĥ�饤�֥��˴ؤ��ư��ڤθ�����
+��ĥ���ޤ���
+
+Appendix A. Ruby�Υ����������ɤ�ʬ��
+
+Ruby�Υ������Ϥ����Ĥ���ʬ�ह�뤳�Ȥ�����ޤ������Τ�������
+���饤�֥�����ʬ�ϴ���Ū�˳�ĥ�饤�֥���Ʊ��������ˤʤ�
+�Ƥ��ޤ��������Υ������Ϻ��ޤǤ������ǤۤȤ������Ǥ����
+�פ��ޤ���
+
+Ruby����Υ���
+
+  class.c         : ���饹�ȥ⥸�塼��
+  error.c         : �㳰���饹���㳰����
+  gc.c            : �����ΰ����
+  load.c          : �饤�֥��Υ�����
+  object.c        : ���֥�������
+  variable.c      : �ѿ������
+
+Ruby�ι�ʸ���ϴ�
+  parse.y         : ������ϴ�ȹ�ʸ���
+    -> parse.c    : ��ư����
+  keywords        : ͽ���
+    -> lex.c      : ��ư����
+
+Ruby��ɾ���� (�̾�YARV)
+  compile.c
+  eval.c
+  eval_error.c
+  eval_jump.c
+  eval_safe.c
+  insns.def           : ���۵���������
+  iseq.c              : VM::ISeq�μ���
+  thread.c            : ����åɴ����ȥ���ƥ������ڤ��ؤ�
+  thread_win32.c      : ����åɼ���
+  thread_pthread.c    : Ʊ��
+  vm.c
+  vm_dump.c
+  vm_eval.c
+  vm_exec.c
+  vm_insnhelper.c
+  vm_method.c
+
+  opt_insns_unif.def  : ̿��ͻ��
+  opt_operand.def     : ��Ŭ���Τ�������
+
+    -> insn*.inc      : ��ư����
+    -> opt*.inc       : ��ư����
+    -> vm.inc         : ��ư����
+
+����ɽ�����󥸥� (����)
+  regex.c
+  regcomp.c
+  regenc.c
+  regerror.c
+  regexec.c
+  regparse.c
+  regsyntax.c
+
+�桼�ƥ���ƥ��ؿ�
+
+  debug.c       : C�ǥХå��ѤΥǥХå�����ܥ�
+  dln.c         : ưŪ�����ǥ���
+  st.c          : ���ѥϥå���ɽ
+  strftime.c    : ��������
+  util.c        : ����¾�Υ桼�ƥ���ƥ�
+
+Ruby���ޥ�ɤμ���
+
+  dmyext.c
+  dmydln.c
+  dmyencoding.c
+  id.c
+  inits.c
+  main.c
+  ruby.c
+  version.c
+
+  gem_prelude.rb
+  prelude.rb
+
+���饹�饤�֥��
+
+  array.c       : Array
+  bignum.c      : Bignum
+  compar.c      : Comparable
+  complex.c     : Complex
+  cont.c        : Fiber, Continuation
+  dir.c         : Dir
+  enum.c        : Enumerable
+  enumerator.c  : Enumerator
+  file.c        : File
+  hash.c        : Hash
+  io.c          : IO
+  marshal.c     : Marshal
+  math.c        : Math
+  numeric.c     : Numeric, Integer, Fixnum, Float
+  pack.c        : Array#pack, String#unpack
+  proc.c        : Binding, Proc
+  process.c     : Process
+  random.c      : ���
+  range.c       : Range
+  rational.c    : Rational
+  re.c          : Regexp, MatchData
+  signal.c      : Signal
+  sprintf.c     : 
+  string.c      : String
+  struct.c      : Struct
+  time.c        : Time
+
+  defs/known_errors.def  : �㳰���饹 Errno::*
+    -> known_errors.inc  : ��ư����
+
+¿���첽
+  encoding.c    : Encoding
+  transcode.c   : Encoding::Converter
+  enc/*.c       : ���󥳡��ǥ��󥰥��饹��
+  enc/trans/*   : �����ɥݥ�����б�ɽ
+
+goruby���ޥ�ɤμ���
+  
+  goruby.c
+  golf_prelude.rb      : goruby��ͭ�Υ饤�֥��
+    -> golf_prelude.c  : ��ư����
+
+
+Appendix B. ��ĥ�Ѵؿ���ե����
+
+C���줫��Ruby�ε�ǽ�����Ѥ���API�ϰʲ����̤�Ǥ��롥
+
+** ��
+
+VALUE
+
+  Ruby���֥������Ȥ�ɽ�����뷿��ɬ�פ˱����ƥ��㥹�Ȥ����Ѥ��롥
+  �Ȥ߹��߷���ɽ������C�η���ruby.h�˵��Ҥ��Ƥ���R�ǻϤޤ빽¤
+  �ΤǤ��롥VALUE���򤳤��˥��㥹�Ȥ��뤿���R�ǻϤޤ빽¤��
+  ̾��������ʸ���ˤ���̾���Υޥ������Ѱդ���Ƥ��롥
+
+** �ѿ������
+
+Qnil
+
+  ���: nil���֥�������
+
+Qtrue
+
+  ���: true���֥�������(���Υǥե������)
+
+Qfalse
+
+  ���: false���֥�������
+
+** C�ǡ����Υ��ץ��벽
+
+Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
+
+  C��Ǥ�դΥݥ��󥿤򥫥ץ��벽����Ruby���֥������Ȥ��֤�����
+  �Υݥ��󥿤�Ruby���饢����������ʤ��ʤä�����free�ǻ��ꤷ��
+  �ؿ����ƤФ�롥�ޤ������Υݥ��󥿤λؤ��ǡ�����¾��Ruby����
+  �������Ȥ�ؤ��Ƥ����硤mark�˻��ꤹ��ؿ��ǥޡ�������ɬ��
+  �����롥
+
+Data_Make_Struct(klass, type, mark, free, sval)
+
+  type���Υ����malloc�����ѿ�sval�����������塤����򥫥ץ�
+  �벽�����ǡ������֤��ޥ�����
+
+Data_Get_Struct(data, type, sval)
+
+  data����type���Υݥ��󥿤���Ф��ѿ�sval����������ޥ�����
+
+** �������å�
+
+TYPE(value)
+FIXNUM_P(value)
+NIL_P(value)
+void Check_Type(VALUE value, int type)
+void Check_SafeStr(VALUE value)
+
+** ���Ѵ�
+
+FIX2INT(value), INT2FIX(i)
+FIX2LONG(value), LONG2FIX(l)
+NUM2INT(value), INT2NUM(i)
+NUM2UINT(value), UINT2NUM(ui)
+NUM2LONG(value), LONG2NUM(l)
+NUM2ULONG(value), ULONG2NUM(ul)
+NUM2LL(value), LL2NUM(ll)
+NUM2ULL(value), ULL2NUM(ull)
+NUM2OFFT(value), OFFT2NUM(off)
+NUM2SIZET(value), SIZET2NUM(size)
+NUM2SSIZET(value), SSIZET2NUM(ssize)
+NUM2DBL(value)
+rb_float_new(f)
+StringValue(value)
+StringValuePtr(value)
+StringValueCStr(value)
+rb_str_new2(s)
+
+** ���饹/�⥸�塼�����
+
+VALUE rb_define_class(const char *name, VALUE super)
+
+  super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹��������롥
+
+VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
+
+  super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹���������module��
+  ����Ȥ���������롥
+
+VALUE rb_define_module(const char *name)
+
+  ������Ruby�⥸�塼���������롥
+
+VALUE rb_define_module_under(VALUE module, const char *name)
+
+  ������Ruby�⥸�塼����������module������Ȥ���������롥
+
+void rb_include_module(VALUE klass, VALUE module)
+
+  �⥸�塼��򥤥󥯥롼�ɤ��롥class�����Ǥ�module�򥤥�
+  �롼�ɤ��Ƥ�����ˤϲ��⤷�ʤ�(¿�ť��󥯥롼�ɤζػ�)��
+
+void rb_extend_object(VALUE object, VALUE module)
+
+  ���֥������Ȥ�⥸�塼��(���������Ƥ���᥽�å�)�ǳ�ĥ���롥
+
+** ����ѿ����
+
+void rb_define_variable(const char *name, VALUE *var)
+
+  Ruby��C�ȤǶ�ͭ���륰�����Х��ѿ���������롥�ѿ�̾��`$'��
+  �Ϥޤ�ʤ����ˤϼ�ưŪ���ɲä���롥name�Ȥ���Ruby�μ��̻�
+  �Ȥ��Ƶ�����ʤ�ʸ��(�㤨��` ')��ޤ���ˤ�Ruby�ץ�����
+  �फ��ϸ����ʤ��ʤ롥
+
+void rb_define_readonly_variable(const char *name, VALUE *var)
+
+  Ruby��C�ȤǶ�ͭ����read only�Υ������Х��ѿ���������롥
+  read only�Ǥ��뤳�Ȱʳ���rb_define_variable()��Ʊ����
+
+void rb_define_virtual_variable(const char *name,
+				VALUE (*getter)(), void (*setter)())
+
+  �ؿ��ˤ�äƼ¸������Ruby�ѿ���������롥�ѿ������Ȥ��줿
+  ���ˤ�getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�
+  �롥
+
+void rb_define_hooked_variable(const char *name, VALUE *var,
+			       VALUE (*getter)(), void (*setter)())
+
+  �ؿ��ˤ�ä�hook�ΤĤ���줿�������Х��ѿ���������롥�ѿ�
+  �����Ȥ��줿���ˤ�getter�����ؿ����ͤ����åȤ��줿���ˤ�
+  setter���ƤФ�롥getter��setter��0����ꤷ�����ˤ�hook��
+  ���ꤷ�ʤ��Τ�Ʊ�����ˤʤ롥
+
+void rb_global_variable(VALUE *var)
+
+  GC�Τ��ᡤRuby�ץ�����फ��ϥ�����������ʤ���, Ruby����
+  �������Ȥ�ޤ�����ѿ���ޡ������롥
+
+** ���
+
+void rb_define_const(VALUE klass, const char *name, VALUE val)
+
+  �����������롥
+
+void rb_define_global_const(const char *name, VALUE val)
+
+  ��������������롥
+
+     rb_define_const(rb_cObject, name, val)
+
+  ��Ʊ����̣��
+
+** �᥽�å����
+
+rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+  �᥽�åɤ�������롥argc��self����������ο���argc��-1�λ�, 
+  �ؿ��ˤϰ����ο�(self��ޤޤʤ�)����1����, �������������2
+  �����Ȥ��������Ϳ������(��3������self)��argc��-2�λ�, 
+  ��1������self, ��2������args(args�ϰ�����ޤ�Ruby������)��
+  ����������Ϳ�����롥
+ 
+rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+  private�᥽�åɤ�������롥������rb_define_method()��Ʊ����
+
+rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+  �ðۥ᥽�åɤ�������롥������rb_define_method()��Ʊ����
+
+rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+  argc, argv������Ϳ����줿���ꤵ�줿�ե����ޥåȤ˽��äư�
+  ����ʬ�򤷡�³��VALUE�ؤλ��Ȥ˥��åȤ��ޤ������Υե����ޥ�
+  �Ȥϡ�ABNF�ǵ��Ҥ���Ȱʲ����̤�Ǥ���
+
+--
+scan-arg-spec  := param-arg-spec [option-hash-arg-spec] [block-arg-spec]
+
+param-arg-spec := pre-arg-spec [post-arg-spec] / post-arg-spec / pre-opt-post-arg-spec
+pre-arg-spec   := num-of-leading-mandatory-args [num-of-optional-args]
+post-arg-spec  := sym-for-variable-length-args [num-of-trailing-mandatory-args]
+pre-opt-post-arg-spec := num-of-leading-mandatory-args num-of-optional-args num-of-trailing-mandatory-args
+option-hash-arg-spec := sym-for-option-hash-arg
+block-arg-spec := sym-for-block-arg
+
+num-of-leading-mandatory-args  := DIGIT ; ��Ƭ���֤�����ά��ǽ�ʰ����ο�
+num-of-optional-args           := DIGIT ; ³�����֤�����ά��ǽ�ʰ����ο�
+sym-for-variable-length-args   := "*"   ; ³�����֤�������Ĺ������
+                                        ; Ruby������Ǽ������뤿��λ���
+num-of-trailing-mandatory-args := DIGIT ; ��ü���֤�����ά��ǽ�ʰ����ο�
+sym-for-option-hash-arg        := ":"   ; ���ץ����ϥå�����������
+                                        ; ����λ���; ��ά��ǽ�ʰ�����
+                                        ; ������¿���ΰ��������ꤵ�졤
+                                        ; �Ǹ�ΰ������ϥå���ʤޤ���
+                                        ; #to_hash���Ѵ���ǽ�ˤξ���
+                                        ; ��������롥�Ǹ�ΰ�����nil��
+                                        ; ��硤����Ĺ�������꤬�ʤ���
+                                        ; ��ά��ǽ�����ο�����¿����
+                                        ; ���������ꤵ�줿���˼��������
+sym-for-block-arg              := "&"   ; ���ƥ졼���֥��å���������뤿���
+                                        ; ����
+--
+
+  �ե����ޥåȤ�"12"�ξ�硤�����Ϻ���1�Ĥǡ�3��(1+2)�ޤǵ���
+  ���Ȥ�����̣�ˤʤ�ޤ������äơ��ե����ޥå�ʸ�����³��
+  ��3�Ĥ�VALUE�ؤλ��Ȥ��֤�ɬ�פ�����ޤ��������ˤϼ�������
+  �ѿ������åȤ���ޤ����ѿ��ؤλ��Ȥ������NULL����ꤹ��
+  ���Ȥ�Ǥ������ξ��ϼ��������������ͤϼΤƤ��ޤ����ʤ���
+  ��ά��ǽ��������ά���줿�����ѿ����ͤ�nil(C����Υ�٥�Ǥ�
+  Qnil)�ˤʤ�ޤ���
+
+  �֤��ͤ�Ϳ����줿�����ο��Ǥ������ץ����ϥå��太��ӥ�
+  �ƥ졼���֥��å��Ͽ����ޤ���
+
+** Ruby�᥽�åɸƤӽФ�
+
+VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+  �᥽�åɸƤӽФ���ʸ���󤫤�mid�����뤿��ˤ�rb_intern()��
+  �Ȥ���
+
+VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+  �᥽�åɸƤӽФ���������argc, argv�������Ϥ���
+
+VALUE rb_eval_string(const char *str)
+
+  ʸ�����Ruby������ץȤȤ��ƥ���ѥ��롦�¹Ԥ��롥
+
+ID rb_intern(const char *name)
+
+  ʸ������б�����ID���֤���
+
+char *rb_id2name(ID id)
+
+  ID���б�����ʸ������֤�(�ǥХå���)��
+
+char *rb_class2name(VALUE klass)
+
+  ���饹��̾�����֤�(�ǥХå���)�����饹��̾��������ʤ�����
+  ��, ������̤ä�̾������ĥ��饹��̾�����֤���
+
+int rb_respond_to(VALUE obj, ID id)
+
+  obj��id�Ǽ������᥽�åɤ���Ĥ��ɤ������֤���
+
+** ���󥹥����ѿ�
+
+VALUE rb_iv_get(VALUE obj, const char *name)
+
+  obj�Υ��󥹥����ѿ����ͤ����롥`@'�ǻϤޤ�ʤ����󥹥���
+  ���ѿ��� Ruby�ץ�����फ�饢�������Ǥ��ʤ��ֱ��줿�ץ���
+  �������ѿ��ˤʤ롥�������ʸ����̾������ĥ��饹(�ޤ���
+  �⥸�塼��)�Υ��󥹥����ѿ��Ȥ��Ƽ�������Ƥ��롥
+
+VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
+
+  obj�Υ��󥹥����ѿ���val�˥��åȤ��롥
+
+** ���湽¤
+
+VALUE rb_block_call(VALUE obj, ID mid, int argc, VALUE * argv,
+		    VALUE (*func) (ANYARGS), VALUE data2)
+
+  func��֥��å��Ȥ������ꤷ��obj��쥷���С�argc��argv�����
+  �Ȥ���mid�᥽�åɤ�ƤӽФ���func����������yield���줿�͡�
+  ���������data2�������롥ʣ�����ͤ�yield���줿���(C�Ǥ�
+  rb_yield_values()��rb_yield_values2(), rb_yield_splat())��
+  data2��Array�Ȥ��ƥѥå�����Ƥ��롥�軰, ��Ͱ�����argc��
+  argv�ˤ�ä�yield���줿�ͤ���Ф����Ȥ��Ǥ��롥
+
+[OBSOLETE] VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+  func2��֥��å��Ȥ������ꤷ, func1�򥤥ƥ졼���Ȥ��ƸƤ֡� 
+  func1�ˤ� arg1�������Ȥ����Ϥ���, func2�ˤ���1�����˥��ƥ졼
+  ������Ϳ����줿��, ��2������arg2���Ϥ���롥
+ 
+  1.9��rb_iterate��Ȥ�����, func1�����Ruby��٥�Υ᥽�å�
+  ��ƤӽФ��ʤ���Фʤ�ʤ�.
+  1.9��obsolete�Ȥʤä�. �����rb_block_call���Ѱդ��줿.
+
+VALUE rb_yield(VALUE val)
+
+  val���ͤȤ��ƥ��ƥ졼���֥��å���ƤӽФ���
+
+VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+  �ؿ�func1��arg1������˸ƤӽФ���func1�μ¹�����㳰��ȯ��
+  �������ˤ� func2��arg2������Ȥ��ƸƤ֡�����ͤ��㳰��ȯ��
+  ���ʤ��ä�����func1�������, �㳰��ȯ���������ˤ�func2����
+  ���ͤǤ��롥
+
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+  �ؿ�func1��arg1������Ȥ��Ƽ¹Ԥ�, �¹Խ�λ��(���Ȥ��㳰��
+  ȯ�����Ƥ�) func2��arg2������Ȥ��Ƽ¹Ԥ��롥����ͤ�func1
+  ������ͤǤ���(�㳰��ȯ�������������ʤ�)��
+
+VALUE rb_protect(VALUE (*func) (VALUE), VALUE arg, int *state)
+
+  �ؿ�func��arg������Ȥ��Ƽ¹Ԥ�, �㳰��ȯ�����ʤ���Ф�����
+  ���ͤ��֤����㳰��ȯ����������, *state����0�򥻥åȤ���
+  Qnil���֤���
+
+void rb_jump_tag(int state)
+
+  rb_protect()��rb_eval_string_protect()����ª���줿�㳰���
+  �����롥state�Ϥ����δؿ������֤��줿�ͤǤʤ���Фʤ�ʤ���
+  ���δؿ���ľ�ܤθƤӽФ��������ʤ���
+
+** �㳰�����顼
+
+void rb_warning(const char *fmt, ...)
+
+  rb_verbose����ɸ�२�顼���Ϥ˷ٹ�����ɽ�����롥������
+  printf()��Ʊ����
+
+void rb_raise(rb_eRuntimeError, const char *fmt, ...)
+
+  RuntimeError�㳰��ȯ�������롥������printf()��Ʊ����
+
+void rb_raise(VALUE exception, const char *fmt, ...)
+
+  exception�ǻ��ꤷ���㳰��ȯ�������롥fmt�ʲ��ΰ�����
+  printf()��Ʊ����
+
+void rb_fatal(const char *fmt, ...)
+
+  ��̿Ū�㳰��ȯ�������롥�̾���㳰�����ϹԤʤ�줺, ���󥿡�
+  �ץ꥿����λ����(������ensure�ǻ��ꤵ�줿�����ɤϽ�λ����
+  �¹Ԥ����)��
+
+void rb_bug(const char *fmt, ...)
+
+  ���󥿡��ץ꥿�ʤɥץ������ΥХ��Ǥ���ȯ������Ϥ��Τʤ�
+  �����λ��Ƥ֡����󥿡��ץ꥿�ϥ�������פ�ľ���˽�λ���롥
+  �㳰�����ϰ��ڹԤʤ��ʤ���
+
+** Ruby�ν�������¹�
+
+Ruby�򥢥ץꥱ����������������ˤϰʲ��Υ��󥿥ե�����
+��Ȥ����̾�γ�ĥ�饤�֥��ˤ�ɬ�פʤ���
+
+void ruby_init()
+
+  Ruby���󥿥ץ꥿�ν������Ԥʤ���
+
+void ruby_options(int argc, char **argv)
+
+  Ruby���󥿥ץ꥿�Υ��ޥ�ɥ饤������ν�����Ԥʤ���
+
+void ruby_run()
+
+  Ruby���󥿥ץ꥿��¹Ԥ��롥
+
+void ruby_script(char *name)
+
+  Ruby�Υ�����ץ�̾($0)�����ꤹ�롥
+
+** ���󥿥ץ꥿�Υ��٥�ȤΥեå�
+
+ void rb_add_event_hook(rb_event_hook_func_t func, rb_event_flag_t events, VALUE data)
+
+���ꤵ�줿���󥿥ץ꥿�Υ��٥�Ȥ��Ф���եå��ؿ����ɲä��ޤ���
+events�ϰʲ����ͤ�or�Ǥʤ���Фʤ�ޤ���:
+
+	RUBY_EVENT_LINE
+	RUBY_EVENT_CLASS
+	RUBY_EVENT_END
+	RUBY_EVENT_CALL
+	RUBY_EVENT_RETURN
+	RUBY_EVENT_C_CALL
+	RUBY_EVENT_C_RETURN
+	RUBY_EVENT_RAISE
+	RUBY_EVENT_ALL
+
+rb_event_hook_func_t������ϰʲ����̤�Ǥ�:
+
+ typedef void (*rb_event_hook_func_t)(rb_event_t event, VALUE data,
+ 				      VALUE self, ID id, VALUE klass)
+
+rb_add_event_hook() ����3���� data �ϡ��եå��ؿ�����2������
+�����Ϥ���ޤ��������1.8�Ǥϸ��ߤ�NODE�ؤΥݥ��󥿤Ǥ�������
+���� RB_EVENT_HOOKS_HAVE_CALLBACK_DATA �⻲�Ȥ��Ƥ���������
+
+ int rb_remove_event_hook(rb_event_hook_func_t func)
+
+���ꤵ�줿�եå��ؿ��������ޤ���
+
+** �ߴ����Τ���Υޥ���
+
+API�θߴ���������å����뤿��˰ʲ��Υޥ������ǥե���Ȥ��������Ƥ��ޤ���
+
+NORETURN_STYLE_NEW
+
+  NORETURN �ޥ������ؿ����ޥ����Ȥ����������Ƥ��뤳�Ȥ��̣���롥
+
+HAVE_RB_DEFINE_ALLOC_FUNC
+
+  rb_define_alloc_func() �ؿ����󶡤���Ƥ��뤳�ȡ��Ĥޤ�
+  allocation framework ���Ȥ��뤳�Ȥ��̣���롥
+  have_func("rb_define_alloc_func", "ruby.h")
+  �η�̤�Ʊ����
+
+HAVE_RB_REG_NEW_STR
+
+  String���֥������Ȥ���Regexp���֥������Ȥ���
+  rb_reg_new_str() �ؿ����󶡤���Ƥ��뤳�Ȥ��̣���롥
+  have_func("rb_reg_new_str", "ruby.h").
+  �η�̤�Ʊ����
+
+HAVE_RB_IO_T
+
+  rb_io_t �����󶡤���Ƥ��뤳�Ȥ��̣���롥
+
+USE_SYMBOL_AS_METHOD_NAME
+
+  �᥽�å�̾���֤��᥽�åɡ�Module#methods, #singleton_methods
+  �ʤɤ�Symbol���֤����Ȥ��̣���롥
+
+HAVE_RUBY_*_H
+
+  ruby.h ���������Ƥ��롥�б�����إå����󶡤���Ƥ��뤳��
+  ���̣���롥���Ȥ��С�HAVE_RUBY_ST_H ���������Ƥ������
+  ñ�ʤ� st.h �ǤϤʤ� ruby/st.h ����Ѥ��롥
+
+RB_EVENT_HOOKS_HAVE_CALLBACK_DATA
+
+  rb_add_event_hook() ���եå��ؿ����Ϥ� data ����3�����Ȥ���
+  ������뤳�Ȥ��̣���롥
+
+Appendix C. extconf.rb�ǻȤ���ؿ�����
+
+extconf.rb����Ǥ����Ѳ�ǽ�ʥ���ѥ���������å��δؿ��ϰ�
+�����̤�Ǥ��롥
+
+have_macro(macro, headers)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��ƥޥ���macro�������
+  ��Ƥ��뤫�ɤ��������å����롥�ޥ������������Ƥ����true
+  ���֤���
+
+have_library(lib, func)
+
+  �ؿ�func��������Ƥ���饤�֥��lib��¸�ߤ�����å����롥
+  �饤�֥�꤬¸�ߤ������true���֤���
+
+find_library(lib, func, path...)
+
+  �ؿ�func��������Ƥ���饤�֥��lib��¸�ߤ� -Lpath ���ɲ�
+  ���ʤ�������å����롥�饤�֥�꤬���դ��ä�����true���֤���
+
+have_func(func, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��ƴؿ�func��¸�ߤ����
+  �å����롥func��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�Τ�
+  ������ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ�
+  �������ؿ���¸�ߤ����true���֤���
+
+have_var(var, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ����ѿ�var��¸�ߤ������
+  �����롥var��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�ΤǤ�
+  ����ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ���
+  �����ѿ���¸�ߤ����true���֤���
+
+have_header(header)
+
+  �إå��ե������¸�ߤ�����å����롥�إå��ե����뤬¸�ߤ�
+  ���true���֤���
+
+find_header(header, path...)
+
+  �إå��ե�����header��¸�ߤ� -Ipath ���ɲä��ʤ�������å�
+  ���롥�إå��ե����뤬���դ��ä�����true���֤���
+
+have_struct_member(type, member, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type�˥���member
+  ��¸�ߤ��뤫������å����롥type���������Ƥ��ơ�member��
+  ���Ĥ����true���֤���
+
+have_type(type, header, opt)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type��¸�ߤ��뤫��
+  �����å����롥type���������Ƥ����true���֤���
+
+check_sizeof(type, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type��charñ�̥���
+  ����Ĵ�٤롥type���������Ƥ�������Υ��������֤��������
+  ��Ƥ��ʤ��Ȥ���nil���֤���
+
+create_makefile(target)
+
+  ��ĥ�饤�֥���Ѥ�Makefile���������롥���δؿ���ƤФʤ���
+  �Ф��Υ饤�֥��ϥ���ѥ��뤵��ʤ���target�ϥ⥸�塼��̾
+  ��ɽ����
+
+find_executable(command, path)
+
+  ���ޥ��command��File::PATH_SEPARATOR�Ƕ��ڤ�줿�ѥ�̾��
+  �ꥹ��path����õ����path��nil�ޤ��Ͼ�ά���줿���ϡ��Ķ�
+  �ѿ�PATH���ͤ���Ѥ��롥�¹Բ�ǽ�ʥ��ޥ�ɤ����Ĥ��ä����
+  �ϥѥ���ޤ�ե�����̾�����Ĥ���ʤ��ä�����nil���֤���
+
+with_config(withval[, default=nil])
+
+  ���ޥ�ɥ饤����--with-<withval>�ǻ��ꤵ�줿���ץ������
+  �����롥
+
+enable_config(config, *defaults)
+disable_config(config, *defaults)
+
+  ���ޥ�ɥ饤����--enable-<config>�ޤ���
+  --disable-<config>�ǻ��ꤵ�줿�����ͤ����롥
+  --enable-<config>�����ꤵ��Ƥ�������true��
+  --disable-<config>�����ꤵ��Ƥ�������false���֤���
+  �ɤ������ꤵ��Ƥ��ʤ����ϡ��֥��å��Ĥ��ǸƤӽФ����
+  �������*defaults��yield������̡��֥��å��ʤ��ʤ�
+  *defaults���֤���
+
+dir_config(target[, default_dir])
+dir_config(target[, default_include, default_lib])
+
+  ���ޥ�ɥ饤����--with-<target>-dir, --with-<target>-include,
+  --with-<target>-lib�Τ����줫�ǻ��ꤵ���ǥ��쥯�ȥ��
+  $CFLAGS �� $LDFLAGS ���ɲä��롥--with-<target>-dir=/path��
+  --with-<target>-include=/path/include --with-<target>-lib=/path/lib
+  �������Ǥ��롥�ɲä��줿 include �ǥ��쥯�ȥ�� lib �ǥ���
+  ���ȥ��������֤��� ([include_dir, lib_dir])
+
+pkg_config(pkg)
+
+  pkg-config���ޥ�ɤ���ѥå�����pkg�ξ�������롥 
+  pkg-config�μºݤΥ��ޥ��̾�ϡ�--with-pkg-config���ޥ��
+  �饤�󥪥ץ����ǻ����ǽ��
+
+/*
+ * Local variables:
+ * fill-column: 60
+ * end:
+ */
diff --git a/README.EXT.jp b/README.EXT.jp
deleted file mode 100644
index dab85df08a..0000000000
--- a/README.EXT.jp
+++ /dev/null
@@ -1,1142 +0,0 @@
-.\" README.EXT -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
-
-Ruby�γ�ĥ�饤�֥��κ�������������ޤ���
-
-1�������μ�
-
-C���ѿ��ˤϷ������ꡤ�ǡ����ˤϷ�������ޤ��󡥤Ǥ����顤��
-�Ȥ��Хݥ��󥿤�int���ѿ�����������ȡ������ͤ������Ȥ��Ƽ�
-�갷���ޤ����դ�Ruby���ѿ��ˤϷ����ʤ����ǡ����˷��������
-�������ΰ㤤�Τ��ᡤC��Ruby����ߤ��Ѵ����ʤ���С����ߤ���
-�ǡ����򥢥������Ǥ��ޤ���
-
-Ruby�Υǡ�����VALUE�Ȥ���C�η���ɽ������ޤ���VALUE���Υǡ�
-���Ϥ��Υǡ��������פ�ʬ���ΤäƤ��ޤ������Υǡ��������פ�
-�����Τϥǡ���(���֥�������)�μºݤι�¤���̣���Ƥ��ơ�Ruby
-�Υ��饹�ȤϤޤ���ä���ΤǤ���
-
-VALUE����C�ˤȤäư�̣�Τ���ǡ�������Ф�����ˤ�
-
- (1) VALUE�Υǡ��������פ��Τ�
- (2) VALUE��C�Υǡ������Ѵ�����
-
-��ξ����ɬ�פǤ���(1)��˺���ȴְ�ä��ǡ������Ѵ����Ԥ��
-�ơ��ǰ��ץ�����बcore dump���ޤ���
-
-1.1 �ǡ���������
-
-Ruby�ˤϥ桼�����Ȥ���ǽ���Τ���ʲ��Υ����פ�����ޤ���
-
-	T_NIL		nil
-	T_OBJECT	�̾�Υ��֥�������
-	T_CLASS		���饹
-	T_MODULE	�⥸�塼��
-	T_FLOAT		��ư��������
-	T_STRING	ʸ����
-	T_REGEXP	����ɽ��
-	T_ARRAY		����
-	T_FIXNUM	Fixnum(31bitĹ����)
-	T_HASH		Ϣ������
-	T_STRUCT	(Ruby��)��¤��
-	T_BIGNUM	¿��Ĺ����
-	T_FILE		������
-	T_TRUE		��
-	T_FALSE		��
-	T_DATA		�ǡ���
-
-����¾�����������Ѥ���Ƥ���ʲ��Υ����פ�����ޤ���
-
-	T_ICLASS
-	T_MATCH
-	T_VARMAP
-	T_SCOPE
-	T_NODE
-
-�ۤȤ�ɤΥ����פ�C�ι�¤�ΤǼ�������Ƥ��ޤ���
-
-1.2 VALUE�Υǡ��������פ�����å�����
-
-ruby.h�Ǥ�TYPE()�Ȥ����ޥ������������Ƥ��ơ�VALUE�Υǡ���
-�����פ��Τ뤳�Ȥ�����ޤ���TYPE()�ޥ����Ͼ�ǾҲ𤷤�T_XXXX
-�η�����������֤��ޤ���VALUE�Υǡ��������פ˱����ƽ�������
-���ˤϡ�TYPE()���ͤ�ʬ�����뤳�Ȥˤʤ�ޤ���
-
-  switch (TYPE(obj)) {
-    case T_FIXNUM:
-      /* FIXNUM�ν��� */
-      break;
-    case T_STRING:
-      /* ʸ����ν��� */
-      break;
-    case T_ARRAY:
-      /* ����ν��� */
-      break;
-    default:
-      /* �㳰��ȯ�������� */
-      TypeError("not valid value");
-      break;
-  }
-
-����ȥǡ��������פ�����å����ơ��������ʤ�����㳰��ȯ����
-��ؿ����Ѱդ���Ƥ��ޤ���
-
-  void Check_Type(VALUE value, int type)
-
-���δؿ���value��type��̵����С��㳰��ȯ�������ޤ���������
-����Ϳ����줿VALUE�Υǡ��������פ����������ɤ��������å���
-�뤿��ˤϡ����δؿ���Ȥ��ޤ���
-
-FIXNUM��NIL�˴ؤ��ƤϤ���®��Ƚ�̥ޥ������Ѱդ���Ƥ��ޤ���
-
-  FIXNUM_P(obj)
-  NIL_P(obj)
-
-1.3 VALUE��C�Υǡ������Ѵ�����
-
-�ǡ��������פ�T_NIL, T_FALSE, T_TRUE�Ǥ�������ǡ����Ϥ��줾
-��nil, false, true�Ǥ������Υǡ��������פΥ��֥������ȤϤҤ�
-�Ĥ��Ĥ���¸�ߤ��ޤ���
-
-�ǡ��������פ�T_FIXNUM�λ��������31bit�Υ����������������
-����FIXNUM��C���������Ѵ����뤿��ˤϥޥ�����FIX2INT()�פ��
-���ޤ������줫�顤FIXNUM�˸¤餺Ruby�Υǡ������������Ѵ�����
-��NUM2INT()�פȤ����ޥ���������ޤ������Υޥ����ϥǡ�������
-�פΥ����å�̵���ǻȤ��ޤ�(�������Ѵ��Ǥ��ʤ����ˤ��㳰��
-ȯ������)��
-
-Ʊ�ͤ˥����å�̵���ǻȤ����Ѵ��ޥ�����double����Ф�
-��NUM2DBL()�פ�char*����Ф���STR2CSTR()�פ�����ޤ���
-
-����ʳ��Υǡ��������פ��б�����C�ι�¤�Τ�����ޤ����б���
-�빽¤�ΤΤ���VALUE�Ϥ��Τޤޥ��㥹��(���Ѵ�)����й�¤�Τ�
-�ݥ��󥿤��Ѵ��Ǥ��ޤ���
-
-��¤�Τϡ�struct RXxxxx�פȤ���̾����ruby.h���������Ƥ���
-�����㤨��ʸ����ϡ�struct RString�פǤ����ºݤ˻Ȥ���ǽ����
-����Τ�ʸ��������󤯤餤���Ȼפ��ޤ���
-
-ruby.h�ǤϹ�¤�Τإ��㥹�Ȥ���ޥ������RXXXXX()��(������ʸ
-���ˤ������)�Ȥ���̾�����󶡤���Ƥ��ޤ�(��: RSTRING())��
-
-�㤨�С�ʸ����str��Ĺ�������뤿��ˤϡ�RSTRING(str)->len�פ�
-����ʸ����str��char*�Ȥ������뤿��ˤϡ�RSTRING(str)->ptr��
-�Ȥ��ޤ�������ξ��ˤϡ����줾���RARRAY(ary)->len�ס�
-��RARRAY(ary)->ptr�פȤʤ�ޤ���
-
-Ruby�ι�¤�Τ�ľ�ܥ�������������˵���Ĥ��ʤ���Фʤ�ʤ���
-�Ȥϡ������ʸ����ι�¤�Τ���Ȥϻ��Ȥ�������ǡ�ľ���ѹ���
-�ʤ����ȤǤ���ľ���ѹ�������硤���֥������Ȥ����Ƥ���������
-�Ȥ�ʤ��ʤäơ��פ�̥Х��θ����ˤʤ�ޤ���
-
-1.4 C�Υǡ�����VALUE���Ѵ�����
-
-VALUE�μºݤι�¤��
-
-  * FIXNUM�ξ��
-
-    1bit�����եȤ��ơ�LSB��Ω�Ƥ롥
-
-  * ����¾�Υݥ��󥿤ξ��
-
-    ���Τޤ�VALUE�˥��㥹�Ȥ��롥
-
-�ȤʤäƤ��ޤ�����äơ�LSB������å������VALUE��FIXNUM����
-�����狼��櫓�Ǥ�(�ݥ��󥿤�LSB��Ω�äƤ��ʤ����Ȥ��ꤷ��
-����)��
-
-�Ǥ����顤FIXNUM�ʳ���Ruby�Υ��֥������Ȥι�¤�Τ�ñ��VALUE
-�˥��㥹�Ȥ��������VALUE���Ѵ�����ޤ�����������Ǥ�դι�¤
-�Τ�VALUE�˥��㥹�Ƚ����櫓�ǤϤ���ޤ��󡥥��㥹�Ȥ����
-��Ruby���ΤäƤ��빽¤��(ruby.h���������Ƥ���struct RXxxx
-�Τ��)�����Ǥ���
-
-FIXNUM�˴ؤ��Ƥ��Ѵ��ޥ������ͳ����ɬ�פ�����ޤ���C������
-����VALUE���Ѵ�����ޥ����ϰʲ��Τ�Τ�����ޤ���ɬ�פ˱���
-�ƻȤ�ʬ���Ƥ���������
-
-  INT2FIX()	��Ȥ�������31bit����˼��ޤ뼫���������
-  INT2NUM()	Ǥ�դ���������VALUE��
-
-INT2NUM()��������FIXNUM���ϰϤ˼��ޤ�ʤ���硤Bignum���Ѵ�
-���Ƥ���ޤ�(���������٤�)��
-
-1.5 Ruby�Υǡ���������
-
-������Ҥ٤��̤ꡤRuby�ι�¤�Τ򥢥���������������Ƥι�����
-�Ԥ����Ȥϴ�����ޤ��󡥤ǡ�Ruby�Υǡ�����������ˤ�
-Ruby���Ѱդ��Ƥ���ؿ����Ѥ��Ƥ���������
-
-�����ǤϤ�äȤ�Ȥ���Ǥ�����ʸ��������������/�����
-���ؿ��򤢤��ޤ�(�����ǤϤʤ��Ǥ�)��
-
- ʸ������Ф���ؿ�
-
-  rb_str_new(char *ptr, int len)
-
-    ������Ruby��ʸ������������롥
-
-  rb_str_new2(char *ptr)
-
-    C��ʸ���󤫤�Ruby��ʸ������������롥���δؿ��ε�ǽ��
-    rb_str_new(ptr, strlen(ptr))��Ʊ���Ǥ��롥
-
-  rb_str_cat(VALUE str, char *ptr, int len)
-
-    Ruby��ʸ����str��len�Х��Ȥ�ʸ����ptr���ɲä��롥
-
- ������Ф���ؿ�
-
-  rb_ary_new()
-
-    ���Ǥ�0��������������롥
-
-  rb_ary_new2(int len)
-
-    ���Ǥ�0��������������롥len����ʬ���ΰ�򤢤餫������
-    ���ƤƤ�����
-
-  rb_ary_new3(int n, ...)
-
-    �����ǻ��ꤷ��n���Ǥ�ޤ�������������롥
-
-  rb_ary_new4(int n, VALUE *elts)
-
-    �����Ϳ����n���Ǥ�������������롥
-
-  rb_ary_push(VALUE ary, VALUE val)
-  rb_ary_pop(VALUE ary)
-  rb_ary_shift(VALUE ary)
-  rb_ary_unshift(VALUE ary, VALUE val)
-  rb_ary_entry(VALUE ary, int idx)
-
-    Array��Ʊ̾�Υ᥽�åɤ�Ʊ��Ư���򤹤�ؿ�����1������ɬ��
-    ����Ǥʤ���Фʤ�ʤ���
-
-2��Ruby�ε�ǽ��Ȥ�
-
-����Ū��Ruby�ǽ񤱤뤳�Ȥ�C�Ǥ�񤱤ޤ���Ruby���Τ�Τ�C�ǵ�
-�Ҥ���Ƥ����Ǥ����顤�����Ȥ����������ʤ�Ǥ����ɡ�������
-��Ruby�γ�ĥ�˻Ȥ����Ȥ�¿����������ͽ¬����뵡ǽ���濴�˾�
-�𤷤ޤ���
-
-2.1 Ruby�˵�ǽ���ɲä���
-
-Ruby���󶡤���Ƥ���ؿ���Ȥ���Ruby���󥿥ץ꥿�˿�������ǽ
-���ɲä��뤳�Ȥ��Ǥ��ޤ���Ruby�Ǥϰʲ��ε�ǽ���ɲä���ؿ���
-�󶡤���Ƥ��ޤ���
-
- * ���饹���⥸�塼��
- * �᥽�åɡ��ðۥ᥽�åɤʤ�
- * ���
-
-�ǤϽ�˾Ҳ𤷤ޤ���
-
-2.1.1 ���饹/�⥸�塼�����
-
-���饹��⥸�塼���������뤿��ˤϡ��ʲ��δؿ���Ȥ��ޤ���
-
-  VALUE rb_define_class(char *name, VALUE super)
-  VALUE rb_define_module(char *name)
-
-�����δؿ��Ͽ�����������줿���饹��⥸�塼����֤��ޤ���
-�᥽�åɤ����������ˤ������ͤ�ɬ�פʤΤǡ��ۤȤ�ɤξ��
-������ͤ��ѿ��˳�Ǽ���Ƥ���ɬ�פ�����Ǥ��礦��
-
-���饹��⥸�塼���¾�Υ��饹�������˥ͥ��Ȥ�������������
-�ϰʲ��δؿ���Ȥ��ޤ���
-
-  VALUE rb_define_class(VALUE outer, char *name, VALUE super)
-  VALUE rb_define_module(VALUE outer, char *name)
-
-2.1.2 �᥽�å�/�ðۥ᥽�å����
-
-�᥽�åɤ��ðۥ᥽�åɤ��������ˤϰʲ��δؿ���Ȥ��ޤ���
-
-  void rb_define_method(VALUE class, char *name, 
-		        VALUE (*func)(), int argc)
-
-  void rb_define_singleton_method(VALUE object, char *name, 
-			          VALUE (*func)(), int argc)
-
-
-ǰ�Τ�����������ȡ��ðۥ᥽�åɡפȤϡ���������Υ��֥�����
-�Ȥ��Ф��Ƥ���ͭ���ʥ᥽�åɤǤ���Ruby�ǤϤ褯Smalltalk�ˤ�
-���륯�饹�᥽�åɤȤ��ơ����饹���Ф����ðۥ᥽�åɤ��Ȥ��
-�ޤ���
-
-�����δؿ��� argc�Ȥ���������C�δؿ����Ϥ��������ο�(��
-����)����ޤ���argc��0�ʾ�λ��ϴؿ��˰����Ϥ������ο����
-̣���ޤ���16�İʾ�ΰ����ϻȤ��ޤ���(�����פ�ޤ����͡���
-��ʤ�)���ºݤδؿ��ˤ���Ƭ�ΰ����Ȥ���self��Ϳ�����ޤ���
-�ǡ����ꤷ�������1¿����������Ĥ��Ȥˤʤ�ޤ���
-
-argc����λ��ϰ����ο��ǤϤʤ�����������ꤷ�����Ȥˤʤ�ޤ���
-argc��-1�λ��ϰ����������������Ϥ���ޤ���argc��-2�λ��ϰ�
-����Ruby������Ȥ����Ϥ���ޤ���
-
-�᥽�åɤ��������ؿ��Ϥ⤦��Ĥ���ޤ����ҤȤĤ�private��
-���åɤ��������ؿ��ǡ�������rb_define_method()��Ʊ���Ǥ���
-
-  void rb_define_private_method(VALUE class, char *name, 
-			        VALUE (*func)(), int argc)
-
-private�᥽�åɤȤϴؿ������Ǥ����ƤӽФ����Ȥν���ʤ��᥽��
-�ɤǤ���
-
-�⤦�ҤȤĤϥ⥸�塼��ؿ�����������ΤǤ����⥸�塼��ؿ�
-�Ȥϥ⥸�塼����ðۥ᥽�åɤǤ��ꡤƱ����private�᥽�åɤ�
-�⤢���ΤǤ�����򤢤����Math�⥸�塼���sqrt()�ʤɤ�����
-���ޤ������Υ᥽�åɤ�
-
-  Math.sqrt(4)
-
-�Ȥ��������Ǥ�
-
-  include Math
-  sqrt(4)
-
-�Ȥ��������Ǥ�Ȥ��ޤ����⥸�塼��ؿ����������ؿ��ϰʲ���
-�̤�Ǥ���
-
-  void rb_define_module_function(VALUE module, char *name, 
-		                 VALUE (*func)(), int argc)
-
-�ؿ�Ū�᥽�å�(Kernel�⥸�塼���private method)��������뤿
-��δؿ��ϰʲ����̤�Ǥ���
-
-  void rb_define_global_function(char *name, VALUE (*func)(), int argc)
-
-
-2.1.3 ������
-
-��ĥ�饤�֥�꤬ɬ�פ�����Ϥ��餫����������Ƥ����������ɤ�
-�Ǥ��礦��������������ؿ�����Ĥ���ޤ���
-
-  void rb_define_const(VALUE class, char *name, VALUE val)
-  void rb_define_global_const(char *name, VALUE val)
-
-���Ԥ�����Υ��饹/�⥸�塼���°�����������������Ρ���
-�Ԥϥ������Х���������������ΤǤ���
-
-2.2 Ruby�ε�ǽ��C����ƤӽФ�
-
-���ˡ�1.5 Ruby�Υǡ���������٤ǰ����Ҳ𤷤��褦�ʴؿ���
-�Ȥ��С�Ruby�ε�ǽ��¸����Ƥ���ؿ���ľ�ܸƤӽФ����Ȥ�����
-�ޤ���
-
-# ���Τ褦�ʴؿ��ΰ���ɽ�Ϥ��ޤΤȤ�������ޤ��󡥥�������
-# �뤷���ʤ��Ǥ��͡�
-
-����ʳ��ˤ�Ruby�ε�ǽ��ƤӽФ���ˡ�Ϥ����Ĥ�����ޤ���
-
-2.2.1 Ruby�Υץ�������eval����
-
-C����Ruby�ε�ǽ��ƤӽФ���äȤ��ñ����ˡ�Ȥ��ơ�ʸ�����
-Ϳ����줿Ruby�Υץ�������ɾ������ؿ�������ޤ���
-
-  VALUE rb_eval_string(char *str)
-
-����ɾ���ϸ��ߤδĶ��ǹԤ��ޤ����Ĥޤꡤ���ߤΥ��������ѿ�
-�ʤɤ�����Ѥ��ޤ���
-
-2.2.2 ID�ޤ��ϥ���ܥ�
-
-C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ����Ȥ�Ǥ���
-�����������ˡ�Ruby���󥿥ץ꥿��ǥ᥽�åɤ��ѿ�̾����ꤹ��
-���˻Ȥ��Ƥ���ID�ˤĤ����������Ƥ����ޤ��礦��
-
-ID�Ȥ��ѿ�̾���᥽�å�̾��ɽ�������Ǥ���Ruby����Ǥ�
-
- :���̻�
-
-�ǥ��������Ǥ��ޤ���C���餳�����������뤿��ˤϴؿ�
-
-  rb_intern(char *name)
-
-��Ȥ��ޤ����ޤ���ʸ���α黻�ҤϤ���ʸ�������ɤ����Τޤޥ���
-�ܥ�ˤʤäƤ��ޤ���Ruby��������Ȥ���Ϳ����줿����ܥ�(��
-����ʸ����)��ID���Ѵ�����ˤϰʲ��δؿ���Ȥ��ޤ���
-
-  rb_to_id(VALUE symbol)
-
-2.2.3 C����Ruby�Υ᥽�åɤ�ƤӽФ�
-
-C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ�����ˤϰʲ�
-�δؿ���Ȥ��ޤ���
-
-  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-���δؿ��ϥ��֥�������recv��mid�ǻ��ꤵ���᥽�åɤ�Ƥӽ�
-���ޤ�������¾�˰����λ���λ������㤦�ʲ��δؿ��⤢��ޤ���
-
-  VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-  VALUE rb_apply(VALUE recv, ID mid, VALUE args)
-
-apply�ˤϰ����Ȥ���Ruby�������Ϳ���ޤ���
-
-2.2.4 �ѿ�/����򻲾�/��������
-
-C����ؿ���Ȥäƻ��ȡ������Ǥ���Τϡ���������󥹥�����
-���Ǥ�������ѿ��ϰ����Τ�Τ�C������ѿ��Ȥ��ƥ��������Ǥ�
-�ޤ������������ѿ��򻲾Ȥ�����ˡ�ϸ������Ƥ��ޤ���
-
-���֥������ȤΥ��󥹥����ѿ��򻲾ȡ���������ؿ��ϰʲ�����
-��Ǥ���
-
-  VALUE rb_ivar_get(VALUE obj, ID id)
-  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id��rb_intern()���������Τ�ȤäƤ���������
-
-����򻲾Ȥ���ˤϰʲ��δؿ���ȤäƤ���������
-
-  VALUE rb_const_get(VALUE obj, ID id)
-
-����򿷤���������뤿��ˤϡ�2.1.3 �������٤ǾҲ�
-��Ƥ���ؿ���ȤäƤ���������
-
-3��Ruby��C�Ȥξ���ͭ
-
-C�����Ruby�δ֤Ǿ����ͭ������ˡ�ˤĤ��Ʋ��⤷�ޤ���
-
-3.1 C���黲�ȤǤ���Ruby�����
-
-�ʲ���Ruby�������C�Υ�٥뤫�黲�ȤǤ��롥
-
-  Qtrue
-  Qfalse
-
-�����͡�Qfalse��C����Ǥ⵶�Ȥߤʤ����(�Ĥޤ�0)��
-
-  Qnil
-
-C���줫�鸫����nil�ס�
-
-3.2 C��Ruby�Ƕ�ͭ���������ѿ�
-
-C��Ruby������ѿ���Ȥäƾ����ͭ�Ǥ��ޤ�����ͭ�Ǥ������
-�ѿ��ˤϤ����Ĥ��μ��ब����ޤ������Τʤ��Ǥ�äȤ��ɤ��Ȥ�
-���Ȼפ���Τ�rb_define_variable()�Ǥ���
-
-  void rb_define_variable(char *name, VALUE *var)
-
-���δؿ���Ruby��C�ȤǶ�ͭ��������ѿ���������ޤ����ѿ�̾��
-`$'�ǻϤޤ�ʤ����ˤϼ�ưŪ���ɲä���ޤ��������ѿ����ͤ���
-������ȼ�ưŪ��Ruby���б������ѿ����ͤ��Ѥ��ޤ���
-
-�ޤ�Ruby¦����Ϲ����Ǥ��ʤ��ѿ��⤢��ޤ�������read only��
-�ѿ��ϰʲ��δؿ���������ޤ���
-
-  void rb_define_readonly_variable(char *name, VALUE *var)
-
-������ѿ���¾��hook��Ĥ�������ѿ�������Ǥ��ޤ���hook�դ�
-������ѿ��ϰʲ��δؿ����Ѥ���������ޤ���hook�դ�����ѿ���
-�ͤλ��Ȥ������hook�ǹԤ�ɬ�פ�����ޤ���
-
-  void rb_define_hooked_variable(char *name, VALUE *var,
-				 VALUE (*getter)(), VALUE (*setter)())
-
-���δؿ���C�δؿ��ˤ�ä�hook�ΤĤ���줿����ѿ����������
-�����ѿ������Ȥ��줿���ˤϴؿ�getter�����ѿ����ͤ����åȤ���
-�����ˤϴؿ�setter���ƤФ�롥hook����ꤷ�ʤ�����getter��
-setter��0����ꤷ�ޤ���
-
-# getter��setter��0�ʤ��rb_define_variable()��Ʊ���ˤʤ롥
-
-���줫�顤C�δؿ��ˤ�äƼ¸������Ruby������ѿ����������
-�ؿ�������ޤ���
-
-  void rb_define_virtual_variable(char *name,
-				  VALUE (*getter)(), VALUE (*setter)())
-
-���δؿ��ˤ�ä�������줿Ruby������ѿ������Ȥ��줿���ˤ�
-getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�ޤ���
-
-getter��setter�λ��ͤϰʲ����̤�Ǥ���
-
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 C�Υǡ�����Ruby���֥������Ȥˤ���
-
-C��������������줿�ǡ���(��¤��)��Ruby�Υ��֥������ȤȤ���
-��갷��������礬���ꤨ�ޤ������Τ褦�ʾ��ˤϡ�Data�Ȥ���
-Ruby���֥������Ȥ�C�ι�¤��(�ؤΥݥ���)�򤯤�ळ�Ȥ�Ruby
-���֥������ȤȤ��Ƽ�갷����褦�ˤʤ�ޤ���
-
-Data���֥������Ȥ��������ƹ�¤�Τ�Ruby���֥������Ȥ˥��ץ���
-�����뤿��ˤϡ��ʲ��Υޥ�����Ȥ��ޤ���
-
-  Data_Wrap_Struct(class,mark,free,ptr)
-
-���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
-
-class�Ϥ���Data���֥������ȤΥ��饹�Ǥ���ptr�ϥ��ץ��벽����
-C�ι�¤�ΤؤΥݥ��󥿤Ǥ���mark�Ϥ��ι�¤�Τ�Ruby�Υ��֥���
-���Ȥؤλ��Ȥ�������˻Ȥ��ؿ��Ǥ������Τ褦�ʻ��Ȥ�ޤޤʤ�
-���ˤ�0����ꤷ�ޤ���
-
-# ���Τ褦�ʻ��Ȥϴ�����ޤ���
-
-free�Ϥ��ι�¤�Τ��⤦���פˤʤä����˸ƤФ��ؿ��Ǥ�������
-�ؿ��������١������쥯������ƤФ�ޤ���
-
-C�ι�¤�Τγ�����Data���֥������Ȥ�������Ʊ���˹Ԥ��ޥ�����
-���ưʲ��Τ�Τ��󶡤���Ƥ��ޤ���
-
-  Data_Make_Struct(class, type, mark, free, sval)
-
-���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
-
-class, mark, free��Data_Wrap_Struct��Ʊ��Ư���򤷤ޤ���type
-�ϳ�����Ƥ�C��¤�Τη��Ǥ���������Ƥ�줿��¤�Τ��ѿ�sval
-����������ޤ��������ѿ��η��� (type*) �Ǥ���ɬ�פ�����ޤ���
-
-Data���֥������Ȥ���ݥ��󥿤���Ф��Τϰʲ��Υޥ������Ѥ�
-�ޤ���
-
-  Data_Get_Struct(obj, type, sval)
-
-C�ι�¤�ΤؤΥݥ��󥿤��ѿ�sval����������ޤ���
-
-������Data�λȤ����Ϥ���ä�ʬ����ˤ����Τǡ������������
-����򻲾Ȥ��Ƥ���������
-
-4������ - dbm�ѥå���������
-
-�����ޤǤ������ǤȤꤢ������ĥ�饤�֥��Ϻ���Ϥ��Ǥ���
-Ruby��ext�ǥ��쥯�ȥ�ˤ��Ǥ˴ޤޤ�Ƥ���dbm�饤�֥������
-�����ʳ�Ū���������ޤ���
-
-(1) �ǥ��쥯�ȥ����
-
-  % mkdir ext/dbm
-
-Ruby 1.1�����Ǥ�դΥǥ��쥯�ȥ�ǥ����ʥߥå��饤�֥����
-�뤳�Ȥ��Ǥ���褦�ˤʤ�ޤ�����Ruby����Ū�˥�󥯤������
-��Ruby��Ÿ�������ǥ��쥯�ȥ�β���ext�ǥ��쥯�ȥ����˳�ĥ
-�饤�֥���ѤΥǥ��쥯�ȥ����ɬ�פ�����ޤ���̾����Ŭ����
-����ǹ����ޤ���
-
-(2) MANIFEST�ե��������
-
-  % cd ext/dbm
-  % touch MANIFEST
-
-��ĥ�饤�֥��Υǥ��쥯�ȥ�β��ˤ�MANIFEST�Ȥ����ե����뤬
-ɬ�פʤΤǡ��Ȥꤢ�������Υե�������äƤ����ޤ�����Ǥ���
-�ե�����ˤ�ɬ�פʥե�������������뤳�Ȥˤʤ�ޤ���
-
-MANIFEST�Ȥ����ե�����ϡ���Ū��󥯤�make�λ��˥ǥ��쥯�ȥ�
-����ĥ�饤�֥���ޤ�Ǥ��뤫�ɤ���Ƚ�ꤹ�뤿��˻Ȥ����
-���ޤ��������ʥߥå��饤�֥�������ˤ�ɬ������ɬ�פǤ�
-����ޤ���
-
-(3) �߷פ���
-
-�ޤ��������ʤ�Ǥ����ɡ��ɤ�������ǽ��¸����뤫�ɤ����ޤ���
-�פ���ɬ�פ�����ޤ����ɤ�ʥ��饹��Ĥ��뤫�����Υ��饹�ˤ�
-�ɤ�ʥ᥽�åɤ����뤫�����饹���󶡤�������ʤɤˤĤ����߷�
-���ޤ���dbm���饹�ˤĤ��Ƥ�ext/dbm.doc�򻲾Ȥ��Ƥ���������
-
-(4) C�����ɤ��
-
-��ĥ�饤�֥�����ΤȤʤ�C����Υ�������񤭤ޤ���C����Υ���
-�����ҤȤĤλ��ˤϡ֥饤�֥��̾.c�פ����֤��ɤ��Ǥ��礦��C
-����Υ�������ʣ���ξ��ˤϵդˡ֥饤�֥��̾.c�פȤ����ե�
-����̾���򤱤�ɬ�פ�����ޤ������֥������ȥե�����ȥ⥸�塼
-�������������Ū�����������֥饤�֥��̾.o�פȤ����ե�����
-�Ȥ����ͤ��뤫��Ǥ���
-
-Ruby�ϳ�ĥ�饤�֥�������ɤ�����ˡ�Init_�饤�֥��̾�פ�
-�����ؿ���ưŪ�˼¹Ԥ��ޤ���dbm�饤�֥��ξ���Init_dbm��
-�Ǥ������δؿ�����ǥ��饹���⥸�塼�롤�᥽�åɡ�����ʤɤ�
-�����Ԥ��ޤ���dbm.c����������Ѥ��ޤ���
-
---
-Init_dbm()
-{
-    /* DBM���饹��������� */
-    cDBM = rb_define_class("DBM", rb_cObject);
-    /* DBM��Enumerate�⥸�塼��򥤥󥯥롼�ɤ��� */
-    rb_include_module(cDBM, rb_mEnumerable);
-
-    /* DBM���饹�Υ��饹�᥽�å�open(): ������C������Ǽ����� */
-    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
-    /* DBM���饹�Υ᥽�å�close(): �����Ϥʤ� */
-    rb_define_method(cDBM, "close", fdbm_close, 0);
-    /* DBM���饹�Υ᥽�å�[]: ������1�� */
-    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
-		:
-
-    /* DBM�ǡ������Ǽ���륤�󥹥����ѿ�̾�Τ����ID */
-    id_dbm = rb_intern("dbm");
-}
---
-
-DBM�饤�֥���dbm�Υǡ������б����륪�֥������Ȥˤʤ�Ϥ���
-�����顤C��������dbm��Ruby�������˼�����ɬ�פ�����ޤ���
-
-
-dbm.c�Ǥ�Data_Make_Struct��ʲ��Τ褦�˻ȤäƤ��ޤ���
-
---
-struct dbmdata {
-    int  di_size;
-    DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(class,struct dbmdata,0,free_dbm,dbmp);
---
-
-�����Ǥ�dbmstruct��¤�ΤؤΥݥ��󥿤�Data�˥��ץ��벽���Ƥ�
-�ޤ���DBM*��ľ�ܥ��ץ��벽���ʤ��Τ�close()�������ν������
-���ƤΤ��ȤǤ���
-
-Data���֥������Ȥ���dbmstruct��¤�ΤΥݥ��󥿤���Ф�����
-�˰ʲ��Υޥ�����ȤäƤ��ޤ���
-
---
-#define GetDBM(obj, dbmp) {\
-    Data_Get_Struct(obj, struct dbmdata, dbmp);\
-    if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-����ä�ʣ���ʥޥ����Ǥ������פ����dbmdata��¤�ΤΥݥ���
-�μ��Ф��ȡ�close����Ƥ��뤫�ɤ����Υ����å���ޤȤ�Ƥ�
-������Ǥ���
-
-DBM���饹�ˤϤ�������᥽�åɤ�����ޤ�����ʬ�ह���3�����
-�����μ�����������ޤ����ҤȤĤϰ����ο�������Τ�Τǡ����
-���Ƥ�delete�᥽�åɤ�����ޤ���delete�᥽�åɤ�������Ƥ���
-fdbm_delete()�Ϥ��Τ褦�ˤʤäƤ��ޤ���
-
---
-static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
-{
-	:
-}
---
-
-�����ο�������Υ����פ���1������self����2�����ʹߤ��᥽�å�
-�ΰ����Ȥʤ�ޤ���
-
-�����ο�������Τ�Τ�C������Ǽ������Τ�Ruby������Ǽ���
-���ΤȤ�����ޤ���dbm�饤�֥�����ǡ�C������Ǽ�������
-��DBM�Υ��饹�᥽�åɤǤ���open()�Ǥ��������������Ƥ����
-��fdbm_s_open()�Ϥ����ʤäƤ��ޤ���
-
---
-static VALUE
-fdbm_s_open(argc, argv, class)
-    int argc;
-    VALUE *argv;
-    VALUE class;
-{
-	:
-    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
-	mode = 0666;		/* default value */
-    }
-	:
-}
---
-
-���Υ����פδؿ�����1������Ϳ����줿�����ο�����2������Ϳ��
-��줿���������äƤ�������ˤʤ�ޤ���self����3�����Ȥ���Ϳ
-�����ޤ���
-
-���������Ϳ����줿��������Ϥ��뤿��δؿ���open()�Ǥ�Ȥ�
-��Ƥ���rb_scan_args()�Ǥ�����3�����˻��ꤷ���ե����ޥåȤ�
-��������4�ѿ��ʹߤ˻��ꤷ���ѿ����ͤ��������Ƥ���ޤ�������
-�ե����ޥåȤϡ���1ʸ���ܤ���ά�Ǥ��ʤ������ο�����2ʸ���ܤ�
-��ά�Ǥ�������ο�����3ʸ���ܤ��б�������̵꤬�����ޤ�ΰ�
-�������뤫�ɤ����򼨤�"*"�Ǥ���2ʸ���ܤ�3ʸ���ܤϾ�ά�Ǥ���
-����dbm.c����Ǥϡ��ե����ޥåȤ�"11"�Ǥ����顤�����Ϻ���1��
-�ǡ�2�Ĥޤǵ������Ȥ�����̣�ˤʤ�ޤ�����ά����Ƥ������
-�ѿ����ͤ�nil(C����Υ�٥�Ǥ�Qnil)�ˤʤ�ޤ���
-
-Ruby������ǰ������������Τ�indexes������ޤ��������Ϥ�
-���Ǥ���
-
---
-static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
-{
-	:
-}
---
-
-��1������self����2������Ruby������Ǥ���
-
-** ���ջ���
-
-Ruby�ȶ�ͭ�Ϥ��ʤ���Ruby�Υ��֥������Ȥ��Ǽ�����ǽ���Τ���
-C������ѿ��ϰʲ��δؿ���Ȥä�Ruby���󥿥ץ꥿���ѿ���¸��
-�򶵤��Ƥ����Ƥ����������Ǥʤ���GC�ǥȥ�֥�򵯤����ޤ���
-
-  void rb_global_variable(VALUE *var)
-
-(5) extconf.rb���Ѱդ���
-
-Makefile������ο����ˤʤ�extconf.rb�Ȥ����ե��������
-�ޤ���extconf.rb�ϥ饤�֥��Υ���ѥ����ɬ�פʾ��Υ�����
-���ʤɤ�Ԥ����Ȥ���Ū�Ǥ����ޤ���
-
-  require 'mkmf'
-
-��extconf.rb����Ƭ���֤��ޤ���extconf.rb����Ǥϰʲ���Ruby��
-����Ȥ����Ȥ�����ޤ���
-
-  have_library(lib, func): �饤�֥���¸�ߥ����å�
-  have_func(func): �ؿ���¸�ߥ����å�
-  have_header(header): �إå��ե������¸�ߥ����å�
-  create_makefile(target): Makefile������
-
-�ʲ����ѿ���Ȥ����Ȥ��Ǥ��ޤ���
-
-  $CFLAGS: ����ѥ�������ɲ�Ū�˻��ꤹ��ե饰(-I�ʤ�)
-  $LDFLAGS: ��󥯻����ɲ�Ū�˻��ꤹ��ե饰(-L�ʤ�)
-
-�饤�֥��򥳥�ѥ��뤹���郎·�鷺�����Υ饤�֥��򥳥�
-�ѥ��뤷�ʤ����ˤ�create_makefile��ƤФʤ����Makefile����
-�����줺������ѥ����Ԥ��ޤ���
-
-(6) depend���Ѱդ���
-
-�⤷���ǥ��쥯�ȥ��depend�Ȥ����ե����뤬¸�ߤ���С�
-Makefile����¸�ط�������å����Ƥ���ޤ���
-
- % gcc -MM *.c > depend
-
-�ʤɤǺ�뤳�Ȥ�����ޤ������ä�»��̵���Ǥ��礦��
-
-(7) MANIFEST�ե�����˥ե�����̾�������
-
-  % find * -type f -print > MANIFEST
-  % vi MANIFEST
-
-*.o, *~�ʤ���ɬ�פʥե�����ʳ���MANIFEST���ɲä��Ƥ����ޤ���
-make���ˤ�MANIFEST�����Ƥϻ��Ȥ��ޤ���Τǡ����ΤޤޤǤ�����
-�ϵ����ޤ��󤬡��ѥå������󥰤λ��˻��Ȥ��뤳�Ȥ�����Τȡ�
-ɬ�פʥե��������̤Ǥ���Τǡ��Ѱդ��Ƥ����������ɤ��Ǥ���
-����
-
-(8) Makefile����������
-
-Makefile��ºݤ��������뤿��ˤ�
-
-  ruby extconf.rb
-
-�Ȥ��ޤ���extconf.rb�� require 'mkmf' �ιԤ��ʤ����ˤϥ��顼
-�ˤʤ�ޤ��Τǡ��������ɲä���
-
-  ruby -r mkmf extconf.rb
-
-�Ȥ��Ƥ���������
-
-�ǥ��쥯�ȥ��ext�ʲ����Ѱդ������ˤ�Ruby���Τ�make�λ���
-��ưŪ��Makefile����������ޤ��Τǡ����Υ��ƥåפ����פǤ���
-
-(9) make����
-
-ưŪ��󥯥饤�֥�������������ˤϤ��ξ��make���Ƥ�����
-����ɬ�פǤ���� make install �ǥ��󥹥ȡ��뤵��ޤ���
-
-ext�ʲ��˥ǥ��쥯�ȥ���Ѱդ������ϡ�Ruby�Υǥ��쥯�ȥ��
-make��¹Ԥ����Makefile����������make��ɬ�פˤ�äƤϤ��Υ�
-���塼���Ruby�ؤΥ�󥯤ޤǼ�ưŪ�˼¹Ԥ��Ƥ���ޤ���
-extconf.rb��񤭴�����ʤɤ���Makefile�κ�������ɬ�פʻ��Ϥ�
-��Ruby�ǥ��쥯�ȥ��make���Ƥ���������
-
-��ĥ�饤�֥���make install��Ruby�饤�֥��Υǥ��쥯�ȥ��
-���˥��ԡ�����ޤ����⤷��ĥ�饤�֥��ȶ�Ĵ���ƻȤ�Ruby�ǵ�
-�Ҥ��줿�ץ�����ब���ꡤRuby�饤�֥����֤��������ˤϡ�
-��ĥ�饤�֥���ѤΥǥ��쥯�ȥ�β��� lib �Ȥ����ǥ��쥯�ȥ�
-���ꡤ������ ��ĥ�� .rb �Υե�������֤��Ƥ�����Ʊ���˥���
-���ȡ��뤵��ޤ���
-
-(10) �ǥХå�
-
-�ޤ����ǥХå����ʤ���ư���ʤ��Ǥ��礦�͡�ext/Setup�˥ǥ���
-���ȥ�̾��񤯤���Ū�˥�󥯤���ΤǥǥХå����Ȥ���褦�ˤ�
-��ޤ�������ʬ����ѥ��뤬�٤��ʤ�ޤ����ɡ�
-
-(11) �Ǥ�������
-
-��Ϥ��ä���Ȥ��ʤꡤ������������ʤꡤ���ʤꡤ����ͳ�ˤ�
-�Ȥ�����������Ruby�κ�Ԥϳ�ĥ�饤�֥��˴ؤ��ư��ڤθ�����
-��ĥ���ޤ���
-
-Appendix A. Ruby�Υ����������ɤ�ʬ��
-
-Ruby�Υ������Ϥ����Ĥ���ʬ�ह�뤳�Ȥ�����ޤ������Τ�������
-���饤�֥�����ʬ�ϴ���Ū�˳�ĥ�饤�֥���Ʊ��������ˤʤ�
-�Ƥ��ޤ��������Υ������Ϻ��ޤǤ������ǤۤȤ������Ǥ����
-�פ��ޤ���
-
-Ruby����Υ���
-
-  class.c
-  error.c
-  eval.c
-  gc.c
-  object.c
-  parse.y
-  variable.c
-
-�桼�ƥ���ƥ��ؿ�
-
-  dln.c
-  fnmatch.c
-  glob.c
-  regex.c
-  st.c
-  util.c
-
-Ruby���ޥ�ɤμ���
-
-  dmyext.c
-  inits.c
-  main.c
-  ruby.c
-  version.c
-
-���饹�饤�֥��
-
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  marshal.c
-  math.c
-  numeric.c
-  pack.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
-
-Appendix B. ��ĥ�Ѵؿ���ե����
-
-C���줫��Ruby�ε�ǽ�����Ѥ���API�ϰʲ����̤�Ǥ��롥
-
-** ��
-
- VALUE
-
-Ruby���֥������Ȥ�ɽ�����뷿��ɬ�פ˱����ƥ��㥹�Ȥ����Ѥ��롥
-�Ȥ߹��߷���ɽ������C�η���ruby.h�˵��Ҥ��Ƥ���R�ǻϤޤ빽¤
-�ΤǤ��롥VALUE���򤳤��˥��㥹�Ȥ��뤿���R�ǻϤޤ빽¤��
-̾��������ʸ���ˤ���̾���Υޥ������Ѱդ���Ƥ��롥
-
-** �ѿ������
-
- Qnil
-
-���: nil���֥�������
-
- Qtrue
-
-���: true���֥�������(���Υǥե������)
-
- Qfalse
-
-���: false���֥�������
-
-** C�ǡ����Υ��ץ��벽
-
- Data_Wrap_Struct(VALUE class, void (*mark)(), void (*free)(), void *sval)
-
-C��Ǥ�դΥݥ��󥿤򥫥ץ��벽����Ruby���֥������Ȥ��֤�����
-�Υݥ��󥿤�Ruby���饢����������ʤ��ʤä�����free�ǻ��ꤷ��
-�ؿ����ƤФ�롥�ޤ������Υݥ��󥿤λؤ��ǡ�����¾��Ruby����
-�������Ȥ�ؤ��Ƥ����硤mark�˻��ꤹ��ؿ��ǥޡ�������ɬ��
-�����롥
-
- Data_Make_Struct(class, type, mark, free, sval)
-
-type���Υ����malloc�����ѿ�sval�����������塤����򥫥ץ�
-�벽�����ǡ������֤��ޥ�����
-
- Data_Get_Struct(data, type, sval)
-
-data����type���Υݥ��󥿤���Ф��ѿ�sval����������ޥ�����
-
-** �������å�
-
- TYPE(value)
- FIXNUM_P(value)
- NIL_P(value)
- void Check_Type(VALUE value, int type)
- void Check_SafeStr(VALUE value)
-
-** ���Ѵ�
-
- FIX2INT(value)
- INT2FIX(i)
- NUM2INT(value)
- INT2NUM(i)
- NUM2DBL(value)
- rb_float_new(f)
- STR2CSTR(value)
- rb_str_new2(s)
-
-** ���饹/�⥸�塼�����
-
- VALUE rb_define_class(char *name, VALUE super)
-
-super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹��������롥
-
- VALUE rb_define_class_under(VALUE module, char *name, VALUE super)
-
-super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹���������module����
-���Ȥ���������롥
-
- VALUE rb_define_module(char *name)
-
-������Ruby�⥸�塼���������롥
-
- VALUE rb_define_module_under(VALUE module, char *name, VALUE super)
-
-������Ruby�⥸�塼����������module������Ȥ���������롥
-
- void rb_include_module(VALUE class, VALUE module)
-
-�⥸�塼��򥤥󥯥롼�ɤ��롥class�����Ǥ�module�򥤥󥯥롼
-�ɤ��Ƥ�����ˤϲ��⤷�ʤ�(¿�ť��󥯥롼�ɤζػ�)��
-
- void rb_extend_object(VALUE object, VALUE module)
-
-���֥������Ȥ�⥸�塼��(���������Ƥ���᥽�å�)�ǳ�ĥ���롥
-
-** ����ѿ����
-
- void rb_define_variable(char *name, VALUE *var)
-
-Ruby��C�ȤǶ�ͭ���륰�����Х��ѿ���������롥�ѿ�̾��`$'�ǻ�
-�ޤ�ʤ����ˤϼ�ưŪ���ɲä���롥name�Ȥ���Ruby�μ��̻ҤȤ�
-�Ƶ�����ʤ�ʸ��(�㤨��` ')��ޤ���ˤ�Ruby�ץ�����फ��
-�ϸ����ʤ��ʤ롥
-
- void rb_define_readonly_variable(char *name, VALUE *var)
-
-Ruby��C�ȤǶ�ͭ����read only�Υ������Х��ѿ���������롥read
-only�Ǥ��뤳�Ȱʳ���rb_define_variable()��Ʊ����
-
- void rb_define_virtual_variable(char *name,
-				VALUE (*getter)(), VALUE (*setter)())
-
-�ؿ��ˤ�äƼ¸������Ruby�ѿ���������롥�ѿ������Ȥ��줿��
-�ˤ�getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�롥
-
- void rb_define_hooked_variable(char *name, VALUE *var,
-				VALUE (*getter)(), VALUE (*setter)())
-
-�ؿ��ˤ�ä�hook�ΤĤ���줿�������Х��ѿ���������롥�ѿ���
-���Ȥ��줿���ˤ�getter�����ؿ����ͤ����åȤ��줿���ˤ�setter
-���ƤФ�롥getter��setter��0����ꤷ�����ˤ�hook����ꤷ��
-���Τ�Ʊ�����ˤʤ롥
-
- void rb_global_variable(VALUE *var)
-
-GC�Τ��ᡤRuby�ץ�����फ��ϥ�����������ʤ���, Ruby���֥���
-���Ȥ�ޤ�����ѿ���ޡ������롥
-
-** ���
-
- void rb_define_const(VALUE klass, char *name, VALUE val)
-
-�����������롥
-
- void rb_define_global_const(char *name, VALUE val)
-
-��������������롥
-
-     rb_define_const(cKernal, name, val)
-
-��Ʊ����̣��
-
-** �᥽�å����
-
- rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-�᥽�åɤ�������롥argc��self����������ο���argc��-1�λ�, 
-�ؿ��ˤϰ����ο�(self��ޤޤʤ�)����1����, �������������2��
-���Ȥ��������Ϳ������(��3������self)��argc��-2�λ�, ��1��
-����self, ��2������args(args�ϰ�����ޤ�Ruby������)�Ȥ�����
-����Ϳ�����롥
-
- rb_define_private_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-private�᥽�åɤ�������롥������rb_define_method()��Ʊ����
-
- rb_define_singleton_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-�ðۥ᥽�åɤ�������롥������rb_define_method()��Ʊ����
-
- rb_scan_args(int argc, VALUE *argv, char *fmt, ...)
-
-argc,argv������Ϳ����줿������ʬ�򤹤롥fmt��ɬ�ܰ����ο�, 
-�ղð����ο�, �Ĥ�ΰ��������뤫����ꤹ��ʸ�����, "������
-��*"�Ȥ��������Ǥ��롥 2 ���ܤο�����"*"�Ϥ��줾���ά��ǽ��
-���롥ɬ�ܰ�������Ĥ�ʤ�����0����ꤹ�롥��3�����ʹߤ���
-���ؤΥݥ��󥿤�, �����������Ǥ������ѿ��˳�Ǽ����롥�ղð�
-�����б����������Ϳ�����Ƥ��ʤ������ѿ���Qnil����������
-�롥
-
-** Ruby�᥽�åɸƤӽФ�
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-�᥽�åɸƤӽФ���ʸ���󤫤�mid�����뤿��ˤ�rb_intern()��Ȥ���
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-�᥽�åɸƤӽФ���������argc,argv�������Ϥ���
-
- VALUE rb_eval_string(char *str)
-
-ʸ�����Ruby�ȥ�����ץȤ��ƥ���ѥ��롦�¹Ԥ��롥
-
- ID rb_intern(char *name)
-
-ʸ������б�����ID���֤���
-
- char *rb_id2name(ID id)
-
-ID���б�����ʸ������֤�(�ǥХå���)��
-
- char *rb_class2name(VALUE class)
-
-class��̾�����֤�(�ǥХå���)��class��̾��������ʤ����ˤ�, 
-������̤ä�̾������ĥ��饹��̾�����֤���
-
-** ���󥹥����ѿ�
-
- VALUE rb_iv_get(VALUE obj, char *name)
-
-obj�Υ��󥹥����ѿ����ͤ����롥`@'�ǻϤޤ�ʤ����󥹥���
-�ѿ��� Ruby�ץ�����फ�饢�������Ǥ��ʤ��ֱ��줿�ץ��󥹥�
-���ѿ��ˤʤ롥�������ʸ����̾������ĥ��饹(�ޤ��ϥ⥸�塼
-��)�Υ��󥹥����ѿ��Ȥ��Ƽ�������Ƥ��롥
-
- VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
-
-obj�Υ��󥹥����ѿ���val�˥��åȤ��롥
-
-** ���湽¤
-
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-func2��֥��å��Ȥ������ꤷ, func1�򥤥ƥ졼���Ȥ��ƸƤ֡� 
-func1�ˤ� arg1�������Ȥ����Ϥ���, func2�ˤ���1�����˥��ƥ졼
-������Ϳ����줿��, ��2������arg2���Ϥ���롥
- 
- VALUE rb_yield(VALUE val)
-
-val���ͤȤ��ƥ��ƥ졼���֥��å���ƤӽФ���
-
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-�ؿ�func1��arg1������˸ƤӽФ���func1�μ¹�����㳰��ȯ����
-�����ˤ� func2��arg2������Ȥ��ƸƤ֡�����ͤ��㳰��ȯ������
-���ä�����func1�������, �㳰��ȯ���������ˤ�func2������ͤ�
-���롥
-
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
-
-�ؿ�func1��arg1������Ȥ��Ƽ¹Ԥ�, �¹Խ�λ��(���Ȥ��㳰��ȯ
-�����Ƥ�) func2��arg2������Ȥ��Ƽ¹Ԥ��롥����ͤ�func1����
-���ͤǤ���(�㳰��ȯ�������������ʤ�)��
-
-** �㳰�����顼
-
- void rb_warning(char *fmt, ...)
-
-rb_verbose����ɸ�२�顼���Ϥ˷ٹ�����ɽ�����롥������printf()��Ʊ����
-
- void rb_raise(rb_eRuntimeError, char *fmt, ...)
-
-RuntimeError�㳰��ȯ�������롥������printf()��Ʊ����
-
- void rb_raise(VALUE exception, char *fmt, ...)
-
-exception�ǻ��ꤷ���㳰��ȯ�������롥fmt�ʲ��ΰ�����printf()��Ʊ����
-
- void rb_fatal(char *fmt, ...)
-
-��̿Ū�㳰��ȯ�������롥�̾���㳰�����ϹԤʤ�줺, ���󥿡�
-�ץ꥿����λ����(������ensure�ǻ��ꤵ�줿�����ɤϽ�λ���˼�
-�Ԥ����)��
-
- void rb_bug(char *fmt, ...)
-
-���󥿡��ץ꥿�ʤɥץ������ΥХ��Ǥ���ȯ������Ϥ��Τʤ���
-���λ��Ƥ֡����󥿡��ץ꥿�ϥ�������פ�ľ���˽�λ���롥�㳰
-�����ϰ��ڹԤʤ��ʤ���
-
-** Ruby�ν�������¹�
-
-Ruby�򥢥ץꥱ����������������ˤϰʲ��Υ��󥿥ե�����
-��Ȥ����̾�γ�ĥ�饤�֥��ˤ�ɬ�פʤ���
-
- void ruby_init(int argc, char **argv, char **envp)
-
-Ruby���󥿥ץ꥿�ν������Ԥʤ���
-
- void ruby_run()
-
-Ruby���󥿥ץ꥿��¹Ԥ��롥
-
- void ruby_script(char *name)
-
-Ruby�Υ�����ץ�̾($0)�����ꤹ�롥
-
-
-Appendix B. extconf.rb�ǻȤ���ؿ�����
-
-extconf.rb����Ǥ����Ѳ�ǽ�ʥ���ѥ���������å��δؿ��ϰ�
-�����̤�Ǥ��롥
-
- have_library(lib, func)
-
-�ؿ�func��������Ƥ���饤�֥��lib��¸�ߤ�����å����롥��
-���֥�꤬¸�ߤ������true���֤���
-
- have_func(func)
-
-�ؿ�func��¸�ߤ�����å����롥func��ɸ��Ǥϥ�󥯤���ʤ���
-���֥����Τ�ΤǤ�����ˤ����have_library�Ǥ��Υ饤�֥��
-������å����Ƥ��������ؿ���¸�ߤ����TRUE���֤���
-
- have_header(header)
-
-�إå��ե������¸�ߤ�����å����롥�إå��ե����뤬¸�ߤ���
-��true���֤���
-
- create_makefile(target)
-
-��ĥ�饤�֥���Ѥ�Makefile���������롥���δؿ���ƤФʤ����
-���Υ饤�֥��ϥ���ѥ��뤵��ʤ���target�ϥ⥸�塼��̾��ɽ
-����
-
-/*
- * Local variables:
- * fill-column: 60
- * end:
- */
diff --git a/README.ja b/README.ja
new file mode 100644
index 0000000000..dd7f67ca59
--- /dev/null
+++ b/README.ja
@@ -0,0 +1,185 @@
+* Ruby�Ȥ�
+
+Ruby�ϥ���ץ뤫�Ķ��Ϥʥ��֥������Ȼظ�������ץȸ���Ǥ���
+Ruby�Ϻǽ餫����ʥ��֥������Ȼظ�����Ȥ����߷פ���Ƥ���
+�����顤���֥������Ȼظ��ץ�����ߥ󥰤��ڤ˹Ԥ����������
+������������̾�μ�³�����Υץ�����ߥ󥰤��ǽ�Ǥ���
+
+Ruby�ϥƥ����Ƚ����ط���ǽ�Ϥʤɤ�ͥ�졤Perl��Ʊ�����餤����
+�Ǥ�������˥���ץ��ʸˡ�ȡ��㳰�����䥤�ƥ졼���ʤɤε���
+�ˤ�äơ����ʬ����䤹���ץ�����ߥ󥰤�����ޤ���
+
+
+* Ruby����Ĺ
+
+  + ����ץ��ʸˡ
+  + ���̤Υ��֥������Ȼظ���ǽ(���饹���᥽�åɥ�����ʤ�)
+  + �ü�ʥ��֥������Ȼظ���ǽ(Mixin, �ðۥ᥽�åɤʤ�)
+  + �黻�ҥ����С�������
+  + �㳰������ǽ
+  + ���ƥ졼���ȥ���������
+  + �����١������쥯��
+  + �����ʥߥå������ǥ��� (�������ƥ�����ˤ��)
+  + �ܿ������⤤��¿����Unix-like/POSIX�ߴ��ץ�åȥե�������
+    ư�������Ǥʤ���Windows�� Mac OS X��BeOS�ʤɤξ�Ǥ�ư��
+    cf. http://redmine.ruby-lang.org/wiki/ruby-19/SupportedPlatformsJa
+
+* ����ˡ
+
+** FTP��
+
+�ʲ��ξ��ˤ����Ƥ���ޤ���
+
+  ftp://ftp.ruby-lang.org/pub/ruby/
+
+** Subversion��
+
+��ȯ��ü�Υ����������ɤϼ��Υ��ޥ�ɤǼ����Ǥ��ޤ���
+
+  $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+¾�˳�ȯ��Υ֥����ΰ����ϼ��Υ��ޥ�ɤǸ����ޤ���
+
+  $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+
+* �ۡ���ڡ���
+
+Ruby�Υۡ���ڡ�����URL��
+
+   http://www.ruby-lang.org/
+
+�Ǥ���
+
+
+* �᡼��󥰥ꥹ��
+
+Ruby�Υ᡼��󥰥ꥹ�Ȥ�����ޤ������ô�˾������
+
+   ruby-list-ctl@ruby-lang.org
+
+�ޤ���ʸ��
+
+   subscribe YourFirstName YourFamilyName
+   
+�Ƚ񤤤����äƲ������� 
+
+Ruby��ȯ�Ը����᡼��󥰥ꥹ�Ȥ⤢��ޤ���������Ǥ�ruby�Υ�
+��������λ��ͳ�ĥ�ʤɼ����������ˤĤ��Ƶ�������Ƥ��ޤ���
+���ô�˾������
+
+   ruby-dev-ctl@ruby-lang.org
+
+�ޤ�ruby-list��Ʊ�ͤ���ˡ�ǥ᡼�뤷�Ƥ��������� 
+
+Ruby��ĥ�⥸�塼��ˤĤ����ä��礦ruby-ext�᡼��󥰥ꥹ�Ȥ�
+���شط�������ˤĤ����ä��礦ruby-math�᡼��󥰥ꥹ�Ȥ�
+�Ѹ���ä��礦ruby-talk�᡼��󥰥ꥹ�Ȥ⤢��ޤ���������ˡ
+�Ϥɤ��Ʊ���Ǥ��� 
+
+
+* ����ѥ��롦���󥹥ȡ���
+
+�ʲ��μ��ǹԤäƤ���������
+
+  1. �⤷configure�ե����뤬���Ĥ���ʤ����⤷����
+     configure.in���Ť��褦�ʤ顢autoconf��¹Ԥ���
+     ������configure����������
+
+  2. configure��¹Ԥ���Makefile�ʤɤ���������
+
+     �Ķ��ˤ�äƤϥǥե���Ȥ�C����ѥ����ѥ��ץ�����դ�
+     �ޤ���configure���ץ����� optflags=.. warnflags=.. ��
+     �Ǿ�񤭤Ǥ��ޤ���
+
+  3. (ɬ�פʤ��)defines.h���Խ�����
+
+     ¿ʬ��ɬ��̵���Ȼפ��ޤ���
+
+  4. (ɬ�פʤ��)ext/Setup����Ū�˥�󥯤����ĥ�⥸�塼���
+     ���ꤹ��
+
+     ext/Setup�˵��Ҥ����⥸�塼�����Ū�˥�󥯤���ޤ���
+
+     �����ʥߥå������ǥ��󥰤򥵥ݡ��Ȥ��Ƥ��ʤ��������ƥ�
+     ����Ǥ�Setup��1���ܤΡ�option nodynamic�פȤ����ԤΥ�
+     ���Ȥ򳰤�ɬ�פ�����ޤ����ޤ������Υ������ƥ������
+     ��ĥ�⥸�塼������Ѥ��뤿��ˤϡ����餫������Ū�˥��
+     �����Ƥ���ɬ�פ�����ޤ���
+
+  5. make��¹Ԥ��ƥ���ѥ��뤹��
+
+  6. make test�ǥƥ��Ȥ�Ԥ���
+
+     ��test succeeded�פ�ɽ�������������Ǥ����������ƥ���
+     ���������Ƥⴰ�������ݾڤ���Ƥ������ǤϤ���ޤ���
+
+  7. make install
+
+     �ʲ��Υǥ��쥯�ȥ���äơ������˥ե�����򥤥󥹥ȡ�
+     �뤷�ޤ���
+
+       * ${DESTDIR}${prefix}/bin
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib
+       * ${DESTDIR}${prefix}/lib/ruby
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}
+       * ${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}
+       * ${DESTDIR}${prefix}/share/man/man1
+       * ${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system
+
+     Ruby��API�С������`x.y.z'�Ǥ���С�((|${MAJOR}|))��
+     `x'�ǡ�((|${MINOR}|))��`y'��((|${TEENY}|))��`z'�Ǥ���
+
+     ����: API�С�������teeny�ϡ�Ruby�ץ������ΥС�����
+     ��Ȥϰۤʤ뤳�Ȥ�����ޤ���
+
+     root�Ǻ�Ȥ���ɬ�פ����뤫�⤷��ޤ���
+
+�⤷������ѥ�����˥��顼��ȯ���������ˤϥ��顼�Υ����ȥ�
+����OS�μ����ޤ�Ǥ�������ܤ�����ݡ��Ȥ��Ԥ����äƤ�
+�������¾�����Τ���ˤ�ʤ�ޤ���
+
+
+* �ܿ�
+
+UNIX�Ǥ����configure���ۤȤ�ɤκ��ۤ�ۼ����Ƥ����Ϥ���
+�������פ�̸���Ȥ������ä����(����˰㤤�ʤ�)����Ԥˤ���
+���Ȥ��ݡ��Ȥ���С����Ǥ��뤫���Τ�ޤ���
+
+�������ƥ�����ˤ�äȤ��¸����Τ�GC���Ǥ���Ruby��GC���о�
+�Υ������ƥ����㤬setjmp()�ޤ���getcontext()�ˤ�ä����ƤΥ�
+��������jmp_buf��ucontext_t�˳�Ǽ���뤳�Ȥȡ�jmp_buf��
+ucontext_t�ȥ����å���32bit���饤����Ȥ���Ƥ��뤳�Ȥ���
+���Ƥ��ޤ����ä����Ԥ���Ω���ʤ������б������˺���Ǥ���
+������Ԥβ������Ū��ñ�ǡ�gc.c�ǥ����å���ޡ������Ƥ���
+��ʬ�˥��饤����ȤΥХ��ȿ��������餷�ƥޡ������륳���ɤ�
+�ɲä�������ǺѤߤޤ�����defined(__mc68000__)�פǳ���Ƥ�
+����ʬ�򻲹ͤˤ��Ƥ���������
+
+�쥸����������ɥ������CPU�Ǥϡ��쥸����������ɥ��򥹥���
+���˥ե�å��夹�륢����֥饳���ɤ��ɲä���ɬ�פ����뤫����
+��ޤ���
+
+
+* ���۾��
+
+COPYING.ja�ե�����򻲾Ȥ��Ƥ���������
+
+
+* ����
+
+�����ȡ��Х���ݡ��Ȥ���¾�� matz@netlab.jp �ޤǡ�
+-------------------------------------------------------
+created at: Thu Aug  3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.jp b/README.jp
deleted file mode 100644
index 4e2be09b26..0000000000
--- a/README.jp
+++ /dev/null
@@ -1,174 +0,0 @@
-* Ruby�Ȥ�
-
-Ruby�ϥ���ץ뤫�Ķ��Ϥʥ��֥������Ȼظ�������ץȸ���Ǥ���
-Ruby�Ϻǽ餫����ʥ��֥������Ȼظ�����Ȥ����߷פ���Ƥ���
-�����顤���֥������Ȼظ��ץ�����ߥ󥰤��ڤ˹Ԥ����������
-������������̾�μ�³�����Υץ�����ߥ󥰤��ǽ�Ǥ���
-
-Ruby�ϥƥ����Ƚ����ط���ǽ�Ϥʤɤ�ͥ�졤Perl��Ʊ�����餤����
-�Ǥ�������˥���ץ��ʸˡ�ȡ��㳰�����䥤�ƥ졼���ʤɤε���
-�ˤ�äơ����ʬ����䤹���ץ�����ߥ󥰤�����ޤ���
-
-
-* Ruby����Ĺ��
-
-  + ����ץ��ʸˡ
-  + ���̤Υ��֥������Ȼظ���ǽ(���饹���᥽�åɥ�����ʤ�)
-  + �ü�ʥ��֥������Ȼظ���ǽ(Mixin, �ðۥ᥽�åɤʤ�)
-  + �黻�ҥ����С�������
-  + �㳰������ǽ
-  + ���ƥ졼���ȥ���������
-  + �����١������쥯��
-  + �����ʥߥå������ǥ��� (�������ƥ�����ˤ��)
-  + �ܿ������⤤��¿����UNIX���ư�������Ǥʤ���DOS��Windows��
-    Mac��BeOS�ʤɤξ�Ǥ�ư��
-
-
-* ����ˡ
-
-** ftp��
-
-�ʲ��ξ��ˤ����Ƥ���ޤ���
-
-  ftp://ftp.netlab.co.jp/pub/lang/ruby/
-
-
-* �ۡ���ڡ���
-
-Ruby�Υۡ���ڡ�����URL��
-
-   http://www.netlab.co.jp/ruby/jp/
-
-�Ǥ���
-
-
-* �᡼��󥰥ꥹ��
-
-Ruby�˴ؤ������Τ���Υ᡼��󥰥ꥹ�Ȥ��ߤ��ޤ�������
-�ɥ쥹��
-
-   ruby-list@netlab.co.jp
-
-�Ǥ������Υ��ɥ쥹�˥᡼�������С���ưŪ����Ͽ����ޤ���
-
-
-* ����ѥ��롦���󥹥ȡ���
-
-�ʲ��μ��ǹԤäƤ���������
-
-  1. configure��¹Ԥ���Makefile�ʤɤ���������
-
-  2. (ɬ�פʤ��)defines.h���Խ�����
-
-     ¿ʬ��ɬ��̵���Ȼפ��ޤ���
-
-  3. (ɬ�פʤ��)ext/Setup����Ū�˥�󥯤����ĥ�⥸�塼���
-     ���ꤹ��
-
-     ext/Setup�˵��Ҥ����⥸�塼�����Ū�˥�󥯤���ޤ���
-
-     �����ʥߥå������ǥ��󥰤򥵥ݡ��Ȥ��Ƥ��ʤ��������ƥ�
-     ����Ǥ�Setup��1���ܤΡ�option nodynamic�פȤ����ԤΥ�
-     ���Ȥ򳰤�ɬ�פ�����ޤ����ޤ������Υ������ƥ������
-     ��ĥ�⥸�塼������Ѥ��뤿��ˤϡ����餫������Ū�˥��
-     �����Ƥ���ɬ�פ�����ޤ���
-
-  4. make��¹Ԥ��ƥ���ѥ��뤹��
-
-  5. make test�ǥƥ��Ȥ�Ԥ���
-
-     ��test succeeded�פ�ɽ�������������Ǥ����������ƥ���
-     ���������Ƥⴰ�������ݾڤ���Ƥ������ǤϤ���ޤ���
-
-  6. make install
-
-     root�Ǻ�Ȥ���ɬ�פ����뤫�⤷��ޤ���
-
-�⤷������ѥ�����˥��顼��ȯ���������ˤϥ��顼�Υ����ȥ�
-����OS�μ����ޤ�Ǥ�������ܤ�����ݡ��Ȥ��Ԥ����äƤ�
-�������¾�����Τ���ˤ�ʤ�ޤ���
-
-
-* �ܿ�
-
-UNIX�Ǥ����configure���ۤȤ�ɤκ��ۤ�ۼ����Ƥ����Ϥ���
-�������פ�̸���Ȥ������ä����(����˰㤤�ʤ�)����Ԥˤ���
-���Ȥ��ݡ��Ȥ���С����Ǥ��뤫���Τ�ޤ���
-
-�������ƥ�����ˤ�äȤ��¸����Τ�GC���Ǥ���Ruby��GC���о�
-�Υ������ƥ����㤬setjmp()�ˤ�ä����ƤΥ쥸������ jmp_buf��
-��Ǽ���뤳�Ȥȡ�jmp_buf�ȥ����å���32bit���饤����Ȥ����
-���뤳�Ȥ��ꤷ�Ƥ��ޤ����ä����Ԥ���Ω���ʤ������б�����
-��˺���Ǥ��礦����Ԥβ������Ū��ñ�ǡ�gc.c�ǥ����å���
-�ޡ������Ƥ�����ʬ�˥��饤����ȤΥХ��ȿ��������餷�ƥޡ�
-�����륳���ɤ��ɲä�������ǺѤߤޤ�����defined(THINK_C)�פ�
-����Ƥ�����ʬ�򻲹ͤˤ��Ƥ�������
-
-# �ºݤˤ�Ruby��Think C�Ǥϥ���ѥ���Ǥ��ޤ���
-
-�쥸����������ɥ������CPU�Ǥϡ��쥸����������ɥ��򥹥���
-���˥ե�å��夹�륢����֥饳���ɤ��ɲä���ɬ�פ����뤫����
-��ޤ���
-
-
-* ���۾��
-
-RUby�ϥե꡼���եȥ������Ǥ���GPL(the GNU General Public
-Licence)�ޤ��ϰʲ��˼�������Ruby������ۤǤ��ޤ���GPL�ˤ�
-���Ƥ�COPYING�ե�����򻲾Ȥ��Ʋ�������
-
-  1. ʣ�������¤ʤ���ͳ�Ǥ���
-
-  2. �ʲ��ξ��Τ����줫�����������˼긵��Ruby�Υ�������
-     ͳ���ѹ��Ǥ��ޤ���
-
-     (a) �ͥåȥ˥塼���˥ݥ��Ȥ����ꡤ��Ԥ��ѹ������դ���
-         �ʤɤ���ˡ�ǡ��ѹ���������롥
-
-     (b) �ѹ�����Ruby��ʬ�ν�°�����ȿ����������ǻȤ���
-
-     (c) �ѹ����������������������եȥ�������̾�����ѹ����롥
-         ���Υ��եȥ����������ۤ�����ˤ��ѹ�����Ruby��Ʊ��
-         �����ۤ��롥�ޤ����ѹ�����Ruby�Υ�����������ˡ����
-         �����롥
-
-     (d) ����¾���ѹ������Ԥȹ�դ��롥
-
-  3. �ʲ��ξ��Τ����줫������������Ruby�򥪥֥������ȥ���
-     �ɤ�¹Է����Ǥ����ۤǤ��ޤ���
-
-     (a) �Х��ʥ�������ä��ͤ�������������Ǥ���褦�ˡ�
-         ������������ˡ���������롥
-
-     (b) �������ɤʥ����������ɤ�ź�դ��롥
-
-     (c) �ѹ���Ԥä��Х��ʥ��̾�����ѹ��������������ꥸ��
-         ��Υ����������ɤ�����ˡ���������롥
-
-     (d) ����¾�����۾����Ԥȹ�դ��롥
-
-  4. ¾�Υץ������ؤΰ��ѤϤ����ʤ���Ū�Ǥ��켫ͳ�Ǥ�����
-     ������Ruby�˴ޤޤ��¾�κ�Ԥˤ�륳���ɤϡ����줾���
-     ��Ԥΰո��ˤ�����¤��ä����ޤ�������Ū�ˤ�gc.c(����)��
-     util.c(����)��st.[ch]��regex.[ch] �����.  /missing�ǥ�
-     �쥯�ȥ겼�Υե����뷲���������ޤ������줾������۾��
-     �ʤɤ��դ��Ƥϳƥե�����򻲾Ȥ��Ƥ���������
-
-  5. Ruby�ؤ����ϤȤʤ륹����ץȤ���ӡ�Ruby����ν��Ϥθ�
-     ����Ruby�κ�ԤǤϤʤ������줾��������Ϥ����������ͤ�
-     °���ޤ����ޤ���Ruby���Ȥ߹��ि��γ�ĥ�饤�֥��ˤ�
-     ���Ƥ�Ʊ�ͤǤ���
-
-  6. Ruby��̵�ݾڤǤ�����Ԥ�Ruby�򥵥ݡ��Ȥ���ջ֤Ϥ����
-     ������Ruby���ȤΥХ����뤤��Ruby������ץȤΥХ��ʤɤ�
-     ��ȯ�����뤤���ʤ�»�����Ф��Ƥ���Ǥ������ޤ���
-
-
-* ����
-
-�����ȡ��Х���ݡ��Ȥ���¾�� matz@netlab.co.jp �ޤǡ�
--------------------------------------------------------
-created at: Thu Aug  3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/ToDo b/ToDo
index d792e1dc5e..7e5ef523a8 100644
--- a/ToDo
+++ b/ToDo
@@ -1,44 +1,124 @@
 Language Spec.
 
-* package or access control for global variables
-* named arguments like foo(nation:="german" or nation: "german").
-* method to retrieve argument information (need new C API)
-* multiple return values, yield values.  maybe imcompatible
-* cascading method invocation.
-* def Class#method .. end
+- Class#allocate - basicNew
+- class Foo::Bar<Baz .. end, module Boo::Bar .. end
+- raise exception by `` error
+- a +1 to be a+1, not a(+1).
+- clarify evaluation order of operator argument (=~, .., ...)
+- :symbol => value hash in the form of {symbol: value, ...} ??
+* operator !! for rescue. ???
+* objectify characters
+* ../... outside condition invokes operator method too.
+* ... inside condition turns off just before right condition.???
+* package or access control for global variables??
+* named arguments like foo(nation:="german") or foo(nation: "german").
+* method to retrieve argument information (needs new C API)
+* multiple return values, yield values.  maybe incompatible ???
+* cascading method invocation ???
+* def Class#method .. end ??
+* def Foo::Bar::baz() .. end ??
+* I18N (or M17N) script/string/regexp
+* discourage use of symbol variables (e.g. $/, etc.) in manual
+* discourage use of Perlish features by giving warnings.
+* non confusing in-block local variable (is it possible?)
+  + remove scope by block
+  + variables appears within block may have independent values.
+* Regexp: make /o thread safe.
+* decide whether begin with rescue or ensure make do..while loop.
+* unify == and eql? again
+* to_i returns nil if str contains no digit.
+* jar like combined library package. -> RubyGems?
+* method combination, e.g. before, after, around, etc.
+* .. or something like defadvice in Emacs.
+* property - for methods, or for objects in general.
+* "in" modifier, to annotate, or to encourage assertion.
+* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
+* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
+* warn/error "bare word" method, like "foo",  you should type "foo()"
 
 Hacking Interpreter
 
-* non-blocking open (e.g. named pipe) for thread
-* avoid blocking with gethostbyname/gethostbyaddr
-* objectify interpreters
+- generational GC
+* non-blocking open (e.g. for named pipe) for thread
+* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
+* objectify interpreters ???
 * remove rb_eval() recursions
 * syntax tree -> bytecode ???
 * scrambled script, or script filter
+* setuid ruby
+* performance tune for in-block (dynamic) local variables.
+* give warnings to assign magic variables.
+* export rb_io_{addstr,printf,puts,print}
+* autoload should work with threads [ruby-talk:4589]
+* remove stdio dependency from IOs.
+* warn for inconsistent local variable usage (lv m and method m at the same time). 
+* MicroRuby
+* Built-in Interactive Ruby.
+* Parser API
+* trap every method invocation, which can be enabled by e.g. trap_call :method.
+* unify Errno exceptions of same errno, or new exception comparison scheme.
+* 2.times{|i| if i==0 then a = 15 else puts eval("a") end} should print nil.
+* Thread#max_stack_size attribute (possible??)
 
 Standard Libraries
 
-* IO/File to call initialize
-* String#scanf(?)
+- Module#define_method which takes a name and a body (block, proc or method).
+- Enume#inject
+- Array#fetch
+- IO::for_fd
+- Process::waitall [ruby-talk:4557]
+- Process::Status
+- File::lchown, File::lchmod; xxx - still need work for non existing platforms
+- move Time::times to Process.
+- Enumerable#sort_by for Schwartzian transformation
+- fork_and_kill_other_threads.
+- signal list (Signal::trap, Signal::list).
+- move NameError under StandardError.
+- Integer#to_s(base)
+- Hash::new{default}
+- hash etc. should handle self referenceing array/hash
+- Array#select(n1,n2...) works like Array#indexes(n1,n2...)
+- use Mersenne Twister RNG for random.
+- deprecate Array#indexes, and Array#indices.
+- remove dependency on MAXPATHLEN.
+- String#scanf(?)
 * Object#fmt(?)
-* Integer[num], Float[num] (String[str]?, Array[obj]??)
-* Stream or Port, abstract superclass of IO.
+* Time::strptime
+* Integer[num], Float[num];  Fixnum[num]?
+* method to retrieve non-number trailer for to_i/to_f.
+* Stream or Port, abstract superclass of IO ?
+* String#{pred,prev}, String#downto
+* optional stepsize argument for succ()
+* Ruby module -- Ruby::Version, Ruby::Interpreter
+* introduce Boolean class; super of TrueClass, FalseClass
+* synchronized method - synchronized{...}, synchronized :foo, :bar
+* Array#&, Array#| to allow duplication. ???
+* way to specify immortal (fork endurance) thread;
+* or raise ForkException to every thread but fork caller.
+* new user-defined marshal scheme. _dump(dumper), _load(restorer)
+* library to load per-user profile seeking .ruby_profile or ruby.ini file.
+* warning framework (warn, warning for Ruby level)
+* marshal should not depend on sprintf (works bad with locale).
+* ternary arg pow: a.pow(b,c) == a**b%c
+* new caller(), e.g. call_stack; needs better name.
+* pointer share mechanism similar to one in String for Array.
+* require "1.6" etc. by /usr/lib/ruby/1.6/1.6.rb ;-)
+* save both "feature names" and "normalized path" in $"
+* implement Mutex_m (or MutexMixin) using Mutex.
 
 Extension Libraries
 
-* FastCGI ruby
 * ptk.rb pTk wrapper that is compatible to tk.rb
+* Berkeley DB extension
+* BitVector
+* thread-safe fcgi
 
 Ruby Libraries
 
-* httplib.rb, urllib.rb, nttplib.rb, etc.
+- urllib.rb, nttplib.rb, etc.
 * format like perl's
 
 Tools
 
-* extension library maker like XS or SWIG
 * freeze or undump to bundle everything
-
-Misc
-
-* publish Ruby books
+* bundle using zlib
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..219d1d4b47
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,610 @@
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#include "ruby/config.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef USE_ELF
+
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+#if defined(HAVE_ALLOCA_H)
+#include <alloca.h>
+#endif
+
+#ifdef HAVE_DL_ITERATE_PHDR
+# ifndef _GNU_SOURCE
+#  define _GNU_SOURCE
+# endif
+# include <link.h>
+#endif
+
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+#  define ElfW(x) Elf64##_##x
+# else
+#  define ElfW(x) Elf32##_##x
+# endif
+#endif
+
+typedef struct {
+    const char *dirname;
+    const char *filename;
+    int line;
+
+    int fd;
+    void *mapped;
+    size_t mapped_size;
+    unsigned long base_addr;
+} line_info_t;
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX];
+
+static unsigned long
+uleb128(char **p) {
+    unsigned long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    r += (unsigned long)b << s;
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static long
+sleb128(char **p) {
+    long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    if (b & 0x40) {
+		r -= (0x80 - b) << s;
+	    }
+	    else {
+		r += (b & 0x3f) << s;
+	    }
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, char *p)
+{
+    if (!dir--) {
+	return "";
+    }
+    while (dir--) {
+	while (*p) p++;
+	p++;
+	if (!*p) {
+	    fprintf(stderr, "Unexpected directory number %lu in %s\n",
+		    dir, binary_filename);
+	    return "";
+	}
+    }
+    return p;
+}
+
+static void
+fill_filename(int file, char *include_directories, char *filenames,
+	      line_info_t *line)
+{
+    int i;
+    char *p = filenames;
+    char *filename;
+    unsigned long dir;
+    for (i = 1; i <= file; i++) {
+	filename = p;
+	if (!*p) {
+	    /* Need to output binary file name? */
+	    fprintf(stderr, "Unexpected file number %d in %s\n",
+		    file, binary_filename);
+	    return;
+	}
+	while (*p) p++;
+	p++;
+	dir = uleb128(&p);
+	/* last modified. */
+	uleb128(&p);
+	/* size of the file. */
+	uleb128(&p);
+
+	if (i == file) {
+	    line->filename = filename;
+	    line->dirname = get_nth_dirname(dir, include_directories);
+	}
+    }
+}
+
+static int
+get_path_from_symbol(const char *symbol, const char **p, size_t *len)
+{
+    if (symbol[0] == '0') {
+	/* libexecinfo */
+	*p   = strchr(symbol, '/');
+	if (*p == NULL) return 0;
+	*len = strlen(*p);
+    }
+    else {
+	/* glibc */
+	const char *q;
+	*p   = symbol;
+	q   = strchr(symbol, '(');
+	if (q == NULL) return 0;
+	*len = q - symbol;
+    }
+    return 1;
+}
+
+static void
+fill_line(int num_traces, void **traces,
+	  unsigned long addr, int file, int line,
+	  char *include_directories, char *filenames, line_info_t *lines)
+{
+    int i;
+    for (i = 0; i < num_traces; i++) {
+	unsigned long a = (unsigned long)traces[i] - lines[i].base_addr;
+	/* We assume one line code doesn't result >100 bytes of native code.
+       We may want more reliable way eventually... */
+	if (addr < a && a < addr + 100) {
+	    fill_filename(file, include_directories, filenames, &lines[i]);
+	    lines[i].line = line;
+	}
+    }
+}
+
+static void
+parse_debug_line_cu(int num_traces, void **traces,
+		    char **debug_line, line_info_t *lines)
+{
+    char *p, *cu_end, *cu_start, *include_directories, *filenames;
+    unsigned long unit_length;
+    int default_is_stmt, line_base;
+    unsigned int header_length, minimum_instruction_length, line_range,
+		 opcode_base;
+    unsigned char *standard_opcode_lengths;
+
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    unsigned int column = 0;
+    int is_stmt;
+    int basic_block = 0;
+    int end_sequence = 0;
+    int prologue_end = 0;
+    int epilogue_begin = 0;
+    unsigned int isa = 0;
+
+    p = *debug_line;
+
+    unit_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+    if (unit_length == 0xffffffff) {
+	unit_length = *(unsigned long *)p;
+	p += sizeof(unsigned long);
+    }
+
+    cu_end = p + unit_length;
+
+    /*dwarf_version = *(unsigned short *)p;*/
+    p += 2;
+
+    header_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+
+    cu_start = p + header_length;
+
+    minimum_instruction_length = *(unsigned char *)p;
+    p++;
+
+    is_stmt = default_is_stmt = *(unsigned char *)p;
+    p++;
+
+    line_base = *(char *)p;
+    p++;
+
+    line_range = *(unsigned char *)p;
+    p++;
+
+    opcode_base = *(unsigned char *)p;
+    p++;
+
+    standard_opcode_lengths = (unsigned char *)p - 1;
+    p += opcode_base - 1;
+
+    include_directories = p;
+
+    /* skip include directories */
+    while (*p) {
+	while (*p) p++;
+	p++;
+    }
+    p++;
+
+    filenames = p;
+
+    p = cu_start;
+
+#define FILL_LINE()						    \
+    do {							    \
+	fill_line(num_traces, traces, addr, file, line,		    \
+		  include_directories, filenames, lines);	    \
+	basic_block = prologue_end = epilogue_begin = 0;	    \
+    } while (0)
+
+    while (p < cu_end) {
+	unsigned long a;
+	unsigned char op = *p++;
+	switch (op) {
+	case DW_LNS_copy:
+	    FILL_LINE();
+	    break;
+	case DW_LNS_advance_pc:
+	    a = uleb128(&p);
+	    addr += a;
+	    break;
+	case DW_LNS_advance_line: {
+	    long a = sleb128(&p);
+	    line += a;
+	    break;
+	}
+	case DW_LNS_set_file:
+	    file = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_set_column:
+	    column = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_negate_stmt:
+	    is_stmt = !is_stmt;
+	    break;
+	case DW_LNS_set_basic_block:
+	    basic_block = 1;
+	    break;
+	case DW_LNS_const_add_pc:
+	    a = ((255 - opcode_base) / line_range) *
+		minimum_instruction_length;
+	    addr += a;
+	    break;
+	case DW_LNS_fixed_advance_pc:
+	    a = *(unsigned char *)p++;
+	    addr += a;
+	    break;
+	case DW_LNS_set_prologue_end:
+	    prologue_end = 1;
+	    break;
+	case DW_LNS_set_epilogue_begin:
+	    epilogue_begin = 1;
+	    break;
+	case DW_LNS_set_isa:
+	    isa = (unsigned int)uleb128(&p);
+	    break;
+	case 0:
+	    a = *(unsigned char *)p++;
+	    op = *p++;
+	    switch (op) {
+	    case DW_LNE_end_sequence:
+		end_sequence = 1;
+		FILL_LINE();
+		addr = 0;
+		file = 1;
+		line = 1;
+		column = 0;
+		is_stmt = default_is_stmt;
+		end_sequence = 0;
+		isa = 0;
+		break;
+	    case DW_LNE_set_address:
+		addr = *(unsigned long *)p;
+		p += sizeof(unsigned long);
+		break;
+	    case DW_LNE_define_file:
+		fprintf(stderr, "Unsupported operation in %s\n",
+			binary_filename);
+		break;
+	    case DW_LNE_set_discriminator:
+		/* TODO:currently ignore */
+		uleb128(&p);
+		break;
+	    default:
+		fprintf(stderr, "Unknown extended opcode: %d in %s\n",
+			op, binary_filename);
+	    }
+	    break;
+	default: {
+	    unsigned long addr_incr;
+	    unsigned long line_incr;
+	    a = op - opcode_base;
+	    addr_incr = (a / line_range) * minimum_instruction_length;
+	    line_incr = line_base + (a % line_range);
+	    addr += (unsigned int)addr_incr;
+	    line += (unsigned int)line_incr;
+	    FILL_LINE();
+	}
+	}
+    }
+    *debug_line = p;
+}
+
+static void
+parse_debug_line(int num_traces, void **traces,
+		 char *debug_line, unsigned long size, line_info_t *lines)
+{
+    char *debug_line_end = debug_line + size;
+    while (debug_line < debug_line_end) {
+	parse_debug_line_cu(num_traces, traces, &debug_line, lines);
+    }
+    if (debug_line != debug_line_end) {
+	fprintf(stderr, "Unexpected size of .debug_line in %s\n",
+		binary_filename);
+    }
+}
+
+/* read file and fill lines */
+static void
+fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
+	   line_info_t *current_line, line_info_t *lines);
+
+static void
+follow_debuglink(char *debuglink, int num_traces, void **traces, char **syms,
+		 line_info_t *current_line, line_info_t *lines)
+{
+    /* Ideally we should check 4 paths to follow gnu_debuglink,
+       but we handle only one case for now as this format is used
+       by some linux distributions. See GDB's info for detail. */
+    static const char global_debug_dir[] = "/usr/lib/debug";
+    char *p, *subdir;
+
+    p = strrchr(binary_filename, '/');
+    if (!p) {
+	return;
+    }
+    p[1] = '\0';
+
+    subdir = (char *)alloca(strlen(binary_filename) + 1);
+    strcpy(subdir, binary_filename);
+    strcpy(binary_filename, global_debug_dir);
+    strncat(binary_filename, subdir,
+	    PATH_MAX - strlen(binary_filename) - 1);
+    strncat(binary_filename, debuglink,
+	    PATH_MAX - strlen(binary_filename) - 1);
+
+    munmap(current_line->mapped, current_line->mapped_size);
+    close(current_line->fd);
+    fill_lines(num_traces, traces, syms, 0, current_line, lines);
+}
+
+/* read file and fill lines */
+static void
+fill_lines(int num_traces, void **traces, char **syms, int check_debuglink,
+	   line_info_t *current_line, line_info_t *lines)
+{
+    int i;
+    char *shstr;
+    char *section_name;
+    ElfW(Ehdr) *ehdr;
+    ElfW(Shdr) *shdr, *shstr_shdr;
+    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+    int fd;
+    off_t filesize;
+    char *file;
+
+    fd = open(binary_filename, O_RDONLY);
+    if (fd < 0) {
+	return;
+    }
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+	int e = errno;
+	close(fd);
+	fprintf(stderr, "lseek: %s\n", strerror(e));
+	return;
+    }
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+	int e = errno;
+	close(fd);
+	fprintf(stderr, "mmap: %s\n", strerror(e));
+	return;
+    }
+
+    current_line->fd = fd;
+    current_line->mapped = file;
+    current_line->mapped_size = filesize;
+
+    for (i = 0; i < num_traces; i++) {
+	const char *path;
+	size_t len;
+	if (get_path_from_symbol(syms[i], &path, &len) &&
+		!strncmp(path, binary_filename, len)) {
+	    lines[i].line = -1;
+	}
+    }
+
+    ehdr = (ElfW(Ehdr) *)file;
+    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+    shstr_shdr = shdr + ehdr->e_shstrndx;
+    shstr = file + shstr_shdr->sh_offset;
+
+    for (i = 0; i < ehdr->e_shnum; i++) {
+	section_name = shstr + shdr[i].sh_name;
+	if (!strcmp(section_name, ".debug_line")) {
+	    debug_line_shdr = shdr + i;
+	    break;
+	} else if (!strcmp(section_name, ".gnu_debuglink")) {
+	    gnu_debuglink_shdr = shdr + i;
+	}
+    }
+
+    if (!debug_line_shdr) {
+	/* This file doesn't have .debug_line section,
+	   let's check .gnu_debuglink section instead. */
+	if (gnu_debuglink_shdr && check_debuglink) {
+	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+			     num_traces, traces, syms,
+			     current_line, lines);
+	}
+	return;
+    }
+
+    parse_debug_line(num_traces, traces,
+		     file + debug_line_shdr->sh_offset,
+		     debug_line_shdr->sh_size,
+		     lines);
+}
+
+#ifdef HAVE_DL_ITERATE_PHDR
+
+typedef struct {
+    int num_traces;
+    char **syms;
+    line_info_t *lines;
+} fill_base_addr_state_t;
+
+static int
+fill_base_addr(struct dl_phdr_info *info, size_t size, void *data)
+{
+    int i;
+    fill_base_addr_state_t *st = (fill_base_addr_state_t *)data;
+    for (i = 0; i < st->num_traces; i++) {
+	const char *path;
+	size_t len;
+	size_t name_len = strlen(info->dlpi_name);
+
+	if (get_path_from_symbol(st->syms[i], &path, &len) &&
+		(len == name_len || (len > name_len && path[len-name_len-1] == '/')) &&
+		!strncmp(path+len-name_len, info->dlpi_name, name_len)) {
+	    st->lines[i].base_addr = info->dlpi_addr;
+	}
+    }
+    return 0;
+}
+
+#endif /* HAVE_DL_ITERATE_PHDR */
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **trace, char **syms)
+{
+    int i;
+    /* async-signal unsafe */
+    line_info_t *lines = (line_info_t *)calloc(num_traces,
+					       sizeof(line_info_t));
+
+    /* Note that line info of shared objects might not be shown
+       if we don't have dl_iterate_phdr */
+#ifdef HAVE_DL_ITERATE_PHDR
+    fill_base_addr_state_t fill_base_addr_state;
+
+    fill_base_addr_state.num_traces = num_traces;
+    fill_base_addr_state.syms = syms;
+    fill_base_addr_state.lines = lines;
+    /* maybe async-signal unsafe */
+    dl_iterate_phdr(fill_base_addr, &fill_base_addr_state);
+#endif /* HAVE_DL_ITERATE_PHDR */
+
+    for (i = 0; i < num_traces; i++) {
+	const char *path;
+	size_t len;
+	if (lines[i].line) {
+	    continue;
+	}
+
+	if (!get_path_from_symbol(syms[i], &path, &len)) {
+	    continue;
+	}
+
+	strncpy(binary_filename, path, len);
+	binary_filename[len] = '\0';
+
+	fill_lines(num_traces, trace, syms, 1, &lines[i], lines);
+    }
+
+    /* fprintf may not be async-signal safe */
+    for (i = 0; i < num_traces; i++) {
+	line_info_t *line = &lines[i];
+
+	if (line->line > 0) {
+	    fprintf(stderr, "%s ", syms[i]);
+	    if (line->filename) {
+		if (line->dirname && line->dirname[0]) {
+		    fprintf(stderr, "%s/", line->dirname);
+		}
+		fprintf(stderr, "%s", line->filename);
+	    } else {
+		fprintf(stderr, "???");
+	    }
+	    fprintf(stderr, ":%d\n", line->line);
+	} else {
+	    fprintf(stderr, "%s\n", syms[i]);
+	}
+    }
+
+    for (i = 0; i < num_traces; i++) {
+	line_info_t *line = &lines[i];
+	if (line->fd) {
+	    munmap(line->mapped, line->mapped_size);
+	    close(line->fd);
+	}
+    }
+    free(lines);
+}
+
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..3782d89e07
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,21 @@
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+
+#ifdef USE_ELF
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces, char **syms);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 25c0051d16..e427cb3320 100644
--- a/array.c
+++ b/array.c
@@ -1,1480 +1,4750 @@
-/************************************************
+/**********************************************************************
 
   array.c -
 
   $Author$
-  $Date$
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1993-1999 Yukihiro Matsumoto
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
+  Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
+  Copyright (C) 2000  Information-technology Promotion Agency, Japan
 
-************************************************/
+**********************************************************************/
 
-#include "ruby.h"
-#include "util.h"
+#include "ruby/ruby.h"
+#include "ruby/util.h"
+#include "ruby/st.h"
+#include "ruby/encoding.h"
+#include "internal.h"
+
+#ifndef ARRAY_DEBUG
+# define NDEBUG
+#endif
+#include <assert.h>
+
+#define numberof(array) (int)(sizeof(array) / sizeof((array)[0]))
 
 VALUE rb_cArray;
 
+static ID id_cmp;
+
 #define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
 
 void
-rb_mem_clear(mem, size)
-    register VALUE *mem;
-    register size_t size;
+rb_mem_clear(register VALUE *mem, register long size)
 {
     while (size--) {
 	*mem++ = Qnil;
     }
 }
 
-static void
-memfill(mem, size, val)
-    register VALUE *mem;
-    register size_t size;
-    register VALUE val;
+static inline void
+memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
 	*mem++ = val;
     }
 }
 
-#define ARY_FREEZE   FL_USER1
-#define ARY_TMPLOCK  FL_USER2
+# define ARY_SHARED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+    (assert(ARY_EMBED_P(a)), \
+     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
+#define FL_SET_EMBED(a) do { \
+    assert(!ARY_SHARED_P(a)); \
+    assert(!OBJ_FROZEN(a)); \
+    FL_SET((a), RARRAY_EMBED_FLAG); \
+} while (0)
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), ELTS_SHARED); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+
+#define ARY_SET_PTR(ary, p) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr = (p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+    long tmp_n = (n); \
+    assert(ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), (n)); \
+    } \
+    else { \
+        ARY_SET_HEAP_LEN((ary), (n)); \
+    } \
+    assert(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do  { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do  { \
+    assert(!OBJ_FROZEN(ary)); \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+    } \
+    else { \
+        RARRAY(ary)->as.heap.len += (n); \
+    } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_CAPA(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!ARY_SHARED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (n); \
+} while (0)
+
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(ARY_SHARED_P(ary)); \
+    assert(ARY_SHARED_ROOT_P(value)); \
+    RARRAY(ary)->as.heap.aux.shared = (value); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+    assert(ARY_SHARED_ROOT_P(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
 
 static void
-rb_ary_modify(ary)
-    VALUE ary;
+ary_resize_capa(VALUE ary, long capacity)
 {
-    if (FL_TEST(ary, ARY_FREEZE))
-	rb_raise(rb_eTypeError, "can't modify frozen array");
-    if (FL_TEST(ary, ARY_TMPLOCK))
-	rb_raise(rb_eTypeError, "can't modify array during sort");
-    if (!FL_TEST(ary, FL_TAINT) && rb_safe_level() >= 4)
+    assert(RARRAY_LEN(ary) <= capacity);
+    assert(!OBJ_FROZEN(ary));
+    assert(!ARY_SHARED_P(ary));
+    if (capacity > RARRAY_EMBED_LEN_MAX) {
+        if (ARY_EMBED_P(ary)) {
+            long len = ARY_EMBED_LEN(ary);
+            VALUE *ptr = ALLOC_N(VALUE, (capacity));
+            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+            FL_UNSET_EMBED(ary);
+            ARY_SET_PTR(ary, ptr);
+            ARY_SET_HEAP_LEN(ary, len);
+        }
+        else {
+            REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, (capacity));
+        }
+        ARY_SET_CAPA(ary, (capacity));
+    }
+    else {
+        if (!ARY_EMBED_P(ary)) {
+            long len = RARRAY_LEN(ary);
+            VALUE *ptr = RARRAY_PTR(ary);
+            if (len > capacity) len = capacity;
+            MEMCPY(RARRAY(ary)->as.ary, ptr, VALUE, len);
+            FL_SET_EMBED(ary);
+            ARY_SET_LEN(ary, len);
+            xfree(ptr);
+        }
+    }
+}
+
+static void
+ary_double_capa(VALUE ary, long min)
+{
+    long new_capa = ARY_CAPA(ary) / 2;
+
+    if (new_capa < ARY_DEFAULT_SIZE) {
+	new_capa = ARY_DEFAULT_SIZE;
+    }
+    if (new_capa >= ARY_MAX_SIZE - min) {
+	new_capa = (ARY_MAX_SIZE - min) / 2;
+    }
+    new_capa += min;
+    ary_resize_capa(ary, new_capa);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared)
+{
+    if (shared) {
+	long num = ARY_SHARED_NUM(shared) - 1;
+	if (num == 0) {
+	    rb_ary_free(shared);
+	    rb_gc_force_recycle(shared);
+	}
+	else if (num > 0) {
+	    ARY_SET_SHARED_NUM(shared, num);
+	}
+    }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+    rb_ary_decrement_share(shared);
+    FL_UNSET_SHARED(ary);
+}
+
+static inline void
+rb_ary_unshare_safe(VALUE ary)
+{
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+    }
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared)
+{
+    long num = ARY_SHARED_NUM(shared);
+    if (num >= 0) {
+	ARY_SET_SHARED_NUM(shared, num + 1);
+    }
+    return shared;
+}
+
+static void
+rb_ary_set_shared(VALUE ary, VALUE shared)
+{
+    rb_ary_increment_share(shared);
+    FL_SET_SHARED(ary);
+    ARY_SET_SHARED(ary, shared);
+}
+
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+    rb_check_frozen(ary);
+    if (!OBJ_UNTRUSTED(ary) && rb_safe_level() >= 4)
 	rb_raise(rb_eSecurityError, "Insecure: can't modify array");
 }
 
+void
+rb_ary_modify(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+        long len = RARRAY_LEN(ary);
+        if (len <= RARRAY_EMBED_LEN_MAX) {
+            VALUE *ptr = ARY_HEAP_PTR(ary);
+            VALUE shared = ARY_SHARED(ary);
+            FL_UNSET_SHARED(ary);
+            FL_SET_EMBED(ary);
+            MEMCPY(ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared);
+            ARY_SET_EMBED_LEN(ary, len);
+        }
+        else {
+            VALUE *ptr = ALLOC_N(VALUE, len);
+            MEMCPY(ptr, RARRAY_PTR(ary), VALUE, len);
+            rb_ary_unshare(ary);
+            ARY_SET_CAPA(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+    }
+}
+
 VALUE
-rb_ary_freeze(ary)
-    VALUE ary;
+rb_ary_freeze(VALUE ary)
 {
-    FL_SET(ary, ARY_FREEZE);
-    return ary;
+    return rb_obj_freeze(ary);
 }
 
+/*
+ *  call-seq:
+ *     ary.frozen?  -> true or false
+ *
+ *  Return <code>true</code> if this array is frozen (or temporarily frozen
+ *  while being sorted).
+ */
+
 static VALUE
-rb_ary_frozen_p(ary)
-    VALUE ary;
+rb_ary_frozen_p(VALUE ary)
 {
-    if (FL_TEST(ary, ARY_FREEZE|ARY_TMPLOCK))
-	return Qtrue;
+    if (OBJ_FROZEN(ary)) return Qtrue;
     return Qfalse;
 }
 
-VALUE
-rb_ary_new2(len)
-    long len;
+static VALUE
+ary_alloc(VALUE klass)
 {
     NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, rb_cArray, T_ARRAY);
+    OBJSETUP(ary, klass, T_ARRAY);
+    FL_SET_EMBED((VALUE)ary);
+    ARY_SET_EMBED_LEN((VALUE)ary, 0);
 
-    if (len < 0) {
+    return (VALUE)ary;
+}
+
+static VALUE
+ary_new(VALUE klass, long capa)
+{
+    VALUE ary;
+
+    if (capa < 0) {
 	rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
-    if (len > 0 && len*sizeof(VALUE) <= 0) {
+    if (capa > ARY_MAX_SIZE) {
 	rb_raise(rb_eArgError, "array size too big");
     }
-    ary->len = 0;
-    ary->capa = len;
-    ary->ptr = 0;
-    ary->ptr = ALLOC_N(VALUE, len);
+    ary = ary_alloc(klass);
+    if (capa > RARRAY_EMBED_LEN_MAX) {
+        FL_UNSET_EMBED(ary);
+        ARY_SET_PTR(ary, ALLOC_N(VALUE, capa));
+        ARY_SET_CAPA(ary, capa);
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
 
-    return (VALUE)ary;
+    return ary;
 }
 
 VALUE
-rb_ary_new()
+rb_ary_new2(long capa)
+{
+    return ary_new(rb_cArray, capa);
+}
+
+
+VALUE
+rb_ary_new(void)
 {
-    return rb_ary_new2(ARY_DEFAULT_SIZE);
+    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
 }
 
-#ifdef HAVE_STDARG_PROTOTYPES
 #include <stdarg.h>
-#define va_init_list(a,b) va_start(a,b)
-#else
-#include <varargs.h>
-#define va_init_list(a,b) va_start(a)
-#endif
 
 VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
 rb_ary_new3(long n, ...)
-#else
-rb_ary_new3(n, va_alist)
-    long n;
-    va_dcl
-#endif
 {
     va_list ar;
     VALUE ary;
     long i;
 
-    if (n < 0) {
-	rb_raise(rb_eIndexError, "negative number of items(%d)", n);
-    }
-    ary = rb_ary_new2(n<ARY_DEFAULT_SIZE?ARY_DEFAULT_SIZE:n);
+    ary = rb_ary_new2(n);
 
-    va_init_list(ar, n);
+    va_start(ar, n);
     for (i=0; i<n; i++) {
-	RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
+	RARRAY_PTR(ary)[i] = va_arg(ar, VALUE);
     }
     va_end(ar);
 
-    RARRAY(ary)->len = n;
+    ARY_SET_LEN(ary, n);
     return ary;
 }
 
 VALUE
-rb_ary_new4(n, elts)
-    long n;
-    VALUE *elts;
+rb_ary_new4(long n, const VALUE *elts)
 {
     VALUE ary;
 
     ary = rb_ary_new2(n);
-    if (elts) {
-	MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
+    if (n > 0 && elts) {
+	MEMCPY(RARRAY_PTR(ary), elts, VALUE, n);
+	ARY_SET_LEN(ary, n);
     }
-    RARRAY(ary)->len = n;
 
     return ary;
 }
 
 VALUE
-rb_assoc_new(car, cdr)
-    VALUE car, cdr;
+rb_ary_tmp_new(long capa)
 {
-    VALUE ary;
+    return ary_new(0, capa);
+}
 
-    ary = rb_ary_new2(2);
-    RARRAY(ary)->ptr[0] = car;
-    RARRAY(ary)->ptr[1] = cdr;
-    RARRAY(ary)->len = 2;
+void
+rb_ary_free(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	xfree(ARY_HEAP_PTR(ary));
+    }
+}
 
-    return ary;
+RUBY_FUNC_EXPORTED size_t
+rb_ary_memsize(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+    }
+    else {
+	return 0;
+    }
 }
 
-static VALUE
-rb_ary_s_new(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
+static inline void
+ary_discard(VALUE ary)
 {
-    long len = 0;
-    VALUE size, val;
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, klass, T_ARRAY);
+    rb_ary_free(ary);
+    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
+}
 
-    ary->len = 0;
-    ary->ptr = 0;
-    if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
-	ary->capa = ARY_DEFAULT_SIZE;
+static VALUE
+ary_make_shared(VALUE ary)
+{
+    assert(!ARY_EMBED_P(ary));
+    if (ARY_SHARED_P(ary)) {
+	return ARY_SHARED(ary);
+    }
+    else if (ARY_SHARED_ROOT_P(ary)) {
+	return ary;
+    }
+    else if (OBJ_FROZEN(ary)) {
+	ary_resize_capa(ary, ARY_HEAP_LEN(ary));
+	FL_SET_SHARED_ROOT(ary);
+	ARY_SET_SHARED_NUM(ary, 1);
+	return ary;
     }
     else {
-	long capa = NUM2LONG(size);
+	NEWOBJ(shared, struct RArray);
+	OBJSETUP(shared, 0, T_ARRAY);
+        FL_UNSET_EMBED(shared);
+
+        ARY_SET_LEN((VALUE)shared, RARRAY_LEN(ary));
+        ARY_SET_PTR((VALUE)shared, RARRAY_PTR(ary));
+	FL_SET_SHARED_ROOT(shared);
+	ARY_SET_SHARED_NUM((VALUE)shared, 1);
+	FL_SET_SHARED(ary);
+	ARY_SET_SHARED(ary, (VALUE)shared);
+	OBJ_FREEZE(shared);
+	return (VALUE)shared;
+    }
+}
 
-	if (capa < 0) {
-	    rb_raise(rb_eArgError, "negative array size");
-	}
-	if (capa > 0 && capa*sizeof(VALUE) <= 0) {
-	    rb_raise(rb_eArgError, "array size too big");
-	}
-	ary->capa = capa;
-	len = capa;
+
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+    if (RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE subst = rb_ary_new2(RARRAY_LEN(ary));
+        MEMCPY(ARY_EMBED_PTR(subst), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
+        ARY_SET_EMBED_LEN(subst, RARRAY_LEN(ary));
+        return subst;
+    }
+    else {
+        return rb_ary_increment_share(ary_make_shared(ary));
     }
-    ary->ptr = ALLOC_N(VALUE, ary->capa);
-    memfill(ary->ptr, len, val);
-    ary->len = len;
+}
 
-    return (VALUE)ary;
+VALUE
+rb_assoc_new(VALUE car, VALUE cdr)
+{
+    return rb_ary_new3(2, car, cdr);
 }
 
 static VALUE
-rb_ary_s_create(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
+to_ary(VALUE ary)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, klass, T_ARRAY);
+    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+}
+
+VALUE
+rb_check_array_type(VALUE ary)
+{
+    return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+}
+
+/*
+ *  call-seq:
+ *     Array.try_convert(obj) -> array or nil
+ *
+ *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
+ *  converted array or +nil+ if +obj+ cannot be converted for any reason.
+ *  This method can be used to check if an argument is an array.
+ *
+ *     Array.try_convert([1])   #=> [1]
+ *     Array.try_convert("1")   #=> nil
+ *
+ *     if tmp = Array.try_convert(arg)
+ *       # the argument is an array
+ *     elsif tmp = String.try_convert(arg)
+ *       # the argument is a string
+ *     end
+ *
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+    return rb_check_array_type(ary);
+}
+
+/*
+ *  call-seq:
+ *     Array.new(size=0, obj=nil)
+ *     Array.new(array)
+ *     Array.new(size) {|index| block }
+ *
+ *  Returns a new array.
+ *
+ *  In the first form, if no arguments are sent, the new array will be empty.
+ *  When a +size+ and an optional +obj+ are sent, an array is created with
+ *  +size+ copies of +obj+.  Take notice that all elements will reference the
+ *  same object +obj+.
+ *
+ *  The second form creates a copy of the array passed as a parameter (the
+ *  array is generated by calling to_ary on the parameter).
+ *
+ *    first_array = ["Matz", "Guido"]
+ *
+ *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *
+ *    first_array.equal? second_array       #=> false
+ *
+ *  In the last form, an array of the given size is created.  Each element in
+ *  this array is created by passing the element's index to the given block
+ *  and storing the return value.
+ *
+ *    Array.new(3){ |index| index ** 2 }
+ *    # => [0, 1, 4]
+ *
+ *  == Common gotchas
+ *
+ *  When sending the second parameter, the same object will be used as the
+ *  value for all the array elements:
+ *
+ *     a = Array.new(2, Hash.new)
+ *     # => [{}, {}]
+ *
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *
+ *     a[1]['cat'] = 'Felix'
+ *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *
+ *  Since all the Array elements store the same hash, changes to one of them
+ *  will affect them all.
+ *
+ *  If multiple copies are what you want, you should use the block
+ *  version which uses the result of that block each time an element
+ *  of the array needs to be initialized:
+ *
+ *     a = Array.new(2) { Hash.new }
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {}]
+ *
+ */
 
-    ary->len = ary->capa = 0;
+static VALUE
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
+{
+    long len;
+    VALUE size, val;
+
+    rb_ary_modify(ary);
     if (argc == 0) {
-	ary->ptr = 0;
+	if (ARY_OWNS_HEAP_P(ary) && RARRAY_PTR(ary)) {
+	    xfree(RARRAY_PTR(ary));
+	}
+        rb_ary_unshare_safe(ary);
+        FL_SET_EMBED(ary);
+	ARY_SET_EMBED_LEN(ary, 0);
+	if (rb_block_given_p()) {
+	    rb_warning("given block not used");
+	}
+	return ary;
+    }
+    rb_scan_args(argc, argv, "02", &size, &val);
+    if (argc == 1 && !FIXNUM_P(size)) {
+	val = rb_check_array_type(size);
+	if (!NIL_P(val)) {
+	    rb_ary_replace(ary, val);
+	    return ary;
+	}
+    }
+
+    len = NUM2LONG(size);
+    if (len < 0) {
+	rb_raise(rb_eArgError, "negative array size");
+    }
+    if (len > ARY_MAX_SIZE) {
+	rb_raise(rb_eArgError, "array size too big");
+    }
+    rb_ary_modify(ary);
+    ary_resize_capa(ary, len);
+    if (rb_block_given_p()) {
+	long i;
+
+	if (argc == 2) {
+	    rb_warn("block supersedes default value argument");
+	}
+	for (i=0; i<len; i++) {
+	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+	    ARY_SET_LEN(ary, i + 1);
+	}
     }
     else {
-	ary->ptr = ALLOC_N(VALUE, argc);
-	MEMCPY(ary->ptr, argv, VALUE, argc);
+	memfill(RARRAY_PTR(ary), len, val);
+	ARY_SET_LEN(ary, len);
     }
-    ary->len = ary->capa = argc;
+    return ary;
+}
 
-    return (VALUE)ary;
+
+/*
+* Returns a new array populated with the given objects.
+*
+*   Array.[]( 1, 'a', /^A/ )
+*   Array[ 1, 'a', /^A/ ]
+*   [ 1, 'a', /^A/ ]
+*/
+
+static VALUE
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+{
+    VALUE ary = ary_new(klass, argc);
+    if (argc > 0 && argv) {
+        MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
+        ARY_SET_LEN(ary, argc);
+    }
+
+    return ary;
 }
 
 void
-rb_ary_store(ary, idx, val)
-    VALUE ary;
-    long idx;
-    VALUE val;
+rb_ary_store(VALUE ary, long idx, VALUE val)
 {
-    rb_ary_modify(ary);
     if (idx < 0) {
-	idx += RARRAY(ary)->len;
+	idx += RARRAY_LEN(ary);
 	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %d out of array",
-		     idx - RARRAY(ary)->len);
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     idx - RARRAY_LEN(ary), -RARRAY_LEN(ary));
 	}
     }
+    else if (idx >= ARY_MAX_SIZE) {
+	rb_raise(rb_eIndexError, "index %ld too big", idx);
+    }
 
-    if (idx >= RARRAY(ary)->capa) {
-	long capa_inc = RARRAY(ary)->capa / 2;
-	if (capa_inc < ARY_DEFAULT_SIZE) {
-	    capa_inc = ARY_DEFAULT_SIZE;
-	}
-	RARRAY(ary)->capa = idx + capa_inc;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+    rb_ary_modify(ary);
+    if (idx >= ARY_CAPA(ary)) {
+	ary_double_capa(ary, idx);
+    }
+    if (idx > RARRAY_LEN(ary)) {
+	rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary),
+		     idx-RARRAY_LEN(ary) + 1);
+    }
+
+    if (idx >= RARRAY_LEN(ary)) {
+	ARY_SET_LEN(ary, idx + 1);
+    }
+    RARRAY_PTR(ary)[idx] = val;
+}
+
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
+{
+    assert(offset >= 0);
+    assert(len >= 0);
+    assert(offset+len <= RARRAY_LEN(ary));
+
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+        VALUE result = ary_alloc(klass);
+        MEMCPY(ARY_EMBED_PTR(result), RARRAY_PTR(ary) + offset, VALUE, len);
+        ARY_SET_EMBED_LEN(result, len);
+        return result;
     }
-    if (idx > RARRAY(ary)->len) {
-	rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len,
-		     idx-RARRAY(ary)->len+1);
+    else {
+        VALUE shared, result = ary_alloc(klass);
+        FL_UNSET_EMBED(result);
+
+        shared = ary_make_shared(ary);
+        ARY_SET_PTR(result, RARRAY_PTR(ary));
+        ARY_SET_LEN(result, RARRAY_LEN(ary));
+        rb_ary_set_shared(result, shared);
+
+        ARY_INCREASE_PTR(result, offset);
+        ARY_SET_LEN(result, len);
+        return result;
     }
+}
+
+static VALUE
+ary_make_shared_copy(VALUE ary)
+{
+    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+}
 
-    if (idx >= RARRAY(ary)->len) {
-	RARRAY(ary)->len = idx + 1;
+enum ary_take_pos_flags
+{
+    ARY_TAKE_FIRST = 0,
+    ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last(int argc, VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    VALUE nv;
+    long n;
+    long offset = 0;
+
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    if (n > RARRAY_LEN(ary)) {
+	n = RARRAY_LEN(ary);
+    }
+    else if (n < 0) {
+	rb_raise(rb_eArgError, "negative array size");
     }
-    RARRAY(ary)->ptr[idx] = val;
+    if (last) {
+	offset = RARRAY_LEN(ary) - n;
+    }
+    return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
+static VALUE rb_ary_push_1(VALUE ary, VALUE item);
+
+/*
+ *  call-seq:
+ *     ary << obj            -> ary
+ *
+ *  Append---Pushes the given object on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together.
+ *
+ *     [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
+ *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *
+ */
+
 VALUE
-rb_ary_push(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_push(VALUE ary, VALUE item)
 {
-    rb_ary_store(ary, RARRAY(ary)->len, item);
+    rb_ary_modify(ary);
+    return rb_ary_push_1(ary, item);
+}
+
+static VALUE
+rb_ary_push_1(VALUE ary, VALUE item)
+{
+    long idx = RARRAY_LEN(ary);
+
+    if (idx >= ARY_CAPA(ary)) {
+	ary_double_capa(ary, idx);
+    }
+    RARRAY_PTR(ary)[idx] = item;
+    ARY_SET_LEN(ary, idx + 1);
     return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.push(obj, ... )   -> ary
+ *
+ *  Append---Pushes the given object(s) on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.push("d", "e", "f")
+ *             #=> ["a", "b", "c", "d", "e", "f"]
+ */
+
 static VALUE
-rb_ary_push_method(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
 {
+    rb_ary_modify(ary);
     while (argc--) {
-	rb_ary_store(ary, RARRAY(ary)->len, *argv++);
+	rb_ary_push_1(ary, *argv++);
     }
     return ary;
 }
 
 VALUE
-rb_ary_pop(ary)
-    VALUE ary;
+rb_ary_pop(VALUE ary)
+{
+    long n;
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) == 0) return Qnil;
+    if (ARY_OWNS_HEAP_P(ary) &&
+	RARRAY_LEN(ary) * 3 < ARY_CAPA(ary) &&
+	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+    {
+	ary_resize_capa(ary, RARRAY_LEN(ary) * 2);
+    }
+    n = RARRAY_LEN(ary)-1;
+    ARY_SET_LEN(ary, n);
+    return RARRAY_PTR(ary)[n];
+}
+
+/*
+ *  call-seq:
+ *     ary.pop    -> obj or nil
+ *     ary.pop(n) -> new_ary
+ *
+ *  Removes the last element from +self+ and returns it, or
+ *  <code>nil</code> if the array is empty.
+ *
+ *  If a number _n_ is given, returns an array of the last n elements
+ *  (or less) just like <code>array.slice!(-n, n)</code> does.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.pop     #=> "d"
+ *     a.pop(2)  #=> ["b", "c"]
+ *     a         #=> ["a"]
+ */
+
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return Qnil;
-    if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
-	RARRAY(ary)->capa = RARRAY(ary)->len * 2;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+    VALUE result;
+
+    if (argc == 0) {
+	return rb_ary_pop(ary);
     }
-    return RARRAY(ary)->ptr[--RARRAY(ary)->len];
+
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    return result;
 }
 
 VALUE
-rb_ary_shift(ary)
-    VALUE ary;
+rb_ary_shift(VALUE ary)
 {
     VALUE top;
 
-    if (RARRAY(ary)->len == 0) return Qnil;
-
-    top = RARRAY(ary)->ptr[0];
-    RARRAY(ary)->len--;
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) == 0) return Qnil;
+    top = RARRAY_PTR(ary)[0];
+    if (!ARY_SHARED_P(ary)) {
+	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+	    MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+1, VALUE, RARRAY_LEN(ary)-1);
+            ARY_INCREASE_LEN(ary, -1);
+	    return top;
+	}
+        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
 
-    /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr, RARRAY(ary)->ptr+1, VALUE, RARRAY(ary)->len);
-    if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
-	RARRAY(ary)->capa = RARRAY(ary)->len * 2;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+	RARRAY_PTR(ary)[0] = Qnil;
+	ary_make_shared(ary);
+    }
+    else if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
+	RARRAY_PTR(ary)[0] = Qnil;
     }
+    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
+    ARY_INCREASE_LEN(ary, -1);
 
     return top;
 }
 
-VALUE
-rb_ary_unshift(ary, item)
-    VALUE ary, item;
+/*
+ *  call-seq:
+ *     ary.shift    -> obj or nil
+ *     ary.shift(n) -> new_ary
+ *
+ *  Returns the first element of +self+ and removes it (shifting all
+ *  other elements down by one). Returns <code>nil</code> if the array
+ *  is empty.
+ *
+ *  If a number _n_ is given, returns an array of the first n elements
+ *  (or less) just like <code>array.slice!(0, n)</code> does.
+ *
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift     #=> "-m"
+ *     args           #=> ["-q", "filename"]
+ *
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift(2)  #=> ["-m", "-q"]
+ *     args           #=> ["filename"]
+ */
+
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
 {
-    rb_ary_modify(ary);
-    if (RARRAY(ary)->len >= RARRAY(ary)->capa) {
-	long capa_inc = RARRAY(ary)->capa / 2;
-	if (capa_inc < ARY_DEFAULT_SIZE) {
-	    capa_inc = ARY_DEFAULT_SIZE;
+    VALUE result;
+    long n;
+
+    if (argc == 0) {
+	return rb_ary_shift(ary);
+    }
+
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    n = RARRAY_LEN(result);
+    if (ARY_SHARED_P(ary)) {
+	if (ARY_SHARED_NUM(ARY_SHARED(ary)) == 1) {
+	    rb_mem_clear(RARRAY_PTR(ary), n);
 	}
-	RARRAY(ary)->capa+=capa_inc;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+        ARY_INCREASE_PTR(ary, n);
+    }
+    else {
+	MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+n, VALUE, RARRAY_LEN(ary)-n);
     }
+    ARY_INCREASE_LEN(ary, -n);
 
-    /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr+1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.unshift(obj, ...)  -> ary
+ *
+ *  Prepends objects to the front of +self+,
+ *  moving other elements upwards.
+ *
+ *     a = [ "b", "c", "d" ]
+ *     a.unshift("a")   #=> ["a", "b", "c", "d"]
+ *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
+ */
 
-    RARRAY(ary)->len++;
-    RARRAY(ary)->ptr[0] = item;
+static VALUE
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
+{
+    long len;
+
+    rb_ary_modify(ary);
+    if (argc == 0) return ary;
+    if (ARY_CAPA(ary) <= (len = RARRAY_LEN(ary)) + argc) {
+	ary_double_capa(ary, len + argc);
+    }
+
+    /* sliding items */
+    MEMMOVE(RARRAY_PTR(ary) + argc, RARRAY_PTR(ary), VALUE, len);
+    MEMCPY(RARRAY_PTR(ary), argv, VALUE, argc);
+    ARY_INCREASE_LEN(ary, argc);
 
     return ary;
 }
 
 VALUE
-rb_ary_entry(ary, offset)
-    VALUE ary;
-    long offset;
+rb_ary_unshift(VALUE ary, VALUE item)
 {
-    if (RARRAY(ary)->len == 0) return Qnil;
+    return rb_ary_unshift_m(1,&item,ary);
+}
 
-    if (offset < 0) {
-	offset = RARRAY(ary)->len + offset;
-    }
-    if (offset < 0 || RARRAY(ary)->len <= offset) {
+/* faster version - use this if you don't need to treat negative offset */
+static inline VALUE
+rb_ary_elt(VALUE ary, long offset)
+{
+    if (RARRAY_LEN(ary) == 0) return Qnil;
+    if (offset < 0 || RARRAY_LEN(ary) <= offset) {
 	return Qnil;
     }
+    return RARRAY_PTR(ary)[offset];
+}
 
-    return RARRAY(ary)->ptr[offset];
+VALUE
+rb_ary_entry(VALUE ary, long offset)
+{
+    if (offset < 0) {
+	offset += RARRAY_LEN(ary);
+    }
+    return rb_ary_elt(ary, offset);
 }
 
-static VALUE
-rb_ary_subary(ary, beg, len)
-    VALUE ary;
-    long beg, len;
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
 {
-    VALUE ary2;
+    VALUE klass;
 
-    if (len < 0) return Qnil;
-    if (beg > RARRAY(ary)->len) return Qnil;
-    if (beg < 0) return Qnil;
-    if (beg + len > RARRAY(ary)->len) {
-	len = RARRAY(ary)->len - beg;
-    }
-    if (len < 0) {
-	len = 0;
-    }
-    if (len == 0) return rb_ary_new2(0);
+    if (beg > RARRAY_LEN(ary)) return Qnil;
+    if (beg < 0 || len < 0) return Qnil;
 
-    ary2 = rb_ary_new2(len);
-    MEMCPY(RARRAY(ary2)->ptr, RARRAY(ary)->ptr+beg, VALUE, len);
-    RARRAY(ary2)->len = len;
+    if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
+	len = RARRAY_LEN(ary) - beg;
+    }
+    klass = rb_obj_class(ary);
+    if (len == 0) return ary_new(klass, 0);
 
-    return ary2;
+    return ary_make_partial(ary, klass, beg, len);
 }
 
+/*
+ *  call-seq:
+ *     ary[index]                -> obj     or nil
+ *     ary[start, length]        -> new_ary or nil
+ *     ary[range]                -> new_ary or nil
+ *     ary.slice(index)          -> obj     or nil
+ *     ary.slice(start, length)  -> new_ary or nil
+ *     ary.slice(range)          -> new_ary or nil
+ *
+ *  Element Reference---Returns the element at _index_,
+ *  or returns a subarray starting at _start_ and
+ *  continuing for _length_ elements, or returns a subarray
+ *  specified by _range_.
+ *  Negative indices count backward from the end of the
+ *  array (-1 is the last element). Returns +nil+ if the index
+ *  (or starting index) are out of range.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a[2] +  a[0] + a[1]    #=> "cab"
+ *     a[6]                   #=> nil
+ *     a[1, 2]                #=> [ "b", "c" ]
+ *     a[1..3]                #=> [ "b", "c", "d" ]
+ *     a[4..7]                #=> [ "e" ]
+ *     a[6..10]               #=> nil
+ *     a[-3, 3]               #=> [ "c", "d", "e" ]
+ *     # special cases
+ *     a[5]                   #=> nil
+ *     a[5, 1]                #=> []
+ *     a[5..10]               #=> []
+ *
+ */
+
 VALUE
-rb_ary_aref(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_aref(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1, arg2;
+    VALUE arg;
     long beg, len;
 
-    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
-	beg = NUM2LONG(arg1);
-	len = NUM2LONG(arg2);
+    if (argc == 2) {
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
 	if (beg < 0) {
-	    beg = RARRAY(ary)->len + beg;
+	    beg += RARRAY_LEN(ary);
 	}
-	return rb_ary_subary(ary, beg, len);
+	return rb_ary_subseq(ary, beg, len);
     }
-
+    if (argc != 1) {
+	rb_scan_args(argc, argv, "11", 0, 0);
+    }
+    arg = argv[0];
     /* special case - speeding up */
-    if (FIXNUM_P(arg1)) {
-	return rb_ary_entry(ary, FIX2LONG(arg1));
+    if (FIXNUM_P(arg)) {
+	return rb_ary_entry(ary, FIX2LONG(arg));
+    }
+    /* check if idx is Range */
+    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+      case Qfalse:
+	break;
+      case Qnil:
+	return Qnil;
+      default:
+	return rb_ary_subseq(ary, beg, len);
     }
-    else if (TYPE(arg1) == T_BIGNUM) {
-	rb_raise(rb_eIndexError, "index too big");
+    return rb_ary_entry(ary, NUM2LONG(arg));
+}
+
+/*
+ *  call-seq:
+ *     ary.at(index)   ->   obj  or nil
+ *
+ *  Returns the element at _index_. A
+ *  negative index counts from the end of +self+.  Returns +nil+
+ *  if the index is out of range. See also <code>Array#[]</code>.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.at(0)     #=> "a"
+ *     a.at(-1)    #=> "e"
+ */
+
+static VALUE
+rb_ary_at(VALUE ary, VALUE pos)
+{
+    return rb_ary_entry(ary, NUM2LONG(pos));
+}
+
+/*
+ *  call-seq:
+ *     ary.first     ->   obj or nil
+ *     ary.first(n)  ->   new_ary
+ *
+ *  Returns the first element, or the first +n+ elements, of the array.
+ *  If the array is empty, the first form returns <code>nil</code>, and the
+ *  second form returns an empty array.
+ *
+ *     a = [ "q", "r", "s", "t" ]
+ *     a.first     #=> "q"
+ *     a.first(2)  #=> ["q", "r"]
+ */
+
+static VALUE
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
+{
+    if (argc == 0) {
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_PTR(ary)[0];
     }
     else {
-	/* check if idx is Range */
-	switch (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 0)) {
-	  case Qfalse:
-	    break;
-	  case Qnil:
-	    return Qnil;
-	  default:
-	    return rb_ary_subary(ary, beg, len);
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary.last     ->  obj or nil
+ *     ary.last(n)  ->  new_ary
+ *
+ *  Returns the last element(s) of +self+. If the array is empty,
+ *  the first form returns <code>nil</code>.
+ *
+ *     a = [ "w", "x", "y", "z" ]
+ *     a.last     #=> "z"
+ *     a.last(2)  #=> ["y", "z"]
+ */
+
+VALUE
+rb_ary_last(int argc, VALUE *argv, VALUE ary)
+{
+    if (argc == 0) {
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_PTR(ary)[RARRAY_LEN(ary)-1];
+    }
+    else {
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary.fetch(index)                    -> obj
+ *     ary.fetch(index, default )          -> obj
+ *     ary.fetch(index) {|index| block }   -> obj
+ *
+ *  Tries to return the element at position <i>index</i>. If the index
+ *  lies outside the array, the first form throws an
+ *  <code>IndexError</code> exception, the second form returns
+ *  <i>default</i>, and the third form returns the value of invoking
+ *  the block, passing in the index. Negative values of <i>index</i>
+ *  count from the end of the array.
+ *
+ *     a = [ 11, 22, 33, 44 ]
+ *     a.fetch(1)               #=> 22
+ *     a.fetch(-1)              #=> 44
+ *     a.fetch(4, 'cat')        #=> "cat"
+ *     a.fetch(4) { |i| i*i }   #=> 16
+ */
+
+static VALUE
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE pos, ifnone;
+    long block_given;
+    long idx;
+
+    rb_scan_args(argc, argv, "11", &pos, &ifnone);
+    block_given = rb_block_given_p();
+    if (block_given && argc == 2) {
+	rb_warn("block supersedes default value argument");
+    }
+    idx = NUM2LONG(pos);
+
+    if (idx < 0) {
+	idx +=  RARRAY_LEN(ary);
+    }
+    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+	if (block_given) return rb_yield(pos);
+	if (argc == 1) {
+	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
 	}
+	return ifnone;
     }
-    return rb_ary_entry(ary, NUM2LONG(arg1));
+    return RARRAY_PTR(ary)[idx];
 }
 
+/*
+ *  call-seq:
+ *     ary.index(obj)           ->  int or nil
+ *     ary.index {|item| block} ->  int or nil
+ *     ary.index                ->  an_enumerator
+ *
+ *  Returns the index of the first object in +self+ such that the object is
+ *  <code>==</code> to <i>obj</i>. If a block is given instead of an
+ *  argument, returns index of first object for which <em>block</em> is true.
+ *  Returns <code>nil</code> if no match is found.
+ *  See also <code>Array#rindex</code>.
+ *
+ *  If neither block nor argument is given, an enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.index("b")        #=> 1
+ *     a.index("z")        #=> nil
+ *     a.index{|x|x=="b"}  #=> 1
+ *
+ *  This is an alias of <code>#find_index</code>.
+ */
+
 static VALUE
-rb_ary_index(ary, val)
-    VALUE ary;
-    VALUE val;
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
 {
+    VALUE val;
     long i;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	if (rb_equal(RARRAY(ary)->ptr[i], val))
-	    return INT2NUM(i);
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
+		return LONG2NUM(i);
+	    }
+	}
+	return Qnil;
+    }
+    rb_scan_args(argc, argv, "1", &val);
+    if (rb_block_given_p())
+	rb_warn("given block not used");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	if (rb_equal(RARRAY_PTR(ary)[i], val))
+	    return LONG2NUM(i);
     }
     return Qnil;
 }
 
+/*
+ *  call-seq:
+ *     ary.rindex(obj)           ->  int or nil
+ *     ary.rindex {|item| block} ->  int or nil
+ *     ary.rindex                ->  an_enumerator
+ *
+ *  Returns the index of the last object in +self+
+ *  <code>==</code> to <i>obj</i>. If a block is given instead of an
+ *  argument, returns index of first object for which <em>block</em> is
+ *  true, starting from the last object.
+ *  Returns <code>nil</code> if no match is found.
+ *  See also <code>Array#index</code>.
+ *
+ *  If neither block nor argument is given, an enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.rindex("b")             #=> 3
+ *     a.rindex("z")             #=> nil
+ *     a.rindex { |x| x == "b" } #=> 3
+ */
+
 static VALUE
-rb_ary_rindex(ary, val)
-    VALUE ary;
-    VALUE val;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
 {
-    long i = RARRAY(ary)->len;
+    VALUE val;
+    long i = RARRAY_LEN(ary);
 
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	while (i--) {
+	    if (RTEST(rb_yield(RARRAY_PTR(ary)[i])))
+		return LONG2NUM(i);
+	    if (i > RARRAY_LEN(ary)) {
+		i = RARRAY_LEN(ary);
+	    }
+	}
+	return Qnil;
+    }
+    rb_scan_args(argc, argv, "1", &val);
+    if (rb_block_given_p())
+	rb_warn("given block not used");
     while (i--) {
-	if (rb_equal(RARRAY(ary)->ptr[i], val))
-	    return INT2NUM(i);
+	if (rb_equal(RARRAY_PTR(ary)[i], val))
+	    return LONG2NUM(i);
+	if (i > RARRAY_LEN(ary)) {
+	    i = RARRAY_LEN(ary);
+	}
     }
     return Qnil;
 }
 
-static VALUE
-rb_ary_indexes(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+VALUE
+rb_ary_to_ary(VALUE obj)
 {
-    VALUE new_ary;
-    long i;
-
-    new_ary = rb_ary_new2(argc);
-    for (i=0; i<argc; i++) {
-	rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
-    }
+    VALUE tmp = rb_check_array_type(obj);
 
-    return new_ary;
+    if (!NIL_P(tmp)) return tmp;
+    return rb_ary_new3(1, obj);
 }
 
 static void
-rb_ary_replace(ary, beg, len, rpl)
-    VALUE ary, rpl;
-    long beg, len;
+rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
 {
-    if (len < 0) rb_raise(rb_eIndexError, "negative length %d", len);
-    if (beg < 0) {
-	beg += RARRAY(ary)->len;
-    }
+    long rlen;
+
+    if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
     if (beg < 0) {
-	beg -= RARRAY(ary)->len;
-	rb_raise(rb_eIndexError, "index %d out of array", beg);
+	beg += RARRAY_LEN(ary);
+	if (beg < 0) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     beg - RARRAY_LEN(ary), -RARRAY_LEN(ary));
+	}
     }
-    if (beg + len > RARRAY(ary)->len) {
-	len = RARRAY(ary)->len - beg;
+    if (RARRAY_LEN(ary) < len || RARRAY_LEN(ary) < beg + len) {
+	len = RARRAY_LEN(ary) - beg;
     }
 
-    if (TYPE(rpl) != T_ARRAY) {
-	rpl = rb_Array(rpl);
+    if (rpl == Qundef) {
+	rlen = 0;
+    }
+    else {
+	rpl = rb_ary_to_ary(rpl);
+	rlen = RARRAY_LEN(rpl);
     }
-
     rb_ary_modify(ary);
-    if (beg >= RARRAY(ary)->len) {
-	len = beg + RARRAY(rpl)->len;
-	if (len >= RARRAY(ary)->capa) {
-	    RARRAY(ary)->capa=len;
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+    if (beg >= RARRAY_LEN(ary)) {
+	if (beg > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", beg);
+	}
+	len = beg + rlen;
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
 	}
-	rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len, beg-RARRAY(ary)->len);
-	MEMCPY(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, RARRAY(rpl)->len);
-	RARRAY(ary)->len = len;
+	rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), beg - RARRAY_LEN(ary));
+	if (rlen > 0) {
+	    MEMCPY(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
+	}
+	ARY_SET_LEN(ary, len);
     }
     else {
 	long alen;
 
-	if (beg + len > RARRAY(ary)->len) {
-	    len = RARRAY(ary)->len - beg;
+	alen = RARRAY_LEN(ary) + rlen - len;
+	if (alen >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, alen);
 	}
 
-	alen = RARRAY(ary)->len + RARRAY(rpl)->len - len;
-	if (alen >= RARRAY(ary)->capa) {
-	    RARRAY(ary)->capa=alen;
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+	if (len != rlen) {
+	    MEMMOVE(RARRAY_PTR(ary) + beg + rlen, RARRAY_PTR(ary) + beg + len,
+		    VALUE, RARRAY_LEN(ary) - (beg + len));
+	    ARY_SET_LEN(ary, alen);
+	}
+	if (rlen > 0) {
+	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_PTR(rpl), VALUE, rlen);
 	}
+    }
+}
+
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary  an array
+ * \param len  new size
+ * \return     \a ary
+ * \post       the size of \a ary is \a len.
+ */
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+    long olen;
 
-	if (len != RARRAY(rpl)->len) {
-	    MEMMOVE(RARRAY(ary)->ptr+beg+RARRAY(rpl)->len, RARRAY(ary)->ptr+beg+len,
-		    VALUE, RARRAY(ary)->len-(beg+len));
-	    RARRAY(ary)->len = alen;
+    rb_ary_modify(ary);
+    olen = RARRAY_LEN(ary);
+    if (len == olen) return ary;
+    if (len > ARY_MAX_SIZE) {
+	rb_raise(rb_eIndexError, "index %ld too big", len);
+    }
+    if (len > olen) {
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
 	}
-	MEMCPY(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, RARRAY(rpl)->len);
+	rb_mem_clear(RARRAY_PTR(ary) + olen, len - olen);
+        ARY_SET_LEN(ary, len);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        ARY_SET_EMBED_LEN(ary, len);
+    }
+    else if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE tmp[RARRAY_EMBED_LEN_MAX];
+	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+	ary_discard(ary);
+	MEMCPY(ARY_EMBED_PTR(ary), tmp, VALUE, len);
+        ARY_SET_EMBED_LEN(ary, len);
     }
+    else {
+	if (olen > len + ARY_DEFAULT_SIZE) {
+	    REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len);
+	    ARY_SET_CAPA(ary, len);
+	}
+	ARY_SET_HEAP_LEN(ary, len);
+    }
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary[index]         = obj                      ->  obj
+ *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
+ *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
+ *
+ *  Element Assignment---Sets the element at _index_,
+ *  or replaces a subarray starting at _start_ and
+ *  continuing for _length_ elements, or replaces a subarray
+ *  specified by _range_.  If indices are greater than
+ *  the current capacity of the array, the array grows
+ *  automatically. A negative indices will count backward
+ *  from the end of the array. Inserts elements if _length_ is
+ *  zero. An +IndexError+ is raised if a negative index points
+ *  past the beginning of the array. See also
+ *  <code>Array#push</code>, and <code>Array#unshift</code>.
+ *
+ *     a = Array.new
+ *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
+ *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
+ *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
+ *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
+ *     a[0..2] = "A"               #=> ["A", "4"]
+ *     a[-1]   = "Z"               #=> ["A", "Z"]
+ *     a[1..-1] = nil              #=> ["A", nil]
+ *     a[1..-1] = []               #=> ["A"]
+ */
+
 static VALUE
-rb_ary_aset(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE arg1, arg2, arg3;
     long offset, beg, len;
 
-    if (rb_scan_args(argc, argv, "21", &arg1, &arg2, &arg3) == 3) {
-	rb_ary_replace(ary, NUM2LONG(arg1), NUM2LONG(arg2), arg3);
-	return arg3;
+    if (argc == 3) {
+	rb_ary_modify_check(ary);
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	rb_ary_splice(ary, beg, len, argv[2]);
+	return argv[2];
+    }
+    if (argc != 2) {
+	rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
     }
-    else if (FIXNUM_P(arg1)) {
-	offset = FIX2LONG(arg1);
+    rb_ary_modify_check(ary);
+    if (FIXNUM_P(argv[0])) {
+	offset = FIX2LONG(argv[0]);
 	goto fixnum;
     }
-    else if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
+    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
 	/* check if idx is Range */
-	rb_ary_replace(ary, beg, len, arg2);
-	return arg2;
-    }
-    if (TYPE(arg1) == T_BIGNUM) {
-	rb_raise(rb_eIndexError, "index too big");
+	rb_ary_splice(ary, beg, len, argv[1]);
+	return argv[1];
     }
 
-    offset = NUM2LONG(arg1);
-  fixnum:
-    rb_ary_store(ary, offset, arg2);
-    return arg2;
+    offset = NUM2LONG(argv[0]);
+fixnum:
+    rb_ary_store(ary, offset, argv[1]);
+    return argv[1];
+}
+
+/*
+ *  call-seq:
+ *     ary.insert(index, obj...)  -> ary
+ *
+ *  Inserts the given values before the element with the given index
+ *  (which may be negative).
+ *
+ *     a = %w{ a b c d }
+ *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
+ *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
+ */
+
+static VALUE
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
+{
+    long pos;
+
+    if (argc < 1) {
+	rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
+    }
+    rb_ary_modify_check(ary);
+    if (argc == 1) return ary;
+    pos = NUM2LONG(argv[0]);
+    if (pos == -1) {
+	pos = RARRAY_LEN(ary);
+    }
+    if (pos < 0) {
+	pos++;
+    }
+    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.each {|item| block }   -> ary
+ *     ary.each                   -> an_enumerator
+ *
+ *  Calls <i>block</i> once for each element in +self+, passing that
+ *  element as a parameter.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.each {|x| print x, " -- " }
+ *
+ *  produces:
+ *
+ *     a -- b -- c --
+ */
+
 VALUE
-rb_ary_each(ary)
-    VALUE ary;
+rb_ary_each(VALUE array)
 {
     long i;
+    volatile VALUE ary = array;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	rb_yield(RARRAY(ary)->ptr[i]);
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_yield(RARRAY_PTR(ary)[i]);
     }
-    return Qnil;
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.each_index {|index| block }  -> ary
+ *     ary.each_index                   -> an_enumerator
+ *
+ *  Same as <code>Array#each</code>, but passes the index of the element
+ *  instead of the element itself.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.each_index {|x| print x, " -- " }
+ *
+ *  produces:
+ *
+ *     0 -- 1 -- 2 --
+ */
+
 static VALUE
-rb_ary_each_index(ary)
-    VALUE ary;
+rb_ary_each_index(VALUE ary)
 {
     long i;
+    RETURN_ENUMERATOR(ary, 0, 0);
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	rb_yield(INT2NUM(i));
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_yield(LONG2NUM(i));
     }
-    return Qnil;
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.reverse_each {|item| block }   -> ary
+ *     ary.reverse_each                   -> an_enumerator
+ *
+ *  Same as <code>Array#each</code>, but traverses +self+ in reverse
+ *  order.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse_each {|x| print x, " " }
+ *
+ *  produces:
+ *
+ *     c b a
+ */
+
 static VALUE
-rb_ary_reverse_each(ary)
-    VALUE ary;
+rb_ary_reverse_each(VALUE ary)
 {
-    long len = RARRAY(ary)->len;
+    long len;
 
+    RETURN_ENUMERATOR(ary, 0, 0);
+    len = RARRAY_LEN(ary);
     while (len--) {
-	rb_yield(RARRAY(ary)->ptr[len]);
+	rb_yield(RARRAY_PTR(ary)[len]);
+	if (RARRAY_LEN(ary) < len) {
+	    len = RARRAY_LEN(ary);
+	}
     }
-    return Qnil;
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.length -> int
+ *
+ *  Returns the number of elements in +self+. May be zero.
+ *
+ *     [ 1, 2, 3, 4, 5 ].length   #=> 5
+ */
+
 static VALUE
-rb_ary_length(ary)
-    VALUE ary;
+rb_ary_length(VALUE ary)
 {
-    return INT2NUM(RARRAY(ary)->len);
+    long len = RARRAY_LEN(ary);
+    return LONG2NUM(len);
 }
 
+/*
+ *  call-seq:
+ *     ary.empty?   -> true or false
+ *
+ *  Returns <code>true</code> if +self+ contains no elements.
+ *
+ *     [].empty?   #=> true
+ */
+
 static VALUE
-rb_ary_empty_p(ary)
-    VALUE ary;
+rb_ary_empty_p(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0)
+    if (RARRAY_LEN(ary) == 0)
 	return Qtrue;
     return Qfalse;
 }
 
-static VALUE
-rb_ary_clone(ary)
-    VALUE ary;
-{
-    VALUE ary2 = rb_ary_new2(RARRAY(ary)->len);
-
-    CLONESETUP(ary2, ary);
-    MEMCPY(RARRAY(ary2)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-    RARRAY(ary2)->len = RARRAY(ary)->len;
-    return ary2;
-}
-
-static VALUE
-rb_ary_dup(ary)
-    VALUE ary;
+VALUE
+rb_ary_dup(VALUE ary)
 {
-    return rb_ary_s_create(RARRAY(ary)->len, RARRAY(ary)->ptr, CLASS_OF(ary));
+    VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+    MEMCPY(RARRAY_PTR(dup), RARRAY_PTR(ary), VALUE, RARRAY_LEN(ary));
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
+    return dup;
 }
 
-static VALUE
-to_ary(ary)
-    VALUE ary;
+VALUE
+rb_ary_resurrect(VALUE ary)
 {
-    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
+    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_PTR(ary));
 }
 
 extern VALUE rb_output_fs;
 
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
 static VALUE
-inspect_join(ary, arg)
-    VALUE ary;
-    VALUE *arg;
+recursive_join(VALUE obj, VALUE argp, int recur)
 {
-    return rb_ary_join(arg[0], arg[1]);
+    VALUE *arg = (VALUE *)argp;
+    VALUE ary = arg[0];
+    VALUE sep = arg[1];
+    VALUE result = arg[2];
+    int *first = (int *)arg[3];
+
+    if (recur) {
+	rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+	ary_join_1(obj, ary, sep, 0, result, first);
+    }
+    return Qnil;
 }
 
-VALUE
-rb_ary_join(ary, sep)
-    VALUE ary, sep;
+static void
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
     long i;
-    VALUE result, tmp;
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-
-    tmp = RARRAY(ary)->ptr[0];
-    switch (TYPE(tmp)) {
-      case T_STRING:
-	result = rb_str_dup(tmp);
-	break;
-      case T_ARRAY:
-	if (rb_inspecting_p(tmp)) {
-	    result = rb_str_new2("[...]");
-	}
-	else {
-	    VALUE args[2];
+    VALUE val;
 
-	    args[0] = tmp;
-	    args[1] = sep;
-	    result = rb_protect_inspect(inspect_join, ary, (VALUE)args);
-	}
-	break;
-      default:
-	result = rb_obj_as_string(tmp);
-	break;
+    if (max > 0) rb_enc_copy(result, RARRAY_PTR(ary)[0]);
+    for (i=0; i<max; i++) {
+	val = RARRAY_PTR(ary)[i];
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+	rb_str_buf_append(result, val);
+	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+	if (OBJ_UNTRUSTED(val)) OBJ_TAINT(result);
     }
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+{
+    VALUE val, tmp;
 
-    for (i=1; i<RARRAY(ary)->len; i++) {
-	tmp = RARRAY(ary)->ptr[i];
-	switch (TYPE(tmp)) {
+    for (; i<RARRAY_LEN(ary); i++) {
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+
+	val = RARRAY_PTR(ary)[i];
+	switch (TYPE(val)) {
 	  case T_STRING:
+	  str_join:
+	    rb_str_buf_append(result, val);
+	    *first = FALSE;
 	    break;
 	  case T_ARRAY:
-	    if (rb_inspecting_p(tmp)) {
-		tmp = rb_str_new2("[...]");
+	    obj = val;
+	  ary_join:
+	    if (val == ary) {
+		rb_raise(rb_eArgError, "recursive array join");
 	    }
 	    else {
-		VALUE args[2];
+		VALUE args[4];
 
-		args[0] = tmp;
+		args[0] = val;
 		args[1] = sep;
-		tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+		args[2] = result;
+		args[3] = (VALUE)first;
+		rb_exec_recursive(recursive_join, obj, (VALUE)args);
 	    }
 	    break;
 	  default:
-	    tmp = rb_obj_as_string(tmp);
+	    tmp = rb_check_string_type(val);
+	    if (!NIL_P(tmp)) {
+		val = tmp;
+		goto str_join;
+	    }
+	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
+	    if (!NIL_P(tmp)) {
+		obj = val;
+		val = tmp;
+		goto ary_join;
+	    }
+	    val = rb_obj_as_string(val);
+	    if (*first) {
+		rb_enc_copy(result, val);
+		*first = FALSE;
+	    }
+	    goto str_join;
 	}
-	if (!NIL_P(sep)) rb_str_concat(result, sep);
-	rb_str_cat(result, RSTRING(tmp)->ptr, RSTRING(tmp)->len);
-	if (OBJ_TAINTED(tmp)) OBJ_TAINT(result);
     }
+}
+
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+    long len = 1, i;
+    int taint = FALSE;
+    int untrust = FALSE;
+    VALUE val, tmp, result;
+
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+    if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = TRUE;
+    if (OBJ_UNTRUSTED(ary) || OBJ_UNTRUSTED(sep)) untrust = TRUE;
+
+    if (!NIL_P(sep)) {
+	StringValue(sep);
+	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	val = RARRAY_PTR(ary)[i];
+	tmp = rb_check_string_type(val);
+
+	if (NIL_P(tmp) || tmp != val) {
+	    int first;
+	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+	    rb_enc_associate(result, rb_usascii_encoding());
+	    if (taint) OBJ_TAINT(result);
+	    if (untrust) OBJ_UNTRUST(result);
+	    ary_join_0(ary, sep, i, result);
+	    first = i == 0;
+	    ary_join_1(ary, ary, sep, i, result, &first);
+	    return result;
+	}
+
+	len += RSTRING_LEN(tmp);
+    }
+
+    result = rb_str_buf_new(len);
+    if (taint) OBJ_TAINT(result);
+    if (untrust) OBJ_UNTRUST(result);
+    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
 
     return result;
 }
 
+/*
+ *  call-seq:
+ *     ary.join(sep=$,)    -> str
+ *
+ *  Returns a string created by converting each element of the array to
+ *  a string, separated by <i>sep</i>.
+ *
+ *     [ "a", "b", "c" ].join        #=> "abc"
+ *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
+ */
+
 static VALUE
-rb_ary_join_method(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
     rb_scan_args(argc, argv, "01", &sep);
     if (NIL_P(sep)) sep = rb_output_fs;
+
     return rb_ary_join(ary, sep);
 }
 
-VALUE
-rb_ary_to_s(ary)
-    VALUE ary;
+static VALUE
+inspect_ary(VALUE ary, VALUE dummy, int recur)
 {
-    VALUE str;
+    int tainted = OBJ_TAINTED(ary);
+    int untrust = OBJ_UNTRUSTED(ary);
+    long i;
+    VALUE s, str;
 
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-    str = rb_ary_join(ary, rb_output_fs);
-    if (NIL_P(str)) return rb_str_new(0, 0);
+    if (recur) return rb_usascii_str_new_cstr("[...]");
+    str = rb_str_buf_new2("[");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	s = rb_inspect(RARRAY_PTR(ary)[i]);
+	if (OBJ_TAINTED(s)) tainted = TRUE;
+	if (OBJ_UNTRUSTED(s)) untrust = TRUE;
+	if (i > 0) rb_str_buf_cat2(str, ", ");
+	else rb_enc_copy(str, s);
+	rb_str_buf_append(str, s);
+    }
+    rb_str_buf_cat2(str, "]");
+    if (tainted) OBJ_TAINT(str);
+    if (untrust) OBJ_UNTRUST(str);
     return str;
 }
 
-static ID inspect_key;
+/*
+ *  call-seq:
+ *     ary.to_s -> string
+ *     ary.inspect  -> string
+ *
+ *  Creates a string representation of +self+.
+ */
 
-struct inspect_arg {
-    VALUE (*func)();
-    VALUE arg1, arg2;
-};
+static VALUE
+rb_ary_inspect(VALUE ary)
+{
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+    return rb_exec_recursive(inspect_ary, ary, 0);
+}
 
 VALUE
-inspect_call(arg)
-    struct inspect_arg *arg;
+rb_ary_to_s(VALUE ary)
 {
-    return (*arg->func)(arg->arg1, arg->arg2);
+    return rb_ary_inspect(ary);
 }
 
+/*
+ *  call-seq:
+ *     ary.to_a     -> ary
+ *
+ *  Returns +self+. If called on a subclass of Array, converts
+ *  the receiver to an Array object.
+ */
+
 static VALUE
-inspect_ensure(obj)
-    VALUE obj;
+rb_ary_to_a(VALUE ary)
 {
-    VALUE inspect_tbl;
+    if (rb_obj_class(ary) != rb_cArray) {
+	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+	rb_ary_replace(dup, ary);
+	return dup;
+    }
+    return ary;
+}
 
-    inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-    rb_ary_pop(inspect_tbl);
-    return 0;
+/*
+ *  call-seq:
+ *     ary.to_ary -> ary
+ *
+ *  Returns +self+.
+ */
+
+static VALUE
+rb_ary_to_ary_m(VALUE ary)
+{
+    return ary;
 }
 
-VALUE
-rb_protect_inspect(func, obj, arg)
-    VALUE (*func)();
-    VALUE obj, arg;
+static void
+ary_reverse(p1, p2)
+    VALUE *p1, *p2;
 {
-    struct inspect_arg iarg;
+    while (p1 < p2) {
+	VALUE tmp = *p1;
+	*p1++ = *p2;
+	*p2-- = tmp;
+    }
+}
 
-    VALUE inspect_tbl;
+VALUE
+rb_ary_reverse(VALUE ary)
+{
+    VALUE *p1, *p2;
 
-    if (!inspect_key) {
-	inspect_key = rb_intern("__inspect_key__");
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > 1) {
+	p1 = RARRAY_PTR(ary);
+	p2 = p1 + RARRAY_LEN(ary) - 1;	/* points last item */
+	ary_reverse(p1, p2);
     }
-    inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-    if (NIL_P(inspect_tbl)) {
-	inspect_tbl = rb_ary_new();
-	rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.reverse!   -> ary
+ *
+ *  Reverses +self+ in place.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse!       #=> ["c", "b", "a"]
+ *     a                #=> ["c", "b", "a"]
+ */
+
+static VALUE
+rb_ary_reverse_bang(VALUE ary)
+{
+    return rb_ary_reverse(ary);
+}
+
+/*
+ *  call-seq:
+ *     ary.reverse -> new_ary
+ *
+ *  Returns a new array containing +self+'s elements in reverse order.
+ *
+ *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
+ *     [ 1 ].reverse               #=> [1]
+ */
+
+static VALUE
+rb_ary_reverse_m(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+
+    if (len > 0) {
+	VALUE *p1 = RARRAY_PTR(ary);
+	VALUE *p2 = RARRAY_PTR(dup) + len - 1;
+	do *p2-- = *p1++; while (--len > 0);
     }
-    rb_ary_push(inspect_tbl, obj);
-    iarg.func = func;
-    iarg.arg1 = obj;
-    iarg.arg2 = arg;
-    return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
+    return dup;
+}
+
+static inline long
+rotate_count(long cnt, long len)
+{
+    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
 }
 
 VALUE
-rb_inspecting_p(obj)
-    VALUE obj;
+rb_ary_rotate(VALUE ary, long cnt)
 {
-    VALUE inspect_tbl;
+    rb_ary_modify(ary);
 
-    if (!inspect_key) return Qfalse;
-    inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-    if (NIL_P(inspect_tbl)) return Qfalse;
-    return rb_ary_includes(inspect_tbl, obj);
+    if (cnt != 0) {
+	VALUE *ptr = RARRAY_PTR(ary);
+	long len = RARRAY_LEN(ary);
+
+	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+	    --len;
+	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+	    if (len > 0) ary_reverse(ptr, ptr + len);
+	    return ary;
+	}
+    }
+
+    return Qnil;
 }
 
+/*
+ *  call-seq:
+ *     ary.rotate!(cnt=1) -> ary
+ *
+ *  Rotates +self+ in place so that the element at +cnt+ comes first,
+ *  and returns +self+.  If +cnt+ is negative then it rotates in
+ *  the opposite direction.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate!        #=> ["b", "c", "d", "a"]
+ *     a                #=> ["b", "c", "d", "a"]
+ *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
+ *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
+ */
+
 static VALUE
-inspect_ary(ary)
-    VALUE ary;
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long i = 0;
-    VALUE s, str;
+    long n = 1;
+
+    switch (argc) {
+      case 1: n = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
+    rb_ary_rotate(ary, n);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.rotate(cnt=1) -> new_ary
+ *
+ *  Returns new array by rotating +self+ so that the element at
+ *  +cnt+ in +self+ is the first element of the new array. If +cnt+
+ *  is negative then it rotates in the opposite direction.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate         #=> ["b", "c", "d", "a"]
+ *     a                #=> ["a", "b", "c", "d"]
+ *     a.rotate(2)      #=> ["c", "d", "a", "b"]
+ *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
+ */
 
-    str = rb_str_new2("[");
+static VALUE
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE rotated, *ptr, *ptr2;
+    long len, cnt = 1;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	s = rb_inspect(RARRAY(ary)->ptr[i]);
-	if (i > 0) rb_str_cat(str, ", ", 2);
-	rb_str_cat(str, RSTRING(s)->ptr, RSTRING(s)->len);
+    switch (argc) {
+      case 1: cnt = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
     }
-    rb_str_cat(str, "]", 1);
 
-    return str;
+    len = RARRAY_LEN(ary);
+    rotated = rb_ary_new2(len);
+    if (len > 0) {
+	cnt = rotate_count(cnt, len);
+	ptr = RARRAY_PTR(ary);
+	ptr2 = RARRAY_PTR(rotated);
+	len -= cnt;
+	MEMCPY(ptr2, ptr + cnt, VALUE, len);
+	MEMCPY(ptr2 + len, ptr, VALUE, cnt);
+    }
+    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+    return rotated;
 }
 
-static VALUE
-rb_ary_inspect(ary)
+struct ary_sort_data {
     VALUE ary;
+    int opt_methods;
+    int opt_inited;
+};
+
+enum {
+    sort_opt_Fixnum,
+    sort_opt_String,
+    sort_optimizable_count
+};
+
+#define STRING_P(s) (TYPE(s) == T_STRING && CLASS_OF(s) == rb_cString)
+
+#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
+#define SORT_OPTIMIZABLE(data, type) \
+    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
+     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
+     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
+      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
+      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
+
+static VALUE
+sort_reentered(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
-    if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
-    return rb_protect_inspect(inspect_ary, ary, 0);
+    if (RBASIC(ary)->klass) {
+	rb_raise(rb_eRuntimeError, "sort reentered");
+    }
+    return Qnil;
 }
 
-static VALUE
-rb_ary_to_a(ary)
-    VALUE ary;
+static int
+sort_1(const void *ap, const void *bp, void *dummy)
 {
-    return ary;
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    int n;
+
+    retval = rb_yield_values(2, a, b);
+    n = rb_cmpint(retval, a, b);
+    sort_reentered(data->ary);
+    return n;
 }
 
-VALUE
-rb_ary_reverse(ary)
-    VALUE ary;
+static int
+sort_2(const void *ap, const void *bp, void *dummy)
 {
-    VALUE *p1, *p2;
-    VALUE tmp;
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    int n;
+
+    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
+	if ((long)a > (long)b) return 1;
+	if ((long)a < (long)b) return -1;
+	return 0;
+    }
+    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+	return rb_str_cmp(a, b);
+    }
 
-    if (RARRAY(ary)->len == 0) return ary;
+    retval = rb_funcall(a, id_cmp, 1, b);
+    n = rb_cmpint(retval, a, b);
+    sort_reentered(data->ary);
 
-    p1 = RARRAY(ary)->ptr;
-    p2 = p1 + RARRAY(ary)->len - 1;	/* points last item */
+    return n;
+}
 
-    while (p1 < p2) {
-	tmp = *p1;
-	*p1 = *p2;
-	*p2 = tmp;
-	p1++; p2--;
+/*
+ *  call-seq:
+ *     ary.sort!                   -> ary
+ *     ary.sort! {| a,b | block }  -> ary
+ *
+ *  Sorts +self+. Comparisons for
+ *  the sort will be done using the <code><=></code> operator or using
+ *  an optional code block. The block implements a comparison between
+ *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
+ *  <code>Enumerable#sort_by</code>.
+ *
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort! {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
+ */
+
+VALUE
+rb_ary_sort_bang(VALUE ary)
+{
+    rb_ary_modify(ary);
+    assert(!ARY_SHARED_P(ary));
+    if (RARRAY_LEN(ary) > 1) {
+	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+	struct ary_sort_data data;
+
+	RBASIC(tmp)->klass = 0;
+	data.ary = tmp;
+	data.opt_methods = 0;
+	data.opt_inited = 0;
+	ruby_qsort(RARRAY_PTR(tmp), RARRAY_LEN(tmp), sizeof(VALUE),
+		   rb_block_given_p()?sort_1:sort_2, &data);
+
+        if (ARY_EMBED_P(tmp)) {
+            assert(ARY_EMBED_P(tmp));
+            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+                rb_ary_unshare(ary);
+            }
+            FL_SET_EMBED(ary);
+            MEMCPY(RARRAY_PTR(ary), ARY_EMBED_PTR(tmp), VALUE, ARY_EMBED_LEN(tmp));
+            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+        }
+        else {
+            assert(!ARY_EMBED_P(tmp));
+            if (ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+                assert(!ARY_EMBED_P(ary));
+                FL_UNSET_SHARED(ary);
+                ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+            }
+            else {
+                assert(!ARY_SHARED_P(tmp));
+                if (ARY_EMBED_P(ary)) {
+                    FL_UNSET_EMBED(ary);
+                }
+                else if (ARY_SHARED_P(ary)) {
+                    /* ary might be destructively operated in the given block */
+                    rb_ary_unshare(ary);
+                }
+                else {
+                    xfree(ARY_HEAP_PTR(ary));
+                }
+                ARY_SET_PTR(ary, RARRAY_PTR(tmp));
+                ARY_SET_HEAP_LEN(ary, RARRAY_LEN(tmp));
+                ARY_SET_CAPA(ary, ARY_CAPA(tmp));
+            }
+            /* tmp was lost ownership for the ptr */
+            FL_UNSET(tmp, FL_FREEZE);
+            FL_SET_EMBED(tmp);
+            ARY_SET_EMBED_LEN(tmp, 0);
+            FL_SET(tmp, FL_FREEZE);
+	}
+        /* tmp will be GC'ed. */
+        RBASIC(tmp)->klass = rb_cArray;
     }
+    return ary;
+}
 
+/*
+ *  call-seq:
+ *     ary.sort                   -> new_ary
+ *     ary.sort {| a,b | block }  -> new_ary
+ *
+ *  Returns a new array created by sorting +self+. Comparisons for
+ *  the sort will be done using the <code><=></code> operator or using
+ *  an optional code block. The block implements a comparison between
+ *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
+ *  <code>Enumerable#sort_by</code>.
+ *
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
+ */
+
+VALUE
+rb_ary_sort(VALUE ary)
+{
+    ary = rb_ary_dup(ary);
+    rb_ary_sort_bang(ary);
     return ary;
 }
 
+
 static VALUE
-rb_ary_reverse_method(ary)
-    VALUE ary;
+sort_by_i(VALUE i)
 {
-    return rb_ary_reverse(rb_ary_dup(ary));
+    return rb_yield(i);
 }
 
-static ID cmp;
+/*
+ *  call-seq:
+ *     ary.sort_by! {| obj | block }    -> ary
+ *     ary.sort_by!                     -> an_enumerator
+ *
+ *  Sorts +self+ in place using a set of keys generated by mapping the
+ *  values in +self+ through the given block.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ */
 
-static int
-sort_1(a, b)
-    VALUE *a, *b;
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
 {
-    VALUE retval = rb_yield(rb_assoc_new(*a, *b));
-    return NUM2INT(retval);
+    VALUE sorted;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rb_ary_modify(ary);
+    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+    rb_ary_replace(ary, sorted);
+    return ary;
 }
 
-static int
-sort_2(a, b)
-    VALUE *a, *b;
+
+/*
+ *  call-seq:
+ *     ary.collect {|item| block }  -> new_ary
+ *     ary.map     {|item| block }  -> new_ary
+ *     ary.collect                  -> an_enumerator
+ *     ary.map                      -> an_enumerator
+ *
+ *  Invokes <i>block</i> once for each element of +self+. Creates a
+ *  new array containing the values returned by the block.
+ *  See also <code>Enumerable#collect</code>.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.collect {|x| x + "!" }   #=> ["a!", "b!", "c!", "d!"]
+ *     a                          #=> ["a", "b", "c", "d"]
+ */
+
+static VALUE
+rb_ary_collect(VALUE ary)
 {
-    VALUE retval;
+    long i;
+    VALUE collect;
 
-    if (FIXNUM_P(*a)) {
-	if (FIXNUM_P(*b)) return *a - *b;
+    RETURN_ENUMERATOR(ary, 0, 0);
+    collect = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_push(collect, rb_yield(RARRAY_PTR(ary)[i]));
     }
-    else if (TYPE(*a) == T_STRING && TYPE(*b) == T_STRING) {
-	return rb_str_cmp(*a, *b);
+    return collect;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.collect! {|item| block }   -> ary
+ *     ary.map!     {|item| block }   -> ary
+ *     ary.collect                    -> an_enumerator
+ *     ary.map                        -> an_enumerator
+ *
+ *  Invokes the block once for each element of +self+, replacing the
+ *  element with the value returned by _block_.
+ *  See also <code>Enumerable#collect</code>.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.collect! {|x| x + "!" }
+ *     a             #=>  [ "a!", "b!", "c!", "d!" ]
+ */
+
+static VALUE
+rb_ary_collect_bang(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rb_ary_modify(ary);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_store(ary, i, rb_yield(RARRAY_PTR(ary)[i]));
     }
+    return ary;
+}
+
+VALUE
+rb_get_values_at(VALUE obj, long olen, int argc, VALUE *argv, VALUE (*func) (VALUE, long))
+{
+    VALUE result = rb_ary_new2(argc);
+    long beg, len, i, j;
 
-    retval = rb_funcall(*a, cmp, 1, *b);
-    return NUM2INT(retval);
+    for (i=0; i<argc; i++) {
+	if (FIXNUM_P(argv[i])) {
+	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+	    continue;
+	}
+	/* check if idx is Range */
+	switch (rb_range_beg_len(argv[i], &beg, &len, olen, 0)) {
+	  case Qfalse:
+	    break;
+	  case Qnil:
+	    continue;
+	  default:
+	    for (j=0; j<len; j++) {
+		rb_ary_push(result, (*func)(obj, j+beg));
+	    }
+	    continue;
+	}
+	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+    }
+    return result;
 }
 
+/*
+ *  call-seq:
+ *     ary.values_at(selector,... )  -> new_ary
+ *
+ *  Returns an array containing the elements in
+ *  +self+ corresponding to the given selector(s). The selectors
+ *  may be either integer indices or ranges.
+ *  See also <code>Array#select</code>.
+ *
+ *     a = %w{ a b c d e f }
+ *     a.values_at(1, 3, 5)
+ *     a.values_at(1, 3, 5, 7)
+ *     a.values_at(-1, -3, -5, -7)
+ *     a.values_at(1..3, 2...5)
+ */
+
 static VALUE
-sort_internal(ary)
-    VALUE ary;
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
-	  rb_iterator_p()?sort_1:sort_2);
-    return ary;
+    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
 }
 
+
+/*
+ *  call-seq:
+ *     ary.select {|item| block } -> new_ary
+ *     ary.select                 -> an_enumerator
+ *
+ *  Invokes the block passing in successive elements from +self+,
+ *  returning an array containing those elements for which the block
+ *  returns a true value (equivalent to <code>Enumerable#select</code>).
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = %w{ a b c d e f }
+ *     a.select {|v| v =~ /[aeiou]/}   #=> ["a", "e"]
+ */
+
 static VALUE
-sort_unlock(ary)
-    VALUE ary;
+rb_ary_select(VALUE ary)
 {
-    FL_UNSET(ary, ARY_TMPLOCK);
-    return ary;
+    VALUE result;
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    result = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (RTEST(rb_yield(RARRAY_PTR(ary)[i]))) {
+	    rb_ary_push(result, rb_ary_elt(ary, i));
+	}
+    }
+    return result;
 }
 
-VALUE
-rb_ary_sort_bang(ary)
-    VALUE ary;
+/*
+ *  call-seq:
+ *     ary.select! {|item| block } -> ary or nil
+ *     ary.select!                 -> an_enumerator
+ *
+ *  Invokes the block passing in successive elements from
+ *  +self+, deleting elements for which the block returns a
+ *  false value. It returns +self+ if changes were made,
+ *  otherwise it returns <code>nil</code>.
+ *  See also <code>Array#keep_if</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
 {
-    if (RARRAY(ary)->len <= 1) return ary;
+    long i1, i2;
 
+    RETURN_ENUMERATOR(ary, 0, 0);
     rb_ary_modify(ary);
-    FL_SET(ary, ARY_TMPLOCK);	/* prohibit modification during sort */
-    rb_ensure(sort_internal, ary, sort_unlock, ary);
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE v = RARRAY_PTR(ary)[i1];
+	if (!RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	i2++;
+    }
+
+    if (RARRAY_LEN(ary) == i2) return Qnil;
+    if (i2 < RARRAY_LEN(ary))
+	ARY_SET_LEN(ary, i2);
     return ary;
 }
 
-VALUE
-rb_ary_sort(ary)
-    VALUE ary;
+/*
+ *  call-seq:
+ *     ary.keep_if {|item| block } -> ary
+ *     ary.keep_if                 -> an_enumerator
+ *
+ *  Deletes every element of +self+ for which <i>block</i> evaluates
+ *  to false.
+ *  See also <code>Array#select!</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = %w{ a b c d e f }
+ *     a.keep_if {|v| v =~ /[aeiou]/}   #=> ["a", "e"]
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return ary;
-    return rb_ary_sort_bang(rb_ary_dup(ary));
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rb_ary_select_bang(ary);
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.delete(obj)            -> obj or nil
+ *     ary.delete(obj) { block }  -> obj or nil
+ *
+ *  Deletes items from +self+ that are equal to <i>obj</i>.
+ *  If any items are found, returns <i>obj</i>.   If
+ *  the item is not found, returns <code>nil</code>. If the optional
+ *  code block is given, returns the result of <i>block</i> if the item
+ *  is not found.  (To remove <code>nil</code> elements and
+ *  get an informative return value, use #compact!)
+ *
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.delete("b")                   #=> "b"
+ *     a                               #=> ["a", "c"]
+ *     a.delete("z")                   #=> nil
+ *     a.delete("z") { "not found" }   #=> "not found"
+ */
+
 VALUE
-rb_ary_delete(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_delete(VALUE ary, VALUE item)
 {
+    VALUE v = item;
     long i1, i2;
 
-    rb_ary_modify(ary);
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	if (rb_equal(RARRAY(ary)->ptr[i1], item)) continue;
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE e = RARRAY_PTR(ary)[i1];
+
+	if (rb_equal(e, item)) {
+	    v = e;
+	    continue;
+	}
 	if (i1 != i2) {
-	    RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
+	    rb_ary_store(ary, i2, e);
 	}
 	i2++;
     }
-    if (RARRAY(ary)->len == i2) {
-	if (rb_iterator_p()) {
+    if (RARRAY_LEN(ary) == i2) {
+	if (rb_block_given_p()) {
 	    return rb_yield(item);
 	}
 	return Qnil;
     }
-    else {
-	RARRAY(ary)->len = i2;
+
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > i2) {
+	ARY_SET_LEN(ary, i2);
+	if (i2 * 2 < ARY_CAPA(ary) &&
+	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+	    ary_resize_capa(ary, i2*2);
+	}
     }
 
-    return item;
+    return v;
 }
 
 VALUE
-rb_ary_delete_at(ary, at)
-    VALUE ary;
-    VALUE at;
+rb_ary_delete_at(VALUE ary, long pos)
 {
-    long i1, i2, pos;
-    VALUE del = Qnil;
+    long len = RARRAY_LEN(ary);
+    VALUE del;
 
-    rb_ary_modify(ary);
-    pos = NUM2LONG(at);
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	if (i1 == pos) {
-	    del = RARRAY(ary)->ptr[i1];
-	    continue;
-	}
-	if (i1 != i2) {
-	    RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
-	}
-	i2++;
+    if (pos >= len) return Qnil;
+    if (pos < 0) {
+	pos += len;
+	if (pos < 0) return Qnil;
     }
-    RARRAY(ary)->len = i2;
+
+    rb_ary_modify(ary);
+    del = RARRAY_PTR(ary)[pos];
+    MEMMOVE(RARRAY_PTR(ary)+pos, RARRAY_PTR(ary)+pos+1, VALUE,
+	    RARRAY_LEN(ary)-pos-1);
+    ARY_INCREASE_LEN(ary, -1);
 
     return del;
 }
 
+/*
+ *  call-seq:
+ *     ary.delete_at(index)  -> obj or nil
+ *
+ *  Deletes the element at the specified index, returning that element,
+ *  or <code>nil</code> if the index is out of range. See also
+ *  <code>Array#slice!</code>.
+ *
+ *     a = %w( ant bat cat dog )
+ *     a.delete_at(2)    #=> "cat"
+ *     a                 #=> ["ant", "bat", "dog"]
+ *     a.delete_at(99)   #=> nil
+ */
+
 static VALUE
-rb_ary_delete_if(ary)
-    VALUE ary;
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
 {
-    long i1, i2;
+    return rb_ary_delete_at(ary, NUM2LONG(pos));
+}
 
-    rb_ary_modify(ary);
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	if (RTEST(rb_yield(RARRAY(ary)->ptr[i1]))) continue;
-	if (i1 != i2) {
-	    RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
+/*
+ *  call-seq:
+ *     ary.slice!(index)         -> obj or nil
+ *     ary.slice!(start, length) -> new_ary or nil
+ *     ary.slice!(range)         -> new_ary or nil
+ *
+ *  Deletes the element(s) given by an index (optionally with a length)
+ *  or by a range. Returns the deleted object (or objects), or
+ *  <code>nil</code> if the index is out of range.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.slice!(1)     #=> "b"
+ *     a               #=> ["a", "c"]
+ *     a.slice!(-1)    #=> "c"
+ *     a               #=> ["a"]
+ *     a.slice!(100)   #=> nil
+ *     a               #=> ["a"]
+ */
+
+static VALUE
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE arg1, arg2;
+    long pos, len, orig_len;
+
+    rb_ary_modify_check(ary);
+    if (argc == 2) {
+	pos = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+      delete_pos_len:
+	if (len < 0) return Qnil;
+	orig_len = RARRAY_LEN(ary);
+	if (pos < 0) {
+	    pos += orig_len;
+	    if (pos < 0) return Qnil;
 	}
-	i2++;
+	else if (orig_len < pos) return Qnil;
+	if (orig_len < pos + len) {
+	    len = orig_len - pos;
+	}
+	if (len == 0) return rb_ary_new2(0);
+	arg2 = rb_ary_new4(len, RARRAY_PTR(ary)+pos);
+	RBASIC(arg2)->klass = rb_obj_class(ary);
+	rb_ary_splice(ary, pos, len, Qundef);
+	return arg2;
     }
-    RARRAY(ary)->len = i2;
 
-    return ary;
+    if (argc != 1) {
+	/* error report */
+	rb_scan_args(argc, argv, "11", NULL, NULL);
+    }
+    arg1 = argv[0];
+
+    if (!FIXNUM_P(arg1)) {
+	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+	  case Qtrue:
+	    /* valid range */
+	    goto delete_pos_len;
+	  case Qnil:
+	    /* invalid range */
+	    return Qnil;
+	  default:
+	    /* not a range */
+	    break;
+	}
+    }
+
+    return rb_ary_delete_at(ary, NUM2LONG(arg1));
 }
 
 static VALUE
-rb_ary_filter(ary)
-    VALUE ary;
+ary_reject(VALUE orig, VALUE result)
 {
     long i;
 
-    rb_ary_modify(ary);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	RARRAY(ary)->ptr[i] = rb_yield(RARRAY(ary)->ptr[i]);
+    for (i = 0; i < RARRAY_LEN(orig); i++) {
+	VALUE v = RARRAY_PTR(orig)[i];
+	if (!RTEST(rb_yield(v))) {
+	    rb_ary_push_1(result, v);
+	}
     }
-    return ary;
+    return result;
 }
 
 static VALUE
-rb_ary_replace_method(ary, ary2)
-    VALUE ary, ary2;
+ary_reject_bang(VALUE ary)
 {
-    ary2 = to_ary(ary2);
-    rb_ary_replace(ary, 0, RARRAY(ary)->len, ary2);
+    long i;
+    VALUE result = Qnil;
+
+    rb_ary_modify_check(ary);
+    for (i = 0; i < RARRAY_LEN(ary); ) {
+	VALUE v = RARRAY_PTR(ary)[i];
+	if (RTEST(rb_yield(v))) {
+	    rb_ary_delete_at(ary, i);
+	    result = ary;
+	}
+	else {
+	    i++;
+	}
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.reject! {|item| block }  -> ary or nil
+ *     ary.reject!                  -> an_enumerator
+ *
+ *  Equivalent to <code>Array#delete_if</code>, deleting elements from
+ *  +self+ for which the block evaluates to true, but returns
+ *  <code>nil</code> if no changes were made.
+ *  The array is changed instantly every time the block is called and
+ *  not after the iteration is over.
+ *  See also <code>Enumerable#reject</code> and <code>Array#delete_if</code>.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_reject_bang(VALUE ary)
+{
+    RETURN_ENUMERATOR(ary, 0, 0);
+    return ary_reject_bang(ary);
+}
+
+/*
+ *  call-seq:
+ *     ary.reject {|item| block }  -> new_ary
+ *     ary.reject                  -> an_enumerator
+ *
+ *  Returns a new array containing the items in +self+
+ *  for which the block is not true.
+ *  See also <code>Array#delete_if</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_reject(VALUE ary)
+{
+    VALUE rejected_ary;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    rejected_ary = rb_ary_new();
+    ary_reject(ary, rejected_ary);
+    return rejected_ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.delete_if {|item| block }  -> ary
+ *     ary.delete_if                  -> an_enumerator
+ *
+ *  Deletes every element of +self+ for which <i>block</i> evaluates
+ *  to true.
+ *  The array is changed instantly every time the block is called and
+ *  not after the iteration is over.
+ *  See also <code>Array#reject!</code>
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.delete_if {|x| x >= "b" }   #=> ["a"]
+ */
+
+static VALUE
+rb_ary_delete_if(VALUE ary)
+{
+    RETURN_ENUMERATOR(ary, 0, 0);
+    ary_reject_bang(ary);
     return ary;
 }
 
 static VALUE
-rb_ary_clear(ary)
-    VALUE ary;
+take_i(VALUE val, VALUE *args, int argc, VALUE *argv)
+{
+    if (args[1]-- == 0) rb_iter_break();
+    if (argc > 1) val = rb_ary_new4(argc, argv);
+    rb_ary_push(args[0], val);
+    return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
 {
-    RARRAY(ary)->len = 0;
-    if (ARY_DEFAULT_SIZE*3 < RARRAY(ary)->capa) {
-	RARRAY(ary)->capa = ARY_DEFAULT_SIZE * 2;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+    VALUE result = rb_check_array_type(obj);
+    VALUE args[2];
+
+    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+    result = rb_ary_new2(n);
+    args[0] = result; args[1] = (VALUE)n;
+    rb_block_call(obj, rb_intern("each"), 0, 0, take_i, (VALUE)args);
+    return result;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.zip(arg, ...)                   -> new_ary
+ *     ary.zip(arg, ...) {| arr | block }  -> nil
+ *
+ *  Converts any arguments to arrays, then merges elements of
+ *  +self+ with corresponding elements from each argument. This
+ *  generates a sequence of <code>self.size</code> <em>n</em>-element
+ *  arrays, where <em>n</em> is one more that the count of arguments. If
+ *  the size of any argument is less than <code>enumObj.size</code>,
+ *  <code>nil</code> values are supplied. If a block is given, it is
+ *  invoked for each output array, otherwise an array of arrays is
+ *  returned.
+ *
+ *     a = [ 4, 5, 6 ]
+ *     b = [ 7, 8, 9 ]
+ *     [1,2,3].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ *     [1,2].zip(a,b)         #=> [[1, 4, 7], [2, 5, 8]]
+ *     a.zip([1,2],[8])       #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
+ */
+
+static VALUE
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
+{
+    int i, j;
+    long len;
+    VALUE result = Qnil;
+
+    len = RARRAY_LEN(ary);
+    for (i=0; i<argc; i++) {
+	argv[i] = take_items(argv[i], len);
+    }
+    if (!rb_block_given_p()) {
+	result = rb_ary_new2(len);
+    }
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	VALUE tmp = rb_ary_new2(argc+1);
+
+	rb_ary_push(tmp, rb_ary_elt(ary, i));
+	for (j=0; j<argc; j++) {
+	    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	}
+	if (NIL_P(result)) {
+	    rb_yield(tmp);
+	}
+	else {
+	    rb_ary_push(result, tmp);
+	}
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.transpose -> new_ary
+ *
+ *  Assumes that +self+ is an array of arrays and transposes the
+ *  rows and columns.
+ *
+ *     a = [[1,2], [3,4], [5,6]]
+ *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
+ */
+
+static VALUE
+rb_ary_transpose(VALUE ary)
+{
+    long elen = -1, alen, i, j;
+    VALUE tmp, result = 0;
+
+    alen = RARRAY_LEN(ary);
+    if (alen == 0) return rb_ary_dup(ary);
+    for (i=0; i<alen; i++) {
+	tmp = to_ary(rb_ary_elt(ary, i));
+	if (elen < 0) {		/* first element */
+	    elen = RARRAY_LEN(tmp);
+	    result = rb_ary_new2(elen);
+	    for (j=0; j<elen; j++) {
+		rb_ary_store(result, j, rb_ary_new2(alen));
+	    }
+	}
+	else if (elen != RARRAY_LEN(tmp)) {
+	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+		     RARRAY_LEN(tmp), elen);
+	}
+	for (j=0; j<elen; j++) {
+	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+	}
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.replace(other_ary)  -> ary
+ *
+ *  Replaces the contents of +self+ with the contents of
+ *  <i>other_ary</i>, truncating or expanding if necessary.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
+ *     a                              #=> ["x", "y", "z"]
+ */
+
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
+{
+    rb_ary_modify_check(copy);
+    orig = to_ary(orig);
+    if (copy == orig) return copy;
+
+    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE *ptr;
+        VALUE shared = 0;
+
+        if (ARY_OWNS_HEAP_P(copy)) {
+            xfree(RARRAY_PTR(copy));
+        }
+        else if (ARY_SHARED_P(copy)) {
+            shared = ARY_SHARED(copy);
+            FL_UNSET_SHARED(copy);
+        }
+        FL_SET_EMBED(copy);
+        ptr = RARRAY_PTR(orig);
+        MEMCPY(RARRAY_PTR(copy), ptr, VALUE, RARRAY_LEN(orig));
+        if (shared) {
+            rb_ary_decrement_share(shared);
+        }
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+    }
+    else {
+        VALUE shared = ary_make_shared(orig);
+        if (ARY_OWNS_HEAP_P(copy)) {
+            xfree(RARRAY_PTR(copy));
+        }
+        else {
+            rb_ary_unshare_safe(copy);
+        }
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, RARRAY_PTR(orig));
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+        rb_ary_set_shared(copy, shared);
+    }
+    return copy;
+}
+
+/*
+ *  call-seq:
+ *     ary.clear    -> ary
+ *
+ *  Removes all elements from +self+.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.clear    #=> [ ]
+ */
+
+VALUE
+rb_ary_clear(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary)) {
+	if (!ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
+    }
+    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
     }
     return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.fill(obj)                                -> ary
+ *     ary.fill(obj, start [, length])              -> ary
+ *     ary.fill(obj, range )                        -> ary
+ *     ary.fill {|index| block }                    -> ary
+ *     ary.fill(start [, length] ) {|index| block } -> ary
+ *     ary.fill(range) {|index| block }             -> ary
+ *
+ *  The first three forms set the selected elements of +self+ (which
+ *  may be the entire array) to <i>obj</i>. A <i>start</i> of
+ *  <code>nil</code> is equivalent to zero. A <i>length</i> of
+ *  <code>nil</code> is equivalent to <i>self.length</i>. The last three
+ *  forms fill the array with the value of the block. The block is
+ *  passed the absolute index of each element to be filled.
+ *  Negative values of <i>start</i> count from the end of the array.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.fill("x")              #=> ["x", "x", "x", "x"]
+ *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
+ *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
+ *     a.fill {|i| i*i}         #=> [0, 1, 4, 9]
+ *     a.fill(-2) {|i| i*i*i}   #=> [0, 1, 8, 27]
+ */
+
 static VALUE
-rb_ary_fill(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
     VALUE item, arg1, arg2;
-    long beg, end, len;
+    long beg = 0, end = 0, len = 0;
     VALUE *p, *pend;
+    int block_p = FALSE;
 
-    rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+    if (rb_block_given_p()) {
+	block_p = TRUE;
+	rb_scan_args(argc, argv, "02", &arg1, &arg2);
+	argc += 1;		/* hackish */
+    }
+    else {
+	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+    }
     switch (argc) {
       case 1:
 	beg = 0;
-	len = RARRAY(ary)->len - beg;
+	len = RARRAY_LEN(ary);
 	break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
+	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
 	    break;
 	}
 	/* fall through */
       case 3:
-	beg = NIL_P(arg1)?0:NUM2LONG(arg1);
+	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
 	if (beg < 0) {
-	    beg = RARRAY(ary)->len + beg;
+	    beg = RARRAY_LEN(ary) + beg;
 	    if (beg < 0) beg = 0;
 	}
-	len = NIL_P(arg2)?RARRAY(ary)->len - beg:NUM2LONG(arg2);
+	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
 	break;
     }
     rb_ary_modify(ary);
+    if (len < 0) {
+        return ary;
+    }
+    if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+	rb_raise(rb_eArgError, "argument too big");
+    }
     end = beg + len;
-    if (end > RARRAY(ary)->len) {
-	if (end >= RARRAY(ary)->capa) {
-	    RARRAY(ary)->capa=end;
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
-	}
-	if (beg > RARRAY(ary)->len) {
-	    rb_mem_clear(RARRAY(ary)->ptr+RARRAY(ary)->len,end-RARRAY(ary)->len);
+    if (RARRAY_LEN(ary) < end) {
+	if (end >= ARY_CAPA(ary)) {
+	    ary_resize_capa(ary, end);
 	}
-	RARRAY(ary)->len = end;
+	rb_mem_clear(RARRAY_PTR(ary) + RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+	ARY_SET_LEN(ary, end);
     }
-    p = RARRAY(ary)->ptr + beg; pend = p + len;
 
-    while (p < pend) {
-	*p++ = item;
+    if (block_p) {
+	VALUE v;
+	long i;
+
+	for (i=beg; i<end; i++) {
+	    v = rb_yield(LONG2NUM(i));
+	    if (i>=RARRAY_LEN(ary)) break;
+	    RARRAY_PTR(ary)[i] = v;
+	}
+    }
+    else {
+	p = RARRAY_PTR(ary) + beg;
+	pend = p + len;
+	while (p < pend) {
+	    *p++ = item;
+	}
     }
     return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary + other_ary   -> new_ary
+ *
+ *  Concatenation---Returns a new array built by concatenating the
+ *  two arrays together to produce a third array.
+ *
+ *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
+ */
+
 VALUE
-rb_ary_plus(x, y)
-    VALUE x, y;
+rb_ary_plus(VALUE x, VALUE y)
 {
     VALUE z;
+    long len;
 
-    if (TYPE(y) != T_ARRAY) {
-	return rb_ary_plus(x, rb_Array(y));
-    }
-
-    z = rb_ary_new2(RARRAY(x)->len + RARRAY(y)->len);
-    MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
-    MEMCPY(RARRAY(z)->ptr+RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
-    RARRAY(z)->len = RARRAY(x)->len + RARRAY(y)->len;
+    y = to_ary(y);
+    len = RARRAY_LEN(x) + RARRAY_LEN(y);
+    z = rb_ary_new2(len);
+    MEMCPY(RARRAY_PTR(z), RARRAY_PTR(x), VALUE, RARRAY_LEN(x));
+    MEMCPY(RARRAY_PTR(z) + RARRAY_LEN(x), RARRAY_PTR(y), VALUE, RARRAY_LEN(y));
+    ARY_SET_LEN(z, len);
     return z;
 }
 
-VALUE
-rb_ary_concat(x, y)
-    VALUE x, y;
-{
-    VALUE *p, *pend;
+/*
+ *  call-seq:
+ *     ary.concat(other_ary)   -> ary
+ *
+ *  Appends the elements of <i>other_ary</i> to +self+.
+ *
+ *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ */
 
-    if (TYPE(y) != T_ARRAY) {
-	return rb_ary_concat(x, rb_Array(y));
-    }
 
-    p = RARRAY(y)->ptr;
-    pend = p + RARRAY(y)->len;
-    while (p < pend) {
-	rb_ary_store(x, RARRAY(x)->len, *p);
-	p++;
+VALUE
+rb_ary_concat(VALUE x, VALUE y)
+{
+    rb_ary_modify_check(x);
+    y = to_ary(y);
+    if (RARRAY_LEN(y) > 0) {
+	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
     }
     return x;
 }
 
+
+/*
+ *  call-seq:
+ *     ary * int     -> new_ary
+ *     ary * str     -> new_string
+ *
+ *  Repetition---With a String argument, equivalent to
+ *  self.join(str). Otherwise, returns a new array
+ *  built by concatenating the _int_ copies of +self+.
+ *
+ *
+ *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
+ *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
+ *
+ */
+
 static VALUE
-rb_ary_times(ary, times)
-    VALUE ary;
-    VALUE times;
+rb_ary_times(VALUE ary, VALUE times)
 {
-    VALUE ary2;
-    long i, len;
+    VALUE ary2, tmp, *ptr, *ptr2;
+    long t, len;
 
-    if (TYPE(times) == T_STRING) {
-	return rb_ary_join(ary, times);
+    tmp = rb_check_string_type(times);
+    if (!NIL_P(tmp)) {
+	return rb_ary_join(ary, tmp);
     }
 
     len = NUM2LONG(times);
+    if (len == 0) {
+	ary2 = ary_new(rb_obj_class(ary), 0);
+	goto out;
+    }
     if (len < 0) {
 	rb_raise(rb_eArgError, "negative argument");
     }
-    len *= RARRAY(ary)->len;
-
-    ary2 = rb_ary_new2(len);
-    RARRAY(ary2)->len = len;
-
-    for (i=0; i<len; i+=RARRAY(ary)->len) {
-	MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+	rb_raise(rb_eArgError, "argument too big");
+    }
+    len *= RARRAY_LEN(ary);
+
+    ary2 = ary_new(rb_obj_class(ary), len);
+    ARY_SET_LEN(ary2, len);
+
+    ptr = RARRAY_PTR(ary);
+    ptr2 = RARRAY_PTR(ary2);
+    t = RARRAY_LEN(ary);
+    if (0 < t) {
+        MEMCPY(ptr2, ptr, VALUE, t);
+        while (t <= len/2) {
+            MEMCPY(ptr2+t, ptr2, VALUE, t);
+            t *= 2;
+        }
+        if (t < len) {
+            MEMCPY(ptr2+t, ptr2, VALUE, len-t);
+        }
     }
+  out:
+    OBJ_INFECT(ary2, ary);
 
     return ary2;
 }
 
+/*
+ *  call-seq:
+ *     ary.assoc(obj)   -> new_ary  or  nil
+ *
+ *  Searches through an array whose elements are also arrays
+ *  comparing _obj_ with the first element of each contained array
+ *  using obj.==.
+ *  Returns the first contained array that matches (that
+ *  is, the first associated array),
+ *  or +nil+ if no match is found.
+ *  See also <code>Array#rassoc</code>.
+ *
+ *     s1 = [ "colors", "red", "blue", "green" ]
+ *     s2 = [ "letters", "a", "b", "c" ]
+ *     s3 = "foo"
+ *     a  = [ s1, s2, s3 ]
+ *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
+ *     a.assoc("foo")      #=> nil
+ */
+
 VALUE
-rb_ary_assoc(ary, key)
-    VALUE ary;
-    VALUE key;
+rb_ary_assoc(VALUE ary, VALUE key)
 {
-    VALUE *p, *pend;
+    long i;
+    VALUE v;
 
-    p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
-    while (p < pend) {
-	if (TYPE(*p) == T_ARRAY
-	    && RARRAY(*p)->len > 1
-	    && rb_equal(RARRAY(*p)->ptr[0], key))
-	    return *p;
-	p++;
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = rb_check_array_type(RARRAY_PTR(ary)[i]);
+	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+	    rb_equal(RARRAY_PTR(v)[0], key))
+	    return v;
     }
     return Qnil;
 }
 
+/*
+ *  call-seq:
+ *     ary.rassoc(obj) -> new_ary or nil
+ *
+ *  Searches through the array whose elements are also arrays. Compares
+ *  _obj_ with the second element of each contained array using
+ *  <code>==</code>. Returns the first contained array that matches. See
+ *  also <code>Array#assoc</code>.
+ *
+ *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
+ *     a.rassoc("two")    #=> [2, "two"]
+ *     a.rassoc("four")   #=> nil
+ */
+
 VALUE
-rb_ary_rassoc(ary, value)
-    VALUE ary;
-    VALUE value;
+rb_ary_rassoc(VALUE ary, VALUE value)
 {
-    VALUE *p, *pend;
+    long i;
+    VALUE v;
 
-    p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
-    while (p < pend) {
-	if (TYPE(*p) == T_ARRAY
-	    && RARRAY(*p)->len > 1
-	    && rb_equal(RARRAY(*p)->ptr[1], value))
-	    return *p;
-	p++;
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = RARRAY_PTR(ary)[i];
+	if (TYPE(v) == T_ARRAY &&
+	    RARRAY_LEN(v) > 1 &&
+	    rb_equal(RARRAY_PTR(v)[1], value))
+	    return v;
     }
     return Qnil;
 }
 
 static VALUE
-rb_ary_equal(ary1, ary2)
-    VALUE ary1, ary2;
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
 {
     long i;
 
-    if (TYPE(ary2) != T_ARRAY) return Qfalse;
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (!rb_equal(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
 	    return Qfalse;
     }
     return Qtrue;
 }
 
+/*
+ *  call-seq:
+ *     ary == other_ary   ->   bool
+ *
+ *  Equality---Two arrays are equal if they contain the same number
+ *  of elements and if each element is equal to (according to
+ *  Object.==) the corresponding element in the other array.
+ *
+ *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
+ *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
+ *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
+ *
+ */
+
+static VALUE
+rb_ary_equal(VALUE ary1, VALUE ary2)
+{
+    if (ary1 == ary2) return Qtrue;
+    if (TYPE(ary2) != T_ARRAY) {
+	if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
+	    return Qfalse;
+	}
+	return rb_equal(ary2, ary1);
+    }
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+}
+
 static VALUE
-rb_ary_eql(ary1, ary2)
-    VALUE ary1, ary2;
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
 {
     long i;
 
-    if (TYPE(ary2) != T_ARRAY) return Qfalse;
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len)
-	return Qfalse;
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (!rb_eql(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
 	    return Qfalse;
     }
     return Qtrue;
 }
 
+/*
+ *  call-seq:
+ *     ary.eql?(other)  -> true or false
+ *
+ *  Returns <code>true</code> if +self+ and _other_ are the same object,
+ *  or are both arrays with the same content.
+ */
+
 static VALUE
-rb_ary_hash(ary)
-    VALUE ary;
+rb_ary_eql(VALUE ary1, VALUE ary2)
+{
+    if (ary1 == ary2) return Qtrue;
+    if (TYPE(ary2) != T_ARRAY) return Qfalse;
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
+}
+
+static VALUE
+recursive_hash(VALUE ary, VALUE dummy, int recur)
 {
     long i;
-    int h;
+    st_index_t h;
+    VALUE n;
 
-    h = RARRAY(ary)->len;
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	int n = rb_hash(RARRAY(ary)->ptr[i]);
-	h ^= NUM2LONG(n);
+    h = rb_hash_start(RARRAY_LEN(ary));
+    if (recur) {
+	h = rb_hash_uint(h, NUM2LONG(rb_hash(rb_cArray)));
     }
-    return INT2FIX(h);
+    else {
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    n = rb_hash(RARRAY_PTR(ary)[i]);
+	    h = rb_hash_uint(h, NUM2LONG(n));
+	}
+    }
+    h = rb_hash_end(h);
+    return LONG2FIX(h);
+}
+
+/*
+ *  call-seq:
+ *     ary.hash   -> fixnum
+ *
+ *  Compute a hash-code for this array. Two arrays with the same content
+ *  will have the same hash code (and will compare using <code>eql?</code>).
+ */
+
+static VALUE
+rb_ary_hash(VALUE ary)
+{
+    return rb_exec_recursive_outer(recursive_hash, ary, 0);
 }
 
+/*
+ *  call-seq:
+ *     ary.include?(obj)   -> true or false
+ *
+ *  Returns <code>true</code> if the given object is present in
+ *  +self+ (that is, if any object <code>==</code> <i>anObject</i>),
+ *  <code>false</code> otherwise.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.include?("b")   #=> true
+ *     a.include?("z")   #=> false
+ */
+
 VALUE
-rb_ary_includes(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_includes(VALUE ary, VALUE item)
 {
     long i;
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	if (rb_equal(RARRAY(ary)->ptr[i], item)) {
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	if (rb_equal(RARRAY_PTR(ary)[i], item)) {
 	    return Qtrue;
 	}
     }
     return Qfalse;
 }
 
+
 static VALUE
-rb_ary_cmp(ary, ary2)
-    VALUE ary;
-    VALUE ary2;
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
 {
     long i, len;
 
-    ary2 = to_ary(ary2);
-    len = RARRAY(ary)->len;
-    if (len > RARRAY(ary2)->len) {
-	len = RARRAY(ary2)->len;
+    if (recur) return Qundef;	/* Subtle! */
+    len = RARRAY_LEN(ary1);
+    if (len > RARRAY_LEN(ary2)) {
+	len = RARRAY_LEN(ary2);
     }
     for (i=0; i<len; i++) {
-	VALUE v = rb_funcall(RARRAY(ary)->ptr[i],cmp,1,RARRAY(ary2)->ptr[i]);
+	VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
 	if (v != INT2FIX(0)) {
 	    return v;
 	}
     }
-    len = RARRAY(ary)->len - RARRAY(ary2)->len;
+    return Qundef;
+}
+
+/*
+ *  call-seq:
+ *     ary <=> other_ary   ->  -1, 0, +1 or nil
+ *
+ *  Comparison---Returns an integer (-1, 0,
+ *  or +1) if this array is less than, equal to, or greater than
+ *  <i>other_ary</i>.  Each object in each array is compared
+ *  (using <=>). If any value isn't
+ *  equal, then that inequality is the return value. If all the
+ *  values found are equal, then the return is based on a
+ *  comparison of the array lengths.  Thus, two arrays are
+ *  ``equal'' according to <code>Array#<=></code> if and only if they have
+ *  the same length and the value of each element is equal to the
+ *  value of the corresponding element in the other array.
+ *
+ *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
+ *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
+ *
+ */
+
+VALUE
+rb_ary_cmp(VALUE ary1, VALUE ary2)
+{
+    long len;
+    VALUE v;
+
+    ary2 = rb_check_array_type(ary2);
+    if (NIL_P(ary2)) return Qnil;
+    if (ary1 == ary2) return INT2FIX(0);
+    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+    if (v != Qundef) return v;
+    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
     return INT2FIX(-1);
 }
 
 static VALUE
-rb_ary_diff(ary1, ary2)
-    VALUE ary1, ary2;
+ary_add_hash(VALUE hash, VALUE ary)
+{
+    long i;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_hash_aset(hash, RARRAY_PTR(ary)[i], Qtrue);
+    }
+    return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(void)
+{
+    VALUE hash = rb_hash_new();
+
+    RBASIC(hash)->klass = 0;
+    return hash;
+}
+
+static VALUE
+ary_make_hash(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
+	    rb_hash_aset(hash, k, v);
+	}
+    }
+    return hash;
+}
+
+static VALUE
+ary_make_hash_by(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash_by(hash, ary);
+}
+
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+    if (RHASH(hash)->ntbl) {
+	st_table *tbl = RHASH(hash)->ntbl;
+	RHASH(hash)->ntbl = 0;
+	st_free_table(tbl);
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary - other_ary    -> new_ary
+ *
+ *  Array Difference---Returns a new array that is a copy of
+ *  the original array, removing any items that also appear in
+ *  <i>other_ary</i>. (If you need set-like behavior, see the
+ *  library class Set.)
+ *
+ *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
+ */
+
+static VALUE
+rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
+    volatile VALUE hash;
     long i;
 
-    ary2 = to_ary(ary2);
+    hash = ary_make_hash(to_ary(ary2));
     ary3 = rb_ary_new();
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (rb_ary_includes(ary2, RARRAY(ary1)->ptr[i])) continue;
-	if (rb_ary_includes(ary3, RARRAY(ary1)->ptr[i])) continue;
-	rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
+
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (st_lookup(RHASH_TBL(hash), RARRAY_PTR(ary1)[i], 0)) continue;
+	rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
+    ary_recycle_hash(hash);
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *     ary & other_ary      -> new_ary
+ *
+ *  Set Intersection---Returns a new array
+ *  containing elements common to the two arrays, with no duplicates.
+ *
+ *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]   #=> [ 1, 3 ]
+ */
+
+
 static VALUE
-rb_ary_and(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_and(VALUE ary1, VALUE ary2)
 {
-    VALUE ary3;
+    VALUE hash, ary3, v;
+    st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new();
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (rb_ary_includes(ary2, RARRAY(ary1)->ptr[i])
-	    && !rb_ary_includes(ary3, RARRAY(ary1)->ptr[i])) {
-	    rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
+    ary3 = rb_ary_new2(RARRAY_LEN(ary1) < RARRAY_LEN(ary2) ?
+	    RARRAY_LEN(ary1) : RARRAY_LEN(ary2));
+    hash = ary_make_hash(ary2);
+
+    if (RHASH_EMPTY_P(hash))
+        return ary3;
+
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	vv = (st_data_t)(v = rb_ary_elt(ary1, i));
+	if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+	    rb_ary_push(ary3, v);
 	}
     }
+    ary_recycle_hash(hash);
+
     return ary3;
 }
 
+/*
+ *  call-seq:
+ *     ary | other_ary     -> new_ary
+ *
+ *  Set Union---Returns a new array by joining this array with
+ *  <i>other_ary</i>, removing duplicates.
+ *
+ *     [ "a", "b", "c" ] | [ "c", "d", "a" ]
+ *            #=> [ "a", "b", "c", "d" ]
+ */
+
 static VALUE
-rb_ary_or(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_or(VALUE ary1, VALUE ary2)
 {
-    VALUE ary3;
+    VALUE hash, ary3, v;
+    st_data_t vv;
     long i;
 
-    if (TYPE(ary2) != T_ARRAY) {
-	if (rb_ary_includes(ary1, ary2)) return ary1;
-	else return rb_ary_plus(ary1, ary2);
-    }
+    ary2 = to_ary(ary2);
+    ary3 = rb_ary_new2(RARRAY_LEN(ary1)+RARRAY_LEN(ary2));
+    hash = ary_add_hash(ary_make_hash(ary1), ary2);
 
-    ary3 = rb_ary_new();
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (!rb_ary_includes(ary3, RARRAY(ary1)->ptr[i]))
-		rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	vv = (st_data_t)(v = rb_ary_elt(ary1, i));
+	if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+	    rb_ary_push(ary3, v);
+	}
     }
-    for (i=0; i<RARRAY(ary2)->len; i++) {
-	if (!rb_ary_includes(ary3, RARRAY(ary2)->ptr[i]))
-		rb_ary_push(ary3, RARRAY(ary2)->ptr[i]);
+    for (i=0; i<RARRAY_LEN(ary2); i++) {
+	vv = (st_data_t)(v = rb_ary_elt(ary2, i));
+	if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+	    rb_ary_push(ary3, v);
+	}
     }
+    ary_recycle_hash(hash);
     return ary3;
 }
 
-static VALUE
-rb_ary_uniq_bang(ary)
-    VALUE ary;
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
 {
-    VALUE *p, *q, *t, *end;
-    VALUE v;
+    rb_ary_push((VALUE)ary, (VALUE)val);
+    return ST_CONTINUE;
+}
 
-    rb_ary_modify(ary);
-    p = RARRAY(ary)->ptr;
-    end = p + RARRAY(ary)->len;
+/*
+ *  call-seq:
+ *     ary.uniq!                -> ary or nil
+ *     ary.uniq! { |item| ... } -> ary or nil
+ *
+ *  Removes duplicate elements from +self+. If a block is given,
+ *  it will use the return value of the block for comparison.
+ *  Returns <code>nil</code> if no changes are made (that is, no
+ *  duplicates are found).
+ *
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq!   # => ["a", "b", "c"]
+ *
+ *     b = [ "a", "b", "c" ]
+ *     b.uniq!   # => nil
+ *
+ *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
+ */
 
-    while (p < end) {
-	v = *p++;
-	q = t = p;
-	while (q < end) {
-	    if (rb_equal(*q, v)) q++;
-	    else *t++ = *q++;
+static VALUE
+rb_ary_uniq_bang(VALUE ary)
+{
+    VALUE hash, v;
+    long i, j;
+
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) <= 1)
+        return Qnil;
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	if (RARRAY_LEN(ary) == (i = RHASH_SIZE(hash))) {
+	    return Qnil;
 	}
-	end = t;
+	ARY_SET_LEN(ary, 0);
+	if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
+	ary_resize_capa(ary, i);
+	st_foreach(RHASH_TBL(hash), push_value, ary);
     }
-    if (RARRAY(ary)->len == (end - RARRAY(ary)->ptr)) {
-	return Qnil;
+    else {
+	hash = ary_make_hash(ary);
+	if (RARRAY_LEN(ary) == (long)RHASH_SIZE(hash)) {
+	    return Qnil;
+	}
+	for (i=j=0; i<RARRAY_LEN(ary); i++) {
+	    st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
+	    if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+		rb_ary_store(ary, j++, v);
+	    }
+	}
+	ARY_SET_LEN(ary, j);
     }
-
-    RARRAY(ary)->len = (end - RARRAY(ary)->ptr);
+    ary_recycle_hash(hash);
 
     return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.uniq                -> new_ary
+ *     ary.uniq { |item| ... } -> new_ary
+ *
+ *  Returns a new array by removing duplicate values in +self+. If a block
+ *  is given, it will use the return value of the block for comparison.
+ *
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq   # => ["a", "b", "c"]
+ *
+ *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
+ */
+
 static VALUE
-rb_ary_uniq(ary)
-    VALUE ary;
+rb_ary_uniq(VALUE ary)
 {
-    VALUE v = rb_ary_uniq_bang(rb_ary_dup(ary));
+    VALUE hash, uniq, v;
+    long i;
 
-    if (NIL_P(v)) return ary;
-    return v;
+    if (RARRAY_LEN(ary) <= 1)
+        return rb_ary_dup(ary);
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
+	st_foreach(RHASH_TBL(hash), push_value, uniq);
+    }
+    else {
+	hash = ary_make_hash(ary);
+	uniq = ary_new(rb_obj_class(ary), RHASH_SIZE(hash));
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    st_data_t vv = (st_data_t)(v = rb_ary_elt(ary, i));
+	    if (st_delete(RHASH_TBL(hash), &vv, 0)) {
+		rb_ary_push(uniq, v);
+	    }
+	}
+    }
+    ary_recycle_hash(hash);
+
+    return uniq;
 }
 
+/*
+ *  call-seq:
+ *     ary.compact!    -> ary  or  nil
+ *
+ *  Removes +nil+ elements from the array.
+ *  Returns +nil+ if no changes were made, otherwise returns
+ *  <i>ary</i>.
+ *
+ *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
+ *     [ "a", "b", "c" ].compact!           #=> nil
+ */
+
 static VALUE
-rb_ary_compact_bang(ary)
-    VALUE ary;
+rb_ary_compact_bang(VALUE ary)
 {
     VALUE *p, *t, *end;
+    long n;
 
     rb_ary_modify(ary);
-    p = t = RARRAY(ary)->ptr;
-    end = p + RARRAY(ary)->len;
+    p = t = RARRAY_PTR(ary);
+    end = p + RARRAY_LEN(ary);
+
     while (t < end) {
 	if (NIL_P(*t)) t++;
 	else *p++ = *t++;
     }
-    if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
+    n = p - RARRAY_PTR(ary);
+    if (RARRAY_LEN(ary) == n) {
 	return Qnil;
     }
-    RARRAY(ary)->len = RARRAY(ary)->capa = (p - RARRAY(ary)->ptr);
-    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    ARY_SET_LEN(ary, n);
+    if (n * 2 < ARY_CAPA(ary) && ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, n * 2);
+    }
 
     return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.compact     -> new_ary
+ *
+ *  Returns a copy of +self+ with all +nil+ elements removed.
+ *
+ *     [ "a", nil, "b", nil, "c", nil ].compact
+ *                       #=> [ "a", "b", "c" ]
+ */
+
 static VALUE
-rb_ary_compact(ary)
-    VALUE ary;
+rb_ary_compact(VALUE ary)
 {
-    VALUE v = rb_ary_compact_bang(rb_ary_dup(ary));
-
-    if (NIL_P(v)) return ary;
-    return v;
+    ary = rb_ary_dup(ary);
+    rb_ary_compact_bang(ary);
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.count      -> int
+ *     ary.count(obj) -> int
+ *     ary.count { |item| block }  -> int
+ *
+ *  Returns the number of elements.  If an argument is given, counts
+ *  the number of elements which equals to <i>obj</i>.  If a block is
+ *  given, counts the number of elements yielding a true value.
+ *
+ *     ary = [1, 2, 4, 2]
+ *     ary.count             #=> 4
+ *     ary.count(2)          #=> 2
+ *     ary.count{|x|x%2==0}  #=> 3
+ *
+ */
+
 static VALUE
-rb_ary_nitems(ary)
-    VALUE ary;
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
     long n = 0;
-    VALUE *p, *pend;
 
-    p = RARRAY(ary)->ptr;
-    pend = p + RARRAY(ary)->len;
-    while (p < pend) {
-	if (!NIL_P(*p)) n++;
-	p++;
+    if (argc == 0) {
+	VALUE *p, *pend;
+
+	if (!rb_block_given_p())
+	    return LONG2NUM(RARRAY_LEN(ary));
+
+	for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
+	    if (RTEST(rb_yield(*p))) n++;
+	}
+    }
+    else {
+	VALUE obj, *p, *pend;
+
+	rb_scan_args(argc, argv, "1", &obj);
+	if (rb_block_given_p()) {
+	    rb_warn("given block not used");
+	}
+	for (p = RARRAY_PTR(ary), pend = p + RARRAY_LEN(ary); p < pend; p++) {
+	    if (rb_equal(*p, obj)) n++;
+	}
     }
-    return INT2NUM(n);
+
+    return LONG2NUM(n);
 }
 
 static VALUE
-rb_ary_flatten_bang(ary)
-    VALUE ary;
+flatten(VALUE ary, int level, int *modified)
 {
-    long i;
-    int mod = 0;
+    long i = 0;
+    VALUE stack, result, tmp, elt;
+    st_table *memo;
+    st_data_t id;
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    result = ary_new(0, RARRAY_LEN(ary));
+    memo = st_init_numtable();
+    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+    *modified = 0;
+
+    while (1) {
+	while (i < RARRAY_LEN(ary)) {
+	    elt = RARRAY_PTR(ary)[i++];
+	    tmp = rb_check_array_type(elt);
+	    if (RBASIC(result)->klass) {
+		rb_raise(rb_eRuntimeError, "flatten reentered");
+	    }
+	    if (NIL_P(tmp) || (level >= 0 && RARRAY_LEN(stack) / 2 >= level)) {
+		rb_ary_push(result, elt);
+	    }
+	    else {
+		*modified = 1;
+		id = (st_data_t)tmp;
+		if (st_lookup(memo, id, 0)) {
+		    st_free_table(memo);
+		    rb_raise(rb_eArgError, "tried to flatten recursive array");
+		}
+		st_insert(memo, id, (st_data_t)Qtrue);
+		rb_ary_push(stack, ary);
+		rb_ary_push(stack, LONG2NUM(i));
+		ary = tmp;
+		i = 0;
+	    }
+	}
+	if (RARRAY_LEN(stack) == 0) {
+	    break;
+	}
+	id = (st_data_t)ary;
+	st_delete(memo, &id, 0);
+	tmp = rb_ary_pop(stack);
+	i = NUM2LONG(tmp);
+	ary = rb_ary_pop(stack);
+    }
+
+    st_free_table(memo);
+
+    RBASIC(result)->klass = rb_class_of(ary);
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.flatten!        -> ary or nil
+ *     ary.flatten!(level) -> array or nil
+ *
+ *  Flattens +self+ in place.
+ *  Returns <code>nil</code> if no modifications were made (i.e.,
+ *  <i>ary</i> contains no subarrays.)  If the optional <i>level</i>
+ *  argument determines the level of recursion to flatten.
+ *
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!   #=> [1, 2, 3, 4, 5]
+ *     a.flatten!   #=> nil
+ *     a            #=> [1, 2, 3, 4, 5]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
+ */
+
+static VALUE
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
+{
+    int mod = 0, level = -1;
+    VALUE result, lv;
+
+    rb_scan_args(argc, argv, "01", &lv);
+    rb_ary_modify_check(ary);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return Qnil;
+
+    result = flatten(ary, level, &mod);
+    if (mod == 0) {
+	ary_discard(result);
+	return Qnil;
+    }
+    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+    rb_ary_replace(ary, result);
+    if (mod) ARY_SET_EMBED_LEN(result, 0);
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.flatten -> new_ary
+ *     ary.flatten(level) -> new_ary
+ *
+ *  Returns a new array that is a one-dimensional flattening of this
+ *  array (recursively). That is, for every element that is an array,
+ *  extract its elements into the new array.  If the optional
+ *  <i>level</i> argument determines the level of recursion to flatten.
+ *
+ *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
+ *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
+ *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
+ */
+
+static VALUE
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+    int mod = 0, level = -1;
+    VALUE result, lv;
+
+    rb_scan_args(argc, argv, "01", &lv);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return ary_make_shared_copy(ary);
+
+    result = flatten(ary, level, &mod);
+    OBJ_INFECT(result, ary);
+
+    return result;
+}
+
+#define OPTHASH_GIVEN_P(opts) \
+    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static VALUE sym_random;
+
+#define RAND_UPTO(max) (long)(rb_random_real(randgen)*(max))
+
+/*
+ *  call-seq:
+ *     ary.shuffle!              -> ary
+ *     ary.shuffle!(random: rng) -> ary
+ *
+ *  Shuffles elements in +self+ in place.
+ *  If +rng+ is given, it will be used as the random number generator.
+ */
+
+static VALUE
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE *ptr, opts, *snap_ptr, randgen = rb_cRandom;
+    long i, snap_len;
 
+    if (OPTHASH_GIVEN_P(opts)) {
+	randgen = rb_hash_lookup2(opts, sym_random, randgen);
+    }
+    if (argc > 0) {
+	rb_raise(rb_eArgError, "wrong number of arguments (%d for 0)", argc);
+    }
     rb_ary_modify(ary);
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	VALUE ary2 = RARRAY(ary)->ptr[i];
-	if (TYPE(ary2) == T_ARRAY) {
-	    rb_ary_replace(ary, i--, 1, ary2);
-	    mod = 1;
+    i = RARRAY_LEN(ary);
+    ptr = RARRAY_PTR(ary);
+    snap_len = i;
+    snap_ptr = ptr;
+    while (i) {
+	long j = RAND_UPTO(i);
+	VALUE tmp;
+	if (snap_len != RARRAY_LEN(ary) || snap_ptr != RARRAY_PTR(ary)) {
+	    rb_raise(rb_eRuntimeError, "modified during shuffle");
 	}
+	tmp = ptr[--i];
+	ptr[i] = ptr[j];
+	ptr[j] = tmp;
     }
-    if (mod == 0) return Qnil;
     return ary;
 }
 
+
+/*
+ *  call-seq:
+ *     ary.shuffle              -> new_ary
+ *     ary.shuffle(random: rng) -> new_ary
+ *
+ *  Returns a new array with elements of this array shuffled.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle                 #=> [2, 3, 1]
+ *
+ *  If +rng+ is given, it will be used as the random number generator.
+ *
+ *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
 static VALUE
-rb_ary_flatten(ary)
-    VALUE ary;
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE v = rb_ary_flatten_bang(rb_ary_dup(ary));
+    ary = rb_ary_dup(ary);
+    rb_ary_shuffle_bang(argc, argv, ary);
+    return ary;
+}
 
-    if (NIL_P(v)) return ary;
-    return v;
+
+/*
+ *  call-seq:
+ *     ary.sample                  -> obj
+ *     ary.sample(random: rng)     -> obj
+ *     ary.sample(n)               -> new_ary
+ *     ary.sample(n, random: rng)  -> new_ary
+ *
+ *  Choose a random element or +n+ random elements from the array. The elements
+ *  are chosen by using random and unique indices into the array in order to
+ *  ensure that an element doesn't repeat itself unless the array already
+ *  contained duplicate elements. If the array is empty the first form returns
+ *  <code>nil</code> and the second form returns an empty array.
+ *
+ *  If +rng+ is given, it will be used as the random number generator.
+ */
+
+
+static VALUE
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE nv, result, *ptr;
+    VALUE opts, randgen = rb_cRandom;
+    long n, len, i, j, k, idx[10];
+    double rnds[numberof(idx)];
+
+    if (OPTHASH_GIVEN_P(opts)) {
+	randgen = rb_hash_lookup2(opts, sym_random, randgen);
+    }
+    ptr = RARRAY_PTR(ary);
+    len = RARRAY_LEN(ary);
+    if (argc == 0) {
+	if (len == 0) return Qnil;
+	if (len == 1) {
+	    i = 0;
+	}
+	else {
+	    double x = rb_random_real(randgen);
+	    if ((len = RARRAY_LEN(ary)) == 0) return Qnil;
+	    i = (long)(x * len);
+	}
+	return RARRAY_PTR(ary)[i];
+    }
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+    if (n > len) n = len;
+    if (n <= numberof(idx)) {
+	for (i = 0; i < n; ++i) {
+	    rnds[i] = rb_random_real(randgen);
+	}
+    }
+    len = RARRAY_LEN(ary);
+    ptr = RARRAY_PTR(ary);
+    if (n > len) n = len;
+    switch (n) {
+      case 0:
+	return rb_ary_new2(0);
+      case 1:
+	i = (long)(rnds[0] * len);
+	return rb_ary_new4(1, &ptr[i]);
+      case 2:
+	i = (long)(rnds[0] * len);
+	j = (long)(rnds[1] * (len-1));
+	if (j >= i) j++;
+	return rb_ary_new3(2, ptr[i], ptr[j]);
+      case 3:
+	i = (long)(rnds[0] * len);
+	j = (long)(rnds[1] * (len-1));
+	k = (long)(rnds[2] * (len-2));
+	{
+	    long l = j, g = i;
+	    if (j >= i) l = i, g = ++j;
+	    if (k >= l && (++k >= g)) ++k;
+	}
+	return rb_ary_new3(3, ptr[i], ptr[j], ptr[k]);
+    }
+    if (n <= numberof(idx)) {
+	VALUE *ptr_result;
+	long sorted[numberof(idx)];
+	sorted[0] = idx[0] = (long)(rnds[0] * len);
+	for (i=1; i<n; i++) {
+	    k = (long)(rnds[i] * --len);
+	    for (j = 0; j < i; ++j) {
+		if (k < sorted[j]) break;
+		++k;
+	    }
+	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+	    sorted[j] = idx[i] = k;
+	}
+	result = rb_ary_new2(n);
+	ptr_result = RARRAY_PTR(result);
+	for (i=0; i<n; i++) {
+	    ptr_result[i] = ptr[idx[i]];
+	}
+    }
+    else {
+	VALUE *ptr_result;
+	result = rb_ary_new4(len, ptr);
+	RBASIC(result)->klass = 0;
+	ptr_result = RARRAY_PTR(result);
+	RB_GC_GUARD(ary);
+	for (i=0; i<n; i++) {
+	    j = RAND_UPTO(len-i) + i;
+	    nv = ptr_result[j];
+	    ptr_result[j] = ptr_result[i];
+	    ptr_result[i] = nv;
+	}
+	RBASIC(result)->klass = rb_cArray;
+    }
+    ARY_SET_LEN(result, n);
+
+    return result;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.cycle(n=nil) {|obj| block }  -> nil
+ *     ary.cycle(n=nil)                 -> an_enumerator
+ *
+ *  Calls <i>block</i> for each element repeatedly _n_ times or
+ *  forever if none or +nil+ is given.  If a non-positive number is
+ *  given or the array is empty, does nothing.  Returns +nil+ if the
+ *  loop has finished without getting interrupted.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *
+ *     a = ["a", "b", "c"]
+ *     a.cycle {|x| puts x }  # print, a, b, c, a, b, c,.. forever.
+ *     a.cycle(2) {|x| puts x }  # print, a, b, c, a, b, c.
+ *
+ */
+
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+    long n, i;
+    VALUE nv = Qnil;
+
+    rb_scan_args(argc, argv, "01", &nv);
+
+    RETURN_ENUMERATOR(ary, argc, argv);
+    if (NIL_P(nv)) {
+        n = -1;
+    }
+    else {
+        n = NUM2LONG(nv);
+        if (n <= 0) return Qnil;
+    }
+
+    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            rb_yield(RARRAY_PTR(ary)[i]);
+        }
+    }
+    return Qnil;
+}
+
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC(s)->klass = rb_cString)
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC(a)->klass = rb_cArray)
+
+/*
+ * Recursively compute permutations of r elements of the set [0..n-1].
+ * When we have a complete permutation of array indexes, copy the values
+ * at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * index: what index we're filling in now
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(long n, long r, long *p, long index, char *used, VALUE values)
+{
+    long i,j;
+    for (i = 0; i < n; i++) {
+	if (used[i] == 0) {
+	    p[index] = i;
+	    if (index < r-1) {             /* if not done yet */
+		used[i] = 1;               /* mark index used */
+		permute0(n, r, p, index+1, /* recurse */
+			 used, values);
+		used[i] = 0;               /* index unused */
+	    }
+	    else {
+		/* We have a complete permutation of array indexes */
+		/* Build a ruby array of the corresponding values */
+		/* And yield it to the associated block */
+		VALUE result = rb_ary_new2(r);
+		VALUE *result_array = RARRAY_PTR(result);
+		const VALUE *values_array = RARRAY_PTR(values);
+
+		for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
+		ARY_SET_LEN(result, r);
+		rb_yield(result);
+		if (RBASIC(values)->klass) {
+		    rb_raise(rb_eRuntimeError, "permute reentered");
+		}
+	    }
+	}
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary.permutation { |p| block }          -> ary
+ *     ary.permutation                        -> an_enumerator
+ *     ary.permutation(n) { |p| block }       -> ary
+ *     ary.permutation(n)                     -> an_enumerator
+ *
+ * When invoked with a block, yield all permutations of length <i>n</i>
+ * of the elements of <i>ary</i>, then return the array itself.
+ * If <i>n</i> is not specified, yield all permutations of all elements.
+ * The implementation makes no guarantees about the order in which
+ * the permutations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3]
+ *     a.permutation.to_a     #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *     a.permutation(1).to_a  #=> [[1],[2],[3]]
+ *     a.permutation(2).to_a  #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ *     a.permutation(3).to_a  #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *     a.permutation(0).to_a  #=> [[]] # one permutation of length 0
+ *     a.permutation(4).to_a  #=> []   # no permutations of length 4
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE num;
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_ENUMERATOR(ary, argc, argv);   /* Return enumerator if no block */
+    rb_scan_args(argc, argv, "01", &num);
+    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+
+    if (r < 0 || n < r) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else {             /* this is the general case */
+	volatile VALUE t0 = tmpbuf(n,sizeof(long));
+	long *p = (long*)RSTRING_PTR(t0);
+	volatile VALUE t1 = tmpbuf(n,sizeof(char));
+	char *used = (char*)RSTRING_PTR(t1);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC(ary0)->klass = 0;
+
+	MEMZERO(used, char, n); /* initialize array */
+
+	permute0(n, r, p, 0, used, ary0); /* compute and yield permutations */
+	tmpbuf_discard(t0);
+	tmpbuf_discard(t1);
+	RBASIC(ary0)->klass = rb_cArray;
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.combination(n) { |c| block }    -> ary
+ *     ary.combination(n)                  -> an_enumerator
+ *
+ * When invoked with a block, yields all combinations of length <i>n</i>
+ * of elements from <i>ary</i> and then returns <i>ary</i> itself.
+ * The implementation makes no guarantees about the order in which
+ * the combinations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3, 4]
+ *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
+ *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ *     a.combination(4).to_a  #=> [[1,2,3,4]]
+ *     a.combination(0).to_a  #=> [[]] # one combination of length 0
+ *     a.combination(5).to_a  #=> []   # no combinations of length 5
+ *
+ */
+
+static VALUE
+rb_ary_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);
+    RETURN_ENUMERATOR(ary, 1, &num);
+    len = RARRAY_LEN(ary);
+    if (n < 0 || len < n) {
+	/* yield nothing */
+    }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < len; i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else {
+	volatile VALUE t0 = tmpbuf(n+1, sizeof(long));
+	long *stack = (long*)RSTRING_PTR(t0);
+	volatile VALUE cc = tmpary(n);
+	VALUE *chosen = RARRAY_PTR(cc);
+	long lev = 0;
+
+	MEMZERO(stack, long, n);
+	stack[0] = -1;
+	for (;;) {
+	    chosen[lev] = RARRAY_PTR(ary)[stack[lev+1]];
+	    for (lev++; lev < n; lev++) {
+		chosen[lev] = RARRAY_PTR(ary)[stack[lev+1] = stack[lev]+1];
+	    }
+	    rb_yield(rb_ary_new4(n, chosen));
+	    if (RBASIC(t0)->klass) {
+		rb_raise(rb_eRuntimeError, "combination reentered");
+	    }
+	    do {
+		if (lev == 0) goto done;
+		stack[lev--]++;
+	    } while (stack[lev+1]+n == len+lev+1);
+	}
+    done:
+	tmpbuf_discard(t0);
+	tmpary_discard(cc);
+    }
+    return ary;
+}
+
+/*
+ * Recursively compute repeated permutations of r elements of the set
+ * [0..n-1].
+ * When we have a complete repeated permutation of array indexes, copy the
+ * values at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * index: what index we're filling in now
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(long n, long r, long *p, long index, VALUE values)
+{
+    long i, j;
+    for (i = 0; i < n; i++) {
+	p[index] = i;
+	if (index < r-1) {              /* if not done yet */
+	    rpermute0(n, r, p, index+1, values); /* recurse */
+	}
+	else {
+	    /* We have a complete permutation of array indexes */
+	    /* Build a ruby array of the corresponding values */
+	    /* And yield it to the associated block */
+	    VALUE result = rb_ary_new2(r);
+	    VALUE *result_array = RARRAY_PTR(result);
+	    const VALUE *values_array = RARRAY_PTR(values);
+
+	    for (j = 0; j < r; j++) result_array[j] = values_array[p[j]];
+	    ARY_SET_LEN(result, r);
+	    rb_yield(result);
+	    if (RBASIC(values)->klass) {
+		rb_raise(rb_eRuntimeError, "repeated permute reentered");
+	    }
+	}
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary.repeated_permutation(n) { |p| block } -> ary
+ *     ary.repeated_permutation(n)               -> an_enumerator
+ *
+ * When invoked with a block, yield all repeated permutations of length
+ * <i>n</i> of the elements of <i>ary</i>, then return the array itself.
+ * The implementation makes no guarantees about the order in which
+ * the repeated permutations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2]
+ *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
+ *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
+ */
+
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_ENUMERATOR(ary, 1, &num);      /* Return enumerator if no block */
+    r = NUM2LONG(num);                    /* Permutation size from argument */
+
+    if (r < 0) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else {             /* this is the general case */
+	volatile VALUE t0 = tmpbuf(r, sizeof(long));
+	long *p = (long*)RSTRING_PTR(t0);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC(ary0)->klass = 0;
+
+	rpermute0(n, r, p, 0, ary0); /* compute and yield repeated permutations */
+	tmpbuf_discard(t0);
+	RBASIC(ary0)->klass = rb_cArray;
+    }
+    return ary;
+}
+
+static void
+rcombinate0(long n, long r, long *p, long index, long rest, VALUE values)
+{
+    long j;
+    if (rest > 0) {
+	for (; index < n; ++index) {
+	    p[r-rest] = index;
+	    rcombinate0(n, r, p, index, rest-1, values);
+	}
+    }
+    else {
+	VALUE result = rb_ary_new2(r);
+	VALUE *result_array = RARRAY_PTR(result);
+	const VALUE *values_array = RARRAY_PTR(values);
+
+	for (j = 0; j < r; ++j) result_array[j] = values_array[p[j]];
+	ARY_SET_LEN(result, r);
+	rb_yield(result);
+	if (RBASIC(values)->klass) {
+	    rb_raise(rb_eRuntimeError, "repeated combination reentered");
+	}
+    }
+}
+
+/*
+ *  call-seq:
+ *     ary.repeated_combination(n) { |c| block } -> ary
+ *     ary.repeated_combination(n)               -> an_enumerator
+ *
+ * When invoked with a block, yields all repeated combinations of
+ * length <i>n</i> of elements from <i>ary</i> and then returns
+ * <i>ary</i> itself.
+ * The implementation makes no guarantees about the order in which
+ * the repeated combinations are yielded.
+ *
+ * If no block is given, an enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3]
+ *     a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
+ *     a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ *     a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ *                                     #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ *     a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ *                                     #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ *                                     #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ *     a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
+ *
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);                 /* Combination size from argument */
+    RETURN_ENUMERATOR(ary, 1, &num);   /* Return enumerator if no block */
+    len = RARRAY_LEN(ary);
+    if (n < 0) {
+	/* yield nothing */
+    }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < len; i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_PTR(ary)[i]));
+	}
+    }
+    else if (len == 0) {
+	/* yield nothing */
+    }
+    else {
+	volatile VALUE t0 = tmpbuf(n, sizeof(long));
+	long *p = (long*)RSTRING_PTR(t0);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC(ary0)->klass = 0;
+
+	rcombinate0(len, n, p, 0, n, ary0); /* compute and yield repeated combinations */
+	tmpbuf_discard(t0);
+	RBASIC(ary0)->klass = rb_cArray;
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.product(other_ary, ...)                -> new_ary
+ *     ary.product(other_ary, ...) { |p| block }  -> ary
+ *
+ *  Returns an array of all combinations of elements from all arrays.
+ *  The length of the returned array is the product of the length
+ *  of +self+ and the argument arrays.
+ *  If given a block, <i>product</i> will yield all combinations
+ *  and return +self+ instead.
+ *
+ *
+ *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ *     [1,2].product()            #=> [[1],[2]]
+ *     [1,2].product([])          #=> []
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+    int n = argc+1;    /* How many arrays we're operating on */
+    volatile VALUE t0 = tmpary(n);
+    volatile VALUE t1 = tmpbuf(n, sizeof(int));
+    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
+    long i,j;
+    long resultlen = 1;
+
+    RBASIC(t0)->klass = 0;
+    RBASIC(t1)->klass = 0;
+
+    /* initialize the arrays of arrays */
+    ARY_SET_LEN(t0, n);
+    arrays[0] = ary;
+    for (i = 1; i < n; i++) arrays[i] = Qnil;
+    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+    /* initialize the counters for the arrays */
+    for (i = 0; i < n; i++) counters[i] = 0;
+
+    /* Otherwise, allocate and fill in an array of results */
+    if (rb_block_given_p()) {
+	/* Make defensive copies of arrays; exit if any is empty */
+	for (i = 0; i < n; i++) {
+	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
+	    arrays[i] = ary_make_shared_copy(arrays[i]);
+	}
+    }
+    else {
+	/* Compute the length of the result array; return [] if any is empty */
+	for (i = 0; i < n; i++) {
+	    long k = RARRAY_LEN(arrays[i]), l = resultlen;
+	    if (k == 0) {
+		result = rb_ary_new2(0);
+		goto done;
+	    }
+	    resultlen *= k;
+	    if (resultlen < k || resultlen < l || resultlen / k != l) {
+		rb_raise(rb_eRangeError, "too big to product");
+	    }
+	}
+	result = rb_ary_new2(resultlen);
+    }
+    for (;;) {
+	int m;
+	/* fill in one subarray */
+	VALUE subarray = rb_ary_new2(n);
+	for (j = 0; j < n; j++) {
+	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+	}
+
+	/* put it on the result array */
+	if(NIL_P(result)) {
+	    FL_SET(t0, FL_USER5);
+	    rb_yield(subarray);
+	    if (! FL_TEST(t0, FL_USER5)) {
+		rb_raise(rb_eRuntimeError, "product reentered");
+	    }
+	    else {
+		FL_UNSET(t0, FL_USER5);
+	    }
+	}
+	else {
+	    rb_ary_push(result, subarray);
+	}
+
+	/*
+	 * Increment the last counter.  If it overflows, reset to 0
+	 * and increment the one before it.
+	 */
+	m = n-1;
+	counters[m]++;
+	while (counters[m] == RARRAY_LEN(arrays[m])) {
+	    counters[m] = 0;
+	    /* If the first counter overflows, we are done */
+	    if (--m < 0) goto done;
+	    counters[m]++;
+	}
+    }
+done:
+    tmpary_discard(t0);
+    tmpbuf_discard(t1);
+
+    return NIL_P(result) ? ary : result;
+}
+
+/*
+ *  call-seq:
+ *     ary.take(n)               -> new_ary
+ *
+ *  Returns first n elements from <i>ary</i>.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take(3)             #=> [1, 2, 3]
+ *
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+    long len = NUM2LONG(n);
+    if (len < 0) {
+	rb_raise(rb_eArgError, "attempt to take negative size");
+    }
+    return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ *  call-seq:
+ *     ary.take_while {|arr| block }   -> new_ary
+ *     ary.take_while                  -> an_enumerator
+ *
+ *  Passes elements to the block until the block returns +nil+ or +false+,
+ *  then stops iterating and returns an array of all prior elements.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take_while {|i| i < 3 }   #=> [1, 2]
+ *
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+    }
+    return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *     ary.drop(n)               -> new_ary
+ *
+ *  Drops first n elements from +ary+ and returns the rest of
+ *  the elements in an array.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop(3)             #=> [4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+    VALUE result;
+    long pos = NUM2LONG(n);
+    if (pos < 0) {
+	rb_raise(rb_eArgError, "attempt to drop negative size");
+    }
+
+    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+    if (result == Qnil) result = rb_ary_new();
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.drop_while {|arr| block }   -> new_ary
+ *     ary.drop_while                  -> an_enumerator
+ *
+ *  Drops elements up to, but not including, the first element for
+ *  which the block returns +nil+ or +false+ and returns an array
+ *  containing the remaining elements.
+ *
+ *  If no block is given, an enumerator is returned instead.
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_PTR(ary)[i]))) break;
+    }
+    return rb_ary_drop(ary, LONG2FIX(i));
 }
 
+
+
+/* Arrays are ordered, integer-indexed collections of any object.
+ * Array indexing starts at 0, as in C or Java.  A negative index is
+ * assumed to be relative to the end of the array---that is, an index of -1
+ * indicates the last element of the array, -2 is the next to last
+ * element in the array, and so on.
+ */
+
 void
-Init_Array()
+Init_Array(void)
 {
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
+
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
-    rb_define_singleton_method(rb_cArray, "new", rb_ary_s_new, -1);
+    rb_define_alloc_func(rb_cArray, ary_alloc);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
-    rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
+    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
+    rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
+    rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
+
     rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+    rb_define_alias(rb_cArray,  "to_s", "inspect");
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
-    rb_define_method(rb_cArray, "to_ary", rb_ary_to_a, 0);
-
-    rb_define_method(rb_cArray, "freeze",  rb_ary_freeze, 0);
+    rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
     rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
     rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
     rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
     rb_define_method(rb_cArray, "hash", rb_ary_hash, 0);
-    rb_define_method(rb_cArray, "===", rb_ary_equal, 1);
 
     rb_define_method(rb_cArray, "[]", rb_ary_aref, -1);
     rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
+    rb_define_method(rb_cArray, "at", rb_ary_at, 1);
+    rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
+    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
+    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
     rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
-    rb_define_method(rb_cArray, "push", rb_ary_push_method, -1);
-    rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
-    rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
-    rb_define_method(rb_cArray, "unshift", rb_ary_unshift, 1);
+    rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+    rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+    rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+    rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+    rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
     rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
     rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
     rb_define_alias(rb_cArray,  "size", "length");
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
-    rb_define_method(rb_cArray, "index", rb_ary_index, 1);
-    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
-    rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
-    rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
-    rb_define_method(rb_cArray, "clone", rb_ary_clone, 0);
-    rb_define_method(rb_cArray, "dup", rb_ary_dup, 0);
-    rb_define_method(rb_cArray, "join", rb_ary_join_method, -1);
-    rb_define_method(rb_cArray, "reverse", rb_ary_reverse_method, 0);
-    rb_define_method(rb_cArray, "reverse!", rb_ary_reverse, 0);
+    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+    rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
+    rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
+    rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
     rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
     rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
+    rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
+    rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
+    rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
+    rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
+    rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
+    rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
-    rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at, 1);
+    rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
     rb_define_method(rb_cArray, "delete_if", rb_ary_delete_if, 0);
-    rb_define_method(rb_cArray, "reject!", rb_ary_delete_if, 0);
-    rb_define_method(rb_cArray, "filter", rb_ary_filter, 0);
-    rb_define_method(rb_cArray, "replace", rb_ary_replace_method, 1);
+    rb_define_method(rb_cArray, "reject", rb_ary_reject, 0);
+    rb_define_method(rb_cArray, "reject!", rb_ary_reject_bang, 0);
+    rb_define_method(rb_cArray, "zip", rb_ary_zip, -1);
+    rb_define_method(rb_cArray, "transpose", rb_ary_transpose, 0);
+    rb_define_method(rb_cArray, "replace", rb_ary_replace, 1);
     rb_define_method(rb_cArray, "clear", rb_ary_clear, 0);
     rb_define_method(rb_cArray, "fill", rb_ary_fill, -1);
     rb_define_method(rb_cArray, "include?", rb_ary_includes, 1);
     rb_define_method(rb_cArray, "<=>", rb_ary_cmp, 1);
 
+    rb_define_method(rb_cArray, "slice", rb_ary_aref, -1);
+    rb_define_method(rb_cArray, "slice!", rb_ary_slice_bang, -1);
+
     rb_define_method(rb_cArray, "assoc", rb_ary_assoc, 1);
     rb_define_method(rb_cArray, "rassoc", rb_ary_rassoc, 1);
 
@@ -1489,9 +4759,24 @@ Init_Array()
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
     rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
-    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
-    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
-    rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
-
-    cmp = rb_intern("<=>");
+    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
+    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+
+    id_cmp = rb_intern("<=>");
+    sym_random = ID2SYM(rb_intern("random"));
 }
diff --git a/atomic.h b/atomic.h
new file mode 100644
index 0000000000..5b3fb99024
--- /dev/null
+++ b/atomic.h
@@ -0,0 +1,56 @@
+#ifndef RUBY_ATOMIC_H
+#define RUBY_ATOMIC_H
+
+#ifdef _WIN32
+#if defined _MSC_VER && _MSC_VER > 1200
+#pragma intrinsic(_InterlockedOr)
+#endif
+typedef LONG rb_atomic_t;
+
+# define ATOMIC_SET(var, val) InterlockedExchange(&(var), (val))
+# define ATOMIC_INC(var) InterlockedIncrement(&(var))
+# define ATOMIC_DEC(var) InterlockedDecrement(&(var))
+#if defined __GNUC__
+# define ATOMIC_OR(var, val) __asm__("lock\n\t" "orl\t%1, %0" : "=m"(var) : "Ir"(val))
+#elif defined _MSC_VER && _MSC_VER <= 1200
+# define ATOMIC_OR(var, val) rb_w32_atomic_or(&(var), (val))
+static inline void
+rb_w32_atomic_or(volatile rb_atomic_t *var, rb_atomic_t val)
+{
+#ifdef _M_IX86
+    __asm mov eax, var;
+    __asm mov ecx, val;
+    __asm lock or [eax], ecx;
+#else
+#error unsupported architecture
+#endif
+}
+#else
+# define ATOMIC_OR(var, val) _InterlockedOr(&(var), (val))
+#endif
+# define ATOMIC_EXCHANGE(var, val) InterlockedExchange(&(var), (val))
+
+#elif defined HAVE_GCC_ATOMIC_BUILTINS
+/* @shyouhei hack to support atomic operations in case of gcc. Gcc
+ * has its own pseudo-insns to support them.  See info, or
+ * http://gcc.gnu.org/onlinedocs/gcc/Atomic-Builtins.html */
+
+typedef unsigned int rb_atomic_t; /* Anything OK */
+# define ATOMIC_SET(var, val)  __sync_lock_test_and_set(&(var), (val))
+# define ATOMIC_INC(var) __sync_fetch_and_add(&(var), 1)
+# define ATOMIC_DEC(var) __sync_fetch_and_sub(&(var), 1)
+# define ATOMIC_OR(var, val) __sync_or_and_fetch(&(var), (val))
+# define ATOMIC_EXCHANGE(var, val) __sync_lock_test_and_set(&(var), (val))
+
+#else
+typedef int rb_atomic_t;
+extern rb_atomic_t ruby_atomic_exchange(rb_atomic_t *ptr, rb_atomic_t val);
+
+# define ATOMIC_SET(var, val) ((var) = (val))
+# define ATOMIC_INC(var) (++(var))
+# define ATOMIC_DEC(var) (--(var))
+# define ATOMIC_OR(var, val) ((var) |= (val))
+# define ATOMIC_EXCHANGE(var, val) ruby_atomic_exchange(&(var), (val))
+#endif
+
+#endif /* RUBY_ATOMIC_H */
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
new file mode 100644
index 0000000000..1cd26a8643
--- /dev/null
+++ b/bcc32/Makefile.sub
@@ -0,0 +1,617 @@
+# -*- makefile -*-
+
+SHELL = $(COMSPEC)
+MKFILES = Makefile
+
+!ifndef MFLAGS
+MFLAGS=-
+!endif
+
+#### Start of system configuration section. ####
+!ifndef OS
+OS = bccwin32
+!endif
+!if !defined(RT)
+!error RT not defined.  Retry from configure pass.
+!endif
+
+arch = $(ARCH)-$(OS)
+
+## variables may be overridden by $(compile_dir)/Makefile
+!ifndef srcdir
+srcdir = ..
+!endif
+!ifndef RUBY_INSTALL_NAME
+RUBY_INSTALL_NAME = ruby
+!endif
+!ifndef RUBYW_INSTALL_NAME
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
+!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
+!endif
+!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
+!endif
+!ifndef RUBY_SO_NAME
+RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)$(TEENY)
+!endif
+!ifndef icondirs
+!ifdef ICONDIRS
+icondirs=$(ICONDIRS)
+!endif
+!endif
+!ifdef icondirs
+icondirs=$(icondirs:\=/)
+iconinc=-I$(icondirs: = -I)
+!endif
+###############
+
+.SUFFIXES: .y
+
+!ifndef CC
+CC = bcc32
+!endif
+!ifndef CPP
+CPP = cpp32
+!endif
+!ifndef RC
+RC = brcc32
+!endif
+!ifndef YACC
+YACC = bison
+!endif
+!ifndef AR
+AR = tlib
+!endif
+!ifndef BASERUBY
+BASERUBY = ruby
+!endif
+
+PURIFY =
+AUTOCONF = autoconf
+IFCHANGE = $(srcdir:/=\)\win32\ifchange.bat
+RM = $(srcdir:/=\)\win32\rm.bat
+CP = copy > nul
+MV = move > nul
+
+!if !defined(PROCESSOR_ARCHITECTURE)
+PROCESSOR_ARCHITECTURE = x86
+!endif
+MACHINE = $(PROCESSOR_ARCHITECTURE)
+!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
+!ifndef PROCESSOR_LEVEL
+PROCESSOR_LEVEL = 5
+!endif
+!if 6 < $(PROCESSOR_LEVEL)
+PROCESSOR_LEVEL = 6
+!endif
+PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
+CPU = i$(PROCESSOR_LEVEL)86
+ARCH = i386
+!else
+CPU = $(PROCESSOR_ARCHITECTURE)
+ARCH = $(PROCESSOR_ARCHITECTURE)
+!endif
+!ifndef DEBUGFLAGS
+DEBUGFLAGS = 
+!endif
+!ifndef OPTFLAGS
+OPTFLAGS = -O
+!endif
+
+!ifndef prefix
+prefix = /usr
+!endif
+!ifndef exec_prefix
+exec_prefix = $(prefix)
+!endif
+!ifndef libdir
+libdir = $(exec_prefix)/lib
+!endif
+!if !defined(datadir)
+datadir = $(prefix)/share
+!endif
+!ifndef EXTOUT
+EXTOUT = .ext
+!endif
+!ifndef TESTUI
+TESTUI = console
+!endif
+!ifndef TESTS
+TESTS =
+!endif
+!ifndef RDOCTARGET
+RDOCTARGET = install-doc
+!endif
+
+OUTFLAG       = -o
+COUTFLAG      = -o
+!ifndef CFLAGS
+CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
+!endif
+!ifndef DEFS
+DEFS =
+!endif
+!ifndef CPPFLAGS
+CPPFLAGS =
+!endif
+CPPFLAGS = $(DEFS) $(CPPFLAGS)
+!ifndef CXXFLAGS
+CXXFLAGS = $(CFLAGS)
+!endif
+!ifndef LDFLAGS
+LDFLAGS = -S:$(STACK)
+!endif
+!ifndef RFLAGS
+RFLAGS = $(iconinc)
+!endif
+!ifndef EXTLIBS
+EXTLIBS =
+!endif
+!ifndef MEMLIB
+MEMLIB =
+!endif
+LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
+MISSING = acosh.obj cbrt.obj crypt.obj erf.obj lgamma_r.obj strlcat.obj strlcpy.obj tgamma.obj win32.obj
+
+!ifndef STACK
+STACK = 0x2000000
+!endif
+
+XCFLAGS = -DRUBY_EXPORT -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir) -I$(srcdir)/missing
+
+ARFLAGS = /a /p32
+LD = ilink32 -q -Gn
+LDSHARED  = $(LD)
+XLDFLAGS  = -Tpe c0x32.obj
+WLDFLAGS  = -aa -Tpe c0w32.obj
+DLDFLAGS  = -Tpd c0d32.obj
+LIBRUBY_LDSHARED = $(LDSHARED)
+LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
+LDOBJECTS = $(MAINOBJ)
+
+SOLIBS = 
+
+EXEEXT = .exe
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
+RUBYDEF = $(RUBY_SO_NAME).def
+MINIRUBY = .\miniruby$(EXEEXT) -I$(srcdir)/lib $(MINIRUBYOPT)
+RUNRUBY = .\$(PROGRAM) -i"$(EXTOUT)/$(arch)" "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
+
+ORGLIBPATH = $(LIB)
+
+#### End of system configuration section. ####
+
+LIBRUBY_A     = $(RUBY_SO_NAME)-static.lib
+LIBRUBY_SO    = $(RUBY_SO_NAME).dll
+LIBRUBY       = $(RUBY_SO_NAME).lib
+LIBRUBYARG    = $(LIBRUBY)
+THREAD_MODEL  = win32
+
+PREP          = miniruby$(EXEEXT)
+
+OBJEXT        = obj
+ASMEXT        = asm
+
+INSTALLED_LIST= .installed.list
+
+MKMAIN_CMD    = mkmain.bat
+
+SRC_FILE      = $(<:\=/)
+
+WINMAINOBJ    = winmain.$(OBJEXT)
+ARCHMINIOBJS  = dmydln.$(OBJEXT)
+
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+hdrdir = $(srcdir)/include
+VPATH = $(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/enc;$(srcdir)/missing;$(srcdir)/win32
+
+.path.c = .;$(srcdir);$(srcdir)/enc;$(srcdir)/win32;$(srcdir)/missing
+.path.ci = $(srcdir)
+.path.inc = .;$(srcdir)
+.path.def = .;$(srcdir)
+.path.h = .;$(arch_hdrdir)/ruby;$(hdrdir)/ruby;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
+.path.y = $(srcdir)
+.path. = $(srcdir)
+
+.c.obj:
+	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -c $(<:/=\)
+
+.c.asm:
+	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) $(COUTFLAG)$@ -S $(<:\=/)
+
+.rc.res:
+	$(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
+
+all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
+
+ruby: $(PROGRAM)
+rubyw: $(WPROGRAM)
+
+!include $(srcdir)/common.mk
+
+$(MKFILES): $(srcdir)/bcc32/Makefile.sub $(srcdir)/bcc32/configure.bat $(srcdir)/bcc32/setup.mak
+	$(COMSPEC) /C $(srcdir:/=\)\bcc32\configure.bat $(configure_args)
+	@echo $(MKFILES) should be updated, re-run $(MAKE).
+	@$(MAKE) > nul -q -f &&|
+PHONY: nul
+	@exit
+|
+
+PHONY: nul
+
+RUBY_CONFIG_H = $(arch_hdrdir)/ruby/config.h
+CONFIG_H = ./.config.h.time
+
+config: config.status
+
+config.status: $(CONFIG_H)
+
+guard = INCLUDE_RUBY_CONFIG_H
+
+$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
+	@if not exist $(arch_hdrdir:/=\) md $(arch_hdrdir:/=\)
+	@if not exist $(arch_hdrdir:/=\)\ruby md $(arch_hdrdir:/=\)\ruby
+	@$(IFCHANGE) $(RUBY_CONFIG_H:/=\) &&|
+\#ifndef $(guard)
+\#define $(guard) 1
+\#define NO_BIG_INLINE 1
+\#define HAVE_SYS_TYPES_H 1
+\#define HAVE_SYS_STAT_H 1
+\#define HAVE_STDLIB_H 1
+\#define HAVE_STRING_H 1
+\#define HAVE_MEMORY_H 1
+\#define HAVE_LONG_LONG 1
+\#define HAVE_OFF_T 1
+\#define SIZEOF_INT 4
+\#define SIZEOF_SHORT 2
+\#define SIZEOF_LONG 4
+\#define SIZEOF_LONG_LONG 0
+\#define SIZEOF___INT64 8
+\#define SIZEOF_OFF_T 8
+\#define SIZEOF_VOIDP 4
+\#define SIZEOF_FLOAT 4
+\#define SIZEOF_DOUBLE 8
+\#define SIZEOF_TIME_T 4
+\#define SIZEOF_RLIM_T 0
+\#define SIZEOF_SIZE_T 4
+\#define SIZEOF_PTRDIFF_T 4
+\#define HAVE_PROTOTYPES 1
+\#define TOKEN_PASTE(x,y) x\#\#y
+\#define HAVE_STDARG_PROTOTYPES 1
+\#define NORETURN(x) x
+\#define RUBY_EXTERN extern __declspec(dllimport)
+\#define HAVE_DECL_SYS_NERR 1
+\#define HAVE_LIMITS_H 1
+\#define HAVE_FCNTL_H 1
+\#define HAVE_UTIME_H 1
+\#define HAVE_FLOAT_H 1
+\#define rb_uid_t uid_t
+\#define rb_gid_t gid_t
+\#define rb_pid_t int
+\#define HAVE_STRUCT_STAT_ST_RDEV 1
+\#define HAVE_ST_RDEV 1
+!if $(BORLANDC) < 0x0580
+\#define int8_t signed char
+\#define uint8_t unsigned char
+\#define int16_t short
+\#define uint16_t unsigned short
+\#define int32_t int
+\#define uint32_t unsigned int
+\#define int64_t __int64
+\#define uint64_t unsigned __int64
+\#define ssize_t int
+!endif
+\#define HAVE_INT8_T 1
+\#define HAVE_UINT8_T 1
+\#define SIZEOF_INT8_T 1
+\#define HAVE_INT16_T 1
+\#define HAVE_UINT16_T 1
+\#define SIZEOF_INT32_T 2
+\#define HAVE_INT32_T 1
+\#define HAVE_UINT32_T 1
+\#define SIZEOF_INT32_T 4
+\#define HAVE_INT64_T 1
+\#define HAVE_UINT64_T 1
+\#define SIZEOF_INT64_T 8
+\#define HAVE_INTPTR_T 1
+\#define HAVE_UINTPTR_T 1
+\#define HAVE_SSIZE_T 1
+\#define GETGROUPS_T int
+\#define RETSIGTYPE void
+\#define HAVE_ALLOCA 1
+\#define HAVE_DUP2 1
+\#define HAVE_MEMMOVE 1
+\#define HAVE_MKDIR 1
+\#define HAVE_STRCASECMP 1
+\#define HAVE_STRNCASECMP 1
+\#define HAVE_STRERROR 1
+\#define HAVE_STRFTIME 1
+\#define HAVE_STRCHR 1
+\#define HAVE_STRSTR 1
+\#define HAVE_STRTOD 1
+\#define HAVE_STRTOL 1
+\#define HAVE_STRTOUL 1
+\#define HAVE_SNPRINTF 1
+\#define HAVE_VSNPRINTF 1
+\#define HAVE_ISNAN 1
+\#define HAVE_FINITE 1
+\#define HAVE_HYPOT 1
+\#define HAVE_FMOD 1
+\#define HAVE_WAITPID 1
+\#define HAVE_FSYNC 1
+\#define HAVE_GETCWD 1
+\#define HAVE_TRUNCATE 1
+\#define HAVE_FTRUNCATE 1
+\#define HAVE_FSEEKO 1
+\#define HAVE_FTELLO 1
+\#define HAVE_TIMES 1
+\#define HAVE_FCNTL 1
+\#define HAVE_LINK 1
+\#define HAVE_TELLDIR 1
+\#define HAVE_SEEKDIR 1
+\#define HAVE_COSH 1
+\#define HAVE_SINH 1
+\#define HAVE_TANH 1
+\#define RSHIFT(x,y) ((x)>>(int)y)
+\#define FILE_COUNT level
+\#define FILE_READPTR curp
+\#define RUBY_SETJMP(env) setjmp(env)
+\#define RUBY_LONGJMP(env,val) longjmp(env,val)
+\#define RUBY_JMP_BUF jmp_buf
+\#define inline __inline
+\#define NEED_IO_SEEK_BETWEEN_RW 1
+\#define STACK_GROW_DIRECTION -1
+\#define DEFAULT_KCODE KCODE_NONE
+\#define LOAD_RELATIVE 1
+\#define DLEXT ".so"
+\#define RUBY_LIB_PREFIX "/lib/ruby"
+\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
+\#endif /* $(guard) */
+|
+	@exit > $(@:/=\)
+
+config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
+	@echo Creating $@
+	@type > $@ &&|
+# Generated automatically by Makefile.sub.
+s,@SHELL@,$$(COMSPEC),;t t
+s,@BUILD_FILE_SEPARATOR@,\,;t t
+s,@PATH_SEPARATOR@,;,;t t
+s,@CFLAGS@,$(CFLAGS),;t t
+s,@DEFS@,$(DEFS),;t t
+s,@CPPFLAGS@,$(CPPFLAGS),;t t
+s,@CXXFLAGS@,$(CXXFLAGS),;t t
+s,@FFLAGS@,$(FFLAGS),;t t
+s,@LDFLAGS@,,;t t
+s,@LIBS@,$(LIBS),;t t
+s,@exec_prefix@,$${prefix},;t t
+s,@prefix@,$(prefix),;t t
+s,@program_transform_name@,s,,,,;t t
+s,@bindir@,$${exec_prefix}/bin,;t t
+s,@sbindir@,$${exec_prefix}/sbin,;t t
+s,@libexecdir@,$${exec_prefix}/libexec,;t t
+s,@datadir@,$${prefix}/share,;t t
+s,@sysconfdir@,$${prefix}/etc,;t t
+s,@sharedstatedir@,/etc,;t t
+s,@localstatedir@,/var,;t t
+s,@libdir@,$${exec_prefix}/lib,;t t
+s,@includedir@,$${prefix}/include,;t t
+s,@oldincludedir@,/usr/include,;t t
+s,@infodir@,$${prefix}/info,;t t
+s,@mandir@,$${prefix}/man,;t t
+s,@ridir@,$${prefix}/share/ri,;t t
+s,@build@,$(CPU)-pc-$(OS),;t t
+s,@build_alias@,$(CPU)-$(OS),;t t
+s,@build_cpu@,$(CPU),;t t
+s,@build_vendor@,pc,;t t
+s,@build_os@,$(OS),;t t
+s,@host@,$(CPU)-pc-$(OS),;t t
+s,@host_alias@,$(CPU)-$(OS),;t t
+s,@host_cpu@,$(CPU),;t t
+s,@host_vendor@,pc,;t t
+s,@host_os@,$(OS),;t t
+s,@target@,$(ARCH)-pc-$(OS),;t t
+s,@target_alias@,$(ARCH)-$(OS),;t t
+s,@target_cpu@,$(ARCH),;t t
+s,@target_vendor@,pc,;t t
+s,@target_os@,$(OS),;t t
+s,@CC@,$(CC),;t t
+s,@CPP@,cpp32,;t t
+s,@CXX@,$$(CC),;t t
+s,@LD@,$(LD),;t t
+s,@YACC@,$(YACC),;t t
+s,@RANLIB@,,;t t
+s,@AR@,$(AR),;t t
+s,@ARFLAGS@,$(ARFLAGS) ,;t t
+s,@LN_S@,$(LN_S),;t t
+s,@SET_MAKE@,MFLAGS = -$$(MAKEFLAGS),;t t
+s,@RM@,$$(top_srcdir:/=\)\win32\rm.bat,;t t
+s,@CP@,copy > nul,;t t
+s,@LIBOBJS@, $(MISSING),;t t
+s,@ALLOCA@,$(ALLOCA),;t t
+s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
+s,@EXEEXT@,.exe,;t t
+s,@OBJEXT@,obj,;t t
+s,@XCFLAGS@,$(XCFLAGS),;t t
+s,@XLDFLAGS@,$(XLDFLAGS),;t t
+s,@DLDFLAGS@,$(DLDFLAGS),;t t
+s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
+s,@STATIC@,$(STATIC),;t t
+s,@CCDLFLAGS@,,;t t
+s,@LDSHARED@,$(LDSHARED),;t t
+s,@DLEXT@,so,;t t
+s,@LIBEXT@,lib,;t t
+s,@STRIP@,$(STRIP),;t t
+s,@EXTSTATIC@,$(EXTSTATIC),;t t
+s,@setup@,Setup,;t t
+s,@MINIRUBY@,$(MINIRUBY),;t t
+s,@PREP@,miniruby$(EXEEXT),;t t
+s,@RUNRUBY@,$(RUNRUBY),;t t
+s,@EXTOUT@,$(EXTOUT),;t t
+s,@ARCHFILE@,,;t t
+s,@RDOCTARGET@,,;t t
+s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
+s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
+s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
+s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
+s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
+s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
+s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
+s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
+s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
+s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
+s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
+s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
+s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
+s,@SOLIBS@,$(SOLIBS),;t t
+s,@DLDLIBS@,$(DLDLIBS),;t t
+s,@ENABLE_SHARED@,yes,;t t
+s,@OUTFLAG@,$(OUTFLAG),;t t
+s,@COUTFLAG@,$(COUTFLAG),;t t
+s,@CPPOUTFILE@,,;t t
+s,@LIBPATHFLAG@, -L"%s",;t t
+s,@RPATHFLAG@,,;t t
+s,@LIBARG@,%s.lib,;t t
+s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS:/=\), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE:/=\), $$(RESFILE:/=\),;t t
+s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
+s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P $(COUTFLAG)$$(@) -c $$(<:/=\),;t t
+s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
+s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
+s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
+s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
+s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
+s,@cleanlibs@,$$*.tds,;t t
+s,@cleanobjs@,$$*-$$(arch).def $$*.il? $$*.lib,;t t
+s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
+s,@EXPORT_PREFIX@,_,;t t
+s,@arch@,$(ARCH)-$(OS),;t t
+s,@sitearch@,$(ARCH)-$(OS),;t t
+s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
+s,@vendordir@,$${prefix}/lib/ruby/vendor_ruby,;t t
+s,@rubyhdrdir@,$$(includedir)/ruby-$$(MAJOR).$$(MINOR).$$(TEENY),;t t
+s,@sitehdrdir@,$$(rubyhdrdir)/site_ruby,;t t
+s,@vendorhdrdir@,$$(rubyhdrdir)/vendor_ruby,;t t
+s,@configure_args@,--enable-shared $(configure_args),;t t
+s,@configure_input@,$$configure_input,;t t
+s,@srcdir@,$(srcdir),;t t
+s,@top_srcdir@,$(srcdir),;t t
+|
+
+miniruby$(EXEEXT):
+		@echo $(LIBS)
+		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS) $(COMMONOBJS:/=\) $(DMYEXT),$@,nul,$(LIBS)
+
+$(PROGRAM):	$(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
+		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
+
+$(WPROGRAM):	$(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
+		$(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
+
+$(LIBRUBY_A):	$(OBJS) $(DMYEXT)
+		@-if exist $@ del $@
+		$(AR) $(ARFLAGS) "$@" $(OBJS) $(DMYEXT)
+
+# $(LIBRUBY):	$(LIBRUBY_SO)
+#		implib $@ $(LIBRUBY_SO)
+
+$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
+		@echo $(DLDOBJS)
+		@$(PRE_LIBRUBY_UPDATE)
+		$(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
+
+$(LIBRUBY): $(LIBRUBY_SO)
+
+$(RUBYDEF):	$(LIBRUBY_A) $(PREP)
+		$(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
+
+$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb $(srcdir)/revision.h $(srcdir)/win32/resource.rb
+		@$(MINIRUBY) $(srcdir)/win32/resource.rb \
+			-ruby_name=$(RUBY_INSTALL_NAME) \
+			-rubyw_name=$(RUBYW_INSTALL_NAME) \
+			-so_name=$(RUBY_SO_NAME) \
+			. $(icondirs) $(srcdir)/win32
+
+lex.c: {$(srcdir)}lex.c.blt
+	copy "$(?:/=\)" $@
+
+post-install-bin::
+	@$(NULLCMD)
+post-install-lib::
+	@$(NULLCMD)
+post-install-ext-comm::
+	@$(NULLCMD)
+post-install-ext-arch::
+	@$(NULLCMD)
+post-install-man::
+	@$(NULLCMD)
+post-install-doc::
+	@$(NULLCMD)
+
+clean-local::
+		@$(RM) $(WINMAINOBJ) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
+		@$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
+		@$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF) ext\ripper\y.output
+
+distclean-local::
+		@$(RM) ext\config.cache $(RBCONFIG:/=\)
+		@$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
+
+clean-ext distclean-ext realclean-ext::
+		@for /R ext %I in (.) do @if exist %I\Makefile ( \
+		    echo $(@:-ext=)ing %~nI & \
+		    cd %I & \
+		    $(MAKE) $(MFLAGS) $(@:-ext=) & \
+		    cd %CD% \
+		)
+
+ext/extinit.obj: ext/extinit.c $(SETUP)
+	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+main.$(OBJEXT): win32.h
+ascii.$(OBJEXT): win32.h
+array.$(OBJEXT): win32.h
+bignum.$(OBJEXT): win32.h
+class.$(OBJEXT): win32.h
+compar.$(OBJEXT): win32.h
+dir.$(OBJEXT): dir.h win32.h
+dln.$(OBJEXT): win32.h
+enum.$(OBJEXT): win32.h
+error.$(OBJEXT): win32.h
+euc_jp.$(OBJEXT): win32.h
+eval.$(OBJEXT): win32.h
+file.$(OBJEXT): win32.h
+gc.$(OBJEXT): win32.h
+hash.$(OBJEXT): win32.h
+inits.$(OBJEXT): win32.h
+io.$(OBJEXT): win32.h
+marshal.$(OBJEXT): win32.h
+math.$(OBJEXT): win32.h
+numeric.$(OBJEXT): win32.h
+object.$(OBJEXT): win32.h
+pack.$(OBJEXT): win32.h
+parse.$(OBJEXT): win32.h
+process.$(OBJEXT): win32.h
+prec.$(OBJEXT): win32.h
+random.$(OBJEXT): win32.h
+range.$(OBJEXT): win32.h
+re.$(OBJEXT): win32.h
+regcomp.$(OBJEXT): win32.h
+regenc.$(OBJEXT): win32.h
+regerror.$(OBJEXT): win32.h
+regexec.$(OBJEXT): win32.h
+reggnu.$(OBJEXT): win32.h
+regparse.$(OBJEXT): win32.h
+ruby.$(OBJEXT): win32.h
+signal.$(OBJEXT): win32.h
+sjis.$(OBJEXT): win32.h
+sprintf.$(OBJEXT): win32.h
+st.$(OBJEXT): win32.h
+string.$(OBJEXT): win32.h
+struct.$(OBJEXT): win32.h
+time.$(OBJEXT): win32.h
+utf_8.$(OBJEXT): win32.h
+util.$(OBJEXT): win32.h
+variable.$(OBJEXT): win32.h
+version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
new file mode 100644
index 0000000000..cd33eec0a1
--- /dev/null
+++ b/bcc32/README.bcc32
@@ -0,0 +1,130 @@
+=begin
+
+= How to build ruby using Borland C++
+
+== Requirement
+
+(1) Borland C++ 5.0 or later.
+
+(2) Please set environment variable (({PATH}))
+    to run required commands properly from the command line.
+
+    Note: building ruby requires following commands.
+     * make
+     * bcc32
+     * tlib
+     * ilink32
+
+(3) If you want to build from CVS source, following commands are required.
+     * bison ((<URL:http://gnuwin32.sourceforge.net/packages/bison.htm>))
+     * sed   ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
+
+(4) We strongly recommend to build ruby on C++Builder, to link following files.
+     * usebormm.lib
+     * memmgr.lib
+
+    RTL's internal memory manager cannot handle large memory block properly,
+    so we should use borlndmm.dll instead.
+     10000.times { "" << "." * 529671; GC.start } # crash
+
+== How to compile and install
+
+(1) Execute bcc32\configure.bat on your build directory.
+     ex. c:\src\ruby> bcc32\configure.bat
+    You can specify the target platform as an argument.
+    For example, run `((%configure i686-bccwin32%))'
+    You can also specify the install directory.
+    For example, run `((%configure --prefix=<install_directory>%))'
+    Default of the install directory is /usr .
+    The default ((|<PLATFORM>|)) is `(({i386-bccwin32}))'.
+     
+(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
+    if you want to change the name of the executable files. 
+    And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
+    executable without console window if also you want.
+
+(3) Run `((%make%))'
+
+(4) Run `((%make test%))'
+
+(5) Run `((%make install%))'
+
+(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
+    usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
+    directory.
+
+== Icons
+
+Any icon files(*.ico) in the build directory, directories specified with
+((|icondirs|)) make variable and (({win32})) directory under the ruby
+source directory will be included in DLL or executable files, according
+to their base names.
+    $(RUBY_INSTALL_NAME).ico or ruby.ico   --> $(RUBY_INSTALL_NAME).exe
+    $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
+    the others                             --> $(RUBY_SO_NAME).dll
+
+Although no icons are distributed with the ruby source or in the official 
+site, you can use anything you like. For example, followings are written 
+in Japanese, but you can download at least.
+
+* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
+  ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
+* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
+  ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
+
+== Build examples
+
+* Build on the ruby source directory.
+
+  ex.)
+    ruby source directory:  C:\ruby
+    build directory:        C:\ruby
+    install directory:      C:\usr\local
+
+    C:
+    cd \ruby
+    bcc32\configure --prefix=/usr/local
+    make
+    make test
+    make install
+
+* Build on the relative directory from the ruby source directory and CPU type 
+  i386.
+
+  ex.)
+    ruby source directory:  C:\ruby
+    build directory:        C:\ruby\bccwin32
+    install directory:      C:\usr\local
+    CPU                     i386
+    
+    C:
+    cd \ruby
+    mkdir bccwin32
+    cd bccwin32
+    ..\bcc32\configure --prefix=/usr/local
+    make
+    make test
+    make install
+
+* Build on the different drive.
+
+  ex.)
+    ruby source directory:  C:\src\ruby
+    build directory:        D:\build\ruby
+    install directory:      C:\usr\local
+
+    D:
+    cd D:\build\ruby
+    C:\src\ruby\bcc32\configure --prefix=C:/usr/local
+    make
+    make test
+    make install
+
+== Bugs
+
+You can ((*NOT*)) use a path name contains any white space characters as
+the ruby source directory, this restriction comes from the behavior of
+(({!INCLUDE})) directives of (({MAKE})).
+((- you may call it a bug. -))
+
+=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
new file mode 100755
index 0000000000..8cdfc64b03
--- /dev/null
+++ b/bcc32/configure.bat
@@ -0,0 +1,163 @@
+@echo off
+::: Don't set environment variable in batch file other than autoexec.bat
+::: to avoid "Out of environment space" problem on Windows 95/98.
+::: set TMPMAKE=~tmp~.mak
+
+echo> ~tmp~.mak ####
+echo>> ~tmp~.mak conf = %0
+echo>> ~tmp~.mak $(conf:\=/): nul
+echo>> ~tmp~.mak 	@del ~setup~.mak
+echo>> ~tmp~.mak 	@-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
+if exist pathlist.tmp del pathlist.tmp
+if exist confargs.mk del confargs.mk
+:loop
+if "%1" == "" goto :end
+if "%1" == "--prefix" goto :prefix
+if "%1" == "prefix" goto :prefix
+if "%1" == "--srcdir" goto :srcdir
+if "%1" == "srcdir" goto :srcdir
+if "%1" == "--target" goto :target
+if "%1" == "target" goto :target
+if "%1" == "--with-static-linked-ext" goto :extstatic
+if "%1" == "--program-suffix" goto :suffix
+if "%1" == "RUBY_SUFFIX" goto :suffix
+if "%1" == "--program-name" goto :installname
+if "%1" == "--install-name" goto :installname
+if "%1" == "RUBY_INSTALL_NAME" goto :installname
+if "%1" == "--so-name" goto :soname
+if "%1" == "RUBY_SO_NAME" goto :soname
+if "%1" == "--enable-install-doc" goto :enable-rdoc
+if "%1" == "--disable-install-doc" goto :disable-rdoc
+if "%1" == "--extout" goto :extout
+if "%1" == "EXTOUT" goto :extout
+if "%1" == "--with-baseruby" goto :baseruby
+if "%1" == "BASERUBY" goto :baseruby
+if "%1" == "--path" goto :path
+if "%1" == "-h" goto :help
+if "%1" == "--help" goto :help
+  echo>>confargs.tmp 	%1 \
+  shift
+goto :loop
+:srcdir
+  echo>> ~tmp~.mak 	-Dsrcdir=%2 \
+  echo>>confargs.tmp 	--srcdir=%2 \
+  shift
+  shift
+goto :loop
+:prefix
+  echo>> ~tmp~.mak 	-Dprefix=%2 \
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:suffix
+  echo>>confargs.mk !ifndef RUBY_SUFFIX
+  echo>>confargs.mk RUBY_SUFFIX = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:installname
+  echo>>confargs.mk !ifndef RUBY_INSTALL_NAME
+  echo>>confargs.mk RUBY_INSTALL_NAME = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:soname
+  echo>>confargs.mk !ifndef RUBY_SO_NAME
+  echo>>confargs.mk RUBY_SO_NAME = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:target
+  echo>> ~tmp~.mak 	%2 \
+  echo>>confargs.tmp 	--target=%2 \
+  shift
+  shift
+goto :loop
+:extstatic
+  echo>>confargs.mk !ifndef EXTSTATIC
+  echo>>confargs.mk EXTSTATIC = static
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1 \
+  shift
+goto :loop
+:enable-rdoc
+  echo>>confargs.mk !ifndef RDOCTARGET
+  echo>>confargs.mk RDOCTARGET = install-doc
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1 \
+  shift
+goto :loop
+:disable-rdoc
+  echo>>confargs.mk !ifndef RDOCTARGET
+  echo>>confargs.mk RDOCTARGET = install-nodoc
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1 \
+  shift
+goto :loop
+:extout
+  echo>>confargs.mk !ifndef EXTOUT
+  echo>>confargs.mk EXTOUT = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:baseruby
+  echo>>confargs.mk !ifndef BASERUBY
+  echo>>confargs.mk BASERUBY = %2
+  echo>>confargs.mk !endif
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:path
+  echo>>pathlist.tmp %2;\
+  echo>>confargs.tmp 	%1=%2 \
+  shift
+  shift
+goto :loop
+:help
+  echo Configuration:
+  echo   --help                  display this help
+  echo   --srcdir=DIR            find the sources in DIR [configure dir or `..']
+  echo Installation directories:
+  echo   --prefix=PREFIX         install files in PREFIX (ignored currently)
+  echo System types:
+  echo   --target=TARGET         configure for TARGET [i386-bccwin32]
+  echo Optional Package:
+  echo   --with-baseruby=RUBY    use RUBY as baseruby [ruby]
+  echo   --with-static-linked-ext link external modules statically
+  echo   --enable-install-doc    install rdoc indexes during install
+  del *.tmp
+  del ~tmp~.mak
+goto :exit
+:end
+echo>> ~tmp~.mak 	-Dbcc32dir=$(@D)
+if not exist confargs.tmp goto :noconfargs
+    echo>>confargs.mk configure_args = \
+    type>>confargs.mk confargs.tmp
+    echo.>>confargs.mk
+    echo>>confargs.mk ####
+:noconfargs
+if not exist pathlist.tmp goto :nopathlist
+    echo>>confargs.mk pathlist = \
+    type>>confargs.mk pathlist.tmp
+    echo.>>confargs.mk
+    echo>>confargs.mk ####
+    echo>>confargs.mk PATH = $(pathlist:;=/bin;)$(PATH)
+    echo>>confargs.mk INCLUDE = $(pathlist:;=/include;)
+    echo>>confargs.mk LIB = $(pathlist:;=/lib;)
+:nopathlist
+if exist confargs.mk copy confargs.mk ~setup~.mak > nul
+type>>~setup~.mak ~tmp~.mak
+del *.tmp > nul
+del ~tmp~.mak > nul
+make -s -f ~setup~.mak
+:exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
new file mode 100755
index 0000000000..888ab2e2a6
--- /dev/null
+++ b/bcc32/mkexports.rb
@@ -0,0 +1,26 @@
+#!./miniruby -s
+
+$:.unshift(File.expand_path("../..", __FILE__))
+require 'win32/mkexports'
+
+class Exports::Bcc < Exports
+  def forwarding(internal, export)
+    internal[/\A_?/]+export
+  end
+
+  def each_line(objs, &block)
+    objs.each do |obj|
+      opt = /\.(?:so|dll)\z/i =~ obj ? "-ee" : "-oiPUBDEF -oiPUBD32"
+      IO.foreach("|tdump -q #{opt} #{obj.tr('/', '\\')} < nul", &block)
+    end
+  end
+
+  def each_export(objs)
+    objdump(objs) do |l|
+      next unless /(?:PUBDEF|PUBD32|EXPORT)/ =~ l
+      yield $1 if /'(.*?)'/ =~ l
+    end
+    yield "_strcasecmp", "_stricmp"
+    yield "_strncasecmp", "_strnicmp"
+  end
+end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
new file mode 100644
index 0000000000..df2fd3c128
--- /dev/null
+++ b/bcc32/setup.mak
@@ -0,0 +1,179 @@
+# -*- makefile -*-
+
+!if "$(srcdir)" != ""
+bcc32dir = $(srcdir)/bcc32
+!elseif "$(bcc32dir)" == "bcc32/"
+srcdir = .
+!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
+srcdir = $(bcc32dir:/bcc32/=)
+!else
+srcdir = $(bcc32dir)/..
+!endif
+!ifndef prefix
+prefix = /usr
+!endif
+OS = bccwin32
+RT = $(OS)
+BANG = !
+APPEND = echo.>>$(MAKEFILE)
+!ifdef MAKEFILE
+MAKE = $(MAKE) -f $(MAKEFILE)
+!else
+MAKEFILE = Makefile
+!endif
+
+all: Makefile
+Makefile: -prologue- -generic- -epilogue-
+i386-$(OS): -prologue- -i386- -epilogue-
+i486-$(OS): -prologue- -i486- -epilogue-
+i586-$(OS): -prologue- -i586- -epilogue-
+i686-$(OS): -prologue- -i686- -epilogue-
+alpha-$(OS): -prologue- -alpha- -epilogue-
+
+-prologue-: -basic-vars- -version- -system-vars-
+
+-basic-vars-: nul
+	@echo Creating $(MAKEFILE)
+	@type > $(MAKEFILE) &&|
+\#\#\# Makefile for ruby $(OS) \#\#\#
+$(BANG)ifndef srcdir
+srcdir = $(srcdir:\=/)
+$(BANG)endif
+$(BANG)ifndef prefix
+prefix = $(prefix:\=/)
+$(BANG)endif
+$(BANG)if !defined(BASERUBY)
+!if defined(BASERUBY)
+BASERUBY = $(BASERUBY)
+!endif
+|
+!if !defined(BASERUBY)
+	@for %I in (ruby.exe) do @echo BASERUBY = "%~$$PATH:I" >> $(MAKEFILE)
+!endif
+	@type >> $(MAKEFILE) &&|
+$(BANG)endif
+|
+!if exist(confargs.mk)
+	@type confargs.mk >> $(MAKEFILE)
+	@del confargs.mk
+!endif
+
+-system-vars-: -runtime- -bormm-
+
+-bormm-: nul
+	@-ilink32 -q -Gn -x usebormm.lib > nul
+	@-if exist usebormm.tds $(APPEND) MEMLIB = usebormm.lib
+	@if exist usebormm.* del usebormm.*
+
+-osname-: nul
+	@echo OS =  >>$(MAKEFILE)
+
+-runtime-: nul
+	type > conftest.c &&|
+\#include <stdio.h>
+int main(){printf("");return 0;}
+|
+	bcc32 conftest.c cw32i.lib > nul
+	tdump conftest.exe < nul > conftest.i
+	grep "^Imports from CC" conftest.i > conftest.c
+	cpp32 -P- -DFile=\# -DImports=RTNAME -Dfrom== conftest.c > nul
+	$(MAKE) > nul -DBANG=$(BANG) -f &&|
+-runtime-: nul
+$(BANG)include conftest.i
+RT = $$(RTNAME:.DLL=)
+OS = $$(RT:CC32=)
+-runtime-:
+	del conftest.*
+$(BANG)if "$$(OS)" == "50"
+	echo OS = bccwin32 >> $(MAKEFILE)
+$(BANG)else
+	echo OS = bccwin32_$$(OS) >> $(MAKEFILE)
+$(BANG)endif
+|
+	@echo RT = $$(OS) >> $(MAKEFILE)
+
+-version-: nul
+	@cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
+\#define RUBY_REVISION 0
+\#include "version.h"
+MAJOR = RUBY_API_VERSION_MAJOR
+MINOR = RUBY_API_VERSION_MINOR
+TEENY = RUBY_API_VERSION_TEENY
+
+BORLANDC = __BORLANDC__
+|
+	@$(MAKE) > nul -DBANG=$(BANG) -f &&,
+-version-: nul
+$(BANG)include $(MAKEFILE)
+$(BANG)include $(MAKEFILE).i
+-version-:
+	@del $(MAKEFILE).i
+	@type >> $(MAKEFILE) &&|
+MAJOR = $$(MAJOR)
+MINOR = $$(MINOR)
+TEENY = $$(TEENY)
+BORLANDC = $$(BORLANDC)
+|
+,
+
+-generic-: nul
+!if defined(PROCESSOR_ARCHITECTURE) ||  defined(PROCESSOR_LEVEL)
+	@type >> $(MAKEFILE) &&|
+!if defined(PROCESSOR_ARCHITECTURE)
+$(BANG)ifndef PROCESSOR_ARCHITECTURE
+PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
+$(BANG)endif
+!endif
+!if defined(PROCESSOR_LEVEL)
+$(BANG)ifndef PROCESSOR_LEVEL
+PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
+$(BANG)endif
+!endif
+|
+!endif
+
+-alpha-: nul
+	@$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
+	@$(APPEND) PROCESSOR_ARCHITECTURE = alpha
+	@$(APPEND) !endif
+-ix86-: nul
+	@$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
+	@$(APPEND) PROCESSOR_ARCHITECTURE = x86
+	@$(APPEND) !endif
+
+-i386-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 3
+	@$(APPEND) !endif
+-i486-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 4
+	@$(APPEND) !endif
+-i586-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 5
+	@$(APPEND) !endif
+-i686-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 6
+	@$(APPEND) !endif
+
+-epilogue-: -encs-
+
+-encs-: nul
+	@$(MAKE) -f $(srcdir)/win32/enc-setup.mak srcdir="$(srcdir)" MAKEFILE=$(MAKEFILE)
+
+-epilogue-: nul
+	@type >> $(MAKEFILE) &&|
+
+\# RUBY_INSTALL_NAME = ruby
+\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
+\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
+\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)/missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
+\# STACK = 0x2000000
+\# LDFLAGS = -S:$$(STACK)
+\# RFLAGS = $$(iconinc)
+\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
+$(BANG)include $$(srcdir)/bcc32/Makefile.sub
+|
+	@echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+  if m == 0 then
+    n + 1
+  elsif n == 0 then
+    ack(m - 1, 1)
+  else
+    ack(m - 1, ack(m, n - 1))
+  end
+end
+
+def the_answer_to_life_the_universe_and_everything
+  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+  if(n > 1)
+    n * fact(n-1)
+  else
+    1
+  end
+end
+
+100.times {
+  fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..89069db7ab
--- /dev/null
+++ b/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+  i = 0
+  while i<100
+    i+=1
+    z = z * z
+    return false if z.abs > 2
+  end
+  true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
+    x = dx / 50.0
+    y = dy / 50.0
+    c = Complex(x, y)
+    ary << c if mandelbrot?(c)
+  }
+}
+
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+  for x in nb
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      for d in [-ROW, -1, 1, ROW]
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      end
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  end
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  for i in 0...ROW*COL
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  end
+end
+
+def pboard
+  print "No. #$no\n"
+  for i in 0...COL
+    print "|"
+    for j in 0...ROW-NP
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    end
+    print "\n"
+  end
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      for s in x do
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      end
+      if f == 0 then
+        for s in x do
+          $b[pos+s] = i
+        end
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        for s in x do
+          $b[pos+s] = -1
+        end
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..01d2ae3219
--- /dev/null
+++ b/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i=0
+while i<300000
+  i+=1
+  begin
+    raise
+  rescue
+  end
+end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7b2f2da5a7
--- /dev/null
+++ b/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i=0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i+=1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+  if x <= y
+  then y
+  else tarai(tarai(x-1, y, z),
+             tarai(y-1, z, x),
+             tarai(z-1, x, y))
+  end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..7b167af774
--- /dev/null
+++ b/benchmark/bm_io_select2.rb
@@ -0,0 +1,18 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..fcdbb96e0e
--- /dev/null
+++ b/benchmark/bm_io_select3.rb
@@ -0,0 +1,17 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..43d35e1131
--- /dev/null
+++ b/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i=0
+while i<30_000_000 # benchmark loop 1
+  i+=1
+end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..e514989661
--- /dev/null
+++ b/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i=0
+while i< 6_000_000 # benchmark loop 2
+  i+=1
+end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..6a26465578
--- /dev/null
+++ b/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,57 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+def STDOUT.write_ *args
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 12 # 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..56b9410632
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i=0
+while i<10
+  i+=1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+  tmp = input.read(4096) or break
+  data = tmp << (input.gets || "")
+  nc += data.length
+  nl += data.count("\n")
+  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+  nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..d8b461290c
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i+=1
+  some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..f8d26797aa
--- /dev/null
+++ b/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+  # create a list of integers (Li1) from 1 to SIZE
+  li1 = (1..SIZE).to_a
+  # copy the list to li2 (not by individual items)
+  li2 = li1.dup
+  # remove each individual item from left side of li2 and
+  # append to right side of li3 (preserving order)
+  li3 = Array.new
+  while (not li2.empty?)
+    li3.push(li2.shift)
+  end
+  # li2 must now be empty
+  # remove each individual item from right side of li3 and
+  # append to right side of li2 (reversing list)
+  while (not li3.empty?)
+    li2.push(li3.pop)
+  end
+  # li3 must now be empty
+  # reverse li1 in place
+  li1.reverse!
+  # check that first item is now SIZE
+  if li1[0] != SIZE then
+    p "not SIZE"
+    0
+  else
+    # compare li1 and li2 for equality
+    if li1 != li2 then
+      return(0)
+    else
+      # return the length of the list
+      li1.length
+    end
+  end
+end
+
+i = 0
+while i<NUM
+  i+=1
+  result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..99cf6a91cc
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values ( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop accross the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the curent row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a muliple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # follwing reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is acheived via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then